The Kinetic Mechanism for DNA Unwinding by Multiple Molecules of Dda Helicase Aligned on DNA†
Eoff, Robert L.; Raney, Kevin D.
2010-01-01
Helicases catalyze the separation of double-stranded nucleic acids to form single-stranded intermediates. Using transient state kinetic methods we have determined the kinetic properties of DNA unwinding under conditions that favor a monomeric form of the Dda helicase as well as conditions that allow multiple molecules to function on the same substrate. Multiple helicase molecules can align like a train on the DNA track. The number of base pairs unwound in a single binding event for Dda is increased from ~19 bp for the monomeric form to ~64 bp when as many as four Dda molecules are aligned on the same substrate, while the kinetic step-size (3.2 ± 0.7 bp) and unwinding rate (242 ± 25 bp s−1) appear to be independent of the number of Dda molecules present on a given substrate. The data support a model in which the helicase molecules bound to the same substrate move along the DNA track independently during DNA unwinding. The observed increase in processivity arises from the increased probability that at least one of the helicases will completely unwind the DNA prior to dissociation. These results are in contrast to previous reports in which multiple Dda molecules on the same track greatly enhanced the rate and amplitude for displacement of protein blocks on the track. Therefore, only when the progress of the lead molecule in the train is impeded by some type of block, such as a protein bound to DNA, do the trailing molecules interact with the lead molecule in order to overcome the block. The fact that trailing helicase molecules have little impact on the lead molecule in the train during routine DNA unwinding suggests that the trailing molecules are moving at similar rates as the lead molecule. This result implicates a step in the translocation mechanism as contributing greatly to the overall rate-limiting step for unwinding of duplex DNA. PMID:20408588
Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions
Gardner, Shea N [San Leandro, CA; Mariella, Jr., Raymond P.; Christian, Allen T [Tracy, CA; Young, Jennifer A [Berkeley, CA; Clague, David S [Livermore, CA
2011-01-18
A method of fabricating a DNA molecule of user-defined sequence. The method comprises the steps of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an even or odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths. In one embodiment starting sequence fragments are of different lengths, n, n+1, n+2, etc.
Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions
Gardner, Shea N; Mariella, Jr., Raymond P; Christian, Allen T; Young, Jennifer A; Clague, David S
2013-06-25
A method of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths.
Single-molecule dilution and multiple displacement amplification for molecular haplotyping.
Paul, Philip; Apgar, Josh
2005-04-01
Separate haploid analysis is frequently required for heterozygous genotyping to resolve phase ambiguity or confirm allelic sequence. We demonstrate a technique of single-molecule dilution followed by multiple strand displacement amplification to haplotype polymorphic alleles. Dilution of DNA to haploid equivalency, or a single molecule, is a simple method for separating di-allelic DNA. Strand displacement amplification is a robust method for non-specific DNA expansion that employs random hexamers and phage polymerase Phi29 for double-stranded DNA displacement and primer extension, resulting in high processivity and exceptional product length. Single-molecule dilution was followed by strand displacement amplification to expand separated alleles to microgram quantities of DNA for more efficient haplotype analysis of heterozygous genes.
DNA melting profiles from a matrix method.
Poland, Douglas
2004-02-05
In this article we give a new method for the calculation of DNA melting profiles. Based on the matrix formulation of the DNA partition function, the method relies for its efficiency on the fact that the required matrices are very sparse, essentially reducing matrix multiplication to vector multiplication and thus making the computer time required to treat a DNA molecule containing N base pairs proportional to N(2). A key ingredient in the method is the result that multiplication by the inverse matrix can also be reduced to vector multiplication. The task of calculating the melting profile for the entire genome is further reduced by treating regions of the molecule between helix-plateaus, thus breaking the molecule up into independent parts that can each be treated individually. The method is easily modified to incorporate changes in the assignment of statistical weights to the different structural features of DNA. We illustrate the method using the genome of Haemophilus influenzae. Copyright 2003 Wiley Periodicals, Inc.
Functional helicoidal model of DNA molecule with elastic nonlinearity
NASA Astrophysics Data System (ADS)
Tseytlin, Y. M.
2013-06-01
We constructed a functional DNA molecule model on the basis of a flexible helicoidal sensor, specifically, a pretwisted hollow nano-strip. We study in this article the helicoidal nano- sensor model with a pretwisted strip axial extension corresponding to the overstretching transition of DNA from dsDNA to ssDNA. Our model and the DNA molecule have similar geometrical and nonlinear mechanical features unlike models based on an elastic rod, accordion bellows, or an imaginary combination of "multiple soft and hard linear springs", presented in some recent publications.
Development of novel vaccines using DNA shuffling and screening strategies.
Locher, Christopher P; Soong, Nay Wei; Whalen, Robert G; Punnonen, Juha
2004-02-01
DNA shuffling and screening technologies recombine and evolve genes in vitro to rapidly obtain molecules with improved biological activity and fitness. In this way, genes from related strains are bred like plants or livestock and their successive progeny are selected. These technologies have also been called molecular breeding-directed molecular evolution. Recent developments in bioinformatics-assisted computer programs have facilitated the design, synthesis and analysis of DNA shuffled libraries of chimeric molecules. New applications in vaccine development are among the key features of DNA shuffling and screening technologies because genes from several strains or antigenic variants of pathogens can be recombined to create novel molecules capable of inducing immune responses that protect against infections by multiple strains of pathogens. In addition, molecules such as co-stimulatory molecules and cytokines have been evolved to have improved T-cell proliferation and cytokine production compared with the wild-type human molecules. These molecules can be used to immunomodulate vaccine responsiveness and have multiple applications in infectious diseases, cancer, allergy and autoimmunity. Moreover, DNA shuffling and screening technologies can facilitate process development of vaccine manufacturing through increased expression of recombinant polypeptides and viruses. Therefore, DNA shuffling and screening technologies can overcome some of the challenges that vaccine development currently faces.
Multiplexed Sequence Encoding: A Framework for DNA Communication.
Zakeri, Bijan; Carr, Peter A; Lu, Timothy K
2016-01-01
Synthetic DNA has great propensity for efficiently and stably storing non-biological information. With DNA writing and reading technologies rapidly advancing, new applications for synthetic DNA are emerging in data storage and communication. Traditionally, DNA communication has focused on the encoding and transfer of complete sets of information. Here, we explore the use of DNA for the communication of short messages that are fragmented across multiple distinct DNA molecules. We identified three pivotal points in a communication-data encoding, data transfer & data extraction-and developed novel tools to enable communication via molecules of DNA. To address data encoding, we designed DNA-based individualized keyboards (iKeys) to convert plaintext into DNA, while reducing the occurrence of DNA homopolymers to improve synthesis and sequencing processes. To address data transfer, we implemented a secret-sharing system-Multiplexed Sequence Encoding (MuSE)-that conceals messages between multiple distinct DNA molecules, requiring a combination key to reveal messages. To address data extraction, we achieved the first instance of chromatogram patterning through multiplexed sequencing, thereby enabling a new method for data extraction. We envision these approaches will enable more widespread communication of information via DNA.
Whitley, Corinna; Gunst, Karin; Müller, Hermann; Funk, Mathis; zur Hausen, Harald
2014-01-01
Epidemiological data point to the involvement of a cow milk factor in the etiology of multiple sclerosis (MS). Eleven circular DNA molecules closely related to transmissible spongiform encephalopathy (TSE)-associated isolate Sphinx 1.76 were isolated from healthy cattle serum, cow milk, and serum and brain tissue from MS patients. PMID:25169859
Enhanced post wash retention of combed DNA molecules by varying multiple combing parameters.
Yadav, Hemendra; Sharma, Pulkit
2017-11-01
Recent advances in genomics have created a need for efficient techniques for deciphering information hidden in various genomes. Single molecule analysis is one such technique to understand molecular processes at single molecule level. Fiber- FISH performed with the help of DNA combing can help us in understanding genetic rearrangements and changes in genome at single DNA molecule level. For performing Fiber-FISH we need high retention of combed DNA molecules post wash as Fiber-FISH requires profuse washing. We optimized combing process involving combing solution, method of DNA mounting on glass slides and coating of glass slides to enhance post-wash retention of DNA molecules. It was found that average number of DNA molecules observed post-wash per field of view was maximum with our optimized combing solution. APTES coated glass slides showed lesser retention than PEI surface but fluorescent intensity was higher in case of APTES coated surface. Capillary method used to mount DNA on glass slides also showed lesser retention but straight DNA molecules were observed as compared to force flow method. Copyright © 2017 Elsevier Inc. All rights reserved.
Preparation and self-folding of amphiphilic DNA origami.
Zhou, Chao; Wang, Dianming; Dong, Yuanchen; Xin, Ling; Sun, Yawei; Yang, Zhongqiang; Liu, Dongsheng
2015-03-01
Amphiphilic DNA origami is prepared by dressing multiple hydrophobic molecules on a rectangular single layer DNA origami, which is then folded or coupled in sandwich-like structures with two outer DNA origami layer and one inner hydrophobic molecules layer. The preference to form different kinds of structures could be tailored by rational design of DNA origami. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Multiplexed Sequence Encoding: A Framework for DNA Communication
Zakeri, Bijan; Carr, Peter A.; Lu, Timothy K.
2016-01-01
Synthetic DNA has great propensity for efficiently and stably storing non-biological information. With DNA writing and reading technologies rapidly advancing, new applications for synthetic DNA are emerging in data storage and communication. Traditionally, DNA communication has focused on the encoding and transfer of complete sets of information. Here, we explore the use of DNA for the communication of short messages that are fragmented across multiple distinct DNA molecules. We identified three pivotal points in a communication—data encoding, data transfer & data extraction—and developed novel tools to enable communication via molecules of DNA. To address data encoding, we designed DNA-based individualized keyboards (iKeys) to convert plaintext into DNA, while reducing the occurrence of DNA homopolymers to improve synthesis and sequencing processes. To address data transfer, we implemented a secret-sharing system—Multiplexed Sequence Encoding (MuSE)—that conceals messages between multiple distinct DNA molecules, requiring a combination key to reveal messages. To address data extraction, we achieved the first instance of chromatogram patterning through multiplexed sequencing, thereby enabling a new method for data extraction. We envision these approaches will enable more widespread communication of information via DNA. PMID:27050646
Scheible, Max B; Pardatscher, Günther; Kuzyk, Anton; Simmel, Friedrich C
2014-03-12
The combination of molecular self-assembly based on the DNA origami technique with lithographic patterning enables the creation of hierarchically ordered nanosystems, in which single molecules are positioned at precise locations on multiple length scales. Based on a hybrid assembly protocol utilizing DNA self-assembly and electron-beam lithography on transparent glass substrates, we here demonstrate a DNA origami microarray, which is compatible with the requirements of single molecule fluorescence and super-resolution microscopy. The spatial arrangement allows for a simple and reliable identification of single molecule events and facilitates automated read-out and data analysis. As a specific application, we utilize the microarray to characterize the performance of DNA strand displacement reactions localized on the DNA origami structures. We find considerable variability within the array, which results both from structural variations and stochastic reaction dynamics prevalent at the single molecule level.
Keyamura, Kenji; Fujikawa, Norie; Ishida, Takuma; Ozaki, Shogo; Su’etsugu, Masayuki; Fujimitsu, Kazuyuki; Kagawa, Wataru; Yokoyama, Shigeyuki; Kurumizaka, Hitoshi; Katayama, Tsutomu
2007-01-01
Escherichia coli DiaA is a DnaA-binding protein that is required for the timely initiation of chromosomal replication during the cell cycle. In this study, we determined the crystal structure of DiaA at 1.8 Å resolution. DiaA forms a homotetramer consisting of a symmetrical pair of homodimers. Mutational analysis revealed that the DnaA-binding activity and formation of homotetramers are required for the stimulation of initiation by DiaA. DiaA tetramers can bind multiple DnaA molecules simultaneously. DiaA stimulated the assembly of multiple DnaA molecules on oriC, conformational changes in ATP–DnaA-specific initiation complexes, and unwinding of oriC duplex DNA. The mutant DiaA proteins are defective in these stimulations. DiaA associated also with ADP–DnaA, and stimulated the assembly of inactive ADP–DnaA–oriC complexes. Specific residues in the putative phosphosugar-binding motif of DiaA were required for the stimulation of initiation and formation of ATP–DnaA-specific–oriC complexes. Our data indicate that DiaA regulates initiation by a novel mechanism, in which DiaA tetramers most likely bind to multiple DnaA molecules and stimulate the assembly of specific ATP–DnaA–oriC complexes. These results suggest an essential role for DiaA in the promotion of replication initiation in a cell cycle coordinated manner. PMID:17699754
Horn, T; Chang, C A; Urdea, M S
1997-12-01
The divergent synthesis of branched DNA (bDNA) comb structures is described. This new type of bDNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branch network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb structures were assembled on a solid support and several synthesis parameters were investigated and optimized. The bDNA comb molecules were characterized by polyacrylamide gel electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The developed chemistry allows synthesis of bDNA comb molecules containing multiple secondary sequences. In the accompanying article we describe the synthesis and characterization of large bDNA combs containing all four deoxynucleotides for use as signal amplifiers in nucleic acid quantification assays.
Horn, T; Chang, C A; Urdea, M S
1997-01-01
The divergent synthesis of branched DNA (bDNA) comb structures is described. This new type of bDNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branch network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb structures were assembled on a solid support and several synthesis parameters were investigated and optimized. The bDNA comb molecules were characterized by polyacrylamide gel electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The developed chemistry allows synthesis of bDNA comb molecules containing multiple secondary sequences. In the accompanying article we describe the synthesis and characterization of large bDNA combs containing all four deoxynucleotides for use as signal amplifiers in nucleic acid quantification assays. PMID:9365265
NASA Astrophysics Data System (ADS)
Reiß, Edda; Hölzel, Ralph; von Nickisch-Rosenegk, Markus; Bier, Frank F.
2006-09-01
In this article the usefulness of the enzyme phi29 DNA polymerase and the principle of rolling circle amplification (RCA) for creating single-stranded DNA (ssDNA) nanostructures is described. Currently we are working on the spatial orientation of a growing ssDNA molecule during its RCA-based synthesis by the application of a hydrodynamic force. Starting at an immobilized primer at single molecule level, the aim is to construct a nanostructure of known location and orientation, providing multiple repeating binding sites that can be addressed via complementary base-pairing. Proof-of-principle experiments demonstrate the potential of the enzymatic reaction. ssDNA molecules of more than 20 μm length were created at an immobilized primer and detected by means of fluorescence microscopy.
Li, Chen-Chen; Zhang, Yan; Tang, Bo; Zhang, Chun-Yang
2018-06-05
We combine single-molecule detection with magnetic separation for simultaneous measurement of human 8-oxoG DNA glycosylase 1 (hOGG1) and uracil DNA glycosylase (UDG) based on excision repair-initiated endonuclease IV (Endo IV)-assisted signal amplification. This method can sensitively detect multiple DNA glycosylases, and it can be further applied for the simultaneous measurement of enzyme kinetic parameters and screening of both hOGG1 and UDG inhibitors.
Antibody-Mediated Small Molecule Detection Using Programmable DNA-Switches.
Rossetti, Marianna; Ippodrino, Rudy; Marini, Bruna; Palleschi, Giuseppe; Porchetta, Alessandro
2018-06-13
The development of rapid, cost-effective, and single-step methods for the detection of small molecules is crucial for improving the quality and efficiency of many applications ranging from life science to environmental analysis. Unfortunately, current methodologies still require multiple complex, time-consuming washing and incubation steps, which limit their applicability. In this work we present a competitive DNA-based platform that makes use of both programmable DNA-switches and antibodies to detect small target molecules. The strategy exploits both the advantages of proximity-based methods and structure-switching DNA-probes. The platform is modular and versatile and it can potentially be applied for the detection of any small target molecule that can be conjugated to a nucleic acid sequence. Here the rational design of programmable DNA-switches is discussed, and the sensitive, rapid, and single-step detection of different environmentally relevant small target molecules is demonstrated.
Control of microtubule trajectory within an electric field by altering surface charge density
Isozaki, Naoto; Ando, Suguru; Nakahara, Tasuku; Shintaku, Hirofumi; Kotera, Hidetoshi; Meyhöfer, Edgar; Yokokawa, Ryuji
2015-01-01
One of challenges for using microtubules (MTs) driven by kinesin motors in microfluidic environments is to control their direction of movement. Although applying physical biases to rectify MTs is prevalent, it has not been established as a design methodology in conjunction with microfluidic devices. In the future, the methodology is expected to achieve functional motor-driven nanosystems. Here, we propose a method to guide kinesin-propelled MTs in multiple directions under an electric field by designing a charged surface of MT minus ends labeled with dsDNA via a streptavidin-biotin interaction. MTs labeled with 20-bp or 50-bp dsDNA molecules showed significantly different trajectories according to the DNA length, which were in good agreement with values predicted from electrophoretic mobilities measured for their minus ends. Since the effective charge of labeled DNA molecules was equal to that of freely dispersed DNA molecules in a buffer solution, MT trajectory could be estimated by selecting labeling molecules with known charges. Moreover, the estimated trajectory enables to define geometrical sizes of a microfluidic device. This rational molecular design and prediction methodology allows MTs to be guided in multiple directions, demonstrating the feasibility of using molecular sorters driven by motor proteins. PMID:25567007
Control of microtubule trajectory within an electric field by altering surface charge density.
Isozaki, Naoto; Ando, Suguru; Nakahara, Tasuku; Shintaku, Hirofumi; Kotera, Hidetoshi; Meyhöfer, Edgar; Yokokawa, Ryuji
2015-01-08
One of challenges for using microtubules (MTs) driven by kinesin motors in microfluidic environments is to control their direction of movement. Although applying physical biases to rectify MTs is prevalent, it has not been established as a design methodology in conjunction with microfluidic devices. In the future, the methodology is expected to achieve functional motor-driven nanosystems. Here, we propose a method to guide kinesin-propelled MTs in multiple directions under an electric field by designing a charged surface of MT minus ends labeled with dsDNA via a streptavidin-biotin interaction. MTs labeled with 20-bp or 50-bp dsDNA molecules showed significantly different trajectories according to the DNA length, which were in good agreement with values predicted from electrophoretic mobilities measured for their minus ends. Since the effective charge of labeled DNA molecules was equal to that of freely dispersed DNA molecules in a buffer solution, MT trajectory could be estimated by selecting labeling molecules with known charges. Moreover, the estimated trajectory enables to define geometrical sizes of a microfluidic device. This rational molecular design and prediction methodology allows MTs to be guided in multiple directions, demonstrating the feasibility of using molecular sorters driven by motor proteins.
Design, synthesis and DNA-binding study of some novel morpholine linked thiazolidinone derivatives
NASA Astrophysics Data System (ADS)
War, Javeed Ahmad; Srivastava, Santosh Kumar; Srivastava, Savitri Devi
2017-02-01
The emergence of multiple drug resistance amongst bacterial strains resulted in many clinical drugs to be ineffective. Being vulnerable to bacterial infections any lack in the development of new antimicrobial drugs could pose a serious threat to public health. Here we report design and synthesis of a novel class of morpholine linked thiazolidinone hybrid molecules. The compounds were characterized by FT-IR, NMR and HRMS techniques. Susceptibility tests showed that most of the synthesized molecules were highly active against multiple bacterial strains. Compound 3f displayed MIC values which were better than the standard drug for most of the tested strains. DNA being a well defined target for many antimicrobial drugs was probed as possible target for these synthetic molecules. DNA-binding study of 3f with sm-DNA was probed through UV-vis absorption, fluorescence quenching, gel electrophoresis and molecular docking techniques. The studies revealed that compound 3f has strong affinity towards DNA and binds at the minor groove. The docking studies revealed that the compound 3f shows preferential binding towards A/T residues.
Design, synthesis and DNA-binding study of some novel morpholine linked thiazolidinone derivatives.
War, Javeed Ahmad; Srivastava, Santosh Kumar; Srivastava, Savitri Devi
2017-02-15
The emergence of multiple drug resistance amongst bacterial strains resulted in many clinical drugs to be ineffective. Being vulnerable to bacterial infections any lack in the development of new antimicrobial drugs could pose a serious threat to public health. Here we report design and synthesis of a novel class of morpholine linked thiazolidinone hybrid molecules. The compounds were characterized by FT-IR, NMR and HRMS techniques. Susceptibility tests showed that most of the synthesized molecules were highly active against multiple bacterial strains. Compound 3f displayed MIC values which were better than the standard drug for most of the tested strains. DNA being a well defined target for many antimicrobial drugs was probed as possible target for these synthetic molecules. DNA-binding study of 3f with sm-DNA was probed through UV-vis absorption, fluorescence quenching, gel electrophoresis and molecular docking techniques. The studies revealed that compound 3f has strong affinity towards DNA and binds at the minor groove. The docking studies revealed that the compound 3f shows preferential binding towards A/T residues. Copyright © 2016 Elsevier B.V. All rights reserved.
The Brain Physics: Multi Laser Beam Interaction with the Brain Topions (the Brain Neurocenters)
NASA Astrophysics Data System (ADS)
Stefan, V. Alexander
2015-03-01
A novel method for the treatment of the neurological diseases is proposed. The multiple-energy laser photons (the blue scanning photons and ultraviolet focusing photons) interact with the specific DNA molecules within the topion (such as Parkinson's and Alzheimer's brain topion) via the matching of laser frequency with the oscillation eigen-frequency of a particular molecule within the DNA. In this way, the corrupt molecules (the structure of molecules) can be manipulated so as to treat (eliminate) the neurological disease. Supported by Nikola Tesla Labs, Stefan University.
Fu, Hua-Hua; Gu, Lei; Wu, Dan-Dan; Zhang, Zu-Quan
2015-04-28
We report a theoretical study highlighting the thermoelectric properties of biological and synthetic DNA molecules. Based on an effective tight-binding model of duplex DNA and by using the nonequilibrium Green's function technique, the thermal conductance, electrical conductance, Seebeck coefficient and thermoelectric figure of merit in the system are numerically calculated by varying the asymmetries of energies and electronic hoppings in the backbone sites to simulate the environmental complications and fluctuations. We find that due to the multiple transport paths in the DNA molecule, the Fano antiresonance occurs, and enhances the Seebeck coefficient and the figure of merit. When the energy difference is produced in every opposite backbone site, the Dicke effect appears. This effect gives rise to a semiconducting-metallic transition, and enhances the thermoelectric efficiency of the DNA molecule remarkably. Moreover, as the Fano antiresonance point is close to the Dicke resonance one, a giant enhancement in the thermoelectric figure of merit in the DNA molecule has been found. These results provide a scenario to obtain effective routes to enhance the thermoelectric efficiency in the DNA molecules, and suggest perspectives for future experiments intending to control the thermoelectric transport in DNA-like nanodevices.
Second-generation DNA-templated macrocycle libraries for the discovery of bioactive small molecules.
Usanov, Dmitry L; Chan, Alix I; Maianti, Juan Pablo; Liu, David R
2018-07-01
DNA-encoded libraries have emerged as a widely used resource for the discovery of bioactive small molecules, and offer substantial advantages compared with conventional small-molecule libraries. Here, we have developed and streamlined multiple fundamental aspects of DNA-encoded and DNA-templated library synthesis methodology, including computational identification and experimental validation of a 20 × 20 × 20 × 80 set of orthogonal codons, chemical and computational tools for enhancing the structural diversity and drug-likeness of library members, a highly efficient polymerase-mediated template library assembly strategy, and library isolation and purification methods. We have integrated these improved methods to produce a second-generation DNA-templated library of 256,000 small-molecule macrocycles with improved drug-like physical properties. In vitro selection of this library for insulin-degrading enzyme affinity resulted in novel insulin-degrading enzyme inhibitors, including one of unusual potency and novel macrocycle stereochemistry (IC 50 = 40 nM). Collectively, these developments enable DNA-templated small-molecule libraries to serve as more powerful, accessible, streamlined and cost-effective tools for bioactive small-molecule discovery.
Kaufman, Brett A.; Durisic, Nela; Mativetsky, Jeffrey M.; Costantino, Santiago; Hancock, Mark A.; Grutter, Peter
2007-01-01
Packaging DNA into condensed structures is integral to the transmission of genomes. The mammalian mitochondrial genome (mtDNA) is a high copy, maternally inherited genome in which mutations cause a variety of multisystem disorders. In all eukaryotic cells, multiple mtDNAs are packaged with protein into spheroid bodies called nucleoids, which are the fundamental units of mtDNA segregation. The mechanism of nucleoid formation, however, remains unknown. Here, we show that the mitochondrial transcription factor TFAM, an abundant and highly conserved High Mobility Group box protein, binds DNA cooperatively with nanomolar affinity as a homodimer and that it is capable of coordinating and fully compacting several DNA molecules together to form spheroid structures. We use noncontact atomic force microscopy, which achieves near cryo-electron microscope resolution, to reveal the structural details of protein–DNA compaction intermediates. The formation of these complexes involves the bending of the DNA backbone, and DNA loop formation, followed by the filling in of proximal available DNA sites until the DNA is compacted. These results indicate that TFAM alone is sufficient to organize mitochondrial chromatin and provide a mechanism for nucleoid formation. PMID:17581862
Sub-Ensemble Monitoring of DNA Strand Displacement Using Multiparameter Single-Molecule FRET.
Baltierra-Jasso, Laura E; Morten, Michael J; Magennis, Steven W
2018-03-05
Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here, we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constant of 10 m -1 s -1 . We also followed the displacement from a DNA three-way junction (3WJ) by ssDNA. The presence of three internal mismatched bases in the middle of the invading strand did not prevent displacement from the 3WJ, but reduced the second-order rate constant by about 50 %. We attribute strand exchange in the dsDNA and 3WJ to a zero-toehold pathway from the blunt-ended duplex arms. The single-molecule approach demonstrated here will be useful for studying complex DNA networks. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Structure of nascent replicative form DNA of coliphage M13
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dasgupta, S.; Mitra, S.
Nascent replicative form type II (RFII) DNA of coliphage M13 synthesized in an Escherichia coli mutant deficient in the 5' ..-->.. 3' exonuclease associated with DNA polymerase I contains ribonucleotides that are retained in the covalently closed RFI DNA sealed in vitro by the joint action of T5 phage DNA polymerase and T4 phage DNA ligase. These RFI molecules are labile to alkali and RNase H, unlike the RFI produced either in vivo or from RFII with E. coli DNA polymerase I and E. coli DNA ligase. The ribonucleotides are located at one site and predominantly in one strand ofmore » the nascent RF DNA. Furthermore, these molecules contain multiple small gaps, randomly located, and one large gap in the intracistronic region.« less
Digitally encoded DNA nanostructures for multiplexed, single-molecule protein sensing with nanopores
NASA Astrophysics Data System (ADS)
Bell, Nicholas A. W.; Keyser, Ulrich F.
2016-07-01
The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.
Bell, Nicholas A W; Keyser, Ulrich F
2016-07-01
The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.
Torsional stress in DNA limits collaboration among reverse gyrase molecules.
Ogawa, Taisaku; Sutoh, Kazuo; Kikuchi, Akihiko; Kinosita, Kazuhiko
2016-04-01
Reverse gyrase is an enzyme that can overwind (introduce positive supercoils into) DNA using the energy obtained from ATP hydrolysis. The enzyme is found in hyperthermophiles, and the overwinding reaction generally requires a temperature above 70 °C. In a previous study using microscopy, we have shown that 30 consecutive mismatched base pairs (a bubble) in DNA serve as a well-defined substrate site for reverse gyrase, warranting the processive overwinding activity down to 50 °C. Here, we inquire how multiple reverse gyrase molecules may collaborate with each other in overwinding one DNA molecule. We introduced one, two, or four bubbles in a linear DNA that tethered a magnetic bead to a coverslip surface. At 40-71 °C in the presence of reverse gyrase, the bead rotated clockwise as viewed from above, to relax the DNA twisted by reverse gyrase. Dependence on the enzyme concentration indicated that each bubble binds reverse gyrase tightly (dissociation constant < 0.1 nm) and that bound enzyme continuously overwinds DNA for > 5 min. Rotation with two bubbles was significantly faster compared with one bubble, indicating that overwinding actions are basically additive, but four bubbles did not show further acceleration except at 40 °C where the activity was very low. The apparent saturation is due to the hydrodynamic friction against the rotating bead, as confirmed by increasing the medium viscosity. When torsional stress in the DNA, determined by the friction, approaches ~ 7 pN·nm (at 71 °C), the overwinding activity of reverse gyrase drops sharply. Multiple molecules of reverse gyrase collaborate additively within this limit. © 2016 The Authors. The FEBS Journal published by John Wiley & Sons Ltd on behalf of Federation of European Biochemical Societies.
Skinner, Gary M; Baumann, Christoph G; Quinn, Diana M; Molloy, Justin E; Hoggett, James G
2004-01-30
A single-molecule transcription assay has been developed that allows, for the first time, the direct observation of promoter binding, initiation, and elongation by a single RNA polymerase (RNAP) molecule in real-time. To promote DNA binding and transcription initiation, a DNA molecule tethered between two optically trapped beads was held near a third immobile surface bead sparsely coated with RNAP. By driving the optical trap holding the upstream bead with a triangular oscillation while measuring the position of both trapped beads, we observed the onset of promoter binding, promoter escape (productive initiation), and processive elongation by individual RNAP molecules. After DNA template release, transcription re-initiation on the same DNA template is possible; thus, multiple enzymatic turnovers by an individual RNAP molecule can be observed. Using bacteriophage T7 RNAP, a commonly used RNAP paradigm, we observed the association and dissociation (k(off)= 2.9 s(-1)) of T7 RNAP and promoter DNA, the transition to the elongation mode (k(for) = 0.36 s(-1)), and the processive synthesis (k(pol) = 43 nt s(-1)) and release of a gene-length RNA transcript ( approximately 1200 nt). The transition from initiation to elongation is much longer than the mean lifetime of the binary T7 RNAP-promoter DNA complex (k(off) > k(for)), identifying a rate-limiting step between promoter DNA binding and promoter escape.
DNA-dependent protein kinase in nonhomologous end joining: a lock with multiple keys?
Weterings, Eric; Chen, David J
2007-10-22
The DNA-dependent protein kinase (DNA-PK) is one of the central enzymes involved in DNA double-strand break (DSB) repair. It facilitates proper alignment of the two ends of the broken DNA molecule and coordinates access of other factors to the repair complex. We discuss the latest findings on DNA-PK phosphorylation and offer a working model for the regulation of DNA-PK during DSB repair.
Enhanced sequencing coverage with digital droplet multiple displacement amplification
Sidore, Angus M.; Lan, Freeman; Lim, Shaun W.; Abate, Adam R.
2016-01-01
Sequencing small quantities of DNA is important for applications ranging from the assembly of uncultivable microbial genomes to the identification of cancer-associated mutations. To obtain sufficient quantities of DNA for sequencing, the small amount of starting material must be amplified significantly. However, existing methods often yield errors or non-uniform coverage, reducing sequencing data quality. Here, we describe digital droplet multiple displacement amplification, a method that enables massive amplification of low-input material while maintaining sequence accuracy and uniformity. The low-input material is compartmentalized as single molecules in millions of picoliter droplets. Because the molecules are isolated in compartments, they amplify to saturation without competing for resources; this yields uniform representation of all sequences in the final product and, in turn, enhances the quality of the sequence data. We demonstrate the ability to uniformly amplify the genomes of single Escherichia coli cells, comprising just 4.7 fg of starting DNA, and obtain sequencing coverage distributions that rival that of unamplified material. Digital droplet multiple displacement amplification provides a simple and effective method for amplifying minute amounts of DNA for accurate and uniform sequencing. PMID:26704978
Biomolecular computers with multiple restriction enzymes.
Sakowski, Sebastian; Krasinski, Tadeusz; Waldmajer, Jacek; Sarnik, Joanna; Blasiak, Janusz; Poplawski, Tomasz
2017-01-01
The development of conventional, silicon-based computers has several limitations, including some related to the Heisenberg uncertainty principle and the von Neumann "bottleneck". Biomolecular computers based on DNA and proteins are largely free of these disadvantages and, along with quantum computers, are reasonable alternatives to their conventional counterparts in some applications. The idea of a DNA computer proposed by Ehud Shapiro's group at the Weizmann Institute of Science was developed using one restriction enzyme as hardware and DNA fragments (the transition molecules) as software and input/output signals. This computer represented a two-state two-symbol finite automaton that was subsequently extended by using two restriction enzymes. In this paper, we propose the idea of a multistate biomolecular computer with multiple commercially available restriction enzymes as hardware. Additionally, an algorithmic method for the construction of transition molecules in the DNA computer based on the use of multiple restriction enzymes is presented. We use this method to construct multistate, biomolecular, nondeterministic finite automata with four commercially available restriction enzymes as hardware. We also describe an experimental applicaton of this theoretical model to a biomolecular finite automaton made of four endonucleases.
Secondary structure prediction and structure-specific sequence analysis of single-stranded DNA.
Dong, F; Allawi, H T; Anderson, T; Neri, B P; Lyamichev, V I
2001-08-01
DNA sequence analysis by oligonucleotide binding is often affected by interference with the secondary structure of the target DNA. Here we describe an approach that improves DNA secondary structure prediction by combining enzymatic probing of DNA by structure-specific 5'-nucleases with an energy minimization algorithm that utilizes the 5'-nuclease cleavage sites as constraints. The method can identify structural differences between two DNA molecules caused by minor sequence variations such as a single nucleotide mutation. It also demonstrates the existence of long-range interactions between DNA regions separated by >300 nt and the formation of multiple alternative structures by a 244 nt DNA molecule. The differences in the secondary structure of DNA molecules revealed by 5'-nuclease probing were used to design structure-specific probes for mutation discrimination that target the regions of structural, rather than sequence, differences. We also demonstrate the performance of structure-specific 'bridge' probes complementary to non-contiguous regions of the target molecule. The structure-specific probes do not require the high stringency binding conditions necessary for methods based on mismatch formation and permit mutation detection at temperatures from 4 to 37 degrees C. Structure-specific sequence analysis is applied for mutation detection in the Mycobacterium tuberculosis katG gene and for genotyping of the hepatitis C virus.
Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process.
Reshetnikov, Roman V; Sponer, Jiri; Rassokhina, Olga I; Kopylov, Alexei M; Tsvetkov, Philipp O; Makarov, Alexander A; Golovin, Andrey V
2011-12-01
A combination of explicit solvent molecular dynamics simulation (30 simulations reaching 4 µs in total), hybrid quantum mechanics/molecular mechanics approach and isothermal titration calorimetry was used to investigate the atomistic picture of ion binding to 15-mer thrombin-binding quadruplex DNA (G-DNA) aptamer. Binding of ions to G-DNA is complex multiple pathway process, which is strongly affected by the type of the cation. The individual ion-binding events are substantially modulated by the connecting loops of the aptamer, which play several roles. They stabilize the molecule during time periods when the bound ions are not present, they modulate the route of the ion into the stem and they also stabilize the internal ions by closing the gates through which the ions enter the quadruplex. Using our extensive simulations, we for the first time observed full spontaneous exchange of internal cation between quadruplex molecule and bulk solvent at atomistic resolution. The simulation suggests that expulsion of the internally bound ion is correlated with initial binding of the incoming ion. The incoming ion then readily replaces the bound ion while minimizing any destabilization of the solute molecule during the exchange. © The Author(s) 2011. Published by Oxford University Press.
Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process
Reshetnikov, Roman V.; Sponer, Jiri; Rassokhina, Olga I.; Kopylov, Alexei M.; Tsvetkov, Philipp O.; Makarov, Alexander A.; Golovin, Andrey V.
2011-01-01
A combination of explicit solvent molecular dynamics simulation (30 simulations reaching 4 µs in total), hybrid quantum mechanics/molecular mechanics approach and isothermal titration calorimetry was used to investigate the atomistic picture of ion binding to 15-mer thrombin-binding quadruplex DNA (G-DNA) aptamer. Binding of ions to G-DNA is complex multiple pathway process, which is strongly affected by the type of the cation. The individual ion-binding events are substantially modulated by the connecting loops of the aptamer, which play several roles. They stabilize the molecule during time periods when the bound ions are not present, they modulate the route of the ion into the stem and they also stabilize the internal ions by closing the gates through which the ions enter the quadruplex. Using our extensive simulations, we for the first time observed full spontaneous exchange of internal cation between quadruplex molecule and bulk solvent at atomistic resolution. The simulation suggests that expulsion of the internally bound ion is correlated with initial binding of the incoming ion. The incoming ion then readily replaces the bound ion while minimizing any destabilization of the solute molecule during the exchange. PMID:21893589
A dynamic bead-based microarray for parallel DNA detection
NASA Astrophysics Data System (ADS)
Sochol, R. D.; Casavant, B. P.; Dueck, M. E.; Lee, L. P.; Lin, L.
2011-05-01
A microfluidic system has been designed and constructed by means of micromachining processes to integrate both microfluidic mixing of mobile microbeads and hydrodynamic microbead arraying capabilities on a single chip to simultaneously detect multiple bio-molecules. The prototype system has four parallel reaction chambers, which include microchannels of 18 × 50 µm2 cross-sectional area and a microfluidic mixing section of 22 cm length. Parallel detection of multiple DNA oligonucleotide sequences was achieved via molecular beacon probes immobilized on polystyrene microbeads of 16 µm diameter. Experimental results show quantitative detection of three distinct DNA oligonucleotide sequences from the Hepatitis C viral (HCV) genome with single base-pair mismatch specificity. Our dynamic bead-based microarray offers an effective microfluidic platform to increase parallelization of reactions and improve microbead handling for various biological applications, including bio-molecule detection, medical diagnostics and drug screening.
May the Best Molecule Win: Competition ESI Mass Spectrometry
Laughlin, Sarah; Wilson, W. David
2015-01-01
Electrospray ionization mass spectrometry has become invaluable in the characterization of macromolecular biological systems such as nucleic acids and proteins. Recent advances in the field of mass spectrometry and the soft conditions characteristic of electrospray ionization allow for the investigation of non-covalent interactions among large biomolecules and ligands. Modulation of genetic processes through the use of small molecule inhibitors with the DNA minor groove is gaining attention as a potential therapeutic approach. In this review, we discuss the development of a competition method using electrospray ionization mass spectrometry to probe the interactions of multiple DNA sequences with libraries of minor groove binding molecules. Such an approach acts as a high-throughput screening method to determine important information including the stoichiometry, binding mode, cooperativity, and relative binding affinity. In addition to small molecule-DNA complexes, we highlight other applications in which competition mass spectrometry has been used. A competitive approach to simultaneously investigate complex interactions promises to be a powerful tool in the discovery of small molecule inhibitors with high specificity and for specific, important DNA sequences. PMID:26501262
Biomolecular computers with multiple restriction enzymes
Sakowski, Sebastian; Krasinski, Tadeusz; Waldmajer, Jacek; Sarnik, Joanna; Blasiak, Janusz; Poplawski, Tomasz
2017-01-01
Abstract The development of conventional, silicon-based computers has several limitations, including some related to the Heisenberg uncertainty principle and the von Neumann “bottleneck”. Biomolecular computers based on DNA and proteins are largely free of these disadvantages and, along with quantum computers, are reasonable alternatives to their conventional counterparts in some applications. The idea of a DNA computer proposed by Ehud Shapiro’s group at the Weizmann Institute of Science was developed using one restriction enzyme as hardware and DNA fragments (the transition molecules) as software and input/output signals. This computer represented a two-state two-symbol finite automaton that was subsequently extended by using two restriction enzymes. In this paper, we propose the idea of a multistate biomolecular computer with multiple commercially available restriction enzymes as hardware. Additionally, an algorithmic method for the construction of transition molecules in the DNA computer based on the use of multiple restriction enzymes is presented. We use this method to construct multistate, biomolecular, nondeterministic finite automata with four commercially available restriction enzymes as hardware. We also describe an experimental applicaton of this theoretical model to a biomolecular finite automaton made of four endonucleases. PMID:29064510
Drug-DNA interactions at single molecule level: A view with optical tweezers
NASA Astrophysics Data System (ADS)
Paramanathan, Thayaparan
Studies of small molecule--DNA interactions are essential for developing new drugs for challenging diseases like cancer and HIV. The main idea behind developing these molecules is to target and inhibit the reproduction of the tumor cells and infected cells. We mechanically manipulate single DNA molecule using optical tweezers to investigate two molecules that have complex and multiple binding modes. Mononuclear ruthenium complexes have been extensively studied as a test for rational drug design. Potential drug candidates should have high affinity to DNA and slow dissociation kinetics. To achieve this, motifs of the ruthenium complexes are altered. Our collaborators designed a dumb-bell shaped binuclear ruthenium complex that can only intercalate DNA by threading through its bases. Studying the binding properties of this complex in bulk studies took hours. By mechanically manipulating a single DNA molecule held with optical tweezers, we lower the barrier to thread and make it fast compared to the bulk experiments. Stretching single DNA molecules with different concentration of drug molecules and holding it at a constant force allows the binding to reach equilibrium. By this we can obtain the equilibrium fractional ligand binding and length of DNA at saturated binding. Fitting these results yields quantitative measurements of the binding thermodynamics and kinetics of this complex process. The second complex discussed in this study is Actinomycin D (ActD), a well studied anti-cancer agent that is used as a prototype for developing new generations of drugs. However, the biophysical basis of its activity is still unclear. Because ActD is known to intercalate double stranded DNA (dsDNA), it was assumed to block replication by stabilizing dsDNA in front of the replication fork. However, recent studies have shown that ActD binds with even higher affinity to imperfect duplexes and some sequences of single stranded DNA (ssDNA). We directly measure the on and off rates by stretching the DNA molecule to a certain force and holding it at constant force while adding the drug and then while washing off the drug. Our finding resolves the long lasting controversy of ActD binding modes, clearly showing that both the dsDNA binding and ssDNA binding converge to the same single mode. The result supports the hypothesis that the primary characteristic of ActD that contributes to its biological activity is its ability to inhibit cellular replication by binding to transcription bubbles and causing cell death.
Takita, Eiji; Kohda, Katsunori; Tomatsu, Hajime; Hanano, Shigeru; Moriya, Kanami; Hosouchi, Tsutomu; Sakurai, Nozomu; Suzuki, Hideyuki; Shinmyo, Atsuhiko; Shibata, Daisuke
2013-01-01
Ligation, the joining of DNA fragments, is a fundamental procedure in molecular cloning and is indispensable to the production of genetically modified organisms that can be used for basic research, the applied biosciences, or both. Given that many genes cooperate in various pathways, incorporating multiple gene cassettes in tandem in a transgenic DNA construct for the purpose of genetic modification is often necessary when generating organisms that produce multiple foreign gene products. Here, we describe a novel method, designated PRESSO (precise sequential DNA ligation on a solid substrate), for the tandem ligation of multiple DNA fragments. We amplified donor DNA fragments with non-palindromic ends, and ligated the fragment to acceptor DNA fragments on solid beads. After the final donor DNA fragments, which included vector sequences, were joined to the construct that contained the array of fragments, the ligation product (the construct) was thereby released from the beads via digestion with a rare-cut meganuclease; the freed linear construct was circularized via an intra-molecular ligation. PRESSO allowed us to rapidly and efficiently join multiple genes in an optimized order and orientation. This method can overcome many technical challenges in functional genomics during the post-sequencing generation. PMID:23897972
Normanno, Davide; Vanzi, Francesco; Pavone, Francesco Saverio
2008-01-01
Gene expression regulation is a fundamental biological process which deploys specific sets of genomic information depending on physiological or environmental conditions. Several transcription factors (including lac repressor, LacI) are present in the cell at very low copy number and increase their local concentration by binding to multiple sites on DNA and looping the intervening sequence. In this work, we employ single-molecule manipulation to experimentally address the role of DNA supercoiling in the dynamics and stability of LacI-mediated DNA looping. We performed measurements over a range of degrees of supercoiling between −0.026 and +0.026, in the absence of axial stretching forces. A supercoiling-dependent modulation of the lifetimes of both the looped and unlooped states was observed. Our experiments also provide evidence for multiple structural conformations of the LacI–DNA complex, depending on torsional constraints. The supercoiling-dependent modulation demonstrated here adds an important element to the model of the lac operon. In fact, the complex network of proteins acting on the DNA in a living cell constantly modifies its topological and mechanical properties: our observations demonstrate the possibility of establishing a signaling pathway from factors affecting DNA supercoiling to transcription factors responsible for the regulation of specific sets of genes. PMID:18310101
Probabilistic switching circuits in DNA
Wilhelm, Daniel; Bruck, Jehoshua
2018-01-01
A natural feature of molecular systems is their inherent stochastic behavior. A fundamental challenge related to the programming of molecular information processing systems is to develop a circuit architecture that controls the stochastic states of individual molecular events. Here we present a systematic implementation of probabilistic switching circuits, using DNA strand displacement reactions. Exploiting the intrinsic stochasticity of molecular interactions, we developed a simple, unbiased DNA switch: An input signal strand binds to the switch and releases an output signal strand with probability one-half. Using this unbiased switch as a molecular building block, we designed DNA circuits that convert an input signal to an output signal with any desired probability. Further, this probability can be switched between 2n different values by simply varying the presence or absence of n distinct DNA molecules. We demonstrated several DNA circuits that have multiple layers and feedback, including a circuit that converts an input strand to an output strand with eight different probabilities, controlled by the combination of three DNA molecules. These circuits combine the advantages of digital and analog computation: They allow a small number of distinct input molecules to control a diverse signal range of output molecules, while keeping the inputs robust to noise and the outputs at precise values. Moreover, arbitrarily complex circuit behaviors can be implemented with just a single type of molecular building block. PMID:29339484
Liquid biopsy: a step forward towards precision medicine in urologic malignancies.
Di Meo, Ashley; Bartlett, Jenni; Cheng, Yufeng; Pasic, Maria D; Yousef, George M
2017-04-14
There is a growing trend towards exploring the use of a minimally invasive "liquid biopsy" to identify biomarkers in a number of cancers, including urologic malignancies. Multiple aspects can be assessed in circulating cell-free DNA, including cell-free DNA levels, integrity, methylation and mutations. Other prospective liquid biopsy markers include circulating tumor cells, circulating RNAs (miRNA, lncRNAs and mRNAs), cell-free proteins, peptides and exosomes have also emerged as non-invasive cancer biomarkers. These circulating molecules can be detected in various biological fluids, including blood, urine, saliva and seminal plasma. Liquid biopsies hold great promise for personalized medicine due to their ability to provide multiple non-invasive global snapshots of the primary and metastatic tumors. Molecular profiling of circulating molecules has been a stepping-stone to the successful introduction of several non-invasive multi-marker tests into the clinic. In this review, we provide an overview of the current state of cell-free DNA-based kidney, prostate and bladder cancer biomarker research and discuss the potential utility other circulating molecules. We will also discuss the challenges and limitations facing non-invasive cancer biomarker discovery and the benefits of this growing area of translational research.
A simple procedure for parallel sequence analysis of both strands of 5'-labeled DNA.
Razvi, F; Gargiulo, G; Worcel, A
1983-08-01
Ligation of a 5'-labeled DNA restriction fragment results in a circular DNA molecule carrying the two 32Ps at the reformed restriction site. Double digestions of the circular DNA with the original enzyme and a second restriction enzyme cleavage near the labeled site allows direct chemical sequencing of one 5'-labeled DNA strand. Similar double digestions, using an isoschizomer that cleaves differently at the 32P-labeled site, allows direct sequencing of the now 3'-labeled complementary DNA strand. It is possible to directly sequence both strands of cloned DNA inserts by using the above protocol and a multiple cloning site vector that provides the necessary restriction sites. The simultaneous and parallel visualization of both DNA strands eliminates sequence ambiguities. In addition, the labeled circular molecules are particularly useful for single-hit DNA cleavage studies and DNA footprint analysis. As an example, we show here an analysis of the micrococcal nuclease-induced breaks on the two strands of the somatic 5S RNA gene of Xenopus borealis, which suggests that the enzyme may recognize and cleave small AT-containing palindromes along the DNA helix.
Replication of each copy of the yeast 2 micron DNA plasmid occurs during the S phase.
Zakian, V A; Brewer, B J; Fangman, W L
1979-08-01
Saccharomyces cerevisiae contains 50-100 copies per cell of a circular plasmid called 2 micron DNA. Replication of this DNA was studied in two ways. The distribution of replication events among 2 micron DNA molecules was examined by density transfer experiments with asynchronous cultures. The data show that 2 micron DNA replication is similar to chromosomal DNA replication: essentially all 2 micron duplexes were of hybrid density at one cell doubling after the density transfer, with the majority having one fully dense strand and one fully light strand. The results show that replication of 2 micron DNA occurs by a semiconservative mechanism where each of the plasmid molecules replicates once each cell cycle. 2 micron DNA is the only known example of a multiple-copy, extrachromosomal DNA in which every molecule replicates in each cell cycle. Quantitative analysis of the data indicates that 2 micron DNA replication is limited to a fraction of the cell cycle. The period in the cell cycle when 2 micron DNA replicates was examined directly with synchronous cell cultures. Synchronization was accomplished by sequentially arresting cells in G1 phase using the yeast pheromone alpha-factor and incubating at the restrictive temperature for a cell cycle (cdc 7) mutant. Replication was monitored by adding 3H-uracil to cells previously labeled with 14C-uracil, and determining the 3H/14C ratio for purified DNA species. 2 micron DNA replication did not occur during the G1 arrest periods. However, the population of 2 micron DNA doubled during the synchronous S phase at the permissive temperature, with most of the replication occurring in the first third of S phase. Our results indicate that a mechanism exists which insures that the origin of replication of each 2 micron DNA molecule is activated each S phase. As with chromosomal DNA, further activation is prevented until the next cell cycle. We propose that the mechanism which controls the replication initiation of each 2 micron DNA molecule is identical to that which controls the initiation of chromosomal DNA.
DNA sequence-directed shape change of photopatterned hydrogels via high-degree swelling
NASA Astrophysics Data System (ADS)
Cangialosi, Angelo; Yoon, ChangKyu; Liu, Jiayu; Huang, Qi; Guo, Jingkai; Nguyen, Thao D.; Gracias, David H.; Schulman, Rebecca
2017-09-01
Shape-changing hydrogels that can bend, twist, or actuate in response to external stimuli are critical to soft robots, programmable matter, and smart medicine. Shape change in hydrogels has been induced by global cues, including temperature, light, or pH. Here we demonstrate that specific DNA molecules can induce 100-fold volumetric hydrogel expansion by successive extension of cross-links. We photopattern up to centimeter-sized gels containing multiple domains that undergo different shape changes in response to different DNA sequences. Experiments and simulations suggest a simple design rule for controlled shape change. Because DNA molecules can be coupled to molecular sensors, amplifiers, and logic circuits, this strategy introduces the possibility of building soft devices that respond to diverse biochemical inputs and autonomously implement chemical control programs.
Michikawa, Yuichi; Sugahara, Keisuke; Suga, Tomo; Ohtsuka, Yoshimi; Ishikawa, Kenichi; Ishikawa, Atsuko; Shiomi, Naoko; Shiomi, Tadahiro; Iwakawa, Mayumi; Imai, Takashi
2008-12-15
The isolation and multiple genotyping of long individual DNA fragments are needed to obtain haplotype information for diploid organisms. Limiting dilution of sample DNA followed by multiple displacement amplification is a useful technique but is restricted to short (<5 kb) DNA fragments. In the current study, a novel modification was applied to overcome these problems. A limited amount of cellular DNA was carefully released from intact cells into a mildly heated alkaline agarose solution and mixed thoroughly. The solution was then gently aliquoted and allowed to solidify while maintaining the integrity of the diluted DNA. Exogenously provided Phi29 DNA polymerase was used to perform consistent genomic amplification with random hexameric oligonucleotides within the agarose gels. Simple heat melting of the gel allowed recovery of the amplified materials in a solution of the polymerase chain reaction (PCR)-ready form. The haplotypes of seven SNPs spanning 240 kb of the DNA surrounding the human ATM gene region on chromosome 11 were determined for 10 individuals, demonstrating the feasibility of this new method.
Molecular analyses of dinosaur osteocytes support the presence of endogenous molecules.
Schweitzer, Mary Higby; Zheng, Wenxia; Cleland, Timothy P; Bern, Marshall
2013-01-01
The discovery of soft, transparent microstructures in dinosaur bone consistent in morphology with osteocytes was controversial. We hypothesize that, if original, these microstructures will have molecular features in common with extant osteocytes. We present immunological and mass spectrometry evidence for preservation of proteins comprising extant osteocytes (Actin, Tubulin, PHEX, Histone H4) in osteocytes recovered from two non-avian dinosaurs. Furthermore, antibodies to DNA show localized binding to these microstructures, which also react positively with DNA intercalating stains propidium iodide (PI) and 4',6'-diamidino-2-phenylindole dihydrochloride (DAPI). Each antibody binds dinosaur cells in patterns similar to extant cells. These data are the first to support preservation of multiple proteins and to present multiple lines of evidence for material consistent with DNA in dinosaurs, supporting the hypothesis that these structures were part of the once living animals. We propose mechanisms for preservation of cells and component molecules, and discuss implications for dinosaurian cellular biology. Copyright © 2012 Elsevier Inc. All rights reserved.
Verma, Vikash; Mallik, Leena; Hariadi, Rizal F.; Sivaramakrishnan, Sivaraj; Skiniotis, Georgios; Joglekar, Ajit P.
2015-01-01
DNA origami provides a versatile platform for conducting ‘architecture-function’ analysis to determine how the nanoscale organization of multiple copies of a protein component within a multi-protein machine affects its overall function. Such analysis requires that the copy number of protein molecules bound to the origami scaffold exactly matches the desired number, and that it is uniform over an entire scaffold population. This requirement is challenging to satisfy for origami scaffolds with many protein hybridization sites, because it requires the successful completion of multiple, independent hybridization reactions. Here, we show that a cleavable dimerization domain on the hybridizing protein can be used to multiplex hybridization reactions on an origami scaffold. This strategy yields nearly 100% hybridization efficiency on a 6-site scaffold even when using low protein concentration and short incubation time. It can also be developed further to enable reliable patterning of a large number of molecules on DNA origami for architecture-function analysis. PMID:26348722
Rocha, M S
2015-09-01
In this review we focus on the idea of establishing connections between the mechanical properties of DNA-ligand complexes and the physical chemistry of DNA-ligand interactions. This type of connection is interesting because it opens the possibility of performing a robust characterization of such interactions by using only one experimental technique: single molecule stretching. Furthermore, it also opens new possibilities in comparing results obtained by very different approaches, in particular when comparing single molecule techniques to ensemble-averaging techniques. We start the manuscript reviewing important concepts of DNA mechanics, from the basic mechanical properties to the Worm-Like Chain model. Next we review the basic concepts of the physical chemistry of DNA-ligand interactions, revisiting the most important models used to analyze the binding data and discussing their binding isotherms. Then, we discuss the basic features of the single molecule techniques most used to stretch DNA-ligand complexes and to obtain "force × extension" data, from which the mechanical properties of the complexes can be determined. We also discuss the characteristics of the main types of interactions that can occur between DNA and ligands, from covalent binding to simple electrostatic driven interactions. Finally, we present a historical survey of the attempts to connect mechanics to physical chemistry for DNA-ligand systems, emphasizing a recently developed fitting approach useful to connect the persistence length of DNA-ligand complexes to the physicochemical properties of the interaction. Such an approach in principle can be used for any type of ligand, from drugs to proteins, even if multiple binding modes are present.
Zhu, Longjiao; Shao, Xiangli; Luo, Yunbo; Huang, Kunlung; Xu, Wentao
2017-05-19
A two-way colorimetric biosensor based on unmodified gold nanoparticles (GNPs) and a switchable double-stranded DNA (dsDNA) concatemer have been demonstrated. Two hairpin probes (H1 and H2) were first designed that provided the fuels to assemble the dsDNA concatemers via hybridization chain reaction (HCR). A functional hairpin (FH) was rationally designed to recognize the target sequences. All the hairpins contained a single-stranded DNA (ssDNA) loop and sticky end to prevent GNPs from salt-induced aggregation. In the presence of target sequence, the capture probe blocked in the FH recognizes the target to form a duplex DNA, which causes the release of the initiator probe by FH conformational change. This process then starts the alternate-opening of H1 and H2 through HCR, and dsDNA concatemers grow from the target sequence. As a result, unmodified GNPs undergo salt-induced aggregation because the formed dsDNA concatemers are stiffer and provide less stabilization. A light purple-to-blue color variation was observed in the bulk solution, termed the light-off sensing way. Furthermore, H1 ingeniously inserted an aptamer sequence to generate dsDNA concatemers with multiple small molecule binding sites. In the presence of small molecule targets, concatemers can be disassembled into mixtures with ssDNA sticky ends. A blue-to-purple reverse color variation was observed due to the regeneration of the ssDNA, termed the light-on way. The two-way biosensor can detect both nucleic acids and small molecule targets with one sensing device. This switchable sensing element is label-free, enzyme-free, and sophisticated-instrumentation-free. The detection limits of both targets were below nanomolar.
Measurement of inelastic cross sections for low-energy electron scattering from DNA bases.
Michaud, Marc; Bazin, Marc; Sanche, Léon
2012-01-01
To determine experimentally the absolute cross sections (CS) to deposit various amount of energies into DNA bases by low-energy electron (LEE) impact. Electron energy loss (EEL) spectra of DNA bases were recorded for different LEE impact energies on the molecules deposited at very low coverage on an inert argon (Ar) substrate. Following their normalisation to the effective incident electron current and molecular surface number density, the EEL spectra were then fitted with multiple Gaussian functions in order to delimit the various excitation energy regions. The CS to excite a molecule into its various excitation modes were finally obtained from computing the area under the corresponding Gaussians. The EEL spectra and absolute CS for the electronic excitations of pyrimidine and the DNA bases thymine, adenine, and cytosine by electron impacts below 18 eV were reported for the molecules deposited at about monolayer coverage on a solid Ar substrate. The CS for electronic excitations of DNA bases by LEE impact were found to lie within the 10(216) to 10(218) cm(2) range. The large value of the total ionisation CS indicated that ionisation of DNA bases by LEE is an important dissipative process via which ionising radiation degrades and is absorbed in DNA.
Measurement of inelastic cross sections for low-energy electron scattering from DNA bases
Michaud, Marc; Bazin, Marc.; Sanche, Léon
2013-01-01
Purpose Determine experimentally the absolute cross sections (CS) to deposit various amount of energies into DNA bases by low-energy electron (LEE) impact. Materials and methods Electron energy loss (EEL) spectra of DNA bases are recorded for different LEE impact energies on the molecules deposited at very low coverage on an inert argon (Ar) substrate. Following their normalisation to the effective incident electron current and molecular surface number density, the EEL spectra are then fitted with multiple Gaussian functions in order to delimit the various excitation energy regions. The CS to excite a molecule into its various excitation modes are finally obtained from computing the area under the corresponding Gaussians. Results The EEL spectra and absolute CS for the electronic excitations of pyrimidine and the DNA bases thymine, adenine, and cytosine by electron impacts below 18 eV are reported for the molecules deposited at about monolayer coverage on a solid Ar substrate. Conclusions The CS for electronic excitations of DNA bases by LEE impact are found to lie within the 10−16 – 10−18 cm2 range. The large value of the total ionisation CS indicates that ionisation of DNA bases by LEE is an important dissipative process via which ionising radiation degrades and is absorbed in DNA. PMID:21615242
Sikora, Bartek; Chen, Yingfeng; Lichti, Cheryl F; Harrison, Melody K; Jennings, Thomas A; Tang, Yong; Tackett, Alan J; Jordan, John B; Sakon, Joshua; Cameron, Craig E; Raney, Kevin D
2008-04-25
HCV NS3 helicase exhibits activity toward DNA and RNA substrates. The DNA helicase activity of NS3 has been proposed to be optimal when multiple NS3 molecules are bound to the same substrate molecule. NS3 catalyzes little or no measurable DNA unwinding under single cycle conditions in which the concentration of substrate exceeds the concentration of enzyme by 5-fold. However, when NS3 (100 nm) is equimolar with the substrate, a small burst amplitude of approximately 8 nm is observed. The burst amplitude increases as the enzyme concentration increases, consistent with the idea that multiple molecules are needed for optimal unwinding. Protein-protein interactions may facilitate optimal activity, so the oligomeric properties of the enzyme were investigated. Chemical cross-linking indicates that full-length NS3 forms higher order oligomers much more readily than the NS3 helicase domain. Dynamic light scattering indicates that full-length NS3 exists as an oligomer, whereas NS3 helicase domain exists in a monomeric form in solution. Size exclusion chromatography also indicates that full-length NS3 behaves as an oligomer in solution, whereas the NS3 helicase domain behaves as a monomer. When NS3 was passed through a small pore filter capable of removing protein aggregates, greater than 95% of the protein and the DNA unwinding activity was removed from solution. In contrast, only approximately 10% of NS3 helicase domain and approximately 20% of the associated DNA unwinding activity was removed from solution after passage through the small pore filter. The results indicate that the optimally active form of full-length NS3 is part of an oligomeric species in vitro.
Shapiro, James A
2016-06-08
The 21st century genomics-based analysis of evolutionary variation reveals a number of novel features impossible to predict when Dobzhansky and other evolutionary biologists formulated the neo-Darwinian Modern Synthesis in the middle of the last century. These include three distinct realms of cell evolution; symbiogenetic fusions forming eukaryotic cells with multiple genome compartments; horizontal organelle, virus and DNA transfers; functional organization of proteins as systems of interacting domains subject to rapid evolution by exon shuffling and exonization; distributed genome networks integrated by mobile repetitive regulatory signals; and regulation of multicellular development by non-coding lncRNAs containing repetitive sequence components. Rather than single gene traits, all phenotypes involve coordinated activity by multiple interacting cell molecules. Genomes contain abundant and functional repetitive components in addition to the unique coding sequences envisaged in the early days of molecular biology. Combinatorial coding, plus the biochemical abilities cells possess to rearrange DNA molecules, constitute a powerful toolbox for adaptive genome rewriting. That is, cells possess "Read-Write Genomes" they alter by numerous biochemical processes capable of rapidly restructuring cellular DNA molecules. Rather than viewing genome evolution as a series of accidental modifications, we can now study it as a complex biological process of active self-modification.
Shapiro, James A.
2016-01-01
The 21st century genomics-based analysis of evolutionary variation reveals a number of novel features impossible to predict when Dobzhansky and other evolutionary biologists formulated the neo-Darwinian Modern Synthesis in the middle of the last century. These include three distinct realms of cell evolution; symbiogenetic fusions forming eukaryotic cells with multiple genome compartments; horizontal organelle, virus and DNA transfers; functional organization of proteins as systems of interacting domains subject to rapid evolution by exon shuffling and exonization; distributed genome networks integrated by mobile repetitive regulatory signals; and regulation of multicellular development by non-coding lncRNAs containing repetitive sequence components. Rather than single gene traits, all phenotypes involve coordinated activity by multiple interacting cell molecules. Genomes contain abundant and functional repetitive components in addition to the unique coding sequences envisaged in the early days of molecular biology. Combinatorial coding, plus the biochemical abilities cells possess to rearrange DNA molecules, constitute a powerful toolbox for adaptive genome rewriting. That is, cells possess “Read–Write Genomes” they alter by numerous biochemical processes capable of rapidly restructuring cellular DNA molecules. Rather than viewing genome evolution as a series of accidental modifications, we can now study it as a complex biological process of active self-modification. PMID:27338490
Lactose-modified DNA tile nanostructures as drug carriers.
Akkus Sut, Pinar; Tunc, Cansu Umran; Culha, Mustafa
2016-09-01
DNA hybridization allows the preparation of nanoscale DNA structures with desired shape and size. DNA structures using simple base pairing can be used for the delivery of drug molecules into the cells. Since DNA carries multiple negative charges, their cellular uptake efficiency is low. Thus, the modification of the DNA structures with molecules that may enhance the cellular internalization may be an option. The objective of this study is to construct DNA-based nanocarrier system and to investigate the cellular uptake of DNA tile with/without lactose modification. Doxorubicin was intercalated to DNA tile and cellular uptake of drug-loaded DNA-based carrier with/without lactose modification was investigated in vitro. HeLa, BT-474, and MDA-MB-231 cancer cells were used for cellular uptake studies and cytotoxicity assays. Using fluorescence spectroscopy, flow cytometry, and confocal microscopy, cellular uptake behavior of DNA tile was investigated. The cytotoxicity of DNA tile structures was determined with WST-1 assay. The results show that modification with lactose effectively increases the intracellular uptake of doxorubicin loaded DNA tile structure by cancer cells compared with the unmodified DNA tile. The findings of this study suggest that DNA-based nanostructures modified with carbohydrates can be used as suitable multifunctional nanocarriers with simple chemical modifications.
Moruno-Manchon, Jose F; Koellhoffer, Edward C; Gopakumar, Jayakrishnan; Hambarde, Shashank; Kim, Nayun; McCullough, Louise D; Tsvetkov, Andrey S
2017-09-12
The G-quadruplex is a non-canonical DNA secondary structure formed by four DNA strands containing multiple runs of guanines. G-quadruplexes play important roles in DNA recombination, replication, telomere maintenance, and regulation of transcription. Small molecules that stabilize the G-quadruplexes alter gene expression in cancer cells. Here, we hypothesized that the G-quadruplexes regulate transcription in neurons. We discovered that pyridostatin, a small molecule that specifically stabilizes G-quadruplex DNA complexes, induced neurotoxicity and promoted the formation of DNA double-strand breaks (DSBs) in cultured neurons. We also found that pyridostatin downregulated transcription of the Brca1 gene, a gene that is critical for DSB repair. Importantly, in an in vitro gel shift assay, we discovered that an antibody specific to the G-quadruplex structure binds to a synthetic oligonucleotide, which corresponds to the first putative G-quadruplex in the Brca1 gene promoter. Our results suggest that the G-quadruplex complexes regulate transcription in neurons. Studying the G-quadruplexes could represent a new avenue for neurodegeneration and brain aging research.
DNA Translator and Aligner: HyperCard utilities to aid phylogenetic analysis of molecules.
Eernisse, D J
1992-04-01
DNA Translator and Aligner are molecular phylogenetics HyperCard stacks for Macintosh computers. They manipulate sequence data to provide graphical gene mapping, conversions, translations and manual multiple-sequence alignment editing. DNA Translator is able to convert documented GenBank or EMBL documented sequences into linearized, rescalable gene maps whose gene sequences are extractable by clicking on the corresponding map button or by selection from a scrolling list. Provided gene maps, complete with extractable sequences, consist of nine metazoan, one yeast, and one ciliate mitochondrial DNAs and three green plant chloroplast DNAs. Single or multiple sequences can be manipulated to aid in phylogenetic analysis. Sequences can be translated between nucleic acids and proteins in either direction with flexible support of alternate genetic codes and ambiguous nucleotide symbols. Multiple aligned sequence output from diverse sources can be converted to Nexus, Hennig86 or PHYLIP format for subsequent phylogenetic analysis. Input or output alignments can be examined with Aligner, a convenient accessory stack included in the DNA Translator package. Aligner is an editor for the manual alignment of up to 100 sequences that toggles between display of matched characters and normal unmatched sequences. DNA Translator also generates graphic displays of amino acid coding and codon usage frequency relative to all other, or only synonymous, codons for approximately 70 select organism-organelle combinations. Codon usage data is compatible with spreadsheet or UWGCG formats for incorporation of additional molecules of interest. The complete package is available via anonymous ftp and is free for non-commercial uses.
Mapping DNA polymerase errors by single-molecule sequencing
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, David F.; Lu, Jenny; Chang, Seungwoo
Genomic integrity is compromised by DNA polymerase replication errors, which occur in a sequence-dependent manner across the genome. Accurate and complete quantification of a DNA polymerase's error spectrum is challenging because errors are rare and difficult to detect. We report a high-throughput sequencing assay to map in vitro DNA replication errors at the single-molecule level. Unlike previous methods, our assay is able to rapidly detect a large number of polymerase errors at base resolution over any template substrate without quantification bias. To overcome the high error rate of high-throughput sequencing, our assay uses a barcoding strategy in which each replicationmore » product is tagged with a unique nucleotide sequence before amplification. Here, this allows multiple sequencing reads of the same product to be compared so that sequencing errors can be found and removed. We demonstrate the ability of our assay to characterize the average error rate, error hotspots and lesion bypass fidelity of several DNA polymerases.« less
Mapping DNA polymerase errors by single-molecule sequencing
Lee, David F.; Lu, Jenny; Chang, Seungwoo; ...
2016-05-16
Genomic integrity is compromised by DNA polymerase replication errors, which occur in a sequence-dependent manner across the genome. Accurate and complete quantification of a DNA polymerase's error spectrum is challenging because errors are rare and difficult to detect. We report a high-throughput sequencing assay to map in vitro DNA replication errors at the single-molecule level. Unlike previous methods, our assay is able to rapidly detect a large number of polymerase errors at base resolution over any template substrate without quantification bias. To overcome the high error rate of high-throughput sequencing, our assay uses a barcoding strategy in which each replicationmore » product is tagged with a unique nucleotide sequence before amplification. Here, this allows multiple sequencing reads of the same product to be compared so that sequencing errors can be found and removed. We demonstrate the ability of our assay to characterize the average error rate, error hotspots and lesion bypass fidelity of several DNA polymerases.« less
Zhang, Hui; Guo, Peixuan
2014-05-15
Direct counting of biomolecules within biological complexes or nanomachines is demanding. Single molecule counting using optical microscopy is challenging due to the diffraction limit. The single molecule photobleaching (SMPB) technology for direct counting developed by our team (Shu et al., 2007 [18]; Zhang et al., 2007 [19]) offers a simple and straightforward method to determine the stoichiometry of molecules or subunits within biocomplexes or nanomachines at nanometer scales. Stoichiometry is determined by real-time observation of the number of descending steps resulted from the photobleaching of individual fluorophore. This technology has now been used extensively for single molecule counting of protein, RNA, and other macromolecules in a variety of complexes or nanostructures. Here, we elucidate the SMPB technology, using the counting of RNA molecules within a bacteriophage phi29 DNA-packaging biomotor as an example. The method described here can be applied to the single molecule counting of other molecules in other systems. The construction of a concise, simple and economical single molecule total internal reflection fluorescence (TIRF) microscope combining prism-type and objective-type TIRF is described. The imaging system contains a deep-cooled sensitive EMCCD camera with single fluorophore detection sensitivity, a laser combiner for simultaneous dual-color excitation, and a Dual-View™ imager to split the multiple outcome signals to different detector channels based on their wavelengths. Methodology of the single molecule photobleaching assay used to elucidate the stoichiometry of RNA on phi29 DNA packaging motor and the mechanism of protein/RNA interaction are described. Different methods for single fluorophore labeling of RNA molecules are reviewed. The process of statistical modeling to reveal the true copy number of the biomolecules based on binomial distribution is also described. Copyright © 2014 Elsevier Inc. All rights reserved.
DNA cloning: A personal view after 40 years
Cohen, Stanley N.
2013-01-01
In November 1973, my colleagues A. C. Y. Chang, H. W. Boyer, R. B. Helling, and I reported in PNAS that individual genes can be cloned and isolated by enzymatically cleaving DNA molecules into fragments, linking the fragments to an autonomously replicating plasmid, and introducing the resulting recombinant DNA molecules into bacteria. A few months later, Chang and I reported that genes from unrelated bacterial species can be combined and propagated using the same approach and that interspecies recombinant DNA molecules can produce a biologically functional protein in a foreign host. Soon afterward, Boyer’s laboratory and mine published our collaborative discovery that even genes from animal cells can be cloned in bacteria. These three PNAS papers quickly led to the use of DNA cloning methods in multiple areas of the biological and chemical sciences. They also resulted in a highly public controversy about the potential hazards of laboratory manipulation of genetic material, a decision by Stanford University and the University of California to seek patents on the technology that Boyer and I had invented, and the application of DNA cloning methods for commercial purposes. In the 40 years that have passed since publication of our findings, use of DNA cloning has produced insights about the workings of genes and cells in health and disease and has altered the nature of the biotechnology and biopharmaceutical industries. Here, I provide a personal perspective of the events that led to, and followed, our report of DNA cloning. PMID:24043817
Thubagere, Anupama J; Li, Wei; Johnson, Robert F; Chen, Zibo; Doroudi, Shayan; Lee, Yae Lim; Izatt, Gregory; Wittman, Sarah; Srinivas, Niranjan; Woods, Damien; Winfree, Erik; Qian, Lulu
2017-09-15
Two critical challenges in the design and synthesis of molecular robots are modularity and algorithm simplicity. We demonstrate three modular building blocks for a DNA robot that performs cargo sorting at the molecular level. A simple algorithm encoding recognition between cargos and their destinations allows for a simple robot design: a single-stranded DNA with one leg and two foot domains for walking, and one arm and one hand domain for picking up and dropping off cargos. The robot explores a two-dimensional testing ground on the surface of DNA origami, picks up multiple cargos of two types that are initially at unordered locations, and delivers them to specified destinations until all molecules are sorted into two distinct piles. The robot is designed to perform a random walk without any energy supply. Exploiting this feature, a single robot can repeatedly sort multiple cargos. Localization on DNA origami allows for distinct cargo-sorting tasks to take place simultaneously in one test tube or for multiple robots to collectively perform the same task. Copyright © 2017, American Association for the Advancement of Science.
A universal DNA-based protein detection system.
Tran, Thua N N; Cui, Jinhui; Hartman, Mark R; Peng, Songming; Funabashi, Hisakage; Duan, Faping; Yang, Dayong; March, John C; Lis, John T; Cui, Haixin; Luo, Dan
2013-09-25
Protein immune detection requires secondary antibodies which must be carefully selected in order to avoid interspecies cross-reactivity, and is therefore restricted by the limited availability of primary/secondary antibody pairs. Here we present a versatile DNA-based protein detection system using a universal adapter to interface between IgG antibodies and DNA-modified reporter molecules. As a demonstration of this capability, we successfully used DNA nano-barcodes, quantum dots, and horseradish peroxidase enzyme to detect multiple proteins using our DNA-based labeling system. Our system not only eliminates secondary antibodies but also serves as a novel method platform for protein detection with modularity, high capacity, and multiplexed capability.
A Universal DNA-Based Protein Detection System
Tran, Thua N. N.; Cui, Jinhui; Hartman, Mark R.; Peng, Songming; Funabashi, Hisakage; Duan, Faping; Yang, Dayong; March, John C.; Lis, John T.; Cui, Haixin; Luo, Dan
2014-01-01
Protein immune detection requires secondary antibodies which must be carefully selected in order to avoid interspecies cross-reactivity, and is therefore restricted by the limited availability of primary/secondary antibody pairs. Here we present a versatile DNA-based protein detection system using a universal adapter to interface between IgG antibodies and DNA-modified reporter molecules. As a demonstration of this capability, we successfully used DNA nano-barcodes, quantum dots, and horseradish peroxidase enzyme to detect multiple proteins using our DNA-based labeling system. Our system not only eliminates secondary antibodies but also serves as a novel method platform for protein detection with modularity, high capacity, and multiplexed capability. PMID:23978265
Piggott, Andrew M; Kriegel, Alison M; Willows, Robert D; Karuso, Peter
2009-10-01
Reverse chemical proteomics using T7 phage display is a powerful technique for identifying cellular receptors of biologically active small molecules. However, to date this method has generally been limited to cDNA libraries constructed from mRNA isolated from eukaryotes. In this paper, we describe the construction of the first prokaryotic T7 phage display libraries from randomly digested Pseudomonas stutzeri and Vibrio fischeri gDNA, as well as a plant cDNA library from Arabidopsis thaliana. We also describe the use of T7 phage display to identify novel proteins from environmental DNA samples using biotinylated FK506 as a model affinity probe.
Long-range barcode labeling-sequencing
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, Feng; Zhang, Tao; Singh, Kanwar K.
Methods for sequencing single large DNA molecules by clonal multiple displacement amplification using barcoded primers. Sequences are binned based on barcode sequences and sequenced using a microdroplet-based method for sequencing large polynucleotide templates to enable assembly of haplotype-resolved complex genomes and metagenomes.
Stoichiometry of DNA binding by the bacteriophage SP01-encoded type II DNA-binding protein TF1.
Schneider, G J; Geiduschek, E P
1990-06-25
The stoichiometry of DNA binding by the bacteriophage SP01-encoded type II DNA-binding protein TF1 has been determined. 3H-Labeled TF1 was allowed to bind to a 32P-labeled DNA fragment containing a TF1 binding site. Multiple TF1-DNA complexes were resolved from each other and from unbound DNA by native gel electrophoresis. DNA-protein complexes were cut from polyacrylamide gels, and the amounts of 3H and 32P contained in each slice were measured. A ratio of 1.12 +/- 0.06 TF1 dimer/DNA molecule was calculated for the fastest-migrating TF1-DNA complex. We conclude that TF1 has a DNA-binding unit of one dimer. More slowly migrating complexes are apparently formed by serial addition of single TF1 dimers.
NASA Astrophysics Data System (ADS)
Stasiak, Andrzej
2016-09-01
Being a geek of DNA topology, I remember very well the stir caused by 1997 Science paper showing that DNA topoisomerases have the ability to simplify DNA topology below the topological equilibrium values [1]. In their seminal experiments Rybenkov et al. [1] started with linear double-stranded DNA molecules with cohesive ends. The mutual cohesiveness of DNA ends was due to mutual complementarity of single-stranded extensions at both ends of linear double-stranded DNA molecules. When such DNA molecules were heated up and then slowly cooled down the single-stranded ends eventually annealed with each other causing DNA circularization. This experimental protocol permitted the authors to establish topological/thermodynamic equilibrium within samples of circularized DNA molecules. Among simple unknotted circles one also observed knotted and catenated DNA molecules. The fraction of knotted molecules in DNA samples at topological equilibrium was increasing with the length of DNA molecules undergoing slow circularization. The fraction of catenated molecules was increasing with the length and the concentration of the molecules undergoing slow circularization. Rybenkov et al. incubated then such equilibrated DNA samples with type II DNA topoisomerases, which pass DNA duplex regions through each other, and observed that as the result of it the fraction of knotted and catenated DNA molecules was dramatically decreased (up to 80-fold). This elegant experiment indicated for the first time that type II DNA topoisomerases acting on knotted or catenated DNA molecules have the ability to select among many potential sites of DNA-DNA passages these that result in DNA unknotting or decatenation. Without such a selection topoisomerases could only maintain the original topological equilibrium obtained during the slow cyclization. The big question was how DNA topoisomerases can be directed to do DNA-DNA passages that preferentially result in DNA unknotting and decatenation.
Unraveling secrets of telomeres: one molecule at a time
Lin, Jiangguo; Kaur, Parminder; Countryman, Preston; Opresko, Patricia L.; Wang, Hong
2016-01-01
Telomeres play important roles in maintaining the stability of linear chromosomes. Telomere maintenance involves dynamic actions of multiple proteins interacting with long repetitive sequences and complex dynamic DNA structures, such as G-quadruplexes, T-loops and t-circles. Given the heterogeneity and complexity of telomeres, single-molecule approaches are essential to fully understand the structure-function relationships that govern telomere maintenance. In this review, we present a brief overview of the principles of single-molecule imaging and manipulation techniques. We then highlight results obtained from applying these single-molecule techniques for studying structure, dynamics and functions of G-quadruplexes, telomerase, and shelterin proteins. PMID:24569170
Getting it done at the ends: Pif1 family DNA helicases and telomeres.
Geronimo, Carly L; Zakian, Virginia A
2016-08-01
It is widely appreciated that the ends of linear DNA molecules cannot be fully replicated by the conventional replication apparatus. Less well known is that semi-conservative replication of telomeric DNA also presents problems for DNA replication. These problems likely arise from the atypical chromatin structure of telomeres, the GC-richness of telomeric DNA that makes it prone to forming DNA secondary structures, and from RNA-DNA hybrids, formed by transcripts of one or both DNA strands. Given the different aspects of telomeres that complicate their replication, it is not surprising that multiple DNA helicases promote replication of telomeric DNA. This review focuses on one such class of DNA helicases, the Pif1 family of 5'-3' DNA helicases. In budding and fission yeasts, Pif1 family helicases impact both telomerase-mediated and semi-conservative replication of telomeric DNA as well as recombination-mediated telomere lengthening. Copyright © 2016. Published by Elsevier B.V.
Getting it done at the ends: Pif1 family DNA helicases and telomeres
Geronimo, Carly L.; Zakian, Virginia A.
2017-01-01
It is widely appreciated that the ends of linear DNA molecules cannot be fully replicated by the conventional replication apparatus. Less well known is that semi-conservative replication of telomeric DNA also presents problems for DNA replication. These problems likely arise from the atypical chromatin structure of telomeres, the GC-richness of telomeric DNA that makes it prone to forming DNA secondary structures, and from RNA-DNA hybrids, formed by transcripts of one or both DNA strands. Given the different aspects of telomeres that complicate their replication, it is not surprising that multiple DNA helicases promote replication of telomeric DNA. This review focuses on one such class of DNA helicases, the Pif1 family of 5′–3′ DNA helicases. In budding and fission yeasts, Pif1 family helicases impact both telomerase-mediated and semi-conservative replication of telomeric DNA as well as recombination-mediated telomere lengthening. PMID:27233114
Programming Light-Harvesting Efficiency Using DNA Origami
2016-01-01
The remarkable performance and quantum efficiency of biological light-harvesting complexes has prompted a multidisciplinary interest in engineering biologically inspired antenna systems as a possible route to novel solar cell technologies. Key to the effectiveness of biological “nanomachines” in light capture and energy transport is their highly ordered nanoscale architecture of photoactive molecules. Recently, DNA origami has emerged as a powerful tool for organizing multiple chromophores with base-pair accuracy and full geometric freedom. Here, we present a programmable antenna array on a DNA origami platform that enables the implementation of rationally designed antenna structures. We systematically analyze the light-harvesting efficiency with respect to number of donors and interdye distances of a ring-like antenna using ensemble and single-molecule fluorescence spectroscopy and detailed Förster modeling. This comprehensive study demonstrates exquisite and reliable structural control over multichromophoric geometries and points to DNA origami as highly versatile platform for testing design concepts in artificial light-harvesting networks. PMID:26906456
NASA Astrophysics Data System (ADS)
Fu, Jinglin; Yang, Yuhe Renee; Johnson-Buck, Alexander; Liu, Minghui; Liu, Yan; Walter, Nils G.; Woodbury, Neal W.; Yan, Hao
2014-07-01
Swinging arms are a key functional component of multistep catalytic transformations in many naturally occurring multi-enzyme complexes. This arm is typically a prosthetic chemical group that is covalently attached to the enzyme complex via a flexible linker, allowing the direct transfer of substrate molecules between multiple active sites within the complex. Mimicking this method of substrate channelling outside the cellular environment requires precise control over the spatial parameters of the individual components within the assembled complex. DNA nanostructures can be used to organize functional molecules with nanoscale precision and can also provide nanomechanical control. Until now, protein-DNA assemblies have been used to organize cascades of enzymatic reactions by controlling the relative distance and orientation of enzymatic components or by facilitating the interface between enzymes/cofactors and electrode surfaces. Here, we show that a DNA nanostructure can be used to create a multi-enzyme complex in which an artificial swinging arm facilitates hydride transfer between two coupled dehydrogenases. By exploiting the programmability of DNA nanostructures, key parameters including position, stoichiometry and inter-enzyme distance can be manipulated for optimal activity.
Fu, Jinglin; Yang, Yuhe Renee; Johnson-Buck, Alexander; Liu, Minghui; Liu, Yan; Walter, Nils G; Woodbury, Neal W; Yan, Hao
2014-07-01
Swinging arms are a key functional component of multistep catalytic transformations in many naturally occurring multi-enzyme complexes. This arm is typically a prosthetic chemical group that is covalently attached to the enzyme complex via a flexible linker, allowing the direct transfer of substrate molecules between multiple active sites within the complex. Mimicking this method of substrate channelling outside the cellular environment requires precise control over the spatial parameters of the individual components within the assembled complex. DNA nanostructures can be used to organize functional molecules with nanoscale precision and can also provide nanomechanical control. Until now, protein-DNA assemblies have been used to organize cascades of enzymatic reactions by controlling the relative distance and orientation of enzymatic components or by facilitating the interface between enzymes/cofactors and electrode surfaces. Here, we show that a DNA nanostructure can be used to create a multi-enzyme complex in which an artificial swinging arm facilitates hydride transfer between two coupled dehydrogenases. By exploiting the programmability of DNA nanostructures, key parameters including position, stoichiometry and inter-enzyme distance can be manipulated for optimal activity.
Intrinsically bent DNA in replication origins and gene promoters.
Gimenes, F; Takeda, K I; Fiorini, A; Gouveia, F S; Fernandez, M A
2008-06-24
Intrinsically bent DNA is an alternative conformation of the DNA molecule caused by the presence of dA/dT tracts, 2 to 6 bp long, in a helical turn phase DNA or with multiple intervals of 10 to 11 bp. Other than flexibility, intrinsic bending sites induce DNA curvature in particular chromosome regions such as replication origins and promoters. Intrinsically bent DNA sites are important in initiating DNA replication, and are sometimes found near to regions associated with the nuclear matrix. Many methods have been developed to localize bent sites, for example, circular permutation, computational analysis, and atomic force microscopy. This review discusses intrinsically bent DNA sites associated with replication origins and gene promoter regions in prokaryote and eukaryote cells. We also describe methods for identifying bent DNA sites for circular permutation and computational analysis.
Miao, VPW.; Rountree, M. R.; Selker, E. U.
1995-01-01
In a variety of organisms, DNA-mediated transformation experiments commonly produce transformants with multiple copies of the transforming DNA, including both selected and unselected molecules. Such ``cotransformants'' are much more common than expected from the individual transformation frequencies, suggesting that subpopulations of cells, or nuclei, are particularly competent for transformation. We found that Neurospora crassa transformants selected for gene replacement at the am gene had not efficiently incorporated additional DNA, suggesting that nuclei that undergo transformation by homologous recombination are not highly competent at integration of DNA by illegitimate recombination. Spheroplasts were treated with DNA fragments homologous to am and with an Escherichia coli hph plasmid. Transformants were initially selected for hph (hygromycin(R)), allowed to conidiate to generate homokaryons and then selected for either Am(-) (gene replacements) or hph. Surprisingly, most am replacement strains were hygromycin(S) (124/140) and carried no extraneous DNA (116/140). Most transformants selected for hph also had ectopic copies of am DNA and/or multiple copies of hph sequences (32/35), generally at multiple sites, confirming that efficient cotransformation could occur. To test the implication that cotransformation involving gene replacement and ectopic integration is rare, we compared the yields of am replacement strains with or without prior selection for hph. The initial selection did not appreciably help (or hinder) recovery of strains with replacements. PMID:7789758
Development of novel small molecules for imaging and drug release
NASA Astrophysics Data System (ADS)
Cao, Yanting
Small organic molecules, including small molecule based fluorescent probes, small molecule based drugs or prodrugs, and smart multifunctional fluorescent drug delivery systems play important roles in biological research, drug discovery, and clinical practices. Despite the significant progress made in these fields, the development of novel and diverse small molecules is needed to meet various demands for research and clinical applications. My Ph.D study focuses on the development of novel functional molecules for recognition, imaging and drug release. In the first part, a turn-on fluorescent probe is developed for the detection of intracellular adenosine-5'-triphosphate (ATP) levels based on multiplexing recognitions. Considering the unique and complicated structure of ATP molecules, a fluorescent probe has been implemented with improved sensitivity and selectivity due to two synergistic binding recognitions by incorporating of 2, 2'-dipicolylamine (Dpa)-Zn(II) for targeting of phospho anions and phenylboronic acid group for cis-diol moiety. The novel probe is able to detect intracellular ATP levels in SH-SY5Y cells. Meanwhile, the advantages of multiplexing recognition design concept have been demonstrated using two control molecules. In the second part, a prodrug system is developed to deliver multiple drugs within one small molecule entity. The prodrug is designed by using 1-(2-nitrophenyl)ethyl (NPE) as phototrigger, and biphenol biquaternary ammonium as the prodrug. With controlled photo activation, both DNA cross-linking agents mechlorethamine and o-quinone methide are delivered and released at the preferred site, leading to efficient DNA cross-links formation and cell death. The prodrug shows negligible cytotoxicity towards normal skin cells (Hekn cells) with and without UV activation, but displays potent activity towards cancer cells (HeLa cells) upon UV activation. The multiple drug release system may hold a great potential for practical application. In the last part, a new photo-initiated fluorescent anticancer prodrug for DNA alkylating agent mechlorethamine releasing and monitoring has been developed. The theranostic prodrug consists a photolabile NPE group, an inactive form of mechlorethamine and a nonfluorescent coumarin in one small molecule. It is demonstrated that the prodrug shows negligible cytotoxicity towards normal skin cells (Hekn cells) with and without UV activation, while the original parent drug mechlorethamine can be photocontrol-released and induces effective DNA cross-linking activity. Importantly, the drug release progress can be conveniently monitored by the 'off-on' fluorescence enhancement in cells. Moreover, the selective prodrug is not only cell permeable but also nuclear permeable. Therefore, the prodrug serves as a promising drug delivery system for spatiotemporal control release and monitoring of an anticancer drug to obtain the optimal treatment efficacy.
Annealing helicase HARP closes RPA-stabilized DNA bubbles non-processively.
Burnham, Daniel R; Nijholt, Bas; De Vlaminck, Iwijn; Quan, Jinhua; Yusufzai, Timur; Dekker, Cees
2017-05-05
We investigate the mechanistic nature of the Snf2 family protein HARP, mutations of which are responsible for Schimke immuno-osseous dysplasia. Using a single-molecule magnetic tweezers assay, we construct RPA-stabilized DNA bubbles within torsionally constrained DNA to investigate the annealing action of HARP on a physiologically relevant substrate. We find that HARP closes RPA-stabilized bubbles in a slow reaction, taking on the order of tens of minutes for ∼600 bp of DNA to be re-annealed. The data indicate that DNA re-anneals through the removal of RPA, which is observed as clear steps in the bubble-closing traces. The dependence of the closing rate on both ionic strength and HARP concentration indicates that removal of RPA occurs via an association-dissociation mechanism where HARP does not remain associated with the DNA. The enzyme exhibits classical Michaelis-Menten kinetics and acts cooperatively with a Hill coefficient of 3 ± 1. Our work also allows the determination of some important features of RPA-bubble structures at low supercoiling, including the existence of multiple bubbles and that RPA molecules are mis-registered on the two strands. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Annealing helicase HARP closes RPA-stabilized DNA bubbles non-processively
Burnham, Daniel R.; Nijholt, Bas; De Vlaminck, Iwijn; Quan, Jinhua; Yusufzai, Timur
2017-01-01
Abstract We investigate the mechanistic nature of the Snf2 family protein HARP, mutations of which are responsible for Schimke immuno-osseous dysplasia. Using a single-molecule magnetic tweezers assay, we construct RPA-stabilized DNA bubbles within torsionally constrained DNA to investigate the annealing action of HARP on a physiologically relevant substrate. We find that HARP closes RPA-stabilized bubbles in a slow reaction, taking on the order of tens of minutes for ∼600 bp of DNA to be re-annealed. The data indicate that DNA re-anneals through the removal of RPA, which is observed as clear steps in the bubble-closing traces. The dependence of the closing rate on both ionic strength and HARP concentration indicates that removal of RPA occurs via an association-dissociation mechanism where HARP does not remain associated with the DNA. The enzyme exhibits classical Michaelis–Menten kinetics and acts cooperatively with a Hill coefficient of 3 ± 1. Our work also allows the determination of some important features of RPA-bubble structures at low supercoiling, including the existence of multiple bubbles and that RPA molecules are mis-registered on the two strands. PMID:28334870
Zhang, Haibo; Yang, Litao; Guo, Jinchao; Li, Xiang; Jiang, Lingxi; Zhang, Dabing
2008-07-23
To enforce the labeling regulations of genetically modified organisms (GMOs), the application of reference molecules as calibrators is becoming essential for practical quantification of GMOs. However, the reported reference molecules with tandem marker multiple targets have been proved not suitable for duplex PCR analysis. In this study, we developed one unique plasmid molecule based on one pMD-18T vector with three exogenous target DNA fragments of Roundup Ready soybean GTS 40-3-2 (RRS), that is, CaMV35S, NOS, and RRS event fragments, plus one fragment of soybean endogenous Lectin gene. This Lectin gene fragment was separated from the three exogenous target DNA fragments of RRS by inserting one 2.6 kb DNA fragment with no relatedness to RRS detection targets in this resultant plasmid. Then, we proved that this design allows the quantification of RRS using the three duplex real-time PCR assays targeting CaMV35S, NOS, and RRS events employing this reference molecule as the calibrator. In these duplex PCR assays, the limits of detection (LOD) and quantification (LOQ) were 10 and 50 copies, respectively. For the quantitative analysis of practical RRS samples, the results of accuracy and precision were similar to those of simplex PCR assays, for instance, the quantitative results were at the 1% level, the mean bias of the simplex and duplex PCR were 4.0% and 4.6%, respectively, and the statistic analysis ( t-test) showed that the quantitative data from duplex and simplex PCR had no significant discrepancy for each soybean sample. Obviously, duplex PCR analysis has the advantages of saving the costs of PCR reaction and reducing the experimental errors in simplex PCR testing. The strategy reported in the present study will be helpful for the development of new reference molecules suitable for duplex PCR quantitative assays of GMOs.
Exercises in molecular computing.
Stojanovic, Milan N; Stefanovic, Darko; Rudchenko, Sergei
2014-06-17
CONSPECTUS: The successes of electronic digital logic have transformed every aspect of human life over the last half-century. The word "computer" now signifies a ubiquitous electronic device, rather than a human occupation. Yet evidently humans, large assemblies of molecules, can compute, and it has been a thrilling challenge to develop smaller, simpler, synthetic assemblies of molecules that can do useful computation. When we say that molecules compute, what we usually mean is that such molecules respond to certain inputs, for example, the presence or absence of other molecules, in a precisely defined but potentially complex fashion. The simplest way for a chemist to think about computing molecules is as sensors that can integrate the presence or absence of multiple analytes into a change in a single reporting property. Here we review several forms of molecular computing developed in our laboratories. When we began our work, combinatorial approaches to using DNA for computing were used to search for solutions to constraint satisfaction problems. We chose to work instead on logic circuits, building bottom-up from units based on catalytic nucleic acids, focusing on DNA secondary structures in the design of individual circuit elements, and reserving the combinatorial opportunities of DNA for the representation of multiple signals propagating in a large circuit. Such circuit design directly corresponds to the intuition about sensors transforming the detection of analytes into reporting properties. While this approach was unusual at the time, it has been adopted since by other groups working on biomolecular computing with different nucleic acid chemistries. We created logic gates by modularly combining deoxyribozymes (DNA-based enzymes cleaving or combining other oligonucleotides), in the role of reporting elements, with stem-loops as input detection elements. For instance, a deoxyribozyme that normally exhibits an oligonucleotide substrate recognition region is modified such that a stem-loop closes onto the substrate recognition region, making it unavailable for the substrate and thus rendering the deoxyribozyme inactive. But a conformational change can then be induced by an input oligonucleotide, complementary to the loop, to open the stem, allow the substrate to bind, and allow its cleavage to proceed, which is eventually reported via fluorescence. In this Account, several designs of this form are reviewed, along with their application in the construction of large circuits that exhibited complex logical and temporal relationships between the inputs and the outputs. Intelligent (in the sense of being capable of nontrivial information processing) theranostic (therapy + diagnostic) applications have always been the ultimate motivation for developing computing (i.e., decision-making) circuits, and we review our experiments with logic-gate elements bound to cell surfaces that evaluate the proximal presence of multiple markers on lymphocytes.
Exercises in Molecular Computing
2014-01-01
Conspectus The successes of electronic digital logic have transformed every aspect of human life over the last half-century. The word “computer” now signifies a ubiquitous electronic device, rather than a human occupation. Yet evidently humans, large assemblies of molecules, can compute, and it has been a thrilling challenge to develop smaller, simpler, synthetic assemblies of molecules that can do useful computation. When we say that molecules compute, what we usually mean is that such molecules respond to certain inputs, for example, the presence or absence of other molecules, in a precisely defined but potentially complex fashion. The simplest way for a chemist to think about computing molecules is as sensors that can integrate the presence or absence of multiple analytes into a change in a single reporting property. Here we review several forms of molecular computing developed in our laboratories. When we began our work, combinatorial approaches to using DNA for computing were used to search for solutions to constraint satisfaction problems. We chose to work instead on logic circuits, building bottom-up from units based on catalytic nucleic acids, focusing on DNA secondary structures in the design of individual circuit elements, and reserving the combinatorial opportunities of DNA for the representation of multiple signals propagating in a large circuit. Such circuit design directly corresponds to the intuition about sensors transforming the detection of analytes into reporting properties. While this approach was unusual at the time, it has been adopted since by other groups working on biomolecular computing with different nucleic acid chemistries. We created logic gates by modularly combining deoxyribozymes (DNA-based enzymes cleaving or combining other oligonucleotides), in the role of reporting elements, with stem–loops as input detection elements. For instance, a deoxyribozyme that normally exhibits an oligonucleotide substrate recognition region is modified such that a stem–loop closes onto the substrate recognition region, making it unavailable for the substrate and thus rendering the deoxyribozyme inactive. But a conformational change can then be induced by an input oligonucleotide, complementary to the loop, to open the stem, allow the substrate to bind, and allow its cleavage to proceed, which is eventually reported via fluorescence. In this Account, several designs of this form are reviewed, along with their application in the construction of large circuits that exhibited complex logical and temporal relationships between the inputs and the outputs. Intelligent (in the sense of being capable of nontrivial information processing) theranostic (therapy + diagnostic) applications have always been the ultimate motivation for developing computing (i.e., decision-making) circuits, and we review our experiments with logic-gate elements bound to cell surfaces that evaluate the proximal presence of multiple markers on lymphocytes. PMID:24873234
NASA Technical Reports Server (NTRS)
Holley, W. R.; Chatterjee, A.
1996-01-01
We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber comprised of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and delta rays due to knock-on collisions involving energy transfers >100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of OH, H, eaq, etc.; (2) OH attack on sugar molecules leading to strand breaks: (3) OH attack on bases; (4) direct ionization of the sugar molecules leading to strand breaks; (5) direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 bp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. The shapes of the spectra of DNA fragment lengths depend on the symmetries or approximate symmetries of the chromatin structure. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper (B. Rydberg, Radiat, Res. 145, 200-209, 1996) after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the chromatin fibers in mammalian DNA.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Barends, Thomas R. M., E-mail: thomas.barends@mpimf-heidelberg.mpg.de; Brosi, Richard W. W.; Steinmetz, Andrea
2013-08-01
The crystal structure of the N-terminal part of T. thermophilus DnaJ unexpectedly showed an ordered GF domain and guided the design of a construct enabling the first structure determination of a complete DnaJ cochaperone molecule. By combining the crystal structures with spin-labelling EPR and cross-linking in solution, a dynamic view of this flexible molecule was developed. Hsp70 chaperones assist in a large variety of protein-folding processes in the cell. Crucial for these activities is the regulation of Hsp70 by Hsp40 cochaperones. DnaJ, the bacterial homologue of Hsp40, stimulates ATP hydrolysis by DnaK (Hsp70) and thus mediates capture of substrate protein,more » but is also known to possess chaperone activity of its own. The first structure of a complete functional dimeric DnaJ was determined and the mobility of its individual domains in solution was investigated. Crystal structures of the complete molecular cochaperone DnaJ from Thermus thermophilus comprising the J, GF and C-terminal domains and of the J and GF domains alone showed an ordered GF domain interacting with the J domain. Structure-based EPR spin-labelling studies as well as cross-linking results showed the existence of multiple states of DnaJ in solution with different arrangements of the various domains, which has implications for the function of DnaJ.« less
Structure and dynamics of proflavine association around DNA.
Sasikala, Wilbee D; Mukherjee, Arnab
2016-04-21
Proflavine is a small molecule that intercalates into DNA and, thereby, acts as an anticancer agent. Intercalation of proflavine is shown to be a two-step process in which the first step is believed to be the formation of a pre-intercalative outside bound state. Experimental studies so far have been unable to capture the nature of the outside bound state. However, the sub-millisecond timescale observed in fluorescence kinetic experiments is often attributed to the binding of proflavine outside of DNA. Here, we have performed molecular dynamics simulations with multiple proflavine molecules to study the structure and dynamics of the formation of the outside bound state of DNA at different ion concentrations. We observed that the timescale of the outside bound state formation is, at least, five orders of magnitude faster (in nanoseconds) than the experimentally reported timescale (sub-milliseconds) attributed to binding outside DNA. Moreover, we also observed the stacked arrangement of proflavine all around DNA, which is different from the experimentally predicted stacking arrangement perpendicular to the helical axis of DNA in the close vicinity of the phosphate groups. This study, therefore, provides insight into the molecular structure and dynamics of the pre-intercalative outside bound state and will help in understanding the overall intercalation mechanism.
Simple method of DNA stretching on glass substrate for fluorescence image and spectroscopy
NASA Astrophysics Data System (ADS)
Neupane, Guru P.; Dhakal, Krishna P.; Lee, Hyunsoo; Guthold, Martin; Joseph, Vincent S.; Hong, Jong-Dal; Kim, Jeongyong
2013-05-01
Study of biological molecule DNA has contributed to developing many breaking thoughts and wide applications in multidisciplinary fields, such as genomic, medical, sensing and forensic fields. Stretching of DNA molecules is an important supportive tool for AFM or spectroscopic studies of DNA in a single molecular level. In this article, we established a simple method of DNA stretching (to its full length) that occurred on a rotating negatively-charged surface of glass substrate. The isolation of a single DNA molecule was attained by the two competitive forces on DNA molecules, that is, the electrostatic attraction developed between the positively charged YOYO-1 stained DNA and the negatively charged substrate, and the centrifugal force of the rotating substrate, which separates the DNA aggregates into the single molecule. Density of stretched DNA molecules was controlled by selecting the specific parameters such as spinning time and rates, loading volume of DNA-dye complex solution etc. The atomic force microscopy image exhibited a single DNA molecule on the negatively-charged substrate in an isolated state. Further, the photoluminescence spectra of a single DNA molecule stained with YOYO-1 were achieved using the method developed in the present study, which is strongly believed to effectively support the spectroscopic analysis of DNA in a single molecular level.
Dynamics and Regulation of RecA Polymerization and De-Polymerization on Double-Stranded DNA
Muniyappa, Kalappa; Yan, Jie
2013-01-01
The RecA filament formed on double-stranded (ds) DNA is proposed to be a functional state analogous to that generated during the process of DNA strand exchange. RecA polymerization and de-polymerization on dsDNA is governed by multiple physiological factors. However, a comprehensive understanding of how these factors regulate the processes of polymerization and de-polymerization of RecA filament on dsDNA is still evolving. Here, we investigate the effects of temperature, pH, tensile force, and DNA ends (in particular ssDNA overhang) on the polymerization and de-polymerization dynamics of the E. coli RecA filament at a single-molecule level. Our results identified the optimal conditions that permitted spontaneous RecA nucleation and polymerization, as well as conditions that could maintain the stability of a preformed RecA filament. Further examination at a nano-meter spatial resolution, by stretching short DNA constructs, revealed a striking dynamic RecA polymerization and de-polymerization induced saw-tooth pattern in DNA extension fluctuation. In addition, we show that RecA does not polymerize on S-DNA, a recently identified novel base-paired elongated DNA structure that was previously proposed to be a possible binding substrate for RecA. Overall, our studies have helped to resolve several previous single-molecule studies that reported contradictory and inconsistent results on RecA nucleation, polymerization and stability. Furthermore, our findings also provide insights into the regulatory mechanisms of RecA filament formation and stability in vivo. PMID:23825559
Molecular cardiology and genetics in the 21st century--a primer.
Roberts, Robert; Gollob, Michael
2006-10-01
The terminology and technology of molecular genetics and recombinant DNA have become an essential part of academic cardiology and will soon be applied at the bedside. The treatise includes a brief summary of the essentials of the DNA molecule, the more common techniques, and their application to genetics and molecular cardiology. It is written to be understood by physicians, scientists, and paramedical personnel who would not necessarily have a background in molecular biology. Inherent in the DNA molecule are three properties fundamental to all of the diagnostic and therapeutic applications, namely, the ability of DNA to separate into single strands, recombine (annealment or hybridization), and the presence of the negative charge enables DNA fragments to be separated easily by electrophoresis. Genetic linkage analysis of a family with an inherited disease enables one to identify the gene without knowing its protein product. Over 50 diseases in cardiology due to single-gene disorders have been identified and multiple mutations have been detected. The new therapeutic frontier will be stem cells and nuclear transfer. Identification of genes responsible for coronary artery disease made possible by genome-wide single nucleotide polymorphism (SNP) mapping techniques paves the way for personalized medicine.
You, Mingxu; Zhu, Guizhi; Chen, Tao; Donovan, Michael J; Tan, Weihong
2015-01-21
The specific inventory of molecules on diseased cell surfaces (e.g., cancer cells) provides clinicians an opportunity for accurate diagnosis and intervention. With the discovery of panels of cancer markers, carrying out analyses of multiple cell-surface markers is conceivable. As a trial to accomplish this, we have recently designed a DNA-based device that is capable of performing autonomous logic-based analysis of two or three cancer cell-surface markers. Combining the specific target-recognition properties of DNA aptamers with toehold-mediated strand displacement reactions, multicellular marker-based cancer analysis can be realized based on modular AND, OR, and NOT Boolean logic gates. Specifically, we report here a general approach for assembling these modular logic gates to execute programmable and higher-order profiling of multiple coexisting cell-surface markers, including several found on cancer cells, with the capacity to report a diagnostic signal and/or deliver targeted photodynamic therapy. The success of this strategy demonstrates the potential of DNA nanotechnology in facilitating targeted disease diagnosis and effective therapy.
Hybrid anticancer 1,2-diazine derivatives with multiple mechanism of action. Part 3.
Antoci, Vasilichia; Mantu, Dorina; Cozma, Danut Gabriel; Usru, Cornelia; Mangalagiu, Ionel I
2014-01-01
Antitumour chemotherapy is nowadays a very active field of research, DNA targeting drugs being the most widely used group in therapy. The design, synthesis and anticancer activity of a new class of anticancer derivatives with pyrrolo-1,2-diazine and benzoquinone skeleton is presented. The synthesis is direct and efficient, involving an alkylation followed by a [3+2] dipolar cycloaddition. The penta- and tetra-cyclic pyrrolo-1,2-diazine were evaluated for their in vitro anticancer activity against an NCI 60 human tumour cell line panel. The pentacyclic-1,2-diazine exhibit a significant anticancer activity against Non-Small Cell Lung Cancer NCI-H460, Leukemia MOLT-4, Leukemia CCRF-CEM and Breast Cancer MCF7. We hypothesize that these molecules will exert their anticancer activity through multiple mechanisms of action: intercalating the DNA, inhibiting the topoisomerase enzymes and, destroying the DNA strands via electron transfer mechanism. However, the intercalation with the DNA seems to prevail in competition with the others mechanisms. Copyright © 2013 Elsevier Ltd. All rights reserved.
Deformation of DNA molecules by hydrodynamic focusing
NASA Astrophysics Data System (ADS)
Wong, Pak Kin; Lee, Yi-Kuen; Ho, Chih-Ming
2003-12-01
The motion of a DNA molecule in a solvent flow reflects the deformation of a nano/microscale flexible mass spring structure by the forces exerted by the fluid molecules. The dynamics of individual molecules can reveal both fundamental properties of the DNA and basic understanding of the complex rheological properties of long-chain molecules. In this study, we report the dynamics of isolated DNA molecules under homogeneous extensional flow. Hydrodynamic focusing generates homogeneous extensional flow with uniform velocity in the transverse direction. The deformation of individual DNA molecules in the flow was visualized with video fluorescence microscopy. A coil stretch transition was observed when the Deborah number (De) is larger than 0.8. With a sudden stopping of the flow, the DNA molecule relaxes and recoils. The longest relaxation time of T2 DNA was determined to be 0.63 s when scaling viscosity to 0.9 cP.
DNA Molecules Adsorbed on Rippled Supported Cationic Lipid Membranes -- A new way to stretch DNAs
NASA Astrophysics Data System (ADS)
Golubovic, Leonardo
2005-03-01
We discuss a novel approach to control to shapes of DNA molecules. We elucidate the recent experimental work of M. Hochrein, L. Golubovic and J. Raedler, on the conformational behavior of DNA molecules adsorbed on lipid membranes that are supported on grooved micro-structured surfaces. We explain the striking ability of the edges formed on these supported membranes to adsorb and completely orient (stretch) very long DNA molecules. Here we explain the experimentally observed DNA stretching effect in terms of the surface curvature dependent electrostatic potential seen by the adsorbed DNA molecules. On the curved, rippled membrane, we show that the DNA molecules undergo localization transitions causing them to stretch by binding to the ripple edges of the supported membrane. In the future, this stretching will allow to directly image, by the common fluorescence microscopy, fundamental biological processes of the interactions between DNA and single protein molecules.
Methods of DNA methylation detection
NASA Technical Reports Server (NTRS)
Maki, Wusi Chen (Inventor); Filanoski, Brian John (Inventor); Mishra, Nirankar (Inventor); Rastogi, Shiva (Inventor)
2010-01-01
The present invention provides for methods of DNA methylation detection. The present invention provides for methods of generating and detecting specific electronic signals that report the methylation status of targeted DNA molecules in biological samples.Two methods are described, direct and indirect detection of methylated DNA molecules in a nano transistor based device. In the direct detection, methylated target DNA molecules are captured on the sensing surface resulting in changes in the electrical properties of a nano transistor. These changes generate detectable electronic signals. In the indirect detection, antibody-DNA conjugates are used to identify methylated DNA molecules. RNA signal molecules are generated through an in vitro transcription process. These RNA molecules are captured on the sensing surface change the electrical properties of nano transistor thereby generating detectable electronic signals.
Chao, Jie; Li, Zhenhua; Li, Jing; Peng, Hongzhen; Su, Shao; Li, Qian; Zhu, Changfeng; Zuo, Xiaolei; Song, Shiping; Wang, Lianhui; Wang, Lihua
2016-07-15
Microarrays of biomolecules hold great promise in the fields of genomics, proteomics, and clinical assays on account of their remarkably parallel and high-throughput assay capability. However, the fluorescence detection used in most conventional DNA microarrays is still limited by sensitivity. In this study, we have demonstrated a novel universal and highly sensitive platform for fluorescent detection of sequence specific DNA at the femtomolar level by combining dextran-coated microarrays with hybridization chain reaction (HCR) signal amplification. Three-dimensional dextran matrix was covalently coated on glass surface as the scaffold to immobilize DNA recognition probes to increase the surface binding capacity and accessibility. DNA nanowire tentacles were formed on the matrix surface for efficient signal amplification by capturing multiple fluorescent molecules in a highly ordered way. By quantifying microscopic fluorescent signals, the synergetic effects of dextran and HCR greatly improved sensitivity of DNA microarrays, with a detection limit of 10fM (1×10(5) molecules). This detection assay could recognize one-base mismatch with fluorescence signals dropped down to ~20%. This cost-effective microarray platform also worked well with samples in serum and thus shows great potential for clinical diagnosis. Copyright © 2016 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Sepehri, Alireza
Recently, some authors have shown that a DNA molecule produces electromagnetic signals and communicates with other DNA molecules or other molecules. In fact, a DNA acts like a receiver or transmitter of radio waves. In this paper, we suggest a mathematical model for the DNA molecule and use of its communication to cure some diseases like cancer. In this model, first, by using concepts from string theory and M-theory, we calculate the energy of a DNA in terms of interactions between free electrons and bound electrons. We show that when a DNA is damaged, its energy changes and an extra current is produced. This extra current causes the electromagnetic signals of a damaged DNA molecule to be different when compared to the electromagnetic signals of a normal DNA molecule. The electromagnetic signals of a damaged DNA molecule induce an extra current in a normal DNA molecule and lead to its destruction. By sending crafted electromagnetic signals to normal DNA molecules and inducing an opposite current with respect to this extra current, we can prevent the destruction of normal DNA. Finally, we argue that the type of packing of DNA in chromosomes of men and women is different. This causes radiated waves from DNAs of men and women to have opposite signs and cancel the effect of each other in a pair. Using this property, we suggest another mechanism to cancel the effect of extra waves, which are produced by DNAs in cancer cells of a male or a female, by extra waves which are produced by DNAs in similar cells of a female or a male and prevent the progression of the disease.
Modulation of inflammation and disease tolerance by DNA damage response pathways.
Neves-Costa, Ana; Moita, Luis F
2017-03-01
The accurate replication and repair of DNA is central to organismal survival. This process is challenged by the many factors that can change genetic information such as replication errors and direct damage to the DNA molecule by chemical and physical agents. DNA damage can also result from microorganism invasion as an integral step of their life cycle or as collateral damage from host defense mechanisms against pathogens. Here we review the complex crosstalk of DNA damage response and immune response pathways that might be evolutionarily connected and argue that DNA damage response pathways can be explored therapeutically to induce disease tolerance through the activation of tissue damage control processes. Such approach may constitute the missing pillar in the treatment of critical illnesses caused by multiple organ failure, such as sepsis and septic shock. © 2016 Federation of European Biochemical Societies.
Role of translational entropy in spatially inhomogeneous, coarse-grained models
NASA Astrophysics Data System (ADS)
Langenberg, Marcel; Jackson, Nicholas E.; de Pablo, Juan J.; Müller, Marcus
2018-03-01
Coarse-grained models of polymer and biomolecular systems have enabled the computational study of cooperative phenomena, e.g., self-assembly, by lumping multiple atomistic degrees of freedom along the backbone of a polymer, lipid, or DNA molecule into one effective coarse-grained interaction center. Such a coarse-graining strategy leaves the number of molecules unaltered. In order to treat the surrounding solvent or counterions on the same coarse-grained level of description, one can also stochastically group several of those small molecules into an effective, coarse-grained solvent bead or "fluid element." Such a procedure reduces the number of molecules, and we discuss how to compensate the concomitant loss of translational entropy by density-dependent interactions in spatially inhomogeneous systems.
Hsieh, Shou-Shing; Chen, Jyun-Hong; Tsai, Cheng-Fung
2013-02-18
A novel DNA molecule stretching technique is developed and tested herein. Through a heated converging-diverging microchannel, thermal convection and thermophoresis induced by regional heating are shown to significantly elongate single DNA molecules; they are visualized via a confocal laser scanning microscopy. In addition, electrophoretic stretching is also implemented to examine the hybrid effect on the conformation and dynamics of single DNA molecules. The physical properties of the DNA molecules are secured via experimental measurements.
Scala, Giovanni; Affinito, Ornella; Palumbo, Domenico; Florio, Ermanno; Monticelli, Antonella; Miele, Gennaro; Chiariotti, Lorenzo; Cocozza, Sergio
2016-11-25
CpG sites in an individual molecule may exist in a binary state (methylated or unmethylated) and each individual DNA molecule, containing a certain number of CpGs, is a combination of these states defining an epihaplotype. Classic quantification based approaches to study DNA methylation are intrinsically unable to fully represent the complexity of the underlying methylation substrate. Epihaplotype based approaches, on the other hand, allow methylation profiles of cell populations to be studied at the single molecule level. For such investigations, next-generation sequencing techniques can be used, both for quantitative and for epihaplotype analysis. Currently available tools for methylation analysis lack output formats that explicitly report CpG methylation profiles at the single molecule level and that have suited statistical tools for their interpretation. Here we present ampliMethProfiler, a python-based pipeline for the extraction and statistical epihaplotype analysis of amplicons from targeted deep bisulfite sequencing of multiple DNA regions. ampliMethProfiler tool provides an easy and user friendly way to extract and analyze the epihaplotype composition of reads from targeted bisulfite sequencing experiments. ampliMethProfiler is written in python language and requires a local installation of BLAST and (optionally) QIIME tools. It can be run on Linux and OS X platforms. The software is open source and freely available at http://amplimethprofiler.sourceforge.net .
Nanomechanical molecular devices made of DNA origami.
Kuzuya, Akinori; Ohya, Yuichi
2014-06-17
CONSPECTUS: Eight years have passed since the striking debut of the DNA origami technique ( Rothemund, P. W. K. Nature 2006 , 440 , 297 - 302 ), in which long single-stranded DNA is folded into a designed nanostructure, in either 2D or 3D, with the aid of many short staple strands. The number of proposals for new design principles for DNA origami structures seems to have already reached a peak. It is apparent that DNA origami study is now entering the second phase of creating practical applications. The development of functional nanomechanical molecular devices using the DNA origami technique is one such application attracting significant interest from researchers in the field. Nanomechanical DNA origami devices, which maintain the characteristics of DNA origami structures, have various advantages over conventional DNA nanomachines. Comparatively high assembly yield, relatively large size visible via atomic force microscopy (AFM) or transmission electron microscopy (TEM), and the capability to assemble multiple functional groups with precision using multiple staple strands are some of the advantages of the DNA origami technique for constructing sophisticated molecular devices. This Account describes the recent developments of such nanomechanical DNA origami devices and reviews the emerging target of DNA origami studies. First, simple "dynamic" DNA origami structures with transformation capability, such as DNA origami boxes and a DNA origami hatch with structure control, are briefly summarized. More elaborate nanomechanical DNA origami devices are then reviewed. The first example describes DNA origami pinching devices that can be used as "single-molecule" beacons to detect a variety of biorelated molecules, from metal ions at the size of a few tens of atomic mass number units to relatively gigantic proteins with a molecular mass greater than a hundred kilodaltons, all on a single platform. Clamshell-like DNA nanorobots equipped with logic gates can discriminate different cell lines, open their shell, and bind to their target. An intelligent DNA origami "sheath" can mimic the function of suppressors in a transcription regulation system to control the expression of a loaded gene. DNA origami "rolls" are created to construct precisely arranged plasmonic devices with metal nanoparticles. All of their functions are derived from their nanomechanical movement, which is programmable by designing the DNA sequence or by using the significant repository of technical achievements in nucleic acid chemistry. Finally, some studies on detailed structural parameters of DNA origami or their mechanical properties in nanoscale are discussed, which may be useful and inspiring for readers who intend to design new nanomechanical DNA origami devices.
Park, Suehyun; Joo, Heesun; Kim, Jun Soo
2018-01-31
Directing the motion of molecules/colloids in any specific direction is of great interest in many applications of chemistry, physics, and biological sciences, where regulated positioning or transportation of materials is highly desired. Using Brownian dynamics simulations of coarse-grained models of a long, double-stranded DNA molecule and positively charged nanoparticles, we observed that the motion of a single nanoparticle bound to and wrapped by the DNA molecule can be directed along a gradient of DNA local flexibility. The flexibility gradient is constructed along a 0.8 kilobase-pair DNA molecule such that local persistence length decreases gradually from 50 nm to 40 nm, mimicking a gradual change in sequence-dependent flexibility. Nanoparticles roll over a long DNA molecule from less flexible regions towards more flexible ones as a result of the decreasing energetic cost of DNA bending and wrapping. In addition, the rolling becomes slightly accelerated as the positive charge of nanoparticles decreases due to a lower free energy barrier of DNA detachment from charged nanoparticle for processive rolling. This study suggests that the variation in DNA local flexibility can be utilized in constructing and manipulating supramolecular assemblies of DNA molecules and nanoparticles in structural DNA nanotechnology.
Nucleic Acid Nanostructures: Bottom-Up Control of Geometry on the Nanoscale
Seeman, Nadrian C.; Lukeman, Philip S.
2012-01-01
DNA may seem an unlikely molecule from which to build nanostructures, but this is not correct. The specificity of interaction that enables DNA to function so successfully as genetic material also enables its use as a smart molecule for construction on the nanoscale. The key to using DNA for this purpose is the design of stable branched molecules, which expand its ability to interact specifically with other nucleic acid molecules. The same interactions used by genetic engineers can be used to make cohesive interactions with other DNA molecules that lead to a variety of new species. Branched DNA molecules are easy to design, and the can assume a variety of structural motifs. These can be used for purposes both of specific construction, such as polyhedra, and for the assembly of topological targets. A variety of two-dimensional periodic arrays with specific patterns have been made. DNA nanomechanical devices have been built with a series of different triggers, small molecules, nucleic acid molecules and proteins. Recently, progress has been made in self-replication of DNA nano-constructs, and in the scaffolding of other species into DNA arrangements. PMID:25152542
Chen, Xiang
2013-09-01
A benzamide molecule is used as a "reader" molecule to form hydrogen bonds with five single DNA bases, i.e., four normal single DNA bases A,T,C,G and one for 5methylC. The whole molecule is then attached to the gold surface so that a meta-molecule junction is formed. We calculate the transmission function and conductance for the five metal-molecule systems, with the implementation of density functional theory-based non-equilibrium Green function method. Our results show that each DNA base exhibits a unique conductance and most of them are on the pS level. The distinguishable conductance of each DNA base provides a way for the fast sequencing of DNA. We also investigate the dependence of conductivity of such a metal-molecule system on the hydrogen bond length between the "reader" molecule and DNA base, which shows that conductance follows an exponential decay as the hydrogen bond length increases, i.e., the conductivity is highly sensitive to the change in hydrogen bond length.
Claveria-Gimeno, Rafael; Lanuza, Pilar M; Morales-Chueca, Ignacio; Jorge-Torres, Olga C; Vega, Sonia; Abian, Olga; Esteller, Manel; Velazquez-Campoy, Adrian
2017-01-31
Methyl-CpG binding protein 2 (MeCP2) preferentially interacts with methylated DNA and it is involved in epigenetic regulation and chromatin remodelling. Mutations in MeCP2 are linked to Rett syndrome, the leading cause of intellectual retardation in girls and causing mental, motor and growth impairment. Unstructured regions in MeCP2 provide the plasticity for establishing interactions with multiple binding partners. We present a biophysical characterization of the methyl binding domain (MBD) from MeCP2 reporting the contribution of flanking domains to its structural stability and dsDNA interaction. The flanking disordered intervening domain (ID) increased the structural stability of MBD, modified its dsDNA binding profile from an entropically-driven moderate-affinity binding to an overwhelmingly enthalpically-driven high-affinity binding. Additionally, ID provided an additional site for simultaneously and autonomously binding an independent dsDNA molecule, which is a key feature linked to the chromatin remodelling and looping activity of MeCP2, as well as its ability to interact with nucleosomes replacing histone H1. The dsDNA interaction is characterized by an unusually large heat capacity linked to a cluster of water molecules trapped within the binding interface. The dynamics of disordered regions together with extrinsic factors are key determinants of MeCP2 global structural properties and functional capabilities.
Claveria-Gimeno, Rafael; Lanuza, Pilar M.; Morales-Chueca, Ignacio; Jorge-Torres, Olga C.; Vega, Sonia; Abian, Olga; Esteller, Manel; Velazquez-Campoy, Adrian
2017-01-01
Methyl-CpG binding protein 2 (MeCP2) preferentially interacts with methylated DNA and it is involved in epigenetic regulation and chromatin remodelling. Mutations in MeCP2 are linked to Rett syndrome, the leading cause of intellectual retardation in girls and causing mental, motor and growth impairment. Unstructured regions in MeCP2 provide the plasticity for establishing interactions with multiple binding partners. We present a biophysical characterization of the methyl binding domain (MBD) from MeCP2 reporting the contribution of flanking domains to its structural stability and dsDNA interaction. The flanking disordered intervening domain (ID) increased the structural stability of MBD, modified its dsDNA binding profile from an entropically-driven moderate-affinity binding to an overwhelmingly enthalpically-driven high-affinity binding. Additionally, ID provided an additional site for simultaneously and autonomously binding an independent dsDNA molecule, which is a key feature linked to the chromatin remodelling and looping activity of MeCP2, as well as its ability to interact with nucleosomes replacing histone H1. The dsDNA interaction is characterized by an unusually large heat capacity linked to a cluster of water molecules trapped within the binding interface. The dynamics of disordered regions together with extrinsic factors are key determinants of MeCP2 global structural properties and functional capabilities. PMID:28139759
Arora, Sanjeevani; Heyza, Joshua; Zhang, Hao; Kalman-Maltese, Vivian; Tillison, Kristin; Floyd, Ashley M.; Chalfin, Elaine M.; Bepler, Gerold; Patrick, Steve M.
2016-01-01
ERCC1-XPF heterodimer is a 5′-3′ structure-specific endonuclease which is essential in multiple DNA repair pathways in mammalian cells. ERCC1-XPF (ERCC1-ERCC4) repairs cisplatin-DNA intrastrand adducts and interstrand crosslinks and its specific inhibition has been shown to enhance cisplatin cytotoxicity in cancer cells. In this study, we describe a high throughput screen (HTS) used to identify small molecules that inhibit the endonuclease activity of ERCC1-XPF. Primary screens identified two compounds that inhibit ERCC1-XPF activity in the nanomolar range. These compounds were validated in secondary screens against two other non-related endonucleases to ensure specificity. Results from these screens were validated using an in vitro gel-based nuclease assay. Electrophoretic mobility shift assays (EMSAs) further show that these compounds do not inhibit the binding of purified ERCC1-XPF to DNA. Next, in lung cancer cells these compounds potentiated cisplatin cytotoxicity and inhibited DNA repair. Structure activity relationship (SAR) studies identified related compounds for one of the original Hits, which also potentiated cisplatin cytotoxicity in cancer cells. Excitingly, dosing with NSC16168 compound potentiated cisplatin antitumor activity in a lung cancer xenograft model. Further development of ERCC1-XPF DNA repair inhibitors is expected to sensitize cancer cells to DNA damage-based chemotherapy. PMID:27650543
Yu, Guihua; Kushwaha, Amit; Lee, Jungkyu K; Shaqfeh, Eric S G; Bao, Zhenan
2011-01-25
DNA has been recently explored as a powerful tool for developing molecular scaffolds for making reproducible and reliable metal contacts to single organic semiconducting molecules. A critical step in the process of exploiting DNA-organic molecule-DNA (DOD) array structures is the controlled tethering and stretching of DNA molecules. Here we report the development of reproducible surface chemistry for tethering DNA molecules at tunable density and demonstrate shear flow processing as a rationally controlled approach for stretching/aligning DNA molecules of various lengths. Through enzymatic cleavage of λ-phage DNA to yield a series of DNA chains of various lengths from 17.3 μm down to 4.2 μm, we have investigated the flow/extension behavior of these tethered DNA molecules under different flow strengths in the flow-gradient plane. We compared Brownian dynamic simulations for the flow dynamics of tethered λ-DNA in shear, and found our flow-gradient plane experimental results matched well with our bead-spring simulations. The shear flow processing demonstrated in our studies represents a controllable approach for tethering and stretching DNA molecules of various lengths. Together with further metallization of DNA chains within DOD structures, this bottom-up approach can potentially enable efficient and reliable fabrication of large-scale nanoelectronic devices based on single organic molecules, therefore opening opportunities in both fundamental understanding of charge transport at the single molecular level and many exciting applications for ever-shrinking molecular circuits.
Single-molecule imaging of DNA polymerase I (Klenow fragment) activity by atomic force microscopy
NASA Astrophysics Data System (ADS)
Chao, J.; Zhang, P.; Wang, Q.; Wu, N.; Zhang, F.; Hu, J.; Fan, C. H.; Li, B.
2016-03-01
We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA.We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr06544e
Horn, T; Chang, C A; Urdea, M S
1997-12-01
The divergent synthesis of bDNA structures is described. This new type of branched DNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branching network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb molecules were assembled on a solid support using parameters optimized for bDNA synthesis. The chemistry was used to synthesize bDNA comb molecules containing 15 secondary sequences. The bDNA comb molecules were elaborated by enzymatic ligation into branched amplification multimers, large bDNA molecules (a total of 1068 nt) containing an average of 36 repeated DNA oligomer sequences, each capable of hybridizing specifically to an alkaline phosphatase-labeled oligonucleotide. The bDNA comb molecules were characterized by electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The branched amplification multimers have been used as signal amplifiers in nucleic acid quantification assays for detection of viral infection. It is possible to detect as few as 50 molecules with bDNA technology.
Horn, T; Chang, C A; Urdea, M S
1997-01-01
The divergent synthesis of bDNA structures is described. This new type of branched DNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branching network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb molecules were assembled on a solid support using parameters optimized for bDNA synthesis. The chemistry was used to synthesize bDNA comb molecules containing 15 secondary sequences. The bDNA comb molecules were elaborated by enzymatic ligation into branched amplification multimers, large bDNA molecules (a total of 1068 nt) containing an average of 36 repeated DNA oligomer sequences, each capable of hybridizing specifically to an alkaline phosphatase-labeled oligonucleotide. The bDNA comb molecules were characterized by electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The branched amplification multimers have been used as signal amplifiers in nucleic acid quantification assays for detection of viral infection. It is possible to detect as few as 50 molecules with bDNA technology. PMID:9365266
Taverniers, Isabel; Van Bockstaele, Erik; De Loose, Marc
2004-03-01
Analytical real-time PCR technology is a powerful tool for implementation of the GMO labeling regulations enforced in the EU. The quality of analytical measurement data obtained by quantitative real-time PCR depends on the correct use of calibrator and reference materials (RMs). For GMO methods of analysis, the choice of appropriate RMs is currently under debate. So far, genomic DNA solutions from certified reference materials (CRMs) are most often used as calibrators for GMO quantification by means of real-time PCR. However, due to some intrinsic features of these CRMs, errors may be expected in the estimations of DNA sequence quantities. In this paper, two new real-time PCR methods are presented for Roundup Ready soybean, in which two types of plasmid DNA fragments are used as calibrators. Single-target plasmids (STPs) diluted in a background of genomic DNA were used in the first method. Multiple-target plasmids (MTPs) containing both sequences in one molecule were used as calibrators for the second method. Both methods simultaneously detect a promoter 35S sequence as GMO-specific target and a lectin gene sequence as endogenous reference target in a duplex PCR. For the estimation of relative GMO percentages both "delta C(T)" and "standard curve" approaches are tested. Delta C(T) methods are based on direct comparison of measured C(T) values of both the GMO-specific target and the endogenous target. Standard curve methods measure absolute amounts of target copies or haploid genome equivalents. A duplex delta C(T) method with STP calibrators performed at least as well as a similar method with genomic DNA calibrators from commercial CRMs. Besides this, high quality results were obtained with a standard curve method using MTP calibrators. This paper demonstrates that plasmid DNA molecules containing either one or multiple target sequences form perfect alternative calibrators for GMO quantification and are especially suitable for duplex PCR reactions.
DNA-psoralen interaction: a single molecule experiment.
Rocha, M S; Viana, N B; Mesquita, O N
2004-11-15
By attaching one end of a single lambda-DNA molecule to a microscope coverslip and the other end to a polystyrene microsphere trapped by an optical tweezers, we can study the entropic elasticity of the lambda-DNA by measuring force versus extension as we stretch the molecule. This powerful method permits single molecule studies. We are particularly interested in the effects of the photosensitive drug psoralen on the elasticity of the DNA molecule. We have illuminated the sample with different light sources, studying how the different wavelengths affect the psoralen-DNA linkage. To do this, we measure the persistence length of individual DNA-psoralen complexes.
DNA of a Human Hepatitis B Virus Candidate
Robinson, William S.; Clayton, David A.; Greenman, Richard L.
1974-01-01
Particles containing DNA polymerase (Dane particles) were purified from the plasma of chronic carriers of hepatitis B antigen. After a DNA polymerase reaction with purified Dane particle preparations treated with Nonidet P-40 detergent, Dane particle core structures containing radioactive DNA product were isolated by sedimentation in a sucrose density gradient. The radioactive DNA was extracted with sodium dodecyl sulfate and isolated by band sedimentation in a preformed CsCl gradient. Examination of the radioactive DNA band by electron microscopy revealed exclusively circular double-stranded DNA molecules approximately 0.78 μm in length. Identical circular molecules were observed when DNA was isolated by a similar procedure from particles that had not undergone a DNA polymerase reaction. The molecules were completely degraded by DNase 1. When Dane particle core structures were treated with DNase 1 before DNA extraction, only 0.78-μm circular DNA molecules were detected. Without DNase treatment of core structures, linear molecules with lengths between 0.5 and 12 μm, in addition to the 0.78-μm circles were found. These results suggest that the 0.78-μm circular molecules were in a protected position within Dane particle cores and the linear molecules were not within core structures. Length measurements on 225 circular molecules revealed a mean length of 0.78 ± 0.09 μm which would correspond to a molecular weight of around 1.6 × 106. The circular molecules probably serve as primer-template for the DNA polymerase reaction carried out by Dane particle cores. Thermal denaturation and buoyant density measurements on the Dane particle DNA polymerase reaction product revealed a guanosine plus cytosine content of 48 to 49%. Images PMID:4847328
Reid-Bayliss, Kate S; Loeb, Lawrence A
2017-08-29
Transcriptional mutagenesis (TM) due to misincorporation during RNA transcription can result in mutant RNAs, or epimutations, that generate proteins with altered properties. TM has long been hypothesized to play a role in aging, cancer, and viral and bacterial evolution. However, inadequate methodologies have limited progress in elucidating a causal association. We present a high-throughput, highly accurate RNA sequencing method to measure epimutations with single-molecule sensitivity. Accurate RNA consensus sequencing (ARC-seq) uniquely combines RNA barcoding and generation of multiple cDNA copies per RNA molecule to eliminate errors introduced during cDNA synthesis, PCR, and sequencing. The stringency of ARC-seq can be scaled to accommodate the quality of input RNAs. We apply ARC-seq to directly assess transcriptome-wide epimutations resulting from RNA polymerase mutants and oxidative stress.
ERIC Educational Resources Information Center
Dimitrov, Valentin V.
2009-01-01
This work focuses on studying properties of DNA molecules and DNA-protein interactions using synthetic nanopores, and it examines the prospects of sequencing DNA using synthetic nanopores. We have developed a method for discriminating between alleles that uses a synthetic nanopore to measure the binding of a restriction enzyme to DNA. There exists…
Improved DNA hybridization parameters by Twisted Intercalating Nucleic Acid (TINA).
Schneider, Uffe Vest
2012-01-01
This thesis establishes oligonucleotide design rules and applications of a novel group of DNA stabilizing molecules collectively called Twisted Intercalating Nucleic Acid - TINA. Three peer-reviewed publications form the basis for the thesis. One publication describes an improved and rapid method for determination of DNA melting points and two publications describe the effects of positioning TINA molecules in parallel triplex helix and antiparallel duplex helix forming DNA structures. The third publication establishes that TINA molecules containing oligonucleotides improve an antiparallel duplex hybridization based capture assay's analytical sensitivity compared to conventionel DNA oligonucleotides. Clinical microbiology is traditionally based on pathogenic microorganisms' culture and serological tests. The introduction of DNA target amplification methods like PCR has improved the analytical sensitivity and total turn around time involved in clinical diagnostics of infections. Due to the relatively weak hybridization between the two strands of double stranded DNA, a number of nucleic acid stabilizing molecules have been developed to improve the sensitivity of DNA based diagnostics through superior binding properties. A short introduction is given to Watson-Crick and Hoogsteen based DNA binding and the derived DNA structures. A number of other nucleic acid stabilizing molecules are described. The stabilizing effect of TINA molecules on different DNA structures is discussed and considered in relation to other nucleic acid stabilizing molecules and in relation to future use of TINA containing oligonucleotides in clinical diagnostics and therapy. In conclusion, design of TINA modified oligonucleotides for antiparallel duplex helixes and parallel triplex helixes follows simple purpose dependent rules. TINA molecules are well suited for improving multiplex PCR assays and can be used as part of novel technologies. Future research should test whether combinations of TINA molecules and other nucleic acid stabilizing molecules can increase analytical sensitivity whilst maintaining nucleobase mismatch discrimination in triplex helix based diagnostic assays.
Bui, Phuc Tan; Nishino, Tomoaki; Shiigi, Hiroshi; Nagaoka, Tsutomu
2015-01-31
A DNA molecule was utilized as a probe tip to achieve single-molecule genetic diagnoses. Hybridization of the probe and target DNAs resulted in electron tunneling along the emergent double-stranded DNA. Simple stationary monitoring of the tunneling current leads to single-molecule DNA detection and discovery of base mismatches and methylation.
Boulanger, Jérôme; Muresan, Leila; Tiemann-Boege, Irene
2012-01-01
In spite of the many advances in haplotyping methods, it is still very difficult to characterize rare haplotypes in tissues and different environmental samples or to accurately assess the haplotype diversity in large mixtures. This would require a haplotyping method capable of analyzing the phase of single molecules with an unprecedented throughput. Here we describe such a haplotyping method capable of analyzing in parallel hundreds of thousands single molecules in one experiment. In this method, multiple PCR reactions amplify different polymorphic regions of a single DNA molecule on a magnetic bead compartmentalized in an emulsion drop. The allelic states of the amplified polymorphisms are identified with fluorescently labeled probes that are then decoded from images taken of the arrayed beads by a microscope. This method can evaluate the phase of up to 3 polymorphisms separated by up to 5 kilobases in hundreds of thousands single molecules. We tested the sensitivity of the method by measuring the number of mutant haplotypes synthesized by four different commercially available enzymes: Phusion, Platinum Taq, Titanium Taq, and Phire. The digital nature of the method makes it highly sensitive to detecting haplotype ratios of less than 1:10,000. We also accurately quantified chimera formation during the exponential phase of PCR by different DNA polymerases.
Instructing cells with programmable peptide DNA hybrids
DOE Office of Scientific and Technical Information (OSTI.GOV)
Freeman, Ronit; Stephanopoulos, Nicholas; Alvarez, Zaida
The native extracellular matrix is a space in which signals can be displayed dynamically and reversibly, positioned with nanoscale precision, and combined synergistically to control cell function. Here we describe a molecular system that can be programmed to control these three characteristics. In this approach we immobilize peptide-DNA (P-DNA) molecules on a surface through complementary DNA tethers directing cells to adhere and spread reversibly over multiple cycles. The DNA can also serve as a molecular ruler to control the distance-dependent synergy between two peptides. Finally, we use two orthogonal DNA handles to regulate two different bioactive signals, with the abilitymore » to independently up- or downregulate each over time. This enabled us to discover that neural stem cells, derived from the murine spinal cord and organized as neurospheres, can be triggered to migrate out in response to an exogenous signal but then regroup into a neurosphere as the signal is removed.« less
Instructing cells with programmable peptide DNA hybrids
Freeman, Ronit; Stephanopoulos, Nicholas; Alvarez, Zaida; ...
2017-07-10
The native extracellular matrix is a space in which signals can be displayed dynamically and reversibly, positioned with nanoscale precision, and combined synergistically to control cell function. Here we describe a molecular system that can be programmed to control these three characteristics. In this approach we immobilize peptide-DNA (P-DNA) molecules on a surface through complementary DNA tethers directing cells to adhere and spread reversibly over multiple cycles. The DNA can also serve as a molecular ruler to control the distance-dependent synergy between two peptides. Finally, we use two orthogonal DNA handles to regulate two different bioactive signals, with the abilitymore » to independently up- or downregulate each over time. This enabled us to discover that neural stem cells, derived from the murine spinal cord and organized as neurospheres, can be triggered to migrate out in response to an exogenous signal but then regroup into a neurosphere as the signal is removed.« less
Computational and experimental analysis of DNA shuffling
Maheshri, Narendra; Schaffer, David V.
2003-01-01
We describe a computational model of DNA shuffling based on the thermodynamics and kinetics of this process. The model independently tracks a representative ensemble of DNA molecules and records their states at every stage of a shuffling reaction. These data can subsequently be analyzed to yield information on any relevant metric, including reassembly efficiency, crossover number, type and distribution, and DNA sequence length distributions. The predictive ability of the model was validated by comparison to three independent sets of experimental data, and analysis of the simulation results led to several unique insights into the DNA shuffling process. We examine a tradeoff between crossover frequency and reassembly efficiency and illustrate the effects of experimental parameters on this relationship. Furthermore, we discuss conditions that promote the formation of useless “junk” DNA sequences or multimeric sequences containing multiple copies of the reassembled product. This model will therefore aid in the design of optimal shuffling reaction conditions. PMID:12626764
Instructing cells with programmable peptide DNA hybrids
NASA Astrophysics Data System (ADS)
Freeman, Ronit; Stephanopoulos, Nicholas; Álvarez, Zaida; Lewis, Jacob A.; Sur, Shantanu; Serrano, Chris M.; Boekhoven, Job; Lee, Sungsoo S.; Stupp, Samuel I.
2017-07-01
The native extracellular matrix is a space in which signals can be displayed dynamically and reversibly, positioned with nanoscale precision, and combined synergistically to control cell function. Here we describe a molecular system that can be programmed to control these three characteristics. In this approach we immobilize peptide-DNA (P-DNA) molecules on a surface through complementary DNA tethers directing cells to adhere and spread reversibly over multiple cycles. The DNA can also serve as a molecular ruler to control the distance-dependent synergy between two peptides. Finally, we use two orthogonal DNA handles to regulate two different bioactive signals, with the ability to independently up- or downregulate each over time. This enabled us to discover that neural stem cells, derived from the murine spinal cord and organized as neurospheres, can be triggered to migrate out in response to an exogenous signal but then regroup into a neurosphere as the signal is removed.
DNA origami as biocompatible surface to match single-molecule and ensemble experiments
Gietl, Andreas; Holzmeister, Phil; Grohmann, Dina; Tinnefeld, Philip
2012-01-01
Single-molecule experiments on immobilized molecules allow unique insights into the dynamics of molecular machines and enzymes as well as their interactions. The immobilization, however, can invoke perturbation to the activity of biomolecules causing incongruities between single molecule and ensemble measurements. Here we introduce the recently developed DNA origami as a platform to transfer ensemble assays to the immobilized single molecule level without changing the nano-environment of the biomolecules. The idea is a stepwise transfer of common functional assays first to the surface of a DNA origami, which can be checked at the ensemble level, and then to the microscope glass slide for single-molecule inquiry using the DNA origami as a transfer platform. We studied the structural flexibility of a DNA Holliday junction and the TATA-binding protein (TBP)-induced bending of DNA both on freely diffusing molecules and attached to the origami structure by fluorescence resonance energy transfer. This resulted in highly congruent data sets demonstrating that the DNA origami does not influence the functionality of the biomolecule. Single-molecule data collected from surface-immobilized biomolecule-loaded DNA origami are in very good agreement with data from solution measurements supporting the fact that the DNA origami can be used as biocompatible surface in many fluorescence-based measurements. PMID:22523083
Stem Cell Physics. Multiple-Laser-Beam Treatment of Parkinson's Disease
NASA Astrophysics Data System (ADS)
Stefan, V.
2013-03-01
A novel method for the treatment of Parkinson's disease is proposed. Pluripotent stem cells are laser cultured, using ultrashort wavelength, (around 0.1 micron-ultraviolet radiation-with intensities of a few mW/cm2) , multiple laser beams.[2] The multiple-energy laser photons[3] interact with the neuron DNA molecules to be cloned. The laser created dopaminergic substantia nigra neurons can be, (theoretically), laser transplanted, (a higher focusing precision as compared to a syringe method), into the striatum or substantia nigra regions of the brain, or both. Supported by Nikola Tesla Labs, Stefan University.
The unusual and dynamic character of PX-DNA
Niu, Dong; Jiang, Hualin; Sha, Ruojie; ...
2015-07-15
PX-DNA is a four-stranded DNA structure that has been implicated in the recognition of homology, either continuously, or in an every-other-half-turn fashion. Some of the structural features of the molecule have been noted previously, but the structure requires further characterization. Here, we report atomic force microscopic characterization of PX molecules that contain periodically placed biotin groups, enabling the molecule to be labeled by streptavidin molecules at these sites. In comparison with conventional double stranded DNA and with antiparallel DNA double crossover molecules, it is clear that PX-DNA is a more dynamic structure. Moreover, the spacing between the nucleotide pairs alongmore » the helix axis is shorter, suggesting a mixed B/A structure. Circular dichroism spectroscopy indicates unusual features in the PX molecule that are absent in both the molecules to which it is compared.« less
Visualization of yeast chromosomal DNA
NASA Technical Reports Server (NTRS)
Lubega, Seth
1990-01-01
The DNA molecule is the most significant life molecule since it codes the blue print for other structural and functional molecules of all living organisms. Agarose gel electrophoresis is now being widely used to separate DNA of virus, bacteria, and lower eukaryotes. The task was undertaken of reviewing the existing methods of DNA fractionation and microscopic visualization of individual chromosonal DNA molecules by gel electrophoresis as a basis for a proposed study to investigate the feasibility of separating DNA molecules in free fluids as an alternative to gel electrophoresis. Various techniques were studied. On the molecular level, agarose gel electrophoresis is being widely used to separate chromosomal DNA according to molecular weight. Carl and Olson separate and characterized the entire karyotype of a lab strain of Saccharomyces cerevisiae. Smith et al. and Schwartz and Koval independently reported the visualization of individual DNA molecules migrating through agarose gel matrix during electrophoresis. The techniques used by these researchers are being reviewed in the lab as a basis for the proposed studies.
Transformation of Escherichia coli with large DNA molecules by electroporation.
Sheng, Y; Mancino, V; Birren, B
1995-01-01
We have examined bacterial electroporation with a specific interest in the transformation of large DNA, i.e. molecules > 100 kb. We have used DNA from bacterial artificial chromosomes (BACs) ranging from 7 to 240 kb, as well as BAC ligation mixes containing a range o different sized molecules. The efficiency of electroporation with large DNA is strongly dependent on the strain of Escherichia coli used; strains which offer comparable efficiencies for 7 kb molecules differ in their uptake of 240 kb DNA by as much as 30-fold. Even with a host strain that transforms relatively well with large DNA, transformation efficiency drops dramatically with increasing size of the DNA. Molecules of 240 kb transform approximately 30-fold less well, on a molar basis, than molecules of 80 kb. Maximum transformation of large DNA occurs with different voltage gradients and with different time constants than are optimal for smaller DNA. This provides the opportunity to increase the yield of transformants which have taken up large DNA relative to the number incorporating smaller molecules. We have demonstrated that conditions may be selected which increase the average size of BAC clones generated by electroporation and compare the overall efficiency of each of the conditions tested. Images PMID:7596828
A Structural Perspective on Readout of Epigenetic Histone and DNA Methylation Marks
Patel, Dinshaw J.
2016-01-01
SUMMARY This article outlines the protein modules that target methylated lysine histone marks and 5mC DNA marks, and the molecular principles underlying recognition. The article focuses on the structural basis underlying readout of isolated marks by single reader molecules, as well as multivalent readout of multiple marks by linked reader cassettes at the histone tail and nucleosome level. Additional topics addressed include the role of histone mimics, cross talk between histone marks, technological developments at the genome-wide level, advances using chemical biology approaches, the linkage between histone and DNA methylation, the role for regulatory lncRNAs, and the promise of chromatin-based therapeutic modalities. PMID:26931326
The study of electrical conductivity of DNA molecules by scanning tunneling spectroscopy
NASA Astrophysics Data System (ADS)
Sharipov, T. I.; Bakhtizin, R. Z.
2017-10-01
An interest to the processes of charge transport in DNA molecules is very high, due to perspective of their using in nanoelectronics. The original sample preparation for studying electrical conductivity of DNA molecules by scanning tunneling spectroscopy has been proposed and tested. The DNA molecules immobilized on gold surface have been imaged clearly and their current-voltage curves have been measured.
The Evolution of DNA-Templated Synthesis as a Tool for Materials Discovery.
O'Reilly, Rachel K; Turberfield, Andrew J; Wilks, Thomas R
2017-10-17
Precise control over reactivity and molecular structure is a fundamental goal of the chemical sciences. Billions of years of evolution by natural selection have resulted in chemical systems capable of information storage, self-replication, catalysis, capture and production of light, and even cognition. In all these cases, control over molecular structure is required to achieve a particular function: without structural control, function may be impaired, unpredictable, or impossible. The search for molecules with a desired function is often achieved by synthesizing a combinatorial library, which contains many or all possible combinations of a set of chemical building blocks (BBs), and then screening this library to identify "successful" structures. The largest libraries made by conventional synthesis are currently of the order of 10 8 distinct molecules. To put this in context, there are 10 13 ways of arranging the 21 proteinogenic amino acids in chains up to 10 units long. Given that we know that a number of these compounds have potent biological activity, it would be highly desirable to be able to search them all to identify leads for new drug molecules. Large libraries of oligonucleotides can be synthesized combinatorially and translated into peptides using systems based on biological replication such as mRNA display, with selected molecules identified by DNA sequencing; but these methods are limited to BBs that are compatible with cellular machinery. In order to search the vast tracts of chemical space beyond nucleic acids and natural peptides, an alternative approach is required. DNA-templated synthesis (DTS) could enable us to meet this challenge. DTS controls chemical product formation by using the specificity of DNA hybridization to bring selected reactants into close proximity, and is capable of the programmed synthesis of many distinct products in the same reaction vessel. By making use of dynamic, programmable DNA processes, it is possible to engineer a system that can translate instructions coded as a sequence of DNA bases into a chemical structure-a process analogous to the action of the ribosome in living organisms but with the potential to create a much more chemically diverse set of products. It is also possible to ensure that each product molecule is tagged with its identifying DNA sequence. Compound libraries synthesized in this way can be exposed to selection against suitable targets, enriching successful molecules. The encoding DNA can then be amplified using the polymerase chain reaction and decoded by DNA sequencing. More importantly, the DNA instruction sequences can be mutated and reused during multiple rounds of amplification, translation, and selection. In other words, DTS could be used as the foundation for a system of synthetic molecular evolution, which could allow us to efficiently search a vast chemical space. This has huge potential to revolutionize materials discovery-imagine being able to evolve molecules for light harvesting, or catalysts for CO 2 fixation. The field of DTS has developed to the point where a wide variety of reactions can be performed on a DNA template. Complex architectures and autonomous "DNA robots" have been implemented for the controlled assembly of BBs, and these mechanisms have in turn enabled the one-pot synthesis of large combinatorial libraries. Indeed, DTS libraries are being exploited by pharmaceutical companies and have already found their way into drug lead discovery programs. This Account explores the processes involved in DTS and highlights the challenges that remain in creating a general system for molecular discovery by evolution.
The Evolution of DNA-Templated Synthesis as a Tool for Materials Discovery
2017-01-01
Conspectus Precise control over reactivity and molecular structure is a fundamental goal of the chemical sciences. Billions of years of evolution by natural selection have resulted in chemical systems capable of information storage, self-replication, catalysis, capture and production of light, and even cognition. In all these cases, control over molecular structure is required to achieve a particular function: without structural control, function may be impaired, unpredictable, or impossible. The search for molecules with a desired function is often achieved by synthesizing a combinatorial library, which contains many or all possible combinations of a set of chemical building blocks (BBs), and then screening this library to identify “successful” structures. The largest libraries made by conventional synthesis are currently of the order of 108 distinct molecules. To put this in context, there are 1013 ways of arranging the 21 proteinogenic amino acids in chains up to 10 units long. Given that we know that a number of these compounds have potent biological activity, it would be highly desirable to be able to search them all to identify leads for new drug molecules. Large libraries of oligonucleotides can be synthesized combinatorially and translated into peptides using systems based on biological replication such as mRNA display, with selected molecules identified by DNA sequencing; but these methods are limited to BBs that are compatible with cellular machinery. In order to search the vast tracts of chemical space beyond nucleic acids and natural peptides, an alternative approach is required. DNA-templated synthesis (DTS) could enable us to meet this challenge. DTS controls chemical product formation by using the specificity of DNA hybridization to bring selected reactants into close proximity, and is capable of the programmed synthesis of many distinct products in the same reaction vessel. By making use of dynamic, programmable DNA processes, it is possible to engineer a system that can translate instructions coded as a sequence of DNA bases into a chemical structure—a process analogous to the action of the ribosome in living organisms but with the potential to create a much more chemically diverse set of products. It is also possible to ensure that each product molecule is tagged with its identifying DNA sequence. Compound libraries synthesized in this way can be exposed to selection against suitable targets, enriching successful molecules. The encoding DNA can then be amplified using the polymerase chain reaction and decoded by DNA sequencing. More importantly, the DNA instruction sequences can be mutated and reused during multiple rounds of amplification, translation, and selection. In other words, DTS could be used as the foundation for a system of synthetic molecular evolution, which could allow us to efficiently search a vast chemical space. This has huge potential to revolutionize materials discovery—imagine being able to evolve molecules for light harvesting, or catalysts for CO2 fixation. The field of DTS has developed to the point where a wide variety of reactions can be performed on a DNA template. Complex architectures and autonomous “DNA robots” have been implemented for the controlled assembly of BBs, and these mechanisms have in turn enabled the one-pot synthesis of large combinatorial libraries. Indeed, DTS libraries are being exploited by pharmaceutical companies and have already found their way into drug lead discovery programs. This Account explores the processes involved in DTS and highlights the challenges that remain in creating a general system for molecular discovery by evolution. PMID:28915003
Hybrid Methods Reveal Multiple Flexibly Linked DNA Polymerases within the Bacteriophage T7 Replisome
Wallen, Jamie R.; Zhang, Hao; Weis, Caroline; ...
2017-01-03
The physical organization of DNA enzymes at a replication fork enables efficient copying of two antiparallel DNA strands, yet dynamic protein interactions within the replication complex complicate replisome structural studies. We employed a combination of crystallographic, native mass spectrometry and small-angle X-ray scattering experiments to capture alternative structures of a model replication system encoded by bacteriophage T7. then, the two molecules of DNA polymerase bind the ring-shaped primase-helicase in a conserved orientation and provide structural insight into how the acidic C-terminal tail of the primase-helicase contacts the DNA polymerase to facilitate loading of the polymerase onto DNA. A third DNA polymerasemore » binds the ring in an offset manner that may enable polymerase exchange during replication. Alternative polymerase binding modes are also detected by small-angle X-ray scattering with DNA substrates present. The collective results unveil complex motions within T7 replisome higher-order structures that are underpinned by multivalent protein-protein interactions with functional implications.« less
A force-based, parallel assay for the quantification of protein-DNA interactions.
Limmer, Katja; Pippig, Diana A; Aschenbrenner, Daniela; Gaub, Hermann E
2014-01-01
Analysis of transcription factor binding to DNA sequences is of utmost importance to understand the intricate regulatory mechanisms that underlie gene expression. Several techniques exist that quantify DNA-protein affinity, but they are either very time-consuming or suffer from possible misinterpretation due to complicated algorithms or approximations like many high-throughput techniques. We present a more direct method to quantify DNA-protein interaction in a force-based assay. In contrast to single-molecule force spectroscopy, our technique, the Molecular Force Assay (MFA), parallelizes force measurements so that it can test one or multiple proteins against several DNA sequences in a single experiment. The interaction strength is quantified by comparison to the well-defined rupture stability of different DNA duplexes. As a proof-of-principle, we measured the interaction of the zinc finger construct Zif268/NRE against six different DNA constructs. We could show the specificity of our approach and quantify the strength of the protein-DNA interaction.
Hybrid Methods Reveal Multiple Flexibly Linked DNA Polymerases within the Bacteriophage T7 Replisome
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wallen, Jamie R.; Zhang, Hao; Weis, Caroline
The physical organization of DNA enzymes at a replication fork enables efficient copying of two antiparallel DNA strands, yet dynamic protein interactions within the replication complex complicate replisome structural studies. We employed a combination of crystallographic, native mass spectrometry and small-angle X-ray scattering experiments to capture alternative structures of a model replication system encoded by bacteriophage T7. then, the two molecules of DNA polymerase bind the ring-shaped primase-helicase in a conserved orientation and provide structural insight into how the acidic C-terminal tail of the primase-helicase contacts the DNA polymerase to facilitate loading of the polymerase onto DNA. A third DNA polymerasemore » binds the ring in an offset manner that may enable polymerase exchange during replication. Alternative polymerase binding modes are also detected by small-angle X-ray scattering with DNA substrates present. The collective results unveil complex motions within T7 replisome higher-order structures that are underpinned by multivalent protein-protein interactions with functional implications.« less
Torsional mechanics of DNA are regulated by small-molecule intercalation.
Celedon, Alfredo; Wirtz, Denis; Sun, Sean
2010-12-23
Whether the bend and twist mechanics of DNA molecules are coupled is unclear. Here, we report the direct measurement of the resistive torque of single DNA molecules to study the effect of ethidium bromide (EtBr) intercalation and pulling force on DNA twist mechanics. DNA molecules were overwound and unwound using recently developed magnetic tweezers where the molecular resistive torque was obtained from Brownian angular fluctuations. The effect of EtBr intercalation on the twist stiffness was found to be significantly different from the effect on the bend persistence length. The twist stiffness of DNA was dramatically reduced at low intercalator concentration (<10 nM); however, it did not decrease further when the intercalator concentration was increased by 3 orders of magnitude. We also determined the dependence of EtBr intercalation on the torque applied to DNA. We propose a model for the elasticity of DNA base pairs with intercalated EtBr molecules to explain the abrupt decrease of twist stiffness at low EtBr concentration. These results indicate that the bend and twist stiffnesses of DNA are independent and can be differently affected by small-molecule binding.
Method for performing site-specific affinity fractionation for use in DNA sequencing
Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.
1999-01-01
A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.
Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.
2000-01-01
A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.
Method for performing site-specific affinity fractionation for use in DNA sequencing
Mirzabekov, A.D.; Lysov, Y.P.; Dubley, S.A.
1999-05-18
A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between the cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting the extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to the extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from the array. 14 figs.
Programmable and Multiparameter DNA-Based Logic Platform For Cancer Recognition and Targeted Therapy
2014-01-01
The specific inventory of molecules on diseased cell surfaces (e.g., cancer cells) provides clinicians an opportunity for accurate diagnosis and intervention. With the discovery of panels of cancer markers, carrying out analyses of multiple cell-surface markers is conceivable. As a trial to accomplish this, we have recently designed a DNA-based device that is capable of performing autonomous logic-based analysis of two or three cancer cell-surface markers. Combining the specific target-recognition properties of DNA aptamers with toehold-mediated strand displacement reactions, multicellular marker-based cancer analysis can be realized based on modular AND, OR, and NOT Boolean logic gates. Specifically, we report here a general approach for assembling these modular logic gates to execute programmable and higher-order profiling of multiple coexisting cell-surface markers, including several found on cancer cells, with the capacity to report a diagnostic signal and/or deliver targeted photodynamic therapy. The success of this strategy demonstrates the potential of DNA nanotechnology in facilitating targeted disease diagnosis and effective therapy. PMID:25361164
DOE Office of Scientific and Technical Information (OSTI.GOV)
Heravi, Mitra; Department of Radiation Oncology, McGill University, Montreal; Segal Cancer Center, Jewish General Hospital, Montreal
2015-06-01
Purpose: ZRBA1 is a combi-molecule designed to induce DNA alkylating lesions and to block epidermal growth factor receptor (EGFR) TK domain. Inasmuch as ZRBA1 downregulates the EGFR TK-mediated antisurvival signaling and induces DNA damage, we postulated that it might be a radiosensitizer. The aim of this study was to further investigate the potentiating effect of ZRBA1 in combination with radiation and to elucidate the possible mechanisms of interaction between these 2 treatment modalities. Methods and Materials: The triple negative human breast MDA-MB-468 cancer cell line and mouse mammary cancer 4T1 cell line were used in this study. Clonogenic assay, Westernmore » blot analysis, and DNA damage analysis were performed at multiple time points after treatment. To confirm our in vitro findings, in vivo tumor growth delay assay was performed. Results: Our results show that a combination of ZRBA1 and radiation increases the radiation sensitivity of both cell lines significantly with a dose enhancement factor of 1.56, induces significant numbers of DNA strand breaks, prolongs higher DNA damage up to 24 hours after treatment, and significantly increases tumor growth delay in a syngeneic mouse model. Conclusions: Our data suggest that the higher efficacy of this combination could be partially due to increased DNA damage and delayed DNA repair process and to the inhibition of EGFR. The encouraging results of this combination demonstrated a significant improvement in treatment efficiency and therefore could be applicable in early clinical trial settings.« less
Multiple pathogen biomarker detection using an encoded bead array in droplet PCR.
Periyannan Rajeswari, Prem Kumar; Soderberg, Lovisa M; Yacoub, Alia; Leijon, Mikael; Andersson Svahn, Helene; Joensson, Haakan N
2017-08-01
We present a droplet PCR workflow for detection of multiple pathogen DNA biomarkers using fluorescent color-coded Luminex® beads. This strategy enables encoding of multiple singleplex droplet PCRs using a commercially available bead set of several hundred distinguishable fluorescence codes. This workflow provides scalability beyond the limited number offered by fluorescent detection probes such as TaqMan probes, commonly used in current multiplex droplet PCRs. The workflow was validated for three different Luminex bead sets coupled to target specific capture oligos to detect hybridization of three microorganisms infecting poultry: avian influenza, infectious laryngotracheitis virus and Campylobacter jejuni. In this assay, the target DNA was amplified with fluorescently labeled primers by PCR in parallel in monodisperse picoliter droplets, to avoid amplification bias. The color codes of the Luminex detection beads allowed concurrent and accurate classification of the different bead sets used in this assay. The hybridization assay detected target DNA of all three microorganisms with high specificity, from samples with average target concentration of a single DNA template molecule per droplet. This workflow demonstrates the possibility of increasing the droplet PCR assay detection panel to detect large numbers of targets in parallel, utilizing the scalability offered by the color-coded Luminex detection beads. Copyright © 2017. Published by Elsevier B.V.
DNA molecules on periodically microstructured lipid membranes: Localization and coil stretching
NASA Astrophysics Data System (ADS)
Hochrein, Marion B.; Leierseder, Judith A.; Golubović, Leonardo; Rädler, Joachim O.
2007-02-01
We explore large scale conformations of DNA molecules adsorbed on curved surfaces. For that purpose, we investigate the behavior of DNA adsorbed on periodically shaped cationic lipid membranes. These unique membrane morphologies are supported on grooved, one-dimensionally periodic microstructured surfaces. Strikingly, we find that these periodically structured membranes are capable to stretch DNA coils. We elucidate this phenomenon in terms of surface curvature dependent potential energy attained by the adsorbed DNA molecules. Due to it, DNA molecules undergo a localization transition causing them to stretch by binding to highly curved sections (edges) of the supported membranes. This effect provides a new venue for controlling conformations of semiflexible polymers such as DNA by employing their interactions with specially designed biocompatible surfaces. We report the first experimental observation of semiflexible polymers unbinding transition in which DNA molecules unbind from one-dimensional manifolds (edges) while remaining bound to two-dimensional manifolds (cationic membranes).
Observation of DNA Molecules Using Fluorescence Microscopy and Atomic Force Microscopy
ERIC Educational Resources Information Center
Ito, Takashi
2008-01-01
This article describes experiments for an undergraduate instrumental analysis laboratory that aim to observe individual double-stranded DNA (dsDNA) molecules using fluorescence microscopy and atomic force microscopy (AFM). dsDNA molecules are observed under several different conditions to discuss their chemical and physical properties. In…
The Divided Bacterial Genome: Structure, Function, and Evolution.
diCenzo, George C; Finan, Turlough M
2017-09-01
Approximately 10% of bacterial genomes are split between two or more large DNA fragments, a genome architecture referred to as a multipartite genome. This multipartite organization is found in many important organisms, including plant symbionts, such as the nitrogen-fixing rhizobia, and plant, animal, and human pathogens, including the genera Brucella , Vibrio , and Burkholderia . The availability of many complete bacterial genome sequences means that we can now examine on a broad scale the characteristics of the different types of DNA molecules in a genome. Recent work has begun to shed light on the unique properties of each class of replicon, the unique functional role of chromosomal and nonchromosomal DNA molecules, and how the exploitation of novel niches may have driven the evolution of the multipartite genome. The aims of this review are to (i) outline the literature regarding bacterial genomes that are divided into multiple fragments, (ii) provide a meta-analysis of completed bacterial genomes from 1,708 species as a way of reviewing the abundant information present in these genome sequences, and (iii) provide an encompassing model to explain the evolution and function of the multipartite genome structure. This review covers, among other topics, salient genome terminology; mechanisms of multipartite genome formation; the phylogenetic distribution of multipartite genomes; how each part of a genome differs with respect to genomic signatures, genetic variability, and gene functional annotation; how each DNA molecule may interact; as well as the costs and benefits of this genome structure. Copyright © 2017 American Society for Microbiology.
Lindsay, Stuart; He, Jin; Sankey, Otto; Hapala, Prokop; Jelinek, Pavel; Zhang, Peiming; Chang, Shuai; Huang, Shuo
2010-01-01
Single molecules in a tunnel junction can now be interrogated reliably using chemically-functionalized electrodes. Monitoring stochastic bonding fluctuations between a ligand bound to one electrode and its target bound to a second electrode (“tethered molecule-pair” configuration) gives insight into the nature of the intermolecular bonding at a single molecule-pair level, and defines the requirements for reproducible tunneling data. Simulations show that there is an instability in the tunnel gap at large currents, and this results in a multiplicity of contacts with a corresponding spread in the measured currents. At small currents (i.e. large gaps) the gap is stable, and functionalizing a pair of electrodes with recognition reagents (the “free analyte” configuration) can generate a distinct tunneling signal when an analyte molecule is trapped in the gap. This opens up a new interface between chemistry and electronics with immediate implications for rapid sequencing of single DNA molecules. PMID:20522930
RNA-Mediated Epigenetic Programming of Genome Rearrangements
Nowacki, Mariusz; Shetty, Keerthi; Landweber, Laura F.
2012-01-01
RNA, normally thought of as a conduit in gene expression, has a novel mode of action in ciliated protozoa. Maternal RNA templates provide both an organizing guide for DNA rearrangements and a template that can transport somatic mutations to the next generation. This opportunity for RNA-mediated genome rearrangement and DNA repair is profound in the ciliate Oxytricha, which deletes 95% of its germline genome during development in a process that severely fragments its chromosomes and then sorts and reorders the hundreds of thousands of pieces remaining. Oxytricha’s somatic nuclear genome is therefore an epigenome formed through RNA templates and signals arising from the previous generation. Furthermore, this mechanism of RNA-mediated epigenetic inheritance can function across multiple generations, and the discovery of maternal template RNA molecules has revealed new biological roles for RNA and has hinted at the power of RNA molecules to sculpt genomic information in cells. PMID:21801022
Reachability bounds for chemical reaction networks and strand displacement systems.
Condon, Anne; Kirkpatrick, Bonnie; Maňuch, Ján
2014-01-01
Chemical reaction networks (CRNs) and DNA strand displacement systems (DSDs) are widely-studied and useful models of molecular programming. However, in order for some DSDs in the literature to behave in an expected manner, the initial number of copies of some reagents is required to be fixed. In this paper we show that, when multiple copies of all initial molecules are present, general types of CRNs and DSDs fail to work correctly if the length of the shortest sequence of reactions needed to produce any given molecule exceeds a threshold that grows polynomially with attributes of the system.
Xue, Chang; Zhang, Shu-Xin; Ouyang, Chang-He; Chang, Dingran; Salena, Bruno J; Li, Yingfu; Wu, Zai-Sheng
2018-06-14
DNA is a highly programmable material that can be configured into unique high-order structures, such as DNA branched junctions containing multiple helical arms converging at a center. Herein we show that DNA programmability can deliver in situ growth of a 3-way junction-based DNA structure (denoted Y-shaped DNA) with the use of three hairpin-shaped DNA molecules as precursors, a specific microRNA target as a recyclable trigger, and a DNA polymerase as a driver. We demonstrate that the Y-shaped configuration comes with the benefit of restricted freedom of movement in confined cellular environment, which makes the approach ideally suited for in situ imaging of small RNA targets, such as microRNAs. Comparative analysis illustrates that the proposed imaging technique is superior to both the classic fluorescence in situ hybridization (FISH) method and an analogous amplified imaging method via programmed growth of a double-stranded DNA (rather than Y-shaped DNA) product. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Guo, Chun Xian; Chitre, Amey Anil; Lu, Xianmao
2014-03-14
A DNA-assisted assembly approach is developed to fabricate a capacitor-type electrode material, DNA-functionalized carbon nanotubes (CNTs@DNA), and a battery-type electrode material, DNA@CNTs-bridged MnO2 spheres (CNTs@DNA-MnO2), for asymmetric supercapacitors. An energy density of 11.6 W h kg(-1) is achieved at a power density of 185.5 W kg(-1) with a high MnO2 mass loading of 4.2 mg cm(-2). It is found that DNA assembly plays a critical role in the enhanced supercapacitor performance. This is because while DNA molecules functionalize carbon nanotubes (CNTs) via π-π stacking, their hydrophilic sugar-phosphate backbones also promote the dispersion of CNTs. The resultant CNTs@DNA chains can link multiple MnO2 spheres to form a networked architecture that facilitates charge transfer and effective MnO2 utilization. The improved performance of the asymmetric supercapacitors indicates that DNA-assisted assembly offers a promising approach to the fabrication of high-performance energy storage devices.
Formation of template-switching artifacts by linear amplification.
Chakravarti, Dhrubajyoti; Mailander, Paula C
2008-07-01
Linear amplification is a method of synthesizing single-stranded DNA from either a single-stranded DNA or one strand of a double-stranded DNA. In this protocol, molecules of a single primer DNA are extended by multiple rounds of DNA synthesis at high temperature using thermostable DNA polymerases. Although linear amplification generates the intended full-length single-stranded product, it is more efficient over single-stranded templates than double-stranded templates. We analyzed linear amplification over single- or double-stranded mouse H-ras DNA (exon 1-2 region). The single-stranded H-ras template yielded only the intended product. However, when the double-stranded template was used, additional artifact products were observed. Increasing the concentration of the double-stranded template produced relatively higher amounts of these artifact products. One of the artifact DNA bands could be mapped and analyzed by sequencing. It contained three template-switching products. These DNAs were formed by incomplete DNA strand extension over the template strand, followed by switching to the complementary strand at a specific Ade nucleotide within a putative hairpin sequence, from which DNA synthesis continued over the complementary strand.
Verma, Subhash C.; Lu, Jie; Cai, Qiliang; Kosiyatrakul, Settapong; McDowell, Maria E.; Schildkraut, Carl L.; Robertson, Erle S.
2011-01-01
Kaposi's sarcoma associated herpesvirus (KSHV), an etiologic agent of Kaposi's sarcoma, Body Cavity Based Lymphoma and Multicentric Castleman's Disease, establishes lifelong latency in infected cells. The KSHV genome tethers to the host chromosome with the help of a latency associated nuclear antigen (LANA). Additionally, LANA supports replication of the latent origins within the terminal repeats by recruiting cellular factors. Our previous studies identified and characterized another latent origin, which supported the replication of plasmids ex-vivo without LANA expression in trans. Therefore identification of an additional origin site prompted us to analyze the entire KSHV genome for replication initiation sites using single molecule analysis of replicated DNA (SMARD). Our results showed that replication of DNA can initiate throughout the KSHV genome and the usage of these regions is not conserved in two different KSHV strains investigated. SMARD also showed that the utilization of multiple replication initiation sites occurs across large regions of the genome rather than a specified sequence. The replication origin of the terminal repeats showed only a slight preference for their usage indicating that LANA dependent origin at the terminal repeats (TR) plays only a limited role in genome duplication. Furthermore, we performed chromatin immunoprecipitation for ORC2 and MCM3, which are part of the pre-replication initiation complex to determine the genomic sites where these proteins accumulate, to provide further characterization of potential replication initiation sites on the KSHV genome. The ChIP data confirmed accumulation of these pre-RC proteins at multiple genomic sites in a cell cycle dependent manner. Our data also show that both the frequency and the sites of replication initiation vary within the two KSHV genomes studied here, suggesting that initiation of replication is likely to be affected by the genomic context rather than the DNA sequences. PMID:22072974
Translocation-coupled DNA cleavage by the Type ISP restriction-modification enzymes
Chand, Mahesh Kumar; Nirwan, Neha; Diffin, Fiona M.; van Aelst, Kara; Kulkarni, Manasi; Pernstich, Christian; Szczelkun, Mark D.; Saikrishnan, Kayarat
2015-01-01
Endonucleolytic double-strand DNA break production requires separate strand cleavage events. Although catalytic mechanisms for simple dimeric endonucleases are available, there are many complex nuclease machines which are poorly understood in comparison. Here we studied the single polypeptide Type ISP restriction-modification (RM) enzymes, which cleave random DNA between distant target sites when two enzymes collide following convergent ATP-driven translocation. We report the 2.7 Angstroms resolution X-ray crystal structure of a Type ISP enzyme-DNA complex, revealing that both the helicase-like ATPase and nuclease are unexpectedly located upstream of the direction of translocation, inconsistent with simple nuclease domain-dimerization. Using single-molecule and biochemical techniques, we demonstrate that each ATPase remodels its DNA-protein complex and translocates along DNA without looping it, leading to a collision complex where the nuclease domains are distal. Sequencing of single cleavage events suggests a previously undescribed endonuclease model, where multiple, stochastic strand nicking events combine to produce DNA scission. PMID:26389736
Manipulation of oligonucleotides immobilized on solid supports - DNA computations on surfaces
NASA Astrophysics Data System (ADS)
Liu, Qinghua
The manipulation of DNA oligonucleotides immobilized on various solid supports has been studied intensively, especially in the area of surface hybridization. Recently, surface-based biotechnology has been applied to the area of molecular computing. These surface-based methods have advantages with regard to ease of handling, facile purification, and less interference when compared to solution methodologies. This dissertation describes the investigation of molecular approaches to DNA computing. The feasibility of encoding a bit (0 or 1) of information for DNA-based computations at the single nucleotide level was studied, particularly with regard to the efficiency and specificity of hybridization discrimination. Both gold and glass surfaces, with addressed arrays of 32 oligonucleotides, were employed with similar hybridization results. Although single-base discrimination may be achieved in the system, it is at the cost of a severe decrease in the efficiency of hybridization to perfectly matched sequences. This compromises the utility of single nucleotide encoding for DNA computing applications in the absence of some additional mechanism for increasing specificity. Several methods are suggested including a multiple-base encoding strategy. The multiple-base encoding strategy was employed to develop a prototype DNA computer. The approach was demonstrated by solving a small example of the Satisfiability (SAT) problem, an NP-complete problem in Boolean logic. 16 distinct DNA oligonucleotides, encoding all candidate solutions to the 4-variable-4-clause-3-SAT problem, were immobilized on a gold surface in the non-addressed format. Four cycles of MARK (hybridization), DESTROY (enzymatic destruction) and UNMARK (denaturation) were performed, which identified and eliminated members of the set which were not solutions to the problem. Determination of the answer was accomplished in the READOUT (sequence identification) operation by PCR amplification of the remaining molecules and hybridization to an addressed array. Four answers were determined and the S/N ratio between correct and incorrect solutions ranged from 10 to 777, making discrimination between correct and incorrect solutions to the problem straightforward. Additionally, studies of enzymatic manipulations of DNA molecules on surfaces suggested the use of E. coli Exonuclease I (Exo I) and perhaps EarI in the DESTROY operation.
Shiroguchi, Katsuyuki; Jia, Tony Z.; Sims, Peter A.; Xie, X. Sunney
2012-01-01
RNA sequencing (RNA-Seq) is a powerful tool for transcriptome profiling, but is hampered by sequence-dependent bias and inaccuracy at low copy numbers intrinsic to exponential PCR amplification. We developed a simple strategy for mitigating these complications, allowing truly digital RNA-Seq. Following reverse transcription, a large set of barcode sequences is added in excess, and nearly every cDNA molecule is uniquely labeled by random attachment of barcode sequences to both ends. After PCR, we applied paired-end deep sequencing to read the two barcodes and cDNA sequences. Rather than counting the number of reads, RNA abundance is measured based on the number of unique barcode sequences observed for a given cDNA sequence. We optimized the barcodes to be unambiguously identifiable, even in the presence of multiple sequencing errors. This method allows counting with single-copy resolution despite sequence-dependent bias and PCR-amplification noise, and is analogous to digital PCR but amendable to quantifying a whole transcriptome. We demonstrated transcriptome profiling of Escherichia coli with more accurate and reproducible quantification than conventional RNA-Seq. PMID:22232676
A Single-Molecule Barcoding System using Nanoslits for DNA Analysis
NASA Astrophysics Data System (ADS)
Jo, Kyubong; Schramm, Timothy M.; Schwartz, David C.
Single DNA molecule approaches are playing an increasingly central role in the analytical genomic sciences because single molecule techniques intrinsically provide individualized measurements of selected molecules, free from the constraints of bulk techniques, which blindly average noise and mask the presence of minor analyte components. Accordingly, a principal challenge that must be addressed by all single molecule approaches aimed at genome analysis is how to immobilize and manipulate DNA molecules for measurements that foster construction of large, biologically relevant data sets. For meeting this challenge, this chapter discusses an integrated approach for microfabricated and nanofabricated devices for the manipulation of elongated DNA molecules within nanoscale geometries. Ideally, large DNA coils stretch via nanoconfinement when channel dimensions are within tens of nanometers. Importantly, stretched, often immobilized, DNA molecules spanning hundreds of kilobase pairs are required by all analytical platforms working with large genomic substrates because imaging techniques acquire sequence information from molecules that normally exist in free solution as unrevealing random coils resembling floppy balls of yarn. However, nanoscale devices fabricated with sufficiently small dimensions fostering molecular stretching make these devices impractical because of the requirement of exotic fabrication technologies, costly materials, and poor operational efficiencies. In this chapter, such problems are addressed by discussion of a new approach to DNA presentation and analysis that establishes scaleable nanoconfinement conditions through reduction of ionic strength; stiffening DNA molecules thus enabling their arraying for analysis using easily fabricated devices that can also be mass produced. This new approach to DNA nanoconfinement is complemented by the development of a novel labeling scheme for reliable marking of individual molecules with fluorochrome labels, creating molecular barcodes, which are efficiently read using fluorescence resonance energy transfer techniques for minimizing noise from unincorporated labels. As such, our integrative approach for the realization of genomic analysis through nanoconfinement, named nanocoding, was demonstrated through the barcoding and mapping of bacterial artificial chromosomal molecules, thereby providing the basis for a high-throughput platform competent for whole genome investigations.
Electrical detection and quantification of single and mixed DNA nucleotides in suspension
NASA Astrophysics Data System (ADS)
Ahmad, Mahmoud Al; Panicker, Neena G.; Rizvi, Tahir A.; Mustafa, Farah
2016-09-01
High speed sequential identification of the building blocks of DNA, (deoxyribonucleotides or nucleotides for short) without labeling or processing in long reads of DNA is the need of the hour. This can be accomplished through exploiting their unique electrical properties. In this study, the four different types of nucleotides that constitute a DNA molecule were suspended in a buffer followed by performing several types of electrical measurements. These electrical parameters were then used to quantify the suspended DNA nucleotides. Thus, we present a purely electrical counting scheme based on the semiconductor theory that allows one to determine the number of nucleotides in a solution by measuring their capacitance-voltage dependency. The nucleotide count was observed to be similar to the multiplication of the corresponding dopant concentration and debye volume after de-embedding the buffer contribution. The presented approach allows for a fast and label-free quantification of single and mixed nucleotides in a solution.
A Proteomic Characterization of Factors Enriched at Nascent DNA Molecules
Lopez-Contreras, Andres J.; Ruppen, Isabel; Nieto-Soler, Maria; Murga, Matilde; Rodriguez-Acebes, Sara; Remeseiro, Silvia; Rodrigo-Perez, Sara; Rojas, Ana M.; Mendez, Juan; Muñoz, Javier; Fernandez-Capetillo, Oscar
2013-01-01
SUMMARY DNA replication is facilitated by multiple factors that concentrate in the vicinity of replication forks. Here, we developed an approach that combines the isolation of proteins on nascent DNA chains with mass spectrometry (iPOND-MS), allowing a comprehensive proteomic characterization of the human replisome and replisome-associated factors. In addition to known replisome components, we provide a broad list of proteins that reside in the vicinity of the replisome, some of which were not previously associated with replication. For instance, our data support a link between DNA replication and the Williams-Beuren syndrome and identify ZNF24 as a replication factor. In addition, we reveal that SUMOylation is wide-spread for factors that concentrate near replisomes, which contrasts with lower UQylation levels at these sites. This resource provides a panoramic view of the proteins that concentrate in the surroundings of the replisome, which should facilitate future investigations on DNA replication and genome maintenance. PMID:23545495
A Theoretical and Experimental Study of DNA Self-assembly
NASA Astrophysics Data System (ADS)
Chandran, Harish
The control of matter and phenomena at the nanoscale is fast becoming one of the most important challenges of the 21st century with wide-ranging applications from energy and health care to computing and material science. Conventional top-down approaches to nanotechnology, having served us well for long, are reaching their inherent limitations. Meanwhile, bottom-up methods such as self-assembly are emerging as viable alternatives for nanoscale fabrication and manipulation. A particularly successful bottom up technique is DNA self-assembly where a set of carefully designed DNA strands form a nanoscale object as a consequence of specific, local interactions among the different components, without external direction. The final product of the self-assembly process might be a static nanostructure or a dynamic nanodevice that performs a specific function. Over the past two decades, DNA self-assembly has produced stunning nanoscale objects such as 2D and 3D lattices, polyhedra and addressable arbitrary shaped substrates, and a myriad of nanoscale devices such as molecular tweezers, computational circuits, biosensors and molecular assembly lines. In this dissertation we study multiple problems in the theory, simulations and experiments of DNA self-assembly. We extend the Turing-universal mathematical framework of self-assembly known as the Tile Assembly Model by incorporating randomization during the assembly process. This allows us to reduce the tile complexity of linear assemblies. We develop multiple techniques to build linear assemblies of expected length N using far fewer tile types than previously possible. We abstract the fundamental properties of DNA and develop a biochemical system, which we call meta-DNA, based entirely on strands of DNA as the only component molecule. We further develop various enzyme-free protocols to manipulate meta-DNA systems and provide strand level details along with abstract notations for these mechanisms. We simulate DNA circuits by providing detailed designs for local molecular computations that involve spatially contiguous molecules arranged on addressable substrates via enzyme-free DNA hybridization reaction cascades. We use the Visual DSD simulation software in conjunction with localized reaction rates obtained from biophysical modeling to create chemical reaction networks of localized hybridization circuits that are then model checked using the PRISM model checking software. We develop a DNA detection system employing the triggered self-assembly of a novel DNA dendritic nanostructure. Detection begins when a specific, single-stranded target DNA strand triggers a hybridization chain reaction between two distinct DNA hairpins. Each hairpin opens and hybridizes up to two copies of the other, and hence each layer of the growing dendritic nanostructure can in principle accommodate an exponentially increasing number of cognate molecules, generating a nanostructure with high molecular weight. We build linear activatable assemblies employing a novel protection/deprotection strategy to strictly enforce the direction of tiling assembly growth to ensure the robustness of the assembly process. Our system consists of two tiles that can form a linear co-polymer. These tiles, which are initially protected such that they do not react with each other, can be activated to form linear co-polymers via the use of a strand displacing enzyme.
Visualization of DNA molecules in time during electrophoresis
NASA Technical Reports Server (NTRS)
Lubega, Seth
1991-01-01
For several years individual DNA molecules have been observed and photographed during agarose gel electrophoresis. The DNA molecule is clearly the largest molecule known. Nevertheless, the largest molecule is still too small to be seen using a microscope. A technique developed by Morikawa and Yanagida has made it possible to visualize individual DNA molecules. When these long molecules are labeled with appropriate fluorescence dyes and observed under a fluorescence microscope, although it is not possible to directly visualize the local ultrastructure of the molecules, yet because they are long light emitting chains, their microscopic dynamical behavior can be observed. This visualization works in the same principle that enables one to observe a star through a telescope because it emits light against a dark background. The dynamics of individual DNA molecules migrating through agarose matrix during electrophoresis have been described by Smith et al. (1989), Schwartz and Koval (1989), and Bustamante et al. (1990). DNA molecules during agarose gel electrophoresis advance lengthwise thorough the gel in an extended configuration. They display an extension-contraction motion and tend to bunch up in their leading ends as the 'heads' find new pores through the gel. From time to time they get hooked on obstacles in the gel to form U-shaped configurations before they resume their linear configuration.
Single Molecule Visualization of Protein-DNA Complexes: Watching Machines at Work
NASA Astrophysics Data System (ADS)
Kowalczykowski, Stephen
2013-03-01
We can now watch individual proteins acting on single molecules of DNA. Such imaging provides unprecedented interrogation of fundamental biophysical processes. Visualization is achieved through the application of two complementary procedures. In one, single DNA molecules are attached to a polystyrene bead and are then captured by an optical trap. The DNA, a worm-like coil, is extended either by the force of solution flow in a micro-fabricated channel, or by capturing the opposite DNA end in a second optical trap. In the second procedure, DNA is attached by one end to a glass surface. The coiled DNA is elongated either by continuous solution flow or by subsequently tethering the opposite end to the surface. Protein action is visualized by fluorescent reporters: fluorescent dyes that bind double-stranded DNA (dsDNA), fluorescent biosensors for single-stranded DNA (ssDNA), or fluorescently-tagged proteins. Individual molecules are imaged using either epifluorescence microscopy or total internal reflection fluorescence (TIRF) microscopy. Using these approaches, we imaged the search for DNA sequence homology conducted by the RecA-ssDNA filament. The manner by which RecA protein finds a single homologous sequence in the genome had remained undefined for almost 30 years. Single-molecule imaging revealed that the search occurs through a mechanism termed ``intersegmental contact sampling,'' in which the randomly coiled structure of DNA is essential for reiterative sampling of DNA sequence identity: an example of parallel processing. In addition, the assembly of RecA filaments on single molecules of single-stranded DNA was visualized. Filament assembly requires nucleation of a protein dimer on DNA, and subsequent growth occurs via monomer addition. Furthermore, we discovered a class of proteins that catalyzed both nucleation and growth of filaments, revealing how the cell controls assembly of this protein-DNA complex.
Global structure of forked DNA in solution revealed by high-resolution single-molecule FRET.
Sabir, Tara; Schröder, Gunnar F; Toulmin, Anita; McGlynn, Peter; Magennis, Steven W
2011-02-09
Branched DNA structures play critical roles in DNA replication, repair, and recombination in addition to being key building blocks for DNA nanotechnology. Here we combine single-molecule multiparameter fluorescence detection and molecular dynamics simulations to give a general approach to global structure determination of branched DNA in solution. We reveal an open, planar structure of a forked DNA molecule with three duplex arms and demonstrate an ion-induced conformational change. This structure will serve as a benchmark for DNA-protein interaction studies.
SA1 and TRF1 synergistically bind to telomeric DNA and promote DNA-DNA pairing
NASA Astrophysics Data System (ADS)
Wang, Hong; Lin, Jiangguo; Countryman, Preston; Pan, Hai; Parminder Kaur Team; Robert Riehn Team; Patricia Opresko Team; Jane Tao Team; Susan Smith Team
Impaired telomere cohesion leads to increased aneuploidy and early onset of tumorigenesis. Cohesion is thought to occur through the entrapment of two DNA strands within tripartite cohesin ring(s), along with a fourth subunit (SA1/SA2). Surprisingly, cohesion rings are not essential for telomere cohesion, which instead requires SA1 and shelterin proteins including TRF1. However, neither this unique cohesion mechanism at telomeres or DNA-binding properties of SA1 is understood. Here, using single-molecule fluorescence imaging of quantum dot-labeled proteins on DNA we discover that while SA1 diffuses across multiple telomeric and non-telomeric regions, the diffusion mediated through its N-terminal domain is slower at telomeric regions. However, addition of TRF1 traps SA1 within telomeric regions, which form longer DNA-DNA pairing tracts than with TRF1 alone, as revealed by atomic force microscopy. Together, these experimental results and coarse-grained molecular dynamics simulations suggest that TRF1 and SA1 synergistically interact with DNA to support telomere cohesion without cohesin rings.
Olsen, Chris M; Shikiya, Ronald; Ganugula, Rajkumar; Reiling-Steffensmeier, Calliste; Khutsishvili, Irine; Johnson, Sarah E; Marky, Luis A
2016-05-01
The overall stability of DNA molecules globally depends on base-pair stacking, base-pairing, polyelectrolyte effect and hydration contributions. In order to understand how they carry out their biological roles, it is essential to have a complete physical description of how the folding of nucleic acids takes place, including their ion and water binding. To investigate the role of ions, water and protons in the stability and melting behavior of DNA structures, we report here an experimental approach i.e., mainly differential scanning calorimetry (DSC), to determine linking numbers: the differential binding of ions (Δnion), water (ΔnW) and protons (ΔnH(+)) in the helix-coil transition of DNA molecules. We use DSC and temperature-dependent UV spectroscopic techniques to measure the differential binding of ions, water, and protons for the unfolding of a variety of DNA molecules: salmon testes DNA (ST-DNA), one dodecamer, one undecamer and one decamer duplexes, nine hairpin loops, and two triplexes. These methods can be applied to any conformational transition of a biomolecule. We determined complete thermodynamic profiles, including all three linking numbers, for the unfolding of each molecule. The favorable folding of a DNA helix results from a favorable enthalpy-unfavorable entropy compensation. DSC thermograms and UV melts as a function of salt, osmolyte and proton concentrations yielded releases of ions and water. Therefore, the favorable folding of each DNA molecule results from the formation of base-pair stacks and uptake of both counterions and water molecules. In addition, the triplex with C(+)GC base triplets yielded an uptake of protons. Furthermore, the folding of a DNA duplex is accompanied by a lower uptake of ions and a similar uptake of four water molecules as the DNA helix gets shorter. In addition, the oligomer duplexes and hairpin thermodynamic data suggest ion and water binding depends on the DNA sequence rather than DNA composition. Copyright © 2015. Published by Elsevier B.V.
DNA-Based Single-Molecule Electronics: From Concept to Function.
Wang, Kun
2018-01-17
Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I-V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed.
DNA-Based Single-Molecule Electronics: From Concept to Function
2018-01-01
Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I–V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed. PMID:29342091
Logic Gate Operation by DNA Translocation through Biological Nanopores.
Yasuga, Hiroki; Kawano, Ryuji; Takinoue, Masahiro; Tsuji, Yutaro; Osaki, Toshihisa; Kamiya, Koki; Miki, Norihisa; Takeuchi, Shoji
2016-01-01
Logical operations using biological molecules, such as DNA computing or programmable diagnosis using DNA, have recently received attention. Challenges remain with respect to the development of such systems, including label-free output detection and the rapidity of operation. Here, we propose integration of biological nanopores with DNA molecules for development of a logical operating system. We configured outputs "1" and "0" as single-stranded DNA (ssDNA) that is or is not translocated through a nanopore; unlabeled DNA was detected electrically. A negative-AND (NAND) operation was successfully conducted within approximately 10 min, which is rapid compared with previous studies using unlabeled DNA. In addition, this operation was executed in a four-droplet network. DNA molecules and associated information were transferred among droplets via biological nanopores. This system would facilitate linking of molecules and electronic interfaces. Thus, it could be applied to molecular robotics, genetic engineering, and even medical diagnosis and treatment.
Logic Gate Operation by DNA Translocation through Biological Nanopores
Takinoue, Masahiro; Tsuji, Yutaro; Osaki, Toshihisa; Kamiya, Koki; Miki, Norihisa; Takeuchi, Shoji
2016-01-01
Logical operations using biological molecules, such as DNA computing or programmable diagnosis using DNA, have recently received attention. Challenges remain with respect to the development of such systems, including label-free output detection and the rapidity of operation. Here, we propose integration of biological nanopores with DNA molecules for development of a logical operating system. We configured outputs “1” and “0” as single-stranded DNA (ssDNA) that is or is not translocated through a nanopore; unlabeled DNA was detected electrically. A negative-AND (NAND) operation was successfully conducted within approximately 10 min, which is rapid compared with previous studies using unlabeled DNA. In addition, this operation was executed in a four-droplet network. DNA molecules and associated information were transferred among droplets via biological nanopores. This system would facilitate linking of molecules and electronic interfaces. Thus, it could be applied to molecular robotics, genetic engineering, and even medical diagnosis and treatment. PMID:26890568
A new polymorphic and multicopy MHC gene family related to nonmammalian class I
DOE Office of Scientific and Technical Information (OSTI.GOV)
Leelayuwat, C.; Degli-Esposti, M.A.; Abraham, L.J.
1994-12-31
The authors have used genomic analysis to characterize a region of the central major histocompatibility complex (MHC) spanning {approximately} 300 kilobases (kb) between TNF and HLA-B. This region has been suggested to carry genetic factors relevant to the development of autoimmune diseases such as myasthenia gravis (MG) and insulin dependent diabetes mellitus (IDDM). Genomic sequence was analyzed for coding potential, using two neural network programs, GRAIL and GeneParser. A genomic probe, JAB, containing putative coding sequences (PERB11) located 60 kb centromeric of HLA-B, was used for northern analysis of human tissues. Multiple transcripts were detected. Southern analysis of genomic DNAmore » and overlapping YAC clones, covering the region from BAT1 to HLA-F, indicated that there are at least five copies of PERB11, four of which are located within this region of the MHC. The partial cDNA sequence of PERB11 was obtained from poly-A RNA derived from skeletal muscle. The putative amino acid sequence of PERB11 shares {approximately} 30% identity to MHC class I molecules from various species, including reptiles, chickens, and frogs, as well as to other MHC class I-like molecules, such as the IgG FcR of the mouse and rat and the human Zn-{alpha}2-glycoprotein. From direct comparison of amino acid sequences, it is concluded that PERB11 is a distinct molecule more closely related to nonmammalian than known mammalian MHC class I molecules. Genomic sequence analysis of PERB11 from five MHC ancestral haplotypes (AH) indicated that the gene is polymorphic at both DNA and protein level. The results suggest that the authors have identified a novel polymorphic gene family with multiple copies within the MHC. 48 refs., 10 figs., 2 tabs.« less
An evolution based biosensor receptor DNA sequence generation algorithm.
Kim, Eungyeong; Lee, Malrey; Gatton, Thomas M; Lee, Jaewan; Zang, Yupeng
2010-01-01
A biosensor is composed of a bioreceptor, an associated recognition molecule, and a signal transducer that can selectively detect target substances for analysis. DNA based biosensors utilize receptor molecules that allow hybridization with the target analyte. However, most DNA biosensor research uses oligonucleotides as the target analytes and does not address the potential problems of real samples. The identification of recognition molecules suitable for real target analyte samples is an important step towards further development of DNA biosensors. This study examines the characteristics of DNA used as bioreceptors and proposes a hybrid evolution-based DNA sequence generating algorithm, based on DNA computing, to identify suitable DNA bioreceptor recognition molecules for stable hybridization with real target substances. The Traveling Salesman Problem (TSP) approach is applied in the proposed algorithm to evaluate the safety and fitness of the generated DNA sequences. This approach improves efficiency and stability for enhanced and variable-length DNA sequence generation and allows extension to generation of variable-length DNA sequences with diverse receptor recognition requirements.
Basic quantitative polymerase chain reaction using real-time fluorescence measurements.
Ares, Manuel
2014-10-01
This protocol uses quantitative polymerase chain reaction (qPCR) to measure the number of DNA molecules containing a specific contiguous sequence in a sample of interest (e.g., genomic DNA or cDNA generated by reverse transcription). The sample is subjected to fluorescence-based PCR amplification and, theoretically, during each cycle, two new duplex DNA molecules are produced for each duplex DNA molecule present in the sample. The progress of the reaction during PCR is evaluated by measuring the fluorescence of dsDNA-dye complexes in real time. In the early cycles, DNA duplication is not detected because inadequate amounts of DNA are made. At a certain threshold cycle, DNA-dye complexes double each cycle for 8-10 cycles, until the DNA concentration becomes so high and the primer concentration so low that the reassociation of the product strands blocks efficient synthesis of new DNA and the reaction plateaus. There are two types of measurements: (1) the relative change of the target sequence compared to a reference sequence and (2) the determination of molecule number in the starting sample. The first requires a reference sequence, and the second requires a sample of the target sequence with known numbers of the molecules of sequence to generate a standard curve. By identifying the threshold cycle at which a sample first begins to accumulate DNA-dye complexes exponentially, an estimation of the numbers of starting molecules in the sample can be extrapolated. © 2014 Cold Spring Harbor Laboratory Press.
Temperature-controlled microintaglio printing for high-resolution micropatterning of RNA molecules.
Kobayashi, Ryo; Biyani, Manish; Ueno, Shingo; Kumal, Subhashini Raj; Kuramochi, Hiromi; Ichiki, Takanori
2015-05-15
We have developed an advanced microintaglio printing method for fabricating fine and high-density micropatterns and applied it to the microarraying of RNA molecules. The microintaglio printing of RNA reported here is based on the hybridization of RNA with immobilized complementary DNA probes. The hybridization was controlled by switching the RNA conformation via the temperature, and an RNA microarray with a diameter of 1.5 µm and a density of 40,000 spots/mm(2) with high contrast was successfully fabricated. Specifically, no size effects were observed in the uniformity of patterned signals over a range of microarray feature sizes spanning one order of magnitude. Additionally, we have developed a microintaglio printing method for transcribed RNA microarrays on demand using DNA-immobilized magnetic beads. The beads were arrayed on wells fabricated on a printing mold and the wells were filled with in vitro transcription reagent and sealed with a DNA-immobilized glass substrate. Subsequently, RNA was in situ synthesized using the bead-immobilized DNA as a template and printed onto the substrate via hybridization. Since the microintaglio printing of RNA using DNA-immobilized beads enables the fabrication of a microarray of spots composed of multiple RNA sequences, it will be possible to screen or analyze RNA functions using an RNA microarray fabricated by temperature-controlled microintaglio printing (TC-µIP). Copyright © 2014 Elsevier B.V. All rights reserved.
Topological events in single molecules of E. coli DNA confined in nanochannels
Reifenberger, Jeffrey G.; Dorfman, Kevin D.; Cao, Han
2015-01-01
We present experimental data concerning potential topological events such as folds, internal backfolds, and/or knots within long molecules of double-stranded DNA when they are stretched by confinement in a nanochannel. Genomic DNA from E. coli was labeled near the ‘GCTCTTC’ sequence with a fluorescently labeled dUTP analog and stained with the DNA intercalator YOYO. Individual long molecules of DNA were then linearized and imaged using methods based on the NanoChannel Array technology (Irys® System) available from BioNano Genomics. Data were collected on 189,153 molecules of length greater than 50 kilobases. A custom code was developed to search for abnormal intensity spikes in the YOYO backbone profile along the length of individual molecules. By correlating the YOYO intensity spikes with the aligned barcode pattern to the reference, we were able to correlate the bright intensity regions of YOYO with abnormal stretching in the molecule, which suggests these events were either a knot or a region of internal backfolding within the DNA. We interpret the results of our experiments involving molecules exceeding 50 kilobases in the context of existing simulation data for relatively short DNA, typically several kilobases. The frequency of these events is lower than the predictions from simulations, while the size of the events is larger than simulation predictions and often exceeds the molecular weight of the simulated molecules. We also identified DNA molecules that exhibit large, single folds as they enter the nanochannels. Overall, topological events occur at a low frequency (~7% of all molecules) and pose an easily surmountable obstacle for the practice of genome mapping in nanochannels. PMID:25991508
NASA Astrophysics Data System (ADS)
Fengyun, Yang; Kaige, Wang; Dan, Sun; Wei, Zhao; Hai-qing, Wang; Xin, He; Gui-ren, Wang; Jin-tao, Bai
2016-07-01
The electrodynamic characteristics of single DNA molecules moving within micro-/nano-fluidic channels are important in the design of biomedical chips and bimolecular sensors. In this study, the dynamic properties of λ-DNA molecules transferring along the microchannels driven by the external electrickinetic force were systemically investigated with the single molecule fluorescence imaging technique. The experimental results indicated that the velocity of DNA molecules was strictly dependent on the value of the applied electric field and the diameter of the channel. The larger the external electric field, the larger the velocity, and the more significant deformation of DNA molecules. More meaningfully, it was found that the moving directions of DNA molecules had two completely different directions: (i) along the direction of the external electric field, when the electric field intensity was smaller than a certain threshold value; (ii) opposite to the direction of the external electric field, when the electric field intensity was greater than the threshold electric field intensity. The reversal movement of DNA molecules was mainly determined by the competition between the electrophoresis force and the influence of electro-osmosis flow. These new findings will theoretically guide the practical application of fluidic channel sensors and lab-on-chips for precisely manipulating single DNA molecules. Project supported by the National Natural Science Foundation of China (Grant No. 61378083), the International Cooperation Foundation of the National Science and Technology Major Project of the Ministry of Science and Technology of China (Grant No. 2011DFA12220), the Major Research Plan of National Natural Science Foundation of China (Grant No. 91123030), and the Natural Science Foundation of Shaanxi Province of China (Grant Nos. 2010JS110 and 2013SZS03-Z01).
Nanopore detection of DNA molecules in crowded neutral polymer solutions
NASA Astrophysics Data System (ADS)
Sharma, Rajesh Kumar; Dai, Liang; Doyle, Patrick; Garaj, Slaven
Nanopore sensing is a precise technique for analysis of the structure and dynamics of individual biomolecules in different environments, and has even become a prominent technique for next-gen DNA sequencing. In the nanopore sensor, an individual DNA molecule is electrophoretically translocated through a single, nanometer-scaled pore in a solid-state membrane separating two chambers filled with electrolyte. The conformation of the molecule is deduced from modulations in the ionic current through the pore during the translocation event. Using nanopores, we investigated the dynamics of the DNA molecules in a crowded solution of neutral polymers of different sizes and concentrations. The translocation dynamics depends significantly on the size and concentration of the polymers, as different contributions to the electrophoretic and entropic forces on the DNA molecules come into play. This setup offers an excellent, tuneable model-system for probing biologically relevant questions regarding the behaviour of DNA molecules in highly confined and crowded environments. Singapore-MIT Alliance for Research and Technology.
Single molecule techniques in DNA repair: A primer
Hughes, Craig D.; Simons, Michelle; Mackenzie, Cassidy E.; Van Houten, Bennett; Kad, Neil M.
2016-01-01
A powerful new approach has become much more widespread and offers insights into aspects of DNA repair unattainable with billions of molecules. Single molecule techniques can be used to image, manipulate or characterize the action of a single repair protein on a single strand of DNA. This allows search mechanisms to be probed, and the effects of force to be understood. These physical aspects can dominate a biochemical reaction, where at the ensemble level their nuances are obscured. In this paper we discuss some of the many technical advances that permit study at the single molecule level. We focus on DNA repair to which these techniques are actively being applied. DNA repair is also a process that encompasses so much of what single molecule studies benefit – searching for targets, complex formation, sequential biochemical reactions and substrate hand-off to name just a few. We discuss how single molecule biophysics is poised to transform our understanding of biological systems, in particular DNA repair. PMID:24819596
Zhu, Shengchao; Zhang, Qin; Guo, Liang-Hong
2008-08-22
Fluorescent organic dyes are currently the standard signal-generating labels used in microarray quantification. However, new labeling strategies are needed to meet the demand for high sensitivity in the detection of low-abundance proteins and small molecules. In this report, a long-chain DNA/dye conjugate was used to attach multiple fluorescence labels on antibodies to improve signal intensity and immunoassay sensitivity. Compared with the 30 base-pair (bp) oligonucleotide used in our previous work [Q. Zhang, L.-H. Guo, Bioconjugate Chem. 18 (2007) 1668-1672], conjugation of a 219 bp DNA in solution with a fluorescent DNA binder SYBR Green I resulted in more than sixfold increase in signal intensity, consistent with the increase in bp number. In a direct immunoassay for the detection of goat anti-mouse IgG in a mouse IgG-coated 96-well plate, the long DNA conjugate label also produced higher fluorescence than the short one, accompanied by about 15-fold improvement in the detection limit. To demonstrate its advantage in real applications, the DNA/dye conjugate was employed in the competitive immunoassay of 17beta-estradiol, a clinically and environmentally important analyte. The biotin-terminated DNA was attached to biotinylated anti-estradiol antibody through the biotin/streptavidin/biotin bridge after the immuno-reaction was completed, followed by conjugation with SYBR Green I. The limit of detection for 17beta-estradiol is 1.9 pg mL(-1), which is 200-fold lower than the assay using fluorescein-labeled antibodies. The new multiple labeling strategy uses readily available reagents, and is also compatible with current biochip platform. It has great potential in the sensitive detection of protein and antibody microarrays.
Structural insights into 5‧ flap DNA unwinding and incision by the human FAN1 dimer
NASA Astrophysics Data System (ADS)
Zhao, Qi; Xue, Xiaoyu; Longerich, Simonne; Sung, Patrick; Xiong, Yong
2014-12-01
Human FANCD2-associated nuclease 1 (FAN1) is a DNA structure-specific nuclease involved in the processing of DNA interstrand crosslinks (ICLs). FAN1 maintains genomic stability and prevents tissue decline in multiple organs, yet it confers ICL-induced anti-cancer drug resistance in several cancer subtypes. Here we report three crystal structures of human FAN1 in complex with a 5‧ flap DNA substrate, showing that two FAN1 molecules form a head-to-tail dimer to locate the lesion, orient the DNA and unwind a 5‧ flap for subsequent incision. Biochemical experiments further validate our model for FAN1 action, as structure-informed mutations that disrupt protein dimerization, substrate orientation or flap unwinding impair the structure-specific nuclease activity. Our work elucidates essential aspects of FAN1-DNA lesion recognition and a unique mechanism of incision. These structural insights shed light on the cellular mechanisms underlying organ degeneration protection and cancer drug resistance mediated by FAN1.
NASA Astrophysics Data System (ADS)
Sprengel, Andreas; Lill, Pascal; Stegemann, Pierre; Bravo-Rodriguez, Kenny; Schöneweiß, Elisa-C.; Merdanovic, Melisa; Gudnason, Daniel; Aznauryan, Mikayel; Gamrad, Lisa; Barcikowski, Stephan; Sanchez-Garcia, Elsa; Birkedal, Victoria; Gatsogiannis, Christos; Ehrmann, Michael; Saccà, Barbara
2017-02-01
The self-organizational properties of DNA have been used to realize synthetic hosts for protein encapsulation. However, current strategies of DNA-protein conjugation still limit true emulation of natural host-guest systems, whose formation relies on non-covalent bonds between geometrically matching interfaces. Here we report one of the largest DNA-protein complexes of semisynthetic origin held in place exclusively by spatially defined supramolecular interactions. Our approach is based on the decoration of the inner surface of a DNA origami hollow structure with multiple ligands converging to their corresponding binding sites on the protein surface with programmable symmetry and range-of-action. Our results demonstrate specific host-guest recognition in a 1:1 stoichiometry and selectivity for the guest whose size guarantees sufficient molecular diffusion preserving short intermolecular distances. DNA nanocontainers can be thus rationally designed to trap single guest molecules in their native form, mimicking natural strategies of molecular recognition and anticipating a new method of protein caging.
The multifaceted influence of histone deacetylases on DNA damage signalling and DNA repair
Roos, Wynand Paul; Krumm, Andrea
2016-01-01
Histone/protein deacetylases play multiple roles in regulating gene expression and protein activation and stability. Their deregulation during cancer initiation and progression cause resistance to therapy. Here, we review the role of histone deacetylases (HDACs) and the NAD+ dependent sirtuins (SIRTs) in the DNA damage response (DDR). These lysine deacetylases contribute to DNA repair by base excision repair (BER), nucleotide excision repair (NER), mismatch repair (MMR), non-homologous end joining (NHEJ), homologous recombination (HR) and interstrand crosslink (ICL) repair. Furthermore, we discuss possible mechanisms whereby these histone/protein deacetylases facilitate the switch between DNA double-strand break (DSB) repair pathways, how SIRTs play a central role in the crosstalk between DNA repair and cell death pathways due to their dependence on NAD+, and the influence of small molecule HDAC inhibitors (HDACi) on cancer cell resistance to genotoxin based therapies. Throughout the review, we endeavor to identify the specific HDAC targeted by HDACi leading to therapy sensitization. PMID:27738139
Biosensing via light scattering from plasmonic core-shell nanospheres coated with DNA molecules
NASA Astrophysics Data System (ADS)
Xie, Huai-Yi; Chen, Minfeng; Chang, Yia-Chung; Moirangthem, Rakesh Singh
2017-05-01
We present both experimental and theoretical studies for investigating DNA molecules attached on metallic nanospheres. We have developed an efficient and accurate numerical method to investigate light scattering from plasmonic nanospheres on a substrate covered by a shell, based on the Green's function approach with suitable spherical harmonic basis. Next, we use this method to study optical scattering from DNA molecules attached to metallic nanoparticles placed on a substrate and compare with experimental results. We obtain fairly good agreement between theoretical predictions and the measured ellipsometric spectra. The metallic nanoparticles were used to detect the binding with DNA molecules in a microfluidic setup via spectroscopic ellipsometry (SE), and a detectable change in ellipsometric spectra was found when DNA molecules are captured on Au nanoparticles. Our theoretical simulation indicates that the coverage of Au nanosphere by a submonolayer of DNA molecules, which is modeled by a thin layer of dielectric material (which may absorb light), can lead to a small but detectable spectroscopic shift in both the Ψ and Δ spectra with more significant change in Δ spectra in agreement with experimental results. Our studies demonstrated the ultrasensitive capability of SE for sensing submonolayer coverage of DNA molecules on Au nanospheres. Hence the spectroscopic ellipsometric measurements coupled with theoretical analysis via an efficient computation method can be an effective tool for detecting DNA molecules attached on Au nanoparticles, thus achieving label-free, non-destructive, and high-sensitivity biosensing with nanoscale resolution.
Fluorescence Microscopy of Nanochannel-Confined DNA.
Westerlund, Fredrik; Persson, Fredrik; Fritzsche, Joachim; Beech, Jason P; Tegenfeldt, Jonas O
2018-01-01
Stretching of DNA in nanoscale confinement allows for several important studies. The genetic contents of the DNA can be visualized on the single DNA molecule level and both the polymer physics of confined DNA and also DNA/protein and other DNA/DNA-binding molecule interactions can be explored. This chapter describes the basic steps to fabricate the nanostructures, perform the experiments and analyze the data.
Genetics Home Reference: mitochondrial neurogastrointestinal encephalopathy disease
... modification) is used as a building block of DNA . Thymidine phosphorylase breaks down thymidine into smaller molecules, ... molecule is damaging to a particular kind of DNA known as mitochondrial DNA or mtDNA. Mitochondria are ...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in
2015-07-28
Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging themore » ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.« less
DNA recombination activity in soybean mitochondria.
Manchekar, Medha; Scissum-Gunn, Karyn; Song, Daqing; Khazi, Fayaz; McLean, Stephanie L; Nielsen, Brent L
2006-02-17
Mitochondrial genomes in higher plants are much larger and more complex as compared to animal mitochondrial genomes. There is growing evidence that plant mitochondrial genomes exist predominantly as a collection of linear and highly branched DNA molecules and replicate by a recombination-dependent mechanism. However, biochemical evidence of mitochondrial DNA (mtDNA) recombination activity in plants has previously been lacking. We provide the first report of strand-invasion activity in plant mitochondria. Similar to bacterial RecA, this activity from soybean is dependent on the presence of ATP and Mg(2+). Western blot analysis using an antibody against the Arabidopsis mitochondrial RecA protein shows cross-reaction with a soybean protein of about 44 kDa, indicating conservation of this protein in at least these two plant species. mtDNA structure was analyzed by electron microscopy of total soybean mtDNA and molecules recovered after field-inversion gel electrophoresis (FIGE). While most molecules were found to be linear, some molecules contained highly branched DNA structures and a small but reproducible proportion consisted of circular molecules (many with tails) similar to recombination intermediates. The presence of recombination intermediates in plant mitochondria preparations is further supported by analysis of mtDNA molecules by 2-D agarose gel electrophoresis, which indicated the presence of complex recombination structures along with a considerable amount of single-stranded DNA. These data collectively provide convincing evidence for the occurrence of homologous DNA recombination in plant mitochondria.
Recombinant DNA encoding a desulfurization biocatalyst
Rambosek, John; Piddington, Chris S.; Kovacevich, Brian R.; Young, Kevin D.; Denome, Sylvia A.
1994-01-01
This invention relates to a recombinant DNA molecule containing a gene or genes which encode a biocatalyst capable of desulfurizing a fossil fuel which contains organic sulfur molecules. For example, the present invention encompasses a recombinant DNA molecule containing a gene or genes of a strain of Rhodococcus rhodochrous.
Single molecule analysis of Trypanosoma brucei DNA replication dynamics
Calderano, Simone Guedes; Drosopoulos, William C.; Quaresma, Marina Mônaco; Marques, Catarina A.; Kosiyatrakul, Settapong; McCulloch, Richard; Schildkraut, Carl L.; Elias, Maria Carolina
2015-01-01
Eukaryotic genome duplication relies on origins of replication, distributed over multiple chromosomes, to initiate DNA replication. A recent genome-wide analysis of Trypanosoma brucei, the etiological agent of sleeping sickness, localized its replication origins to the boundaries of multigenic transcription units. To better understand genomic replication in this organism, we examined replication by single molecule analysis of replicated DNA. We determined the average speed of replication forks of procyclic and bloodstream form cells and we found that T. brucei DNA replication rate is similar to rates seen in other eukaryotes. We also analyzed the replication dynamics of a central region of chromosome 1 in procyclic forms. We present evidence for replication terminating within the central part of the chromosome and thus emanating from both sides, suggesting a previously unmapped origin toward the 5′ extremity of chromosome 1. Also, termination is not at a fixed location in chromosome 1, but is rather variable. Importantly, we found a replication origin located near an ORC1/CDC6 binding site that is detected after replicative stress induced by hydroxyurea treatment, suggesting it may be a dormant origin activated in response to replicative stress. Collectively, our findings support the existence of more replication origins in T. brucei than previously appreciated. PMID:25690894
Single molecule analysis of Trypanosoma brucei DNA replication dynamics.
Calderano, Simone Guedes; Drosopoulos, William C; Quaresma, Marina Mônaco; Marques, Catarina A; Kosiyatrakul, Settapong; McCulloch, Richard; Schildkraut, Carl L; Elias, Maria Carolina
2015-03-11
Eukaryotic genome duplication relies on origins of replication, distributed over multiple chromosomes, to initiate DNA replication. A recent genome-wide analysis of Trypanosoma brucei, the etiological agent of sleeping sickness, localized its replication origins to the boundaries of multigenic transcription units. To better understand genomic replication in this organism, we examined replication by single molecule analysis of replicated DNA. We determined the average speed of replication forks of procyclic and bloodstream form cells and we found that T. brucei DNA replication rate is similar to rates seen in other eukaryotes. We also analyzed the replication dynamics of a central region of chromosome 1 in procyclic forms. We present evidence for replication terminating within the central part of the chromosome and thus emanating from both sides, suggesting a previously unmapped origin toward the 5' extremity of chromosome 1. Also, termination is not at a fixed location in chromosome 1, but is rather variable. Importantly, we found a replication origin located near an ORC1/CDC6 binding site that is detected after replicative stress induced by hydroxyurea treatment, suggesting it may be a dormant origin activated in response to replicative stress. Collectively, our findings support the existence of more replication origins in T. brucei than previously appreciated. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Rapid purification of circular DNA by triplex-mediated affinity capture
Ji, Huamin; Smith, Lloyd M.
1997-01-01
A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Henderson, S.L.; Ryan, K.; Sollner-Webb, B.
1989-02-01
We have examined the mechanism by which transcriptional initiation at the mouse rDNA promoter is augmented by the RNA polymerase I terminator element that resides just upstream of it. Using templates in which terminator elements are instead positioned at the opposite side of the plasmid rather than proximal to the promoter, or conditions where transcription is terminated elsewhere in the plasmid by UV-induced lesions, we show that the terminator's stimulatory effect is not position dependent. Mouse terminator elements therefore do not stimulate via the previously postulated 'read-through enhancement' model in which terminated polymerases are handed off to an adjacent promotermore » in a concerted reaction. The position independence and orientation dependence of the terminator also makes it unlikely that the terminator functions as a promoter element or as an enhancer. Instead, terminators serve to augment initiation by preventing polymerases from reading completely around the plasmid and through the promoter from upstream, an event which we show interferes with subsequent rounds of initiation. Notably, this transcriptional interference arises because polymerase passage across a promoter disrupts the otherwise stable transcription complex, specifically releasing the bound transcription factor D. These liberated D molecules can then bind to other templates and activate their expression. The rDNA transcriptional interference is not due to a steric impediment to the binding of new polymerase molecules, and it does not similarly liberate the initiation-competent polymerase (factor C). These studies have also convincingly demonstrated that multiple rounds of transcription are obtained from rDNA template molecules in vitro.« less
NASA Astrophysics Data System (ADS)
Hanasaki, Itsuo; Yukimoto, Naoya; Uehara, Satoshi; Shintaku, Hirofumi; Kawano, Satoyuki
2015-04-01
Because long DNA molecules usually exist in random coil states due to the entropic effect, linearisation is required for devices equipped with nanopores where electrical sequencing is necessary during single-file translocation. We present a novel technique for linearising DNA molecules in a micro-channel. In our device, electrodes are embedded in the bottom surface of the channel. The application of a voltage induces the trapping of λDNA molecules on the positive electrode. An instantaneous voltage drop is used to put the λDNA molecules in a partly released state and the hydrodynamic force of the solution induces linearisation. Phenomena were directly observed using an optical microscopy system equipped with a high-speed camera and the linearisation principle was explored in detail. Furthermore, we estimate the tensile characteristics produced by the flow of the solution through a numerical model of a tethered polymer subject to a Poiseuille flow. The mean tensile force is in the range of 0.1-1 pN. This is sufficiently smaller than the structural transition point of λDNA but counterbalances the entropic elasticity that causes the random coil shape of λDNA molecules in solution. We show the important role of thermal fluctuation in the manipulation of molecules in solution and clarify the tensile conditions required for DNA linearisation using a combination of solution flow and voltage variation in a microchannel.
Single-Molecule Electrical Random Resequencing of DNA and RNA
NASA Astrophysics Data System (ADS)
Ohshiro, Takahito; Matsubara, Kazuki; Tsutsui, Makusu; Furuhashi, Masayuki; Taniguchi, Masateru; Kawai, Tomoji
2012-07-01
Two paradigm shifts in DNA sequencing technologies--from bulk to single molecules and from optical to electrical detection--are expected to realize label-free, low-cost DNA sequencing that does not require PCR amplification. It will lead to development of high-throughput third-generation sequencing technologies for personalized medicine. Although nanopore devices have been proposed as third-generation DNA-sequencing devices, a significant milestone in these technologies has been attained by demonstrating a novel technique for resequencing DNA using electrical signals. Here we report single-molecule electrical resequencing of DNA and RNA using a hybrid method of identifying single-base molecules via tunneling currents and random sequencing. Our method reads sequences of nine types of DNA oligomers. The complete sequence of 5'-UGAGGUA-3' from the let-7 microRNA family was also identified by creating a composite of overlapping fragment sequences, which was randomly determined using tunneling current conducted by single-base molecules as they passed between a pair of nanoelectrodes.
Identifying DNA methylation in a nanochannel
NASA Astrophysics Data System (ADS)
Sun, Xiaoyin; Yasui, Takao; Yanagida, Takeshi; Kaji, Noritada; Rahong, Sakon; Kanai, Masaki; Nagashima, Kazuki; Kawai, Tomoji; Baba, Yoshinobu
2016-01-01
DNA methylation is a stable epigenetic modification, which is well known to be involved in gene expression regulation. In general, however, analyzing DNA methylation requires rather time consuming processes (24-96 h) via DNA replication and protein modification. Here we demonstrate a methodology to analyze DNA methylation at a single DNA molecule level without any protein modifications by measuring the contracted length and relaxation time of DNA within a nanochannel. Our methodology is based on the fact that methylation makes DNA molecules stiffer, resulting in a longer contracted length and a longer relaxation time (a slower contraction rate). The present methodology offers a promising way to identify DNA methylation without any protein modification at a single DNA molecule level within 2 h.
Recombinant DNA encoding a desulfurization biocatalyst
Rambosek, J.; Piddington, C.S.; Kovacevich, B.R.; Young, K.D.; Denome, S.A.
1994-10-18
This invention relates to a recombinant DNA molecule containing a gene or genes which encode a biocatalyst capable of desulfurizing a fossil fuel which contains organic sulfur molecules. For example, the present invention encompasses a recombinant DNA molecule containing a gene or genes of a strain of Rhodococcus rhodochrous. 13 figs.
NASA Astrophysics Data System (ADS)
Shafirovich, Vladimir; Singh, Carolyn; Geacintov, Nicholas E.
2003-11-01
Oxidative damage of DNA molecules associated with electron-transfer reactions is an important phenomenon in living cells, which can lead to mutations and contribute to carcinogenesis and the aging processes. This article describes the design of several simple experiments to explore DNA damage initiated by photoinduced electron-transfer reactions sensitized by the acridine derivative, proflavine (PF). A supercoiled DNA agarose gel nicking assay is employed as a sensitive probe of DNA strand cleavage. A low-cost experimental and computer-interfaced imaging apparatus is described allowing for the digital recording and analysis of the gel electrophoresis results. The first experiment describes the formation of direct strand breaks in double-stranded DNA induced by photoexcitation of the intercalated PF molecules. The second experiment demonstrates that the addition of the well-known electron acceptor, methylviologen, gives rise to a significant enhancement of the photochemical DNA strand cleavage effect. This occurs by an electron transfer step to methylviologen that renders the inital photoinduced charge separation between photoexcited PF and DNA irreversible. The third experiment demonstrates that the action spectrum of the DNA photocleavage matches the absorption spectrum of DNA-bound, intercalated PF molecules, which differs from that of free PF molecules. This result demonstrates that the photoinduced DNA strand cleavage is initiated by intercalated rather than free PF molecules.
CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules
NASA Astrophysics Data System (ADS)
Sarangi, S. N.; Sahu, S. N.; Nozaki, S.
2018-03-01
CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of <220>. Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.
Visnapuu, Mari-Liis; Fazio, Teresa; Wind, Shalom; Greene, Eric C.
2009-01-01
The analysis of individual molecules is evolving into an important tool for biological research, and presents conceptually new ways of approaching experimental design strategies. However, more robust methods are required if these technologies are to be made broadly available to the biological research community. To help achieve this goal we have combined nanofabrication techniques with single-molecule optical microscopy for assembling and visualizing curtains comprised of thousands of individual DNA molecules organized at engineered diffusion barriers on a lipid bilayer-coated surface. Here we present an important extension of this technology that implements geometric barrier patterns comprised of thousands of nanoscale wells that can be loaded with single molecules of DNA. We show that these geometric nanowells can be used to precisely control the lateral distribution of the individual DNA molecules within curtains assembled along the edges of the engineered barrier patterns. The individual molecules making up the DNA curtain can be separated from one another by a user-defined distance dictated by the dimensions of the nanowells. We demonstrate the broader utility of these patterned DNA curtains in a novel, real time restriction assay that we refer to as dynamic optical restriction mapping, which can be used to rapidly identify entire sets of cleavage sites within a large DNA molecule. PMID:18788761
Agarose gel electrophoresis for the separation of DNA fragments.
Lee, Pei Yun; Costumbrado, John; Hsu, Chih-Yuan; Kim, Yong Hoon
2012-04-20
Agarose gel electrophoresis is the most effective way of separating DNA fragments of varying sizes ranging from 100 bp to 25 kb(1). Agarose is isolated from the seaweed genera Gelidium and Gracilaria, and consists of repeated agarobiose (L- and D-galactose) subunits(2). During gelation, agarose polymers associate non-covalently and form a network of bundles whose pore sizes determine a gel's molecular sieving properties. The use of agarose gel electrophoresis revolutionized the separation of DNA. Prior to the adoption of agarose gels, DNA was primarily separated using sucrose density gradient centrifugation, which only provided an approximation of size. To separate DNA using agarose gel electrophoresis, the DNA is loaded into pre-cast wells in the gel and a current applied. The phosphate backbone of the DNA (and RNA) molecule is negatively charged, therefore when placed in an electric field, DNA fragments will migrate to the positively charged anode. Because DNA has a uniform mass/charge ratio, DNA molecules are separated by size within an agarose gel in a pattern such that the distance traveled is inversely proportional to the log of its molecular weight(3). The leading model for DNA movement through an agarose gel is "biased reptation", whereby the leading edge moves forward and pulls the rest of the molecule along(4). The rate of migration of a DNA molecule through a gel is determined by the following: 1) size of DNA molecule; 2) agarose concentration; 3) DNA conformation(5); 4) voltage applied, 5) presence of ethidium bromide, 6) type of agarose and 7) electrophoresis buffer. After separation, the DNA molecules can be visualized under uv light after staining with an appropriate dye. By following this protocol, students should be able to: Understand the mechanism by which DNA fragments are separated within a gel matrix Understand how conformation of the DNA molecule will determine its mobility through a gel matrix Identify an agarose solution of appropriate concentration for their needs Prepare an agarose gel for electrophoresis of DNA samples Set up the gel electrophoresis apparatus and power supply Select an appropriate voltage for the separation of DNA fragments Understand the mechanism by which ethidium bromide allows for the visualization of DNA bands Determine the sizes of separated DNA fragments.
Schneider, Uffe V.; Géci, Imrich; Jøhnk, Nina; Mikkelsen, Nikolaj D.; Pedersen, Erik B.; Lisby, Gorm
2011-01-01
The sensitivity and specificity of clinical diagnostic assays using DNA hybridization techniques are limited by the dissociation of double-stranded DNA (dsDNA) antiparallel duplex helices. This situation can be improved by addition of DNA stabilizing molecules such as nucleic acid intercalators. Here, we report the synthesis of a novel ortho-Twisted Intercalating Nucleic Acid (TINA) amidite utilizing the phosphoramidite approach, and examine the stabilizing effect of ortho- and para-TINA molecules in antiparallel DNA duplex formation. In a thermal stability assay, ortho- and para-TINA molecules increased the melting point (Tm) of Watson-Crick based antiparallel DNA duplexes. The increase in Tm was greatest when the intercalators were placed at the 5′ and 3′ termini (preferable) or, if placed internally, for each half or whole helix turn. Terminally positioned TINA molecules improved analytical sensitivity in a DNA hybridization capture assay targeting the Escherichia coli rrs gene. The corresponding sequence from the Pseudomonas aeruginosa rrs gene was used as cross-reactivity control. At 150 mM ionic strength, analytical sensitivity was improved 27-fold by addition of ortho-TINA molecules and 7-fold by addition of para-TINA molecules (versus the unmodified DNA oligonucleotide), with a 4-fold increase retained at 1 M ionic strength. Both intercalators sustained the discrimination of mismatches in the dsDNA (indicated by ΔTm), unless placed directly adjacent to the mismatch – in which case they partly concealed ΔTm (most pronounced for para-TINA molecules). We anticipate that the presented rules for placement of TINA molecules will be broadly applicable in hybridization capture assays and target amplification systems. PMID:21673988
Paliwoda, Rebecca E; Li, Feng; Reid, Michael S; Lin, Yanwen; Le, X Chris
2014-06-17
Functionalizing nanomaterials for diverse analytical, biomedical, and therapeutic applications requires determination of surface coverage (or density) of DNA on nanomaterials. We describe a sequential strand displacement beacon assay that is able to quantify specific DNA sequences conjugated or coconjugated onto gold nanoparticles (AuNPs). Unlike the conventional fluorescence assay that requires the target DNA to be fluorescently labeled, the sequential strand displacement beacon method is able to quantify multiple unlabeled DNA oligonucleotides using a single (universal) strand displacement beacon. This unique feature is achieved by introducing two short unlabeled DNA probes for each specific DNA sequence and by performing sequential DNA strand displacement reactions. Varying the relative amounts of the specific DNA sequences and spacing DNA sequences during their coconjugation onto AuNPs results in different densities of the specific DNA on AuNP, ranging from 90 to 230 DNA molecules per AuNP. Results obtained from our sequential strand displacement beacon assay are consistent with those obtained from the conventional fluorescence assays. However, labeling of DNA with some fluorescent dyes, e.g., tetramethylrhodamine, alters DNA density on AuNP. The strand displacement strategy overcomes this problem by obviating direct labeling of the target DNA. This method has broad potential to facilitate more efficient design and characterization of novel multifunctional materials for diverse applications.
Detecting the Length of Double-stranded DNA with Solid State Nanopores
NASA Astrophysics Data System (ADS)
Li, Jiali; Gershow, Marc; Stein, Derek; Qun, Cai; Brandin, Eric; Wang, Hui; Huang, Albert; Branton, Dan; Golovchenko, Jene
2003-03-01
We report on the use of nanometer scale diameter, solid-state nanopores as single molecule detectors of double stranded DNA molecules. These solid-state nanopores are fabricated in thin membranes of silicon nitride, by ion beam sculpting 1. They produce discrete electronic signals: current blockages, when an electrically biased nanopore is exposed to DNA molecules in aqueous salt solutions. We demonstrate examples of such electronic signals for 3k base pairs (bp) and 10k bp double stranded DNA molecules, which suggest that these molecules are individually translocating through the nanopore during the detection process. The translocating time for the 10k bp double stranded DNA is about 3 times longer than the 3k bp, demonstrating that a solid-state nanopore device can be used to detect the lengths of double stranded DNA molecules. Similarities and differences with signals obtained from single stranded DNA in a biological nanopores are discussed 2. 1. Li, J., Stein, D., McMullan, C., Branton, D. Aziz, M. J. and Golovchenko, J. Ion Beam Sculpting at nanometer length scales. Nature 412, 166-169 (2001). 2. Meller, A., L. Nivon, E. Brandin, Golovchenko, J. & Branton, D. Proc. Natl. Acad. Sci. USA 97, 1079-1084 (2000).
NASA Astrophysics Data System (ADS)
Zhang, Ce; Zhang, Fang; van Kan, Jeroen A.; van der Maarel, Johan R. C.
2008-06-01
Single T4-DNA molecules were confined in rectangular-shaped channels with a depth of 300 nm and a width in the range of 150-300 nm casted in a poly(dimethylsiloxane) nanofluidic chip. The extensions of the DNA molecules were measured with fluorescence microscopy as a function of the ionic strength and composition of the buffer as well as the DNA intercalation level by the YOYO-1 dye. The data were interpreted with the scaling theory for a wormlike polymer in good solvent, including the effects of confinement, charge, and self-avoidance. It was found that the elongation of the DNA molecules with decreasing ionic strength can be interpreted in terms of an increase of the persistence length. Self-avoidance effects on the extension are moderate, due to the small correlation length imposed by the channel cross-sectional diameter. Intercalation of the dye results in an increase of the DNA contour length and a partial neutralization of the DNA charge, but besides effects of electrostatic origin it has no significant effect on the bare bending rigidity. In the presence of divalent cations, the DNA molecules were observed to contract, but they do not collapse into a condensed structure. It is proposed that this contraction results from a divalent counterion mediated attractive force between the segments of the DNA molecule.
Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A
2007-09-15
We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.
Nanofabricated Racks of Aligned and Anchored DNA Substrates for Single-Molecule Imaging
2009-01-01
Single-molecule studies of biological macromolecules can benefit from new experimental platforms that facilitate experimental design and data acquisition. Here we develop new strategies to construct curtains of DNA in which the molecules are aligned with respect to one another and maintained in an extended configuration by anchoring both ends of the DNA to the surface of a microfluidic sample chamber that is otherwise coated with an inert lipid bilayer. This “double-tethered” DNA substrate configuration is established through the use of nanofabricated rack patterns comprised of two distinct functional elements: linear barriers to lipid diffusion that align DNA molecules anchored by one end to the bilayer and antibody-coated pentagons that provide immobile anchor points for the opposite ends of the DNA. These devices enable the alignment and anchoring of thousands of individual DNA molecules, which can then be visualized using total internal reflection fluorescence microscopy under conditions that do not require continuous application of buffer flow to stretch the DNA. This unique strategy offers the potential for studying protein−DNA interactions on large DNA substrates without compromising measurements through application of hydrodynamic force. We provide a proof-of-principle demonstration that double-tethered DNA curtains made with nanofabricated rack patterns can be used in a one-dimensional diffusion assay that monitors the motion of quantum dot-tagged proteins along DNA. PMID:19736980
Nanofabricated racks of aligned and anchored DNA substrates for single-molecule imaging.
Gorman, Jason; Fazio, Teresa; Wang, Feng; Wind, Shalom; Greene, Eric C
2010-01-19
Single-molecule studies of biological macromolecules can benefit from new experimental platforms that facilitate experimental design and data acquisition. Here we develop new strategies to construct curtains of DNA in which the molecules are aligned with respect to one another and maintained in an extended configuration by anchoring both ends of the DNA to the surface of a microfluidic sample chamber that is otherwise coated with an inert lipid bilayer. This "double-tethered" DNA substrate configuration is established through the use of nanofabricated rack patterns comprised of two distinct functional elements: linear barriers to lipid diffusion that align DNA molecules anchored by one end to the bilayer and antibody-coated pentagons that provide immobile anchor points for the opposite ends of the DNA. These devices enable the alignment and anchoring of thousands of individual DNA molecules, which can then be visualized using total internal reflection fluorescence microscopy under conditions that do not require continuous application of buffer flow to stretch the DNA. This unique strategy offers the potential for studying protein-DNA interactions on large DNA substrates without compromising measurements through application of hydrodynamic force. We provide a proof-of-principle demonstration that double-tethered DNA curtains made with nanofabricated rack patterns can be used in a one-dimensional diffusion assay that monitors the motion of quantum dot-tagged proteins along DNA.
Wang, Ying; Schellenberg, Helene; Walhorn, Volker; Toensing, Katja; Anselmetti, Dario
2017-09-01
Fluorescent dyes are broadly used in many biotechnological applications to detect and visualize DNA molecules. However, their binding to DNA alters the structural and nanomechanical properties of DNA and, thus, interferes with associated biological processes. In this work we employed magnetic tweezers and fluorescence spectroscopy to investigate the binding of PicoGreen to DNA at room temperature in a concentration-dependent manner. PicoGreen is an ultrasensitive quinolinium nucleic acid stain exhibiting hardly any background signal from unbound dye molecules. By means of stretching and overwinding single, torsionally constrained, nick-free double-stranded DNA molecules, we acquired force-extension and supercoiling curves which allow quantifying DNA contour length, persistence length and other thermodynamical binding parameters, respectively. The results of our magnetic tweezers single-molecule binding study were well supported through analyzing the fluorescent spectra of stained DNA. On the basis of our work, we could identify a concentration-dependent bimodal binding behavior, where, apparently, PicoGreen associates to DNA as an intercalator and minor-groove binder simultaneously.
Hengel, Sarah R; Spies, M Ashley; Spies, Maria
2017-09-21
To maintain stable genomes and to avoid cancer and aging, cells need to repair a multitude of deleterious DNA lesions, which arise constantly in every cell. Processes that support genome integrity in normal cells, however, allow cancer cells to develop resistance to radiation and DNA-damaging chemotherapeutics. Chemical inhibition of the key DNA repair proteins and pharmacologically induced synthetic lethality have become instrumental in both dissecting the complex DNA repair networks and as promising anticancer agents. The difficulty in capitalizing on synthetically lethal interactions in cancer cells is that many potential targets do not possess well-defined small-molecule binding determinates. In this review, we discuss several successful campaigns to identify and leverage small-molecule inhibitors of the DNA repair proteins, from PARP1, a paradigm case for clinically successful small-molecule inhibitors, to coveted new targets, such as RAD51 recombinase, RAD52 DNA repair protein, MRE11 nuclease, and WRN DNA helicase. Copyright © 2017 Elsevier Ltd. All rights reserved.
Like-charge attraction and opposite-charge decomplexation between polymers and DNA molecules
NASA Astrophysics Data System (ADS)
Buyukdagli, Sahin
2017-02-01
We scrutinize the effect of polyvalent ions on polymer-DNA interactions. We extend a recently developed test-charge theory [S. Buyukdagli et al., Phys. Rev. E 94, 042502 (2016), 10.1103/PhysRevE.94.042502] to the case of a stiff polymer interacting with a DNA molecule in an electrolyte mixture. The theory accounts for one-loop level electrostatic correlation effects such as the ionic cloud deformation around the strongly charged DNA molecule as well as image-charge forces induced by the low DNA permittivity. Our model can reproduce and explain various characteristics of the experimental phase diagrams for polymer solutions. First, the addition of polyvalent cations to the electrolyte solution results in the attraction of the negatively charged polymer by the DNA molecule. The glue of the like-charge attraction is the enhanced shielding of the polymer charges by the dense counterion layer at the DNA surface. Second, through the shielding of the DNA-induced electrostatic potential, mono- and polyvalent cations of large concentration both suppress the like-charge attraction. Within the same formalism, we also predict a new opposite-charge repulsion effect between the DNA molecule and a positively charged polymer. In the presence of polyvalent anions such as sulfate or phosphate, their repulsion by the DNA charges leads to the charge screening deficiency of the region around the DNA molecule. This translates into a repulsive force that results in the decomplexation of the polymer from DNA. This opposite-charge repulsion phenomenon can be verified by current experiments and the underlying mechanism can be beneficial to gene therapeutic applications where the control over polymer-DNA interactions is the key factor.
Mechanism of chimera formation during the Multiple Displacement Amplification reaction.
Lasken, Roger S; Stockwell, Timothy B
2007-04-12
Multiple Displacement Amplification (MDA) is a method used for amplifying limiting DNA sources. The high molecular weight amplified DNA is ideal for DNA library construction. While this has enabled genomic sequencing from one or a few cells of unculturable microorganisms, the process is complicated by the tendency of MDA to generate chimeric DNA rearrangements in the amplified DNA. Determining the source of the DNA rearrangements would be an important step towards reducing or eliminating them. Here, we characterize the major types of chimeras formed by carrying out an MDA whole genome amplification from a single E. coli cell and sequencing by the 454 Life Sciences method. Analysis of 475 chimeras revealed the predominant reaction mechanisms that create the DNA rearrangements. The highly branched DNA synthesized in MDA can assume many alternative secondary structures. DNA strands extended on an initial template can be displaced becoming available to prime on a second template creating the chimeras. Evidence supports a model in which branch migration can displace 3'-ends freeing them to prime on the new templates. More than 85% of the resulting DNA rearrangements were inverted sequences with intervening deletions that the model predicts. Intramolecular rearrangements were favored, with displaced 3'-ends reannealing to single stranded 5'-strands contained within the same branched DNA molecule. In over 70% of the chimeric junctions, the 3' termini had initiated priming at complimentary sequences of 2-21 nucleotides (nts) in the new templates. Formation of chimeras is an important limitation to the MDA method, particularly for whole genome sequencing. Identification of the mechanism for chimera formation provides new insight into the MDA reaction and suggests methods to reduce chimeras. The 454 sequencing approach used here will provide a rapid method to assess the utility of reaction modifications.
Mechanism of chimera formation during the Multiple Displacement Amplification reaction
Lasken, Roger S; Stockwell, Timothy B
2007-01-01
Background Multiple Displacement Amplification (MDA) is a method used for amplifying limiting DNA sources. The high molecular weight amplified DNA is ideal for DNA library construction. While this has enabled genomic sequencing from one or a few cells of unculturable microorganisms, the process is complicated by the tendency of MDA to generate chimeric DNA rearrangements in the amplified DNA. Determining the source of the DNA rearrangements would be an important step towards reducing or eliminating them. Results Here, we characterize the major types of chimeras formed by carrying out an MDA whole genome amplification from a single E. coli cell and sequencing by the 454 Life Sciences method. Analysis of 475 chimeras revealed the predominant reaction mechanisms that create the DNA rearrangements. The highly branched DNA synthesized in MDA can assume many alternative secondary structures. DNA strands extended on an initial template can be displaced becoming available to prime on a second template creating the chimeras. Evidence supports a model in which branch migration can displace 3'-ends freeing them to prime on the new templates. More than 85% of the resulting DNA rearrangements were inverted sequences with intervening deletions that the model predicts. Intramolecular rearrangements were favored, with displaced 3'-ends reannealing to single stranded 5'-strands contained within the same branched DNA molecule. In over 70% of the chimeric junctions, the 3' termini had initiated priming at complimentary sequences of 2–21 nucleotides (nts) in the new templates. Conclusion Formation of chimeras is an important limitation to the MDA method, particularly for whole genome sequencing. Identification of the mechanism for chimera formation provides new insight into the MDA reaction and suggests methods to reduce chimeras. The 454 sequencing approach used here will provide a rapid method to assess the utility of reaction modifications. PMID:17430586
Dressman, Devin; Yan, Hai; Traverso, Giovanni; Kinzler, Kenneth W.; Vogelstein, Bert
2003-01-01
Many areas of biomedical research depend on the analysis of uncommon variations in individual genes or transcripts. Here we describe a method that can quantify such variation at a scale and ease heretofore unattainable. Each DNA molecule in a collection of such molecules is converted into a single magnetic particle to which thousands of copies of DNA identical in sequence to the original are bound. This population of beads then corresponds to a one-to-one representation of the starting DNA molecules. Variation within the original population of DNA molecules can then be simply assessed by counting fluorescently labeled particles via flow cytometry. This approach is called BEAMing on the basis of four of its principal components (beads, emulsion, amplification, and magnetics). Millions of individual DNA molecules can be assessed in this fashion with standard laboratory equipment. Moreover, specific variants can be isolated by flow sorting and used for further experimentation. BEAMing can be used for the identification and quantification of rare mutations as well as to study variations in gene sequences or transcripts in specific populations or tissues. PMID:12857956
Sriram, K. K.; Chang, Chun-Ling; Rajesh Kumar, U.; Chou, Chia-Fu
2014-01-01
Molecular combing and flow-induced stretching are the most commonly used methods to immobilize and stretch DNA molecules. While both approaches require functionalization steps for the substrate surface and the molecules, conventionally the former does not take advantage of, as the latter, the versatility of microfluidics regarding robustness, buffer exchange capability, and molecule manipulation using external forces for single molecule studies. Here, we demonstrate a simple one-step combing process involving only low-pressure oxygen (O2) plasma modified polysilsesquioxane (PSQ) polymer layer to facilitate both room temperature microfluidic device bonding and immobilization of stretched single DNA molecules without molecular functionalization step. Atomic force microscopy and Kelvin probe force microscopy experiments revealed a significant increase in surface roughness and surface potential on low-pressure O2 plasma treated PSQ, in contrast to that with high-pressure O2 plasma treatment, which are proposed to be responsible for enabling effective DNA immobilization. We further demonstrate the use of our platform to observe DNA-RNA polymerase complexes and cancer drug cisplatin induced DNA condensation using wide-field fluorescence imaging. PMID:25332730
NASA Astrophysics Data System (ADS)
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
Rapid purification of circular DNA by triplex-mediated affinity capture
Ji, H.; Smith, L.M.
1997-01-07
A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support. 3 figs.
DNA Microcapsule for Photo-Triggered Drug Release Systems.
Kamiya, Yukiko; Yamada, Yoshinobu; Muro, Takahiro; Matsuura, Kazunori; Asanuma, Hiroyuki
2017-12-19
In this study we constructed spherical photo-responsive microcapsules composed of three photo-switchable DNA strands. These strands first formed a three-way junction (TWJ) motif that further self-assembled to form microspheres through hybridization of the sticky-end regions of each branch. To serve as the photo-switch, multiple unmodified azobenzene (Azo) or 2,6-dimethyl-4-(methylthio)azobenzene (SDM-Azo) were introduced into the sticky-end regions via a d-threoninol linker. The DNA capsule structure deformed upon trans-to-cis isomerization of Azo or SDM-Azo induced by specific light irradiation. In addition, photo-triggered release of encapsulated small molecules from the DNA microcapsule was successfully achieved. Moreover, we demonstrated that photo-triggered release of doxorubicin caused cytotoxicity to cultured cells. This biocompatible photo-responsive microcapsule has potential application as a photo-controlled drug-release system. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Integrating DNA strand displacement circuitry to the nonlinear hybridization chain reaction.
Zhang, Zhuo; Fan, Tsz Wing; Hsing, I-Ming
2017-02-23
Programmable and modular attributes of DNA molecules allow one to develop versatile sensing platforms that can be operated isothermally and enzyme-free. In this work, we present an approach to integrate upstream DNA strand displacement circuits that can be turned on by a sequence-specific microRNA analyte with a downstream nonlinear hybridization chain reaction for a cascading hyperbranched nucleic acid assembly. This system provides a two-step amplification strategy for highly sensitive detection of the miRNA analyte, conducive for multiplexed detection. Multiple miRNA analytes were tested with our integrated circuitry using the same downstream signal amplification setting, showing the decoupling of nonlinear self-assembly with the analyte sequence. Compared with the reported methods, our signal amplification approach provides an additional control module for higher-order DNA self-assembly and could be developed into a promising platform for the detection of critical nucleic-acid based biomarkers.
Multivariate Boosting for Integrative Analysis of High-Dimensional Cancer Genomic Data
Xiong, Lie; Kuan, Pei-Fen; Tian, Jianan; Keles, Sunduz; Wang, Sijian
2015-01-01
In this paper, we propose a novel multivariate component-wise boosting method for fitting multivariate response regression models under the high-dimension, low sample size setting. Our method is motivated by modeling the association among different biological molecules based on multiple types of high-dimensional genomic data. Particularly, we are interested in two applications: studying the influence of DNA copy number alterations on RNA transcript levels and investigating the association between DNA methylation and gene expression. For this purpose, we model the dependence of the RNA expression levels on DNA copy number alterations and the dependence of gene expression on DNA methylation through multivariate regression models and utilize boosting-type method to handle the high dimensionality as well as model the possible nonlinear associations. The performance of the proposed method is demonstrated through simulation studies. Finally, our multivariate boosting method is applied to two breast cancer studies. PMID:26609213
Mammalian DNA single-strand break repair: an X-ra(y)ted affair.
Caldecott, K W
2001-05-01
The genetic stability of living cells is continuously threatened by the presence of endogenous reactive oxygen species and other genotoxic molecules. Of particular threat are the thousands of DNA single-strand breaks that arise in each cell, each day, both directly from disintegration of damaged sugars and indirectly from the excision repair of damaged bases. If un-repaired, single-strand breaks can be converted into double-strand breaks during DNA replication, potentially resulting in chromosomal rearrangement and genetic deletion. Consequently, cells have adopted multiple pathways to ensure the rapid and efficient removal of single-strand breaks. A general feature of these pathways appears to be the extensive employment of protein-protein interactions to stimulate both the individual component steps and the overall repair reaction. Our current understanding of DNA single-strand break repair is discussed, and testable models for the architectural coordination of this important process are presented. Copyright 2001 John Wiley & Sons, Inc.
NASA Astrophysics Data System (ADS)
Vologodskii, Alexander
2016-09-01
The widespread circular form of DNA molecules inside cells creates very serious topological problems during replication. Due to the helical structure of the double helix the parental strands of circular DNA form a link of very high order, and yet they have to be unlinked before the cell division. DNA topoisomerases, the enzymes that catalyze passing of one DNA segment through another, solve this problem in principle. However, it is very difficult to remove all entanglements between the replicated DNA molecules due to huge length of DNA comparing to the cell size. One strategy that nature uses to overcome this problem is to create the topoisomerases that can dramatically reduce the fraction of linked circular DNA molecules relative to the corresponding fraction at thermodynamic equilibrium. This striking property of the enzymes means that the enzymes that interact with DNA only locally can access their topology, a global property of circular DNA molecules. This review considers the experimental studies of the phenomenon and analyzes the theoretical models that have been suggested in attempts to explain it. We describe here how various models of enzyme action can be investigated computationally. There is no doubt at the moment that we understand basic principles governing enzyme action. Still, there are essential quantitative discrepancies between the experimental data and the theoretical predictions. We consider how these discrepancies can be overcome.
Fatima, Sabiha; Jatavath, Mohan Babu; Bathini, Raju; Sivan, Sree Kanth; Manga, Vijjulatha
2014-10-01
Poly(ADP-ribose) polymerase-1 (PARP-1) functions as a DNA damage sensor and signaling molecule. It plays a vital role in the repair of DNA strand breaks induced by radiation and chemotherapeutic drugs; inhibitors of this enzyme have the potential to improve cancer chemotherapy or radiotherapy. Three-dimensional quantitative structure activity relationship (3D QSAR) models were developed using comparative molecular field analysis, comparative molecular similarity indices analysis and docking studies. A set of 88 molecules were docked into the active site of six X-ray crystal structures of poly(ADP-ribose)polymerase-1 (PARP-1), by a procedure called multiple receptor conformation docking (MRCD), in order to improve the 3D QSAR models through the analysis of binding conformations. The docked poses were clustered to obtain the best receptor binding conformation. These dock poses from clustering were used for 3D QSAR analysis. Based on MRCD and QSAR information, some key features have been identified that explain the observed variance in the activity. Two receptor-based QSAR models were generated; these models showed good internal and external statistical reliability that is evident from the [Formula: see text], [Formula: see text] and [Formula: see text]. The identified key features enabled us to design new PARP-1 inhibitors.
Single molecule fluorescence burst detection of DNA fragments separated by capillary electrophoresis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Haab, B.B.; Mathies, R.A.
A method has been developed for detecting DNA separated by capillary gel electrophoresis (CGE) using single molecule photon burst counting. A confocal fluorescence microscope was used to observe the fluorescence bursts from single molecules of DNA multiply labeled with the thiazole orange derivative TO6 as they passed through the nearly 2-{mu}m diameter focused laser beam. Amplified photo-electron pulses from the photomultiplier are grouped into bins of 360-450 {mu}s in duration, and the resulting histogram is stored in a computer for analysis. Solutions of M13 DNA were first flowed through the capillary at various concentrations, and the resulting data were usedmore » to optimize the parameters for digital filtering using a low-pass Fourier filter, selecting a discriminator level for peak detection, and applying a peak-calling algorithm. The optimized single molecule counting method was then applied to an electrophoretic separation of M13 DNA and to a separation of pBR 322 DNA from pRL 277 DNA. Clusters of discreet fluorescence bursts were observed at the expected appearance time of each DNA band. The auto-correlation function of these data indicated transit times that were consistent with the observed electrophoretic velocity. These separations were easily detected when only 50-100 molecules of DNA per band traveled through the detection region. This new detection technology should lead to the routine analysis of DNA in capillary columns with an on-column sensitivity of nearly 100 DNA molecules/band or better. 45 refs., 10 figs.« less
Winding single-molecule double-stranded DNA on a nanometer-sized reel
You, Huijuan; Iino, Ryota; Watanabe, Rikiya; Noji, Hiroyuki
2012-01-01
A molecular system of a nanometer-sized reel was developed from F1–ATPase, a rotary motor protein. By combination with magnetic tweezers and optical tweezers, single-molecule double-stranded DNA (dsDNA) was wound around the molecular reel. The bending stiffness of dsDNA was determined from the winding tension (0.9–6.0 pN) and the diameter of the wound loop (21.4–8.5 nm). Our results were in good agreement with the conventional worm-like chain model and a persistence length of 54 ± 9 nm was estimated. This molecular reel system offers a new platform for single-molecule study of micromechanics of sharply bent DNA molecules and is expected to be applicable to the elucidation of the molecular mechanism of DNA-associating proteins on sharply bent DNA strands. PMID:22772992
DNA intermediates and telomere addition during genome reorganization in Euplotes crassus.
Roth, M; Prescott, D M
1985-06-01
Three gene-sized molecules cloned intact from macronuclear DNA served as hybridization probes to study excision of these molecules from chromosomes and their processing during macronuclear development in the hypotrich Euplotes crassus. These molecules occur in integrated forms within polytene chromosomal DNA during macronuclear developmental. After transection of the polytene chromosomes, the three molecules occur in intermediate forms. One of the three molecules first appeared in a large intermediate that was subsequently replaced by a second intermediate, approximately 140 bp larger than the final molecule. The other two macronuclear molecules were detected only in intermediates approximately 140 bp larger than the mature form. These penultimate intermediates are larger by virtue of oversized telomeres, which are pared to yield the mature gene-sized molecules.
High-throughput DNA separation in nanofilter arrays.
Choi, Sungup; Kim, Ju Min; Ahn, Kyung Hyun; Lee, Seung Jong
2014-08-01
We numerically investigated the dynamics of short double-stranded DNA molecules moving through a deep-shallow alternating nanofilter, by utilizing Brownian dynamics simulation. We propose a novel mechanism for high-throughput DNA separation with a high electric field, which was originally predicted by Laachi et al. [Phys. Rev. Lett. 2007, 98, 098106]. In this work, we show that DNA molecules deterministically move along different electrophoretic streamlines according to their length, owing to geometric constraint at the exit of the shallow region. Consequently, it is more probable that long DNA molecules pass over a deep well region without significant lateral migration toward the bottom of the deep well, which is in contrast to the long dwelling time for short DNA molecules. We investigated the dynamics of DNA passage through a nanofilter facilitating electrophoretic field kinematics. The statistical distribution of the DNA molecules according to their size clearly corroborates our assumption. On the other hand, it was also found that the tapering angle between the shallow and deep regions significantly affects the DNA separation performance. The current results show that the nonuniform field effect combined with geometric constraint plays a key role in nanofilter-based DNA separation. We expect that our results will be helpful in designing and operating nanofluidics-based DNA separation devices and in understanding the polymer dynamics in confined geometries. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Generation of Gene-Engineered Chimeric DNA Molecules for Specific Therapy of Autoimmune Diseases
Gesheva, Vera; Szekeres, Zsuzsanna; Mihaylova, Nikolina; Dimitrova, Iliyana; Nikolova, Maria; Erdei, Anna; Prechl, Jozsef
2012-01-01
Abstract Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by the development of self-reactive B and T cells and autoantibody production. In particular, double-stranded DNA-specific B cells play an important role in lupus progression, and their selective elimination is a reasonable approach for effective therapy of SLE. DNA-based vaccines aim at the induction of immune response against the vector-encoded antigen. Here, we are exploring, as a new DNA-based therapy of SLE, a chimeric DNA molecule encoding a DNA-mimotope peptide, and the Fv but not the immunogenic Fc fragment of an FcγRIIb-specific monoclonal antibody. This DNA construct was inserted in the expression vector pNut and used as a naked DNA vaccine in a mouse model of lupus. The chimeric DNA molecule can be expressed in eukaryotic cells and cross-links cell surface receptors on DNA-specific B cells, delivering an inhibitory intracellular signal. Intramuscular administration of the recombinant DNA molecule to lupus-prone MRL/lpr mice prevented increase in IgG anti-DNA antibodies and was associated with a low degree of proteinuria, modulation of cytokine profile, and suppression of lupus nephritis. PMID:23075110
DNA mechanics as a tool to probe helicase and translocase activity.
Lionnet, Timothée; Dawid, Alexandre; Bigot, Sarah; Barre, François-Xavier; Saleh, Omar A; Heslot, François; Allemand, Jean-François; Bensimon, David; Croquette, Vincent
2006-01-01
Helicases and translocases are proteins that use the energy derived from ATP hydrolysis to move along or pump nucleic acid substrates. Single molecule manipulation has proved to be a powerful tool to investigate the mechanochemistry of these motors. Here we first describe the basic mechanical properties of DNA unraveled by single molecule manipulation techniques. Then we demonstrate how the knowledge of these properties has been used to design single molecule assays to address the enzymatic mechanisms of different translocases. We report on four single molecule manipulation systems addressing the mechanism of different helicases using specifically designed DNA substrates: UvrD enzyme activity detection on a stretched nicked DNA molecule, HCV NS3 helicase unwinding of a RNA hairpin under tension, the observation of RecBCD helicase/nuclease forward and backward motion, and T7 gp4 helicase mediated opening of a synthetic DNA replication fork. We then discuss experiments on two dsDNA translocases: the RuvAB motor studied on its natural substrate, the Holliday junction, and the chromosome-segregation motor FtsK, showing its unusual coupling to DNA supercoiling.
Small-molecule inhibitors of APE1 DNA repair function: an overview.
Al-Safi, Rasha I; Odde, Srinivas; Shabaik, Yumna; Neamati, Nouri
2012-01-01
APE1 is a multifaceted protein that orchestrates multiple activities in the cell, one of which is the preservation of genomic integrity; a vital process that takes place in the context of the base excision repair (BER) pathway. Studies have implicated APE1 in rendering cancerous cells less vulnerable to the effects of DNA-damaging agents that are commonly used for the treatment of cancer. Furthermore, suppression of APE1 expression in cancer cell lines is accompanied by the potentiation of the activity of cytotoxic agents. As a result, major efforts have been directed towards the identification of small-molecule inhibitors of this DNA-repair enzyme. Herein, we review all patented small-molecule APE1 inhibitors reported prior to 2011. Unfortunately, the potency and selectivity of many of the reported inhibitors were not disclosed by the original authors, and at present it is unclear if APE1 is a bona fide target for many of the purported inhibitors. Moreover, cellular activity and toxicity of many inhibitors remain to be established. Since this is the first comprehensive review of small molecule APE1 inhibitors, we present all compounds reported to inhibit APE1 activity with an IC50 value ≤ 25 μM. Efforts towards a careful validation and optimization of these compounds are warranted. Furthermore, we explore potential allosteric drug-binding sites on the protein as an alternative approach for modulating the activity of this multifunctional protein. In addition, we give an overview of APE2, as well as other APE1 homologues in some disease-causing pathogens. Finally, given the universal importance of DNA repair, as well as the considerable conservation of repair proteins across all living organisms, we propose targeting the AP endonuclease activity of pathogens by the compounds discussed in this review, thereby expanding their therapeutic potential and application.
Development of a reference material of a single DNA molecule for the quality control of PCR testing.
Mano, Junichi; Hatano, Shuko; Futo, Satoshi; Yoshii, Junji; Nakae, Hiroki; Naito, Shigehiro; Takabatake, Reona; Kitta, Kazumi
2014-09-02
We developed a reference material of a single DNA molecule with a specific nucleotide sequence. The double-strand linear DNA which has PCR target sequences at the both ends was prepared as a reference DNA molecule, and we named the PCR targets on each side as confirmation sequence and standard sequence. The highly diluted solution of the reference molecule was dispensed into 96 wells of a plastic PCR plate to make the average number of molecules in a well below one. Subsequently, the presence or absence of the reference molecule in each well was checked by real-time PCR targeting for the confirmation sequence. After an enzymatic treatment of the reaction mixture in the positive wells for the digestion of PCR products, the resultant solution was used as the reference material of a single DNA molecule with the standard sequence. PCR analyses revealed that the prepared samples included only one reference molecule with high probability. The single-molecule reference material developed in this study will be useful for the absolute evaluation of a detection limit of PCR-based testing methods, the quality control of PCR analyses, performance evaluations of PCR reagents and instruments, and the preparation of an accurate calibration curve for real-time PCR quantitation.
Recombination and Transfection Mapping of Cistron 5 of Bacteriophage Sp82g
Green, D. MacDonald; Urban, Margeret I.
1972-01-01
Recombination between transfecting SP82G DNA molecules has been studied in Bacillus subtilis. Recombinant progeny issuing from transfected cells show many of the features that characterize progeny production in multiplicity reactivated bacteriophage, such as: majority recombinant clones, non-reciprocity of recombinant clones and the frequent absence of input alleles. While transfection substantially lowers the linkage observed between markers in normal phage crosses, linkage is observed at small map distances in transfection either by plating transfected bacteria or the progeny phage. Maps constructed from transfection crosses are identical to those of normal phage crosses, except in magnitude.—Examination of the concentration response of two marker biparental crosses, and three marker triparental crosses using transfecting DNA leads to the conclusion that at all concentrations, transfective centers are saturated with respect to the number of molecules that can be taken up. Thus, the frequency of recombinant infective centers, or recombinant progeny is independent of concentration effects. PMID:17248556
NASA Technical Reports Server (NTRS)
Yang, Tianbao; Poovaiah, B. W.
2002-01-01
We reported earlier that the tobacco early ethylene-responsive gene NtER1 encodes a calmodulin-binding protein (Yang, T., and Poovaiah, B. W. (2000) J. Biol. Chem. 275, 38467-38473). Here we demonstrate that there is one NtER1 homolog as well as five related genes in Arabidopsis. These six genes are rapidly and differentially induced by environmental signals such as temperature extremes, UVB, salt, and wounding; hormones such as ethylene and abscisic acid; and signal molecules such as methyl jasmonate, H(2)O(2), and salicylic acid. Hence, they were designated as AtSR1-6 (Arabidopsis thaliana signal-responsive genes). Ca(2+)/calmodulin binds to all AtSRs, and their calmodulin-binding regions are located on a conserved basic amphiphilic alpha-helical motif in the C terminus. AtSR1 targets the nucleus and specifically recognizes a novel 6-bp CGCG box (A/C/G)CGCG(G/T/C). The multiple CGCG cis-elements are found in promoters of genes such as those involved in ethylene signaling, abscisic acid signaling, and light signal perception. The DNA-binding domain in AtSR1 is located on the N-terminal 146 bp where all AtSR1-related proteins share high similarity but have no similarity to other known DNA-binding proteins. The calmodulin-binding nuclear proteins isolated from wounded leaves exhibit specific CGCG box DNA binding activities. These results suggest that the AtSR gene family encodes a family of calmodulin-binding/DNA-binding proteins involved in multiple signal transduction pathways in plants.
Cell-targetable DNA nanocapsules for spatiotemporal release of caged bioactive small molecules
NASA Astrophysics Data System (ADS)
Veetil, Aneesh T.; Chakraborty, Kasturi; Xiao, Kangni; Minter, Myles R.; Sisodia, Sangram S.; Krishnan, Yamuna
2017-12-01
Achieving triggered release of small molecules with spatial and temporal precision at designated cells within an organism remains a challenge. By combining a cell-targetable, icosahedral DNA-nanocapsule loaded with photoresponsive polymers, we show cytosolic delivery of small molecules with the spatial resolution of single endosomes in specific cells in Caenorhabditis elegans. Our technology can report on the extent of small molecules released after photoactivation as well as pinpoint the location at which uncaging of the molecules occurred. We apply this technology to release dehydroepiandrosterone (DHEA), a neurosteroid that promotes neurogenesis and neuron survival, and determined the timescale of neuronal activation by DHEA, using light-induced release of DHEA from targeted DNA nanocapsules. Importantly, sequestration inside the DNA capsule prevents photocaged DHEA from activating neurons prematurely. Our methodology can in principle be generalized to diverse neurostimulatory molecules.
Design of stapled DNA-minor-groove-binding molecules with a mutable atom simulated annealing method
NASA Astrophysics Data System (ADS)
Walker, Wynn L.; Kopka, Mary L.; Dickerson, Richard E.; Goodsell, David S.
1997-11-01
We report the design of optimal linker geometries for the synthesis of stapledDNA-minor-groove-binding molecules. Netropsin, distamycin, and lexitropsinsbind side-by-side to mixed-sequence DNA and offer an opportunity for thedesign of sequence-reading molecules. Stapled molecules, with two moleculescovalently linked side-by-side, provide entropic gains and restrain theposition of one molecule relative to its neighbor. Using a free-atom simulatedannealing technique combined with a discrete mutable atom definition, optimallengths and atomic composition for covalent linkages are determined, and anovel hydrogen bond `zipper' is proposed to phase two molecules accuratelyside-by-side.
Single-Molecule Denaturation Mapping of Genomic DNA in Nanofluidic Channels
NASA Astrophysics Data System (ADS)
Reisner, Walter; Larsen, Niels; Kristensen, Anders; Tegenfeldt, Jonas O.; Flyvbjerg, Henrik
2009-03-01
We have developed a new DNA barcoding technique based on the partial denaturation of extended fluorescently labeled DNA molecules. We partially melt DNA extended in nanofluidic channels via a combination of local heating and added chemical denaturants. The melted molecules, imaged via a standard fluorescence videomicroscopy setup, exhibit a nonuniform fluorescence profile corresponding to a series of local dips and peaks in the intensity trace along the stretched molecule. We show that this barcode is consistent with the presence of locally melted regions and can be explained by calculations of sequence-dependent melting probability. We believe this melting mapping technology is the first optically based single molecule technique sensitive to genome wide sequence variation that does not require an additional enzymatic labeling or restriction scheme.
Gating electrical transport through DNA molecules that bridge between silicon nanogaps.
Takagi, Shogo; Takada, Tadao; Matsuo, Naoto; Yokoyama, Shin; Nakamura, Mitsunobu; Yamana, Kazushige
2012-03-21
DNA electronic devices were prepared on silicon-based three-terminal electrodes. Both ends of DNA molecules (400 bp long, mixed sequences) were bridged via chemical bonds between the source-drain nanogap (120 nm) electrodes. S-Shaped I-V curves were obtained and the electric current can be modulated by the gate voltage. The DNA molecules act as semiconducting p-type nanowires in the three-terminal device. This journal is © The Royal Society of Chemistry 2012
NASA Astrophysics Data System (ADS)
Azuma, Naoki; Itoh, Shintaro; Fukuzawa, Kenji; Zhang, Hedong
2018-02-01
Through electrophoresis driven by a pulsed electric field, we succeeded in separating large DNA molecules with an electrophoretic microchip based on size exclusion chromatography (SEC), which was proposed in our previous study. The conditions of the pulsed electric field required to achieve the separation were determined by numerical analyses using our originally proposed separation model. From the numerical results, we succeeded in separating large DNA molecules (λ DNA and T4 DNA) within 1600 s, which was approximately half of that achieved under a direct electric field in our previous study. Our SEC-based electrophoresis microchip will be one of the effective tools to meet the growing demand of faster and more convenient separation of large DNA molecules, especially in the field of epidemiological research of infectious diseases.
NASA Astrophysics Data System (ADS)
Nicasio-Collazo, Luz Adriana; Delgado-González, Alexandra; Hernández-Lemus, Enrique; Castañeda-Priego, Ramón
2017-04-01
The study of the effects associated with the electrostatic properties of DNA is of fundamental importance to understand both its molecular properties at the single molecule level, like the rigidity of the chain, and its interaction with other charged bio-molecules, including other DNA molecules; such interactions are crucial to maintain the thermodynamic stability of the intra-cellular medium. In the present work, we combine the Poisson-Boltzmann mean-field theory with an irreversible thermodynamic approximation to analyze the effects of counterion accumulation inside DNA on both the denaturation profile of the chain and the equation of state of the suspension. To this end, we model the DNA molecule as a porous charged cylinder immersed in an aqueous solution. These thermo-electrostatic effects are explicitly studied in the particular case of some genes for which damage in their sequence is associated with diffuse large B-cell lymphoma.
Wang, Yaru; Ma, Na; Wang, Yan; Chen, Guangju
2012-01-01
It has been extensively developed in recent years that cell-permeable small molecules, such as polyamide, can be programmed to disrupt transcription factor-DNA interfaces and can silence aberrant gene expression. For example, cyclic pyrrole-imidazole polyamide that competes with glucocorticoid receptor (GR) for binding to glucocorticoid response elements could be expected to affect the DNA dependent binding by interfering with the protein-DNA interface. However, how such small molecules affect the transcription factor-DNA interfaces and gene regulatory pathways through DNA structure distortion is not fully understood so far. In the present work, we have constructed some models, especially the ternary model of polyamides+DNA+GR DNA-binding domain (GRDBD) dimer, and carried out molecular dynamics simulations and free energy calculations for them to address how polyamide molecules disrupt the GRDBD and DNA interface when polyamide and protein bind at the same sites on opposite grooves of DNA. We found that the cyclic polyamide binding in minor groove of DNA can induce a large structural perturbation of DNA, i.e. a >4 Å widening of the DNA minor groove and a compression of the major groove by more than 4 Å as compared with the DNA molecule in the GRDBD dimer+DNA complex. Further investigations for the ternary system of polyamides+DNA+GRDBD dimer and the binary system of allosteric DNA+GRDBD dimer revealed that the compression of DNA major groove surface causes GRDBD to move away from the DNA major groove with the initial average distance of ∼4 Å to the final average distance of ∼10 Å during 40 ns simulation course. Therefore, this study straightforward explores how small molecule targeting specific sites in the DNA minor groove disrupts the transcription factor-DNA interface in DNA major groove, and consequently modulates gene expression.
Molecular structure of r/GCG/d/TATACGC/ - A DNA-RNA hybrid helix joined to double helical DNA
NASA Technical Reports Server (NTRS)
Wang, A. H.-J.; Fujii, S.; Rich, A.; Van Boom, J. H.; Van Der Marel, G. A.; Van Boeckel, S. A. A.
1982-01-01
The molecule r(GCG)d(TATACGC) is self-complementary and forms two DNA-RNA hybrid segments surrounding a central region of double helical DNA; its molecular structure has been solved by X-ray analysis. All three parts of the molecule adopt a conformation which is close to that seen in the 11-fold RNA double helix. The conformation of the ribonucleotides is partly determined by water molecules bridging between the ribose O2' hydroxyl group and cytosine O2. The hybrid-DNA duplex junction contains no structural discontinuities. However, the central DNA TATA sequence has some structural irregularities.
Hu, Rong; Zhang, Xi; Xu, Qiang; Lu, Dan-Qing; Yang, Yun-Hui; Xu, Quan-Qing; Ruan, Qiong; Mo, Liu-Ting; Zhang, Xiao-Bing
2017-06-15
A universal aptameric system based on the taking advantage of double-stranded DNA/perylene diimide (dsDNA/PDI) as the signal probe was developed for multiplexed detection of small molecules. Aptamers are single-stranded DNA or RNA oligonucleotides which are selected in vitro by a process known as systematic evolution of ligands by exponential enrichment. In this work, we synthesized a new kind of PDI and reported this aggregated PDI could quench the double-stranded DNA (dsDNA)-labeled fluorophores with a high quenching efficiency. The quenching efficiencies on the fluorescence of FAM, TAMRA and Cy5 could reach to 98.3%±0.9%, 97.2%±0.6% and 98.1%±1.1%, respectively. This broad-spectrum quencher was then adopted to construct a multicolor biosensor via a label-free approach. A structure-switching-triggered enzymatic recycling amplification was employed for signal amplification. High quenching efficiency combined with autocatalytic target recycling amplification afforded the biosensor with high sensitivity towards small analytes. For other targets, changing the corresponding aptamer can achieve the goal. The quencher did not interfere with the catalytic activity of nuclease. The biosensor could be manipulated with similar sensitivity no matter in pre-addition or post-addition manner. Moreover, simultaneous and multiplexed analysis of several small molecules in homogeneous solution was achieved, demonstrating its potential application in the rapid screening of multiple biotargets. Copyright © 2017 Elsevier B.V. All rights reserved.
DNA confinement in nanochannels: physics and biological applications
NASA Astrophysics Data System (ADS)
Reisner, Walter; Pedersen, Jonas N.; Austin, Robert H.
2012-10-01
DNA is the central storage molecule of genetic information in the cell, and reading that information is a central problem in biology. While sequencing technology has made enormous advances over the past decade, there is growing interest in platforms that can readout genetic information directly from long single DNA molecules, with the ultimate goal of single-cell, single-genome analysis. Such a capability would obviate the need for ensemble averaging over heterogeneous cellular populations and eliminate uncertainties introduced by cloning and molecular amplification steps (thus enabling direct assessment of the genome in its native state). In this review, we will discuss how the information contained in genomic-length single DNA molecules can be accessed via physical confinement in nanochannels. Due to self-avoidance interactions, DNA molecules will stretch out when confined in nanochannels, creating a linear unscrolling of the genome along the channel for analysis. We will first review the fundamental physics of DNA nanochannel confinement—including the effect of varying ionic strength—and then discuss recent applications of these systems to genomic mapping. Apart from the intense biological interest in extracting linear sequence information from elongated DNA molecules, from a physics view these systems are fascinating as they enable probing of single-molecule conformation in environments with dimensions that intersect key physical length-scales in the 1 nm to 100 µm range.
DNA confinement in nanochannels: physics and biological applications.
Reisner, Walter; Pedersen, Jonas N; Austin, Robert H
2012-10-01
DNA is the central storage molecule of genetic information in the cell, and reading that information is a central problem in biology. While sequencing technology has made enormous advances over the past decade, there is growing interest in platforms that can readout genetic information directly from long single DNA molecules, with the ultimate goal of single-cell, single-genome analysis. Such a capability would obviate the need for ensemble averaging over heterogeneous cellular populations and eliminate uncertainties introduced by cloning and molecular amplification steps (thus enabling direct assessment of the genome in its native state). In this review, we will discuss how the information contained in genomic-length single DNA molecules can be accessed via physical confinement in nanochannels. Due to self-avoidance interactions, DNA molecules will stretch out when confined in nanochannels, creating a linear unscrolling of the genome along the channel for analysis. We will first review the fundamental physics of DNA nanochannel confinement--including the effect of varying ionic strength--and then discuss recent applications of these systems to genomic mapping. Apart from the intense biological interest in extracting linear sequence information from elongated DNA molecules, from a physics view these systems are fascinating as they enable probing of single-molecule conformation in environments with dimensions that intersect key physical length-scales in the 1 nm to 100 µm range.
Interplay of space radiation and microgravity in DNA damage and DNA damage response.
Moreno-Villanueva, María; Wong, Michael; Lu, Tao; Zhang, Ye; Wu, Honglu
2017-01-01
In space, multiple unique environmental factors, particularly microgravity and space radiation, pose constant threat to the DNA integrity of living organisms. Specifically, space radiation can cause damage to DNA directly, through the interaction of charged particles with the DNA molecules themselves, or indirectly through the production of free radicals. Although organisms have evolved strategies on Earth to confront such damage, space environmental conditions, especially microgravity, can impact DNA repair resulting in accumulation of severe DNA lesions. Ultimately these lesions, namely double strand breaks, chromosome aberrations, micronucleus formation, or mutations, can increase the risk for adverse health effects, such as cancer. How spaceflight factors affect DNA damage and the DNA damage response has been investigated since the early days of the human space program. Over the years, these experiments have been conducted either in space or using ground-based analogs. This review summarizes the evidence for DNA damage induction by space radiation and/or microgravity as well as spaceflight-related impacts on the DNA damage response. The review also discusses the conflicting results from studies aimed at addressing the question of potential synergies between microgravity and radiation with regard to DNA damage and cellular repair processes. We conclude that further experiments need to be performed in the true space environment in order to address this critical question.
Kim, Kyung-Il; Lee, Seonghyun; Jin, Xuelin; Kim, Su Ji; Jo, Kyubong; Lee, Jung Heon
2017-01-01
Synthesis of smooth and continuous DNA nanowires, preserving the original structure of native DNA, and allowing its analysis by scanning electron microscope (SEM), is demonstrated. Gold nanoparticles densely assembled on the DNA backbone via thiol-tagged DNA binding peptides work as seeds for metallization of DNA. This method allows whole analysis of DNA molecules with entangled 3D features. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Current-voltage characteristics of double stranded versus single stranded DNA molecules
NASA Astrophysics Data System (ADS)
Hartzell, B.; Chen, Hong; Heremans, J. J.; McCord, B.; Soghomonian, V.
2004-03-01
Investigation of DNA conductivity has focused on the native, duplex structure, with controversial results. Here, we present the influence of the double-helical structure on charge transport through lambda DNA molecules. The current-voltage (I-V) characteristics of both disulfide-labeled double stranded DNA (dsDNA) and disulfide-labeled single stranded DNA (ssDNA) were measured. The ssDNA was formed from the dsDNA using two different methods for comparison purposes: a thermal/chemical denaturation and enzymatic digestion utilizing lambda exonuclease. Resulting I-V characteristics of both the double stranded and single stranded samples were close-to-linear when measured at room temperature. However, the ssDNA samples consistently gave conductivity values about two orders of magnitude smaller in amplitude. Our results suggest an integral relationship between the native structure of DNA with its stacked base pairs and the molecule's ability to support charge transport.(NSF NIRT 0103034)
KiranKumar, Hulihalli N; RohitKumar, Heggodu G; Advirao, Gopal M
2018-01-01
Two new derivatives of pyrimido[4',5';4,5]thieno(2,3-b)quinoline (PTQ), 9-hydroxy-4-(3-diethylaminopropylamino)pyrimido[4',5';4,5]thieno(2,3-b)quinoline (Hydroxy-DPTQ) and 8-methoxy-4-(3-diethylaminopropylamino)pyrimido[4',5';4,5]thieno(2,3-b)quinoline (Methoxy-DPTQ) were synthesized and their DNA binding ability was analyzed using spectroscopy (UV-visible, fluorescence and circular dichroism), ethidium bromide dye displacement assay, melting temperature (T m ) analysis and computational docking studies. The hypochromism in UV-visible spectrum and increased fluorescence emission of Hydroxy-DPTQ and Methoxy-DPTQ in the presence of DNA suggested the molecule-DNA interaction. The association constants calculated from UV-visible and spectral titrations were of the order 10 4 to 10 6 M -1 . Circular dichroism studies corroborated the induced conformational changes in DNA upon addition of molecules. The change in the ellipticity was observed both in negative and positive peak of DNA, thus, suggesting the intercalation of molecules. The observed displacement of ethidium bromide from the DNA and increased T m , upon addition of DNA confirmed the intercalative mode of binding. This was further validated by computational docking, which showed clear intercalation of molecules into the d(GpC)-d(CpG) site of the receptor DNA. Anticancer activities of these molecules are evaluated by using MTT assay. Both molecules showed antiproliferative activity against all the three cancer cells studied, with Hydroxy-DPTQ being more potential molecule among the two. IC 50 value of Hydroxy-DPTQ and Methoxy-DPTQ were in the range of 3-5μM and 130-250μM, respectively. Copyright © 2017 Elsevier B.V. All rights reserved.
Single-molecule analysis of DNA uncoiling by a type II topoisomerase
NASA Astrophysics Data System (ADS)
Strick, Terence R.; Croquette, Vincent; Bensimon, David
2000-04-01
Type II DNA topoisomerases are ubiquitous ATP-dependent enzymes capable of transporting a DNA through a transient double-strand break in a second DNA segment. This enables them to untangle DNA and relax the interwound supercoils (plectonemes) that arise in twisted DNA. In vivo, they are responsible for untangling replicated chromosomes and their absence at mitosis or meiosis ultimately causes cell death. Here we describe a micromanipulation experiment in which we follow in real time a single Drosophila melanogaster topoisomerase II acting on a linear DNA molecule which is mechanically stretched and supercoiled. By monitoring the DNA's extension in the presence of ATP, we directly observe the relaxation of two supercoils during a single catalytic turnover. By controlling the force pulling on the molecule, we determine the variation of the reaction rate with the applied stress. Finally, in the absence of ATP, we observe the clamping of a DNA crossover by a single topoisomerase on at least two different timescales (configurations). These results show that single molecule experiments are a powerful new tool for the study of topoisomerases.
Yoshizaki, Yuta; Yuba, Eiji; Sakaguchi, Naoki; Koiwai, Kazunori; Harada, Atsushi; Kono, Kenji
2017-10-01
Efficient vaccine carriers for cancer immunotherapy require two functions: antigen delivery to dendritic cells (DCs) and the activation of DCs, a so-called adjuvant effect. We previously reported antigen delivery system using liposomes modified with pH-sensitive polymers, such as 3-methylglutarylated hyperbranched poly(glycidol) (MGlu-HPG), for the induction of antigen-specific immune responses. We reported that inclusion of cationic lipids to MGlu-HPG-modified liposomes activates DCs and enhances antitumor effects. In this study, CpG-DNA, a ligand to Toll-like receptor 9 (TLR9) expressing in endosomes of DCs, was introduced to MGlu-HPG-modified liposomes containing cationic lipids using two complexation methods (Pre-mix and Post-mix) for additional activation of antigen-specific immunity. For Pre-mix, thin membrane of lipids and polymers were dispersed by a mixture of antigen/CpG-DNA. For Post-mix, CpG-DNA was added to pre-formed liposomes. Both Pre-mix and Post-mix delivered CpG-DNA to DC endosomes, where TLR9 is expressing, more efficiently than free CpG-DNA solution did. These liposomes promoted cytokine production from DCs and the expression of co-stimulatory molecules in vitro and induced antigen-specific immune responses in vivo. Both Pre-mix and Post-mix exhibited strong antitumor effects compared with conventional pH-sensitive polymer-modified liposomes. Results show that inclusion of multiple adjuvant molecules into pH-sensitive polymer-modified liposomes and suitable CpG-DNA complexation methods are important to design potent vaccine carriers. Copyright © 2017 Elsevier Ltd. All rights reserved.
van 't Hoff, Marcel; Reuter, Marcel; Dryden, David T F; Oheim, Martin
2009-09-21
Bacteriophage lambda-DNA molecules are frequently used as a scaffold to characterize the action of single proteins unwinding, translocating, digesting or repairing DNA. However, scaling up such single-DNA-molecule experiments under identical conditions to attain statistically relevant sample sizes remains challenging. Additionally the movies obtained are frequently noisy and difficult to analyse with any precision. We address these two problems here using, firstly, a novel variable-angle total internal reflection fluorescence (VA-TIRF) reflector composed of a minimal set of optical reflective elements, and secondly, using single value decomposition (SVD) to improve the signal-to-noise ratio prior to analysing time-lapse image stacks. As an example, we visualize under identical optical conditions hundreds of surface-tethered single lambda-DNA molecules, stained with the intercalating dye YOYO-1 iodide, and stretched out in a microcapillary flow. Another novelty of our approach is that we arrange on a mechanically driven stage several capillaries containing saline, calibration buffer and lambda-DNA, respectively, thus extending the approach to high-content, high-throughput screening of single molecules. Our length measurements of individual DNA molecules from noise-reduced kymograph images using SVD display a 6-fold enhanced precision compared to raw-data analysis, reaching approximately 1 kbp resolution. Combining these two methods, our approach provides a straightforward yet powerful way of collecting statistically relevant amounts of data in a semi-automated manner. We believe that our conceptually simple technique should be of interest for a broader range of single-molecule studies, well beyond the specific example of lambda-DNA shown here.
Single DNA molecule detection using nanopipettes and nanoparticles.
Karhanek, Miloslav; Kemp, Jennifer T; Pourmand, Nader; Davis, Ronald W; Webb, Chris D
2005-02-01
Single DNA molecules labeled with nanoparticles can be detected by blockades of ionic current as they are translocated through a nanopipette tip formed by a pulled glass capillary. The nanopipette detection technique can provide not only tools for detection and identification of single DNA and protein molecules but also deeper insight and understanding of stochastic interactions of various biomolecules with their environment.
Method for in vitro recombination
Gibson, Daniel Glenn; Smith, Hamilton O
2013-05-07
The present invention relates to an in vitro method, using isolated protein reagents, for joining two double-stranded (ds) DNA molecules of interest, wherein the distal region of the first DNA molecule and the proximal region of the second DNA molecule share a region of sequence identity. The method allows the joining of a number of DNA fragments, in a predetermined order and orientation, without the use of restriction enzymes. It can be used, e.g., to join synthetically produced sub-fragments of a gene or genome of interest.
Osica, V D; Pyatigorskaya, T L; Polyvtsev, O F; Dembo, A T; Kliya, M O; Vasilchenko, V N; Verkin, B I; Sukharevskya, B Y
1977-04-01
Double-stranded DNA molecules (molecular weight 2.5 X 10(5) - 5 X 10(5) daltons) have been crystallized from water-salt solutions as cetyltrimethylammonium salts (CTA-DNA). Variation of crystallization conditions results in a production of different types of CTA-DNA crystals: spherulits, dendrites, needle-shaped and faceted rhombic crystals, the latter beeing up to 0.3 mm on a side. X-ray diffraction data indicate that DNA molecules in the crystals form a hexagonal lattice which parameters vary slightly with the morphological type of the crystal. Comparison of the melting curves of the DNA preparation before and after crystallization suggests that DNA molecules are partially fractionated in the course of crystallization. Crystals of the CTA-DNA-proflavine complex have also been obtained.
Osica, V D; Pyatigorskaya, T L; Polyvtsev, O F; Dembo, A T; Kliya, M O; Vasilchenko, V N; Verkin, B I; Sukharevskya, B Y
1977-01-01
Double-stranded DNA molecules (molecular weight 2.5 X 10(5) - 5 X 10(5) daltons) have been crystallized from water-salt solutions as cetyltrimethylammonium salts (CTA-DNA). Variation of crystallization conditions results in a production of different types of CTA-DNA crystals: spherulits, dendrites, needle-shaped and faceted rhombic crystals, the latter beeing up to 0.3 mm on a side. X-ray diffraction data indicate that DNA molecules in the crystals form a hexagonal lattice which parameters vary slightly with the morphological type of the crystal. Comparison of the melting curves of the DNA preparation before and after crystallization suggests that DNA molecules are partially fractionated in the course of crystallization. Crystals of the CTA-DNA-proflavine complex have also been obtained. Images PMID:866188
3DNALandscapes: a database for exploring the conformational features of DNA.
Zheng, Guohui; Colasanti, Andrew V; Lu, Xiang-Jun; Olson, Wilma K
2010-01-01
3DNALandscapes, located at: http://3DNAscapes.rutgers.edu, is a new database for exploring the conformational features of DNA. In contrast to most structural databases, which archive the Cartesian coordinates and/or derived parameters and images for individual structures, 3DNALandscapes enables searches of conformational information across multiple structures. The database contains a wide variety of structural parameters and molecular images, computed with the 3DNA software package and known to be useful for characterizing and understanding the sequence-dependent spatial arrangements of the DNA sugar-phosphate backbone, sugar-base side groups, base pairs, base-pair steps, groove structure, etc. The data comprise all DNA-containing structures--both free and bound to proteins, drugs and other ligands--currently available in the Protein Data Bank. The web interface allows the user to link, report, plot and analyze this information from numerous perspectives and thereby gain insight into DNA conformation, deformability and interactions in different sequence and structural contexts. The data accumulated from known, well-resolved DNA structures can serve as useful benchmarks for the analysis and simulation of new structures. The collective data can also help to understand how DNA deforms in response to proteins and other molecules and undergoes conformational rearrangements.
How to read and write mechanical information in DNA molecules
NASA Astrophysics Data System (ADS)
Schiessel, Helmut
In this talk I will show that DNA molecules contain another layer of information on top of the classical genetic information. This different type of information is of mechanical nature and guides the folding of DNA molecules inside cells. With the help of a new Monte Carlo technique, the Mutation Monte Carlo method, we demonstrate that the two layers of information can be multiplexed (as one can have two phone conversations on the same wire). For instance, we can guide on top of genes with single base-pair precision the packaging of DNA into nucleosomes. Finally, we study the mechanical properties of DNA molecules belonging to organisms all across the tree of life. From this we learn that in multicellular organisms the stiffness of DNA around transcription start sites differs dramatically from that of unicellular life. The reason for this difference is surprising.
Inhibition of exportin-1 function results in rapid cell cycle-associated DNA damage in cancer cells
Burke, Russell T.; Marcus, Joshua M.; Orth, James D.
2017-01-01
Selective inhibitors of nuclear export (SINE) are small molecules in development as anti-cancer agents. The first-in-class SINE, selinexor, is in clinical trials for blood and solid cancers. Selinexor forms a covalent bond with exportin-1 at cysteine-528, and blocks its ability to export cargos. Previous work has shown strong cell cycle effects and drug-induced cell death across many different cancer-derived cell lines. Here, we report strong cell cycle-associated DNA double-stranded break formation upon the treatment of cancer cells with SINE. In multiple cell models, selinexor treatment results in the formation of clustered DNA damage foci in 30-40% of cells within 8 hours that is dependent upon cysteine-528. DNA damage strongly correlates with G1/S-phase and decreased DNA replication. Live cell microscopy reveals an association between DNA damage and cell fate. Cells that form damage in G1-phase more often die or arrest, while those damaged in S/G2-phase frequently progress to cell division. Up to half of all treated cells form damage foci, and most cells that die after being damaged, were damaged in G1-phase. By comparison, non-transformed cell lines show strong cell cycle effects but little DNA damage and less death than cancer cells. Significant drug combination effects occur when selinexor is paired with different classes of agents that either cause DNA damage or that diminish DNA damage repair. These data present a novel effect of exportin-1 inhibition and provide a strong rationale for multiple combination treatments of selinexor with agents that are currently in use for the treatment of different solid cancers. PMID:28467801
Franzini, Raphael M; Samain, Florent; Abd Elrahman, Maaly; Mikutis, Gediminas; Nauer, Angela; Zimmermann, Mauro; Scheuermann, Jörg; Hall, Jonathan; Neri, Dario
2014-08-20
DNA-encoded chemical libraries are collections of small molecules, attached to DNA fragments serving as identification barcodes, which can be screened against multiple protein targets, thus facilitating the drug discovery process. The preparation of large DNA-encoded chemical libraries crucially depends on the availability of robust synthetic methods, which enable the efficient conjugation to oligonucleotides of structurally diverse building blocks, sharing a common reactive group. Reactions of DNA derivatives with amines and/or carboxylic acids are particularly attractive for the synthesis of encoded libraries, in view of the very large number of building blocks that are commercially available. However, systematic studies on these reactions in the presence of DNA have not been reported so far. We first investigated conditions for the coupling of primary amines to oligonucleotides, using either a nucleophilic attack on chloroacetamide derivatives or a reductive amination on aldehyde-modified DNA. While both methods could be used for the production of secondary amines, the reductive amination approach was generally associated with higher yields and better purity. In a second endeavor, we optimized conditions for the coupling of a diverse set of 501 carboxylic acids to DNA derivatives, carrying primary and secondary amine functions. The coupling efficiency was generally higher for primary amines, compared to secondary amine substituents, but varied considerably depending on the structure of the acids and on the synthetic methods used. Optimal reaction conditions could be found for certain sets of compounds (with conversions >80%), but multiple reaction schemes are needed when assembling large libraries with highly diverse building blocks. The reactions and experimental conditions presented in this article should facilitate the synthesis of future DNA-encoded chemical libraries, while outlining the synthetic challenges that remain to be overcome.
Spontaneous Transport of Single-Stranded DNA through Graphene-MoS2 Heterostructure Nanopores.
Luan, Binquan; Zhou, Ruhong
2018-04-24
The effective transport of a single-stranded DNA (ssDNA) molecule through a solid-state nanopore is essential to the future success of high-throughput and low-cost DNA sequencing. Compatible with current electric sensing technologies, here, we propose and demonstrate by molecular dynamics simulations the ssDNA transport through a quasi-two-dimensional nanopore in a heterostructure stacked together with different 2D materials, such as graphene and molybdenum disulfide (MoS 2 ). Due to different chemical potentials, U, of DNA bases on different 2D materials, it is energetically favorable for a ssDNA molecule to move from the low- U MoS 2 surface to the high- U graphene surface through a nanopore. With the proper attraction between the negatively charged phosphate group in each nucleotide and the positively charged Mo atoms exposed on the pore surface, the ssDNA molecule can be temporarily seized and released thereafter through a thermal activation, that is, a slow and possible nucleotide-by-nucleotide transport. A theoretical formulation is then developed for the free energy of the ssDNA transiting a heterostructure nanopore to properly characterize the non-equilibrium stick-slip-like motion of a ssDNA molecule.
Heterologous mitochondrial DNA recombination in human cells.
D'Aurelio, Marilena; Gajewski, Carl D; Lin, Michael T; Mauck, William M; Shao, Leon Z; Lenaz, Giorgio; Moraes, Carlos T; Manfredi, Giovanni
2004-12-15
Inter-molecular heterologous mitochondrial DNA (mtDNA) recombination is known to occur in yeast and plants. Nevertheless, its occurrence in human cells is still controversial. To address this issue we have fused two human cytoplasmic hybrid cell lines, each containing a distinct pathogenic mtDNA mutation and specific sets of genetic markers. In this hybrid model, we found direct evidence of recombination between these two mtDNA haplotypes. Recombinant mtDNA molecules in the hybrid cells were identified using three independent experimental approaches. First, recombinant molecules containing genetic markers from both parental alleles were demonstrated with restriction fragment length polymorphism of polymerase chain reaction products, by measuring the relative frequencies of each marker. Second, fragments of recombinant mtDNA were cloned and sequenced to identify the regions involved in the recombination events. Finally, recombinant molecules were demonstrated directly by Southern blot using appropriate combinations of polymorphic restriction sites and probes. This combined approach confirmed the existence of heterogeneous species of recombinant mtDNA molecules in the hybrid cells. These findings have important implications for mtDNA-related diseases, the interpretation of human evolution and population genetics and forensic analyses based on mtDNA genotyping.
Single Molecule Study of Metalloregulatory Protein-DNA Interactions
NASA Astrophysics Data System (ADS)
Sarkar, Susanta; Benitez, Jaime; Huang, Zhengxi; Wang, Qi; Chen, Peng
2007-03-01
Control of metal concentrations is essential for living body. Metalloregulatory proteins respond to metal concentrations by regulating transcriptions of metal resistance genes via protein-DNA interactions. It is thus necessary to understand interactions of metalloregulatory proteins with DNA. Ensemble measurements provide average behavior of a vast number of biomolecules. In contrast, single molecule spectroscopy can track single molecules individually and elucidate dynamics of processes of short time scales and intermediate structures not revealed by ensemble measurements. Here we present single molecule study of interactions between PbrR691, a MerR-family metalloregulatory protein and DNA. We presume that the dynamics of protein/DNA conformational changes and interactions are important for the transcription regulation and kinetics of these dynamic processes can provide useful information about the mechanisms of these metalloregulatory proteins.
Hori, Yuichiro; Otomura, Norimichi; Nishida, Ayuko; Nishiura, Miyako; Umeno, Maho; Suetake, Isao; Kikuchi, Kazuya
2018-02-07
Hybrid probes consisting of synthetic molecules and proteins are powerful tools for detecting biological molecules and signals in living cells. To date, most targets of the hybrid probes have been limited to pH and small analytes. Although biomacromolecules are essential to the physiological function of cells, the hybrid-probe-based approach has been scarcely employed for live-cell detection of biomacromolecules. Here, we developed a hybrid probe with a chemical switch for live-cell imaging of methylated DNA, an important macromolecule in the repression of gene expression. Using a protein labeling technique, we created a hybrid probe containing a DNA-binding fluorogen and a methylated-DNA-binding domain. The hybrid probe enhanced fluorescence intensity upon binding to methylated DNA and successfully monitored methylated DNA during mitosis. The hybrid probe offers notable advantages absent from probes based on small molecules or fluorescent proteins and is useful for live-cell analyses of epigenetic phenomena and diseases related to DNA methylation.
He, Peng; He, Lin
2009-07-13
We report here an approach to grafting DNA-polymer bioconjugates on a planar solid support using reversible addition-fragmentation chain transfer (RAFT) polymerization. In particular, a trithiocarbonate compound as the RAFT chain transfer agent (CTA) is attached to the distal point of a surface-immobilized oligonucleotide. Initiation of RAFT polymerization leads to controlled growth of polymers atop DNA molecules on the surface. Growth kinetics of poly(monomethoxy-capped oligo(ethylene glycol) methacrylate) atop DNA molecules is investigated by monitoring the change of polymer film thickness as a function of reaction time. The reaction conditions, including the polymerization temperature, the initiator concentration, the CTA surface density, and the selection of monomers, are varied to examine their impacts on the grafting efficiency of DNA-polymer conjugates. Comparing to polymer growth atop small molecules, the experimental results suggest that DNA molecules significantly accelerate polymer growth, which is speculated as a result of the presence of highly charged DNA backbones and purine/pyrimidine moieties surrounding the reaction sites.
Influence of DNA Lesions on Polymerase-Mediated DNA Replication at Single-Molecule Resolution.
Gahlon, Hailey L; Romano, Louis J; Rueda, David
2017-11-20
Faithful replication of DNA is a critical aspect in maintaining genome integrity. DNA polymerases are responsible for replicating DNA, and high-fidelity polymerases do this rapidly and at low error rates. Upon exposure to exogenous or endogenous substances, DNA can become damaged and this can alter the speed and fidelity of a DNA polymerase. In this instance, DNA polymerases are confronted with an obstacle that can result in genomic instability during replication, for example, by nucleotide misinsertion or replication fork collapse. It is important to know how DNA polymerases respond to damaged DNA substrates to understand the mechanism of mutagenesis and chemical carcinogenesis. Single-molecule techniques have helped to improve our current understanding of DNA polymerase-mediated DNA replication, as they enable the dissection of mechanistic details that can otherwise be lost in ensemble-averaged experiments. These techniques have also been used to gain a deeper understanding of how single DNA polymerases behave at the site of the damage in a DNA substrate. In this review, we evaluate single-molecule studies that have examined the interaction between DNA polymerases and damaged sites on a DNA template.
Small Molecule Protection of Bone Marrow Hematopoietic Stem Cells
2015-10-01
several recently identified small molecules can protect hematopoietic stem cells (HSCs) from damage or killing by endogenous aldehydes . Proof-of-concept...anemia bone marrow failure CD34+ hematopoietic stem cells aldehydes formaldehyde DNA damage DNA base adduct DNA-protein crosslink mass...below. Revised Specific Aim 1: Small molecule protection of human cells from aldehyde - induced killing (in vitro studies - no mice or human subjects
NASA Astrophysics Data System (ADS)
Alshehri, Mansoor H.; Cox, Barry J.; Hill, James M.
2014-09-01
Fullerenes have attracted considerable attention in various areas of science and technology. Owing to their exceptional physical, chemical, and biological properties, they have many applications, particularly in cosmetic and medical products. Using the Lennard-Jones 6-12 potential function and the continuum approximation, which assumes that intermolecular interactions can be approximated by average atomic surface densities, we determine the binding energies of a C60 fullerene with respect to both single-strand and double-strand DNA molecules. We assume that all configurations are in a vacuum and that the C60 fullerene is initially at rest. Double integrals are performed to determine the interaction energy of the system. We find that the C60 fullerene binds to the double-strand DNA molecule, at either the major or minor grooves, with binding energies of -4.7 eV or -2.3 eV, respectively, and that the C60 molecule binds to the single-strand DNA molecule with a binding energy of -1.6 eV. Our results suggest that the C60 molecule is most likely to be linked to the major groove of the dsDNA molecule.
Balcioglu, Mustafa; Rana, Muhit; Robertson, Neil; Yigit, Mehmet V
2014-08-13
We controlled the fluorescence emission of a fluorescently labeled iron oxide nanoparticle using three different nanomaterials with ultraefficient quenching capabilities. The control over the fluorescence emission was investigated via spacing introduced by the surface-functionalized single-stranded DNA molecules. DNA molecules were conjugated on different templates, either on the surface of the fluorescently labeled iron oxide nanoparticles or gold and nanographene oxide. The efficiency of the quenching was determined and compared with various fluorescently labeled iron oxide nanoparticle and nanoquencher combinations using DNA molecules with three different lengths. We have found that the template for DNA conjugation plays significant role on quenching the fluorescence emission of the fluorescently labeled iron oxide nanoparticles. We have observed that the size of the DNA controls the quenching efficiency when conjugated only on the fluorescently labeled iron oxide nanoparticles by setting a spacer between the surfaces and resulting change in the hydrodynamic size. The quenching efficiency with 12mer, 23mer and 36mer oligonucleotides decreased to 56%, 54% and 53% with gold nanoparticles, 58%, 38% and 32% with nanographene oxide, 46%, 38% and 35% with MoS2, respectively. On the other hand, the presence, not the size, of the DNA molecules on the other surfaces quenched the fluorescence significantly with different degrees. To understand the effect of the mobility of the DNA molecules on the nanoparticle surface, DNA molecules were attached to the surface with two different approaches. Covalently immobilized oligonucleotides decreased the quenching efficiency of nanographene oxide and gold nanoparticles to ∼22% and ∼21%, respectively, whereas noncovalently adsorbed oligonucleotides decreased it to ∼25% and ∼55%, respectively. As a result, we have found that each nanoquencher has a powerful quenching capability against a fluorescent nanoparticle, which can be tuned with surface functionalized DNA molecules.
O'Dowd, Hardwin; Shannon, Dean E; Chandupatla, Kishan R; Dixit, Vaishali; Engtrakul, Juntyma J; Ye, Zhengqi; Jones, Steven M; O'Brien, Colleen F; Nicolau, David P; Tessier, Pamela R; Crandon, Jared L; Song, Bin; Macikenas, Dainius; Hanzelka, Brian L; Le Tiran, Arnaud; Bennani, Youssef L; Charifson, Paul S; Grillot, Anne-Laure
2015-07-09
Benzimidazole 1 is the lead compound resulting from an antibacterial program targeting dual inhibitors of bacterial DNA gyrase and topoisomerase IV. With the goal of improving key drug-like properties, namely, the solubility and the formulability of 1, an effort to identify prodrugs was undertaken. This has led to the discovery of a phosphate ester prodrug 2. This prodrug is rapidly cleaved to the parent drug molecule upon both oral and intravenous administration. The prodrug achieved equivalent exposure of 1 compared to dosing the parent in multiple species. The prodrug 2 has improved aqueous solubility, simplifying both intravenous and oral formulation.
NASA Astrophysics Data System (ADS)
Kikuchi, Hayato; Nose, Keiji; Yoshikawa, Yuko; Yoshikawa, Kenichi
2018-06-01
It is becoming increasingly apparent that changes in the higher-order structure of genome-sized DNA molecules of more than several tens kbp play important roles in the self-control of genome activity in living cells. Unfortunately, it has been rather difficult to prepare genome-sized DNA molecules without damage or fragmentation. Here, we evaluated the degree of double-strand breaks (DSBs) caused by mechanical mixing by single-molecule observation with fluorescence microscopy. The results show that DNA breaks are most significant for the first second after the initiation of mechanical agitation. Based on such observation, we propose a novel mixing procedure to significantly decrease DSBs.
[Synthesis of Circular DNA Templates with T4 RNA Ligase for Rolling Circle Amplification].
Sakhabutdinova, A R; Maksimova, M A; Garafutdinov, R R
2017-01-01
Currently, isothermal methods of nucleic acid amplification have been well established; in particular, rolling circle amplification is of great interest. In this approach, circular ssDNA molecules have been used as a target that can be obtained by the intramolecular template-dependent ligation of an oligonucleotide C-probe. Here, a new method of synthesizing small circular DNA molecules via the cyclization of ssDNA based on T4 RNA ligase has been proposed. Circular ssDNA is further used as the template for the rolling circle amplification. The maximum yield of the cyclization products was observed in the presence of 5-10% polyethylene glycol 4000, and the optimum DNA length for the cyclization constituted 50 nucleotides. This highly sensitive method was shown to detect less than 10^(2) circular DNA molecules. The method reliability was proved based on artificially destroyed dsDNA, which suggests its implementation for analyzing any significantly fragmented dsDNA.
Microarray Detection of Duplex and Triplex DNA Binders with DNA-Modified Gold Nanoparticles
Lytton-Jean, Abigail K. R.; Han, Min Su; Mirkin, Chad A.
2008-01-01
We have designed a chip-based assay, using microarray technology, for determining the relative binding affinities of duplex and triplex DNA binders. This assay combines the high discrimination capabilities afforded by DNA-modified Au nanoparticles with the high-throughput capabilities of DNA microarrays. The detection and screening of duplex DNA binders are important because these molecules, in many cases, are potential anticancer agents as well as toxins. Triplex DNA binders are also promising drug candidates. These molecules, in conjunction with triplex forming oligonucleotides, could potentially be used to achieve control of gene expression by interfering with transcription factors that bind to DNA. Therefore, the ability to screen for these molecules in a high-throughput fashion could dramatically improve the drug screening process. The assay reported here provides excellent discrimination between strong, intermediate, and weak duplex and triplex DNA binders in a high-throughput fashion. PMID:17614366
Single helically folded aromatic oligoamides that mimic the charge surface of double-stranded B-DNA
NASA Astrophysics Data System (ADS)
Ziach, Krzysztof; Chollet, Céline; Parissi, Vincent; Prabhakaran, Panchami; Marchivie, Mathieu; Corvaglia, Valentina; Bose, Partha Pratim; Laxmi-Reddy, Katta; Godde, Frédéric; Schmitter, Jean-Marie; Chaignepain, Stéphane; Pourquier, Philippe; Huc, Ivan
2018-05-01
Numerous essential biomolecular processes require the recognition of DNA surface features by proteins. Molecules mimicking these features could potentially act as decoys and interfere with pharmacologically or therapeutically relevant protein-DNA interactions. Although naturally occurring DNA-mimicking proteins have been described, synthetic tunable molecules that mimic the charge surface of double-stranded DNA are not known. Here, we report the design, synthesis and structural characterization of aromatic oligoamides that fold into single helical conformations and display a double helical array of negatively charged residues in positions that match the phosphate moieties in B-DNA. These molecules were able to inhibit several enzymes possessing non-sequence-selective DNA-binding properties, including topoisomerase 1 and HIV-1 integrase, presumably through specific foldamer-protein interactions, whereas sequence-selective enzymes were not inhibited. Such modular and synthetically accessible DNA mimics provide a versatile platform to design novel inhibitors of protein-DNA interactions.
Seeman, Nadrian C.
2012-01-01
The combination of synthetic stable branched DNA and sticky ended cohesion has led to the development of structural DNA nanotechnology over the past 30 years. The basis of this enterprise is that it is possible to construct novel DNA-based materials by combining these features in a self-assembly protocol. Thus, simple branched molecules lead directly to the construction of polyhedra whose edges consist of double helical DNA, and whose vertices correspond to the branch points. Stiffer branched motifs can be used to produce self-assembled two-dimensional and three-dimensional periodic lattices of DNA (crystals). DNA has also been used to make a variety of nanomechanical devices, including molecules that change their shapes, and molecules that can walk along a DNA sidewalk. Devices have been incorporated into two-dimensional DNA arrangements; sequence-dependent devices are driven by increases in nucleotide pairing at each step in their machine cycles. PMID:20222824
Mechanisms of small molecule–DNA interactions probed by single-molecule force spectroscopy
Almaqwashi, Ali A.; Paramanathan, Thayaparan; Rouzina, Ioulia; Williams, Mark C.
2016-01-01
There is a wide range of applications for non-covalent DNA binding ligands, and optimization of such interactions requires detailed understanding of the binding mechanisms. One important class of these ligands is that of intercalators, which bind DNA by inserting aromatic moieties between adjacent DNA base pairs. Characterizing the dynamic and equilibrium aspects of DNA-intercalator complex assembly may allow optimization of DNA binding for specific functions. Single-molecule force spectroscopy studies have recently revealed new details about the molecular mechanisms governing DNA intercalation. These studies can provide the binding kinetics and affinity as well as determining the magnitude of the double helix structural deformations during the dynamic assembly of DNA–ligand complexes. These results may in turn guide the rational design of intercalators synthesized for DNA-targeted drugs, optical probes, or integrated biological self-assembly processes. Herein, we survey the progress in experimental methods as well as the corresponding analysis framework for understanding single molecule DNA binding mechanisms. We discuss briefly minor and major groove binding ligands, and then focus on intercalators, which have been probed extensively with these methods. Conventional mono-intercalators and bis-intercalators are discussed, followed by unconventional DNA intercalation. We then consider the prospects for using these methods in optimizing conventional and unconventional DNA-intercalating small molecules. PMID:27085806
NASA Technical Reports Server (NTRS)
Joyce, Gerald F. (Inventor); Breaker, Ronald R. (Inventor)
1998-01-01
The present invention discloses deoxyribonucleic acid enzymes--catalytic or enzymatic DNA molecules--capable of cleaving nucleic acid sequences or molecules, particularly RNA, in a site-specific manner, as well as compositions including same. Methods of making and using the disclosed enzymes and compositions are also disclosed.
End labeling procedures: an overview.
Hilario, Elena
2004-09-01
There are two ways to label a DNA molecular; by the ends or all along the molecule. End labeling can be performed at the 3'- or 5'-end. Labeling at the 3' end is performed by filling 3'-end recessed ends with a mixture or labeled and unlabeled dNTPs using Klenow or T4 DNA polymerases. Both reactions are template dependent. Terminal deoxynucleotide transferase incorporates dNTPs at the 3' end of any kind of DNA molecule or RNA. Labels incorporated at the 3'-end of the DNA molecule prevent any further extension or ligation to any other molecule, but this can be overcome by labeling the 5'-end of the desired DNA molecule. 5'-end labeling is performed by enzymatic methods (T4 polynucleotide kinase exchange and forward reactions), by chemical modification of sensitized oligonucleotides with phosphoroamidite, or by combined methods. Probe cleanup is recommended when high background problems occur, but caution should be taken not to damage the attached probe with harsh chemicals or by light exposure.
Charlot, B.; Bardin, F.; Sanchez, N.; Roux, P.; Teixeira, S.; Schwob, E.
2014-01-01
Ordered deposition of elongated DNA molecules was achieved by the forced dewetting of a DNA solution droplet over a microstructured substrate. This technique allows trapping, uncoiling, and deposition of DNA fragments without the need of a physicochemical anchoring of the molecule and results in the combing of double stranded DNA from the edge of microwells on a polydimethylsiloxane (PDMS) substrate. The technique involves scanning a droplet of DNA solution caught between a movable blade and a PDMS substrate containing an array of microwells. The deposition and elongation appears when the receding meniscus dewets microwells, the latter acting here as a perturbation in the dewetting line forcing the water film to break locally. Thus, DNA molecules can be deposited in an ordered manner and elongated conformation based solely on a physical phenomenon, allowing uncoiled DNA molecules to be observed in all their length. However, the exact mechanism that governs the deposition of DNA strands is not well understood. This paper is an analysis of the physical phenomenon occurring in the deposition process and is based on observations made with the use of high frame/second rate video microscopy. PMID:24753724
Banerjee, T; Banerjee, S; Sett, S; Ghosh, S; Rakshit, T; Mukhopadhyay, R
2016-01-01
DNA threading intercalators are a unique class of intercalating agents, albeit little biophysical information is available on their intercalative actions. Herein, the intercalative effects of nogalamycin, which is a naturally-occurring DNA threading intercalator, have been investigated by high-resolution atomic force microscopy (AFM) and spectroscopy (AFS). The results have been compared with those of the well-known chemotherapeutic drug daunomycin, which is a non-threading classical intercalator bearing structural similarity to nogalamycin. A comparative AFM assessment revealed a greater increase in DNA contour length over the entire incubation period of 48 h for nogalamycin treatment, whereas the contour length increase manifested faster in case of daunomycin. The elastic response of single DNA molecules to an externally applied force was investigated by the single molecule AFS approach. Characteristic mechanical fingerprints in the overstretching behaviour clearly distinguished the nogalamycin/daunomycin-treated dsDNA from untreated dsDNA-the former appearing less elastic than the latter, and the nogalamycin-treated DNA distinguished from the daunomycin-treated DNA-the classically intercalated dsDNA appearing the least elastic. A single molecule AFS-based discrimination of threading intercalation from the classical type is being reported for the first time.
3D DNA Crystals and Nanotechnology
DOE Office of Scientific and Technical Information (OSTI.GOV)
Paukstelis, Paul; Seeman, Nadrian
DNA's molecular recognition properties have made it one of the most widely used biomacromolecular construction materials. The programmed assembly of DNA oligonucleotides has been used to create complex 2D and 3D self-assembled architectures and to guide the assembly of other molecules. The origins of DNA nanotechnology are rooted in the goal of assembling DNA molecules into designed periodic arrays, i.e., crystals. Here, we highlight several DNA crystal structures, the progress made in designing DNA crystals, and look at the current prospects and future directions of DNA crystals in nanotechnology.
3D DNA Crystals and Nanotechnology
Paukstelis, Paul; Seeman, Nadrian
2016-08-18
DNA's molecular recognition properties have made it one of the most widely used biomacromolecular construction materials. The programmed assembly of DNA oligonucleotides has been used to create complex 2D and 3D self-assembled architectures and to guide the assembly of other molecules. The origins of DNA nanotechnology are rooted in the goal of assembling DNA molecules into designed periodic arrays, i.e., crystals. Here, we highlight several DNA crystal structures, the progress made in designing DNA crystals, and look at the current prospects and future directions of DNA crystals in nanotechnology.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maaloum, M.; Muller, P.; Beker, A-F.
Almost two decades ago, measurements of force versus extension on isolated double-stranded DNA molecules revealed a force plateau. This unusual stretching phenomenon in DNA suggests that the long molecules may be extended from the usual B form into a new conformation. Different models have been proposed to describe the nature of DNA in its stretched form, S-DNA. Using atomic force microscopy combined with a molecular combing method, we identified the structure of {lambda}-phage DNA for different stretching values. We provide strong evidence for the existence of a first-order transition between B form and S form. Beyond a certain extension ofmore » the natural length, DNA molecules adopt a new double-helix conformation characterized by a diameter of 1.2 nm and a helical pitch of18 nm.« less
Thermoelectric effect and its dependence on molecular length and sequence in single DNA molecules.
Li, Yueqi; Xiang, Limin; Palma, Julio L; Asai, Yoshihiro; Tao, Nongjian
2016-04-15
Studying the thermoelectric effect in DNA is important for unravelling charge transport mechanisms and for developing relevant applications of DNA molecules. Here we report a study of the thermoelectric effect in single DNA molecules. By varying the molecular length and sequence, we tune the charge transport in DNA to either a hopping- or tunnelling-dominated regimes. The thermoelectric effect is small and insensitive to the molecular length in the hopping regime. In contrast, the thermoelectric effect is large and sensitive to the length in the tunnelling regime. These findings indicate that one may control the thermoelectric effect in DNA by varying its sequence and length. We describe the experimental results in terms of hopping and tunnelling charge transport models.
Thermoelectric effect and its dependence on molecular length and sequence in single DNA molecules
Li, Yueqi; Xiang, Limin; Palma, Julio L.; Asai, Yoshihiro; Tao, Nongjian
2016-01-01
Studying the thermoelectric effect in DNA is important for unravelling charge transport mechanisms and for developing relevant applications of DNA molecules. Here we report a study of the thermoelectric effect in single DNA molecules. By varying the molecular length and sequence, we tune the charge transport in DNA to either a hopping- or tunnelling-dominated regimes. The thermoelectric effect is small and insensitive to the molecular length in the hopping regime. In contrast, the thermoelectric effect is large and sensitive to the length in the tunnelling regime. These findings indicate that one may control the thermoelectric effect in DNA by varying its sequence and length. We describe the experimental results in terms of hopping and tunnelling charge transport models. PMID:27079152
Simons, Michelle; Szczelkun, Mark D.
2011-01-01
The Type I restriction-modification enzymes comprise three protein subunits; HsdS and HsdM that form a methyltransferase (MTase) and HsdR that associates with the MTase and catalyses Adenosine-5′-triphosphate (ATP)-dependent DNA translocation and cleavage. Here, we examine whether the MTase and HsdR components can ‘turnover’ in vitro, i.e. whether they can catalyse translocation and cleavage events on one DNA molecule, dissociate and then re-bind a second DNA molecule. Translocation termination by both EcoKI and EcoR124I leads to HsdR dissociation from linear DNA but not from circular DNA. Following DNA cleavage, the HsdR subunits appear unable to dissociate even though the DNA is linear, suggesting a tight interaction with the cleaved product. The MTases of EcoKI and EcoAI can dissociate from DNA following either translocation or cleavage and can initiate reactions on new DNA molecules as long as free HsdR molecules are available. In contrast, the MTase of EcoR124I does not turnover and additional cleavage of circular DNA is not observed by inclusion of RecBCD, a helicase–nuclease that degrades the linear DNA product resulting from Type I cleavage. Roles for Type I restriction endonuclease subunit dynamics in restriction alleviation in the cell are discussed. PMID:21712244
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xiong, Xiu-Fang; Li, Hui; Cao, En-Hua
PIG11 (p53-induced protein 11), one of early transcriptional targets of tumor suppressor p53, was up-regulated in the induction of apoptosis or cell growth inhibition by multiple chemopreventive agents. However, its biological role remains unclear. Here, we expressed His{sub 6}-tagged PIG11 protein in Escherichia coli and demonstrated the recombinant His{sub 6}-tagged PIG11 protein could bind to supercoiled and relaxed closed circular plasmid DNA or linear DNA with different length using gel retardation assays in vitro. The interaction between DNA and PIG11 protein was sequence-independent and related to charge effect. The reducing thiol group in PIG11 protein was involved in the bindingmore » activity of PIG11 to DNA. Furthermore, the images of atomic force microscopy directly confirmed the binding of DNA and PIG11 protein and showed the PIG11-DNA complex formed a beads-on-a-string appearance in which PIG11 protein associated with DNA as polymer. These findings suggest that PIG11 protein may play an important role by interaction with other biological molecules in the regulation of apoptosis and provided us a novel angel of view to explore the possible function of PIG11 in vivo.« less
Kai, Takeshi; Higuchi, Mariko; Fujii, Kentaro; Watanabe, Ritsuko; Yokoya, Akinari
2012-12-01
To develop a method for simulating the dynamics of the photoelectrons and Auger electrons ejected from DNA molecules irradiated with pulsed monochromatic X-rays. A 30-base-pair (bp) DNA molecule was used as the target model, and the X-rays were assumed to have a Gaussian-shaped time distribution. Photoionization and Auger decay were considered as the atomic processes. The atoms from which the photoelectrons or Auger electrons were emitted were specified in the DNA molecule (or DNA ion) using the Monte Carlo method, and the trajectory of each electron in the electric field formed around the positively charged DNA molecule was calculated with a Newtonian equation. The kinetics of the electrons produced by irradiation with X-rays at an intensity ranging from 1 × 10(12) to 1 × 10(16) photons/mm(2) and energies of 380 eV (below the carbon K-edge), 435 eV (above the nitrogen K-edge), and 560 eV (above the oxygen K-edge) were evaluated. It was found that at an X-ray intensity of 1 × 10(14) photons/mm(2) or less, all the produced electrons escaped from the target. However, above an X-ray intensity of 1 × 10(15) photons/mm(2) and an energy of 560 eV, some photoelectrons that were ejected from the oxygen atoms were trapped near the target DNA. A simulation method for studying the trajectories of electrons ejected from a 30-bp DNA molecule irradiated with pulsed monochromatic X-rays has been developed. The present results show that electron dynamics are strongly dependent on the charged density induced in DNA by pulsed X-ray irradiation.
Biophysics of protein-DNA interactions and chromosome organization
Marko, John F.
2014-01-01
The function of DNA in cells depends on its interactions with protein molecules, which recognize and act on base sequence patterns along the double helix. These notes aim to introduce basic polymer physics of DNA molecules, biophysics of protein-DNA interactions and their study in single-DNA experiments, and some aspects of large-scale chromosome structure. Mechanisms for control of chromosome topology will also be discussed. PMID:25419039
Supercoiled circular DNA of an insect granulosis virus
Tweeten, Kathleen A.; Bulla, Lee A.; Consigli, Richard A.
1977-01-01
The DNA of the granulosis virus of the Indian meal moth, Plodia interpunctella, was characterized by physical chemical and electron microscopic techniques. Twenty-five percent of the DNA extracted from purified virus was isolated as supercoiled circular molecules. The remaining 75% consisted of relaxed circular molecules. These molecular forms were indicated by the production of two radioactive bands during sedimentation of 3H-labeled granulosis virus DNA in alkaline sucrose gradients or in equilibrium density gradients of neutral cesium chloride/propidium iodide. Electron microscopic visualization of the DNA that banded at the higher density in the latter gradients revealed supercoiled structures whereas that of DNA that banded at the lower density demonstrated relaxed circular molecules. The superhelical molecules were converted to relaxed circles by treatment with pancreatic DNase. The molecular weight of the viral DNA was calculated to be 81 × 106 by sedimentation in neutral sucrose and 78 × 106 by sedimentation in alkaline sucrose. The molecular weight estimated from length measurements in electron micrographs was 76 × 106. The buoyant density of the granulosis virus DNA was 1.703 g/cm3 and that of its insect host DNA was 1.697 g/cm3. Equilibrium sedimentation in cesium chloride and thermal denaturation indicated G + C contents of 44% and 39% for the viral and host DNA, respectively. Images PMID:198791
Supercoiled circular DNA of an insect granulosis virus.
Tweeten, K A; Bulla, L A; Consigli, R A
1977-08-01
The DNA of the granulosis virus of the Indian meal moth, Plodia interpunctella, was characterized by physical chemical and electron microscopic techniques. Twenty-five percent of the DNA extracted from purified virus was isolated as supercoiled circular molecules. The remaining 75% consisted of relaxed circular molecules. These molecular forms were indicated by the production of two radioactive bands during sedimentation of (3)H-labeled granulosis virus DNA in alkaline sucrose gradients or in equilibrium density gradients of neutral cesium chloride/propidium iodide. Electron microscopic visualization of the DNA that banded at the higher density in the latter gradients revealed supercoiled structures whereas that of DNA that banded at the lower density demonstrated relaxed circular molecules. The superhelical molecules were converted to relaxed circles by treatment with pancreatic DNase. The molecular weight of the viral DNA was calculated to be 81 x 10(6) by sedimentation in neutral sucrose and 78 x 10(6) by sedimentation in alkaline sucrose. The molecular weight estimated from length measurements in electron micrographs was 76 x 10(6). The buoyant density of the granulosis virus DNA was 1.703 g/cm(3) and that of its insect host DNA was 1.697 g/cm(3). Equilibrium sedimentation in cesium chloride and thermal denaturation indicated G + C contents of 44% and 39% for the viral and host DNA, respectively.
Shao, Zhiyong; Graf, Shannon; Chaga, Oleg Y; Lavrov, Dennis V
2006-10-15
The 16,937-nuceotide sequence of the linear mitochondrial DNA (mt-DNA) molecule of the moon jelly Aurelia aurita (Cnidaria, Scyphozoa) - the first mtDNA sequence from the class Scypozoa and the first sequence of a linear mtDNA from Metazoa - has been determined. This sequence contains genes for 13 energy pathway proteins, small and large subunit rRNAs, and methionine and tryptophan tRNAs. In addition, two open reading frames of 324 and 969 base pairs in length have been found. The deduced amino-acid sequence of one of them, ORF969, displays extensive sequence similarity with the polymerase [but not the exonuclease] domain of family B DNA polymerases, and this ORF has been tentatively identified as dnab. This is the first report of dnab in animal mtDNA. The genes in A. aurita mtDNA are arranged in two clusters with opposite transcriptional polarities; transcription proceeding toward the ends of the molecule. The determined sequences at the ends of the molecule are nearly identical but inverted and lack any obvious potential secondary structures or telomere-like repeat elements. The acquisition of mitochondrial genomic data for the second class of Cnidaria allows us to reconstruct characteristic features of mitochondrial evolution in this animal phylum.
Borovok, Natalia; Iram, Natalie; Zikich, Dragoslav; Ghabboun, Jamal; Livshits, Gideon I; Porath, Danny; Kotlyar, Alexander B
2008-09-01
We describe a method for the preparation of novel long (hundreds of nanometers), uniform, inter-molecular G4-DNA molecules composed of four parallel G-strands. The only long continuous G4-DNA reported so far are intra-molecular structures made of a single G-strand. To enable a tetra-molecular assembly of the G-strands we developed a novel approach based on avidin-biotin biological recognition. The steps of the G4-DNA production include: (i) Enzymatic synthesis of long poly(dG)-poly(dC) molecules with biotinylated poly(dG)-strand; (ii) Formation of a complex between avidin-tetramer and four biotinylated poly(dG)-poly(dC) molecules; (iii) Separation of the poly(dC) strands from the poly(dG)-strands, which are connected to the avidin; (iv) Assembly of the four G-strands attached to the avidin into tetra-molecular G4-DNA. The average contour length of the formed structures, as measured by AFM, is equal to that of the initial poly(dG)-poly(dC) molecules, suggesting a tetra-molecular mechanism of the G-strands assembly. The height of tetra-molecular G4-nanostructures is larger than that of mono-molecular G4-DNA molecules having similar contour length. The CD spectra of the tetra- and mono-molecular G4-DNA are markedly different, suggesting different structural organization of these two types of molecules. The tetra-molecular G4-DNA nanostructures showed clear electrical polarizability. This suggests that they may be useful for molecular electronics.
Fluorescence In situ Hybridization: Cell-Based Genetic Diagnostic and Research Applications.
Cui, Chenghua; Shu, Wei; Li, Peining
2016-01-01
Fluorescence in situ hybridization (FISH) is a macromolecule recognition technology based on the complementary nature of DNA or DNA/RNA double strands. Selected DNA strands incorporated with fluorophore-coupled nucleotides can be used as probes to hybridize onto the complementary sequences in tested cells and tissues and then visualized through a fluorescence microscope or an imaging system. This technology was initially developed as a physical mapping tool to delineate genes within chromosomes. Its high analytical resolution to a single gene level and high sensitivity and specificity enabled an immediate application for genetic diagnosis of constitutional common aneuploidies, microdeletion/microduplication syndromes, and subtelomeric rearrangements. FISH tests using panels of gene-specific probes for somatic recurrent losses, gains, and translocations have been routinely applied for hematologic and solid tumors and are one of the fastest-growing areas in cancer diagnosis. FISH has also been used to detect infectious microbias and parasites like malaria in human blood cells. Recent advances in FISH technology involve various methods for improving probe labeling efficiency and the use of super resolution imaging systems for direct visualization of intra-nuclear chromosomal organization and profiling of RNA transcription in single cells. Cas9-mediated FISH (CASFISH) allowed in situ labeling of repetitive sequences and single-copy sequences without the disruption of nuclear genomic organization in fixed or living cells. Using oligopaint-FISH and super-resolution imaging enabled in situ visualization of chromosome haplotypes from differentially specified single-nucleotide polymorphism loci. Single molecule RNA FISH (smRNA-FISH) using combinatorial labeling or sequential barcoding by multiple round of hybridization were applied to measure mRNA expression of multiple genes within single cells. Research applications of these single molecule single cells DNA and RNA FISH techniques have visualized intra-nuclear genomic structure and sub-cellular transcriptional dynamics of many genes and revealed their functions in various biological processes.
DNA nanotechnology-enabled biosensors.
Chao, Jie; Zhu, Dan; Zhang, Yinan; Wang, Lianhui; Fan, Chunhai
2016-02-15
Biosensors employ biological molecules to recognize the target and utilize output elements which can translate the biorecognition event into electrical, optical or mass-sensitive signals to determine the quantities of the target. DNA-based biosensors, as a sub-field to biosensor, utilize DNA strands with short oligonucleotides as probes for target recognition. Although DNA-based biosensors have offered a promising alternative for fast, simple and cheap detection of target molecules, there still exist key challenges including poor stability and reproducibility that hinder their competition with the current gold standard for DNA assays. By exploiting the self-recognition properties of DNA molecules, researchers have dedicated to make versatile DNA nanostructures in a highly rigid, controllable and functionalized manner, which offers unprecedented opportunities for developing DNA-based biosensors. In this review, we will briefly introduce the recent advances on design and fabrication of static and dynamic DNA nanostructures, and summarize their applications for fabrication and functionalization of DNA-based biosensors. Copyright © 2015 Elsevier B.V. All rights reserved.
Maruyama, Rika; Echigoya, Yusuke; Caluseriu, Oana; Aoki, Yoshitsugu; Takeda, Shin'ichi; Yokota, Toshifumi
2017-01-01
Exon-skipping therapy is an emerging approach that uses synthetic DNA-like molecules called antisense oligonucleotides (AONs) to splice out frame-disrupting parts of mRNA, restore the reading frame, and produce truncated yet functional proteins. Multiple exon skipping utilizing a cocktail of AONs can theoretically treat 80-90% of patients with Duchenne muscular dystrophy (DMD). The success of multiple exon skipping by the systemic delivery of a cocktail of AONs called phosphorodiamidate morpholino oligomers (PMOs) in a DMD dog model has made a significant impact on the development of therapeutics for DMD, leading to clinical trials of PMO-based drugs. Here, we describe the systemic delivery of a cocktail of PMOs to skip multiple exons in dystrophic dogs and the evaluation of the efficacies and toxicity in vivo.
Ji, Yuhang; Zhang, Lei; Zhu, Longyi; Lei, Jianping; Wu, Jie; Ju, Huangxian
2017-10-15
A binding-induced DNA walker-assisted signal amplification was developed for highly selective electrochemical detection of protein. Firstly, the track of DNA walker was constructed by self-assembly of the high density ferrocene (Fc)-labeled anchor DNA and aptamer 1 on the gold electrode surface. Sequentially, a long swing-arm chain containing aptamer 2 and walking strand DNA was introduced onto gold electrode through aptamers-target specific recognition, and thus initiated walker strand sequences to hybridize with anchor DNA. Then, the DNA walker was activated by the stepwise cleavage of the hybridized anchor DNA by nicking endonuclease to release multiple Fc molecules for signal amplification. Taking thrombin as the model target, the Fc-generated electrochemical signal decreased linearly with logarithm value of thrombin concentration ranging from 10pM to 100nM with a detection limit of 2.5pM under the optimal conditions. By integrating the specific recognition of aptamers to target with the enzymatic cleavage of nicking endonuclease, the aptasensor showed the high selectivity. The binding-induced DNA walker provides a promising strategy for signal amplification in electrochemical biosensor, and has the extensive applications in sensitive and selective detection of the various targets. Copyright © 2017 Elsevier B.V. All rights reserved.
Logical NAND and NOR Operations Using Algorithmic Self-assembly of DNA Molecules
NASA Astrophysics Data System (ADS)
Wang, Yanfeng; Cui, Guangzhao; Zhang, Xuncai; Zheng, Yan
DNA self-assembly is the most advanced and versatile system that has been experimentally demonstrated for programmable construction of patterned systems on the molecular scale. It has been demonstrated that the simple binary arithmetic and logical operations can be computed by the process of self assembly of DNA tiles. Here we report a one-dimensional algorithmic self-assembly of DNA triple-crossover molecules that can be used to execute five steps of a logical NAND and NOR operations on a string of binary bits. To achieve this, abstract tiles were translated into DNA tiles based on triple-crossover motifs. Serving as input for the computation, long single stranded DNA molecules were used to nucleate growth of tiles into algorithmic crystals. Our method shows that engineered DNA self-assembly can be treated as a bottom-up design techniques, and can be capable of designing DNA computer organization and architecture.
DNA Motion Capture Reveals the Mechanical Properties of DNA at the Mesoscale
Price, Allen C.; Pilkiewicz, Kevin R.; Graham, Thomas G.W.; Song, Dan; Eaves, Joel D.; Loparo, Joseph J.
2015-01-01
Single-molecule studies probing the end-to-end extension of long DNAs have established that the mechanical properties of DNA are well described by a wormlike chain force law, a polymer model where persistence length is the only adjustable parameter. We present a DNA motion-capture technique in which DNA molecules are labeled with fluorescent quantum dots at specific sites along the DNA contour and their positions are imaged. Tracking these positions in time allows us to characterize how segments within a long DNA are extended by flow and how fluctuations within the molecule are correlated. Utilizing a linear response theory of small fluctuations, we extract elastic forces for the different, ∼2-μm-long segments along the DNA backbone. We find that the average force-extension behavior of the segments can be well described by a wormlike chain force law with an anomalously small persistence length. PMID:25992731
Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark
2003-01-01
Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251
Structure and Environment Influence in DNA Conduction
NASA Technical Reports Server (NTRS)
Adessi, C.; Walch, S.; Anantram, M. P.; Biegel, Bryan A. (Technical Monitor)
2002-01-01
Results for transmission through a poly(G) DNA molecule are presented. We show that a modification of the rise of a B-DNA form can induce a shift of the conduction channel toward the valence one. We clearly prove that deformation of the backbone of the molecule has a significant influence on hole transport. Finally, we observe that the presence of ionic species, such Na, near the molecule can create new conduction channels.
Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt V; Ferapontova, Elena E
2010-06-01
A DNA molecular beacon approach was used for the analysis of interactions between DNA and Methylene Blue (MB) as a redox indicator of a hybridization event. DNA hairpin structures of different length and guanine (G) content were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 5'-end. Binding of MB to the folded hairpin DNA was electrochemically studied and compared with binding to the duplex structure formed by hybridization of the hairpin DNA to a complementary DNA strand. Variation of the electrochemical signal from the DNA-MB complex was shown to depend primarily on the DNA length and sequence used: the G-C base pairs were the preferential sites of MB binding in the duplex. For short 20 nts long DNA sequences, the increased electrochemical response from MB bound to the duplex structure was consistent with the increased amount of bound and electrochemically readable MB molecules (i.e. MB molecules that are available for the electron transfer (ET) reaction with the electrode). With longer DNA sequences, the balance between the amounts of the electrochemically readable MB molecules bound to the hairpin DNA and to the hybrid was opposite: a part of the MB molecules bound to the long-sequence DNA duplex seem to be electrochemically mute due to long ET distance. The increasing electrochemical response from MB bound to the short-length DNA hybrid contrasts with the decreasing signal from MB bound to the long-length DNA hybrid and allows an "off"-"on" genosensor development.
10 CFR 602.10 - Additional requirements.
Code of Federal Regulations, 2010 CFR
2010-01-01
... conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...
10 CFR 605.11 - Additional requirements.
Code of Federal Regulations, 2010 CFR
2010-01-01
... Conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...
10 CFR 605.11 - Additional requirements.
Code of Federal Regulations, 2011 CFR
2011-01-01
... Conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...
10 CFR 602.10 - Additional requirements.
Code of Federal Regulations, 2011 CFR
2011-01-01
... conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...
10 CFR 602.10 - Additional requirements.
Code of Federal Regulations, 2013 CFR
2013-01-01
... conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...
10 CFR 602.10 - Additional requirements.
Code of Federal Regulations, 2012 CFR
2012-01-01
... conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...
10 CFR 605.11 - Additional requirements.
Code of Federal Regulations, 2012 CFR
2012-01-01
... Conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...
10 CFR 602.10 - Additional requirements.
Code of Federal Regulations, 2014 CFR
2014-01-01
... conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...
10 CFR 605.11 - Additional requirements.
Code of Federal Regulations, 2013 CFR
2013-01-01
... Conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...
10 CFR 605.11 - Additional requirements.
Code of Federal Regulations, 2014 CFR
2014-01-01
... Conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...
2010-01-01
Background Genetic diversity among wild accessions and cultivars of common bean (Phaseolus vulgaris L.) has been characterized using plant morphology, seed protein allozymes, random amplified polymorphic DNA, restriction fragment length polymorphisms, DNA sequence analysis, chloroplast DNA, and microsatellite markers. Yet, little is known about whether these traits, which distinguish among genetically distinct types of common bean, can be evaluated using omics technologies. Results Three 'omics' approaches: transcriptomics, proteomics, and metabolomics were used to qualitatively evaluate the diversity of common bean from two Centers of Domestication (COD). All three approaches were able to classify common bean according to their COD using unsupervised analyses; these findings are consistent with the hypothesis that differences exist in gene transcription, protein expression, and synthesis and metabolism of small molecules among common bean cultivars representative of different COD. Metabolomic analyses of multiple cultivars within two common bean gene pools revealed cultivar differences in small molecules that were of sufficient magnitude to allow identification of unique cultivar fingerprints. Conclusions Given the high-throughput and low cost of each of these 'omics' platforms, significant opportunities exist for their use in the rapid identification of traits of agronomic and nutritional importance as well as to characterize genetic diversity. PMID:21126341
Imaging and sizing of single DNA molecules on a mobile phone.
Wei, Qingshan; Luo, Wei; Chiang, Samuel; Kappel, Tara; Mejia, Crystal; Tseng, Derek; Chan, Raymond Yan Lok; Yan, Eddie; Qi, Hangfei; Shabbir, Faizan; Ozkan, Haydar; Feng, Steve; Ozcan, Aydogan
2014-12-23
DNA imaging techniques using optical microscopy have found numerous applications in biology, chemistry and physics and are based on relatively expensive, bulky and complicated set-ups that limit their use to advanced laboratory settings. Here we demonstrate imaging and length quantification of single molecule DNA strands using a compact, lightweight and cost-effective fluorescence microscope installed on a mobile phone. In addition to an optomechanical attachment that creates a high contrast dark-field imaging setup using an external lens, thin-film interference filters, a miniature dovetail stage and a laser-diode for oblique-angle excitation, we also created a computational framework and a mobile phone application connected to a server back-end for measurement of the lengths of individual DNA molecules that are labeled and stretched using disposable chips. Using this mobile phone platform, we imaged single DNA molecules of various lengths to demonstrate a sizing accuracy of <1 kilobase-pairs (kbp) for 10 kbp and longer DNA samples imaged over a field-of-view of ∼2 mm2.
Paximadis, M; Rey, M E
2001-12-01
The complete DNA A of the begomovirus Tobacco leaf curl Zimbabwe virus (TbLCZWV) was sequenced: it comprises 2767 nucleotides with six major open reading frames encoding proteins with molecular masses greater than 9 kDa. Full-length TbLCZWV DNA A tandem dimers, cloned in binary vectors (pBin19 and pBI121) and transformed into Agrobacterium tumefaciens, were systemically infectious upon agroinoculation of tobacco and tomato. Efforts to identify a DNA B component were unsuccessful. These findings suggest that TbLCZWV is a new member of the monopartite group of begomoviruses. Phylogenetic analysis identified TbLCZWV as a distinct begomovirus with its closest relative being Chayote mosaic virus. Abutting primer PCR amplified ca. 1300 bp molecules, and cloning and sequencing of two of these molecules revealed them to be subgenomic defective DNA molecules originating from TbLCZWV DNA A. Variable symptom severity associated with tobacco leaf curl disease and TbLCZWV is discussed.
Multitargeting by curcumin as revealed by molecular interaction studies
Gupta, Subash C.; Prasad, Sahdeo; Kim, Ji Hye; Patchva, Sridevi; Webb, Lauren J.; Priyadarsini, Indira K.
2012-01-01
Curcumin (diferuloylmethane), the active ingredient in turmeric (Curcuma longa), is a highly pleiotropic molecule with anti-inflammatory, anti-oxidant, chemopreventive, chemosensitization, and radiosensitization activities. The pleiotropic activities attributed to curcumin come from its complex molecular structure and chemistry, as well as its ability to influence multiple signaling molecules. Curcumin has been shown to bind by multiple forces directly to numerous signaling molecules, such as inflammatory molecules, cell survival proteins, protein kinases, protein reductases, histone acetyltransferase, histone deacetylase, glyoxalase I, xanthine oxidase, proteasome, HIV1 integrase, HIV1 protease, sarco (endo) plasmic reticulum Ca2+ ATPase, DNA methyltransferases 1, FtsZ protofilaments, carrier proteins, and metal ions. Curcumin can also bind directly to DNA and RNA. Owing to its β-diketone moiety, curcumin undergoes keto–enol tautomerism that has been reported as a favorable state for direct binding. The functional groups on curcumin found suitable for interaction with other macromolecules include the α, β-unsaturated β-diketone moiety, carbonyl and enolic groups of the β-diketone moiety, methoxy and phenolic hydroxyl groups, and the phenyl rings. Various biophysical tools have been used to monitor direct interaction of curcumin with other proteins, including absorption, fluorescence, Fourier transform infrared (FTIR) and circular dichroism (CD) spectroscopy, surface plasmon resonance, competitive ligand binding, Forster type fluorescence resonance energy transfer (FRET), radiolabeling, site-directed mutagenesis, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS), immunoprecipitation, phage display biopanning, electron microscopy, 1-anilino-8-naphthalene-sulfonate (ANS) displacement, and co-localization. Molecular docking, the most commonly employed computational tool for calculating binding affinities and predicting binding sites, has also been used to further characterize curcumin’s binding sites. Furthermore, the ability of curcumin to bind directly to carrier proteins improves its solubility and bioavailability. In this review, we focus on how curcumin directly targets signaling molecules, as well as the different forces that bind the curcumin–protein complex and how this interaction affects the biological properties of proteins. We will also discuss various analogues of curcumin designed to bind selective targets with increased affinity. PMID:21979811
Constitutive Expression of Short Hairpin RNA in Vivo Triggers Buildup of Mature Hairpin Molecules
Ahn, M.; Witting, S.R.; Ruiz, R.; Saxena, R.
2011-01-01
Abstract RNA interference (RNAi) has become the cornerstone technology for studying gene function in mammalian cells. In addition, it is a promising therapeutic treatment for multiple human diseases. Virus-mediated constitutive expression of short hairpin RNA (shRNA) has the potential to provide a permanent source of silencing molecules to tissues, and it is being devised as a strategy for the treatment of liver conditions such as hepatitis B and hepatitis C virus infection. Unintended interaction between silencing molecules and cellular components, leading to toxic effects, has been described in vitro. Despite the enormous interest in using the RNAi technology for in vivo applications, little is known about the safety of constitutively expressing shRNA for multiple weeks. Here we report the effects of in vivo shRNA expression, using helper-dependent adenoviral vectors. We show that gene-specific knockdown is maintained for at least 6 weeks after injection of 1 × 1011 viral particles. Nonetheless, accumulation of mature shRNA molecules was observed up to weeks 3 and 4, and then declined gradually, suggesting the buildup of mature shRNA molecules induced cell death with concomitant loss of viral DNA and shRNA expression. No evidence of well-characterized innate immunity activation (such as interferon production) or saturation of the exportin-5 pathway was observed. Overall, our data suggest constitutive expression of shRNA results in accumulation of mature shRNA molecules, inducing cellular toxicity at late time points, despite the presence of gene silencing. PMID:21780944
Blueprints for green biotech: development and application of standards for plant synthetic biology.
Patron, Nicola J
2016-06-15
Synthetic biology aims to apply engineering principles to the design and modification of biological systems and to the construction of biological parts and devices. The ability to programme cells by providing new instructions written in DNA is a foundational technology of the field. Large-scale de novo DNA synthesis has accelerated synthetic biology by offering custom-made molecules at ever decreasing costs. However, for large fragments and for experiments in which libraries of DNA sequences are assembled in different combinations, assembly in the laboratory is still desirable. Biological assembly standards allow DNA parts, even those from multiple laboratories and experiments, to be assembled together using the same reagents and protocols. The adoption of such standards for plant synthetic biology has been cohesive for the plant science community, facilitating the application of genome editing technologies to plant systems and streamlining progress in large-scale, multi-laboratory bioengineering projects. © 2016 The Author(s). published by Portland Press Limited on behalf of the Biochemical Society.
Structure and Mechanism of Action of the BRCA2 Breast Cancer Tumor Suppressor
Malivert, Laurent; McIlwraith, Michael J.; Pape, Tillman; West, Stephen C.; Zhang, Xiaodong
2014-01-01
Mutations in BRCA2 increase susceptibility to breast, ovarian and prostate cancers. The product of human BRCA2, BRCA2 protein, plays a key role in the repair of DNA double strand breaks and interstrand crosslinks by RAD51-mediated homologous recombination. Here, we present a biochemical and structural characterization of full length (3,418 amino acid) BRCA2, alone and in complex with RAD51. We show that BRCA2 facilitates nucleation of RAD51 filaments at multiple sites on single-stranded DNA. Three-dimensional electron microscopy reconstructions revealed that BRCA2 exists as a dimer and that two oppositely-oriented sets of RAD51 molecules bind the dimer. Single stranded DNA binds along the long axis of BRCA2, such that only one set of RAD51 monomers can form a productive complex with DNA and establish filament formation. Our data define the molecular mechanism by which this tumor suppressor facilitates RAD51-mediated homologous recombinational repair. PMID:25282148
Absorption by DNA single strands of adenine isolated in vacuo: The role of multiple chromophores
NASA Astrophysics Data System (ADS)
Nielsen, Lisbeth Munksgaard; Pedersen, Sara Øvad; Kirketerp, Maj-Britt Suhr; Nielsen, Steen Brøndsted
2012-02-01
The degree of electronic coupling between DNA bases is a topic being up for much debate. Here we report on the intrinsic electronic properties of isolated DNA strands in vacuo free of solvent, which is a good starting point for high-level excited states calculations. Action spectra of DNA single strands of adenine reveal sign of exciton coupling between stacked bases from blueshifted absorption bands (˜3 nm) relative to that of the dAMP mononucleotide (one adenine base). The bands are blueshifted by about 10 nm compared to those of solvated strands, which is a shift similar to that for the adenine molecule and the dAMP mononucleotide. Desolvation has little effect on the bandwidth, which implies that inhomogenous broadening of the absorption bands in aqueous solution is of minor importance compared to, e.g., conformational disorder. Finally, at high photon energies, internal conversion competes with electron detachment since dissociation of the bare photoexcited ions on the microsecond time scale is measured.
Sprengel, Andreas; Lill, Pascal; Stegemann, Pierre; Bravo-Rodriguez, Kenny; Schöneweiß, Elisa-C.; Merdanovic, Melisa; Gudnason, Daniel; Aznauryan, Mikayel; Gamrad, Lisa; Barcikowski, Stephan; Sanchez-Garcia, Elsa; Birkedal, Victoria; Gatsogiannis, Christos; Ehrmann, Michael; Saccà, Barbara
2017-01-01
The self-organizational properties of DNA have been used to realize synthetic hosts for protein encapsulation. However, current strategies of DNA–protein conjugation still limit true emulation of natural host–guest systems, whose formation relies on non-covalent bonds between geometrically matching interfaces. Here we report one of the largest DNA–protein complexes of semisynthetic origin held in place exclusively by spatially defined supramolecular interactions. Our approach is based on the decoration of the inner surface of a DNA origami hollow structure with multiple ligands converging to their corresponding binding sites on the protein surface with programmable symmetry and range-of-action. Our results demonstrate specific host–guest recognition in a 1:1 stoichiometry and selectivity for the guest whose size guarantees sufficient molecular diffusion preserving short intermolecular distances. DNA nanocontainers can be thus rationally designed to trap single guest molecules in their native form, mimicking natural strategies of molecular recognition and anticipating a new method of protein caging. PMID:28205515
McAndrew, Christopher P.; Tyson, Christopher; Zischkau, Joseph; Mehl, Patrick; Tuma, Pamela L.; Pegg, Ian L.; Sarkar, Abhijit
2016-01-01
We report the development of a simple-to-implement magnetic force transducer that can apply a wide range of piconewton (pN) scale forces on single DNA molecules and DNA–protein complexes in the horizontal plane. The resulting low-noise force-extension data enable very high-resolution detection of changes in the DNA tether’s extension: ~0.05 pN in force and <10 nm change in extension. We have also verified that we can manipulate DNA in near equilibrium conditions through the wide range of forces by ramping the force from low to high and back again, and observing minimal hysteresis in the molecule’s force response. Using a calibration technique based on Stokes’ drag law, we have confirmed our force measurements from DNA force-extension experiments obtained using the fluctuation-dissipation theorem applied to transverse fluctuations of the magnetic microsphere. We present data on the force-distance characteristics of a DNA molecule complexed with histones. The results illustrate how the tweezers can be used to study DNA binding proteins at the single molecule level. PMID:26757808
Perwez, T; Meyer, R
1996-01-01
An essential early step in conjugal mobilization of R1162, nicking of the DNA strand that is subsequently transferred, is carried out in the relaxosome, a complex of two plasmid-encoded proteins and DNA at the origin of transfer (oriT). A third protein, MobB, is also required for efficient mobilization. We show that in the cell this protein increases the proportion of molecules specifically nicked at oriT, resulting in lower yields of covalently closed molecules after alkaline extraction. These nicked molecules largely remain supercoiled, with unwinding presumably constrained by the relaxosome. MobB enhances the sensitivity of the oriT DNA to oxidation by permanganate, indicating that the protein acts by increasing the fraction of complexed molecules. Mutations that significantly reduce the amount of complexed DNA in the cell were isolated. However, plasmids with these mutations were mobilized at nearly the normal frequency, were nicked at a commensurate level, and still required MobB. Our results indicate that the frequency of transfer is determined both by the amount of time each molecule is in the nicked form and by the proportion of complexed molecules in the total population. PMID:8824623
Computational Identification and Functional Predictions of Long Noncoding RNA in Zea mays
Boerner, Susan; McGinnis, Karen M.
2012-01-01
Background Computational analysis of cDNA sequences from multiple organisms suggests that a large portion of transcribed DNA does not code for a functional protein. In mammals, noncoding transcription is abundant, and often results in functional RNA molecules that do not appear to encode proteins. Many long noncoding RNAs (lncRNAs) appear to have epigenetic regulatory function in humans, including HOTAIR and XIST. While epigenetic gene regulation is clearly an essential mechanism in plants, relatively little is known about the presence or function of lncRNAs in plants. Methodology/Principal Findings To explore the connection between lncRNA and epigenetic regulation of gene expression in plants, a computational pipeline using the programming language Python has been developed and applied to maize full length cDNA sequences to identify, classify, and localize potential lncRNAs. The pipeline was used in parallel with an SVM tool for identifying ncRNAs to identify the maximal number of ncRNAs in the dataset. Although the available library of sequences was small and potentially biased toward protein coding transcripts, 15% of the sequences were predicted to be noncoding. Approximately 60% of these sequences appear to act as precursors for small RNA molecules and may function to regulate gene expression via a small RNA dependent mechanism. ncRNAs were predicted to originate from both genic and intergenic loci. Of the lncRNAs that originated from genic loci, ∼20% were antisense to the host gene loci. Conclusions/Significance Consistent with similar studies in other organisms, noncoding transcription appears to be widespread in the maize genome. Computational predictions indicate that maize lncRNAs may function to regulate expression of other genes through multiple RNA mediated mechanisms. PMID:22916204
Illegitimate recombination mediated by calf thymus DNA topoisomerase II in vitro.
Bae, Y S; Kawasaki, I; Ikeda, H; Liu, L F
1988-01-01
We have found that purified calf thymus DNA topoisomerase II mediates recombination between two phage lambda DNA molecules in an in vitro system. The enzyme mainly produced a linear monomer recombinant DNA that can be packaged in vitro. Novobiocin and anti-calf thymus DNA topoisomerase II antibody inhibit this ATP-dependent recombination. The recombinant molecules contain duplications or deletions, and most crossovers take place between nonhomologous sequences of lambda DNA, as judged by the sequences of recombination junctions. Therefore, the recombination mediated by the calf thymus DNA topoisomerase II is an illegitimate recombination that is similar to recombination mediated by Escherichia coli DNA gyrase or phage T4 DNA topoisomerase. The subunit exchange model, which has been suggested for the DNA gyrase-mediated recombination, is now generalized as follows: DNA topoisomerase II molecules bind to DNAs, associate with each other, and lead to the exchange of DNA strands through the exchange of topoisomerase II subunits. Illegitimate recombination might be carried out by a general mechanism in organisms ranging from prokaryotes to higher eukaryotes. Images PMID:2832845
Microfluidic DNA sample preparation method and device
Krulevitch, Peter A.; Miles, Robin R.; Wang, Xiao-Bo; Mariella, Raymond P.; Gascoyne, Peter R. C.; Balch, Joseph W.
2002-01-01
Manipulation of DNA molecules in solution has become an essential aspect of genetic analyses used for biomedical assays, the identification of hazardous bacterial agents, and in decoding the human genome. Currently, most of the steps involved in preparing a DNA sample for analysis are performed manually and are time, labor, and equipment intensive. These steps include extraction of the DNA from spores or cells, separation of the DNA from other particles and molecules in the solution (e.g. dust, smoke, cell/spore debris, and proteins), and separation of the DNA itself into strands of specific lengths. Dielectrophoresis (DEP), a phenomenon whereby polarizable particles move in response to a gradient in electric field, can be used to manipulate and separate DNA in an automated fashion, considerably reducing the time and expense involved in DNA analyses, as well as allowing for the miniaturization of DNA analysis instruments. These applications include direct transport of DNA, trapping of DNA to allow for its separation from other particles or molecules in the solution, and the separation of DNA into strands of varying lengths.
Forget, Anthony L.; Dombrowski, Christopher C.; Amitani, Ichiro; Kowalczykowski, Stephen C.
2015-01-01
In this Protocol, we describe a procedure to generate ‘DNA-dumbbells’ — single molecules of DNA with a microscopic bead attached at each end — and techniques for manipulating individual DNA-dumbbells. We also detail the design and fabrication of a microfluidic device (flow cell) used in conjunction with dual optical trapping to manipulate DNA-dumbbells and to visualize individual protein–DNA complexes by single-molecule epifluorescence microscopy. Our design of the flow cell enables the rapid movement of trapped molecules between laminar flow channels and a flow-free ‘reservoir’. The reservoir provides the means to examine formation of DNA–protein complexes in solution in the absence of external flow forces, while still maintaining a predetermined end-to-end extension of the DNA. These features facilitate examination of the role of three-dimensional DNA conformation and dynamics in protein–DNA interactions. Preparation of flow cells and reagents requires two days each; in situ DNA-dumbbell assembly and imaging of single protein–DNA complexes requires another day. PMID:23411634
End-to-end distance and contour length distribution functions of DNA helices
NASA Astrophysics Data System (ADS)
Zoli, Marco
2018-06-01
I present a computational method to evaluate the end-to-end and the contour length distribution functions of short DNA molecules described by a mesoscopic Hamiltonian. The method generates a large statistical ensemble of possible configurations for each dimer in the sequence, selects the global equilibrium twist conformation for the molecule, and determines the average base pair distances along the molecule backbone. Integrating over the base pair radial and angular fluctuations, I derive the room temperature distribution functions as a function of the sequence length. The obtained values for the most probable end-to-end distance and contour length distance, providing a measure of the global molecule size, are used to examine the DNA flexibility at short length scales. It is found that, also in molecules with less than ˜60 base pairs, coiled configurations maintain a large statistical weight and, consistently, the persistence lengths may be much smaller than in kilo-base DNA.
Single-Molecule Denaturation Mapping of DNA in Nanofluidic Channels
NASA Astrophysics Data System (ADS)
Reisner, Walter; Larsen, Niels; Silahtaroglu, Asli; Kristensen, Anders; Tommerup, Niels; Tegenfeldt, Jonas O.; Flyvbjerg, Henrik
2010-03-01
Nanochannel based DNA stretching can serve as a platform for a new optical mapping technique based on measuring the pattern of partial melting along the extended molecules. We partially melt DNA extended in nanofluidic channels via a combination of local heating and added chemical denaturants. The melted molecules, imaged via a standard fluorescence videomicroscopy setup, exhibit a nonuniform fluorescence profile corresponding to a series of local dips and peaks in the intensity trace along the stretched molecule. We show that this barcode is consistent with the presence of locally melted regions along the molecule and can be explained by calculations of sequence-dependent melting probability. Specifically, we obtain experimental melting profiles for T4, T7, lambda-phage and bacterial artificial chromosome DNA (from human chromosome 12) and compare these profiles to theory. In addition, we demonstrate that the BAC melting profile can be used to align the BAC to its correct position on chromosome 12.
Li, Chunmei; Yu, Zhilong; Fu, Yusi; Pang, Yuhong; Huang, Yanyi
2017-04-26
We develop a novel single-cell-based platform through digital counting of amplified genomic DNA fragments, named multifraction amplification (mfA), to detect the copy number variations (CNVs) in a single cell. Amplification is required to acquire genomic information from a single cell, while introducing unavoidable bias. Unlike prevalent methods that directly infer CNV profiles from the pattern of sequencing depth, our mfA platform denatures and separates the DNA molecules from a single cell into multiple fractions of a reaction mix before amplification. By examining the sequencing result of each fraction for a specific fragment and applying a segment-merge maximum likelihood algorithm to the calculation of copy number, we digitize the sequencing-depth-based CNV identification and thus provide a method that is less sensitive to the amplification bias. In this paper, we demonstrate a mfA platform through multiple displacement amplification (MDA) chemistry. When performing the mfA platform, the noise of MDA is reduced; therefore, the resolution of single-cell CNV identification can be improved to 100 kb. We can also determine the genomic region free of allelic drop-out with mfA platform, which is impossible for conventional single-cell amplification methods.
Nucleotide excision repair is a potential therapeutic target in multiple myeloma
Szalat, R; Samur, M K; Fulciniti, M; Lopez, M; Nanjappa, P; Cleynen, A; Wen, K; Kumar, S; Perini, T; Calkins, A S; Reznichenko, E; Chauhan, D; Tai, Y-T; Shammas, M A; Anderson, K C; Fermand, J-P; Arnulf, B; Avet-Loiseau, H; Lazaro, J-B; Munshi, N C
2018-01-01
Despite the development of novel drugs, alkylating agents remain an important component of therapy in multiple myeloma (MM). DNA repair processes contribute towards sensitivity to alkylating agents and therefore we here evaluate the role of nucleotide excision repair (NER), which is involved in the removal of bulky adducts and DNA crosslinks in MM. We first evaluated NER activity using a novel functional assay and observed a heterogeneous NER efficiency in MM cell lines and patient samples. Using next-generation sequencing data, we identified that expression of the canonical NER gene, excision repair cross-complementation group 3 (ERCC3), significantly impacted the outcome in newly diagnosed MM patients treated with alkylating agents. Next, using small RNA interference, stable knockdown and overexpression, and small-molecule inhibitors targeting xeroderma pigmentosum complementation group B (XPB), the DNA helicase encoded by ERCC3, we demonstrate that NER inhibition significantly increases sensitivity and overcomes resistance to alkylating agents in MM. Moreover, inhibiting XPB leads to the dual inhibition of NER and transcription and is particularly efficient in myeloma cells. Altogether, we show that NER impacts alkylating agents sensitivity in myeloma cells and identify ERCC3 as a potential therapeutic target in MM. PMID:28588253
NASA Astrophysics Data System (ADS)
Zhang, Yuning; Reisner, Walter
2013-03-01
Nanopore and nanochannel based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with embedded pore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a pore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We demonstrate that we can optically detect successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. In particular, we show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore, suggesting that the pore could be used as a nanoscale window through which to interrogate a nanochannel extended DNA molecule. Furthermore, electrical measurements through the nanopore are performed, indicating that DNA sensing is feasible using the nanochannel-nanopore device.
A 3D-DNA Molecule Made of PlayMais
ERIC Educational Resources Information Center
Caine, Massimo; Horié, Ninon; Zuchuat, Sandrine; Weber, Aurélia; Ducret, Verena; Linder, Patrick; Perron, Karl
2015-01-01
More than 60 years have passed since the work of Rosalind Franklin, James Watson, and Francis Crick led to the discovery of the 3D-DNA double-helix structure. Nowadays, due to the simple and elegant architecture of its double helix, the structure of DNA is widely known. The biological role of the DNA molecule (e.g., genetic information), however,…
Procedure for normalization of cDNA libraries
Bonaldo, Maria DeFatima; Soares, Marcelo Bento
1997-01-01
This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library.
Building block synthesis using the polymerase chain assembly method.
Marchand, Julie A; Peccoud, Jean
2012-01-01
De novo gene synthesis allows the creation of custom DNA molecules without the typical constraints of traditional cloning assembly: scars, restriction site incompatibility, and the quest to find all the desired parts to name a few. Moreover, with the help of computer-assisted design, the perfect DNA molecule can be created along with its matching sequence ready to download. The challenge is to build the physical DNA molecules that have been designed with the software. Although there are several DNA assembly methods, this section presents and describes a method using the polymerase chain assembly (PCA).
SINGLE STRAND-CONTAINING REPLICATING MOLECULES OF CIRCULAR MITOCHONDRIAL DNA
Wolstenholme, David R.; Koike, Katsuro; Cochran-Fouts, Patricia
1973-01-01
Mitochondrial DNAs (mtDNAs) from Chang rat solid hepatomas and Novikoff rat ascites hepatomas were examined in the electron microscope after preparation by the aqueous and by the formamide protein monolayer techniques. MtDNAs from both tumors were found to include double-forked circular molecules with a form and size suggesting they were replicative intermediates. These molecules were of two classes. In molecules of one class, all three segments were apparently totally double stranded. Molecules of the second class were distinguished by the fact that one of the segments spanning the region between the forks in which replication had occurred (the daughter segments) was either totally single stranded, or contained a single-stranded region associated with one of the forks. Daughter segments of both totally double-stranded and single strand-containing replicating molecules varied in length from about 3 to about 80% of the circular contour length of the molecule. Similar classes of replicating molecules were found in mtDNA from regenerating rat liver and chick embryos, indicating them to be normal intermediates in the replication of mtDNA All of the mtDNAs examined included partially single-stranded simple (nonforked) circular molecules. A possible scheme for the replication of mtDNA is presented, based on the different molecular forms observed PMID:4345165
DOE Office of Scientific and Technical Information (OSTI.GOV)
Żurek-Biesiada, Dominika; Szczurek, Aleksander T.; Prakash, Kirti
Higher order chromatin structure is not only required to compact and spatially arrange long chromatids within a nucleus, but have also important functional roles, including control of gene expression and DNA processing. However, studies of chromatin nanostructures cannot be performed using conventional widefield and confocal microscopy because of the limited optical resolution. Various methods of superresolution microscopy have been described to overcome this difficulty, like structured illumination and single molecule localization microscopy. We report here that the standard DNA dye Vybrant{sup ®} DyeCycle™ Violet can be used to provide single molecule localization microscopy (SMLM) images of DNA in nuclei ofmore » fixed mammalian cells. This SMLM method enabled optical isolation and localization of large numbers of DNA-bound molecules, usually in excess of 10{sup 6} signals in one cell nucleus. The technique yielded high-quality images of nuclear DNA density, revealing subdiffraction chromatin structures of the size in the order of 100 nm; the interchromatin compartment was visualized at unprecedented optical resolution. The approach offers several advantages over previously described high resolution DNA imaging methods, including high specificity, an ability to record images using a single wavelength excitation, and a higher density of single molecule signals than reported in previous SMLM studies. The method is compatible with DNA/multicolor SMLM imaging which employs simple staining methods suited also for conventional optical microscopy. - Highlights: • Super-resolution imaging of nuclear DNA with Vybrant Violet and blue excitation. • 90nm resolution images of DNA structures in optically thick eukaryotic nuclei. • Enhanced resolution confirms the existence of DNA-free regions inside the nucleus. • Optimized imaging conditions enable multicolor super-resolution imaging.« less
Two-subunit DNA escort mechanism and inactive subunit bypass in an ultra-fast ring ATPase
Liu, Ninning; Chistol, Gheorghe; Bustamante, Carlos
2015-10-09
SpoIIIE is a homo-hexameric dsDNA translocase responsible for completing chromosome segregation in Bacillus subtilis. Here in this study, we use a single-molecule approach to monitor SpoIIIE translocation when challenged with neutral-backbone DNA and non-hydrolyzable ATP analogs. We show that SpoIIIE makes multiple essential contacts with phosphates on the 5'→3' strand in the direction of translocation. Using DNA constructs with two neutral-backbone segments separated by a single charged base pair, we deduce that SpoIIIE’s step size is 2 bp. Finally, experiments with non-hydrolyzable ATP analogs suggest that SpoIIIE can operate with non-consecutive inactive subunits. We propose a two-subunit escort translocation mechanismmore » that is strict enough to enable SpoIIIE to track one DNA strand, yet sufficiently compliant to permit the motor to bypass inactive subunits without arrest. We speculate that such a flexible mechanism arose for motors that, like SpoIIIE, constitute functional bottlenecks where the inactivation of even a single motor can be lethal for the cell.« less
Two-subunit DNA escort mechanism and inactive subunit bypass in an ultra-fast ring ATPase
Liu, Ninning; Chistol, Gheorghe; Bustamante, Carlos
2015-10-09
SpoIIIE is a homo-hexameric dsDNA translocase responsible for completing chromosome segregation in Bacillus subtilis . Here, we use a single-molecule approach to monitor SpoIIIE translocation when challenged with neutral-backbone DNA and non-hydrolyzable ATP analogs. We show that SpoIIIE makes multiple essential contacts with phosphates on the 5'→3' strand in the direction of translocation. Using DNA constructs with two neutral-backbone segments separated by a single charged base pair, we deduce that SpoIIIE’s step size is 2 bp. Finally, experiments with non-hydrolyzable ATP analogs suggest that SpoIIIE can operate with non-consecutive inactive subunits. We propose a two-subunit escort translocation mechanism that ismore » strict enough to enable SpoIIIE to track one DNA strand, yet sufficiently compliant to permit the motor to bypass inactive subunits without arrest. We speculate that such a flexible mechanism arose for motors that, like SpoIIIE, constitute functional bottlenecks where the inactivation of even a single motor can be lethal for the cell.« less
Discrimination of Single Base Pair Differences Among Individual DNA Molecules Using a Nanopore
NASA Technical Reports Server (NTRS)
Vercoutere, Wenonah; DeGuzman, Veronica
2003-01-01
The protein toxin alpha-hemolysin form nanometer scale channels across lipid membranes. Our lab uses a single channel in an artificial lipid bilayer in a patch clamp device to capture and examine individual DNA molecules. This nanopore detector used with a support vector machine (SVM) can analyze DNA hairpin molecules on the millisecond time scale. We distinguish duplex stem length, base pair mismatches, loop length, and single base pair differences. The residual current fluxes also reveal structural molecular dynamics elements. DNA end-fraying (terminal base pair dissociation) can be observed as near full blockades, or spikes, in current. This technique can be used to investigate other biological processes dependent on DNA end-fraying, such as the processing of HIV DNA by HIV integrase.
A rule of seven in Watson-Crick base-pairing of mismatched sequences.
Cisse, Ibrahim I; Kim, Hajin; Ha, Taekjip
2012-05-13
Sequence recognition through base-pairing is essential for DNA repair and gene regulation, but the basic rules governing this process remain elusive. In particular, the kinetics of annealing between two imperfectly matched strands is not well characterized, despite its potential importance in nucleic acid-based biotechnologies and gene silencing. Here we use single-molecule fluorescence to visualize the multiple annealing and melting reactions of two untethered strands inside a porous vesicle, allowing us to precisely quantify the annealing and melting rates. The data as a function of mismatch position suggest that seven contiguous base pairs are needed for rapid annealing of DNA and RNA. This phenomenological rule of seven may underlie the requirement for seven nucleotides of complementarity to seed gene silencing by small noncoding RNA and may help guide performance improvement in DNA- and RNA-based bio- and nanotechnologies, in which off-target effects can be detrimental.
Emerging Therapies in Metastatic Prostate Cancer.
Sonnenburg, Daniel W; Morgans, Alicia K
2018-04-11
In the last decade, there have been multiple landmark therapeutic advances for the treatment of metastatic prostate cancer, both in the castration-resistant and hormone-sensitive setting. In this review, we highlight recent progress and ongoing trials for metastatic prostate cancer, including advances in chemotherapy, androgen receptor-directed therapy, targeted therapies, and immunotherapy. Several landmark studies for men with metastatic hormone-sensitive prostate cancer demonstrated improvement in overall survival with the addition of docetaxel chemotherapy or abiraterone acetate to standard androgen deprivation therapy. A single-arm phase 2 study of the PARP inhibitor olaparib demonstrated high response rates and more favorable progression-free and overall survival for men with metastatic castration-resistant prostate cancer and DNA repair defects treated with olaparib compared with men without DNA repair defects. Multiple ongoing clinical trials are investigating novel hormonal therapies and combinations of chemotherapy, targeted small molecules, immunotherapy, and radiopharmaceuticals. Progress continues to be made in the treatment of metastatic prostate cancer, and ongoing clinical trials continue to investigate novel agents and approaches to treatment.
Human Neoplasms Elicit Multiple Specific Immune Responses in the Autologous Host
NASA Astrophysics Data System (ADS)
Sahin, Ugur; Tureci, Ozlem; Schmitt, Holger; Cochlovius, Bjorn; Johannes, Thomas; Schmits, Rudolf; Stenner, Frank; Luo, Guorong; Schobert, Ingrid; Pfreundschuh, Michael
1995-12-01
Expression of cDNA libraries from human melanoma, renal cancer, astrocytoma, and Hodgkin disease in Escherichia coli and screening for clones reactive with high-titer IgG antibodies in autologous patient serum lead to the discovery of at least four antigens with a restricted expression pattern in each tumor. Besides antigens known to elicit T-cell responses, such as MAGE-1 and tyrosinase, numerous additional antigens that were overexpressed or specifically expressed in tumors of the same type were identified. Sequence analyses suggest that many of these molecules, besides being the target of a specific immune response, might be of relevance for tumor growth. Antibodies to a given antigen were usually confined to patients with the same tumor type. The unexpected frequency of human tumor antigens, which can be readily defined at the molecular level by the serological analysis of autologous tumor cDNA expression cloning, indicates that human neoplasms elicit multiple specific immune responses in the autologous host and provides diagnostic and therapeutic approaches to human cancer.
Folding and unfolding single RNA molecules under tension
Woodside, Michael T; García-García, Cuauhtémoc; Block, Steven M
2010-01-01
Single-molecule force spectroscopy constitutes a powerful method for probing RNA folding: it allows the kinetic, energetic, and structural properties of intermediate and transition states to be determined quantitatively, yielding new insights into folding pathways and energy landscapes. Recent advances in experimental and theoretical methods, including fluctuation theorems, kinetic theories, novel force clamps, and ultrastable instruments, have opened new avenues for study. These tools have been used to probe folding in simple model systems, for example, RNA and DNA hairpins. Knowledge gained from such systems is helping to build our understanding of more complex RNA structures composed of multiple elements, as well as how nucleic acids interact with proteins involved in key cellular activities, such as transcription and translation. PMID:18786653
Prominent mitochondrial DNA recombination intermediates in human heart muscle.
Kajander, O A; Karhunen, P J; Holt, I J; Jacobs, H T
2001-11-01
Recombination intermediates containing four-way (Holliday) junctions are generated during DNA repair and replication in many systems, including yeast mitochondrial DNA (mtDNA). In contrast, convincing evidence for recombination in mammalian mtDNA is lacking. We have used two-dimensional agarose-gel electrophoresis to analyse non-linear forms of mtDNA in human heart muscle. Replication intermediates from both the coupled and strand-asynchronous mtDNA replication pathways were detected. An additional class of non-linear molecules, with the electrophoretic properties of four-way junctions, was also prominent. These molecules were insensitive to topoisomerase I or RNase H, but were diminished by branch migration or RuvC treatment. Junctional molecules were detected in all regions of the mitochondrial genome, were found in myocardial DNA from young and old adults, but were present at lower levels in skeletal muscle and placenta. We suggest that they could represent intermediates of mtDNA repair, given their prevalence in the oxyradical-rich environment of heart muscle mitochondria.
Improved Analysis of Nanopore Sequence Data and Scanning Nanopore Techniques
NASA Astrophysics Data System (ADS)
Szalay, Tamas
The field of nanopore research has been driven by the need to inexpensively and rapidly sequence DNA. In order to help realize this goal, this thesis describes the PoreSeq algorithm that identifies and corrects errors in real-world nanopore sequencing data and improves the accuracy of de novo genome assembly with increasing coverage depth. The approach relies on modeling the possible sources of uncertainty that occur as DNA advances through the nanopore and then using this model to find the sequence that best explains multiple reads of the same region of DNA. PoreSeq increases nanopore sequencing read accuracy of M13 bacteriophage DNA from 85% to 99% at 100X coverage. We also use the algorithm to assemble E. coli with 30X coverage and the lambda genome at a range of coverages from 3X to 50X. Additionally, we classify sequence variants at an order of magnitude lower coverage than is possible with existing methods. This thesis also reports preliminary progress towards controlling the motion of DNA using two nanopores instead of one. The speed at which the DNA travels through the nanopore needs to be carefully controlled to facilitate the detection of individual bases. A second nanopore in close proximity to the first could be used to slow or stop the motion of the DNA in order to enable a more accurate readout. The fabrication process for a new pyramidal nanopore geometry was developed in order to facilitate the positioning of the nanopores. This thesis demonstrates that two of them can be placed close enough to interact with a single molecule of DNA, which is a prerequisite for being able to use the driving force of the pores to exert fine control over the motion of the DNA. Another strategy for reading the DNA is to trap it completely with one pore and to move the second nanopore instead. To that end, this thesis also shows that a single strand of immobilized DNA can be captured in a scanning nanopore and examined for a full hour, with data from many scans at many different voltages obtained in order to detect a bound protein placed partway along the molecule.
DNA conformation on surfaces measured by fluorescence self-interference.
Moiseev, Lev; Unlü, M Selim; Swan, Anna K; Goldberg, Bennett B; Cantor, Charles R
2006-02-21
The conformation of DNA molecules tethered to the surface of a microarray may significantly affect the efficiency of hybridization. Although a number of methods have been applied to determine the structure of the DNA layer, they are not very sensitive to variations in the shape of DNA molecules. Here we describe the application of an interferometric technique called spectral self-interference fluorescence microscopy to the precise measurement of the average location of a fluorescent label in a DNA layer relative to the surface and thus determine specific information on the conformation of the surface-bound DNA molecules. Using spectral self-interference fluorescence microscopy, we have estimated the shape of coiled single-stranded DNA, the average tilt of double-stranded DNA of different lengths, and the amount of hybridization. The data provide important proofs of concept for the capabilities of novel optical surface analytical methods of the molecular disposition of DNA on surfaces. The determination of DNA conformations on surfaces and hybridization behavior provide information required to move DNA interfacial applications forward and thus impact emerging clinical and biotechnological fields.
Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules
Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David
2003-01-01
We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778
Structural Transitions in Supercoiled Stretched DNA
NASA Astrophysics Data System (ADS)
v, Croquette
1998-03-01
Using magnetic micromanipulation techniques [Strick 96]( uc(T.R.) Strick, J.-F. Allemand, D. Bensimon, A. Bensimon) and uc(V.) Croquette, "The elasticity of a single supercoiled DNA molecule", Science, 271, 1835 (1996)., we have studied the mechanical properties (force versus extension) of single DNA molecules under a wide range of torsional stresses (supercoiling). We show that unwinding the DNA double helix leads to a phase separation between regular B-DNA and denaturation bubbles. The fraction of denatured molecule increases linearly with the degree of unwinding, beginning at a value of 1% unwinding. We have confirmed this denatured state by hybridization of homologous single-stranded DNA probes and by a chemical attack of the exposed bases. Surprisingly, when we overwind the molecule, the elasticity curves we obtain may also be interpreted by the coexistence of two phases, B-DNA and a new phase which we note P-DNA. The fraction of this new phase increases smoothly with overwinding, beginning at 3 % and continuing up to 300 %. Our results indicate that this new phase is four times more twisted that the standard B-DNA and is 1.75 times longer. Although the structure of this phase is not yet known, such a high twisting can only be attained if the sugar-phosphate backbones of the two strands are twisted closely while the bases are expelled outside of the molecule's core, in a structure reminiscent of the one proposed by Pauling. Indeed we have shown that this new phase is sensitive to chemical attack whereas the B-DNA is not. This new phase begins to appear on a molecule overwound by 3 % and stretched by a force of 5 pN, conditions typically encountered in vivo during gene transcription. This new phase may thus play a biological role (for more details).
Quantifying short-lived events in multistate ionic current measurements.
Balijepalli, Arvind; Ettedgui, Jessica; Cornio, Andrew T; Robertson, Joseph W F; Cheung, Kin P; Kasianowicz, John J; Vaz, Canute
2014-02-25
We developed a generalized technique to characterize polymer-nanopore interactions via single channel ionic current measurements. Physical interactions between analytes, such as DNA, proteins, or synthetic polymers, and a nanopore cause multiple discrete states in the current. We modeled the transitions of the current to individual states with an equivalent electrical circuit, which allowed us to describe the system response. This enabled the estimation of short-lived states that are presently not characterized by existing analysis techniques. Our approach considerably improves the range and resolution of single-molecule characterization with nanopores. For example, we characterized the residence times of synthetic polymers that are three times shorter than those estimated with existing algorithms. Because the molecule's residence time follows an exponential distribution, we recover nearly 20-fold more events per unit time that can be used for analysis. Furthermore, the measurement range was extended from 11 monomers to as few as 8. Finally, we applied this technique to recover a known sequence of single-stranded DNA from previously published ion channel recordings, identifying discrete current states with subpicoampere resolution.
The Alarmin Properties of DNA and DNA-associated Nuclear Proteins.
Magna, Melinda; Pisetsky, David S
2016-05-01
The communication of cell injury and death is a critical element in host defense. Although immune cells can serve this function by elaborating cytokines and chemokines, somatic cells can repurpose nuclear macromolecules to function as damage-associated molecular patterns (DAMPs) or alarmins to exert similar activity. Among these molecules, DNA, high-mobility group box-1, and histone proteins can all act as DAMPs once they are in an extracellular location. This review describes current information on the role of the nuclear DAMPs, their translocation to the outside of cells, and pathways of activation after uptake into the inside of immune cells. MEDLINE and PubMed databases were searched for citations (1990-2016) in English related to the following terms: DAMPs, high-mobility group box-1, DNA, histones, cell death, danger, and immune activation. Selected articles with the most relevant studies were included for a more detailed consideration. Although nuclear molecules have important structural and genetic regulatory roles inside the cell nucleus, when released into the extracellular space during cell death, these molecules can acquire immune activity and serve as alarmins or DAMPs. Although apoptosis is generally considered the source of extracellular nuclear material, other cell death pathways such as necroptosis, NETosis, and pyroptosis can contribute to the release of nuclear molecules. Importantly, the release of nuclear DAMPs occurs with both soluble and particulate forms of these molecules. The activity of nuclear molecules may depend on posttranslational modifications, redox changes, and the binding of other molecules. Once in an extracellular location, nuclear DAMPs can engage the same pattern recognition receptors as do pathogen-associated molecular patterns. These interactions can activate immune cells and lead to cytokine and chemokine production. Among these receptors, internal receptors for DNA are key to the response to this molecule; the likely function of these internal sensors is the recognition of DNA from intracellular infection by bacteria or viruses. Activation of these receptors requires translocation of extracellular DNA into specialized compartments. In addition to nuclear DNA, mitochondrial DNA can also serve as a DAMP. The communication of cell injury and death is a critical element in host defense and involves the repurposing of nuclear molecules as immune triggers. As such, the presence of extracellular nuclear material can serve as novel biomarkers for conditions involving cell injury and death. Targeting of these molecules may also represent an important new approach to therapy. Published by Elsevier Inc.
DNA under Force: Mechanics, Electrostatics, and Hydration.
Li, Jingqiang; Wijeratne, Sithara S; Qiu, Xiangyun; Kiang, Ching-Hwa
2015-02-25
Quantifying the basic intra- and inter-molecular forces of DNA has helped us to better understand and further predict the behavior of DNA. Single molecule technique elucidates the mechanics of DNA under applied external forces, sometimes under extreme forces. On the other hand, ensemble studies of DNA molecular force allow us to extend our understanding of DNA molecules under other forces such as electrostatic and hydration forces. Using a variety of techniques, we can have a comprehensive understanding of DNA molecular forces, which is crucial in unraveling the complex DNA functions in living cells as well as in designing a system that utilizes the unique properties of DNA in nanotechnology.
Substrate preparation for reliable imaging of DNA molecules with the scanning force microscope.
Vesenka, J; Guthold, M; Tang, C L; Keller, D; Delaine, E; Bustamante, C
1992-07-01
A simple method of substrate preparation for imaging circular DNA molecules with the scanning force microscope (SFM) is presented. These biomolecules are adsorbed onto mica that has been soaked in magnesium acetate, sonicated and glow-discharged. The stylus-sample forces that may be endured before sample damage occurs depends on the ambient relative humidity. Images of circular DNA molecules have been obtained routinely using tips specially modified by an electron beam with a radius of curvature, Rc, of about 10 nm [D. Keller and C. Chih-Chung, Surf. Sci. 268 (1992) 333]. The resolution of these adsorbed biomolecules is determined by the Rc. At higher forces individual circular DNA molecules can be manipulated with the SFM stylus. Strategies to develop still sharper probes will be discussed.
DNA Gyrase Is Involved in Chloroplast Nucleoid Partitioning
Cho, Hye Sun; Lee, Sang Sook; Kim, Kwang Dong; Hwang, Inhwan; Lim, Jong-Seok; Park, Youn-Il; Pai, Hyun-Sook
2004-01-01
DNA gyrase, which catalyzes topological transformation of DNA, plays an essential role in replication and transcription in prokaryotes. Virus-induced gene silencing of NbGyrA or NbGyrB, which putatively encode DNA gyrase subunits A and B, respectively, resulted in leaf yellowing phenotypes in Nicotiana benthamiana. NbGyrA and NbGyrB complemented the gyrA and gyrB temperature-sensitive mutations of Escherichia coli, respectively, which indicates that the plant and bacterial subunits are functionally similar. NbGyrA and NbGyrB were targeted to both chloroplasts and mitochondria, and depletion of these subunits affected both organelles by reducing chloroplast numbers and inducing morphological and physiological abnormalities in both organelles. Flow cytometry analysis revealed that the average DNA content in the affected chloroplasts and mitochondria was significantly higher than in the control organelles. Furthermore, 4′,6-diamidino-2-phenylindole staining revealed that the abnormal chloroplasts contained one or a few large nucleoids instead of multiple small nucleoids dispersed throughout the stroma. Pulse-field gel electrophoresis analyses of chloroplasts demonstrated that the sizes and/or structure of the DNA molecules in the abnormal chloroplast nucleoids are highly aberrant. Based on these results, we propose that DNA gyrase plays a critical role in chloroplast nucleoid partitioning by regulating DNA topology. PMID:15367714
Lee, James W.; Thundat, Thomas G.
2005-06-14
An apparatus and method for performing nucleic acid (DNA and/or RNA) sequencing on a single molecule. The genetic sequence information is obtained by probing through a DNA or RNA molecule base by base at nanometer scale as though looking through a strip of movie film. This DNA sequencing nanotechnology has the theoretical capability of performing DNA sequencing at a maximal rate of about 1,000,000 bases per second. This enhanced performance is made possible by a series of innovations including: novel applications of a fine-tuned nanometer gap for passage of a single DNA or RNA molecule; thin layer microfluidics for sample loading and delivery; and programmable electric fields for precise control of DNA or RNA movement. Detection methods include nanoelectrode-gated tunneling current measurements, dielectric molecular characterization, and atomic force microscopy/electrostatic force microscopy (AFM/EFM) probing for nanoscale reading of the nucleic acid sequences.
Nanomechanical DNA origami 'single-molecule beacons' directly imaged by atomic force microscopy
Kuzuya, Akinori; Sakai, Yusuke; Yamazaki, Takahiro; Xu, Yan; Komiyama, Makoto
2011-01-01
DNA origami involves the folding of long single-stranded DNA into designed structures with the aid of short staple strands; such structures may enable the development of useful nanomechanical DNA devices. Here we develop versatile sensing systems for a variety of chemical and biological targets at molecular resolution. We have designed functional nanomechanical DNA origami devices that can be used as 'single-molecule beacons', and function as pinching devices. Using 'DNA origami pliers' and 'DNA origami forceps', which consist of two levers ~170 nm long connected at a fulcrum, various single-molecule inorganic and organic targets ranging from metal ions to proteins can be visually detected using atomic force microscopy by a shape transition of the origami devices. Any detection mechanism suitable for the target of interest, pinching, zipping or unzipping, can be chosen and used orthogonally with differently shaped origami devices in the same mixture using a single platform. PMID:21863016
[Single-molecule detection and characterization of DNA replication based on DNA origami].
Wang, Qi; Fan, Youjie; Li, Bin
2014-08-01
To investigate single-molecule detection and characterization of DNA replication. Single-stranded DNA (ssDNA) as the template of DNA replication was attached to DNA origami by a hybridization reaction based on the complementary base-pairing principle. DNA replication catalyzed by E.coli DNA polymerase I Klenow Fragment (KF) was detected using atomic force microscopy (AFM). The height variations between the ssDNA and the double-stranded DNA (dsDNA), the distribution of KF during DNA replication and biotin-streptavidin (BA) complexes on the DNA strand after replication were detected. Agarose gel electrophoresis was employed to analyze the changes in the DNA after replication. The designed ssDNA could be anchored on the target positions of over 50% of the DNA origami. The KF was capable of binding to the ssDNA fixed on DNA origami and performing its catalytic activities, and was finally dissociated from the DNA after replication. The height of DNA strand increased by about 0.7 nm after replication. The addition of streptavidin also resulted in an DNA height increase to about 4.9 nm due to the formation of BA complexes on the biotinylated dsDNA. The resulting dsDNA and BA complex were subsequently confirmed by agarose gel electrophoresis. The combination of AFM and DNA origami allows detection and characterization of DNA replication at the single molecule level, and this approach provides better insights into the mechanism of DNA polymerase and the factors affecting DNA replication.
NASA Astrophysics Data System (ADS)
Zhang, Yuning; Reisner, Walter
2012-02-01
Nanopore and nanochannel based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with nanpore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a nanopore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We will discuss our recent progress on device fabrication and characterization. In particular, we demonstrate that we can detect - using fluorescent microscopy - successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. In particular, we show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore, suggesting that the embedded pore could be used as a nanoscale window through which to interrogate a nanochannel extended DNA molecule.
Żurek-Biesiada, Dominika; Szczurek, Aleksander T; Prakash, Kirti; Mohana, Giriram K; Lee, Hyun-Keun; Roignant, Jean-Yves; Birk, Udo J; Dobrucki, Jurek W; Cremer, Christoph
2016-05-01
Higher order chromatin structure is not only required to compact and spatially arrange long chromatids within a nucleus, but have also important functional roles, including control of gene expression and DNA processing. However, studies of chromatin nanostructures cannot be performed using conventional widefield and confocal microscopy because of the limited optical resolution. Various methods of superresolution microscopy have been described to overcome this difficulty, like structured illumination and single molecule localization microscopy. We report here that the standard DNA dye Vybrant(®) DyeCycle™ Violet can be used to provide single molecule localization microscopy (SMLM) images of DNA in nuclei of fixed mammalian cells. This SMLM method enabled optical isolation and localization of large numbers of DNA-bound molecules, usually in excess of 10(6) signals in one cell nucleus. The technique yielded high-quality images of nuclear DNA density, revealing subdiffraction chromatin structures of the size in the order of 100nm; the interchromatin compartment was visualized at unprecedented optical resolution. The approach offers several advantages over previously described high resolution DNA imaging methods, including high specificity, an ability to record images using a single wavelength excitation, and a higher density of single molecule signals than reported in previous SMLM studies. The method is compatible with DNA/multicolor SMLM imaging which employs simple staining methods suited also for conventional optical microscopy. Copyright © 2016. Published by Elsevier Inc.
A single molecule study of G-quadruplex and short duplex DNA structures
NASA Astrophysics Data System (ADS)
Roy, William A., Jr.
Given that certain conditions are met, a single stranded DNA/RNA (ssDNA/RNA) structure called G-quadruplex (GQ) can form in regions throughout the genome, including at the telomeres and internal regions of the chromosomes. These structures serve various functions depending on the region in which they form which include protecting the chromosome ends, interfering with telomere elongation in cancer cells, and regulating transcription and translation level gene expression. Due to their high stability, various cellular mechanisms, such as GQ destabilizing proteins, are employed to unfold these structures during DNA replication or repair. Yet, their distinct layered structure has made GQs an attractive drug target in cancer treatment as GQ stabilizing molecules could inhibit telomerase dependent telomere elongation, a mechanism occurring in the majority of cancer cells to avoid senescence and apoptosis. However, proteins or small molecules interact with GQ that is under the influence of various cellular tension mechanisms, including the tension applied by other nearby molecules or the tension due to DNA structure within the chromatin context. Therefore, it is important to characterize the stability of various GQs and their response to interacting molecules when subjected to a tensile force. We employed a novel DNA-based nano tension generator that utilizes the elastic properties of circularized short double-stranded DNA (dsDNA) oligonucleotides to apply tension on the GQ. Since this is a completely new approach, the majority of this thesis was dedicated to proof-of-principle studies that demonstrated the feasibility and functionality of the method.
Contactless experiments on individual DNA molecules show no evidence for molecular wire behavior.
Gómez-Navarro, C; Moreno-Herrero, F; de Pablo, P J; Colchero, J; Gómez-Herrero, J; Baró, A M
2002-06-25
A fundamental requirement for a molecule to be considered a molecular wire (MW) is the ability to transport electrical charge with a reasonably low resistance. We have carried out two experiments that measure first, the charge transfer from an electrode to the molecule, and second, the dielectric response of the MW. The latter experiment requires no contacts to either end of the molecule. From our experiments we conclude that adsorbed individual DNA molecules have a resistivity similar to mica, glass, and silicon oxide substrates. Therefore adsorbed DNA is not a conductor, and it should not be considered as a viable candidate for MW applications. Parallel studies on other nanowires, including single-walled carbon nanotubes, showed conductivity as expected.
Kai, Takeshi; Yokoya, Akinari; Ukai, Masatoshi; Fujii, Kentaro; Toigawa, Tomohiro; Watanabe, Ritsuko
2018-01-24
Although most of the radiation damage to genomic DNA could be rendered harmless using repair enzymes in a living cell, a certain fraction of the damage is persistent resulting in serious genetic effects, such as mutation induction. In order to understand the mechanisms of the deleterious DNA damage formation in terms of its earliest physical stage at the radiation track end, dynamics of low energy electrons and their thermalization processes around DNA molecules were investigated using a dynamic Monte Carlo code. The primary incident (1 keV) electrons multiply collide within 1 nm (equivalent to three DNA-base-pairs, 3bp) and generate secondary electrons which show non-Gaussian and non-thermal equilibrium distributions within 300 fs. On the other hand, the secondary electrons are mainly distributed within approximately 10 nm from their parent cations although approximately 5% of the electrons are localized within 1 nm of the cations owing to the interaction of their Coulombic fields. The mean electron energy is 0.7 eV; however, more than 10% of the electrons fall into a much lower-energy region than 0.1 eV at 300 fs. These results indicate that pre-hydrated electrons are formed from the extremely decelerated electrons over a few nm from the cations. DNA damage sites comprising multiple nucleobase lesions or single strand breaks can therefore be formed by multiple collisions of these electrons within 3bp. This multiple damage site is hardly processed by base excision repair enzymes. However, pre-hydrated electrons can also be produced resulting in an additional base lesion (or a strand break) more than 3bp away from the multi-damage site. These damage sites may be finally converted into a double strand break (DSB) when base excision enzymes process the additional base lesions. This DSB includes another base lesion(s) at their termini, and may introduce miss-rejoining by DSB repair enzymes, and hence may result in biological effects such as mutation in surviving cells.
Payne, Andrew C; Andregg, Michael; Kemmish, Kent; Hamalainen, Mark; Bowell, Charlotte; Bleloch, Andrew; Klejwa, Nathan; Lehrach, Wolfgang; Schatz, Ken; Stark, Heather; Marblestone, Adam; Church, George; Own, Christopher S; Andregg, William
2013-01-01
We present "molecular threading", a surface independent tip-based method for stretching and depositing single and double-stranded DNA molecules. DNA is stretched into air at a liquid-air interface, and can be subsequently deposited onto a dry substrate isolated from solution. The design of an apparatus used for molecular threading is presented, and fluorescence and electron microscopies are used to characterize the angular distribution, straightness, and reproducibility of stretched DNA deposited in arrays onto elastomeric surfaces and thin membranes. Molecular threading demonstrates high straightness and uniformity over length scales from nanometers to micrometers, and represents an alternative to existing DNA deposition and linearization methods. These results point towards scalable and high-throughput precision manipulation of single-molecule polymers.
Molecule counting with alkanethiol and DNA immobilized on gold microplates for extended gate FET.
Cao, Zhong; Xiao, Zhong-Liang; Zhang, Ling; Luo, Dong-Mei; Kamahori, Masao; Shimoda, Maki
2013-04-01
Several molecule counting methods based on electrochemical characterization of alkanethiol and thiolated single-stranded oligonucleotide (HS-ssDNA) immobilized on gold microplates, which were used as extended gates of field effect transistors (FETs), have been investigated in this paper. The surface density of alkanethiol and DNA monolayers on gold microplates were quantitatively evaluated from the reductive desorption charge by using cyclic voltammetry (CV) and fast CV (FCV) methods in strong alkali solution. Typically, the surface density of 6-hydroxy-1-hexanethiol (6-HHT) was evaluated to be 4.639 molecules/nm(2), and the 28 base-pair dsDNA about 1.226-4.849 molecules/100 nm(2) on Au microplates after post-treatment with 6-HHT. The behaviors on surface potential and capacitance of different aminoalkanethiols on Au microplates were measured in 0.1 mol/L Na2SO4 and 10 mmol/L Tris-HCl (pH=7.4) solutions, indicating that the surface potential increases and the double-layer capacitance decreases with the length of carbon chain increased for the thiol monolayers, which obey a physics relationship for a capacitor. Comparably, a simple sensing method based on the electronic signals of biochemical reaction events on DNA immobilization and hybridization at the Au surface of the extended gate FET (EGFET) was developed, with which the surface density of the hybridized dsDNA on the gold surface of the EGFET was evaluated to be 1.36 molecules per 100 nm(2), showing that the EGFET is a promising sensing biochip for DNA molecule counting. Copyright © 2012 Elsevier B.V. All rights reserved.
Probing the dynamics of restriction endonuclease NgoMIV-DNA interaction by single-molecule FRET.
Tutkus, Marijonas; Sasnauskas, Giedrius; Rutkauskas, Danielis
2017-12-01
Many type II restriction endonucleases require two copies of their recognition sequence for optimal activity. Concomitant binding of two DNA sites by such an enzyme produces a DNA loop. Here we exploit single-molecule Förster resonance energy transfer (smFRET) of surface-immobilized DNA fragments to study the dynamics of DNA looping induced by tetrameric endonuclease NgoMIV. We have employed a DNA fragment with two NgoMIV recognition sites and a FRET dye pair such that upon protein-induced DNA looping the dyes are brought to close proximity resulting in a FRET signal. The dynamics of DNA-NgoMIV interactions proved to be heterogeneous, with individual smFRET trajectories exhibiting broadly different average looped state durations. Distinct types of the dynamics were attributed to different types of DNA-protein complexes, mediated either by one NgoMIV tetramer simultaneously bound to two specific sites ("slow" trajectories) or by semi-specific interactions of two DNA-bound NgoMIV tetramers ("fast" trajectories), as well as to conformational heterogeneity of individual NgoMIV molecules. © 2017 Wiley Periodicals, Inc.
Live-Cell Imaging of DNA Methylation Based on Synthetic-Molecule/Protein Hybrid Probe.
Kumar, Naresh; Hori, Yuichiro; Kikuchi, Kazuya
2018-06-04
The epigenetic modification of DNA involves the conversion of cytosine to 5-methylcytosine, also known as DNA methylation. DNA methylation is important in modulating gene expression and thus, regulating genome and cellular functions. Recent studies have shown that aberrations in DNA methylation are associated with various epigenetic disorders or diseases including cancer. This stimulates great interest in the development of methods that can detect and visualize DNA methylation. For instance, fluorescent proteins (FPs) in conjugation with methyl-CpG-binding domain (MBD) have been employed for live-cell imaging of DNA methylation. However, the FP-based approach showed fluorescence signals for both the DNA-bound and -unbound states and thus differentiation between these states is difficult. Synthetic-molecule/protein hybrid probes can provide an alternative to overcome this restriction. In this article, we discuss the synthetic-molecule/protein hybrid probe that we developed recently for live-cell imaging of DNA methylation, which exhibited fluorescence enhancement only after binding to methylated DNA. © 2018 The Chemical Society of Japan & Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
ERIC Educational Resources Information Center
Brinner, Bonnie
1992-01-01
Presents an activity in which models help students visualize both the DNA process and transcription. After constructing DNA, RNA messenger, and RNA transfer molecules; students model cells, protein synthesis, codons, and RNA movement. (MDH)
Light-Triggered Release of DNA from Plasmon-Resonant Nanoparticles
NASA Astrophysics Data System (ADS)
Huschka, Ryan
Plasmon-resonant nanoparticle complexes show promising potential for lighttriggered, controllable delivery of deoxyribonucleic acids (DNA) for research and therapeutic purposes. For example, the approach of RNA interference (RNAi) . using antisense DNA or RNA oligonucleotides to silence activity of a specific pathogenic gene transcript and reduce expression of the encoded protein . is very useful in dissecting genetic function and holds promise as a molecular therapeutic. Herein, we investigate the mechanism and probe the in vitro therapeutic potential of DNA light-triggered release from plasmonic nanoparticles. First, we investigate the mechanism of light-triggered release by dehybridizing double-stranded (dsDNA) via laser illumination from two types of nanoparticle substrates: gold (Au) nanoshells and Au nanorods. Both light-triggered and thermally induced releases are distinctly observable from nanoshell-based complexes. Surprisingly, no analogous measurable light-triggered release was observable from nanorod-based complexes below the DNA melting temperature. These results suggest that a nonthermal mechanism may play a role in light-triggered DNA release. Second, we demonstrate the in vitro light-triggered release of molecules noncovalently attached within dsDNA bound to the Au nanoshell surface. DAPI (4',6- diamidino-2-phenylindole), a bright blue fluorescent molecule that binds reversibly to double-stranded DNA, was chosen to visualize this intracellular light-induced release process. Illumination through the cell membrane of the nanoshell-dsDNA-DAPI complexes dehybridizes the DNA and releases the DAPI molecules within living cells. The DAPI molecules diffuse to the nucleus and associate with the cell's endogenous DNA. This work could have future applications towards drug delivery of molecules that associate with dsDNA. Finally, we demonstrate an engineered Au nanoshell (AuNS)-based therapeutic oligonucleotide delivery vehicle, designed to release its cargo on demand upon illumination with a near-infrared (NIR) laser. A poly(L)lysine peptide (PLL) epilayer coated onto the AuNS surface (AuNS-PLL) is used to capture intact, single-stranded antisense DNA oligonucleotide, or alternatively, double-stranded short-interfering RNA (siRNA) molecules. A green fluorescent protein (GFP)-expressing human lung cancer H1299 cell line was used to determine cellular uptake and GFP gene silencing mediated by AuNS-PLL delivery vector. The light-triggered release of oligonucleotides could have broad applications in the study of cellular processes and in the development of intracellular targeted therapies.
Wang, Guihong; Li, Chaoqun; Wang, Yan; Chen, Guangju
2013-01-01
Background Smads, the homologs of Sma and MAD proteins, play a key role in gene expression regulation in the transforming growth factor-β (TGF-β) signaling pathway. Recent experimental studies have revealed that Smad4/R-Smad heterodimers bound on DNA are energetically more favorable than homodimeric R-Smad/R-Smad complexes bound on DNA, which indicates that Smad4 might act as binding vehicle to cooperatively assemble with activated R-Smads on DNA in the nucleus. However, the details of interaction mechanism for cooperative recruitment of Smad4 protein to R-Smad proteins on DNA, and allosteric communication between the Smad4-DNA and R-Smad-DNA interfaces via DNA mediating are not yet clear so far. Methodology In the present work, we have constructed a series of Smadn+DNA+Smadn (n = 1, 3, 4) models and carried out molecular dynamics simulations, free energy calculations and DNA dynamics analysis for them to study the interaction properties of Smadn (n = 1, 3, 4) with DNA molecule. Results The results revealed that the binding of Smad4 protein to DNA molecule facilitates energetically the formation of the heteromeric Smad4+DNA+Smad1/3 complex by increasing the affinity of Smad1/3 with DNA molecule. Further investigations through the residue/base motion correlation and DNA dynamics analyses predicted that the binding of Smad4 protein to DNA molecule in the heteromeric Smad4+DNA+Smad1/3 model induces an allosteric communication from the Smad4-DNA interface to Smad1/Smad3-DNA interface via DNA base-pair helical motions, surface conformation changes and new hydrogen bond formations. The present work theoretically explains the mechanism of cooperative recruitment of Smad4 protein to Smad1/3 protein via DNA-mediated indirect readout mode in the nucleus. PMID:23326519
The complete mitochondrial genome of Hydra vulgaris (Hydroida: Hydridae).
Pan, Hong-Chun; Fang, Hong-Yan; Li, Shi-Wei; Liu, Jun-Hong; Wang, Ying; Wang, An-Tai
2014-12-01
The complete mitochondrial genome of Hydra vulgaris (Hydroida: Hydridae) is composed of two linear DNA molecules. The mitochondrial DNA (mtDNA) molecule 1 is 8010 bp long and contains six protein-coding genes, large subunit rRNA, methionine and tryptophan tRNAs, two pseudogenes consisting respectively of a partial copy of COI, and terminal sequences at two ends of the linear mtDNA, while the mtDNA molecule 2 is 7576 bp long and contains seven protein-coding genes, small subunit rRNA, methionine tRNA, a pseudogene consisting of a partial copy of COI and terminal sequences at two ends of the linear mtDNA. COI gene begins with GTG as start codon, whereas other 12 protein-coding genes start with a typical ATG initiation codon. In addition, all protein-coding genes are terminated with TAA as stop codon.
Zheng, Haocheng; Goldner, Lori S; Leuba, Sanford H
2007-03-01
Many technical improvements in fluorescence microscopy over the years have focused on decreasing background and increasing the signal to noise ratio (SNR). The scanning confocal fluorescence microscope (SCFM) represented a major improvement in these efforts. The SCFM acquires signal from a thin layer of a thick sample, rejecting light whose origin is not in the focal plane thereby dramatically decreasing the background signal. A second major innovation was the advent of high quantum-yield, low noise, single-photon counting detectors. The superior background rejection of SCFM combined with low-noise, high-yield detectors makes it possible to detect the fluorescence from single-dye molecules. By labeling a DNA molecule or a DNA/protein complex with a donor/acceptor dye pair, fluorescence resonance energy transfer (FRET) can be used to track conformational changes in the molecule/complex itself, on a single molecule/complex basis. In this methods paper, we describe the core concepts of SCFM in the context of a study that uses FRET to reveal conformational fluctuations in individual Holliday junction DNA molecules and nucleosomal particles. We also discuss data processing methods for SCFM.
Single-molecule DNA detection with an engineered MspA protein nanopore
Butler, Tom Z.; Pavlenok, Mikhail; Derrington, Ian M.; Niederweis, Michael; Gundlach, Jens H.
2008-01-01
Nanopores hold great promise as single-molecule analytical devices and biophysical model systems because the ionic current blockades they produce contain information about the identity, concentration, structure, and dynamics of target molecules. The porin MspA of Mycobacterium smegmatis has remarkable stability against environmental stresses and can be rationally modified based on its crystal structure. Further, MspA has a short and narrow channel constriction that is promising for DNA sequencing because it may enable improved characterization of short segments of a ssDNA molecule that is threaded through the pore. By eliminating the negative charge in the channel constriction, we designed and constructed an MspA mutant capable of electronically detecting and characterizing single molecules of ssDNA as they are electrophoretically driven through the pore. A second mutant with additional exchanges of negatively-charged residues for positively-charged residues in the vestibule region exhibited a factor of ≈20 higher interaction rates, required only half as much voltage to observe interaction, and allowed ssDNA to reside in the vestibule ≈100 times longer than the first mutant. Our results introduce MspA as a nanopore for nucleic acid analysis and highlight its potential as an engineerable platform for single-molecule detection and characterization applications. PMID:19098105
Procedure for normalization of cDNA libraries
Bonaldo, M.D.; Soares, M.B.
1997-12-30
This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library. 1 fig.
Definition of the persistence length in the coarse-grained models of DNA elasticity.
Fathizadeh, A; Eslami-Mossallam, B; Ejtehadi, M R
2012-11-01
By considering the detailed structure of DNA in the base pair level, two possible definitions of the persistence length are compared. One definition is related to the orientation of the terminal base pairs, and the other is based on the vectors which connect two adjacent base pairs at each end of the molecule. It is shown that although these definitions approach each other for long DNA molecules, they are dramatically different on short length scales. We show analytically that the difference mostly comes from the shear flexibility of the molecule and can be used to measure the shear modulus of DNA.
DNA motion capture reveals the mechanical properties of DNA at the mesoscale.
Price, Allen C; Pilkiewicz, Kevin R; Graham, Thomas G W; Song, Dan; Eaves, Joel D; Loparo, Joseph J
2015-05-19
Single-molecule studies probing the end-to-end extension of long DNAs have established that the mechanical properties of DNA are well described by a wormlike chain force law, a polymer model where persistence length is the only adjustable parameter. We present a DNA motion-capture technique in which DNA molecules are labeled with fluorescent quantum dots at specific sites along the DNA contour and their positions are imaged. Tracking these positions in time allows us to characterize how segments within a long DNA are extended by flow and how fluctuations within the molecule are correlated. Utilizing a linear response theory of small fluctuations, we extract elastic forces for the different, ∼2-μm-long segments along the DNA backbone. We find that the average force-extension behavior of the segments can be well described by a wormlike chain force law with an anomalously small persistence length. Copyright © 2015 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Effect of DNA-CTMA complex on optical properties of LDS 821 dye
NASA Astrophysics Data System (ADS)
Udayan, Sony; Ramachandran, Vijesh Kavumoottil; Sebastian, Mathew; Chandran, Pradeep; Nampoori, Vadakkedath Parameswaran Narayanan; Thomas, Sheenu
2017-07-01
We have investigated the fluorescence behavior of LDS 821 dye (Styryl 9 M) with deoxyribonucleic acid attached with cetyltrimethyl-ammonium (DNA-CTMA). Optical absorption studies confirm the intercalation of the dye molecules with DNA-CTMA. Fluorescence studies show an enhancement of fluorescence intensity of dye with DNA-CTMA, which suggest the reduction of TICT states of the dye molecule. The FWHM of the fluorescence spectrum increases from 95 nm to 161 nm indicating the formation of new energy levels when DNA-CTMA forms a complex with LDS 821 dye. Fluorescence lifetime measurements shows that lifetime of LDS 821 varies from 507ps to 953 ps with the addition of DNA-CTMA, which also confirms the deactivation of TICT states of dye molecule. Results show that the incorporation of DNA-CTMA with LDS 821 dye improves the optical characteristics of LDS 821 dye and therefore, can be used as a good fluorescence probe for DNA visualization as well as in lasing applications.
Digital DNA detection based on a compact optofluidic laser with ultra-low sample consumption.
Lee, Wonsuk; Chen, Qiushu; Fan, Xudong; Yoon, Dong Ki
2016-11-29
DNA lasers self-amplify optical signals from a DNA analyte as well as thermodynamic differences between sequences, allowing quasi-digital DNA detection. However, these systems have drawbacks, such as relatively large sample consumption and complicated dye labelling. Moreover, although the lasing signal can detect the target DNA, it is superimposed on an unintended fluorescence background, which persists for non-target DNA samples as well. From an optical point of view, it is thus not truly digital detection and requires spectral analysis to identify the target. In this work, we propose and demonstrate an optofluidic laser that has a single layer of DNA molecules as the gain material. A target DNA produces intensive laser emission comparable to existing DNA lasers, while any unnecessary fluorescence background is successfully suppressed. As a result, the target DNA can be detected with a single laser pulse, in a truly digital manner. Since the DNA molecules cover only a single layer on the surface of the laser microcavity, the DNA sample consumption is a few orders of magnitude lower than that of existing DNA lasers. Furthermore, the DNA molecules are stained by simply immersing the microcavity in the intercalating dye solution, and thus the proposed DNA laser is free of any complex dye-labelling process prior to analysis.
Nano-funnels as electro-osmotic ``tweezers and pistons''
NASA Astrophysics Data System (ADS)
Wang, Yanqian; Panyukov, Sergey; Zhou, Jinsheng; Menard, Laurent D.; Ramsey, J. Michael; Rubinstien, Michael
2014-03-01
An electric field is used to force a DNA molecule into a nano-channel by compensating the free energy penalty that results from the reduced conformational entropy of the confined macromolecule. Narrow nano-channels require high critical electric fields to achieve DNA translocation, leading to short dwell times of DNA in these channels. We demonstrate that nano-funnels integrated with nano-channels reduce the free energy barrier and lower the critical electric field required for DNA translocation. A focused electric field within the funnel increases the electric force on the DNA, compresses the molecule, and increases the osmotic pressure at the nano-channel entrance. This ``electro-osmotic piston'' forces the molecule into the nano-channel at lower electric fields than those observed without the funnel. Appropirately designed nano-funnels can also function as tweezers that allow manipulation of the position of the DNA molecule. The predictions of our theory describing double-stranded DNA behavior in nano-funnel - nano-channel devices are consistent with experimental results. Thanks for the financial support from NSF (DMR-1309892, DMR-1121107, DMR-1122483), NIH (1-P50-HL107168, 1-P01-HL108808-01A1, R01HG02647), NHGRI and CF Foundation.
Model systems for single molecule polymer dynamics
Latinwo, Folarin
2012-01-01
Double stranded DNA (dsDNA) has long served as a model system for single molecule polymer dynamics. However, dsDNA is a semiflexible polymer, and the structural rigidity of the DNA double helix gives rise to local molecular properties and chain dynamics that differ from flexible chains, including synthetic organic polymers. Recently, we developed single stranded DNA (ssDNA) as a new model system for single molecule studies of flexible polymer chains. In this work, we discuss model polymer systems in the context of “ideal” and “real” chain behavior considering thermal blobs, tension blobs, hydrodynamic drag and force–extension relations. In addition, we present monomer aspect ratio as a key parameter describing chain conformation and dynamics, and we derive dynamical scaling relations in terms of this molecular-level parameter. We show that asymmetric Kuhn segments can suppress monomer–monomer interactions, thereby altering global chain dynamics. Finally, we discuss ssDNA in the context of a new model system for single molecule polymer dynamics. Overall, we anticipate that future single polymer studies of flexible chains will reveal new insight into the dynamic behavior of “real” polymers, which will highlight the importance of molecular individualism and the prevalence of non-linear phenomena. PMID:22956980
Sett, S.; Ghosh, S.; Rakshit, T.; Mukhopadhyay, R.
2016-01-01
DNA threading intercalators are a unique class of intercalating agents, albeit little biophysical information is available on their intercalative actions. Herein, the intercalative effects of nogalamycin, which is a naturally-occurring DNA threading intercalator, have been investigated by high-resolution atomic force microscopy (AFM) and spectroscopy (AFS). The results have been compared with those of the well-known chemotherapeutic drug daunomycin, which is a non-threading classical intercalator bearing structural similarity to nogalamycin. A comparative AFM assessment revealed a greater increase in DNA contour length over the entire incubation period of 48 h for nogalamycin treatment, whereas the contour length increase manifested faster in case of daunomycin. The elastic response of single DNA molecules to an externally applied force was investigated by the single molecule AFS approach. Characteristic mechanical fingerprints in the overstretching behaviour clearly distinguished the nogalamycin/daunomycin-treated dsDNA from untreated dsDNA—the former appearing less elastic than the latter, and the nogalamycin-treated DNA distinguished from the daunomycin-treated DNA—the classically intercalated dsDNA appearing the least elastic. A single molecule AFS-based discrimination of threading intercalation from the classical type is being reported for the first time. PMID:27183010
Histone H3 phosphorylation near the nucleosome dyad alters chromatin structure
North, Justin A.; Šimon, Marek; Ferdinand, Michelle B.; Shoffner, Matthew A.; Picking, Jonathan W.; Howard, Cecil J.; Mooney, Alex M.; van Noort, John; Poirier, Michael G.; Ottesen, Jennifer J.
2014-01-01
Nucleosomes contain ∼146 bp of DNA wrapped around a histone protein octamer that controls DNA accessibility to transcription and repair complexes. Posttranslational modification (PTM) of histone proteins regulates nucleosome function. To date, only modest changes in nucleosome structure have been directly attributed to histone PTMs. Histone residue H3(T118) is located near the nucleosome dyad and can be phosphorylated. This PTM destabilizes nucleosomes and is implicated in the regulation of transcription and repair. Here, we report gel electrophoretic mobility, sucrose gradient sedimentation, thermal disassembly, micrococcal nuclease digestion and atomic force microscopy measurements of two DNA–histone complexes that are structurally distinct from nucleosomes. We find that H3(T118ph) facilitates the formation of a nucleosome duplex with two DNA molecules wrapped around two histone octamers, and an altosome complex that contains one DNA molecule wrapped around two histone octamers. The nucleosome duplex complex forms within short ∼150 bp DNA molecules, whereas altosomes require at least ∼250 bp of DNA and form repeatedly along 3000 bp DNA molecules. These results are the first report of a histone PTM significantly altering the nucleosome structure. PMID:24561803
Model Checking Temporal Logic Formulas Using Sticker Automata
Feng, Changwei; Wu, Huanmei
2017-01-01
As an important complex problem, the temporal logic model checking problem is still far from being fully resolved under the circumstance of DNA computing, especially Computation Tree Logic (CTL), Interval Temporal Logic (ITL), and Projection Temporal Logic (PTL), because there is still a lack of approaches for DNA model checking. To address this challenge, a model checking method is proposed for checking the basic formulas in the above three temporal logic types with DNA molecules. First, one-type single-stranded DNA molecules are employed to encode the Finite State Automaton (FSA) model of the given basic formula so that a sticker automaton is obtained. On the other hand, other single-stranded DNA molecules are employed to encode the given system model so that the input strings of the sticker automaton are obtained. Next, a series of biochemical reactions are conducted between the above two types of single-stranded DNA molecules. It can then be decided whether the system satisfies the formula or not. As a result, we have developed a DNA-based approach for checking all the basic formulas of CTL, ITL, and PTL. The simulated results demonstrate the effectiveness of the new method. PMID:29119114
Kunig, Verena; Potowski, Marco; Gohla, Anne; Brunschweiger, Andreas
2018-06-27
DNA-encoded compound libraries are a highly attractive technology for the discovery of small molecule protein ligands. These compound collections consist of small molecules covalently connected to individual DNA sequences carrying readable information about the compound structure. DNA-tagging allows for efficient synthesis, handling and interrogation of vast numbers of chemically synthesized, drug-like compounds. They are screened on proteins by an efficient, generic assay based on Darwinian principles of selection. To date, selection of DNA-encoded libraries allowed for the identification of numerous bioactive compounds. Some of these compounds uncovered hitherto unknown allosteric binding sites on target proteins; several compounds proved their value as chemical biology probes unraveling complex biology; and the first examples of clinical candidates that trace their ancestry to a DNA-encoded library were reported. Thus, DNA-encoded libraries proved their value for the biomedical sciences as a generic technology for the identification of bioactive drug-like molecules numerous times. However, large scale experiments showed that even the selection of billions of compounds failed to deliver bioactive compounds for the majority of proteins in an unbiased panel of target proteins. This raises the question of compound library design.
Saftic, Dijana; Ban, Zeljka; Matic, Josipa; Tumir, Lidija-Marija; Piantanida, Ivo
2018-05-07
Among the most intensively studied classes of small molecules (molecular weight < 650) in biomedical research are small molecules that non-covalently bind to DNA/RNA, and another intensively studied class are nucleobase derivatives. Both classes have been intensively elaborated in many books and reviews. However, conjugates consisting of DNA/RNA binder covalently linked to nucleobase are much less studied and have not been reviewed in the last two decades. Therefore, this review summarized reports on the design of classical DNA/RNA binder - nucleobase conjugates, as well as data about their interactions with various DNA or RNA targets, and even in some cases protein targets involved. According to these data, the most important structural aspects of selective or even specific recognition between small molecule and target are proposed, and where possible related biochemical and biomedical aspects were discussed. The general conclusion is that this, rather new class of molecules showed an amazing set of recognition tools for numerous DNA or RNA targets in the last two decades, as well as few intriguing in vitro and in vivo selectivities. Several lead research lines show promising advancements toward either novel, highly selective markers or bioactive, potentially druggable molecules. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Single-molecule study of thymidine glycol and i-motif through the alpha-hemolysin ion channel
NASA Astrophysics Data System (ADS)
He, Lidong
Nanopore-based devices have emerged as a single-molecule detection and analysis tool for a wide range of applications. Through electrophoretically driving DNA molecules across a nanosized pore, a lot of information can be received, including unfolding kinetics and DNA-protein interactions. This single-molecule method has the potential to sequence kilobase length DNA polymers without amplification or labeling, approaching "the third generation" genome sequencing for around $1000 within 24 hours. alpha-Hemolysin biological nanopores have the advantages of excellent stability, low-noise level, and precise site-directed mutagenesis for engineering this protein nanopore. The first work presented in this thesis established the current signal of the thymidine glycol lesion in DNA oligomers through an immobilization experiment. The thymidine glycol enantiomers were differentiated from each other by different current blockage levels. Also, the effect of bulky hydrophobic adducts to the current blockage was investigated. Secondly, the alpha-hemolysin nanopore was used to study the human telomere i-motif and RET oncogene i-motif at a single-molecule level. In Chapter 3, it was demonstrated that the alpha-hemolysin nanopore can differentiate an i-motif form and single-strand DNA form at different pH values based on the same sequence. In addition, it shows potential to differentiate the folding topologies generated from the same DNA sequence.
DNA curtains for high-throughput single-molecule optical imaging.
Greene, Eric C; Wind, Shalom; Fazio, Teresa; Gorman, Jason; Visnapuu, Mari-Liis
2010-01-01
Single-molecule approaches provide a valuable tool in the arsenal of the modern biologist, and new discoveries continue to be made possible through the use of these state-of-the-art technologies. However, it can be inherently difficult to obtain statistically relevant data from experimental approaches specifically designed to probe individual reactions. This problem is compounded with more complex biochemical reactions, heterogeneous systems, and/or reactions requiring the use of long DNA substrates. Here we give an overview of a technology developed in our laboratory, which relies upon simple micro- or nanofabricated structures in combination with "bio-friendly" lipid bilayers, to align thousands of long DNA molecules into defined patterns on the surface of a microfluidic sample chamber. We call these "DNA curtains," and we have developed several different versions varying in complexity and DNA substrate configuration, which are designed to meet different experimental needs. This novel approach to single-molecule imaging provides a powerful experimental platform that offers the potential for concurrent observation of hundreds or even thousands of protein-DNA interactions in real time. Copyright 2010 Elsevier Inc. All rights reserved.
Attomole-level Genomics with Single-molecule Direct DNA, cDNA and RNA Sequencing Technologies.
Ozsolak, Fatih
2016-01-01
With the introduction of next-generation sequencing (NGS) technologies in 2005, the domination of microarrays in genomics quickly came to an end due to NGS's superior technical performance and cost advantages. By enabling genetic analysis capabilities that were not possible previously, NGS technologies have started to play an integral role in all areas of biomedical research. This chapter outlines the low-quantity DNA and cDNA sequencing capabilities and applications developed with the Helicos single molecule DNA sequencing technology.
Molecular modelling study of changes induced by netropsin binding to nucleosome core particles.
Pérez, J J; Portugal, J
1990-01-01
It is well known that certain sequence-dependent modulators in structure appear to determine the rotational positioning of DNA on the nucleosome core particle. That preference is rather weak and could be modified by some ligands as netropsin, a minor-groove binding antibiotic. We have undertaken a molecular modelling approach to calculate the relative energy of interaction between a DNA molecule and the protein core particle. The histones particle is considered as a distribution of positive charges on the protein surface that interacts with the DNA molecule. The molecular electrostatic potentials for the DNA, simulated as a discontinuous cylinder, were calculated using the values for all the base pairs. Computing these parameters, we calculated the relative energy of interaction and the more stable rotational setting of DNA. The binding of four molecules of netropsin to this model showed that a new minimum of energy is obtained when the DNA turns toward the protein surface by about 180 degrees, so a new energetically favoured structure appears where netropsin binding sites are located facing toward the histones surface. The effect of netropsin could be explained in terms of an induced change in the phasing of DNA on the core particle. The induced rotation is considered to optimize non-bonded contacts between the netropsin molecules and the DNA backbone. PMID:2165249
Genome amplification of single sperm using multiple displacement amplification.
Jiang, Zhengwen; Zhang, Xingqi; Deka, Ranjan; Jin, Li
2005-06-07
Sperm typing is an effective way to study recombination rate on a fine scale in regions of interest. There are two strategies for the amplification of single meiotic recombinants: repulsion-phase allele-specific PCR and whole genome amplification (WGA). The former can selectively amplify single recombinant molecules from a batch of sperm but is not scalable for high-throughput operation. Currently, primer extension pre-amplification is the only method used in WGA of single sperm, whereas it has limited capacity to produce high-coverage products enough for the analysis of local recombination rate in multiple large regions. Here, we applied for the first time a recently developed WGA method, multiple displacement amplification (MDA), to amplify single sperm DNA, and demonstrated its great potential for producing high-yield and high-coverage products. In a 50 mul reaction, 76 or 93% of loci can be amplified at least 2500- or 250-fold, respectively, from single sperm DNA, and second-round MDA can further offer >200-fold amplification. The MDA products are usable for a variety of genetic applications, including sequencing and microsatellite marker and single nucleotide polymorphism (SNP) analysis. The use of MDA in single sperm amplification may open a new era for studies on local recombination rates.
Soares, Marcelo Bento; Bonaldo, Maria de Fatima
1998-01-01
This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods.
Soares, M.B.; Fatima Bonaldo, M. de
1998-12-08
This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods. 25 figs.
42 CFR 66.207 - Other HHS regulations and policies that apply.
Code of Federal Regulations, 2011 CFR
2011-10-01
... Federal financial assistance 48 FR 24556—Guidelines for Research Involving Recombinant DNA Molecules... Involving Recombinant DNA Molecules. Note: This policy is subject to change, and interested persons should...
42 CFR 66.207 - Other HHS regulations and policies that apply.
Code of Federal Regulations, 2010 CFR
2010-10-01
... Federal financial assistance 48 FR 24556—Guidelines for Research Involving Recombinant DNA Molecules... Involving Recombinant DNA Molecules. Note: This policy is subject to change, and interested persons should...
42 CFR 66.207 - Other HHS regulations and policies that apply.
Code of Federal Regulations, 2013 CFR
2013-10-01
... Federal financial assistance 48 FR 24556—Guidelines for Research Involving Recombinant DNA Molecules... Involving Recombinant DNA Molecules. Note: This policy is subject to change, and interested persons should...
42 CFR 66.207 - Other HHS regulations and policies that apply.
Code of Federal Regulations, 2012 CFR
2012-10-01
... Federal financial assistance 48 FR 24556—Guidelines for Research Involving Recombinant DNA Molecules... Involving Recombinant DNA Molecules. Note: This policy is subject to change, and interested persons should...
42 CFR 66.207 - Other HHS regulations and policies that apply.
Code of Federal Regulations, 2014 CFR
2014-10-01
... Federal financial assistance 48 FR 24556—Guidelines for Research Involving Recombinant DNA Molecules... Involving Recombinant DNA Molecules. Note: This policy is subject to change, and interested persons should...
Fixed-Gap Tunnel Junction for Reading DNA Nucleotides
2015-01-01
Previous measurements of the electronic conductance of DNA nucleotides or amino acids have used tunnel junctions in which the gap is mechanically adjusted, such as scanning tunneling microscopes or mechanically controllable break junctions. Fixed-junction devices have, at best, detected the passage of whole DNA molecules without yielding chemical information. Here, we report on a layered tunnel junction in which the tunnel gap is defined by a dielectric layer, deposited by atomic layer deposition. Reactive ion etching is used to drill a hole through the layers so that the tunnel junction can be exposed to molecules in solution. When the metal electrodes are functionalized with recognition molecules that capture DNA nucleotides via hydrogen bonds, the identities of the individual nucleotides are revealed by characteristic features of the fluctuating tunnel current associated with single-molecule binding events. PMID:25380505
Controlled enzymatic cutting of DNA molecules adsorbed on surfaces using soft lithography
NASA Astrophysics Data System (ADS)
Auerbach, Alyssa; Budassi, Julia; Shea, Emily; Zhu, Ke; Sokolov, Jonathan
2013-03-01
The enzyme DNase I was applied to adsorbed and aligned DNA molecules (Lamda, 48.5 kilobase pairs (kbp), and T4, 165.6 kbp), stretched linearly on a surface, by stamping with a polydimethylsiloxane (PDMS) grating. The DNAs were cut by the enzyme into separated, micron-sized segments along the length of the molecules at positions determined by the grating dimensions (3-20 microns). Ozone-treated PDMS stamps were coated with DNase I solutions and placed in contact with surface-adsorbed DNA molecules deposited on a 750 polymethylmethacrylate (PMMA) film spun-cast onto a silicon substrate. The stamps were applied under pressure for times up to 15 minutes at 37 C. The cutting was observed by fluorescence microscopy imaging of DNA labeled with YOYO dye. Cutting was found to be efficient despite the steric hindrance due to surface attachment of the molecules. Methods for detaching and separating the cut segments for sequencing applications will be discussed. Supported by NSF-DMR program.
Kollmann, Christopher S; Bai, Xiaopeng; Tsai, Ching-Hsuan; Yang, Hongfang; Lind, Kenneth E; Skinner, Steven R; Zhu, Zhengrong; Israel, David I; Cuozzo, John W; Morgan, Barry A; Yuki, Koichi; Xie, Can; Springer, Timothy A; Shimaoka, Motomu; Evindar, Ghotas
2014-04-01
The inhibition of protein-protein interactions remains a challenge for traditional small molecule drug discovery. Here we describe the use of DNA-encoded library technology for the discovery of small molecules that are potent inhibitors of the interaction between lymphocyte function-associated antigen 1 and its ligand intercellular adhesion molecule 1. A DNA-encoded library with a potential complexity of 4.1 billion compounds was exposed to the I-domain of the target protein and the bound ligands were affinity selected, yielding an enriched small-molecule hit family. Compounds representing this family were synthesized without their DNA encoding moiety and found to inhibit the lymphocyte function-associated antigen 1/intercellular adhesion molecule-1 interaction with submicromolar potency in both ELISA and cell adhesion assays. Re-synthesized compounds conjugated to DNA or a fluorophore were demonstrated to bind to cells expressing the target protein. Copyright © 2014 Elsevier Ltd. All rights reserved.
Integrity and Biological Activity of DNA after UV Exposure
NASA Astrophysics Data System (ADS)
Lyon, Delina Y.; Monier, Jean-Michel; Dupraz, Sébastien; Freissinet, Caroline; Simonet, Pascal; Vogel, Timothy M.
2010-04-01
The field of astrobiology lacks a universal marker with which to indicate the presence of life. This study supports the proposal to use nucleic acids, specifically DNA, as a signature of life (biosignature). In addition to its specificity to living organisms, DNA is a functional molecule that can confer new activities and characteristics to other organisms, following the molecular biology dogma, that is, DNA is transcribed to RNA, which is translated into proteins. Previous criticisms of the use of DNA as a biosignature have asserted that DNA molecules would be destroyed by UV radiation in space. To address this concern, DNA in plasmid form was deposited onto different surfaces and exposed to UVC radiation. The surviving DNA was quantified via the quantitative polymerase chain reaction (qPCR). Results demonstrate increased survivability of DNA attached to surfaces versus non-adsorbed DNA. The DNA was also tested for biological activity via transformation into the bacterium Acinetobacter sp. and assaying for antibiotic resistance conferred by genes encoded by the plasmid. The success of these methods to detect DNA and its gene products after UV exposure (254 nm, 3.5 J/m2s) not only supports the use of the DNA molecule as a biosignature on mineral surfaces but also demonstrates that the DNA retained biological activity.
Kawakami, Hironori; Su'etsugu, Masayuki; Katayama, Tsutomu
2006-10-01
In Escherichia coli, a complex consisting of Hda and the DNA-loaded clamp-subunit of the DNA polymerase III holoenzyme promotes hydrolysis of DnaA-ATP. The resultant ADP-DnaA is inactive for initiation of chromosomal DNA replication, thereby repressing excessive initiations. As the cellular content of the clamp is 10-100 times higher than that of Hda, most Hda molecules might be complexed with the clamp in vivo. Although Hda predominantly forms irregular aggregates when overexpressed, in the present study we found that co-overexpression of the clamp with Hda enhances Hda solubility dramatically and we efficiently isolated the Hda-clamp complex. A single molecule of the complex appears to consist of two Hda molecules and a single clamp. The complex is competent in DnaA-ATP hydrolysis and DNA replication in the presence of DNA and the clamp deficient subassembly of the DNA polymerase III holoenzyme (pol III*). These findings indicate that the clamp contained in the complex is loaded onto DNA through an interaction with the pol III* and that the Hda activity is preserved in these processes. The complex consisting of Hda and the DNA-unloaded clamp may play a specific role in a process proceeding to the DnaA-ATP hydrolysis in vivo.
Wu, Zining; Graybill, Todd L; Zeng, Xin; Platchek, Michael; Zhang, Jean; Bodmer, Vera Q; Wisnoski, David D; Deng, Jianghe; Coppo, Frank T; Yao, Gang; Tamburino, Alex; Scavello, Genaro; Franklin, G Joseph; Mataruse, Sibongile; Bedard, Katie L; Ding, Yun; Chai, Jing; Summerfield, Jennifer; Centrella, Paolo A; Messer, Jeffrey A; Pope, Andrew J; Israel, David I
2015-12-14
DNA-encoded small-molecule library technology has recently emerged as a new paradigm for identifying ligands against drug targets. To date, this technology has been used with soluble protein targets that are produced and used in a purified state. Here, we describe a cell-based method for identifying small-molecule ligands from DNA-encoded libraries against integral membrane protein targets. We use this method to identify novel, potent, and specific inhibitors of NK3, a member of the tachykinin family of G-protein coupled receptors (GPCRs). The method is simple and broadly applicable to other GPCRs and integral membrane proteins. We have extended the application of DNA-encoded library technology to membrane-associated targets and demonstrate the feasibility of selecting DNA-tagged, small-molecule ligands from complex combinatorial libraries against targets in a heterogeneous milieu, such as the surface of a cell.
Single-molecule live-cell imaging of bacterial DNA repair and damage tolerance.
Ghodke, Harshad; Ho, Han; van Oijen, Antoine M
2018-02-19
Genomic DNA is constantly under threat from intracellular and environmental factors that damage its chemical structure. Uncorrected DNA damage may impede cellular propagation or even result in cell death, making it critical to restore genomic integrity. Decades of research have revealed a wide range of mechanisms through which repair factors recognize damage and co-ordinate repair processes. In recent years, single-molecule live-cell imaging methods have further enriched our understanding of how repair factors operate in the crowded intracellular environment. The ability to follow individual biochemical events, as they occur in live cells, makes single-molecule techniques tremendously powerful to uncover the spatial organization and temporal regulation of repair factors during DNA-repair reactions. In this review, we will cover practical aspects of single-molecule live-cell imaging and highlight recent advances accomplished by the application of these experimental approaches to the study of DNA-repair processes in prokaryotes. © 2018 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.
An effective model of DNA like helicoidal structure: with length fluctuation nonlinearity
NASA Astrophysics Data System (ADS)
Tseytlin, Y. M.
2011-03-01
One of the natural helicoidal nanostructure, which thermomechanical features are studied carefully with the help of different mechanical models, is a DNA cell / molecule. Our study proves that the experimentally determined nonlinear fluctuations of the molecular length of DNA can be better understood by modeling the molecule as a helicoidal pretwisted nanostrip sensor with nonlinear function. The calculations presented here are in good agreement with the experimental data within 10%. Other used by many researchers mechanical models such as an elastic rod, wormlike chain (WLC), accordion bellows, or an elastic core wrapped with rigid wires do not show the possible variance nonlinearity of thermomechanical DNA molecular length fluctuations. We have found that the nonlinear variance of the length fluctuations is an intrinsic property of the micro-nano-sensors with helicoidal shape. This model allows us to estimate the persistence length and twist-stretch coupling of a DNA molecule as well. It also shows the molecule's overwinding possibility at initial stretching with correct numerical representation.
Unraveling DNA dynamics using atomic force microscopy.
Suzuki, Yuki; Yoshikawa, Yuko; Yoshimura, Shige H; Yoshikawa, Kenichi; Takeyasu, Kunio
2011-01-01
The elucidation of structure-function relationships of biological samples has become important issue in post-genomic researches. In order to unveil the molecular mechanisms controlling gene regulations, it is essential to understand the interplay between fundamental DNA properties and the dynamics of the entire molecule. The wide range of applicability of atomic force microscopy (AFM) has allowed us to extract physicochemical properties of DNA and DNA-protein complexes, as well as to determine their topographical information. Here, we review how AFM techniques have been utilized to study DNA and DNA-protein complexes and what types of analyses have accelerated the understanding of the DNA dynamics. We begin by illustrating the application of AFM to investigate the fundamental feature of DNA molecules; topological transition of DNA, length dependent properties of DNA molecules, flexibility of double-stranded DNA, and capability of the formation of non-Watson-Crick base pairing. These properties of DNA are critical for the DNA folding and enzymatic reactions. The technical advancement in the time-resolution of AFM and sample preparation methods enabled visual analysis of DNA-protein interactions at sub-second time region. DNA tension-dependent enzymatic reaction and DNA looping dynamics by restriction enzymes were examined at a nanoscale in physiological environments. Contribution of physical properties of DNA to dynamics of nucleosomes and transition of the higher-order structure of reconstituted chromatin are also reviewed. Copyright © 2011 John Wiley & Sons, Inc.
Single molecule fluorescence microscopy for ultra-sensitive RNA expression profiling
NASA Astrophysics Data System (ADS)
Hesse, Jan; Jacak, Jaroslaw; Regl, Gerhard; Eichberger, Thomas; Aberger, Fritz; Schlapak, Robert; Howorka, Stefan; Muresan, Leila; Frischauf, Anna-Maria; Schütz, Gerhard J.
2007-02-01
We developed a microarray analysis platform for ultra-sensitive RNA expression profiling of minute samples. It utilizes a novel scanning system for single molecule fluorescence detection on cm2 size samples in combination with specialized biochips, optimized for low autofluorescence and weak unspecific adsorption. 20 μg total RNA was extracted from 10 6 cells of a human keratinocyte cell line (HaCaT) and reversely transcribed in the presence of Alexa647-aha-dUTP. 1% of the resulting labeled cDNA was used for complex hybridization to a custom-made oligonucleotide microarray representing a set of 125 different genes. For low abundant genes, individual cDNA molecules hybridized to the microarray spots could be resolved. Single cDNA molecules hybridized to the chip surface appeared as diffraction limited features in the fluorescence images. The à trous wavelet method was utilized for localization and counting of the separated cDNA signals. Subsequently, the degree of labeling of the localized cDNA molecules was determined by brightness analysis for the different genes. Variations by factors up to 6 were found, which in conventional microarray analysis would result in a misrepresentation of the relative abundance of mRNAs.
Robinson, Nicholas P
2013-01-01
Branched DNA molecules are generated by the essential processes of replication and recombination. Owing to their distinctive extended shapes, these intermediates migrate differently from linear double-stranded DNA under certain electrophoretic conditions. However, these branched species exist in the cell at much low abundance than the bulk linear DNA. Consequently, branched molecules cannot be visualized by conventional electrophoresis and ethidium bromide staining. Two-dimensional native-native agarose electrophoresis has therefore been developed as a method to facilitate the separation and visualization of branched replication and recombination intermediates. A wide variety of studies have employed this technique to examine branched molecules in eukaryotic, archaeal, and bacterial cells, providing valuable insights into how DNA is duplicated and repaired in all three domains of life.
Lee, Wonbae; Gillies, John P.; Jose, Davis; Israels, Brett A.; von Hippel, Peter H.; Marcus, Andrew H.
2016-01-01
Gene 32 protein (gp32) is the single-stranded (ss) DNA binding protein of the bacteriophage T4. It binds transiently and cooperatively to ssDNA sequences exposed during the DNA replication process and regulates the interactions of the other sub-assemblies of the replication complex during the replication cycle. We here use single-molecule FRET techniques to build on previous thermodynamic studies of gp32 binding to initiate studies of the dynamics of the isolated and cooperative binding of gp32 molecules within the replication complex. DNA primer/template (p/t) constructs are used as models to determine the effects of ssDNA lattice length, gp32 concentration, salt concentration, binding cooperativity and binding polarity at p/t junctions. Hidden Markov models (HMMs) and transition density plots (TDPs) are used to characterize the dynamics of the multi-step assembly pathway of gp32 at p/t junctions of differing polarity, and show that isolated gp32 molecules bind to their ssDNA targets weakly and dissociate quickly, while cooperatively bound dimeric or trimeric clusters of gp32 bind much more tightly, can ‘slide’ on ssDNA sequences, and exhibit binding dynamics that depend on p/t junction polarities. The potential relationships of these binding dynamics to interactions with other components of the T4 DNA replication complex are discussed. PMID:27694621
Protein Detection via Direct Enzymatic Amplification of Short DNA Aptamers
Fischer, Nicholas O.; Tarasow, Theodore M.; Tok, Jeffrey B.-H.
2008-01-01
Aptamers are single-stranded nucleic acids that fold into defined tertiary structures to bind target molecules with high specificities and affinities. DNA aptamers have garnered much interest as recognition elements for biodetection and diagnostic applications due to their small size, ease of discovery and synthesis, and chemical and thermal stability. Herein, we describe the design and application of a short DNA molecule capable of both protein target binding and amplifiable bioreadout processes. As both recognition and readout capabilities are incorporated into a single DNA molecule, tedious conjugation procedures required for protein-DNA hybrids can be omitted. The DNA aptamer is designed to be amplified directly by either the polymerase chain reaction (PCR) or rolling circle amplification (RCA) processes, taking advantage of real-time amplification monitoring techniques for target detection. A combination of both RCA and PCR provides a wide protein target dynamic range (1 μM to 10 pM). PMID:17980857
DNA Structure and Supercoiling: Ribbons and a Yo-Yo Model
ERIC Educational Resources Information Center
Van Horn, J. David
2011-01-01
The double-helical structure of DNA is a pop cultural icon. Images of the DNA molecule appear in newspapers, popular journals, and advertisements. In addition to scientific instrument sales, the aura surrounding the central molecule of life has been used to sell everything from perfume to beverages and is the inspiration of items ranging from…
Izanloo, Cobra
2017-09-02
An understanding of the mechanism of DNA interactions with gold nanoparticles is useful in today medicine applications. We have performed a molecular dynamics simulation on a B-DNA duplex (CCTCAGGCCTCC) in the vicinity of a gold nanoparticle with a truncated octahedron structure composed of 201 gold atoms (diameter ∼1.8 nm) to investigate gold nanoparticle (GNP) effects on the stability of DNA. During simulation, the nanoparticle is closed to DNA and phosphate groups direct the particles into the major grooves of the DNA molecule. Because of peeling and untwisting states that are occur at end of DNA, the nucleotide base lies flat on the surface of GNP. The configuration entropy is estimated using the covariance matrix of atom-positional fluctuations for different bases. The results show that when a gold nanoparticle has interaction with DNA, entropy increases. The results of conformational energy and the hydrogen bond numbers for DNA indicated that DNA becomes unstable in the vicinity of a gold nanoparticle. The radial distribution function was calculated for water hydrogen-phosphate oxygen pairs. Almost for all nucleotide, the presence of a nanoparticle around DNA caused water molecules to be released from the DNA duplex and cations were close to the DNA.
Single molecule analysis of Thermus thermophilus SSB protein dynamics on single-stranded DNA.
Zhang, Jichuan; Zhou, Ruobo; Inoue, Jin; Mikawa, Tsutomu; Ha, Taekjip
2014-04-01
Single-stranded (ss) DNA binding (SSB) proteins play central roles in DNA replication, recombination and repair in all organisms. We previously showed that Escherichia coli (Eco) SSB, a homotetrameric bacterial SSB, undergoes not only rapid ssDNA-binding mode transitions but also one-dimensional diffusion (or migration) while remaining bound to ssDNA. Whereas the majority of bacterial SSB family members function as homotetramers, dimeric SSB proteins were recently discovered in a distinct bacterial lineage of extremophiles, the Thermus-Deinococcus group. Here we show, using single-molecule fluorescence resonance energy transfer (FRET), that homodimeric bacterial SSB from Thermus thermophilus (Tth) is able to diffuse spontaneously along ssDNA over a wide range of salt concentrations (20-500 mM NaCl), and that TthSSB diffusion can help transiently melt the DNA hairpin structures. Furthermore, we show that two TthSSB molecules undergo transitions among different DNA-binding modes while remaining bound to ssDNA. Our results extend our previous observations on homotetrameric SSBs to homodimeric SSBs, indicating that the dynamic features may be shared among different types of SSB proteins. These dynamic features of SSBs may facilitate SSB redistribution and removal on/from ssDNA, and help recruit other SSB-interacting proteins onto ssDNA for subsequent DNA processing in DNA replication, recombination and repair.
NASA Astrophysics Data System (ADS)
Zhao, Weian; Brook, Michael A.; Li, Yingfu
Periodical assembly of nanospecies is desirable for the construction of nanodevices. We provide a protocol for the preparation of a gold nanoparticle (AuNP)/DNA scaffold on which nanospecies can be assembled in a periodical manner. AuNP/DNA scaffold is prepared by growing long single-stranded DNA (ssDNA) molecules (typically hundreds of nanometers to a few microns in length) on AuNPs via rolling circle amplification (RCA). Since these long ssDNA molecules contain many repetitive sequence units, complementary DNA-attached nanospecies can be assembled through specific hybridization in a controllable and periodical manner.
NASA Astrophysics Data System (ADS)
Herold, Christoph; Schwille, Petra; Petrov, Eugene P.
2016-02-01
We present experimental results on the interaction of DNA macromolecules with cationic lipid membranes with different properties, including freestanding membranes in the fluid and gel state, and supported lipid membranes in the fluid state and under conditions of fluid-gel phase coexistence. We observe diverse conformational dynamics of membrane-bound DNA molecules controlled by the local properties of the lipid bilayer. In case of fluid-state freestanding lipid membranes, the behaviour of DNA on the membrane is controlled by the membrane charge density: whereas DNA bound to weakly charged membranes predominantly behaves as a 2D random coil, an increase in the membrane charge density leads to membrane-driven irreversible DNA collapse and formation of subresolution-sized DNA globules. On the other hand, electrostatic binding of DNA macromolecules to gel-state freestanding membranes leads to completely arrested diffusion and conformational dynamics of membrane-adsorbed DNA. A drastically different picture is observed in case of DNA interaction with supported cationic lipid bilayers: When the supported bilayer is in the fluid state, membrane-bound DNA molecules undergo 2D translational Brownian motion and conformational fluctuations, irrespectively of the charge density of the supported bilayer. At the same time, when the supported cationic membrane shows fluid-gel phase coexistence, membrane-bound DNA molecules are strongly attracted to micrometre-sized gel-phase domains enriched with the cationic lipid, which results in 2D compaction of the membrane-bound macromolecules. This DNA compaction, however, is fully reversible, and disappears as soon as the membrane is heated above the fluid-gel coexistence. We also discuss possible biological implications of our experimental findings.
An introduction to the mechanics of DNA.
Travers, A A; Thompson, J M T
2004-07-15
This article gives an overview of recent research on the mechanical properties and spatial deformations of the DNA molecule. Globally the molecule behaves like a uniform elastic rod, and its twisting and writhing govern its compaction and packaging within a cell. Meanwhile high mechanical stresses can induce structural transitions of DNA giving, for example, a phase diagram in the space of the applied tension and torque. Locally, the mechanical properties vary according to the local sequence organization. These variations play a vital role in the biological functioning of the molecule.
Characterization of individual polynucleotide molecules using a membrane channel
NASA Technical Reports Server (NTRS)
Kasianowicz, J. J.; Brandin, E.; Branton, D.; Deamer, D. W.
1996-01-01
We show that an electric field can drive single-stranded RNA and DNA molecules through a 2.6-nm diameter ion channel in a lipid bilayer membrane. Because the channel diameter can accommodate only a single strand of RNA or DNA, each polymer traverses the membrane as an extended chain that partially blocks the channel. The passage of each molecule is detected as a transient decrease of ionic current whose duration is proportional to polymer length. Channel blockades can therefore be used to measure polynucleotide length. With further improvements, the method could in principle provide direct, high-speed detection of the sequence of bases in single molecules of DNA or RNA.
Surface Biology of DNA by Atomic Force Microscopy
NASA Astrophysics Data System (ADS)
Hansma, Helen G.
2001-10-01
The atomic force microscope operates on surfaces. Since surfaces occupy much of the space in living organisms, surface biology is a valid and valuable form of biology that has been difficult to investigate in the past owing to a lack of good technology. Atomic force microscopy (AFM) of DNA has been used to investigate DNA condensation for gene therapy, DNA mapping and sizing, and a few applications to cancer research and to nanotechnology. Some of the most exciting new applications for atomic force microscopy of DNA involve pulling on single DNA molecules to obtain measurements of single-molecule mechanics and thermodynamics.
Direct Observation of Azimuthal Correlations between DNA in Hydrated Aggregates
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kornyshev, Alexei A.; Lee, Dominic J.; Wynveen, Aaron
2005-09-30
This study revisits the classical x-ray diffraction patterns from hydrated, noncrystalline fibers originally used to establish the helical structure of DNA. We argue that changes in these diffraction patterns with DNA packing density reveal strong azimuthally dependent interactions between adjacent molecules up to {approx}40 A interaxial or {approx}20 A surface-to-surface separations. These interactions appear to force significant torsional 'straightening' of DNA and strong azimuthal alignment of nearest neighbor molecules. The results are in good agreement with the predictions of recent theoretical models relating DNA-DNA interactions to the helical symmetry of their surface charge patterns.
NASA Astrophysics Data System (ADS)
Tao, Yinglei; Kumar Wickramasinghe, H.
2017-02-01
We demonstrate a coaxial AFM nanoprobe device for dielectrophoretic (DEP) trapping of DNA molecules in Tris-EDTA (TE) and phosphate-buffered saline (PBS) buffers. The DEP properties of 20 nm polystyrene beads were studied with coaxial probes in media with different conductivities. Due to the special geometry of our DEP probe device, sufficiently high electric fields were generated at the probe end to focus DNA molecules with positive DEP. DEP trapping for both polystyrene beads and DNA molecules was quantitatively analyzed over the frequency range from 100 kHz to 50 MHz and compared with the Clausius-Mossotti theory. Finally, we discussed the negative effect of medium salinity during DEP trapping.
Probing the size of proteins with glass nanopores
NASA Astrophysics Data System (ADS)
Steinbock, L. J.; Krishnan, S.; Bulushev, R. D.; Borgeaud, S.; Blokesch, M.; Feletti, L.; Radenovic, A.
2014-11-01
Single molecule studies using nanopores have gained attention due to the ability to sense single molecules in aqueous solution without the need to label them. In this study, short DNA molecules and proteins were detected with glass nanopores, whose sensitivity was enhanced by electron reshaping which decreased the nanopore diameter and created geometries with a reduced sensing length. Further, proteins having molecular weights (MW) ranging from 12 kDa to 480 kDa were detected, which showed that their corresponding current peak amplitude changes according to their MW. In the case of the 12 kDa ComEA protein, its DNA-binding properties to an 800 bp long DNA molecule was investigated. Moreover, the influence of the pH on the charge of the protein was demonstrated by showing a change in the translocation direction. This work emphasizes the wide spectrum of detectable molecules using nanopores from glass nanocapillaries, which stand out because of their inexpensive, lithography-free, and rapid manufacturing process.Single molecule studies using nanopores have gained attention due to the ability to sense single molecules in aqueous solution without the need to label them. In this study, short DNA molecules and proteins were detected with glass nanopores, whose sensitivity was enhanced by electron reshaping which decreased the nanopore diameter and created geometries with a reduced sensing length. Further, proteins having molecular weights (MW) ranging from 12 kDa to 480 kDa were detected, which showed that their corresponding current peak amplitude changes according to their MW. In the case of the 12 kDa ComEA protein, its DNA-binding properties to an 800 bp long DNA molecule was investigated. Moreover, the influence of the pH on the charge of the protein was demonstrated by showing a change in the translocation direction. This work emphasizes the wide spectrum of detectable molecules using nanopores from glass nanocapillaries, which stand out because of their inexpensive, lithography-free, and rapid manufacturing process. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr05001k
Micromanipulation by laser microbeam and optical tweezers: from plant cells to single molecules.
Greulich, K O; Pilarczyk, G; Hoffmann, A; Meyer Zu Hörste, G; Schäfer, B; Uhl, V; Monajembashi, S
2000-06-01
Complete manipulation by laser light allows precise and gentle treatment of plant cells, subcellular structures, and even individual DNA molecules. Recently, affordable lasers have become available for the construction of microbeams as well as for optical tweezers. This may generate new interest in these tools for plant biologists. Early experiments, reviewed in this journal, showed that laser supported microinjection of material into plant cells or tissues circumvents mechanical problems encountered in microinjection by fragile glass capillaries. Plant protoplasts could be fused with each other when under microscopical observation, and it was no major problem to generate a triple or quadruple fusion product. In the present paper we review experiments where membrane material was prepared from root hair tips and microgravity was simulated in algae. As many plant cells are transparent, it is possible to work inside living, intact cells. New experiments show that it is possible to release by optical micromanipulation, with high spatial resolutions, intracellular calcium from caged compounds and to study calcium oscillations. An example for avian cardiac tissue is given, but the technique is also suitable for plant cell research. As a more technical tool, optical tweezers can be used to spatially fix subcellular structures otherwise moving inside a cell and thus make them available for investigation with a confocal microscope even when the time for image formation is extended (for example at low fluorescence emission). A molecular biological example is the handling of chromosomes and isolated individual DNA molecules by laser microtools. For example, chromosomes can be cut along complex trajectories, not only perpendicular to their long axis. Single DNA molecules are cut by the laser microbeam and, after coupling such a molecule to a polystrene microbead, are handled in complex geometries. Here, the individual DNA molecules are made visible with a conventional fluorescence microscope by fluorescent dyes such as SYBRGreen. The cutting of a single DNA molecule by molecules of the restriction endonuclease EcoRI can be observed directly, i.e. a type of single molecule restriction analysis is possible. Finally, mechanical properties of individual DNA molecules can be observed directly.
Methods for immobilizing nucleic acids on a gel substrate
Mirzabekov, Andrei Darievich; Proudnikov, Dimitri Y.; Timofeev, Edward N.; Kochetkova, Svetlana V.; Florentiev, Vladimir L.; Shick, Valentine V.
1999-01-01
A method for labeling oligonucleotide molecules, and for immobilizing oligonucleotide and DNA molecules is provided comprising modifying the molecules to create a chemically active group, and contacting activated fluorescent dyes to the region. A method for preparing an immobilization substrate is also provided comprising modifying a gel to contain desired functional groups which covalently interact with certain moieties of the oligonucleotide molecules. A method for immobilizing biomolecules and other molecules within a gel by copolymerization of allyl-substituted oligonucleotides, DNA and proteins with acrylamide is also provided.
Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease
NASA Astrophysics Data System (ADS)
Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.
2018-04-01
We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.
NASA Astrophysics Data System (ADS)
Greulich, Karl-Otto; Monajembashi, Shamci; Celeda, D.; Endlich, N.; Eickhoff, Holger; Hoyer, Carsten; Leitz, G.; Weber, Gerd; Scheef, J.; Rueterjans, H.
1994-12-01
Genomes of higher organisms are larger than one typically expects. For example, the DNA of a single human cell is almost two meters long, the DNA in the human body covers the distance Earth-Sun approximately 140 times. This is often not considered in typical molecular biological approaches for DNA diagnostics, where usually only DNA of the length of a gene is investigated. Also, one basic aspect of sequencing the human genome is not really solved: the problem how to prepare the huge amounts of DNA required. Approaches from biomedical optics combined with new developments in single molecule biotechnology may at least contribute some parts of the puzzle. A large genome can be partitioned into portions comprising approximately 1% of the whole DNA using a laser microbeam. The single DNA fragment can be amplified by the polymerase chain reaction in order to obtain a sufficient amount of molecules for conventional DNA diagnostics or for analysis by octanucleotide hybridization. When not amplified by biotechnological processes, the individual DNA molecule can be visualized in the light microscope and can be manipulated and dissected with the laser microbeam trap. The DNA probes obtained by single molecule biotechnology can be employed for fluorescence in situ introduced into plant cells and subcellular structures even when other techniques fail. Since the laser microbeam trap allows to work in the interior of a cell without opening it, subcellular structures can be manipulated. For example, in algae, such structures can be moved out of their original position and used to study intracellular viscosities.
Multicopy Single-Stranded DNA Directs Intestinal Colonization of Enteric Pathogens
DOE Office of Scientific and Technical Information (OSTI.GOV)
Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.
Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking itsmore » retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.« less
Multicopy single-stranded DNA directs intestinal colonization of enteric pathogens
DOE Office of Scientific and Technical Information (OSTI.GOV)
Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.
Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking itsmore » retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate, but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.« less
Multicopy single-stranded DNA directs intestinal colonization of enteric pathogens
Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.; ...
2015-09-14
Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking itsmore » retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate, but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.« less
Universal Temporal Profile of Replication Origin Activation in Eukaryotes
NASA Astrophysics Data System (ADS)
Goldar, Arach
2011-03-01
The complete and faithful transmission of eukaryotic genome to daughter cells involves the timely duplication of mother cell's DNA. DNA replication starts at multiple chromosomal positions called replication origin. From each activated replication origin two replication forks progress in opposite direction and duplicate the mother cell's DNA. While it is widely accepted that in eukaryotic organisms replication origins are activated in a stochastic manner, little is known on the sources of the observed stochasticity. It is often associated to the population variability to enter S phase. We extract from a growing Saccharomyces cerevisiae population the average rate of origin activation in a single cell by combining single molecule measurements and a numerical deconvolution technique. We show that the temporal profile of the rate of origin activation in a single cell is similar to the one extracted from a replicating cell population. Taking into account this observation we exclude the population variability as the origin of observed stochasticity in origin activation. We confirm that the rate of origin activation increases in the early stage of S phase and decreases at the latter stage. The population average activation rate extracted from single molecule analysis is in prefect accordance with the activation rate extracted from published micro-array data, confirming therefore the homogeneity and genome scale invariance of dynamic of replication process. All these observations point toward a possible role of replication fork to control the rate of origin activation.
A method to track rotational motion for use in single-molecule biophysics.
Lipfert, Jan; Kerssemakers, Jacob J W; Rojer, Maylon; Dekker, Nynke H
2011-10-01
The double helical nature of DNA links many cellular processes such as DNA replication, transcription, and repair to rotational motion and the accumulation of torsional strain. Magnetic tweezers (MTs) are a single-molecule technique that enables the application of precisely calibrated stretching forces to nucleic acid tethers and to control their rotational motion. However, conventional magnetic tweezers do not directly monitor rotation or measure torque. Here, we describe a method to directly measure rotational motion of particles in MT. The method relies on attaching small, non-magnetic beads to the magnetic beads to act as fiducial markers for rotational tracking. CCD images of the beads are analyzed with a tracking algorithm specifically designed to minimize crosstalk between translational and rotational motion: first, the in-plane center position of the magnetic bead is determined with a kernel-based tracker, while subsequently the height and rotation angle of the bead are determined via correlation-based algorithms. Evaluation of the tracking algorithm using both simulated images and recorded images of surface-immobilized beads demonstrates a rotational resolution of 0.1°, while maintaining a translational resolution of 1-2 nm. Example traces of the rotational fluctuations exhibited by DNA-tethered beads confined in magnetic potentials of varying stiffness demonstrate the robustness of the method and the potential for simultaneous tracking of multiple beads. Our rotation tracking algorithm enables the extension of MTs to magnetic torque tweezers (MTT) to directly measure the torque in single molecules. In addition, we envision uses of the algorithm in a range of biophysical measurements, including further extensions of MT, tethered particle motion, and optical trapping measurements.
Lu, Li-Min; Zhang, Xiao-Bing; Kong, Rong-Mei; Yang, Bin; Tan, Weihong
2011-08-03
Many types of fluorescent sensing systems have been reported for biological small molecules. Particularly, several methods have been developed for the recognition of ATP or NAD(+), but they only show moderate sensitivity, and they cannot discriminate either ATP or NAD(+) from their respective analogues. We have addressed these limitations and report here a dual strategy which combines split DNAzyme-based background reduction with catalytic and molecular beacon (CAMB)-based amplified detection to develop a ligation-triggered DNAzyme cascade, resulting in ultrahigh sensitivity. First, the 8-17 DNAzyme is split into two separate oligonucleotide fragments as the building blocks for the DNA ligation reaction, thereby providing a zero-background signal to improve overall sensitivity. Next, a CAMB strategy is further employed for amplified signal detection achieved through cycling and regenerating the DNAzyme to realize the true enzymatic multiple turnover (one enzyme catalyzes the cleavage of several substrates) of catalytic beacons. This combination of zero-background signal and signal amplification significantly improves the sensitivity of the sensing systems, resulting in detection limits of 100 and 50 pM for ATP and NAD(+), respectively, much lower than those of previously reported biosensors. Moreover, by taking advantage of the highly specific biomolecule-dependence of the DNA ligation reaction, the developed DNAzyme cascades show significantly high selectivity toward the target cofactor (ATP or NAD(+)), and the target biological small molecule can be distinguished from its analogues. Therefore, as a new and universal platform for the design of DNA ligation reaction-based sensing systems, this novel ligation-triggered DNAzyme cascade method may find a broad spectrum of applications in both environmental and biomedical fields.
Selective inhibition of c-Myc/Max dimerization and DNA binding by small molecules.
Kiessling, Anke; Sperl, Bianca; Hollis, Angela; Eick, Dirk; Berg, Thorsten
2006-07-01
bZip and bHLHZip protein family members comprise a large fraction of eukaryotic transcription factors and need to bind DNA in order to exert most of their fundamental biological roles. Their binding to DNA requires homo- or heterodimerization via alpha-helical domains, which generally do not contain obvious binding sites for small molecules. We have identified two small molecules, dubbed Mycro1 and Mycro2, which inhibit the protein-protein interactions between the bHLHZip proteins c-Myc and Max. Mycros are the first inhibitors of c-Myc/Max dimerization, which have been demonstrated to inhibit DNA binding of c-Myc with preference over other dimeric transcription factors in vitro. Mycros inhibit c-Myc-dependent proliferation, gene transcription, and oncogenic transformation in the low micromolar concentration range. Our data support the idea that dimeric transcription factors can be druggable even in the absence of obvious small-molecule binding pockets.
Adaptive resolution simulation of oligonucleotides
NASA Astrophysics Data System (ADS)
Netz, Paulo A.; Potestio, Raffaello; Kremer, Kurt
2016-12-01
Nucleic acids are characterized by a complex hierarchical structure and a variety of interaction mechanisms with other molecules. These features suggest the need of multiscale simulation methods in order to grasp the relevant physical properties of deoxyribonucleic acid (DNA) and RNA using in silico experiments. Here we report an implementation of a dual-resolution modeling of a DNA oligonucleotide in physiological conditions; in the presented setup only the nucleotide molecule and the solvent and ions in its proximity are described at the atomistic level; in contrast, the water molecules and ions far from the DNA are represented as computationally less expensive coarse-grained particles. Through the analysis of several structural and dynamical parameters, we show that this setup reliably reproduces the physical properties of the DNA molecule as observed in reference atomistic simulations. These results represent a first step towards a realistic multiscale modeling of nucleic acids and provide a quantitatively solid ground for their simulation using dual-resolution methods.
Gitman, A G; Graessmann, A; Loyter, A
1985-11-01
Insulin molecules were covalently attached to detergent-solubilized Sendai virus envelope glycoproteins (HN and F polypeptides) by the use of the crosslinking reagent succinimidyl 4-(p-maleimidophenyl)butyrate (SMPB). Reconstitution of modified viral glycoproteins (carrying covalently attached insulin) together with unmodified viral glycoproteins resulted in the formation of "fusogenic" viral envelopes bearing insulin molecules. Reconstitution of such fusogenic viral envelopes in the presence of ricin A or simian virus 40 (SV40) DNA resulted in the formation of viral envelopes bearing insulin molecules and loaded with ricin A or SV40 DNA. Such viral envelopes were able to bind to hepatoma tissue culture cells (HTCC) from which Sendai virus receptors were removed by treatment with neuraminidase. Incubation of viral envelopes loaded with ricin A with virus receptor-depleted HTCC resulted in fusion-mediated injection of the toxin, as inferred from inhibition of protein synthesis and decrease in cell viability of the microinjected cells. Fusion-mediated injection of SV40 DNA was inferred from the appearance of SV40 tumor antigen in microinjected cells. Binding and fusion of the loaded viral envelopes to neuraminidase-treated HTCC was mediated solely by the virus-associated insulin molecules. Addition of free insulin molecules inhibited binding of the viral envelopes and, consequently, the microinjection of ricin A and SV40 DNA.
Gitman, A G; Graessmann, A; Loyter, A
1985-01-01
Insulin molecules were covalently attached to detergent-solubilized Sendai virus envelope glycoproteins (HN and F polypeptides) by the use of the crosslinking reagent succinimidyl 4-(p-maleimidophenyl)butyrate (SMPB). Reconstitution of modified viral glycoproteins (carrying covalently attached insulin) together with unmodified viral glycoproteins resulted in the formation of "fusogenic" viral envelopes bearing insulin molecules. Reconstitution of such fusogenic viral envelopes in the presence of ricin A or simian virus 40 (SV40) DNA resulted in the formation of viral envelopes bearing insulin molecules and loaded with ricin A or SV40 DNA. Such viral envelopes were able to bind to hepatoma tissue culture cells (HTCC) from which Sendai virus receptors were removed by treatment with neuraminidase. Incubation of viral envelopes loaded with ricin A with virus receptor-depleted HTCC resulted in fusion-mediated injection of the toxin, as inferred from inhibition of protein synthesis and decrease in cell viability of the microinjected cells. Fusion-mediated injection of SV40 DNA was inferred from the appearance of SV40 tumor antigen in microinjected cells. Binding and fusion of the loaded viral envelopes to neuraminidase-treated HTCC was mediated solely by the virus-associated insulin molecules. Addition of free insulin molecules inhibited binding of the viral envelopes and, consequently, the microinjection of ricin A and SV40 DNA. PMID:2997783
In vitro selection of shape-changing DNA nanostructures capable of binding-induced cargo release.
Oh, Seung Soo; Plakos, Kory; Xiao, Yi; Eisenstein, Michael; Soh, H Tom
2013-11-26
Many biological systems employ allosteric regulatory mechanisms, which offer a powerful means of directly linking a specific binding event to a wide spectrum of molecular functionalities. There is considerable interest in generating synthetic allosteric regulators that can perform useful molecular functions for applications in diagnostics, imaging and targeted therapies, but generating such molecules through either rational design or directed evolution has proven exceptionally challenging. To address this need, we present an in vitro selection strategy for generating conformation-switching DNA nanostructures that selectively release a small-molecule payload in response to binding of a specific trigger molecule. As an exemplar, we have generated a DNA nanostructure that hybridizes with a separate 'cargo strand' containing an abasic site. This abasic site stably sequesters a fluorescent cargo molecule in an inactive state until the DNA nanostructure encounters an ATP trigger molecule. This ATP trigger causes the nanostructure to release the cargo strand, thereby liberating the fluorescent payload and generating a detectable fluorescent readout. Our DNA nanostructure is highly sensitive, with an EC50 of 30 μM, and highly specific, releasing its payload in response to ATP but not to other chemically similar nucleotide triphosphates. We believe that this selection approach could be generalized to generate synthetic nanostructures capable of selective and controlled release of other small-molecule cargos in response to a variety of triggers, for both research and clinical applications.
Wilkins, Heather M; Koppel, Scott J; Weidling, Ian W; Roy, Nairita; Ryan, Lauren N; Stanford, John A; Swerdlow, Russell H
2016-12-01
Mitochondria and mitochondrial debris are found in the brain's extracellular space, and extracellular mitochondrial components can act as damage associated molecular pattern (DAMP) molecules. To characterize the effects of potential mitochondrial DAMP molecules on neuroinflammation, we injected either isolated mitochondria or mitochondrial DNA (mtDNA) into hippocampi of C57BL/6 mice and seven days later measured markers of inflammation. Brains injected with whole mitochondria showed increased Tnfα and decreased Trem2 mRNA, increased GFAP protein, and increased NFκB phosphorylation. Some of these effects were also observed in brains injected with mtDNA (decreased Trem2 mRNA, increased GFAP protein, and increased NFκB phosphorylation), and mtDNA injection also caused several unique changes including increased CSF1R protein and AKT phosphorylation. To further establish the potential relevance of this response to Alzheimer's disease (AD), a brain disorder characterized by neurodegeneration, mitochondrial dysfunction, and neuroinflammation we also measured App mRNA, APP protein, and Aβ 1-42 levels. We found mitochondria (but not mtDNA) injections increased these parameters. Our data show that in the mouse brain extracellular mitochondria and its components can induce neuroinflammation, extracellular mtDNA or mtDNA-associated proteins can contribute to this effect, and mitochondria derived-DAMP molecules can influence AD-associated biomarkers.
ONC201 kills breast cancer cells in vitro by targeting mitochondria.
Greer, Yoshimi Endo; Porat-Shliom, Natalie; Nagashima, Kunio; Stuelten, Christina; Crooks, Dan; Koparde, Vishal N; Gilbert, Samuel F; Islam, Celia; Ubaldini, Ashley; Ji, Yun; Gattinoni, Luca; Soheilian, Ferri; Wang, Xiantao; Hafner, Markus; Shetty, Jyoti; Tran, Bao; Jailwala, Parthav; Cam, Maggie; Lang, Martin; Voeller, Donna; Reinhold, William C; Rajapakse, Vinodh; Pommier, Yves; Weigert, Roberto; Linehan, W Marston; Lipkowitz, Stanley
2018-04-06
We report a novel mechanism of action of ONC201 as a mitochondria-targeting drug in cancer cells. ONC201 was originally identified as a small molecule that induces transcription of TNF-related apoptosis-inducing ligand (TRAIL) and subsequently kills cancer cells by activating TRAIL death receptors. In this study, we examined ONC201 toxicity on multiple human breast and endometrial cancer cell lines. ONC201 attenuated cell viability in all cancer cell lines tested. Unexpectedly, ONC201 toxicity was not dependent on either TRAIL receptors nor caspases. Time-lapse live cell imaging revealed that ONC201 induces cell membrane ballooning followed by rupture, distinct from the morphology of cells undergoing apoptosis. Further investigation found that ONC201 induces phosphorylation of AMP-dependent kinase and ATP loss. Cytotoxicity and ATP depletion were significantly enhanced in the absence of glucose, suggesting that ONC201 targets mitochondrial respiration. Further analysis indicated that ONC201 indirectly inhibits mitochondrial respiration. Confocal and electron microscopic analysis demonstrated that ONC201 triggers mitochondrial structural damage and functional impairment. Moreover, ONC201 decreased mitochondrial DNA (mtDNA). RNAseq analysis revealed that ONC201 suppresses expression of multiple mtDNA-encoded genes and nuclear-encoded mitochondrial genes involved in oxidative phosphorylation and other mitochondrial functions. Importantly, fumarate hydratase deficient cancer cells and multiple cancer cell lines with reduced amounts of mtDNA were resistant to ONC201. These results indicate that cells not dependent on mitochondrial respiration are ONC201-resistant. Our data demonstrate that ONC201 kills cancer cells by disrupting mitochondrial function and further suggests that cancer cells that are dependent on glycolysis will be resistant to ONC201.
ONC201 kills breast cancer cells in vitro by targeting mitochondria
Greer, Yoshimi Endo; Porat-Shliom, Natalie; Nagashima, Kunio; Stuelten, Christina; Crooks, Dan; Koparde, Vishal N.; Gilbert, Samuel F.; Islam, Celia; Ubaldini, Ashley; Ji, Yun; Gattinoni, Luca; Soheilian, Ferri; Wang, Xiantao; Hafner, Markus; Shetty, Jyoti; Tran, Bao; Jailwala, Parthav; Cam, Maggie; Lang, Martin; Voeller, Donna; Reinhold, William C.; Rajapakse, Vinodh; Pommier, Yves; Weigert, Roberto; Linehan, W. Marston; Lipkowitz, Stanley
2018-01-01
We report a novel mechanism of action of ONC201 as a mitochondria-targeting drug in cancer cells. ONC201 was originally identified as a small molecule that induces transcription of TNF-related apoptosis-inducing ligand (TRAIL) and subsequently kills cancer cells by activating TRAIL death receptors. In this study, we examined ONC201 toxicity on multiple human breast and endometrial cancer cell lines. ONC201 attenuated cell viability in all cancer cell lines tested. Unexpectedly, ONC201 toxicity was not dependent on either TRAIL receptors nor caspases. Time-lapse live cell imaging revealed that ONC201 induces cell membrane ballooning followed by rupture, distinct from the morphology of cells undergoing apoptosis. Further investigation found that ONC201 induces phosphorylation of AMP-dependent kinase and ATP loss. Cytotoxicity and ATP depletion were significantly enhanced in the absence of glucose, suggesting that ONC201 targets mitochondrial respiration. Further analysis indicated that ONC201 indirectly inhibits mitochondrial respiration. Confocal and electron microscopic analysis demonstrated that ONC201 triggers mitochondrial structural damage and functional impairment. Moreover, ONC201 decreased mitochondrial DNA (mtDNA). RNAseq analysis revealed that ONC201 suppresses expression of multiple mtDNA-encoded genes and nuclear-encoded mitochondrial genes involved in oxidative phosphorylation and other mitochondrial functions. Importantly, fumarate hydratase deficient cancer cells and multiple cancer cell lines with reduced amounts of mtDNA were resistant to ONC201. These results indicate that cells not dependent on mitochondrial respiration are ONC201-resistant. Our data demonstrate that ONC201 kills cancer cells by disrupting mitochondrial function and further suggests that cancer cells that are dependent on glycolysis will be resistant to ONC201. PMID:29719618
Moriyama, Kenji; Yoshizawa-Sugata, Naoko; Masai, Hisao
2018-03-09
Rap1-interacting protein 1 (Rif1) regulates telomere length in budding yeast. We previously reported that, in metazoans and fission yeast, Rif1 also plays pivotal roles in controlling genome-wide DNA replication timing. We proposed that Rif1 may assemble chromatin compartments that contain specific replication-timing domains by promoting chromatin loop formation. Rif1 also is involved in DNA lesion repair, restart after replication fork collapse, anti-apoptosis activities, replicative senescence, and transcriptional regulation. Although multiple physiological functions of Rif1 have been characterized, biochemical and structural information on mammalian Rif1 is limited, mainly because of difficulties in purifying the full-length protein. Here, we expressed and purified the 2418-amino-acid-long, full-length murine Rif1 as well as its partially truncated variants in human 293T cells. Hydrodynamic analyses indicated that Rif1 forms elongated or extended homo-oligomers in solution, consistent with the presence of a HEAT-type helical repeat segment known to adopt an elongated shape. We also observed that the purified murine Rif1 bound G-quadruplex (G4) DNA with high specificity and affinity, as was previously shown for Rif1 from fission yeast. Both the N-terminal (HEAT-repeat) and C-terminal segments were involved in oligomer formation and specifically bound G4 DNA, and the central intrinsically disordered polypeptide segment increased the affinity for G4. Of note, pulldown assays revealed that Rif1 simultaneously binds multiple G4 molecules. Our findings support a model in which Rif1 modulates chromatin loop structures through binding to multiple G4 assemblies and by holding chromatin fibers together. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Biomedical Requirements for High Productivity Computing Systems
2005-04-01
server at http://www.ncbi.nlm.nih.gov/BLAST/. There are many variants of BLAST, including: 1. BLASTN - Compares a DNA query to a DNA database. Searches ...database (3 reading frames from each strand of the DNA) searching . 13 4. TBLASTN - Compares a protein query to a DNA database, in the 6 possible...the molecular during this phase. After eliminating molecules that could not match the query , an atom-by-atom search for the molecules in conducted
Clark, Katie A.; Howe, Dana K.; Gafner, Kristin; Kusuma, Danika; Ping, Sita; Estes, Suzanne; Denver, Dee R.
2012-01-01
Selfish DNA poses a significant challenge to genome stability and organismal fitness in diverse eukaryotic lineages. Although selfish mitochondrial DNA (mtDNA) has known associations with cytoplasmic male sterility in numerous gynodioecious plant species and is manifested as petite mutants in experimental yeast lab populations, examples of selfish mtDNA in animals are less common. We analyzed the inheritance and evolution of mitochondrial DNA bearing large heteroplasmic deletions including nad5 gene sequences (nad5Δ mtDNA), in the nematode Caenorhabditis briggsae. The deletion is widespread in C. briggsae natural populations and is associated with deleterious organismal effects. We studied the inheritance patterns of nad5Δ mtDNA using eight sets of C. briggsae mutation-accumulation (MA) lines, each initiated from a different natural strain progenitor and bottlenecked as single hermaphrodites across generations. We observed a consistent and strong drive toward higher levels of deletion-bearing molecules in the heteroplasmic pool of mtDNA after ten generations of bottlenecking. Our results demonstrate a uniform transmission bias whereby nad5Δ mtDNA accumulates to higher levels relative to intact mtDNA in multiple genetically diverse natural strains of C. briggsae. We calculated an average 1% per-generation transmission bias for deletion-bearing mtDNA relative to intact genomes. Our study, coupled with known deleterious phenotypes associated with high deletion levels, shows that nad5Δ mtDNA are selfish genetic elements that have evolved in natural populations of C. briggsae, offering a powerful new system to study selfish mtDNA dynamics in metazoans. PMID:22859984
Electrophoresis of DNA in agarose gels, polyacrylamide gels and in free solution
Stellwagen, Nancy C.
2009-01-01
This review describes the electrophoresis of curved and normal DNA molecules in agarose gels, polyacrylamide gels and in free solution. These studies were undertaken to clarify why curved DNA molecules migrate anomalously slowly in polyacrylamide gels but not in agarose gels. Two milestone papers are cited, in which Ferguson plots were used to estimate the effective pore size of agarose and polyacrylamide gels. Subsequent studies on the effect of the electric field on agarose and polyacrylamide gel matrices, DNA interactions with the two gel matrices, and the effect of curvature on the free solution mobility of DNA are also described. The combined results suggest that the anomalously slow mobilities observed for curved DNA molecules in polyacrylamide gels are due primarily to preferential interactions of curved DNAs with the polyacrylamide gel matrix; the restrictive pore size of the matrix is of lesser importance. In free solution, DNA mobilities increase with increasing molecular mass until leveling off at a plateau value of (3.17 ± 0.01) × 10-4 cm2/Vs in 40 mM Tris-acetate-EDTA buffer at 20°C. Curved DNA molecules migrate anomalously slowly in free solution as well as in polyacrylamide gels, explaining why the Ferguson plots of curved and normal DNAs containing the same number of base pairs extrapolate to different mobilities at zero gel concentration. PMID:19517510
Spatially-Interactive Biomolecular Networks Organized by Nucleic Acid Nanostructures
Fu, Jinglin; Liu, Minghui; Liu, Yan; Yan, Hao
2013-01-01
Conspectus Living systems have evolved a variety of nanostructures to control the molecular interactions that mediate many functions including the recognition of targets by receptors, the binding of enzymes to substrates, and the regulation of enzymatic activity. Mimicking these structures outside of the cell requires methods that offer nanoscale control over the organization of individual network components. Advances in DNA nanotechnology have enabled the design and fabrication of sophisticated one-, two- and three-dimensional (1D, 2D and 3D) nanostructures that utilize spontaneous and sequence specific DNA hybridization. Compared to other self-assembling biopolymers, DNA nanostructures offer predictable and programmable interactions, and surface features to which other nanoparticles and bio-molecules can be precisely positioned. The ability to control the spatial arrangement of the components while constructing highly-organized networks will lead to various applications of these systems. For example, DNA nanoarrays with surface displays of molecular probes can sense noncovalent hybridization interactions with DNA, RNA, and proteins and covalent chemical reactions. DNA nanostructures can also align external molecules into well-defined arrays, which may improve the resolution of many structural determination methods, such as X-ray diffraction, cryo-EM, NMR, and super-resolution fluorescence. Moreover, by constraining target entities to specific conformations, self-assembled DNA nanostructures can serve as molecular rulers to evaluate conformation-dependent activities. This Account describes the most recent advances in the DNA nanostructure directed assembly of biomolecular networks and explores the possibility of applying this technology to other fields of study. Recently, several reports have demonstrated the DNA nanostructure directed assembly of spatially-interactive biomolecular networks. For example, researchers have constructed synthetic multi-enzyme cascades by organizing the position of the components using DNA nanoscaffolds in vitro, or by utilizing RNA matrices in vivo. These structures display enhanced efficiency compared to the corresponding unstructured enzyme mixtures. Such systems are designed to mimic cellular function, where substrate diffusion between enzymes is facilitated and reactions are catalyzed with high efficiency and specificity. In addition, researchers have assembled multiple choromophores into arrays using a DNA nanoscaffold that optimizes the relative distance between the dyes and their spatial organization. The resulting artificial light harvesting system exhibits efficient cascading energy transfers. Finally, DNA nanostructures have been used as assembly templates to construct nanodevices that execute rationally-designed behaviors, including cargo loading, transportation and route control. PMID:22642503
Static and Dynamic Properties of DNA Confined in Nanochannels
NASA Astrophysics Data System (ADS)
Gupta, Damini
Next-generation sequencing (NGS) techniques have considerably reduced the cost of high-throughput DNA sequencing. However, it is challenging to detect large-scale genomic variations by NGS due to short read lengths. Genome mapping can easily detect large-scale structural variations because it operates on extremely large intact molecules of DNA with adequate resolution. One of the promising methods of genome mapping is based on confining large DNA molecules inside a nanochannel whose cross-sectional dimensions are approximately 50 nm. Even though this genome mapping technology has been commercialized, the current understanding of the polymer physics of DNA in nanochannel confinement is based on theories and lacks much needed experimental support. The results of this dissertation are aimed at providing a detailed experimental understanding of equilibrium properties of nanochannel-confined DNA molecules. The results are divided into three parts. In first part, we evaluate the role of channel shape on thermodynamic properties of channel confined DNA molecules using a combination of fluorescence microscopy and simulations. Specifically, we show that high aspect ratio of rectangular channels significantly alters the chain statistics as compared to an equivalent square channel with same cross-sectional area. In the second part, we present experimental evidence that weak excluded volume effects arise in DNA nanochannel confinement, which form the physical basis for the extended de Gennes regime. We also show how confinement spectroscopy and simulations can be combined to reduce molecular weight dispersity effects arising from shearing, photo-cleavage, and nonuniform staining of DNA. Finally, the third part of the thesis concerns the dynamic properties of nanochannel confined DNA. We directly measure the center-of-mass diffusivity of single DNA molecules in confinement and show that that it is necessary to modify the classical results of de Gennes to account for local chain stiffness of DNA in order to explain the experimental results. In the end, we believe that our findings from the experimental test of the phase diagram for channel-confined DNA, with careful control over molecular weight dispersity, channel geometry, and electrostatic interactions, will provide a firm foundation for the emerging genome mapping technology.
NASA Astrophysics Data System (ADS)
Turan, Muhammed K.; Sehirli, Eftal; Elen, Abdullah; Karas, Ismail R.
2015-07-01
Gel electrophoresis (GE) is one of the most used method to separate DNA, RNA, protein molecules according to size, weight and quantity parameters in many areas such as genetics, molecular biology, biochemistry, microbiology. The main way to separate each molecule is to find borders of each molecule fragment. This paper presents a software application that show columns edges of DNA fragments in 3 steps. In the first step the application obtains lane histograms of agarose gel electrophoresis images by doing projection based on x-axis. In the second step, it utilizes k-means clustering algorithm to classify point values of lane histogram such as left side values, right side values and undesired values. In the third step, column edges of DNA fragments is shown by using mean algorithm and mathematical processes to separate DNA fragments from the background in a fully automated way. In addition to this, the application presents locations of DNA fragments and how many DNA fragments exist on images captured by a scientific camera.
Model of biological quantum logic in DNA.
Mihelic, F Matthew
2013-08-02
The DNA molecule has properties that allow it to act as a quantum logic processor. It has been demonstrated that there is coherent conduction of electrons longitudinally along the DNA molecule through pi stacking interactions of the aromatic nucleotide bases, and it has also been demonstrated that electrons moving longitudinally along the DNA molecule are subject to a very efficient electron spin filtering effect as the helicity of the DNA molecule interacts with the spin of the electron. This means that, in DNA, electrons are coherently conducted along a very efficient spin filter. Coherent electron spin is held in a logically and thermodynamically reversible chiral symmetry between the C2-endo and C3-endo enantiomers of the deoxyribose moiety in each nucleotide, which enables each nucleotide to function as a quantum gate. The symmetry break that provides for quantum decision in the system is determined by the spin direction of an electron that has an orbital angular momentum that is sufficient to overcome the energy barrier of the double well potential separating the C2-endo and C3-endo enantiomers, and that enantiomeric energy barrier is appropriate to the Landauer limit of the energy necessary to randomize one bit of information.
NASA Astrophysics Data System (ADS)
Piatnytskyi, Dmytro V.; Zdorevskyi, Oleksiy O.; Perepelytsya, Sergiy M.; Volkov, Sergey N.
2015-11-01
Changes in the medium of biological cells under ion beam irradiation has been considered as a possible cause of cell function disruption in the living body. The interaction of hydrogen peroxide, a long-lived molecular product of water radiolysis, with active sites of DNA macromolecule was studied, and the formation of stable DNA-peroxide complexes was considered. The phosphate groups of the macromolecule backbone were picked out among the atomic groups of DNA double helix as a probable target for interaction with hydrogen peroxide molecules. Complexes consisting of combinations including: the DNA phosphate group, H2O2 and H2O molecules, and Na+ counterion, were considered. The counterions have been taken into consideration insofar as under the natural conditions they neutralise DNA sugar-phosphate backbone. The energy of the complexes have been determined by considering the electrostatic and the Van der Waals interactions within the framework of atom-atom potential functions. As a result, the stability of various configurations of molecular complexes was estimated. It was shown that DNA phosphate groups and counterions can form stable complexes with hydrogen peroxide molecules, which are as stable as the complexes with water molecules. It has been demonstrated that the formation of stable complexes of H2O2-Na+-PO4- may be detected experimentally by observing specific vibrations in the low-frequency Raman spectra. The interaction of H2O2 molecule with phosphate group of the double helix backbone can disrupt DNA biological function and induce the deactivation of the cell genetic apparatus. Thus, the production of hydrogen peroxide molecules in the nucleus of living cells can be considered as an additional mechanism by which high-energy ion beams destroy tumour cells during ion beam therapy. Contribution to the Topical Issue "COST Action Nano-IBCT: Nano-scale Processes Behind Ion-Beam Cancer Therapy", edited by Andrey Solov'yov, Nigel Mason, Gustavo García, Eugene Surdutovich.
Zou, Xiaojing; Qu, Mingyi; Fang, Fang; Fan, Zeng; Chen, Lin; Yue, Wen; Xie, Xiaoyan; Pei, Xuetao
2017-01-01
Platelets (PLTs) are produced by megakaryocytes (MKs) that completed differentiation and endomitosis. Endomitosis is an important process in which the cell replicates its DNA without cytokinesis and develops highly polyploid MK. In this study, to gain a better PLTs production, four small molecules (Rho-Rock inhibitor (RRI), nicotinamide (NIC), Src inhibitor (SI), and Aurora B inhibitor (ABI)) and their combinations were surveyed as MK culture supplements for promoting polyploidization. Three leukemia cell lines as well as primary mononuclear cells were chosen in the function and mechanism studies of the small molecules. In an optimal culture method, cells were treated with different small molecules and their combinations. The impact of the small molecules on megakaryocytic surface marker expression, polyploidy, proliferation, and apoptosis was examined for the best MK polyploidization supplement. The elaborate analysis confirmed that the combination of SI and RRI together with our MK induction system might result in efficient ploidy promotion. Our experiments demonstrated that, besides direct downregulation on the expression of cytoskeleton protein actin, SI and RRI could significantly enhance the level of cyclins through the suppression of p53 and p21. The verified small molecule combination might be further used in the in vitro PLT manufacture and clinical applications.
Fang, Fang; Chen, Lin; Yue, Wen
2017-01-01
Platelets (PLTs) are produced by megakaryocytes (MKs) that completed differentiation and endomitosis. Endomitosis is an important process in which the cell replicates its DNA without cytokinesis and develops highly polyploid MK. In this study, to gain a better PLTs production, four small molecules (Rho-Rock inhibitor (RRI), nicotinamide (NIC), Src inhibitor (SI), and Aurora B inhibitor (ABI)) and their combinations were surveyed as MK culture supplements for promoting polyploidization. Three leukemia cell lines as well as primary mononuclear cells were chosen in the function and mechanism studies of the small molecules. In an optimal culture method, cells were treated with different small molecules and their combinations. The impact of the small molecules on megakaryocytic surface marker expression, polyploidy, proliferation, and apoptosis was examined for the best MK polyploidization supplement. The elaborate analysis confirmed that the combination of SI and RRI together with our MK induction system might result in efficient ploidy promotion. Our experiments demonstrated that, besides direct downregulation on the expression of cytoskeleton protein actin, SI and RRI could significantly enhance the level of cyclins through the suppression of p53 and p21. The verified small molecule combination might be further used in the in vitro PLT manufacture and clinical applications. PMID:29201898
Declerck, Ken; Szarc vel Szic, Katarzyna; Palagani, Ajay; Heyninck, Karen; Haegeman, Guy; Morand, Christine; Milenkovic, Dragan; Vanden Berghe, Wim
2016-01-01
Nowadays, epigenetic mechanisms involving DNA methylation, histone modifications and microRNA regulation emerge as important players in cardiovascular disease (CVD). Epigenetics may provide the missing link between environment, genome and disease phenotype and be responsible for the strong interindividual variation in disease risk factors underlying CVD. Daily diet is known to have a major influence on both the development and the prevention of CVD. Interestingly, the dietary lifestyle of our (grand)parents and of us contributes to CVD risk by metabolic (re)programming of our epigenome in utero, after birth or during life. In contrast to genetic mutations, the plasticity of CVD related epigenetic changes makes them attractive candidates for nutritional prevention or pharmacological intervention. Although a growing number of epidemiologic studies have shown a link between the ingestion of nutritional polyphenols and cardiovascular health benefits, potential involvement of epigenetic mechanisms has been underexplored. In this review, we will give an overview of epigenetic alterations in atherosclerosis, with the focus on DNA and histone modifications by chromatin-modifying proteins. Finally, we illustrate that cocoa flavanols and other classes of dietary molecules may promote cardiovascular health by targeting multiple classes of chromatin writer-reader-eraser proteins related to histone acetylation-methylation and DNA methylation.
Kong, Muwen; Beckwitt, Emily C; Springall, Luke; Kad, Neil M; Van Houten, Bennett
2017-01-01
Single-molecule approaches to solving biophysical problems are powerful tools that allow static and dynamic real-time observations of specific molecular interactions of interest in the absence of ensemble-averaging effects. Here, we provide detailed protocols for building an experimental system that employs atomic force microscopy and a single-molecule DNA tightrope assay based on oblique angle illumination fluorescence microscopy. Together with approaches for engineering site-specific lesions into DNA substrates, these complementary biophysical techniques are well suited for investigating protein-DNA interactions that involve target-specific DNA-binding proteins, such as those engaged in a variety of DNA repair pathways. In this chapter, we demonstrate the utility of the platform by applying these techniques in the studies of proteins participating in nucleotide excision repair. © 2017 Elsevier Inc. All rights reserved.
Transcription of tandemly repetitive DNA: functional roles.
Biscotti, Maria Assunta; Canapa, Adriana; Forconi, Mariko; Olmo, Ettore; Barucca, Marco
2015-09-01
A considerable fraction of the eukaryotic genome is made up of satellite DNA constituted of tandemly repeated sequences. These elements are mainly located at centromeres, pericentromeres, and telomeres and are major components of constitutive heterochromatin. Although originally satellite DNA was thought silent and inert, an increasing number of studies are providing evidence on its transcriptional activity supporting, on the contrary, an unexpected dynamicity. This review summarizes the multiple structural roles of satellite noncoding RNAs at chromosome level. Indeed, satellite noncoding RNAs play a role in the establishment of a heterochromatic state at centromere and telomere. These highly condensed structures are indispensable to preserve chromosome integrity and genome stability, preventing recombination events, and ensuring the correct chromosome pairing and segregation. Moreover, these RNA molecules seem to be involved also in maintaining centromere identity and in elongation, capping, and replication of telomere. Finally, the abnormal variation of centromeric and pericentromeric DNA transcription across major eukaryotic lineages in stress condition and disease has evidenced the critical role that these transcripts may play and the potentially dire consequences for the organism.
RNA-Cleaving DNA Enzymes with Altered Regio- or Enantioselectivity
NASA Technical Reports Server (NTRS)
Ordoukhanian, Phillip; Joyce, Gerald F.
2002-01-01
In vitro evolution methods were used to obtain DNA enzymes that cleave either a 2',5' - phosphodiester following a wibonucleotide or a 3',5' -phosphodiester following an L-ribonucleotide. Both enzymes can operate in an intermolecular reaction format with multiple turnover. The DNA enzyme that cleaves a 2',5' -phosphodiester exhibits a k(sub cat) of approx. 0.01/ min and catalytic efficiency, k(sub cat)/k(sub m) of approx. 10(exp 5)/ M min. The enzyme that cleaves an L-ribonudeotide is about 10-fold slower and has a catalytic efficiency of approx. 4 x 10(exp 5)/ M min. Both enzymes require a divalent metal cation for their activity and have optimal catalytic rate at pH 7-8 and 35-50 C. In a comparison of each enzyme s activity with either its corresponding substrate that contains an unnatural ribonudeotide or a substrate that instead contains a standard ribonucleotide, the 2',5' -phosphodiester-deaving DNA enzyme exhibited a regioselectivity of 6000- fold, while the L-ribonucleotide-cleaving DNA enzyme exhibited an enantioselectivity of 50-fold. These molecules demonstrate how in vitro evolution can be used to obtain regio- and enantioselective catalysts that exhibit specificities for nonnatural analogues of biological compounds.
Rössl, Anthony; Bentley-DeSousa, Amanda; Tseng, Yi-Chieh; Nwosu, Christine; Downey, Michael
2016-10-01
Nicotinamide is both a reaction product and an inhibitor of the conserved sirtuin family of deacetylases, which have been implicated in a broad range of cellular functions in eukaryotes from yeast to humans. Phenotypes observed following treatment with nicotinamide are most often assumed to stem from inhibition of one or more of these enzymes. Here, we used this small molecule to inhibit multiple sirtuins at once during treatment with DNA damaging agents in the Saccharomyces cerevisiae model system. Since sirtuins have been previously implicated in the DNA damage response, we were surprised to observe that nicotinamide actually increased the survival of yeast cells exposed to the DNA damage agent MMS. Remarkably, we found that enhanced resistance to MMS in the presence of nicotinamide was independent of all five yeast sirtuins. Enhanced resistance was also independent of the nicotinamide salvage pathway, which uses nicotinamide as a substrate to generate NAD+, and of a DNA damage-induced increase in the salvage enzyme Pnc1 Our data suggest a novel and unexpected function for nicotinamide that has broad implications for its use in the study of sirtuin biology across model systems. Copyright © 2016 by the Genetics Society of America.
Rössl, Anthony; Bentley-DeSousa, Amanda; Tseng, Yi-Chieh; Nwosu, Christine; Downey, Michael
2016-01-01
Nicotinamide is both a reaction product and an inhibitor of the conserved sirtuin family of deacetylases, which have been implicated in a broad range of cellular functions in eukaryotes from yeast to humans. Phenotypes observed following treatment with nicotinamide are most often assumed to stem from inhibition of one or more of these enzymes. Here, we used this small molecule to inhibit multiple sirtuins at once during treatment with DNA damaging agents in the Saccharomyces cerevisiae model system. Since sirtuins have been previously implicated in the DNA damage response, we were surprised to observe that nicotinamide actually increased the survival of yeast cells exposed to the DNA damage agent MMS. Remarkably, we found that enhanced resistance to MMS in the presence of nicotinamide was independent of all five yeast sirtuins. Enhanced resistance was also independent of the nicotinamide salvage pathway, which uses nicotinamide as a substrate to generate NAD+, and of a DNA damage-induced increase in the salvage enzyme Pnc1. Our data suggest a novel and unexpected function for nicotinamide that has broad implications for its use in the study of sirtuin biology across model systems. PMID:27527516
Sekhar, Ashok; Nagesh, Jayashree; Rosenzweig, Rina; Kay, Lewis E
2017-11-01
The Hsp70 chaperone system plays a critical role in cellular homeostasis by binding to client protein molecules. We have recently shown by methyl-TROSY NMR methods that the Escherichia coli Hsp70, DnaK, can form multiple bound complexes with a small client protein, hTRF1. In an effort to characterize the interactions further we report here the results of an NMR-based titration study of hTRF1 and DnaK, where both molecular components are monitored simultaneously, leading to a binding model. A central finding is the formation of a previously undetected 3:1 hTRF1-DnaK complex, suggesting that under heat shock conditions, DnaK might be able to protect cytosolic proteins whose net concentrations would exceed that of the chaperone. Moreover, these results provide new insight into the heterogeneous ensemble of complexes formed by DnaK chaperones and further emphasize the unique role of NMR spectroscopy in obtaining information about individual events in a complex binding scheme by exploiting a large number of probes that report uniquely on distinct binding processes. © 2017 The Protein Society.
Extensive paternal mtDNA leakage in natural populations of Drosophila melanogaster.
Nunes, Maria D S; Dolezal, Marlies; Schlötterer, Christian
2013-04-01
Strict maternal inheritance is considered a hallmark of animal mtDNA. Although recent reports suggest that paternal leakage occurs in a broad range of species, it is still considered an exceptionally rare event. To evaluate the impact of paternal leakage on the evolution of mtDNA, it is essential to reliably estimate the frequency of paternal leakage in natural populations. Using allele-specific real-time quantitative PCR (RT-qPCR), we show that heteroplasmy is common in natural populations with at least 14% of the individuals carrying multiple mitochondrial haplotypes. However, the average frequency of the minor mtDNA haplotype is low (0.8%), which suggests that this pervasive heteroplasmy has not been noticed before due to a lack of power in sequencing surveys. Based on the distribution of mtDNA haplotypes in the offspring of heteroplasmic mothers, we found no evidence for strong selection against one of the haplotypes. We estimated that the rate of paternal leakage is 6% and that at least 100 generations are required for complete sorting of mtDNA haplotypes. Despite the high proportion of heteroplasmic individuals in natural populations, we found no evidence for recombination between mtDNA molecules, suggesting that either recombination is rare or recombinant haplotypes are counter-selected. Our results indicate that evolutionary studies using mtDNA as a marker might be biased by paternal leakage in this species. © 2013 Blackwell Publishing Ltd.
Escherichia coli DNA polymerase I can disrupt G-quadruplex structures during DNA replication.
Teng, Fang-Yuan; Hou, Xi-Miao; Fan, San-Hong; Rety, Stephane; Dou, Shuo-Xing; Xi, Xu-Guang
2017-12-01
Non-canonical four-stranded G-quadruplex (G4) DNA structures can form in G-rich sequences that are widely distributed throughout the genome. The presence of G4 structures can impair DNA replication by hindering the progress of replicative polymerases (Pols), and failure to resolve these structures can lead to genetic instability. In the present study, we combined different approaches to address the question of whether and how Escherichia coli Pol I resolves G4 obstacles during DNA replication and/or repair. We found that E. coli Pol I-catalyzed DNA synthesis could be arrested by G4 structures at low protein concentrations and the degree of inhibition was strongly dependent on the stability of the G4 structures. Interestingly, at high protein concentrations, E. coli Pol I was able to overcome some kinds of G4 obstacles without the involvement of other molecules and could achieve complete replication of G4 DNA. Mechanistic studies suggested that multiple Pol I proteins might be implicated in G4 unfolding, and the disruption of G4 structures requires energy derived from dNTP hydrolysis. The present work not only reveals an unrealized function of E. coli Pol I, but also presents a possible mechanism by which G4 structures can be resolved during DNA replication and/or repair in E. coli. © 2017 Federation of European Biochemical Societies.
NASA Astrophysics Data System (ADS)
Åkerman, Björn
1997-04-01
DNA orientation measurements by linear dichroism (LD) spectroscopy and single molecule imaging by fluorescence microscopy are used to investigate the effect of DNA size (71-740 kilo base pairs) and field strength E (1-5.9 V/cm) on the conformation dynamics during the field-driven threading of DNA molecules through a set of parallel pores in agarose gels, with average pore radii between 380 Å and 1400 Å. Locally relaxed but globally oriented DNA molecules are subjected to a perpendicular field, and the observed LD time profile is compared with a recent theory for the threading [D. Long and J.-L. Viovy, Phys. Rev. E 53, 803 (1996)] which assumes the same initial state. As predicted the DNA is driven by the ends into a U-form, leading to an overshoot in the LD. The overshoot-time scales as E-(1.2-1.4) as predicted, but grows more slowly with DNA size than the predicted linear dependence. For long molecules loops form initially in the threading process but are finally consumed by the ends, and the process of transfer of DNA segments, from the loops to the arms of the U, leads to a shoulder in the LD as predicted. The critical size below which loops do not form (as indicated by the LD shoulder being absent) is between 71 and 105 kbp (0.5% agarose, 5.9 V/cm), and considerably larger than predicted because in the initial state the DNA molecules are housed in gel cavities with effective pore sizes about four times larger than the average pore size. From the data, the separation of DNA by exploiting the threading dynamics in pulsed fields [D. Long et al., CR Acad. Sci. Paris, Ser. IIb 321, 239 (1995)] is shown to be feasible in principle in an agarose-based system.
Repurposing a Benchtop Centrifuge for High-Throughput Single-Molecule Force Spectroscopy.
Yang, Darren; Wong, Wesley P
2018-01-01
We present high-throughput single-molecule manipulation using a benchtop centrifuge, overcoming limitations common in other single-molecule approaches such as high cost, low throughput, technical difficulty, and strict infrastructure requirements. An inexpensive and compact Centrifuge Force Microscope (CFM) adapted to a commercial centrifuge enables use by nonspecialists, and integration with DNA nanoswitches facilitates both reliable measurements and repeated molecular interrogation. Here, we provide detailed protocols for constructing the CFM, creating DNA nanoswitch samples, and carrying out single-molecule force measurements.
"DNA Origami Traffic Lights" with a Split Aptamer Sensor for a Bicolor Fluorescence Readout.
Walter, Heidi-Kristin; Bauer, Jens; Steinmeyer, Jeannine; Kuzuya, Akinori; Niemeyer, Christof M; Wagenknecht, Hans-Achim
2017-04-12
A split aptamer for adenosine triphosphate (ATP) was embedded as a recognition unit into two levers of a nanomechanical DNA origami construct by extension and modification of selected staple strands. An additional optical module in the stem of the split aptamer comprised two different cyanine-styryl dyes that underwent an energy transfer from green (donor) to red (acceptor) emission if two ATP molecules were bound as target molecule to the recognition module and thereby brought the dyes in close proximity. As a result, the ATP as a target triggered the DNA origami shape transition and yielded a fluorescence color change from green to red as readout. Conventional atomic force microscopy (AFM) images confirmed the topology change from the open form of the DNA origami in the absence of ATP into the closed form in the presence of the target molecule. The obtained closed/open ratios in the absence and presence of target molecules tracked well with the fluorescence color ratios and thereby validated the bicolor fluorescence readout. The correct positioning of the split aptamer as the functional unit farthest away from the fulcrum of the DNA origami was crucial for the aptasensing by fluorescence readout. The fluorescence color change allowed additionally to follow the topology change of the DNA origami aptasensor in real time in solution. The concepts of fluorescence energy transfer for bicolor readout in a split aptamer in solution, and AFM on surfaces, were successfully combined in a single DNA origami construct to obtain a bimodal readout. These results are important for future custom DNA devices for chemical-biological and bioanalytical purposes because they are not only working as simple aptamers but are also visible by AFM on the single-molecule level.
Cortini, Ruggero; Cheng, Xiaolin; Smith, Jeremy C.
2017-01-16
Electrostatic interactions between DNA molecules have been extensively studied experimentally and theoretically, but several aspects (e.g. its role in determining the pitch of the cholesteric DNA phase) still remain unclear. Here, we performed large-scale all-atom molecular dynamics simulations in explicit water and 150 mM sodium chloride, to reconstruct the potential of mean force (PMF) of two DNA oligomers 24 base pairs long as a function of their interaxial angle and intermolecular distance. We find that the potential of mean force is dominated by total DNA charge, and not by the helical geometry of its charged groups. The theory of homogeneously charged cylinders fits well all our simulation data, and the fit yields the optimal value of the total compensated charge on DNA to ≈65% of its total fixed charge (arising from the phosphorous atoms), close to the value expected from Manning's theory of ion condensation. The PMF calculated from our simulations does not show a significant dependence on the handedness of the angle between the two DNA molecules, or its size is on the order ofmore » $$1{{k}_{\\text{B}}}T$$ . Thermal noise for molecules of the studied length seems to mask the effect of detailed helical charge patterns of DNA. The fact that in monovalent salt the effective interaction between two DNA molecules is independent on the handedness of the tilt may suggest that alternative mechanisms are required to understand the cholesteric phase of DNA.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cortini, Ruggero; Cheng, Xiaolin; Smith, Jeremy C.
Electrostatic interactions between DNA molecules have been extensively studied experimentally and theoretically, but several aspects (e.g. its role in determining the pitch of the cholesteric DNA phase) still remain unclear. Here, we performed large-scale all-atom molecular dynamics simulations in explicit water and 150 mM sodium chloride, to reconstruct the potential of mean force (PMF) of two DNA oligomers 24 base pairs long as a function of their interaxial angle and intermolecular distance. We find that the potential of mean force is dominated by total DNA charge, and not by the helical geometry of its charged groups. The theory of homogeneously charged cylinders fits well all our simulation data, and the fit yields the optimal value of the total compensated charge on DNA to ≈65% of its total fixed charge (arising from the phosphorous atoms), close to the value expected from Manning's theory of ion condensation. The PMF calculated from our simulations does not show a significant dependence on the handedness of the angle between the two DNA molecules, or its size is on the order ofmore » $$1{{k}_{\\text{B}}}T$$ . Thermal noise for molecules of the studied length seems to mask the effect of detailed helical charge patterns of DNA. The fact that in monovalent salt the effective interaction between two DNA molecules is independent on the handedness of the tilt may suggest that alternative mechanisms are required to understand the cholesteric phase of DNA.« less
Clark, Andrew G; Naufer, M Nabuan; Westerlund, Fredrik; Lincoln, Per; Rouzina, Ioulia; Paramanathan, Thayaparan; Williams, Mark C
2018-02-06
Molecules that bind DNA via threading intercalation show high binding affinity as well as slow dissociation kinetics, properties ideal for the development of anticancer drugs. To this end, it is critical to identify the specific molecular characteristics of threading intercalators that result in optimal DNA interactions. Using single-molecule techniques, we quantify the binding of a small metal-organic ruthenium threading intercalator (Δ,Δ-B) and compare its binding characteristics to a similar molecule with significantly larger threading moieties (Δ,Δ-P). The binding affinities of the two molecules are the same, while comparison of the binding kinetics reveals significantly faster kinetics for Δ,Δ-B. However, the kinetics is still much slower than that observed for conventional intercalators. Comparison of the two threading intercalators shows that the binding affinity is modulated independently by the intercalating section and the binding kinetics is modulated by the threading moiety. In order to thread DNA, Δ,Δ-P requires a "lock mechanism", in which a large length increase of the DNA duplex is required for both association and dissociation. In contrast, measurements of the force-dependent binding kinetics show that Δ,Δ-B requires a large DNA length increase for association but no length increase for dissociation from DNA. This contrasts strongly with conventional intercalators, for which almost no DNA length change is required for association but a large DNA length change must occur for dissociation. This result illustrates the fundamentally different mechanism of threading intercalation compared with conventional intercalation and will pave the way for the rational design of therapeutic drugs based on DNA threading intercalation.
Structural DNA Nanotechnology: Artificial Nanostructures for Biomedical Research.
Ke, Yonggang; Castro, Carlos; Choi, Jong Hyun
2018-06-04
Structural DNA nanotechnology utilizes synthetic or biologic DNA as designer molecules for the self-assembly of artificial nanostructures. The field is founded upon the specific interactions between DNA molecules, known as Watson-Crick base pairing. After decades of active pursuit, DNA has demonstrated unprecedented versatility in constructing artificial nanostructures with significant complexity and programmability. The nanostructures could be either static, with well-controlled physicochemical properties, or dynamic, with the ability to reconfigure upon external stimuli. Researchers have devoted considerable effort to exploring the usability of DNA nanostructures in biomedical research. We review the basic design methods for fabricating both static and dynamic DNA nanostructures, along with their biomedical applications in fields such as biosensing, bioimaging, and drug delivery.
DNA Origami Directed Au Nanostar Dimers for Single-Molecule Surface-Enhanced Raman Scattering.
Tanwar, Swati; Haldar, Krishna Kanta; Sen, Tapasi
2017-12-06
We demonstrate the synthesis of Au nanostar dimers with tunable interparticle gap and controlled stoichiometry assembled on DNA origami. Au nanostars with uniform and sharp tips were immobilized on rectangular DNA origami dimerized structures to create nanoantennas containing monomeric and dimeric Au nanostars. Single Texas red (TR) dye was specifically attached in the junction of the dimerized origami to act as a Raman reporter molecule. The SERS enhancement factors of single TR dye molecules located in the conjunction region in dimer structures having interparticle gaps of 7 and 13 nm are 2 × 10 10 and 8 × 10 9 , respectively, which are strong enough for single analyte detection. The highly enhanced electromagnetic field generated by the plasmon coupling between sharp tips and cores of two Au nanostars in the wide conjunction region allows the accommodation and specific detection of large biomolecules. Such DNA-directed assembled nanoantennas with controlled interparticle separation distance and stoichiometry, and well-defined geometry, can be used as excellent substrates in single-molecule SERS spectroscopy and will have potential applications as a reproducible platform in single-molecule sensing.
Internal twisting motion dependent conductance of an aperiodic DNA molecule
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta
The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less
Viral nanoparticle-encapsidated enzyme and restructured DNA for cell delivery and gene expression
Liu, Jinny L.; Dixit, Aparna Banerjee; Robertson, Kelly L.; Qiao, Eric; Black, Lindsay W.
2014-01-01
Packaging specific exogenous active proteins and DNAs together within a single viral-nanocontainer is challenging. The bacteriophage T4 capsid (100 × 70 nm) is well suited for this purpose, because it can hold a single long DNA or multiple short pieces of DNA up to 170 kb packed together with more than 1,000 protein molecules. Any linear DNA can be packaged in vitro into purified procapsids. The capsid-targeting sequence (CTS) directs virtually any protein into the procapsid. Procapsids are assembled with specific CTS-directed exogenous proteins that are encapsidated before the DNA. The capsid also can display on its surface high-affinity eukaryotic cell-binding peptides or proteins that are in fusion with small outer capsid and head outer capsid surface-decoration proteins that can be added in vivo or in vitro. In this study, we demonstrate that the site-specific recombinase cyclic recombination (Cre) targeted into the procapsid is enzymatically active within the procapsid and recircularizes linear plasmid DNA containing two terminal loxP recognition sites when packaged in vitro. mCherry expression driven by a cytomegalovirus promoter in the capsid containing Cre-circularized DNA is enhanced over linear DNA, as shown in recipient eukaryotic cells. The efficient and specific packaging into capsids and the unpackaging of both DNA and protein with release of the enzymatically altered protein–DNA complexes from the nanoparticles into cells have potential in numerous downstream drug and gene therapeutic applications. PMID:25161284
Quantification of differential gene expression by multiplexed targeted resequencing of cDNA
Arts, Peer; van der Raadt, Jori; van Gestel, Sebastianus H.C.; Steehouwer, Marloes; Shendure, Jay; Hoischen, Alexander; Albers, Cornelis A.
2017-01-01
Whole-transcriptome or RNA sequencing (RNA-Seq) is a powerful and versatile tool for functional analysis of different types of RNA molecules, but sample reagent and sequencing cost can be prohibitive for hypothesis-driven studies where the aim is to quantify differential expression of a limited number of genes. Here we present an approach for quantification of differential mRNA expression by targeted resequencing of complementary DNA using single-molecule molecular inversion probes (cDNA-smMIPs) that enable highly multiplexed resequencing of cDNA target regions of ∼100 nucleotides and counting of individual molecules. We show that accurate estimates of differential expression can be obtained from molecule counts for hundreds of smMIPs per reaction and that smMIPs are also suitable for quantification of relative gene expression and allele-specific expression. Compared with low-coverage RNA-Seq and a hybridization-based targeted RNA-Seq method, cDNA-smMIPs are a cost-effective high-throughput tool for hypothesis-driven expression analysis in large numbers of genes (10 to 500) and samples (hundreds to thousands). PMID:28474677
Ultralocalized thermal reactions in subnanoliter droplets-in-air.
Salm, Eric; Guevara, Carlos Duarte; Dak, Piyush; Dorvel, Brian Ross; Reddy, Bobby; Alam, Muhammad Ashraf; Bashir, Rashid
2013-02-26
Miniaturized laboratory-on-chip systems promise rapid, sensitive, and multiplexed detection of biological samples for medical diagnostics, drug discovery, and high-throughput screening. Within miniaturized laboratory-on-chips, static and dynamic droplets of fluids in different immiscible media have been used as individual vessels to perform biochemical reactions and confine the products. Approaches to perform localized heating of these individual subnanoliter droplets can allow for new applications that require parallel, time-, and space-multiplex reactions on a single integrated circuit. Our method positions droplets on an array of individual silicon microwave heaters on chip to precisely control the temperature of droplets-in-air, allowing us to perform biochemical reactions, including DNA melting and detection of single base mismatches. We also demonstrate that ssDNA probe molecules can be placed on heaters in solution, dried, and then rehydrated by ssDNA target molecules in droplets for hybridization and detection. This platform enables many applications in droplets including hybridization of low copy number DNA molecules, lysing of single cells, interrogation of ligand-receptor interactions, and rapid temperature cycling for amplification of DNA molecules.
Liang, Feng; Guo, Yuzheng; Hou, Shaocong; Quan, Qimin
2017-01-01
Current methods to study molecular interactions require labeling the subject molecules with fluorescent reporters. However, the effect of the fluorescent reporters on molecular dynamics has not been quantified because of a lack of alternative methods. We develop a hybrid photonic-plasmonic antenna-in-a-nanocavity single-molecule biosensor to study DNA-protein dynamics without using fluorescent labels. Our results indicate that the fluorescein and fluorescent protein labels decrease the interaction between a single DNA and a protein due to weakened electrostatic interaction. Although the study is performed on the DNA-XPA system, the conclusion has a general implication that the traditional fluorescent labeling methods might be misestimating the molecular interactions. PMID:28560341
Single Molecule Nano-Metronome
Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip
2008-01-01
We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule sensor of minute sequence differences of a target DNA. PMID:16522050
Rapid screening for plasmid DNA.
Hughes, C; Meynell, G G
1977-03-07
A procedure is described for demonstrating plasmid DNA and its molecular weight, based on rate zonal centrifugation of unlabelled DNA in neutral sucrose gradients containing a low concentration of ethidium bromide. Each DNA species is then visualized as a discrete fluorescent band when the centrifuge tube is illuminated with ultra-violet light. Plasmids exist as closed circular and as relaxed circular molecules, which sediment separately, but during preparation of lysates, closed circular molecules are nicked so that each plasmid forms only a single band of relaxed circles within the gradient.
Nam, Gimoon; Hisette, Marie Laure; Sun, Yuting Liang; Gisler, Thomas; Johner, Albert; Thalmann, Fabrice; Schröder, André Pierre; Marques, Carlos Manuel; Lee, Nam-Kyung
2010-08-20
Stained end-grafted DNA molecules about 20 μm long are scraped away and stretched out by the spreading front of a bioadhesive vesicle. Tethered biotin ligands bind the vesicle bilayer to a streptavidin substrate, stapling the DNAs into frozen confinement paths. Image analysis of the stapled DNA gives access, within optical resolution, to the local stretching values of individual DNA molecules swept by the spreading front, and provides evidence of self-entanglements.
Microfabricated, flowthrough porous apparatus for discrete detection of binding reactions
Beattie, Kenneth L.
1998-01-01
An improved microfabricated apparatus for conducting a multiplicity of individual and simultaneous binding reactions is described. The apparatus comprises a substrate on which are located discrete and isolated sites for binding reactions. The apparatus is characterized by discrete and isolated regions that extend through said substrate and terminate on a second surface thereof such that when a test sample is allowed to the substrate, it is capable of penetrating through each such region during the course of said binding reaction. The apparatus is especially useful for sequencing by hybridization of DNA molecules.
Prescott, D M
1994-01-01
Ciliates contain two types of nuclei: a micronucleus and a macronucleus. The micronucleus serves as the germ line nucleus but does not express its genes. The macronucleus provides the nuclear RNA for vegetative growth. Mating cells exchange haploid micronuclei, and a new macronucleus develops from a new diploid micronucleus. The old macronucleus is destroyed. This conversion consists of amplification, elimination, fragmentation, and splicing of DNA sequences on a massive scale. Fragmentation produces subchromosomal molecules in Tetrahymena and Paramecium cells and much smaller, gene-sized molecules in hypotrichous ciliates to which telomere sequences are added. These molecules are then amplified, some to higher copy numbers than others. rDNA is differentially amplified to thousands of copies per macronucleus. Eliminated sequences include transposonlike elements and sequences called internal eliminated sequences that interrupt gene coding regions in the micronuclear genome. Some, perhaps all, of these are excised as circular molecules and destroyed. In at least some hypotrichs, segments of some micronuclear genes are scrambled in a nonfunctional order and are recorded during macronuclear development. Vegetatively growing ciliates appear to possess a mechanism for adjusting copy numbers of individual genes, which corrects gene imbalances resulting from random distribution of DNA molecules during amitosis of the macronucleus. Other distinctive features of ciliate DNA include an altered use of the conventional stop codons. Images PMID:8078435
DNA adsorption characteristics of hollow spherule allophane nano-particles.
Matsuura, Yoko; Iyoda, Fumitoshi; Arakawa, Shuichi; John, Baiju; Okamoto, Masami; Hayashi, Hidetomo
2013-12-01
To understand the propensity of natural allophane to adsorb the DNA molecules, the adsorption characteristics were assessed against natural allophane (AK70), using single-stranded DNA (ss-DNA) and adenosine 5'-monophosphate (5'-AMP) as a reference molecule. The adsorption capacity of ss-DNA on AK70 exhibited one order of magnitude lower value as compared with that of 5'-AMP. The adsorption capacity of ss-DNA decreased with increasing pH due to the interaction generated between phosphate groups of ss-DNA and functional Al-OH groups on the wall perforations through deprotonating, associated with higher energy barrier for the adsorption of ss-DNA. The adsorption morphologies consisting of the individual ss-DNA with mono-layer coverage of the clustered allophane particle were observed successfully through transmission electron microscopy analysis. © 2013.
Single DNA imaging and length quantification through a mobile phone microscope
NASA Astrophysics Data System (ADS)
Wei, Qingshan; Luo, Wei; Chiang, Samuel; Kappel, Tara; Mejia, Crystal; Tseng, Derek; Chan, Raymond Yan L.; Yan, Eddie; Qi, Hangfei; Shabbir, Faizan; Ozkan, Haydar; Feng, Steve; Ozcan, Aydogan
2016-03-01
The development of sensitive optical microscopy methods for the detection of single DNA molecules has become an active research area which cultivates various promising applications including point-of-care (POC) genetic testing and diagnostics. Direct visualization of individual DNA molecules usually relies on sophisticated optical microscopes that are mostly available in well-equipped laboratories. For POC DNA testing/detection, there is an increasing need for the development of new single DNA imaging and sensing methods that are field-portable, cost-effective, and accessible for diagnostic applications in resource-limited or field-settings. For this aim, we developed a mobile-phone integrated fluorescence microscopy platform that allows imaging and sizing of single DNA molecules that are stretched on a chip. This handheld device contains an opto-mechanical attachment integrated onto a smartphone camera module, which creates a high signal-to-noise ratio dark-field imaging condition by using an oblique illumination/excitation configuration. Using this device, we demonstrated imaging of individual linearly stretched λ DNA molecules (48 kilobase-pair, kbp) over 2 mm2 field-of-view. We further developed a robust computational algorithm and a smartphone app that allowed the users to quickly quantify the length of each DNA fragment imaged using this mobile interface. The cellphone based device was tested by five different DNA samples (5, 10, 20, 40, and 48 kbp), and a sizing accuracy of <1 kbp was demonstrated for DNA strands longer than 10 kbp. This mobile DNA imaging and sizing platform can be very useful for various diagnostic applications including the detection of disease-specific genes and quantification of copy-number-variations at POC settings.
Sainsard-Chanet, A; Begel, O; Belcour, L
1994-10-07
In the filamentous fungus Podospora anserina, the unavoidable phenomenon of senescence is associated with the amplification of the first intron of the mitochondrial cox1 that accumulates as circular DNA molecules consisting of tandem repeats. This group II intron (cox1-i1 or alpha) is able to transpose and contains an open reading frame with significant amino acid similarity with reverse transcriptases. The generation of these intronic circular DNA molecules, their amplification and their involvement in the senescence process are unresolved questions. We demonstrate here that: (1) another group II intron, the fourth intron of gene cox1, cox1-i4, is also able to give precise DNA end to end junctions; (2) this intronic sequence can be found amplified during senescence, although to a lesser extent than cox1-i1; (3) the amplification of the DNA multimeric cox1-i1 molecules likely does not proceed by autonomous replication; (4) the generation of the DNA intronic circles does not require efficient intron splicing; (5) a DNA double-strand break occurs in vivo at the 3' extremity of the cox1-e1 and cox1-e4 exons preceding the group II introns that form circular DNAs. On the whole, these results show that the ability to form DNA circular molecules is a property of some group II introns and they demonstrate the occurrence of a specific DNA cleavage at or near the integration site of these group II introns. The results strongly suggest that this cleavage is involved in the formation of the group II intronic DNA circles and could also be involved in the phenomenon of group II intron homing.
Adsorption of DNA to mica mediated by divalent counterions: a theoretical and experimental study.
Pastré, David; Piétrement, Olivier; Fusil, Stéphane; Landousy, Fabrice; Jeusset, Josette; David, Marie-Odile; Hamon, Loïc; Le Cam, Eric; Zozime, Alain
2003-10-01
The adsorption of DNA molecules onto a flat mica surface is a necessary step to perform atomic force microscopy studies of DNA conformation and observe DNA-protein interactions in physiological environment. However, the phenomenon that pulls DNA molecules onto the surface is still not understood. This is a crucial issue because the DNA/surface interactions could affect the DNA biological functions. In this paper we develop a model that can explain the mechanism of the DNA adsorption onto mica. This model suggests that DNA attraction is due to the sharing of the DNA and mica counterions. The correlations between divalent counterions on both the negatively charged DNA and the mica surface can generate a net attraction force whereas the correlations between monovalent counterions are ineffective in the DNA attraction. DNA binding is then dependent on the fractional surface densities of the divalent and monovalent cations, which can compete for the mica surface and DNA neutralizations. In addition, the attraction can be enhanced when the mica has been pretreated by transition metal cations (Ni(2+), Zn(2+)). Mica pretreatment simultaneously enhances the DNA attraction and reduces the repulsive contribution due to the electrical double-layer force. We also perform end-to-end distance measurement of DNA chains to study the binding strength. The DNA binding strength appears to be constant for a fixed fractional surface density of the divalent cations at low ionic strength (I < 0.1 M) as predicted by the model. However, at higher ionic strength, the binding is weakened by the screening effect of the ions. Then, some equations were derived to describe the binding of a polyelectrolyte onto a charged surface. The electrostatic attraction due to the sharing of counterions is particularly effective if the polyelectrolyte and the surface have nearly the same surface charge density. This characteristic of the attraction force can explain the success of mica for performing single DNA molecule observation by AFM. In addition, we explain how a reversible binding of the DNA molecules can be obtained with a pretreated mica surface.
Teschome, Bezu; Facsko, Stefan; Schönherr, Tommy; Kerbusch, Jochen; Keller, Adrian; Erbe, Artur
2016-10-11
DNA origami nanostructures have been used extensively as scaffolds for numerous applications such as for organizing both organic and inorganic nanomaterials, studying single molecule reactions, and fabricating photonic devices. Yet, little has been done toward the integration of DNA origami nanostructures into nanoelectronic devices. Among other challenges, the technical difficulties in producing well-defined electrical contacts between macroscopic electrodes and individual DNA origami-based nanodevices represent a serious bottleneck that hinders the thorough characterization of such devices. Therefore, in this work, we have developed a method to electrically contact individual DNA origami-based metallic nanowires using electron beam lithography. We then characterize the charge transport of such nanowires in the temperature range from room temperature down to 4.2 K. The room temperature charge transport measurements exhibit ohmic behavior, whereas at lower temperatures, multiple charge transport mechanisms such as tunneling and thermally assisted transport start to dominate. Our results confirm that charge transport along metallized DNA origami nanostructures may deviate from pure metallic behavior due to several factors including partial metallization, seed inhomogeneities, impurities, and weak electronic coupling among AuNPs. Besides, this study further elucidates the importance of variable temperature measurements for determining the dominant charge transport mechanisms for conductive nanostructures made by self-assembly approaches.
Dynamics of flexible molecules in thinning fluid filaments
NASA Astrophysics Data System (ADS)
Arratia, Paulo E.; Juarez, Gabriel
2011-11-01
Newtonian liquids that contain small amounts (~ppm) of flexible polymers can exhibit viscoelastic behavior in extensional flows. In this talk, we report the results of experiments on the thinning and breakup of polymeric fluids in a simple microfluidic device. We aim to understand the stretching dynamics of flexible polymers by direct visualization of fluorescent DNA molecules, a model polymer. A Boger fluid, composed of 100 ppm polyacrylamide and 85% w/w glycerol, is seeded with stained lambdaâDNA molecules (<10% v/v) imaged by high speed epifluorescence microscopy. We observe that the strong flow in the thinning fluid threads provide sufficient forces to stretch the DNA molecules away from their equilibrium coiled state. The distribution of stretch lengths, however, is very heterogeneous due to molecular individualism and initial conditions. Once the molecules are stretched to their full length and aligned with the flow, they translate along the fluid thread as rigid rods until the point of pinch off. After pinch off, both the fluid and molecules return to a relaxed state.
NASA Astrophysics Data System (ADS)
Patil, Avinash J.; Li, Mei; Mann, Stephen
2013-07-01
Synthesis of functional hybrid nanoscale objects has been a core focus of the rapidly progressing field of nanomaterials science. In particular, there has been significant interest in the integration of evolutionally optimized biological systems such as proteins, DNA, virus particles and cells with functional inorganic building blocks to construct mesoscopic architectures and nanostructured materials. However, in many cases the fragile nature of the biomolecules seriously constrains their potential applications. As a consequence, there is an on-going quest for the development of novel strategies to modulate the thermal and chemical stabilities, and performance of biomolecules under adverse conditions. This feature article highlights new methods of ``inorganic molecular wrapping'' of single or multiple protein molecules, individual double-stranded DNA helices, lipid bilayer vesicles and self-assembled organic dye superstructures using inorganic building blocks to produce bio-inorganic nanoconstructs with core-shell type structures. We show that spatial isolation of the functional biological nanostructures as ``armour-plated'' enzyme molecules or polynucleotide strands not only maintains their intact structure and biochemical properties, but also enables the fabrication of novel hybrid nanomaterials for potential applications in diverse areas of bionanotechnology.
Nomani, Alireza; Haririan, Ismaeil; Rahimnia, Ramin; Fouladdel, Shamileh; Gazori, Tarane; Dinarvand, Rassoul; Omidi, Yadollah; Azizi, Ebrahim
2010-01-01
To gain a deeper understanding of the physicochemical phenomenon of self-assembled nanoparticles of different generations and ratios of poly (amidoamine) dendrimer (PAMAM) dendrimer and a short-stranded DNA (antisense oligonucleotide), multiple methods were used to characterize these nanoparticles including photon correlation spectroscopy (PCS); zeta potential measurement; and atomic force microscopy (AFM). PCS and AFM results revealed that, in contrast to larger molecules of DNA, smaller molecules produce more heterodisperse and large nanoparticles when they are condensed with a cationic dendrimer. AFM images also showed that such nanoparticles were spherical. The stability of the antisense content of the nanoparticles was investigated over different charge ratios using polyacrylamide gel electrophoresis. It was clear from such analyses that much more than charge neutrality point was required to obtain stable nanoparticles. For cell uptake, self-assembled nanoparticles were prepared with PAMAM G5 and 5’-FITC labeled antisense and the uptake experiment was carried out in T47D cell culture. This investigation also shows that the cytotoxicity of the nanoparticles was dependent upon the generation and charge ratio of the PAMAM dendrimer, and the antisense concentration had no significant effect on the cytotoxicity. PMID:20517481
Patil, Avinash J; Li, Mei; Mann, Stephen
2013-08-21
Synthesis of functional hybrid nanoscale objects has been a core focus of the rapidly progressing field of nanomaterials science. In particular, there has been significant interest in the integration of evolutionally optimized biological systems such as proteins, DNA, virus particles and cells with functional inorganic building blocks to construct mesoscopic architectures and nanostructured materials. However, in many cases the fragile nature of the biomolecules seriously constrains their potential applications. As a consequence, there is an on-going quest for the development of novel strategies to modulate the thermal and chemical stabilities, and performance of biomolecules under adverse conditions. This feature article highlights new methods of "inorganic molecular wrapping" of single or multiple protein molecules, individual double-stranded DNA helices, lipid bilayer vesicles and self-assembled organic dye superstructures using inorganic building blocks to produce bio-inorganic nanoconstructs with core-shell type structures. We show that spatial isolation of the functional biological nanostructures as "armour-plated" enzyme molecules or polynucleotide strands not only maintains their intact structure and biochemical properties, but also enables the fabrication of novel hybrid nanomaterials for potential applications in diverse areas of bionanotechnology.
Identification of DNA primase inhibitors via a combined fragment-based and virtual screening
NASA Astrophysics Data System (ADS)
Ilic, Stefan; Akabayov, Sabine R.; Arthanari, Haribabu; Wagner, Gerhard; Richardson, Charles C.; Akabayov, Barak
2016-11-01
The structural differences between bacterial and human primases render the former an excellent target for drug design. Here we describe a technique for selecting small molecule inhibitors of the activity of T7 DNA primase, an ideal model for bacterial primases due to their common structural and functional features. Using NMR screening, fragment molecules that bind T7 primase were identified and then exploited in virtual filtration to select larger molecules from the ZINC database. The molecules were docked to the primase active site using the available primase crystal structure and ranked based on their predicted binding energies to identify the best candidates for functional and structural investigations. Biochemical assays revealed that some of the molecules inhibit T7 primase-dependent DNA replication. The binding mechanism was delineated via NMR spectroscopy. Our approach, which combines fragment based and virtual screening, is rapid and cost effective and can be applied to other targets.
Toulmin, Anita; Baltierra-Jasso, Laura E; Morten, Michael J; Sabir, Tara; McGlynn, Peter; Schröder, Gunnar F; Smith, Brian O; Magennis, Steven W
2017-09-19
DNA three-way junctions (3WJs) are branched structures that serve as important biological intermediates and as components in DNA nanostructures. We recently derived the global structure of a fully complementary 3WJ and found that it contained unpaired bases at the branchpoint, which is consistent with previous observations of branch flexibility and branchpoint reactivity. By combining high-resolution single-molecule Förster resonance energy transfer, molecular modeling, time-resolved ensemble fluorescence spectroscopy, and the first 19 F nuclear magnetic resonance observations of fully complementary 3WJs, we now show that the 3WJ structure can adopt multiple distinct conformations depending upon the sequence at the branchpoint. A 3WJ with a GC-rich branchpoint adopts an open conformation with unpaired bases at the branch and at least one additional conformation with an increased number of base interactions at the branchpoint. This structural diversity has implications for branch interactions and processing in vivo and for technological applications.
A Symmetric Inchworm Nanowalker
NASA Astrophysics Data System (ADS)
Chiang, Yi Herng
Intracellular transport by biological nanowalkers occurs in inchworm (IW) gait as well as hand-over-hand (HOH) gait. Multiple versions of artificial inchworm nanowalkers are also realized and proposed, but all rely on different 'head' and 'tail' to gain a direction. Here we demonstrate an inchworm bipedal nanowalker made of DNA that possesses two identical legs and moves directionally along a linear track under alternating ultraviolet and visible light. The inchworm gait is confirmed by operating the walker on a DNA duplex track that is designed to show a distinctive pattern for inchworm versus hand-over-hand gait. Interestingly, the same walker exhibits stride-controlled direction reversals and IW-to-HOH gait switch when the track is systematically modified for elongated spacing between periodic binding stations for the walker. The IW and HOH regimes altogether present an integrated nanowalker mechanism, which can be used to implement nanowalkers of different gaits and directions with DNA, other biomolecules or synthetic molecules on molecular tracks, optical potentials or even solid-state substrates.
Mitochondrial RNA polymerase is an essential enzyme in erythrocytic stages of Plasmodium falciparum.
Ke, Hangjun; Morrisey, Joanne M; Ganesan, Suresh M; Mather, Michael W; Vaidya, Akhil B
2012-09-01
We have shown that transgenic Plasmodium falciparum parasites expressing the yeast DHODH (dihydroorotate dehydrogenase) are independent of the mtETC (mitochondrial electron transport chain), suggesting that they might not need the mitochondrial genome (mtDNA), since it only encodes three protein subunits belonging to the mtETC and fragmentary ribosomal RNA molecules. Disrupting the mitochondrial RNA polymerase (mtRNAP), which is critical for mtDNA replication and transcription, might then cause the generation of a ρ(0) parasite line lacking mtDNA. We made multiple attempts to disrupt the mtRNAP gene by double crossover recombination methods in parasite lines expressing yDHODH either episomally or integrated in the genome, but were unable to produce the desired knockout. We verified that the mtRNAP gene was accessible to recombination by successfully integrating a triple HA tag at the 3' end via single cross-over recombination. These studies suggest that mtRNAP is essential even in mtETC-independent P. falciparum parasites. Copyright © 2012 Elsevier B.V. All rights reserved.
Cellular strategies for regulating DNA supercoiling: A single-molecule perspective
Koster, Daniel A.; Crut, Aurélien; Shuman, Stewart; Bjornsti, Mary-Ann; Dekker, Nynke H.
2010-01-01
Summary Excess entangling and twisting of cellular DNA (i.e., DNA supercoiling) are problems inherent to the helical structure of double-stranded DNA. Supercoiling affects transcription, DNA replication, and chromosomal segregation. Consequently the cell must fine-tune supercoiling to optimize these key processes. Here, we summarize how supercoiling is generated and review experimental and theoretical insights into supercoil relaxation. We distinguish between the passive dissipation of supercoils by diffusion and the active removal of supercoils by topoisomerase enzymes. We also review single-molecule studies that elucidate the timescales and mechanisms of supercoil removal. PMID:20723754
NASA Astrophysics Data System (ADS)
Poudel, Lokendra
Doxorubicin (trade name Adriamycin, abbreviated DOX) is a well-known an- thracyclic chemotherapeutic used in treating a variety of cancers including acute leukemia, lymphoma, multiple myeloma, and a range of stomach, lung, bladder, bone, breast, and ovarian cancers. The purpose of the present work is to study electronic structure, partial charge distribution and interaction energy of DOX under different environments. It provides a framework for better understanding of bioactivity of DOX with DNA. While in this work, we focus on DOX -- DNA interactions; the obtained knowledge could be translated to other drug -- target interactions or biomolecular interactions. The electronic structure and partial charge distribution of DOX in three dierent molecular environments: isolated, solvated, and intercalated into a DNA complex,were studied by rst principles density functional methods. It is shown that the addition of solvating water molecules to DOX and the proximity and interaction with DNA has a signicant impact on the electronic structure as well as the partial charge distribution. The calculated total partial charges for DOX in the three models are 0.0, +0.123 and -0.06 electrons for the isolated, solvated, and intercalated state, respectively. Furthermore, by using the more accurate ab initio partial charge values on every atom in the models, signicant improvement in estimating the DOX-DNA interaction energy is obtained in conjunction with the NAnoscale Molecular Dynamics (NAMD) code. The electronic structure of the DOX-DNA is further elucidated by resolving the total density of states (TDOS) into dierent functional groups of DOX, DNA, water, co-crystallized Spermine molecule, and Na ions. The surface partial charge distribution in the DOX-DNA is calculated and displayed graphically. We conclude that the presence of the solvent as well as the details of the interaction geometry matter greatly in the determination of the stability of the DOX complexion. Ab initio calculations on realistic models are an important step towards a more accurate description of biomolecular interaction and in the eventual understanding of long-range interactions in biomolecular systems.
Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)
NASA Astrophysics Data System (ADS)
Risqi, A. M.; Yudiarsah, E.
2017-07-01
Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.
Gel electrophoresis of partially denatured DNA. Retardation effect: its analysis and application.
Lyamichev, V I; Panyutin, I G; Lyubchenko YuL
1982-01-01
The hypothesis about the role of partial denaturation in DNA retardation during its electrophoresis in denaturing gel /1,2/ was tested. We used partially melted DNA molecules in which the size of the melted regions and their location were known. They were obtained through glyoxal treatment of the melted regions by a procedure allowing the denatured state to be fixed at any point within the melting range. The approach and the availability of the melting maps of DNAs made it possible to investigate DNA molecules differing in length and in the size of the melted regions. The presence of a denatured region at the end of the molecule or inside of it was shown to decrease its electrophoretic mobility, the effect depending on the size of the melted region and on the DNA length. On the basis of the experimental results an explanation is proposed for the cause of retardation in the case of partially denatured DNA. Images PMID:7133999
Simoncelli, Sabrina; Roller, Eva-Maria; Urban, Patrick; Schreiber, Robert; Turberfield, Andrew J; Liedl, Tim; Lohmüller, Theobald
2016-11-22
DNA origami is a powerful approach for assembling plasmonic nanoparticle dimers and Raman dyes with high yields and excellent positioning control. Here we show how optothermal-induced shrinking of a DNA origami template can be employed to control the gap sizes between two 40 nm gold nanoparticles in a range from 1 to 2 nm. The high field confinement achieved with this optothermal approach was demonstrated by detection of surface-enhanced Raman spectroscopy (SERS) signals from single molecules that are precisely placed within the DNA origami template that spans the nanoparticle gap. By comparing the SERS intensity with respect to the field enhancement in the plasmonic hot-spot region, we found good agreement between measurement and theory. Our straightforward approach for the fabrication of addressable plasmonic nanosensors by DNA origami demonstrates a path toward future sensing applications with single-molecule resolution.
Distinguishing Individual DNA Bases in a Network by Non-Resonant Tip-Enhanced Raman Scattering.
Zhang, Rui; Zhang, Xianbiao; Wang, Huifang; Zhang, Yao; Jiang, Song; Hu, Chunrui; Zhang, Yang; Luo, Yi; Dong, Zhenchao
2017-05-08
The importance of identifying DNA bases at the single-molecule level is well recognized for many biological applications. Although such identification can be achieved by electrical measurements using special setups, it is still not possible to identify single bases in real space by optical means owing to the diffraction limit. Herein, we demonstrate the outstanding ability of scanning tunneling microscope (STM)-controlled non-resonant tip-enhanced Raman scattering (TERS) to unambiguously distinguish two individual complementary DNA bases (adenine and thymine) with a spatial resolution down to 0.9 nm. The distinct Raman fingerprints identified for the two molecules allow to differentiate in real space individual DNA bases in coupled base pairs. The demonstrated ability of non-resonant Raman scattering with super-high spatial resolution will significantly extend the applicability of TERS, opening up new routes for single-molecule DNA sequencing. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Srinivasan, Ajay; Gold, Barry
2013-01-01
A major challenge in the future development of cancer therapeutics is the identification of biological targets and pathways, and the subsequent design of molecules to combat the drug-resistant cells hiding in virtually all cancers. This therapeutic approach is justified based upon the limited advances in cancer cures over the past 30 years, despite the development of many novel chemotherapies and earlier detection, which often fail due to drug resistance. Among the various targets to overcome tumor resistance are the DNA repair systems that can reverse the cytotoxicity of many clinically used DNA-damaging agents. Some progress has already been made but much remains to be done. We explore some components of the DNA-repair process, which are involved in repair of alkylation damage of DNA, as targets for the development of novel and effective molecules designed to improve the efficacy of existing anticancer drugs. PMID:22709253
Gonzalez, E; Lino, J; Deriabina, A; Herrera, J N F; Poltev, V I
2013-01-01
To elucidate details of the DNA-water interactions we performed the calculations and systemaitic search for minima of interaction energy of the systems consisting of one of DNA bases and one or two water molecules. The results of calculations using two force fields of molecular mechanics (MM) and correlated ab initio method MP2/6-31G(d, p) of quantum mechanics (QM) have been compared with one another and with experimental data. The calculations demonstrated a qualitative agreement between geometry characteristics of the most of local energy minima obtained via different methods. The deepest minima revealed by MM and QM methods correspond to water molecule position between two neighbor hydrophilic centers of the base and to the formation by water molecule of hydrogen bonds with them. Nevertheless, the relative depth of some minima and peculiarities of mutual water-base positions in' these minima depend on the method used. The analysis revealed insignificance of some differences in the results of calculations performed via different methods and the importance of other ones for the description of DNA hydration. The calculations via MM methods enable us to reproduce quantitatively all the experimental data on the enthalpies of complex formation of single water molecule with the set of mono-, di-, and trimethylated bases, as well as on water molecule locations near base hydrophilic atoms in the crystals of DNA duplex fragments, while some of these data cannot be rationalized by QM calculations.
Petersen, Philippe A D; Silva, Andreia S; Gonçalves, Marcos B; Lapolli, André L; Ferreira, Ana Maria C; Carbonari, Artur W; Petrilli, Helena M
2014-06-03
In this work, perturbed angular correlation (PAC) spectroscopy is used to study differences in the nuclear quadrupole interactions of Cd probes in DNA molecules of mice infected with the Y-strain of Trypanosoma cruzi. The possibility of investigating the local genetic alterations in DNA, which occur along generations of mice infected with T. cruzi, using hyperfine interactions obtained from PAC measurements and density functional theory (DFT) calculations in DNA bases is discussed. A comparison of DFT calculations with PAC measurements could determine the type of Cd coordination in the studied molecules. To the best of our knowledge, this is the first attempt to use DFT calculations and PAC measurements to investigate the local environment of Cd ions bound to DNA bases in mice infected with Chagas disease. The obtained results also allowed the detection of local changes occurring in the DNA molecules of different generations of mice infected with T. cruzi, opening the possibility of using this technique as a complementary tool in the characterization of complicated biological systems.
Wu, Qiong; Chen, Xia; Jia, Lizhen; Wang, Yi; Sun, Ying; Huang, Xingjun; Shen, Yuxiang; Wang, Jun
2017-11-01
The interaction of DNA with Bis [N,N-bis (carboxymethyl) aminomethyl] fluorescein-Ferrous(III) (Fluorescein-DA-Fe(III)) with dual functional (sonodynamic and sonocatalytic) activity was studied by UV-vis spectroscopy, fluorescence spectroscopy, FT-IR spectroscopy, circular dichroism (CD) spectroscopy and viscosity measurements. And then, the damage of DNA caused by Fluorescein-DA-Fe(III) under ultrasonic irradiation (US) was researched by agarose gel electrophoresis and cytotoxicity assay. Meanwhile, some influenced factors such as ultrasonic irradiation time and Fluorescein-DA-Fe(III) concentration on the damage degree of DNA molecules were also examined. As a control, for Bis [N,N-bis (carboxymethyl) aminomethyl] fluorescein (Fluorescein-DA), the same experiments were carried out. The results showed that both Fluorescein-DA-Fe(III) and Fluorescein-DA can interact with DNA molecules. Under ultrasonic irradiation, Fluorescein-DA shows sonodynamic activity, which can damage DNA molecules. While, in the presence of Fe(III) ion, the Fluorescein-DA-Fe(III) displays not only sonodynamic activity but also sonocatalytic activity under ultrasonic irradiation, which injures DNA more serious than Fluorescein-DA. The researches confirmed the dual function (sonodynamic activity and sonocatalytic activity) of Fluorescein-DA-Fe(III) and expanded the usage of Fluorescein-DA-Fe(III) as a sonosensitizer in sonodynamic therapy (SDT). Copyright © 2017 Elsevier B.V. All rights reserved.