Optimally cloned binary coherent states

NASA Astrophysics Data System (ADS)

Müller, C. R.; Leuchs, G.; Marquardt, Ch.; Andersen, U. L.

2017-10-01

Binary coherent state alphabets can be represented in a two-dimensional Hilbert space. We capitalize this formal connection between the otherwise distinct domains of qubits and continuous variable states to map binary phase-shift keyed coherent states onto the Bloch sphere and to derive their quantum-optimal clones. We analyze the Wigner function and the cumulants of the clones, and we conclude that optimal cloning of binary coherent states requires a nonlinearity above second order. We propose several practical and near-optimal cloning schemes and compare their cloning fidelity to the optimal cloner.

Cytoreductive conditioning intensity predicts clonal diversity in ADA-SCID retroviral gene therapy patients

PubMed Central

Lill, Georgia R.; Shaw, Kit; Carbonaro-Sarracino, Denise A.; Davila, Alejandra; Sokolic, Robert; Candotti, Fabio; Pellegrini, Matteo

2017-01-01

Retroviral gene therapy has proved efficacious for multiple genetic diseases of the hematopoietic system, but roughly half of clinical gene therapy trial protocols using gammaretroviral vectors have reported leukemias in some of the patients treated. In dramatic contrast, 39 adenosine deaminase–deficient severe combined immunodeficiency (ADA-SCID) patients have been treated with 4 distinct gammaretroviral vectors without oncogenic consequence. We investigated clonal dynamics and diversity in a cohort of 15 ADA-SCID children treated with gammaretroviral vectors and found clear evidence of genotoxicity, indicated by numerous common integration sites near proto-oncogenes and by increased abundance of clones with integrations near MECOM and LMO2. These clones showed stable behavior over multiple years and never expanded to the point of dominance or dysplasia. One patient developed a benign clonal dominance that could not be attributed to insertional mutagenesis and instead likely resulted from expansion of a transduced natural killer clone in response to chronic Epstein-Barr virus viremia. Clonal diversity and T-cell repertoire, measured by vector integration site sequencing and T-cell receptor β-chain rearrangement sequencing, correlated significantly with the amount of busulfan preconditioning delivered to patients and to CD34+ cell dose. These data, in combination with results of other ADA-SCID gene therapy trials, suggest that disease background may be a crucial factor in leukemogenic potential of retroviral gene therapy and underscore the importance of cytoreductive conditioning in this type of gene therapy approach. PMID:28351939

Cytoreductive conditioning intensity predicts clonal diversity in ADA-SCID retroviral gene therapy patients.

PubMed

Cooper, Aaron R; Lill, Georgia R; Shaw, Kit; Carbonaro-Sarracino, Denise A; Davila, Alejandra; Sokolic, Robert; Candotti, Fabio; Pellegrini, Matteo; Kohn, Donald B

2017-05-11

Retroviral gene therapy has proved efficacious for multiple genetic diseases of the hematopoietic system, but roughly half of clinical gene therapy trial protocols using gammaretroviral vectors have reported leukemias in some of the patients treated. In dramatic contrast, 39 adenosine deaminase-deficient severe combined immunodeficiency (ADA-SCID) patients have been treated with 4 distinct gammaretroviral vectors without oncogenic consequence. We investigated clonal dynamics and diversity in a cohort of 15 ADA-SCID children treated with gammaretroviral vectors and found clear evidence of genotoxicity, indicated by numerous common integration sites near proto-oncogenes and by increased abundance of clones with integrations near MECOM and LMO2 These clones showed stable behavior over multiple years and never expanded to the point of dominance or dysplasia. One patient developed a benign clonal dominance that could not be attributed to insertional mutagenesis and instead likely resulted from expansion of a transduced natural killer clone in response to chronic Epstein-Barr virus viremia. Clonal diversity and T-cell repertoire, measured by vector integration site sequencing and T-cell receptor β-chain rearrangement sequencing, correlated significantly with the amount of busulfan preconditioning delivered to patients and to CD34 + cell dose. These data, in combination with results of other ADA-SCID gene therapy trials, suggest that disease background may be a crucial factor in leukemogenic potential of retroviral gene therapy and underscore the importance of cytoreductive conditioning in this type of gene therapy approach.

Evidence to Support a Contribution of Polyreactive Antibodies to HLA Serum Reactivity.

PubMed

Gao, Baoshan; Rong, Chunshu; Porcheray, Fabrice; Moore, Carolina; Girouard, Timothy C; Saidman, Susan L; Wong, Waichi; Fu, Yaowen; Zorn, Emmanuel

2016-01-01

Assessing the serum reactivity to HLA is essential for the evaluation of transplant candidates and the follow-up of allograft recipients. In this study, we look for evidence at the clonal level that polyreactive antibodies cross-reactive to apoptotic cells and multiple autoantigens can also react to HLA and contribute to the overall serum reactivity. We immortalized B cell clones from the blood of 2 kidney transplant recipients and characterized their reactivity to self-antigens, apoptotic cells as well as native, denatured, and cryptic HLA determinants using enzyme-linked immunosorbent assay (ELISA), immunofluorescence, flow cytometry and Luminex assays. We also assessed the reactivity of 300 pretransplant serum specimens to HLA and apoptotic cells. We report here 4 distinct B cell clones cross-reactive to self and HLA class I. All 4 clones reacted to numerous HLA class I alleles but did not appear to target canonical "shared" epitopes. In parallel experiments, we observed a strong correlation between IgG reactivity to HLA and apoptotic cells in pretransplant serum samples collected from 300 kidney transplant recipients. Further analysis revealed that samples with higher reactivity to apoptotic cells displayed significantly higher class I percent panel-reactive antibodies compared to samples with low reactivity to apoptotic cells. We provide here (1) proof of principle at the clonal level that human polyreactive antibodies can cross-react to HLA, multiple self-antigens and apoptotic cells and (2) supportive evidence that polyreactive antibodies contribute to overall HLA reactivity in the serum of patients awaiting kidney transplant.

In vitro development of cloned bovine embryos produced by handmade cloning using somatic cells from distinct levels of cell culture confluence.

PubMed

Gerger, R P C; Ribeiro, E S; Forell, F; Bertolini, L R; Rodrigues, J L; Ambrósio, C E; Miglino, M A; Mezzalira, A; Bertolini, M

2010-02-18

The relationship between the level of cell confluence near the plateau phase of growth and blastocyst yield following somatic cell cloning is not well understood. We examined the effect of distinct cell culture confluence levels on in vitro development of cloned bovine embryos. In vitro-matured bovine oocytes were manually bisected and selected by DNA staining. One or two enucleated hemi-cytoplasts were paired and fused with an adult skin somatic cell. Cultured skin cells from an adult Nellore cow harvested at three distinct culture confluence levels (70-80, 80-90, and >95%) were used for construction of embryos and hemi-embryos. After activation, structures were cultured in vitro as one embryo (1 x 100%) or as aggregates of two hemi-embryos (2 x 50%) per microwell. Fusion, cleavage and blastocyst rates were compared using the chi(2) test. The fusion rate for hemi-embryos (51.4%) was lower than for embryos (67.6%), with no influence of degree of cell confluence. However, blastocyst rates improved linearly (7.0, 17.5, and 29.4%) with increases in cell confluence. We conclude that degree of cell culture confluence significantly influences subsequent embryo development; use of a cell population in high confluence (>90%) for nuclear transfer significantly improved blastocyst yield after cloning.

Differences in salinity tolerance of genetically distinct Phragmites australis clones

PubMed Central

Achenbach, Luciana; Eller, Franziska; Nguyen, Loc Xuan; Brix, Hans

2013-01-01

Different clones of the wetland grass Phragmites australis differ in their morphology and physiology, and hence in their ability to cope with environmental stress. We analysed the responses of 15 P. australis clones with distinct ploidy levels (PLs) (4n, 6n, 8n, 10n, 12n) and geographic origins (Romania, Russia, Japan, Czech Republic, Australia) to step-wise increased salinity (8, 16, 24, 32, 40, 56 and 72 ppt). Shoot elongation rate, photosynthesis and plant part-specific ion accumulation were studied in order to assess if traits associated with salinity tolerance can be related to the genetic background and the geographic origin of the clones. Salt stress affected all clones, but at different rates. The maximum height was reduced from 1860 mm in control plants to 660 mm at 40 ppt salinity. The shoot elongation rate of salt-exposed plants varied significantly between clones until 40 ppt salinity. The light-saturated photosynthesis rate (Pmax) was stimulated by a salinity of 8 ppt, but decreased significantly at higher salinities. The stomatal conductance (gs) and the transpiration rate (E) decreased with increasing salinity. Only three clones survived at 72 ppt salinity, although their rates of photosynthesis were strongly inhibited. The roots and basal leaves of the salt-exposed plants accumulated high concentrations of water-extractable Na+ (1646 and 1004 µmol g−1 dry mass (DM), respectively) and Cl− (1876 and 1400 µmol g−1 DM, respectively). The concentrations of water-extractable Mg2+ and Ca2+ were reduced in salt-exposed plants compared with controls. The variation of all the measured parameters was higher among clones than among PLs. We conclude that the salinity tolerance of distinct P. australis clones varies widely and can be partially attributed to their longitudinal geographic origin, but not to PL. Further investigation will help in improving the understanding of this species' salt tolerance mechanisms and their connection to genetic factors.

Lineage-tracking of stem cell differentiation: a neutral model of hematopoiesis in rhesus macaque

NASA Astrophysics Data System (ADS)

Chou, Tom

How a potentially diverse population of hematopoietic stem cells (HSCs) differentiates and proliferates to supply more than 1011 mature blood cells every day in humans remains a key biological question. We investigated this process by quantitatively analyzing the clonal structure of peripheral blood that is generated by a population of transplanted lentivirus-marked HSCs in myeloablated rhesus macaques. Each transplanted HSC generates a clonal lineage of cells in the peripheral blood that is then detected and quantified through deep sequencing of the viral vector integration sites (VIS) common within each lineage. This approach allowed us to observe, over a period of 4-12 years, hundreds of distinct clonal lineages. Surprisingly, while the distinct clone sizes varied by three orders of magnitude, we found that collectively, they form a steady-state clone size-distribution with a distinctive shape. Our concise model shows that slow HSC differentiation followed by fast progenitor growth is responsible for the observed broad clone size-distribution. Although all cells are assumed to be statistically identical, analogous to a neutral theory for the different clone lineages, our mathematical approach captures the intrinsic variability in the times to HSC differentiation after transplantation. Steady-state solutions of our model show that the predicted clone size-distribution is sensitive to only two combinations of parameters. By fitting the measured clone size-distributions to our mechanistic model, we estimate both the effective HSC differentiation rate and the number of active HSCs. NSF and NIH.

Recolonization and radiation in Larix (Pinaceae): evidence from nuclear ribosomal DNA paralogues.

PubMed

Wei, Xiao-Xin; Wang, Xiao-Quan

2004-10-01

Gene paralogy frequently causes the conflict between gene tree and species tree, but sometimes the coexistence of a few paralogous copies could provide more markers for tracing the phylogeographical process of some organisms. In the present study, nrDNA ITS paralogues were cloned from all but one species of Larix, an Eocene genus having two sections, Larix and Multiserialis, with a huge circumboreal distribution and an Eastern Asia-Western North America disjunction, respectively. A total of 96 distinct clones, excluding five putative pseudogenes or recombinants, were obtained and used in the gene genealogy analysis. The clones from all Eurasian species of section Larix are mixed together, suggesting that recolonization and recent morphological differentiation could have played important roles in the evolution of this section. In contrast, the species diversification of the Eurasian section Multiserialis may result from radiation in the east Himalayas and its vicinity, considering extensive nrDNA founder effects in this group. Our study also suggests that the distribution pattern analysis of members of multiple gene family would be very useful in tracking the evolutionary history of some taxa with recent origin or rapid radiation that cannot be resolved by other molecular markers.

Stable MSAP markers for the distinction of Vitis vinifera cv Pinot noir clones.

PubMed

Ocaña, Juan; Walter, Bernard; Schellenbaum, Paul

2013-11-01

Grapevine is one of the most economically important fruit crops. Molecular markers have been used to study grapevine diversity. For instance, simple sequence repeats are a powerful tool for identification of grapevine cultivars, while amplified fragment length polymorphisms have shown their usefulness in intra-varietal diversity studies. Other techniques such as sequence-specific amplified polymorphism are based on the presence of mobile elements in the genome, but their detection lies upon their activity. Relevant attention has been drawn toward epigenetic sources of variation. In this study, a set of Vitis vinifera cv Pinot noir clones were analyzed using the methylation-sensitive amplified polymorphism technique with isoschizomers MspI and HpaII. Nine out of fourteen selective primer combinations were informative and generated two types of polymorphic fragments which were categorized as "stable" and "unstable." In total, 23 stable fragments were detected and they discriminated 92.5 % of the studied clones. Detected stable polymorphisms were either common to several clones, restricted to a few clones or unique to a single clone. The identification of these stable epigenetic markers will be useful in clonal diversity studies. We highlight the relevance of stable epigenetic variation in V. vinifera clones and analyze at which level these markers could be applicable for the development of forthright techniques for clonal distinction.

Structural defect linked to nonrandom mutations in the matrix gene of Biden strain subacute sclerosing panencephalitis virus defined by cDNA cloning and expression of chimeric genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ayata, M.; Hirano, A.; Wong, T.C.

1989-03-01

Biken strain, a nonproductive measles viruslike agent isolated from a subacute sclerosing panencephalitis (SSPE) patient, contains a posttranscriptional defect affecting matrix (M) protein. A putative M protein was translated in vitro with RNA from Biken strain-infected cells. A similar protein was detected in vivo by an antiserum against a peptide synthesized from the cloned M gene of Edmonston strain measles virus. By using a novel method, full-length cDNAs of the Biken M gene were selectively cloned. The cloned Biken M gene contained an open reading frame which encoded 8 extra carboxy-terminal amino acid residues and 20 amino acid substitutions predictedmore » to affect both the hydrophobicity and secondary structure of the gene product. The cloned gene was expressed in vitro and in vivo into a 37,500 M/sub r/ protein electrophoretically and antigenically distinct from the M protein of Edmonston strain but identical to the M protein in Biken strain-infected cells. Chimeric M proteins synthesized in vitro and in vivo showed that the mutations in the carboxy-proximal region altered the local antigenicity and those in the amino region affected the overall protein conformation. The protein expressed from the Biken M gene was unstable in vivo. Instability was attributed to multiple mutations. These results offer insights into the basis of the defect in Biken strain and pose intriguing questions about the evolutionary origins of SSPE viruses in general.« less

Short, interspersed, and repetitive DNA sequences in Spiroplasma species.

PubMed

Nur, I; LeBlanc, D J; Tully, J G

1987-03-01

Small fragments of DNA from an 8-kbp plasmid, pRA1, from a plant pathogenic strain of Spiroplasma citri were shown previously to be present in the chromosomal DNA of at least two species of Spiroplasma. We describe here the shot-gun cloning of chromosomal DNA from S. citri Maroc and the identification of two distinct sequences exhibiting homology to pRA1. Further subcloning experiments provided specific molecular probes for the identification of these two sequences in chromosomal DNA from three distinct plant pathogenic species of Spiroplasma. The results of Southern blot hybridization indicated that each of the pRA1-associated sequences is present as multiple copies in short, dispersed, and repetitive sequences in the chromosomes of these three strains. None of the sequences was detectable in chromosomal DNA from an additional nine Spiroplasma strains examined.

Differential expression and activation of a family of murine peroxisome proliferator-activated receptors.

PubMed Central

Kliewer, S A; Forman, B M; Blumberg, B; Ong, E S; Borgmeyer, U; Mangelsdorf, D J; Umesono, K; Evans, R M

1994-01-01

To gain insight into the function of peroxisome proliferator-activated receptor (PPAR) isoforms in mammals, we have cloned and characterized two PPAR alpha-related cDNAs (designated PPAR gamma and -delta, respectively) from mouse. The three PPAR isoforms display widely divergent patterns of expression during embryogenesis and in the adult. Surprisingly, PPAR gamma and -delta are not activated by pirinixic acid (Wy 14,643), a potent peroxisome proliferator and activator of PPAR alpha. However, PPAR gamma and -delta are activated by the structurally distinct peroxisome proliferator LY-171883 and linoleic acid, respectively, indicating that each of the isoforms can act as a regulated activator of transcription. These data suggest that tissue-specific responsiveness to peroxisome proliferators, including certain fatty acids, is in part a consequence of differential expression of multiple, pharmacologically distinct PPAR isoforms. Images PMID:8041794

Evidence to support a contribution of polyreactive antibodies to HLA serum reactivity

PubMed Central

Gao, Baoshan; Rong, Chunshu; Porcheray, Fabrice; Moore, Carolina; Girouard, Timothy C.; Saidman, Susan L.; Wong, Waichi; Fu, Yaowen; Zorn, Emmanuel

2015-01-01

Background Assessing the serum reactivity to HLA is essential for the evaluation of transplant candidates and the follow-up of allograft recipients. In this study, we look for evidence at the clonal level that polyreactive antibodies cross-reactive to apoptotic cells and multiple autoantigens can also react to HLA and contribute to the overall serum reactivity. Methods We immortalized B cell clones from the blood of two kidney transplant recipients and characterized their reactivity to self-antigens, apoptotic cells as well as native, denatured and cryptic HLA determinants using ELISA, immunofluorescence, flow cytometry and Luminex assays. We also assessed the reactivity of 300 pre-transplant serum specimens to HLA and apoptotic cells. Results We report here 4 distinct B cell clones cross-reactive to self and HLA class I. All 4 clones reacted to numerous HLA class I alleles but did not appear to target canonical “shared” epitopes. In parallel experiments, we observed a strong correlation between IgG reactivity to HLA and apoptotic cells in pre-transplant serum samples collected from 300 kidney transplant recipients. Further analysis revealed that samples with higher reactivity to apoptotic cells displayed significantly higher class I percent PRA compared to samples with low reactivity to apoptotic cells. Conclusions We provide here 1) proof of principle at the clonal level that human polyreactive antibodies can cross-react to HLA, multiple self-antigens and apoptotic cells and 2) supportive evidence that polyreactive antibodies contribute to overall HLA reactivity in the serum of patients awaiting kidney transplant. PMID:26285015

Intercontinental spread of a genetically distinctive complex of clones of Neisseria meningitidis causing epidemic disease.

PubMed

Caugant, D A; Frøholm, L O; Bøvre, K; Holten, E; Frasch, C E; Mocca, L F; Zollinger, W D; Selander, R K

1986-07-01

Strains of Neisseria meningitidis responsible for an epidemic of meningococcal disease occurring in Norway since the mid-1970s and for recent increases in the incidence of disease in several other parts of Europe have been identified by multilocus enzyme electrophoresis as members of a distinctive group of 22 closely related clones (the ET-5 complex). Clones of this complex have also colonized South Africa, Chile, Cuba, and Florida, where they have been identified as the causative agents of recent outbreaks of meningococcal disease. There is strong circumstantial evidence that outbreaks of disease occurring in Miami in 1981 and 1982 were caused in large part by bacteria that reached Florida via human immigrants from Cuba.

SciClone: inferring clonal architecture and tracking the spatial and temporal patterns of tumor evolution.

PubMed

Miller, Christopher A; White, Brian S; Dees, Nathan D; Griffith, Malachi; Welch, John S; Griffith, Obi L; Vij, Ravi; Tomasson, Michael H; Graubert, Timothy A; Walter, Matthew J; Ellis, Matthew J; Schierding, William; DiPersio, John F; Ley, Timothy J; Mardis, Elaine R; Wilson, Richard K; Ding, Li

2014-08-01

The sensitivity of massively-parallel sequencing has confirmed that most cancers are oligoclonal, with subpopulations of neoplastic cells harboring distinct mutations. A fine resolution view of this clonal architecture provides insight into tumor heterogeneity, evolution, and treatment response, all of which may have clinical implications. Single tumor analysis already contributes to understanding these phenomena. However, cryptic subclones are frequently revealed by additional patient samples (e.g., collected at relapse or following treatment), indicating that accurately characterizing a tumor requires analyzing multiple samples from the same patient. To address this need, we present SciClone, a computational method that identifies the number and genetic composition of subclones by analyzing the variant allele frequencies of somatic mutations. We use it to detect subclones in acute myeloid leukemia and breast cancer samples that, though present at disease onset, are not evident from a single primary tumor sample. By doing so, we can track tumor evolution and identify the spatial origins of cells resisting therapy.

Fast-growing willow shrub named `Tully Champion`

DOE Office of Scientific and Technical Information (OSTI.GOV)

Abrahamson, Lawrence P; Kopp, Richard F; Smart, Lawrence B

2007-08-28

A distinct female cultivar of Salix viminalis.times.S. miyabeana named `Tully Champion`, characterized by rapid stem growth producing greater than 25% more woody biomass than two current production clones (Salix dasyclados `SV1` and Salix miyabeana `SX64`), more than 2.5-fold greater biomass than one of its parents (Salix miyabeana `SX67`), and nearly 3-fold more biomass than another production clone (Salix sacchalinensis, `SX61`) when grown in the same field for the same length of time (two growing seasons after coppice) in Tully, N.Y. `Tully Champion` can be planted from dormant stem cuttings, produces multiple stems after coppice, and the stem biomass can bemore » harvested when the plant is dormant. In the spring following harvest, the plant will re-sprout very vigorously, producing new stems that can be harvested repeatedly after two to four years of growth. `Tully Champion` displays a low incidence of rust disease and is not damaged by potato leafhoppers.« less

SciClone: Inferring Clonal Architecture and Tracking the Spatial and Temporal Patterns of Tumor Evolution

PubMed Central

Dees, Nathan D.; Griffith, Malachi; Welch, John S.; Griffith, Obi L.; Vij, Ravi; Tomasson, Michael H.; Graubert, Timothy A.; Walter, Matthew J.; Ellis, Matthew J.; Schierding, William; DiPersio, John F.; Ley, Timothy J.; Mardis, Elaine R.; Wilson, Richard K.; Ding, Li

2014-01-01

The sensitivity of massively-parallel sequencing has confirmed that most cancers are oligoclonal, with subpopulations of neoplastic cells harboring distinct mutations. A fine resolution view of this clonal architecture provides insight into tumor heterogeneity, evolution, and treatment response, all of which may have clinical implications. Single tumor analysis already contributes to understanding these phenomena. However, cryptic subclones are frequently revealed by additional patient samples (e.g., collected at relapse or following treatment), indicating that accurately characterizing a tumor requires analyzing multiple samples from the same patient. To address this need, we present SciClone, a computational method that identifies the number and genetic composition of subclones by analyzing the variant allele frequencies of somatic mutations. We use it to detect subclones in acute myeloid leukemia and breast cancer samples that, though present at disease onset, are not evident from a single primary tumor sample. By doing so, we can track tumor evolution and identify the spatial origins of cells resisting therapy. PMID:25102416

Demographic profile of states with human cloning laws: morality policy meets political economy.

PubMed

Stabile, Bonnie

2007-03-01

This analysis seeks to identify factors that may shape the policy stance - whether restrictive or permissive - that each state in the United States with a human cloning law in place takes toward human therapeutic cloning. The investigation also considers if cloning policy is more the product of morality politics or political economy. Results show that among states with human cloning policies in place, those with a greater biotechnological capacity, more permissive abortion laws, fewer Evangelical Protestants, and higher political liberalism rankings are more likely to have permissive cloning laws. A higher Roman Catholic population is strongly associated with permissive cloning laws, rather than restrictive cloning laws as originally supposed. Factors with morality policy and economic bases were both found to be associated with cloning policy outcomes. Results suggest that morality policies, though distinct in some ways, do share determinants with public policies based on political economy.

Statistical inference for classification of RRIM clone series using near IR reflectance properties

NASA Astrophysics Data System (ADS)

Ismail, Faridatul Aima; Madzhi, Nina Korlina; Hashim, Hadzli; Abdullah, Noor Ezan; Khairuzzaman, Noor Aishah; Azmi, Azrie Faris Mohd; Sampian, Ahmad Faiz Mohd; Harun, Muhammad Hafiz

2015-08-01

RRIM clone is a rubber breeding series produced by RRIM (Rubber Research Institute of Malaysia) through "rubber breeding program" to improve latex yield and producing clones attractive to farmers. The objective of this work is to analyse measurement of optical sensing device on latex of selected clone series. The device using transmitting NIR properties and its reflectance is converted in terms of voltage. The obtained reflectance index value via voltage was analyzed using statistical technique in order to find out the discrimination among the clones. From the statistical results using error plots and one-way ANOVA test, there is an overwhelming evidence showing discrimination of RRIM 2002, RRIM 2007 and RRIM 3001 clone series with p value = 0.000. RRIM 2008 cannot be discriminated with RRIM 2014; however both of these groups are distinct from the other clones.

Multi-omics approaches to deciphering a hypervirulent strain of Campylobacter jejuni

USDA-ARS?s Scientific Manuscript database

Background: Campylobacter jejuni clone SA recently emerged as the predominant cause of sheep abortion in the U.S. and is also associated with foodborne gastroenteritis in humans. A distinct phenotype of this clone is its ability to induce bacteremia and abortion. To facilitate understanding the path...

Exponential megapriming PCR (EMP) cloning--seamless DNA insertion into any target plasmid without sequence constraints.

PubMed

Ulrich, Alexander; Andersen, Kasper R; Schwartz, Thomas U

2012-01-01

We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP) cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF) cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts.

Twenty-seven nonoverlapping zinc finger cDNAs from human T cells map to nine different chromosomes with apparent clustering.

PubMed Central

Huebner, K; Druck, T; Croce, C M; Thiesen, H J

1991-01-01

cDNA clones encoding zinc finger structures were isolated by screening Molt4 and Jurkat cDNA libraries with zinc finger consensus sequences. Candidate clones were partially sequenced to verify the presence of zinc finger-encoding regions; nonoverlapping cDNA clones were chosen on the basis of sequences and genomic hybridization pattern. Zinc finger structure-encoding clones, which were designated by the term "Kox" and a number from 1 to 32 and which were apparently unique (i.e., distinct from each other and distinct from those isolated by other laboratories), were chosen for mapping in the human genome. DNAs from rodent-human somatic cell hybrids retaining defined complements of human chromosomes were analyzed for the presence of each of the Kox genes. Correlation between the presence of specific human chromosome regions and specific Kox genes established the chromosomal locations. Multiple Kox loci were mapped to 7q (Kox 18 and 25 and a locus detected by both Kox 8 cDNA and Kox 27 cDNA), 8q24 5' to the myc locus (Kox 9 and 32), 10cen----q24 (Kox 2, 15, 19, 21, 30, and 31), 12q13-qter (Kox 1 and 20), 17p13 (Kox 11 and 26), and 19q (Kox 5, 6, 10, 22, 24, and 28). Single Kox loci were mapped to 7p22 (Kox 3), 18q12 (Kox 17), 19p (Kox 13), 22q11 between IG lambda and BCR-1 (locus detected by both Kox 8 cDNA and Kox 27 cDNA), and Xp (Kox 14). Several of the Kox loci map to regions in which other zinc finger structure-encoding loci have already been localized, indicating possible zinc finger gene clusters. In addition, Kox genes at 8q24, 17p13, and 22q11--and perhaps other Kox genes--are located near recurrent chromosomal translocation breakpoints. Others, such as those on 7p and 7q, may be near regions specifically active in T cells. Images Figure 4 Figure 5 Figure 2 Figure 3 PMID:2014798

Cancer cells copy migratory behavior and exchange signaling networks via extracellular vesicles.

PubMed

Steenbeek, Sander C; Pham, Thang V; de Ligt, Joep; Zomer, Anoek; Knol, Jaco C; Piersma, Sander R; Schelfhorst, Tim; Huisjes, Rick; Schiffelers, Raymond M; Cuppen, Edwin; Jimenez, Connie R; van Rheenen, Jacco

2018-06-14

Recent data showed that cancer cells from different tumor subtypes with distinct metastatic potential influence each other's metastatic behavior by exchanging biomolecules through extracellular vesicles (EVs). However, it is debated how small amounts of cargo can mediate this effect, especially in tumors where all cells are from one subtype, and only subtle molecular differences drive metastatic heterogeneity. To study this, we have characterized the content of EVs shed in vivo by two clones of melanoma (B16) tumors with distinct metastatic potential. Using the Cre-LoxP system and intravital microscopy, we show that cells from these distinct clones phenocopy their migratory behavior through EV exchange. By tandem mass spectrometry and RNA sequencing, we show that EVs shed by these clones into the tumor microenvironment contain thousands of different proteins and RNAs, and many of these biomolecules are from interconnected signaling networks involved in cellular processes such as migration. Thus, EVs contain numerous proteins and RNAs and act on recipient cells by invoking a multi-faceted biological response including cell migration. © 2018 The Authors. Published under the terms of the CC BY 4.0 license.

The population structure of Vibrio cholerae from the Chandigarh Region of Northern India.

PubMed

Abd El Ghany, Moataz; Chander, Jagadish; Mutreja, Ankur; Rashid, Mamoon; Hill-Cawthorne, Grant A; Ali, Shahjahan; Naeem, Raeece; Thomson, Nicholas R; Dougan, Gordon; Pain, Arnab

2014-07-01

Cholera infection continues to be a threat to global public health. The current cholera pandemic associated with Vibrio cholerae El Tor has now been ongoing for over half a century. Thirty-eight V. cholerae El Tor isolates associated with a cholera outbreak in 2009 from the Chandigarh region of India were characterised by a combination of microbiology, molecular typing and whole-genome sequencing. The genomic analysis indicated that two clones of V. cholera circulated in the region and caused disease during this time. These clones fell into two distinct sub-clades that map independently onto wave 3 of the phylogenetic tree of seventh pandemic V. cholerae El Tor. Sequence analyses of the cholera toxin gene, the Vibrio seventh Pandemic Island II (VSPII) and SXT element correlated with this phylogenetic position of the two clades on the El Tor tree. The clade 2 isolates, characterized by a drug-resistant profile and the expression of a distinct cholera toxin, are closely related to the recent V. cholerae isolated elsewhere, including Haiti, but fell on a distinct branch of the tree, showing they were independent outbreaks. Multi-Locus Sequence Typing (MLST) distinguishes two sequence types among the 38 isolates, that did not correspond to the clades defined by whole-genome sequencing. Multi-Locus Variable-length tandem-nucleotide repeat Analysis (MLVA) identified 16 distinct clusters. The use of whole-genome sequencing enabled the identification of two clones of V. cholerae that circulated during the 2009 Chandigarh outbreak. These clones harboured a similar structure of ICEVchHai1 but differed mainly in the structure of CTX phage and VSPII. The limited capacity of MLST and MLVA to discriminate between the clones that circulated in the 2009 Chandigarh outbreak highlights the value of whole-genome sequencing as a route to the identification of further genetic markers to subtype V. cholerae isolates.

Determination of multiple-clone infection at allelic dimorphism site of Plasmodium vivax merozoite surface protein-1 in the Republic of Korea by pyrosequencing assay.

PubMed

Dinzouna-Boutamba, Sylvatrie-Danne; Lee, Sanghyun; Son, Ui-Han; Yun, Hae Soo; Joo, So-Young; Jeong, Sookwan; Rhee, Man Hee; Kwak, Dongmi; Xuan, Xuenan; Hong, Yeonchul; Chung, Dong-Il; Goo, Youn-Kyoung

2017-12-01

Allelic diversity leading to multiple gene polymorphisms of vivax malaria parasites has been shown to greatly contribute to antigenic variation and drug resistance, increasing the potential for multiple-clone infections within the host. Therefore, to identify multiple-clone infections and the predominant haplotype of Plasmodium vivax in a South Korean population, P. vivax merozoite surface protein-1 (PvMSP-1) was analyzed by pyrosequencing. Pyrosequencing of 156 vivax malaria-infected samples yielded 97 (62.18%) output pyrograms showing two main types of peak patterns of the dimorphic allele for threonine and alanine (T1476A). Most of the samples evaluated (88.66%) carried multiple-clone infections (wild- and mutant-types), whereas 11.34% of the same population carried only the mutant-type (1476A). In addition, each allele showed a high frequency of guanine (G) base substitution at both the first and third positions (86.07% and 81.13%, respectively) of the nucleotide combinations. Pyrosequencing of the PvMSP-1 42-kDa fragment revealed a heterogeneous parasite population, with the mutant-type dominant compared to the wild-type. Understanding the genetic diversity and multiple-clone infection rates may lead to improvements in vivax malaria prevention and strategic control plans. Further studies are needed to improve the efficacy of the pyrosequencing assay with large sample sizes and additional nucleotide positions. Copyright © 2017 Elsevier B.V. All rights reserved.

Molecular analysis of genetic fidelity in Cannabis sativa L. plants grown from synthetic (encapsulated) seeds following in vitro storage.

PubMed

Lata, Hemant; Chandra, Suman; Techen, Natascha; Khan, Ikhlas A; ElSohly, Mahmoud A

2011-12-01

The increasing utilization of synthetic (encapsulated) seeds for germplasm conservation and propagation necessitates the assessment of genetic stability of conserved propagules following their plantlet conversion. We have assessed the genetic stability of synthetic seeds of Cannabis sativa L. during in vitro multiplication and storage for 6 months at different growth conditions using inter simple sequence repeat (ISSR) DNA fingerprinting. Molecular analysis of randomly selected plants from each batch was conducted using 14 ISSR markers. Of the 14 primers tested, nine produced 40 distinct and reproducible bands. All the ISSR profiles from in vitro stored plants were monomorphic and comparable to the mother plant which confirms the genetic stability among the clones. GC analysis of six major cannabinoids [Δ(9)-tetrahydrocannabinol, tetrahydrocannabivarin, cannabidiol, cannabichromene, cannabigerol and cannabinol] showed homogeneity in the re-grown clones and the mother plant with insignificant differences in cannabinoids content, thereby confirming the stability of plants derived from synthetic seeds following 6 months storage. © Springer Science+Business Media B.V. 2011

Molecular Characterization of Multiresistant d-Tartrate-Positive Salmonella enterica Serovar Paratyphi B Isolates

PubMed Central

Miko, Angelika; Guerra, Beatriz; Schroeter, Andreas; Dorn, Christina; Helmuth, Reiner

2002-01-01

Since 1996, the National Salmonella Reference Laboratory of Germany has received an increasing number of Salmonella enterica subsp. enterica serovar Paratyphi B isolates. Nearly all of these belonged to the dextrorotatory tartrate-positive variant (S. enterica subsp. enterica serovar Paratyphi B dT+), formerly called S. enterica subsp. enterica serovar Java. A total of 55 selected contemporary and older S. enterica subsp. enterica serovar Paratyphi B dT+ isolates were analyzed by plasmid profiling, antimicrobial resistance testing, pulsed-field gel electrophoresis, IS200 profiling, and PCR-based detection of integrons. The results showed a high genetic heterogeneity among 10 old strains obtained from 1960 to 1993. In the following years, however, new distinct multiresistant S. enterica subsp. enterica serovar Paratyphi B dT+ clones emerged, and one clonal lineage successfully displaced the older ones. Since 1994, 88% of the isolates investigated were multiple drug resistant. Today, a particular clone predominates in some German poultry production lines, poultry products, and various other sources. It was also detected in contemporary isolates from two neighboring countries as well. PMID:12202551

Polyclonal and monoclonal antibodies in clinic.

PubMed

Wootla, Bharath; Denic, Aleksandar; Rodriguez, Moses

2014-01-01

Immunoglobulins (Ig) or antibodies are heavy plasma proteins, with sugar chains added to amino-acid residues by N-linked glycosylation and occasionally by O-linked glycosylation. The versatility of antibodies is demonstrated by the various functions that they mediate such as neutralization, agglutination, fixation with activation of complement and activation of effector cells. Naturally occurring antibodies protect the organism against harmful pathogens, viruses and infections. In addition, almost any organic chemical induces antibody production of antibodies that would bind specifically to the chemical. These antibodies are often produced from multiple B cell clones and referred to as polyclonal antibodies. In recent years, scientists have exploited the highly evolved machinery of the immune system to produce structurally and functionally complex molecules such as antibodies from a single B clone, heralding the era of monoclonal antibodies. Most of the antibodies currently in the clinic, target components of the immune system, are not curative and seek to alleviate symptoms rather than cure disease. Our group used a novel strategy to identify reparative human monoclonal antibodies distinct from conventional antibodies. In this chapter, we discuss the therapeutic relevance of both polyclonal and monoclonal antibodies in clinic.

Symbiodinium diversity in the sea anemone Entacmaea quadricolor on the east Australian coast

NASA Astrophysics Data System (ADS)

Pontasch, S.; Scott, A.; Hill, R.; Bridge, T.; Fisher, P. L.; Davy, S. K.

2014-06-01

The diversity of Symbiodinium spp. in Entacmaea quadricolor was analysed from five locations along ~2,100 km on the east coast of Australia using denaturing gradient gel electrophoresis (DGGE) of the internal transcribed spacer 2 region (ITS2) combined with bacterial cloning. DGGE revealed that E. quadricolor predominantly associated with six types of clade C (four of which are novel) and that most anemones harboured multiple types simultaneously. Anemones from southern locations associated with a mixed assemblage of C25 and a variant of C3. This assemblage also dominated the central location, but was absent at the northern location. At central and northern sites, two novel variants of C42(type2) and C1 were found. Anemones hosting C42(type2) also showed a low abundance of variants of C3 and C1, and E1 was found in one sample, as revealed by bacterial cloning. The occurrence of geographically distinct ITS2 types or a consortium of types might reflect a need to optimise physiological performance of the symbiosis at different latitudes.

Cloning of the IgM heavy chain of the bottlenose dolphin (Tursiops truncatus), and initial analysis of VH gene usage.

PubMed

Lundqvist, Mats L; Kohlberg, Kathleen E; Gefroh, Holly A; Arnaud, Philippe; Middleton, Darlene L; Romano, Tracy A; Warr, Gregory W

2002-07-01

Clones encoding the dolphin IgM heavy (micro) chain gene were isolated from a cDNA library of peripheral blood leukocytes. Genomic Southern blot analyses showed that the dolphin IGHM gene is most likely present in a single copy, and its sequence shows greatest similarity to those of the IGHM gene of the sheep, pig and cow, evolutionarily related artiodactyls. The transmembrane (TM) form of the IGHM chain was isolated by 3' RACE. While showing similarities to the TM regions of other mammalian IGHM chains, the highly conserved Ser residue of the CART motif is substituted with a Gly in the dolphin. In contrast to the pig and cow, which utilize only a single VH family, the dolphin expresses at least two distinct VH families, belonging to the mammalian VH clans I and III. At least two JH genes were identified in the dolphin. Some CDR3 regions of the dolphin VH are long (up to 21 amino acids), and contain multiple Cys residues, hypothesized to stabilize the CDR3 structure through disulfide bond formation.

Recombinational Cloning Using Gateway and In-Fusion Cloning Schemes

PubMed Central

Throop, Andrea L.; LaBaer, Joshua

2015-01-01

The comprehensive study of protein structure and function, or proteomics, depends on the obtainability of full-length cDNAs in species-specific expression vectors and subsequent functional analysis of the expressed protein. Recombinational cloning is a universal cloning technique based on site-specific recombination that is independent of the insert DNA sequence of interest, which differentiates this method from the classical restriction enzyme-based cloning methods. Recombinational cloning enables rapid and efficient parallel transfer of DNA inserts into multiple expression systems. This unit summarizes strategies for generating expression-ready clones using the most popular recombinational cloning technologies, including the commercially available Gateway® (Life Technologies) and In-Fusion® (Clontech) cloning technologies. PMID:25827088

Altering the selection capabilities of common cloning vectors via restriction enzyme mediated gene disruption

PubMed Central

2013-01-01

Background The cloning of gene sequences forms the basis for many molecular biological studies. One important step in the cloning process is the isolation of bacterial transformants carrying vector DNA. This involves a vector-encoded selectable marker gene, which in most cases, confers resistance to an antibiotic. However, there are a number of circumstances in which a different selectable marker is required or may be preferable. Such situations can include restrictions to host strain choice, two phase cloning experiments and mutagenesis experiments, issues that result in additional unnecessary cloning steps, in which the DNA needs to be subcloned into a vector with a suitable selectable marker. Results We have used restriction enzyme mediated gene disruption to modify the selectable marker gene of a given vector by cloning a different selectable marker gene into the original marker present in that vector. Cloning a new selectable marker into a pre-existing marker was found to change the selection phenotype conferred by that vector, which we were able to demonstrate using multiple commonly used vectors and multiple resistance markers. This methodology was also successfully applied not only to cloning vectors, but also to expression vectors while keeping the expression characteristics of the vector unaltered. Conclusions Changing the selectable marker of a given vector has a number of advantages and applications. This rapid and efficient method could be used for co-expression of recombinant proteins, optimisation of two phase cloning procedures, as well as multiple genetic manipulations within the same host strain without the need to remove a pre-existing selectable marker in a previously genetically modified strain. PMID:23497512

Genetic characterization of Hawaiian isolates of Plasmodium relictum reveals mixed-genotype infections

USGS Publications Warehouse

Jarvi, S.I.; Farias, M.E.M.; Atkinson, C.T.

2008-01-01

Background: The relatively recent introduction of a highly efficient mosquito vector and an avian pathogen (Plasmodium relictum) to an isolated island ecosystem with nai??ve, highly susceptible avian hosts provides a unique opportunity to investigate evolution of virulence in a natural system. Mixed infections can significantly contribute to the uncertainty in host-pathogen dynamics with direct impacts on virulence. Toward further understanding of how host-parasite and parasite-parasite relationships may impact virulence, this study characterizes within-host diversity of malaria parasite populations based on genetic analysis of the trap (thrombospondin-related anonymous protein) gene in isolates originating from Hawaii, Maui and Kauai Islands. Methods: A total of 397 clones were produced by nested PCR amplification and cloning of a 1664 bp fragment of the trap gene from two malarial isolates, K1 (Kauai) and KV115 (Hawaii) that have been used for experimental studies, and from additional isolates from wild birds on Kauai, Maui and Hawaii Islands. Diversity of clones was evaluated initially by RFLP-based screening, followed by complete sequencing of 33 selected clones. Results: RFLP analysis of trap revealed a minimum of 28 distinct RFLP haplotypes among the 397 clones from 18 birds. Multiple trap haplotypes were detected in every bird evaluated, with an average of 5.9 haplotypes per bird. Overall diversity did not differ between the experimental isolates, however, a greater number of unique haplotypes were detected in K1 than in KV115. We detected high levels of clonal diversity with clear delineation between isolates K1 and KV115 in a haplotype network. The patterns of within-host haplotype clustering are consistent with the possibility of a clonal genetic structure and rapid within-host mutation after infection. Conclusion: Avian malaria (P. relictum) and Avipoxvirus are the significant infectious diseases currently affecting the native Hawaiian avifauna. This study shows that clonal diversity of Hawaiian isolates of P. relictum is much higher than previously recognized. Mixed infections can significantly contribute to the uncertainty in host-pathogen dynamics with direct implications for host demographics, disease management strategies, and evolution of virulence. The results of this study indicate a widespread presence of multiple-genotype malaria infections with high clonal diversity in native birds of Hawaii, which when coupled with concurrent infection with Avipoxvirus, may significantly influence evolution of virulence. ?? 2008 Jarvi et al; licensee BioMed Central Ltd.

Molecular genetic anatomy of inter- and intraserotype variation in the human bacterial pathogen group A Streptococcus.

PubMed

Beres, Stephen B; Richter, Ellen W; Nagiec, Michal J; Sumby, Paul; Porcella, Stephen F; DeLeo, Frank R; Musser, James M

2006-05-02

In recent years we have studied the relationship between strain genotypes and patient phenotypes in group A Streptococcus (GAS), a model human bacterial pathogen that causes extensive morbidity and mortality worldwide. We have concentrated our efforts on serotype M3 organisms because these strains are common causes of pharyngeal and invasive infections, produce unusually severe invasive infections, and can exhibit epidemic behavior. Our studies have been hindered by the lack of genome-scale phylogenies of multiple GAS strains and whole-genome sequences of multiple serotype M3 strains recovered from individuals with defined clinical phenotypes. To remove some of these impediments, we sequenced to closure the genome of four additional GAS strains and conducted comparative genomic resequencing of 12 contemporary serotype M3 strains representing distinct genotypes and phenotypes. Serotype M3 strains are a single phylogenetic lineage. Strains from asymptomatic throat carriers were significantly less virulent for mice than sterile-site isolates and evolved to a less virulent phenotype by multiple genetic pathways. Strain persistence or extinction between epidemics was strongly associated with presence or absence, respectively, of the prophage encoding streptococcal pyrogenic exotoxin A. A serotype M3 clone significantly underrepresented among necrotizing fasciitis cases has a unique frameshift mutation that truncates MtsR, a transcriptional regulator controlling expression of genes encoding iron-acquisition proteins. Expression microarray analysis of this clone confirmed significant alteration in expression of genes encoding iron metabolism proteins. Our analysis provided unprecedented detail about the molecular anatomy of bacterial strain genotype-patient phenotype relationships.

Exponential Megapriming PCR (EMP) Cloning—Seamless DNA Insertion into Any Target Plasmid without Sequence Constraints

PubMed Central

Ulrich, Alexander; Andersen, Kasper R.; Schwartz, Thomas U.

2012-01-01

We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP) cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF) cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts. PMID:23300917

Metabolomic phenotyping of a cloned pig model

PubMed Central

2011-01-01

Background Pigs are widely used as models for human physiological changes in intervention studies, because of the close resemblance between human and porcine physiology and the high degree of experimental control when using an animal model. Cloned animals have, in principle, identical genotypes and possibly also phenotypes and this offer an extra level of experimental control which could possibly make them a desirable tool for intervention studies. Therefore, in the present study, we address how phenotype and phenotypic variation is affected by cloning, through comparison of cloned pigs and normal outbred pigs. Results The metabolic phenotype of cloned pigs (n = 5) was for the first time elucidated by nuclear magnetic resonance (NMR)-based metabolomic analysis of multiple bio-fluids including plasma, bile and urine. The metabolic phenotype of the cloned pigs was compared with normal outbred pigs (n = 6) by multivariate data analysis, which revealed differences in the metabolic phenotypes. Plasma lactate was higher for cloned vs control pigs, while multiple metabolites were altered in the bile. However a lower inter-individual variability for cloned pigs compared with control pigs could not be established. Conclusions From the present study we conclude that cloned and normal outbred pigs are phenotypically different. However, it cannot be concluded that the use of cloned animals will reduce the inter-individual variation in intervention studies, though this is based on a limited number of animals. PMID:21859467

Multidrug-Resistant Salmonella enterica Serovar Infantis, Israel

PubMed Central

Valinsky, Lea; Weinberger, Miriam; Guy, Sara; Jaffe, Joseph; Schorr, Yosef Ilan; Raisfeld, Abraham; Agmon, Vered; Nissan, Israel

2010-01-01

To determine whether rapid emergence of Salmonella enterica serovar Infantis in Israel resulted from an increase in different biotypes or spread of 1 clone, we characterized 87 serovar Infantis isolates on the genotypic and phenotypic levels. The emerging strain comprised 1 genetic clone with a distinct pulsed-field gel electrophoresis profile and a common antimicrobial drug resistance pattern. PMID:21029536

Multidrug-resistant Salmonella enterica serovar Infantis, Israel.

PubMed

Gal-Mor, Ohad; Valinsky, Lea; Weinberger, Miriam; Guy, Sara; Jaffe, Joseph; Schorr, Yosef Ilan; Raisfeld, Abraham; Agmon, Vered; Nissan, Israel

2010-11-01

To determine whether rapid emergence of Salmonella enterica serovar Infantis in Israel resulted from an increase in different biotypes or spread of 1 clone, we characterized 87 serovar Infantis isolates on the genotypic and phenotypic levels. The emerging strain comprised 1 genetic clone with a distinct pulsed-field gel electrophoresis profile and a common antimicrobial drug resistance pattern.

A journey through horse cloning.

PubMed

Gambini, Andrés; Maserati, Marc

2017-01-01

Interest in equine somatic cell nuclear transfer technology has increased significantly since the first equid clones were produced in 2003. This is demonstrated by the multiple commercial equine cloning companies having produced numerous cloned equids to date; worldwide, more than 370 cloned horses have been produced in at least six different countries. Equine cloning can be performed using several different approaches, each with different rates of success. In this review we cover the history and applications of equine cloning and summarise the major scientific advances in the development of this technology in horses. We explain the advantages and disadvantages of different procedures to produce cloned equine embryos and describe the current status of equine clone commercialisation, along with observations of differences in regional breed association registration regulations.

Hot Fusion: an efficient method to clone multiple DNA fragments as well as inverted repeats without ligase.

PubMed

Fu, Changlin; Donovan, William P; Shikapwashya-Hasser, Olga; Ye, Xudong; Cole, Robert H

2014-01-01

Molecular cloning is utilized in nearly every facet of biological and medical research. We have developed a method, termed Hot Fusion, to efficiently clone one or multiple DNA fragments into plasmid vectors without the use of ligase. The method is directional, produces seamless junctions and is not dependent on the availability of restriction sites for inserts. Fragments are assembled based on shared homology regions of 17-30 bp at the junctions, which greatly simplifies the construct design. Hot Fusion is carried out in a one-step, single tube reaction at 50 °C for one hour followed by cooling to room temperature. In addition to its utility for multi-fragment assembly Hot Fusion provides a highly efficient method for cloning DNA fragments containing inverted repeats for applications such as RNAi. The overall cloning efficiency is in the order of 90-95%.

Hot Fusion: An Efficient Method to Clone Multiple DNA Fragments as Well as Inverted Repeats without Ligase

PubMed Central

Fu, Changlin; Donovan, William P.; Shikapwashya-Hasser, Olga; Ye, Xudong; Cole, Robert H.

2014-01-01

Molecular cloning is utilized in nearly every facet of biological and medical research. We have developed a method, termed Hot Fusion, to efficiently clone one or multiple DNA fragments into plasmid vectors without the use of ligase. The method is directional, produces seamless junctions and is not dependent on the availability of restriction sites for inserts. Fragments are assembled based on shared homology regions of 17–30 bp at the junctions, which greatly simplifies the construct design. Hot Fusion is carried out in a one-step, single tube reaction at 50°C for one hour followed by cooling to room temperature. In addition to its utility for multi-fragment assembly Hot Fusion provides a highly efficient method for cloning DNA fragments containing inverted repeats for applications such as RNAi. The overall cloning efficiency is in the order of 90–95%. PMID:25551825

Diversity, origins and virulence of Avipoxviruses in Hawaiian Forest Birds

USGS Publications Warehouse

Jarvi, S.I.; Triglia, D.; Giannoulis, A.; Farias, M.; Bianchi, K.; Atkinson, C.T.

2008-01-01

We cultured avian pox (Avipoxvirus spp.) from lesions collected on Hawai'i, Maui, Moloka'i, and 'Oahu in the Hawaiian Islands from 15 native or non-native birds representing three avian orders. Phylogenetic analysis of a 538 bp fragment of the gene encoding the virus 4b core polypeptide revealed two distinct variant clusters, with sequences from chickens (fowlpox) forming a third distinct basal cluster. Pox isolates from one of these two clusters appear closely related to canarypox and other passerine pox viruses, while the second appears more specific to Hawai'i. There was no evidence that birds were infected simultaneously with multiple pox virus variants based on evaluation of multiples clones from four individuals. No obvious temporal or geographic associations were observed and strict host specificity was not apparent among the 4b-defined field isolates. We amplified a 116 bp 4b core protein gene fragment from an 'Elepaio (Chasiempis sandwichensis) collected in 1900 on Hawai'i Island that clustered closely with the second of the two variants, suggesting that this variant has been in Hawai'i for at least 100 years. The high variation detected between the three 4b clusters provides evidence for multiple, likely independent introductions, and does not support the hypothesis of infection of native species through introduction of infected fowl. Preliminary experimental infections in native Hawai'i 'Amakihi (Hemignathus virens) suggest that the 4b-defined variants may be biologically distinct, with one variant appearing more virulent. These pox viruses may interact with avian malaria (Plasmodium relictum), another introduced pathogen in Hawaiian forest bird populations, through modulation of host immune responses. ?? 2007 Springer Science+Business Media B.V.

Multiple, Distinct Isoforms of Sucrose Synthase in Pea1

PubMed Central

Barratt, D.H. Paul; Barber, Lorraine; Kruger, Nicholas J.; Smith, Alison M.; Wang, Trevor L.; Martin, Cathie

2001-01-01

Genes encoding three isoforms of sucrose synthase (Sus1, Sus2, and Sus3) have been cloned from pea (Pisum sativum). The genes have distinct patterns of expression in different organs of the plant, and during organ development. Studies of the isoforms expressed as recombinant proteins in Escherichia coli show that they differ in kinetic properties. Although not of great magnitude, the differences in properties are consistent with some differentiation of physiological function between the isoforms. Evidence for differentiation of function in vivo comes from the phenotypes of rug4 mutants of pea, which carry mutations in the gene encoding Sus1. One mutant line (rug4-c) lacks detectable Sus1 protein in both the soluble and membrane-associated fractions of the embryo, and Sus activity in the embryo is reduced by 95%. The starch content of the embryo is reduced by 30%, but the cellulose content is unaffected. The results imply that different isoforms of Sus may channel carbon from sucrose towards different metabolic fates within the cell. PMID:11598239

Reverse genetics in high throughput: rapid generation of complete negative strand RNA virus cDNA clones and recombinant viruses thereof.

PubMed

Nolden, T; Pfaff, F; Nemitz, S; Freuling, C M; Höper, D; Müller, T; Finke, Stefan

2016-04-05

Reverse genetics approaches are indispensable tools for proof of concepts in virus replication and pathogenesis. For negative strand RNA viruses (NSVs) the limited number of infectious cDNA clones represents a bottleneck as clones are often generated from cell culture adapted or attenuated viruses, with limited potential for pathogenesis research. We developed a system in which cDNA copies of complete NSV genomes were directly cloned into reverse genetics vectors by linear-to-linear RedE/T recombination. Rapid cloning of multiple rabies virus (RABV) full length genomes and identification of clones identical to field virus consensus sequence confirmed the approache's reliability. Recombinant viruses were recovered from field virus cDNA clones. Similar growth kinetics of parental and recombinant viruses, preservation of field virus characters in cell type specific replication and virulence in the mouse model were confirmed. Reduced titers after reporter gene insertion indicated that the low level of field virus replication is affected by gene insertions. The flexibility of the strategy was demonstrated by cloning multiple copies of an orthobunyavirus L genome segment. This important step in reverse genetics technology development opens novel avenues for the analysis of virus variability combined with phenotypical characterization of recombinant viruses at a clonal level.

Molecular cloning and chromosomal localization of a pseudogene related to the human Acyl-CoA binding protein/diazepam binding inhibitor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gersuk, V.H.; Rose, T.M.; Todaro, G.J.

The acyl-CoA binding protein (ACBP) and the diazepam binding inhibitor (DBI) or endozepine are independent isolates of a single 86-amino-acid, 10-kDa protein. ACBP/DBI is highly conserved between species and has been identified in several diverse organisms, including human, cow, rat, frog, duck, insects, plants, and yeast. Although the genomic locus has not yet been cloned in humans, complementary DNA clones with different 5{prime} ends have been isolated and characterized. These cDNA clones appear to be encoded by a single gene. However, Southern blot analyses, in situ hybridizations, and somatic cell hybrid chromosomal mapping all suggest that there are multiple ACBP/DBI-relatedmore » sequences in the genome. To identify potential members of this gene family, degenerate oligonucleotides corresponding to highly conserved regions of ACBP/DBI were used to screen a human genomic DNA library using the polymerase chain reaction. A novel gene, DBIP1, that is closely related to ACBP/DBI but is clearly distinct was identified. DBIP1 bears extensive sequence homology to ACBP/DBI but lacks the introns predicted by rat and duck genomic sequence studies. A 1-base deletion in the coding region results in a frameshift and, along with the absence of introns and the lack of a detectable transcript, suggests that DBIP1 is a pseudogene. ACBP/DBI has previously been mapped to chromosome 2, although this was recently disputed, and a chromosome 6 location was suggested. We show that ACBP/DBI is correctly placed on chromosome 2 and that the gene identified on chromosome 6 is DBIP1. 33 refs., 3 figs., 1 tab.« less

Comparative sequence analyses of sixteen reptilian paramyxoviruses

USGS Publications Warehouse

Ahne, W.; Batts, W.N.; Kurath, G.; Winton, J.R.

1999-01-01

Viral genomic RNA of Fer-de-Lance virus (FDLV), a paramyxovirus highly pathogenic for reptiles, was reverse transcribed and cloned. Plasmids with significant sequence similarities to the hemagglutinin-neuraminidase (HN) and polymerase (L) genes of mammalian paramyxoviruses were identified by BLAST search. Partial sequences of the FDLV genes were used to design primers for amplification by nested polymerase chain reaction (PCR) and sequencing of 518-bp L gene and 352-bp HN gene fragments from a collection of 15 previously uncharacterized reptilian paramyxoviruses. Phylogenetic analyses of the partial L and HN sequences produced similar trees in which there were two distinct subgroups of isolates that were supported with maximum bootstrap values, and several intermediate isolates. Within each subgroup the nucleotide divergence values were less than 2.5%, while the divergence between the two subgroups was 20-22%. This indicated that the two subgroups represent distinct virus species containing multiple virus strains. The five intermediate isolates had nucleotide divergence values of 11-20% and may represent additional distinct species. In addition to establishing diversity among reptilian paramyxoviruses, the phylogenetic groupings showed some correlation with geographic location, and clearly demonstrated a low level of host species-specificity within these viruses. Copyright (C) 1999 Elsevier Science B.V.

Software-supported USER cloning strategies for site-directed mutagenesis and DNA assembly.

PubMed

Genee, Hans Jasper; Bonde, Mads Tvillinggaard; Bagger, Frederik Otzen; Jespersen, Jakob Berg; Sommer, Morten O A; Wernersson, Rasmus; Olsen, Lars Rønn

2015-03-20

USER cloning is a fast and versatile method for engineering of plasmid DNA. We have developed a user friendly Web server tool that automates the design of optimal PCR primers for several distinct USER cloning-based applications. Our Web server, named AMUSER (Automated DNA Modifications with USER cloning), facilitates DNA assembly and introduction of virtually any type of site-directed mutagenesis by designing optimal PCR primers for the desired genetic changes. To demonstrate the utility, we designed primers for a simultaneous two-position site-directed mutagenesis of green fluorescent protein (GFP) to yellow fluorescent protein (YFP), which in a single step reaction resulted in a 94% cloning efficiency. AMUSER also supports degenerate nucleotide primers, single insert combinatorial assembly, and flexible parameters for PCR amplification. AMUSER is freely available online at http://www.cbs.dtu.dk/services/AMUSER/.

Multiple Site-Directed and Saturation Mutagenesis by the Patch Cloning Method.

PubMed

Taniguchi, Naohiro; Murakami, Hiroshi

2017-01-01

Constructing protein-coding genes with desired mutations is a basic step for protein engineering. Herein, we describe a multiple site-directed and saturation mutagenesis method, termed MUPAC. This method has been used to introduce multiple site-directed mutations in the green fluorescent protein gene and in the moloney murine leukemia virus reverse transcriptase gene. Moreover, this method was also successfully used to introduce randomized codons at five desired positions in the green fluorescent protein gene, and for simple DNA assembly for cloning.

Novel immortal human cell lines reveal subpopulations in the nucleus pulposus

PubMed Central

2014-01-01

Introduction Relatively little is known about cellular subpopulations in the mature nucleus pulposus (NP). Detailed understanding of the ontogenetic, cellular and molecular characteristics of functional intervertebral disc (IVD) cell populations is pivotal to the successful development of cell replacement therapies and IVD regeneration. In this study, we aimed to investigate whether phenotypically distinct clonal cell lines representing different subpopulations in the human NP could be generated using immortalization strategies. Methods Nondegenerate healthy disc material (age range, 8 to 15 years) was obtained as surplus surgical material. Early passage NP monolayer cell cultures were initially characterized using a recently established NP marker set. NP cells were immortalized by simian virus 40 large T antigen (SV40LTag) and human telomerase reverse transcriptase expression. Immortalized cells were clonally expanded and characterized based on collagen type I, collagen type II, α1 (COL2A1), and SRY-box 9 (SOX9) protein expression profiles, as well as on expression of a subset of established in vivo NP cell lineage markers. Results A total of 54 immortal clones were generated. Profiling of a set of novel NP markers (CD24, CA12, PAX1, PTN, FOXF1 and KRT19 mRNA) in a representative set of subclones substantiated successful immortalization of multiple cellular subpopulations from primary isolates and confirmed their NP origin and/or phenotype. We were able to identify two predominant clonal NP subtypes based on their morphological characteristics and their ability to induce SOX9 and COL2A1 under conventional differentiation conditions. In addition, cluster of differentiation 24 (CD24)–negative NP responder clones formed spheroid structures in various culture systems, suggesting the preservation of a more immature phenotype compared to CD24-positive nonresponder clones. Conclusions Here we report the generation of clonal NP cell lines from nondegenerate human IVD tissue and present a detailed characterization of NP cellular subpopulations. Differential cell surface marker expression and divergent responses to differentiation conditions suggest that the NP subtypes may correspond to distinct maturation stages and represent distinct NP cell subpopulations. Hence, we provide evidence that the immortalization strategy that we applied is capable of detecting cell heterogeneity in the NP. Our cell lines yield novel insights into NP biology and provide promising new tools for studies of IVD development, cell function and disease. PMID:24972717

Novel immortal human cell lines reveal subpopulations in the nucleus pulposus.

PubMed

van den Akker, Guus G H; Surtel, Don A M; Cremers, Andy; Rodrigues-Pinto, Ricardo; Richardson, Stephen M; Hoyland, Judith A; van Rhijn, Lodewijk W; Welting, Tim J M; Voncken, Jan Willem

2014-06-27

Relatively little is known about cellular subpopulations in the mature nucleus pulposus (NP). Detailed understanding of the ontogenetic, cellular and molecular characteristics of functional intervertebral disc (IVD) cell populations is pivotal to the successful development of cell replacement therapies and IVD regeneration. In this study, we aimed to investigate whether phenotypically distinct clonal cell lines representing different subpopulations in the human NP could be generated using immortalization strategies. Nondegenerate healthy disc material (age range, 8 to 15 years) was obtained as surplus surgical material. Early passage NP monolayer cell cultures were initially characterized using a recently established NP marker set. NP cells were immortalized by simian virus 40 large T antigen (SV40LTag) and human telomerase reverse transcriptase expression. Immortalized cells were clonally expanded and characterized based on collagen type I, collagen type II, α1 (COL2A1), and SRY-box 9 (SOX9) protein expression profiles, as well as on expression of a subset of established in vivo NP cell lineage markers. A total of 54 immortal clones were generated. Profiling of a set of novel NP markers (CD24, CA12, PAX1, PTN, FOXF1 and KRT19 mRNA) in a representative set of subclones substantiated successful immortalization of multiple cellular subpopulations from primary isolates and confirmed their NP origin and/or phenotype. We were able to identify two predominant clonal NP subtypes based on their morphological characteristics and their ability to induce SOX9 and COL2A1 under conventional differentiation conditions. In addition, cluster of differentiation 24 (CD24)-negative NP responder clones formed spheroid structures in various culture systems, suggesting the preservation of a more immature phenotype compared to CD24-positive nonresponder clones. Here we report the generation of clonal NP cell lines from nondegenerate human IVD tissue and present a detailed characterization of NP cellular subpopulations. Differential cell surface marker expression and divergent responses to differentiation conditions suggest that the NP subtypes may correspond to distinct maturation stages and represent distinct NP cell subpopulations. Hence, we provide evidence that the immortalization strategy that we applied is capable of detecting cell heterogeneity in the NP. Our cell lines yield novel insights into NP biology and provide promising new tools for studies of IVD development, cell function and disease.

Species-specific challenges in dog cloning.

PubMed

Kim, G A; Oh, H J; Park, J E; Kim, M J; Park, E J; Jo, Y K; Jang, G; Kim, M K; Kim, H J; Lee, B C

2012-12-01

Somatic cell nuclear transfer (SCNT) is now an established procedure used in cloning of several species. SCNT in dogs involves multiple steps including the removal of the nuclear material, injection of a donor cell, fusion, activation of the reconstructed oocytes and finally transfer to a synchronized female recipient. There are therefore many factors that contribute to cloning efficiency. By performing a retrospective analysis of 2005-2012 published papers regarding dog cloning, we define the optimum procedure and summarize the specific feature for dog cloning. © 2012 Blackwell Verlag GmbH.

Development of the gateway recycling cloning system for multiple linking of expression cassettes in a defined order, and direction on gateway compatible binary vectors.

PubMed

Kimura, Tetsuya; Nakao, Akihide; Murata, Sachiko; Kobayashi, Yasuyuki; Tanaka, Yuji; Shibahara, Kenta; Kawazu, Tetsu; Nakagawa, Tsuyoshi

2013-01-01

We developed the Gateway recycling cloning system, which allows multiple linking of expression cassettes by multiple rounds of the Gateway LR reaction. Employing this system, the recycling donor vector pRED419 was subjected to the first LR reaction with an attR1-attR2 type destination vector. Then conversion vector pCON was subjected to an LR reaction to restore the attR1-attR2 site on the destination vector for the next cloning cycle. By repetition of these two simple steps, we linked four expression cassettes of a reporter gene in Gateway binary vector pGWB1, introduced the constructs into tobacco BY-2 cells, and observed the expression of transgenes.

THY-1 Receptor Expression Differentiates Cardiosphere-Derived Cells with Divergent Cardiogenic Differentiation Potential

PubMed Central

Gago-Lopez, Nuria; Awaji, Obinna; Zhang, Yiqiang; Ko, Christopher; Nsair, Ali; Liem, David; Stempien-Otero, April; MacLellan, W. Robb

2014-01-01

Summary Despite over a decade of intense research, the identity and differentiation potential of human adult cardiac progenitor cells (aCPC) remains controversial. Cardiospheres have been proposed as a means to expand aCPCs in vitro, but the identity of the progenitor cell within these 3D structures is unknown. We show that clones derived from cardiospheres could be subdivided based on expression of thymocyte differentiation antigen 1 (THY-1/CD90) into two distinct populations that exhibit divergent cardiac differentiation potential. One population, which is CD90+, expressed markers consistent with a mesenchymal/myofibroblast cell. The second clone type was CD90− and could form mature, functional myocytes with sarcomeres albeit at a very low rate. These two populations of cardiogenic clones displayed distinct cell surface markers and unique transcriptomes. Our study suggests that a rare aCPC exists in cardiospheres along with a mesenchymal/myofibroblast cell, which demonstrates incomplete cardiac myocyte differentiation. PMID:24936447

Multiple factors affect pest and pathogen damage on 31 Populus clones in South Carolina

Treesearch

David R. Coyle; Mark D. Coleman; Jaclin A. Durant; Lee A. Newman

2006-01-01

Populus species and hybrids have many practical applications, but there is a paucity of data regarding selections that perform well in the southeastern US. We compared pest susceptibility of 31 Populus clones over 3 years in South Carolina, USA. Cuttings were planted in spring 2001 on two study sites. Clones planted in the...

Demography and Intercontinental Spread of the USA300 Community-Acquired Methicillin-Resistant Staphylococcus aureus Lineage

PubMed Central

Glaser, Philippe; Martins-Simões, Patrícia; Villain, Adrien; Barbier, Maxime; Tristan, Anne; Bouchier, Christiane; Ma, Laurence; Bes, Michele; Laurent, Frederic; Guillemot, Didier; Wirth, Thierry

2016-01-01

ABSTRACT Community-acquired methicillin-resistant Staphylococcus aureus (CA-MRSA) was recognized worldwide during the 1990s; in less than a decade, several genetically distinct CA-MRSA lineages carrying Panton-Valentine leukocidin genes have emerged on every continent. Most notably, in the United States, the sequence type 18-IV (ST8-IV) clone known as USA300 has become highly prevalent, outcompeting methicillin-susceptible S. aureus (MSSA) and other MRSA strains in both community and hospital settings. CA-MRSA bacteria are much less prevalent in Europe, where the European ST80-IV European CA-MRSA clone, USA300 CA-MRSA strains, and other lineages, such as ST22-IV, coexist. The question that arises is whether the USA300 CA-MRSA present in Europe (i) was imported once or on very few occasions, followed by a broad geographic spread, anticipating an increased prevalence in the future, or (ii) derived from multiple importations with limited spreading success. In the present study, we applied whole-genome sequencing to a collection of French USA300 CA-MRSA strains responsible for sporadic cases and micro-outbreaks over the past decade and United States ST8 MSSA and MRSA isolates. Genome-wide phylogenetic analysis demonstrated that the population structure of the French isolates is the product of multiple introductions dating back to the onset of the USA300 CA-MRSA clone in North America. Coalescent-based demography of the USA300 lineage shows that a strong expansion occurred during the 1990s concomitant with the acquisition of the arginine catabolic mobile element and antibiotic resistance, followed by a sharp decline initiated around 2008, reminiscent of the rise-and-fall pattern previously observed in the ST80 lineage. A future expansion of the USA300 lineage in Europe is therefore very unlikely. PMID:26884428

Chromosomal Organization and Sequence Diversity of Genes Encoding Lachrymatory Factor Synthase in Allium cepa L.

PubMed Central

Masamura, Noriya; McCallum, John; Khrustaleva, Ludmila; Kenel, Fernand; Pither-Joyce, Meegham; Shono, Jinji; Suzuki, Go; Mukai, Yasuhiko; Yamauchi,, Naoki; Shigyo, Masayoshi

2012-01-01

Lachrymatory factor synthase (LFS) catalyzes the formation of lachrymatory factor, one of the most distinctive traits of bulb onion (Allium cepa L.). Therefore, we used LFS as a model for a functional gene in a huge genome, and we examined the chromosomal organization of LFS in A. cepa by multiple approaches. The first-level analysis completed the chromosomal assignment of LFS gene to chromosome 5 of A. cepa via the use of a complete set of A. fistulosum–shallot (A. cepa L. Aggregatum group) monosomic addition lines. Subsequent use of an F2 mapping population from the interspecific cross A. cepa × A. roylei confirmed the assignment of an LFS locus to this chromosome. Sequence comparison of two BAC clones bearing LFS genes, LFS amplicons from diverse germplasm, and expressed sequences from a doubled haploid line revealed variation consistent with duplicated LFS genes. Furthermore, the BAC-FISH study using the two BAC clones as a probe showed that LFS genes are localized in the proximal region of the long arm of the chromosome. These results suggested that LFS in A. cepa is transcribed from at least two loci and that they are localized on chromosome 5. PMID:22690373

LabVIEW Task Manager v. 1.10.0

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vargo, Timothy D.

LabVIEW Task Manager is a debugging tool for use during code development in the National Instruments (NI) LabVIEW® IDE. While providing a dynamic & big-picture view of running code, an expandable/collapsible tree diagram displays detailed information (both static and dynamic) on all VIs in memory, belonging to a selected project/target. It allows for interacting with single or multiple selected VIs at a time, providing significant benefits while troubleshooting, and has the following features: Look & Feel similar to Windows® Task Manager; Selection of project/target; Lists all VIs in memory, grouped by class/library; Searches for and enumerates clones in memory; DropInmore » VI for including dynamically referenced clones (Clone Beacon); 'Refresh Now' (F5) re-reads all VIs in memory and adds new ones to the tree; Displays VI name, owning class/library, state, path, data size & code size; Displays VI FP Behavior, Reentrant?, Reentrancy Type, Paused? & Highlight?; Sort by any column, including by library name; Filter by item types vi, ctl, and vit/ctt; Filter out vi.lib and global VIs; Tracking of, and ability to toggle, execution highlighting on multiple selected VIs; Tracking of paused VIs with ability to Pause/Resume/TogglePause multiple selected VIs; DropIn VI for pausing on a condition; If a clone initiates a pause, a different pause symbol is used for all clones of that same reentrant original VI; Select multiple VIs and open or close their FPs or BDs; Double Click a VI from the tree to bring the BD (first choice) or FP to front, if already open; and Select multiple top-level VIs and Abort them.« less

Evidence of drug-response heterogeneity rapidly generated from a single cancer cell.

PubMed

Wang, Rong; Jin, Chengmeng; Hu, Xun

2017-06-20

One cancer cell line is believed to be composed of numerous clones with different drug sensitivity. We sought to investigate the difference of drug-response pattern in clones from a cell line or from a single cell. We showed that 22 clones derived from 4T1 cells were drastically different from each other with respect to drug-response pattern against 11 anticancer drugs and expression profile of 19 genes associated with drug resistance or sensitivity. Similar results were obtained using daughter clones derived from a single 4T1 cell. Each daughter clone showed distinct drug-response pattern and gene expression profile. Similar results were also obtained using Bcap37 cells. We conclude that a single cancer cell can rapidly produce a population of cells with high heterogeneity of drug response and the acquisition of drug-response heterogeneity is random.

A universal mini-vector and an annealing of PCR products (APP)-based cloning strategy for convenient molecular biological manipulations.

PubMed

Liu, Xia; Li, Tuoping; Hart, Darren J; Gao, Song; Wang, Hongling; Gao, Herui; Xu, Shumin; Zhang, Yifeng; Liu, Yifei; An, Yingfeng

2018-03-18

Currently, the most widely used strategies for molecular cloning are sticky-end ligation-based cloning, TA cloning, blunt-end ligation-based cloning and ligase-independent cloning. In this study we have developed a novel mini-vector pANY1 which can simultaneously meet the requirements of all these cloning strategies. In addition, the selection of appropriate restriction digestion sites is difficult in some cases because of the presence of internal sites. In this study, an annealing of PCR products (APP)-based sticky-end cloning strategy was introduced to avoid this issue. Additionally, false positives occur during molecular cloning, which increases the workload of isolating positive clones. The plasmid pANY1 contains a ccdB cassette between multiple cloning sites, which efficiently avoids these false positives. Therefore, this mini-vector should serve as a useful tool with wide applications in biosciences, agriculture, food technologies, etc. Copyright © 2018 Elsevier Inc. All rights reserved.

Genetic characterization of Hawaiian isolates of Plasmodium relictum reveals mixed-genotype infections

PubMed Central

Jarvi, Susan I; Farias, Margaret EM; Atkinson, Carter T

2008-01-01

Background The relatively recent introduction of a highly efficient mosquito vector and an avian pathogen (Plasmodium relictum) to an isolated island ecosystem with naïve, highly susceptible avian hosts provides a unique opportunity to investigate evolution of virulence in a natural system. Mixed infections can significantly contribute to the uncertainty in host-pathogen dynamics with direct impacts on virulence. Toward further understanding of how host-parasite and parasite-parasite relationships may impact virulence, this study characterizes within-host diversity of malaria parasite populations based on genetic analysis of the trap (thrombospondin-related anonymous protein) gene in isolates originating from Hawaii, Maui and Kauai Islands. Methods A total of 397 clones were produced by nested PCR amplification and cloning of a 1664 bp fragment of the trap gene from two malarial isolates, K1 (Kauai) and KV115 (Hawaii) that have been used for experimental studies, and from additional isolates from wild birds on Kauai, Maui and Hawaii Islands. Diversity of clones was evaluated initially by RFLP-based screening, followed by complete sequencing of 33 selected clones. Results RFLP analysis of trap revealed a minimum of 28 distinct RFLP haplotypes among the 397 clones from 18 birds. Multiple trap haplotypes were detected in every bird evaluated, with an average of 5.9 haplotypes per bird. Overall diversity did not differ between the experimental isolates, however, a greater number of unique haplotypes were detected in K1 than in KV115. We detected high levels of clonal diversity with clear delineation between isolates K1 and KV115 in a haplotype network. The patterns of within-host haplotype clustering are consistent with the possibility of a clonal genetic structure and rapid within-host mutation after infection. Conclusion Avian malaria (P. relictum) and Avipoxvirus are the significant infectious diseases currently affecting the native Hawaiian avifauna. This study shows that clonal diversity of Hawaiian isolates of P. relictum is much higher than previously recognized. Mixed infections can significantly contribute to the uncertainty in host-pathogen dynamics with direct implications for host demographics, disease management strategies, and evolution of virulence. The results of this study indicate a widespread presence of multiple-genotype malaria infections with high clonal diversity in native birds of Hawaii, which when coupled with concurrent infection with Avipoxvirus, may significantly influence evolution of virulence. Reviewers This article was reviewed by Joseph Schall (nominated by Laura Landweber), Daniel Jeffares (nominated by Anthony Poole) and Susan Perkins (nominated by Eugene Koonin). PMID:18578879

Rapid modification of the pET-28 expression vector for ligation independent cloning using homologous recombination in Saccharomyces cerevisiae

PubMed Central

Gay, Glen; Wagner, Drew T.; Keatinge-Clay, Adrian T.; Gay, Darren C.

2014-01-01

The ability to rapidly customize an expression vector of choice is a valuable tool for any researcher involved in high-throughput molecular cloning for protein overexpression. Unfortunately, it is common practice to amend or neglect protein targets if the gene that encodes the protein of interest is incompatible with the multiple-cloning region of a preferred expression vector. To address this issue, a method was developed to quickly exchange the multiple-cloning region of the popular expression plasmid pET-28 with a ligation-independent cloning cassette, generating pGAY-28. This cassette contains dual inverted restriction sites that reduce false positive clones by generating a linearized plasmid incapable of self-annealing after a single restriction-enzyme digest. We also establish that progressively cooling the vector and insert leads to a significant increase in ligation-independent transformation efficiency, demonstrated by the incorporation of a 10.3 kb insert into the vector. The method reported to accomplish plasmid reconstruction is uniquely versatile yet simple, relying on the strategic placement of primers combined with homologous recombination of PCR products in yeast. PMID:25304917

T-cell libraries allow simple parallel generation of multiple peptide-specific human T-cell clones.

PubMed

Theaker, Sarah M; Rius, Cristina; Greenshields-Watson, Alexander; Lloyd, Angharad; Trimby, Andrew; Fuller, Anna; Miles, John J; Cole, David K; Peakman, Mark; Sewell, Andrew K; Dolton, Garry

2016-03-01

Isolation of peptide-specific T-cell clones is highly desirable for determining the role of T-cells in human disease, as well as for the development of therapies and diagnostics. However, generation of monoclonal T-cells with the required specificity is challenging and time-consuming. Here we describe a library-based strategy for the simple parallel detection and isolation of multiple peptide-specific human T-cell clones from CD8(+) or CD4(+) polyclonal T-cell populations. T-cells were first amplified by CD3/CD28 microbeads in a 96U-well library format, prior to screening for desired peptide recognition. T-cells from peptide-reactive wells were then subjected to cytokine-mediated enrichment followed by single-cell cloning, with the entire process from sample to validated clone taking as little as 6 weeks. Overall, T-cell libraries represent an efficient and relatively rapid tool for the generation of peptide-specific T-cell clones, with applications shown here in infectious disease (Epstein-Barr virus, influenza A, and Ebola virus), autoimmunity (type 1 diabetes) and cancer. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Identification of Prostate Cancer-Specific microDNAs

DTIC Science & Technology

2014-12-01

displacement amplification (MDA). 2 adopted multiple displacement amplification (MDA) with random primers for enriched circular DNA by rolling circle ... amplification (RCA) (Fig. 1) and then amplified DNA fragments were subject to deep sequencing. Sequence NO of Reads seq 1 184 seq 2 133 seq 3 2407 seq...prostate cancer cells through multiple displacement amplification .  Clone #7 is the top candidate which has been cloned in an expression vector and it

Nitrous Oxide Reductase (nosZ) Gene Fragments Differ between Native and Cultivated Michigan Soils

PubMed Central

Stres, Blaž; Mahne, Ivan; Avguštin, Gorazd; Tiedje, James M.

2004-01-01

The effect of standard agricultural management on the genetic heterogeneity of nitrous oxide reductase (nosZ) fragments from denitrifying prokaryotes in native and cultivated soil was explored. Thirty-six soil cores were composited from each of the two soil management conditions. nosZ gene fragments were amplified from triplicate samples, and PCR products were cloned and screened by restriction fragment length polymorphism (RFLP). The total nosZ RFLP profiles increased in similarity with soil sample size until triplicate 3-g samples produced visually identical RFLP profiles for each treatment. Large differences in total nosZ profiles were observed between the native and cultivated soils. The fragments representing major groups of clones encountered at least twice and four randomly selected clones with unique RFLP patterns were sequenced to verify nosZ identity. The sequence diversity of nosZ clones from the cultivated field was higher, and only eight patterns were found in clone libraries from both soils among the 182 distinct nosZ RFLP patterns identified from the two soils. A group of clones that comprised 32% of all clones dominated the gene library of native soil, whereas many minor groups were observed in the gene library of cultivated soil. The 95% confidence intervals of the Chao1 nonparametric richness estimator for nosZ RFLP data did not overlap, indicating that the levels of species richness are significantly different in the two soils, the cultivated soil having higher diversity. Phylogenetic analysis of deduced amino acid sequences grouped the majority of nosZ clones into an interleaved Michigan soil cluster whose cultured members are α-Proteobacteria. Only four nosZ sequences from cultivated soil and one from the native soil were related to sequences found in γ-Proteobacteria. Sequences from the native field formed a distinct, closely related cluster (Dmean = 0.16) containing 91.6% of the native clones. Clones from the cultivated field were more distantly related to each other (Dmean = 0.26), and 65% were found outside of the cluster from the native soil, further indicating a difference in the two communities. Overall, there appears to be a relationship between use and richness, diversity, and the phylogenetic position of nosZ sequences, indicating that agricultural use of soil caused a shift to a more diverse denitrifying community. PMID:14711656

Formation of functional asialoglycoprotein receptor after transfection with cDNAs encoding the receptor proteins.

PubMed Central

McPhaul, M; Berg, P

1986-01-01

The rat asialoglycoprotein receptor (ASGP-R) has been expressed in cultured rat hepatoma cells (HTC cells) after transfection with cloned cDNAs. Fluorescence-activated cell sorting of transfected cells was used to identify the functional cDNA clones and to isolate cells expressing the ASGP-R. Simultaneous or sequential transfections with two cloned cDNAs that encode related but distinctive polypeptide chains were needed to obtain ASGP-R activity; transfection with either cDNA alone failed to produce detectable ASGP-R. The affinity of transduced ASGP-R for asialo orosomucoid is less than that of the native rat ASGP-R, and the number of surface receptors in clones expressing ASGP-R is about one-fifth that found on rat hepatocytes. Images PMID:3466162

A strategy for clone selection under different production conditions.

PubMed

Legmann, Rachel; Benoit, Brian; Fedechko, Ronald W; Deppeler, Cynthia L; Srinivasan, Sriram; Robins, Russell H; McCormick, Ellen L; Ferrick, David A; Rodgers, Seth T; Russo, A Peter

2011-01-01

Top performing clones have failed at the manufacturing scale while the true best performer may have been rejected early in the screening process. Therefore, the ability to screen multiple clones in complex fed-batch processes using multiple process variations can be used to assess robustness and to identify critical factors. This dynamic ranking of clones' strategy requires the execution of many parallel experiments than traditional approaches. Therefore, this approach is best suited for micro-bioreactor models which can perform hundreds of experiments quickly and efficiently. In this study, a fully monitored and controlled small scale platform was used to screen eight CHO clones producing a recombinant monoclonal antibody across several process variations, including different feeding strategies, temperature shifts and pH control profiles. The first screen utilized 240 micro-bioreactors were run for two weeks for this assessment of the scale-down model as a high-throughput tool for clone evaluation. The richness of the outcome data enable to clearly identify the best and worst clone as well as process in term of maximum monoclonal antibody titer. The follow-up comparison study utilized 180 micro-bioreactors in a full factorial design and a subset of 12 clone/process combinations was selected to be run parallel in duplicate shake flasks. Good correlation between the micro-bioreactor predictions and those made in shake flasks with a Pearson correlation value of 0.94. The results also demonstrate that this micro-scale system can perform clone screening and process optimization for gaining significant titer improvements simultaneously. This dynamic ranking strategy can support better choices of production clones. Copyright © 2011 American Institute of Chemical Engineers (AIChE).

T-cell stimuli independently sum to regulate an inherited clonal division fate

PubMed Central

Marchingo, J. M.; Prevedello, G.; Kan, A.; Heinzel, S.; Hodgkin, P. D.; Duffy, K. R.

2016-01-01

In the presence of antigen and costimulation, T cells undergo a characteristic response of expansion, cessation and contraction. Previous studies have revealed that population-level reproducibility is a consequence of multiple clones exhibiting considerable disparity in burst size, highlighting the requirement for single-cell information in understanding T-cell fate regulation. Here we show that individual T-cell clones resulting from controlled stimulation in vitro are strongly lineage imprinted with highly correlated expansion fates. Progeny from clonal families cease dividing in the same or adjacent generations, with inter-clonal variation producing burst-size diversity. The effects of costimulatory signals on individual clones sum together with stochastic independence; therefore, the net effect across multiple clones produces consistent, but heterogeneous population responses. These data demonstrate that substantial clonal heterogeneity arises through differences in experience of clonal progenitors, either through stochastic antigen interaction or by differences in initial receptor sensitivities. PMID:27869196

Distinct T cell interactions with HLA class II tetramers characterize a spectrum of TCR affinities in the human antigen-specific T cell response.

PubMed

Reichstetter, S; Ettinger, R A; Liu, A W; Gebe, J A; Nepom, G T; Kwok, W W

2000-12-15

The polyclonal nature of T cells expanding in an ongoing immune response results in a range of disparate affinities and activation potential. Recently developed human class II tetramers provide a means to analyze this diversity by direct characterization of the trimolecular TCR-peptide-MHC interaction in live cells. Two HSV-2 VP16(369-379)-specific, DQA1*0102/DQB1*0602 (DQ0602)-restricted T cell clones were compared by means of T cell proliferation assay and HLA-DQ0602 tetramer staining. These two clones were obtained from the same subject, but show different TCR gene usage. Clone 48 was 10-fold more sensitive to VP16(369-379) peptide stimulation than clone 5 as assayed by proliferation assays, correlating with differences in MHC tetramer binding. Clone 48 gave positive staining with the DQ0602/VP16(369-379) tetramer at either 23 or 37 degrees C. Weak staining was also observed at 4 degrees C. Clone 5 showed weaker staining compared with clone 48 at 37 degrees C, and no staining was observed at 23 degrees C or on ice. Receptor internalization was not required for positive staining. Competitive binding indicates that the cell surface TCR of clone 48 has higher affinity for the DQ0602/VP16(369-379) complex than clone 5. The higher binding affinity of clone 48 for the peptide-MHC complex also correlates with a slower dissociation rate compared with clone 5.

Three copies of a single protein II-encoding sequence in the genome of Neisseria gonorrhoeae JS3: evidence for gene conversion and gene duplication.

PubMed

van der Ley, P

1988-11-01

Gonococci express a family of related outer membrane proteins designated protein II (P.II). These surface proteins are subject to both phase variation and antigenic variation. The P.II gene repertoire of Neisseria gonorrhoeae strain JS3 was found to consist of at least ten genes, eight of which were cloned. Sequence analysis and DNA hybridization studies revealed that one particular P.II-encoding sequence is present in three distinct, but almost identical, copies in the JS3 genome. These genes encode the P.II protein that was previously identified as P.IIc. Comparison of their sequences shows that the multiple copies of this P.IIc-encoding gene might have been generated by both gene conversion and gene duplication.

Animal transgenesis: state of the art and applications.

PubMed

Melo, Eduardo O; Canavessi, Aurea M O; Franco, Mauricio M; Rumpf, Rodolfo

2007-01-01

There is a constant expectation for fast improvement of livestock production and human health care products. The advent of DNA recombinant technology and the possibility of gene transfer between organisms of distinct species, or even distinct phylogenic kingdoms, has opened a wide range of possibilities. Nowadays we can produce human insulin in bacteria or human coagulation factors in cattle milk. The recent advances in gene transfer, animal cloning, and assisted reproductive techniques have partly fulfilled the expectation in the field of livestock transgenesis. This paper reviews the recent advances and applications of transgenesis in livestock and their derivative products. At first, the state of art and the techniques that enhance the efficiency of livestock transgenesis are presented. The consequent reduction in the cost and time necessary to reach a final product has enabled the multiplication of transgenic prototypes around the world. We also analyze here some emerging applications of livestock transgenesis in the field of pharmacology, meat and dairy industry, xenotransplantation, and human disease modeling. Finally, some bioethical and commercial concerns raised by the transgenesis applications are discussed.

Cloning and Functional Analysis of Three Chalcone Synthases from the Flowers of Safflowers Carthamus tinctorius.

PubMed

Shinozaki, Junichi; Kenmoku, Hiromichi; Nihei, Kenichi; Masuda, Kazuo; Noji, Masaaki; Konno, Katsuhiro; Asakawa, Yoshinori; Kazuma, Kohei

2016-06-01

The flowers of safflowers (Carthamus tinctorius L.) are very important as they are the sole source of their distinct pigments, i.e. carthamus-red and -yellows, and have historically had strong connections to the cultural side of human activities such as natural dyes, rouge, and traditional medicines. The distinct pigments are quinochalcone C-glucosides, which are found specifically in the flowers of C. tinctorius. To investigate the biosynthetic pathways of quinochalcone C-glucosides, de novo assembly of the transcriptome was performed on the flowers using an Illumina sequencing platform to obtain 69,312 annotated coding DNA sequences. Three chalcone synthase like genes, CtCHS1, 2 and 3 were focused on and cloned, which might be involved in quinochalcone C-glucosides biosynthesis by establishing the C6-C3-C6 chalcone skeleton. It was demonstrated that all the recombinant CtCHSs could recognize p-coumaroyl-CoA, caffeoyl-CoA, feruloyl-CoA, and sinapoyl-CoA as starter substrates. This is the first report on the cloning and functional analysis of the three chalcone synthase genes from the flowers of C. tinctorius.

A genetically diverse but distinct North American population of Sarcocystis neurona includes an overrepresented clone described by 12 microsatellite alleles.

PubMed

Asmundsson, Ingrid M; Dubey, J P; Rosenthal, Benjamin M

2006-09-01

The population genetics and systematics of most coccidians remain poorly defined despite their impact on human and veterinary health. Non-recombinant parasite clones characterized by distinct transmission and pathogenesis traits persist in the coccidian Toxoplasma gondii despite opportunities for sexual recombination. In order to determine whether this may be generally true for tissue-cyst forming coccidia, and to address evolutionary and taxonomic problems within the genus Sarcocystis, we characterized polymorphic microsatellite markers in Sarcocystis neurona, the major causative agent of equine protozoal myeloencephalitis (EPM). Bayesian statistical modeling, phylogenetic reconstruction based on genotypic chord distances, and analyses of linkage disequilibrium were employed to examine the population structure within S. neurona and closely related Sarcocystis falcatula isolates from North and South America. North American S. neurona were clearly differentiated from those of South America and also from isolates of S. falcatula. Although S. neurona is characterized by substantial allelic and genotypic diversity typical of interbreeding populations, one genotype occurs with significantly excessive frequency; thus, some degree of asexual propagation of S. neurona clones may naturally occur. Finally, S. neurona isolated from disparate North American localities and diverse hosts (opossums, a Southern sea otter, and horses) comprise a single genetic population. Isolates associated with clinical neurological disease bear no obvious distinction as measured by these presumably neutral genetic markers.

Cloned cows with short telomeres deliver healthy offspring with normal-length telomeres.

PubMed

Miyashita, Norikazu; Kubo, Yasuaki; Yonai, Miharu; Kaneyama, Kanako; Saito, Norio; Sawai, Ken; Minamihashi, Akira; Suzuki, Toshiyuki; Kojima, Toshiyuki; Nagai, Takashi

2011-10-01

Dolly, the first mammal cloned from a somatic cell, had shorter telomeres than age-matched controls and died at an early age because of disease. To investigate longevity and lifetime performance in cloned animals, we produced cloned cows with short telomeres using oviductal epithelial cells as donor cells. At 5 years of age, despite the presence of short telomeres, all cloned cows delivered multiple healthy offspring following artificial insemination with conventionally processed spermatozoa from noncloned bulls, and their milk production was comparable to that of donor cows. Moreover, this study revealed that the offspring had normal-length telomeres in their leukocytes and major organs. Thus, cloned animals have normal functional germ lines, and therefore germ line function can completely restore telomere lengths in clone gametes by telomerase activity, resulting in healthy offspring with normal-length telomeres.

Genomic instability in human lymphoid cells exposed to 1 GeV/amu Fe ions

NASA Technical Reports Server (NTRS)

Grosovsky, A.; Bethel, H.; Parks, K.; Ritter, L.; Giver, C.; Gauny, S.; Wiese, C.; Kronenberg, A.

2001-01-01

The goal of this study was to assess whether charged particle radiations of importance to spaceflight elicit genomic instability in human TK6 lymphoblasts. The incidence of genomic instability in TK6 cells was assessed 21 days after exposure to 2, 4, or 6 Fe ions (1 GeV/amu, LET= 146 keV/micrometers). Three indices of instability were used: intraclonal karyotypic heterogeneity, mutation rate analysis at the thymidine kinase (TK1) locus, and re-cloning efficiency. Fifteen of sixty clones demonstrated karyotypic heterogeneity. Five clones had multiple indicators of karyotypic change. One clone was markedly hypomutable and polyploid. Six clones were hypomutable, while 21 clones were mutators. Of these, seven were karyotypically unstable. Six clones had low re-cloning efficiencies, one of which was a mutator. All had normal karyotypes. In summary, many clones that survived exposure to a low fluence of Fe ions manifested one or more forms of genomic instability that may hasten the development of neoplasia through deletion or by recombination.

Genomic instability in human lymphoid cells exposed to 1 GeV/amu Fe ions.

PubMed

Grosovsky, A; Bethel, H; Parks, K; Ritter, L; Giver, C; Gauny, S; Wiese, C; Kronenberg, A

2001-01-01

The goal of this study was to assess whether charged particle radiations of importance to spaceflight elicit genomic instability in human TK6 lymphoblasts. The incidence of genomic instability in TK6 cells was assessed ~21 days after exposure to 2, 4, or 6 Fe ions (1 GeV/amu, LET= 146 keV/micrometers). Three indices of instability were used: intraclonal karyotypic heterogeneity, mutation rate analysis at the thymidine kinase (TK1) locus, and re-cloning efficiency. Fifteen of sixty clones demonstrated karyotypic heterogeneity. Five clones had multiple indicators of karyotypic change. One clone was markedly hypomutable and polyploid. Six clones were hypomutable, while 21 clones were mutators. Of these, seven were karyotypically unstable. Six clones had low re-cloning efficiencies, one of which was a mutator. All had normal karyotypes. In summary, many clones that survived exposure to a low fluence of Fe ions manifested one or more forms of genomic instability that may hasten the development of neoplasia through deletion or by recombination.

Screening of willow species for resistance to heavy metals: comparison of performance in a hydroponics system and field trials.

PubMed

Watson, C; Pulford, I D; Riddell-Black, D

2003-01-01

The aim of this study was to ascertain whether metal resistance in willow (Salix) clones grown in a hydroponics screening test correlated with data from the same clones grown independently in a field trial. If so, results from a short-term, glasshouse-based system could be extrapolated to the field, allowing rapid identification of willows suitable for planting in metal-contaminated substrates without necessitating longterm field trials. Principal Components Analysis was used to show groups of clones and to assess the relative importance of the parameters measured in both the hydroponics system and the field; including plant response factors such as increase in stem height, as well as metal concentrations in plant tissues. The clones tested fell into two distinct groups. Salix viminalis clones and the basket willow Black Maul (S. triandra) were less resistant to elevated concentrations of heavy metals than a group of hardier clones, including S. burjatica 'Germany,' S.x dasyclados, S. candida and S. spaethii. The more resistant clones produced more biomass in the glasshouse and field, and had higher metal concentrations in the wood. The less resistant clones had greater concentrations of Cu and Ni in the bark, and produced less biomass in the glasshouse and field. Significant relationships were found between the response of the same clones grown the in short-term glasshouse hydroponics system and in the field.

A novel anti-EMMPRIN function-blocking antibody reduces T cell proliferation and neurotoxicity: relevance to multiple sclerosis

PubMed Central

2012-01-01

Background Extracellular matrix metalloproteinase inducer (EMMPRIN; CD147, basigin) is an inducer of the expression of several matrix metalloproteinases (MMPs). We reported previously that blocking EMMPRIN activity reduced neuroinflammation and severity of disease in an animal model of multiple sclerosis (MS), experimental autoimmune encephalomyelitis (EAE). Methods To improve upon EMMPRIN blockade, and to help unravel the biological functions of EMMPRIN in inflammatory disorders, we have developed several anti-EMMPRIN monoclonal antibodies. Results Of these monoclonal antibodies, a particular one, clone 10, was efficient in binding mouse and human cells using several methods of detection. The specificity of clone 10 was demonstrated by its lack of staining of EMMPRIN-null embryos compared to heterozygous and wild-type mouse samples. Functionally, human T cells activated with anti-CD3 and anti-CD28 elevated their expression of EMMPRIN and the treatment of these T cells with clone 10 resulted in decreased proliferation and matrix metalloproteinase- 9 (MMP-9) production. Activated human T cells were toxic to human neurons in culture and clone 10 pretreatment reduced T cell cytotoxicity correspondent with decrease of granzyme B levels within T cells. In vivo, EAE mice treated with clone 10 had a markedly reduced disease score compared to mice treated with IgM isotype control. Conclusions We have produced a novel anti-EMMPRIN monoclonal antibody that blocks several aspects of T cell activity, thus highlighting the multiple roles of EMMPRIN in T cell biology. Moreover, clone 10 reduces EAE scores in mice compared to controls, and has activity on human cells, potentially allowing for the testing of anti-EMMPRIN treatment not only in EAE, but conceivably also in MS. PMID:22480370

A novel anti-EMMPRIN function-blocking antibody reduces T cell proliferation and neurotoxicity: relevance to multiple sclerosis.

PubMed

Agrawal, Smriti M; Silva, Claudia; Wang, Janet; Tong, Jade Pui-Wai; Yong, V Wee

2012-04-05

Extracellular matrix metalloproteinase inducer (EMMPRIN; CD147, basigin) is an inducer of the expression of several matrix metalloproteinases (MMPs). We reported previously that blocking EMMPRIN activity reduced neuroinflammation and severity of disease in an animal model of multiple sclerosis (MS), experimental autoimmune encephalomyelitis (EAE). To improve upon EMMPRIN blockade, and to help unravel the biological functions of EMMPRIN in inflammatory disorders, we have developed several anti-EMMPRIN monoclonal antibodies. Of these monoclonal antibodies, a particular one, clone 10, was efficient in binding mouse and human cells using several methods of detection. The specificity of clone 10 was demonstrated by its lack of staining of EMMPRIN-null embryos compared to heterozygous and wild-type mouse samples. Functionally, human T cells activated with anti-CD3 and anti-CD28 elevated their expression of EMMPRIN and the treatment of these T cells with clone 10 resulted in decreased proliferation and matrix metalloproteinase- 9 (MMP-9) production. Activated human T cells were toxic to human neurons in culture and clone 10 pretreatment reduced T cell cytotoxicity correspondent with decrease of granzyme B levels within T cells. In vivo, EAE mice treated with clone 10 had a markedly reduced disease score compared to mice treated with IgM isotype control. We have produced a novel anti-EMMPRIN monoclonal antibody that blocks several aspects of T cell activity, thus highlighting the multiple roles of EMMPRIN in T cell biology. Moreover, clone 10 reduces EAE scores in mice compared to controls, and has activity on human cells, potentially allowing for the testing of anti-EMMPRIN treatment not only in EAE, but conceivably also in MS.

Cloning of Buffalo, a Highly Valued Livestock Species of South and Southeast Asia: Any Achievements?

PubMed

Selokar, Naresh L; Saini, Monika; Palta, Prabhat; Chauhan, Manmohan S; Manik, Radhey S; Singla, Suresh K

2018-04-01

Buffalo (Bubalus bubalis) is a major source of milk, meat, and draught power in many developing countries in Asia. Animal cloning holds a lot of potential for fast multiplication of elite buffaloes and conservation of their valuable germplasm. Although the progress of buffalo cloning has been slow in comparison to cattle or pig, several breakthroughs were reported in buffalo cloning such as the production of cloned calves from somatic cells isolated from over one-decade old frozen-thawed semen or from urine-derived cells. Since the initiation of buffalo cloning, several approaches have been tried to refine nuclear transfer protocols. This has resulted in increasing the blastocyst production rate and improving their quality leading to an increase in live birth rate. In this review, we discuss current developments in buffalo cloning, its challenges, and the future roadmap.

Similar Responses of Intestinal T Cells From Untreated Children and Adults With Celiac Disease to Deamidated Gluten Epitopes.

PubMed

Ráki, Melinda; Dahal-Koirala, Shiva; Yu, Hao; Korponay-Szabó, Ilma R; Gyimesi, Judit; Castillejo, Gemma; Jahnsen, Jørgen; Qiao, Shuo-Wang; Sollid, Ludvig M

2017-09-01

Celiac disease is a chronic small intestinal inflammatory disorder mediated by an immune response to gluten peptides in genetically susceptible individuals. Celiac disease is often diagnosed in early childhood, but some patients receive a diagnosis late in life. It is uncertain whether pediatric celiac disease is distinct from adult celiac disease. It has been proposed that gluten-reactive T cells in children recognize deamidated and native gluten epitopes, whereas T cells from adults only recognize deamidated gluten peptides. We studied the repertoire of gluten epitopes recognized by T cells from children and adults. We examined T-cell responses against gluten by generating T-cell lines and T-cell clones from intestinal biopsies of adults and children and tested proliferative response to various gluten peptides. We analyzed T cells from 14 children (2-5 years old) at high risk for celiac disease who were followed for celiac disease development. We also analyzed T cells from 6 adults (26-55 years old) with untreated celiac disease. All children and adults were positive for HLA-DQ2.5. Biopsies were incubated with gluten digested with chymotrypsin (modified or unmodified by the enzyme transglutaminase 2) or the peptic-tryptic digest of gliadin (in native and deamidated forms) before T-cell collection. Levels of T-cell responses were higher to deamidated gluten than to native gluten in children and adults. T cells from children and adults each reacted to multiple gluten epitopes. Several T-cell clones were cross-reactive, especially clones that recognized epitopes from γ-and ω-gliadin. About half of the generated T-cell clones from children and adults reacted to unknown epitopes. T-cell responses to different gluten peptides appear to be similar between adults and children at the time of diagnosis of celiac disease. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

The origin of multiple clones in the parthenogenetic lizard species Darevskia rostombekowi.

PubMed

Ryskov, Alexey P; Osipov, Fedor A; Omelchenko, Andrey V; Semyenova, Seraphima K; Girnyk, Anastasiya E; Korchagin, Vitaly I; Vergun, Andrey A; Murphy, Robert W

2017-01-01

The all-female Caucasian rock lizard Darevskia rostombekowi and other unisexual species of this genus reproduce normally via true parthenogenesis. Typically, diploid parthenogenetic reptiles exhibit some amount of clonal diversity. However, allozyme data from D. rostombekowi have suggested that this species consists of a single clone. Herein, we test this hypothesis by evaluating variation at three variable microsatellite loci for 42 specimens of D. rostombekowi from four populations in Armenia. Analyses based on single nucleotide polymorphisms of each locus reveal five genotypes or presumptive clones in this species. All individuals are heterozygous at the loci. The major clone occurs in 24 individuals and involves three populations. Four rare clones involve one or several individuals from one or two populations. Most variation owes to parent-specific single nucleotide polymorphisms, which occur as heterozygotes. This result fails to reject the hypothesis of a single hybridization founder event that resulted in the initial formation of one major clone. The other clones appear to have originated via post-formation microsatellite mutations of the major clone.

Evidence for Multiple Phototransduction Pathways in a Reef-Building Coral

PubMed Central

Mason, Benjamin; Schmale, Michael; Gibbs, Patrick; Miller, Margaret W.; Wang, Qiang; Levay, Konstantin; Shestopalov, Valery; Slepak, Vladlen Z.

2012-01-01

Photosensitive behaviors and circadian rhythms are well documented in reef-building corals and their larvae, but the mechanisms responsible for photoreception have not been described in these organisms. Here we report the cloning, immunolocalization, and partial biochemical characterization of three opsins and four G proteins expressed in planulae of the Caribbean elkhorn coral, Acropora palmata. All three opsins (acropsins 1–3) possess conserved seven-pass transmembrane structure, and localize to distinct regions of coral planulae. Acropsin 1 was localized in the larval endoderm, while acropsin 2 was localized in solitary cells of the ectoderm. These rod-like cells displayed a remarkably polarized distribution, concentrated in the aboral end. We also cloned four A. palmata G protein alpha subunits. Three were homologs of vertebrate Gi, Go, and Gq. The fourth is presumably a novel G protein, which displays only 40% identity with the nearest known G protein, and we termed it Gc for “cnidarian”. We show that Gc and Gq can be activated by acropsins in a light-dependent manner in vitro. This indicates that at least acropsins 1 and 3 can form functional photoreceptors and potentially may play a role in color preference during settlement, vertical positioning and other light-guided behaviors observed in coral larvae. PMID:23227169

Cloning of Trametes versicolar genes induced by nitrogen starvation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Trudel, P.; Courchesne, D.; Roy, C.

1988-06-01

We have screened a genomic library of Trametes versicolar for genes whose expression is associated with nitrogen starvation, which has been shown to induce ligninolytic activity. Using two different approaches based on differential expression, we isolated 29 clones. These were shown by restriction mapping and cross-hybridization to code for 11 distinct differentially expressed genes. Northern analysis of the kinetics of expression of these genes revealed that at least four of them have kinetics of induction that parallel kinetics of induction of ligninolytic activity.

Clone-preventive technique that features magnetic microfibers and cryptography

NASA Astrophysics Data System (ADS)

Matsumoto, Hiroyuki; Suzuki, Keiichi; Matsumoto, Tsutomu

1998-04-01

We have used the term 'clone' to refer to those things which are produced by methods such as counterfeiting, alteration, duplication or simulation. To satisfy the requirements of secure and low-cost techniques for preventing card fraud, we have recently developed a clone preventive system called 'FibeCrypt (Fiber Cryptosystem)' which utilizes physical characteristics. Each card has a canonical domain (i.e. a distinctive part), similar to fingerprints as the biometric measurement, made up of magnetic micro-fibers scattered randomly inside. We have applied cryptosystems to the system. FibeCrypt examines and authenticates the unique pattern of the canonical domain using pre-stored reference data and a digital signature. In our paper, the schemes and the features of this system are described in detail. The results of our examinations show the accuracy of authentication of the system. We conclude that this authentication technique which utilizes physical characteristics can be very effective for clone prevention in various fields.

K-Cl cotransporters, cell volume homeostasis, and neurological disease

PubMed Central

Kahle, Kristopher T.; Khanna, Arjun R.; Alper, Seth L.; Adragna, Norma C.; Lauf, Peter K.; Sun, Dandan; Delpire, Eric

2016-01-01

K+-Cl− cotransporters (KCCs) were originally characterized as regulators of red blood cell (RBC) volume. Since then, four distinct KCCs have been cloned, and their importance for volume regulation has been demonstrated in other cell types. Genetic models of certain KCCs, such as KCC3, and their inhibitory WNK-STE20/SPS1-related proline/alanine-rich kinase (SPAK) serine-threonine kinases, have demonstrated the evolutionary necessity of these molecules for nervous system cell volume regulation, structure, and function, and their involvement in neurological disease. The recent characterization of a swelling-activated dephosphorylation mechanism that potently stimulates the KCCs has pinpointed a potentially druggable switch of KCC activity. An improved understanding of WNK/SPAK-mediated KCC cell volume regulation in the nervous system might reveal novel avenues for the treatment of multiple neurological diseases. PMID:26142773

K-Cl cotransporters, cell volume homeostasis, and neurological disease.

PubMed

Kahle, Kristopher T; Khanna, Arjun R; Alper, Seth L; Adragna, Norma C; Lauf, Peter K; Sun, Dandan; Delpire, Eric

2015-08-01

K(+)-Cl(-) cotransporters (KCCs) were originally characterized as regulators of red blood cell (RBC) volume. Since then, four distinct KCCs have been cloned, and their importance for volume regulation has been demonstrated in other cell types. Genetic models of certain KCCs, such as KCC3, and their inhibitory WNK-STE20/SPS1-related proline/alanine-rich kinase (SPAK) serine-threonine kinases, have demonstrated the evolutionary necessity of these molecules for nervous system cell volume regulation, structure, and function, and their involvement in neurological disease. The recent characterization of a swelling-activated dephosphorylation mechanism that potently stimulates the KCCs has pinpointed a potentially druggable switch of KCC activity. An improved understanding of WNK/SPAK-mediated KCC cell volume regulation in the nervous system might reveal novel avenues for the treatment of multiple neurological diseases. Copyright © 2015 Elsevier Ltd. All rights reserved.

The Three Major Spanish Clones of Penicillin-Resistant Streptococcus pneumoniae Are the Most Common Clones Recovered in Recent Cases of Meningitis in Spain

PubMed Central

Enright, Mark C.; Fenoll, Asunción; Griffiths, David; Spratt, Brian G.

1999-01-01

One hundred six isolates of Streptococcus pneumoniae recovered in Spain from patients with meningitis in 1997 and 1998 were characterized by multilocus sequence typing. A heterogeneous collection of genotypes was associated with meningitis in Spain: 65 different sequence types were resolved and, even at a genetic distance of 0.43, there were 37 distinct lineages. Thirty-eight percent of the isolates, including all isolates of serotypes 6B, 9V, 14, and 23F, were resistant to penicillin, and 24% of the isolates were members of the three major Spanish penicillin-resistant or multidrug-resistant clones of serotypes 6B, 9V, and 23F or serotype variants of these clones. These three clones (MICs, 1 to 2 μg of penicillin/ml) were the most common clones associated with pneumococcal meningitis in Spain during 1997 and 1998. Only two of the other clones associated with meningitis were penicillin resistant (MICs, 0.12 to 0.5 μg/ml). One of the two most prevalent penicillin-susceptible clones causing meningitis (serotype 3) has not been detected outside of Spain, whereas the other (serotype 18C) has been recovered from patients with meningitis in the United Kingdom, The Netherlands, and Denmark. The prevalence of meningitis caused by isolates of the three major Spanish penicillin-resistant or multiply antibiotic-resistant clones, which are now globally distributed, is disturbing and clearly establishes their ability to cause life-threatening disease. PMID:10488179

Novel narrow-host-range vectors for direct cloning of foreign DNA in Pseudomonas.

PubMed

Boivin, R; Bellemare, G; Dion, P

1994-01-01

Narrow-host-range vectors, based on an indigenous replicon and containing a multiple cloning site, have been constructed in a Pseudomonas host capable of growth on unusual substrates. The new cloning vectors yield sufficient amounts of DNA for preparative purposes and belong to an incompatibility group different from that of the incP and incQ broad-host-range vectors. One of these vectors, named pDB47F, was used to clone, directly in Pseudomonas, DNA fragments from Agrobacterium, Pseudomonas, and Rhizobium. A clone containing Agrobacterium and KmR gene sequences was transformed with a higher efficiency than an RSF1010-derived vector (by as much as 1250-fold) in four out of five Pseudomonas strains tested. The considerable efficiency obtained with this system makes possible the direct cloning and phenotypic selection of foreign DNA in Pseudomonas.

Fidelity of DNA Replication in Normal and Malignant Human Breast Cells.

DTIC Science & Technology

1997-08-01

enzyme) into the multiple cloning site (MCS). This template will not only replicate inside a mammalian cell (utilizing the E-B virus origin), and...Maniatis, T. Commonly used techniques in molecular cloning . In: Molecular cloning : REFERENCES a laboratory manual, 2nd edition. Cold Spring Harbor...A vatit"Y Of DNA synthesis and the typt of DNA replica~tion Products " celular prca including DNA rsplicatlon. DNA repsair. R~NA formed in experiments

Native plants for effective coastal wetland restoration

USGS Publications Warehouse

Howard, Rebecca J.

2003-01-01

Plant communities, along with soils and appropriate water regimes, are essential components of healthy wetland systems. In Louisiana, the loss of wetland habitat continues to be an issue of major concern. Wetland loss is caused by several interacting factors, both natural and human-induced (e.g., erosion and saltwater intrusion from the construction of canals and levees). Recent estimates of annual coastal land loss rates of about 62 km2 (24 mi2 ) over the past decade emphasize the magnitude of this problem. In an attempt to slow the rate of loss and perhaps halt the overall trend, resource managers in Louisiana apply various techniques to restore damaged or degraded habitats to functioning wetland systems.Researchers at the U.S. Geological Survey’s National Wetlands Research Center (NWRC) have cooperated with the Louisiana Department of Natural Resources in studies that address effective restoration strategies for coastal wetlands. The studies have identified differences in growth that naturally exist in native Louisiana wetland plant species and genetic varieties (i.e., clones) within species. Clones of a species have a distinctive genetic identity, and some clones may also have distinctive growth responses under various environmental conditions (i.e., preferences). Indeed, large areas of coastal marsh are typically populated by several clones of a plant species, each growing in a microenvironment suited to its preferences.These studies will provide information that will assist resource managers in selecting plant species and clones of species with known growth characteristics that can be matched to environmental conditions at potential restoration sites. Before the studies began, a collection of several clones from four plant species native to coastal Louisiana was established. The species collected included saltgrass (Distichlis spicata), common reed (Phragmites australis), giant bulrush (Schoenoplectus californicus), and saltmarsh bulrush (Schoenoplectus robustus). Plants connected by roots were collected from public lands across the coastal zone, and then allowed to grow several months and produce new stems and plants from underground stems called “rhizomes.” These procedures maintained the genetic identity of the clones and allowed the plants to adjust to greenhouse conditions before experimental treatments began.

The Multi-Resistant Reaction of Drought-Tolerant Coffee 'Conilon Clone 14' to Meloidogyne spp. and Late Hypersensitive-Like Response in Coffea canephora.

PubMed

Lima, Edriana A; Furlanetto, Cleber; Nicole, Michel; Gomes, Ana C M M; Almeida, Maria R A; Jorge-Júnior, Aldemiro; Correa, Valdir R; Salgado, Sônia Maria; Ferrão, Maria A G; Carneiro, Regina M D G

2015-06-01

Root-knot nematodes (RKN), Meloidogyne spp., have major economic impact on coffee production in Central and South America. Genetic control of RKN constitutes an essential part for integrated pest management strategy. The objective of this study was to evaluate the resistance of Coffea canephora genotypes (clones) to Meloidogyne spp. Sensitive and drought-tolerant coffee genotypes were used to infer their resistance using nematode reproduction factor and histopathology. Eight clonal genotypes were highly resistant to M. paranaensis. 'Clone 14' (drought-tolerant) and 'ESN2010-04' were the only genotypes highly resistant and moderately resistant, respectively, to both M. incognita races 3 and 1. Several clones were highly resistant to both avirulent and virulent M. exigua. Clone 14 and ESN2010-04 showed multiple resistance to major RKNs tested. Roots of 'clone 14' (resistant) and 'clone 22' (susceptible) were histologically studied against infection by M. incognita race 3 and M. paranaensis. Reduction of juvenile (J2) penetration in clone 14 was first seen at 2 to 6 days after inoculation (DAI). Apparent early hypersensitive reaction (HR) was seen in root cortex between 4 and 6 DAI, which led to cell death and prevention of some nematode development. At 12 to 20 DAI, giant cells formed in the vascular cylinder, besides normal development into J3/J4. From 32 to 45 DAI, giant cells were completely degenerated. Late, intense HR and cell death were frequently observed around young females and giant cells reported for the first time in coffee pathosystem. These results provide rational bases for future studies, including prospection, characterization, and expression profiling of genomic loci involved in both drought tolerance and resistance to multiple RKN species.

Tissue-Culture Method of Cloning Rubber Plants

NASA Technical Reports Server (NTRS)

Ball, E. A.

1983-01-01

Guayule plant, a high-yield rubber plant cloned by tissue-culture method to produce multiple new plants that mature quickly. By adjusting culture medium, excised shoot tip produces up to 50 identical guayule plants. Varying concentration of cytokinin, single excised tip produces either 1 or several (up to 50) new plants.

The Genome Sequence of a Type ST239 Methicillin-Resistant Staphylococcus aureus Isolate from a Malaysian Hospital

PubMed Central

Lee, LS; Teh, LK; Zainuddin, ZF; Salleh, MZ

2014-01-01

We report the genome sequence of a healthcare-associated MRSA type ST239 clone isolated from a patient with septicemia in Malaysia. This clone typifies the characteristics of ST239 lineage, including resistance to multiple antibiotics and antiseptics. PMID:25197474

New Approaches to Attenuated Hepatitis a Vaccine Development: Cloning and Sequencing of Cell-Culture Adapted Viral cDNA.

DTIC Science & Technology

1987-10-13

after multiple passages in vivo and in vitro. J. Gen. Virol. 67, 1741- 1744. Sabin , A.B. (1985). Oral poliovirus vaccine : history of its development...IN (N NEW APPROACHES TO ATTENUATED HEPATITIS A VACCINE DEVELOPMENT: Q) CLONING AND SEQUENCING OF CELL-CULTURE ADAPTED VIRAL cDNA I ANNUAL REPORT...6ll02Bsl0 A 055 11. TITLE (Include Security Classification) New Approaches to Attenuated Hepatitis A Vaccine Development: Cloning and Sequencing of Cell

Physical mapping of complex genomes

DOEpatents

Evans, G.A.

1993-06-15

A method for the simultaneous identification of overlapping cosmid clones among multiple cosmid clones and the use of the method for mapping complex genomes are provided. A library of cosmid clones that contains the DNA to be mapped is constructed and arranged in a manner such that individual clones can be identified and replicas of the arranged clones prepared. In preferred embodiments, the clones are arranged in a two dimensional matrix. In such embodiments, the cosmid clones in a row are pooled, mixed probes complementary to the ends of the DNA inserts in the pooled clones are synthesized, hybridized to a first replica of the library. Hybridizing clones, which include the pooled row, are identified. A second portion of clones is prepared by pooling cosmid clones that correspond to a column in the matrix. The second pool thereby includes one clone from the first portion pooled clones. This common clone is located on the replica at the intersection of the column and row. Mixed probes complementary to the ends of the DNA inserts in the second pooled portion of clones are prepared and hybridized to a second replica of the library. The hybridization pattern on the first and second replicas of the library are compared and cross-hybridizing clones, other than the clones in the pooled column and row, that hybridize to identical clones in the first and second replicas are identified. These clones necessarily include DNA inserts that overlap with the DNA insert in the common clone located at the intersection of the pooled row and pooled column. The DNA in the entire library may be mapped by pooling the clones in each of the rows and columns of the matrix, preparing mixed end-specific probes and hybridizing the probes from each row or column to a replica of the library. Since all clones in the library are located at the intersection of a column and a row, the overlapping clones for all clones in the library may be identified and a physical map constructed.

Cloning goes to the movies.

PubMed

Cormick, Craig

2006-10-01

Public attitude research conducted by Biotechnology Australia shows that one of the major sources of information on human reproductive cloning is movies. Traditionally, understanding of new and emerging technologies has come through the mass media but human cloning, being so widely addressed through the popular culture of movies, is more effectively defined by Hollywood than the news media or science media. But how well are the science and social issues of cloning portrayed in box office hits such as The Island, Multiplicity, Star Wars: Attack of the Clones and Jurassic Park? These movies have enormous reach and undoubted influence, and are therefore worth analyzing in some detail. This study looks at 33 movies made between 1971 and 2005 that address human reproductive cloning, and it categorizes the films based on their genre and potential influence. Yet rather than simply rating the quality of the science portrayed, the study compares the key messages in these movies with public attitudes towards cloning, to examine the correlations.

Cancer systems biology in the genome sequencing era: part 1, dissecting and modeling of tumor clones and their networks.

PubMed

Wang, Edwin; Zou, Jinfeng; Zaman, Naif; Beitel, Lenore K; Trifiro, Mark; Paliouras, Miltiadis

2013-08-01

Recent tumor genome sequencing confirmed that one tumor often consists of multiple cell subpopulations (clones) which bear different, but related, genetic profiles such as mutation and copy number variation profiles. Thus far, one tumor has been viewed as a whole entity in cancer functional studies. With the advances of genome sequencing and computational analysis, we are able to quantify and computationally dissect clones from tumors, and then conduct clone-based analysis. Emerging technologies such as single-cell genome sequencing and RNA-Seq could profile tumor clones. Thus, we should reconsider how to conduct cancer systems biology studies in the genome sequencing era. We will outline new directions for conducting cancer systems biology by considering that genome sequencing technology can be used for dissecting, quantifying and genetically characterizing clones from tumors. Topics discussed in Part 1 of this review include computationally quantifying of tumor subpopulations; clone-based network modeling, cancer hallmark-based networks and their high-order rewiring principles and the principles of cell survival networks of fast-growing clones. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

Ab initio multiple cloning simulations of pyrrole photodissociation: TKER spectra and velocity map imaging

DOE PAGES

Makhov, Dmitry V.; Saita, Kenichiro; Martinez, Todd J.; ...

2014-12-11

In this study, we report a detailed computational simulation of the photodissociation of pyrrole using the ab initio Multiple Cloning (AIMC) method implemented within MOLPRO. The efficiency of the AIMC implementation, employing train basis sets, linear approximation for matrix elements, and Ehrenfest configuration cloning, allows us to accumulate significant statistics. We calculate and analyze the total kinetic energy release (TKER) spectrum and Velocity Map Imaging (VMI) of pyrrole and compare the results directly with experimental measurements. Both the TKER spectrum and the structure of the velocity map image (VMI) are well reproduced. Previously, it has been assumed that the isotropicmore » component of the VMI arises from long time statistical dissociation. Instead, our simulations suggest that ultrafast dynamics contributes significantly to both low and high energy portions of the TKER spectrum.« less

Ab initio multiple cloning simulations of pyrrole photodissociation: TKER spectra and velocity map imaging

DOE Office of Scientific and Technical Information (OSTI.GOV)

Makhov, Dmitry V.; Saita, Kenichiro; Martinez, Todd J.

In this study, we report a detailed computational simulation of the photodissociation of pyrrole using the ab initio Multiple Cloning (AIMC) method implemented within MOLPRO. The efficiency of the AIMC implementation, employing train basis sets, linear approximation for matrix elements, and Ehrenfest configuration cloning, allows us to accumulate significant statistics. We calculate and analyze the total kinetic energy release (TKER) spectrum and Velocity Map Imaging (VMI) of pyrrole and compare the results directly with experimental measurements. Both the TKER spectrum and the structure of the velocity map image (VMI) are well reproduced. Previously, it has been assumed that the isotropicmore » component of the VMI arises from long time statistical dissociation. Instead, our simulations suggest that ultrafast dynamics contributes significantly to both low and high energy portions of the TKER spectrum.« less

Archaeal Diversity in Waters from Deep South African Gold Mines

PubMed Central

Takai, Ken; Moser, Duane P.; DeFlaun, Mary; Onstott, Tullis C.; Fredrickson, James K.

2001-01-01

A culture-independent molecular analysis of archaeal communities in waters collected from deep South African gold mines was performed by performing a PCR-mediated terminal restriction fragment length polymorphism (T-RFLP) analysis of rRNA genes (rDNA) in conjunction with a sequencing analysis of archaeal rDNA clone libraries. The water samples used represented various environments, including deep fissure water, mine service water, and water from an overlying dolomite aquifer. T-RFLP analysis revealed that the ribotype distribution of archaea varied with the source of water. The archaeal communities in the deep gold mine environments exhibited great phylogenetic diversity; the majority of the members were most closely related to uncultivated species. Some archaeal rDNA clones obtained from mine service water and dolomite aquifer water samples were most closely related to environmental rDNA clones from surface soil (soil clones) and marine environments (marine group I [MGI]). Other clones exhibited intermediate phylogenetic affiliation between soil clones and MGI in the Crenarchaeota. Fissure water samples, derived from active or dormant geothermal environments, yielded archaeal sequences that exhibited novel phylogeny, including a novel lineage of Euryarchaeota. These results suggest that deep South African gold mines harbor novel archaeal communities distinct from those observed in other environments. Based on the phylogenetic analysis of archaeal strains and rDNA clones, including the newly discovered archaeal rDNA clones, the evolutionary relationship and the phylogenetic organization of the domain Archaea are reevaluated. PMID:11722932

Scalable Cloning on Large-Scale GPU Platforms with Application to Time-Stepped Simulations on Grids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yoginath, Srikanth B.; Perumalla, Kalyan S.

Cloning is a technique to efficiently simulate a tree of multiple what-if scenarios that are unraveled during the course of a base simulation. However, cloned execution is highly challenging to realize on large, distributed memory computing platforms, due to the dynamic nature of the computational load across clones, and due to the complex dependencies spanning the clone tree. In this paper, we present the conceptual simulation framework, algorithmic foundations, and runtime interface of CloneX, a new system we designed for scalable simulation cloning. It efficiently and dynamically creates whole logical copies of a dynamic tree of simulations across a largemore » parallel system without full physical duplication of computation and memory. The performance of a prototype implementation executed on up to 1,024 graphical processing units of a supercomputing system has been evaluated with three benchmarks—heat diffusion, forest fire, and disease propagation models—delivering a speed up of over two orders of magnitude compared to replicated runs. Finally, the results demonstrate a significantly faster and scalable way to execute many what-if scenario ensembles of large simulations via cloning using the CloneX interface.« less

Scalable Cloning on Large-Scale GPU Platforms with Application to Time-Stepped Simulations on Grids

DOE PAGES

Yoginath, Srikanth B.; Perumalla, Kalyan S.

2018-01-31

Cloning is a technique to efficiently simulate a tree of multiple what-if scenarios that are unraveled during the course of a base simulation. However, cloned execution is highly challenging to realize on large, distributed memory computing platforms, due to the dynamic nature of the computational load across clones, and due to the complex dependencies spanning the clone tree. In this paper, we present the conceptual simulation framework, algorithmic foundations, and runtime interface of CloneX, a new system we designed for scalable simulation cloning. It efficiently and dynamically creates whole logical copies of a dynamic tree of simulations across a largemore » parallel system without full physical duplication of computation and memory. The performance of a prototype implementation executed on up to 1,024 graphical processing units of a supercomputing system has been evaluated with three benchmarks—heat diffusion, forest fire, and disease propagation models—delivering a speed up of over two orders of magnitude compared to replicated runs. Finally, the results demonstrate a significantly faster and scalable way to execute many what-if scenario ensembles of large simulations via cloning using the CloneX interface.« less

Milestone reached for ORFeome Collaboration | Office of Cancer Genomics

Cancer.gov

The ORFeome Collaboration (OC) is a team of academic and commercial entities which have generated the largest collection of clones containing verified open-reading frames (ORFs) of known human genes. The clones are made available to researchers worldwide through multiple distributors. This valuable resource allows researchers to easily express and study human genes.

Meiosis completion and various sperm responses lead to unisexual and sexual reproduction modes in one clone of polyploid Carassius gibelio.

PubMed

Zhang, Jun; Sun, Min; Zhou, Li; Li, Zhi; Liu, Zhen; Li, Xi-Yin; Liu, Xiao-Li; Liu, Wei; Gui, Jian-Fang

2015-06-04

Unisexual polyploid vertebrates are commonly known to reproduce by gynogenesis, parthenogenesis, or hybridogenesis. One clone of polyploid Carassius gibelio has been revealed to possess multiple modes of unisexual gynogenesis and sexual reproduction, but the cytological and developmental mechanisms have remained unknown. In this study, normal meiosis completion was firstly confirmed by spindle co-localization of β-tubulin and Spindlin. Moreover, three types of various nuclear events and development behaviors were revealed by DAPI staining and BrdU-incorporated immunofluorescence detection during the first mitosis in the fertilized eggs by three kinds of different sperms. They include normal sexual reproduction in response to sperm from the same clone male, typical unisexual gynogenesis in response to sperm from the male of another species Cyprinus carpio, and an unusual hybrid-similar development mode in response to sperm from another different clone male. Based on these findings, we have discussed cytological and developmental mechanisms on multiple reproduction modes in the polyploid fish, and highlighted evolutionary significance of meiosis completion and evolutionary consequences of reproduction mode diversity in polyploid vertebrates.

Clonal multiplication of Cymbidiums through tissue culture of the shoot meristem

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wimber, Donald E.

The propagation of clonal varieties of some orchids is at times exasperatingly slow and occasionally an almost futile effort. Clonal multiplication is generally confined to dlvidlng mature plants and to starting plants from pseudobulbs. There is, of course, the specialized technique for obtaining Phalaenopsis plantlets from the aseptic culture of inflorescence nodes, but this is basically the same thing as propagating plants from pseudobulbs. In certain cases it is highly desirable to rapidly multiply certain clones of orchids. Awarded varieties could thereby be dispersed with great rapidity where now it may take decades for some clones to became fairly common.more » Commercial flower production would be very much enhanced if certain desirable clones could be multiplied ad infinitum within a short time. Orchid flower production could then be placed more on a par with many of the other cut flowers and the clonal peculiarities of some fo the current hybrids could be pampered instead of ignored. This paper describes a tissue culture method for the rapid propagation of Cymbidium clones.« less

Meiosis completion and various sperm responses lead to unisexual and sexual reproduction modes in one clone of polyploid Carassius gibelio

PubMed Central

Zhang, Jun; Sun, Min; Zhou, Li; Li, Zhi; Liu, Zhen; Li, Xi-Yin; Liu, Xiao-Li; Liu, Wei; Gui, Jian-Fang

2015-01-01

Unisexual polyploid vertebrates are commonly known to reproduce by gynogenesis, parthenogenesis, or hybridogenesis. One clone of polyploid Carassius gibelio has been revealed to possess multiple modes of unisexual gynogenesis and sexual reproduction, but the cytological and developmental mechanisms have remained unknown. In this study, normal meiosis completion was firstly confirmed by spindle co-localization of β-tubulin and Spindlin. Moreover, three types of various nuclear events and development behaviors were revealed by DAPI staining and BrdU-incorporated immunofluorescence detection during the first mitosis in the fertilized eggs by three kinds of different sperms. They include normal sexual reproduction in response to sperm from the same clone male, typical unisexual gynogenesis in response to sperm from the male of another species Cyprinus carpio, and an unusual hybrid-similar development mode in response to sperm from another different clone male. Based on these findings, we have discussed cytological and developmental mechanisms on multiple reproduction modes in the polyploid fish, and highlighted evolutionary significance of meiosis completion and evolutionary consequences of reproduction mode diversity in polyploid vertebrates. PMID:26042995

Induction of multixenobiotic defense mechanisms in resistant Daphnia magna clones as a general cellular response to stress.

PubMed

Jordão, Rita; Campos, Bruno; Lemos, Marco F L; Soares, Amadeu M V M; Tauler, Romà; Barata, Carlos

2016-06-01

Multixenobiotic resistance mechanisms (MXR) were recently identified in Daphnia magna. Previous results characterized gene transcripts of genes encoding and efflux activities of four putative ABCB1 and ABCC transporters that were chemically induced but showed low specificity against model transporter substrates and inhibitors, thus preventing us from distinguishing between activities of different efflux transporter types. In this study we report on the specificity of induction of ABC transporters and of the stress protein hsp70 in clones selected to be genetically resistant to ABCB1 chemical substrates. Clones resistant to mitoxantrone, ivermectin and pentachlorophenol showed distinctive transcriptional responses of transporter protein coding genes and of putative transporter dye activities. Expression of hsp70 proteins also varied across resistant clones. Clones resistant to mitoxantrone and pentachlorophenol showed high constitutive levels of hsp70. Transcriptional levels of the abcb1 gene transporter and of putative dye transporter activity were also induced to a greater extent in the pentachlorophenol resistant clone. Observed higher dye transporter activities in individuals from clones resistant to mitoxantrone and ivermectin were unrelated with transcriptional levels of the studied four abcc and abcb1 transporter genes. These findings suggest that Abcb1 induction in D. magna may be a part of a general cellular stress response. Copyright © 2016 Elsevier B.V. All rights reserved.

Highly abundant and stage-specific mRNAs in the obligate pathogen Bremia lactucae.

PubMed

Judelson, H S; Michelmore, R W

1990-01-01

Germinating spores of the obligate pathogen Bremia lactucae (lettuce downy mildew) contain several unusually abundant species of mRNA. Thirty-nine cDNA clones corresponding to prevalent transcripts were isolated from a library synthesized using poly(A)+ RNA from germinating spores; these clones represented only five distinct classes. Each corresponding mRNA accounted for from 0.4 to 9 percent by mass of poly(A)+ RNA from germinating spores and together represented greater than 20 percent of the mRNA. The expression of the corresponding genes, and a gene encoding Hsp70, was analyzed in spores during germination and during growth in planta. The Hsp70 mRNA and mRNA from one abundant cDNA clone (ham34) were expressed constitutively. Two clones (ham9 and ham12) hybridized only to mRNA from spores and germinating spores. Two clones (ham37 and ham27) showed hybridization specific to germinating spores. Quantification of the number of genes homologous to each cDNA clone indicated that four clones corresponded to one or two copies per haploid genome, and one hybridized to an approximately 11-member family of genes. A sequence of the gene corresponding to ham34 was obtained to investigate its function and to identify sequences conferring high levels of gene expression for use in constructing vectors for the transformation of B. lactucae.

Cloning, preparation and preliminary crystallographic studies of penicillin V acylase autoproteolytic processing mutants

PubMed Central

Chandra, P. Manish; Brannigan, James A.; Prabhune, Asmita; Pundle, Archana; Turkenburg, Johan P.; Dodson, G. Guy; Suresh, C. G.

2005-01-01

The crystallization of three catalytically inactive mutants of penicillin V acylase (PVA) from Bacillus sphaericus in precursor and processed forms is reported. The mutant proteins crystallize in different primitive monoclinic space groups that are distinct from the crystal forms for the native enzyme. Directed mutants and clone constructs were designed to study the post-translational autoproteolytic processing of PVA. The catalytically inactive mutants will provide three-dimensional structures of precursor PVA forms, plus open a route to the study of enzyme–substrate complexes for this industrially important enzyme. PMID:16508111

Mutational profiles of breast cancer metastases from a rapid autopsy series reveal multiple evolutionary trajectories.

PubMed

Avigdor, Bracha Erlanger; Cimino-Mathews, Ashley; DeMarzo, Angelo M; Hicks, Jessica L; Shin, James; Sukumar, Saraswati; Fetting, John; Argani, Pedram; Park, Ben H; Wheelan, Sarah J

2017-12-21

Heterogeneity within and among tumors in a metastatic cancer patient is a well-established phenomenon that may confound treatment and accurate prognosis. Here, we used whole-exome sequencing to survey metastatic breast cancer tumors from 5 patients in a rapid autopsy program to construct the origin and genetic development of metastases. Metastases were obtained from 5 breast cancer patients using a rapid autopsy protocol and subjected to whole-exome sequencing. Metastases were evaluated for sharing of somatic mutations, correlation of copy number variation and loss of heterozygosity, and genetic similarity scores. Pathological features of the patients' disease were assessed by immunohistochemical analyses. Our data support a monoclonal origin of metastasis in 3 cases, but in 2 cases, metastases arose from at least 2 distinct subclones in the primary tumor. In the latter 2 cases, the primary tumor presented with mixed histologic and pathologic features, suggesting early divergent evolution within the primary tumor with maintenance of metastatic capability in multiple lineages. We used genetic and histopathological evidence to demonstrate that metastases can be derived from a single or multiple independent clones within a primary tumor. This underscores the complexity of breast cancer clonal evolution and has implications for how best to determine and implement therapies for early- and late-stage disease.

Mutational profiles of breast cancer metastases from a rapid autopsy series reveal multiple evolutionary trajectories

PubMed Central

Avigdor, Bracha Erlanger; Cimino-Mathews, Ashley; DeMarzo, Angelo M.; Hicks, Jessica L.; Shin, James; Sukumar, Saraswati; Fetting, John; Argani, Pedram; Park, Ben H.; Wheelan, Sarah J.

2017-01-01

Heterogeneity within and among tumors in a metastatic cancer patient is a well-established phenomenon that may confound treatment and accurate prognosis. Here, we used whole-exome sequencing to survey metastatic breast cancer tumors from 5 patients in a rapid autopsy program to construct the origin and genetic development of metastases. Metastases were obtained from 5 breast cancer patients using a rapid autopsy protocol and subjected to whole-exome sequencing. Metastases were evaluated for sharing of somatic mutations, correlation of copy number variation and loss of heterozygosity, and genetic similarity scores. Pathological features of the patients’ disease were assessed by immunohistochemical analyses. Our data support a monoclonal origin of metastasis in 3 cases, but in 2 cases, metastases arose from at least 2 distinct subclones in the primary tumor. In the latter 2 cases, the primary tumor presented with mixed histologic and pathologic features, suggesting early divergent evolution within the primary tumor with maintenance of metastatic capability in multiple lineages. We used genetic and histopathological evidence to demonstrate that metastases can be derived from a single or multiple independent clones within a primary tumor. This underscores the complexity of breast cancer clonal evolution and has implications for how best to determine and implement therapies for early- and late-stage disease. PMID:29263308

Clonal T-Cell Receptor γ-Chain Gene Rearrangements in Differential Diagnosis of Lymphomatoid Papulosis From Skin Metastasis of Nodal Anaplastic Large-Cell Lymphoma

PubMed Central

Akilov, Oleg E.; Pillai, Raju K.; Grandinetti, Lisa M.; Kant, Jeffrey A.; Geskin, Larisa

2012-01-01

Background In patients with a history of nodal anaplastic large-cell lymphoma (ALCL), differentiation of type C lymphomatoid papulosis from cutaneous involvement of systemic ALCL may be challenging because the 2 entities may exhibit identical histologic features. Although metastatic ALCL generally carries the same clone as the primary lymphoma, expression of a distinct clone likely represents a distinct process. Observations A 54-year-old white man had a history of anaplastic lymphoma kinase 1–negative ALCL in the right inguinal lymph node 6 years ago. A complete response was achieved after 6 cycles of CHOP (cyclophosphamide, doxorubicin, vincristine [Oncovin], and prednisone administered in 21-day cycles) and radiation therapy. After 3½ years, the patient observed waxing and waning papules and nodules. Examination of the biopsy specimen revealed a dense CD30+ lymphocytic infiltrate; no evidence of systemic malignancy was evident on positron emission tomography. Although clinically the presentation was consistent with lymphomatoid papulosis, metastatic ALCL had to be excluded. Polymerase chain reaction analysis with T-cell receptor γ-chain gene rearrangement (TCR-γR) was performed on the original lymph node and new skin lesions. Results of the TCR-γR analysis were positive for clonality in both lesions. However, separate clonal processes were identified. The identification of distinct clones supported the clinical impression of lymphomatoid papulosis. Conclusion Polymerase chain reaction analysis of TCR-γR is a useful method for distinguishing different clonal processes and is recommended when differentiation of primary and secondary lymphoproliferative disorders is required. PMID:21844453

Two members of the mouse mdr gene family confer multidrug resistance with overlapping but distinct drug specificities.

PubMed Central

Devault, A; Gros, P

1990-01-01

We report the cloning and functional analysis of a complete clone for the third member of the mouse mdr gene family, mdr3. Nucleotide and predicted amino acid sequence analyses showed that the three mouse mdr genes encode highly homologous membrane glycoproteins, which share the same length (1,276 residues), the same predicted functional domains, and overall structural arrangement. Regions of divergence among the three proteins are concentrated in discrete segments of the predicted polypeptides. Sequence comparison indicated that the three mouse mdr genes were created from a common ancestor by two independent gene duplication events, the most recent one producing mdr1 and mdr3. When transfected and overexpressed in otherwise drug-sensitive cells, the mdr3 gene, like mdr1 and unlike mdr2, conferred multidrug resistance to these cells. In independently derived transfected cell clones expressing similar amounts of either MDR1 or MDR3 protein, the drug resistance profile conferred by mdr3 was distinct from that conferred by mdr1. Cells transfected with and expressing MDR1 showed a marked 7- to 10-fold preferential resistance to colchicine and Adriamycin compared with cells expressing equivalent amounts of MDR3. Conversely, cells transfected with and expressing MDR3 showed a two- to threefold preferential resistance to actinomycin D over their cellular counterpart expressing MDR1. These results suggest that MDR1 and MDR3 are membrane-associated efflux pumps which, in multidrug-resistant cells and perhaps normal tissues, have overlapping but distinct substrate specificities. Images PMID:1969610

Intravenous infusion of phage-displayed antibody library in human cancer patients: enrichment and cancer-specificity of tumor-homing phage-antibodies.

PubMed

Shukla, Girja S; Krag, David N; Peletskaya, Elena N; Pero, Stephanie C; Sun, Yu-Jing; Carman, Chelsea L; McCahill, Laurence E; Roland, Thomas A

2013-08-01

Phage display is a powerful method for target discovery and selection of ligands for cancer treatment and diagnosis. Our goal was to select tumor-binding antibodies in cancer patients. Eligibility criteria included absence of preexisting anti-phage-antibodies and a Stage IV cancer status. All patients were intravenously administered 1 × 10(11) TUs/kg of an scFv library 1 to 4 h before surgical resection of their tumors. No significant adverse events related to the phage library infusion were observed. Phage were successfully recovered from all tumors. Individual clones from each patient were assessed for binding to the tumor from which clones were recovered. Multiple tumor-binding phage-antibodies were identified. Soluble scFv antibodies were produced from the phage clones showing higher tumor binding. The tumor-homing phage-antibodies and derived soluble scFvs were found to bind varying numbers (0-5) of 8 tested normal human tissues (breast, cervix, colon, kidney, liver, spleen, skin, and uterus). The clones that showed high tumor-specificity were found to bind corresponding tumors from other patients also. Clone enrichment was observed based on tumor binding and DNA sequence data. Clone sequences of multiple variable regions showed significant matches to certain cancer-related antibodies. One of the clones (07-2,355) that was found to share a 12-amino-acid-long motif with a reported IL-17A antibody was further studied for competitive binding for possible antigen target identification. We conclude that these outcomes support the safety and utility of phage display library panning in cancer patients for ligand selection and target discovery for cancer treatment and diagnosis.

The expression and evolution of virulence in multiple infections: the role of specificity, relative virulence and relative dose

PubMed Central

2013-01-01

Background Multiple infections of the same host by different strains of the same microparasite species are believed to play a crucial role during the evolution of parasite virulence. We investigated the role of specificity, relative virulence and relative dose in determining the competitive outcome of multiple infections in the Daphnia magna-Pasteuria ramosa host-parasite system. Results We found that infections by P. ramosa clones (single genotype) were less virulent and produced more spores than infections by P. ramosa isolates (possibly containing multiple genotypes). We also found that two similarly virulent isolates of P. ramosa differed considerably in their within-host competitiveness and their effects on host offspring production when faced with coinfecting P. ramosa isolates and clones. Although the relative virulence of a P. ramosa isolate/clone appears to be a good indicator of its competitiveness during multiple infections, the relative dose may alter the competitive outcome. Moreover, spore counts on day 20 post-infection indicate that the competitive outcome is largely decided early in the parasite’s growth phase, possibly mediated by direct interference or apparent competition. Conclusions Our results emphasize the importance of epidemiology as well as of various parasite traits in determining the outcome of within-host competition. Incorporating realistic epidemiological and ecological conditions when testing theoretical models of multiple infections, as well as using a wider range of host and parasite genotypes, will enable us to better understand the course of virulence evolution. PMID:23641899

The expression and evolution of virulence in multiple infections: the role of specificity, relative virulence and relative dose.

PubMed

Ben-Ami, Frida; Routtu, Jarkko

2013-05-03

Multiple infections of the same host by different strains of the same microparasite species are believed to play a crucial role during the evolution of parasite virulence. We investigated the role of specificity, relative virulence and relative dose in determining the competitive outcome of multiple infections in the Daphnia magna-Pasteuria ramosa host-parasite system. We found that infections by P. ramosa clones (single genotype) were less virulent and produced more spores than infections by P. ramosa isolates (possibly containing multiple genotypes). We also found that two similarly virulent isolates of P. ramosa differed considerably in their within-host competitiveness and their effects on host offspring production when faced with coinfecting P. ramosa isolates and clones. Although the relative virulence of a P. ramosa isolate/clone appears to be a good indicator of its competitiveness during multiple infections, the relative dose may alter the competitive outcome. Moreover, spore counts on day 20 post-infection indicate that the competitive outcome is largely decided early in the parasite's growth phase, possibly mediated by direct interference or apparent competition. Our results emphasize the importance of epidemiology as well as of various parasite traits in determining the outcome of within-host competition. Incorporating realistic epidemiological and ecological conditions when testing theoretical models of multiple infections, as well as using a wider range of host and parasite genotypes, will enable us to better understand the course of virulence evolution.

Occurrence of Carbapenem-Resistant Acinetobacter baumannii Clones at Multiple Hospitals in London and Southeast England

PubMed Central

Coelho, Juliana M.; Turton, Jane F.; Kaufmann, Mary E.; Glover, Judith; Woodford, Neil; Warner, Marina; Palepou, Marie-France; Pike, Rachel; Pitt, Tyrone L.; Patel, Bharat C.; Livermore, David M.

2006-01-01

From late 2003 to the end of 2005, the Health Protection Agency's national reference laboratories received approximately 1,600 referrals of Acinetobacter spp., including 419 and 58 examples, respectively, of two carbapenem-resistant Acinetobacter baumannii lineages, designated OXA-23 clones 1 and 2. Representatives of these clones were obtained from 40 and 8 hospitals, respectively, in London or elsewhere in Southeast England. Both clones had blaOXA-23-like genes, as well as the intrinsic (but downregulated) blaOXA-51-like carbapenemase genes typical of A. baumannii. Both were highly multiresistant: only colistin and tigecycline remained active versus OXA-23 clone 1 isolates; OXA-23 clone 2 isolates were also susceptible to amikacin and minocycline. These lineages increase the burden created by the southeast (SE) clone, a previously reported A. baumannii lineage with variable carbapenem resistance contingent on upregulation of the blaOXA-51-like gene. Known since 2000, the SE clone had been referred from over 40 hospitals by the end of 2005, with 627 representatives received by the reference laboratories. The OXA-23 clone 2 is now in decline, but OXA-23 clone 1 continues to be referred from new sites, as does the SE clone. Their spread is forcing the use of unorthodox therapies, principally colistin and tigecycline, although the optimal regimens remain uncertain. PMID:17021090

Cloning crops in a CELSS via tissue culture: Prospects and problems

NASA Technical Reports Server (NTRS)

Carman, John G.; Hess, J. Richard

1990-01-01

Micropropagation is currently used to clone fruits, nuts, and vegetables and involves controlling the outgrowth in vitro of basal, axillary, or adventitious buds. Following clonal multiplication, shoots are divided and rooted. This process has greatly reduced space and energy requirements in greenhouses and field nurseries and has increased multiplication rates by greater than 20 fold for some vegetatively propagated crops and breeding lines. Cereal and legume crops can also be cloned by tissue culture through somatic embryogenesis. Somatic embryos can be used to produce 'synthetic seed', which can tolerate desiccation and germinate upon rehydration. Synthetic seed of hybrid wheat, rice, soybean and other crops could be produced in a controlled ecological life support system. Thus, yield advantages of hybreds over inbreds (10 to 20 percent) could be exploited without having to provide additional facilities and energy for parental-line and hybrid seed nurseries.

Genomic Epidemiology of Hypervirulent Serogroup W, ST-11 Neisseria meningitidis

PubMed Central

Mustapha, Mustapha M.; Marsh, Jane W.; Krauland, Mary G.; Fernandez, Jorge O.; de Lemos, Ana Paula S.; Dunning Hotopp, Julie C.; Wang, Xin; Mayer, Leonard W.; Lawrence, Jeffrey G.; Hiller, N. Luisa; Harrison, Lee H.

2015-01-01

Neisseria meningitidis is a leading bacterial cause of sepsis and meningitis globally with dynamic strain distribution over time. Beginning with an epidemic among Hajj pilgrims in 2000, serogroup W (W) sequence type (ST) 11 emerged as a leading cause of epidemic meningitis in the African ‘meningitis belt’ and endemic cases in South America, Europe, Middle East and China. Previous genotyping studies were unable to reliably discriminate sporadic W ST-11 strains in circulation since 1970 from the Hajj outbreak strain (Hajj clone). It is also unclear what proportion of more recent W ST-11 disease clusters are caused by direct descendants of the Hajj clone. Whole genome sequences of 270 meningococcal strains isolated from patients with invasive meningococcal disease globally from 1970 to 2013 were compared using whole genome phylogenetic and major antigen-encoding gene sequence analyses. We found that all W ST-11 strains were descendants of an ancestral strain that had undergone unique capsular switching events. The Hajj clone and its descendants were distinct from other W ST-11 strains in that they shared a common antigen gene profile and had undergone recombination involving virulence genes encoding factor H binding protein, nitric oxide reductase, and nitrite reductase. These data demonstrate that recent acquisition of a distinct antigen-encoding gene profile and variations in meningococcal virulence genes was associated with the emergence of the Hajj clone. Importantly, W ST-11 strains unrelated to the Hajj outbreak contribute a significant proportion of W ST-11 cases globally. This study helps illuminate genomic factors associated with meningococcal strain emergence and evolution. PMID:26629539

Combining yeast display and competitive FACS to select rare hapten-specific clones from recombinant antibody libraries

DOE PAGES

Sun, Yue; Ban, Bhupal; Bradbury, Andrew; ...

2016-08-29

The development of antibodies to low molecular weight haptens remains challenging due to both the low immunogenicity of many haptens and the cross-reactivity of the protein carriers used to generate the immune response. Recombinant antibodies and novel display technologies have greatly advanced antibody development; however, new techniques are still required to select rare hapten-specific antibodies from large recombinant libraries. In the present study, we used a combination of phage and yeast display to screen an immune antibody library (size, 4.4 × 10 6 ) against hapten markers for petroleum contamination (phenanthrene and methylphenanthrenes). Selection via phage display was used firstmore » to enrich the library between 20- and 100- fold for clones that bound to phenanthrene-protein conjugates. The enriched libraries were subsequently transferred to a yeast display system and a newly developed competitive FACS procedure was employed to select rare hapten-specific clones. Competitive FACS increased the frequency of hapten-specific scFvs in our yeast-displayed scFvs from 0.025 to 0.005% in the original library to between 13 and 35% in selected pools. The presence of hapten-specific scFvs was confirmed by competitive ELISA using periplasmic protein. Three distinct antibody clones that recognize phenanthrene and methylphenanthrenes were selected, and their distinctive binding properties were characterized. To our knowledge, these are first antibodies that can distinguish between methylated (petrogenic) versus unmethylated (pyrogenic) phenanthrenes; such antibodies will be useful in detecting the sources of environmental contamination. Furthermore, this selection method could be generally adopted in the selection of other hapten-specific recombinant antibodies.« less

Combining yeast display and competitive FACS to select rare hapten-specific clones from recombinant antibody libraries

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun, Yue; Ban, Bhupal; Bradbury, Andrew

The development of antibodies to low molecular weight haptens remains challenging due to both the low immunogenicity of many haptens and the cross-reactivity of the protein carriers used to generate the immune response. Recombinant antibodies and novel display technologies have greatly advanced antibody development; however, new techniques are still required to select rare hapten-specific antibodies from large recombinant libraries. In the present study, we used a combination of phage and yeast display to screen an immune antibody library (size, 4.4 × 10 6 ) against hapten markers for petroleum contamination (phenanthrene and methylphenanthrenes). Selection via phage display was used firstmore » to enrich the library between 20- and 100- fold for clones that bound to phenanthrene-protein conjugates. The enriched libraries were subsequently transferred to a yeast display system and a newly developed competitive FACS procedure was employed to select rare hapten-specific clones. Competitive FACS increased the frequency of hapten-specific scFvs in our yeast-displayed scFvs from 0.025 to 0.005% in the original library to between 13 and 35% in selected pools. The presence of hapten-specific scFvs was confirmed by competitive ELISA using periplasmic protein. Three distinct antibody clones that recognize phenanthrene and methylphenanthrenes were selected, and their distinctive binding properties were characterized. To our knowledge, these are first antibodies that can distinguish between methylated (petrogenic) versus unmethylated (pyrogenic) phenanthrenes; such antibodies will be useful in detecting the sources of environmental contamination. Furthermore, this selection method could be generally adopted in the selection of other hapten-specific recombinant antibodies.« less

Multiple productive immunoglobulin heavy chain gene rearrangements in chronic lymphocytic leukemia are mostly derived from independent clones

PubMed Central

Plevova, Karla; Francova, Hana Skuhrova; Burckova, Katerina; Brychtova, Yvona; Doubek, Michael; Pavlova, Sarka; Malcikova, Jitka; Mayer, Jiri; Tichy, Boris; Pospisilova, Sarka

2014-01-01

In chronic lymphocytic leukemia, usually a monoclonal disease, multiple productive immunoglobulin heavy chain gene rearrangements are identified sporadically. Prognostication of such cases based on immunoglobulin heavy variable gene mutational status can be problematic, especially if the different rearrangements have discordant mutational status. To gain insight into the possible biological mechanisms underlying the origin of the multiple rearrangements, we performed a comprehensive immunogenetic and immunophenotypic characterization of 31 cases with the multiple rearrangements identified in a cohort of 1147 patients with chronic lymphocytic leukemia. For the majority of cases (25/31), we provide evidence of the co-existence of at least two B lymphocyte clones with a chronic lymphocytic leukemia phenotype. We also identified clonal drifts in serial samples, likely driven by selection forces. More specifically, higher immunoglobulin variable gene identity to germline and longer complementarity determining region 3 were preferred in persistent or newly appearing clones, a phenomenon more pronounced in patients with stereotyped B-cell receptors. Finally, we report that other factors, such as TP53 gene defects and therapy administration, influence clonal selection. Our findings are relevant to clonal evolution in the context of antigen stimulation and transition of monoclonal B-cell lymphocytosis to chronic lymphocytic leukemia. PMID:24038023

[Human cloning or cannibalism].

PubMed

Sokolowski, L M

2001-01-01

In this article I develop the idea presented in my previous work that human cloning would be of little practical use since almost any aim that one would like to attain by multiple cloning of a concrete man or a group of people, are unattainable or it might be achieved by easier, cheaper and more efficient traditional methods. For this reason cloning of a man is unlikely to occur on a larger scale and only few people will decide to clone themselves. In this sense no social effects of human cloning will be disastrous for the human population. Yet investigations in human genetics are very important since they may provide medical applications far more important than human cloning. It is argued that the main trend of modern medicine: organ transplantation from an alien donor, will become socially dangerous in near future since the number of donors will be drastically smaller than the number of potential patients waiting for transplantations. This in turn may cause social conflicts and a form of medical cannibalism may arise. These problems and conflicts will be avoided if organ transplantation from an alien donor is replaced by organ cloning, i.e. by transplanting an organ developed from the patient.

Genetic characterization and barcoding of taxa in the genus Wolffia Horkel ex Schleid. (Lemnaceae) as revealed by two plastidic markers and amplified fragment length polymorphism (AFLP).

PubMed

Bog, Manuela; Schneider, Philipp; Hellwig, Frank; Sachse, Svea; Kochieva, Elena Z; Martyrosian, Elena; Landolt, Elias; Appenroth, Klaus-J

2013-01-01

The genus Wolffia of the duckweed family (Lemnaceae) contains the smallest flowering plants. Presently, 11 species are recognized and categorized mainly on the basis of morphology. Because of extreme reduction of structure of all species, molecular methods are especially required for barcoding and identification of species and clones of this genus. We applied AFLP combined with Bayesian analysis of population structure to 66 clones covering all 11 species. Nine clusters were identified: (1) W. angusta and W. microscopica (only one clone), (2) W. arrhiza, (3) W. cylindracea (except one clone that might be a transition form), (4) W. australiana, (5) W. globosa, (6) W. globosa, W. neglecta, and W. borealis, (7) W. brasiliensis, and W. columbiana, (8) W. columbiana, (9) W. elongata. Furthermore, we investigated the sequences of plastidic regions rps16 (54 clones) and rpl16 (55 clones), and identified the following species: W. angusta, W. australiana, W. brasiliensis, W. cylindracea, W. elongata, W. microscopica, and W. neglecta. Wolffia globosa has been separated into two groups by both methods. One group which consists only of clones from North America and East Asia was labelled here "typical W. globosa". The other group of W. globosa, termed operationally "W. neglecta", contains also clones of W. neglecta and shows high similarity to W. borealis. None of the methods recognized W. borealis as a distinct species. Although each clone could be characterized individually by AFLP and plastidic sequences, and most species could be bar-coded, the presently available data are not sufficient to identify all taxa of Wolffia.

Monoclonal antibodies against simian virus 40 T antigens: evidence for distinct sublcasses of large T antigen and for similarities among nonviral T antigens.

PubMed Central

Gurney, E G; Harrison, R O; Fenno, J

1980-01-01

We have isolated three clones of hybrid cells which synthesize antibodies specific for determinants on simian virus 40 (SV40) T antigens. Mouse myeloma NS1 cells were fused with spleen cells from mice that had been immunized with SV40-transformed mouse cells. Hybrid cells were selected in HAT medium and cloned in soft agar. We used an enzyme-linked immunosorbent assay for detection and quantification of mouse antibodies against SV40 T antigens. Monoclonal antibodies from 3 of the 24 clones that scored as positive in the enzyme-linked immunosorbent assay were verified by immunoprecipitation to be specific for SV40 T antigens. Two clones (7 and 412) produced antibodies that recognized denaturation-sensitive antigenic determinants unique to large T antigen. Antibodies from clone 7 appeared to have a low affinity for large T antigen. Antibodies from clone 412 had a higher affinity for large T antigen but did not recognize a subclass of large T antigen that was recognized by tumor serum. Antibodies of the third clone, clone 122, recognized a denaturation-stable antigenic determinant of the 53,000-dalton mouse nonviral T antigen in SV40-transformed cells. Antibodies from clone 122 also recognized similar (51,000- to 56,000-dalton) nonviral T antigens in SV40-transormed or lytically infected cells from five mammalian species and in four uninfected mouse lines. From these observations, we have concluded that (i) the 94,000-dalton SV40 large T antigen may exist as immunologically distinguishable subclasses, and (ii) the nonviral T antigens of five mammalian species share at least one antigenic determinant. Images PMID:6155477

Factors influencing the commercialisation of cloning in the pork industry.

PubMed

Pratt, S L; Sherrer, E S; Reeves, D E; Stice, S L

2006-01-01

Production of cloned pigs using somatic cell nuclear transfer (SCNT) is a repeatable and predictable procedure and multiple labs around the world have generated cloned pigs and genetically modified cloned pigs. Due to the integrated nature of the pork production industry, pork producers are the most likely to benefit and are in the best position to introduce cloning in to production systems. Cloning can be used to amplify superior genetics or be used in conjunction with genetic modifications to produce animals with superior economic traits. Though unproven, cloning could add value by reducing pig-to-pig variability in economically significant traits such as growth rate, feed efficiency, and carcass characteristics. However, cloning efficiencies using SCNT are low, but predictable. The inefficiencies are due to the intrusive nature of the procedure, the quality of oocytes and/or the somatic cells used in the procedure, the quality of the nuclear transfer embryos transferred into recipients, pregnancy rates of the recipients, and neonatal survival of the clones. Furthermore, in commercial animal agriculture, clones produced must be able to grow and thrive under normal management conditions, which include attainment of puberty and subsequent capability to reproduce. To integrate SCNT into the pork industry, inefficiencies at each step of the procedure must be overcome. In addition, it is likely that non-surgical embryo transfer will be required to deliver cloned embryos, and/or additional methods to generate high health clones will need to be developed. This review will focus on the state-of-the-art for SCNT in pigs and the steps required for practical implementation of pig cloning in animal agriculture.

Selective advantages of two major clones of carbapenem-resistant Pseudomonas aeruginosa isolates (CC235 and CC641) from Korea: antimicrobial resistance, virulence and biofilm-forming activity.

PubMed

Lee, Ji-Young; Peck, Kyong Ran; Ko, Kwan Soo

2013-07-01

The characteristics of carbapenem-resistant P. aeruginosa (CRPA) isolates from Korea were investigated. Two major clones, clonal complex (CC) 235 and CC641, were identified. CC235, an important international clone, might have been imported recently in Korea as this clone displayed a homogeneous genotype, oprD mutation and antimicrobial resistance profile. While 13 ST235 isolates harboured the blaIMP-6 gene, which conferred high-level meropenem resistance, CC641 isolates showed high biofilm-forming activity. CC235 and CC641 isolates showed distinct distribution of ferripyoverdine receptor type and virulence markers. While all CC235 isolates were of the fpvAIIb type and exoS(-)/exoU(+), CC641 isolates were exoS(+)/exoU(-), and all but one showed the fpvAIII type. CC235 and CC641 isolates were also characterized by different extracellular protease activity: staphylolysin and elastase activities in CC235 and CC641, respectively. Two major CRPA clones in Korea seem to be predominant, reflecting their selective advantage by virtue of antimicrobial resistance, virulence and biofilm-forming activity.

Hyper-reactive cloned mice generated by direct nuclear transfer of antigen-specific CD4+ T cells.

PubMed

Kaminuma, Osamu; Katayama, Kazufumi; Inoue, Kimiko; Saeki, Mayumi; Nishimura, Tomoe; Kitamura, Noriko; Shimo, Yusuke; Tofukuji, Soichi; Ishida, Satoru; Ogonuki, Narumi; Kamimura, Satoshi; Oikawa, Mami; Katoh, Shigeki; Mori, Akio; Shichijo, Michitaka; Hiroi, Takachika; Ogura, Atsuo

2017-06-01

T-cell receptor (TCR)-transgenic mice have been employed for evaluating antigen-response mechanisms, but their non-endogenous TCR might induce immune response differently than the physiologically expressed TCR Nuclear transfer cloning produces animals that retain the donor genotype in all tissues including germline and immune systems. Taking advantage of this feature, we generated cloned mice that carry endogenously rearranged TCR genes from antigen-specific CD4 + T cells. We show that T cells of the cloned mice display distinct developmental pattern and antigen reactivity because of their endogenously pre-rearranged TCRα (rTα) and TCRβ (rTβ) alleles. These alleles were transmitted to the offspring, allowing us to establish a set of mouse lines that show chronic-type allergic phenotypes, that is, bronchial and nasal inflammation, upon local administrations of the corresponding antigens. Intriguingly, the existence of either rTα or rTβ is sufficient to induce in vivo hypersensitivity. These cloned mice expressing intrinsic promoter-regulated antigen-specific TCR are a unique animal model with allergic predisposition for investigating CD4 + T-cell-mediated pathogenesis and cellular commitment in immune diseases. © 2017 The Authors.

Dissemination of VIM-2 producing Pseudomonas aeruginosa ST233 at tertiary care hospitals in Egypt.

PubMed

Zafer, Mai Mahmoud; Al-Agamy, Mohamed Hamed; El-Mahallawy, Hadir Ahmed; Amin, Magdy Aly; El Din Ashour, Seif

2015-03-12

Pseudomonas aeruginosa is an important nosocomial pathogen, commonly causing infections in immunocompromised patients. The aim of this study was to examine the genetic relatedness of metallo-beta-lactamase (MBL) producing carbapenem resistant Pseudomonas aeruginosa clinical isolates collected from 2 tertiary hospitals in Cairo, Egypt using Multi Locus sequence typing (MLST). Phenotypic and genotypic detection of metallo-beta-lactamase for forty eight non-duplicate carbapenem resistant P. aeruginosa isolates were carried out. DNA sequencing and MLST were done. The bla VIM-2 gene was highly prevalent (28/33 strains, 85%) among 33 MBL-positive P.aeruginosa isolates. MLST revealed eleven distinct Sequence Types (STs). A unique ST233 clone producing VIM-2 was documented by MLST in P.aeruginosa strains isolated from Cairo university hospitals. The high prevalence of VIM-2 producers was not due to the spread of a single clone. The findings of the present study clearly demonstrate that clones of VIM-2 positive in our hospitals are different from those reported from European studies. Prevalence of VIM-2 producers of the same clone was detected from surgical specimens whereas oncology related specimens were showing diverse clones.

Reprogramming human A375 amelanotic melanoma cells by catalase overexpression: Reversion or promotion of malignancy by inducing melanogenesis or metastasis

PubMed Central

Bracalente, Candelaria; Salguero, Noelia; Notcovich, Cintia; Müller, Carolina B.; da Motta, Leonardo L.; Klamt, Fabio; Ibañez, Irene L.; Durán, Hebe

2016-01-01

Advanced melanoma is the most aggressive form of skin cancer. It is highly metastatic and dysfunctional in melanogenesis; two processes that are induced by H2O2. This work presents a melanoma cell model with low levels of H2O2 induced by catalase overexpression to study differentiation/dedifferentiation processes. Three clones (A7, C10 and G10) of human A375 amelanotic melanoma cells with quite distinct phenotypes were obtained. These clones faced H2O2 scavenging by two main strategies. One developed by clone G10 where ROS increased. This resulted in G10 migration and metastasis associated with the increased of cofilin-1 and CAP1. The other strategy was observed in clone A7 and C10, where ROS levels were maintained reversing malignant features. Particularly, C10 was not tumorigenic, while A7 reversed the amelanotic phenotype by increasing melanin content and melanocytic differentiation markers. These clones allowed the study of potential differentiation and migration markers and its association with ROS levels in vitro and in vivo, providing a new melanoma model with different degree of malignancy. PMID:27206672

Reprogramming human A375 amelanotic melanoma cells by catalase overexpression: Reversion or promotion of malignancy by inducing melanogenesis or metastasis.

PubMed

Bracalente, Candelaria; Salguero, Noelia; Notcovich, Cintia; Müller, Carolina B; da Motta, Leonardo L; Klamt, Fabio; Ibañez, Irene L; Durán, Hebe

2016-07-05

Advanced melanoma is the most aggressive form of skin cancer. It is highly metastatic and dysfunctional in melanogenesis; two processes that are induced by H2O2. This work presents a melanoma cell model with low levels of H2O2 induced by catalase overexpression to study differentiation/dedifferentiation processes. Three clones (A7, C10 and G10) of human A375 amelanotic melanoma cells with quite distinct phenotypes were obtained. These clones faced H2O2 scavenging by two main strategies. One developed by clone G10 where ROS increased. This resulted in G10 migration and metastasis associated with the increased of cofilin-1 and CAP1. The other strategy was observed in clone A7 and C10, where ROS levels were maintained reversing malignant features. Particularly, C10 was not tumorigenic, while A7 reversed the amelanotic phenotype by increasing melanin content and melanocytic differentiation markers. These clones allowed the study of potential differentiation and migration markers and its association with ROS levels in vitro and in vivo, providing a new melanoma model with different degree of malignancy.

Isolation and characterization of porcine adipose tissue-derived adult stem cells.

PubMed

Williams, Kellie J; Picou, Alicia A; Kish, Sharon L; Giraldo, Angelica M; Godke, Robert A; Bondioli, Kenneth R

2008-01-01

Stem cell characteristics such as self-renewal, differentiation and expression of CD34 and CD44 stem cell markers have not been identified in porcine adipose tissue-derived adult stem (ADAS) cells. The objective of this study was to develop a protocol for the isolation and culture of porcine adipose tissue-derived cells and to determine stem cell-like characteristics. Primary cultures were established and cell cultures were maintained. Cloning capacity was determined using a ring cloning procedure. Primary cultures and clones were differentiated and stained for multiple differentiated phenotypes. CD34 and CD44 messenger ribonucleic acid (mRNA) was isolated and reverse transcriptase polymerase chain reaction was used to compare expression profiles. An average of 2,700,000 nucleated cells/ml was isolated; 26% were adherent, and cells completed a cell cycle approximately every 3.3 days. Ring cloning identified 19 colonies. Primary cultures and clones were determined to differentiate along osteogenic, adipogenic and chondrogenic tissue lineages. The mRNA expression profiles showed CD34 expression was higher for undifferentiated ADAS cells versus differentiated cell types and the CD34 expression level was lower than that of CD44 among differentiated cells. Improved culture conditions and defined cellular characteristics of these porcine ADAS cells have been identified. Porcine ADAS can self-renew, can differentiate into multiple tissue lineages and they express CD34. Copyright 2008 S. Karger AG, Basel.

A cell clone strain from Mythimna separata (Lepidoptera: Noctuidae) highly susceptible to Autographa californica multiple nucleopolyhedrovirus (AcMNPV) and M. separata NPV (MsNPV).

PubMed

Meng, Xiang-Qian; Zheng, Gui-Ling; Zhao, Chuan-De; Wan, Fang-Hao; Li, Chang-You

2017-08-01

In this study, we describe a cell line, Ms-10C, cloned from the line QAU-Ms-E-10 (simplified Ms-10), an embryonic line from Mythimna separata. The cloned cell line was significantly more sensitive to nucleopolyhedrovirus (NPV). Ms-10C cells were mainly spherical with a diameter of 14.42 ± 2.23 μm. DNA amplification fingerprinting (DAF) confirmed the profile of PCR-amplified bands of the cloned cell line was consistent with those of the parental cell line, Ms-10. The sequencing result of the mitochondrial cytochrome c oxidase I (mtCO I) fragment confirmed that the amplified 636-bps mtCOI fragment was 100% identical to that of M. separata. Its chromosomes exhibited the typical characters of lepidopteran cell lines. Its population doubling time was 42.2 h at 27°C. Ms-10C was more sensitive than Ms-10 to both Autographa californica multiple nucleopolyhedrovirus (AcMNPV) and M. separata nucleopolyhedrovirus (MsNPV). At 4 d post infection, the infection rates of two viruses reached 94.2 and 92.3%, respectively. The availability of this cell clone strain will provide a useful tool for the basic research on nucleopolyhedrovirus and for potential application in expression of recombinant proteins with baculovirus expression vector system.

Comparative Proteomics of Rubber Latex Revealed Multiple Protein Species of REF/SRPP Family Respond Diversely to Ethylene Stimulation among Different Rubber Tree Clones.

PubMed

Tong, Zheng; Wang, Dan; Sun, Yong; Yang, Qian; Meng, Xueru; Wang, Limin; Feng, Weiqiang; Li, Ling; Wurtele, Eve Syrkin; Wang, Xuchu

2017-05-02

Rubber elongation factor (REF) and small rubber particle protein (SRPP) are two key factors for natural rubber biosynthesis. To further understand the roles of these proteins in rubber formation, six different genes for latex abundant REF or SRPP proteins, including REF 138,175,258 and SRPP 117,204,243 , were characterized from Hevea brasiliensis Reyan (RY) 7-33-97. Sequence analysis showed that REFs have a variable and long N-terminal, whereas SRPPs have a variable and long C-terminal beyond the REF domain, and REF 258 has a β subunit of ATPase in its N-terminal. Through two-dimensional electrophoresis (2-DE), each REF/SRPP protein was separated into multiple protein spots on 2-DE gels, indicating they have multiple protein species. The abundance of REF/SRPP proteins was compared between ethylene and control treatments or among rubber tree clones with different levels of latex productivity by analyzing 2-DE gels. The total abundance of each REF/SRPP protein decreased or changed a little upon ethylene stimulation, whereas the abundance of multiple protein species of the same REF/SRPP changed diversely. Among the three rubber tree clones, the abundance of the protein species also differed significantly. Especially, two protein species of REF 175 or REF 258 were ethylene-responsive only in the high latex productivity clone RY 8-79 instead of in RY 7-33-97 and PR 107. Some individual protein species were positively related to ethylene stimulation and latex productivity. These results suggested that the specific protein species could be more important than others for rubber production and post-translational modifications might play important roles in rubber biosynthesis.

Prognostic value of paroxysmal nocturnal haemoglobinuria clone presence in aplastic anaemia patients treated with combined immunosuppression: results of two-centre prospective study.

PubMed

Kulagin, Alexander; Lisukov, Igor; Ivanova, Maria; Golubovskaya, Irina; Kruchkova, Irina; Bondarenko, Sergey; Vavilov, Vladimir; Stancheva, Natalia; Babenko, Elena; Sipol, Alexandra; Pronkina, Natalia; Kozlov, Vladimir; Afanasyev, Boris

2014-02-01

Paroxysmal nocturnal haemoglobinuria (PNH) clones are frequently detected in patients with aplastic anaemia (AA). To evaluate the prognostic role of PNH clone presence we conducted a prospective study in 125 AA patients treated with combined immunosuppressive therapy (IST). Seventy-four patients (59%) had a PNH clone (PNH+ patients) at diagnosis, with a median clone size of 0·60% in granulocytes and 0·15% in red blood cells. The response rate at 6 months was higher in PNH+ patients than that in PNH- patients, both after first- and second-line IST: 68% vs. 45%, P = 0·0164 and 53% vs. 13%, P = 0·0502 respectively. Moreover, 42% of PNH+ patients achieved complete remission compared with only 16% of PNH- patients (P = 0·0029). In multivariate logistic regression analysis, PNH clone presence (odds ratio 2·56, P = 0·0180) and baseline absolute reticulocyte count (ARC) ≥30 × 10(9) /l (odds ratio 5·19, P = 0·0011) were independent predictors of response to treatment. Stratification according to PNH positivity and ARC ≥30 × 10(9) /l showed significant distinctions for cumulative incidence of response, overall and failure-free survival. The results of this prospective study confirmed the favourable prognostic value of PNH clone presence in the setting of IST for AA. © 2013 John Wiley & Sons Ltd.

Quantum dot-based molecular imaging of cancer cell growth using a clone formation assay.

PubMed

Geng, Xia-Fei; Fang, Min; Liu, Shao-Ping; Li, Yan

2016-10-01

This aim of the present study was to investigate clonal growth behavior and analyze the proliferation characteristics of cancer cells. The MCF‑7 human breast cancer cell line, SW480 human colon cancer cell line and SGC7901 human gastric cancer cell line were selected to investigate the morphology of cell clones. Quantum dot‑based molecular targeted imaging techniques (which stained pan‑cytokeratin in the cytoplasm green and Ki67 in the cell nucleus yellow or red) were used to investigate the clone formation rate, cell morphology, discrete tendency, and Ki67 expression and distribution in clones. From the cell clone formation assay, the MCF‑7, SW480 and SGC7901 cells were observed to form clones on days 6, 8 and 12 of cell culture, respectively. These three types of cells had heterogeneous morphology, large nuclear:cytoplasmic ratios, and conspicuous pathological mitotic features. The cells at the clone periphery formed multiple pseudopodium. In certain clones, cancer cells at the borderline were separated from the central cell clusters or presented a discrete tendency. With quantum dot‑based molecular targeted imaging techniques, cells with strong Ki67 expression were predominantly shown to be distributed at the clone periphery, or concentrated on one side of the clones. In conclusion, cancer cell clones showed asymmetric growth behavior, and Ki67 was widely expressed in clones of these three cell lines, with strong expression around the clones, or aggregated at one side. Cell clone formation assay based on quantum dots molecular imaging offered a novel method to study the proliferative features of cancer cells, thus providing a further insight into tumor biology.

Mechanisms of CTC Biomarkers in Breast Cancer Brain Metastasis

DTIC Science & Technology

2015-10-01

from breast cancer patients are very distinct from breast cancer cell lines that are widely used for drug discovery, a finding which raises the...These findings are of relevance because the formation of invadopodia in CTC is required for the in vivo extravasation through blood-brain barrier as...Optimization of PCR conditions to prepare distinct Notch1/HPSE shRNAs with the establishment of an effective cloning protocol to construct pINDUCER11-shRNA

A Pleistocene Clone of Palmer's Oak Persisting in Southern California

PubMed Central

May, Michael R.; Provance, Mitchell C.; Sanders, Andrew C.; Ellstrand, Norman C.; Ross-Ibarra, Jeffrey

2009-01-01

Background The distribution of Palmer's oak (Quercus palmeri Engelm.) includes numerous isolated populations that are presumably relicts of a formerly larger range that has contracted due to spreading aridity following the end of the Pleistocene. Principal Findings We investigated a recently discovered disjunct population of Palmer's oak in the Jurupa Mountains of Riverside County, California. Patterns of allozyme polymorphism, morphological homogeneity, widespread fruit abortion, and evidence of fire resprouting all strongly support the hypothesis that the population is a single clone. The size of the clone and estimates of annual growth from multiple populations lead us to conclude that the clone is in excess of 13,000 years old. Conclusions The ancient age of the clone implies it originated during the Pleistocene and is a relict of a vanished vegetation community. Range contraction after climate change best explains the modern disjunct distribution of Q. palmeri and perhaps other plants in California. PMID:20041136

Genetic engineering of Pichia stipitis for fermentation of xylose

Treesearch

Thomas W. Jeffries; N. Q. Shi; J. Y. Cho; P. Lu; K. Dahn; J. Hendrick; H. K. Sreenath

1998-01-01

A useful genetic system has been developed for the transformation of Pichia stipitis. This includes two selectable markers (URA3 and LEU2), integrating and autonomous replication vectors, a pop-out cassette that enables multiple targeted disruptions, and a genomic X-library for rapid cloning. Using this system we have cloned two genes for alcohol dehydrogenase (PsADH1...

MultiSite Gateway-Compatible Cell Type-Specific Gene-Inducible System for Plants1[OPEN

PubMed Central

Siligato, Riccardo; Wang, Xin; Yadav, Shri Ram; Lehesranta, Satu; Ma, Guojie; Ursache, Robertas; Sevilem, Iris; Zhang, Jing; Gorte, Maartje; Prasad, Kalika; Heidstra, Renze

2016-01-01

A powerful method to study gene function is expression or overexpression in an inducible, cell type-specific system followed by observation of consequent phenotypic changes and visualization of linked reporters in the target tissue. Multiple inducible gene overexpression systems have been developed for plants, but very few of these combine plant selection markers, control of expression domains, access to multiple promoters and protein fusion reporters, chemical induction, and high-throughput cloning capabilities. Here, we introduce a MultiSite Gateway-compatible inducible system for Arabidopsis (Arabidopsis thaliana) plants that provides the capability to generate such constructs in a single cloning step. The system is based on the tightly controlled, estrogen-inducible XVE system. We demonstrate that the transformants generated with this system exhibit the expected cell type-specific expression, similar to what is observed with constitutively expressed native promoters. With this new system, cloning of inducible constructs is no longer limited to a few special cases but can be used as a standard approach when gene function is studied. In addition, we present a set of entry clones consisting of histochemical and fluorescent reporter variants designed for gene and promoter expression studies. PMID:26644504

Recent independent emergence of multiple multidrug-resistant Serratia marcescens clones within the United Kingdom and Ireland

PubMed Central

Moradigaravand, Danesh; Boinett, Christine J.; Martin, Veronique; Peacock, Sharon J.; Parkhill, Julian

2016-01-01

Serratia marcescens, a member of the Enterobacteriaceae family, is a Gram-negative bacterium responsible for a wide range of nosocomial infections. The emergence of multidrug-resistant strains is an increasing danger to public health. To design effective means to control the dissemination of S. marcescens, an in-depth analysis of the population structure and variation is required. Utilizing whole-genome sequencing, we characterized the population structure and variation, as well as the antimicrobial resistance determinants, of a systematic collection of antimicrobial-resistant S. marcescens associated with bloodstream infections in hospitals across the United Kingdom and Ireland between 2001 and 2011. Our results show that S. marcescens is a diverse species with a high level of genomic variation. However, the collection was largely composed of a limited number of clones that emerged from this diverse background within the past few decades. We identified potential recent transmissions of these clones, within and between hospitals, and showed that they have acquired antimicrobial resistance determinants for different beta-lactams, ciprofloxacin, and tetracyclines on multiple occasions. The expansion of these multidrug-resistant clones suggests that the treatment of S. marcescens infections will become increasingly difficult in the future. PMID:27432456

Physical mapping of complex genomes

DOEpatents

Evans, Glen A.

1993-01-01

Method for simultaneous identification of overlapping cosmid clones among multiple cosmid clones and the use of the method for mapping complex genomes are provided. A library of cosmid clones that contains the DNA to be mapped is constructed and arranged in a manner such that individual clones can be identified and replicas of the arranged clones prepared. In preferred embodiments, the clones are arranged in a two dimensional matrix. In such embodiments, the cosmid clones in a row are pooled, mixed probes complementary to the ends of the DNA inserts int he pooled clones are synthesized, hybridized to a first replica of the library. Hybridizing clones, which include the pooled row, are identified. A second portion of clones is prepared by pooling cosmid clones that correspond to a column in the matrix. The second pool thereby includes one clone from the first portion pooled clones. This common clone is located on the replica at the intersection of the column and row. Mixed probes complementary to the ends of the DNA inserts in the second pooled portion of clones are prepared and hybridized to a second replica of the library. The hybridization pattern on the first and second replicas of the library are compared and cross-hybridizing clones, other than the clones in the pooled column and row, that hybridize to identical clones in the first and second replicas are identified. These clones necessarily include DNA inserts that overlap with the DNA insert int he common clone located at the intersection of the pooled row and pooled column. The DNA in the entire library may be mapped by pooling the clones in each of the rows and columns of the matrix, preparing mixed end-specific probes and hybridizing the probes from each row or column to a replica of the library. Since all clones in the library are located at the intersection of a column and a row, the overlapping clones for all clones in the library may be identified and a physical map constructed. In other preferred embodiments, the cosmid clones are arranged in a three dimensional matrix, pooled and compared in threes according to intersecting planes of the three dimensional matrix. Arrangements corresponding to geometries of higher dimensions may also be prepared and used to simultaneously identify overlapping clones in highly complex libraries with relatively few hybridization reactions.

Case report: Concomitant Chronic Lymphocytic Leukaemia and Cytogenetically Normal de novo Acute Leukaemia in a Patient.

PubMed

Kajtár, Béla; Rajnics, Péter; Egyed, Miklós; Alizadeh, Hussain

2015-01-01

The simultaneous occurrence of acute myeloid leukaemia with untreated chronic lymphocytic leukemia is extremely rare. We report a case of a 74-year-old man who was evaluated for macrocytic anaemia. Based on the morphology and immunophenotyping analysis of peripheral blood, a diagnosis of chronic lymphocytic leukemia was established. Subsequently, the bone marrow examination revealed the presence of two distinct, coexisting CLL and AML clones. Cytogenetic and molecular genetic analysis detected deletion 13q14.3 and unmutated immunoglobulin variable heavy-chain in the CLL clone, only. The AML and CLL clones did not share clonality, and the AML did not involve the peripheral blood. A diagnosis of cytogenetically normal de novo AML occurring concurrently with untreated CLL has not been reported previously in English literature. © 2015 by the Association of Clinical Scientists, Inc.

A high-throughput screen for single gene activities: isolation of apoptosis inducers.

PubMed

Albayrak, Timur; Grimm, Stefan

2003-05-16

We describe a novel genetic screen that is performed by transfecting every individual clone of an expression library into a separate population of cells in a high-throughput mode. The screen allows one to achieve a hitherto unattained sensitivity in expression cloning which was exploited in a first read-out to clone apoptosis-inducing genes. This led to the isolation of several genes whose proteins induce distinct phenotypes of apoptosis in 293T cells. One of the isolated genes is the tumor suppressor cytochrome b(L) (cybL), a component of the respiratory chain complex II, that diminishes the activity of this complex for apoptosis induction. This gene is more efficient and specific for causing cell death than a drug with the same activity. These results suggest further applications, both of the isolated genes and the screen.

Evolutionary genetic relationships of clones of Salmonella serovars that cause human typhoid and other enteric fevers.

PubMed Central

Selander, R K; Beltran, P; Smith, N H; Helmuth, R; Rubin, F A; Kopecko, D J; Ferris, K; Tall, B D; Cravioto, A; Musser, J M

1990-01-01

Multilocus enzyme electrophoresis was employed to measure chromosomal genotypic diversity and evolutionary relationships among 761 isolates of the serovars Salmonella typhi, S. paratyphi A, S. paratyphi B, S. paratyphi C, and S. sendai, which are human-adapted agents of enteric fever, and S. miami and S. java, which are serotypically similar to S. sendai and S. paratyphi B, respectively, but cause gastroenteritis in both humans and animals. To determine the phylogenetic positions of the clones of these forms within the context of the salmonellae of subspecies I, comparative data for 22 other common serovars were utilized. Except for S. paratyphi A and S. sendai, the analysis revealed no close phylogenetic relationships among clones of different human-adapted serovars, which implies convergence in host adaptation and virulence factors. Clones of S. miami are not allied with those of S. sendai or S. paratyphi A, being, instead, closely related to strains of S. panama. Clones of S. paratyphi B and S. java belong to a large phylogenetic complex that includes clones of S. typhimurium, S. heidelberg, S. saintpaul, and S. muenchen. Most strains of S. paratyphi B belong to a globally distributed clone that is highly polymorphic in biotype, bacteriophage type, and several other characters, whereas strains of S. java represent seven diverse lineages. The flagellar monophasic forms of S. java are genotypically more similar to clones of S. typhimurium than to other clones of S. java or S. paratyphi B. Clones of S. paratyphi C are related to those of S. choleraesuis. DNA probing with a segment of the viaB region specific for the Vi capsular antigen genes indicated that the frequent failure of isolates of S. paratyphi C to express Vi antigen is almost entirely attributable to regulatory processes rather than to an absence of the structural determinant genes themselves. Two clones of S. typhisuis are related to those of S. choleraesuis and S. paratyphi C, but a third clone is not. Although the clones of S. decatur and S. choleraesuis are serologically and biochemically similar, they are genotypically very distinct. Two clones of S. typhi were distinguished, one globally distributed and another apparently confined to Africa; both clones are distantly related to those of all other serovars studied. Images PMID:1973153

Amoxicillin and Clavulanate Form Chemically and Immunologically Distinct Multiple Haptenic Structures in Patients.

PubMed

Meng, Xiaoli; Earnshaw, Caroline J; Tailor, Arun; Jenkins, Rosalind E; Waddington, James C; Whitaker, Paul; French, Neil S; Naisbitt, Dean J; Park, B Kevin

2016-10-17

Amoxicillin-clavulanate (AC) is one of the most common causes of drug induced liver injury (DILI). The association between AC-DILI and HLA alleles and the detection of drug-specific T cells in patients with AC-DILI indicate that the adaptive immune system is involved in the disease pathogenesis. In this study, mass spectrometric methods were employed to characterize the antigen formed by AC in exposed patients and the antigenic determinants that stimulate T cells. Amoxicillin formed penicilloyl adducts with lysine residues on human serum albumin (HSA) in vitro, with K190 and K199 being the most reactive sites. Amoxicillin-modified K190 and K199 have also been detected in all patients, and more extensive modification was observed in patients exposed to higher doses of amoxicillin. In contrast, the binding of clavulanic acid to HSA was more complicated. Multiple adducts were identified at high concentrations in vitro, including those formed by direct binding of clavulanic acid to lysine residues, novel pyrazine adducts derived from binding to the degradation products of clavulanic acid, and a cross-linking adduct. Stable adducts derived from formylacetic acid were detected in all patients exposed to the drug. Importantly, analysis of hapten-protein adducts formed in the cell culture medium revealed that the highly drug-specific T-cell responses were likely driven by the markedly different haptenic structures formed by these two drugs. In this study, the unique haptenic structures on albumin in patients formed by amoxicillin and clavulanic acid have been characterized and shown to function as chemically distinct antigens which can stimulate separate, specific T-cell clones.

Transposons and integrons in colistin-resistant clones of Klebsiella pneumoniae and Acinetobacter baumannii with epidemic or sporadic behaviour.

PubMed

Arduino, Sonia M; Quiroga, María Paula; Ramírez, María Soledad; Merkier, Andrea Karina; Errecalde, Laura; Di Martino, Ana; Smayevsky, Jorgelina; Kaufman, Sara; Centrón, Daniela

2012-10-01

Multiple transposons, integrons and carbapenemases were found in Klebsiella pneumoniae colistin-resistant isolates as well as a genomic resistance island of the AbaR type in Acinetobacter baumannii colistin-resistant isolates from different hospitals from Buenos Aires City. PFGE analysis showed a polyclonal dissemination of antimicrobial resistance mechanisms among K. pneumoniae isolates, while in A. baumannii isolates the epidemic clone 1 from South America was found. Resistance determinants associated with horizontal gene transfer are contributing to the evolution to pandrug resistance in both epidemic and sporadic clones.

Local circulating clones of Staphylococcus aureus in Ecuador.

PubMed

Zurita, Jeannete; Barba, Pedro; Ortega-Paredes, David; Mora, Marcelo; Rivadeneira, Sebastián

The spread of pandemic Staphylococcus aureus clones, mainly methicillin-resistant S. aureus (MRSA), must be kept under surveillance to assemble an accurate, local epidemiological analysis. In Ecuador, the prevalence of the USA300 Latin American variant clone (USA300-LV) is well known; however, there is little information about other circulating clones. The aim of this work was to identify the sequence types (ST) using a Multiple-Locus Variable number tandem repeat Analysis 14-locus genotyping approach. We analyzed 132 S. aureus strains that were recovered from 2005 to 2013 and isolated in several clinical settings in Quito, Ecuador. MRSA isolates composed 46.97% (62/132) of the study population. Within MRSA, 37 isolates were related to the USA300-LV clone (ST8-MRSA-IV, Panton-Valentine Leukocidin [PVL] +) and 10 were related to the Brazilian clone (ST239-MRSA-III, PVL-). Additionally, two isolates (ST5-MRSA-II, PVL-) were related to the New York/Japan clone. One isolate was related to the Pediatric clone (ST5-MRSA-IV, PVL-), one isolate (ST45-MRSA-II, PVL-) was related to the USA600 clone, and one (ST22-MRSA-IV, PVL-) was related to the epidemic UK-EMRSA-15 clone. Moreover, the most prevalent MSSA sequence types were ST8 (11 isolates), ST45 (8 isolates), ST30 (8 isolates), ST5 (7 isolates) and ST22 (6 isolates). Additionally, we found one isolate that was related to the livestock associated S. aureus clone ST398. We conclude that in addition to the high prevalence of clone LV-ST8-MRSA-IV, other epidemic clones are circulating in Quito, such as the Brazilian, Pediatric and New York/Japan clones. The USA600 and UK-EMRSA-15 clones, which were not previously described in Ecuador, were also found. Moreover, we found evidence of the presence of the livestock associated clone ST398 in a hospital environment. Copyright © 2016 Sociedade Brasileira de Infectologia. Published by Elsevier Editora Ltda. All rights reserved.

Ovulation Statuses of Surrogate Gilts Are Associated with the Efficiency of Excellent Pig Cloning.

PubMed

Huan, Yanjun; Hu, Kui; Xie, Bingteng; Shi, Yongqian; Wang, Feng; Zhou, Yang; Liu, Shichao; Huang, Bo; Zhu, Jiang; Liu, Zhongfeng; He, Yilong; Li, Jingyu; Kong, Qingran; Liu, Zhonghua

2015-01-01

Somatic cell nuclear transfer (SCNT) is an assisted reproductive technique that can produce multiple copies of excellent livestock. However, low cloning efficiency limits the application of SCNT. In this study, we systematically investigated the major influencing factors related to the overall cloning efficiency in pigs. Here, 13620 cloned embryos derived from excellent pigs were transferred into 79 surrogate gilts, and 119 live cloned piglets were eventually generated. During cloning, group of cloned embryos derived from excellent Landrace or Large white pigs presented no significant differences of cleavage and blastocyst rates, blastocyst cell numbers, surrogate pregnancy and delivery rates, average numbers of piglets born and alive and cloning efficiencies, and group of 101-150, 151-200 or 201-250 cloned embryos transferred per surrogate also displayed a similar developmental efficiency. When estrus stage of surrogate gilts was compared, group of embryo transfer on Day 2 of estrus showed significantly higher pregnancy rate, delivery rate, average number of piglets born, average alive piglet number or cloning efficiency than group on Day 1, Day 3, Day 4 or Day 5, respectively (P<0.05). And, in comparison with the preovulation and postovulation groups, group of surrogate gilts during periovulation displayed a significantly higher overall cloning efficiency (P<0.05). Further investigation of surrogate estrus stage and ovulation status displayed that ovulation status was the real factor underlying estrus stage to determine the overall cloning efficiency. And more, follicle puncture for preovulation, not transfer position shallowed for preovulation or deepened for postovulation, significantly improved the average number of piglets alive and cloning efficiency (P<0.05). In conclusion, our results demonstrated that ovulation status of surrogate gilts was the fundamental factor determining the overall cloning efficiency of excellent pigs, and follicle puncture, not transfer position change, improved cloning efficiency. This work would have important implications in preserving and breeding excellent livestock and improving the overall cloning efficiency.

Ovulation Statuses of Surrogate Gilts Are Associated with the Efficiency of Excellent Pig Cloning

PubMed Central

Huan, Yanjun; Hu, Kui; Xie, Bingteng; Shi, Yongqian; Wang, Feng; Zhou, Yang; Liu, Shichao; Huang, Bo; Zhu, Jiang; Liu, Zhongfeng; He, Yilong; Li, Jingyu; Kong, Qingran; Liu, Zhonghua

2015-01-01

Somatic cell nuclear transfer (SCNT) is an assisted reproductive technique that can produce multiple copies of excellent livestock. However, low cloning efficiency limits the application of SCNT. In this study, we systematically investigated the major influencing factors related to the overall cloning efficiency in pigs. Here, 13620 cloned embryos derived from excellent pigs were transferred into 79 surrogate gilts, and 119 live cloned piglets were eventually generated. During cloning, group of cloned embryos derived from excellent Landrace or Large white pigs presented no significant differences of cleavage and blastocyst rates, blastocyst cell numbers, surrogate pregnancy and delivery rates, average numbers of piglets born and alive and cloning efficiencies, and group of 101–150, 151–200 or 201–250 cloned embryos transferred per surrogate also displayed a similar developmental efficiency. When estrus stage of surrogate gilts was compared, group of embryo transfer on Day 2 of estrus showed significantly higher pregnancy rate, delivery rate, average number of piglets born, average alive piglet number or cloning efficiency than group on Day 1, Day 3, Day 4 or Day 5, respectively (P<0.05). And, in comparison with the preovulation and postovulation groups, group of surrogate gilts during periovulation displayed a significantly higher overall cloning efficiency (P<0.05). Further investigation of surrogate estrus stage and ovulation status displayed that ovulation status was the real factor underlying estrus stage to determine the overall cloning efficiency. And more, follicle puncture for preovulation, not transfer position shallowed for preovulation or deepened for postovulation, significantly improved the average number of piglets alive and cloning efficiency (P<0.05). In conclusion, our results demonstrated that ovulation status of surrogate gilts was the fundamental factor determining the overall cloning efficiency of excellent pigs, and follicle puncture, not transfer position change, improved cloning efficiency. This work would have important implications in preserving and breeding excellent livestock and improving the overall cloning efficiency. PMID:26565717

Wide but Variable Distribution of a Hypervirulent Campylobacter jejuni Clone in Beef and Dairy Cattle in the United States

PubMed Central

Tang, Yizhi; Meinersmann, Richard J.; Sahin, Orhan; Wu, Zuowei; Dai, Lei; Carlson, James; Plumblee Lawrence, Jodie; Genzlinger, Linda; LeJeune, Jeffrey T.

2017-01-01

ABSTRACT Campylobacter jejuni clone SA is the major cause of sheep abortion and contributes significantly to foodborne illnesses in the United States. Clone SA is hypervirulent because of its distinct ability to produce systemic infection and its predominant role in clinical sheep abortion. Despite the importance of clone SA, little is known about its distribution and epidemiological features in cattle. Here we describe a prospective study on C. jejuni clone SA prevalence in 35 feedlots in 5 different states in the United States and a retrospective analysis of clone SA in C. jejuni isolates collected by National Animal Health Monitoring System (NAHMS) dairy studies in 2002, 2007, and 2014. In feedlot cattle feces, the overall prevalence of Campylobacter organisms was 72.2%, 82.1% of which were C. jejuni. Clone SA accounted for 5.8% of the total C. jejuni isolates, but its prevalence varied by feedlot and state. Interestingly, starlings on the feedlots harbored C. jejuni in feces, including clone SA, suggesting that these birds may play a role in the transmission of Campylobacter. In dairy cattle, the overall prevalence of clone SA was 7.2%, but a significant decrease in the prevalence was observed from 2002 to 2014. Whole-genome sequence analysis of the dairy clone SA isolates revealed that it was genetically stable over the years and most of the isolates carried the tetracycline resistance gene tet(O) in the chromosome. These findings indicate that clone SA is widely distributed in both beef and dairy cattle and provide new insights into the molecular epidemiology of clone SA in ruminants. IMPORTANCE C. jejuni clone SA is a major cause of small-ruminant abortion and an emerging threat to food safety because of its association with foodborne outbreaks. Cattle appear to serve as a major reservoir for this pathogenic organism, but there is a major gap in our knowledge about the epidemiology of clone SA in beef and dairy cattle. By taking advantage of surveillance studies conducted on a national scale, we found a wide but variable distribution of clone SA in feedlot cattle and dairy cows in the United States. Additionally, the work revealed important genomic features of clone SA isolates from cattle. These findings provide critically needed information for the development of preharvest interventions to control the transmission of this zoonotic pathogen. Control of C. jejuni clone SA will benefit both animal health and public health, as it is a zoonotic pathogen causing disease in both ruminants and humans. PMID:28970227

Wide but variable distribution of a hypervirulent Campylobacter jejuni clone in beef and dairy cattle in the United States.

PubMed

Tang, Yizhi; Meinersmann, Richard J; Sahin, Orhan; Wu, Zuowei; Dai, Lei; Carlson, James; Plumblee, Jodie; Genzlinger, Linda; LeJeune, Jeffrey T; Zhang, Qijing

2017-09-29

Campylobacter jejuni clone SA is the major cause of sheep abortion and contributes significantly to foodborne illnesses in the United States. Clone SA is hypervirulent because of its distinct ability to produce systemic infection and its predominant role in clinical sheep abortion. Despite the importance of clone SA, little is known about its distribution and epidemiological features in cattle. Here, we describe a prospective study on C. jejuni clone SA prevalence in 35 feedlots in 5 different states in the U.S. and a retrospective analysis of clone SA in C. jejuni isolates collected by National Animal Health Monitoring System (NAHMS) Dairy Studies 2002, 2007 and 2014. In feedlot cattle feces, the overall prevalence of Campylobacter was 72.2%, 82.1% of which were C. jejuni Clone SA accounted for 5.8% of the total C. jejuni isolates, but its prevalence varied by feedlot and state. Interestingly, starlings on the feedlots harbored C. jejuni in feces including clone SA, suggesting it may play a role in the transmission of Campylobacter In dairy cattle, the overall prevalence of clone SA was 7.2%, but a significant decrease in the prevalence was observed from 2002 to 2014. Whole genome sequence analysis of the dairy clone SA isolates revealed that it was genetically stable over the years and most of the isolates carried the tetracycline resistance gene tet(O ) in the chromosome. These findings indicate clone SA is widely distributed in both beef and dairy cattle, and provide new insights into the molecular epidemiology of clone SA in ruminants. Importance C. jejuni clone SA is a major cause of small ruminant abortion and an emerging threat to food safety because of its association with foodborne outbreaks. Cattle appears to serve as a major reservoir for this pathogenic organism, but there is a major gap in our knowledge about the epidemiology of clone SA in beef and dairy cattle. By taking advantage of surveillance studies conducted on a national scale, this manuscript describes wide but variable distribution of clone SA in feedlot cattle and dairy cows in the United States. Additionally, the work revealed important genomic features of clone SA isolates from cattle. These findings provide critically needed information for the development of pre-harvest interventions to control the transmission of this zoonotic pathogen. Control of C. jejuni clone SA will benefit both animal health and public health as it is a zoonotic pathogen causing disease in both ruminants and humans. Copyright © 2017 Tang et al.

Infection of human T lymphotropic virus-I-specific immune T cell clones by human T lymphotropic virus-I.

PubMed Central

Mitsuya, H; Jarrett, R F; Cossman, J; Cohen, O J; Kao, C S; Guo, H G; Reitz, M S; Broder, S

1986-01-01

Human T lymphotropic virus-I (HTLV-I)-specific T cell lines were established and cloned. K5, an OKT8+ clone bearing multiple proviral integration sites, retained its HTLV-I-specific cytotoxicity and a normal dependence on interleukin 2 (IL-2), indicating that there is a finite number of transforming integration sites. R2, an OKT4+ HTLV-I-infected clone, initially mounted a proliferative response to HTLV-I; but then its IL-2-independent proliferation increased and the antigen specificity was lost. All HTLV-I-infected clones tested including K7, another OKT8+ transformed cytotoxic clone that had lost its reactivity, expressed comparable levels of T cell receptor beta-chain (TCR-beta) messenger (m)RNA. Although clones K5 and K7 had different functional properties, they had the same rearrangement of the TCR-beta gene, suggesting that they had the same clonal origin. These data indicate that HTLV-I-specific T cells retain their immune reactivity for variable periods of time following infection, but then usually lose it; in some cases, however, no alteration in function can be detected. The data also suggest that different consequences can take place in the same clone depending on the pattern of retroviral infection. Images PMID:2877011

Large-Scale Concatenation cDNA Sequencing

PubMed Central

Yu, Wei; Andersson, Björn; Worley, Kim C.; Muzny, Donna M.; Ding, Yan; Liu, Wen; Ricafrente, Jennifer Y.; Wentland, Meredith A.; Lennon, Greg; Gibbs, Richard A.

1997-01-01

A total of 100 kb of DNA derived from 69 individual human brain cDNA clones of 0.7–2.0 kb were sequenced by concatenated cDNA sequencing (CCS), whereby multiple individual DNA fragments are sequenced simultaneously in a single shotgun library. The method yielded accurate sequences and a similar efficiency compared with other shotgun libraries constructed from single DNA fragments (>20 kb). Computer analyses were carried out on 65 cDNA clone sequences and their corresponding end sequences to examine both nucleic acid and amino acid sequence similarities in the databases. Thirty-seven clones revealed no DNA database matches, 12 clones generated exact matches (≥98% identity), and 16 clones generated nonexact matches (57%–97% identity) to either known human or other species genes. Of those 28 matched clones, 8 had corresponding end sequences that failed to identify similarities. In a protein similarity search, 27 clone sequences displayed significant matches, whereas only 20 of the end sequences had matches to known protein sequences. Our data indicate that full-length cDNA insert sequences provide significantly more nucleic acid and protein sequence similarity matches than expressed sequence tags (ESTs) for database searching. [All 65 cDNA clone sequences described in this paper have been submitted to the GenBank data library under accession nos. U79240–U79304.] PMID:9110174

Genome organization of Tobacco leaf curl Zimbabwe virus, a new, distinct monopartite begomovirus associated with subgenomic defective DNA molecules.

PubMed

Paximadis, M; Rey, M E

2001-12-01

The complete DNA A of the begomovirus Tobacco leaf curl Zimbabwe virus (TbLCZWV) was sequenced: it comprises 2767 nucleotides with six major open reading frames encoding proteins with molecular masses greater than 9 kDa. Full-length TbLCZWV DNA A tandem dimers, cloned in binary vectors (pBin19 and pBI121) and transformed into Agrobacterium tumefaciens, were systemically infectious upon agroinoculation of tobacco and tomato. Efforts to identify a DNA B component were unsuccessful. These findings suggest that TbLCZWV is a new member of the monopartite group of begomoviruses. Phylogenetic analysis identified TbLCZWV as a distinct begomovirus with its closest relative being Chayote mosaic virus. Abutting primer PCR amplified ca. 1300 bp molecules, and cloning and sequencing of two of these molecules revealed them to be subgenomic defective DNA molecules originating from TbLCZWV DNA A. Variable symptom severity associated with tobacco leaf curl disease and TbLCZWV is discussed.

The Decline of Mortality of Cottonwood Clone Stoneville 124 on a Clay Soil

Treesearch

John K. Francis; Francis I. McCracken

1985-01-01

A decline sequence involving multiple factors was proposed as the cause of death and diminished crowns of 12-year-old cottonwood planted on a clay site. Stoneville clone 124, of which the plantation was formed, has proved to be poorly adapted to clay soils. Rates of death and weakened crowns were shown to be related to minor elevation differences within the plantation...

Leech segmental repeats develop normally in the absence of signals from either anterior or posterior segments

NASA Technical Reports Server (NTRS)

Seaver, E. C.; Shankland, M.

2000-01-01

We have investigated whether the development of segmental repeats is autonomous in the embryo of the leech Helobdella robusta. The segmental tissues of the germinal band arise from progeny of five stem cells called teloblasts. Asymmetric divisions of the teloblasts form chains of segment founder cells (called primary blast cells) that divide in a stereotypical manner to produce differentiated descendants. Using two distinct techniques, we have looked for potential interactions between neighboring blast cell clones along the anterior-posterior axis. In one technique, we prevented the birth of primary blast cells by injection of DNase I into the teloblast, thereby depriving the last blast cell produced before the ablation of its normal posterior neighbors. We also ablated single blast cells with a laser microbeam, which allowed us to assess potential signals acting on either more anterior or more posterior primary blast cell clones. Our results suggest that interactions along the anterior-posterior axis between neighboring primary blast cell clones are not required for development of normal segmental organization within the blast cell clone. We also examined the possibility that blast cells receive redundant signals from both anterior and posterior neighboring clones and that either is sufficient for normal development. Using double blast cell laser ablations to isolate a primary blast cell clone by removal of both its anterior and its posterior neighbor, we found that the isolated clone still develops normally. These results reveal that the fundamental segmental repeat in the leech embryo, the primary blast cell clone, can develop normally in the apparent absence of signals from adjacent repeats along the anterior-posterior axis.

Stoichiometric differences in food quality: impacts on genetic diversity and the coexistence of aquatic herbivores in a Daphnia hybrid complex.

PubMed

Weider, Lawrence J; Jeyasingh, Punidan D; Looper, Karen G

2008-11-01

The maintenance of genetic and species diversity in an assemblage of genotypes (clones) in the Daphnia pulex species complex (Cladocera: Anomopoda) in response to variation in the carbon:phosphorus ratio (quantity and quality) of the green alga, Scenedesmus acutus, was examined in a 90-day microcosm competition experiment. Results indicated that mixed assemblages of seven distinct genotypes (representing clonal lineages of D. pulex, D. pulicaria and interspecific hybrids) showed rapid loss of genetic diversity in all treatments (2 x 2 factorial design, high vs. low quantity, and high vs. low quality). However, the erosion of diversity (measured as the effective number of clones) was slowest under the poorest food conditions (i.e., low quantity, low quality) and by the conclusion of the experiment (90 days) had resulted in the (low, low) treatment having significantly greater genetic diversity than the other three treatments. In addition, significant genotype (clone) x (food) environment interactions were observed, with a different predominant species/clone found under low food quality versus high food quality (no significant differences were detected for the two food quantities). A clone of D. pulex displaced the other clones under low food quality conditions, while a clone of D. pulicaria displaced the other clones in the high food quality treatments. Subsequent life-history experiments were not sufficient to predict the outcome of competitive interactions among members of this clonal assemblage. Our results suggest that genetic diversity among herbivore species such as Daphnia may be impacted not only by differences in food quantity but also by those in food quality and could be important in the overall maintenance of genetic diversity in natural populations.

Influence of Cytokinins in Combination with GA3 on Shoot Multiplication and Elongation of Tea Clone Iran 100 (Camellia sinensis (L.) O. Kuntze)

PubMed Central

Gonbad, Reza Azadi; Mohamad, Rosfarizan

2014-01-01

The use of in vitro culture has been accepted as an efficient technique for clonal propagation of many woody plants. In the present research, we report the results of a number of experiments aimed at optimizing micropropagation protocol for tea (Camellia sinensis (L.) O. Kuntze) (clone Iran 100) using nodal segments as the explant. The effect of different combinations and concentrations of plant growth regulators (PGR) (BAP, TDZ, GA3) on shoot multiplication and elongation was assessed. The influence of exposure to IBA in liquid form prior to transfer to solid media on rooting of tea microshoots was investigated. The results of this study showed that the best treatment for nodal segment multiplication in terms of the number of shoot per explant and shoot elongation was obtained using 3 mg/L BAP in combination with 0.5 mg/L GA3. TDZ was found to be inappropriate for multiplication of tea clone Iran 100 as it resulted in hyperhydricity especially at concentrations higher than 0.05 mg/L. Healthy shoots treated with 300 mg/L IBA for 30 min followed by transfer to 1/2 strength MS medium devoid of PGR resulted in 72.3% of shoots producing roots and upon transferring them to acclimatization chamber 65% survival was obtained prior to field transfer. PMID:24605069

Construction and biological activities of the first infectious cDNA clones of the genus Foveavirus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meng, Baozhong, E-mail: bmeng@uoguelph.ca; Venkataraman, Srividhya; Li, Caihong

Grapevine rupestris stem pitting-associated virus (GRSPaV, genus Foveavirus, family Betaflexiviridae) is one of the most prevalent viruses in grapevines and is associated with three distinct diseases: rupestris stem pitting, vein necrosis and Syrah decline. Little is known about the biology and pathological properties of GRSPaV. In this work, we engineered a full-length infectious cDNA clone for GRSPaV and a GFP-tagged variant, both under the transcriptional control of Cauliflower mosaic virus 35 S promoter. We demonstrated that these cDNA clones were infectious in grapevines and Nicotiana benthamiana through fluorescence microscopy, RT-PCR, Western blotting and immuno electron microscopy. Interestingly, GRSPaV does notmore » cause systemic infection in four of the most commonly used herbaceous plants, even in the presence of the movement proteins of two other viruses which are known to complement numerous movement-defective viruses. These infectious clones are the first of members of Foveavirus which would allow further investigations into mechanisms governing different aspects of replication for GRSPaV and perhaps related viruses.« less

The maize stripe virus major noncapsid protein messenger RNA transcripts contain heterogeneous leader sequences at their 5' termini.

PubMed

Huiet, L; Feldstein, P A; Tsai, J H; Falk, B W

1993-12-01

Primer extension analyses and a PCR-based cloning strategy were used to identify and characterize 5' nucleotide sequences on the maize stripe virus (MStV) RNA4 mRNA transcripts encoding the major noncapsid protein (NCP). Direct RNA sequence analysis by primer extension showed that the NCP mRNA transcripts had 10-15 nucleotides beyond the 5' terminus of the MStV RNA4 nucleotide sequence. MStV genomic RNAs isolated from ribonucleoprotein particles (RNPs) lacked the additional 5' nucleotides. cDNA clones representing the 5' region of the mRNA transcripts were constructed, and the nucleotide sequences of the 5' regions were determined for 16 clones. Each was found to have a distinct 10-15 nucleotide sequence immediately 5' of the MStV RNA4 sequence. Eleven of 16 clones had the correct MStV RNA4 5' nucleotide sequence, while five showed minor variations at or near the 5' most MStV RNA4 nucleotide. These characteristics show strong similarities to other viral mRNA transcripts which are synthesized by cap snatching.

An updated phylogenetic analysis of vertebrate melatonin receptor sequences: reflection on the melatonin receptor nomenclature by the Nomenclature Subcommittee of the International Union of Pharmacology.

PubMed

Shiu, S Y; Pang, S F

1998-01-01

In the past few years, significant progress on melatonin receptor research has led to the discovery of a family of genetically related but pharmacologically distinctive G-protein-coupled receptors in the vertebrates. With increasing number of receptor clones being identified, there is a need for a system of classification and nomenclature for these receptor subtypes. Recently, an updated nomenclature system, which has renamed the existing mammalian melatonin receptor clones, has been proposed by the relevant subcommittee of the International Union of Pharmacology (NC-IUPHAR). However, the majority of receptor clones which have been identified in non-mammalian vertebrates are not clearly defined by this system. By performing phylogenetic analysis of both mammalian and non-mammalian melatonin receptor clones, we would like to propose a classification-nomenclature system for vertebrate melatonin receptors. Hopefully, our system, which incorporates genetic data as well as the pharmacological criteria that have been adopted by the NC-IUPHAR nomenclature system, will provide the framework for future development of a unified scheme of classification and nomenclature for melatonin receptors.

Loss of Asparagine-Linked Glycosylation Sites in Variable Region 5 of Human Immunodeficiency Virus Type 1 Envelope Is Associated with Resistance to CD4 Antibody Ibalizumab ▿

PubMed Central

Toma, Jonathan; Weinheimer, Steven P.; Stawiski, Eric; Whitcomb, Jeannette M.; Lewis, Stanley T.; Petropoulos, Christos J.; Huang, Wei

2011-01-01

Ibalizumab (formerly TNX-355) is a first-in-class, monoclonal antibody inhibitor of CD4-mediated human immunodeficiency type 1 (HIV-1) entry. Multiple clinical trials with HIV-infected patients have demonstrated the antiviral activity, safety, and tolerability of ibalizumab treatment. A 9-week phase Ib study adding ibalizumab monotherapy to failing drug regimens led to transient reductions in HIV viral loads and the evolution of HIV-1 variants with reduced susceptibility to ibalizumab. This report characterizes these variants by comparing the phenotypic susceptibilities and envelope (env) sequences of (i) paired baseline and on-treatment virus populations, (ii) individual env clones from selected paired samples, and (iii) env clones containing site-directed mutations. Viruses with reduced susceptibility to ibalizumab were found to exhibit reduced susceptibility to the anti-CD4 antibody RPA-T4. Conversely, susceptibility to soluble CD4, which targets the HIV-1 gp120 envelope protein, was enhanced. No changes in susceptibility to the fusion inhibitor enfuvirtide or the CCR5 antagonist maraviroc were observed. Functionally, viruses with reduced ibalizumab susceptibility also displayed high levels of infectivity relative to those of paired baseline viruses. Individual env clones exhibiting reduced ibalizumab susceptibility contained multiple amino acid changes in different regions relative to the paired baseline clones. In particular, clones with reduced susceptibility to ibalizumab contained fewer potential asparagine-linked glycosylation sites (PNGSs) in variable region 5 (V5) than did paired ibalizumab-susceptible clones. The reduction in ibalizumab susceptibility due to the loss of V5 PNGSs was confirmed by site-directed mutagenesis. Taken together, these findings provide important insights into resistance to this new class of antiretroviral drug. PMID:21289125

Linkage of mating-type loci distinguishes bipolar from tetrapolar mating in basidiomycetous smut fungi.

PubMed Central

Bakkeren, G; Kronstad, J W

1994-01-01

Sexual compatibility requires self vs. non-self recognition. Genetically, two compatibility or mating-type systems govern recognition in heterothallic basidiomycete fungi such as the edible and woodrotting mushrooms and the economically important rust and smut phytopathogens. A bipolar system is defined by a single genetic locus (MAT) that can have two or multiple alleles. A tetrapolar system has two loci, each with two or more specificities. We have employed two species from the genus Ustilago (smut fungi) to discover a molecular explanation for the genetic difference in mating systems. Ustilago maydis, a tetrapolar species, has two genetically unlinked loci that encode the distinct mating functions of cell fusion (a locus) and subsequent sexual development and pathogenicity (b locus). We have recently described a b locus in a bipolar species, Ustilago hordei, wherein the existence of an a locus has been suspected, but not demonstrated. We report here the cloning of an allele of the a locus (a1) from U. hordei and the discovery that physical linkage of the a and b loci in this bipolar fungus accounts for the distinct mating system. Linkage establishes a large complex MAT locus in U. hordei; this locus appears to be in a region suppressed for recombination. Images PMID:7913746

Identification of a Polymorphic Gene, BCL2A1, Encoding Two Novel Hematopoietic Lineage-specific Minor Histocompatibility Antigens

PubMed Central

Akatsuka, Yoshiki; Nishida, Tetsuya; Kondo, Eisei; Miyazaki, Mikinori; Taji, Hirohumi; Iida, Hiroatsu; Tsujimura, Kunio; Yazaki, Makoto; Naoe, Tomoki; Morishima, Yasuo; Kodera, Yoshihisa; Kuzushima, Kiyotaka; Takahashi, Toshitada

2003-01-01

We report the identification of two novel minor histocompatibility antigens (mHAgs), encoded by two separate single nucleotide polymorphisms on a single gene, BCL2A1, and restricted by human histocompatibility leukocyte antigen (HLA)-A*2402 (the most common HLA-A allele in Japanese) and B*4403, respectively. Two cytotoxic T lymphocyte (CTL) clones specific for these mHAgs were first isolated from two distinct recipients after hematopoietic cell transplantation. Both clones lyse only normal and malignant cells within the hematopoietic lineage. To localize the gene encoding the mHAgs, two-point linkage analysis was performed on the CTL lytic patterns of restricting HLA-transfected B lymphoblastoid cell lines obtained from Centre d'Etude du Polymorphisme Humain. Both CTL clones showed a completely identical lytic pattern for 4 pedigrees and the gene was localized within a 3.6-cM interval of 15q24.3–25.1 region that encodes at least 46 genes. Of those, only BCL2A1 has been reported to be expressed in hematopoietic cells and possess three nonsynonymous nucleotide changes. Minigene transfection and epitope reconstitution assays with synthetic peptides identified both HLA-A*2402– and B*4403-restricted mHAg epitopes to be encoded by distinct polymorphisms within BCL2A1. PMID:12771180

Microbial community composition during anaerobic mineralization of tert-butyl alcohol (TBA) in fuel-contaminated aquifer material.

PubMed

Wei, Na; Finneran, Kevin T

2011-04-01

Anaerobic mineralization of tert-butyl alcohol (TBA) and methyl tert-butyl ether (MTBE) were studied in sediment incubations prepared with fuel-contaminated aquifer material. Microbial community compositions in all incubations were characterized by amplified ribosomal DNA restriction analysis (ARDRA). The aquifer material mineralized 42.3±9.9% of [U-(14)C]-TBA to 14CO2 without electron acceptor amendment. Fe(III), sulfate, and Fe(III) plus anthraquinone-2,6-disulfonate addition also promoted U-[14C]-TBA mineralization at levels similar to those of the unamended controls. Nitrate actually inhibited TBA mineralization relative to unamended controls. In contrast to TBA, [U-(14)C]-MTBE was not significantly mineralized in 400 days regardless of electron acceptor amendment. Microbial community analysis indicated that the abundance of one dominant clone group correlated closely with anaerobic TBA mineralization. The clone was phylogenetically distinct from known aerobic TBA-degrading microorganisms, Fe(III)- or sulfate-reducing bacteria. It was most closely associated with organisms belonging to the alphaproteobacteria. Microbial communities were different in MTBE and TBA amended incubations. Shannon indices and Simpson indices (statistical community comparison tools) both demonstrated that microbial community diversity decreased in incubations actively mineralizing TBA, with distinct "dominant" clones developing. These data contribute to our understanding of anaerobic microbial transformation of fuel oxygenates in contaminated aquifer material and the organisms that may catalyze the reactions.

Molecular Cloning Designer Simulator (MCDS): All-in-one molecular cloning and genetic engineering design, simulation and management software for complex synthetic biology and metabolic engineering projects.

PubMed

Shi, Zhenyu; Vickers, Claudia E

2016-12-01

Molecular Cloning Designer Simulator (MCDS) is a powerful new all-in-one cloning and genetic engineering design, simulation and management software platform developed for complex synthetic biology and metabolic engineering projects. In addition to standard functions, it has a number of features that are either unique, or are not found in combination in any one software package: (1) it has a novel interactive flow-chart user interface for complex multi-step processes, allowing an integrated overview of the whole project; (2) it can perform a user-defined workflow of cloning steps in a single execution of the software; (3) it can handle multiple types of genetic recombineering, a technique that is rapidly replacing classical cloning for many applications; (4) it includes experimental information to conveniently guide wet lab work; and (5) it can store results and comments to allow the tracking and management of the whole project in one platform. MCDS is freely available from https://mcds.codeplex.com.

Somatic hypermutation of the new antigen receptor gene (NAR) in the nurse shark does not generate the repertoire: possible role in antigen-driven reactions in the absence of germinal centers.

PubMed

Diaz, M; Greenberg, A S; Flajnik, M F

1998-11-24

The new antigen receptor (NAR) gene in the nurse shark diversifies extensively by somatic hypermutation. It is not known, however, whether NAR somatic hypermutation generates the primary repertoire (like in the sheep) or rather is used in antigen-driven immune responses. To address this issue, the sequences of NAR transmembrane (Tm) and secretory (Sec) forms, presumed to represent the primary and secondary repertoires, respectively, were examined from the peripheral blood lymphocytes of three adult nurse sharks. More than 40% of the Sec clones but fewer than 11% of Tm clones contained five mutations or more. Furthermore, more than 75% of the Tm clones had few or no mutations. Mutations in the Sec clones occurred mostly in the complementarity-determining regions (CDR) with a significant bias toward replacement substitutions in CDR1; in Tm clones there was no significant bias toward replacements and only a low level of targeting to the CDRs. Unlike the Tm clones where the replacement mutational pattern was similar to that seen for synonymous changes, Sec replacements displayed a distinct pattern of mutations. The types of mutations in NAR were similar to those found in mouse Ig genes rather than to the unusual pattern reported for shark and Xenopus Ig. Finally, an oligoclonal family of Sec clones revealed a striking trend toward acquisition of glutamic/aspartic acid, suggesting some degree of selection. These data strongly suggest that hypermutation of NAR does not generate the repertoire, but instead is involved in antigen-driven immune responses.

The molecular epidemiology of cholera in Latin America.

PubMed

Wachsmuth, I K; Evins, G M; Fields, P I; Olsvik, O; Popovic, T; Bopp, C A; Wells, J G; Carrillo, C; Blake, P A

1993-03-01

To explain the sudden appearance and rapid spread of cholera in Latin America in January 1991, molecular techniques were used to define Vibrio cholerae O1 isolates from around the world. Restriction fragment length polymorphisms of rRNA and ctxA genes, DNA sequence of cholera toxin B subunit gene ctxB, and multilocus enzyme electrophoresis data were used to characterize 197 isolates. Worldwide, there are at least four distinct toxigenic El Tor V. cholerae O1 clones: the seventh pandemic (Eastern Hemisphere), US Gulf Coast, Australian, and Latin American. Nontoxigenic V. cholerae O1 previously isolated in Brazil, Mexico, and Peru are unlike current toxigenic isolates. The Latin American clone probably represents an extension of the seventh pandemic into the Western Hemisphere, while the US Gulf Coast clone most likely evolved separately. These data will be useful in monitoring the spread of cholera, determining the origin of outbreaks in both hemispheres, and implicating specific vehicles of transmission.

Self-preservation: an argument for therapeutic cloning, and a strategy for fostering respect for moral integrity.

PubMed

Mahowald, Mary B

2004-01-01

The issues of human cloning and stem cell retrieval are inseparable in circumstances in which the rationale of self-preservation may be invoked as a negative right. I apply this rationale to a hypothetical case in which cloning is necessary to preserve the bodily integrity or life of an individual. Self-preservation as moral integrity is examined in a narrower context, i.e., as applicable to those for whom deliberate termination of embryonic life is morally-problematic. This issue is addressed through comparison with two paradigms commonly used in support of clinical practice: the distinction between letting die and killing, and the permissibility of vital organ retrieval after death. Although these paradigms are questionable in their own right, they offer a rationale by which scientists and clinicians may respect the negative right to moral integrity of those with whom they disagree.

Multiple opiate receptors: déjà vu all over again.

PubMed

Pasternak, Gavril W

2004-01-01

The concept of multiple opioid receptors has changed dramatically since their initial proposal by Martin nearly 40 years ago. Three major opioid receptor families have now been proposed: mu, kappa and delta. Most of the opioid analgesics used clinically selectively bind to mu opioid receptors. Yet, clinicians have long appreciated subtle, but significant, differences in their pharmacology. These observations suggested more than one mu opioid receptor mechanism of action and led us to propose multiple mu opioid receptors over 20 years ago based upon a range of pharmacological and receptor binding approaches. A mu opioid receptor, MOR-1, was cloned about a decade ago. More recent studies have now identified a number of splice variants of this clone. These splice variants may help explain the pharmacology of the mu opioids and open interesting directions for future opioid research.

Highly osteogenic PDL stem cell clones specifically express elevated levels of ICAM1, ITGB1 and TERT.

PubMed

Sununliganon, Laddawun; Singhatanadgit, Weerachai

2012-01-01

Cells derived from the periodontal ligament (PDL) have previously been reported to have stem cell-like characteristics (PDL stem cells; PDLSCs) and play an important part in bone engineering, including that of alveolar bone. However, these populations have been heterogeneous, and thus far no specific marker has yet been established from adult human stem cells derived from PDL tissue. We have previously isolated highly purified single cell-derived PDLSC clones and delineated their phenotypic and functional characteristics. In this report, we further obtained three homogeneous and distinct PDLSC clones demonstrating low, moderate and high mineralized matrix forming ability-namely PC12, PC4 and PC3, respectively, and the expression of mesenchymal stem cell pathway-specific genes in these clones was investigated. PCR array revealed that the expression of intercellular adhesion molecule 1 (ICAM1), integrin beta 1 (ITGB1) and telomerase reverse transcriptase (TERT) was associated with highly osteogenic PDLSC clones, as determined by the expression of key osteoblastic markers and their ability to form alizarin red S positive mineralized matrix in vitro. The present results suggest that these three mesenchymal stem cell-associated markers could potentially be used to isolate PDLSCs with high osteogenic capability for engineering new bone.

Persistence and evolution of allergen-specific IgE repertoires during subcutaneous specific immunotherapy

PubMed Central

Levin, Mattias; King, Jasmine J.; Glanville, Jacob; Jackson, Katherine J. L.; Looney, Timothy J.; Hoh, Ramona A.; Mari, Adriano; Andersson, Morgan; Greiff, Lennart; Fire, Andrew Z.; Boyd, Scott D.; Ohlin, Mats

2016-01-01

Background Specific immunotherapy (SIT) is the only treatment with proven long-term curative potential in allergic disease. Allergen-specific IgE is the causative agent of allergic disease, and antibodies contribute to SIT, but the effects of SIT on aeroallergen-specific B cell repertoires are not well understood. Objective To characterize the IgE sequences expressed by allergen-specific B cells, and track the fate of these B cell clones during SIT. Methods We have used high-throughput antibody gene sequencing and identification of allergen-specific IgE using combinatorial antibody fragment library technology to analyze immunoglobulin repertoires of blood and nasal mucosa of aeroallergen-sensitized individuals before and during the first year of subcutaneous SIT. Results Of 52 distinct allergen-specific IgE heavy chains from eight allergic donors, 37 were also detected by high-throughput antibody gene sequencing of blood, nasal mucosa, or both sample types. The allergen-specific clones had increased persistence, higher likelihood of belonging to clones expressing other switched isotypes, and possibly larger clone size than the rest of the IgE repertoire. Clone members in nasal tissue showed close mutational relationships. Conclusion Combining functional binding studies, deep antibody repertoire sequencing, and information on clinical outcomes in larger studies may in the future aid assessment of SIT mechanisms and efficacy. PMID:26559321

Cloning: plants – micropropagation/tissue culture

USDA-ARS?s Scientific Manuscript database

Clonal micropropagation is the multiplication of the buds and shoots that occur in leaf axils on a defined nutrient medium in an aseptic in vitro environment. The resulting shoots are either subdivided for continued multiplication or rooted and acclimatized to the greenhouse or field. Micropropagati...

Genetic polymorphism of merozoite surface protein-1 and merozoite surface protein-2 in Plasmodium falciparum isolates from Brazzaville, Republic of Congo

PubMed Central

2011-01-01

Background The characterization of malaria parasite populations circulating in an area is part of site characterization, as a basis for evaluating the impact of malaria interventions on genetic diversity, parasite species, and multiplicity of infection. The present study was aimed at analysing genetic diversity of Plasmodium falciparum merozoite surface proteins 1 and 2 (MSP-1 and MSP-2) and to determine the multiplicity of infection in clinical isolates collected from children living in the Southern district of Brazzaville in the Republic of Congo. Methods A total of 125 isolates from patients with uncomplicated malaria attending Terinkyo and Madibou health centres were collected between January and June 2005 while evaluating the therapeutic efficacy of amodiaquine-artesunate combination. DNA was extracted and msp-1 and msp-2 genes were genotyped using allele-specific nested-PCR. Results Out of 468 distinct fragments detected, 15 msp-1 and 20 msp-2 genotypes were identified. For the msp-1 gene, K1 family was the predominant allelic type carried alone or in association with RO33 and Mad20 types, whereas the 3D7 family was the most prevalent in the msp-2 gene. Overall, the mean multiplicity of infection was 2.2. Out of 125 samples, 104 (83%) harboured more than one parasite genotype. There was no statistical significant difference in the multiplicity of infection by either sex or age of patients. However, a statistically significant correlation was found between parasite densities and the number of genotypes. Conclusion Polymorphism in P. falciparum clinical isolates from Brazzaville was high and mainly of multiple clones. The basis for the positive association between parasite densities and multiplicity of infection is discussed. PMID:21936949

cFinder: definition and quantification of multiple haplotypes in a mixed sample.

PubMed

Niklas, Norbert; Hafenscher, Julia; Barna, Agnes; Wiesinger, Karin; Pröll, Johannes; Dreiseitl, Stephan; Preuner-Stix, Sandra; Valent, Peter; Lion, Thomas; Gabriel, Christian

2015-09-07

Next-generation sequencing allows for determining the genetic composition of a mixed sample. For instance, when performing resistance testing for BCR-ABL1 it is necessary to identify clones and define compound mutations; together with an exact quantification this may complement diagnosis and therapy decisions with additional information. Moreover, that applies not only to oncological issues but also determination of viral, bacterial or fungal infection. The efforts to retrieve multiple haplotypes (more than two) and proportion information from data with conventional software are difficult, cumbersome and demand multiple manual steps. Therefore, we developed a tool called cFinder that is capable of automatic detection of haplotypes and their accurate quantification within one sample. BCR-ABL1 samples containing multiple clones were used for testing and our cFinder could identify all previously found clones together with their abundance and even refine some results. Additionally, reads were simulated using GemSIM with multiple haplotypes, the detection was very close to linear (R(2) = 0.96). Our aim is not to deduce haploblocks over statistics, but to characterize one sample's composition precisely. As a result the cFinder reports the connections of variants (haplotypes) with their readcount and relative occurrence (percentage). Download is available at http://sourceforge.net/projects/cfinder/. Our cFinder is implemented in an efficient algorithm that can be run on a low-performance desktop computer. Furthermore, it considers paired-end information (if available) and is generally open for any current next-generation sequencing technology and alignment strategy. To our knowledge, this is the first software that enables researchers without extensive bioinformatic support to designate multiple haplotypes and how they constitute to a sample.

Biochemical markers assisted screening of Fusarium wilt resistant Musa paradisiaca (L.) cv. puttabale micropropagated clones.

PubMed

Venkatesh; Krishna, V; Kumar, K Girish; Pradeepa, K; Kumar, S R Santosh; Kumar, R Shashi

2013-07-01

An efficient protocol was standardized for screening of panama wilt resistant Musa paradisiaca cv. Puttabale clones, an endemic cultivar of Karnataka, India. The synergistic effect of 6-benzyleaminopurine (2 to 6 mg/L) and thidiazuron (0.1 to 0.5 mg/L) on MS medium provoked multiple shoot induction from the excised meristem. An average of 30.10 +/- 5.95 shoots was produced per propagule at 4 mg/L 6-benzyleaminopurine and 0.3 mg/L thidiazuron concentrations. Elongation of shoots observed on 5 mg/L BAP augmented medium with a mean length of 8.38 +/- 0.30 shoots per propagule. For screening of disease resistant clones, multiple shoot buds were mutated with 0.4% ethyl-methane-sulfonate and cultured on MS medium supplemented with Fusarium oxysporum f. sp. cubense (FOC) culture filtrate (5-15%). Two month old co-cultivated secondary hardened plants were used for screening of disease resistance against FOC by the determination of biochemical markers such as total phenol, phenylalanine ammonia lyase, oxidative enzymes like peroxidase, polyphenol oxidase, catalase and PR-proteins like chitinase, beta-1-3 glucanase activities. The mutated clones of M. paradisiaca cv. Puttabale cultured on FOC culture filtrate showed significant increase in the levels of biochemical markers as an indicative of acquiring disease resistant characteristics to FOC wilt.

Recent independent emergence of multiple multidrug-resistant Serratia marcescens clones within the United Kingdom and Ireland.

PubMed

Moradigaravand, Danesh; Boinett, Christine J; Martin, Veronique; Peacock, Sharon J; Parkhill, Julian

2016-08-01

Serratia marcescens, a member of the Enterobacteriaceae family, is a Gram-negative bacterium responsible for a wide range of nosocomial infections. The emergence of multidrug-resistant strains is an increasing danger to public health. To design effective means to control the dissemination of S. marcescens, an in-depth analysis of the population structure and variation is required. Utilizing whole-genome sequencing, we characterized the population structure and variation, as well as the antimicrobial resistance determinants, of a systematic collection of antimicrobial-resistant S. marcescens associated with bloodstream infections in hospitals across the United Kingdom and Ireland between 2001 and 2011. Our results show that S. marcescens is a diverse species with a high level of genomic variation. However, the collection was largely composed of a limited number of clones that emerged from this diverse background within the past few decades. We identified potential recent transmissions of these clones, within and between hospitals, and showed that they have acquired antimicrobial resistance determinants for different beta-lactams, ciprofloxacin, and tetracyclines on multiple occasions. The expansion of these multidrug-resistant clones suggests that the treatment of S. marcescens infections will become increasingly difficult in the future. © 2016 Moradigaravand et al.; Published by Cold Spring Harbor Laboratory Press.

The high diversity of MRSA clones detected in a university hospital in istanbul.

PubMed

Oksuz, Lutfiye; Dupieux, Celine; Tristan, Anne; Bes, Michele; Etienne, Jerome; Gurler, Nezahat

2013-01-01

To characterize the methicillin-resistant Staphylococcus aureus (MRSA) clones present in Istanbul, 102 MRSA isolates collected during a 5-year period at the Istanbul Medical Faculty Hospital were characterized using microarray analysis and phenotypic resistance profiles. Resistance to methicillin was detected with a cefoxitin disk diffusion assay and confirmed with a MRSA-agar and MRSA detection kit. Antimicrobial susceptibility testing was performed by a disk diffusion assay and interpreted according to the 2012 guidelines of the Antibiogram Committee of the French Society for Microbiology. Decreased susceptibility to glycopeptides was confirmed using the population analysis profile-area under the curve (PAP-AUC) method. The presence of the mecA gene was detected by polymerase chain reaction. Bacterial DNA was extracted according to the manufacturer's recommended protocol using commercial extraction kits. Strains were extensively characterized using the DNA microarray. Isolates were grouped into six clonal complexes. The most frequently detected clone was the Vienna/Hungarian/Brazilian clone (ST239-MRSA-III), which accounted for 53.9% of the isolates. These isolates were resistant to multiple antibiotics, particularly penicillin, tetracycline, rifampicin, kanamycin, tobramycin, gentamicin, levofloxacin, erythromycin, lincomycin and fosfomycin. Furthermore, three isolates were detected by population analysis profile as heterogeneous vancomycin-intermediate S. aureus (hVISA). The UK-EMRSA-15 clone (ST22-MRSA-IV PVL negative) was detected in 9.8% of the isolates and was mainly susceptible to all anti-staphylococcal antibiotics. Seven isolates (6.9%) were positive for PVL genes and were assigned to the CC80-MRSA-IV clone (European CA-MRSA clone, three isolates), ST8-MRSA-IV clone (USA300 clone, two isolates, one ACME-positive) or ST22-MRSA-IV clone ("Regensburg EMRSA" clone, two isolates). All other clones were detected in one to six isolates and corresponded to well-known clones (e.g., Pediatric clone, Dublin EMRSA clone, WA MRSA-54/63, WA MRSA-1/57). This work highlighted both the high prevalence of ST239-MRSA-III clone and the large diversity of the other MRSA clones detected in a university hospital in Istanbul.

The High Diversity of MRSA Clones Detected in a University Hospital in Istanbul

PubMed Central

Oksuz, Lutfiye; Dupieux, Celine; Tristan, Anne; Bes, Michele; Etienne, Jerome; Gurler, Nezahat

2013-01-01

Background: To characterize the methicillin-resistant Staphylococcus aureus (MRSA) clones present in Istanbul, 102 MRSA isolates collected during a 5-year period at the Istanbul Medical Faculty Hospital were characterized using microarray analysis and phenotypic resistance profiles. Methods: Resistance to methicillin was detected with a cefoxitin disk diffusion assay and confirmed with a MRSA-agar and MRSA detection kit. Antimicrobial susceptibility testing was performed by a disk diffusion assay and interpreted according to the 2012 guidelines of the Antibiogram Committee of the French Society for Microbiology. Decreased susceptibility to glycopeptides was confirmed using the population analysis profile-area under the curve (PAP-AUC) method. The presence of the mecA gene was detected by polymerase chain reaction. Bacterial DNA was extracted according to the manufacturer's recommended protocol using commercial extraction kits. Strains were extensively characterized using the DNA microarray. Results: Isolates were grouped into six clonal complexes. The most frequently detected clone was the Vienna/Hungarian/Brazilian clone (ST239-MRSA-III), which accounted for 53.9% of the isolates. These isolates were resistant to multiple antibiotics, particularly penicillin, tetracycline, rifampicin, kanamycin, tobramycin, gentamicin, levofloxacin, erythromycin, lincomycin and fosfomycin. Furthermore, three isolates were detected by population analysis profile as heterogeneous vancomycin-intermediate S. aureus (hVISA). The UK-EMRSA-15 clone (ST22-MRSA-IV PVL negative) was detected in 9.8% of the isolates and was mainly susceptible to all anti-staphylococcal antibiotics. Seven isolates (6.9%) were positive for PVL genes and were assigned to the CC80-MRSA-IV clone (European CA-MRSA clone, three isolates), ST8-MRSA-IV clone (USA300 clone, two isolates, one ACME-positive) or ST22-MRSA-IV clone (“Regensburg EMRSA” clone, two isolates). All other clones were detected in one to six isolates and corresponded to well-known clones (e.g., Pediatric clone, Dublin EMRSA clone, WA MRSA-54/63, WA MRSA-1/57). Conclusions: This work highlighted both the high prevalence of ST239-MRSA-III clone and the large diversity of the other MRSA clones detected in a university hospital in Istanbul. PMID:24151444

Usefulness of Housekeeping Genes for the Diagnosis of Helicobacter pylori Infection, Strain Discrimination and Detection of Multiple Infection.

PubMed

Palau, Montserrat; Kulmann, Marcos; Ramírez-Lázaro, María José; Lario, Sergio; Quilez, María Elisa; Campo, Rafael; Piqué, Núria; Calvet, Xavier; Miñana-Galbis, David

2016-12-01

Helicobacter pylori infects human stomachs of over half the world's population, evades the immune response and establishes a chronic infection. Although most people remains asymptomatic, duodenal and gastric ulcers, MALT lymphoma and progression to gastric cancer could be developed. Several virulence factors such as flagella, lipopolysaccharide, adhesins and especially the vacuolating cytotoxin VacA and the oncoprotein CagA have been described for H. pylori. Despite the extensive published data on H. pylori, more research is needed to determine new virulence markers, the exact mode of transmission or the role of multiple infection. Amplification and sequencing of six housekeeping genes (amiA, cgt, cpn60, cpn70, dnaJ, and luxS) related to H. pylori pathogenesis have been performed in order to evaluate their usefulness for the specific detection of H. pylori, the genetic discrimination at strain level and the detection of multiple infection. A total of 52 H. pylori clones, isolated from 14 gastric biopsies from 11 patients, were analyzed for this purpose. All genes were specifically amplified for H. pylori and all clones isolated from different patients were discriminated, with gene distances ranged from 0.9 to 7.8%. Although most clones isolated from the same patient showed identical gene sequences, an event of multiple infection was detected in all the genes and microevolution events were showed for amiA and cpn60 genes. These results suggested that housekeeping genes could be useful for H. pylori detection and to elucidate the mode of transmission and the relevance of the multiple infection. © 2016 John Wiley & Sons Ltd.

Temporal and intraclonal variation of flowering and pseudovivipary in Poa bulbosa

PubMed Central

Ofir, Micha; Kigel, Jaime

2014-01-01

Background and Aims Versatility in the reproductive development of pseudoviviparous grasses in response to growth conditions is an intriguing reproduction strategy. To better understand this strategy, this study examined variation in flowering and pseudovivipary among populations, co-occurring clones within populations, and among tillers in individual clones of Poa bulbosa, a summer-dormant geophytic grass that reproduces sexually by seed, and asexually by basal tiller bulbs and bulbils formed in proliferated panicles. Methods Clones were collected from 17 populations across a rainfall gradient. Patterns of reproduction were monitored for 11 years in a common garden experiment and related to interannual differences in climatic conditions. Intraclonal variation in flowering and pseudovivipary was studied in a phytotron, under daylengths marginal for flowering induction. Key Results Clones showed large temporal variability in their reproductive behaviour. They flowered in some years but not in others, produced normal or proliferated panicles in different years, or became dormant without flowering. Proliferating clones did not show a distinct time sequence of flowering and proliferation across years. Populations differed in incidence of flowering and proliferation. The proportion of flowering clones increased with decreasing rainfall at the site of population origin, but no consistent relationship was found between flowering and precipitation in the common garden experiment across years. In contrast, flowering decreased at higher temperatures during early growth stages after bulb sprouting. Pulses of soil fertilization greatly increased the proportion of flowering clones and panicle production. High intraclonal tiller heterogeneity was observed, as shown by the divergent developmental fates of daughter plants arising from bulbs from the same parent clone and grown under similar conditions. Panicle proliferation was enhanced by non-inductive 8 h short days, while marginally inductive 12 h days promoted normal panicles. Conclusions Interannual variation in flowering and proliferation in P. bulbosa clones was attributed to differences in the onset of the rainy season, resulting in different daylength and temperature conditions during the early stages of growth, during which induction of flowering and dormancy occurs. PMID:24685715

TA-GC cloning: A new simple and versatile technique for the directional cloning of PCR products for recombinant protein expression.

PubMed

Niarchos, Athanasios; Siora, Anastasia; Konstantinou, Evangelia; Kalampoki, Vasiliki; Lagoumintzis, George; Poulas, Konstantinos

2017-01-01

During the last few decades, the recombinant protein expression finds more and more applications. The cloning of protein-coding genes into expression vectors is required to be directional for proper expression, and versatile in order to facilitate gene insertion in multiple different vectors for expression tests. In this study, the TA-GC cloning method is proposed, as a new, simple and efficient method for the directional cloning of protein-coding genes in expression vectors. The presented method features several advantages over existing methods, which tend to be relatively more labour intensive, inflexible or expensive. The proposed method relies on the complementarity between single A- and G-overhangs of the protein-coding gene, obtained after a short incubation with T4 DNA polymerase, and T and C overhangs of the novel vector pET-BccI, created after digestion with the restriction endonuclease BccI. The novel protein-expression vector pET-BccI also facilitates the screening of transformed colonies for recombinant transformants. Evaluation experiments of the proposed TA-GC cloning method showed that 81% of the transformed colonies contained recombinant pET-BccI plasmids, and 98% of the recombinant colonies expressed the desired protein. This demonstrates that TA-GC cloning could be a valuable method for cloning protein-coding genes in expression vectors.

TA-GC cloning: A new simple and versatile technique for the directional cloning of PCR products for recombinant protein expression

PubMed Central

Niarchos, Athanasios; Siora, Anastasia; Konstantinou, Evangelia; Kalampoki, Vasiliki; Poulas, Konstantinos

2017-01-01

During the last few decades, the recombinant protein expression finds more and more applications. The cloning of protein-coding genes into expression vectors is required to be directional for proper expression, and versatile in order to facilitate gene insertion in multiple different vectors for expression tests. In this study, the TA-GC cloning method is proposed, as a new, simple and efficient method for the directional cloning of protein-coding genes in expression vectors. The presented method features several advantages over existing methods, which tend to be relatively more labour intensive, inflexible or expensive. The proposed method relies on the complementarity between single A- and G-overhangs of the protein-coding gene, obtained after a short incubation with T4 DNA polymerase, and T and C overhangs of the novel vector pET-BccI, created after digestion with the restriction endonuclease BccI. The novel protein-expression vector pET-BccI also facilitates the screening of transformed colonies for recombinant transformants. Evaluation experiments of the proposed TA-GC cloning method showed that 81% of the transformed colonies contained recombinant pET-BccI plasmids, and 98% of the recombinant colonies expressed the desired protein. This demonstrates that TA-GC cloning could be a valuable method for cloning protein-coding genes in expression vectors. PMID:29091919

Molecular evidence for zoonotic transmission of an emergent, highly pathogenic Campylobacter jejuni clone in the United States.

PubMed

Sahin, Orhan; Fitzgerald, Collette; Stroika, Steven; Zhao, Shaohua; Sippy, Rachel J; Kwan, Patrick; Plummer, Paul J; Han, Jing; Yaeger, Michael J; Zhang, Qijing

2012-03-01

Campylobacter jejuni is a major zoonotic pathogen. A highly virulent, tetracycline-resistant C. jejuni clone (clone SA) has recently emerged in ruminant reservoirs and has become the predominant cause of sheep abortion in the United States. To determine whether clone SA is associated with human disease, we compared the clinical isolates of clone SA from sheep abortions with the human isolates of the PulseNet National Campylobacter databases at the CDC and the FDA using pulsed-field gel electrophoresis (PFGE), multilocus sequence typing (MLST), and serotyping. The combined SmaI and KpnI PFGE pattern designations of clone SA from sheep were indistinguishable from those of 123 (9.03%) human C. jejuni isolates (total, 1,361) in the CDC database, among which 56 were associated with sporadic infections and 67 were associated with outbreaks that occurred in multiple states from 2003 to 2010. Most of the outbreaks were attributed to raw milk, while the sources for most of the sporadic cases were unknown. All clone SA isolates examined, including PFGE-matched human isolates, belong to sequence type 8 (ST-8) by MLST and serotype HS:1,8, further indicating the clonality of the related isolates from different host species. Additionally, C. jejuni clone SA was identified in raw milk, cattle feces, the feces and bile of healthy sheep, and abortion cases of cattle and goats, indicating the broad distribution of this pathogenic clone in ruminants. These results provide strong molecular and epidemiological evidence for zoonotic transmission of this emergent clone from ruminants to humans and indicate that C. jejuni clone SA is an important threat to public health.

Molecular Evidence for Zoonotic Transmission of an Emergent, Highly Pathogenic Campylobacter jejuni Clone in the United States

PubMed Central

Sahin, Orhan; Fitzgerald, Collette; Stroika, Steven; Zhao, Shaohua; Sippy, Rachel J.; Kwan, Patrick; Plummer, Paul J.; Han, Jing; Yaeger, Michael J.

2012-01-01

Campylobacter jejuni is a major zoonotic pathogen. A highly virulent, tetracycline-resistant C. jejuni clone (clone SA) has recently emerged in ruminant reservoirs and has become the predominant cause of sheep abortion in the United States. To determine whether clone SA is associated with human disease, we compared the clinical isolates of clone SA from sheep abortions with the human isolates of the PulseNet National Campylobacter databases at the CDC and the FDA using pulsed-field gel electrophoresis (PFGE), multilocus sequence typing (MLST), and serotyping. The combined SmaI and KpnI PFGE pattern designations of clone SA from sheep were indistinguishable from those of 123 (9.03%) human C. jejuni isolates (total, 1,361) in the CDC database, among which 56 were associated with sporadic infections and 67 were associated with outbreaks that occurred in multiple states from 2003 to 2010. Most of the outbreaks were attributed to raw milk, while the sources for most of the sporadic cases were unknown. All clone SA isolates examined, including PFGE-matched human isolates, belong to sequence type 8 (ST-8) by MLST and serotype HS:1,8, further indicating the clonality of the related isolates from different host species. Additionally, C. jejuni clone SA was identified in raw milk, cattle feces, the feces and bile of healthy sheep, and abortion cases of cattle and goats, indicating the broad distribution of this pathogenic clone in ruminants. These results provide strong molecular and epidemiological evidence for zoonotic transmission of this emergent clone from ruminants to humans and indicate that C. jejuni clone SA is an important threat to public health. PMID:22189122

Multiple Classes of Immune-Related Proteases Associated with the Cell Death Response in Pepper Plants

PubMed Central

Bae, Chungyun; Kim, Su-min; Lee, Dong Ju; Choi, Doil

2013-01-01

Proteases regulate a large number of biological processes in plants, such as metabolism, physiology, growth, and defense. In this study, we carried out virus-induced gene silencing assays with pepper cDNA clones to elucidate the biological roles of protease superfamilies. A total of 153 representative protease genes from pepper cDNA were selected and cloned into a Tobacco rattle virus-ligation independent cloning vector in a loss-of-function study. Silencing of 61 proteases resulted in altered phenotypes, such as the inhibition of shoot growth, abnormal leaf shape, leaf color change, and lethality. Furthermore, the silencing experiments revealed that multiple proteases play a role in cell death and immune response against avirulent and virulent pathogens. Among these 153 proteases, 34 modulated the hypersensitive cell death response caused by infection with an avirulent pathogen, and 16 proteases affected disease symptom development caused by a virulent pathogen. Specifically, we provide experimental evidence for the roles of multiple protease genes in plant development and immune defense following pathogen infection. With these results, we created a broad sketch of each protease function. This information will provide basic information for further understanding the roles of the protease superfamily in plant growth, development, and defense. PMID:23696830

Early generation selection results from a two year, six location study

USDA-ARS?s Scientific Manuscript database

In potato breeding programs, early generation selections are rarely evaluated in multiple environments because of limited seed quantities. By the time seed quantities are available, few clones remain from the original population. The purpose of this study was to allow multiple locations to select ...

Elucidating the genomic architecture of Asian EGFR-mutant lung adenocarcinoma through multi-region exome sequencing.

PubMed

Nahar, Rahul; Zhai, Weiwei; Zhang, Tong; Takano, Angela; Khng, Alexis J; Lee, Yin Yeng; Liu, Xingliang; Lim, Chong Hee; Koh, Tina P T; Aung, Zaw Win; Lim, Tony Kiat Hon; Veeravalli, Lavanya; Yuan, Ju; Teo, Audrey S M; Chan, Cheryl X; Poh, Huay Mei; Chua, Ivan M L; Liew, Audrey Ann; Lau, Dawn Ping Xi; Kwang, Xue Lin; Toh, Chee Keong; Lim, Wan-Teck; Lim, Bing; Tam, Wai Leong; Tan, Eng-Huat; Hillmer, Axel M; Tan, Daniel S W

2018-01-15

EGFR-mutant lung adenocarcinomas (LUAD) display diverse clinical trajectories and are characterized by rapid but short-lived responses to EGFR tyrosine kinase inhibitors (TKIs). Through sequencing of 79 spatially distinct regions from 16 early stage tumors, we show that despite low mutation burdens, EGFR-mutant Asian LUADs unexpectedly exhibit a complex genomic landscape with frequent and early whole-genome doubling, aneuploidy, and high clonal diversity. Multiple truncal alterations, including TP53 mutations and loss of CDKN2A and RB1, converge on cell cycle dysregulation, with late sector-specific high-amplitude amplifications and deletions that potentially beget drug resistant clones. We highlight the association between genomic architecture and clinical phenotypes, such as co-occurring truncal drivers and primary TKI resistance. Through comparative analysis with published smoking-related LUAD, we postulate that the high intra-tumor heterogeneity observed in Asian EGFR-mutant LUAD may be contributed by an early dominant driver, genomic instability, and low background mutation rates.

K-Anonymous Multi-party Secret Handshakes

NASA Astrophysics Data System (ADS)

Xu, Shouhuai; Yung, Moti

Anonymity-protection techniques are crucial for various commercial and financial transactions, where participants are worried about their privacy. On the other hand, authentication methods are also crucial for such interactions. Secret handshake is a relatively recent mechanism that facilitates privacy-preserving mutual authentication between communicating peers. In recent years, researchers have proposed a set of secret handshake schemes based on different assumptions about the credentials used: from one-time credentials to the more general PKI-like credentials. In this paper, we concentrate on k-anonymous secret handshake schemes based on PKI-like infrastructures. More specifically, we deal with the k-anonymous m-party (m > 2) secret handshake problem, which is significantly more involved than its two-party counterpart due to the following: When an honest user hand-shakes with m - 1 parties, it must be assured that these parties are distinct; otherwise, under the mask of anonymity a dishonest participant may clone itself in a single handshake session (i.e., assuming multiple personalities).

Food Forensics: Using Mass Spectrometry To Detect Foodborne Protein Contaminants, as Exemplified by Shiga Toxin Variants and Prion Strains.

PubMed

Silva, Christopher J

2018-06-13

Food forensicists need a variety of tools to detect the many possible food contaminants. As a result of its analytical flexibility, mass spectrometry is one of those tools. Use of the multiple reaction monitoring (MRM) method expands its use to quantitation as well as detection of infectious proteins (prions) and protein toxins, such as Shiga toxins. The sample processing steps inactivate prions and Shiga toxins; the proteins are digested with proteases to yield peptides suitable for MRM-based analysis. Prions are detected by their distinct physicochemical properties and differential covalent modification. Shiga toxin analysis is based on detecting peptides derived from the five identical binding B subunits comprising the toxin. 15 N-labeled internal standards are prepared from cloned proteins. These examples illustrate the power of MRM, in that the same instrument can be used to safely detect and quantitate protein toxins, prions, and small molecules that might contaminate our food.

Evidence of a dynamic microbial community structure and predation through combined microbiological and stable isotope characterization

NASA Astrophysics Data System (ADS)

Druhan, J. L.; Bill, M.; Lim, H. C.; Wu, C.; Conrad, M. E.; Williams, K. H.; DePaolo, D. J.; Brodie, E.

2014-12-01

The speciation, reactivity and mobility of carbon in the near surface environment is intimately linked to the prevalence, diversity and dynamics of native microbial populations. We utilize this relationship by introducing 13C-labeled acetate to sediments recovered from a shallow aquifer system to track both the cycling of carbon through multiple redox pathways and the associated spatial and temporal evolution of bacterial communities in response to this nutrient source. Results demonstrate a net loss of sediment organic carbon over the course of the amendment experiment. Furthermore, these data demonstrated a source of isotopically labeled inorganic carbon that was not attributable to primary metabolism by acetate-oxidizing microorganisms. Fluid samples analyzed weekly for microbial composition by pyrosequencing of ribosomal RNA genes showed a transient microbial community structure, with distinct occurrences of Azoarcus, Geobacter and multiple sulfate reducing species over the course of the experiment. In combination with DNA sequencing data, the anomalous carbon cycling process is shown to occur exclusively during the period of predominant Geobacter species growth. Pyrosequencing indicated, and targeted cloning and sequencing confirmed the presence of several bacteriovorous protozoa, including species of the Breviata, Planococcus and Euplotes genera. Cloning and qPCR analysis demonstrated that Euplotes species were most abundant and displayed a growth trajectory that closely followed that of the Geobacter population. These results suggest a previously undocumented secondary turnover of biomass carbon related to protozoan grazing that was not sufficiently prevalent to be observed in bulk concentrations of carbon species in the system, but was clearly identifiable in the partitioning of carbon isotopes. The impact of predator-prey relationships on subsurface microbial community dynamics and therefore the flux of carbon through a system via the microbial biomass pool suggests a diversity of processes that should be considered for inclusion in reactive transport models that aim to predict carbon turnover, nutrient flux, and redox reactions in natural and stimulated subsurface systems.

Mechanisms of Microwave Induced Damage in Biologic Materials

DTIC Science & Technology

1988-01-25

display senescence after multiple population doublings (14). Fibroblasts of Clone 12 BE, derived from a patient with the disease xeroderma pigmentosum ...were also employed. The xeroderma pigmentosum (XP) cells are deficient in DNA repair (6), a genetic defect which produced the disease condition in the...SARs as high as 1500-1600 mW/g. 2.3.3 Xeroderma Pigmentosum (Clone 12BE) Irradiations To supplement the CW data on IMR-90 an additional set of

Evolutionary dynamics of methicillin-resistant Staphylococcus aureus within a healthcare system.

PubMed

Hsu, Li-Yang; Harris, Simon R; Chlebowicz, Monika A; Lindsay, Jodi A; Koh, Tse-Hsien; Krishnan, Prabha; Tan, Thean-Yen; Hon, Pei-Yun; Grubb, Warren B; Bentley, Stephen D; Parkhill, Julian; Peacock, Sharon J; Holden, Matthew T G

2015-04-23

In the past decade, several countries have seen gradual replacement of endemic multi-resistant healthcare-associated methicillin-resistant Staphylococcus aureus (MRSA) with clones that are more susceptible to antibiotic treatment. One example is Singapore, where MRSA ST239, the dominant clone since molecular profiling of MRSA began in the mid-1980s, has been replaced by ST22 isolates belonging to EMRSA-15, a recently emerged pandemic lineage originating from Europe. We investigated the population structure of MRSA in Singaporean hospitals spanning three decades, using whole genome sequencing. Applying Bayesian phylogenetic methods we report that prior to the introduction of ST22, the ST239 MRSA population in Singapore originated from multiple introductions from the surrounding region; it was frequently transferred within the healthcare system resulting in a heterogeneous hospital population. Following the introduction of ST22 around the beginning of the millennium, this clone spread rapidly through Singaporean hospitals, supplanting the endemic ST239 population. Coalescent analysis revealed that although the genetic diversity of ST239 initially decreased as ST22 became more dominant, from 2007 onwards the genetic diversity of ST239 began to increase once more, which was not associated with the emergence of a sub-clone of ST239. Comparative genomic analysis of the accessory genome of the extant ST239 population identified that the Arginine Catabolic Mobile Element arose multiple times, thereby introducing genes associated with enhanced skin colonization into this population. Our results clearly demonstrate that, alongside clinical practice and antibiotic usage, competition between clones also has an important role in driving the evolution of nosocomial pathogen populations.

Russell body inducing threshold depends on the variable domain sequences of individual human IgG clones and the cellular protein homeostasis.

PubMed

Stoops, Janelle; Byrd, Samantha; Hasegawa, Haruki

2012-10-01

Russell bodies are intracellular aggregates of immunoglobulins. Although the mechanism of Russell body biogenesis has been extensively studied by using truncated mutant heavy chains, the importance of the variable domain sequences in this process and in immunoglobulin biosynthesis remains largely unknown. Using a panel of structurally and functionally normal human immunoglobulin Gs, we show that individual immunoglobulin G clones possess distinctive Russell body inducing propensities that can surface differently under normal and abnormal cellular conditions. Russell body inducing predisposition unique to each immunoglobulin G clone was corroborated by the intrinsic physicochemical properties encoded in the heavy chain variable domain/light chain variable domain sequence combinations that define each immunoglobulin G clone. While the sequence based intrinsic factors predispose certain immunoglobulin G clones to be more prone to induce Russell bodies, extrinsic factors such as stressful cell culture conditions also play roles in unmasking Russell body propensity from immunoglobulin G clones that are normally refractory to developing Russell bodies. By taking advantage of heterologous expression systems, we dissected the roles of individual subunit chains in Russell body formation and examined the effect of non-cognate subunit chain pair co-expression on Russell body forming propensity. The results suggest that the properties embedded in the variable domain of individual light chain clones and their compatibility with the partnering heavy chain variable domain sequences underscore the efficiency of immunoglobulin G biosynthesis, the threshold for Russell body induction, and the level of immunoglobulin G secretion. We propose that an interplay between the unique properties encoded in variable domain sequences and the state of protein homeostasis determines whether an immunoglobulin G expressing cell will develop the Russell body phenotype in a dynamic cellular setting. Copyright © 2012 Elsevier B.V. All rights reserved.

Bellerophon: A program to detect chimeric sequences in multiple sequence alignments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huber, Thomas; Faulkner, Geoffrey; Hugenholtz, Philip

2003-12-23

Bellerophon is a program for detecting chimeric sequences in multiple sequence datasets by an adaption of partial treeing analysis. Bellerophon was specifically developed to detect 16S rRNA gene chimeras in PCR-clone libraries of environmental samples but can be applied to other nucleotide sequence alignments.

Characterization of a candidate bcl-1 gene.

PubMed Central

Withers, D A; Harvey, R C; Faust, J B; Melnyk, O; Carey, K; Meeker, T C

1991-01-01

The t(11;14)(q13;q32) translocation has been associated with human B-lymphocytic malignancy. Several examples of this translocation have been cloned, documenting that this abnormality joins the immunoglobulin heavy-chain gene to the bcl-1 locus on chromosome 11. However, the identification of the bcl-1 gene, a putative dominant oncogene, has been elusive. In this work, we have isolated genomic clones covering 120 kb of the bcl-1 locus. Probes from the region of an HpaII-tiny-fragment island identified a candidate bcl-1 gene. cDNAs representing the bcl-1 mRNA were cloned from three cell lines, two with the translocation. The deduced amino acid sequence from these clones showed bcl-1 to be a member of the cyclin gene family. In addition, our analysis of expression of bcl-1 in an extensive panel of human cell lines showed it to be widely expressed except in lymphoid or myeloid lineages. This observation may provide a molecular basis for distinct modes of cell cycle control in different mammalian tissues. Activation of the bcl-1 gene may be oncogenic by directly altering progression through the cell cycle. Images PMID:1833629

Emergence of a bacterial clone with enhanced virulence by acquisition of a phage encoding a secreted phospholipase A2.

PubMed

Sitkiewicz, Izabela; Nagiec, Michal J; Sumby, Paul; Butler, Stephanie D; Cywes-Bentley, Colette; Musser, James M

2006-10-24

The molecular basis of pathogen clone emergence is relatively poorly understood. Acquisition of a bacteriophage encoding a previously unknown secreted phospholipase A(2) (designated SlaA) has been implicated in the rapid emergence in the mid-1980s of a new hypervirulent clone of serotype M3 group A Streptococcus. Although several lines of circumstantial evidence suggest that SlaA is a virulence factor, this issue has not been addressed experimentally. We found that an isogenic DeltaslaA mutant strain was significantly impaired in ability to adhere to and kill human epithelial cells compared with the wild-type parental strain. The mutant strain was less virulent for mice than the wild-type strain, and immunization with purified SlaA significantly protected mice from invasive disease. Importantly, the mutant strain was significantly attenuated for colonization in a monkey model of pharyngitis. We conclude that transductional acquisition of the ability of a GAS strain to produce SlaA enhanced the spread and virulence of the serotype M3 precursor strain. Hence, these studies identified a crucial molecular event underlying the evolution, rapid emergence, and widespread dissemination of unusually severe human infections caused by a distinct bacterial clone.

Extreme heterogeneity of polyadenylation sites in mRNAs encoding chloroplast RNA-binding proteins in Nicotiana plumbaginifolia.

PubMed

Klahre, U; Hemmings-Mieszczak, M; Filipowicz, W

1995-06-01

We have previously characterized nuclear cDNA clones encoding two RNA binding proteins, CP-RBP30 and CP-RBP-31, which are targeted to chloroplasts in Nicotiana plumbaginifolia. In this report we describe the analysis of the 3'-untranslated regions (3'-UTRs) in 22 CP-RBP30 and 8 CP-RBP31 clones which reveals that mRNAs encoding both proteins have a very complex polyadenylation pattern. Fourteen distinct poly(A) sites were identified among CP-RBP30 clones and four sites among the CP-RBP31 clones. The authenticity of the sites was confirmed by RNase A/T1 mapping of N. plumbaginifolia RNA. CP-RBP30 provides an extreme example of the heterogeneity known to be a feature of mRNA polyadenylation in higher plants. Using PCR we have demonstrated that CP-RBP genes in N. plumbaginifolia and N. sylvestris, in addition to the previously described introns interrupting the coding region, contain an intron located in the 3' non-coding part of the gene. In the case of the CP-RBP31, we have identified one polyadenylation event occurring in this intron.

Cloning of the unculturable parasite Pasteuria ramosa and its Daphnia host reveals extreme genotype-genotype interactions.

PubMed

Luijckx, Pepijn; Ben-Ami, Frida; Mouton, Laurence; Du Pasquier, Louis; Ebert, Dieter

2011-02-01

The degree of specificity in host-parasite interactions has important implications for ecology and evolution. Unfortunately, specificity can be difficult to determine when parasites cannot be cultured. In such cases, studies often use isolates of unknown genetic composition, which may lead to an underestimation of specificity. We obtained the first clones of the unculturable bacterium Pasteuria ramosa, a parasite of Daphnia magna. Clonal genotypes of the parasite exhibited much more specific interactions with host genotypes than previous studies using isolates. Clones of P. ramosa infected fewer D. magna genotypes than isolates and host clones were either fully susceptible or fully resistant to the parasite. Our finding enhances our understanding of the evolution of virulence and coevolutionary dynamics in this system. We recommend caution when using P. ramosa isolates as the presence of multiple genotypes may influence the outcome and interpretation of some experiments. © 2010 Blackwell Publishing Ltd/CNRS.

Bacterial Diversity in Human Subgingival Plaque

PubMed Central

Paster, Bruce J.; Boches, Susan K.; Galvin, Jamie L.; Ericson, Rebecca E.; Lau, Carol N.; Levanos, Valerie A.; Sahasrabudhe, Ashish; Dewhirst, Floyd E.

2001-01-01

The purpose of this study was to determine the bacterial diversity in the human subgingival plaque by using culture-independent molecular methods as part of an ongoing effort to obtain full 16S rRNA sequences for all cultivable and not-yet-cultivated species of human oral bacteria. Subgingival plaque was analyzed from healthy subjects and subjects with refractory periodontitis, adult periodontitis, human immunodeficiency virus periodontitis, and acute necrotizing ulcerative gingivitis. 16S ribosomal DNA (rDNA) bacterial genes from DNA isolated from subgingival plaque samples were PCR amplified with all-bacterial or selective primers and cloned into Escherichia coli. The sequences of cloned 16S rDNA inserts were used to determine species identity or closest relatives by comparison with sequences of known species. A total of 2,522 clones were analyzed. Nearly complete sequences of approximately 1,500 bases were obtained for putative new species. About 60% of the clones fell into 132 known species, 70 of which were identified from multiple subjects. About 40% of the clones were novel phylotypes. Of the 215 novel phylotypes, 75 were identified from multiple subjects. Known putative periodontal pathogens such as Porphyromonas gingivalis, Bacteroides forsythus, and Treponema denticola were identified from multiple subjects, but typically as a minor component of the plaque as seen in cultivable studies. Several phylotypes fell into two recently described phyla previously associated with extreme natural environments, for which there are no cultivable species. A number of species or phylotypes were found only in subjects with disease, and a few were found only in healthy subjects. The organisms identified only from diseased sites deserve further study as potential pathogens. Based on the sequence data in this study, the predominant subgingival microbial community consisted of 347 species or phylotypes that fall into 9 bacterial phyla. Based on the 347 species seen in our sample of 2,522 clones, we estimate that there are 68 additional unseen species, for a total estimate of 415 species in the subgingival plaque. When organisms found on other oral surfaces such as the cheek, tongue, and teeth are added to this number, the best estimate of the total species diversity in the oral cavity is approximately 500 species, as previously proposed. PMID:11371542

Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues

DOE Office of Scientific and Technical Information (OSTI.GOV)

Prody, C.A.; Zevin-Sonkin, D.; Gnatt, A.

1987-06-01

To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase and Torpedo electric organ true acetylcholinesterase. Using these probes, the authors isolated several cDNA clones from lambdagt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. Inmore » RNA blots of poly(A)/sup +/ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These finding demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species.« less

Ozone sensitivity in hybrid poplar correlates with insensitivity to both salicylic acid and jasmonic acid. The role of programmed cell death in lesion formation.

PubMed

Koch, J R; Creelman, R A; Eshita, S M; Seskar, M; Mullet, J E; Davis, K R

2000-06-01

Our earlier studies demonstrated that the ozone-sensitive hybrid poplar clone NE-388 displays an attenuated level of ozone-, wound-, and phytopathogen-induced defense gene expression. To determine if this reduced gene activation involves signal transduction pathways dependent on salicylic acid (SA) and/or jasmonic acid (JA), we compared the responses of NE-388 and an ozone-tolerant clone, NE-245, to these signal molecules. JA levels increased in both clones in response to ozone, but only minimal increases in SA levels were measured for either clone. Treatment with SA and methyl jasmonate induced defense gene expression only in NE-245, indicating that NE-388 is insensitive to these signal molecules. DNA fragmentation, an indicator of programmed cell death (PCD), was detected in NE-245 treated with either ozone or an avirulent phytopathogen, but was not detected in NE-388. We conclude that these clones undergo two distinct mechanisms of ozone-induced lesion formation. In NE-388, lesions appear to be due to toxic cell death resulting from a limited ability to perceive and subsequently activate SA- and/or JA-mediated antioxidant defense responses. In NE-245, SA-dependent PCD precedes lesion formation via a process related to the PCD pathway activated by phytopathogenic bacteria. These results support the hypothesis that ozone triggers a hypersensitive response.

Ozone Sensitivity in Hybrid Poplar Correlates with Insensitivity to Both Salicylic Acid and Jasmonic Acid. The Role of Programmed Cell Death in Lesion Formation1

PubMed Central

Koch, Jennifer Riehl; Creelman, Robert A.; Eshita, Steven M.; Seskar, Mirjana; Mullet, John E.; Davis, Keith R.

2000-01-01

Our earlier studies demonstrated that the ozone-sensitive hybrid poplar clone NE-388 displays an attenuated level of ozone-, wound-, and phytopathogen-induced defense gene expression. To determine if this reduced gene activation involves signal transduction pathways dependent on salicylic acid (SA) and/or jasmonic acid (JA), we compared the responses of NE-388 and an ozone-tolerant clone, NE-245, to these signal molecules. JA levels increased in both clones in response to ozone, but only minimal increases in SA levels were measured for either clone. Treatment with SA and methyl jasmonate induced defense gene expression only in NE-245, indicating that NE-388 is insensitive to these signal molecules. DNA fragmentation, an indicator of programmed cell death (PCD), was detected in NE-245 treated with either ozone or an avirulent phytopathogen, but was not detected in NE-388. We conclude that these clones undergo two distinct mechanisms of ozone-induced lesion formation. In NE-388, lesions appear to be due to toxic cell death resulting from a limited ability to perceive and subsequently activate SA- and/or JA-mediated antioxidant defense responses. In NE-245, SA-dependent PCD precedes lesion formation via a process related to the PCD pathway activated by phytopathogenic bacteria. These results support the hypothesis that ozone triggers a hypersensitive response. PMID:10859179

Virulence Strategies of the Dominant USA300 Lineage of Community Associated Methicillin Resistant Staphylococcus aureus (CA-MRSA)

PubMed Central

Thurlow, Lance R.; Joshi, Gauri S.; Richardson, Anthony R.

2014-01-01

Methicillin-Resistant Staphylococcus aureus (MRSA) poses a serious threat to worldwide health. Historically, MRSA clones have strictly been associated with hospital settings and most hospital-associated MRSA (HA-MRSA) disease resulted from a limited number of virulent clones. Recently, MRSA has spread into the community causing disease in otherwise healthy people with no discernible contact with healthcare environments. These community-associated (CA-MRSA) are phylogenetically distinct from traditional HA-MRSA clones and CA-MRSA strains seem to exhibit hyper virulence and more efficient host:host transmission. Consequently, CA-MRSA clones belonging to the USA300 lineage have become dominant sources of MRSA infections in North America. The rise of this successful USA300 lineage represents an important step in the evolution of emerging pathogens and a great deal of effort has been exerted to understand how these clones evolved. Here we review much of the recent literature aimed at illuminating the source of USA300 success and broadly categorize these findings into three main categories: newly acquired virulence genes, altered expression of common virulence determinants and alterations in protein sequence that increase fitness. We argue that none of these evolutionary events alone account for the success of USA300, but rather their combination may be responsible for the rise and spread of CA-MRSA. PMID:22309135

Mapping and characterization of vicriviroc resistance mutations from HIV-1 isolated from treatment-experienced subjects enrolled in a phase II study (VICTOR-E1).

PubMed

McNicholas, Paul M; Mann, Paul A; Wojcik, Lisa; Qiu, Ping; Lee, Erin; McCarthy, Michael; Shen, Junwu; Black, Todd A; Strizki, Julie M

2011-03-01

In the phase 2 VICTOR-E1 study, treatment-experienced subjects receiving 20 mg or 30 mg of the CCR5 antagonist vicriviroc (VCV), with a boosted protease containing optimized background regimen, experienced significantly greater reductions in HIV-1 viral load compared with control subjects. Among the 79 VCV-treated subjects, 15 experienced virologic failure, and of these 5 had VCV-resistant virus. This study investigated the molecular basis for the changes in susceptibility to VCV in these subjects. Sequence analysis and phenotypic susceptibility testing was performed on envelope clones from VCV-resistant virus. For select clones, an exchange of mutations in the V3 loop was performed between phenotypically resistant clones and the corresponding susceptible clones. Phenotypic resistance was manifest by reductions in the maximum percent inhibition. Clonal analysis of envelopes from the 5 subjects identified multiple amino acid changes in gp160 that were exclusive to the resistant clones, however, none of the changes were conserved between subjects. Introduction of V3 loop substitutions from the resistant clones into the matched susceptible clones was not sufficient to reproduce the resistant phenotype. Likewise, changing the substitutions in the V3 loops from resistant clones to match susceptible clones only restored susceptibility in 1 clone. There were no clearly conserved patterns of mutations in gp160 associated with phenotypic resistance to VCV and mutations both within and outside of the V3 loop contributed to the resistance phenotype. These data suggest that genotypic tests for VCV susceptibility may require larger training sets and additional information beyond V3 sequences.

Rapid Construction of Stable Infectious Full-Length cDNA Clone of Papaya Leaf Distortion Mosaic Virus Using In-Fusion Cloning

PubMed Central

Tuo, Decai; Shen, Wentao; Yan, Pu; Li, Xiaoying; Zhou, Peng

2015-01-01

Papaya leaf distortion mosaic virus (PLDMV) is becoming a threat to papaya and transgenic papaya resistant to the related pathogen, papaya ringspot virus (PRSV). The generation of infectious viral clones is an essential step for reverse-genetics studies of viral gene function and cross-protection. In this study, a sequence- and ligation-independent cloning system, the In-Fusion® Cloning Kit (Clontech, Mountain View, CA, USA), was used to construct intron-less or intron-containing full-length cDNA clones of the isolate PLDMV-DF, with the simultaneous scarless assembly of multiple viral and intron fragments into a plasmid vector in a single reaction. The intron-containing full-length cDNA clone of PLDMV-DF was stably propagated in Escherichia coli. In vitro intron-containing transcripts were processed and spliced into biologically active intron-less transcripts following mechanical inoculation and then initiated systemic infections in Carica papaya L. seedlings, which developed similar symptoms to those caused by the wild-type virus. However, no infectivity was detected when the plants were inoculated with RNA transcripts from the intron-less construct because the instability of the viral cDNA clone in bacterial cells caused a non-sense or deletion mutation of the genomic sequence of PLDMV-DF. To our knowledge, this is the first report of the construction of an infectious full-length cDNA clone of PLDMV and the splicing of intron-containing transcripts following mechanical inoculation. In-Fusion cloning shortens the construction time from months to days. Therefore, it is a faster, more flexible, and more efficient method than the traditional multistep restriction enzyme-mediated subcloning procedure. PMID:26633465

Rapid Construction of Stable Infectious Full-Length cDNA Clone of Papaya Leaf Distortion Mosaic Virus Using In-Fusion Cloning.

PubMed

Tuo, Decai; Shen, Wentao; Yan, Pu; Li, Xiaoying; Zhou, Peng

2015-12-01

Papaya leaf distortion mosaic virus (PLDMV) is becoming a threat to papaya and transgenic papaya resistant to the related pathogen, papaya ringspot virus (PRSV). The generation of infectious viral clones is an essential step for reverse-genetics studies of viral gene function and cross-protection. In this study, a sequence- and ligation-independent cloning system, the In-Fusion(®) Cloning Kit (Clontech, Mountain View, CA, USA), was used to construct intron-less or intron-containing full-length cDNA clones of the isolate PLDMV-DF, with the simultaneous scarless assembly of multiple viral and intron fragments into a plasmid vector in a single reaction. The intron-containing full-length cDNA clone of PLDMV-DF was stably propagated in Escherichia coli. In vitro intron-containing transcripts were processed and spliced into biologically active intron-less transcripts following mechanical inoculation and then initiated systemic infections in Carica papaya L. seedlings, which developed similar symptoms to those caused by the wild-type virus. However, no infectivity was detected when the plants were inoculated with RNA transcripts from the intron-less construct because the instability of the viral cDNA clone in bacterial cells caused a non-sense or deletion mutation of the genomic sequence of PLDMV-DF. To our knowledge, this is the first report of the construction of an infectious full-length cDNA clone of PLDMV and the splicing of intron-containing transcripts following mechanical inoculation. In-Fusion cloning shortens the construction time from months to days. Therefore, it is a faster, more flexible, and more efficient method than the traditional multistep restriction enzyme-mediated subcloning procedure.

Role of Stat3 and ErbB2 in Breast Cancer

DTIC Science & Technology

2011-10-01

Cell. Biol. 29 (2009) 1796–1813. [29] M. Kohler, S. Ansieau, S. Prehn , A. Leutz, H. Haller, E. Hartmann, Cloning of two novel human importin-alpha...Christiansen, F.R. Bischoff, S. Prehn ,H.Haller, D. Gorlich, E. Hartmann, Evidence for distinct substrate specificities of importin alpha family members in

Interferon Antagonism as a Common Virulence Factor of Hemorrhagic Fever Viruses

DTIC Science & Technology

2009-02-01

pathogenesis. Proc Soc Exp Biol Med 223:241-57. 11. Kohler, M., S. Ansieau, S. Prehn , A. Leutz, H. Haller, and E. Hartmann. 1997. Cloning of two novel human...Christiansen, F. R. Bischoff, S. Prehn , H. Haller, D. Gorlich, and E. Hartmann. 1999. Evidence for distinct substrate specificities of importin

Odorant-binding proteins from a primitive termite.

PubMed

Ishida, Yuko; Chiang, Vicky P; Haverty, Michael I; Leal, Walter S

2002-09-01

Hitherto, odorant-binding proteins (OBPs) have been identified from insects belonging to more highly evolved insect orders (Lepidoptera, Coleoptera, Diptera, Hymenoptera, and Hemiptera), whereas only chemosensory proteins have been identified from more primitive species, such as orthopteran and phasmid species. Here, we report for the first time the isolation and cloning of odorant-binding proteins from a primitive termite species, the dampwood termite. Zootermopsis nevadensis nevadensis (Isoptera: Termopsidae). A major antennae-specific protein was detected by native PAGE along with four other minor proteins, which were also absent in the extract from control tissues (hindlegs). Multiple cDNA cloning led to the full characterization of the major antennae-specific protein (ZnevOBP1) and to the identification of two other antennae-specific cDNAs, encoding putative odorant-binding proteins (ZnevOBP2 and ZnevOBP3). N-terminal amino acid sequencing of the minor antennal bands and cDNA cloning showed that olfaction in Z. n. nevadensis may involve multiple odorant-binding proteins. Database searches suggest that the OBPs from this primitive termite are homologues of the pheromone-binding proteins from scarab beetles and antennal-binding proteins from moths.

Molecular Cloning and Sequence Analysis of a Phenylalanine Ammonia-Lyase Gene from Dendrobium

PubMed Central

Cai, Yongping; Lin, Yi

2013-01-01

In this study, a phenylalanine ammonia-lyase (PAL) gene was cloned from Dendrobium candidum using homology cloning and RACE. The full-length sequence and catalytic active sites that appear in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum are also found: PAL cDNA of D. candidum (designated Dc-PAL1, GenBank No. JQ765748) has 2,458 bps and contains a complete open reading frame (ORF) of 2,142 bps, which encodes 713 amino acid residues. The amino acid sequence of DcPAL1 has more than 80% sequence identity with the PAL genes of other plants, as indicated by multiple alignments. The dominant sites and catalytic active sites, which are similar to that showing in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum, are also found in DcPAL1. Phylogenetic tree analysis revealed that DcPAL is more closely related to PALs from orchidaceae plants than to those of other plants. The differential expression patterns of PAL in protocorm-like body, leaf, stem, and root, suggest that the PAL gene performs multiple physiological functions in Dendrobium candidum. PMID:23638048

Locating Sequence on FPC Maps and Selecting a Minimal Tiling Path

PubMed Central

Engler, Friedrich W.; Hatfield, James; Nelson, William; Soderlund, Carol A.

2003-01-01

This study discusses three software tools, the first two aid in integrating sequence with an FPC physical map and the third automatically selects a minimal tiling path given genomic draft sequence and BAC end sequences. The first tool, FSD (FPC Simulated Digest), takes a sequenced clone and adds it back to the map based on a fingerprint generated by an in silico digest of the clone. This allows verification of sequenced clone positions and the integration of sequenced clones that were not originally part of the FPC map. The second tool, BSS (Blast Some Sequence), takes a query sequence and positions it on the map based on sequence associated with the clones in the map. BSS has multiple uses as follows: (1) When the query is a file of marker sequences, they can be added as electronic markers. (2) When the query is draft sequence, the results of BSS can be used to close gaps in a sequenced clone or the physical map. (3) When the query is a sequenced clone and the target is BAC end sequences, one may select the next clone for sequencing using both sequence comparison results and map location. (4) When the query is whole-genome draft sequence and the target is BAC end sequences, the results can be used to select many clones for a minimal tiling path at once. The third tool, pickMTP, automates the majority of this last usage of BSS. Results are presented using the rice FPC map, BAC end sequences, and whole-genome shotgun from Syngenta. PMID:12915486

Improved robustness of an ethanologenic yeast strain through adaptive evolution in acetic acid is associated with its enzymatic antioxidant ability.

PubMed

Gurdo, N; Novelli Poisson, G F; Juárez, Á B; Ríos de Molina, M C; Galvagno, M A

2018-05-16

To investigate multiple tolerance of Saccharomyces cerevisiae obtained through a laboratory strategy of adaptive evolution in acetic acid, its relation with enzymatic ROS detoxification and bioethanol 2G production. After adaptive evolution in acetic acid, a clone (Y8A) was selected for its tolerance to high acetic acid concentrations (13 g l -1 ) in batch cultures. Y8A was resistant to multiple stresses: osmotic, thermic, oxidative, saline, ethanol, organic acid, phenolic compounds and slow freeze-thawing cycles. Also, Y8A was able to maintain redox homeostasis under oxidative stress, whereas the isogenic parental strain (Y8) could not, indicating higher basal activity levels of antioxidative enzyme Catalase (CAT) and Gluthatione-S-Transferase (GST) in Y8A. Y8A reached higher bioethanol levels in a fermentation medium containing up to 8 g l -1 of acetic acid when compared to parental strain Y8. A multiple-stress-tolerant clone was obtained using adaptive evolution in acetic acid. Stress cross-tolerance could be explained by its enzymatic antioxidative capacity, namely CAT and GST. We demonstrate that adaptive evolution used in S. cerevisiae was a useful strategy to obtain a yeast clone tolerant to multiple stresses. At the same time, our findings support the idea that tolerance to oxidative stress is the common basis for stress co-tolerance, which is related to an increase in the specific enzymes CAT and GST but not in Superoxide dismutase (SOD), emphasizing the fact that detoxification of H 2 O 2 and not O 2 . is a key condition for multiple stress tolerance in S. cerevisiae. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Efficient Generation of Somatic Cell Nuclear Transfer-Competent Porcine Cells with Mutated Alleles at Multiple Target Loci by Using CRISPR/Cas9 Combined with Targeted Toxin-Based Selection System.

PubMed

Sato, Masahiro; Miyoshi, Kazuchika; Nakamura, Shingo; Ohtsuka, Masato; Sakurai, Takayuki; Watanabe, Satoshi; Kawaguchi, Hiroaki; Tanimoto, Akihide

2017-12-04

The recent advancement in genome editing such a CRISPR/Cas9 system has enabled isolation of cells with knocked multiple alleles through a one-step transfection. Somatic cell nuclear transfer (SCNT) has been frequently employed as one of the efficient tools for the production of genetically modified (GM) animals. To use GM cells as SCNT donor, efficient isolation of transfectants with mutations at multiple target loci is often required. The methods for the isolation of such GM cells largely rely on the use of drug selection-based approach using selectable genes; however, it is often difficult to isolate cells with mutations at multiple target loci. In this study, we used a novel approach for the efficient isolation of porcine cells with at least two target loci mutations by one-step introduction of CRISPR/Cas9-related components. A single guide (sg) RNA targeted to GGTA1 gene, involved in the synthesis of cell-surface α-Gal epitope (known as xenogenic antigen), is always a prerequisite. When the transfected cells were reacted with toxin-labeled BS-I-B₄ isolectin for 2 h at 37 C to eliminate α-Gal epitope-expressing cells, the surviving clones lacked α-Gal epitope expression and were highly expected to exhibit induced mutations at another target loci. Analysis of these α-Gal epitope-negative surviving cells demonstrated a 100% occurrence of genome editing at target loci. SCNT using these cells as donors resulted in the production of cloned blastocysts with the genotype similar to that of the donor cells used. Thus, this novel system will be useful for SCNT-mediated acquisition of GM cloned piglets, in which multiple target loci may be mutated.

Multiplex CRISPR/Cas9-based genome engineering from a single lentiviral vector

PubMed Central

Kabadi, Ami M.; Ousterout, David G.; Hilton, Isaac B.; Gersbach, Charles A.

2014-01-01

Engineered DNA-binding proteins that manipulate the human genome and transcriptome have enabled rapid advances in biomedical research. In particular, the RNA-guided CRISPR/Cas9 system has recently been engineered to create site-specific double-strand breaks for genome editing or to direct targeted transcriptional regulation. A unique capability of the CRISPR/Cas9 system is multiplex genome engineering by delivering a single Cas9 enzyme and two or more single guide RNAs (sgRNAs) targeted to distinct genomic sites. This approach can be used to simultaneously create multiple DNA breaks or to target multiple transcriptional activators to a single promoter for synergistic enhancement of gene induction. To address the need for uniform and sustained delivery of multiplex CRISPR/Cas9-based genome engineering tools, we developed a single lentiviral system to express a Cas9 variant, a reporter gene and up to four sgRNAs from independent RNA polymerase III promoters that are incorporated into the vector by a convenient Golden Gate cloning method. Each sgRNA is efficiently expressed and can mediate multiplex gene editing and sustained transcriptional activation in immortalized and primary human cells. This delivery system will be significant to enabling the potential of CRISPR/Cas9-based multiplex genome engineering in diverse cell types. PMID:25122746

Functional Analysis of the Anti-adalimumab Response Using Patient-derived Monoclonal Antibodies♦

PubMed Central

van Schouwenburg, Pauline A.; Kruithof, Simone; Votsmeier, Christian; van Schie, Karin; Hart, Margreet H.; de Jong, Rob N.; van Buren, Esther E. L.; van Ham, Marieke; Aarden, Lucien; Wolbink, Gertjan; Wouters, Diana; Rispens, Theo

2014-01-01

The production of antibodies to adalimumab in autoimmune patients treated with adalimumab is shown to diminish treatment efficacy. We previously showed that these antibodies are almost exclusively neutralizing, indicating a restricted response. Here, we investigated the characteristics of a panel of patient-derived monoclonal antibodies for binding to adalimumab. Single B-cells were isolated from two patients, cultured, and screened for adalimumab specificity. Analysis of variable region sequences of 16 clones suggests that the immune response against adalimumab is broad, involving multiple B-cell clones each using different combinations of V(D)J segments. A strong bias for replacement mutations in the complementarity determining regions was found, indicating an antigen-driven response. We recombinantly expressed 11 different monoclonal antibodies and investigated their affinity and specificity. All clones except one are of high affinity (Kd between 0.6 and 233 pm) and compete with TNF as well as each other for binding to adalimumab. However, binding to a panel of single-point mutants of adalimumab indicates markedly different fine specificities that also result in a differential tendency of each clone to form dimeric and multimeric immune complexes. We conclude that although all anti-adalimumab antibodies compete for binding to TNF, the response is clonally diverse and involves multiple epitopes on adalimumab. These results are important for understanding the relationship between self and non-self or idiotypic determinants on therapeutic antibodies and their potential immunogenicity. PMID:25326381

Genome assortment, not serogroup, defines Vibrio cholerae pandemic strains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brettin, Thomas S; Bruce, David C; Challacombe, Jean F

2009-01-01

Vibrio cholerae, the causative agent of cholera, is a bacterium autochthonous to the aquatic environment, and a serious public health threat. V. cholerae serogroup O1 is responsible for the previous two cholera pandemics, in which classical and El Tor biotypes were dominant in the 6th and the current 7th pandemics, respectively. Cholera researchers continually face newly emerging and re-emerging pathogenic clones carrying combinations of new serogroups as well as of phenotypic and genotypic properties. These genotype and phenotype changes have hampered control of the disease. Here we compare the complete genome sequences of 23 strains of V. cholerae isolated frommore » a variety of sources and geographical locations over the past 98 years in an effort to elucidate the evolutionary mechanisms governing genetic diversity and genesis of new pathogenic clones. The genome-based phylogeny revealed 12 distinct V. cholerae phyletic lineages, of which one, designated the V. cholerae core genome (CG), comprises both O1 classical and EI Tor biotypes. All 7th pandemic clones share nearly identical gene content, i.e., the same genome backbone. The transition from 6th to 7th pandemic strains is defined here as a 'shift' between pathogenic clones belonging to the same O1 serogroup, but from significantly different phyletic lineages within the CG clade. In contrast, transition among clones during the present 7th pandemic period can be characterized as a 'drift' between clones, differentiated mainly by varying composition of laterally transferred genomic islands, resulting in emergence of variants, exemplified by V.cholerae serogroup O139 and V.cholerae O1 El Tor hybrid clones that produce cholera toxin of classical biotype. Based on the comprehensive comparative genomics presented in this study it is concluded that V. cholerae undergoes extensive genetic recombination via lateral gene transfer, and, therefore, genome assortment, not serogroup, should be used to define pathogenic V. cholerae clones.« less

Physiological and biochemical responses to severe drought stress of nine Eucalyptus globulus clones: a multivariate approach.

PubMed

Granda, Víctor; Delatorre, Carolina; Cuesta, Candela; Centeno, María L; Fernández, Belén; Rodríguez, Ana; Feito, Isabel

2014-07-01

Seasonal drought, typical of temperate and Mediterranean environments, creates problems in establishing plantations and affects development and yield, and it has been widely studied in numerous species. Forestry fast-growing species such as Eucalyptus spp. are an important resource in such environments, selected clones being generally used for production purposes in plantations in these areas. However, use of mono-specific plantations increases risk of plant loss due to abiotic stresses, making it essential to understand differences in an individual clone's physiological responses to drought stress. In order to study clonal differences in drought responses, nine Eucalyptus globulus (Labill.) clones (C14, C46, C97, C120, C222, C371, C405, C491 and C601) were gradually subjected to severe drought stress (<14% of field capacity). A total of 31 parameters, physiological (e.g., photosynthesis, gas exchange), biochemical (e.g., chlorophyll content) and hormonal (abscisic acid [ABA] content), were analysed by classic and multivariate techniques. Relationships between parameters were established, allowing related measurements to be grouped into functional units (pigment, growth, water and ABA). Differences in these units showed that there were two distinct groups of E. globulus clones on the basis of their different strategies when faced with drought stress. The C14 group (C14, C120, C405, C491 and C601) clones behave as water savers, maintaining high water content and showing high stomatal adjustment, and reducing their aerial growth to a great extent. The C46 group (C46, C97, C222 and C371) clones behave as water spenders, reducing their water content drastically and presenting osmotic adjustment. The latter maintains the highest growth rate under the conditions tested. The method presented here can be used to identify appropriate E. globulus clones for drought environments, facilitating the selection of material for production and repopulation environments. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

A reassessment of IgM memory subsets in humans

PubMed Central

Bagnara, Davide; Squillario, Margherita; Kipling, David; Mora, Thierry; Walczak, Aleksandra M.; Da Silva, Lucie; Weller, Sandra; Dunn-Walters, Deborah K.; Weill, Jean-Claude; Reynaud, Claude-Agnès

2015-01-01

From paired blood and spleen samples from three adult donors we performed high-throughput V-h sequencing of human B-cell subsets defined by IgD and CD27 expression: IgD+CD27+ (“MZ”), IgD−CD27+(“memory”, including IgM (“IgM-only”), IgG and IgA) and IgD−CD27− cells (“double-negative”, including IgM, IgG and IgA). 91,294 unique sequences clustered in 42,670 clones, revealing major clonal expansions in each of these subsets. Among these clones, we further analyzed those shared sequences from different subsets or tissues for Vh-gene mutation, H-CDR3-length, and Vh/Jh usage, comparing these different characteristics with all sequences from their subset of origin, for which these parameters constitute a distinct signature. The IgM-only repertoire profile differed notably from that of MZ B cells by a higher mutation frequency, and lower Vh4 and higher Jh6 gene usage. Strikingly, IgM sequences from clones shared between the MZ and the memory IgG/IgA compartments showed a mutation and repertoire profile of IgM-only and not of MZ B cells. Similarly, all IgM clonal relationships (between MZ, IgM-only, and double-negative compartments) involved sequences with the characteristics of IgM-only B cells. Finally, clonal relationships between tissues suggested distinct recirculation characteristics between MZ and switched B cells. The “IgM-only” subset (including cells with its repertoire signature but higher IgD or lower CD27 expression levels) thus appear as the only subset showing precursor-product relationships with CD27+ switched memory B cells, indicating that they represent germinal center-derived IgM memory B cells, and that IgM memory and MZ B cells constitute two distinct entities. PMID:26355154

A Reassessment of IgM Memory Subsets in Humans.

PubMed

Bagnara, Davide; Squillario, Margherita; Kipling, David; Mora, Thierry; Walczak, Aleksandra M; Da Silva, Lucie; Weller, Sandra; Dunn-Walters, Deborah K; Weill, Jean-Claude; Reynaud, Claude-Agnès

2015-10-15

From paired blood and spleen samples from three adult donors, we performed high-throughput VH sequencing of human B cell subsets defined by IgD and CD27 expression: IgD(+)CD27(+) ("marginal zone [MZ]"), IgD(-)CD27(+) ("memory," including IgM ["IgM-only"], IgG and IgA) and IgD(-)CD27(-) cells ("double-negative," including IgM, IgG, and IgA). A total of 91,294 unique sequences clustered in 42,670 clones, revealing major clonal expansions in each of these subsets. Among these clones, we further analyzed those shared sequences from different subsets or tissues for VH gene mutation, H-CDR3-length, and VH/JH usage, comparing these different characteristics with all sequences from their subset of origin for which these parameters constitute a distinct signature. The IgM-only repertoire profile differed notably from that of MZ B cells by a higher mutation frequency and lower VH4 and higher JH6 gene usage. Strikingly, IgM sequences from clones shared between the MZ and the memory IgG/IgA compartments showed a mutation and repertoire profile of IgM-only and not of MZ B cells. Similarly, all IgM clonal relationships (among MZ, IgM-only, and double-negative compartments) involved sequences with the characteristics of IgM-only B cells. Finally, clonal relationships between tissues suggested distinct recirculation characteristics between MZ and switched B cells. The "IgM-only" subset (including cells with its repertoire signature but higher IgD or lower CD27 expression levels) thus appear as the only subset showing precursor-product relationships with CD27(+) switched memory B cells, indicating that they represent germinal center-derived IgM memory B cells and that IgM memory and MZ B cells constitute two distinct entities. Copyright © 2015 by The American Association of Immunologists, Inc.

HIGH-THROUGHPUT IDENTIFICATION OF THE PREDOMINANT MALARIA PARASITE CLONE IN COMPLEX BLOOD STAGE INFECTIONS USING A MULTI-SNP MOLECULAR HAPLOTYPING ASSAY

PubMed Central

COLE-TOBIAN, JENNIFER L.; ZIMMERMAN, PETER A.; KING, CHRISTOPHER L.

2013-01-01

Individuals living in malaria endemic areas are often infected with multiple parasite clones. Currently used single nucleotide polymorphism (SNP) genotyping methods for malaria parasites are cumbersome; furthermore, few methods currently exist that can rapidly determine the most abundant clone in these complex infections. Here we describe an oligonucleotide ligation assay (OLA) to distinguish SNPs in the Plasmodium vivax Duffy binding protein gene (Pvdbp) at 14 polymorphic residues simultaneously. Allele abundance is determined by the highest mean fluorescent intensity of each allele. Using mixtures of plasmids encoding known haplotypes of the Pvdbp, single clones of P. vivax parasites from infected Aotus monkeys, and well-defined mixed infections from field samples, we were able to identify the predominant Pvdbp genotype with > 93% accuracy when the dominant clone is twice as abundant as a lesser genotype and > 97% of the time if the ratio was 5:1 or greater. Thus, the OLA can accurately, reproducibly, and rapidly determine the predominant parasite haplotype in complex blood stage infections. PMID:17255222

Fast conversion of scFv to Fab antibodies using type IIs restriction enzymes.

PubMed

Sanmark, Hanna; Huovinen, Tuomas; Matikka, Tero; Pettersson, Tiina; Lahti, Maria; Lamminmäki, Urpo

2015-11-01

Single chain variable fragment (scFv) antibody libraries are widely used for developing novel bioaffinity reagents, although Fab or IgG molecules are the preferred antibody formats in many final applications. Therefore, rapid conversion methods for combining multiple DNA fragments are needed to attach constant domains to the scFv derived variable domains. In this study we describe a fast and easy cloning method for the conversion of single framework scFv fragments to Fab fragments using type IIS restriction enzymes. All cloning steps excluding plating of the Fab transformants can be done in 96 well plates and the procedure can be completed in one working day. The concept was tested by converting 69 scFv clones into Fab format on 96 well plates, which resulted in 93% success rate. The method is particularly useful as a high-throughput tool for the conversion of the chosen scFv clones into Fab molecules in order to analyze them as early as possible, as the conversion can significantly affect the binding properties of the chosen clones. Copyright © 2015 Elsevier B.V. All rights reserved.

Molecular cloning and characterization of Hymenolepis diminuta alpha-tubulin gene.

PubMed

Mohajer-Maghari, Behrokh; Amini-Bavil-Olyaee, Samad; Webb, Rodney A; Coe, Imogen R

2007-02-01

To isolate a full-length alpha-tubulin cDNA from an eucestode, Hymenolepis diminuta, a lambda phage cDNA library was constructed. The alpha-tubulin gene was cloned, sequenced and characterized. The H. diminuta alpha-tubulin consisted of 450 amino acids. This protein contained putative sites for all posttranslational modifications as detyrosination/tyrosination at the carboxyl-terminal of protien, phosphorylation at residues R79 and K336, glycylation/glutamylation at residue G445 and acetylation at residue K40. Comparisons of H. diminuta alpha-tubulin with all full-length alpha-tubulin proteins revealed that H. diminuta alpha-tubulin possesses 10 distinctive residues, which are not found in any other alpha-tubulins. Phylogenetic analysis showed that H. diminuta alpha-tubulin has grouped in a separated branch adjacent eucestode and trematodes branch with 92% bootstrap value (1000 replicates). In conclusion, this is the first report of H. diminuta cDNA library construction, cloning and characterization of H. diminuta alpha-tubulin gene.

Fluorescent Amplified-Fragment Length Polymorphism Genotyping of Neisseria meningitidis Identifies Clones Associated with Invasive Disease

PubMed Central

Goulding, Jonathan N.; Hookey, John V.; Stanley, John; Olver, Will; Neal, Keith R.; Ala'Aldeen, Dlawer A. A.; Arnold, Catherine

2000-01-01

Fluorescent amplified-fragment length polymorphism (FAFLP), a genotyping technique with phylogenetic significance, was applied to 123 isolates of Neisseria meningitidis. Nine of these were from an outbreak in a British university; 9 were from a recent outbreak in Pontypridd, Glamorgan; 15 were from sporadic cases of meningococcal disease; 26 were from the National Collection of Type Cultures; 58 were carrier isolates from Ironville, Derbyshire; 1 was a disease isolate from Ironville; and five were representatives of invasive clones of N. meningitidis. FAFLP analysis results were compared with previously published multilocus sequence typing (MLST) and pulsed-field gel electrophoresis (PFGE) results. FAFLP was able to identify hypervirulent, hyperendemic lineages (invasive clones) of N. meningitidis as well as did MLST. PFGE did not discriminate between two strains from the outbreak that were classified as similar but distinct by FAFLP. The results suggest that high resolution of N. meningitidis for outbreak and other epidemiological analyses is more cost efficient by FAFLP than by sequencing procedures. PMID:11101599

Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

DOE Office of Scientific and Technical Information (OSTI.GOV)

C.A.Reddy, PI

2005-06-30

G. lucidum is one of the most important and widely distributed ligninolytic white rot fungi from habitats such as forest soils, agricultural soils, and tropical mangrove ecosystems and produce laccases as an important family of lignin modifying enzymes. Biochemically, laccases are blue multi copper oxidases that couple four electron reduction of molecular oxygen to water. There is a growing interest in the use of laccases for a variety of industrial applications such as bio-pulping and biobleaching as well as in their ability to detoxify a wide variety of toxic environmental pollutants. These key oxidative enzymes are found in all themore » three domains of life: Eukaryota. Prokarya, and Archaea. Ganoderma lucidum (strain no.103561) produces laccase with some of the highest activity (17,000 micro katals per mg of protein) reported for any laccases to date. Our results showed that this organism produces at least 11 different isoforms of laccase based on variation in mol. weight and/or PI. Our Studies showed that the presence of copper in the medium yields 15- to 20-fold greater levels of enzyme by G. lucidum. Dialysation of extra cellular fluid of G. lucidum against 10mM sodium tartrate (pH5.5) gave an additional 15 to 17 fold stimulation of activity with an observed specific activity of 17,000 {micro}katals/mg protein. Dialysis against acetate buffer gave five fold increase in activity while dialysis against glycine showed inhibition of activity. Purification by FPLC and preparative gel electrophoresis gave purified fractions that resolved into eleven isoforms as separated by isoelectric focusing, and the PI,s were 4.7, 4.6, 4.5, 4.3, 4.2, 4.1, 3.8, 3.7, 3.5, 3.4 and 3.3. Genomic clones of laccase were isolated using G. lucidum DNA as a template and using inverse PCR and forward/reverse primers corresponding to the sequences of the conserved copper binding region in the N-terminal domain of one of the laccases of this organism. Inverse PCR amplication of HindIII digested and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity of 53-55% to Trametes versicolorLAC3 and LAC4. The consensus copper-binding domains found in other basidiomycete laccases are conserved in the LAC1 protein of G.lucidum. Eight putative N-glycosylation sites as well as consensus eukaryotic promoter sequence and polyadenylation signal sequences are also found. Coding sequence of lac4 is interrupted by 7 introns, encodes a mature protein of 525aa (Mr: 57,750), and has 98% nt homology to lac1, but was otherwise identical. Molecular masses of GLAC1 and GLAC4 were 49.8 kDa (462aa) and 52.5 kDa (524aa) in comparison to T. versicolr laccase which was 56.3 kDa (524aa). Predicted PI values of GLAC1, GLAC4 and T. versicolor laccase are, respectively 4.5, 4.7, and 4.2. Eight other laccase clones, distinct from lac1 and lac4 have recently been isolated from G. lucidum Our results show the existence of a laccase multi-gene family in G. lucidum in agreement with our earlier results showing multiple isoforms of laccase in this organism.« less

Evolution and Epidemiology of Multidrug-Resistant Klebsiella pneumoniae in the United Kingdom and Ireland

PubMed Central

Moradigaravand, Danesh; Martin, Veronique; Peacock, Sharon J.

2017-01-01

ABSTRACT Klebsiella pneumoniae is a human commensal and opportunistic pathogen that has become a leading causative agent of hospital-based infections over the past few decades. The emergence and global expansion of hypervirulent and multidrug-resistant (MDR) clones of K. pneumoniae have been increasingly reported in community-acquired and nosocomial infections. Despite this, the population genomics and epidemiology of MDR K. pneumoniae at the national level are still poorly understood. To obtain insights into these, we analyzed a systematic large-scale collection of invasive MDR K. pneumoniae isolates from hospitals across the United Kingdom and Ireland. Using whole-genome phylogenetic analysis, we placed these in the context of previously sequenced K. pneumoniae populations from geographically diverse countries and identified their virulence and drug resistance determinants. Our results demonstrate that United Kingdom and Ireland MDR isolates are a highly diverse population drawn from across the global phylogenetic tree of K. pneumoniae and represent multiple recent international introductions that are mainly from Europe but in some cases from more distant countries. In addition, we identified novel genetic determinants underlying resistance to beta-lactams, gentamicin, ciprofloxacin, and tetracyclines, indicating that both increased virulence and resistance have emerged independently multiple times throughout the population. Our data show that MDR K. pneumoniae isolates in the United Kingdom and Ireland have multiple distinct origins and appear to be part of a globally circulating K. pneumoniae population. PMID:28223459

Molecular complexity of successive bacterial epidemics deconvoluted by comparative pathogenomics.

PubMed

Beres, Stephen B; Carroll, Ronan K; Shea, Patrick R; Sitkiewicz, Izabela; Martinez-Gutierrez, Juan Carlos; Low, Donald E; McGeer, Allison; Willey, Barbara M; Green, Karen; Tyrrell, Gregory J; Goldman, Thomas D; Feldgarden, Michael; Birren, Bruce W; Fofanov, Yuriy; Boos, John; Wheaton, William D; Honisch, Christiane; Musser, James M

2010-03-02

Understanding the fine-structure molecular architecture of bacterial epidemics has been a long-sought goal of infectious disease research. We used short-read-length DNA sequencing coupled with mass spectroscopy analysis of SNPs to study the molecular pathogenomics of three successive epidemics of invasive infections involving 344 serotype M3 group A Streptococcus in Ontario, Canada. Sequencing the genome of 95 strains from the three epidemics, coupled with analysis of 280 biallelic SNPs in all 344 strains, revealed an unexpectedly complex population structure composed of a dynamic mixture of distinct clonally related complexes. We discovered that each epidemic is dominated by micro- and macrobursts of multiple emergent clones, some with distinct strain genotype-patient phenotype relationships. On average, strains were differentiated from one another by only 49 SNPs and 11 insertion-deletion events (indels) in the core genome. Ten percent of SNPs are strain specific; that is, each strain has a unique genome sequence. We identified nonrandom temporal-spatial patterns of strain distribution within and between the epidemic peaks. The extensive full-genome data permitted us to identify genes with significantly increased rates of nonsynonymous (amino acid-altering) nucleotide polymorphisms, thereby providing clues about selective forces operative in the host. Comparative expression microarray analysis revealed that closely related strains differentiated by seemingly modest genetic changes can have significantly divergent transcriptomes. We conclude that enhanced understanding of bacterial epidemics requires a deep-sequencing, geographically centric, comparative pathogenomics strategy.

Caenorhabditis elegans OSR-1 regulates behavioral and physiological responses to hyperosmotic environments.

PubMed Central

Solomon, Aharon; Bandhakavi, Sricharan; Jabbar, Sean; Shah, Rena; Beitel, Greg J; Morimoto, Richard I

2004-01-01

The molecular mechanisms that enable multicellular organisms to sense and modulate their responses to hyperosmotic environments are poorly understood. Here, we employ Caenorhabditis elegans to characterize the response of a multicellular organism to osmotic stress and establish a genetic screen to isolate mutants that are osmotic stress resistant (OSR). In this study, we describe the cloning of a novel gene, osr-1, and demonstrate that it regulates osmosensation, adaptation, and survival in hyperosmotic environments. Whereas wild-type animals exposed to hyperosmotic conditions rapidly lose body volume, motility, and viability, osr-1(rm1) mutant animals maintain normal body volume, motility, and viability even upon chronic exposures to high osmolarity environments. In addition, osr-1(rm1) animals are specifically resistant to osmotic stress and are distinct from previously characterized osmotic avoidance defective (OSM) and general stress resistance age-1(hx546) mutants. OSR-1 is expressed in the hypodermis and intestine, and expression of OSR-1 in hypodermal cells rescues the osr-1(rm1) phenotypes. Genetic epistasis analysis indicates that OSR-1 regulates survival under osmotic stress via CaMKII and a conserved p38 MAP kinase signaling cascade and regulates osmotic avoidance and resistance to acute dehydration likely by distinct mechanisms. We suggest that OSR-1 plays a central role in integrating stress detection and adaptation responses by invoking multiple signaling pathways to promote survival under hyperosmotic environments. PMID:15166144

Evolutionary dynamics of paroxysmal nocturnal hemoglobinuria.

PubMed

Mon Père, Nathaniel; Lenaerts, Tom; Pacheco, Jorge M; Dingli, David

2018-06-01

Paroxysmal nocturnal hemoglobinuria (PNH) is an acquired clonal blood disorder characterized by hemolysis and a high risk of thrombosis, that is due to a deficiency in several cell surface proteins that prevent complement activation. Its origin has been traced to a somatic mutation in the PIG-A gene within hematopoietic stem cells (HSC). However, to date the question of how this mutant clone expands in size to contribute significantly to hematopoiesis remains under debate. One hypothesis posits the existence of a selective advantage of PIG-A mutated cells due to an immune mediated attack on normal HSC, but the evidence supporting this hypothesis is inconclusive. An alternative (and simpler) explanation attributes clonal expansion to neutral drift, in which case selection neither favours nor inhibits expansion of PIG-A mutated HSC. Here we examine the implications of the neutral drift model by numerically evolving a Markov chain for the probabilities of all possible outcomes, and investigate the possible occurrence and evolution, within this framework, of multiple independently arising clones within the HSC pool. Predictions of the model agree well with the known incidence of the disease and average age at diagnosis. Notwithstanding the slight difference in clonal expansion rates between our results and those reported in the literature, our model results lead to a relative stability of clone size when averaging multiple cases, in accord with what has been observed in human trials. The probability of a patient harbouring a second clone in the HSC pool was found to be extremely low ([Formula: see text]). Thus our results suggest that in clinical cases of PNH where two independent clones of mutant cells are observed, only one of those is likely to have originated in the HSC pool.

The Memory Cytotoxic T-Lymphocyte (CTL) Response to Human Cytomegalovirus Infection Contains Individual Peptide-Specific CTL Clones That Have Undergone Extensive Expansion In Vivo

PubMed Central

Weekes, Michael P.; Wills, Mark R.; Mynard, Kim; Carmichael, Andrew J.; Sissons, J. G. Patrick

1999-01-01

Human cytomegalovirus (HCMV)-specific CD8+ cytotoxic T lymphocytes (CTL) appear to play an important role in the control of virus replication and in protection against HCMV-related disease. We have previously reported high frequencies of memory CTL precursors (CTLp) specific to the HCMV tegument protein pp65 in the peripheral blood of healthy virus carriers. In some individuals, the CTL response to this protein is focused on only a single epitope, whereas in other virus carriers CTL recognized multiple epitopes which we identified by using synthetic peptides. We have analyzed the clonal composition of the memory CTL response to four of these pp65 epitopes by sequencing the T-cell receptors (TCR) of multiple independently derived epitope-specific CTL clones, which were derived by formal single-cell cloning or from clonal CTL microcultures. In all cases, we have observed a high degree of clonal focusing: the majority of CTL clones specific to a defined pp65 peptide from any one virus carrier use only one or two different TCRs at the level of the nucleotide sequence. Among virus carriers who have the same major histocompatibility complex (MHC) class I allele, we observed that CTL from different donors that recognize the same peptide-MHC complex often used the same Vβ segment, although other TCR gene segments and CDR3 length were not in general conserved. We have also examined the clonal composition of CTL specific to pp65 peptides in asymptomatic human immunodeficiency virus-infected individuals. We have observed a similarly focused peptide-specific CTL response. Thus, the large population of circulating HCMV peptide-specific memory CTLp in virus carriers in fact contains individual CTL clones that have undergone extensive clonal expansion in vivo. PMID:9971792

Dynamics of extended-spectrum cephalosporin resistance in pathogenic Escherichia coli isolated from diseased pigs in Quebec, Canada.

PubMed

Jahanbakhsh, Seyedehameneh; Smith, Matthew G; Kohan-Ghadr, Hamid-Reza; Letellier, Ann; Abraham, Sam; Trott, Darren J; Fairbrother, John Morris

2016-08-01

The aim of this study was to investigate the evolution with time of ceftiofur-resistant Escherichia coli clinical isolates from pigs in Québec, Canada, between 1997 and 2012 with respect to pathotypes, clones and antimicrobial resistance. Eighty-five ceftiofur-resistant E. coli isolates were obtained from the OIE (World Organisation for Animal Health) Reference Laboratory for Escherichia coli. The most prevalent pathovirotypes were enterotoxigenic E. coli (ETEC):F4 (40%), extraintestinal pathogenic E. coli (ExPEC) (16.5%) and Shiga toxin-producing E. coli (STEC):F18 (8.2%). Susceptibility testing to 15 antimicrobial agents revealed a high prevalence of resistance to 13 antimicrobials, with all isolates being multidrug-resistant. blaCMY-2 (96.5%) was the most frequently detected β-lactamase gene, followed by blaTEM (49.4%) and blaCTX-M (3.5%). Pulsed-field gel electrophoresis (PFGE) applied to 45 representative E. coli isolates revealed that resistance to ceftiofur is spread both horizontally and clonally. In addition, the emergence of extended-spectrum β-lactamase-producing E. coli isolates carrying blaCTX-M was observed in 2011 and 2012 in distinct clones. The most predominant plasmid incompatibility (Inc) groups were IncFIB, IncI1, IncA/C and IncFIC. Resistance to gentamicin, kanamycin and chloramphenicol as well as the frequency of blaTEM and IncA/C significantly decreased over the study period, whereas the frequency of IncI1 and multidrug resistance to seven antimicrobial categories significantly increased. These findings reveal that extended-spectrum cephalosporin-resistant porcine E. coli isolates in Québec belong to several different clones with diverse antimicrobial resistance patterns and plasmids. Furthermore, blaCMY-2 was the major β-lactamase gene in these isolates. From 2011, we report the emergence of blaCTX-M in distinct clones. Copyright © 2016 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.

Phylogenetic diversity, host-specificity and community profiling of sponge-associated bacteria in the northern Gulf of Mexico.

PubMed

Erwin, Patrick M; Olson, Julie B; Thacker, Robert W

2011-01-01

Marine sponges can associate with abundant and diverse consortia of microbial symbionts. However, associated bacteria remain unexamined for the majority of host sponges and few studies use phylogenetic metrics to quantify symbiont community diversity. DNA fingerprinting techniques, such as terminal restriction fragment length polymorphisms (T-RFLP), might provide rapid profiling of these communities, but have not been explicitly compared to traditional methods. We investigated the bacterial communities associated with the marine sponges Hymeniacidon heliophila and Haliclona tubifera, a sympatric tunicate, Didemnum sp., and ambient seawater from the northern Gulf of Mexico by combining replicated clone libraries with T-RFLP analyses of 16S rRNA gene sequences. Clone libraries revealed that bacterial communities associated with the two sponges exhibited lower species richness and lower species diversity than seawater and tunicate assemblages, with differences in species composition among all four source groups. T-RFLP profiles clustered microbial communities by source; individual T-RFs were matched to the majority (80.6%) of clone library sequences, indicating that T-RFLP analysis can be used to rapidly profile these communities. Phylogenetic metrics of community diversity indicated that the two sponge-associated bacterial communities include dominant and host-specific bacterial lineages that are distinct from bacteria recovered from seawater, tunicates, and unrelated sponge hosts. In addition, a large proportion of the symbionts associated with H. heliophila were shared with distant, conspecific host populations in the southwestern Atlantic (Brazil). The low diversity and species-specific nature of bacterial communities associated with H. heliophila and H. tubifera represent a distinctly different pattern from other, reportedly universal, sponge-associated bacterial communities. Our replicated sampling strategy, which included samples that reflect the ambient environment, allowed us to differentiate resident symbionts from potentially transient or prey bacteria. Pairing replicated clone library construction with rapid community profiling via T-RFLP analyses will greatly facilitate future studies of sponge-microbe symbioses.

Construction of New Campylobacter Cloning Vectors and a New Mutational Cat Cassette

DTIC Science & Technology

1993-01-01

mutational cat cassette PE - 61102A PR - 3M161102 6. AUTHOR(S) TA - BS13AK Yao R, Aim RA, Trust TJ, Guerry P WU- 1291 7. PERFORMING ORGANIZATION NAME(S) AND...mutational cat cassette %~ccesion For (Site-specific mutagenesis; recombinant DNA; multiple cloning site; PCR; shuttle vectors) NTIS CRA&I OTIC TAB E...campylobacter portion of these vectors, only three CAT , Cm acetyllraaseriase; car, gene encoding CAT , Cm, restriction sites in the IacZ MCS remain unique

ECOPASS - a multivariate model used as an index of growth performance of poplar clones

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ceulemans, R.; Impens, I.

The model (ECOlogical PASSport) reported was constructed by principal component analysis from a combination of biochemical, anatomical/morphological and ecophysiological gas exchange parameters measured on 5 fast growing poplar clones. Productivity data were 10 selected trees in 3 plantations in Belgium and given as m.a.i.(b.a.). The model is shown to be able to reflect not only genetic origin and the relative effects of the different parameters of the clones, but also their production potential. Multiple regression analysis of the 4 principal components showed a high cumulative correlation (96%) between the 3 components related to ecophysiological, biochemical and morphological parameters, and productivity;more » the ecophysiological component alone correlated 85% with productivity.« less

[Cloning and law in Hungary].

PubMed

Julesz, Máté

2015-03-01

Reproductive human cloning is prohibited in Hungary, as in many other countries. Therapeutic human cloning is not prohibited, just like in many other countries. Stem cell therapy is also allowed. Article III, paragraph (3) of the Hungarian basic law (constitution) strictly forbids total human cloning. Article 1 of the Additional Protocol to the Oviedo Convention, on the Prohibition of Cloning Human Beings (1998) stipulates that any intervention seeking to create a human being genetically identical to another human being, whether living or dead, is prohibited. In Hungary, according to Article 174 of the Criminal Code, total human cloning constitutes a crime. Article 180, paragraph (3) of the Hungarian Act on Health declares that embryos shall not be brought about for research purposes; research shall be conducted only on embryos brought about for reproductive purposes when this is authorized by the persons entitled to decide upon its disposal, or when the embryo is damaged. Article 180, paragraph (5) of the Hungarian Act on Health stipulates that multiple individuals who genetically conform to one another shall not be brought about. According to Article 181, paragraph (1) of the Hungarian Act on Health, an embryo used for research shall be kept alive for not longer than 14 days, not counting the time it was frozen for storage and the time period of research.

Functional exchangeability of the nuclear localization signal (NLS) of capsid protein between PCV1 and PCV2 in vitro: Implications for the role of NLS in viral replication

PubMed Central

2011-01-01

Background Porcine circovirus type 2 (PCV2) is believed to be the primary causative agent of postweaning multisystemic wasting syndrome (PMWS). It is supposed that capsid protein of PCV may contribute to replication control via interaction between Cap and Rep in the nucleoplasm. In this study, we described the construction and in vitro characterization of NLS-exchanged PCV DNA clones based on a PMWS-associated PCV2b isolate from China to determine the role of ORF2 NLS in PCV replication. Results The PCV1, PCV2, PCV2-NLS1 and PCV1-NLS2 DNA clone were generated by ligating a copy of respective genome in tandem with a partial duplication. The PCV2-NLS1 and PCV1-NLS2 DNA clone contained a chimeric genome in which the ORF2 NLS was exchanged. The four DNA clones were all confirmed to be infectious in vitro when transfected into PK-15 cells, as PCV capsid protein were expressed in approximately 10-20% of the transfected cells. The in vitro growth characteristics of the DNA clones were then determined and compared. All the recovered progeny viruses gave rise to increasing infectious titers during passages and were genetically stable by genomic sequencing. The chimeric PCV1-NLS2 and PCV2-NLS1 viruses had the final titers of about 104.2 and 103.8 TCID50/ml, which were significantly lower than that of PCV1 and PCV2 (105.6 and 105.0 TCID50/ml, respectively). When the ORF2 NLS exchanged, the mutant PCV2 (PCV2-NLS1) still replicated less efficiently and showed lower infectious titer than did PCV1 mutant (PCV1-NLS2), which was consistent with the distinction between wild type PCV1 and PCV2. Conclusions Recovery of the chimeiric PCV1-NLS2 and PCV2-NLS1 progeny viruses indicate that the nuclear localization signal sequence of capsid protein are functionally exchangeable between PCV1 and PCV2 with respect to the role of nuclear importing and propagation. The findings also reveal that ORF2 NLS play an accessory role in the replication of PCV. However, we found that ORF2 NLS was not responsible for the distinction of in vitro growth characteristic between PCV1 and PCV2. Further studies are required to determine the in vivo viral replication and pathogenicity of the NLS chimeric DNA clones. PMID:21733152

Rift Valley Fever Vaccine Virus Clone 13 Is Able to Cross the Ovine Placental Barrier Associated with Foetal Infections, Malformations, and Stillbirths.

PubMed

Makoschey, Birgit; van Kilsdonk, Emma; Hubers, Willem R; Vrijenhoek, Mieke P; Smit, Marianne; Wichgers Schreur, Paul J; Kortekaas, Jeroen; Moulin, Véronique

2016-03-01

Rift Valley fever virus (RVFV) is a mosquito-borne pathogen that affects domesticated ruminants and occasionally humans. Classical RVF vaccines are based on formalin-inactivated virus or the live-attenuated Smithburn strain. The inactivated vaccine is highly safe but requires multiple administrations and yearly re-vaccinations. Although the Smithburn vaccine provides solid protection after a single vaccination, this vaccine is not safe for pregnant animals. An alternative live-attenuated vaccine, named Clone 13, carries a large natural deletion in the NSs gene which encodes the major virulence factor of the virus. The Clone 13 vaccine was previously shown to be safe for young lambs and calves. Moreover, a study in pregnant ewes suggested that the vaccine could also be applied safely during gestation. To anticipate on a possible future incursion of RVFV in Europe, we have evaluated the safety of Clone 13 for young lambs and pregnant ewes. In line with the guidelines from the World Organisation for Animal health (Office International des Epizooties, OIE) and regulations of the European Pharmacopeia (EP), these studies were performed with an overdose. Our studies with lambs showed that Clone 13 dissemination within vaccinated animals is very limited. Moreover, the Clone 13 vaccine virus was not shed nor spread to in-contact sentinels and did not revert to virulence upon animal-to-animal passage. Importantly, a large experiment with pregnant ewes demonstrated that the Clone 13 virus is able to spread to the fetus, resulting in malformations and stillbirths. Altogether, our results suggest that Clone 13 can be applied safely in lambs, but that caution should be taken when Clone 13 is used in pregnant animals, particularly during the first trimester of gestation.

An Outbreak of Respiratory Tularemia Caused by Diverse Clones of Francisella tularensis

PubMed Central

Johansson, Anders; Lärkeryd, Adrian; Widerström, Micael; Mörtberg, Sara; Myrtännäs, Kerstin; Öhrman, Caroline; Birdsell, Dawn; Keim, Paul; Wagner, David M.; Forsman, Mats; Larsson, Pär

2014-01-01

Background. The bacterium Francisella tularensis is recognized for its virulence, infectivity, genetic homogeneity, and potential as a bioterrorism agent. Outbreaks of respiratory tularemia, caused by inhalation of this bacterium, are poorly understood. Such outbreaks are exceedingly rare, and F. tularensis is seldom recovered from clinical specimens. Methods. A localized outbreak of tularemia in Sweden was investigated. Sixty-seven humans contracted laboratory-verified respiratory tularemia. F. tularensis subspecies holarctica was isolated from the blood or pleural fluid of 10 individuals from July to September 2010. Using whole-genome sequencing and analysis of single-nucleotide polymorphisms (SNPs), outbreak isolates were compared with 110 archived global isolates. Results. There were 757 SNPs among the genomes of the 10 outbreak isolates and the 25 most closely related archival isolates (all from Sweden/Finland). Whole genomes of outbreak isolates were >99.9% similar at the nucleotide level and clustered into 3 distinct genetic clades. Unexpectedly, high-sequence similarity grouped some outbreak and archival isolates that originated from patients from different geographic regions and up to 10 years apart. Outbreak and archival genomes frequently differed by only 1–3 of 1 585 229 examined nucleotides. Conclusions. The outbreak was caused by diverse clones of F. tularensis that occurred concomitantly, were widespread, and apparently persisted in the environment. Multiple independent acquisitions of F. tularensis from the environment over a short time period suggest that natural outbreaks of respiratory tularemia are triggered by environmental cues. The findings additionally caution against interpreting genome sequence identity for this pathogen as proof of a direct epidemiological link. PMID:25097081

Genetic Diversity of Clinical and Environmental Strains of Salmonella enterica Serotype Weltevreden Isolated in Malaysia

PubMed Central

Thong, K. L.; Goh, Y. L.; Radu, S.; Noorzaleha, S.; Yasin, R.; Koh, Y. T.; Lim, V. K. E.; Rusul, G.; Puthucheary, S. D.

2002-01-01

The incidence of food-borne salmonellosis due to Salmonella enterica serotype Weltevreden is reported to be on the increase in Malaysia. The pulsed-field gel electrophoresis (PFGE) subtyping method was used to assess the extent of genetic diversity and clonality of Salmonella serotype Weltevreden strains from humans and the environment. PFGE of XbaI-digested chromosomal DNA from 95 strains of Salmonella serotype Weltevreden gave 39 distinct profiles with a wide range of Dice coefficients (0.27 to 1.00), indicating that PFGE is very discriminative and that multiple clones of Salmonella serotype Weltevreden exist among clinical and environmental isolates. Strains of one dominant pulsotype (pulsotype X1/X2) appeared to be endemic in this region, as they were consistently recovered from humans with salmonellosis between 1996 and 2001 and from raw vegetables. In addition, the sharing of similar PFGE profiles among isolates from humans, vegetables, and beef provides indirect evidence of the possible transmission of salmonellosis from contaminated raw vegetables and meat to humans. Furthermore, the recurrence of PFGE profile X21 among isolates found in samples of vegetables from one wet market indicated the persistence of this clone. The environment in the wet markets may represent a major source of cross-contamination of vegetables with Salmonella serotype Weltevreden. Antibiotic sensitivity tests showed that the clinical isolates of Salmonella serotype Weltevreden remained drug sensitive but that the vegetable isolates were resistant to at least two antibiotics. To the best of our knowledge, this is the first study to compare clinical and environmental isolates of Salmonella serotype Weltevreden in Malaysia. PMID:12089269

Genetic diversity of clinical and environmental strains of Salmonella enterica serotype Weltevreden isolated in Malaysia.

PubMed

Thong, K L; Goh, Y L; Radu, S; Noorzaleha, S; Yasin, R; Koh, Y T; Lim, V K E; Rusul, G; Puthucheary, S D

2002-07-01

The incidence of food-borne salmonellosis due to Salmonella enterica serotype Weltevreden is reported to be on the increase in Malaysia. The pulsed-field gel electrophoresis (PFGE) subtyping method was used to assess the extent of genetic diversity and clonality of Salmonella serotype Weltevreden strains from humans and the environment. PFGE of XbaI-digested chromosomal DNA from 95 strains of Salmonella serotype Weltevreden gave 39 distinct profiles with a wide range of Dice coefficients (0.27 to 1.00), indicating that PFGE is very discriminative and that multiple clones of Salmonella serotype Weltevreden exist among clinical and environmental isolates. Strains of one dominant pulsotype (pulsotype X1/X2) appeared to be endemic in this region, as they were consistently recovered from humans with salmonellosis between 1996 and 2001 and from raw vegetables. In addition, the sharing of similar PFGE profiles among isolates from humans, vegetables, and beef provides indirect evidence of the possible transmission of salmonellosis from contaminated raw vegetables and meat to humans. Furthermore, the recurrence of PFGE profile X21 among isolates found in samples of vegetables from one wet market indicated the persistence of this clone. The environment in the wet markets may represent a major source of cross-contamination of vegetables with Salmonella serotype Weltevreden. Antibiotic sensitivity tests showed that the clinical isolates of Salmonella serotype Weltevreden remained drug sensitive but that the vegetable isolates were resistant to at least two antibiotics. To the best of our knowledge, this is the first study to compare clinical and environmental isolates of Salmonella serotype Weltevreden in Malaysia.

Bacterial diversity and reductive dehalogenase redundancy in a 1,2-dichloroethane-degrading bacterial consortium enriched from a contaminated aquifer

PubMed Central

2010-01-01

Background Bacteria possess a reservoir of metabolic functionalities ready to be exploited for multiple purposes. The use of microorganisms to clean up xenobiotics from polluted ecosystems (e.g. soil and water) represents an eco-sustainable and powerful alternative to traditional remediation processes. Recent developments in molecular-biology-based techniques have led to rapid and accurate strategies for monitoring and identification of bacteria and catabolic genes involved in the degradation of xenobiotics, key processes to follow up the activities in situ. Results We report the characterization of the response of an enriched bacterial community of a 1,2-dichloroethane (1,2-DCA) contaminated aquifer to the spiking with 5 mM lactate as electron donor in microcosm studies. After 15 days of incubation, the microbial community structure was analyzed. The bacterial 16S rRNA gene clone library showed that the most represented phylogenetic group within the consortium was affiliated with the phylum Firmicutes. Among them, known degraders of chlorinated compounds were identified. A reductive dehalogenase genes clone library showed that the community held four phylogenetically-distinct catalytic enzymes, all conserving signature residues previously shown to be linked to 1,2-DCA dehalogenation. Conclusions The overall data indicate that the enriched bacterial consortium shares the metabolic functionality between different members of the microbial community and is characterized by a high functional redundancy. These are fundamental features for the maintenance of the community's functionality, especially under stress conditions and suggest the feasibility of a bioremediation treatment with a potential prompt dehalogenation and a process stability over time. PMID:20170484

Cytotoxic T cell clones isolated from ovarian tumor-infiltrating lymphocytes recognize multiple antigenic epitopes on autologous tumor cells.

PubMed

Ioannides, C G; Freedman, R S; Platsoucas, C D; Rashed, S; Kim, Y P

1991-03-01

CTL clones were developed from tumor infiltrating lymphocytes (TIL) from the ascites of a patient with ovarian carcinoma by coculture of TIL with autologous tumor cells and subsequent cloning in the presence of autologous tumor cells. These CTL clones expressed preferential cytolytic activity against autologous tumor cells but not against allogeneic ovarian tumor cells and the NK-sensitive cell line K562. The cytolytic activity of these CTL against autologous tumors was inhibited by anti-TCR (WT31 mAb), anti-HLA class I, and anti-CD3 mAb but not by the NK function antibody Leu 11b. Cloning of the autologous tumor cells in vitro revealed that the CTL clones of the ovarian TIL expressed differential abilities to lyse autologous tumor cell clones. The specificity analysis of these autologous tumor specific CTL suggested that they recognize several antigenic determinants present on the ovarian tumor cells. Our results indicate the presence of at least three antigenic epitopes on the tumor cells (designated OVA-1A, OVA-1B, and OVA-1C), one of which (OVA-1C) is unstable. These determinants are present either simultaneously or separately, and six types of ovarian clones can be distinguished on the basis of their expression. These results indicate that CTL of the TIL detect intratumor antigenic heterogeneity. The novel heterogeneity identified within the ovarian tumor cells in this report may be of significance for understanding cellular immunity in ovarian cancer and developing adoptive specific immunotherapeutic approaches in ovarian cancer.

United we stand, divided we fall: a meta-analysis of experiments on clonal integration and its relationship to invasiveness.

PubMed

Song, Yao-Bin; Yu, Fei-Hai; Keser, Lidewij H; Dawson, Wayne; Fischer, Markus; Dong, Ming; van Kleunen, Mark

2013-02-01

Many ecosystems are dominated by clonal plants. Among the most distinctive characteristics of clonal plants is their potential for clonal integration (i.e. the translocation of resources between interconnected ramets), suggesting that integration may play a role in their success. However, a general synthesis of effects of clonal integration on plant performance is lacking. We conducted a meta-analysis on the effects of clonal integration on biomass production and asexual reproduction of the whole clone, the recipient part (i.e. the part of a clone that imports resources) and the donor part (i.e. the part of a clone that exports resources). The final dataset contained 389 effect sizes from 84 studies covering 57 taxa. Overall, clonal integration increased performance of recipient parts without decreasing that of donor parts, and thus increased performance of whole clones. Among the studies and taxa considered, the benefits of clonal integration did not differ between two types of experimental approaches, between stoloniferous and rhizomatous growth forms, between directions of resource translocation (from younger to older ramet or vice versa), or among types of translocated resources (water, nutrients and carbohydrates). Clonal taxa with larger benefits of integration on whole-clone performance were not more invasive globally, but taxa in which recipient parts in unfavorable patches benefited more from integration were. Our results demonstrate general performance benefits of clonal integration, at least in the short term, and suggest that clonal integration contributes to the success of clonal plants.

Steady-state nutrition of soil grown trembling aspen clones and the potential for gaseous pollutant experiments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Coleman, M.D.; Dickson, R.E.; Isebrands, J.G.

To assess the interaction of gaseous pollutants and plant nutrition it is desirable to grow plants at a constant growth rate while maintaining constant nutrient status. Once constant, or steady-state, conditions are established relationships between growth, nutrition, physiology and stress responses are simplified. Relative nutrient additions are an effective way to maintain such constant conditions in solution culture; however, few experiments have applied such treatments to soil grown plants. This experiment evaluates the response of two aspen clones (259 and 271) to various relative nutrient addition rates (1,2,3,4,5 % per day) applied to the peat:sand:vermiculite growing media. Although the initialmore » lag phase (adjustment period) lasted up to 50 days, subsequent relative growth rates were uniform and related to treatment. Growth responses among treatments were distinct with final biomass in the higher addition rates (3,4,5% per day) as much as twice that of the next lower treatment. Clone 271 (ozone tolerant) produced only 61% of the biomass that clone 259 (ozone sensitive) produced in the 5% per day treatment. Final leaf nitrogen was 1.5, 2.1, 3.4, 3.8, 4.3% dry weight for 1 to 5% per day addition rate treatments respectively. Concentrations between clones were equal. Results demonstrate the effectiveness of steady-state nutrition in controlling growth and nutrient status of soil grown aspen, enabling more critical control of stress experiments.« less

Sphagnum palustre clone vs native Pseudoscleropodium purum: A first trial in the field to validate the future of the moss bag technique.

PubMed

Capozzi, F; Adamo, P; Di Palma, A; Aboal, J R; Bargagli, R; Fernandez, J A; Lopez Mahia, P; Reski, R; Tretiach, M; Spagnuolo, V; Giordano, S

2017-06-01

Although a large body of literature exists on the use of transplanted mosses for biomonitoring of air pollution, no article has addressed so far the use and the accumulation performance of a cloned moss for this purpose. In this work, a direct comparison of metal accumulation between bags filled with a Sphagnum palustre L. clone or with native Pseudoscleropodium purum Hedw., one of the most used moss species in biomonitoring surveys, was investigated. The test was performed in sites with different atmospheric contamination levels selected in urban, industrial, agricultural and background areas of Italy and Spain. Among the eighteen elements investigated, S. palustre was significantly enriched in 10 elements (Al, Ba, Cr, Cu, Fe, Hg, Pb, Sr, V and Zn), while P. purum was enriched only in 6 elements (Al, Ba, Cu, Hg, Pb and Sr), and had a consistently lower uptake capacity than S. palustre. The clone proved to be more sensitive in terms of metal uptake and showed a better performance as a bioaccumulator, providing a higher accumulation signal and allowing a finer distinction among the different land uses and levels of pollution. The excellent uptake performance of the S. palustre clone compared to the native P. purum and its low and stable baseline elemental content, evidenced in this work, are key features for the improvement of the moss bag approach and its large scale application. Copyright © 2017 Elsevier Ltd. All rights reserved.

Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues.

PubMed Central

Prody, C A; Zevin-Sonkin, D; Gnatt, A; Goldberg, O; Soreq, H

1987-01-01

To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase (BtChoEase; EC 3.1.1.8) and Torpedo electric organ "true" acetylcholinesterase (AcChoEase; EC 3.1.1.7). Using these probes, we isolated several cDNA clones from lambda gt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. In RNA blots of poly(A)+ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These findings demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species. Images PMID:3035536

Differences between bacterial communities in the gut of a soil-feeding termite (Cubitermes niokoloensis) and its mounds.

PubMed

Fall, Saliou; Hamelin, Jérôme; Ndiaye, Farma; Assigbetse, Komi; Aragno, Michel; Chotte, Jean Luc; Brauman, Alain

2007-08-01

In tropical ecosystems, termite mound soils constitute an important soil compartment covering around 10% of African soils. Previous studies have shown (S. Fall, S. Nazaret, J. L. Chotte, and A. Brauman, Microb. Ecol. 28:191-199, 2004) that the bacterial genetic structure of the mounds of soil-feeding termites (Cubitermes niokoloensis) is different from that of their surrounding soil. The aim of this study was to characterize the specificity of bacterial communities within mounds with respect to the digestive and soil origins of the mound. We have compared the bacterial community structures of a termite mound, termite gut sections, and surrounding soil using PCR-denaturing gradient gel electrophoresis (DGGE) analysis and cloning and sequencing of PCR-amplified 16S rRNA gene fragments. DGGE analysis revealed a drastic difference between the genetic structures of the bacterial communities of the termite gut and the mound. Analysis of 266 clones, including 54 from excised bands, revealed a high level of diversity in each biota investigated. The soil-feeding termite mound was dominated by the Actinobacteria phylum, whereas the Firmicutes and Proteobacteria phyla dominate the gut sections of termites and the surrounding soil, respectively. Phylogenetic analyses revealed a distinct clustering of Actinobacteria phylotypes between the mound and the surrounding soil. The Actinobacteria clones of the termite mound were diverse, distributed among 10 distinct families, and like those in the termite gut environment lightly dominated by the Nocardioidaceae family. Our findings confirmed that the soil-feeding termite mound (C. niokoloensis) represents a specific bacterial habitat in the tropics.

Identification of a Highly Transmissible Animal-Independent Staphylococcus aureus ST398 Clone with Distinct Genomic and Cell Adhesion Properties

PubMed Central

Uhlemann, Anne-Catrin; Porcella, Stephen F.; Trivedi, Sheetal; Sullivan, Sean B.; Hafer, Cory; Kennedy, Adam D.; Barbian, Kent D.; McCarthy, Alex J.; Street, Craig; Hirschberg, David L.; Lipkin, W. Ian; Lindsay, Jodi A.; DeLeo, Frank R.; Lowy, Franklin D.

2012-01-01

ABSTRACT A methicillin-resistant Staphylococcus aureus (MRSA) clone known as ST398 has emerged as a major cause of acute infections in individuals who have close contact with livestock. More recently, the emergence of an animal-independent ST398 methicillin-sensitive S. aureus (MSSA) clone has been documented in several countries. However, the limited surveillance of MSSA has precluded an accurate assessment of the global spread of ST398 and its clinical relevance. Here we provide evidence that ST398 is a frequent source of MSSA infections in northern Manhattan and is readily transmitted between individuals in households. This contrasts with the limited transmissibility of livestock-associated ST398 (LA-ST398) MRSA strains between humans. Our whole-genome sequence analysis revealed that the chromosome of the human-associated ST398 MSSA clone is smaller than that of the LA-ST398 MRSA reference strain S0385, due mainly to fewer mobile genetic elements (MGEs). In contrast, human ST398 MSSA isolates harbored the prophage φ3 and the human-specific immune evasion cluster (IEC) genes chp and scn. While most of the core genome was conserved between the human ST398 MSSA clone and S0385, these strains differed substantially in their repertoire and composition of intact adhesion genes. These genetic changes were associated with significantly enhanced adhesion of human ST398 MSSA isolates to human skin keratinocytes and keratin. We propose that the human ST398 MSSA clone can spread independent of animal contact using an optimized repertoire of MGEs and adhesion molecules adapted to transmission among humans. PMID:22375071

Self-mating in the definitive host potentiates clonal outbreaks of the apicomplexan parasites Sarcocystis neurona and Toxoplasma gondii.

PubMed

Wendte, Jered M; Miller, Melissa A; Lambourn, Dyanna M; Magargal, Spencer L; Jessup, David A; Grigg, Michael E

2010-12-23

Tissue-encysting coccidia, including Toxoplasma gondii and Sarcocystis neurona, are heterogamous parasites with sexual and asexual life stages in definitive and intermediate hosts, respectively. During its sexual life stage, T. gondii reproduces either by genetic out-crossing or via clonal amplification of a single strain through self-mating. Out-crossing has been experimentally verified as a potent mechanism capable of producing offspring possessing a range of adaptive and virulence potentials. In contrast, selfing and other life history traits, such as asexual expansion of tissue-cysts by oral transmission among intermediate hosts, have been proposed to explain the genetic basis for the clonal population structure of T. gondii. In this study, we investigated the contributing roles self-mating and sexual recombination play in nature to maintain clonal population structures and produce or expand parasite clones capable of causing disease epidemics for two tissue encysting parasites. We applied high-resolution genotyping against strains isolated from a T. gondii waterborne outbreak that caused symptomatic disease in 155 immune-competent people in Brazil and a S. neurona outbreak that resulted in a mass mortality event in Southern sea otters. In both cases, a single, genetically distinct clone was found infecting outbreak-exposed individuals. Furthermore, the T. gondii outbreak clone was one of several apparently recombinant progeny recovered from the local environment. Since oocysts or sporocysts were the infectious form implicated in each outbreak, the expansion of the epidemic clone can be explained by self-mating. The results also show that out-crossing preceded selfing to produce the virulent T. gondii clone. For the tissue encysting coccidia, self-mating exists as a key adaptation potentiating the epidemic expansion and transmission of newly emerged parasite clones that can profoundly shape parasite population genetic structures or cause devastating disease outbreaks.

Development of three full-length infectious cDNA clones of distinct brassica yellows virus genotypes for agrobacterium-mediated inoculation.

PubMed

Zhang, Xiao-Yan; Dong, Shu-Wei; Xiang, Hai-Ying; Chen, Xiang-Ru; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

2015-02-02

Brassica yellows virus is a newly identified species in the genus of Polerovirus within the family Luteoviridae. Brassica yellows virus (BrYV) is prevalently distributed throughout Mainland China and South Korea, is an important virus infecting cruciferous crops. Based on six BrYV genomic sequences of isolates from oilseed rape, rutabaga, radish, and cabbage, three genotypes, BrYV-A, BrYV-B, and BrYV-C, exist, which mainly differ in the 5' terminal half of the genome. BrYV is an aphid-transmitted and phloem-limited virus. The use of infectious cDNA clones is an alternative means of infecting plants that allows reverse genetic studies to be performed. In this study, full-length cDNA clones of BrYV-A, recombinant BrYV5B3A, and BrYV-C were constructed under control of the cauliflower mosaic virus 35S promoter. An agrobacterium-mediated inoculation system of Nicotiana benthamiana was developed using these cDNA clones. Three days after infiltration with full-length BrYV cDNA clones, necrotic symptoms were observed in the inoculated leaves of N. benthamiana; however, no obvious symptoms appeared in the upper leaves. Reverse transcription-PCR (RT-PCR) and western blot detection of samples from the upper leaves showed that the maximum infection efficiency of BrYVs could reach 100%. The infectivity of the BrYV-A, BrYV-5B3A, and BrYV-C cDNA clones was further confirmed by northern hybridization. The system developed here will be useful for further studies of BrYV, such as host range, pathogenicity, viral gene functions, and plant-virus-vector interactions, and especially for discerning the differences among the three genotypes. Copyright © 2014 Elsevier B.V. All rights reserved.

Dynamics of long-term colonization of respiratory tract by Haemophilus influenzae in cystic fibrosis patients shows a marked increase in hypermutable strains.

PubMed

Román, Federico; Cantón, Rafael; Pérez-Vázquez, María; Baquero, Fernando; Campos, José

2004-04-01

The persistence and variability of 188 Haemophilus influenzae isolates in respiratory tract of 30 cystic fibrosis (CF) patients over the course of 7 years was studied. Antibiotic susceptibility testing, DNA fingerprinting, and analysis of outer membrane protein profiles were performed on all isolates. A total of 115 distinct pulsed-field gel electrophoresis profiles were identified. Ninety percent of patients were cocolonized with two or more clones over the studied period. A third of the patients were cross-colonized with one or two H. influenzae strains; 11% of the clones persisted for 3 or more months. Biotype, outer membrane protein profiles, and resistance profiles showed variation along the studied period, even in persisting clones. Four isolates (2.1%) recovered from 3 patients were type f capsulate, with three of them belonging to the same clone. beta-Lactamase production was detected in 23.9% of isolates while 7% of the beta-lactamase-negative isolates presented diminished susceptibility to ampicillin (beta-lactamase-negative ampicillin resistance phenotype). Remarkably, 21.3% of the H. influenzae isolates presented decreased susceptibility to ciprofloxacin, which was mainly observed in persisting clones. Of the H. influenzae isolates from CF patients, 18 (14.5%) were found to be hypermutable in comparison with 1 (1.4%) from non-CF patients (P < 0.0001). Ten patients (33.3%) were colonized by hypermutable strains over the study period. A multiresistance phenotype and long-term clonal persistence were significantly associated in some cases for up to 7 years. These results suggest that H. influenzae bronchial colonization in CF patients is a dynamic process, but better-adapted clones can persist for long periods of time.

Dynamics of Long-Term Colonization of Respiratory Tract by Haemophilus influenzae in Cystic Fibrosis Patients Shows a Marked Increase in Hypermutable Strains

PubMed Central

Román, Federico; Cantón, Rafael; Pérez-Vázquez, María; Baquero, Fernando; Campos, José

2004-01-01

The persistence and variability of 188 Haemophilus influenzae isolates in respiratory tract of 30 cystic fibrosis (CF) patients over the course of 7 years was studied. Antibiotic susceptibility testing, DNA fingerprinting, and analysis of outer membrane protein profiles were performed on all isolates. A total of 115 distinct pulsed-field gel electrophoresis profiles were identified. Ninety percent of patients were cocolonized with two or more clones over the studied period. A third of the patients were cross-colonized with one or two H. influenzae strains; 11% of the clones persisted for 3 or more months. Biotype, outer membrane protein profiles, and resistance profiles showed variation along the studied period, even in persisting clones. Four isolates (2.1%) recovered from 3 patients were type f capsulate, with three of them belonging to the same clone. β-Lactamase production was detected in 23.9% of isolates while 7% of the β-lactamase-negative isolates presented diminished susceptibility to ampicillin (β-lactamase-negative ampicillin resistance phenotype). Remarkably, 21.3% of the H. influenzae isolates presented decreased susceptibility to ciprofloxacin, which was mainly observed in persisting clones. Of the H. influenzae isolates from CF patients, 18 (14.5%) were found to be hypermutable in comparison with 1 (1.4%) from non-CF patients (P < 0.0001). Ten patients (33.3%) were colonized by hypermutable strains over the study period. A multiresistance phenotype and long-term clonal persistence were significantly associated in some cases for up to 7 years. These results suggest that H. influenzae bronchial colonization in CF patients is a dynamic process, but better-adapted clones can persist for long periods of time. PMID:15070988

Faecal Escherichia coli from patients with E. coli urinary tract infection and healthy controls who have never had a urinary tract infection.

PubMed

Nielsen, Karen L; Dynesen, Pia; Larsen, Preben; Frimodt-Møller, Niels

2014-04-01

Urinary tract infections (UTIs) are primarily caused by Escherichia coli with the patient's own faecal flora acting as a reservoir for the infecting E. coli. Here we sought to characterize the E. coli faecal flora of UTI patients and healthy controls who had never had a UTI. Up to 20 E. coli colonies from each rectal swab were random amplified polymorphic DNA (RAPD) typed for clonality, dominance in the sample and correlation to the infecting UTI isolate in patients. Each distinct clone was phylotyped and tested for antimicrobial susceptibility. Eighty-seven per cent of the UTI patients carried the infecting strain in their faecal flora, and faecal clones causing UTI were more often dominant in the faecal flora. Patients had a larger diversity of E. coli in their gut flora by carrying more unique E. coli clones compared to controls, and patient faecal clones were more often associated with multidrug resistance compared to controls. We found a similar phylotype distribution of faecal clones from UTI patients and healthy controls, including a large proportion of B2 isolates in the control group. Faecal-UTI isolates from patients were more often associated with multidrug resistance compared to faecal-only clones, indicating a link between UTI virulence and antimicrobial resistance. Intake of any antibiotic less than 6 months prior to inclusion in the experiment occurred significantly more in patients with UTI than in controls. In contrast, presence of an intrauterine device was significantly more common in controls indicating a protective effect against UTI. In conclusion, healthy controls have a large proportion of potentially pathogenic E. coli phylotypes in their faecal flora without this causing infection.

T Cell Receptor-Major Histocompatibility Complex Interaction Strength Defines Trafficking and CD103+ Memory Status of CD8 T Cells in the Brain.

PubMed

Sanecka, Anna; Yoshida, Nagisa; Kolawole, Elizabeth Motunrayo; Patel, Harshil; Evavold, Brian D; Frickel, Eva-Maria

2018-01-01

T cell receptor-major histocompatibility complex (TCR-MHC) affinities span a wide range in a polyclonal T cell response, yet it is undefined how affinity shapes long-term properties of CD8 T cells during chronic infection with persistent antigen. Here, we investigate how the affinity of the TCR-MHC interaction shapes the phenotype of memory CD8 T cells in the chronically Toxoplasma gondii- infected brain. We employed CD8 T cells from three lines of transnuclear (TN) mice that harbor in their endogenous loci different T cell receptors specific for the same Toxoplasma antigenic epitope ROP7. The three TN CD8 T cell clones span a wide range of affinities to MHCI-ROP7. These three CD8 T cell clones have a distinct and fixed hierarchy in terms of effector function in response to the antigen measured as proliferation capacity, trafficking, T cell maintenance, and memory formation. In particular, the T cell clone of lowest affinity does not home to the brain. The two higher affinity T cell clones show differences in establishing resident-like memory populations (CD103 + ) in the brain with the higher affinity clone persisting longer in the host during chronic infection. Transcriptional profiling of naïve and activated ROP7-specific CD8 T cells revealed that Klf2 encoding a transcription factor that is known to be a negative marker for T cell trafficking is upregulated in the activated lowest affinity ROP7 clone. Our data thus suggest that TCR-MHC affinity dictates memory CD8 T cell fate at the site of infection.

Highly complex neutralization determinants on a monophyletic lineage of newly transmitted subtype C HIV-1 Env clones from India.

PubMed

Kulkarni, Smita S; Lapedes, Alan; Tang, Haili; Gnanakaran, S; Daniels, Marcus G; Zhang, Ming; Bhattacharya, Tanmoy; Li, Ming; Polonis, Victoria R; McCutchan, Francine E; Morris, Lynn; Ellenberger, Dennis; Butera, Salvatore T; Bollinger, Robert C; Korber, Bette T; Paranjape, Ramesh S; Montefiori, David C

2009-03-15

Little is known about the neutralization properties of HIV-1 in India to optimally design and test vaccines. For this reason, a functional Env clone was obtained from each of ten newly acquired, heterosexually transmitted HIV-1 infections in Pune, Maharashtra. These clones formed a phylogenetically distinct genetic lineage within subtype C. As Env-pseudotyped viruses the clones were mostly resistant to IgG1b12, 2G12 and 2F5 but all were sensitive to 4E10. When compared to a large multi-subtype panel of Env-pseudotyped viruses (subtypes B, C and CRF02_AG) in neutralization assays with a multi-subtype panel of HIV-1-positive plasma samples, the Indian Envs were remarkably complex. With the exception of the Indian Envs, results of a hierarchical clustering analysis showed a strong subtype association with the patterns of neutralization susceptibility. From these patterns we were able to identify 19 neutralization cluster-associated amino acid signatures in gp120 and 14 signatures in the ectodomain and cytoplasmic tail of gp41. We conclude that newly transmitted Indian Envs are antigenically complex in spite of close genetic similarity. Delineation of neutralization-associated amino acid signatures provides a deeper understanding of the antigenic structure of HIV-1 Env.

Endophytic bacteria in plant tissue culture: differences between easy- and difficult-to-propagate Prunus avium genotypes.

PubMed

Quambusch, Mona; Pirttilä, Anna Maria; Tejesvi, Mysore V; Winkelmann, Traud; Bartsch, Melanie

2014-05-01

The endophytic bacterial communities of six Prunus avium L. genotypes differing in their growth patterns during in vitro propagation were identified by culture-dependent and culture-independent methods. Five morphologically distinct isolates from tissue culture material were identified by 16S rDNA sequence analysis. To detect and analyze the uncultivable fraction of endophytic bacteria, a clone library was established from the amplified 16S rDNA of total plant extract. Bacterial diversity within the clone libraries was analyzed by amplified ribosomal rDNA restriction analysis and by sequencing a clone for each identified operational taxonomic unit. The most abundant bacterial group was Mycobacterium sp., which was identified in the clone libraries of all analyzed Prunus genotypes. Other dominant bacterial genera identified in the easy-to-propagate genotypes were Rhodopseudomonas sp. and Microbacterium sp. Thus, the community structures in the easy- and difficult-to-propagate cherry genotypes differed significantly. The bacterial genera, which were previously reported to have plant growth-promoting effects, were detected only in genotypes with high propagation success, indicating a possible positive impact of these bacteria on in vitro propagation of P. avium, which was proven in an inoculation experiment. © The Author 2014. Published by Oxford University Press. All rights reserved.

Purification and cDNA cloning of SAPKK3, the major activator of RK/p38 in stress- and cytokine-stimulated monocytes and epithelial cells.

PubMed Central

Cuenda, A; Alonso, G; Morrice, N; Jones, M; Meier, R; Cohen, P; Nebreda, A R

1996-01-01

Two chromatographically distinct stress-activated protein kinase kinases (SAPKKs) have been identified in several mammalian cells, termed SAPKK2 and SAPKK3, which activate the MAP kinase family member RK/p38 but not JNK/SAPK in vitro. Here we demonstrate that SAPKK2 is identical or very closely related to the MAP kinase kinase family member MKK3. However, under our assay conditions, SAPKK3 was the major activator of RK/p38 detected in extracts prepared from stress- or interleukin-1-stimulated epithelial (KB) cells, from bacterial lipopolysaccharide and tumour necrosis factor alpha-stimulated THP1 monocytes or from rabbit skeletal muscle. The activated form of SAPKK3 was purified from muscle to near homogeneity, and tryptic peptide sequences were used to clone human and murine cDNAs encoding this enzyme. Human SAPKK3 comprised 334 amino acids and was 78% identical to MKK3. The murine and human SAPKK3 were 97% identical in their amino acid sequences. We also cloned a different murine cDNA that appears to encode a SAPKK3 protein truncated at the N-terminus. SAPKK3 is identical to the recently cloned MKK6. Images PMID:8861944

Scarcity of autoreactive human blood IgA+ memory B cells

PubMed Central

Prigent, Julie; Lorin, Valérie; Kök, Ayrin; Hieu, Thierry; Bourgeau, Salomé

2016-01-01

Class‐switched memory B cells are key components of the “reactive” humoral immunity, which ensures a fast and massive secretion of high‐affinity antigen‐specific antibodies upon antigenic challenge. In humans, IgA class‐switched (IgA+) memory B cells and IgA antibodies are abundant in the blood. Although circulating IgA+ memory B cells and their corresponding secreted immunoglobulins likely possess major protective and/or regulatory immune roles, little is known about their specificity and function. Here, we show that IgA+ and IgG+ memory B‐cell antibodies cloned from the same healthy humans share common immunoglobulin gene features. IgA and IgG memory antibodies have comparable lack of reactivity to vaccines, common mucosa‐tropic viruses and commensal bacteria. However, the IgA+ memory B‐cell compartment contains fewer polyreactive clones and importantly, only rare self‐reactive clones compared to IgG+ memory B cells. Self‐reactivity of IgAs is acquired following B‐cell affinity maturation but not antibody class switching. Together, our data suggest the existence of different regulatory mechanisms for removing autoreactive clones from the IgG+ and IgA+ memory B‐cell repertoires, and/or different maturation pathways potentially reflecting the distinct nature and localization of the cognate antigens recognized by individual B‐cell populations. PMID:27469325

Prokaryotic diversity, composition structure, and phylogenetic analysis of microbial communities in leachate sediment ecosystems.

PubMed

Liu, Jingjing; Wu, Weixiang; Chen, Chongjun; Sun, Faqian; Chen, Yingxu

2011-09-01

In order to obtain insight into the prokaryotic diversity and community in leachate sediment, a culture-independent DNA-based molecular phylogenetic approach was performed with archaeal and bacterial 16S rRNA gene clone libraries derived from leachate sediment of an aged landfill. A total of 59 archaeal and 283 bacterial rDNA phylotypes were identified in 425 archaeal and 375 bacterial analyzed clones. All archaeal clones distributed within two archaeal phyla of the Euryarchaeota and Crenarchaeota, and well-defined methanogen lineages, especially Methanosaeta spp., are the most numerically dominant species of the archaeal community. Phylogenetic analysis of the bacterial library revealed a variety of pollutant-degrading and biotransforming microorganisms, including 18 distinct phyla. A substantial fraction of bacterial clones showed low levels of similarity with any previously documented sequences and thus might be taxonomically new. Chemical characteristics and phylogenetic inferences indicated that (1) ammonium-utilizing bacteria might form consortia to alleviate or avoid the negative influence of high ammonium concentration on other microorganisms, and (2) members of the Crenarchaeota found in the sediment might be involved in ammonium oxidation. This study is the first to report the composition of the microbial assemblages and phylogenetic characteristics of prokaryotic populations extant in leachate sediment. Additional work on microbial activity and contaminant biodegradation remains to be explored.

Genotypes of macrolide-resistant pneumococci from children in southwestern Japan: raised incidence of strains that have both erm(B) and mef(A) with serotype 6B clones.

PubMed

Ikenaga, Masaaki; Kosowska-Shick, Klaudia; Gotoh, Kenji; Hidaka, Hidenobu; Koga, Hiroyasu; Masunaga, Kenji; Nagai, Kensuke; Tsumura, Naoki; Appelbaum, Peter C; Matsuishi, Toyojiro

2008-09-01

MICs of penicillin G, erythromycin, clarithromycin, clindamycin, azithromycin, and telithromycin were tested for 189 clinical isolates collected during 2002 to 2005 from children in southwestern Japan. Serotyping and polymerase chain reaction for presence of erm(B) and mef(A) were performed. All strains with erm(B) + mef(A) were analyzed by pulsed-field gel electrophoresis (PFGE) and compared to 3 global clones: Spain(23F)-1; Spain(9V)-3 and its variant -14; a South Korean strain same as Taiwan (19F)-14 clone and 5 strains with erm(B) + mef(A) from other countries. Of the 173 macrolide-resistant (erythromycin MIC > or =0.5 microg/mL) strains, 104 (60.1%) had erm(B), 47 (27.2%) had mef(A), and 22 (12.7%) had erm(B) + mef(A). Strains expressing erm(B) or both erm(B) and mef(A) had high macrolide MIC(90)s (>64 microg/mL), except telithromycin (MIC(90), 0.25 microg/mL). Of the 22 erm(B) + mef(A) strains, 10 had 4 distinct PFGE patterns and were mainly serotype 6B clones, which differed from those described in previous reports; 5 other strains had unique profiles.

Molecular Phylogenetic Diversity and Spatial Distribution of Bacterial Communities in Cooling Stage during Swine Manure Composting

PubMed Central

Guo, Yan; Zhang, Jinliang; Yan, Yongfeng; Wu, Jian; Zhu, Nengwu; Deng, Changyan

2015-01-01

Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and subsequent sub-cloning and sequencing were used in this study to analyze the molecular phylogenetic diversity and spatial distribution of bacterial communities in different spatial locations during the cooling stage of composted swine manure. Total microbial DNA was extracted, and bacterial near full-length 16S rRNA genes were subsequently amplified, cloned, RFLP-screened, and sequenced. A total of 420 positive clones were classified by RFLP and near-full-length 16S rDNA sequences. Approximately 48 operational taxonomic units (OTUs) were found among 139 positive clones from the superstratum sample; 26 among 149 were from the middle-level sample and 35 among 132 were from the substrate sample. Thermobifida fusca was common in the superstratum layer of the pile. Some Bacillus spp. were remarkable in the middle-level layer, and Clostridium sp. was dominant in the substrate layer. Among 109 OTUs, 99 displayed homology with those in the GenBank database. Ten OTUs were not closely related to any known species. The superstratum sample had the highest microbial diversity, and different and distinct bacterial communities were detected in the three different layers. This study demonstrated the spatial characteristics of the microbial community distribution in the cooling stage of swine manure compost. PMID:25925066

DNA cloning: A personal view after 40 years

PubMed Central

Cohen, Stanley N.

2013-01-01

In November 1973, my colleagues A. C. Y. Chang, H. W. Boyer, R. B. Helling, and I reported in PNAS that individual genes can be cloned and isolated by enzymatically cleaving DNA molecules into fragments, linking the fragments to an autonomously replicating plasmid, and introducing the resulting recombinant DNA molecules into bacteria. A few months later, Chang and I reported that genes from unrelated bacterial species can be combined and propagated using the same approach and that interspecies recombinant DNA molecules can produce a biologically functional protein in a foreign host. Soon afterward, Boyer’s laboratory and mine published our collaborative discovery that even genes from animal cells can be cloned in bacteria. These three PNAS papers quickly led to the use of DNA cloning methods in multiple areas of the biological and chemical sciences. They also resulted in a highly public controversy about the potential hazards of laboratory manipulation of genetic material, a decision by Stanford University and the University of California to seek patents on the technology that Boyer and I had invented, and the application of DNA cloning methods for commercial purposes. In the 40 years that have passed since publication of our findings, use of DNA cloning has produced insights about the workings of genes and cells in health and disease and has altered the nature of the biotechnology and biopharmaceutical industries. Here, I provide a personal perspective of the events that led to, and followed, our report of DNA cloning. PMID:24043817

Short communication: evidence of HIV type 1 clade C env clones containing low V3 loop charge obtained from an AIDS patient in India that uses CXCR6 and CCR8 for entry in addition to CCR5.

PubMed

Gharu, Lavina; Ringe, Rajesh; Satyakumar, Anupindi; Patil, Ajit; Bhattacharya, Jayanta

2011-02-01

Abstract HIV-1 clade C is the major subtype circulating in India and preferentially uses CCR5 during the entire disease course. We have recently shown that env clones from an Indian patient; NARI-VB105 uses multiple coreceptors for entry and was presented with an unusual V3 loop sequence giving rise to high net V3 loop positive charges. Here we show that env clones belonging to subtype C obtained from an AIDS patient, NARI-VB52, use CXCR6 and CCR8 in addition to CCR5 for entry. However, unlike the NARI-105 patient, the env clones contained a low V3 loop net charge of +3 with a conserved GPGQ motif typical of CCR5 using subtype C strains, indicating that residues outside the V3 loop contributed to extended coreceptor use in this particular patient.

Unified quantum no-go theorems and transforming of quantum pure states in a restricted set

NASA Astrophysics Data System (ADS)

Luo, Ming-Xing; Li, Hui-Ran; Lai, Hong; Wang, Xiaojun

2017-12-01

The linear superposition principle in quantum mechanics is essential for several no-go theorems such as the no-cloning theorem, the no-deleting theorem and the no-superposing theorem. In this paper, we investigate general quantum transformations forbidden or permitted by the superposition principle for various goals. First, we prove a no-encoding theorem that forbids linearly superposing of an unknown pure state and a fixed pure state in Hilbert space of a finite dimension. The new theorem is further extended for multiple copies of an unknown state as input states. These generalized results of the no-encoding theorem include the no-cloning theorem, the no-deleting theorem and the no-superposing theorem as special cases. Second, we provide a unified scheme for presenting perfect and imperfect quantum tasks (cloning and deleting) in a one-shot manner. This scheme may lead to fruitful results that are completely characterized with the linear independence of the representative vectors of input pure states. The upper bounds of the efficiency are also proved. Third, we generalize a recent superposing scheme of unknown states with a fixed overlap into new schemes when multiple copies of an unknown state are as input states.

The Molecular Epidemiology of the Highly Virulent ST93 Australian Community Staphylococcus aureus Strain

PubMed Central

Coombs, Geoffrey W.; Goering, Richard V.; Chua, Kyra Y. L.; Monecke, Stefan; Howden, Benjamin P.; Stinear, Timothy P.; Ehricht, Ralf; O’Brien, Frances G.; Christiansen, Keryn J.

2012-01-01

In Australia the PVL - positive ST93-IV [2B], colloquially known as “Queensland CA-MRSA” has become the dominant CA-MRSA clone. First described in the early 2000s, ST93-IV [2B] is associated with skin and severe invasive infections including necrotizing pneumonia. A singleton by multilocus sequence typing (MLST) eBURST analysis ST93 is distinct from other S aureus clones. To determine if the increased prevalence of ST93-IV [2B] is due to the widespread transmission of a single strain of ST93-IV [2B] the genetic relatedness of 58 S. aureus ST93 isolated throughout Australia over an extended period were studied in detail using a variety of molecular methods including pulsed-field gel electrophoresis, spa typing, MLST, microarray DNA, SCCmec typing and dru typing. Identification of the phage harbouring the lukS-PV/lukF-PV Panton Valentine leucocidin genes, detection of allelic variations in lukS-PV/lukF-PV, and quantification of LukF-PV expression was also performed. Although ST93-IV [2B] is known to have an apparent enhanced clinical virulence, the isolates harboured few known virulence determinants. All PVL-positive isolates carried the PVL-encoding phage ΦSa2USA and the lukS-PV/lukF-PV genes had the same R variant SNP profile. The isolates produced similar expression levels of LukF-PV. Although multiple rearrangements of the spa sequence have occurred, the core genome in ST93 is very stable. The emergence of ST93-MRSA is due to independent acquisitions of different dru-defined type IV and type V SCCmec elements in several spa-defined ST93-MSSA backgrounds. Rearrangement of the spa sequence in ST93-MRSA has subsequently occurred in some of these strains. Although multiple ST93-MRSA strains were characterised, little genetic diversity was identified for most isolates, with PVL-positive ST93-IVa [2B]-t202-dt10 predominant across Australia. Whether ST93-IVa [2B] t202-dt10 arose from one PVL-positive ST93-MSSA-t202, or by independent acquisitions of SCCmec-IVa [2B]-dt10 into multiple PVL-positive ST93-MSSA-t202 strains is not known. PMID:22900085

T-cell clonality analysis in biopsy specimens from two different skin sites shows high specificity in the diagnosis of patients with suggested mycosis fungoides.

PubMed

Thurber, Stacy E; Zhang, Bing; Kim, Youn H; Schrijver, Iris; Zehnder, James; Kohler, Sabine

2007-11-01

The diagnosis of mycosis fungoides (MF) is often difficult because of significant clinical and histopathologic overlap with inflammatory dermatoses. T-cell receptor (TCR)gamma chain rearrangement by polymerase chain reaction (PCR) (TCR-PCR) is a helpful adjuvant tool in this setting, but several of the inflammatory dermatoses in the differential diagnosis of MF may contain a clonal T-cell proliferation. We examined whether analysis for T-cell clonality and comparison of the clones with the standardized BIOMED-2 PCR multiplex primers for the TCRgamma chain from two anatomically distinct skin sites improves diagnostic accuracy. We examined two biopsy specimens each from 10 patients with unequivocal MF, from 18 patients with inflammatory dermatoses, and from 18 patients who could initially not be definitively given a diagnosis based on clinical and histopathologic criteria. Eight of 10 patients with unequivocal MF had an identical clone in both biopsy specimens. Two of 18 patients with inflammatory dermatoses were found to have a clone in one of the biopsy specimens. On further follow-up of the 18 patients with morphologically nondiagnostic biopsy specimens, 13 of 18 were later confirmed to have MF and 5 of 18 had inflammatory dermatoses. Eleven of 13 patients with MF had an identical clone in both biopsy specimens; two of 13 had a polyclonal amplification pattern in both biopsy specimens. Four of 5 patients with inflammatory dermatoses had no clone in either biopsy specimen. One patient with an inflammatory dermatosis had an identical clone in both specimens. The sensitivity of TCR-PCR analysis to evaluate for an identical clone at different anatomic skin sites (dual TCR-PCR) is 82.6% and the specificity is 95.7%. The number of patients in the study group was limited. These data suggest that dual TCR-PCR is a very promising technique with high specificity in distinguishing MF from inflammatory dermatoses.

Effect of timing of the removal of oocyte chromosomes before or after injection of somatic nucleus on development of NT embryos.

PubMed

Wakayama, Sayaka; Cibelli, Jose B; Wakayama, Teruhiko

2003-01-01

Cloning methods are now well described and becoming routine. Yet the frequency at which live cloned offspring are produced (as a percentage of starting one-cell embryos) remains below 5% irrespective of nucleus donor species or cell type. In considering the cause(s) of this universally low efficiency, features common to all cloning protocols are strong candidates. One such shared feature is enucleation; the donor nucleus is inserted into an enucleated cytoplast (ooplast). However, it is not known whether a nucleus-free metaphase II oocyte is developmentally impaired other than by virtue of lacking chromosomes, or if in nuclear transfer protocols, enucleation removes factors necessary to reprogram the incoming nucleus. We have here investigated the role of enucleation in nuclear transfer. Three hours after the injection of cumulus cell nuclei into non-enucleated oocytes, 65% contained two distinct metaphase spindles, with the remainder exhibiting a single spindle in which oocyte-derived and nucleus donor chromosomes were mixed. However, staining only one hour after donor nucleus insertion revealed that most had two discrete spindles. In the absence of staining, the donor nucleus spindle was not visible. This provided a straightforward way to identify and select the oocyte-derived metaphase chromosomes 1 h after donor nucleus microinjection, and 34-41% cloned embryo developed to the morulla-blastocyst stage following Sr(2+)-induced activation. Of these, two (1% of starting one-cell embryos) developed to term, an efficiency which is comparable to that obtained for controls (6 clone; 1-2%) in which enucleation preceded nuclear transfer. In conclusion, the timing of the removal of oocyte chromosomes before or after injection of somatic nucleus had no effect on cloned embryo development. These findings argue that neither oocyte chromosome depletion per se, nor the potential removal of "reprogramming" factors during enucleation explain the low efficiency of nuclear transfer cloning.

CRISPR-Cas9-Edited Site Sequencing (CRES-Seq): An Efficient and High-Throughput Method for the Selection of CRISPR-Cas9-Edited Clones.

PubMed

Veeranagouda, Yaligara; Debono-Lagneaux, Delphine; Fournet, Hamida; Thill, Gilbert; Didier, Michel

2018-01-16

The emergence of clustered regularly interspaced short palindromic repeats-Cas9 (CRISPR-Cas9) gene editing systems has enabled the creation of specific mutants at low cost, in a short time and with high efficiency, in eukaryotic cells. Since a CRISPR-Cas9 system typically creates an array of mutations in targeted sites, a successful gene editing project requires careful selection of edited clones. This process can be very challenging, especially when working with multiallelic genes and/or polyploid cells (such as cancer and plants cells). Here we described a next-generation sequencing method called CRISPR-Cas9 Edited Site Sequencing (CRES-Seq) for the efficient and high-throughput screening of CRISPR-Cas9-edited clones. CRES-Seq facilitates the precise genotyping up to 96 CRISPR-Cas9-edited sites (CRES) in a single MiniSeq (Illumina) run with an approximate sequencing cost of $6/clone. CRES-Seq is particularly useful when multiple genes are simultaneously targeted by CRISPR-Cas9, and also for screening of clones generated from multiallelic genes/polyploid cells. © 2018 by John Wiley & Sons, Inc. Copyright © 2018 John Wiley & Sons, Inc.

Grapevine necrotic union, A newly recognized disease of unknown etiology in grapevines grafted on 110 Richter rootstock in California

USDA-ARS?s Scientific Manuscript database

In Northern California, surveys of several vineyards planted to Vitis vinifera cv. Pinot noir (PN) clones 02A, 667, 777, and UCD 04 grafted onto the rootstock V. berlandieri x V. rupestris 110 Richter (110R) revealed 2 to 45% of vines showing solid red leaf canopies and two distinct disease stages, ...

Cloning of enterotoxin gene from Aeromonas hydrophila provides conclusive evidence of production of a cytotonic enterotoxin.

PubMed Central

Chakraborty, T; Montenegro, M A; Sanyal, S C; Helmuth, R; Bulling, E; Timmis, K N

1984-01-01

Culture filtrates of two Aeromonas hydrophila strains which were isolated from patients with diarrhea and assumed to be causative agents of the infections were shown to contain enterotoxic, cytotoxic, and hemolytic activities. Modest heat treatment of the filtrates inactivated the cytotoxic and cytolytic activities, but not the enterotoxic activity. The construction of cosmid gene banks in Escherichia coli of DNA from both A. hydrophila strains demonstrated that the determinants of the three activities are located on three different segments of the A. hydrophila chromosome. Both heated culture filtrates of A. hydrophila and nonheated filtrates of an E. coli clone containing the A. hydrophila enterotoxin gene provoked fluid accumulation in the rabbit ileal loop and suckling mouse models and caused elongation of Chinese hamster ovary cells. Differences in the responses of the models to the A. hydrophila enterotoxin and to the heat-labile and heat-stabile toxins of E. coli indicated that the former is distinct from the latter two types of toxin. These results constitute conclusive evidence for the production by A. hydrophila of a cytotonic enterotoxin that is distinct from the A. hydrophila cytotoxin and hemolysin and known E. coli enterotoxins. Images PMID:6500697

Genetic relationships and clonal population structure of serotype 2 strains of Neisseria meningitidis.

PubMed Central

Caugant, D A; Zollinger, W D; Mocca, L F; Frasch, C E; Whittam, T S; Frøholm, L O; Selander, R K

1987-01-01

Two hundred and thirty-four strains of Neisseria meningitidis, including 94 serotype 2a, 111 serotype 2b, and 19 serotype 2c isolates, together with 10 isolates that were serotyped as 2 with polyvalent antiserum but did not react with monoclonal antibodies, were characterized by the electrophoretic mobilities of 15 metabolic enzymes. Of these enzymes, 14 were polymorphic, and 56 distinctive combinations of alleles at the enzyme loci (electrophoretic types) were identified, among which the mean genetic diversity per locus was 0.413, or about 75% of that recorded for the species N. meningitidis as a whole. Mean genetic diversity among electrophoretic types of the same serotype (2a, 2b, or 2c) was, however, on average, less than half the total species diversity, and no multilocus genotypes were shared between isolates of the different serotypes, which belong to distinctive clonal lineages. Recent temporal changes in the frequencies of recovery of pathogenic strains of serotypes 2a and 2b in South Africa and North America resulted from clone replacement in these populations rather than evolutionary modification of the serotype protein of the initially dominant clones. PMID:3106223

Structure, production and signaling of leptin

PubMed Central

Münzberg, Heike; Morrison, Christopher D.

2014-01-01

The cloning of leptin in 1994 was an important milestone in obesity research. In those days obesity was stigmatized as a condition caused by lack of character and self-control. Mutations in either leptin or its receptor were the first single gene mutations found to cause morbid obesity, and it is now appreciated that obesity is caused by a dysregulation of central neuronal circuits. From the first discovery of the leptin deficient obese mouse (ob/ob), to the cloning of leptin (ob aka lep) and leptin receptor (db aka lepr) genes, much has been learned about leptin and its action in the central nervous system. The initial high hopes that leptin would cure obesity were quickly dampened by the discovery that most obese humans have increased leptin levels and develop leptin resistance. Nevertheless, leptin target sites in the brain represent an excellent blueprint for distinct neuronal circuits that control energy homeostasis. A better understanding of the regulation and interconnection of these circuits will further guide and improve the development of safe and effective interventions to treat obesity. This review will highlight our current knowledge about the hormone leptin, its signaling pathways and its central actions to mediate distinct physiological functions. PMID:25305050

Growth associated protein (GAP-43): cloning and the development of a sensitive ELISA for neurological disorders.

PubMed

Gnanapavan, Sharmilee; Yousaf, Nasim; Heywood, Wendy; Grant, Donna; Mills, Kevin; Chernajovsky, Yuti; Keir, Geoff; Giovannoni, Gavin

2014-11-15

GAP-43 has been studied in the rodent and mammalian brain and shown to be present specifically in areas undergoing axonal elongation and synapse formation. GAP-43 was cloned using the baculovirus expression system and purified. A sandwich ELISA was developed using the recombinant GAP-43 as standard and validated. CSF GAP-43 levels were analysed in benign intracranial hypertension, movement disorders, multiple sclerosis, neuropathy, CNS infections, motor neuron disease, and headache (neurological controls). GAP-43 levels were low in all disorders analysed (in particular motor neuron disease; p=0.001, and movement disorders and multiple sclerosis; p<0.0001) compared to controls, aside from CNS infections. GAP-43 is preferentially reduced in the CSF of neurological disorders associated with neurodegeneration. Copyright © 2014. Published by Elsevier B.V.

Parallel computing of physical maps--a comparative study in SIMD and MIMD parallelism.

PubMed

Bhandarkar, S M; Chirravuri, S; Arnold, J

1996-01-01

Ordering clones from a genomic library into physical maps of whole chromosomes presents a central computational problem in genetics. Chromosome reconstruction via clone ordering is usually isomorphic to the NP-complete Optimal Linear Arrangement problem. Parallel SIMD and MIMD algorithms for simulated annealing based on Markov chain distribution are proposed and applied to the problem of chromosome reconstruction via clone ordering. Perturbation methods and problem-specific annealing heuristics are proposed and described. The SIMD algorithms are implemented on a 2048 processor MasPar MP-2 system which is an SIMD 2-D toroidal mesh architecture whereas the MIMD algorithms are implemented on an 8 processor Intel iPSC/860 which is an MIMD hypercube architecture. A comparative analysis of the various SIMD and MIMD algorithms is presented in which the convergence, speedup, and scalability characteristics of the various algorithms are analyzed and discussed. On a fine-grained, massively parallel SIMD architecture with a low synchronization overhead such as the MasPar MP-2, a parallel simulated annealing algorithm based on multiple periodically interacting searches performs the best. For a coarse-grained MIMD architecture with high synchronization overhead such as the Intel iPSC/860, a parallel simulated annealing algorithm based on multiple independent searches yields the best results. In either case, distribution of clonal data across multiple processors is shown to exacerbate the tendency of the parallel simulated annealing algorithm to get trapped in a local optimum.

How social evolution theory impacts our understanding of development in the social amoeba Dictyostelium.

PubMed

Strassmann, Joan E; Queller, David C

2011-05-01

Dictyostelium discoideum has been very useful for elucidating principles of development over the last 50 years, but a key attribute means there is a lot to be learned from a very different intellectual tradition: social evolution. Because Dictyostelium arrives at multicellularity by aggregation instead of through a single-cell bottleneck, the multicellular body could be made up of genetically distinct cells. If they are genetically distinct, natural selection will result in conflict over which cells become fertile spores and which become dead stalk cells. Evidence for this conflict includes unequal representation of two genetically different clones in spores of a chimera, the poison-like differentiation inducing factor (DIF) system that appears to involve some cells forcing others to become stalk, and reduced functionality in migrating chimeras. Understanding how selection operates on chimeras of genetically distinct clones is crucial for a comprehensive view of Dictyostelium multicellularity. In nature, Dictyostelium fruiting bodies are often clonal, or nearly so, meaning development will often be very cooperative. Relatedness levels tell us what benefits must be present for sociality to evolve. Therefore it is important to measure relatedness in nature, show that it has an impact on cooperation in the laboratory, and investigate genes that Dictyostelium uses to discriminate between relatives and non-relatives. Clearly, there is a promising future for research at the interface of development and social evolution in this fascinating group. © 2011 The Authors. Development, Growth & Differentiation © 2011 Japanese Society of Developmental Biologists.

Identification and cloning of four riboswitches from Burkholderia pseudomallei strain K96243

NASA Astrophysics Data System (ADS)

Munyati-Othman, Noor; Fatah, Ahmad Luqman Abdul; Piji, Mohd Al Akmarul Fizree Bin Md; Ramlan, Effirul Ikhwan; Raih, Mohd Firdaus

2015-09-01

Structured RNAs referred as riboswitches have been predicted to be present in the genome sequence of Burkholderia pseudomallei strain K96243. Four of the riboswitches were identified and analyzed through BLASTN, Rfam search and multiple sequence alignment. The RNA aptamers belong to the following riboswitch classifications: glycine riboswitch, cobalamin riboswitch, S-adenosyl-(L)-homocysteine (SAH) riboswitch and flavin mononucleotide (FMN) riboswitch. The conserved nucleotides for each aptamer were identified and were marked on the secondary structure generated by RNAfold. These riboswitches were successfully amplified and cloned for further study.

Species richness in soil bacterial communities: a proposed approach to overcome sample size bias.

PubMed

Youssef, Noha H; Elshahed, Mostafa S

2008-09-01

Estimates of species richness based on 16S rRNA gene clone libraries are increasingly utilized to gauge the level of bacterial diversity within various ecosystems. However, previous studies have indicated that regardless of the utilized approach, species richness estimates obtained are dependent on the size of the analyzed clone libraries. We here propose an approach to overcome sample size bias in species richness estimates in complex microbial communities. Parametric (Maximum likelihood-based and rarefaction curve-based) and non-parametric approaches were used to estimate species richness in a library of 13,001 near full-length 16S rRNA clones derived from soil, as well as in multiple subsets of the original library. Species richness estimates obtained increased with the increase in library size. To obtain a sample size-unbiased estimate of species richness, we calculated the theoretical clone library sizes required to encounter the estimated species richness at various clone library sizes, used curve fitting to determine the theoretical clone library size required to encounter the "true" species richness, and subsequently determined the corresponding sample size-unbiased species richness value. Using this approach, sample size-unbiased estimates of 17,230, 15,571, and 33,912 were obtained for the ML-based, rarefaction curve-based, and ACE-1 estimators, respectively, compared to bias-uncorrected values of 15,009, 11,913, and 20,909.

Development of positive control materials for DNA-based detection of cystic fibrosis: Cloning and sequencing of 31 mutations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Iovannisci, D.; Brown, C.; Winn-Deen, E.

1994-09-01

The cloning and sequencing of the gene associated with cystic fibrosis (CF) now provides the opportunity for earlier detection and carrier screening through DNA-based detection schemes. To date, over 300 mutations have been reported to the CF Consortium; however, only 30 mutations have been observed frequently enough world-wide to warrant routine screening. Many of these mutations are not available as cloned material or as established tissue culture cell lines to aid in the development of DNA-based detection assays. We have therefore cloned the 30 most frequently reported mutations, plus the mutation R347H due to its association with male infertility (31more » mutations, total). Two approaches were employed: direct PCR amplification, where mutations were available from patient sources, and site-directed PCR mutagenesis of normal genomic DNA to generate the remaining mutations. After amplification, products were cloned into a sequencing vector, bacterial transformants were screened by a novel method (PCR/oligonucleotide litigation assay/sequence-coded separation), and plamid DNA sequences determined by automated fluorescent methods on the Applied Biosystems 373A. Mixing of the clones allows the construction of artificial genotypes useful as positive control material for assay validation. A second round of mutagenesis, resulting in the construction of plasmids bearing multiple mutations, will be evaluated for their utility as reagent control materials in kit development.« less

Effect of aminglycoside administration on the occurrence and multiplication of resistant bacteria.

PubMed

Milas, Josip; Kalenić, Smilja; Milas, Vesna; Miskulin, Maja; Vuković, Dubravka; Rudan, Stjepan; Puntarić, Dinko

2009-06-01

In the prospective study the susceptibility of 41 Escherichia coli strains and 55 Pseudomonas aeruginosa strains to gentamicin, netilmicin and amikacin was tested at a 2-year interval (period I April 1998 to March 1999, and period II April to July 2001). Genotyping was performed by pulsed-field gel electrophoresis, and a clone based on 80% or 90% similarity was determined for each of the study bacteria. In 24 (32.0%) clones, strains showed no variation over 2-year interval, supporting the hypothesis on a priori susceptible strains. Transformation from susceptibility in period I to resistance in period II was demonstrated in 5 (6.7%) clones, a pattern consistent with the concept of bacterial development of resistance under the influence of antibiotics. However, there were 10 (13.3%) clones whose strains exhibited an inverse pattern. Accordingly, two-way transformation of susceptibility took place during the study period. The utilization of the study aminoglycosides had no major impact on the variation of microbial susceptibility. Changes in microbial susceptibility were found to follow some regular patterns, which were not influenced by the study aminoglycosides. Two phenomena were observed: (i) there were stable clones that did not develop resistance in spite of selective antibiotic challenge; and (ii) changes of susceptibility in isolated bacteria from both inpatient and outpatient strains of the same clone were two-way and reversible.

Polyclonal secondary FGFR2 mutations drive acquired resistance to FGFR inhibition in patients with FGFR2 fusion-positive cholangiocarcinoma

PubMed Central

Goyal, Lipika; Saha, Supriya K.; Liu, Leah Y.; Siravegna, Giulia; Leshchiner, Ignaty; Ahronian, Leanne G.; Lennerz, Jochen K.; Vu, Phuong; Deshpande, Vikram; Kambadakone, Avinash; Mussolin, Benedetta; Reyes, Stephanie; Henderson, Laura; Sun, Jiaoyuan Elisabeth; Van Seventer, Emily E.; Gurski, Joseph M.; Baltschukat, Sabrina; Schacher-Engstler, Barbara; Barys, Louise; Stamm, Christelle; Furet, Pascal; Ryan, David P.; Stone, James R.; Iafrate, A. John; Getz, Gad; Porta, Diana Graus; Tiedt, Ralph; Bardelli, Alberto; Juric, Dejan; Corcoran, Ryan B.; Bardeesy, Nabeel; Zhu, Andrew X.

2017-01-01

Genetic alterations in the fibroblast growth factor receptor (FGFR) pathway are promising therapeutic targets in many cancers, including intrahepatic cholangiocarcinoma (ICC). The FGFR inhibitor BGJ398 displayed encouraging efficacy in patients with FGFR2 fusion-positive ICC in a phase II trial, but the durability of response was limited in some patients. Here, we report the molecular basis for acquired resistance to BGJ398 in three patients via integrative genomic characterization of cell-free circulating tumor DNA (cfDNA), primary tumors, and metastases. Serial analysis of cfDNA demonstrated multiple recurrent point mutations in the FGFR2 kinase domain at progression. Accordingly, biopsy of post-progression lesions and rapid autopsy revealed marked inter- and intra-lesional heterogeneity, with different FGFR2 mutations in individual resistant clones. Molecular modeling and in vitro studies indicated that each mutation lead to BGJ398 resistance and was surmountable by structurally distinct FGFR inhibitors. Thus, polyclonal secondary FGFR2 mutations represent an important clinical resistance mechanism that may guide development of future therapeutic strategies. PMID:28034880

Changes of heterogeneous cell populations in the Ishikawa cell line during long-term culture: Proposal for an in vitro clonal evolution model of tumor cells.

PubMed

Kasai, Fumio; Hirayama, Noriko; Ozawa, Midori; Iemura, Masashi; Kohara, Arihiro

2016-06-01

Genomic changes in tumor cell lines can occur during culture, leading to differences between cell lines carrying the same name. In this study, genome profiles between low and high passages were investigated in the Ishikawa 3-H-12 cell line (JCRB1505). Cells contained between 43 and 46 chromosomes and the modal number changed from 46 to 45 during culture. Cytogenetic analysis revealed that a translocation t(9;14), observed in all metaphases, is a robust marker for this cell line. Single-nucleotide polymorphism microarrays showed a heterogeneous copy number in the early passages and distinct profiles at late passages. These results demonstrate that cell culture can lead to elimination of ancestral clones by sequential selection, resulting in extensive replacement with a novel clone. Our observations on Ishikawa cells in vitro are different from the in vivo heterogeneity in which ancestral clones are often retained during tumor evolution and suggest a model for in vitro clonal evolution. Copyright © 2016 Elsevier Inc. All rights reserved.

A phage display vector optimized for the generation of human antibody combinatorial libraries and the molecular cloning of monoclonal antibody fragments.

PubMed

Solforosi, Laura; Mancini, Nicasio; Canducci, Filippo; Clementi, Nicola; Sautto, Giuseppe Andrea; Diotti, Roberta Antonia; Clementi, Massimo; Burioni, Roberto

2012-07-01

A novel phagemid vector, named pCM, was optimized for the cloning and display of antibody fragment (Fab) libraries on the surface of filamentous phage. This vector contains two long DNA "stuffer" fragments for easier differentiation of the correctly cut forms of the vector. Moreover, in pCM the fragment at the heavy-chain cloning site contains an acid phosphatase-encoding gene allowing an easy distinction of the Escherichia coli cells containing the unmodified form of the phagemid versus the heavy-chain fragment coding cDNA. In pCM transcription of heavy-chain Fd/gene III and light chain is driven by a single lacZ promoter. The light chain is directed to the periplasm by the ompA signal peptide, whereas the heavy-chain Fd/coat protein III is trafficked by the pelB signal peptide. The phagemid pCM was used to generate a human combinatorial phage display antibody library that allowed the selection of a monoclonal Fab fragment antibody directed against the nucleoprotein (NP) of Influenza A virus.

Diversity and community structure of fungi through a permafrost core profile from the Qinghai-Tibet Plateau of China.

PubMed

Hu, Weigang; Zhang, Qi; Li, Dingyao; Cheng, Gang; Mu, Jing; Wu, Qingbai; Niu, Fujun; An, Lizhe; Feng, Huyuan

2014-12-01

While a vast number of studies have addressed the prokaryotic diversity in permafrost, characterized by subzero temperatures, low water activity, and extremely low rates of nutrient and metabolite transfer, fungal patterns have received surprisingly limited attention. Here, the fungal diversity and community structure were investigated by culture-dependent technique combined with cloning-restriction fragment length polymorphism (RFLP) analysis of sediments in a 10-m-long permafrost core from the Qinghai-Tibet Plateau of China. A total of 62 fungal phylotypes related to 10 distinct classes representing three phyla were recovered from 5031 clones generated in 13 environmental gene libraries. A large proportion of the phylotypes (25/62) that were distantly related to described fungal species appeared to be novel diversity. Ascomycota was the predominant group of fungi, with respect to both clone and phylotype number. Our results suggested there was the existence of cosmopolitan psychrophilic or psychrotolerant fungi in permafrost sediments, the community composition of fungi varied with increasing depth, while these communities largely distributed according to core layers. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Genotype diversity in the honey bee parasite Nosema ceranae: multi-strain isolates, cryptic sex or both?

PubMed

Sagastume, Soledad; Martín-Hernández, Raquel; Higes, Mariano; Henriques-Gil, Nuno

2016-10-18

There is great controversy as to whether Microsporidia undergo a sexual cycle. In the paradigmatic case of Nosema ceranae, although there is no morphological evidence of sex, some meiosis-specific genes are present in its reduced genome and there is also high intraspecific variability, with incongruent phylogenies having been systematically obtained. The possibility of sexual recombination is important from an epidemiological standpoint, particularly as N. ceranae is considered to be a major factor in the current disquieting epidemic of widespread bee colony losses. This parasite apparently originated in oriental honey bees, spreading out of Asia and Australia to infect honey bees worldwide. This study had three main objectives: i) to obtain genetic markers that are not part of known multi-copy arrays for strain determination; ii) to shed light on the intraspecific variability and recombination of N. ceranae; and iii) to assess the variability in N. ceranae populations. The answers to these questions are critical to understand the capacity of adaptation of microsporidia. Biallelic polymorphisms were detected at a number of specific points in the five coding loci analyzed from European and Australian isolates of N. ceranae. Heterozygous genotypes were abundant and cloning experiments demonstrate that they reflect the existence of multiple alternative sequences in each isolate. The comparisons of different clones and genotypes clearly indicate that new haplotypes are generated by homologous recombination. The N. ceranae isolates from honey bees correspond to genotypically distinct populations, revealing that individual honey bees may not be infected by a particular clone but rather, a pool of different strains. Homologous recombination implies the existence of a cryptic sex cycle yet to be described in N. ceranae. There are no diagnostic alleles associated with Australian or European origins, nor are there differences between the two hosts, A. cerana and A. mellifera, supporting the absence of biological barriers for N. ceranae transmission. Diversity is high among microsporidia of both these origins, and the maintenance of a high heterozygosis in the recently invaded European populations, could hypothetically underlie the stronger virulence of N. ceranae observed in A. mellifera.

Metal mobilization by iron- and sulfur-oxidizing bacteria in a multiple extreme mine tailings in the Atacama Desert, Chile.

PubMed

Korehi, H; Blöthe, M; Sitnikova, M A; Dold, B; Schippers, A

2013-03-05

The marine shore sulfidic mine tailings dump at the Chañaral Bay in the Atacama Desert, northern Chile, is characterized by extreme acidity, high salinity, and high heavy metals concentrations. Due to pyrite oxidation, metals (especially copper) are mobilized under acidic conditions and transported toward the tailings surface and precipitate as secondary minerals (Dold, Environ. Sci. Technol. 2006, 40, 752-758.). Depth profiles of total cell counts in this almost organic-carbon free multiple extreme environment showed variable numbers with up to 10(8) cells g(-1) dry weight for 50 samples at four sites. Real-time PCR quantification and bacterial 16S rRNA gene diversity analysis via clone libraries revealed a dominance of Bacteria over Archaea and the frequent occurrence of the acidophilic iron(II)- and sulfur-oxidizing and iron(III)-reducing genera Acidithiobacillus, Alicyclobacillus, and Sulfobacillus. Acidophilic chemolithoautotrophic iron(II)-oxidizing bacteria were also frequently found via most-probable-number (MPN) cultivation. Halotolerant iron(II)-oxidizers in enrichment cultures were active at NaCl concentrations up to 1 M. Maximal microcalorimetrically determined pyrite oxidation rates coincided with maxima of the pyrite content, total cell counts, and MPN of iron(II)-oxidizers. These findings indicate that microbial pyrite oxidation and metal mobilization preferentially occur in distinct tailings layers at high salinity. Microorganisms for biomining with seawater salt concentrations obviously exist in nature.

Reproductive and therapeutic cloning, germline therapy, and purchase of gametes and embryos: comments on Canadian legislation governing reproduction technologies.

PubMed

Bernier, L; Grégoire, D

2004-12-01

In Canada, the Assisted Human Reproduction Act received royal assent on 29 March 2004. The approach proposed by the federal government responds to Canadians' strong desire for an enforceable legislative framework in the field of reproduction technologies through criminal law. As a result of the widening gap between the rapid pace of technological change and governing legislation, a distinct need was perceived to create a regulatory framework to guide decisions regarding reproductive technologies. In this article the three main topics covered in the new legislation are commented on: cloning, germline therapy, and purchase of gametes and embryos. Some important issues also covered in the new legislation, such as privacy and access to information, data protection, identity of donors, and inspection, will not be addressed.

Cloning, expression, and sequence analysis of the Bacillus methanolicus C1 methanol dehydrogenase gene.

PubMed Central

de Vries, G E; Arfman, N; Terpstra, P; Dijkhuizen, L

1992-01-01

The gene (mdh) coding for methanol dehydrogenase (MDH) of thermotolerant, methylotroph Bacillus methanolicus C1 has been cloned and sequenced. The deduced amino acid sequence of the mdh gene exhibited similarity to those of five other alcohol dehydrogenase (type III) enzymes, which are distinct from the long-chain zinc-containing (type I) or short-chain zinc-lacking (type II) enzymes. Highly efficient expression of the mdh gene in Escherichia coli was probably driven from its own promoter sequence. After purification of MDH from E. coli, the kinetic and biochemical properties of the enzyme were investigated. The physiological effect of MDH synthesis in E. coli and the role of conserved sequence patterns in type III alcohol dehydrogenases have been analyzed and are discussed. Images PMID:1644761

Cloning, preparation and preliminary crystallographic studies of penicillin V acylase autoproteolytic processing mutants

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chandra, P. Manish; Brannigan, James A., E-mail: jab@ysbl.york.ac.uk; Prabhune, Asmita

The production, crystallization and characterization of three inactive mutants of penicillin V acylase from B. sphaericus in their respective precursor and processed forms are reported. The space groups are different for the native enzyme and the mutants. The crystallization of three catalytically inactive mutants of penicillin V acylase (PVA) from Bacillus sphaericus in precursor and processed forms is reported. The mutant proteins crystallize in different primitive monoclinic space groups that are distinct from the crystal forms for the native enzyme. Directed mutants and clone constructs were designed to study the post-translational autoproteolytic processing of PVA. The catalytically inactive mutants willmore » provide three-dimensional structures of precursor PVA forms, plus open a route to the study of enzyme–substrate complexes for this industrially important enzyme.« less

Human cloning and embryo research: the 2003 John J. Conley Lecture on medical ethics.

PubMed

George, Robert P

2004-01-01

The author, a member of the U.S. President's Council on Bioethics, discusses ethical issues raised by human cloning, whether for purposes of bringing babies to birth or for research purposes. He first argues that every cloned human embryo is a new, distinct, and enduring organism, belonging to the species Homo sapiens, and directing its own development toward maturity. He then distinguishes between two types of capacities belonging to individual organisms belonging to this species, an immediately exerciseable capacity and a basic natural capacity that develops over time. He argues that it is the second type of capacity that is the ground for full moral respect, and that this capacity (and its concomitant degree of respect) belongs to cloned human embryos no less than to adult human beings. He then considers and rejects counter-arguments to his position, including the suggestion that the capacity of embryos is equivalent to the capacity of somatic cells, that full human rights are afforded only to human organisms with functioning brains, that the possibility of twinning diminishes the moral status of embryos, that the fact that people do not typically mourn the loss of early embryos implies that they have a diminished moral status, that the fact that early spontaneous abortions occur frequently diminishes the moral status of embryos, and that his arguments depend upon a concept of ensoulment. He concludes that if the moral status of cloned human embryos is equivalent to that of adults, then public policy should be based upon this assumption.

Analysis of Facultative Lithotroph Distribution and Diversity on Volcanic Deposits by Use of the Large Subunit of Ribulose 1,5-Bisphosphate Carboxylase/Oxygenase†

PubMed Central

Nanba, K.; King, G. M.; Dunfield, K.

2004-01-01

A 492- to 495-bp fragment of the gene coding for the large subunit of the form I ribulose 1,5-bisphosphate carboxylase/oxygenase (RubisCO) (rbcL) was amplified by PCR from facultatively lithotrophic aerobic CO-oxidizing bacteria, colorless and purple sulfide-oxidizing microbial mats, and genomic DNA extracts from tephra and ash deposits from Kilauea volcano, for which atmospheric CO and hydrogen have been previously documented as important substrates. PCR products from the mats and volcanic sites were used to construct rbcL clone libraries. Phylogenetic analyses showed that the rbcL sequences from all isolates clustered with form IC rbcL sequences derived from facultative lithotrophs. In contrast, the microbial mat clone sequences clustered with sequences from obligate lithotrophs representative of form IA rbcL. Clone sequences from volcanic sites fell within the form IC clade, suggesting that these sites were dominated by facultative lithotrophs, an observation consistent with biogeochemical patterns at the sites. Based on phylogenetic and statistical analyses, clone libraries differed significantly among volcanic sites, indicating that they support distinct lithotrophic assemblages. Although some of the clone sequences were similar to known rbcL sequences, most were novel. Based on nucleotide diversity and average pairwise difference, a forested site and an 1894 lava flow were found to support the most diverse and least diverse lithotrophic populations, respectively. These indices of diversity were not correlated with rates of atmospheric CO and hydrogen uptake but were correlated with estimates of respiration and microbial biomass. PMID:15066819

Analysis of facultative lithotroph distribution and diversity on volcanic deposits by use of the large subunit of ribulose 1,5-bisphosphate carboxylase/oxygenase.

PubMed

Nanba, K; King, G M; Dunfield, K

2004-04-01

A 492- to 495-bp fragment of the gene coding for the large subunit of the form I ribulose 1,5-bisphosphate carboxylase/oxygenase (RubisCO) (rbcL) was amplified by PCR from facultatively lithotrophic aerobic CO-oxidizing bacteria, colorless and purple sulfide-oxidizing microbial mats, and genomic DNA extracts from tephra and ash deposits from Kilauea volcano, for which atmospheric CO and hydrogen have been previously documented as important substrates. PCR products from the mats and volcanic sites were used to construct rbcL clone libraries. Phylogenetic analyses showed that the rbcL sequences from all isolates clustered with form IC rbcL sequences derived from facultative lithotrophs. In contrast, the microbial mat clone sequences clustered with sequences from obligate lithotrophs representative of form IA rbcL. Clone sequences from volcanic sites fell within the form IC clade, suggesting that these sites were dominated by facultative lithotrophs, an observation consistent with biogeochemical patterns at the sites. Based on phylogenetic and statistical analyses, clone libraries differed significantly among volcanic sites, indicating that they support distinct lithotrophic assemblages. Although some of the clone sequences were similar to known rbcL sequences, most were novel. Based on nucleotide diversity and average pairwise difference, a forested site and an 1894 lava flow were found to support the most diverse and least diverse lithotrophic populations, respectively. These indices of diversity were not correlated with rates of atmospheric CO and hydrogen uptake but were correlated with estimates of respiration and microbial biomass.

Study the Expression of marA Gene in Ciprofloxacin and Tetracycline Resistant Mutants of Esherichia coli

PubMed Central

Pourahmad Jaktaji, Razieh; Ebadi, Rayhaneh

2013-01-01

MarA activates two membrane dependent mechanisms of resistance to different antibiotics, such as ciprofloxacin and tetracycline, including promotion of outflux and inhibition of influx of antibiotics. Thus, MarA causes multiple antibiotic resistance phenotype. The activation of these mechanisms needs overexpression of marA. This could happen through mutation in marR. Thus, the aim of this study was to measure marA expression in ciprofloxacin resistant E. coli gyrA mutants and clones with or without marR mutation. For this purpose, real time PCR was used to measure relative expression of marA in above mutants and clones. Results showed that two clones, C14 and C17 overexpressed marA. It is concluded that the level of marA expression is important for activation of above mechanisms. PMID:24523773

Study the Expression of marA Gene in Ciprofloxacin and Tetracycline Resistant Mutants of Esherichia coli.

PubMed

Pourahmad Jaktaji, Razieh; Ebadi, Rayhaneh

2013-01-01

MarA activates two membrane dependent mechanisms of resistance to different antibiotics, such as ciprofloxacin and tetracycline, including promotion of outflux and inhibition of influx of antibiotics. Thus, MarA causes multiple antibiotic resistance phenotype. The activation of these mechanisms needs overexpression of marA. This could happen through mutation in marR. Thus, the aim of this study was to measure marA expression in ciprofloxacin resistant E. coli gyrA mutants and clones with or without marR mutation. For this purpose, real time PCR was used to measure relative expression of marA in above mutants and clones. Results showed that two clones, C14 and C17 overexpressed marA. It is concluded that the level of marA expression is important for activation of above mechanisms.

Effect of seedling stock on the early stand development and physiology of improved loblolly pine (Pinus taeda L.) seedlings

Treesearch

Shakuntala Sharma; Joshua P. Adams; Jamie L. Schuler; Robert L. Ficklin; Don C. Bragg

2016-01-01

This study assessed the effects of spacing and genotype on the growth and physiology of improved loblolly pine (Pinus taeda L.) seedlings from three distinct genotypes planted in Drew County, Arkansas (USA). Genotype had a significant effect on survival and height. Clone CF Var 1 showed greater height and survival compared to other seedlings....

Theological issues in genetics.

PubMed

Walter, J J

1999-03-01

Theological reflection can contribute a distinctive perspective from which to analyze and evaluate moral debates about issues in modern genetics and reproductive medicine. The author appeals to two hermeneutical themes, human beings as "images of God" and the tendency of humans to "play God," in order to discuss various church statements and theological literature on human gene transfer, somatic cell nuclear transplant cloning of human beings, and patenting of human genes.

Synergistic capture of Clostridium botulinum Type A neurotoxin by scFv antibodies to novel epitopes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gray, Sean A.; Barr, John R.; Kalb, Suzanne R.

2011-10-01

A non-immune library of human single chain fragment variable (scFv) antibodies displayed on Saccharomyces cerevisiae was screened for binding to the Clostridium botulinum neurotoxin serotype A binding domain [BoNT/A (Hc)] with the goal of identifying scFv to novel epitopes. To do this, an antibody-mediated labeling strategy was used in which antigen-binding yeast clones were selected after labeling with previously characterized monoclonal antibodies (MAbs) specific to the Hc. Twenty unique scFv clones were isolated that bound Hc. Of these, three also bound to full-length BoNT/A toxin complex with affinities ranging from 5 nM to 170 nM. Epitope binning showed that themore » three unique clones recognized at least two epitopes that were distinct from one another and from the detection MAbs. After production in E. coli, the scFv were coupled to magnetic particles and tested for their ability to capture BoNT/A holotoxin using an Endopep-MS assay. In this assay, toxin captured by scFv coated magnetic particles was detected by incubation of the complex with a peptide containing a BoNT/A-specific cleavage sequence. Mass spectrometry was used to detect the ratio of intact peptide to cleavage products as evidence for toxin capture. When tested individually, each of the scFv showed a weak positive Endopep-MS result. However, when the particles were coated with all three scFv simultaneously, they exhibited significantly higher Endopep-MS activity, consistent with synergistic binding. These results demonstrate novel approaches toward the isolation and characterization of scFv antibodies specific to unlabeled antigen. They also provide evidence that distinct scFv antibodies can work synergistically to increase the efficiency of antigen capture onto a solid support.« less

Genome-Based Infection Tracking Reveals Dynamics of Clostridium difficile Transmission and Disease Recurrence.

PubMed

Kumar, Nitin; Miyajima, Fabio; He, Miao; Roberts, Paul; Swale, Andrew; Ellison, Louise; Pickard, Derek; Smith, Godfrey; Molyneux, Rebecca; Dougan, Gordon; Parkhill, Julian; Wren, Brendan W; Parry, Christopher M; Pirmohamed, Munir; Lawley, Trevor D

2016-03-15

Accurate tracking of Clostridium difficile transmission within healthcare settings is key to its containment but is hindered by the lack of discriminatory power of standard genotyping methods. We describe a whole-genome phylogenetic-based method to track the transmission of individual clones in infected hospital patients from the epidemic C. difficile 027/ST1 lineage, and to distinguish between the 2 causes of recurrent disease, relapse (same strain), or reinfection (different strain). We monitored patients with C. difficile infection in a UK hospital over a 2-year period. We performed whole-genome sequencing and phylogenetic analysis of 108 strains isolated from symptomatic patients. High-resolution phylogeny was integrated with in-hospital transfers and contact data to create an infection network linking individual patients and specific hospital wards. Epidemic C. difficile 027/ST1 caused the majority of infections during our sampling period. Integration of whole-genome single nucleotide polymorphism (SNP) phylogenetic analysis, which accurately discriminated between 27 distinct SNP genotypes, with patient movement and contact data identified 32 plausible transmission events, including ward-based contamination (66%) or direct donor-recipient contact (34%). Highly contagious donors were identified who contributed to the persistence of clones within distinct hospital wards and the spread of clones between wards, especially in areas of intense turnover. Recurrent cases were identified between 4 and 26 weeks, highlighting the limitation of the standard <8-week cutoff used for patient diagnosis and management. Genome-based infection tracking to monitor the persistence and spread of C. difficile within healthcare facilities could inform infection control and patient management. © The Author 2015. Published by Oxford University Press for the Infectious Diseases Society of America.

Perturbed hematopoietic stem and progenitor cell hierarchy in myelodysplastic syndromes patients with monosomy 7 as the sole cytogenetic abnormality.

PubMed

Dimitriou, Marios; Woll, Petter S; Mortera-Blanco, Teresa; Karimi, Mohsen; Wedge, David C; Doolittle, Helen; Douagi, Iyadh; Papaemmanuil, Elli; Jacobsen, Sten Eirik W; Hellström-Lindberg, Eva

2016-11-08

The stem and progenitor cell compartments in low- and intermediate-risk myelodysplastic syndromes (MDS) have recently been described, and shown to be highly conserved when compared to those in acute myeloid leukemia (AML). Much less is known about the characteristics of the hematopoietic hierarchy of subgroups of MDS with a high risk of transforming to AML. Immunophenotypic analysis of immature stem and progenitor cell compartments from patients with an isolated loss of the entire chromosome 7 (isolated -7), an independent high-risk genetic event in MDS, showed expansion and dominance of the malignant -7 clone in the granulocyte and macrophage progenitors (GMP), and other CD45RA+ progenitor compartments, and a significant reduction of the LIN-CD34+CD38low/-CD90+CD45RA- hematopoietic stem cell (HSC) compartment, highly reminiscent of what is typically seen in AML, and distinct from low-risk MDS. Established functional in vitro and in vivo stem cell assays showed a poor readout for -7 MDS patients irrespective of marrow blast counts. Moreover, while the -7 clone dominated at all stages of GM differentiation, the -7 clone had a competitive disadvantage in erythroid differentiation. In azacitidine-treated -7 MDS patients with a clinical response, the decreased clonal involvement in mononuclear bone marrow cells was not accompanied by a parallel reduced clonal involvement in the dominant CD45RA+ progenitor populations, suggesting a selective azacitidine-resistance of these distinct -7 progenitor compartments. Our data demonstrate, in a subgroup of high risk MDS with monosomy 7, that the perturbed stem and progenitor cell compartments resemble more that of AML than low-risk MDS.

A cloning and expression analysis of pregnancy-associated glycoproteins expressed in trophoblasts of the white-tail deer placenta.

PubMed

Brandt, Gretchen A; Parks, Tina E; Killian, Gary; Ealy, Alan D; Green, Jonathan A

2007-11-01

The pregnancy-associated glycoproteins (PAGs) are placental proteins that have been cloned from swine, sheep, goats, and cattle, but never from animals within the Cervidae family. The goal of this work was to characterize PAGs in white-tailed deer. Placenta and uterine tissues were collected from pregnant does at days 85 and 90 of pregnancy. RNA from cotyledons was used to amplify deer PAGs by RT-PCR. Ten distinct cDNAs were cloned and sequenced. Some normally conserved amino acids comprising the catalytic site were found to be altered in deer PAGs 4, 5, and 8; another PAG, (PAG-9) was a splice variant that lacked exon 7. In each case, these mutations would likely preclude proteolytic activity for these proteins. A phylogenetic analysis revealed that most of the deer PAGs fell within the ancient PAG grouping. The remainder fell within the more modern (BNC-specific) PAG group. Western blotting was performed with anti-PAG antibodies and this analysis revealed that deer PAGs comprise a heterogeneous group based on different antigenicities and electrophoretic mobilities. Immunohistochemistry and in situ hybridization revealed some unique localization patterns of PAGs in the deer placentome compared to those in other ruminants. Most notably, deer PAGs 4 and 5, which according to the phylogeny, are "ancient PAGs," were expected to be present in all trophoblasts; instead, they were localized to the BNC. Although many of the PAGs identified here are very similar to those in Bovidae, some are clearly distinct in their expression pattern and probably possess functional roles unique to cervid reproduction. (c) 2007 Wiley-Liss, Inc.

Emergence and genomic diversification of a virulent serogroup W:ST-2881(CC175) Neisseria meningitidis clone in the African meningitis belt.

PubMed

Lamelas, Araceli; Hauser, Julia; Dangy, Jean-Pierre; Hamid, Abdul-Wahab M; Röltgen, Katharina; Abdul Sater, Mohamad R; Hodgson, Abraham; Sie, Ali; Junghanss, Thomas; Harris, Simon R; Parkhill, Julian; Bentley, Stephen D; Pluschke, Gerd

2017-08-01

Countries of the African 'meningitis belt' are susceptible to meningococcal meningitis outbreaks. While in the past major epidemics have been primarily caused by serogroup A meningococci, W strains are currently responsible for most of the cases. After an epidemic in Mecca in 2000, W:ST-11 strains have caused many outbreaks worldwide. An unrelated W:ST-2881 clone was described for the first time in 2002, with the first meningitis cases caused by these bacteria reported in 2003. Here we describe results of a comparative whole-genome analysis of 74 W:ST-2881 strains isolated within the framework of two longitudinal colonization and disease studies conducted in Ghana and Burkina Faso. Genomic data indicate that the W:ST-2881 clone has emerged from Y:ST-175(CC175) bacteria by capsule switching. The circulating W:ST-2881 populations were composed of a variety of closely related but distinct genomic variants with no systematic differences between colonization and disease isolates. Two distinct and geographically clustered phylogenetic clonal variants were identified in Burkina Faso and a third in Ghana. On the basis of the presence or absence of 17 recombination fragments, the Ghanaian variant could be differentiated into five clusters. All 25 Ghanaian disease isolates clustered together with 23 out of 40 Ghanaian isolates associated with carriage within one cluster, indicating that W:ST-2881 clusters differ in virulence. More than half of the genes affected by horizontal gene transfer encoded proteins of the 'cell envelope' and the 'transport/binding protein' categories, which indicates that exchange of non-capsular antigens plays an important role in immune evasion.

Binding-, intracellular transport-, and biosynthesis-defective mutants of vasopressin type 2 receptor in patients with X-linked nephrogenic diabetes insipidus.

PubMed Central

Tsukaguchi, H; Matsubara, H; Taketani, S; Mori, Y; Seido, T; Inada, M

1995-01-01

Nephrogenic diabetes insipidus (NDI) is most often an X-linked disorder in which urine is not concentrated due to renal resistance to arginine vasopressin. We recently identified four vasopressin type 2 receptor gene mutations in unrelated X-linked NDI families, including R143P, delta V278, R202C, and 804insG. All these mutations reduced ligand binding activity to < 10% of the normal without affecting mRNA accumulation. To elucidate whether the receptors are expressed on the cell surface, we analyzed biosynthesis and localization of tagged or untagged receptors stably expressed in Chinese hamster ovary (CHO) cells, using two antibodies directed against distinct termini. Whole-cell and surface labeling studies revealed that the R202C clone had both surface-localized (50-55 kD) and intracellular proteins (40 and 75 kD), similar to the wild-type AVPR2 clone, whereas the R143P and delta V278 clones lacked the surface receptors, despite relatively increased intracellular components. The 804insG mutant cell produced no proteins despite an adequate mRNA level. Immunofluorescence staining confirmed that the R202C mutant reaches the cell surface, whereas the R143P and delta V278 mutants are retained within the cytoplasmic compartment. Thus, R202C, R143P/delta V278, and 804insG result in three distinct phenotypes, that is, a simple binding impairment at the cell surface, blocked intracellular transport, and ineffective biosynthesis or/and accelerated degradation of the receptor, respectively, and therefore are responsible for NDI. This phenotypic classification will help understanding of molecular pathophysiology of this disorder. Images PMID:7560098

Single-Cell RNA Sequencing Reveals Expanded Clones of Islet Antigen-Reactive CD4+ T Cells in Peripheral Blood of Subjects with Type 1 Diabetes.

PubMed

Cerosaletti, Karen; Barahmand-Pour-Whitman, Fariba; Yang, Junbao; DeBerg, Hannah A; Dufort, Matthew J; Murray, Sara A; Israelsson, Elisabeth; Speake, Cate; Gersuk, Vivian H; Eddy, James A; Reijonen, Helena; Greenbaum, Carla J; Kwok, William W; Wambre, Erik; Prlic, Martin; Gottardo, Raphael; Nepom, Gerald T; Linsley, Peter S

2017-07-01

The significance of islet Ag-reactive T cells found in peripheral blood of type 1 diabetes (T1D) subjects is unclear, partly because similar cells are also found in healthy control (HC) subjects. We hypothesized that key disease-associated cells would show evidence of prior Ag exposure, inferred from expanded TCR clonotypes, and essential phenotypic properties in their transcriptomes. To test this, we developed single-cell RNA sequencing procedures for identifying TCR clonotypes and transcript phenotypes in individual T cells. We applied these procedures to analysis of islet Ag-reactive CD4 + memory T cells from the blood of T1D and HC individuals after activation with pooled immunodominant islet peptides. We found extensive TCR clonotype sharing in Ag-activated cells, especially from individual T1D subjects, consistent with in vivo T cell expansion during disease progression. The expanded clonotype from one T1D subject was detected at repeat visits spanning >15 mo, demonstrating clonotype stability. Notably, we found no clonotype sharing between subjects, indicating a predominance of "private" TCR specificities. Expanded clones from two T1D subjects recognized distinct IGRP peptides, implicating this molecule as a trigger for CD4 + T cell expansion. Although overall transcript profiles of cells from HC and T1D subjects were similar, profiles from the most expanded clones were distinctive. Our findings demonstrate that islet Ag-reactive CD4 + memory T cells with unique Ag specificities and phenotypes are expanded during disease progression and can be detected by single-cell analysis of peripheral blood. Copyright © 2017 by The American Association of Immunologists, Inc.

Human natural killer cell receptors for HLA-class I molecules. Evidence that the Kp43 (CD94) molecule functions as receptor for HLA-B alleles

PubMed Central

1994-01-01

GL183 or EB6 (p58) molecules have been shown to function as receptors for different HLA-C alleles and to deliver an inhibitory signal to natural killer (NK) cells, thus preventing lysis of target cells. In this study, we analyzed a subset of NK cells characterized by a p58- negative surface phenotype. We show that p58-negative clones, although specific for class I molecules do not recognize HLA-C alleles. In addition, by the use of appropriate target cells transfected with different HLA-class I alleles we identified HLA-B7 as the protective element recognized by a fraction of p58-negative clones. In an attempt to identify the receptor molecules expressed by HLA-B7-specific clones, monoclonal antibodies (mAbs) were selected after mice immunization with such clones. Two of these mAbs, termed XA-88 and XA-185, and their F(ab')2 fragments, were found to reconstitute lysis of B7+ target cells by B7-specific NK clones. Both mAbs were shown to be directed against the recently clustered Kp43 molecule (CD94). Thus, mAb-mediated masking of Kp43 molecules interferes with recognition of HLA-B7 and results in target cell lysis. Moreover, in a redirected killing assay, the cross- linking of Kp43 molecules mediated by the XA185 mAb strongly inhibited the cytolytic activity of HLA-B7-specific NK clones, thus mimicking the functional effect of B7 molecules. Taken together, these data strongly suggest that Kp43 molecules function as receptors for HLA-B7 and that this receptor/ligand interaction results in inhibition of the NK- mediated cytolytic activity. Indirect immunofluorescence and FACS analysis of a large number of random NK clones showed that Kp43 molecules (a) were brightly expressed on a subset of p58-negative clones, corresponding to those specific for HLA-B7; (b) displayed a medium/low fluorescence in the p58-negative clones that are not B7- specific as well as in most p58+ NK clones; and (c) were brightly expressed as in the p58+ clone ET34 (GL183-/EB6+, Cw4-specific). Functional analysis revealed that Kp43 functioned as an inhibitory receptor only in NK clones displaying bright fluorescence. These studies also indicate that some NK clones (e.g., the ET34) can coexpress two distinct receptors (p58 and Kp43) for different class I alleles (Cw4 and B7). Finally, we show that Kp43 molecules function as receptors only for some HLA-B alleles and that still undefined receptor(s) must exist for other HLA-B alleles including B27. PMID:8046333

Multiple approaches to characterize the microbial community in a thermophilic anaerobic digester running on swine manure: a case study.

PubMed

Tuan, Nguyen Ngoc; Chang, Yi-Chia; Yu, Chang-Ping; Huang, Shir-Ly

2014-01-01

In this study, the first survey of microbial community in thermophilic anaerobic digester using swine manure as sole feedstock was performed by multiple approaches including denaturing gradient gel electrophoresis (DGGE), clone library and pyrosequencing techniques. The integrated analysis of 21 DGGE bands, 126 clones and 8506 pyrosequencing read sequences revealed that Clostridia from the phylum Firmicutes account for the most dominant Bacteria. In addition, our analysis also identified additional taxa that were missed by the previous researches, including members of the bacterial phyla Synergistetes, Planctomycetes, Armatimonadetes, Chloroflexi and Nitrospira which might also play a role in thermophilic anaerobic digester. Most archaeal 16S rRNA sequences could be assigned to the order Methanobacteriales instead of Methanomicrobiales comparing to previous studies. In addition, this study reported that the member of Methanothermobacter genus was firstly found in thermophilic anaerobic digester. Copyright © 2014 Elsevier GmbH. All rights reserved.

Autographa californica multiple nucleopolyhedrovirus ODV-E56 is a per os infectivity factor, but is not essential for binding and fusion of occlusion-derived virus to the host midgut

USDA-ARS?s Scientific Manuscript database

The Autographa californica multiple nucleopolyhedrovirus (AcMNPV) occlusion-derived virus (ODV) envelope protein ODV-E56 is essential for oral infection of neonate Heliothis virescens larvae. Here, we present a more detailed study of ODV-E56 function. Bioassays with recombinant clones of AcMNPV lack...

Identification and characterization of a new multigene family in the human MHC: A candidate autoimmune disease susceptibility element (3.8-1)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harris, J.M.; Venditti, C.P.; Chorney, M.J.

1994-09-01

An association between idiopathic hemochromatosis (HFE) and the HLA-A3 locus has been previously well-established. In an attempt to identify potential HFE candidate genes, a genomic DNA fragment distal to the HLA-A9 breakpoint was used to screen a B cell cDNA library; a member (3.8-1) of a new multigene family, composed of five distinct genomic cross-reactive fragments, was identified. Clone 3.8-1 represents the 3{prime} end of 9.6 kb transcript which is expressed in multiple tissues including the spleen, thymus, lung and kidney. Sequencing and genome database analysis indicate that 3.8-1 is unique, with no homology to any known entries. The genomicmore » residence of 3-8.1, defined by polymorphism analysis and physical mapping using YAC clones, appears to be absent from the genomes of higher primates, although four other cross-reactivities are maintained. The absence of this gene as well as other probes which map in the TNF to HLA-B interval, suggest that this portion of the human HMC, located between the Class I and Class III regions, arose in humans as the result of a post-speciation insertional event. The large size of the 3.8-1 gene and the possible categorization of 3.8-1 as a human-specific gene are significant given the genetic data that place an autoimmune susceptibility element for IDDM and myasthenia gravis in the precise region where this gene resides. In an attempt to isolate the 5{prime} end of this large transcript, we have constructed a cosmid contig which encompasses the genomic locus of this gene and are progressively isolating coding sequences by exon trapping.« less

Identification and molecular cloning of novel transcripts of the human kallikrein-related peptidase 10 (KLK10) gene using next-generation sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Adamopoulos, Panagiotis G.; Kontos, Christos K.; Scorilas, Andreas

Tissue kallikrein and kallikrein-related peptidases (KLKs) form the largest group of serine proteases in the human genome, sharing many structural and functional characteristics. Multiple alternative transcripts have been reported for the most human KLK genes, while many of them are aberrantly expressed in various malignancies, thus possessing significant prognostic and/or diagnostic value. Alternative splicing of cancer-related genes is a common cellular mechanism accounting for cancer cell transcriptome complexity, as it affects cell cycle control, proliferation, apoptosis, invasion, and metastasis. In this study, we describe the identification and molecular cloning of eight novel transcripts of the human KLK10 gene using 3′more » rapid amplification of cDNA ends (3′ RACE) and next-generation sequencing (NGS), as well as their expression analysis in a wide panel of cell lines, originating from several distinct cancerous and normal tissues. Bioinformatic analysis revealed that the novel KLK10 transcripts contain new alternative splicing events between already annotated exons as well as novel exons. In addition, investigation of their expression profile in a wide panel of cell lines was performed with nested RT-PCR using variant-specific pairs of primers. Since many KLK mRNA transcripts possess clinical value, these newly discovered alternatively spliced KLK10 transcripts appear as new potential biomarkers for diagnostic and/or prognostic purposes or as targets for therapeutic strategies. - Highlights: • NGS was used to identify novel transcripts of the human KLK10 gene. • 8 novel KLK10 transcripts were identified. • A novel 3′UTR was detected and characterized. • The expression profiles of all 8 novel KLK10 transcripts were identified.« less

An outbreak of respiratory tularemia caused by diverse clones of Francisella tularensis.

PubMed

Johansson, Anders; Lärkeryd, Adrian; Widerström, Micael; Mörtberg, Sara; Myrtännäs, Kerstin; Ohrman, Caroline; Birdsell, Dawn; Keim, Paul; Wagner, David M; Forsman, Mats; Larsson, Pär

2014-12-01

The bacterium Francisella tularensis is recognized for its virulence, infectivity, genetic homogeneity, and potential as a bioterrorism agent. Outbreaks of respiratory tularemia, caused by inhalation of this bacterium, are poorly understood. Such outbreaks are exceedingly rare, and F. tularensis is seldom recovered from clinical specimens. A localized outbreak of tularemia in Sweden was investigated. Sixty-seven humans contracted laboratory-verified respiratory tularemia. F. tularensis subspecies holarctica was isolated from the blood or pleural fluid of 10 individuals from July to September 2010. Using whole-genome sequencing and analysis of single-nucleotide polymorphisms (SNPs), outbreak isolates were compared with 110 archived global isolates. There were 757 SNPs among the genomes of the 10 outbreak isolates and the 25 most closely related archival isolates (all from Sweden/Finland). Whole genomes of outbreak isolates were >99.9% similar at the nucleotide level and clustered into 3 distinct genetic clades. Unexpectedly, high-sequence similarity grouped some outbreak and archival isolates that originated from patients from different geographic regions and up to 10 years apart. Outbreak and archival genomes frequently differed by only 1-3 of 1 585 229 examined nucleotides. The outbreak was caused by diverse clones of F. tularensis that occurred concomitantly, were widespread, and apparently persisted in the environment. Multiple independent acquisitions of F. tularensis from the environment over a short time period suggest that natural outbreaks of respiratory tularemia are triggered by environmental cues. The findings additionally caution against interpreting genome sequence identity for this pathogen as proof of a direct epidemiological link. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

The VBP and a1/EBP leucine zipper factors bind overlapping subsets of avian retroviral long terminal repeat CCAAT/enhancer elements.

PubMed

Smith, C D; Baglia, L A; Curristin, S M; Ruddell, A

1994-10-01

Two long terminal repeat (LTR) enhancer-binding proteins which may regulate high rates of avian leukosis virus (ALV) LTR-enhanced c-myc transcription during bursal lymphomagenesis have been identified (A. Ruddell, M. Linial, and M. Groudine, Mol. Cell. Biol. 9:5660-5668, 1989). The genes encoding the a1/EBP and a3/EBP binding factors were cloned by expression screening of a lambda gt11 cDNA library from chicken bursal lymphoma cells. The a1/EBP cDNA encodes a novel leucine zipper transcription factor (W. Bowers and A. Ruddell, J. Virol. 66:6578-6586, 1992). The partial a3/EBP cDNA clone encodes amino acids 84 to 313 of vitellogenin gene-binding protein (VBP), a leucine zipper factor that binds the avian vitellogenin II gene promoter (S. Iyer, D. Davis, and J. Burch, Mol. Cell. Biol. 11:4863-4875, 1991). Multiple VBP mRNAs are expressed in B cells in a pattern identical to that previously observed for VBP in other cell types. The LTR-binding activities of VBP, a1/EBP, and B-cell nuclear extract protein were compared and mapped by gel shift, DNase I footprinting, and methylation interference assays. The purified VBP and a1/EBP bacterial fusion proteins bind overlapping but distinct subsets of CCAAT/enhancer elements in the closely related ALV and Rous sarcoma virus (RSV) LTR enhancers. Protein binding to these CCAAT/enhancer elements accounts for most of the labile LTR enhancer-binding activity observed in B-cell nuclear extracts. VBP and a1/EBP could mediate the high rates of ALV and RSV LTR-enhanced transcription in bursal lymphoma cells and many other cell types.

Global epidemiology of capsular group W meningococcal disease (1970-2015): Multifocal emergence and persistence of hypervirulent sequence type (ST)-11 clonal complex.

PubMed

Mustapha, Mustapha M; Marsh, Jane W; Harrison, Lee H

2016-03-18

Following an outbreak in Mecca Saudi Arabia in 2000, meningococcal strains expressing capsular group W (W) emerged as a major cause of invasive meningococcal disease (IMD) worldwide. The Saudi Arabian outbreak strain (Hajj clone) belonging to the ST-11 clonal complex (cc11) is similar to W cc11 causing occasional sporadic disease before 2000. Since 2000, W cc11 has caused large meningococcal disease epidemics in the African meningitis belt and endemic disease in South America, Europe and China. Traditional molecular epidemiologic typing suggested that a majority of current W cc11 burden represented global spread of the Hajj clone. However, recent whole genome sequencing (WGS) analyses revealed significant genetic heterogeneity among global W cc11 strains. While continued spread of the Hajj clone occurs in the Middle East, the meningitis belt and South Africa have co-circulation of the Hajj clone and other unrelated W cc11 strains. Notably, South America, the UK, and France share a genetically distinct W cc11 strain. Other W lineages persist in low numbers in Europe, North America and the meningitis belt. In summary, WGS is helping to unravel the complex genomic epidemiology of group W meningococcal strains. Wider application of WGS and strengthening of global IMD surveillance is necessary to monitor the continued evolution of group W lineages. Copyright © 2016 Elsevier Ltd. All rights reserved.

Gene encoding a deubiquitinating enzyme is mutated in artesunate- and chloroquine-resistant rodent malaria parasites.

PubMed

Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro

2007-07-01

Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed.

Gene encoding a deubiquitinating enzyme is mutated in artesunate- and chloroquine-resistant rodent malaria parasites§

PubMed Central

Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro

2007-01-01

Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed. PMID:17581118

Repressive but not activating epigenetic modifications are aberrant on the inactive X chromosome in live cloned cattle.

PubMed

Geng-Sheng, Cao; Yu, Gao; Kun, Wang; Fang-Rong, Ding; Ning, Li

2009-08-01

X inactivation is the process of a chromosome-wide silencing of the majority of genes on the X chromosome during early mammalian development. This process may be aberrant in cloned animals. Here we show that repressive modifications, such as methylation of DNA, and the presence of methylated histones, H3K9me2 and H3K27me3, exhibit distinct aberrance on the inactive X chromosome in live clones. In contrast, H3K4me3, an active gene marker, is obviously missing from the inactive X chromosome in all cattle studied. This suggests that the disappearance of active histone modifications (H3K4me3) seems to be more important for X inactivation than deposition of marks associated with heterochromatin (DNA methylation, H3K27me3 and H3K9me2). It also implies that even apparently normal clones may have subtle abnormalities in repressive, but not activating epigenetic modifications on the inactive X when they survive to term. We also found that the histone H3 methylations were enriched and co-localized at q21-31 of the active X chromosome, which may be associated with an abundance of LINE1 repeat elements. © 2009 The Authors. Journal compilation © 2009 Japanese Society of Developmental Biologists.

Development and evaluation of an efficient heterologous gene knock-in reporter system in Lactococcus lactis.

PubMed

Lu, Yifei; Yan, Hongxiang; Deng, Jiezhong; Huang, Zhigang; Jin, Xurui; Yu, Yanlan; Hu, Qiwen; Hu, Fuquan; Wang, Jing

2017-09-18

Lactococcus lactis is a food grade probiotics and widely used to express heterologous proteins. Generally, target genes are knocked into the L. lactis genome through double-crossover recombination to express heterologous proteins stably. However, creating marker-less heterologous genes knocked-in clones is laborious. In this study, an efficient heterologous gene knock-in reporter system was developed in L. lactis NZ9000. Our knock-in reporter system consists of a temperature-sensitive plasmid pJW and a recombinant L. lactis strain named NZB. The pJW contains homologous arms, and was constructed to knock-in heterologous genes at a fixed locus of NZ9000 genome. lacZ (β-galactosidase) gene was knocked into the chromosome of NZ9000 as a counter-selective marker through the plasmid pJW to generate NZB. The engineered NZB strain formed blue colonies on X-Gal plate. The desired double-crossover mutants formed white colonies distinctive from the predominantly blue colonies (parental and plasmid-integrated clones) when the embedded lacZ was replaced with the target heterologous genes carried by pJW in NZB. By using the system, the heterologous gene knocked-in clones are screened by colony phenotype change rather than by checking colonies individually. Our new knock-in reporter system provides an efficient method to create heterologous genes knocked-in clones.

Evidence of the Insensitivity of the α-inc Allele to the Function of the Homothallic Genes in Saccharomyces Yeasts

PubMed Central

Takano, Isamu; Arima, Kenji

1979-01-01

The possible function of the α-inc allele (an α mating-type allele that is insensitive to the function of the homothallic gene system) was investigated by means of protoplast fusion. The fusion of protoplasts prepared from haploid strains of α-inc HO HMα HMa and α ho hmα HMa gave rise mainly to nonmating clones (58 of 64 isolates) and a few clones (six of 64 isolates) showing α mating type. Thirty of the 58 nonmating clones showed the diploid cell size and 28 clones had a larger cell size. Tetrad analysis of the nonmating clones with diploid cell size indicated that they were a/α-inc diploid; the normal α allele in α/α-inc cells was preferentially switched to an a allele. This observation further indicated that the HO/ho HMα/hmα HMa/HMa genotype is effective for the conversion of the α to a and that the inconvertibility of the α-inc allele is due to the insensitivity of the mating-type allele to the functional combination of the homothallic genes. It was suspected that fusion products larger than diploid cells might have been caused by multiple fusion of protoplasts. PMID:17248884

Embryonic rather than extraembryonic tissues have more impact on the development of placental hyperplasia in cloned mice.

PubMed

Miki, H; Wakisaka, N; Inoue, K; Ogonuki, N; Mori, M; Kim, J-M; Ohta, A; Ogura, A

2009-06-01

Somatic cell cloning by nuclear transfer (NT) in mice is associated with hyperplastic placentas at term. To dissect the effects of embryonic and extraembryonic tissues on this clone-associated phenotype, we constructed diploid (2n) fused with (<-->) tetraploid (4n) chimeras from NT- and fertilization-derived (FD) embryos. Generally, the 4n cells contributed efficiently to all the extraembryonic tissues but not to the embryo itself. Embryos constructed by 2n NT<-->4n FD aggregation developed hyperplastic placentas (0.33+/-0.22 g) with a predominant contribution by NT-derived cells. Even when the population of FD-derived cells in placentas was increased using multiple FD embryos (up to four) for aggregation, most placentas remained hyperplastic (0.36+/-0.13 g). By contrast, placentas of the reciprocal combination, 2n FD<-->4n NT, were less hyperplastic (0.15+/-0.02 g). These nearly normal-looking placentas had a large proportion of NT-derived cells. Thus, embryonic rather than extraembryonic tissues had more impact on the onset of placental hyperplasia, and that the abnormal placentation in clones occurs in a noncell-autonomous manner. These findings suggest that for improvement of cloning efficiency we should understand the mechanisms regulating placentation, especially those of embryonic origin that might control the proliferation of trophoblastic lineage cells.

A cloned DNA segment from the telomeric region of human chromosome 4p is not detectably rearranged in Huntington disease patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pritchard, C.; Casher, D.; Myers, R.M.

1990-09-01

Genetic linkage studies have mapped the Huntington disease (HD) mutation to the distal region of the short arm of human chromosome 4. Analysis of recombination events in this region has produced contradictory locations for HD. One possible location is in the region distal to the D4S90 marker, which is located within 300 kilobases of the telomere. Other crossover events predict a more centromeric position for HD. Here the authors analyze the telomeric region of 4p in detail. Cloned DNA segments were derived from this region by utilizing a radiation-induced somatic cell hybrid as a source of DNA combined with preparativemore » pulsed-field gel electrophoresis to enrich for the telmoeric fraction. Additional DNA was obtained by using the cloned segments as multiple start points for cosmid walks. This strategy proved to be an effective method for cloning 250 kilobases of DNA in the region telomeric to D4S90. Hybridization analysis with the cloned DNA did not provide any evidence for the presence of rearrangements of 100 base pairs or greater in the DNA of individuals affected with HD. They also found no charge in the size or structure of the 4p telomere in these samples.« less

Cloning and expression of delta-1-pyrroline-5-carboxylate dehydrogenase in Escherichia coli DH5α improves phosphate solubilization.

PubMed

Gong, Mingbo; Tang, Chaoxi; Zhu, Changxiong

2014-11-01

A primary cDNA library of Penicillium oxalicum I1 was constructed using the switching mechanism at the 5' end of the RNA transcript (SMART) technique. A total of 106 clones showed halos in tricalcium phosphate (TCP) medium, and clone I-40 showed clear halos. The full-length cDNA of clone I-40 was 1355 bp with a complete open reading frame (ORF) of 1032 bp, encoding a protein of 343 amino acids. Multiple alignment analysis revealed a high degree of homology between the ORF of clone I-40 and delta-1-pyrroline-5-carboxylate dehydrogenase (P5CDH) of other fungi. The ORF expression vector was constructed and transformed into Escherichia coli DH5α. The transformant (ORF-1) with the P5CDH gene secreted organic acid in medium with TCP as the sole source of phosphate. Acetic acid and α-ketoglutarate were secreted in 4 and 24 h, respectively. ORF-1 decreased the pH of the medium from 6.62 to 3.45 and released soluble phosphate at 0.172 mg·mL(-1) in 28 h. Expression of the P. oxalicum I1 p5cdh gene in E. coli could enhance organic acid secretion and phosphate-solubilizing ability.

Stable long-term blood formation by stem cells in murine steady-state hematopoiesis.

PubMed

Zavidij, Oksana; Ball, Claudia R; Herbst, Friederike; Oppel, Felix; Fessler, Sylvia; Schmidt, Manfred; von Kalle, Christof; Glimm, Hanno

2012-09-01

Hematopoietic stem cells (HSCs) generate all mature blood cells during the whole lifespan of an individual. However, the clonal contribution of individual HSC and progenitor cells in steady-state hematopoiesis is poorly understood. To investigate the activity of HSCs under steady-state conditions, murine HSC and progenitor cells were genetically marked in vivo by integrating lentiviral vectors (LVs) encoding green fluorescent protein (GFP). Hematopoietic contribution of individual marked clones was monitored by determination of lentiviral integration sites using highly sensitive linear amplification-mediated-polymerase chain reaction. A remarkably stable small proportion of hematopoietic cells expressed GFP in LV-injected animals for up to 24 months, indicating stable marking of murine steady-state hematopoiesis. Analysis of the lentiviral integration sites revealed that multiple hematopoietic clones with both myeloid and lymphoid differentiation potential contributed to long-term hematopoiesis. In contrast to intrafemoral vector injection, intravenous administration of LV preferentially targeted short-lived progenitor cells. Myelosuppressive treatment of mice prior to LV-injection did not affect the marking efficiency. Our study represents the first continuous analysis of clonal behavior of genetically marked hematopoietic cells in an unmanipulated system, providing evidence that multiple clones are simultaneously active in murine steady-state hematopoiesis. Copyright © 2012 AlphaMed Press.

Efficient assembly of full-length infectious clone of Brazilian IBDV isolate by homologous recombination in yeast

PubMed Central

Silva, J.V.J.; Arenhart, S.; Santos, H.F.; Almeida-Queiroz, S.R.; Silva, A.N.M.R.; Trevisol, I.M.; Bertani, G.R.; Gil, L.H.V.G.

2014-01-01

The Infectious Bursal Disease Virus (IBDV) causes immunosuppression in young chickens. Advances in molecular virology and vaccines for IBDV have been achieved by viral reverse genetics (VRG). VRG for IBDV has undergone changes over time, however all strategies used to generate particles of IBDV involves multiple rounds of amplification and need of in vitro ligation and restriction sites. The aim of this research was to build the world’s first VRG for IBDV by yeast-based homologous recombination; a more efficient, robust and simple process than cloning by in vitro ligation. The wild type IBDV (Wt-IBDV-Br) was isolated in Brazil and had its genome cloned in pJG-CMV-HDR vector by yeast-based homologous recombination. The clones were transfected into chicken embryo fibroblasts and the recovered virus (IC-IBDV-Br) showed genetic stability and similar phenotype to Wt-IBDV-Br, which were observed by nucleotide sequence, focus size/morphology and replication kinetics, respectively. Thus, IBDV reverse genetics by yeast-based homologous recombination provides tools to IBDV understanding and vaccines/viral vectors development. PMID:25763067

Tissue Gene Expression Analysis Using Arrayed Normalized cDNA Libraries

PubMed Central

Eickhoff, Holger; Schuchhardt, Johannes; Ivanov, Igor; Meier-Ewert, Sebastian; O'Brien, John; Malik, Arif; Tandon, Neeraj; Wolski, Eryk-Witold; Rohlfs, Elke; Nyarsik, Lajos; Reinhardt, Richard; Nietfeld, Wilfried; Lehrach, Hans

2000-01-01

We have used oligonucleotide-fingerprinting data on 60,000 cDNA clones from two different mouse embryonic stages to establish a normalized cDNA clone set. The normalized set of 5,376 clones represents different clusters and therefore, in almost all cases, different genes. The inserts of the cDNA clones were amplified by PCR and spotted on glass slides. The resulting arrays were hybridized with mRNA probes prepared from six different adult mouse tissues. Expression profiles were analyzed by hierarchical clustering techniques. We have chosen radioactive detection because it combines robustness with sensitivity and allows the comparison of multiple normalized experiments. Sensitive detection combined with highly effective clustering algorithms allowed the identification of tissue-specific expression profiles and the detection of genes specifically expressed in the tissues investigated. The obtained results are publicly available (http://www.rzpd.de) and can be used by other researchers as a digital expression reference. [The sequence data described in this paper have been submitted to the EMBL data library under accession nos. AL360374–AL36537.] PMID:10958641

Intratumoral genetic heterogeneity in metastatic melanoma is accompanied by variation in malignant behaviors.

PubMed

Anaka, Matthew; Hudson, Christopher; Lo, Pu-Han; Do, Hongdo; Caballero, Otavia L; Davis, Ian D; Dobrovic, Alexander; Cebon, Jonathan; Behren, Andreas

2013-10-11

Intratumoral heterogeneity is a major obstacle for the treatment of cancer, as the presence of even minor populations that are insensitive to therapy can lead to disease relapse. Increased clonal diversity has been correlated with a poor prognosis for cancer patients, and we therefore examined genetic, transcriptional, and functional diversity in metastatic melanoma. Amplicon sequencing and SNP microarrays were used to profile somatic mutations and DNA copy number changes in multiple regions from metastatic lesions. Clonal genetic and transcriptional heterogeneity was also assessed in single cell clones from early passage cell lines, which were then subjected to clonogenicity and drug sensitivity assays. MAPK pathway and tumor suppressor mutations were identified in all regions of the melanoma metastases analyzed. In contrast, we identified copy number abnormalities present in only some regions in addition to homogeneously present changes, suggesting ongoing genetic evolution following metastatic spread. Copy number heterogeneity from a tumor was represented in matched cell line clones, which also varied in their clonogenicity and drug sensitivity. Minor clones were identified based on dissimilarity to the parental cell line, and these clones were the most clonogenic and least sensitive to drugs. Finally, treatment of a polyclonal cell line with paclitaxel to enrich for drug-resistant cells resulted in the adoption of a gene expression profile with features of one of the minor clones, supporting the idea that these populations can mediate disease relapse. Our results support the hypothesis that minor clones might have major consequences for patient outcomes in melanoma.

Protective effect of black garlic extracts on tert-Butyl hydroperoxide-induced injury in hepatocytes via a c-Jun N-terminal kinase-dependent mechanism

PubMed Central

Lee, Ko-Chao; Teng, Chih-Chuan; Shen, Chien-Heng; Huang, Wen-Shih; Lu, Chien-Chang; Kuo, Hsing-Chun; Tung, Shui-Yi

2018-01-01

Black garlic has been reported to show multiple bioactivities against the development of different diseases. In the present study, the hepatoprotective effect of black garlic on injured liver cells was investigated. Rat clone-9 hepatocytes were used for all experiments; tert-Butyl hydroperoxide (tBHP) was used to induce injury of rat clone-9 hepatocytes. The contents of malondialdehyde (MDA) and glutathione (GSH); anti-oxidative enzyme activities of catalase (CAT), superoxide dismutase (SOD), glutathione peroxidase (GPx); and mRNA expression levels of interleukin (IL)-6 and IL-8 in rat clone-9 hepatocytes were determined to evaluate the level of cell damage. Black garlic extracts were demonstrated to significantly attenuate tBHP-induced cell death of rat clone-9 hepatocytes (P<0.05). Pretreatment with black garlic extracts antagonized GSH depletion, tBHP-increased MDA accumulation and the mRNA expression level of IL-6/IL-8, and tBHP-decreased antioxidative enzyme activities (all P<0.05). Moreover, the present study revealed that c-Jun N-terminal kinase signaling regulated black garlic-inhibited tBHP effects in rat clone-9 hepatocytes. Our findings demonstrate that black garlic has the hepatoprotective potential to block tBHP-damaged effects on cell death, lipid peroxidation, oxidative stress, and inflammation in rat clone-9 hepatocytes. Thus, the present study indicates that black garlic may be an excellent natural candidate in the development of adjuvant therapy and healthy foods for liver protection. PMID:29456651

The effect of sampling techniques used in the multiconfigurational Ehrenfest method

NASA Astrophysics Data System (ADS)

Symonds, C.; Kattirtzi, J. A.; Shalashilin, D. V.

2018-05-01

In this paper, we compare and contrast basis set sampling techniques recently developed for use in the ab initio multiple cloning method, a direct dynamics extension to the multiconfigurational Ehrenfest approach, used recently for the quantum simulation of ultrafast photochemistry. We demonstrate that simultaneous use of basis set cloning and basis function trains can produce results which are converged to the exact quantum result. To demonstrate this, we employ these sampling methods in simulations of quantum dynamics in the spin boson model with a broad range of parameters and compare the results to accurate benchmarks.

Agonist-specific coupling of a cloned Drosophila octopamine/tyramine receptor to multiple second messenger systems.

PubMed Central

Robb, S; Cheek, T R; Hannan, F L; Hall, L M; Midgley, J M; Evans, P D

1994-01-01

A cloned seven transmembrane-spanning Drosophila octopamine/tyramine receptor, permanently expressed in a Chinese hamster ovary cell line, both inhibits adenylate cyclase activity and leads to the elevation of intracellular Ca2+ levels by separate G-protein-coupled pathways. Agonists of this receptor (octopamine and tyramine), differing by only a single hydroxyl group in their side chain, may be capable of differentially coupling it to different second messenger systems. Thus, a single receptor may have a different pharmacological profile depending on which second messenger system is used to assay its efficacy. PMID:8137817

The effect of sampling techniques used in the multiconfigurational Ehrenfest method.

PubMed

Symonds, C; Kattirtzi, J A; Shalashilin, D V

2018-05-14

In this paper, we compare and contrast basis set sampling techniques recently developed for use in the ab initio multiple cloning method, a direct dynamics extension to the multiconfigurational Ehrenfest approach, used recently for the quantum simulation of ultrafast photochemistry. We demonstrate that simultaneous use of basis set cloning and basis function trains can produce results which are converged to the exact quantum result. To demonstrate this, we employ these sampling methods in simulations of quantum dynamics in the spin boson model with a broad range of parameters and compare the results to accurate benchmarks.

The Complex Epidemiology of Carbapenem-Resistant Enterobacter Infections: A Multicenter Descriptive Analysis.

PubMed

Lazarovitch, Tsilia; Amity, Keren; Coyle, Joseph R; Ackerman, Benjamin; Tal-Jasper, Ruthy; Ofer-Friedman, Hadas; Hayakawa, Kayoko; Bogan, Christopher; Lephart, Paul R; Kaplansky, Tamir; Maskit, Moran; Azouri, Tal; Zaidenstein, Ronit; Perez, Federico; Bonomo, Robert A; Kaye, Keith S; Marchaim, Dror

2015-11-01

The pandemic of carbapenem-resistant Enterobacteriaceae (CRE) was primarily due to clonal spread of bla KPC producing Klebsiella pneumoniae. Thus, thoroughly studied CRE cohorts have consisted mostly of K. pneumoniae. To conduct an extensive epidemiologic analysis of carbapenem-resistant Enterobacter spp. (CREn) from 2 endemic and geographically distinct centers. CREn were investigated at an Israeli center (Assaf Harofeh Medical Center, January 2007 to July 2012) and at a US center (Detroit Medical Center, September 2008 to September 2009). bla KPC genes were queried by polymerase chain reaction. Repetitive extragenic palindromic polymerase chain reaction and pulsed-field gel electrophoresis were used to determine genetic relatedness. In this analysis, 68 unique patients with CREn were enrolled. Sixteen isolates (24%) were from wounds, and 33 (48%) represented colonization only. All isolates exhibited a positive Modified Hodge Test, but only 93% (27 of 29) contained bla KPC. Forty-three isolates (63%) were from elderly adults, and 5 (7.4%) were from neonates. Twenty-seven patients died in hospital (40.3% of infected patients). Enterobacter strains consisted of 4 separate clones from Assaf Harofeh Medical Center and of 4 distinct clones from Detroit Medical Center. In this study conducted at 2 distinct CRE endemic regions, there were unique epidemiologic features to CREn: (i) polyclonality, (ii) neonates accounting for more than 7% of cohort, and (iii) high rate of colonization (almost one-half of all cases represented colonization). Since false-positive Modified Hodge Tests in Enterobacter spp. are common, close monitoring of carbapenem resistance mechanisms (particularly carbapenemase production) among Enterobacter spp. is important.

Identification of the Propionicin F Bacteriocin Immunity Gene (pcfI) and Development of a Food-Grade Cloning System for Propionibacterium freudenreichii▿ †

PubMed Central

Brede, Dag Anders; Lothe, Sheba; Salehian, Zhian; Faye, Therese; Nes, Ingolf F.

2007-01-01

This report describes the first functional analysis of a bacteriocin immunity gene from Propionibacterium freudenreichii and its use as a selection marker for food-grade cloning. Cloning of the pcfI gene (previously orf5 [located as part of the pcfABC propionicin F operon]) rendered the sensitive host 1,000-fold more tolerant to the propionicin F bacteriocin. The physiochemical properties of the 127-residue large PcfI protein resemble those of membrane-bound immunity proteins from bacteriocin systems found in lactic acid bacteria. The high level of immunity conferred by pcfI allowed its use as a selection marker for plasmid transformation in P. freudenreichii. Electroporation of P. freudenreichii IFO12426 by use of the pcfI expression plasmid pSL102 and propionicin F selection (200 bacteriocin units/ml) yielded 107 transformants/μg DNA. The 2.7-kb P. freudenreichii food-grade cloning vector pSL104 consists of the pLME108 replicon, a multiple cloning site, and pcfI expressed from the constitutive PpampS promoter for selection. The pSL104 vector efficiently facilitated cloning of the propionicin T1 bacteriocin in P. freudenreichii. High-level propionicin T1 production (640 BU/ml) was obtained with the IFO12426 strain, and the food-grade propionicin T1 expression plasmid pSL106 was maintained by ∼91% of the cells over 25 generations in the absence of selection. To the best of our knowledge this is the first report of an efficient cloning system that facilitates the generation of food-grade recombinant P. freudenreichii strains. PMID:17933941

Identification of the propionicin F bacteriocin immunity gene (pcfI) and development of a food-grade cloning system for Propionibacterium freudenreichii.

PubMed

Brede, Dag Anders; Lothe, Sheba; Salehian, Zhian; Faye, Therese; Nes, Ingolf F

2007-12-01

This report describes the first functional analysis of a bacteriocin immunity gene from Propionibacterium freudenreichii and its use as a selection marker for food-grade cloning. Cloning of the pcfI gene (previously orf5 [located as part of the pcfABC propionicin F operon]) rendered the sensitive host 1,000-fold more tolerant to the propionicin F bacteriocin. The physiochemical properties of the 127-residue large PcfI protein resemble those of membrane-bound immunity proteins from bacteriocin systems found in lactic acid bacteria. The high level of immunity conferred by pcfI allowed its use as a selection marker for plasmid transformation in P. freudenreichii. Electroporation of P. freudenreichii IFO12426 by use of the pcfI expression plasmid pSL102 and propionicin F selection (200 bacteriocin units/ml) yielded 10(7) transformants/microg DNA. The 2.7-kb P. freudenreichii food-grade cloning vector pSL104 consists of the pLME108 replicon, a multiple cloning site, and pcfI expressed from the constitutive P(pampS) promoter for selection. The pSL104 vector efficiently facilitated cloning of the propionicin T1 bacteriocin in P. freudenreichii. High-level propionicin T1 production (640 BU/ml) was obtained with the IFO12426 strain, and the food-grade propionicin T1 expression plasmid pSL106 was maintained by approximately 91% of the cells over 25 generations in the absence of selection. To the best of our knowledge this is the first report of an efficient cloning system that facilitates the generation of food-grade recombinant P. freudenreichii strains.

Diversity, cellular origin and autoreactivity of antibody-secreting cell expansions in acute Systemic Lupus Erythematosus

PubMed Central

Tipton, Christopher M; Fucile, Christopher F; Darce, Jaime; Chida, Asiya; Ichikawa, Travis; Gregoretti, Ivan; Schieferl, Sandra; Hom, Jennifer; Jenks, Scott; Feldman, Ron J; Mehr, Ramit; Wei, Chungwen; Lee, F. Eun-Hyung; Cheung, Wan Cheung; Rosenberg, Alexander F; Sanz, Iñaki

2015-01-01

Acute SLE courses with antibody-secreting cells (ASC) surges whose origin, diversity, and contribution to serum autoantibodies remain unknown. Deep sequencing, autoantibody proteome and single-cell analysis demonstrated highly diversified ASC punctuated by VH4-34 clones that produce dominant serum autoantibodies. A fraction of ASC clones contained unmutated autoantibodies, a finding consistent with differentiation outside the germinal centers. A substantial ASC segment derived from a distinct subset of newly activated naïve cells of significant clonality that persist in the circulation for several months. Thus, selection of SLE autoreactivities occurred during polyclonal activation with prolonged recruitment of recently activated naïve B cells. These findings shed light into SLE pathogenesis, help explain the benefit of anti-B cell agents and facilitate the design of future therapies. PMID:26006014

A new source of cytoplasmic male sterility in pearl millet: RFLP analysis of mitochondrial DNA.

PubMed

Sujata, V; Sivaramakrishnan, S; Rai, K N; Seetha, K

1994-06-01

A new source of cytoplasmic male sterility (cms) in pearl millet (Pennisetum glaucum (L.) R.Br.) derived from a half-sib progeny of the Early Gene Pool (EGP 261) and used in a male-sterile line, ICMA 90111, was compared with other known cms sources for RFLP of mitochondrial (mt) DNA. Southern blot hybridization of mtDNA from ICMA 90111 digested with several restriction enzymes and probed with homologous mtDNA clones from pearl millet and heterologous gene clones from maize and wheat revealed the RFLP patterns of ICMA 90111 distinct from others studied so far. The dendrogram of male-sterile lines constructed from the Southern blot hybridization patterns indicated that ICMA 90111 represents a separate group. Our results suggest that this source of cms is unique in several respects.

HCV proteins and immunoglobulin variable gene (IgV) subfamilies in HCV-induced type II mixed cryoglobulinemia: a concurrent pathogenetic role.

PubMed

Sautto, Giuseppe; Mancini, Nicasio; Solforosi, Laura; Diotti, Roberta A; Clementi, Massimo; Burioni, Roberto

2012-01-01

The association between hepatitis C virus (HCV) infection and type II mixed cryoglobulinemia (MCII) is well established, but the role played by distinct HCV proteins and by specific components of the anti-HCV humoral immune response remains to be clearly defined. It is widely accepted that HCV drives the expansion of few B-cell clones expressing a restricted pool of selected immunoglobulin variable (IgV) gene subfamilies frequently endowed with rheumatoid factor (RF) activity. Moreover, the same IgV subfamilies are frequently observed in HCV-transformed malignant B-cell clones occasionally complicating MCII. In this paper, we analyze both the humoral and viral counterparts at the basis of cryoglobulins production in HCV-induced MCII, with particular attention reserved to the single IgV subfamilies most frequently involved.

HCV Proteins and Immunoglobulin Variable Gene (IgV) Subfamilies in HCV-Induced Type II Mixed Cryoglobulinemia: A Concurrent Pathogenetic Role

PubMed Central

Sautto, Giuseppe; Mancini, Nicasio; Solforosi, Laura; Diotti, Roberta A.; Clementi, Massimo; Burioni, Roberto

2012-01-01

The association between hepatitis C virus (HCV) infection and type II mixed cryoglobulinemia (MCII) is well established, but the role played by distinct HCV proteins and by specific components of the anti-HCV humoral immune response remains to be clearly defined. It is widely accepted that HCV drives the expansion of few B-cell clones expressing a restricted pool of selected immunoglobulin variable (IgV) gene subfamilies frequently endowed with rheumatoid factor (RF) activity. Moreover, the same IgV subfamilies are frequently observed in HCV-transformed malignant B-cell clones occasionally complicating MCII. In this paper, we analyze both the humoral and viral counterparts at the basis of cryoglobulins production in HCV-induced MCII, with particular attention reserved to the single IgV subfamilies most frequently involved. PMID:22690241

Spatial diversity of bacterioplankton communities in surface water of northern South China Sea.

PubMed

Li, Jialin; Li, Nan; Li, Fuchao; Zou, Tao; Yu, Shuxian; Wang, Yinchu; Qin, Song; Wang, Guangyi

2014-01-01

The South China Sea is one of the largest marginal seas, with relatively frequent passage of eddies and featuring distinct spatial variation in the western tropical Pacific Ocean. Here, we report a phylogenetic study of bacterial community structures in surface seawater of the northern South China Sea (nSCS). Samples collected from 31 sites across large environmental gradients were used to construct clone libraries and yielded 2,443 sequences grouped into 170 OTUs. Phylogenetic analysis revealed 23 bacterial classes with major components α-, β- and γ-Proteobacteria, as well as Cyanobacteria. At class and genus taxon levels, community structure of coastal waters was distinctively different from that of deep-sea waters and displayed a higher diversity index. Redundancy analyses revealed that bacterial community structures displayed a significant correlation with the water depth of individual sampling sites. Members of α-Proteobacteria were the principal component contributing to the differences of the clone libraries. Furthermore, the bacterial communities exhibited heterogeneity within zones of upwelling and anticyclonic eddies. Our results suggested that surface bacterial communities in nSCS had two-level patterns of spatial distribution structured by ecological types (coastal VS. oceanic zones) and mesoscale physical processes, and also provided evidence for bacterial phylogenetic phyla shaped by ecological preferences.

Genome sequence analysis of emm89 Streptococcus pyogenes strains causing infections in Scotland, 2010-2016.

PubMed

Beres, Stephen B; Olsen, Randall J; Ojeda Saavedra, Matthew; Ure, Roisin; Reynolds, Arlene; Lindsay, Diane S J; Smith, Andrew J; Musser, James M

2017-12-01

Strains of type emm89 Streptococcus pyogenes have recently increased in frequency as a cause of human infections in several countries in Europe and North America. This increase has been molecular epidemiologically linked with the emergence of a new genetically distinct clone, designated clade 3. We sought to extend our understanding of this epidemic behavior by the genetic characterization of type emm89 strains responsible in recent years for an increased frequency of infections in Scotland. We sequenced the genomes of a retrospective cohort of 122 emm89 strains recovered from patients with invasive and noninvasive infections throughout Scotland during 2010 to 2016. All but one of the 122 emm89 infection isolates are of the recently emerged epidemic clade 3 clonal lineage. The Scotland isolates are closely related to and not genetically distinct from recent emm89 strains from England, they constitute a single genetic population. The clade 3 clone causes virtually all-contemporary emm89 infections in Scotland. These findings add Scotland to a growing list of countries of Europe and North America where, by whole genome sequencing, emm89 clade 3 strains have been demonstrated to be the cause of an ongoing epidemic of invasive infections and to be genetically related due to descent from a recent common progenitor.

Molecular Characterization of a Dechlorinating Community Resulting from In Situ Biostimulation in a Trichloroethene-Contaminated Deep, Fractured Basalt Aquifer and Comparison to a Derivative Laboratory Culture

PubMed Central

Macbeth, Tamzen W.; Cummings, David E.; Spring, Stefan; Petzke, Lynn M.; Sorenson, Kent S.

2004-01-01

Sodium lactate additions to a trichloroethene (TCE) residual source area in deep, fractured basalt at a U.S. Department of Energy site have resulted in the enrichment of the indigenous microbial community, the complete dechlorination of nearly all aqueous-phase TCE to ethene, and the continued depletion of the residual source since 1999. The bacterial and archaeal consortia in groundwater obtained from the residual source were assessed by using PCR-amplified 16S rRNA genes. A clone library of bacterial amplicons was predominated by those from members of the class Clostridia (57 of 93 clones), of which a phylotype most similar to that of the homoacetogen Acetobacterium sp. strain HAAP-1 was most abundant (32 of 93 clones). The remaining Bacteria consisted of phylotypes affiliated with Sphingobacteria, Bacteroides, Spirochaetes, Mollicutes, and Proteobacteria and candidate divisions OP11 and OP3. The two proteobacterial phylotypes were most similar to those of the known dechlorinators Trichlorobacter thiogenes and Sulfurospirillum multivorans. Although not represented by the bacterial clones generated with broad-specificity bacterial primers, a Dehalococcoides-like phylotype was identified with genus-specific primers. Only four distinct phylotypes were detected in the groundwater archaeal library, including predominantly a clone affiliated with the strictly acetoclastic methanogen Methanosaeta concilii (24 of 43 clones). A mixed culture that completely dechlorinates TCE to ethene was enriched from this groundwater, and both communities were characterized by terminal restriction fragment length polymorphism (T-RFLP). According to T-RFLP, the laboratory enrichment community was less diverse overall than the groundwater community, with 22 unique phylotypes as opposed to 43 and a higher percentage of Clostridia, including the Acetobacterium population. Bioreactor archaeal structure was very similar to that of the groundwater community, suggesting that methane is generated primarily via the acetoclastic pathway, using acetate generated by lactate fermentation and acetogenesis in both systems. PMID:15574933

Self-Mating in the Definitive Host Potentiates Clonal Outbreaks of the Apicomplexan Parasites Sarcocystis neurona and Toxoplasma gondii

PubMed Central

Wendte, Jered M.; Miller, Melissa A.; Lambourn, Dyanna M.; Magargal, Spencer L.; Jessup, David A.; Grigg, Michael E.

2010-01-01

Tissue-encysting coccidia, including Toxoplasma gondii and Sarcocystis neurona, are heterogamous parasites with sexual and asexual life stages in definitive and intermediate hosts, respectively. During its sexual life stage, T. gondii reproduces either by genetic out-crossing or via clonal amplification of a single strain through self-mating. Out-crossing has been experimentally verified as a potent mechanism capable of producing offspring possessing a range of adaptive and virulence potentials. In contrast, selfing and other life history traits, such as asexual expansion of tissue-cysts by oral transmission among intermediate hosts, have been proposed to explain the genetic basis for the clonal population structure of T. gondii. In this study, we investigated the contributing roles self-mating and sexual recombination play in nature to maintain clonal population structures and produce or expand parasite clones capable of causing disease epidemics for two tissue encysting parasites. We applied high-resolution genotyping against strains isolated from a T. gondii waterborne outbreak that caused symptomatic disease in 155 immune-competent people in Brazil and a S. neurona outbreak that resulted in a mass mortality event in Southern sea otters. In both cases, a single, genetically distinct clone was found infecting outbreak-exposed individuals. Furthermore, the T. gondii outbreak clone was one of several apparently recombinant progeny recovered from the local environment. Since oocysts or sporocysts were the infectious form implicated in each outbreak, the expansion of the epidemic clone can be explained by self-mating. The results also show that out-crossing preceded selfing to produce the virulent T. gondii clone. For the tissue encysting coccidia, self-mating exists as a key adaptation potentiating the epidemic expansion and transmission of newly emerged parasite clones that can profoundly shape parasite population genetic structures or cause devastating disease outbreaks. PMID:21203443

Construction of an infectious cDNA clone of avian hepatitis E virus (avian HEV) recovered from a clinically healthy chicken in the United States and characterization of its pathogenicity in specific-pathogen-free chickens.

PubMed

Kwon, Hyuk Moo; LeRoith, Tanya; Pudupakam, R S; Pierson, F William; Huang, Yao-Wei; Dryman, Barbara A; Meng, Xiang-Jin

2011-01-27

A genetically distinct strain of avian hepatitis E virus (avian HEV-VA strain) was isolated from a healthy chicken in Virginia, and thus it is important to characterize and compare its pathogenicity with the prototype strain (avian HEV-prototype) isolated from a diseased chicken. Here we first constructed an infectious clone of the avian HEV-VA strain. Capped RNA transcripts from the avian HEV-VA clone were replication-competent after transfection of LMH chicken liver cells. Chickens inoculated intrahepatically with RNA transcripts of avian HEV-VA clone developed active infection as evidenced by fecal virus shedding, viremia, and seroconversion. To characterize the pathogenicity, RNA transcripts of both avian HEV-VA and avian HEV-prototype clones were intrahepatically inoculated into the livers of chickens. Avian HEV RNA was detected in feces, serum and bile samples from 10/10 avian HEV-VA-inoculated and 9/9 avian HEV-prototype-inoculated chickens although seroconversion occurred only in some chickens during the experimental period. The histopathological lesion scores were lower for avian HEV-VA group than avian HEV-prototype group in the liver at 3 and 5 weeks post-inoculation (wpi) and in the spleen at 3 wpi, although the differences were not statistically significant. The liver/body weight ratio, indicative of liver enlargement, of both avian HEV-VA and avian HEV-prototype groups were significantly higher than that of the control group at 5 wpi. Overall, the avian HEV-VA strain still induces histological liver lesions even though it was isolated from a healthy chicken. The results also showed that intrahepatic inoculation of chickens with RNA transcripts of avian HEV infectious clone may serve as an alternative for live virus in animal pathogenicity studies. Copyright © 2010 Elsevier B.V. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wei, Yifeng; Li, Bin; Prakash, Divya

Two subtypes of class III anaerobic ribonucleotide reductases (RNRs) studied so far couple the reduction of ribonucleotides to the oxidation of formate, or the oxidation of NADPH via thioredoxin and thioredoxin reductase. Certain methanogenic archaea contain a phylogenetically distinct third subtype of class III RNR, with distinct active-site residues. Here we report the cloning and recombinant expression of the Methanosarcina barkeri class III RNR and show that the electrons required for ribonucleotide reduction can be delivered by a [4Fe-4S] protein ferredoxin disulfide reductase, and a conserved thioredoxin-like protein NrdH present in the RNR operon. The diversity of class III RNRsmore » reflects the diversity of electron carriers used in anaerobic metabolism« less

Sequence of a second gene encoding bovine submaxillary mucin: implication for mucin heterogeneity and cloning.

PubMed

Jiang, W; Woitach, J T; Gupta, D; Bhavanandan, V P

1998-10-20

Secreted epithelial mucins are extremely large and heterogeneous glycoproteins. We report the 5 kilobase DNA sequence of a second gene, BSM2, which encodes bovine submaxillary mucin. The determined nucleotide and deduced amino acid sequences of BSM2 are 95.2% and 92. 2% identical, respectively, to those of the previously described BSM1 gene isolated from the same cow. Further, the five predicted protein domains of the two genes are 100%, 94%, 93%, 77%, and 88% identical. Based on the above results, we propose that expression of multiple homologous core proteins from a single animal is a factor in generating diversity of saccharides in mucins and in providing resistance of the molecules to proteolysis. In addition, this work raises several important issues in mucin cloning such as assembling sequences from seemingly overlapping clones and deducing consensus sequences for nearly identical tandem repeats. Copyright 1998 Academic Press.

Therapeutic Remyelination Strategies in a Novel Model of Multiple Sclerosis: Japanese Macaque Encephalomyelitis

DTIC Science & Technology

2010-05-01

viruses, especially gama- herpesviruses , may act as a trigger of multiple sclerosis (MS; Ascherio and Munger, 2010). Furthermore, there is growing...than others, suggesting a genetic pre-disposition to JME. Furthermore, we have cloned a gamma- herpesvirus (called Japanese macaque rhadovirus; JMRV...models in non-human primates and rodents. We aim to use this model to better understand how gamma- herpesviruses trigger MS; whether polymorphisms in

Bellerophon: a program to detect chimeric sequences in multiple sequence alignments.

PubMed

Huber, Thomas; Faulkner, Geoffrey; Hugenholtz, Philip

2004-09-22

Bellerophon is a program for detecting chimeric sequences in multiple sequence datasets by an adaption of partial treeing analysis. Bellerophon was specifically developed to detect 16S rRNA gene chimeras in PCR-clone libraries of environmental samples but can be applied to other nucleotide sequence alignments. Bellerophon is available as an interactive web server at http://foo.maths.uq.edu.au/~huber/bellerophon.pl

A new set of ESTs and cDNA clones from full-length and normalized libraries for gene discovery and functional characterization in citrus

PubMed Central

Marques, M Carmen; Alonso-Cantabrana, Hugo; Forment, Javier; Arribas, Raquel; Alamar, Santiago; Conejero, Vicente; Perez-Amador, Miguel A

2009-01-01

Background Interpretation of ever-increasing raw sequence information generated by modern genome sequencing technologies faces multiple challenges, such as gene function analysis and genome annotation. Indeed, nearly 40% of genes in plants encode proteins of unknown function. Functional characterization of these genes is one of the main challenges in modern biology. In this regard, the availability of full-length cDNA clones may fill in the gap created between sequence information and biological knowledge. Full-length cDNA clones facilitate functional analysis of the corresponding genes enabling manipulation of their expression in heterologous systems and the generation of a variety of tagged versions of the native protein. In addition, the development of full-length cDNA sequences has the power to improve the quality of genome annotation. Results We developed an integrated method to generate a new normalized EST collection enriched in full-length and rare transcripts of different citrus species from multiple tissues and developmental stages. We constructed a total of 15 cDNA libraries, from which we isolated 10,898 high-quality ESTs representing 6142 different genes. Percentages of redundancy and proportion of full-length clones range from 8 to 33, and 67 to 85, respectively, indicating good efficiency of the approach employed. The new EST collection adds 2113 new citrus ESTs, representing 1831 unigenes, to the collection of citrus genes available in the public databases. To facilitate functional analysis, cDNAs were introduced in a Gateway-based cloning vector for high-throughput functional analysis of genes in planta. Herein, we describe the technical methods used in the library construction, sequence analysis of clones and the overexpression of CitrSEP, a citrus homolog to the Arabidopsis SEP3 gene, in Arabidopsis as an example of a practical application of the engineered Gateway vector for functional analysis. Conclusion The new EST collection denotes an important step towards the identification of all genes in the citrus genome. Furthermore, public availability of the cDNA clones generated in this study, and not only their sequence, enables testing of the biological function of the genes represented in the collection. Expression of the citrus SEP3 homologue, CitrSEP, in Arabidopsis results in early flowering, along with other phenotypes resembling the over-expression of the Arabidopsis SEPALLATA genes. Our findings suggest that the members of the SEP gene family play similar roles in these quite distant plant species. PMID:19747386

Cloning, Assembly, and Modification of the Primary Human Cytomegalovirus Isolate Toledo by Yeast-Based Transformation-Associated Recombination.

PubMed

Vashee, Sanjay; Stockwell, Timothy B; Alperovich, Nina; Denisova, Evgeniya A; Gibson, Daniel G; Cady, Kyle C; Miller, Kristofer; Kannan, Krishna; Malouli, Daniel; Crawford, Lindsey B; Voorhies, Alexander A; Bruening, Eric; Caposio, Patrizia; Früh, Klaus

2017-01-01

Genetic engineering of cytomegalovirus (CMV) currently relies on generating a bacterial artificial chromosome (BAC) by introducing a bacterial origin of replication into the viral genome using in vivo recombination in virally infected tissue culture cells. However, this process is inefficient, results in adaptive mutations, and involves deletion of viral genes to avoid oversized genomes when inserting the BAC cassette. Moreover, BAC technology does not permit the simultaneous manipulation of multiple genome loci and cannot be used to construct synthetic genomes. To overcome these limitations, we adapted synthetic biology tools to clone CMV genomes in Saccharomyces cerevisiae . Using an early passage of the human CMV isolate Toledo, we first applied transformation-associated recombination (TAR) to clone 16 overlapping fragments covering the entire Toledo genome in Saccharomyces cerevisiae . Then, we assembled these fragments by TAR in a stepwise process until the entire genome was reconstituted in yeast. Since next-generation sequence analysis revealed that the low-passage-number isolate represented a mixture of parental and fibroblast-adapted genomes, we selectively modified individual DNA fragments of fibroblast-adapted Toledo (Toledo-F) and again used TAR assembly to recreate parental Toledo (Toledo-P). Linear, full-length HCMV genomes were transfected into human fibroblasts to recover virus. Unlike Toledo-F, Toledo-P displayed characteristics of primary isolates, including broad cellular tropism in vitro and the ability to establish latency and reactivation in humanized mice. Our novel strategy thus enables de novo cloning of CMV genomes, more-efficient genome-wide engineering, and the generation of viral genomes that are partially or completely derived from synthetic DNA. IMPORTANCE The genomes of large DNA viruses, such as human cytomegalovirus (HCMV), are difficult to manipulate using current genetic tools, and at this time, it is not possible to obtain, molecular clones of CMV without extensive tissue culture. To overcome these limitations, we used synthetic biology tools to capture genomic fragments from viral DNA and assemble full-length genomes in yeast. Using an early passage of the HCMV isolate Toledo containing a mixture of wild-type and tissue culture-adapted virus. we directly cloned the majority sequence and recreated the minority sequence by simultaneous modification of multiple genomic regions. Thus, our novel approach provides a paradigm to not only efficiently engineer HCMV and other large DNA viruses on a genome-wide scale but also facilitates the cloning and genetic manipulation of primary isolates and provides a pathway to generating entirely synthetic genomes.

Cloning, Assembly, and Modification of the Primary Human Cytomegalovirus Isolate Toledo by Yeast-Based Transformation-Associated Recombination

PubMed Central

Vashee, Sanjay; Stockwell, Timothy B.; Alperovich, Nina; Denisova, Evgeniya A.; Gibson, Daniel G.; Cady, Kyle C.; Miller, Kristofer; Kannan, Krishna; Malouli, Daniel; Crawford, Lindsey B.; Voorhies, Alexander A.; Bruening, Eric; Caposio, Patrizia

2017-01-01

ABSTRACT Genetic engineering of cytomegalovirus (CMV) currently relies on generating a bacterial artificial chromosome (BAC) by introducing a bacterial origin of replication into the viral genome using in vivo recombination in virally infected tissue culture cells. However, this process is inefficient, results in adaptive mutations, and involves deletion of viral genes to avoid oversized genomes when inserting the BAC cassette. Moreover, BAC technology does not permit the simultaneous manipulation of multiple genome loci and cannot be used to construct synthetic genomes. To overcome these limitations, we adapted synthetic biology tools to clone CMV genomes in Saccharomyces cerevisiae. Using an early passage of the human CMV isolate Toledo, we first applied transformation-associated recombination (TAR) to clone 16 overlapping fragments covering the entire Toledo genome in Saccharomyces cerevisiae. Then, we assembled these fragments by TAR in a stepwise process until the entire genome was reconstituted in yeast. Since next-generation sequence analysis revealed that the low-passage-number isolate represented a mixture of parental and fibroblast-adapted genomes, we selectively modified individual DNA fragments of fibroblast-adapted Toledo (Toledo-F) and again used TAR assembly to recreate parental Toledo (Toledo-P). Linear, full-length HCMV genomes were transfected into human fibroblasts to recover virus. Unlike Toledo-F, Toledo-P displayed characteristics of primary isolates, including broad cellular tropism in vitro and the ability to establish latency and reactivation in humanized mice. Our novel strategy thus enables de novo cloning of CMV genomes, more-efficient genome-wide engineering, and the generation of viral genomes that are partially or completely derived from synthetic DNA. IMPORTANCE The genomes of large DNA viruses, such as human cytomegalovirus (HCMV), are difficult to manipulate using current genetic tools, and at this time, it is not possible to obtain, molecular clones of CMV without extensive tissue culture. To overcome these limitations, we used synthetic biology tools to capture genomic fragments from viral DNA and assemble full-length genomes in yeast. Using an early passage of the HCMV isolate Toledo containing a mixture of wild-type and tissue culture-adapted virus. we directly cloned the majority sequence and recreated the minority sequence by simultaneous modification of multiple genomic regions. Thus, our novel approach provides a paradigm to not only efficiently engineer HCMV and other large DNA viruses on a genome-wide scale but also facilitates the cloning and genetic manipulation of primary isolates and provides a pathway to generating entirely synthetic genomes. PMID:28989973

Sexual recombination is a signature of a persisting malaria epidemic in Peru

PubMed Central

2011-01-01

Background The aim of this study was to consider the impact that multi-clone, complex infections have on a parasite population structure in a low transmission setting. In general, complexity of infection (minimum number of clones within an infection) and the overall population level diversity is expected to be minimal in low transmission settings. Additionally, the parasite population structure is predicted to be clonal, rather than sexual due to infrequent parasite inoculation and lack of recombination between genetically distinct clones. However, in this low transmission of the Peruvian Amazon, complex infections are becoming more frequent, in spite of decreasing infection prevalence. In this study, it was hypothesized that sexual recombination between distinct clonal lineages of Plasmodium falciparum parasites were altering the subpopulation structure and effectively maintaining the population-level diversity. Methods Fourteen microsatellite markers were chosen to describe the genetic diversity in 313 naturally occurring P. falciparum infections from Peruvian Amazon. The population and subpopulation structure was characterized by measuring: clusteredness, expected heterozygosity (He), allelic richness, private allelic richness, and linkage disequilibrium. Next, microsatellite haplotypes and alleles were correlated with P. falciparum merozoite surface protein 1 Block 2 (Pfmsp1-B2) to examine the presence of recombinant microsatellite haplotypes. Results The parasite population structure consists of six genetically diverse subpopulations of clones, called "clusters". Clusters 1, 3, 4, and 6 have unique haplotypes that exceed 70% of the total number of clones within each cluster, while Clusters 2 and 5 have a lower proportion of unique haplotypes, but still exceed 46%. By measuring the He, allelic richness, and private allelic richness within each of the six subpopulations, relatively low levels of genetic diversity within each subpopulation (except Cluster 4) are observed. This indicated that the number of alleles, and not the combination of alleles, are limited. Next, the standard index of association (IAS) was measured, which revealed a significant decay in linkage disequilibrium (LD) associated with Cluster 6, which is indicative of independent assortment of alleles. This decay in LD is a signature of this subpopulation approaching linkage equilibrium by undergoing sexual recombination. To trace possible recombination events, the two most frequent microsatellite haplotypes observed over time (defined by either a K1 or Mad20) were selected as the progenitors and then potential recombinants were identified in within the natural population. Conclusions Contrary to conventional low transmission models, this study provides evidence of a parasite population structure that is superficially defined by a clonal backbone. Sexual recombination does occur and even arguably is responsible for maintaining the substructure of this population. PMID:22039962

Prokaryotic diversity in one of the largest hypersaline coastal lagoons in the world.

PubMed

Clementino, M M; Vieira, R P; Cardoso, A M; Nascimento, A P A; Silveira, C B; Riva, T C; Gonzalez, A S M; Paranhos, R; Albano, R M; Ventosa, A; Martins, O B

2008-07-01

Araruama Lagoon is an environment characterized by high salt concentrations. The low raining and high evaporation rates in this region favored the development of many salty ponds around the lagoon. In order to reveal the microbial composition of this system, we performed a 16S rRNA gene survey. Among archaea, most clones were related to uncultured environmental Euryarchaeota. In lagoon water, we found some clones related to Methanomicrobia and Methanothermococcus groups, while in the saline pond water members related to the genus Haloarcula were detected. Bacterial community was dominated by clones related to Gamma-proteobacteria, Actinobacteria, and Synechococcus in lagoon water, while Salinibacter ruber relatives dominated in saline pond. We also detected the presence of Alpha-proteobacteria, Pseudomonas-like bacteria and Verrucomicrobia. Only representatives of the genus Ralstonia were cosmopolitan, being observed in both systems. The detection of a substantial number of clones related to uncultured archaea and bacteria suggest that the hypersaline waters of Araruama harbor a pool of novel prokaryotic phylotypes, distinct from those observed in other similar systems. We also observed clones related to halophilic genera of cyanobacteria that are specific for each habitat studied. Additionally, two bacterioplankton molecular markers with ecological relevance were analyzed, one is linked to nitrogen fixation (nifH) and the other is linked to carbon fixation by bacterial photosynthesis, the protochlorophyllide genes, revealing a specific genetic distribution in this ecosystem. This is the first study of the biogeography and community structure of microbial assemblages in Brazilian tropical hypersaline environments. This work is directed towards a better understanding of the free-living prokaryotic diversity adapted to life in hypersaline waters.

Variation in the sizes of eggs and oncospheres and the numbers and distributions of testes in the tapeworm, Hymenolepis diminuta.

PubMed

Pappas, P W; Leiby, D A

1986-06-01

Four "strains" of Hymenolepis diminuta were examined for morphological variation. These included the ARME "strain" (currently maintained at the University of Keele, U.K.), the OSU "strain" (currently maintained at The Ohio State University) and the TOR (or UT) "strain" (currently maintained at the University of Toronto), all of which were derived from the parental RICE "strain," and the ANU "strain" (currently maintained at the Australian National University). Additionally, 2 separate "clonal" populations (populations derived from single cysticercoids) from both the OSU and ANU "strains" were examined. All "strains" and "clones" were maintained under identical conditions using Tenebrio molitor and male Sprague-Dawley rats as the intermediate and definitive hosts, respectively. The lengths and widths of eggs and larvae (oncospheres) passed in the hosts' feces, and the numbers and distributions of testes in proglottids were quantified and the data analyzed. Although analyses of the lengths and widths of eggs and larvae demonstrated significant differences among some "strains" and "clones," a discriminate analysis of the data indicated these parameters to be of questionable taxonomic significance. The eggs of all "strains" and "clones" consisted of 2 distinct populations differing in density and size but not infectivity; the relative proportions of eggs in the 2 populations were not determined. Considering all possible numbers and distributions of testes, 17 variations were seen in the strobilae of tapeworms. Analyses of the data demonstrated that the "strains" and "clones" could be differentiated clearly using only the frequencies of the 1p2a (1 poral and 2 aporal testes) or 1p3a distribution, or the frequencies of proglottids containing 3 or 4 testes; all other variations failed to clearly differentiate or group the various "strains" and "clones."(ABSTRACT TRUNCATED AT 250 WORDS)

Molecular cloning of cDNAs for the nerve-cell specific phosphoprotein, synapsin I.

PubMed Central

Kilimann, M W; DeGennaro, L J

1985-01-01

To provide access to synapsin I-specific DNA sequences, we have constructed cDNA clones complementary to synapsin I mRNA isolated from rat brain. Synapsin I mRNA was specifically enriched by immunoadsorption of polysomes prepared from the brains of 10-14 day old rats. Employing this enriched mRNA, a cDNA library was constructed in pBR322 and screened by differential colony hybridization with single-stranded cDNA probes made from synapsin I mRNA and total polysomal poly(A)+ RNA. This screening procedure proved to be highly selective. Five independent recombinant plasmids which exhibited distinctly stronger hybridization with the synapsin I probe were characterized further by restriction mapping. All of the cDNA inserts gave restriction enzyme digestion patterns which could be aligned. In addition, some of the cDNA inserts were shown to contain poly(dA) sequences. Final identification of synapsin I cDNA clones relied on the ability of the cDNA inserts to hybridize specifically to synapsin I mRNA. Several plasmids were tested by positive hybridization selection. They specifically selected synapsin I mRNA which was identified by in vitro translation and immunoprecipitation of the translation products. The established cDNA clones were used for a blot-hybridization analysis of synapsin I mRNA. A fragment (1600 bases) from the longest cDNA clone hybridized with two discrete RNA species 5800 and 4500 bases long, in polyadenylated RNA from rat brain and PC12 cells. No hybridization was detected to RNA from rat liver, skeletal muscle or cardiac muscle. Images Fig. 1. Fig. 2. Fig. 4. Fig. 5. PMID:3933975

Transcript levels of several epigenome regulatory genes in bovine somatic donor cells are not correlated with their cloning efficiency.

PubMed

Zhou, Wenli; Sadeghieh, Sanaz; Abruzzese, Ronald; Uppada, Subhadra; Meredith, Justin; Ohlrichs, Charletta; Broek, Diane; Polejaeva, Irina

2009-09-01

Among many factors that potentially affect somatic cell nuclear transfer (SCNT) embryo development is the donor cell itself. Cloning potentials of somatic donor cells vary greatly, possibly because the cells have different capacities to be reprogrammed by ooplasma. It is therefore intriguing to identify factors that regulate the reprogrammability of somatic donor cells. Gene expression analysis is a widely used tool to investigate underlying mechanisms of various phenotypes. In this study, we conducted a retrospective analysis investigating whether donor cell lines with distinct cloning efficiencies express different levels of genes involved in epigenetic reprogramming including histone deacetylase-1 (HDAC1), -2 (HDAC2); DNA methyltransferase-1 (DNMT1), -3a (DNMT3a),-3b (DNMT3b), and the bovine homolog of yeast sucrose nonfermenting-2 (SNF2L), a SWI/SNF family of ATPases. Cell samples from 12 bovine donor cell lines were collected at the time of nuclear transfer experiments and expression levels of the genes were measured using quantitative polymerase chain reaction (PCR). Our results show that there are no significant differences in expression levels of these genes between donor cell lines of high and low cloning efficiency defined as live calving rates, although inverse correlations are observed between in vitro embryo developmental rates and expression levels of HDAC2 and SNF2L. We also show that selection of stable reference genes is important for relative quantification, and different batches of cells can have different gene expression patterns. In summary, we demonstrate that expression levels of these epigenome regulatory genes in bovine donor cells are not correlated with cloning potential. The experimental design and data analysis method reported here can be applied to study any genes expressed in donor cells.

Phenotypic and genotypic characterization of vancomycin-resistant Enterococcus faecium clinical isolates from two hospitals in Mexico: First detection of VanB phenotype-vanA genotype.

PubMed

Bocanegra-Ibarias, Paola; Flores-Treviño, Samantha; Camacho-Ortiz, Adrián; Morfin-Otero, Rayo; Villarreal-Treviño, Licet; Llaca-Díaz, Jorge; Martínez-Landeros, Erik Alan; Rodríguez-Noriega, Eduardo; Calzada-Güereca, Andrés; Maldonado-Garza, Héctor Jesús; Garza-González, Elvira

2016-01-01

Enterococcus faecium has emerged as a multidrug-resistant nosocomial pathogen involved in outbreaks worldwide. Our aim was to determine the antimicrobial susceptibility, biofilm production, and clonal relatedness of vancomycin-resistant E. faecium (VREF) clinical isolates from two hospitals in Mexico. Consecutive clinical isolates (n=56) were collected in two tertiary care hospitals in Mexico from 2011 to 2014. VREF isolates were characterized by phenotypic and molecular methods including pulsed-field gel electrophoresis (PFGE). VREF isolates were highly resistant to vancomycin, erythromycin, norfloxacin, high-level streptomycin, and teicoplanin, and showed lower resistance to tetracycline, nitrofurantoin and quinupristin-dalfopristin. None of the isolates were resistant to linezolid. The vanA gene was detected in all isolates. Two VanB phenotype-vanA genotype isolates, highly resistant to vancomycin and susceptible to teicoplanin, were detected. Furthermore, 17.9% of the isolates were classified as biofilm producers, and the espfm gene was found in 98.2% of the isolates. A total of 37 distinct PFGE patterns and 6 clones (25% of the isolates as clone A, 5.4% as clone B, and 3.6% each as clone C, D, E, and F) were detected. Clone A was detected in 5 different wards of the same hospital during 14 months of surveillance. The high resistance to most antimicrobial agents and the moderate cross-transmission of VREF detected accentuates the need for continuous surveillance of E. faecium in the hospital setting. This is also the first reported incidence of the E. faecium VanB phenotype-vanA genotype in the Americas. Copyright © 2015 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

Integrated physical map of bread wheat chromosome arm 7DS to facilitate gene cloning and comparative studies.

PubMed

Tulpová, Zuzana; Luo, Ming-Cheng; Toegelová, Helena; Visendi, Paul; Hayashi, Satomi; Vojta, Petr; Paux, Etienne; Kilian, Andrzej; Abrouk, Michaël; Bartoš, Jan; Hajdúch, Marián; Batley, Jacqueline; Edwards, David; Doležel, Jaroslav; Šimková, Hana

2018-03-08

Bread wheat (Triticum aestivum L.) is a staple food for a significant part of the world's population. The growing demand on its production can be satisfied by improving yield and resistance to biotic and abiotic stress. Knowledge of the genome sequence would aid in discovering genes and QTLs underlying these traits and provide a basis for genomics-assisted breeding. Physical maps and BAC clones associated with them have been valuable resources from which to generate a reference genome of bread wheat and to assist map-based gene cloning. As a part of a joint effort coordinated by the International Wheat Genome Sequencing Consortium, we have constructed a BAC-based physical map of bread wheat chromosome arm 7DS consisting of 895 contigs and covering 94% of its estimated length. By anchoring BAC contigs to one radiation hybrid map and three high resolution genetic maps, we assigned 73% of the assembly to a distinct genomic position. This map integration, interconnecting a total of 1713 markers with ordered and sequenced BAC clones from a minimal tiling path, provides a tool to speed up gene cloning in wheat. The process of physical map assembly included the integration of the 7DS physical map with a whole-genome physical map of Aegilops tauschii and a 7DS Bionano genome map, which together enabled efficient scaffolding of physical-map contigs, even in the non-recombining region of the genetic centromere. Moreover, this approach facilitated a comparison of bread wheat and its ancestor at BAC-contig level and revealed a reconstructed region in the 7DS pericentromere. Copyright © 2018. Published by Elsevier B.V.

Molecular epidemiology of Methicillin-resistant Staphylococcus aureus in Africa: a systematic review

PubMed Central

Abdulgader, Shima M.; Shittu, Adebayo O.; Nicol, Mark P.; Kaba, Mamadou

2015-01-01

Methicillin-resistant Staphylococcus aureus (MRSA) infections are a serious global problem, with considerable impact on patients and substantial health care costs. This systematic review provides an overview on the clonal diversity of MRSA, as well as the prevalence of Panton-Valentine leukocidin (PVL)-positive MRSA in Africa. A search on the molecular characterization of MRSA in Africa was conducted by two authors using predefined terms. We screened for articles published in English and French through to October 2014 from five electronic databases. A total of 57 eligible studies were identified. Thirty-four reports from 15 countries provided adequate genotyping data. CC5 is the predominant clonal complex in the healthcare setting in Africa. The hospital-associated MRSA ST239/ST241-III [3A] was identified in nine African countries. This clone was also described with SCCmec type IV [2B] in Algeria and Nigeria, and type V [5C] in Niger. In Africa, the European ST80-IV [2B] clone was limited to Algeria, Egypt and Tunisia. The clonal types ST22-IV [2B], ST36-II [2A], and ST612-IV [2B] were only reported in South Africa. No clear distinctions were observed between MRSA responsible for hospital and community infections. The community clones ST8-IV [2B] and ST88-IV [2B] were reported both in the hospital and community settings in Angola, Cameroon, Gabon, Ghana, Madagascar, Nigeria, and São Tomé and Príncipe. The proportion of PVL-positive MRSA carriage and/or infections ranged from 0.3 to 100% in humans. A number of pandemic clones were identified in Africa. Moreover, some MRSA clones are limited to specific countries or regions. We strongly advocate for more surveillance studies on MRSA in Africa. PMID:25983721

Human antibodies against spores of the genus Bacillus: a model study for detection of and protection against anthrax and the bioterrorist threat.

PubMed

Zhou, Bin; Wirsching, Peter; Janda, Kim D

2002-04-16

A naive, human single-chain Fv (scFv) phage-display library was used in bio-panning against live, native spores of Bacillus subtilis IFO 3336 suspended in solution. A direct in vitro panning and enzyme-linked immunosorbent assay-based selection afforded a panel of nine scFv-phage clones of which two, 5B and 7E, were chosen for further study. These two clones differed in their relative specificity and affinity for spores of B. subtilis IFO 3336 vs. a panel of spores from 11 other Bacillus species/strains. A variety of enzyme-linked immunosorbent assay protocols indicated these scFv-phage clones recognized different spore epitopes. Notably, some spore epitopes markedly changed between the free and microtiter-plate immobilized state as revealed by antibody-phage binding. An additional library selection procedure also was examined by constructing a Fab chain-shuffled sublibrary from the nine positive clones and by using a subtractive panning strategy to remove crossreactivity with B. licheniformis 5A24. The Fab-phage clone 52 was improved compared with 5B and was comparable to 7E in binding B. subtilis IFO 3336 vs. B. licheniformis 5A24, yet showed a distinctive crossreactivity pattern with other spores. We also developed a method to directly detect individual spores by using fluorescently labeled antibody-phage. Finally, a variety of "powders" that might be used in deploying spores of B. anthracis were examined for antibody-phage binding. The strategies described provide a foundation to discover human antibodies specific for native spores of B. anthracis that can be developed as diagnostic and therapeutic reagents.

Characterization of Microbial Community Structure in Gulf of Mexico Gas Hydrates: Comparative Analysis of DNA- and RNA-Derived Clone Libraries

PubMed Central

Mills, Heath J.; Martinez, Robert J.; Story, Sandra; Sobecky, Patricia A.

2005-01-01

The characterization of microbial assemblages within solid gas hydrate, especially those that may be physiologically active under in situ hydrate conditions, is essential to gain a better understanding of the effects and contributions of microbial activities in Gulf of Mexico (GoM) hydrate ecosystems. In this study, the composition of the Bacteria and Archaea communities was determined by 16S rRNA phylogenetic analyses of clone libraries derived from RNA and DNA extracted from sediment-entrained hydrate (SEH) and interior hydrate (IH). The hydrate was recovered from an exposed mound located in the northern GoM continental slope with a hydrate chipper designed for use on the manned-submersible Johnson Sea Link (water depth, 550 m). Previous geochemical analyses indicated that there was increased metabolic activity in the SEH compared to the IH layer (B. N. Orcutt, A. Boetius, S. K. Lugo, I. R. Macdonald, V. A. Samarkin, and S. Joye, Chem. Geol. 205:239-251). Phylogenetic analysis of RNA- and DNA-derived clones indicated that there was greater diversity in the SEH libraries than in the IH libraries. A majority of the clones obtained from the metabolically active fraction of the microbial community were most closely related to putative sulfate-reducing bacteria and anaerobic methane-oxidizing archaea. Several novel bacterial and archaeal phylotypes for which there were no previously identified closely related cultured isolates were detected in the RNA- and DNA-derived clone libraries. This study was the first phylogenetic analysis of the metabolically active fraction of the microbial community extant in the distinct SEH and IH layers of GoM gas hydrate. PMID:15933026

Adaptive Roles of SSY1 and SIR3 During Cycles of Growth and Starvation in Saccharomyces cerevisiae Populations Enriched for Quiescent or Nonquiescent Cells.

PubMed

Wloch-Salamon, Dominika M; Tomala, Katarzyna; Aggeli, Dimitra; Dunn, Barbara

2017-06-07

Over its evolutionary history, Saccharomyces cerevisiae has evolved to be well-adapted to fluctuating nutrient availability. In the presence of sufficient nutrients, yeast cells continue to proliferate, but upon starvation haploid yeast cells enter stationary phase and differentiate into nonquiescent (NQ) and quiescent (Q) cells. Q cells survive stress better than NQ cells and show greater viability when nutrient-rich conditions are restored. To investigate the genes that may be involved in the differentiation of Q and NQ cells, we serially propagated yeast populations that were enriched for either only Q or only NQ cell types over many repeated growth-starvation cycles. After 30 cycles (equivalent to 300 generations), each enriched population produced a higher proportion of the enriched cell type compared to the starting population, suggestive of adaptive change. We also observed differences in each population's fitness suggesting possible tradeoffs: clones from NQ lines were better adapted to logarithmic growth, while clones from Q lines were better adapted to starvation. Whole-genome sequencing of clones from Q- and NQ-enriched lines revealed mutations in genes involved in the stress response and survival in limiting nutrients ( ECM21 , RSP5 , MSN1 , SIR4 , and IRA2 ) in both Q and NQ lines, but also differences between the two lines: NQ line clones had recurrent independent mutations affecting the Ssy1p-Ptr3p-Ssy5p (SPS) amino acid sensing pathway, while Q line clones had recurrent, independent mutations in SIR3 and FAS1 Our results suggest that both sets of enriched-cell type lines responded to common, as well as distinct, selective pressures. Copyright © 2017 Wloch-Salamon et al.

Susceptibility to viral infection is enhanced by stable expression of 3A or 3AB proteins from foot-and-mouth disease virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rosas, Maria F.; Vieira, Yuri A.; Postigo, Raul

2008-10-10

The foot-and-mouth disease virus (FMDV) 3A protein is involved in virulence and host range. A distinguishing feature of FMDV 3B among picornaviruses is that three non-identical copies are encoded in the viral RNA and required for optimal replication in cell culture. Here, we have studied the involvement of the 3AB region on viral infection using constitutive and transient expression systems. BHK-21 stably transformed clones expressed low levels of FMDV 3A or 3A(B) proteins in the cell cytoplasm. Transformed cells stably expressing these proteins did not exhibit inner cellular rearrangements detectable by electron microscope analysis. Upon FMDV infection, clones expressing eithermore » 3A alone or 3A(B) proteins showed a significant increase in the percentage of infected cells, the number of plaque forming units and the virus yield. The 3A-enhancing effect was specific for FMDV as no increase in viral multiplication was observed in transformed clones infected with another picornavirus, encephalomyocarditis virus, or the negative-strand RNA virus vesicular stomatitis virus. A potential role of 3A protein in viral RNA translation was discarded by the lack of effect on FMDV IRES-dependent translation. Increased viral susceptibility was not caused by a released factor; neither the supernatant of transformed clones nor the addition of purified 3A protein to the infection medium was responsible for this effect. Unlike stable expression, high levels of 3A or 3A(B) protein transient expression led to unspecific inhibition of viral infection. Therefore, the effect observed on viral yield, which inversely correlated with the intracellular levels of 3A protein, suggests a transacting role operating on the FMDV multiplication cycle.« less

Genistein promotes DNA demethylation of the steroidogenic factor 1 (SF-1) promoter in endometrial stromal cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matsukura, Hiroshi, E-mail: hmatsukura.epi@mri.tmd.ac.jp; Aisaki, Ken-ichi; Igarashi, Katsuhide

2011-08-26

Highlights: {yields} Genistein (GEN) is a phytoestrogen found in soy products. {yields} GEN demethylated/unsilenced the steroidogenic factor 1 gene in endometrial tissue. {yields} GEN thus altered mRNA expression in uteri of ovariectomized (OVX) mice. {yields} A high-resolution melting assay was used to screen for epigenetic change. {yields} We isolated an endometrial cell clone that was epigenetically modulated by GEN. -- Abstract: It has recently been demonstrated that genistein (GEN), a phytoestrogen in soy products, is an epigenetic modulator in various types of cells; but its effect on endometrium has not yet been determined. We investigated the effects of GEN onmore » mouse uterine cells, in vivo and in vitro. Oral administration of GEN for 1 week induced mild proliferation of the endometrium in ovariectomized (OVX) mice, which was accompanied by the induction of steroidogenic factor 1 (SF-1) gene expression. GEN administration induced demethylation of multiple CpG sites in the SF-1 promoter; these sites are extensively methylated and thus silenced in normal endometrium. The GEN-mediated promoter demethylation occurred predominantly on the luminal side, as opposed to myometrium side, indicating that the epigenetic change was mainly shown in regenerated cells. Primary cultures of endometrial stromal cell colonies were screened for GEN-mediated alterations of DNA methylation by a high-resolution melting (HRM) method. One out of 20 colony-forming cell clones showed GEN-induced demethylation of SF-1. This clone exhibited a high proliferation capacity with continuous colony formation activity through multiple serial clonings. We propose that only a portion of endometrial cells are capable of receiving epigenetic modulation by GEN.« less

Speed genome editing by transient CRISPR/Cas9 targeting and large DNA fragment deletion.

PubMed

Luo, Jing; Lu, Liaoxun; Gu, Yanrong; Huang, Rong; Gui, Lin; Li, Saichao; Qi, Xinhui; Zheng, Wenping; Chao, Tianzhu; Zheng, Qianqian; Liang, Yinming; Zhang, Lichen

2018-06-07

Genetic engineering of cell lines and model organisms has been facilitated enormously by the CRISPR/Cas9 system. However, in cell lines it remains labor intensive and time consuming to obtain desirable mutant clones due to the difficulties in isolating the mutated clones and sophisticated genotyping. In this study, we have validated fluorescent protein reporter aided cell sorting which enables the isolation of maximal diversity in mutant cells. We further applied two spectrally distinct fluorescent proteins DsRed2 and ECFP as reporters for independent CRISPR/Cas9 mediated targeting, which allows for one-cell-one-well sorting of the mutant cells. Because of ultra-high efficiency of the CRISPR/Cas9 system with dual reporters and large DNA fragment deletion resulting from independent loci cleavage, monoclonal mutant cells could be easily identified by conventional PCR. In the speed genome editing method presented here, sophisticated genotyping methods are not necessary to identify loss of function mutations after CRISPR/Cas9 genome editing, and desirable loss of function mutant clones could be obtained in less than one month following transfection. Copyright © 2018 Elsevier B.V. All rights reserved.

Cloning and Expression Analysis of Phenylalanine Ammonia-Lyase Gene in the Mycelium and Fruit Body of the Edible Mushroom Flammulina velutipes

PubMed Central

Yun, Yeo Hong; Koo, Ja Sun

2015-01-01

Phenylalanine ammonia-lyase (PAL) gene is known to be expressed in plants, and is involved in the differentiation, growth and synthesis of secondary metabolites. However, its expression in fungi remains to be explored. To understand its expression in mushroom fungi, the PAL gene of the edible mushroom Flammulina velutipes (Fvpal) was cloned and characterized. The cloned Fvpal consists of 2,175 bp, coding for a polypeptide containing 724 amino acids and having 11 introns. The translated amino acid sequence of Fvpal shares a high identity (66%) with that of ectomycorrhizal fungus Tricholoma matsutake. Distinctively, the Fvpal expression in the mycelium was higher in minimal medium supplemented with L-tyrosine than with other aromatic amino acids. During cultivation of the mushroom on sawdust medium, Fvpal expression in the fruit body correspondingly increased as the mushroom grew. In the fruiting body, Fvpal was expressed more in the stipe than in the pileus. These results suggest that F. velutipes PAL activity differs in the different organs of the mushroom. Overall, this is first report to show that the PAL gene expression is associated with mushroom growth in fungi. PMID:26539050

Isolation and characterisation of a pod dehiscence zone-specific polygalacturonase from Brassica napus.

PubMed

Petersen, M; Sander, L; Child, R; van Onckelen, H; Ulvskov, P; Borkhardt, B

1996-06-01

Seven distinct partial cDNAs, similar in sequence to previously described polygalacturonases (PGs), were amplified from cDNA derived from rape pod wall, dehiscence zone and leaves by the polymerase chain reaction. Northern analysis showed that one clone, PG35-8, was expressed at low levels in the dehiscence zone during the first five weeks after anthesis but was very abundantly expressed at week 6. In contrast, no PG35-8-related RNA was detected in the pod wall. Our data suggest that there are temporal and spatial correlations between the breakdown of the middle lamella, of the dehiscence zone cells and the pattern of synthesis of PG35-8 transcripts which may indicate a role for this particular PG in rape pod dehiscence. PG35-8 was used to isolate five cDNA clones from a rape dehiscence zone cDNA library. Restriction enzyme analysis and partial sequencing revealed that they were derived from four highly homologous transcripts which are probably allelic forms of a single gene. One full-length clone, RDPG1, was completely sequenced. The predicted protein of RDPG1 showed its highest identity with PG from apple fruit with an identity of 52%.

Clonal dominance among T-lymphocyte infiltrates in arthritis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stamenkovic, I.; Stegagno, M.; Wright, K.A.

1988-02-01

Synovial membranes in patients with rheumatoid arthritis as well as other types of chronic destructive inflammatory arthritis contain infiltrates of activated T lymphocytes that probably contribute to the pathogenesis of the disease. In an effort to elucidate the nature of these infiltrates, interleukin 2 (IL-2)-responsive T lymphocytes were grown out of synovial fragments from 14 patients undergoing surgery for advanced destructive inflammatory joint disease. Eleven of the samples examined were from patients with classical rheumatoid arthritis, while three others were obtained from individuals with clinical osteoarthritis. Southern blot analysis of T-cell receptor (TCR) ..beta..-chain genes in 13 of 14 culturesmore » showed distinct rearrangements, indicating that each culture was characterized by the predominance of a limited number of clones. T-cell populations from peripheral blood stimulated with a variety of activators and expanded with IL-2 did not demonstrate evidence of similar clonality in long-term culture. These results suggest that a limited number of activated T-cell clones predominate at the site of tissue injury in rheumatoid synovial membranes as well as in other types of destructive inflammatory joint disease. Further characterization of these T-cell clones may aid our understanding of the pathogenesis of these rheumatic disorders.« less

Clonal Dominance among T-Lymphocyte Infiltrates in Arthritis

NASA Astrophysics Data System (ADS)

Stamenkovic, Ivan; Stegagno, Michele; Wright, Kathryn A.; Krane, Stephen M.; Amento, Edward P.; Colvin, Robert B.; Duquesnoy, Rene J.; Kurnick, James T.

1988-02-01

Synovial membranes in patients with rheumatoid arthritis as well as other types of chronic destructive inflammatory arthritis contain infiltrates of activated T lymphocytes that probably contribute to the pathogenesis of the disease. In an effort to elucidate the nature of these infiltrates, interleukin 2 (IL-2)-responsive T lymphocytes were grown out of synovial fragments from 14 patients undergoing surgery for advanced destructive inflammatory joint disease. Eleven of the samples examined were from patients with classical rheumatoid arthritis, while three others were obtained from individuals with clinical osteoarthritis. Southern blot analysis of T-cell receptor (TCR) β -chain genes in 13 of 14 cultures showed distinct rearrangements, indicating that each culture was characterized by the predominance of a limited number of clones. T-cell populations from peripheral blood stimulated with a variety of activators and expanded with IL-2 did not demonstrate evidence of similar clonality in long-term culture. These results suggest that a limited number of activated T-cell clones predominate at the site of tissue injury in rheumatoid synovial membranes as well as in other types of destructive inflammatory joint disease. Further characterization of these T-cell clones may aid our understanding of the pathogenesis of these rheumatic disorders.

To feed or not to feed: plant factors located in the epidermis, mesophyll, and sieve elements influence pea aphid's ability to feed on legume species.

PubMed

Schwarzkopf, Alexander; Rosenberger, Daniel; Niebergall, Martin; Gershenzon, Jonathan; Kunert, Grit

2013-01-01

The pea aphid (Acyrthosiphon pisum Harris), a legume specialist, encompasses at least 11 genetically distinct sympatric host races. Each host race shows a preference for a certain legume species. Six pea aphid clones from three host races were used to localize plant factors influencing aphid probing and feeding behavior on four legume species. Aphid performance was tested by measuring survival and growth. The location of plant factors influencing aphid probing and feeding was determined using the electrical penetration graph (EPG) technique. Every aphid clone performed best on the plant species from which it was originally collected, as well as on Vicia faba. On other plant species, clones showed intermediate or poor performance. The most important plant factors influencing aphid probing and feeding behavior were localized in the epidermis and sieve elements. Repetitive puncturing of sieve elements might be relevant for establishing phloem feeding, since feeding periods appear nearly exclusively after these repetitive sieve element punctures. A combination of plant factors influences the behavior of pea aphid host races on different legume species and likely contributes to the maintenance of these races.

Archaea in Organic-Lean and Organic-Rich Marine Subsurface Sediments: An Environmental Gradient Reflected in Distinct Phylogenetic Lineages

PubMed Central

Durbin, Alan M.; Teske, Andreas

2012-01-01

Examining the patterns of archaeal diversity in little-explored organic-lean marine subsurface sediments presents an opportunity to study the association of phylogenetic affiliation and habitat preference in uncultured marine Archaea. Here we have compiled and re-analyzed published archaeal 16S rRNA clone library datasets across a spectrum of sediment trophic states characterized by a wide range of terminal electron-accepting processes. Our results show that organic-lean marine sediments in deep marine basins and oligotrophic open ocean locations are inhabited by distinct lineages of archaea that are not found in the more frequently studied, organic-rich continental margin sediments. We hypothesize that different combinations of electron donor and acceptor concentrations along the organic-rich/organic-lean spectrum result in distinct archaeal communities, and propose an integrated classification of habitat characteristics and archaeal community structure. PMID:22666218

Ants farm subterranean aphids mostly in single clone groups - an example of prudent husbandry for carbohydrates and proteins?

PubMed Central

2012-01-01

Background Mutualistic interactions are wide-spread but the mechanisms underlying their evolutionary stability and ecological dynamics remain poorly understood. Cultivation mutualisms in which hosts consume symbionts occur in phylogenetically diverse groups, but often have symbiont monocultures for each host. This is consistent with the prediction that symbionts should avoid coexistence with other strains so that host services continue to benefit relatives, but it is less clear whether hosts should always favor monocultures and what mechanisms they might have to manipulate symbiont diversity. Few mutualisms have been studied in sufficient genetic detail to address these issues, so we decided to characterize symbiont diversity in the complex mutualism between multiple root aphid species and Lasius flavus ants. After showing elsewhere that three of these aphid species have low dispersal and mostly if not exclusively asexual reproduction, we here investigate aphid diversity within and between ant nest mounds. Results The three focal species (Geoica utricularia, Forda marginata and Tetraneura ulmi) had considerable clonal diversity at the population level. Yet more than half of the ant mounds contained just a single aphid species, a significantly higher percentage than expected from a random distribution. Over 60% of these single-species mounds had a single aphid clone, and clones tended to persist across subsequent years. Whenever multiple species/clones co-occurred in the same mound, they were spatially separated with more than 95% of the aphid chambers containing individuals of a single clone. Conclusions L. flavus “husbandry” is characterized by low aphid “livestock” diversity per colony, especially at the nest-chamber level, but it lacks the exclusive monocultures known from other cultivation mutualisms. The ants appear to eat most of the early instar aphids, so that adult aphids are unlikely to face limited phloem resources and scramble competition with other aphids. We suggest that such culling of carbohydrate-providing symbionts for protein ingestion may maintain maximal host yield per aphid while also benefitting the domesticated aphids as long as their clone-mates reproduce successfully. The cost-benefit logic of this type of polyculture husbandry has striking analogies with human farming practices based on slaughtering young animals for meat to maximize milk-production by a carefully regulated adult livestock population. PMID:22747564

Individual crypt genetic heterogeneity and the origin of metaplastic glandular epithelium in human Barrett’s oesophagus

PubMed Central

Leedham, S J; Preston, S L; McDonald, S A C; Elia, G; Bhandari, P; Poller, D; Harrison, R; Novelli, M R; Jankowski, J A; Wright, N A

2008-01-01

Objectives: Current models of clonal expansion in human Barrett’s oesophagus are based upon heterogenous, flow-purified biopsy analysis taken at multiple segment levels. Detection of identical mutation fingerprints from these biopsy samples led to the proposal that a mutated clone with a selective advantage can clonally expand to fill an entire Barrett’s segment at the expense of competing clones (selective sweep to fixation model). We aimed to assess clonality at a much higher resolution by microdissecting and genetically analysing individual crypts. The histogenesis of Barrett’s metaplasia and neo-squamous islands has never been demonstrated. We investigated the oesophageal gland squamous ducts as the source of both epithelial sub-types. Methods: Individual crypts across Barrett’s biopsy and oesophagectomy blocks were dissected. Determination of tumour suppressor gene loss of heterozygosity patterns, p16 and p53 point mutations were carried out on a crypt-by-crypt basis. Cases of contiguous neo-squamous islands and columnar metaplasia with oesophageal squamous ducts were identified. Tissues were isolated by laser capture microdissection and genetically analysed. Results: Individual crypt dissection revealed mutation patterns that were masked in whole biopsy analysis. Dissection across oesophagectomy specimens demonstrated marked clonal heterogeneity, with multiple independent clones present. We identified a p16 point mutation arising in the squamous epithelium of the oesophageal gland duct, which was also present in a contiguous metaplastic crypt, whereas neo-squamous islands arising from squamous ducts were wild-type with respect to surrounding Barrett’s dysplasia. Conclusions: By studying clonality at the crypt level we demonstrate that Barrett’s heterogeneity arises from multiple independent clones, in contrast to the selective sweep to fixation model of clonal expansion previously described. We suggest that the squamous gland ducts situated throughout the oesophagus are the source of a progenitor cell that may be susceptible to gene mutation resulting in conversion to Barrett’s metaplastic epithelium. Additionally, these data suggest that wild-type ducts may be the source of neo-squamous islands. PMID:18305067

Generation of mammalian cells stably expressing multiple genes at predetermined levels.

PubMed

Liu, X; Constantinescu, S N; Sun, Y; Bogan, J S; Hirsch, D; Weinberg, R A; Lodish, H F

2000-04-10

Expression of cloned genes at desired levels in cultured mammalian cells is essential for studying protein function. Controlled levels of expression have been difficult to achieve, especially for cell lines with low transfection efficiency or when expression of multiple genes is required. An internal ribosomal entry site (IRES) has been incorporated into many types of expression vectors to allow simultaneous expression of two genes. However, there has been no systematic quantitative analysis of expression levels in individual cells of genes linked by an IRES, and thus the broad use of these vectors in functional analysis has been limited. We constructed a set of retroviral expression vectors containing an IRES followed by a quantitative selectable marker such as green fluorescent protein (GFP) or truncated cell surface proteins CD2 or CD4. The gene of interest is placed in a multiple cloning site 5' of the IRES sequence under the control of the retroviral long terminal repeat (LTR) promoter. These vectors exploit the approximately 100-fold differences in levels of expression of a retrovirus vector depending on its site of insertion in the host chromosome. We show that the level of expression of the gene downstream of the IRES and the expression level and functional activity of the gene cloned upstream of the IRES are highly correlated in stably infected target cells. This feature makes our vectors extremely useful for the rapid generation of stably transfected cell populations or clonal cell lines expressing specific amounts of a desired protein simply by fluorescent activated cell sorting (FACS) based on the level of expression of the gene downstream of the IRES. We show how these vectors can be used to generate cells expressing high levels of the erythropoietin receptor (EpoR) or a dominant negative Smad3 protein and to generate cells expressing two different cloned proteins, Ski and Smad4. Correlation of a biologic effect with the level of expression of the protein downstream of the IRES provides strong evidence for the function of the protein placed upstream of the IRES.

Evaluation of microbial community in hydrothermal field by direct DNA sequencing

NASA Astrophysics Data System (ADS)

Kawarabayasi, Y.; Maruyama, A.

2002-12-01

Many extremophiles have been discovered from terrestrial and marine hydrothermal fields. Some thermophiles can grow beyond 90°C in culture, while direct microscopic analysis occasionally indicates that microbes may survive in much hotter hydrothermal fluids. However, it is very difficult to isolate and cultivate such microbes from the environments, i.e., over 99% of total microbes remains undiscovered. Based on experiences of entire microbial genome analysis (Y.K.) and microbial community analysis (A.M.), we started to find out unique microbes/genes in hydrothermal fields through direct sequencing of environmental DNA fragments. At first, shotgun plasmid libraries were directly constructed with the DNA molecules prepared from mixed microbes collected by an in situ filtration system from low-temperature fluids at RM24 in the Southern East Pacific Rise (S-EPR). A gene amplification (PCR) technique was not used for preventing mutation in the process. The nucleotide sequences of 285 clones indicated that no sequence had identical data in public databases. Among 27 clones determined entire sequences, no ORF was identified on 14 clones like intron in Eukaryote. On four clones, tetra-nucleotide-long multiple tandem repetitive sequences were identified. This type of sequence was identified in some familiar disease in human. The result indicates that living/dead materials with eukaryotic features may exist in this low temperature field. Secondly, shotgun plasmid libraries were constructed from the environmental DNA prepared from Beppu hot springs. In randomly-selected 143 clones used for sequencing, no known sequence was identified. Unlike the clones in S-EPR library, clear ORFs were identified on all nine clones determined the entire sequence. It was found that one clone, H4052, contained the complete Aspartyl-tRNA synthetase. Phylogenetic analysis using amino acid sequences of this gene indicated that this gene was separated from other Euryarchaea before the differentiation of species. Thus, some novel archaeal species are expected to be in this field. The present direct cloning and sequencing technique is now opening a window to the new world in hydrothermal microbial community analysis.

Intratumoral genetic heterogeneity in metastatic melanoma is accompanied by variation in malignant behaviors

PubMed Central

2013-01-01

Background Intratumoral heterogeneity is a major obstacle for the treatment of cancer, as the presence of even minor populations that are insensitive to therapy can lead to disease relapse. Increased clonal diversity has been correlated with a poor prognosis for cancer patients, and we therefore examined genetic, transcriptional, and functional diversity in metastatic melanoma. Methods Amplicon sequencing and SNP microarrays were used to profile somatic mutations and DNA copy number changes in multiple regions from metastatic lesions. Clonal genetic and transcriptional heterogeneity was also assessed in single cell clones from early passage cell lines, which were then subjected to clonogenicity and drug sensitivity assays. Results MAPK pathway and tumor suppressor mutations were identified in all regions of the melanoma metastases analyzed. In contrast, we identified copy number abnormalities present in only some regions in addition to homogeneously present changes, suggesting ongoing genetic evolution following metastatic spread. Copy number heterogeneity from a tumor was represented in matched cell line clones, which also varied in their clonogenicity and drug sensitivity. Minor clones were identified based on dissimilarity to the parental cell line, and these clones were the most clonogenic and least sensitive to drugs. Finally, treatment of a polyclonal cell line with paclitaxel to enrich for drug-resistant cells resulted in the adoption of a gene expression profile with features of one of the minor clones, supporting the idea that these populations can mediate disease relapse. Conclusion Our results support the hypothesis that minor clones might have major consequences for patient outcomes in melanoma. PMID:24119551

AFEAP cloning: a precise and efficient method for large DNA sequence assembly.

PubMed

Zeng, Fanli; Zang, Jinping; Zhang, Suhua; Hao, Zhimin; Dong, Jingao; Lin, Yibin

2017-11-14

Recent development of DNA assembly technologies has spurred myriad advances in synthetic biology, but new tools are always required for complicated scenarios. Here, we have developed an alternative DNA assembly method named AFEAP cloning (Assembly of Fragment Ends After PCR), which allows scarless, modular, and reliable construction of biological pathways and circuits from basic genetic parts. The AFEAP method requires two-round of PCRs followed by ligation of the sticky ends of DNA fragments. The first PCR yields linear DNA fragments and is followed by a second asymmetric (one primer) PCR and subsequent annealing that inserts overlapping overhangs at both sides of each DNA fragment. The overlapping overhangs of the neighboring DNA fragments annealed and the nick was sealed by T4 DNA ligase, followed by bacterial transformation to yield the desired plasmids. We characterized the capability and limitations of new developed AFEAP cloning and demonstrated its application to assemble DNA with varying scenarios. Under the optimized conditions, AFEAP cloning allows assembly of an 8 kb plasmid from 1-13 fragments with high accuracy (between 80 and 100%), and 8.0, 11.6, 19.6, 28, and 35.6 kb plasmids from five fragments at 91.67, 91.67, 88.33, 86.33, and 81.67% fidelity, respectively. AFEAP cloning also is capable to construct bacterial artificial chromosome (BAC, 200 kb) with a fidelity of 46.7%. AFEAP cloning provides a powerful, efficient, seamless, and sequence-independent DNA assembly tool for multiple fragments up to 13 and large DNA up to 200 kb that expands synthetic biologist's toolbox.

Characterization of the bacterial communities associated with the bald sea urchin disease of the echinoid Paracentrotus lividus.

PubMed

Becker, Pierre T; Egea, Emilie; Eeckhaut, Igor

2008-06-01

The microbial communities involved in the bald sea urchin disease of the echinoid Paracentrotus lividus are investigated using culture-independent techniques. Lesions of diseased specimens from two locations in France, La Ciotat (Mediterranean Sea) and Morgat (Atlantic Ocean), are examined by Scanning Electron Microscopy (SEM) and the diversity of their microbiota is analysed by Denaturing Gradient Gel Electrophoresis (DGGE) and 16S rRNA gene clones libraries construction. Microscopic observations demonstrated that only the central area of the lesions is invaded by bacteria but not the peripheral zone and the surrounding healthy tissues. Molecular analysis identified at least 24 bacterial genomospecies in bald sea urchin lesions: 5 are Alphaproteobacteria, 10 are Gammaproteobacteria, 8 are CFB bacteria and 1 is a Fusobacteria. Out of them, 4 are observed in both locations while 10 occur only in the Atlantic Ocean and 10 only in the Mediterranean Sea. Gammaproteobacteria are the most represented in clones libraries from both locations, with respectively 65% and 43% of the total clones. CFB and Alphaproteobacteria accounted for the majority of the remaining clones and were detected by DGGE in virtually all samples from both stations. Our results demonstrate that bacterial communities observed on diseased individuals of the same echinoid species but originating from distinct locations are not similar and thus support the hypothesis that bacteria involved in the worldwide echinoid disease commonly called the bald sea urchin disease are opportunistic and not specific.

A Reverse Genetics Platform That Spans the Zika Virus Family Tree

PubMed Central

Widman, Douglas G.; Young, Ellen; Yount, Boyd L.; Plante, Kenneth S.; Gallichotte, Emily N.; Carbaugh, Derek L.; Plante, Jessica; Swanstrom, Jesica; Heise, Mark T.; Lazear, Helen M.

2017-01-01

ABSTRACT Zika virus (ZIKV), a mosquito-borne flavivirus discovered in 1947, has only recently caused large outbreaks and emerged as a significant human pathogen. In 2015, ZIKV was detected in Brazil, and the resulting epidemic has spread throughout the Western Hemisphere. Severe complications from ZIKV infection include neurological disorders such as Guillain-Barré syndrome in adults and a variety of fetal abnormalities, including microcephaly, blindness, placental insufficiency, and fetal demise. There is an urgent need for tools and reagents to study the pathogenesis of epidemic ZIKV and for testing vaccines and antivirals. Using a reverse genetics platform, we generated six ZIKV infectious clones and derivative viruses representing diverse temporal and geographic origins. These include three versions of MR766, the prototype 1947 strain (with and without a glycosylation site in the envelope protein), and H/PF/2013, a 2013 human isolate from French Polynesia representative of the virus introduced to Brazil. In the course of synthesizing a clone of a circulating Brazilian strain, phylogenetic studies identified two distinct ZIKV clades in Brazil. We reconstructed viable clones of strains SPH2015 and BeH819015, representing ancestral members of each clade. We assessed recombinant virus replication, binding to monoclonal antibodies, and virulence in mice. This panel of molecular clones and recombinant virus isolates will enable targeted studies of viral determinants of pathogenesis, adaptation, and evolution, as well as the rational attenuation of contemporary outbreak strains to facilitate the design of vaccines and therapeutics. PMID:28270583

Accumulation of human T lymphotropic virus (HTLV)-I-specific T cell clones in HTLV-I-associated myelopathy/tropical spastic paraparesis patients.

PubMed

Höger, T A; Jacobson, S; Kawanishi, T; Kato, T; Nishioka, K; Yamamoto, K

1997-08-15

Human T lymphotropic virus type I (HTLV-I)-associated myelopathy/tropical spastic paraperesis (HAM/TSP) is a slowly progressive neurologic disorder following infection with HTLV-I. It is characterized by spasticity and hyper-reflexia of the lower extremities, urinary bladder disturbance, lower extremity muscle weakness, and sensory disturbances. HTLV-I, as an inducer of a strong humoral and cytotoxic response, is a well-known pathogenic factor for the progression of HAM/TSP. Peptides derived from proviral tax and env genes provide epitopes recognized by T cells. We herein report an accumulation of distinct clonotypes of alpha/beta TCR+ peripheral blood T lymphocytes from HAM/TSP patients in comparison with that observed in both asymptomatic carriers and healthy controls, using the reverse-transcriptase PCR/single-strand conformation polymorphism method. We also found that some of the accumulated T cell clones in the peripheral blood and cerebrospinal fluid are HTLV-I Tax(11-19) peptide specific. Such clones were found to expand strongly after being cultured with an HTLV-I Tax(11-19) peptide. Moreover, the cultured samples exhibited a strong MHC class I-restricted cytotoxic activity against HTLV-I Tax(11-19) peptide-expressing targets, and therefore most likely also include the disease-associated T cell clones observed in the patients. This is the first report of a direct assessment of Ag-specific T cell responses in fresh PBL and cerebrospinal fluid.

The Role of Epidemic Resistance Plasmids and International High-Risk Clones in the Spread of Multidrug-Resistant Enterobacteriaceae

PubMed Central

Mathers, Amy J.; Peirano, Gisele

2015-01-01

SUMMARY Escherichia coli sequence type 131 (ST131) and Klebsiella pneumoniae ST258 emerged in the 2000s as important human pathogens, have spread extensively throughout the world, and are responsible for the rapid increase in antimicrobial resistance among E. coli and K. pneumoniae strains, respectively. E. coli ST131 causes extraintestinal infections and is often fluoroquinolone resistant and associated with extended-spectrum β-lactamase production, especially CTX-M-15. K. pneumoniae ST258 causes urinary and respiratory tract infections and is associated with carbapenemases, most often KPC-2 and KPC-3. The most prevalent lineage within ST131 is named fimH30 because it contains the H30 variant of the type 1 fimbrial adhesin gene, and recent molecular studies have demonstrated that this lineage emerged in the early 2000s and was then followed by the rapid expansion of its sublineages H30-R and H30-Rx. K. pneumoniae ST258 comprises 2 distinct lineages, namely clade I and clade II. Moreover, it seems that ST258 is a hybrid clone that was created by a large recombination event between ST11 and ST442. Epidemic plasmids with blaCTX-M and blaKPC belonging to incompatibility group F have contributed significantly to the success of these clones. E. coli ST131 and K. pneumoniae ST258 are the quintessential examples of international multidrug-resistant high-risk clones. PMID:25926236

Quantifying and resolving multiple vector transformants in S. cerevisiae plasmid libraries.

PubMed

Scanlon, Thomas C; Gray, Elizabeth C; Griswold, Karl E

2009-11-20

In addition to providing the molecular machinery for transcription and translation, recombinant microbial expression hosts maintain the critical genotype-phenotype link that is essential for high throughput screening and recovery of proteins encoded by plasmid libraries. It is known that Escherichia coli cells can be simultaneously transformed with multiple unique plasmids and thusly complicate recombinant library screening experiments. As a result of their potential to yield misleading results, bacterial multiple vector transformants have been thoroughly characterized in previous model studies. In contrast to bacterial systems, there is little quantitative information available regarding multiple vector transformants in yeast. Saccharomyces cerevisiae is the most widely used eukaryotic platform for cell surface display, combinatorial protein engineering, and other recombinant library screens. In order to characterize the extent and nature of multiple vector transformants in this important host, plasmid-born gene libraries constructed by yeast homologous recombination were analyzed by DNA sequencing. It was found that up to 90% of clones in yeast homologous recombination libraries may be multiple vector transformants, that on average these clones bear four or more unique mutant genes, and that these multiple vector cells persist as a significant proportion of library populations for greater than 24 hours during liquid outgrowth. Both vector concentration and vector to insert ratio influenced the library proportion of multiple vector transformants, but their population frequency was independent of transformation efficiency. Interestingly, the average number of plasmids born by multiple vector transformants did not vary with their library population proportion. These results highlight the potential for multiple vector transformants to dominate yeast libraries constructed by homologous recombination. The previously unrecognized prevalence and persistence of multiply transformed yeast cells have important implications for yeast library screens. The quantitative information described herein should increase awareness of this issue, and the rapid sequencing approach developed for these studies should be widely useful for identifying multiple vector transformants and avoiding complications associated with cells that have acquired more than one unique plasmid.

3-Hydroxy-3-methylglutaryl CoA lyase (HL): Mouse and human HL gene (HMGCL) cloning and detection of large gene deletions in two unrelated HL-deficient patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, S.P.; Robert, M.F.; Mitchell, G.A.

1996-04-01

3-hydroxy-3-methylglutaryl CoA lyase (HL, EC 4.1.3.4) catalyzes the cleavage of 3-hydroxy-3-methylglutaryl CoA to acetoacetic acid and acetyl CoA, the final reaction of both ketogenesis and leucine catabolism. Autosomal-recessive HL deficiency in humans results in episodes of hypoketotic hypoglycemia and coma. Using a mouse HL cDNA as a probe, we isolated a clone containing the full-length mouse HL gene that spans about 15 kb of mouse chromosome 4 and contains nine exons. The promoter region of the mouse HL gene contains elements characteristic of a housekeeping gene: a CpG island containing multiple Sp1 binding sites surrounds exon 1, and neither amore » TATA nor a CAAT box are present. We identified multiple transcription start sites in the mouse HL gene, 35 to 9 bases upstream of the translation start codon. We also isolated two human HL genomic clones that include HL exons 2 to 9 within 18 kb. The mouse and human HL genes (HGMW-approved symbol HMGCL) are highly homologous, with identical locations of intron-exon junctions. By genomic Southern blot analysis and exonic PCR, was found 2 of 33 HL-deficient probands to be homozygous for large deletions in the HL gene. 26 refs., 4 figs., 2 tabs.« less

Two new gene clusters involved in the degradation of plant cell wall from the fecal microbiota of Tunisian dromedary

PubMed Central

Ameri, Rihab; Laville, Elisabeth; Potocki-Véronèse, Gabrielle; Trabelsi, Sahar; Mezghani, Monia; Elgharbi, Fatma

2018-01-01

Dromedaries are capable of digesting plant cell wall with high content of lignocellulose of poor digestibility. Consequently, their intestinal microbiota can be a source of novel carbohydrate-active enzymes (CAZymes). To the best of our knowledge, no data are available describing the biochemical analysis of enzymes in dromedary intestinal microbiota. To investigate new hydrolytic enzymes from the dromedary gut, a fosmid library was constructed using metagenomic DNA from feces of non-domestic adult dromedary camels living in the Tunisian desert. High-throughput functional screening of 13756 clones resulted in 47 hit clones active on a panel of various chromogenic and non-chromogenic glycan substrates. Two of them, harboring multiple activities, were retained for further analysis. Clone 26H3 displayed activity on AZO-CM-cellulose, AZCL Carob galactomannan and Tween 20, while clone 36A23 was active on AZCL carob galactomannan and AZCL barley β-glucan. The functional annotation of their sequences highlighted original metagenomic loci originating from bacteria of the Bacteroidetes/Chlorobi group, involved in the metabolization of mannosides and β-glucans thanks to a complete battery of endo- and exo-acting glycoside hydrolases, esterases, phosphorylases and transporters. PMID:29601586

Molecular cloning and characterization of Echinostoma caproni heat shock protein-70 and differential expression in the parasite derived from low- and high-compatible hosts.

PubMed

Higón, M; Monteagudo, C; Fried, B; Esteban, J G; Toledo, R; Marcilla, A

2008-10-01

We cloned and expressed Echinostoma caproni HSP70 in Escherichia coli. This molecule presents an open reading frame (ORF) of 655 amino acids, and a theoretical molecular weight of 71 kDa. E. caproni HSP70 protein showed a high homology to other helminth molecules, major differences being located in the C-terminal region of the molecule, with a hydrophobic portion. Studies of protein and messenger RNA (mRNA) expression revealed a distinct pattern, depending on the host (low- or high-compatible). Specific polyclonal antisera raised against the recombinant protein expressed in Escherichia coli demonstrated its selective presence in excretory/secretory products (ESP) of adult parasites obtained from high-compatible hosts. Immunological studies showed clearly the association of HSP70 with the parasite surface and other structures, including eggs.

Cloning, sequence, and disruption of the Saccharomyces diastaticus DAR1 gene encoding a glycerol-3-phosphate dehydrogenase.

PubMed Central

Wang, H T; Rahaim, P; Robbins, P; Yocum, R R

1994-01-01

The Saccharomyces diastaticus DAR1 gene was cloned by complementation in an Escherichia coli strain auxogrophic for glycerol-3-phosphate. DAR1 encodes an NADH-dependent dihydroxyacetone phosphate reductase (sn-glycerol-3-phosphate dehydrogenase [G3PDase; EC 1.1.1.8]) homologous to several other eukaryotic G3PDases. DAR1 is distinct from GUT2, which encodes a glucose-repressed mitochondrial G3PDase, but is identical to GPD1 from S. cerevisiae, a close relative of S. diastaticus. The level of DAR1-encoded G3PDase was increased about threefold in a medium of high osmolarity. Disruption of DAR1 in a haploid S. cerevisiae was not lethal but led to a decrease in cytoplasmic NADH-dependent G3PDase activity, an increase in osmotic sensitivity, and a 25% reduction in glycerol secretion from cells grown anaerobically on glucose. PMID:7961476

Cloning, sequence, and disruption of the Saccharomyces diastaticus DAR1 gene encoding a glycerol-3-phosphate dehydrogenase.

PubMed

Wang, H T; Rahaim, P; Robbins, P; Yocum, R R

1994-11-01

The Saccharomyces diastaticus DAR1 gene was cloned by complementation in an Escherichia coli strain auxogrophic for glycerol-3-phosphate. DAR1 encodes an NADH-dependent dihydroxyacetone phosphate reductase (sn-glycerol-3-phosphate dehydrogenase [G3PDase; EC 1.1.1.8]) homologous to several other eukaryotic G3PDases. DAR1 is distinct from GUT2, which encodes a glucose-repressed mitochondrial G3PDase, but is identical to GPD1 from S. cerevisiae, a close relative of S. diastaticus. The level of DAR1-encoded G3PDase was increased about threefold in a medium of high osmolarity. Disruption of DAR1 in a haploid S. cerevisiae was not lethal but led to a decrease in cytoplasmic NADH-dependent G3PDase activity, an increase in osmotic sensitivity, and a 25% reduction in glycerol secretion from cells grown anaerobically on glucose.

Tumor evolutionary directed graphs and the history of chronic lymphocytic leukemia.

PubMed

Wang, Jiguang; Khiabanian, Hossein; Rossi, Davide; Fabbri, Giulia; Gattei, Valter; Forconi, Francesco; Laurenti, Luca; Marasca, Roberto; Del Poeta, Giovanni; Foà, Robin; Pasqualucci, Laura; Gaidano, Gianluca; Rabadan, Raul

2014-12-11

Cancer is a clonal evolutionary process, caused by successive accumulation of genetic alterations providing milestones of tumor initiation, progression, dissemination, and/or resistance to certain therapeutic regimes. To unravel these milestones we propose a framework, tumor evolutionary directed graphs (TEDG), which is able to characterize the history of genetic alterations by integrating longitudinal and cross-sectional genomic data. We applied TEDG to a chronic lymphocytic leukemia (CLL) cohort of 70 patients spanning 12 years and show that: (a) the evolution of CLL follows a time-ordered process represented as a global flow in TEDG that proceeds from initiating events to late events; (b) there are two distinct and mutually exclusive evolutionary paths of CLL evolution; (c) higher fitness clones are present in later stages of the disease, indicating a progressive clonal replacement with more aggressive clones. Our results suggest that TEDG may constitute an effective framework to recapitulate the evolutionary history of tumors.

Non-cell-autonomous driving of tumour growth supports sub-clonal heterogeneity.

PubMed

Marusyk, Andriy; Tabassum, Doris P; Altrock, Philipp M; Almendro, Vanessa; Michor, Franziska; Polyak, Kornelia

2014-10-02

Cancers arise through a process of somatic evolution that can result in substantial sub-clonal heterogeneity within tumours. The mechanisms responsible for the coexistence of distinct sub-clones and the biological consequences of this coexistence remain poorly understood. Here we used a mouse xenograft model to investigate the impact of sub-clonal heterogeneity on tumour phenotypes and the competitive expansion of individual clones. We found that tumour growth can be driven by a minor cell subpopulation, which enhances the proliferation of all cells within a tumour by overcoming environmental constraints and yet can be outcompeted by faster proliferating competitors, resulting in tumour collapse. We developed a mathematical modelling framework to identify the rules underlying the generation of intra-tumour clonal heterogeneity. We found that non-cell-autonomous driving of tumour growth, together with clonal interference, stabilizes sub-clonal heterogeneity, thereby enabling inter-clonal interactions that can lead to new phenotypic traits.

Molecular cloning and analysis of the ergopeptine assembly system in the ergot fungus Claviceps purpurea.

PubMed

Correia, Telmo; Grammel, Nicolas; Ortel, Ingo; Keller, Ullrich; Tudzynski, Paul

2003-12-01

Claviceps purpurea produces the pharmacological important ergopeptines, a class of cyclol-structured alkaloid peptides containing D-lysergic acid. These compounds are assembled from D-lysergic acid and three different amino acids by the nonribosomal peptide synthetase enzymes LPS1 and LPS2. Cloning of alkaloid biosynthesis genes from C. purpurea has revealed a gene cluster including two NRPS genes, cpps 1 and cpps 2. Protein sequence data had assigned earlier cpps1 to encode the trimodular LPS1 assembling the tripeptide portion of ergopeptines. Here, we show by transcriptional analysis, targeted inactivation, analysis of disruption mutants, and heterologous expression that cpps 2 encodes the monomodular LPS2 responsible for D-lysergic acid activation and incorporation into the ergopeptine backbone. The presence of two distinct NRPS subunits catalyzing formation of ergot peptides is the first example of a fungal NRPS system consisting of different NRPS subunits.

Gene-for-gene disease resistance: bridging insect pest and pathogen defense.

PubMed

Kaloshian, Isgouhi

2004-12-01

Active plant defense, also known as gene-for-gene resistance, is triggered when a plant resistance (R) gene recognizes the intrusion of a specific insect pest or pathogen. Activation of plant defense includes an array of physiological and transcriptional reprogramming. During the past decade, a large number of plant R genes that confer resistance to diverse group of pathogens have been cloned from a number of plant species. Based on predicted protein structures, these genes are classified into a small number of groups, indicating that structurally related R genes recognize phylogenetically distinct pathogens. An extreme example is the tomato Mi-1 gene, which confers resistance to potato aphid (Macrosiphum euphorbiae), whitefly (Bemisia tabaci), and root-knot nematodes (Meloidogyne spp.). While Mi-1 remains the only cloned insect R gene, there is evidence that gene-for-gene type of plant defense against piercing-sucking insects exists in a number of plant species.

Monoclonal IgM-related AL amyloidosis.

PubMed

Milani, Paolo; Merlini, Giampaolo

2016-06-01

Monoclonal immunoglobulin M (IgM)-related light chain (AL) amyloidosis, which accounts for 5%-7% of all AL amyloidosis cases, is a distinct clinical entity that poses specific challenges to clinicians. Several studies reported that although there is a substantial overlap, the pattern of organ involvement is peculiar, with higher frequencies of lung, lymph nodes, and peripheral nervous system involvement. A recent collaborative study from three European referral centers, defined that cardiac involvement, advanced Mayo disease stage, neuropathic, and liver involvement were independent factors that had impact on survival in IgM-AL amyloidosis patients. Once the diagnosis of amyloidosis is made, correct amyloid typing is necessary to design appropriate therapy and follow-up. Treatment is focused on the suppression of the clone, and fast reduction of the circulating free light chains. New drugs targeting the amyloid deposits will be used in combination with anti-clone therapies. Copyright © 2016. Published by Elsevier Ltd.

Kainate receptors coming of age: milestones of two decades of research

PubMed Central

Contractor, Anis; Mulle, Christophe; Swanson, Geoffrey T

2011-01-01

Two decades have passed since the first report of the cloning of a kainate receptor (KAR) subunit. The intervening years have seen a rapid growth in our understanding of the biophysical properties and function of kainate receptors in the brain. This research has led to an appreciation that kainate receptors play quite distinct roles at synapses relative to other members of the glutamate-gated ion channel receptor family, despite structural and functional commonalities. The surprisingly diverse and complex nature of KAR signaling underlies their unique impact on neuronal networks through their direct and indirect effects on synaptic transmission, and their prominent role in regulating cellular excitability. This review pieces together highlights from the two decades of research subsequent to the cloning of the first subunit, and provides an overview of our current understanding of the role of KARs in the CNS and their potential importance to neurological and neuropsychiatric disorders. PMID:21256604

Human Neoplasms Elicit Multiple Specific Immune Responses in the Autologous Host

NASA Astrophysics Data System (ADS)

Sahin, Ugur; Tureci, Ozlem; Schmitt, Holger; Cochlovius, Bjorn; Johannes, Thomas; Schmits, Rudolf; Stenner, Frank; Luo, Guorong; Schobert, Ingrid; Pfreundschuh, Michael

1995-12-01

Expression of cDNA libraries from human melanoma, renal cancer, astrocytoma, and Hodgkin disease in Escherichia coli and screening for clones reactive with high-titer IgG antibodies in autologous patient serum lead to the discovery of at least four antigens with a restricted expression pattern in each tumor. Besides antigens known to elicit T-cell responses, such as MAGE-1 and tyrosinase, numerous additional antigens that were overexpressed or specifically expressed in tumors of the same type were identified. Sequence analyses suggest that many of these molecules, besides being the target of a specific immune response, might be of relevance for tumor growth. Antibodies to a given antigen were usually confined to patients with the same tumor type. The unexpected frequency of human tumor antigens, which can be readily defined at the molecular level by the serological analysis of autologous tumor cDNA expression cloning, indicates that human neoplasms elicit multiple specific immune responses in the autologous host and provides diagnostic and therapeutic approaches to human cancer.

A complex regulatory network coordinating cell cycles during C. elegans development is revealed by a genome-wide RNAi screen.

PubMed

Roy, Sarah H; Tobin, David V; Memar, Nadin; Beltz, Eleanor; Holmen, Jenna; Clayton, Joseph E; Chiu, Daniel J; Young, Laura D; Green, Travis H; Lubin, Isabella; Liu, Yuying; Conradt, Barbara; Saito, R Mako

2014-02-28

The development and homeostasis of multicellular animals requires precise coordination of cell division and differentiation. We performed a genome-wide RNA interference screen in Caenorhabditis elegans to reveal the components of a regulatory network that promotes developmentally programmed cell-cycle quiescence. The 107 identified genes are predicted to constitute regulatory networks that are conserved among higher animals because almost half of the genes are represented by clear human orthologs. Using a series of mutant backgrounds to assess their genetic activities, the RNA interference clones displaying similar properties were clustered to establish potential regulatory relationships within the network. This approach uncovered four distinct genetic pathways controlling cell-cycle entry during intestinal organogenesis. The enhanced phenotypes observed for animals carrying compound mutations attest to the collaboration between distinct mechanisms to ensure strict developmental regulation of cell cycles. Moreover, we characterized ubc-25, a gene encoding an E2 ubiquitin-conjugating enzyme whose human ortholog, UBE2Q2, is deregulated in several cancers. Our genetic analyses suggested that ubc-25 acts in a linear pathway with cul-1/Cul1, in parallel to pathways employing cki-1/p27 and lin-35/pRb to promote cell-cycle quiescence. Further investigation of the potential regulatory mechanism demonstrated that ubc-25 activity negatively regulates CYE-1/cyclin E protein abundance in vivo. Together, our results show that the ubc-25-mediated pathway acts within a complex network that integrates the actions of multiple molecular mechanisms to control cell cycles during development. Copyright © 2014 Roy et al.

Presence of Classical Enterotoxin Genes, agr Typing, Antimicrobial Resistance, and Genetic Diversity of Staphylococcus aureus from Milk of Cows with Mastitis in Southern Brazil.

PubMed

Kroning, Isabela S; Iglesias, Mariana A; Mendonça, Karla S; Lopes, Graciela V; Silva, Wladimir P

2018-05-01

Staphylococcus aureus is a common causative agent of bovine mastitis in dairy cows and commonly associated with foodborne disease outbreaks. The aim of this study was to evaluate the presence of enterotoxin genes, agr typing, antimicrobial resistance, and genetic diversity of S. aureus isolated from milk of cows with mastitis in dairy farms from southern Brazil. Results showed that 7 (22.6%) of 31 S. aureus isolates were positive for enterotoxin genes. Specifically, the genes encoding for enterotoxins A ( n = 4), C ( n = 2), and B ( n = 1) were detected. Isolates belonging to the agr group III (10 of 31, 32.2%) and agr group I (7 of 31, 22.5%) were the most common. To our knowledge, this is the first report of both agr I and III in the same S. aureus isolate from milk of cows with bovine mastitis. The antimicrobial resistance test showed that 54% of the isolates were multiresistant to antimicrobial agents. The macrorestriction analysis produced 16 different major SmaI pulsed-field gel electrophoresis patterns, with up to two subpatterns. Moreover, the presence of some S. aureus clones in a distinct area was observed. Although this study characterized a limited number of S. aureus isolates, the presence of classical enterotoxin genes and resistance to multiple antimicrobial agents reinforces the importance of this microorganism to animal and human health. In addition, similar genetic profiles have been identified in distinct geographic areas, suggesting clonal dissemination of S. aureus in dairy herds from southern Brazil.

Variability and repertoire size of T-cell receptor V alpha gene segments.

PubMed

Becker, D M; Pattern, P; Chien, Y; Yokota, T; Eshhar, Z; Giedlin, M; Gascoigne, N R; Goodnow, C; Wolf, R; Arai, K

The immune system of higher organisms is composed largely of two distinct cell types, B lymphocytes and T lymphocytes, each of which is independently capable of recognizing an enormous number of distinct entities through their antigen receptors; surface immunoglobulin in the case of the former, and the T-cell receptor (TCR) in the case of the latter. In both cell types, the genes encoding the antigen receptors consist of multiple gene segments which recombine during maturation to produce many possible peptides. One striking difference between B- and T-cell recognition that has not yet been resolved by the structural data is the fact that T cells generally require a major histocompatibility determinant together with an antigen whereas, in most cases, antibodies recognize antigen alone. Recently, we and others have found that a series of TCR V beta gene sequences show conservation of many of the same residues that are conserved between heavy- and light-chain immunoglobulin V regions, and these V beta sequences are predicted to have an immunoglobulin-like secondary structure. To extend these studies, we have isolated and sequenced eight additional alpha-chain complementary cDNA clones and compared them with published sequences. Analyses of these sequences, reported here, indicate that V alpha regions have many of the characteristics of V beta gene segments but differ in that they almost always occur as cross-hybridizing gene families. We conclude that there may be very different selective pressures operating on V alpha and V beta sequences and that the V alpha repertoire may be considerably larger than that of V beta.

Complete Amino Acid Sequence of a Copper/Zinc-Superoxide Dismutase from Ginger Rhizome.

PubMed

Nishiyama, Yuki; Fukamizo, Tamo; Yoneda, Kazunari; Araki, Tomohiro

2017-04-01

Superoxide dismutase (SOD) is an antioxidant enzyme protecting cells from oxidative stress. Ginger (Zingiber officinale) is known for its antioxidant properties, however, there are no data on SODs from ginger rhizomes. In this study, we purified SOD from the rhizome of Z. officinale (Zo-SOD) and determined its complete amino acid sequence using N terminal sequencing, amino acid analysis, and de novo sequencing by tandem mass spectrometry. Zo-SOD consists of 151 amino acids with two signature Cu/Zn-SOD motifs and has high similarity to other plant Cu/Zn-SODs. Multiple sequence alignment showed that Cu/Zn-binding residues and cysteines forming a disulfide bond, which are highly conserved in Cu/Zn-SODs, are also present in Zo-SOD. Phylogenetic analysis revealed that plant Cu/Zn-SODs clustered into distinct chloroplastic, cytoplasmic, and intermediate groups. Among them, only chloroplastic enzymes carried amino acid substitutions in the region functionally important for enzymatic activity, suggesting that chloroplastic SODs may have a function distinct from those of SODs localized in other subcellular compartments. The nucleotide sequence of the Zo-SOD coding region was obtained by reverse-translation, and the gene was synthesized, cloned, and expressed. The recombinant Zo-SOD demonstrated pH stability in the range of 5-10, which is similar to other reported Cu/Zn-SODs, and thermal stability in the range of 10-60 °C, which is higher than that for most plant Cu/Zn-SODs but lower compared to the enzyme from a Z. officinale relative Curcuma aromatica.

Coexistence of two different mutations in codon 12 of the Kras gene in colorectal cancer: Report of a case supporting the concept of tumoral heterogeneity.

PubMed

Improta, Giuseppina; Zupa, Angela; Possidente, Luciana; Tartarone, Alfredo; Pedicini, Piernicola; Nappi, Antonio; Molinari, Sergio; Fraggetta, Filippo; Vita, Giulia

2013-05-01

Evaluation of the mutational status of KRAS is a crucial step for the correct therapeutic approach in treating advanced colorectal cancer as the identification of wild-type KRAS tumors leads to more specific and less toxic treatments for patients. Although several studies have highlighted the differences between primary and metastatic tumors, the possibility of two or more mutations in the same codon has seldom been reported. The present study reports an additional case of an advanced adenocarcinoma of the colon showing two somatic mutations (p.G12D and p.G12V) in the same codon (codon 12) of exon 2 of the KRAS gene, thus supporting the possibility of two differing clonal origins of the tumor. Although the clinical significance of multiple mutations remains unknown at present, based on the limited data available in the literature, this rare event appears to be associated with a more aggressive disease, as in the present case. This case report demonstrates the existence of intratumoral heterogeneity and the coexistence of distinct clones within a tumor that may have profound clinical implications for disease progression and therapeutic responses.

Immune networks: multi-tasking capabilities at medium load

NASA Astrophysics Data System (ADS)

Agliari, E.; Annibale, A.; Barra, A.; Coolen, A. C. C.; Tantari, D.

2013-08-01

Associative network models featuring multi-tasking properties have been introduced recently and studied in the low-load regime, where the number P of simultaneously retrievable patterns scales with the number N of nodes as P ˜ log N. In addition to their relevance in artificial intelligence, these models are increasingly important in immunology, where stored patterns represent strategies to fight pathogens and nodes represent lymphocyte clones. They allow us to understand the crucial ability of the immune system to respond simultaneously to multiple distinct antigen invasions. Here we develop further the statistical mechanical analysis of such systems, by studying the medium-load regime, P ˜ Nδ with δ ∈ (0, 1]. We derive three main results. First, we reveal the nontrivial architecture of these networks: they exhibit a high degree of modularity and clustering, which is linked to their retrieval abilities. Second, by solving the model we demonstrate for δ < 1 the existence of large regions in the phase diagram where the network can retrieve all stored patterns simultaneously. Finally, in the high-load regime δ = 1 we find that the system behaves as a spin-glass, suggesting that finite-connectivity frameworks are required to achieve effective retrieval.

Independent losses of function in a polyphenol oxidase in rice: differentiation in grain discoloration between subspecies and the role of positive selection under domestication.

PubMed

Yu, Yanchun; Tang, Tian; Qian, Qian; Wang, Yonghong; Yan, Meixian; Zeng, Dali; Han, Bin; Wu, Chung-I; Shi, Suhua; Li, Jiayang

2008-11-01

Asian rice (Oryza sativa) cultivars originated from wild rice and can be divided into two subspecies by several criteria, one of which is the phenol reaction (PHR) phenotype. Grains of indica cultivars turn brown in a phenol solution that accelerates a similar process that occurs during prolonged storage. By contrast, the grains of japonica do not discolor. This distinction may reflect the divergent domestication of these two subspecies. The PHR is controlled by a single gene, Phr1; here, we report the cloning of Phr1, which encodes a polyphenol oxidase. The Phr1 gene is indeed responsible for the PHR phenotype, as transformation with a functional Phr1 can complement a PHR negative cultivar. Phr1 is defective in all japonica lines but functional in nearly all indica and wild strains. Phylogenetic analysis showed that the defects in Phr1 arose independently three times. The multiple recent origins and rapid spread of phr1 in japonica suggest the action of positive selection, which is further supported by several population genetic tests. This case may hence represent an example of artificial selection driving the differentiation among domesticated varieties.

A Ferredoxin Disulfide Reductase Delivers Electrons to the Methanosarcina barkeri Class III Ribonucleotide Reductase

DOE PAGES

Wei, Yifeng; Li, Bin; Prakash, Divya; ...

2015-11-04

Two subtypes of class III anaerobic ribonucleotide reductases (RNRs) studied so far couple the reduction of ribonucleotides to the oxidation of formate, or the oxidation of NADPH via thioredoxin and thioredoxin reductase. Certain methanogenic archaea contain a phylogenetically distinct third subtype of class III RNR, with distinct active-site residues. Here we report the cloning and recombinant expression of the Methanosarcina barkeri class III RNR and show that the electrons required for ribonucleotide reduction can be delivered by a [4Fe-4S] protein ferredoxin disulfide reductase, and a conserved thioredoxin-like protein NrdH present in the RNR operon. The diversity of class III RNRsmore » reflects the diversity of electron carriers used in anaerobic metabolism« less

Archaea Dominate the Ammonia-Oxidizing Community in Deep-Sea Sediments of the Eastern Indian Ocean—from the Equator to the Bay of Bengal

PubMed Central

Wang, Jing; Kan, Jinjun; Zhang, Xiaodong; Xia, Zhiqiang; Zhang, Xuecheng; Qian, Gang; Miao, Yanyi; Leng, Xiaoyun; Sun, Jun

2017-01-01

Ammonia-oxidizing Archaea (AOA) and ammonia-oxidizing Bacteria (AOB) oxidize ammonia to nitrite, and therefore play essential roles in nitrification and global nitrogen cycling. To better understand the population structure and the distribution of AOA and AOB in the deep Eastern Indian Ocean (EIO), nine surface sediment samples (>3,300 m depth) were collected during the inter-monsoon Spring 2013. One sediment sample from the South China Sea (SCS; 2,510 m) was also included for comparison. The community composition, species richness, and diversity were characterized by clone libraries (total 1,238 clones), and higher diversity of archaeal amoA genes than bacterial amoA genes was observed in all analyzed samples. Real time qPCR analysis also demonstrated higher abundances (gene copy numbers) of archaeal amoA genes than bacterial amoA genes, and the ratios of AOA/AOB ranged from 1.42 to 8.49 among sites. In addition, unique and distinct clades were found in both reconstructed AOA and AOB phylogeny, suggesting the presence of niche-specific ammonia-oxidizing microorganisms in the EIO. The distribution pattern of both archaeal and bacterial amoA genes revealed by NMDS (non-metric multidimensional scaling) showed a distinct geographic separation of the sample from the SCS and most of the samples from the EIO following nitrogen gradients. Higher abundance and diversity of archaeal amoA genes indicated that AOA may play a more important role than AOB in the deep Indian Ocean. Environmental parameters shaping the distribution pattern of AOA were different from that of AOB, indicating distinct metabolic characteristics and/or adaptation mechanisms between AOA and AOB in the EIO, especially in deep-sea environments. PMID:28360898

Population genetics of Vibrio vulnificus: identification of two divisions and a distinct eel-pathogenic clone.

PubMed

Gutacker, Michaela; Conza, Nadine; Benagli, Cinzia; Pedroli, Ambra; Bernasconi, Marco Valerio; Permin, Lise; Aznar, Rosa; Piffaretti, Jean-Claude

2003-06-01

Genetic relationships among 62 Vibrio vulnificus strains of different geographical and host origins were analyzed by multilocus enzyme electrophoresis (MLEE), random amplification of polymorphic DNA (RAPD), and sequence analyses of the recA and glnA genes. Out of 15 genetic loci analyzed by MLEE, 11 were polymorphic. Cluster analysis identified 43 distinct electrophoretic types (ETs) separating the V. vulnificus population into two divisions (divisions I and II). One ET (ET 35) included all indole-negative isolates from diseased eels worldwide (biotype 2). A second ET (ET 2) marked all of the strains from Israel isolated from patients who handled St. Peter's fish (biotype 3). RAPD analysis of the 62 V. vulnificus isolates identified 26 different profiles separated into two divisions as well. In general, this subdivision was comparable (but not identical) to that observed by MLEE. Phylogenetic analysis of 543 bp of the recA gene and of 402 bp of the glnA gene also separated the V. vulnificus population into two major divisions in a manner similar to that by MLEE and RAPD. Sequence data again indicated the overall subdivision of the V. vulnificus population into different biotypes. In particular, indole-negative eel-pathogenic isolates (biotype 2) on one hand and the Israeli isolates (biotype 3) on the other tended to cluster together in both gene trees. None of the methods showed an association between distinct clones and human clinical manifestations. Furthermore, except for the Israeli strains, only minor clusters comprising geographically related isolates were observed. In conclusion, all three approaches (MLEE, RAPD, and DNA sequencing) generated comparable but not always equivalent results. The significance of the two divisions (divisions I and II) still remains to be clarified, and a reevaluation of the definition of the biotypes is also needed.

Two distinct major QTL for resistance to fire blight co-localize on linkage group 12 in apple genotypes 'Evereste' and Malus floribunda clone 821.

PubMed

Durel, C-E; Denancé, C; Brisset, M-N

2009-02-01

Fire blight, caused by the bacterium Erwinia amylovora, is one of the most destructive diseases of apple (Malus xdomestica) worldwide. No major, qualitative gene for resistance to this disease has been identified so far in apple. A quantitative trait locus (QTL) analysis was performed in two F1 progenies derived from two controled crosses: one between the susceptible rootstock cultivar 'MM106' and the resistant ornamental cultivar 'Evereste' and the other one between the moderately susceptible cultivar 'Golden Delicious' and the wild apple Malus floribunda clone 821, with unknown level of fire blight resistance. Both progenies were inoculated in the greenhouse with the same reference strain of E. amylovora. The length of stem necrosis was scored 7 and 14 days after inoculation. A strong QTL effect was identified in both 'Evereste' and M. floribunda 821 at a similar position on the distal region of linkage group 12 of the apple genome. From 50% to 70% of the phenotypic variation was explained by the QTL in 'Evereste' progeny according to the scored trait. More than 40% of the phenotypic variation was explained by the M. floribunda QTL in the second progeny. It was shown that 'Evereste' and M. floribunda 821 carried distinct QTL alleles at that genomic position. A small additional QTL was identified in 'Evereste' on linkage group 15, which explained about 6% of the phenotypic variation. Although it was not possible to confirm whether or not 'Evereste' and M. floribunda QTL belonged to the same locus or two distinct closely related loci, these QTL can be valuable targets in marker-assisted selection to obtain fire blight resistant apple cultivars and form a starting point for discovering the function of the genes controlling apple fire blight resistance.

A method for release and multiple strand amplification of small quantities of DNA from endospores of the fastidious bacterium Pasteuria penetrans.

PubMed

Mauchline, T H; Mohan, S; Davies, K G; Schaff, J E; Opperman, C H; Kerry, B R; Hirsch, P R

2010-05-01

To establish a reliable protocol to extract DNA from Pasteuria penetrans endospores for use as template in multiple strand amplification, thus providing sufficient material for genetic analyses. To develop a highly sensitive PCR-based diagnostic tool for P. penetrans. An optimized method to decontaminate endospores, release and purify DNA enabled multiple strand amplification. DNA purity was assessed by cloning and sequencing gyrB and 16S rRNA gene fragments obtained from PCR using generic primers. Samples indicated to be 100%P. penetrans by the gyrB assay were estimated at 46% using the 16S rRNA gene. No bias was detected on cloning and sequencing 12 housekeeping and sporulation gene fragments from amplified DNA. The detection limit by PCR with Pasteuria-specific 16S rRNA gene primers following multiple strand amplification of DNA extracted using the method was a single endospore. Generation of large quantities DNA will facilitate genomic sequencing of P. penetrans. Apparent differences in sample purity are explained by variations in 16S rRNA gene copy number in Eubacteria leading to exaggerated estimations of sample contamination. Detection of single endospores will facilitate investigations of P. penetrans molecular ecology. These methods will advance studies on P. penetrans and facilitate research on other obligate and fastidious micro-organisms where it is currently impractical to obtain DNA in sufficient quantity and quality.

Development of the Distinct Multiple Intelligences in Primary Students through Interest Centers

ERIC Educational Resources Information Center

Dueñas Macías, Fredy Alonso

2013-01-01

This article reports on an action research study that focused on developing the distinct multiple intelligences of an English class of fifth graders through interest centers at a Colombian school. A multiple intelligences questionnaire, an open-ended observation form, and a student mini-report sheet were used to collect data. Findings revealed…

Different Vaccine Vectors Delivering the Same Antigen Elicit CD8plus T Cell Responses with Distinct Clonotype and Epitope Specificity

DOE Office of Scientific and Technical Information (OSTI.GOV)

M Honda; R Wang; W Kong

Prime-boost immunization with gene-based vectors has been developed to generate more effective vaccines for AIDS, malaria, and tuberculosis. Although these vectors elicit potent T cell responses, the mechanisms by which they stimulate immunity are not well understood. In this study, we show that immunization by a single gene product, HIV-1 envelope, with alternative vector combinations elicits CD8{sup +} cells with different fine specificities and kinetics of mobilization. Vaccine-induced CD8{sup +} T cells recognized overlapping third V region loop peptides. Unexpectedly, two anchor variants bound H-2D{sup d} better than the native sequences, and clones with distinct specificities were elicited by alternativemore » vectors. X-ray crystallography revealed major differences in solvent exposure of MHC-bound peptide epitopes, suggesting that processed HIV-1 envelope gave rise to MHC-I/peptide conformations recognized by distinct CD8{sup +} T cell populations. These findings suggest that different gene-based vectors generate peptides with alternative conformations within MHC-I that elicit distinct T cell responses after vaccination.« less

Different Vaccine Vectors Delivering the Same Antigen Elicit CD8+ T Cell Responses with Distinct Clonotype and Epitope Specificity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Honda, M.; Robinson, H.; Wang, R.

Prime-boost immunization with gene-based vectors has been developed to generate more effective vaccines for AIDS, malaria, and tuberculosis. Although these vectors elicit potent T cell responses, the mechanisms by which they stimulate immunity are not well understood. In this study, we show that immunization by a single gene product, HIV-1 envelope, with alternative vector combinations elicits CD8{sup +} cells with different fine specificities and kinetics of mobilization. Vaccine-induced CD8{sup +} T cells recognized overlapping third V region loop peptides. Unexpectedly, two anchor variants bound H-2D{sup d} better than the native sequences, and clones with distinct specificities were elicited by alternativemore » vectors. X-ray crystallography revealed major differences in solvent exposure of MHC-bound peptide epitopes, suggesting that processed HIV-1 envelope gave rise to MHC-I/peptide conformations recognized by distinct CD8{sup +} T cell populations. These findings suggest that different gene-based vectors generate peptides with alternative conformations within MHC-I that elicit distinct T cell responses after vaccination.« less

Inheritance of graft compatibility in Douglas fir.

Treesearch

D.L. Copes

1973-01-01

Graft compatibility of genetically related and unrelated rootstock-scion combinations was compared. Scion clones were 75% compatible when grafted on half-related rootstocks but only 56% compatible when grafted on unrelated rootstocks. Most variance associated with graft incompatibility in Douglas-fir appears to be caused by multiple genes.

Importance of Neutralizing Monoclonal Antibodies Targeting Multiple Antigenic Sites on the Middle East Respiratory Syndrome Coronavirus Spike Glycoprotein To Avoid Neutralization Escape

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Lingshu; Shi, Wei; Chappell, James D.

ABSTRACT Middle East respiratory syndrome coronavirus (MERS-CoV) causes a highly lethal pulmonary infection with ~35% mortality. The potential for a future pandemic originating from animal reservoirs or health care-associated events is a major public health concern. There are no vaccines or therapeutic agents currently available for MERS-CoV. Using a probe-based single B cell cloning strategy, we have identified and characterized multiple neutralizing monoclonal antibodies (MAbs) specifically binding to the receptor-binding domain (RBD) or S1 (non-RBD) regions from a convalescent MERS-CoV-infected patient and from immunized rhesus macaques. RBD-specific MAbs tended to have greater neutralizing potency than non-RBD S1-specific MAbs. Six RBD-specificmore » and five S1-specific MAbs could be sorted into four RBD and three non-RBD distinct binding patterns, based on competition assays, mapping neutralization escape variants, and structural analysis. We determined cocrystal structures for two MAbs targeting the RBD from different angles and show they can bind the RBD only in the “out” position. We then showed that selected RBD-specific, non-RBD S1-specific, and S2-specific MAbs given prophylactically prevented MERS-CoV replication in lungs and protected mice from lethal challenge. Importantly, combining RBD- and non-RBD MAbs delayed the emergence of escape mutations in a cell-based virus escape assay. These studies identify MAbs targeting different antigenic sites on S that will be useful for defining mechanisms of MERS-CoV neutralization and for developing more effective interventions to prevent or treat MERS-CoV infections. IMPORTANCEMERS-CoV causes a highly lethal respiratory infection for which no vaccines or antiviral therapeutic options are currently available. Based on continuing exposure from established reservoirs in dromedary camels and bats, transmission of MERS-CoV into humans and future outbreaks are expected. Using structurally defined probes for the MERS-CoV spike glycoprotein (S), the target for neutralizing antibodies, single B cells were sorted from a convalescent human and immunized nonhuman primates (NHPs). MAbs produced from paired immunoglobulin gene sequences were mapped to multiple epitopes within and outside the receptor-binding domain (RBD) and protected against lethal MERS infection in a murine model following passive immunization. Importantly, combining MAbs targeting distinct epitopes prevented viral neutralization escape from RBD-directed MAbs. These data suggest that antibody responses to multiple domains on CoV spike protein may improve immunity and will guide future vaccine and therapeutic development efforts.« less

The TiPS/TINS lecture: the molecular biology of mammalian glutamate receptor channels.

PubMed

Seeburg, P H

1993-08-01

In native brain membranes the principal excitatory neurotransmitter L-glutamate activates cation-conducting channels with distinct biophysical and pharmacological properties. Molecular cloning has revealed the existence of 16 channel subunits that can assemble in homomeric or heteromeric configurations in vitro to form receptor channels with disparate functional properties. This review describes the different channel types obtained by recombinant means and the genetic mechanisms controlling the expression of functionally important channel structures.

The TINS/TiPS Lecture. The molecular biology of mammalian glutamate receptor channels.

PubMed

Seeburg, P H

1993-09-01

In native brain membranes the principal excitatory neurotransmitter L-glutamate activates cation-conducting channels with distinct biophysical and pharmacological properties. Molecular cloning has revealed the existence of 16 channel subunits that can assemble in homomeric or heteromeric configurations in vitro to form receptor channels with disparate functional properties. This review describes the different channel types obtained by recombinant means and the genetic mechanisms controlling the expression of functionally important channel structures.

Detection of mosaicism for the polymorphic variants in the 5'-UTR of hOGG1 by cloning and sequence analysis and pyrosequencing.

PubMed

Cao, Lili; Li, Tianfeng; Zhu, Yanbei; Zhou, Wei; Guo, Wenwen; Cai, Zhenming; Xie, Yuan; He, Xuan; Li, Xinxiu; Zhu, Dalong; Wang, Yaping

2013-04-01

Mosaicism refers to the presence of genetically distinct cell lines within an organism or a tissue. Somatic mosaicism exists in distinct populations of somatic cells and commonly arises as a result of somatic mutations, mainly in early embryonic development. SNPs are important markers that distinguish between different individuals in heterogeneous biological samples and contribute greatly to disease risk association studies. In this work, we investigated the relationship between the functional variants in the 5'-UTR of the hOGG1 gene and the risk of type 2 diabetes. Upon detection of the polymorphisms c.-53G>C, c.-23A>G, and c.-18G>T in the hOGG1 gene, we found that mosaicism was present in 3/28 (10.71%), 7/51 (13.73%), and 1/44 (2.27%) patients respectively, who were carriers of these single nucleotide variations, by cloning and sequence analysis and pyrosequencing. Statistical analysis showed that the frequency of the variation c.-23A>G in the hOGG1 5'-UTR in type 2 diabetic patients was significantly higher than that in healthy controls. However, sequencing of the mutant alleles in mosaic individuals showed weak peaks that may affect detection of the SNPs and impair association-based investigations. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Repression of hTERT transcription by the introduction of chromosome 3 into human oral squamous cell carcinoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nishio, Sachiyo; Department of Biomedical Science, Institute of Regenerative Medicine and Biofunction, Graduate School of Medical Science, Tottori University, Yonago, Tottori, 683-8503; Ohira, Takahito

Telomerase is a ribonucleoprotein enzyme that maintains telomere length. Telomerase activity is primarily attributed to the expression of telomerase reverse transcriptase (TERT). It has been reported that introduction of an intact human chromosome 3 into the human oral squamous cell carcinoma cell line HSC3 suppresses the tumorigenicity of these cells. However, the mechanisms that regulate tumorigenicity have not been elucidated. To determine whether this reduction in tumorigenicity was accompanied by a reduction in telomerase activity, we investigated the transcriptional activation of TERT in HSC3 microcell hybrid clones with an introduced human chromosome 3 (HSC3#3). HSC#3 cells showed inhibition of hTERT transcriptionmore » compared to that of the parental HSC3 cells. Furthermore, cell fusion experiments showed that hybrids of HSC3 cells and cells of the RCC23 renal carcinoma cell line, which also exhibits suppression of TERT transcription by the introduction of human chromosome 3, also displayed suppressed TERT transcription. These results suggested that human chromosome 3 may carry functionally distinct, additional TERT repressor genes. - Highlights: • hTERT mRNA expression level decreased in the chromosome 3 introduced HSC3 clones. • hTERT mRNA expression level was tend to suppressed in HSC3 and RCC23 hybrid cells. • We provide evidence that human chromosome 3 carries at least two distinct hTERT regulatory factors.« less

Stem Cell Physics. Multiple-Laser-Beam Treatment of Parkinson's Disease

NASA Astrophysics Data System (ADS)

Stefan, V.

2013-03-01

A novel method for the treatment of Parkinson's disease is proposed. Pluripotent stem cells are laser cultured, using ultrashort wavelength, (around 0.1 micron-ultraviolet radiation-with intensities of a few mW/cm2) , multiple laser beams.[2] The multiple-energy laser photons[3] interact with the neuron DNA molecules to be cloned. The laser created dopaminergic substantia nigra neurons can be, (theoretically), laser transplanted, (a higher focusing precision as compared to a syringe method), into the striatum or substantia nigra regions of the brain, or both. Supported by Nikola Tesla Labs, Stefan University.

Origin and evolution of European community-acquired methicillin-resistant Staphylococcus aureus.

PubMed

Stegger, Marc; Wirth, Thierry; Andersen, Paal S; Skov, Robert L; De Grassi, Anna; Simões, Patricia Martins; Tristan, Anne; Petersen, Andreas; Aziz, Maliha; Kiil, Kristoffer; Cirković, Ivana; Udo, Edet E; del Campo, Rosa; Vuopio-Varkila, Jaana; Ahmad, Norazah; Tokajian, Sima; Peters, Georg; Schaumburg, Frieder; Olsson-Liljequist, Barbro; Givskov, Michael; Driebe, Elizabeth E; Vigh, Henrik E; Shittu, Adebayo; Ramdani-Bougessa, Nadjia; Rasigade, Jean-Philippe; Price, Lance B; Vandenesch, Francois; Larsen, Anders R; Laurent, Frederic

2014-08-26

Community-acquired methicillin-resistant Staphylococcus aureus (CA-MRSA) was recognized in Europe and worldwide in the late 1990s. Within a decade, several genetically and geographically distinct CA-MRSA lineages carrying the small SCCmec type IV and V genetic elements and the Panton-Valentine leukocidin (PVL) emerged around the world. In Europe, the predominant CA-MRSA strain belongs to clonal complex 80 (CC80) and is resistant to kanamycin/amikacin and fusidic acid. CC80 was first reported in 1993 but was relatively rare until the late 1990s. It has since been identified throughout North Africa, the Middle East, and Europe, with recent sporadic reports in sub-Saharan Africa. While strongly associated with skin and soft tissue infections, it is rarely found among asymptomatic carriers. Methicillin-sensitive S. aureus (MSSA) CC80 strains are extremely rare except in sub-Saharan Africa. In the current study, we applied whole-genome sequencing to a global collection of both MSSA and MRSA CC80 isolates. Phylogenetic analyses strongly suggest that the European epidemic CA-MRSA lineage is derived from a PVL-positive MSSA ancestor from sub-Saharan Africa. Moreover, the tree topology suggests a single acquisition of both the SCCmec element and a plasmid encoding the fusidic acid resistance determinant. Four canonical SNPs distinguish the derived CA-MRSA lineage and include a nonsynonymous mutation in accessory gene regulator C (agrC). These changes were associated with a star-like expansion into Europe, the Middle East, and North Africa in the early 1990s, including multiple cases of cross-continent imports likely driven by human migrations. With increasing levels of CA-MRSA reported from most parts of the Western world, there is a great interest in understanding the origin and factors associated with the emergence of these epidemic lineages. To trace the origin, evolution, and dissemination pattern of the European CA-MRSA clone (CC80), we sequenced a global collection of strains of the S. aureus CC80 lineage. Our study determined that a single descendant of a PVL-positive methicillin-sensitive ancestor circulating in sub-Saharan Africa rose to become the dominant CA-MRSA clone in Europe, the Middle East, and North Africa. In the transition from a methicillin-susceptible lineage to a successful CA-MRSA clone, it simultaneously became resistant to fusidic acid, a widely used antibiotic for skin and soft tissue infections, thus demonstrating the importance of antibiotic selection in the success of this clone. This finding furthermore highlights the significance of horizontal gene acquisitions and underscores the combined importance of these factors for the success of CA-MRSA. Copyright © 2014 Stegger et al.

ADAMTS13 Autoantibodies Cloned from Patients with Acquired Thrombotic Thrombocytopenic Purpura: 1. Structural and functional characterization in vitro

PubMed Central

Ostertag, Eric M.; Kacir, Stephen; Thiboutot, Michelle; Gulendran, Gayathri; Zheng, X. Long; Cines, Douglas B.; Siegel, Don L.

2016-01-01

BACKGROUND Acquired thrombotic thrombocytopenia purpura (TTP) is a life-threatening illness caused by autoantibodies that decrease the activity of ADAMTS13, the von Willebrand Factor cleaving protease. Despite efficacy of plasma exchange, mortality remains high and relapse is common. Improved therapies may come from understanding the diversity of pathogenic autoantibodies on a molecular/genetic level. Cloning comprehensive repertoires of patient autoantibodies can provide the necessary tools for studying immunobiology of disease and developing animal models. STUDY DESIGN AND METHODS Anti-ADAMTS13 antibodies were cloned from four patients with acquired TTP using phage display and characterized with respect to genetic origin, inhibition of ADAMTS13 proteolytic activity, and epitope specificity. Anti-idiotypic antisera raised to a subset of autoantibodies enabled comparison of their relatedness to each other and to polyclonal IgG in patient plasma. RESULTS Fifty-one unique antibodies were isolated comprising epitope specificities resembling the diversity found in circulating patient IgG. Antibodies directed to both the amino terminal domains and those requiring the ADAMTS13 cysteine-rich/spacer region for binding inhibited proteolytic activity, while those solely targeting carboxy-terminal domains were non-inhibitory. Anti-idiotypic antisera raised to a subset of antibody clones crossreacted with and reduced the inhibitory activity of polyclonal IgG from a set of unrelated patients. CONCLUSIONS Anti-ADAMTS13 autoantibodies isolated by repertoire cloning display the diversity of epitope specificities found in patient plasma and provide tools for developing animal models of acquired TTP. Shared idiotypes of inhibitory clones with circulating IgG from multiple patients suggest common features of pathogenic autoantibodies that could be exploited for developing more targeted therapies. PMID:27040144

Capturing diversity of marine heterotrophic protists: one cell at a time

PubMed Central

Heywood, Jane L; Sieracki, Michael E; Bellows, Wendy; Poulton, Nicole J; Stepanauskas, Ramunas

2011-01-01

Recent applications of culture-independent, molecular methods have revealed unexpectedly high diversity in a variety of functional and phylogenetic groups of microorganisms in the ocean. However, none of the existing research tools are free from significant limitations, such as PCR and cloning biases, low phylogenetic resolution and others. Here, we employed novel, single-cell sequencing techniques to assess the composition of small (<10 μm diameter), heterotrophic protists from the Gulf of Maine. Single cells were isolated by flow cytometry, their genomes amplified, and 18S rRNA marker genes were amplified and sequenced. We compared the results to traditional environmental PCR cloning of sorted cells. The diversity of heterotrophic protists was significantly higher in the library of single amplified genomes (SAGs) than in environmental PCR clone libraries of the 18S rRNA gene, obtained from the same coastal sample. Libraries of SAGs, but not clones contained several recently discovered, uncultured groups, including picobiliphytes and novel marine stramenopiles. Clone, but not SAG, libraries contained several large clusters of identical and nearly identical sequences of Dinophyceae, Cercozoa and Stramenopiles. Similar results were obtained using two alternative primer sets, suggesting that PCR biases may not be the only explanation for the observed patterns. Instead, differences in the number of 18S rRNA gene copies among the various protist taxa probably had a significant role in determining the PCR clone composition. These results show that single-cell sequencing has the potential to more accurately assess protistan community composition than previously established methods. In addition, the creation of SAG libraries opens opportunities for the analysis of multiple genes or entire genomes of the uncultured protist groups. PMID:20962875

Fluoroquinolone-Resistant Enteric Bacteria in Sub-Saharan Africa: Clones, Implications and Research Needs

PubMed Central

Chattaway, Marie A.; Aboderin, Aaron O.; Fashae, Kayode; Okoro, Chinyere K.; Opintan, Japheth A.; Okeke, Iruka N.

2016-01-01

Fluoroquinolones came into widespread use in African countries in the early 2000s, after patents for the first generation of these drugs expired. By that time, quinolone antibacterial agents had been used intensively worldwide and resistant lineages of many bacterial species had evolved. We sought to understand which Gram negative enteric pandemic lineages have been reported from Africa, as well as the nature and transmission of any indigenous resistant clones. A systematic review of articles indexed in the Medline and AJOL literature databases was conducted. We report on the findings of 43 eligible studies documenting local or pandemic fluoroquinolone-resistant enteric clones in sub-Sahara African countries. Most reports are of invasive non-typhoidal Salmonella and Escherichia coli lineages and there have been three reports of cholera outbreaks caused by fluoroquinolone-resistant Vibrio cholerae O1. Fluoroquinolone-resistant clones have also been reported from commensals and animal isolates but there are few data for non-Enterobacteriaceae and almost none for difficult-to-culture Campylobacter spp. Fluoroquinolone-resistant lineages identified in African countries were universally resistant to multiple other classes of antibacterial agents. Although as many as 972 non-duplicate articles refer to fluoroquinolone resistance in enteric bacteria from Africa, most do not report on subtypes and therefore information on the epidemiology of fluoroquinolone-resistant clones is available from only a handful of countries in the subcontinent. When resistance is reported, resistance mechanisms and lineage information is rarely investigated. Insufficient attention has been given to molecular and sequence-based methods necessary for identifying and tracking resistant clones in Africa and more research is needed in this area. PMID:27148238

T-cells from HLA-B*57:01+ human subjects are activated with abacavir through two independent pathways and induce cell death by multiple mechanisms.

PubMed

Bell, Catherine C; Faulkner, Lee; Martinsson, Klara; Farrell, John; Alfirevic, Ana; Tugwood, Jonathan; Pirmohamed, Munir; Naisbitt, Dean J; Park, B Kevin

2013-05-20

Susceptibility to abacavir hypersensitivity has been attributed to possession of the specific human leukocyte antigen allele HLA-B*57:01. HLA-B*57:01-restricted activation of CD8+ T-cells provides a link between the genetic association and the iatrogenic disease. The objectives of this study were to characterize the functionality of drug-responsive CD8+ T-cell clones generated from HLA-B*57:01+ drug-naive subjects and to explore the relationship between abacavir accumulation in antigen presenting cells and the T-cell response. Seventy-four CD8+ clones expressing different Vβ receptors were shown to proliferate and kill target cells via different mechanisms when exposed to abacavir. Certain clones were activated with abacavir in the absence of antigen presenting cells. Analysis of the remaining clones revealed two pathways of drug-dependent T-cell activation. Overnight incubation of antigen presenting cells with abacavir, followed by repeated washing to remove soluble drug, activated approximately 50% of the clones, and the response was blocked by glutaraldehyde fixation. In contrast, a 1 h antigen presenting cell pulse did not activate any of the clones. Accumulation of abacavir in antigen presenting cells was rapid (less than 1 h), and the intracellular concentrations were maintained for 16 h. However, intracellular abacavir was not detectable by mass spectrometry after pulsing. These data suggest that T-cells can be activated by abacavir through a direct interaction with surface and intracellular major histocompatibility complex (MHC) molecules. With the former, abacavir seemingly participates in the MHC T-cell receptor binding interaction. In contrast, the latter pathway likely involves MHC binding peptides displayed as a consequence of abacavir exposure, but not abacavir itself.

Multiple Antibiotic Resistance Plasmids Allow Scalable,
PCR-Mediated DNA Manipulation and Near-Zero Background Cloning

PubMed Central

Arnak, Remigiusz; Altun, Burcin; Tosato, Valentina

2016-01-01

Summary We have constructed two plasmids that can be used for cloning as templates for PCR- -based gene disruption, mutagenesis and the construction of DNA chromosome translocation cassettes. To our knowledge, these plasmids are the first vectors that confer resistance to ampicillin, kanamycin and hygromycin B in bacteria, and to geneticin (G418) and hygromycin B in Saccharomyces cerevisiae simultaneously. The option of simultaneously using up to three resistance markers provides a highly stringent control of recombinant selection and the almost complete elimination of background resistance, while unique restriction sites allow easy cloning of chosen genetic material. Moreover, we successfully used these new vectors as PCR templates for the induction of chromosome translocation in budding yeast by the bridge-induced translocation system. Cells in which translocation was induced carried chromosomal rearrangements as expected and exhibited resistance to both, G418 and hygromycin B. These features make our constructs very handy tools for many molecular biology applications. PMID:27956856

Fetal well-being assessment in bovine near-term gestations: Current knowledge and future perspectives arising from comparative medicine

PubMed Central

Buczinski, Sébastien M.C.; Fecteau, Gilles; Lefebvre, Réjean C.; Smith, Lawrence C.

2007-01-01

Cloning technology is associated with multiple losses throughout pregnancy and in the neonatal period. Any maternal or fetal disease can compromise pregnancy. A paucity of data are available on bovine fetal well-being in late pregnancy; development of well-being assessment methods might augment early diagnosis of abnormal pregnancy or fetal distress, allowing early intervention. This review presents the current knowledge on fetal well-being based on bovine, ovine, equine, and human studies, as well as interesting research parameters that have been studied in other species and not yet investigated in cattle. Transabdominal ultrasonography allows for diagnosis of large placentomes and hydrallantois that frequently accompany clone pregnancies. Fetal inactivity or large hyperechoic particles imaged within the fetal annexes are associated with fetal distress or death, and should be reassessed to confirm compromised pregnancy. Measurements of different fetal parameters (thoracic aorta, metacarpal or metatarsal thickness) could be reliable tools for early detection of the large offspring syndrome commonly found in cloned calves. PMID:17334032

Computational Image Analysis Reveals Intrinsic Multigenerational Differences between Anterior and Posterior Cerebral Cortex Neural Progenitor Cells

PubMed Central

Winter, Mark R.; Liu, Mo; Monteleone, David; Melunis, Justin; Hershberg, Uri; Goderie, Susan K.; Temple, Sally; Cohen, Andrew R.

2015-01-01

Summary Time-lapse microscopy can capture patterns of development through multiple divisions for an entire clone of proliferating cells. Images are taken every few minutes over many days, generating data too vast to process completely by hand. Computational analysis of this data can benefit from occasional human guidance. Here we combine improved automated algorithms with minimized human validation to produce fully corrected segmentation, tracking, and lineaging results with dramatic reduction in effort. A web-based viewer provides access to data and results. The improved approach allows efficient analysis of large numbers of clones. Using this method, we studied populations of progenitor cells derived from the anterior and posterior embryonic mouse cerebral cortex, each growing in a standardized culture environment. Progenitors from the anterior cortex were smaller, less motile, and produced smaller clones compared to those from the posterior cortex, demonstrating cell-intrinsic differences that may contribute to the areal organization of the cerebral cortex. PMID:26344906

Diversity of hydrolases from hydrothermal vent sediments of the Levante Bay, Vulcano Island (Aeolian archipelago) identified by activity-based metagenomics and biochemical characterization of new esterases and an arabinopyranosidase.

PubMed

Placido, Antonio; Hai, Tran; Ferrer, Manuel; Chernikova, Tatyana N; Distaso, Marco; Armstrong, Dale; Yakunin, Alexander F; Toshchakov, Stepan V; Yakimov, Michail M; Kublanov, Ilya V; Golyshina, Olga V; Pesole, Graziano; Ceci, Luigi R; Golyshin, Peter N

2015-12-01

A metagenomic fosmid expression library established from environmental DNA (eDNA) from the shallow hot vent sediment sample collected from the Levante Bay, Vulcano Island (Aeolian archipelago) was established in Escherichia coli. Using activity-based screening assays, we have assessed 9600 fosmid clones corresponding to approximately 350 Mbp of the cloned eDNA, for the lipases/esterases/lactamases, haloalkane and haloacid dehalogenases, and glycoside hydrolases. Thirty-four positive fosmid clones were selected from the total of 120 positive hits and sequenced to yield ca. 1360 kbp of high-quality assemblies. Fosmid inserts were attributed to the members of ten bacterial phyla, including Proteobacteria, Bacteroidetes, Acidobateria, Firmicutes, Verrucomicrobia, Chloroflexi, Spirochaetes, Thermotogae, Armatimonadetes, and Planctomycetes. Of ca. 200 proteins with high biotechnological potential identified therein, we have characterized in detail three distinct α/β-hydrolases (LIPESV12_9, LIPESV12_24, LIPESV12_26) and one new α-arabinopyranosidase (GLV12_5). All LIPESV12 enzymes revealed distinct substrate specificities tested against 43 structurally diverse esters and 4 p-nitrophenol carboxyl esters. Of 16 different glycosides tested, the GLV12_5 hydrolysed only p-nitrophenol-α-(L)-arabinopyranose with a high specific activity of about 2.7 kU/mg protein. Most of the α/β-hydrolases were thermophilic and revealed a high tolerance to, and high activities in the presence of, numerous heavy metal ions. Among them, the LIPESV12_24 was the best temperature-adapted, retaining its activity after 40 min of incubation at 90 °C. Furthermore, enzymes were active in organic solvents (e.g., >30% methanol). Both LIPESV12_24 and LIPESV12_26 had the GXSXG pentapeptides and the catalytic triads Ser-Asp-His typical to the representatives of carboxylesterases of EC 3.1.1.1.

Distinction between wild and cultivated enset (Ensete ventricosum) gene pools in Ethiopia using RAPD markers.

PubMed

Birmeta, Genet; Nybom, Hilde; Bekele, Endashaw

2004-01-01

In southwest Ethiopia, the cultivation area of Ensete ventricosum (enset) overlaps with the natural distribution area of this species. Analyses of genetic diversity were undertaken using RAPD to provide information for conservation strategies as well as evidence of possible gene flow between the different gene pools, which can be of interest for future improvement of cultivated enset. The extent of RAPD variation in wild enset was investigated in 5 populations in the Bonga area (Kefficho administrative region) and 9 cultivated clones. Comparisons were also made with some Musa samples of potential relevance for crop improvement. Nine oligonucleotide primers amplified 72 polymorphic loci. Population differentiation was estimated with the Shannon index (G'(ST)=0.10), Nei's G(ST) (0.12) and AMOVA (Phi(ST)=0.12), and appears to be relatively low when compared with outbreeding, perennial species in general. Cluster analysis (UPGMA) and principal component analysis (PCA) similarly indicated low population differentiation, and also demonstrated that cultivated clones essentially clustered distinctly from wild enset samples, suggesting that the present-day cultivated enset clones have been introduced to domestication from a limited number of wild progenitors. In addition, subsequent gene flow between wild and cultivated enset may have been prohibited by differences between modes of propagation and harvesting time; cultivated enset is propagated vegetatively through sucker production and the plant is generally harvested before maturity or flower set, thereby hindering pollination by wild enset or vice versa. A significant correlation was not found between genetic and geographical distances. The relatively high total RAPD diversity suggests that wild enset populations in the Bonga area harbour genetic variability which could potentially act as a source for useful or rare genes in the improvement of cultivated enset. As expected, E. ventricosum was clearly differentiated from the analysed Musa samples, that clustered in accordance with the present morphology- and molecular marker-based taxonomy of the genus.

Genetic diversity and distribution of a distinct strain of Chili leaf curl virus and associated betasatellite infecting tomato and pepper in Oman.

PubMed

Khan, Akhtar J; Akhtar, Sohail; Al-Zaidi, Amal M; Singh, Achuit K; Briddon, Rob W

2013-10-01

Tomato and pepper are widely grown in Oman for local consumption. A countrywide survey was conducted during 2010-2011 to collect samples and assess the diversity of begomoviruses associated with leaf curl disease of tomato and pepper. A virus previously only identified on the Indian subcontinent, chili leaf curl virus (ChLCV), was found associated with tomato and pepper diseases in all vegetable grown areas of Oman. Some of the infected plant samples were also found to contain a betasatellite. A total of 19 potentially full-length begomovirus and eight betasatellite clones were sequenced. The begomovirus clones showed >96% nucleotide sequence identity, showing them to represent a single species. Comparisons to sequences available in the databases showed the highest levels of nucleotide sequence identity (88.0-91.1%) to isolates of the "Pakistan" strain of ChLCV (ChLCV-PK), indicating the virus from Oman to be a distinct strain, for which the name Oman strain (ChLCV-OM) is proposed. An analysis for recombination showed ChLCV-OM likely to have originated by recombination between ChLCV-PK (the major parent), pepper leaf curl Lahore virus and a third strain of ChLCV. The betasatellite sequences obtained were shown to have high levels of identity to isolates of tomato leaf curl betasatellite (ToLCB) previous shown to be present in Oman. For the disease in tomato Koch's postulates were satisfied by Agrobacterium-mediated inoculation of virus and betasatellites clones. This showed the symptoms induced by the virus in the presence of the betasatellite to be enhanced, although viral DNA levels were not affected. ChLCV-OM is the fourth begomovirus identified in tomato in Oman and the first in Capsicum. The significance of these findings is discussed. Copyright © 2013 Elsevier B.V. All rights reserved.

The Mobilome; A Major Contributor to Escherichia coli stx2-Positive O26:H11 Strains Intra-Serotype Diversity.

PubMed

Delannoy, Sabine; Mariani-Kurkdjian, Patricia; Webb, Hattie E; Bonacorsi, Stephane; Fach, Patrick

2017-01-01

Shiga toxin-producing Escherichia coli of serotype O26:H11/H- constitute a diverse group of strains and several clones with distinct genetic characteristics have been identified and characterized. Whole genome sequencing was performed using Illumina and PacBio technologies on eight stx2 -positive O26:H11 strains circulating in France. Comparative analyses of the whole genome of the stx2 -positive O26:H11 strains indicate that several clones of EHEC O26:H11 are co-circulating in France. Phylogenetic analysis of the French strains together with stx2 -positive and stx -negative E. coli O26:H11 genomes obtained from Genbank indicates the existence of four clonal complexes (SNP-CCs) separated in two distinct lineages, one of which comprises the "new French clone" (SNP-CC1) that appears genetically closely related to stx -negative attaching and effacing E. coli (AEEC) strains. Interestingly, the whole genome SNP (wgSNP) phylogeny is summarized in the cas gene phylogeny, and a simple qPCR assay targeting the CRISPR array specific to SNP-CC1 (SP_O26-E) can distinguish between the two main lineages. The PacBio sequencing allowed a detailed analysis of the mobile genetic elements (MGEs) of the strains. Numerous MGEs were identified in each strain, including a large number of prophages and up to four large plasmids, representing overall 8.7-19.8% of the total genome size. Analysis of the prophage pool of the strains shows a considerable diversity with a complex history of recombination. Each clonal complex (SNP-CC) is characterized by a unique set of plasmids and phages, including stx -prophages, suggesting evolution through separate acquisition events. Overall, the MGEs appear to play a major role in O26:H11 intra-serotype clonal diversification.

Genotypic characterization of gentamicin and cephalosporin resistant Escherichia coli isolates from blood cultures in a Norwegian university hospital 2011-2015.

PubMed

Fladberg, Øyvind Andreas; Jørgensen, Silje Bakken; Aamot, Hege Vangstein

2017-01-01

Cephalosporin resistance in clinical E. coli isolates is increasing internationally. The increase has been caused by virulent and often multidrug-resistant clones, especially the extended spectrum β-lactamase (ESBL) producing E. coli clone O25b-ST131. In Norway, recommended empirical treatment of sepsis consists of gentamicin and penicillin combined, or a broad-spectrum cephalosporin. To investigate if increased gentamicin and cephalosporins resistance rates in our hospital could be caused by specific clones, we conducted a retrospective study on E. coli blood culture isolates from 2011 through 2015. All E. coli isolates non-susceptible to gentamicin and/or third-generation cephalosporins were genotyped using multiple-locus variable-number of tandem repeat analysis (MLVA) and compared with antibiotic susceptible isolates. The frequency of the most common genes causing ESBL production ( bla CTX-M , bla ampC ) was examined by Real-Time PCR. A total of 158 cephalosporin and/or gentamicin resistant and 97 control isolates were differentiated into 126 unique MLVA types. Of these, 31% of the isolates belonged to a major MLVA cluster consisting of 41% of the gentamicin resistant and 35% of the cephalosporin resistant isolates. The majority (65/80 isolates) of this MLVA cluster contained MLVA types associated with the E. coli O25b-ST131 clone. Genes encoding CTX-M enzyme phylogroups 1 and 9 occurred in 65% and 19% of cephalosporin resistant isolates, respectively, whereas bla ampC-CIT was identified in 3%. No local E. coli bacteraemia clone was identified. Antibiotic resistance was dispersed over a variety of genotypes. However, association with the international E. coli O25b-ST131 clone was frequent and may be an important driver behind increased resistance rates. Monitoring and preventing dissemination of these resistant clones are important for continued optimal treatment.

Cloned Erwinia chrysanthemi out genes enable Escherichia coli to selectively secrete a diverse family of heterologous proteins to its milieu.

PubMed

He, S Y; Lindeberg, M; Chatterjee, A K; Collmer, A

1991-02-01

The out genes of the enterobacterial plant pathogen Erwinia chrysanthemi are responsible for the efficient extracellular secretion of multiple plant cell wall-degrading enzymes, including four isozymes of pectate lyase, exo-poly-alpha-D-galacturonosidase, pectin methylesterase, and cellulase. Out- mutants of Er. chrysanthemi are unable to export any of these proteins beyond the periplasm and are severely reduced in virulence. We have cloned out genes from Er. chrysanthemi in the stable, low-copy-number cosmid pCPP19 by complementing several transposon-induced mutations. The cloned out genes were clustered in a 12-kilobase chromosomal DNA region, complemented all existing out mutations in Er. chrysanthemi EC16, and enabled Escherichia coli strains to efficiently secrete the extracellular pectic enzymes produced from cloned Er. chrysanthemi genes, while retaining the periplasmic marker protein beta-lactamase. DNA sequencing of a 2.4-kilobase EcoRI fragment within the out cluster revealed four genes arranged colinearly and sharing substantial similarity with the Klebsiella pneumoniae genes pulH, pulI, pulJ, and pulK, which are necessary for pullulanase secretion. However, K. pneumoniae cells harboring the cloned Er. chrysanthemi pelE gene were unable to secrete the Erwinia pectate lyase. Furthermore, the Er. chrysanthemi Out system was unable to secrete an extracellular pectate lyase encoded by a gene from a closely related plant pathogen. Erwinia carotovora ssp. carotovora. The results suggest that these enterobacteria secrete polysaccharidases by a conserved mechanism whose protein-recognition capacities have diverged.

A novel cloning template designing method by using an artificial bee colony algorithm for edge detection of CNN based imaging sensors.

PubMed

Parmaksızoğlu, Selami; Alçı, Mustafa

2011-01-01

Cellular Neural Networks (CNNs) have been widely used recently in applications such as edge detection, noise reduction and object detection, which are among the main computer imaging processes. They can also be realized as hardware based imaging sensors. The fact that hardware CNN models produce robust and effective results has attracted the attention of researchers using these structures within image sensors. Realization of desired CNN behavior such as edge detection can be achieved by correctly setting a cloning template without changing the structure of the CNN. To achieve different behaviors effectively, designing a cloning template is one of the most important research topics in this field. In this study, the edge detecting process that is used as a preliminary process for segmentation, identification and coding applications is conducted by using CNN structures. In order to design the cloning template of goal-oriented CNN architecture, an Artificial Bee Colony (ABC) algorithm which is inspired from the foraging behavior of honeybees is used and the performance analysis of ABC for this application is examined with multiple runs. The CNN template generated by the ABC algorithm is tested by using artificial and real test images. The results are subjectively and quantitatively compared with well-known classical edge detection methods, and other CNN based edge detector cloning templates available in the imaging literature. The results show that the proposed method is more successful than other methods.

A Novel Cloning Template Designing Method by Using an Artificial Bee Colony Algorithm for Edge Detection of CNN Based Imaging Sensors

PubMed Central

Parmaksızoğlu, Selami; Alçı, Mustafa

2011-01-01

Cellular Neural Networks (CNNs) have been widely used recently in applications such as edge detection, noise reduction and object detection, which are among the main computer imaging processes. They can also be realized as hardware based imaging sensors. The fact that hardware CNN models produce robust and effective results has attracted the attention of researchers using these structures within image sensors. Realization of desired CNN behavior such as edge detection can be achieved by correctly setting a cloning template without changing the structure of the CNN. To achieve different behaviors effectively, designing a cloning template is one of the most important research topics in this field. In this study, the edge detecting process that is used as a preliminary process for segmentation, identification and coding applications is conducted by using CNN structures. In order to design the cloning template of goal-oriented CNN architecture, an Artificial Bee Colony (ABC) algorithm which is inspired from the foraging behavior of honeybees is used and the performance analysis of ABC for this application is examined with multiple runs. The CNN template generated by the ABC algorithm is tested by using artificial and real test images. The results are subjectively and quantitatively compared with well-known classical edge detection methods, and other CNN based edge detector cloning templates available in the imaging literature. The results show that the proposed method is more successful than other methods. PMID:22163903

Molecular epidemiology of community-onset methicillin-resistant Staphylococcus aureus infections in Israel.

PubMed

Biber, A; Parizade, M; Taran, D; Jaber, H; Berla, E; Rubin, C; Rahav, G; Glikman, D; Regev-Yochay, G

2015-08-01

Data on community-associated (CA) methicillin-resistant Staphylococcus aureus (MRSA) in Israel are scarce. The objective of this study was to characterize the major CA-MRSA clones in Israel. All clinical MRSA isolates detected in the community during a period of 2.5 years (2011-2013) from individuals insured by a major health maintenance organization in Israel were collected, with additional data from medical records. Antibiotic susceptibility patterns and staphylococcal chromosomal cassette mec (SCCmec) typing were determined. SCCmec IV and V isolates were further typed by pulsed-field gel electrophoresis (PFGE), spa typing, and detection of a panel of toxin genes. MRSA were detected in 280 patients, mostly from skin infections. Patients with SCCmec IV (n = 120, 43 %) were younger (p < 0.0001) and reported less contact with healthcare facilities. Almost all isolates were trimethoprim-sulfamethoxazole susceptible (98 %). spa-CC032, a typical nosocomial MRSA clone, accounted for 28 % of SCCmec IV. The two major CA-MRSA clones were t008 USA300 (13 %) and t991 (10 %); t991 was isolated mainly from children (75 %), was Panton-Valentine leukocidin (PVL) negative but eta-positive, and was typically susceptible to most antibiotic groups. PVL-positive strains (n = 31) included mainly USA300 (52 %) and t019 (13 %). While multiple genetic lineages were evident among community-onset MRSA in Israel, approximately 20 % are typical CA-MRSA clones, mainly USA300 and a local clone, t991.

Understanding Transcriptional Enhancement in Monoclonal Antibody-Producing Chinese Hamster Ovary Cells

NASA Astrophysics Data System (ADS)

Nicoletti, Sarah E.

With the demand for monoclonal antibody (mAB) therapeutics continually increasing, the need to better understand what makes a high productivity clone has gained substantial interest. Monoclonal antibody producing Chinese hamster ovary (CHO) cells with different productivities were provided by a biopharmaceutical company for investigation. Gene copy numbers, mRNA levels, and mAb productivities were previously determined for two low producing clones and their amplified progeny. These results showed an increase in mRNA copy number in amplified clones, which correlated to the observed increases in specific productivity of these clones. The presence of multiple copies of mRNA per one copy of DNA in the higher productivity clones has been coined as transcriptional enhancement. The methylation status of the CMV promoter as well as transcription factor/promoter interactions were evaluated to determine the cause of transcriptional enhancement. Methylation analysis via bisulfite sequencing revealed no significant difference in overall methylation status of the CMV promoter. These data did, however, reveal the possibility of differential interactions of transcription factors between the high and low productivity cell clones. This finding was further supported by chromatin immunoprecipitations previously performed in the lab, as well as literature studies. Transcription activator-like effector (TALE) binding proteins were constructed and utilized to selectively immunoprecipitate the CMV promoter along with its associated transcription factors in the different CHO cell clones. Cells were transfected with the TALE proteins, harvested and subjected to a ChIP-like procedure. Results obtained from the TALE ChIP demonstrated the lack of binding of the protein to the promoter and the need to redesign the TALE. Overall, results obtained from this study were unable to give a clear indication as to the causes of transcriptional enhancement in the amplified CHO cell clones. Further investigations into both epigenetic modifications and transcription factor interactions will help gain a better understanding of what characteristics make a higher producing CHO cell line. Discovery of these characteristics will aid in better genetic engineering strategies for future recombinant cell lines, improving productivity and shortening the clonal selection process.

T cell receptor (TCR) structure of autologous melanoma-reactive cytotoxic T lymphocyte (CTL) clones: tumor-infiltrating lymphocytes overexpress in vivo the TCR beta chain sequence used by an HLA-A2- restricted and melanocyte-lineage-specific CTL clone

PubMed Central

1993-01-01

HLA-A2+ melanomas express common melanoma-associated antigens (Ags) recognized in vitro by autologous cytotoxic T lymphocytes (CTL). However, it is not known whether tumor Ags can drive in vivo a selective accumulation/expansion of Ag-specific, tumor-infiltrating T lymphocytes (TIL). Therefore, to evaluate this possibility, 39 CTL clones isolated from several independent mixed lymphocyte tumor cultures (MLTC) of TIL and peripheral blood lymphocytes (PBL) of an HLA- A2+ melanoma patient and selected for T cell receptor (TCR)-dependent, HLA-restricted tumor lysis, were used for analysis of TCR alpha and beta chain structure by the cDNA polymerase chain reaction (PCR) technique with variable gene-specific primers followed by sequencing. Despite absence of oligoclonality in fresh TIL and PBL, as well as in T cells of day 28 MLTC (day of cloning), sequence analysis of TCR alpha and beta chains of TIL clones revealed a dominance of a major category of melanoma-specific, HLA-A2-restricted T cells expressing a V alpha 8.2/J alpha AP511/C alpha and V beta 2.1/D beta 1/J beta 1.1/C beta 1 TCR. The same TCR was also found in 2 out of 14 PBL clones. The other PBL clones employed a V alpha 2.1 gene segment associated with either V beta 13.2, 14, or w22. Clones A81 (V alpha 2.1/J alpha IGRJ alpha 04/C alpha and V beta 14/D beta 1/J beta 1.2/C beta 1) and A21 (V alpha 8.2/J alpha AP511/C alpha and V beta 2.1/D beta 1/J beta 1.1/C beta 1), representative of the two most frequent TCR of PBL and TIL, respectively, expressed different lytic patterns, but both were HLA-A2 restricted and lysed only HLA-A2+ melanomas and normal melanocytes, thus indicating recognition of two distinct HLA-A2-associated and tissue-related Ags. Finally, by the inverse PCR technique, the specific TCR beta chain (V beta 2.1/D beta 1/J beta 1.1/C beta 1) expressed by the dominant TIL clone was found to represent 19 and 18.4% of all V beta 2 sequences expressed in the fresh tumor sample and in the purified TIL, respectively, but < 0.19% of V beta 2+ sequences expressed in PBL. These results are consistent with the hypothesis that a clonal expansion/accumulation of a melanocyte-lineage-specific and HLA-A2-restricted T cell clone occurred in vivo at the site of tumor growth. PMID:8376931

Persistence of bacterial and archaeal communities in sea ice through an Arctic winter

PubMed Central

Collins, R Eric; Rocap, Gabrielle; Deming, Jody W

2010-01-01

The structure of bacterial communities in first-year spring and summer sea ice differs from that in source seawaters, suggesting selection during ice formation in autumn or taxon-specific mortality in the ice during winter. We tested these hypotheses by weekly sampling (January–March 2004) of first-year winter sea ice (Franklin Bay, Western Arctic) that experienced temperatures from −9°C to −26°C, generating community fingerprints and clone libraries for Bacteria and Archaea. Despite severe conditions and significant decreases in microbial abundance, no significant changes in richness or community structure were detected in the ice. Communities of Bacteria and Archaea in the ice, as in under-ice seawater, were dominated by SAR11 clade Alphaproteobacteria and Marine Group I Crenarchaeota, neither of which is known from later season sea ice. The bacterial ice library contained clones of Gammaproteobacteria from oligotrophic seawater clades (e.g. OM60, OM182) but no clones from gammaproteobacterial genera commonly detected in later season sea ice by similar methods (e.g. Colwellia, Psychrobacter). The only common sea ice bacterial genus detected in winter ice was Polaribacter. Overall, selection during ice formation and mortality during winter appear to play minor roles in the process of microbial succession that leads to distinctive spring and summer sea ice communities. PMID:20192970

Community structure of planktonic methane-oxidizing bacteria in a subtropical reservoir characterized by dominance of phylotype closely related to nitrite reducer

NASA Astrophysics Data System (ADS)

Kojima, Hisaya; Tokizawa, Riho; Kogure, Kouhei; Kobayashi, Yuki; Itoh, Masayuki; Shiah, Fuh-Kwo; Okuda, Noboru; Fukui, Manabu

2014-07-01

Methane-oxidizing bacteria (MOB) gain energy from the oxidation of methane and may play important roles in freshwater ecosystems. In this study, the community structure of planktonic MOB was investigated in a subtropical reservoir. Bacterial community structure was investigated through the analysis of the 16S rRNA gene. Three groups of phylogenetically distinct MOB were detected in the clone libraries of polymerase chain reaction products obtained with universal primers. The groups belonged to the class Gammaproteobacteria, the class Alphaproteobacteria, and the candidate phylum NC10. The last group, which consists of close relatives of the nitrite reducer `Candidatus Methylomirabilis oxyfera', was frequently detected in the clone libraries of deep-water environments. The presence of 3 groups of MOB in deep water was also shown by a cloning analysis of the pmoA gene encoding particulate methane monooxygenase. The dominance of `M. oxyfera'-like organisms in deep water was confirmed by catalyzed reporter deposition-fluorescence in situ hybridization, in which cells stained with a specific probe accounted for 16% of total microbial cells. This is the first study to demonstrate that close relatives of the nitrite reducer can be major component of planktonic MOB community which may affect carbon flow in aquatic ecosystems.

Clonal evolution revealed by whole genome sequencing in a case of primary myelofibrosis transformed to secondary acute myeloid leukemia.

PubMed

Engle, E K; Fisher, D A C; Miller, C A; McLellan, M D; Fulton, R S; Moore, D M; Wilson, R K; Ley, T J; Oh, S T

2015-04-01

Clonal architecture in myeloproliferative neoplasms (MPNs) is poorly understood. Here we report genomic analyses of a patient with primary myelofibrosis (PMF) transformed to secondary acute myeloid leukemia (sAML). Whole genome sequencing (WGS) was performed on PMF and sAML diagnosis samples, with skin included as a germline surrogate. Deep sequencing validation was performed on the WGS samples and an additional sample obtained during sAML remission/relapsed PMF. Clustering analysis of 649 validated somatic single-nucleotide variants revealed four distinct clonal groups, each including putative driver mutations. The first group (including JAK2 and U2AF1), representing the founding clone, included mutations with high frequency at all three disease stages. The second clonal group (including MYB) was present only in PMF, suggesting the presence of a clone that was dispensable for transformation. The third group (including ASXL1) contained mutations with low frequency in PMF and high frequency in subsequent samples, indicating evolution of the dominant clone with disease progression. The fourth clonal group (including IDH1 and RUNX1) was acquired at sAML transformation and was predominantly absent at sAML remission/relapsed PMF. Taken together, these findings illustrate the complex clonal dynamics associated with disease evolution in MPNs and sAML.

Cases with manifestation of chemodectoma diagnosed in dogs in Department of Internal Diseases with Horses, Dogs and Cats Clinic, Veterinary Medicine Faculty, University of Environmental and Life Sciences, Wroclaw, Poland

PubMed Central

2010-01-01

In the period of 3 years, 9 tumours of chemodectoma were supravitally diagnosed and histopathologically verified in dogs. In this period 15 351 dogs were admitted to the Clinic of Dogs and Cats and 2 145 dogs were examined in the cardiological outpatient clinic for dogs. This tumour is located in a typical place - at the base of the heart. Most frequently the tumour manifested in older boxers. Only in one case such a tumour was diagnosed in another breed of dogs. The tumours ranged in size between 3 and 16 cm in diameter. The principal sign accompanying tumours of cardiac base involved dyspnoea but in 3 cases the tumours yielded no clinical signs. All the diagnoses were additionally verified using immunohistochemical examination. We used antibodies to chromogranin A (clone DAK-A3 1:100), synaptophysin (clone SY38 1:20) and neuron-specific enolase (clone BBS/NC/VI-H14 1:150). An immunohistochemical examination is vital for the diagnosis since it allows to differentiate histologically distinct types of neoplasia which may locate in the same site and may manifest a similar histological pattern. PMID:20492718

Identification of a high-virulence clone of type III Streptococcus agalactiae (group B Streptococcus) causing invasive neonatal disease.

PubMed

Musser, J M; Mattingly, S J; Quentin, R; Goudeau, A; Selander, R K

1989-06-01

Chromosomal genotypes of 128 isolates of six serotypes (Ia, Ib, Ic, II, Ic/II, and III) of Streptococcus agalactiae (group B Streptococcus) recovered predominantly from human infants in the United States were characterized by an analysis of electrophoretically demonstrable allelic profiles at 11 metabolic enzyme loci. Nineteen distinctive electrophoretic types (ETs), representing multilocus clonal genotypes, were identified. Mean genetic diversity per locus among ETs of isolates of the same serotype was, on average, nearly equal to that in all 19 ETs. Cluster analysis of the ETs revealed two primary phylogenetic divisions at a genetic distance of 0.65. A single clone (ET 1) represented by 40 isolates expressing type III antigen formed division I. Division II was composed of 18 ETs in three major lineages diverging from one another at distances greater than 0.35 and included strains of all six antigenic classes. The type III organisms in division I produce more extracellular neuraminidase and apparently are more virulent than the type III strains in division II, which are related to strains of other serotypes that cause disease much less frequently. The existence of this unusually virulent clone accounts, in major part, for the high morbidity and mortality associated with infection by type III organisms.

Phospholipid epitopes for mouse antibodies against bromelain-treated mouse erythrocytes.

PubMed Central

Kawaguchi, S

1987-01-01

The reactivity of mouse antibodies against bromelain-treated mouse erythrocytes (BrMRBC) with phospholipid epitopes was assessed by ELISA, using four clones of monoclonal anti-BrMRBC antibodies that had idiotypes distinct from one another. The four antibodies could bind to low-density lipoproteins (LDL) from human and chicken, but not to LDL from mouse and rat. As to liposomes of natural phospholipids, all the clones reacted with liposomes of phosphatidylcholine, and some of them could react with liposomes of sphingomyelin, phosphatidylglycerol, phosphatidylic acid or cardiolipin. For liposomes of synthetic phosphatidylcholine with different fatty acids, the length of carbon chains and the number of unsaturated carbon chains of the fatty acids markedly affected the binding of each monoclonal antibody to the liposomes. The addition of dicetyl phosphate or stearylamine to phosphatidylcholine liposomes changed the reactivity of the liposomes. These results support the view that mouse anti-BrMRBC antibodies can recognize appropriately spaced phosphorylcholine residues on the surface of phospholipid liposomes, LDL and cells. The four clones had similar capacities for binding to LDL as well as to BrMRBC, but they had obviously different capacities for binding to phospholipid liposomes; the epitopes on phospholipid liposomes used in the present study were not so perfect as to react well with every anti-BrMRBC antibody. PMID:2443446

Identification of Abundantly Expressed Novel and Conserved Genes from the Infective Larval Stage of Toxocara canis by an Expressed Sequence Tag Strategy

PubMed Central

Tetteh, Kevin K. A.; Loukas, Alex; Tripp, Cindy; Maizels, Rick M.

1999-01-01

Larvae of Toxocara canis, a nematode parasite of dogs, infect humans, causing visceral and ocular larva migrans. In noncanid hosts, larvae neither grow nor differentiate but endure in a state of arrested development. Reasoning that parasite protein production is orientated to immune evasion, we undertook a random sequencing project from a larval cDNA library to characterize the most highly expressed transcripts. In all, 266 clones were sequenced, most from both 3′ and 5′ ends, and similarity searches against GenBank protein and dbEST nucleotide databases were conducted. Cluster analyses showed that 128 distinct gene products had been found, all but 3 of which represented newly identified genes. Ninety-five genes were represented by a single clone, but seven transcripts were present at high frequencies, each composing >2% of all clones sequenced. These high-abundance transcripts include a mucin and a C-type lectin, which are both major excretory-secretory antigens released by parasites. Four highly expressed novel gene transcripts, termed ant (abundant novel transcript) genes, were found. Together, these four genes comprised 18% of all cDNA clones isolated, but no similar sequences occur in the Caenorhabditis elegans genome. While the coding regions of the four genes are dissimilar, their 3′ untranslated tracts have significant homology in nucleotide sequence. The discovery of these abundant, parasite-specific genes of newly identified lectins and mucins, as well as a range of conserved and novel proteins, provides defined candidates for future analysis of the molecular basis of immune evasion by T. canis. PMID:10456930

DNA aptamers for the detection of Haemophilus influenzae type b by cell SELEX.

PubMed

Bitaraf, F S; Rasooli, I; Mousavi Gargari, S L

2016-03-01

Haemophilus influenzae type b (Hib) causes acute bacterial meningitis (ABM) in children, with a mortality rate of about 3-6 % of the affected patients. ABM can lead to death during a period of hours to several days and, hence, rapid and early detection of the infection is crucial. Aptamers, the short single-stranded DNA or RNA with high affinity to target molecules, are selected by a high-flux screening technique known as in vitro screening and systematic evolution of ligands by exponential enrichment technology (SELEX). In this study, whole-cell SELEX was applied for the selection of target-specific aptamers with high affinity to Hib. ssDNA aptamers prepared by lambda exonuclease were incubated with the target cells (Hib). The aptameric binding rate to Hib was characterized for binding affinity after seven SELEX rounds by flow cytometry. The aptamers with higher binding affinity were cloned. Four of 68 aptamer clones were selected for sequencing. The dissociation constant (Kd) of the high-affinity aptamer clones 45 and 63 were 47.10 and 28.46 pM, respectively. These aptamers did not bind to other bacterial species, including the seven meningitis-causing bacteria. They showed distinct affinity to various H. influenzae strains only. These aptamers showed the highest affinity to Hib and the lowest affinity to H. influenzae type c and to other meningitis-causing bacteria. Clone 63 could detect Hib in patients' cerebrospinal fluid (CSF) samples at 60 colony-forming units (CFU)/mL. The results indicate applicability of the aptamers for rapid and early detection of infections brought about by Hib.

Molecular characterization and antibiotic susceptibility of Haemophilus influenzae clinical isolates.

PubMed

K L Ç, Hüseyin; Akyol, Selcan; Parkan, Õmür Mustafa; Dinç, Gõkçen; Sav, Hafize; Aydemir, Gonca

2017-03-01

Haemophilus influenzae can cause invasive and severe infections in both adults and children such as otitis media, sinusitis, pneumonia, meningitis and bacteremia. The emerging antibiotic resistance in recent years against ampicillin and several other antibiotics among strains of H. influenzae gives cause for serious concern. Here, we investigate ß-lactamase (BL) activity in clinical isolates of H. influenzae, profile their resistance to antibiotics, and characterize the clonal relationship of the isolates. Antibiotic susceptibilities of 92 clinical isolates of H. influenzae (March 2011-May 2012) were determined using the disk diffusion method according to the Clinical & Laboratory Standards Institute (CLSI), and BL activity was detected using the nitrocefin disk method. The Rep-PCR method was used to characterize clonality of the isolates. All strains were found to be susceptible to levofloxacin and cefotaxime. Four isolates out of 92 (4.3%) were found resistant to ampicillin, one isolate (1.1%) was resistant to amoxicillin/clavulanic acid, 21 isolates (22.8%) were resistant to trimethoprim-sulfamethoxazole (SXT), and three isolates (3.3%) showed BL activity. One strain was BL-negative but resistant to ampicillin. The three isolates with BL activity and four isolates with resistance to ampicillin did not have a clonal relationship. Three distinct clones [clone A (with subclones A1 and A2), clone B, and clone C] were identified among the SXT-resistant strains. Most of the H. influenzae isolates in this study were susceptible to the antibiotics while SXT resistance was relatively more prevalent, which suggests that significant obstacles in the therapeutic use of antibiotics against H. influenzae strains are not expected in our region.

In silico design, construction and cloning of Trastuzumab humanized monoclonal antibody: A possible biosimilar for Herceptin

PubMed Central

Akbarzadeh-Sharbaf, Soudabeh; Yakhchali, Bagher; Minuchehr, Zarrin; Shokrgozar, Mohammad Ali; Zeinali, Sirous

2012-01-01

Background: There is a novel hypothesis in that antibodies may have specificity for two distinct antigens that have been named “dual specificity”. This hypothesis was evaluated for some defined therapeutic monoclonal antibodies (mAbs) such as Trastuzumab, Pertuzumab, Bevacizumab, and Cetuximab. In silico design and construction of expression vectors for trastuzumab monoclonal antibody also in this work were performed. Materials and Methods: First, in bioinformatics studies the 3D structures of concerned mAbs were obtained from the Protein Data Bank (PDB). Three-dimensional structural alignments were performed with SIM and MUSTANG softwares. AutoDock4.2 software also was used for the docking analysis. Second, the suitable genes for trastuzumab heavy and light chains were designed, synthesized, and cloned in the prokaryotic vector. These fragments individually were PCR amplified and cloned into pcDNA™ 3.3-TOPO® and pOptiVEC™ TOPO® shuttle vectors, using standard methods. Results: First, many bioinformatics tools and softwares were applied but we did not meet any new dual specificity in the selected antibodies. In the following step, the suitable expression cascade for the heavy and light chains of Trastuzumab therapeutic mAb were designed and constructed. Gene cloning was successfully performed and created constructs were confirmed using gene mapping and sequencing. Conclusions: This study was based on a recently developed technology for mAb expression in mammalian cells. The obtained constructs could be successfully used for biosimilar recombinant mAb production in CHO DG44 dihydrofolate reductase (DHFR) gene deficient cell line in the suspension culture medium. PMID:23210080

Understanding Selective Downregulation of c-Myc Expression through Inhibition of General Transcription Regulators in Multiple Myeloma

DTIC Science & Technology

2014-06-01

AUTHOR(S) 5d. PROJECT NUMBER Dr. Charles Lin 5e. TASK NUMBER E-Mail: Charles_lin@dfci.harvard.edu 5f. WORK UNIT NUMBER 7...landscape of Multiple Myeloma (MM), this project has endeavored to provide an explanatory mechanism for how treatment with inhibitors of chromatin...category: 1472-1), BRD4 (Epitomics, category: 5716-1) or b-actin ( Sigma , clone AC-15, A5441). Data Analysis All ChIP-seq data sets were aligned using

An effective system for detecting protein-protein interaction based on in vivo cleavage by PPV NIa protease.

PubMed

Zheng, Nuoyan; Huang, Xiahe; Yin, Bojiao; Wang, Dan; Xie, Qi

2012-12-01

Detection of protein-protein interaction can provide valuable information for investigating the biological function of proteins. The current methods that applied in protein-protein interaction, such as co-immunoprecipitation and pull down etc., often cause plenty of working time due to the burdensome cloning and purification procedures. Here we established a system that characterization of protein-protein interaction was accomplished by co-expression and simply purification of target proteins from one expression cassette within E. coli system. We modified pET vector into co-expression vector pInvivo which encoded PPV NIa protease, two cleavage site F and two multiple cloning sites that flanking cleavage sites. The target proteins (for example: protein A and protein B) were inserted at multiple cloning sites and translated into polyprotein in the order of MBP tag-protein A-site F-PPV NIa protease-site F-protein B-His(6) tag. PPV NIa protease carried out intracellular cleavage along expression, then led to the separation of polyprotein components, therefore, the interaction between protein A-protein B can be detected through one-step purification and analysis. Negative control for protein B was brought into this system for monitoring interaction specificity. We successfully employed this system to prove two cases of reported protien-protein interaction: RHA2a/ANAC and FTA/FTB. In conclusion, a convenient and efficient system has been successfully developed for detecting protein-protein interaction.

Evolution of multi-drug resistant HCV clones from pre-existing resistant-associated variants during direct-acting antiviral therapy determined by third-generation sequencing

NASA Astrophysics Data System (ADS)

Takeda, Haruhiko; Ueda, Yoshihide; Inuzuka, Tadashi; Yamashita, Yukitaka; Osaki, Yukio; Nasu, Akihiro; Umeda, Makoto; Takemura, Ryo; Seno, Hiroshi; Sekine, Akihiro; Marusawa, Hiroyuki

2017-03-01

Resistance-associated variant (RAV) is one of the most significant clinical challenges in treating HCV-infected patients with direct-acting antivirals (DAAs). We investigated the viral dynamics in patients receiving DAAs using third-generation sequencing technology. Among 283 patients with genotype-1b HCV receiving daclatasvir + asunaprevir (DCV/ASV), 32 (11.3%) failed to achieve sustained virological response (SVR). Conventional ultra-deep sequencing of HCV genome was performed in 104 patients (32 non-SVR, 72 SVR), and detected representative RAVs in all non-SVR patients at baseline, including Y93H in 28 (87.5%). Long contiguous sequences spanning NS3 to NS5A regions of each viral clone in 12 sera from 6 representative non-SVR patients were determined by third-generation sequencing, and showed the concurrent presence of several synonymous mutations linked to resistance-associated substitutions in a subpopulation of pre-existing RAVs and dominant isolates at treatment failure. Phylogenetic analyses revealed close genetic distances between pre-existing RAVs and dominant RAVs at treatment failure. In addition, multiple drug-resistant mutations developed on pre-existing RAVs after DCV/ASV in all non-SVR cases. In conclusion, multi-drug resistant viral clones at treatment failure certainly originated from a subpopulation of pre-existing RAVs in HCV-infected patients. Those RAVs were selected for and became dominant with the acquisition of multiple resistance-associated substitutions under DAA treatment pressure.

Development of t(8;21) and RUNX1-RUNX1T1 in the Philadelphia-positive clone of a patient with chronic myelogenous leukemia: additional evidence for multiple steps involved in disease progression.

PubMed

Najfeld, Vesna; Wisch, Nathaniel; Mascarenhas, John; Issa, Leonard; Tripodi, Joseph; Sidhu, Manpreet; Hoffman, Ronald

2011-03-01

A 65-year-old patient with a high hemoglobin and hematocrit was treated for 14 months with therapeutic phlebotomy when cytogenetics of bone marrow revealed 100% cells with the Ph chromosome and 45% of the Ph+ cells contained trisomy 8. Treatment with tyrosine kinase inhibitors did not reduce the BCR-ABL1 fusion positive clone. Instead, the Ph positive cells acquired further the t(8;21)/RUNX1-RUNX1T1, del(4q) and trisomy 15 chromosomal abnormalities which were resistant to further treatment. Literature review revealed eight other patients who either had t(9;22) and t(8;21) simultaneously or developed t(8;21) in the Ph positive clone. We conclude that there are rare patients with CML who either present in blast crisis with coexistence of t(9;22) and t(8;21) with or without +8, or progress to blast crisis with acquiring RUNX1-RUNX1T1 in the BCR-ABL1 clone which may or may not be therapy related and represent a later event in a multistep pathogenesis. Copyright © 2011 Elsevier Inc. All rights reserved.

Phylogenetic Copy-Number Factorization of Multiple Tumor Samples.

PubMed

Zaccaria, Simone; El-Kebir, Mohammed; Klau, Gunnar W; Raphael, Benjamin J

2018-04-16

Cancer is an evolutionary process driven by somatic mutations. This process can be represented as a phylogenetic tree. Constructing such a phylogenetic tree from genome sequencing data is a challenging task due to the many types of mutations in cancer and the fact that nearly all cancer sequencing is of a bulk tumor, measuring a superposition of somatic mutations present in different cells. We study the problem of reconstructing tumor phylogenies from copy-number aberrations (CNAs) measured in bulk-sequencing data. We introduce the Copy-Number Tree Mixture Deconvolution (CNTMD) problem, which aims to find the phylogenetic tree with the fewest number of CNAs that explain the copy-number data from multiple samples of a tumor. We design an algorithm for solving the CNTMD problem and apply the algorithm to both simulated and real data. On simulated data, we find that our algorithm outperforms existing approaches that either perform deconvolution/factorization of mixed tumor samples or build phylogenetic trees assuming homogeneous tumor samples. On real data, we analyze multiple samples from a prostate cancer patient, identifying clones within these samples and a phylogenetic tree that relates these clones and their differing proportions across samples. This phylogenetic tree provides a higher resolution view of copy-number evolution of this cancer than published analyses.

Differentiation of closely related but biologically distinct cherry isolates of Prunus necrotic ringspot virus by polymerase chain reaction.

PubMed

Hammond, R W; Crosslin, J M; Pasini, R; Howell, W E; Mink, G I

1999-07-01

Prunus necrotic ringspot ilarvirus (PNRSV) exists as a number of biologically distinct variants which differ in host specificity, serology, and pathology. Previous nucleotide sequence alignment and phylogenetic analysis of cloned reverse transcription-polymerase chain reaction (RT-PCR) products of several biologically distinct sweet cherry isolates revealed correlations between symptom type and the nucleotide and amino acid sequences of the 3a (putative movement protein) and 3b (coat protein) open reading frames. Based upon this analysis, RT-PCR assays have been developed that can identify isolates displaying different symptoms and serotypes. The incorporation of primers in a multiplex PCR protocol permits rapid detection and discrimination among the strains. The results of PCR amplification using type-specific primers that amplify a portion of the coat protein gene demonstrate that the primer-selection procedure developed for PNRSV constitutes a reliable method of viral strain discrimination in cherry for disease control and will also be useful for examining biological diversity within the PNRSV virus group.

Intermediate-type vancomycin resistance (VISA) in genetically-distinct Staphylococcus aureus isolates is linked to specific, reversible metabolic alterations.

PubMed

Alexander, Elizabeth L; Gardete, Susana; Bar, Haim Y; Wells, Martin T; Tomasz, Alexander; Rhee, Kyu Y

2014-01-01

Intermediate (VISA-type) vancomycin resistance in Staphylococcus aureus has been associated with a range of physiologic and genetic alterations. Previous work described the emergence of VISA-type resistance in two clonally-distinct series of isolates. In both series (the first belonging to MRSA clone ST8-USA300, and the second to ST5-USA100), resistance was conferred by a single mutation in yvqF (a negative regulator of the vraSR two-component system associated with vancomycin resistance). In the USA300 series, resistance was reversed by a secondary mutation in vraSR. In this study, we combined systems-level metabolomic profiling with statistical modeling techniques to discover specific, reversible metabolic alterations associated with the VISA phenotype.

Moral qualms, future persons, and embryo research.

PubMed

Shaw, David Martin

2008-05-01

Many people have moral qualms about embryo research, feeling that embryos must deserve some kind of protection, if not so much as is afforded to persons. This paper will show that these qualms serve to camouflage motives that are really prudential, at the cost of also obscuring the real ethical issues at play in the debate concerning embryo research and therapeutic cloning. This in turn leads to fallacious use of the Actions/Omissions Distinction and ultimately neglects the duties that we have towards future persons.

Multiple intensity distributions from a single optical element

NASA Astrophysics Data System (ADS)

Berens, Michael; Bruneton, Adrien; Bäuerle, Axel; Traub, Martin; Wester, Rolf; Stollenwerk, Jochen; Loosen, Peter

2013-09-01

We report on an extension of the previously published two-step freeform optics tailoring algorithm using a Monge-Kantorovich mass transportation framework. The algorithm's ability to design multiple freeform surfaces allows for the inclusion of multiple distinct light paths and hence the implementation of multiple lighting functions in a single optical element. We demonstrate the procedure in the context of automotive lighting, in which a fog lamp and a daytime running lamp are integrated in a single optical element illuminated by two distinct groups of LEDs.

Analyzing Clonal Variation of Monoclonal Antibody-Producing CHO Cell Lines Using an In Silico Metabolomic Platform

PubMed Central

Ghorbaniaghdam, Atefeh; Chen, Jingkui; Henry, Olivier; Jolicoeur, Mario

2014-01-01

Monoclonal antibody producing Chinese hamster ovary (CHO) cells have been shown to undergo metabolic changes when engineered to produce high titers of recombinant proteins. In this work, we have studied the distinct metabolism of CHO cell clones harboring an efficient inducible expression system, based on the cumate gene switch, and displaying different expression levels, high and low productivities, compared to that of the parental cells from which they were derived. A kinetic model for CHO cell metabolism was further developed to include metabolic regulation. Model calibration was performed using intracellular and extracellular metabolite profiles obtained from shake flask batch cultures. Model simulations of intracellular fluxes and ratios known as biomarkers revealed significant changes correlated with clonal variation but not to the recombinant protein expression level. Metabolic flux distribution mostly differs in the reactions involving pyruvate metabolism, with an increased net flux of pyruvate into the tricarboxylic acid (TCA) cycle in the high-producer clone, either being induced or non-induced with cumate. More specifically, CHO cell metabolism in this clone was characterized by an efficient utilization of glucose and a high pyruvate dehydrogenase flux. Moreover, the high-producer clone shows a high rate of anaplerosis from pyruvate to oxaloacetate, through pyruvate carboxylase and from glutamate to α-ketoglutarate, through glutamate dehydrogenase, and a reduced rate of cataplerosis from malate to pyruvate, through malic enzyme. Indeed, the increase of flux through pyruvate carboxylase was not driven by an increased anabolic demand. It is in fact linked to an increase of the TCA cycle global flux, which allows better regulation of higher redox and more efficient metabolic states. To the best of our knowledge, this is the first time a dynamic in silico platform is proposed to analyze and compare the metabolomic behavior of different CHO clones. PMID:24632968

Identifying the bacterial community on the surface of Intralox belting in a meat boning room by culture-dependent and culture-independent 16S rDNA sequence analysis.

PubMed

Brightwell, Gale; Boerema, Jackie; Mills, John; Mowat, Eilidh; Pulford, David

2006-05-25

We examined the bacterial community present on an Intralox conveyor belt system in an operating lamb boning room by sequencing the 16S ribosomal DNA (rDNA) of bacteria extracted in the presence or absence of cultivation. RFLP patterns for 16S rDNA clone library and cultures were generated using HaeIII and MspI restriction endonucleases. 16S rDNA amplicons produced 8 distinct RFLP pattern groups. RFLP groups I-IV were represented in the clone library and RFLP groups I and V-VIII were represented amongst the cultured isolates. Partial DNA sequences from each RFLP group revealed that all group I, II and VIII representatives were Pseudomonas spp., group III were Sphingomonas spp., group IV clones were most similar to an uncultured alpha proteobacterium, group V was similar to a Serratia spp., group VI with an Alcaligenes spp., and group VII with Microbacterium spp. Sphingomonads were numerically dominant in the culture-independent clone library and along with the group IV alpha proteobacterium were not represented amongst the cultured isolates. Serratia, Alcaligenes and Microbacterium spp. were only represented with cultured isolates. Pseudomonads were detected by both culture-dependent (84% of isolates) and culture-independent (12.5% of clones) methods and their presence at high frequency does pose the risk of product spoilage if transferred onto meat stored under aerobic conditions. The detection of sphingomonads in large numbers by the culture-independent method demands further analysis because sphingomonads may represent a new source of meat spoilage that has not been previously recognised in the meat processing environment. The 16S rDNA collections generated by both methods were important at representing the diversity of the bacterial population associated with an Intralox conveyor belt system.

[Analysis of Microbial Community in the Membrane Bio-Reactor (MBR) Rural Sewage Treatment System].

PubMed

Kong, Xiao; Cui, Bing-jian; Jin, De-cai; Wu, Shang-hua; Yang, Bo; Deng, Ye; Zhuang, Guo-qiang; Zhuang, Xu-liang

2015-09-01

Uncontrolled release and arbitrary irrigation reuse of rural wastewater may lead to water pollution, and the microbial pathogens could threaten the safety of freshwater resources and public health. To understand the microbial community structure of rural wastewater and provide the theory for microbial risk assessment of wastewater irrigation, microbial community diversities in the Membrane Bio-Reactor (MBR) process for rural wastewater treatment was studied by terminal restriction fragment length polymorphism (T-RFLP) and 16S rDNA gene clone library. Meanwhile, changes of Arcobacter spp. and total bacteria before and after treatment were detected through real-time quantitative PCR. The clone library results showed that there were 73 positive clones included Proteobacteria (91. 80%), Firmicutes (2. 70%), Bacteroidetes (1. 40%), and uncultured bacteria (4. 10%) in the untreated wastewater. The typical pathogenic genus Arcobacter belonging to e-Proteobacteria was the dominant component of the library, accounting for 68. 5% of all clones. The main groups and their abundance in different treatments were significantly distinct. The highest values of species abundance (S), Shannon-Wiener (H) and Evenness (E) were observed in the adjusting tank, which were 43. 0, 3. 56 and 0. 95, respectively. The real-time quantitative PCR results showed that the copy number of Arcobacter spp. was (1. 09 ± 0. 064 0) x 10(11) copies.L-1 in the untreated sewage, which was consistent with the result of 16S rDNA gene clone library. Compared to untreated wastewater, bacterial copy number in the treated effluent decreased 100 to 1 000 times, respectively, suggesting that MBR treatment system could remove the microbial quantity in such scale. In the recycled water, the physicochemical parameters and indicator bacteria met the water quality standard of farmland irrigation. However, further research is needed to estimate the potential health risks caused by residual pathogenic microorganisms in future.

Cloning and characterization of three Eimeria tenella lipid phosphate phosphatases.

PubMed

Guo, Aijiang; Cai, Jianping; Luo, Xuenong; Zhang, Shaohua; Hou, Junling; Li, Hui; Cai, Xuepeng

2015-01-01

Although lipid phosphate phosphatases (LPPs) play an important role in cellular signaling in addition to lipid biosynthesis, little is thus far known about parasite LPPs. In this study, we characterized three Eimeria tenella cDNA clones encoding LPP named EtLPP1, EtLPP2 and EtLPP3. Key structural features previously described in LPPs, including the three conserved domains proposed as catalytic sites, a single conserved N-glycosylation site, and putative transmembrane domains were discovered in the three resulting EtLPP amino acid sequences. Expression of His6-tagged EtLPP1, -2, and -3 in HEK293 cells produced immunoreactive proteins with variable molecular sizes, suggesting the presence of multiple forms of each of the three EtLPPs. The two faster-migrating protein bands below each of the three EtLPP proteins were found to be very similar to the porcine 35-kDa LPP enzyme in their molecular size and the extent of their N-glycosylation, suggesting that the three EtLPPs are partially N-glycosylated. Kinetic analyses of the activity of the three enzymes against PA, LPA, C1P and S1P showed that Km values for each of the substrates were (in μM) 284, 46, 28, and 22 for EtLPP1; 369, 179, 237, and 52 for EtLPP2; and 355, 83, and 260 for EtLPP3. However, EtLPP3 showed negligible activity on S1P. These results confirmed that the three EtLPPs have broad substrate specificity. The results also indicated that despite structural similarities, the three EtLPPs may play distinct functions through their different models of substrate preference. Furthermore, particularly high expression levels of the three EtLPP genes were detected in the sporozoite stage of the E. tenella life cycle (p<0.001), suggesting that their encoded proteins might play an important biological function in the sporozoite stage.

Omega-3 fatty acid desaturase gene family from two ω-3 sources, Salvia hispanica and Perilla frutescens: Cloning, characterization and expression

PubMed Central

Xue, Yufei; Chen, Baojun; Win, Aung Naing; Fu, Chun; Lian, Jianping; Liu, Xue; Wang, Rui; Zhang, Xingcui

2018-01-01

Omega-3 fatty acid desaturase (ω-3 FAD, D15D) is a key enzyme for α-linolenic acid (ALA) biosynthesis. Both chia (Salvia hispanica) and perilla (Perilla frutescens) contain high levels of ALA in seeds. In this study, the ω-3 FAD gene family was systematically and comparatively cloned from chia and perilla. Perilla FAD3, FAD7, FAD8 and chia FAD7 are encoded by single-copy (but heterozygous) genes, while chia FAD3 is encoded by 2 distinct genes. Only 1 chia FAD8 sequence was isolated. In these genes, there are 1 to 6 transcription start sites, 1 to 8 poly(A) tailing sites, and 7 introns. The 5’UTRs of PfFAD8a/b contain 1 to 2 purine-stretches and 2 pyrimidine-stretches. An alternative splice variant of ShFAD7a/b comprises a 5’UTR intron. Their encoded proteins harbor an FA_desaturase conserved domain together with 4 trans-membrane helices and 3 histidine boxes. Phylogenetic analysis validated their identity of dicot microsomal or plastidial ω-3 FAD proteins, and revealed some important evolutionary features of plant ω-3 FAD genes such as convergent evolution across different phylums, single-copy status in algae, and duplication events in certain taxa. The qRT-PCR assay showed that the ω-3 FAD genes of two species were expressed at different levels in various organs, and they also responded to multiple stress treatments. The functionality of the ShFAD3 and PfFAD3 enzymes was confirmed by yeast expression. The systemic molecular and functional features of the ω-3 FAD gene family from chia and perilla revealed in this study will facilitate their use in future studies on genetic improvement of ALA traits in oilseed crops. PMID:29351555

Cottowood Breeding Strategies for the Future

Treesearch

D. T. Cooper

1976-01-01

A large number of genotypes of eastern cottonwood of diverse parentage should be evaluated followed by multiple-stage selection for the most important characters to obtain substantial gains per sexual cycle while retaining genetic diversity. More intensive testing should be practiced in selecting clones tor commercial use than for use as parents of the next generation...

Flavanol Quantification of Grapes via Multiple Reaction Monitoring Mass Spectrometry. Application to Differentiation among Clones of Vitis vinifera L. cv. Rufete Grapes.

PubMed

García-Estévez, Ignacio; Alcalde-Eon, Cristina; Escribano-Bailón, M Teresa

2017-08-09

The determination of the detailed flavanol composition in food matrices is not a simple task because of the structural similarities of monomers and, consequently, oligomers and polymers. The aim of this study was the development and validation of an HPLC-MS/MS-multiple reaction monitoring (MRM) method that would allow the accurate and precise quantification of catechins, gallocatechins, and oligomeric proanthocyanidins. The high correlation coefficients of the calibration curves (>0.993), the recoveries not statistically different from 100%, the good intra- and interday precisions (<5%), and the LOD and LOQ values, low enough to quantify flavanols in grapes, are good results from the method validation procedure. Its usefulness has also been tested by determining the detailed composition of Vitis vinifera L. cv. Rufete grapes. Seventy-two (38 nongalloylated and 34 galloylated) and 53 (24 procyanidins and 29 prodelphinidins) flavanols have been identified and quantified in grape seed and grape skin, respectively. The use of HCA and PCA on the detailed flavanol composition has allowed differentiation among Rufete clones.

Homeologous plastid DNA transformation in tobacco is mediated by multiple recombination events.

PubMed Central

Kavanagh, T A; Thanh, N D; Lao, N T; McGrath, N; Peter, S O; Horváth, E M; Dix, P J; Medgyesy, P

1999-01-01

Efficient plastid transformation has been achieved in Nicotiana tabacum using cloned plastid DNA of Solanum nigrum carrying mutations conferring spectinomycin and streptomycin resistance. The use of the incompletely homologous (homeologous) Solanum plastid DNA as donor resulted in a Nicotiana plastid transformation frequency comparable with that of other experiments where completely homologous plastid DNA was introduced. Physical mapping and nucleotide sequence analysis of the targeted plastid DNA region in the transformants demonstrated efficient site-specific integration of the 7.8-kb Solanum plastid DNA and the exclusion of the vector DNA. The integration of the cloned Solanum plastid DNA into the Nicotiana plastid genome involved multiple recombination events as revealed by the presence of discontinuous tracts of Solanum-specific sequences that were interspersed between Nicotiana-specific markers. Marked position effects resulted in very frequent cointegration of the nonselected peripheral donor markers located adjacent to the vector DNA. Data presented here on the efficiency and features of homeologous plastid DNA recombination are consistent with the existence of an active RecA-mediated, but a diminished mismatch, recombination/repair system in higher-plant plastids. PMID:10388829

Methicillin Resistant Staphylococcus aureus Transmission in a Ghanaian Burn Unit: The Importance of Active Surveillance in Resource-Limited Settings.

PubMed

Amissah, Nana Ama; Buultjens, Andrew H; Ablordey, Anthony; van Dam, Lieke; Opoku-Ware, Ampomah; Baines, Sarah L; Bulach, Dieter; Tetteh, Caitlin S; Prah, Isaac; van der Werf, Tjip S; Friedrich, Alexander W; Seemann, Torsten; van Dijl, Jan Maarten; Stienstra, Ymkje; Stinear, Timothy P; Rossen, John W

2017-01-01

Objectives: Staphylococcus aureus infections in burn patients can lead to serious complications and death. The frequency of S. aureus infection is high in low- and middle-income countries presumably due to limited resources, misuse of antibiotics and poor infection control. The objective of the present study was to apply population genomics to precisely define, for the first time, the transmission of antibiotic resistant S. aureus in a resource-limited setting in sub-Saharan Africa. Methods: Staphylococcus aureus surveillance was performed amongst burn patients and healthcare workers during a 7-months survey within the burn unit of the Korle Bu Teaching Hospital in Ghana. Results: Sixty-six S. aureus isolates (59 colonizing and 7 clinical) were obtained from 31 patients and 10 healthcare workers. Twenty-one of these isolates were ST250-IV methicillin-resistant S. aureus (MRSA). Notably, 25 (81%) of the 31 patients carried or were infected with S. aureus within 24 h of admission. Genome comparisons revealed six distinct S. aureus clones circulating in the burn unit, and demonstrated multiple transmission events between patients and healthcare workers. Further, the collected S. aureus isolates exhibited a wide range of genotypic resistances to antibiotics, including trimethoprim (21%), aminoglycosides (33%), oxacillin (33%), chloramphenicol (50%), tetracycline (59%) and fluoroquinolones (100%). Conclusion: Population genomics uncovered multiple transmission events of S. aureus , especially MRSA, within the investigated burn unit. Our findings highlight lapses in infection control and prevention, and underscore the great importance of active surveillance to protect burn victims against multi-drug resistant pathogens in resource-limited settings.

Comparative study of all Salmonella enterica serovar Enteritidis strains isolated from food and food animals in Greece from 2008 to 2010 with clinical isolates.

PubMed

Papadopoulos, T; Petridou, E; Zdragas, A; Mandilara, G; Nair, S; Peters, T; Chattaway, M; de Pinna, E; Passiotou, M; Vatopoulos, A

2016-05-01

The aim of the present work was to study the epidemiology of Salmonella enterica serovar Enteritidis (S. Enteritidis) in Greece, comparing all the food and food animal isolates during a 3-year period with clinical isolates. Submission of the generated data to the PulseNet Europe database was carried out in order to study the population structure of this particular serovar and indicate possible connections with European strains. One hundred and sixty-eight (168) S. Enteritidis strains of human, animal, and food origin, isolated during the period 2008-2010 in Greece, were studied. Strains were characterized by phenotypic (antibiotic resistance) and molecular [pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST)] methods. PFGE revealed 39 XbaI, 48 BlnI, and 80 XbaI-BlnI distinct pulsotypes, suggesting several clones circulating through the food chain and multiple sources of transmission. Submission to the PulseNet Europe database indicated that PFGE profile SENTXB.0001, the most common PFGE profile in Europe, was also predominant in Greece (33.3 %). MLST showed that all the strains studied shared the same sequence type (ST11), representing the most common ST in Europe. High rates of resistance to nalidixic acid were observed among human and poultry isolates (~25 %), indicating the potential fluoroquinolone treatment failure. Our data suggest that strains originating from multiple reservoirs circulated in Greece through the food chain during the study period. Predominant profiles in Greece were common to PulseNet Europe profiles, indicating similarities between the S. Enteritidis populations in Greece and Europe.

Cloned Erwinia chrysanthemi out genes enable Escherichia coli to selectively secrete a diverse family of heterologous proteins to its milieu.

PubMed Central

He, S Y; Lindeberg, M; Chatterjee, A K; Collmer, A

1991-01-01

The out genes of the enterobacterial plant pathogen Erwinia chrysanthemi are responsible for the efficient extracellular secretion of multiple plant cell wall-degrading enzymes, including four isozymes of pectate lyase, exo-poly-alpha-D-galacturonosidase, pectin methylesterase, and cellulase. Out- mutants of Er. chrysanthemi are unable to export any of these proteins beyond the periplasm and are severely reduced in virulence. We have cloned out genes from Er. chrysanthemi in the stable, low-copy-number cosmid pCPP19 by complementing several transposon-induced mutations. The cloned out genes were clustered in a 12-kilobase chromosomal DNA region, complemented all existing out mutations in Er. chrysanthemi EC16, and enabled Escherichia coli strains to efficiently secrete the extracellular pectic enzymes produced from cloned Er. chrysanthemi genes, while retaining the periplasmic marker protein beta-lactamase. DNA sequencing of a 2.4-kilobase EcoRI fragment within the out cluster revealed four genes arranged colinearly and sharing substantial similarity with the Klebsiella pneumoniae genes pulH, pulI, pulJ, and pulK, which are necessary for pullulanase secretion. However, K. pneumoniae cells harboring the cloned Er. chrysanthemi pelE gene were unable to secrete the Erwinia pectate lyase. Furthermore, the Er. chrysanthemi Out system was unable to secrete an extracellular pectate lyase encoded by a gene from a closely related plant pathogen. Erwinia carotovora ssp. carotovora. The results suggest that these enterobacteria secrete polysaccharidases by a conserved mechanism whose protein-recognition capacities have diverged. Images PMID:1992458

Uniform amplification of phage display libraries in monodisperse emulsions.

PubMed

Matochko, Wadim L; Ng, Simon; Jafari, Mohammad R; Romaniuk, Joseph; Tang, Sindy K Y; Derda, Ratmir

2012-09-01

In this paper, we describe a complete experimental setup for the uniform amplification of libraries of phage. Uniform amplification, which multiplies every phage clone by the same amount irrespective of the growth rate of the clone is essential for phage-display screening. Amplification of phage libraries in a common solution is often non-uniform: it favors fast-growing clones and eliminates those that grow slower. This competition leads to elimination of many useful binding clones, and it is a major barrier to identification of ligands for targets with multiple binding sites such as cells, tissues, or mixtures of proteins. Uniform amplification is achieved by encapsulating individual phage clones into isolated compartments (droplets) of identical volume. Each droplet contains culture medium and an excess of host (Escherichia coli). Here, we describe microfluidics devices that generate mono-disperse droplet-based compartments, and optimal conditions for amplification of libraries of different size. We also describe the detailed synthesis of a perfluoro surfactant, which gives droplets exceptional stability. Droplets stabilized by this compound do not coalesce after many hours in shaking culture. We identified a commercially available compound (Krytox), which destabilizes these droplets to recover the amplified libraries. Overall, uniform amplification is a sequence of three simple steps: (1) encapsulation of mixture of phage and bacteria in droplets using microfluidics; (2) incubation of droplets in a shaking culture; (3) destabilization of droplets to harvest the amplified phage. We anticipate that this procedure can be easily adapted in any academic or industrial laboratory that uses phage display. Copyright © 2012 Elsevier Inc. All rights reserved.

Isolation and Characterization of Highly Replicable Hepatitis C Virus Genotype 1a Strain HCV-RMT

PubMed Central

Arai, Masaaki; Tokunaga, Yuko; Takagi, Asako; Tobita, Yoshimi; Hirata, Yuichi; Ishida, Yuji; Tateno, Chise; Kohara, Michinori

2013-01-01

Multiple genotype 1a clones have been reported, including the very first hepatitis C virus (HCV) clone called H77. The replication ability of some of these clones has been confirmed in vitro and in vivo, although this ability is somehow compromised. We now report a newly isolated genotype 1a clone, designated HCV-RMT, which has the ability to replicate efficiently in patients, chimeric mice with humanized liver, and cultured cells. An authentic subgenomic replicon cell line was established from the HCV-RMT sequence with spontaneous introduction of three adaptive mutations, which were later confirmed to be responsible for efficient replication in HuH-7 cells as both subgenomic replicon RNA and viral genome RNA. Following transfection, the HCV-RMT RNA genome with three adaptive mutations was maintained for more than 2 months in HuH-7 cells. One clone selected from the transfected cells had a high copy number, and its supernatant could infect naïve HuH-7 cells. Direct injection of wild-type HCV-RMT RNA into the liver of chimeric mice with humanized liver resulted in vigorous replication, similar to inoculation with the parental patient’s serum. A study of virus replication using HCV-RMT derivatives with various combinations of adaptive mutations revealed a clear inversely proportional relationship between in vitro and in vivo replication abilities. Thus, we suggest that HCV-RMT and its derivatives are important tools for HCV genotype 1a research and for determining the mechanism of HCV replication in vitro and in vivo. PMID:24358200

Isolation and characterization of highly replicable hepatitis C virus genotype 1a strain HCV-RMT.

PubMed

Arai, Masaaki; Tokunaga, Yuko; Takagi, Asako; Tobita, Yoshimi; Hirata, Yuichi; Ishida, Yuji; Tateno, Chise; Kohara, Michinori

2013-01-01

Multiple genotype 1a clones have been reported, including the very first hepatitis C virus (HCV) clone called H77. The replication ability of some of these clones has been confirmed in vitro and in vivo, although this ability is somehow compromised. We now report a newly isolated genotype 1a clone, designated HCV-RMT, which has the ability to replicate efficiently in patients, chimeric mice with humanized liver, and cultured cells. An authentic subgenomic replicon cell line was established from the HCV-RMT sequence with spontaneous introduction of three adaptive mutations, which were later confirmed to be responsible for efficient replication in HuH-7 cells as both subgenomic replicon RNA and viral genome RNA. Following transfection, the HCV-RMT RNA genome with three adaptive mutations was maintained for more than 2 months in HuH-7 cells. One clone selected from the transfected cells had a high copy number, and its supernatant could infect naïve HuH-7 cells. Direct injection of wild-type HCV-RMT RNA into the liver of chimeric mice with humanized liver resulted in vigorous replication, similar to inoculation with the parental patient's serum. A study of virus replication using HCV-RMT derivatives with various combinations of adaptive mutations revealed a clear inversely proportional relationship between in vitro and in vivo replication abilities. Thus, we suggest that HCV-RMT and its derivatives are important tools for HCV genotype 1a research and for determining the mechanism of HCV replication in vitro and in vivo.

Molecular cloning and characterization of a new basic peroxidase cDNA from soybean hypocotyls infected with Phytophthora sojae f.sp. glycines.

PubMed

Yi, S Y; Hwang, B K

1998-10-31

Differential display techniques were used to isolate cDNA clones corresponding to genes which were expressed in soybean hypocotyls by Phytophthora sojae f.sp. glycines infection. With a partial cDNA clone C20CI4 from the differential display PCR as a probe, a new basic peroxidase cDNA clone, designated GMIPER1, was isolated from a cDNA library of soybean hypocotyls infected with P. sojae f.sp. glycines. Sequence analysis revealed that the peroxidase clone encodes a mature protein of 35,813 Da with a putative signal peptide of 27 amino acids in its N-terminus. The amino acid sequence of the soybean peroxidase GMIPER1 is between 54-75% identical to other plant peroxidases including a soybean seed coat peroxidase. Southern blot analysis indicated that multiple copies of sequences related to GMIPER1 exist in the soybean genome. The mRNAs corresponding to the GMIPER1 cDNA accumulated predominantly in the soybean hypocotyls infected with the incompatible race of P. sojae f.sp. glycines, but were expressed at low levels in the compatible interaction. Soybean GMIPER1 mRNAs were not expressed in hypocotyls, leaves, stems, and roots of soybean seedlings. However, treatments with ethephon, salicylic acid or methyl jasmonate induced the accumulation of the GMIPER1 mRNAs in the different organs of soybean. These results suggest that the GMIPER1 gene encoding a putative pathogen-induced peroxidase may play an important role in induced resistance of soybean to P. sojae f.sp. glycines and in response to various external stresses.

Using msa-2b as a molecular marker for genotyping Mexican isolates of Babesia bovis.

PubMed

Genis, Alma D; Perez, Jocelin; Mosqueda, Juan J; Alvarez, Antonio; Camacho, Minerva; Muñoz, Maria de Lourdes; Rojas, Carmen; Figueroa, Julio V

2009-12-01

Variable merozoite surface antigens of Babesia bovis are exposed glycoproteins having a role in erythrocyte invasion. Members of this gene family include msa-1 and msa-2 (msa-2c, msa-2a(1), msa-2a(2) and msa-2b). To determine the sequence variation among B. bovis Mexican isolates using msa-2b as a genetic marker, PCR amplicons corresponding to msa-2b were cloned and plasmids carrying the corresponding inserts were purified and sequenced. Comparative analysis of nucleotide and deduced amino acid sequences revealed distinct degrees of variability and identity among the coding gene sequences obtained from 16 geographically different Mexican B. bovis isolates and a reference strain. Clustal-W multiple alignments of the MSA-2b deduced amino acid sequences performed with the 17 B. bovis Mexican isolates, revealed the identification of three genotypes with a distinct set each of amino acid residues present at the variable region: Genotype I represented by the MO7 strain (in vitro culture-derived from the Mexico isolate) as well as RAD, Chiapas-1, Tabasco and Veracruz-3 isolates; Genotype II, represented by the Jalisco, Mexico and Veracruz-2 isolates; and Genotype III comprising the sequences from most of the isolates studied, Tamaulipas-1, Chiapas-2, Guerrero-1, Nayarit, Quintana Roo, Nuevo Leon, Tamaulipas-2, Yucatan and Guerrero-2. Moreover, these three genotypes could be discriminated against each other by using a PCR-RFLP approach. The results suggest that occurrence of indels within the variable region of msa-2b sequences can be useful markers for identifying a particular genotype present in field populations of B. bovis isolated from infected cattle in Mexico.

Assembling the Streptococcus thermophilus clustered regularly interspaced short palindromic repeats (CRISPR) array for multiplex DNA targeting.

PubMed

Guo, Lijun; Xu, Kun; Liu, Zhiyuan; Zhang, Cunfang; Xin, Ying; Zhang, Zhiying

2015-06-01

In addition to the advantages of scalable, affordable, and easy to engineer, the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein (Cas) technology is superior for multiplex targeting, which is laborious and inconvenient when achieved by cloning multiple gRNA expressing cassettes. Here, we report a simple CRISPR array assembling method which will facilitate multiplex targeting usage. First, the Streptococcus thermophilus CRISPR3/Cas locus was cloned. Second, different CRISPR arrays were assembled with different crRNA spacers. Transformation assays using different Escherichia coli strains demonstrated efficient plasmid DNA targeting, and we achieved targeting efficiency up to 95% with an assembled CRISPR array with three crRNA spacers. Copyright © 2015 Elsevier Inc. All rights reserved.

Production of Transgenic Pigs with an Introduced Missense Mutation of the Bone Morphogenetic Protein Receptor Type IB Gene Related to Prolificacy.

PubMed

Zhao, Xueyan; Yang, Qiang; Zhao, Kewei; Jiang, Chao; Ren, Dongren; Xu, Pan; He, Xiaofang; Liao, Rongrong; Jiang, Kai; Ma, Junwu; Xiao, Shijun; Ren, Jun; Xing, Yuyun

2016-07-01

In the last few decades, transgenic animal technology has witnessed an increasingly wide application in animal breeding. Reproductive traits are economically important to the pig industry. It has been shown that the bone morphogenetic protein receptor type IB (BMPR1B) A746G polymorphism is responsible for the fertility in sheep. However, this causal mutation exits exclusively in sheep and goat. In this study, we attempted to create transgenic pigs by introducing this mutation with the aim to improve reproductive traits in pigs. We successfully constructed a vector containing porcine BMPR1B coding sequence (CDS) with the mutant G allele of A746G mutation. In total, we obtained 24 cloned male piglets using handmade cloning (HMC) technique, and 12 individuals survived till maturation. A set of polymerase chain reactions indicated that 11 of 12 matured boars were transgene-positive individuals, and that the transgenic vector was most likely disrupted during cloning. Of 11 positive pigs, one (No. 11) lost a part of the terminator region but had the intact promoter and the CDS regions. cDNA sequencing showed that the introduced allele (746G) was expressed in multiple tissues of transgene-positive offspring of No.11. Western blot analysis revealed that BMPR1B protein expression in multiple tissues of transgene-positive F1 piglets was 0.5 to 2-fold higher than that in the transgene-negative siblings. The No. 11 boar showed normal litter size performance as normal pigs from the same breed. Transgene-positive F1 boars produced by No. 11 had higher semen volume, sperm concentration and total sperm per ejaculate than the negative siblings, although the differences did not reached statistical significance. Transgene-positive F1 sows had similar litter size performance to the negative siblings, and more data are needed to adequately assess the litter size performance. In conclusion, we obtained 24 cloned transgenic pigs with the modified porcine BMPR1B CDS using HMC. cDNA sequencing and western blot indicated that the exogenous BMPR1B CDS was successfully expressed in host pigs. The transgenic pigs showed normal litter size performance. However, no significant differences in litter size were found between transgene-positive and negative sows. Our study provides new insight into producing cloned transgenic livestock related to reproductive traits.

The murine ufo receptor: molecular cloning, chromosomal localization and in situ expression analysis.

PubMed

Faust, M; Ebensperger, C; Schulz, A S; Schleithoff, L; Hameister, H; Bartram, C R; Janssen, J W

1992-07-01

We have cloned the mouse homologue of the ufo oncogene. It encodes a novel tyrosine kinase receptor characterized by a unique extracellular domain containing two immunoglobulin-like and two fibronectin type III repeats. Comparison of the predicted ufo amino acid sequences of mouse and man revealed an overall identity of 87.6%. The ufo locus maps to mouse chromosome 7A3-B1 and thereby extends the known conserved linkage group between mouse chromosome 7 and human chromosome 19. RNA in situ hybridization analysis established the onset of specific ufo expression in the late embryogenesis at day 12.5 post coitum (p.c.) and localized ufo transcription to distinct substructures of a broad spectrum of developing tissues (e.g. subepidermal cells of the skin, mesenchymal cells of the periosteum). In adult animals ufo is expressed in cells forming organ capsules as well as in connective tissue structures. ufo may function as a signal transducer between specific cell types of mesodermal origin.

Fate mapping of human glioblastoma reveals an invariant stem cell hierarchy.

PubMed

Lan, Xiaoyang; Jörg, David J; Cavalli, Florence M G; Richards, Laura M; Nguyen, Long V; Vanner, Robert J; Guilhamon, Paul; Lee, Lilian; Kushida, Michelle M; Pellacani, Davide; Park, Nicole I; Coutinho, Fiona J; Whetstone, Heather; Selvadurai, Hayden J; Che, Clare; Luu, Betty; Carles, Annaick; Moksa, Michelle; Rastegar, Naghmeh; Head, Renee; Dolma, Sonam; Prinos, Panagiotis; Cusimano, Michael D; Das, Sunit; Bernstein, Mark; Arrowsmith, Cheryl H; Mungall, Andrew J; Moore, Richard A; Ma, Yussanne; Gallo, Marco; Lupien, Mathieu; Pugh, Trevor J; Taylor, Michael D; Hirst, Martin; Eaves, Connie J; Simons, Benjamin D; Dirks, Peter B

2017-09-14

Human glioblastomas harbour a subpopulation of glioblastoma stem cells that drive tumorigenesis. However, the origin of intratumoural functional heterogeneity between glioblastoma cells remains poorly understood. Here we study the clonal evolution of barcoded glioblastoma cells in an unbiased way following serial xenotransplantation to define their individual fate behaviours. Independent of an evolving mutational signature, we show that the growth of glioblastoma clones in vivo is consistent with a remarkably neutral process involving a conserved proliferative hierarchy rooted in glioblastoma stem cells. In this model, slow-cycling stem-like cells give rise to a more rapidly cycling progenitor population with extensive self-maintenance capacity, which in turn generates non-proliferative cells. We also identify rare 'outlier' clones that deviate from these dynamics, and further show that chemotherapy facilitates the expansion of pre-existing drug-resistant glioblastoma stem cells. Finally, we show that functionally distinct glioblastoma stem cells can be separately targeted using epigenetic compounds, suggesting new avenues for glioblastoma-targeted therapy.

Fate mapping of human glioblastoma reveals an invariant stem cell hierarchy

PubMed Central

Lan, Xiaoyang; Jörg, David J.; Cavalli, Florence M. G.; Richards, Laura M.; Nguyen, Long V.; Vanner, Robert J.; Guilhamon, Paul; Lee, Lilian; Kushida, Michelle; Pellacani, Davide; Park, Nicole I.; Coutinho, Fiona J.; Whetstone, Heather; Selvadurai, Hayden J.; Che, Clare; Luu, Betty; Carles, Annaick; Moksa, Michelle; Rastegar, Naghmeh; Head, Renee; Dolma, Sonam; Prinos, Panagiotis; Cusimano, Michael D.; Das, Sunit; Bernstein, Mark; Arrowsmith, Cheryl H.; Mungall, Andrew J.; Moore, Richard A.; Ma, Yussanne; Gallo, Marco; Lupien, Mathieu; Pugh, Trevor J.; Taylor, Michael D.; Hirst, Martin; Eaves, Connie J.; Simons, Benjamin D.; Dirks, Peter B.

2017-01-01

Summary Human glioblastomas (GBMs) harbour a subpopulation of glioblastoma stem cells (GSCs) that drive tumourigenesis. However, the origin of intra-tumoural functional heterogeneity between GBM cells remains poorly understood. Here we study the clonal evolution of barcoded GBM cells in an unbiased way following serial xenotransplantation to define their individual fate behaviours. Independent of an evolving mutational signature, we show that the growth of GBM clones in vivo is consistent with a remarkably neutral process involving a conserved proliferative hierarchy rooted in GSCs. In this model, slow-cycling stem-like cells give rise to a more rapidly cycling progenitor population with extensive self-maintenance capacity, that in turn generates non-proliferative cells. We also identify rare “outlier” clones that deviate from these dynamics, and further show that chemotherapy facilitates the expansion of pre-existing drug-resistant GSCs. Finally, we show that functionally distinct GSCs can be separately targeted using epigenetic compounds, suggesting new avenues for GBM targeted therapy. PMID:28854171

High-Resolution Genotyping of Streptococcus pyogenes Serotype M1 Isolates by Fluorescent Amplified-Fragment Length Polymorphism Analysis

PubMed Central

Desai, Meeta; Efstratiou, Androulla; George, Robert; Stanley, John

1999-01-01

We have used fluorescent amplified-fragment length polymorphism (FAFLP) analysis to subtype clinical isolates of Streptococcus pyogenes serotype M1. Established typing methods define most M1 isolates as members of a clone that has a worldwide distribution and that is strongly associated with invasive diseases. FAFLP analysis simultaneously sampled 90 to 120 loci throughout the M1 genome. Its discriminatory power, precision, and reproducibility were compared with those of other molecular typing methods. Irrespective of disease symptomatology or geographic origin, the majority of the clinical M1 isolates shared a single ribotype, pulsed-field gel electrophoresis macrorestriction profile, and emm1 gene sequence. Nonetheless, among these isolates, FAFLP analysis could differentiate 17 distinct profiles, including seven multi-isolate groups. The FAFLP profiles of M1 isolates reproducibly exhibited between 1 and more than 20 amplified fragment differences. The high discriminatory power of genotyping by FAFLP analysis revealed genetic microheterogeneity and differentiated otherwise “identical” M1 isolates as members of a clone complex. PMID:10325352

Identification of apoptosis-related PLZF target genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bernardo, Maria Victoria; Yelo, Estefania; Gimeno, Lourdes

2007-07-27

The PLZF gene encodes a BTB/POZ-zinc finger-type transcription factor, involved in physiological development, proliferation, differentiation, and apoptosis. In this paper, we investigate proliferation, survival, and gene expression regulation in stable clones from the human haematopoietic K562, DG75, and Jurkat cell lines with inducible expression of PLZF. In Jurkat cells, but not in K562 and DG75 cells, PLZF induced growth suppression and apoptosis in a cell density-dependent manner. Deletion of the BTB/POZ domain of PLZF abrogated growth suppression and apoptosis. PLZF was expressed with a nuclear speckled pattern distinctively in the full-length PLZF-expressing Jurkat clones, suggesting that the nuclear speckled localizationmore » is required for PLZF-induced apoptosis. By microarray analysis, we identified that the apoptosis-inducer TP53INP1, ID1, and ID3 genes were upregulated, and the apoptosis-inhibitor TERT gene was downregulated. The identification of apoptosis-related PLZF target genes may have biological and clinical relevance in cancer typified by altered PLZF expression.« less

Epigenetic Memory Underlies Cell-Autonomous Heterogeneous Behavior of Hematopoietic Stem Cells.

PubMed

Yu, Vionnie W C; Yusuf, Rushdia Z; Oki, Toshihiko; Wu, Juwell; Saez, Borja; Wang, Xin; Cook, Colleen; Baryawno, Ninib; Ziller, Michael J; Lee, Eunjung; Gu, Hongcang; Meissner, Alexander; Lin, Charles P; Kharchenko, Peter V; Scadden, David T

2016-11-17

Stem cells determine homeostasis and repair of many tissues and are increasingly recognized as functionally heterogeneous. To define the extent of-and molecular basis for-heterogeneity, we overlaid functional, transcriptional, and epigenetic attributes of hematopoietic stem cells (HSCs) at a clonal level using endogenous fluorescent tagging. Endogenous HSC had clone-specific functional attributes over time in vivo. The intra-clonal behaviors were highly stereotypic, conserved under the stress of transplantation, inflammation, and genotoxic injury, and associated with distinctive transcriptional, DNA methylation, and chromatin accessibility patterns. Further, HSC function corresponded to epigenetic configuration but not always to transcriptional state. Therefore, hematopoiesis under homeostatic and stress conditions represents the integrated action of highly heterogeneous clones of HSC with epigenetically scripted behaviors. This high degree of epigenetically driven cell autonomy among HSCs implies that refinement of the concepts of stem cell plasticity and of the stem cell niche is warranted. Copyright © 2016 Elsevier Inc. All rights reserved.

Prospecting Metagenomic Enzyme Subfamily Genes for DNA Family Shuffling by a Novel PCR-based Approach*

PubMed Central

Wang, Qiuyan; Wu, Huili; Wang, Anming; Du, Pengfei; Pei, Xiaolin; Li, Haifeng; Yin, Xiaopu; Huang, Lifeng; Xiong, Xiaolong

2010-01-01

DNA family shuffling is a powerful method for enzyme engineering, which utilizes recombination of naturally occurring functional diversity to accelerate laboratory-directed evolution. However, the use of this technique has been hindered by the scarcity of family genes with the required level of sequence identity in the genome database. We describe here a strategy for collecting metagenomic homologous genes for DNA shuffling from environmental samples by truncated metagenomic gene-specific PCR (TMGS-PCR). Using identified metagenomic gene-specific primers, twenty-three 921-bp truncated lipase gene fragments, which shared 64–99% identity with each other and formed a distinct subfamily of lipases, were retrieved from 60 metagenomic samples. These lipase genes were shuffled, and selected active clones were characterized. The chimeric clones show extensive functional and genetic diversity, as demonstrated by functional characterization and sequence analysis. Our results indicate that homologous sequences of genes captured by TMGS-PCR can be used as suitable genetic material for DNA family shuffling with broad applications in enzyme engineering. PMID:20962349

Kainate receptors coming of age: milestones of two decades of research.

PubMed

Contractor, Anis; Mulle, Christophe; Swanson, Geoffrey T

2011-03-01

Two decades have passed since the first report of the cloning of a kainate-type glutamate receptor (KAR) subunit. The intervening years have seen a rapid growth in our understanding of the biophysical properties and function of KARs in the brain. This research has led to an appreciation that KARs play very distinct roles at synapses relative to other members of the glutamate-gated ion channel receptor family, despite structural and functional commonalities. The surprisingly diverse and complex nature of KAR signaling underlies their unique impact upon neuronal networks through their direct and indirect effects on synaptic transmission, and their prominent role in regulating cell excitability. This review pieces together highlights from the two decades of research subsequent to the cloning of the first subunit, and provides an overview of our current understanding of the role of KARs in the CNS and their potential importance to neurological and neuropsychiatric disorders. Copyright © 2011 Elsevier Ltd. All rights reserved.

Discrete forms of amylose are synthesized by isoforms of GBSSI in pea.

PubMed

Edwards, Anne; Vincken, Jean-Paul; Suurs, Luc C J M; Visser, Richard G F; Zeeman, Sam; Smith, Alison; Martin, Cathie

2002-08-01

Amyloses with distinct molecular masses are found in the starch of pea embryos compared with the starch of pea leaves. In pea embryos, a granule-bound starch synthase protein (GBSSIa) is required for the synthesis of a significant portion of the amylose. However, this protein seems to be insignificant in the synthesis of amylose in pea leaves. cDNA clones encoding a second isoform of GBSSI, GBSSIb, have been isolated from pea leaves. Comparison of GBSSIa and GBSSIb activities shows them to have distinct properties. These differences have been confirmed by the expression of GBSSIa and GBSSIb in the amylose-free mutant of potato. GBSSIa and GBSSIb make distinct forms of amylose that differ in their molecular mass. These differences in product specificity, coupled with differences in the tissues in which GBSSIa and GBSSIb are most active, explain the distinct forms of amylose found in different tissues of pea. The shorter form of amylose formed by GBSSIa confers less susceptibility to the retrogradation of starch pastes than the amylose formed by GBSSIb. The product specificity of GBSSIa could provide beneficial attributes to starches for food and nonfood uses.

Discrete Forms of Amylose Are Synthesized by Isoforms of GBSSI in PeaW⃞

PubMed Central

Edwards, Anne; Vincken, Jean-Paul; Suurs, Luc C. J. M.; Visser, Richard G. F.; Zeeman, Sam; Smith, Alison; Martin, Cathie

2002-01-01

Amyloses with distinct molecular masses are found in the starch of pea embryos compared with the starch of pea leaves. In pea embryos, a granule-bound starch synthase protein (GBSSIa) is required for the synthesis of a significant portion of the amylose. However, this protein seems to be insignificant in the synthesis of amylose in pea leaves. cDNA clones encoding a second isoform of GBSSI, GBSSIb, have been isolated from pea leaves. Comparison of GBSSIa and GBSSIb activities shows them to have distinct properties. These differences have been confirmed by the expression of GBSSIa and GBSSIb in the amylose-free mutant of potato. GBSSIa and GBSSIb make distinct forms of amylose that differ in their molecular mass. These differences in product specificity, coupled with differences in the tissues in which GBSSIa and GBSSIb are most active, explain the distinct forms of amylose found in different tissues of pea. The shorter form of amylose formed by GBSSIa confers less susceptibility to the retrogradation of starch pastes than the amylose formed by GBSSIb. The product specificity of GBSSIa could provide beneficial attributes to starches for food and nonfood uses. PMID:12172021

Molecular analysis and antimicrobial susceptibility of methicillin resistant Staphylococcus aureus in one of the hospitals of Tehran University of Medical Sciences: high prevalence of sequence type 239 (ST239) clone.

PubMed

Shahsavan, Shadi; Jabalameli, Leila; Maleknejad, Parviz; Aligholi, Marzieh; Imaneini, Hossein; Jabalameli, Fereshteh; Halimi, Shahnaz; Taherikalani, Morovat; Khoramian, Babak; Eslampour, Mohammad Amin; Feizabadi, Mohammad Mehdi; Emaneini, Mohammad

2011-03-01

Methicillin-resistant Staphylococcus aureus (MRSA), particularly the multidrug-resistant clones, is an increasing worldwide problem. The average incidence rate of MRSA in Tehran was found to be over 40%. A total of 140 MRSA isolates obtained from patients attending a teaching hospital in Tehran, from May 2009 to December 2009, were included in this study. The antimicrobial susceptibility profile of MRSA isolates was determined by the agar disk diffusion method. Molecular analysis of MRSA strains was accomplished by Pulsed-Field Gel Electrophoresis (PFGE) and Multi-locus sequence typing (MLST). Detection of mecA gene was used to confirm resistance to methicillin among the MRSA isolates. All the MRSA isolates were susceptible to chloramphenicol, teicoplanin, tigecycline and vancomycin. All MRSAisolates were resistant to oxacillin, whilst 139 strains showed resistance against ciprofloxacin, erythromycin, gentamicin, tetracycline and trimethoprim-sulfamethoxazole. PFGE analysis of all the 140 MRSA isolates produced five distinct pulsotypes designated as pulsotypes A-E. Most of the isolates (n=132) were clustered into pulsotype A. The most prevalent sequence type (ST) was ST 239 (pulsotype A) found in 82% (37/45) of the tested isolates. The second most prevalent type was ST 1238 (pulsotypes B, C and D) found in 15% (7/45) of the isolates. The remaining type, ST 8 (pulsotype E) was found in a single isolate. The results of this study indicated that the MRSA clone ST 239 was a major clone in the selected university hospital of Tehran and that it was widely spread among the different wards as well as all the age groups of patients.

Identity, diversity, and molecular phylogeny of the endophytic mycobiota in the roots of rare wild rice (Oryza granulate) from a nature reserve in Yunnan, China.

PubMed

Yuan, Zhi-Lin; Zhang, Chu-Long; Lin, Fu-Cheng; Kubicek, Christian P

2010-03-01

Rice (Oryza sativa L.) is, on a global scale, one of the most important food crops. Although endophytic fungi and bacteria associated with rice have been investigated, little is known about the endophytic fungi of wild rice (Oryza granulate) in China. Here we studied the root endophytic mycobiota residing in roots of O. granulate by the use of an integrated approach consisting of microscopy, cultivation, ecological indices, and direct PCR. Microscopy confirmed the ubiquitousness of dark septate endophytes (DSEs) and sclerotium-like structures in root tissues. Isolations from 204 root segments from 15 wild rice plants yielded 58 isolates, for which 31 internal transcribed spacer (ITS)-based genotypes were recorded. The best BLAST match indicated that 34.5% of all taxa encountered may represent hitherto undescribed species. Most of the fungi were isolated with a very low frequency. Calculation of ecological indices and estimation of taxon accumulation curves indicated a high diversity of fungal species. A culture-independent approach was also performed to analyze the endophytic fungal community. Three individual clone libraries were constructed. Using a threshold of 90% similarity, 35 potentially different sequences (phylotypes) were found among 186 positive clones. Phylogenetic analysis showed that frequently detected clones were classified as Basidiomycota, and 60.2% of total analyzed clones were affiliated with unknown taxa. Exophiala, Cladophialophora, Harpophora, Periconia macrospinosa, and the Ceratobasidium/Rhizoctonia complex may act as potential DSE groups. A comparison of the fungal communities characterized by the two approaches demonstrated distinctive fungal groups, and only a few taxa overlapped. Our findings indicate a complex and rich endophytic fungal consortium in wild rice roots, thus offering a potential bioresource for establishing a novel model of plant-fungal mutualistic interactions.

Transcriptome Sequencing of Hevea brasiliensis for Development of Microsatellite Markers and Construction of a Genetic Linkage Map

PubMed Central

Triwitayakorn, Kanokporn; Chatkulkawin, Pornsupa; Kanjanawattanawong, Supanath; Sraphet, Supajit; Yoocha, Thippawan; Sangsrakru, Duangjai; Chanprasert, Juntima; Ngamphiw, Chumpol; Jomchai, Nukoon; Therawattanasuk, Kanikar; Tangphatsornruang, Sithichoke

2011-01-01

To obtain more information on the Hevea brasiliensis genome, we sequenced the transcriptome from the vegetative shoot apex yielding 2 311 497 reads. Clustering and assembly of the reads produced a total of 113 313 unique sequences, comprising 28 387 isotigs and 84 926 singletons. Also, 17 819 expressed sequence tag (EST)-simple sequence repeats (SSRs) were identified from the data set. To demonstrate the use of this EST resource for marker development, primers were designed for 430 of the EST-SSRs. Three hundred and twenty-three primer pairs were amplifiable in H. brasiliensis clones. Polymorphic information content values of selected 47 SSRs among 20 H. brasiliensis clones ranged from 0.13 to 0.71, with an average of 0.51. A dendrogram of genetic similarities between the 20 H. brasiliensis clones using these 47 EST-SSRs suggested two distinct groups that correlated well with clone pedigree. These novel EST-SSRs together with the published SSRs were used for the construction of an integrated parental linkage map of H. brasiliensis based on 81 lines of an F1 mapping population. The map consisted of 97 loci, consisting of 37 novel EST-SSRs and 60 published SSRs, distributed on 23 linkage groups and covered 842.9 cM with a mean interval of 11.9 cM and ∼4 loci per linkage group. Although the numbers of linkage groups exceed the haploid number (18), but with several common markers between homologous linkage groups with the previous map indicated that the F1 map in this study is appropriate for further study in marker-assisted selection. PMID:22086998