In Silico Screening Based on Predictive Algorithms as a Design Tool for Exon Skipping Oligonucleotides in Duchenne Muscular Dystrophy

PubMed Central

Echigoya, Yusuke; Mouly, Vincent; Garcia, Luis; Yokota, Toshifumi; Duddy, William

2015-01-01

The use of antisense ‘splice-switching’ oligonucleotides to induce exon skipping represents a potential therapeutic approach to various human genetic diseases. It has achieved greatest maturity in exon skipping of the dystrophin transcript in Duchenne muscular dystrophy (DMD), for which several clinical trials are completed or ongoing, and a large body of data exists describing tested oligonucleotides and their efficacy. The rational design of an exon skipping oligonucleotide involves the choice of an antisense sequence, usually between 15 and 32 nucleotides, targeting the exon that is to be skipped. Although parameters describing the target site can be computationally estimated and several have been identified to correlate with efficacy, methods to predict efficacy are limited. Here, an in silico pre-screening approach is proposed, based on predictive statistical modelling. Previous DMD data were compiled together and, for each oligonucleotide, some 60 descriptors were considered. Statistical modelling approaches were applied to derive algorithms that predict exon skipping for a given target site. We confirmed (1) the binding energetics of the oligonucleotide to the RNA, and (2) the distance in bases of the target site from the splice acceptor site, as the two most predictive parameters, and we included these and several other parameters (while discounting many) into an in silico screening process, based on their capacity to predict high or low efficacy in either phosphorodiamidate morpholino oligomers (89% correctly predicted) and/or 2’O Methyl RNA oligonucleotides (76% correctly predicted). Predictions correlated strongly with in vitro testing for sixteen de novo PMO sequences targeting various positions on DMD exons 44 (R2 0.89) and 53 (R2 0.89), one of which represents a potential novel candidate for clinical trials. We provide these algorithms together with a computational tool that facilitates screening to predict exon skipping efficacy at each position of a target exon. PMID:25816009

A compatible exon-exon junction database for the identification of exon skipping events using tandem mass spectrum data.

PubMed

Mo, Fan; Hong, Xu; Gao, Feng; Du, Lin; Wang, Jun; Omenn, Gilbert S; Lin, Biaoyang

2008-12-16

Alternative splicing is an important gene regulation mechanism. It is estimated that about 74% of multi-exon human genes have alternative splicing. High throughput tandem (MS/MS) mass spectrometry provides valuable information for rapidly identifying potentially novel alternatively-spliced protein products from experimental datasets. However, the ability to identify alternative splicing events through tandem mass spectrometry depends on the database against which the spectra are searched. We wrote scripts in perl, Bioperl, mysql and Ensembl API and built a theoretical exon-exon junction protein database to account for all possible combinations of exons for a gene while keeping the frame of translation (i.e., keeping only in-phase exon-exon combinations) from the Ensembl Core Database. Using our liver cancer MS/MS dataset, we identified a total of 488 non-redundant peptides that represent putative exon skipping events. Our exon-exon junction database provides the scientific community with an efficient means to identify novel alternatively spliced (exon skipping) protein isoforms using mass spectrometry data. This database will be useful in annotating genome structures using rapidly accumulating proteomics data.

Immortalized Muscle Cell Model to Test the Exon Skipping Efficacy for Duchenne Muscular Dystrophy

PubMed Central

Nguyen, Quynh

2017-01-01

Duchenne muscular dystrophy (DMD) is a lethal genetic disorder that most commonly results from mutations disrupting the reading frame of the dystrophin (DMD) gene. Among the therapeutic approaches employed, exon skipping using antisense oligonucleotides (AOs) is one of the most promising strategies. This strategy aims to restore the reading frame, thus producing a truncated, yet functioning dystrophin protein. In 2016, the Food and Drug Administration (FDA) conditionally approved the first AO-based drug, eteplirsen (Exondys 51), developed for DMD exon 51 skipping. An accurate and reproducible method to quantify exon skipping efficacy is essential for evaluating the therapeutic potential of different AOs sequences. However, previous in vitro screening studies have been hampered by the limited proliferative capacity and insufficient amounts of dystrophin expressed by primary muscle cell lines that have been the main system used to evaluate AOs sequences. In this paper, we illustrate the challenges associated with primary muscle cell lines and describe a novel approach that utilizes immortalized cell lines to quantitatively evaluate the exon skipping efficacy in in vitro studies. PMID:29035327

Intron self-complementarity enforces exon inclusion in a yeast pre-mRNA

PubMed Central

Howe, Kenneth James; Ares, Manuel

1997-01-01

Skipping of internal exons during removal of introns from pre-mRNA must be avoided for proper expression of most eukaryotic genes. Despite significant understanding of the mechanics of intron removal, mechanisms that ensure inclusion of internal exons in multi-intron pre-mRNAs remain mysterious. Using a natural two-intron yeast gene, we have identified distinct RNA–RNA complementarities within each intron that prevent exon skipping and ensure inclusion of internal exons. We show that these complementarities are positioned to act as intron identity elements, bringing together only the appropriate 5′ splice sites and branchpoints. Destroying either intron self-complementarity allows exon skipping to occur, and restoring the complementarity using compensatory mutations rescues exon inclusion, indicating that the elements act through formation of RNA secondary structure. Introducing new pairing potential between regions near the 5′ splice site of intron 1 and the branchpoint of intron 2 dramatically enhances exon skipping. Similar elements identified in single intron yeast genes contribute to splicing efficiency. Our results illustrate how intron secondary structure serves to coordinate splice site pairing and enforce exon inclusion. We suggest that similar elements in vertebrate genes could assist in the splicing of very large introns and in the evolution of alternative splicing. PMID:9356473

Histone hyperacetylation and exon skipping: a calcium-mediated dynamic regulation in cardiomyocytes

PubMed Central

Sharma, Alok; Nguyen, Hieu; Cai, Lu; Lou, Hua

2015-01-01

In contrast to cell type-specific pre-mRNA alternative splicing, mechanisms controlling activity-dependent alternative splicing is under-studied and not well understood. In a recent study, we conducted a comprehensive analysis of calcium-mediated mechanism that regulates alternative exon skipping in mouse cardiomyocytes. Our results reveal a strong link between histone hyperacetylation and skipping of cassette exons, and provide support to the kinetic coupling model of the epigenetic regulation of alternative splicing at the chromatin level. PMID:26325491

HnRNP C, YB-1 and hnRNP L coordinately enhance skipping of human MUSK exon 10 to generate a Wnt-insensitive MuSK isoform

PubMed Central

Nasrin, Farhana; Rahman, Mohammad Alinoor; Masuda, Akio; Ohe, Kenji; Takeda, Jun-ichi; Ohno, Kinji

2014-01-01

Muscle specific receptor tyrosine kinase (MuSK) is an essential postsynaptic transmembrane molecule that mediates clustering of acetylcholine receptors (AChR). MUSK exon 10 is alternatively skipped in human, but not in mouse. Skipping of this exon disrupts a cysteine-rich region (Fz-CRD), which is essential for Wnt-mediated AChR clustering. To investigate the underlying mechanisms of alternative splicing, we exploited block-scanning mutagenesis with human minigene and identified a 20-nucleotide block that contained exonic splicing silencers. Using RNA-affinity purification, mass spectrometry, and Western blotting, we identified that hnRNP C, YB-1 and hnRNP L are bound to MUSK exon 10. siRNA-mediated knockdown and cDNA overexpression confirmed the additive, as well as the independent, splicing suppressing effects of hnRNP C, YB-1 and hnRNP L. Antibody-mediated in vitro protein depletion and scanning mutagenesis additionally revealed that binding of hnRNP C to RNA subsequently promotes binding of YB-1 and hnRNP L to the immediate downstream sites and enhances exon skipping. Simultaneous tethering of two splicing trans-factors to the target confirmed the cooperative effect of YB-1 and hnRNP L on hnRNP C-mediated exon skipping. Search for a similar motif in the human genome revealed nine alternative exons that were individually or coordinately regulated by hnRNP C and YB-1. PMID:25354590

Analysis of the functional consequences of targeted exon deletion in COL7A1 reveals prospects for dystrophic epidermolysis bullosa therapy

PubMed Central

Bornert, Olivier; Kühl, Tobias; Bremer, Jeroen; van den Akker, Peter C; Pasmooij, Anna MG; Nyström, Alexander

2016-01-01

Genetically evoked deficiency of collagen VII causes dystrophic epidermolysis bullosa (DEB)—a debilitating disease characterized by chronic skin fragility and progressive fibrosis. Removal of exons carrying frame-disrupting mutations can reinstate protein expression in genetic diseases. The therapeutic potential of this approach is critically dependent on gene, protein, and disease intrinsic factors. Naturally occurring exon skipping in COL7A1, translating collagen VII, suggests that skipping of exons containing disease-causing mutations may be feasible for the treatment of DEB. However, despite a primarily in-frame arrangement of exons in the COL7A1 gene, no general conclusion of the aptitude of exon skipping for DEB can be drawn, since regulation of collagen VII functionality is complex involving folding, intra- and intermolecular interactions. To directly address this, we deleted two conceptually important exons located at both ends of COL7A1, exon 13, containing recurrent mutations, and exon 105, predicted to impact folding. The resulting recombinantly expressed proteins showed conserved functionality in biochemical and in vitro assays. Injected into DEB mice, the proteins promoted skin stability. By demonstrating functionality of internally deleted collagen VII variants, our study provides support of targeted exon deletion or skipping as a potential therapy to treat a large number of individuals with DEB. PMID:27157667

Development of Exon Skipping Therapies for Duchenne Muscular Dystrophy: A Critical Review and a Perspective on the Outstanding Issues

PubMed Central

Aartsma-Rus, Annemieke; Straub, Volker; Hemmings, Robert; Haas, Manuel; Schlosser-Weber, Gabriele; Stoyanova-Beninska, Violeta; Mercuri, Eugenio; Muntoni, Francesco; Sepodes, Bruno; Vroom, Elizabeth

2017-01-01

Duchenne muscular dystrophy (DMD) is a rare, severe, progressive muscle-wasting disease leading to disability and premature death. Patients lack the muscle membrane-stabilizing protein dystrophin. Antisense oligonucleotide (AON)-mediated exon skipping is a therapeutic approach that aims to induce production of partially functional dystrophins. Recently, an AON targeting exon 51 became the first of its class to be approved by the United States regulators [Food and Drug Administration (FDA)] for the treatment of DMD. A unique aspect of the exon-skipping approach for DMD is that, depending on the size and location of the mutation, different exons need to be skipped. This challenge raises a number of questions regarding the development and regulatory approval of those individual compounds. In this study, we present a perspective on those questions, following a European stakeholder meeting involving academics, regulators, and representatives from industry and patient organizations, and in the light of the most recent scientific and regulatory experience. PMID:28796573

Therapeutic NOTCH3 cysteine correction in CADASIL using exon skipping: in vitro proof of concept.

PubMed

Rutten, Julie W; Dauwerse, Hans G; Peters, Dorien J M; Goldfarb, Andrew; Venselaar, Hanka; Haffner, Christof; van Ommen, Gert-Jan B; Aartsma-Rus, Annemieke M; Lesnik Oberstein, Saskia A J

2016-04-01

Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy, or CADASIL, is a hereditary cerebral small vessel disease caused by characteristic cysteine altering missense mutations in the NOTCH3 gene. NOTCH3 mutations in CADASIL result in an uneven number of cysteine residues in one of the 34 epidermal growth factor like-repeat (EGFr) domains of the NOTCH3 protein. The consequence of an unpaired cysteine residue in an EGFr domain is an increased multimerization tendency of mutant NOTCH3, leading to toxic accumulation of the protein in the (cerebro)vasculature, and ultimately reduced cerebral blood flow, recurrent stroke and vascular dementia. There is no therapy to delay or alleviate symptoms in CADASIL. We hypothesized that exclusion of the mutant EGFr domain from NOTCH3 would abolish the detrimental effect of the unpaired cysteine and thus prevent toxic NOTCH3 accumulation and the negative cascade of events leading to CADASIL. To accomplish this NOTCH3 cysteine correction by EGFr domain exclusion, we used pre-mRNA antisense-mediated skipping of specific NOTCH3 exons. Selection of these exons was achieved using in silico studies and based on the criterion that skipping of a particular exon or exon pair would modulate the protein in such a way that the mutant EGFr domain is eliminated, without otherwise corrupting NOTCH3 structure and function. Remarkably, we found that this strategy closely mimics evolutionary events, where the elimination and fusion of NOTCH EGFr domains led to the generation of four functional NOTCH homologues. We modelled a selection of exon skip strategies using cDNA constructs and show that the skip proteins retain normal protein processing, can bind ligand and be activated by ligand. We then determined the technical feasibility of targeted NOTCH3 exon skipping, by designing antisense oligonucleotides targeting exons 2-3, 4-5 and 6, which together harbour the majority of distinct CADASIL-causing mutations. Transfection of these antisense oligonucleotides into CADASIL patient-derived cerebral vascular smooth muscle cells resulted in successful exon skipping, without abrogating NOTCH3 signalling. Combined, these data provide proof of concept for this novel application of exon skipping, and are a first step towards the development of a rational therapeutic approach applicable to up to 94% of CADASIL-causing mutations. © The Author (2016). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

In vivo effects on intron retention and exon skipping by the U2AF large subunit and SF1/BBP in the nematode Caenorhabditis elegans

PubMed Central

Ma, Long; Tan, Zhiping; Teng, Yanling; Hoersch, Sebastian; Horvitz, H. Robert

2011-01-01

The in vivo analysis of the roles of splicing factors in regulating alternative splicing in animals remains a challenge. Using a microarray-based screen, we identified a Caenorhabditis elegans gene, tos-1, that exhibited three of the four major types of alternative splicing: intron retention, exon skipping, and, in the presence of U2AF large subunit mutations, the use of alternative 3′ splice sites. Mutations in the splicing factors U2AF large subunit and SF1/BBP altered the splicing of tos-1. 3′ splice sites of the retained intron or before the skipped exon regulate the splicing pattern of tos-1. Our study provides in vivo evidence that intron retention and exon skipping can be regulated largely by the identities of 3′ splice sites. PMID:22033331

Expression of exon-8-skipped kindlin-1 does not compensate for defects of Kindler syndrome.

PubMed

Natsuga, Ken; Nishie, Wataru; Shinkuma, Satoru; Nakamura, Hideki; Matsushima, Yoichiro; Tatsuta, Aya; Komine, Mayumi; Shimizu, Hiroshi

2011-01-01

Kindler syndrome (KS) is a rare, inherited skin disease characterized by blister formation and generalized poikiloderma. Mutations in KIND1, which encodes kindlin-1, are responsible for KS. c.1089del/1089+1del is a recurrent splice-site deletion mutation in KS patients. To elucidate the effects of c.1089del/1089+1del at the mRNA and protein level. Two KS patients with c.1089del/1089+1del were included in this study. Immunofluorescence analysis of KS skin samples using antibodies against the dermo-epidermal junction proteins was performed. Exon-trapping experiments were performed to isolate the mRNA sequences transcribed from genomic DNA harbouring c.1089del/1089+1del. β1 integrin activation in HeLa cells transfected with truncated KIND1 cDNA was analyzed. Immunofluorescence study showed positive expression of kindlin-1 in KS skin with c.1089del/1089+1del mutation. We identified the exon-8-skipped in-frame transcript as the main product among multiple splicing variants derived from that mutation. HeLa cells transfected with KIND1 cDNA without exon 8 showed impaired β1 integrin activation. Exon-8-coding amino acids are located in the FERM F2 domain, which is conserved among species, and the unstructured region between F2 and the pleckstrin homology domain. This study suggests that exon-8-skipped truncated kindlin-1 is functionally defective and does not compensate for the defects of KS, even though kindlin-1 expression in skin is positive. Copyright © 2010 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

Modulating Calcium Signals to Boost AON Exon Skipping for DMD

DTIC Science & Technology

2016-10-01

RNA Seq analysis to identify mechanisms of activity and specificity in order to guide discovery of second-generation skipping drugs or combinations...with greater activity. 15. SUBJECT TERMS Exon skipping, Dantrolene, Calcium, Duchenne, Dytrophy, Dystrophin, anti-sense-oligonucleatide, DMD, RNA ...for a subset of very rare mutations. Finally, we hypothesize that by combining chemical genomics with RNA Seq analysis we can begin to identify

Longitudinal effect of eteplirsen versus historical control on ambulation in Duchenne muscular dystrophy

PubMed Central

Goemans, Nathalie; Lowes, Linda P.; Alfano, Lindsay N.; Berry, Katherine; Shao, James; Kaye, Edward M.; Mercuri, Eugenio; Hamid, Hoda Abdel; Byrne, Barry J.; Connolly, Anne M.; Dracker, Robert A.; Matthew Frank, L.; Heydemann, Peter T.; O'Brien, Kevin C.; Sparks, Susan E.; Specht, Linda A.; Rodino‐Klapac, Louise; Sahenk, Zarife; Al‐Zaidy, Samiah; Cripe, Linda H.; Lewis, Sarah; M, Pane; E, Mazzone; S, Messina; GL, Vita; Bertini, D Amico A; Casimiro, Berardinelli A; Y, Torrente; F, Magri; GP, Comi; G, Baranello; T, Mongini; A, Pini; R, Battini; E, Pegoraro; C, Bruno; L, Politano; S, Previtali

2016-01-01

Objective To continue evaluation of the long‐term efficacy and safety of eteplirsen, a phosphorodiamidate morpholino oligomer designed to skip DMD exon 51 in patients with Duchenne muscular dystrophy (DMD). Three‐year progression of eteplirsen‐treated patients was compared to matched historical controls (HC). Methods Ambulatory DMD patients who were ≥7 years old and amenable to exon 51 skipping were randomized to eteplirsen (30/50mg/kg) or placebo for 24 weeks. Thereafter, all received eteplirsen on an open‐label basis. The primary functional assessment in this study was the 6‐Minute Walk Test (6MWT). Respiratory muscle function was assessed by pulmonary function testing (PFT). Longitudinal natural history data were used for comparative analysis of 6MWT performance at baseline and months 12, 24, and 36. Patients were matched to the eteplirsen group based on age, corticosteroid use, and genotype. Results At 36 months, eteplirsen‐treated patients (n = 12) demonstrated a statistically significant advantage of 151m (p < 0.01) on 6MWT and experienced a lower incidence of loss of ambulation in comparison to matched HC (n = 13) amenable to exon 51 skipping. PFT results remained relatively stable in eteplirsen‐treated patients. Eteplirsen was well tolerated. Analysis of HC confirmed the previously observed change in disease trajectory at age 7 years, and more severe progression was observed in patients with mutations amenable to exon skipping than in those not amenable. The subset of patients amenable to exon 51 skipping showed a more severe disease course than those amenable to any exon skipping. Interpretation Over 3 years of follow‐up, eteplirsen‐treated patients showed a slower rate of decline in ambulation assessed by 6MWT compared to untreated matched HC. Ann Neurol 2016;79:257–271 PMID:26573217

Identification of a splicing enhancer in MLH1 using COMPARE a new assay for determination of relative RNA splicing efficiencies

PubMed Central

Xu, Dong-Qing; Mattox, William

2006-01-01

Exonic splicing enhancers (ESEs) are sequences that facilitate recognition of splice sites and prevent exon-skipping. Because ESEs are often embedded within proteincoding sequences, alterations in them can also often be interpreted as nonsense, missense or silent mutations. To correctly interpret exonic mutations and their roles in disease, it is important to develop strategies that identify ESE mutations. Potential ESEs can be found computationally in many exons but it has proven difficult to predict if a given mutation will have effects on splicing based on sequence alone. Here we describe a flexible in vitro method that can be used to functionally compare the effects of multiple sequence variants on ESE activity in a single in vitro splicing reaction. We have applied this method in parallel with conventional splicing assays to test for a splicing enhancer in exon 17 of the human MLH1 gene. Point mutations associated with hereditary nonpolyposis colorectal cancer (HNPCC) have previously been found to correlate with exon-skipping in both lymphocytes and tumors from patients. We show that sequences from this exon can replace an ESE from the mouse IgM gene to support RNA splicing in HeLa nuclear extracts. ESE activity was reduced by HNPCC point mutations in codon 659 indicating that their primary effect is on splicing. Surprisingly the strongest enhancer function mapped to a different region of the exon upstream of this codon. Together our results indicate that HNPCC point mutations in codon 659 affect an auxillary element that augments the enhancer function to ensure exon inclusion. PMID:16357104

Antisense oligonucleotide-induced alternative splicing of the APOB mRNA generates a novel isoform of APOB.

PubMed

Khoo, Bernard; Roca, Xavier; Chew, Shern L; Krainer, Adrian R

2007-01-17

Apolipoprotein B (APOB) is an integral part of the LDL, VLDL, IDL, Lp(a) and chylomicron lipoprotein particles. The APOB pre-mRNA consists of 29 constitutively-spliced exons. APOB exists as two natural isoforms: the full-length APOB100 isoform, assembled into LDL, VLDL, IDL and Lp(a) and secreted by the liver in humans; and the C-terminally truncated APOB48, assembled into chylomicrons and secreted by the intestine in humans. Down-regulation of APOB100 is a potential therapy to lower circulating LDL and cholesterol levels. We investigated the ability of 2'O-methyl RNA antisense oligonucleotides (ASOs) to induce the skipping of exon 27 in endogenous APOB mRNA in HepG2 cells. These ASOs are directed towards the 5' and 3' splice-sites of exon 27, the branch-point sequence (BPS) of intron 26-27 and several predicted exonic splicing enhancers within exon 27. ASOs targeting either the 5' or 3' splice-site, in combination with the BPS, are the most effective. The splicing of other alternatively spliced genes are not influenced by these ASOs, suggesting that the effects seen are not due to non-specific changes in alternative splicing. The skip 27 mRNA is translated into a truncated isoform, APOB87SKIP27. The induction of APOB87SKIP27 expression in vivo should lead to decreased LDL and cholesterol levels, by analogy to patients with hypobetalipoproteinemia. As intestinal APOB mRNA editing and APOB48 expression rely on sequences within exon 26, exon 27 skipping should not affect APOB48 expression unlike other methods of down-regulating APOB100 expression which also down-regulate APOB48.

Lariat sequencing in a unicellular yeast identifies regulated alternative splicing of exons that are evolutionarily conserved with humans.

PubMed

Awan, Ali R; Manfredo, Amanda; Pleiss, Jeffrey A

2013-07-30

Alternative splicing is a potent regulator of gene expression that vastly increases proteomic diversity in multicellular eukaryotes and is associated with organismal complexity. Although alternative splicing is widespread in vertebrates, little is known about the evolutionary origins of this process, in part because of the absence of phylogenetically conserved events that cross major eukaryotic clades. Here we describe a lariat-sequencing approach, which offers high sensitivity for detecting splicing events, and its application to the unicellular fungus, Schizosaccharomyces pombe, an organism that shares many of the hallmarks of alternative splicing in mammalian systems but for which no previous examples of exon-skipping had been demonstrated. Over 200 previously unannotated splicing events were identified, including examples of regulated alternative splicing. Remarkably, an evolutionary analysis of four of the exons identified here as subject to skipping in S. pombe reveals high sequence conservation and perfect length conservation with their homologs in scores of plants, animals, and fungi. Moreover, alternative splicing of two of these exons have been documented in multiple vertebrate organisms, making these the first demonstrations of identical alternative-splicing patterns in species that are separated by over 1 billion y of evolution.

A Duchenne Muscular Dystrophy Gene Hot Spot Mutation in Dystrophin-Deficient Cavalier King Charles Spaniels Is Amenable to Exon 51 Skipping

PubMed Central

Walmsley, Gemma L.; Arechavala-Gomeza, Virginia; Fernandez-Fuente, Marta; Burke, Margaret M.; Nagel, Nicole; Holder, Angela; Stanley, Rachael; Chandler, Kate; Marks, Stanley L.; Muntoni, Francesco; Shelton, G. Diane; Piercy, Richard J.

2010-01-01

Background Duchenne muscular dystrophy (DMD), which afflicts 1 in 3500 boys, is one of the most common genetic disorders of children. This fatal degenerative condition is caused by an absence or deficiency of dystrophin in striated muscle. Most affected patients have inherited or spontaneous deletions in the dystrophin gene that disrupt the reading frame resulting in unstable truncated products. For these patients, restoration of the reading frame via antisense oligonucleotide-mediated exon skipping is a promising therapeutic approach. The major DMD deletion “hot spot” is found between exons 45 and 53, and skipping exon 51 in particular is predicted to ameliorate the dystrophic phenotype in the greatest number of patients. Currently the mdx mouse is the most widely used animal model of DMD, although its mild phenotype limits its suitability in clinical trials. The Golden Retriever muscular dystrophy (GRMD) model has a severe phenotype, but due to its large size, is expensive to use. Both these models have mutations in regions of the dystrophin gene distant from the commonly mutated DMD “hot spot”. Methodology/Principal Findings Here we describe the severe phenotype, histopathological findings, and molecular analysis of Cavalier King Charles Spaniels with dystrophin-deficient muscular dystrophy (CKCS-MD). The dogs harbour a missense mutation in the 5′ donor splice site of exon 50 that results in deletion of exon 50 in mRNA transcripts and a predicted premature truncation of the translated protein. Antisense oligonucleotide-mediated skipping of exon 51 in cultured myoblasts from an affected dog restored the reading frame and protein expression. Conclusions/Significance Given the small size of the breed, the amiable temperament and the nature of the mutation, we propose that CKCS-MD is a valuable new model for clinical trials of antisense oligonucleotide-induced exon skipping and other therapeutic approaches for DMD. PMID:20072625

Dystrophin quantification and clinical correlations in Becker muscular dystrophy: implications for clinical trials.

PubMed

Anthony, Karen; Cirak, Sebahattin; Torelli, Silvia; Tasca, Giorgio; Feng, Lucy; Arechavala-Gomeza, Virginia; Armaroli, Annarita; Guglieri, Michela; Straathof, Chiara S; Verschuuren, Jan J; Aartsma-Rus, Annemieke; Helderman-van den Enden, Paula; Bushby, Katherine; Straub, Volker; Sewry, Caroline; Ferlini, Alessandra; Ricci, Enzo; Morgan, Jennifer E; Muntoni, Francesco

2011-12-01

Duchenne muscular dystrophy is caused by mutations in the DMD gene that disrupt the open reading frame and prevent the full translation of its protein product, dystrophin. Restoration of the open reading frame and dystrophin production can be achieved by exon skipping using antisense oligonucleotides targeted to splicing elements. This approach aims to transform the Duchenne muscular dystrophy phenotype to that of the milder disorder, Becker muscular dystrophy, typically caused by in-frame dystrophin deletions that allow the production of an internally deleted but partially functional dystrophin. There is ongoing debate regarding the functional properties of the different internally deleted dystrophins produced by exon skipping for different mutations; more insight would be valuable to improve and better predict the outcome of exon skipping clinical trials. To this end, we have characterized the clinical phenotype of 17 patients with Becker muscular dystrophy harbouring in-frame deletions relevant to on-going or planned exon skipping clinical trials for Duchenne muscular dystrophy and correlated it to the levels of dystrophin, and dystrophin-associated protein expression. The cohort of 17 patients, selected exclusively on the basis of their genotype, included 4 asymptomatic, 12 mild and 1 severe patient. All patients had dystrophin levels of >40% of control and significantly higher dystrophin (P = 0.013), β-dystroglycan (P = 0.025) and neuronal nitric oxide synthase (P = 0.034) expression was observed in asymptomatic individuals versus symptomatic patients with Becker muscular dystrophy. Furthermore, grouping the patients by deletion, patients with Becker muscular dystrophy with deletions with an end-point of exon 51 (the skipping of which could rescue the largest group of Duchenne muscular dystrophy deletions) showed significantly higher dystrophin levels (P = 0.034) than those with deletions ending with exon 53. This is the first quantitative study on both dystrophin and dystrophin-associated protein expression in patients with Becker muscular dystrophy with deletions relevant for on-going exon skipping trials in Duchenne muscular dystrophy. Taken together, our results indicate that all varieties of internally deleted dystrophin assessed in this study have the functional capability to provide a substantial clinical benefit to patients with Duchenne muscular dystrophy.

Dystrophin quantification and clinical correlations in Becker muscular dystrophy: implications for clinical trials

PubMed Central

Anthony, Karen; Cirak, Sebahattin; Torelli, Silvia; Tasca, Giorgio; Feng, Lucy; Arechavala-Gomeza, Virginia; Armaroli, Annarita; Guglieri, Michela; Straathof, Chiara S.; Verschuuren, Jan J.; Aartsma-Rus, Annemieke; Helderman-van den Enden, Paula; Bushby, Katherine; Straub, Volker; Sewry, Caroline; Ferlini, Alessandra; Ricci, Enzo; Morgan, Jennifer E.

2011-01-01

Duchenne muscular dystrophy is caused by mutations in the DMD gene that disrupt the open reading frame and prevent the full translation of its protein product, dystrophin. Restoration of the open reading frame and dystrophin production can be achieved by exon skipping using antisense oligonucleotides targeted to splicing elements. This approach aims to transform the Duchenne muscular dystrophy phenotype to that of the milder disorder, Becker muscular dystrophy, typically caused by in-frame dystrophin deletions that allow the production of an internally deleted but partially functional dystrophin. There is ongoing debate regarding the functional properties of the different internally deleted dystrophins produced by exon skipping for different mutations; more insight would be valuable to improve and better predict the outcome of exon skipping clinical trials. To this end, we have characterized the clinical phenotype of 17 patients with Becker muscular dystrophy harbouring in-frame deletions relevant to on-going or planned exon skipping clinical trials for Duchenne muscular dystrophy and correlated it to the levels of dystrophin, and dystrophin-associated protein expression. The cohort of 17 patients, selected exclusively on the basis of their genotype, included 4 asymptomatic, 12 mild and 1 severe patient. All patients had dystrophin levels of >40% of control and significantly higher dystrophin (P = 0.013), β-dystroglycan (P = 0.025) and neuronal nitric oxide synthase (P = 0.034) expression was observed in asymptomatic individuals versus symptomatic patients with Becker muscular dystrophy. Furthermore, grouping the patients by deletion, patients with Becker muscular dystrophy with deletions with an end-point of exon 51 (the skipping of which could rescue the largest group of Duchenne muscular dystrophy deletions) showed significantly higher dystrophin levels (P = 0.034) than those with deletions ending with exon 53. This is the first quantitative study on both dystrophin and dystrophin-associated protein expression in patients with Becker muscular dystrophy with deletions relevant for on-going exon skipping trials in Duchenne muscular dystrophy. Taken together, our results indicate that all varieties of internally deleted dystrophin assessed in this study have the functional capability to provide a substantial clinical benefit to patients with Duchenne muscular dystrophy. PMID:22102647

A role for exon sequences in alternative splicing of the human fibronectin gene.

PubMed Central

Mardon, H J; Sebastio, G; Baralle, F E

1987-01-01

Exon EDIIIA of the fibronectin (Fn) gene is alternatively spliced via pathways which either skip or include the whole exon in the messenger RNA (mRNA). We have investigated the role of EDIIIA exon sequences in the human Fn gene in determining alternative splicing of this exon during transient expression of alpha globin/Fn minigene hybrids in HeLa cells. We demonstrate that a DNA sequence of 81bp within the central region of exon EDIIIA is required for alternative splicing during processing of the primary transcript to generate both EDIIIA+ and EDIIIA- mRNA's. Furthermore, alternative splicing of EDIIIA only occurs when this sequence is present in the correct orientation since when it is in antisense orientation splicing always occurs via exon-skipping generating EDIIIA- mRNA. Images PMID:3671064

Exon skipping and gene transfer restore dystrophin expression in human induced pluripotent stem cells-cardiomyocytes harboring DMD mutations.

PubMed

Dick, Emily; Kalra, Spandan; Anderson, David; George, Vinoj; Ritso, Morten; Laval, Steven H; Barresi, Rita; Aartsma-Rus, Annemieke; Lochmüller, Hanns; Denning, Chris

2013-10-15

With an incidence of ∼1:3,500 to 5,000 in male children, Duchenne muscular dystrophy (DMD) is an X-linked disorder in which progressive muscle degeneration occurs and affected boys usually die in their twenties or thirties. Cardiac involvement occurs in 90% of patients and heart failure accounts for up to 40% of deaths. To enable new therapeutics such as gene therapy and exon skipping to be tested in human cardiomyocytes, we produced human induced pluripotent stem cells (hiPSC) from seven patients harboring mutations across the DMD gene. Mutations were retained during differentiation and analysis indicated the cardiomyocytes showed a dystrophic gene expression profile. Antisense oligonucleotide-mediated skipping of exon 51 restored dystrophin expression to ∼30% of normal levels in hiPSC-cardiomyocytes carrying exon 47-50 or 48-50 deletions. Alternatively, delivery of a dystrophin minigene to cardiomyocytes with a deletion in exon 35 or a point mutation in exon 70 allowed expression levels similar to those seen in healthy cells. This demonstrates that DMD hiPSC-cardiomyocytes provide a novel tool to evaluate whether new therapeutics can restore dystrophin expression in the heart.

Exon Skipping and Gene Transfer Restore Dystrophin Expression in Human Induced Pluripotent Stem Cells-Cardiomyocytes Harboring DMD Mutations

PubMed Central

Dick, Emily; Kalra, Spandan; Anderson, David; George, Vinoj; Ritso, Morten; Laval, Steven H.; Barresi, Rita; Aartsma-Rus, Annemieke; Lochmüller, Hanns

2013-01-01

With an incidence of ∼1:3,500 to 5,000 in male children, Duchenne muscular dystrophy (DMD) is an X-linked disorder in which progressive muscle degeneration occurs and affected boys usually die in their twenties or thirties. Cardiac involvement occurs in 90% of patients and heart failure accounts for up to 40% of deaths. To enable new therapeutics such as gene therapy and exon skipping to be tested in human cardiomyocytes, we produced human induced pluripotent stem cells (hiPSC) from seven patients harboring mutations across the DMD gene. Mutations were retained during differentiation and analysis indicated the cardiomyocytes showed a dystrophic gene expression profile. Antisense oligonucleotide-mediated skipping of exon 51 restored dystrophin expression to ∼30% of normal levels in hiPSC-cardiomyocytes carrying exon 47–50 or 48–50 deletions. Alternatively, delivery of a dystrophin minigene to cardiomyocytes with a deletion in exon 35 or a point mutation in exon 70 allowed expression levels similar to those seen in healthy cells. This demonstrates that DMD hiPSC-cardiomyocytes provide a novel tool to evaluate whether new therapeutics can restore dystrophin expression in the heart. PMID:23829870

A mechanism for exon skipping caused by nonsense or missense mutations in BRCA1 and other genes.

PubMed

Liu, H X; Cartegni, L; Zhang, M Q; Krainer, A R

2001-01-01

Point mutations can generate defective and sometimes harmful proteins. The nonsense-mediated mRNA decay (NMD) pathway minimizes the potential damage caused by nonsense mutations. In-frame nonsense codons located at a minimum distance upstream of the last exon-exon junction are recognized as premature termination codons (PTCs), targeting the mRNA for degradation. Some nonsense mutations cause skipping of one or more exons, presumably during pre-mRNA splicing in the nucleus; this phenomenon is termed nonsense-mediated altered splicing (NAS), and its underlying mechanism is unclear. By analyzing NAS in BRCA1, we show here that inappropriate exon skipping can be reproduced in vitro, and results from disruption of a splicing enhancer in the coding sequence. Enhancers can be disrupted by single nonsense, missense and translationally silent point mutations, without recognition of an open reading frame as such. These results argue against a nuclear reading-frame scanning mechanism for NAS. Coding-region single-nucleotide polymorphisms (cSNPs) within exonic splicing enhancers or silencers may affect the patterns or efficiency of mRNA splicing, which may in turn cause phenotypic variability and variable penetrance of mutations elsewhere in a gene.

Dynamic ASXL1 Exon Skipping and Alternative Circular Splicing in Single Human Cells

PubMed Central

Natarajan, Sivaraman; Carter, Robert; Brown, Patrick O.

2016-01-01

Circular RNAs comprise a poorly understood new class of noncoding RNA. In this study, we used a combination of targeted deletion, high-resolution splicing detection, and single-cell sequencing to deeply probe ASXL1 circular splicing. We found that efficient circular splicing required the canonical transcriptional start site and inverted AluSx elements. Sequencing-based interrogation of isoforms after ASXL1 overexpression identified promiscuous linear splicing between all exons, with the two most abundant non-canonical linear products skipping the exons that produced the circular isoforms. Single-cell sequencing revealed a strong preference for either the linear or circular ASXL1 isoforms in each cell, and found the predominant exon skipping product is frequently co-expressed with its reciprocal circular isoform. Finally, absolute quantification of ASXL1 isoforms confirmed our findings and suggests that standard methods overestimate circRNA abundance. Taken together, these data reveal a dynamic new view of circRNA genesis, providing additional framework for studying their roles in cellular biology. PMID:27736885

Intron-mediated alternative splicing of Arabidopsis P5CS1 and its association with natural variation in proline and climate adaptation

PubMed Central

Kesari, Ravi; Lasky, Jesse R.; Villamor, Joji Grace; Des Marais, David L.; Chen, Ying-Jiun C.; Liu, Tzu-Wen; Juenger, Thomas E.; Verslues, Paul E.

2012-01-01

Drought-induced proline accumulation is widely observed in plants but its regulation and adaptive value are not as well understood. Proline accumulation of the Arabidopsis accession Shakdara (Sha) was threefold less than that of Landsberg erecta (Ler) and quantitative trait loci mapping identified a reduced function allele of the proline synthesis enzyme Δ1-pyrroline-5-carboxylate synthetase1 (P5CS1) as a basis for the lower proline of Sha. Sha P5CS1 had additional TA repeats in intron 2 and a G-to-T transversion in intron 3 that were sufficient to promote alternative splicing and production of a nonfunctional transcript lacking exon 3 (exon 3-skip P5CS1). In Sha, and additional accessions with the same intron polymorphisms, the nonfunctional exon 3-skip P5CS1 splice variant constituted as much as half of the total P5CS1 transcript. In a larger panel of Arabidopsis accessions, low water potential-induced proline accumulation varied by 10-fold and variable production of exon 3-skip P5CS1 among accessions was an important, but not the sole, factor underlying variation in proline accumulation. Population genetic analyses suggest that P5CS1 may have evolved under positive selection, and more extensive correlation of exon 3-skip P5CS1 production than proline abundance with climate conditions of natural accessions also suggest a role of P5CS1 in local adaptation to the environment. These data identify a unique source of alternative splicing in plants, demonstrate a role of exon 3-skip P5CS1 in natural variation of proline metabolism, and suggest an association of P5CS1 and its alternative splicing with environmental adaptation. PMID:22615385

Restoring Dystrophin Expression in Duchenne Muscular Dystrophy Muscle

PubMed Central

Hoffman, Eric P.; Bronson, Abby; Levin, Arthur A.; Takeda, Shin'ichi; Yokota, Toshifumi; Baudy, Andreas R.; Connor, Edward M.

2011-01-01

The identification of the Duchenne muscular dystrophy gene and protein in the late 1980s led to high hopes of rapid translation to molecular therapeutics. These hopes were fueled by early reports of delivering new functional genes to dystrophic muscle in mouse models using gene therapy and stem cell transplantation. However, significant barriers have thwarted translation of these approaches to true therapies, including insufficient therapeutic material (eg, cells and viral vectors), challenges in systemic delivery, and immunological hurdles. An alternative approach is to repair the patient's own gene. Two innovative small-molecule approaches have emerged as front-line molecular therapeutics: exon skipping and stop codon read through. Both approaches are in human clinical trials and aim to coax dystrophin protein production from otherwise inactive mutant genes. In the clinically severe dog model of Duchenne muscular dystrophy, the exon-skipping approach recently improved multiple functional outcomes. We discuss the status of these two methods aimed at inducing de novo dystrophin production from mutant genes and review implications for other disorders. PMID:21703390

Clinical characterisation of Becker muscular dystrophy patients predicts favourable outcome in exon-skipping therapy.

PubMed

van den Bergen, J C; Schade van Westrum, S M; Dekker, L; van der Kooi, A J; de Visser, M; Wokke, B H A; Straathof, C S; Hulsker, M A; Aartsma-Rus, A; Verschuuren, J J; Ginjaar, H B

2014-01-01

Duchenne and Becker muscular dystrophy (DMD/BMD) are both caused by mutations in the DMD gene. Out-of-frame mutations in DMD lead to absence of the dystrophin protein, while in-frame BMD mutations cause production of internally deleted dystrophin. Clinically, patients with DMD loose ambulance around the age of 12, need ventilatory support at their late teens and die in their third or fourth decade due to pulmonary or cardiac failure. BMD has a more variable disease course. The disease course of patients with BMD with specific mutations could be very informative to predict the outcome of the exon-skipping therapy, aiming to restore the reading-frame in patients with DMD. Patients with BMD with a mutation equalling a DMD mutation after successful exon skipping were selected from the Dutch Dystrophinopathy Database. Information about disease course was gathered through a standardised questionnaire. Cardiac data were collected from medical correspondence and a previous study on cardiac function in BMD. Forty-eight patients were included, representing 11 different mutations. Median age of patients was 43 years (range 6-67). Nine patients were wheelchair users (26-56 years). Dilated cardiomyopathy was present in 7/36 patients. Only one patient used ventilatory support. Three patients had died at the age of 45, 50 and 76 years, respectively. This study provides mutation specific data on the course of disease in patients with BMD. It shows that the disease course of patients with BMD, with a mutation equalling a 'skipped' DMD mutation is relatively mild. This finding strongly supports the potential benefit of exon skipping in patients with DMD.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Asai, Hirohide; Hirano, Makito; Kiriyama, Takao

Intranuclear events due to mutations in the Parkin gene remain elusive in autosomal recessive juvenile parkinsonism (ARJP). We identified a mutant PARKIN protein in fibroblast cultures from a pair of siblings with ARJP who were homozygous for the exon 4-deleted Parkin gene. Disease was mild in one patient and debilitating in the other. The detected mutant, encoded by a transcript lacking exon 3 as well as exon 4, is an in-frame deletion that removes 121 aa, resulting in a 344-aa protein (PaDel3,4). Cell culture and transfection studies revealed negative correlations between expression levels of PaDel3,4 and those of cell cyclemore » proteins, including cyclin E, CDK2, ppRb, and E2F-1, and demonstrated that GFP-PaDel3,4 entered nucleus and ubiquitinated cyclin E as a part of SCF{sup hSel-10} ligase complex in the patient cells. In addition, nuclear localization signal-tagged PaDel3,4 expressed in the transfected patient cells most effectively ubiquitinated cyclin E and reduced DNA damage, protecting cells from oxidative stress. Antisense-oligonucleotide treatment promoted skipping of exon 3 and thus generated PaDel3,4, increasing cell survival. Collectively, we propose that naturally- and experimentally-induced exon skipping at least partly restores the mutant Parkin gene deficit, providing a molecular basis for the development of therapeutic exon skipping.« less

Exon 11 skipping of SCN10A coding for voltage-gated sodium channels in dorsal root ganglia

PubMed Central

Schirmeyer, Jana; Szafranski, Karol; Leipold, Enrico; Mawrin, Christian; Platzer, Matthias; Heinemann, Stefan H

2014-01-01

The voltage-gated sodium channel NaV1.8 (encoded by SCN10A) is predominantly expressed in dorsal root ganglia (DRG) and plays a critical role in pain perception. We analyzed SCN10A transcripts isolated from human DRGs using deep sequencing and found a novel splice variant lacking exon 11, which codes for 98 amino acids of the domain I/II linker. Quantitative PCR analysis revealed an abundance of this variant of up to 5–10% in human, while no such variants were detected in mouse or rat. Since no obvious functional differences between channels with and without the exon-11 sequence were detected, it is suggested that SCN10A exon 11 skipping in humans is a tolerated event. PMID:24763188

Splicing regulation and dysregulation of cholinergic genes expressed at the neuromuscular junction.

PubMed

Ohno, Kinji; Rahman, Mohammad Alinoor; Nazim, Mohammad; Nasrin, Farhana; Lin, Yingni; Takeda, Jun-Ichi; Masuda, Akio

2017-08-01

We humans have evolved by acquiring diversity of alternative RNA metabolisms including alternative means of splicing and transcribing non-coding genes, and not by acquiring new coding genes. Tissue-specific and developmental stage-specific alternative RNA splicing is achieved by tightly regulated spatiotemporal regulation of expressions and activations of RNA-binding proteins that recognize their cognate splicing cis-elements on nascent RNA transcripts. Genes expressed at the neuromuscular junction are also alternatively spliced. In addition, germline mutations provoke aberrant splicing by compromising binding of RNA-binding proteins, and cause congenital myasthenic syndromes (CMS). We present physiological splicing mechanisms of genes for agrin (AGRN), acetylcholinesterase (ACHE), MuSK (MUSK), acetylcholine receptor (AChR) α1 subunit (CHRNA1), and collagen Q (COLQ) in human, and their aberration in diseases. Splicing isoforms of AChE T , AChE H , and AChE R are generated by hnRNP H/F. Skipping of MUSK exon 10 makes a Wnt-insensitive MuSK isoform, which is unique to human. Skipping of exon 10 is achieved by coordinated binding of hnRNP C, YB-1, and hnRNP L to exon 10. Exon P3A of CHRNA1 is alternatively included to generate a non-functional AChR α1 subunit in human. Molecular dissection of splicing mutations in patients with CMS reveals that exon P3A is alternatively skipped by hnRNP H, polypyrimidine tract-binding protein 1, and hnRNP L. Similarly, analysis of an exonic mutation in COLQ exon 16 in a CMS patient discloses that constitutive splicing of exon 16 requires binding of serine arginine-rich splicing factor 1. Intronic and exonic splicing mutations in CMS enable us to dissect molecular mechanisms underlying alternative and constitutive splicing of genes expressed at the neuromuscular junction. This is an article for the special issue XVth International Symposium on Cholinergic Mechanisms. © 2017 International Society for Neurochemistry.

Genome-wide Analysis Reveals SR Protein Cooperation and Competition in Regulated Splicing

PubMed Central

Pandit, Shatakshi; Zhou, Yu; Shiue, Lily; Coutinho-Mansfield, Gabriela; Li, Hairi; Qiu, Jinsong; Huang, Jie; Yeo, Gene W.; Ares, Manuel; Fu, Xiang-Dong

2013-01-01

Summary SR proteins are well-characterized RNA binding proteins that promote exon inclusion by binding to exonic splicing enhancers (ESEs). However, it has been unclear whether regulatory rules deduced on model genes apply generally to activities of SR proteins in the cell. Here, we report global analyses of two prototypical SR proteins SRSF1 (SF2/ASF) and SRSF2 (SC35) using splicing-sensitive arrays and CLIP-seq on mouse embryo fibroblasts (MEFs). Unexpectedly, we find that these SR proteins promote both inclusion and skipping of exons in vivo, but their binding patterns do not explain such opposite responses. Further analyses reveal that loss of one SR protein is accompanied by coordinated loss or compensatory gain in the interaction of other SR proteins at the affected exons. Therefore, specific effects on regulated splicing by one SR protein actually depend on a complex set of relationships with multiple other SR proteins in mammalian genomes. PMID:23562324

Functional analysis of a large set of BRCA2 exon 7 variants highlights the predictive value of hexamer scores in detecting alterations of exonic splicing regulatory elements.

PubMed

Di Giacomo, Daniela; Gaildrat, Pascaline; Abuli, Anna; Abdat, Julie; Frébourg, Thierry; Tosi, Mario; Martins, Alexandra

2013-11-01

Exonic variants can alter pre-mRNA splicing either by changing splice sites or by modifying splicing regulatory elements. Often these effects are difficult to predict and are only detected by performing RNA analyses. Here, we analyzed, in a minigene assay, 26 variants identified in the exon 7 of BRCA2, a cancer predisposition gene. Our results revealed eight new exon skipping mutations in this exon: one directly altering the 5' splice site and seven affecting potential regulatory elements. This brings the number of splicing regulatory mutations detected in BRCA2 exon 7 to a total of 11, a remarkably high number considering the total number of variants reported in this exon (n = 36), all tested in our minigene assay. We then exploited this large set of splicing data to test the predictive value of splicing regulator hexamers' scores recently established by Ke et al. (). Comparisons of hexamer-based predictions with our experimental data revealed high sensitivity in detecting variants that increased exon skipping, an important feature for prescreening variants before RNA analysis. In conclusion, hexamer scores represent a promising tool for predicting the biological consequences of exonic variants and may have important applications for the interpretation of variants detected by high-throughput sequencing. © 2013 WILEY PERIODICALS, INC.

An RRM–ZnF RNA recognition module targets RBM10 to exonic sequences to promote exon exclusion

PubMed Central

Collins, Katherine M.; Kainov, Yaroslav A.; Christodolou, Evangelos; Ray, Debashish; Morris, Quaid; Hughes, Timothy; Taylor, Ian A.

2017-01-01

Abstract RBM10 is an RNA-binding protein that plays an essential role in development and is frequently mutated in the context of human disease. RBM10 recognizes a diverse set of RNA motifs in introns and exons and regulates alternative splicing. However, the molecular mechanisms underlying this seemingly relaxed sequence specificity are not understood and functional studies have focused on 3΄ intronic sites only. Here, we dissect the RNA code recognized by RBM10 and relate it to the splicing regulatory function of this protein. We show that a two-domain RRM1–ZnF unit recognizes a GGA-centered motif enriched in RBM10 exonic sites with high affinity and specificity and test that the interaction with these exonic sequences promotes exon skipping. Importantly, a second RRM domain (RRM2) of RBM10 recognizes a C-rich sequence, which explains its known interaction with the intronic 3΄ site of NUMB exon 9 contributing to regulation of the Notch pathway in cancer. Together, these findings explain RBM10's broad RNA specificity and suggest that RBM10 functions as a splicing regulator using two RNA-binding units with different specificities to promote exon skipping. PMID:28379442

An RRM-ZnF RNA recognition module targets RBM10 to exonic sequences to promote exon exclusion.

PubMed

Collins, Katherine M; Kainov, Yaroslav A; Christodolou, Evangelos; Ray, Debashish; Morris, Quaid; Hughes, Timothy; Taylor, Ian A; Makeyev, Eugene V; Ramos, Andres

2017-06-20

RBM10 is an RNA-binding protein that plays an essential role in development and is frequently mutated in the context of human disease. RBM10 recognizes a diverse set of RNA motifs in introns and exons and regulates alternative splicing. However, the molecular mechanisms underlying this seemingly relaxed sequence specificity are not understood and functional studies have focused on 3΄ intronic sites only. Here, we dissect the RNA code recognized by RBM10 and relate it to the splicing regulatory function of this protein. We show that a two-domain RRM1-ZnF unit recognizes a GGA-centered motif enriched in RBM10 exonic sites with high affinity and specificity and test that the interaction with these exonic sequences promotes exon skipping. Importantly, a second RRM domain (RRM2) of RBM10 recognizes a C-rich sequence, which explains its known interaction with the intronic 3΄ site of NUMB exon 9 contributing to regulation of the Notch pathway in cancer. Together, these findings explain RBM10's broad RNA specificity and suggest that RBM10 functions as a splicing regulator using two RNA-binding units with different specificities to promote exon skipping. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Correction of Dystrophin Expression in Cells From Duchenne Muscular Dystrophy Patients Through Genomic Excision of Exon 51 by Zinc Finger Nucleases

PubMed Central

Ousterout, David G; Kabadi, Ami M; Thakore, Pratiksha I; Perez-Pinera, Pablo; Brown, Matthew T; Majoros, William H; Reddy, Timothy E; Gersbach, Charles A

2015-01-01

Duchenne muscular dystrophy (DMD) is caused by genetic mutations that result in the absence of dystrophin protein expression. Oligonucleotide-induced exon skipping can restore the dystrophin reading frame and protein production. However, this requires continuous drug administration and may not generate complete skipping of the targeted exon. In this study, we apply genome editing with zinc finger nucleases (ZFNs) to permanently remove essential splicing sequences in exon 51 of the dystrophin gene and thereby exclude exon 51 from the resulting dystrophin transcript. This approach can restore the dystrophin reading frame in ~13% of DMD patient mutations. Transfection of two ZFNs targeted to sites flanking the exon 51 splice acceptor into DMD patient myoblasts led to deletion of this genomic sequence. A clonal population was isolated with this deletion and following differentiation we confirmed loss of exon 51 from the dystrophin mRNA transcript and restoration of dystrophin protein expression. Furthermore, transplantation of corrected cells into immunodeficient mice resulted in human dystrophin expression localized to the sarcolemmal membrane. Finally, we quantified ZFN toxicity in human cells and mutagenesis at predicted off-target sites. This study demonstrates a powerful method to restore the dystrophin reading frame and protein expression by permanently deleting exons. PMID:25492562

Deep sequencing with intronic capture enables identification of an APC exon 10 inversion in a patient with polyposis.

PubMed

Shirts, Brian H; Salipante, Stephen J; Casadei, Silvia; Ryan, Shawnia; Martin, Judith; Jacobson, Angela; Vlaskin, Tatyana; Koehler, Karen; Livingston, Robert J; King, Mary-Claire; Walsh, Tom; Pritchard, Colin C

2014-10-01

Single-exon inversions have rarely been described in clinical syndromes and are challenging to detect using Sanger sequencing. We report the case of a 40-year-old woman with adenomatous colon polyps too numerous to count and who had a complex inversion spanning the entire exon 10 in APC (the gene encoding for adenomatous polyposis coli), causing exon skipping and resulting in a frameshift and premature protein truncation. In this study, we employed complete APC gene sequencing using high-coverage next-generation sequencing by ColoSeq, analysis with BreakDancer and SLOPE software, and confirmatory transcript analysis. ColoSeq identified a complex small genomic rearrangement consisting of an inversion that results in translational skipping of exon 10 in the APC gene. This mutation would not have been detected by traditional sequencing or gene-dosage methods. We report a case of adenomatous polyposis resulting from a complex single-exon inversion. Our report highlights the benefits of large-scale sequencing methods that capture intronic sequences with high enough depth of coverage-as well as the use of informatics tools-to enable detection of small pathogenic structural rearrangements.

Deletion of exons 3-9 encompassing a mutational hot spot in the DMD gene presents an asymptomatic phenotype, indicating a target region for multiexon skipping therapy.

PubMed

Nakamura, Akinori; Fueki, Noboru; Shiba, Naoko; Motoki, Hirohiko; Miyazaki, Daigo; Nishizawa, Hitomi; Echigoya, Yusuke; Yokota, Toshifumi; Aoki, Yoshitsugu; Takeda, Shin'ichi

2016-07-01

Few cases of dystrophinopathy show an asymptomatic phenotype with mutations in the 5' (exons 3-7) hot spot in the Duchenne muscular dystrophy (DMD) gene. Our patient showed increased serum creatine kinase levels at 12 years of age. A muscle biopsy at 15 years of age led to a diagnosis of Becker muscular dystrophy. The patient showed a slight decrease in cardiac function at the age of 21 years and was administered a β-blocker, but there was no muscle involvement even at the age of 27 years. A deletion of exons 3-9 encompassing a mutational hot spot in the DMD gene was detected, and dystrophin protein expression was ∼15% that of control level. We propose that in-frame deletion of exons 3-9 may produce a functional protein, and that multiexon skipping therapy targeting these exons may be feasible for severe dystrophic patients with a mutation in the 5' hot spot of the DMD gene.

Two-Exon Skipping within MLPH Is Associated with Coat Color Dilution in Rabbits

PubMed Central

Lehner, Stefanie; Gähle, Marion; Dierks, Claudia; Stelter, Ricarda; Gerber, Jonathan; Brehm, Ralph; Distl, Ottmar

2013-01-01

Coat color dilution turns black coat color to blue and red color to cream and is a characteristic in many mammalian species. Matings among Netherland Dwarf, Loh, and Lionhead Dwarf rabbits over two generations gave evidence for a monogenic autosomal recessive inheritance of coat colour dilution. Histological analyses showed non-uniformly distributed, large, agglomerating melanin granules in the hair bulbs of coat color diluted rabbits. We sequenced the cDNA of MLPH in two dilute and one black rabbit for polymorphism detection. In both color diluted rabbits, skipping of exons 3 and 4 was present resulting in altered amino acids at p.QGL[37-39]QWA and a premature stop codon at p.K40*. Sequencing of genomic DNA revealed a c.111-5C>A splice acceptor mutation within the polypyrimidine tract of intron 2 within MLPH. This mutation presumably causes skipping of exons 3 and 4. In 14/15 dilute rabbits, the c.111-5C>A mutation was homozygous and in a further dilute rabbit, heterozygous and in combination with a homozygous frame shift mutation within exon 6 (c.585delG). In conclusion, our results demonstrated a colour dilution associated MLPH splice variant causing a strongly truncated protein (p.Q37QfsX4). An involvement of further MLPH-associated mutations needs further investigations. PMID:24376820

Nanoparticle Delivery of Antisense Oligonucleotides and Their Application in the Exon Skipping Strategy for Duchenne Muscular Dystrophy

PubMed Central

Falzarano, Maria Sofia; Passarelli, Chiara

2014-01-01

Antisense therapy is a powerful tool for inducing post-transcriptional modifications and thereby regulating target genes associated with disease. There are several classes of antisense oligonucleotides (AONs) with therapeutic use, such as double-stranded RNAs (interfering RNAs, utilized for gene silencing, and single-stranded AONs with various chemistries, which are useful for antisense targeting of micro-RNAs and mRNAs. In particular, the use of AONs for exon skipping, by targeting pre-mRNA, is proving to be a highly promising therapy for some genetic disorders like Duchenne muscular dystrophy and spinal muscular atrophy. However, AONs are unable to cross the plasma membrane unaided, and several other obstacles still remain to be overcome, in particular their instability due to their nuclease sensitivity and their lack of tissue specificity. Various drug delivery systems have been explored to improve the bioavailability of nucleic acids, and nanoparticles (NPs) have been suggested as potential vectors for DNA/RNA. This review describes the recent progress in AON conjugation with natural and synthetic delivery systems, and provides an overview of the efficacy of NP-AON complexes as an exon-skipping treatment for Duchenne muscular dystrophy. PMID:24506782

MET Exon 14 Skipping Mutations in Lung Adenocarcinoma: Clinicopathologic Implications and Prognostic Values.

PubMed

Lee, Geun Dong; Lee, Seung Eun; Oh, Doo-Yi; Yu, Dan-Bi; Jeong, Hae Min; Kim, Jooseok; Hong, Sungyoul; Jung, Hun Soon; Oh, Ensel; Song, Ji-Young; Lee, Mi-Sook; Kim, Mingi; Jung, Kyungsoo; Kim, Jhingook; Shin, Young Kee; Choi, Yoon-La; Kim, Hyeong Ryul

2017-08-01

Response to mesenchymal-epithelial transition (MET) inhibitors in NSCLC with mesenchymal-epithelial transition gene (MET) exon 14 skipping (METex14) has fueled molecular screening efforts and the search for optimal therapies. However, further work is needed to refine the clinicopathologic and prognostic implications of METex14 skipping. Among 795 East Asian patients who underwent a surgical procedure for NSCLC, we screened 45 patients with quintuple-negative (EGFR-negative/KRAS-negative/anaplastic lymphoma kinase gene [ALK]-negative/ROS1-negative/ret proto-oncogene [RET]-negative) lung adenocarcinomas by using reverse-transcriptase polymerase chain reaction and found 17 patients (37.8%) with METex14 skipping. We also investigated the effect of small interfering RNA (siRNA) targeting skipping junction in cells with METex14 skipping. The median age of the 17 patients was 73 years. The acinar subtype was predominant (52.9%), followed by the solid subtype (35.3%). MET immunohistochemistry demonstrated 100% sensitivity and 70.4% specificity. Multivariate analyses showed that patients with METex14 skipping had a higher recurrence rate than those with ALK fusion (versus METex14 skipping) (hazard ratio = 0.283, 95% confidence interval: 0.119-0.670) in stage I to IIIA disease; however, the differences in overall survival were not significant after adjustment for pathologic stage (p = 0.669). Meanwhile, siRNA decreased MET-driven signaling pathways in Hs746T cells, and combined treatment with siRNA and crizotinib inhibited cell proliferation in crizotinib-resistant H596 cells. The prevalence of METex14 skipping was quite high in East Asian patients without other driver mutations in lung adenocarcinomas. METex14 skipping was associated with old age, the acinar or solid histologic subtype, and high MET immunohistochemical expression. The prognosis of patients with METex14 skipping was similar to that of patients with major driver mutations. siRNA targeting the junction of METex14 skipping could inhibit MET-driven signaling pathways in cells with METex14 skipping. Copyright © 2017 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.

Unusual splice site mutations disrupt FANCA exon 8 definition.

PubMed

Mattioli, Chiara; Pianigiani, Giulia; De Rocco, Daniela; Bianco, Anna Monica Rosaria; Cappelli, Enrico; Savoia, Anna; Pagani, Franco

2014-07-01

The pathological role of mutations that affect not conserved splicing regulatory sequences can be difficult to determine. In a patient with Fanconi anemia, we identified two unpredictable splicing mutations that act on either sides of FANCA exon 8. In patients-derived cells and in minigene splicing assay, we showed that both an apparently benign intronic c.710-5T>C transition and the nonsense c.790C>T substitution induce almost complete exon 8 skipping. Site-directed mutagenesis experiments indicated that the c.710-5T>C transition affects a polypyrimidine tract where most of the thymidines cannot be compensated by cytidines. The c.790C>T mutation located in position -3 relative to the donor site induce exon 8 skipping in an NMD-independent manner and complementation experiments with modified U1 snRNAs showed that U1 snRNP is only partially involved in the splicing defect. Our results highlight the importance of performing splicing functional assay for correct identification of disease-causing mechanism of genomic variants and provide mechanistic insights on how these two FANCA mutations affect exon 8 definition. Copyright © 2014 Elsevier B.V. All rights reserved.

Single-cut genome editing restores dystrophin expression in a new mouse model of muscular dystrophy

PubMed Central

Amoasii, Leonela; Long, Chengzu; Li, Hui; Mireault, Alex A.; Shelton, John M.; Sanchez-Ortiz, Efrain; McAnally, John R.; Bhattacharyya, Samadrita; Schmidt, Florian; Grimm, Dirk; Hauschka, Stephen D.; Bassel-Duby, Rhonda; Olson, Eric N.

2017-01-01

Duchenne muscular dystrophy (DMD) is a severe, progressive muscle disease caused by mutations in the dystrophin gene. The majority of DMD mutations are deletions that prematurely terminate the dystrophin protein. Deletions of exon 50 of the dystrophin gene are among the most common single exon deletions causing DMD. Such mutations can be corrected by skipping exon 51, thereby restoring the dystrophin reading frame. Using clustered regularly interspaced short palindromic repeats/CRISPR-associated 9 (CRISPR/Cas9), we generated a DMD mouse model by deleting exon 50. These ΔEx50 mice displayed severe muscle dysfunction, which was corrected by systemic delivery of adeno-associated virus encoding CRISPR/Cas9 genome editing components. We optimized the method for dystrophin reading frame correction using a single guide RNA that created reframing mutations and allowed skipping of exon 51. In conjunction with muscle-specific expression of Cas9, this approach restored up to 90% of dystrophin protein expression throughout skeletal muscles and the heart of ΔEx50 mice. This method of permanently bypassing DMD mutations using a single cut in genomic DNA represents a step toward clinical correction of DMD mutations and potentially those of other neuromuscular disorders. PMID:29187645

An Ethyl-Nitrosourea-Induced Point Mutation in Phex Causes Exon Skipping, X-Linked Hypophosphatemia, and Rickets

PubMed Central

Carpinelli, Marina R.; Wicks, Ian P.; Sims, Natalie A.; O’Donnell, Kristy; Hanzinikolas, Katherine; Burt, Rachel; Foote, Simon J.; Bahlo, Melanie; Alexander, Warren S.; Hilton, Douglas J.

2002-01-01

We describe the clinical, genetic, biochemical, and molecular characterization of a mouse that arose in the first generation (G1) of a random mutagenesis screen with the chemical mutagen ethyl-nitrosourea. The mouse was observed to have skeletal abnormalities inherited with an X-linked dominant pattern of inheritance. The causative mutation, named Skeletal abnormality 1 (Ska1), was shown to be a single base pair mutation in a splice donor site immediately following exon 8 of the Phex (phosphate-regulating gene with homologies to endopeptidases located on the X-chromosome) gene. This point mutation caused skipping of exon 8 from Phex mRNA, hypophosphatemia, and features of rickets. This experimentally induced phenotype mirrors the human condition X-linked hypophosphatemia; directly confirms the role of Phex in phosphate homeostasis, normal skeletal development, and rickets; and illustrates the power of mutagenesis in exploring animal models of human disease. PMID:12414538

An ethyl-nitrosourea-induced point mutation in phex causes exon skipping, x-linked hypophosphatemia, and rickets.

PubMed

Carpinelli, Marina R; Wicks, Ian P; Sims, Natalie A; O'Donnell, Kristy; Hanzinikolas, Katherine; Burt, Rachel; Foote, Simon J; Bahlo, Melanie; Alexander, Warren S; Hilton, Douglas J

2002-11-01

We describe the clinical, genetic, biochemical, and molecular characterization of a mouse that arose in the first generation (G(1)) of a random mutagenesis screen with the chemical mutagen ethyl-nitrosourea. The mouse was observed to have skeletal abnormalities inherited with an X-linked dominant pattern of inheritance. The causative mutation, named Skeletal abnormality 1 (Ska1), was shown to be a single base pair mutation in a splice donor site immediately following exon 8 of the Phex (phosphate-regulating gene with homologies to endopeptidases located on the X-chromosome) gene. This point mutation caused skipping of exon 8 from Phex mRNA, hypophosphatemia, and features of rickets. This experimentally induced phenotype mirrors the human condition X-linked hypophosphatemia; directly confirms the role of Phex in phosphate homeostasis, normal skeletal development, and rickets; and illustrates the power of mutagenesis in exploring animal models of human disease.

Multiple Isoforms of ANRIL in Melanoma Cells: Structural Complexity Suggests Variations in Processing.

PubMed

Sarkar, Debina; Oghabian, Ali; Bodiyabadu, Pasani K; Joseph, Wayne R; Leung, Euphemia Y; Finlay, Graeme J; Baguley, Bruce C; Askarian-Amiri, Marjan E

2017-06-27

The long non-coding RNA ANRIL , antisense to the CDKN2B locus, is transcribed from a gene that encompasses multiple disease-associated polymorphisms. Despite the identification of multiple isoforms of ANRIL , expression of certain transcripts has been found to be tissue-specific and the characterisation of ANRIL transcripts remains incomplete. Several functions have been associated with ANRIL . In our judgement, studies on ANRIL functionality are premature pending a more complete appreciation of the profusion of isoforms. We found differential expression of ANRIL exons, which indicates that multiple isoforms exist in melanoma cells. In addition to linear isoforms, we identified circular forms of ANRIL ( circANRIL ). Further characterisation of circANR IL in two patient-derived metastatic melanoma cell lines (NZM7 and NZM37) revealed the existence of a rich assortment of circular isoforms. Moreover, in the two melanoma cell lines investigated, the complements of circANRIL isoforms were almost completely different. Novel exons were also discovered. We also found the family of linear ANRIL was enriched in the nucleus, whilst the circular isoforms were enriched in the cytoplasm and they differed markedly in stability. With respect to the variable processing of circANRIL species, bioinformatic analysis indicated that intronic Arthrobacter luteus (Alu) restriction endonuclease inverted repeats and exon skipping were not involved in selection of back-spliced exon junctions. Based on our findings, we hypothesise that " ANRIL " has wholly distinct dual sets of functions in melanoma. This reveals the dynamic nature of the locus and constitutes a basis for investigating the functions of ANRIL in melanoma.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alvarez, Enrique, E-mail: ealvarez@cbm.uam.es; Castello, Alfredo; Carrasco, Luis

Highlights: {yields} Novel role for poliovirus 2A protease as splicing modulator. {yields} Poliovirus 2A protease inhibits the alternative splicing of pre-mRNAs. {yields} Poliovirus 2A protease blocks the second catalytic step of splicing. -- Abstract: Viruses have developed multiple strategies to interfere with the gene expression of host cells at different stages to ensure their own survival. Here we report a new role for poliovirus 2A{sup pro} modulating the alternative splicing of pre-mRNAs. Expression of 2A{sup pro} potently inhibits splicing of reporter genes in HeLa cells. Low amounts of 2A{sup pro} abrogate Fas exon 6 skipping, whereas higher levels of proteasemore » fully abolish Fas and FGFR2 splicing. In vitro splicing of MINX mRNA using nuclear extracts is also strongly inhibited by 2A{sup pro}, leading to accumulation of the first exon and the lariat product containing the unspliced second exon. These findings reveal that the mechanism of action of 2A{sup pro} on splicing is to selectively block the second catalytic step.« less

Basal exon skipping and genetic pleiotropy: A predictive model of disease pathogenesis.

PubMed

Drivas, Theodore G; Wojno, Adam P; Tucker, Budd A; Stone, Edwin M; Bennett, Jean

2015-06-10

Genetic pleiotropy, the phenomenon by which mutations in the same gene result in markedly different disease phenotypes, has proven difficult to explain with traditional models of disease pathogenesis. We have developed a model of pleiotropic disease that explains, through the process of basal exon skipping, how different mutations in the same gene can differentially affect protein production, with the total amount of protein produced correlating with disease severity. Mutations in the centrosomal protein of 290 kDa (CEP290) gene are associated with a spectrum of phenotypically distinct human diseases (the ciliopathies). Molecular biologic examination of CEP290 transcript and protein expression in cells from patients carrying CEP290 mutations, measured by quantitative polymerase chain reaction and Western blotting, correlated with disease severity and corroborated our model. We show that basal exon skipping may be the mechanism underlying the disease pleiotropy caused by CEP290 mutations. Applying our model to a different disease gene, CC2D2A (coiled-coil and C2 domains-containing protein 2A), we found that the same correlations held true. Our model explains the phenotypic diversity of two different inherited ciliopathies and may establish a new model for the pathogenesis of other pleiotropic human diseases. Copyright © 2015, American Association for the Advancement of Science.

Combination Antisense Treatment for Destructive Exon Skipping of Myostatin and Open Reading Frame Rescue of Dystrophin in Neonatal mdx Mice.

PubMed

Lu-Nguyen, Ngoc B; Jarmin, Susan A; Saleh, Amer F; Popplewell, Linda; Gait, Michael J; Dickson, George

2015-08-01

The fatal X-linked Duchenne muscular dystrophy (DMD), characterized by progressive muscle wasting and muscle weakness, is caused by mutations within the DMD gene. The use of antisense oligonucleotides (AOs) modulating pre-mRNA splicing to restore the disrupted dystrophin reading frame, subsequently generating a shortened but functional protein has emerged as a potential strategy in DMD treatment. AO therapy has recently been applied to induce out-of-frame exon skipping of myostatin pre-mRNA, knocking-down expression of myostatin protein, and such an approach is suggested to enhance muscle hypertrophy/hyperplasia and to reduce muscle necrosis. Within this study, we investigated dual exon skipping of dystrophin and myostatin pre-mRNAs using phosphorodiamidate morpholino oligomers conjugated with an arginine-rich peptide (B-PMOs). Intraperitoneal administration of B-PMOs was performed in neonatal mdx males on the day of birth, and at weeks 3 and 6. At week 9, we observed in treated mice (as compared to age-matched, saline-injected controls) normalization of muscle mass, a recovery in dystrophin expression, and a decrease in muscle necrosis, particularly in the diaphragm. Our data provide a proof of concept for antisense therapy combining dystrophin restoration and myostatin inhibition for the treatment of DMD.

Context Dependent Effects of Chimeric Peptide Morpholino Conjugates Contribute to Dystrophin Exon-skipping Efficiency.

PubMed

Yin, Haifang; Boisguerin, Prisca; Moulton, Hong M; Betts, Corinne; Seow, Yiqi; Boutilier, Jordan; Wang, Qingsong; Walsh, Anthony; Lebleu, Bernard; Wood, Matthew Ja

2013-09-24

We have recently reported that cell-penetrating peptides (CPPs) and novel chimeric peptides containing CPP (referred as B peptide) and muscle-targeting peptide (referred as MSP) motifs significantly improve the systemic exon-skipping activity of morpholino phosphorodiamidate oligomers (PMOs) in dystrophin-deficient mdx mice. In the present study, the general mechanistic significance of the chimeric peptide configuration on the activity and tissue uptake of peptide conjugated PMOs in vivo was investigated. Four additional chimeric peptide-PMO conjugates including newly identified peptide 9 (B-9-PMO and 9-B-PMO) and control peptide 3 (B-3-PMO and 3-B-PMO) were tested in mdx mice. Immunohistochemical staining, RT-PCR and western blot results indicated that B-9-PMO induced significantly higher level of exon skipping and dystrophin restoration than its counterpart (9-B-PMO), further corroborating the notion that the activity of chimeric peptide-PMO conjugates is dependent on relative position of the tissue-targeting peptide motif within the chimeric peptide with respect to PMOs. Subsequent mechanistic studies showed that enhanced cellular uptake of B-MSP-PMO into muscle cells leads to increased exon-skipping activity in comparison with MSP-B-PMO. Surprisingly, further evidence showed that the uptake of chimeric peptide-PMO conjugates of both orientations (B-MSP-PMO and MSP-B-PMO) was ATP- and temperature-dependent and also partially mediated by heparan sulfate proteoglycans (HSPG), indicating that endocytosis is likely the main uptake pathway for both chimeric peptide-PMO conjugates. Collectively, our data demonstrate that peptide orientation in chimeric peptides is an important parameter that determines cellular uptake and activity when conjugated directly to oligonucleotides. These observations provide insight into the design of improved cell targeting compounds for future therapeutics studies.Molecular Therapy-Nucleic Acids (2013) 2, e124; doi:10.1038/mtna.2013.51; published online 24 September 2013.

A splice variant in the ACSL5 gene relates migraine with fatty acid activation in mitochondria

PubMed Central

Matesanz, Fuencisla; Fedetz, María; Barrionuevo, Cristina; Karaky, Mohamad; Catalá-Rabasa, Antonio; Potenciano, Victor; Bello-Morales, Raquel; López-Guerrero, Jose-Antonio; Alcina, Antonio

2016-01-01

Genome-wide association studies (GWAS) in migraine are providing the molecular basis of this heterogeneous disease, but the understanding of its aetiology is still incomplete. Although some biomarkers have currently been accepted for migraine, large amount of studies for identifying new ones is needed. The migraine-associated variant rs12355831:A>G (P=2 × 10−6), described in a GWAS of the International Headache Genetic Consortium, is localized in a non-coding sequence with unknown function. We sought to identify the causal variant and the genetic mechanism involved in the migraine risk. To this end, we integrated data of RNA sequences from the Genetic European Variation in Health and Disease (GEUVADIS) and genotypes from 1000 GENOMES of 344 lymphoblastoid cell lines (LCLs), to determine the expression quantitative trait loci (eQTLs) in the region. We found that the migraine-associated variant belongs to a linkage disequilibrium block associated with the expression of an acyl-coenzyme A synthetase 5 (ACSL5) transcript lacking exon 20 (ACSL5-Δ20). We showed by exon-skipping assay a direct causality of rs2256368-G in the exon 20 skipping of approximately 20 to 40% of ACSL5 RNA molecules. In conclusion, we identified the functional variant (rs2256368:A>G) affecting ACSL5 exon 20 skipping, as a causal factor linked to the migraine-associated rs12355831:A>G, suggesting that the activation of long-chain fatty acids by the spliced ACSL5-Δ20 molecules, a mitochondrial located enzyme, is involved in migraine pathology. PMID:27189022

Thousands of exon skipping events differentiate among splicing patterns in sixteen human tissues.

PubMed

Florea, Liliana; Song, Li; Salzberg, Steven L

2013-01-01

Alternative splicing is widely recognized for its roles in regulating genes and creating gene diversity. However, despite many efforts, the repertoire of gene splicing variation is still incompletely characterized, even in humans. Here we describe a new computational system, ASprofile, and its application to RNA-seq data from Illumina's Human Body Map project (>2.5 billion reads).  Using the system, we identified putative alternative splicing events in 16 different human tissues, which provide a dynamic picture of splicing variation across the tissues. We detected 26,989 potential exon skipping events representing differences in splicing patterns among the tissues. A large proportion of the events (>60%) were novel, involving new exons (~3000), new introns (~16000), or both. When tracing these events across the sixteen tissues, only a small number (4-7%) appeared to be differentially expressed ('switched') between two tissues, while 30-45% showed little variation, and the remaining 50-65% were not present in one or both tissues compared.  Novel exon skipping events appeared to be slightly less variable than known events, but were more tissue-specific. Our study represents the first effort to build a comprehensive catalog of alternative splicing in normal human tissues from RNA-seq data, while providing insights into the role of alternative splicing in shaping tissue transcriptome differences. The catalog of events and the ASprofile software are freely available from the Zenodo repository ( http://zenodo.org/record/7068; doi: 10.5281/zenodo.7068) and from our web site http://ccb.jhu.edu/software/ASprofile.

Skipping of exon 27 in C3 gene compromises TED domain and results in complete human C3 deficiency.

PubMed

da Silva, Karina Ribeiro; Fraga, Tatiana Rodrigues; Lucatelli, Juliana Faggion; Grumach, Anete Sevciovic; Isaac, Lourdes

2016-05-01

Primary deficiency of complement C3 is rare and usually associated with increased susceptibility to bacterial infections. In this work, we investigated the molecular basis of complete C3 deficiency in a Brazilian 9-year old female patient with a family history of consanguinity. Hemolytic assays revealed complete lack of complement-mediated hemolytic activity in the patient's serum. While levels of the complement regulatory proteins Factor I, Factor H and Factor B were normal in the patient's and family members' sera, complement C3 levels were undetectable in the patient's serum and were reduced by at least 50% in the sera of the patient's parents and brother. Additionally, no C3 could be observed in the patient's plasma and cell culture supernatants by Western blot. We also observed that patient's skin fibroblasts stimulated with Escherichia coli LPS were unable to secrete C3, which might be accumulated within the cells before being intracellularly degraded. Sequencing analysis of the patient's C3 cDNA revealed a genetic mutation responsible for the complete skipping of exon 27, resulting in the loss of 99 nucleotides (3450-3549) located in the TED domain. Sequencing of the intronic region between the exons 26 and 27 of the C3 gene (nucleotides 6690313-6690961) showed a nucleotide exchange (T→C) at position 6690626 located in a splicing donor site, resulting in the complete skipping of exon 27 in the C3 mRNA. Copyright © 2016. Published by Elsevier GmbH.

A Plant 5S Ribosomal RNA Mimic Regulates Alternative Splicing of Transcription Factor IIIA Pre-mRNAs

PubMed Central

Hammond, Ming C.; Wachter, Andreas; Breaker, Ronald R.

2009-01-01

Transcription factor IIIA (TFIIIA) is required for eukaryotic synthesis of 5S ribosomal RNA by RNA polymerase III. Here we report the discovery of a structured RNA element with striking resemblance to 5S rRNA that is conserved within TFIIIA precursor mRNAs (pre-mRNAs) from diverse plant lineages. TFIIIA protein expression is controlled by alternative splicing of the exon containing the plant 5S rRNA mimic (P5SM). P5SM triggers exon skipping upon binding of ribosomal protein L5, a natural partner of 5S rRNA, which demonstrates the functional adaptation of its structural mimicry. Since the exon-skipped splice product encodes full-length TFIIIA protein, these results reveal a ribosomal protein-mRNA interaction that is involved in 5S rRNA synthesis and has implications for cross-coordination of ribosomal components. This study also provides insight into the origin and function of a newfound class of structured RNA that regulates alternative splicing. PMID:19377483

A plant 5S ribosomal RNA mimic regulates alternative splicing of transcription factor IIIA pre-mRNAs.

PubMed

Hammond, Ming C; Wachter, Andreas; Breaker, Ronald R

2009-05-01

Transcription factor IIIA (TFIIIA) is required for eukaryotic synthesis of 5S ribosomal RNA by RNA polymerase III. Here we report the discovery of a structured RNA element with clear resemblance to 5S rRNA that is conserved within TFIIIA precursor mRNAs from diverse plant lineages. TFIIIA protein expression is controlled by alternative splicing of the exon containing the plant 5S rRNA mimic (P5SM). P5SM triggers exon skipping upon binding of ribosomal protein L5, a natural partner of 5S rRNA, which demonstrates the functional adaptation of its structural mimicry. As the exon-skipped splice product encodes full-length TFIIIA protein, these results reveal a ribosomal protein-mRNA interaction that is involved in 5S rRNA synthesis and has implications for cross-coordination of ribosomal components. This study also provides insight into the origin and function of a newfound class of structured RNA that regulates alternative splicing.

PubMed Central

Bello, Luca

2016-01-01

Accurate definition of genetic mutations causing Duchenne muscular dystrophy (DMD) has always been relevant in order to provide genetic counseling to patients and families, and helps to establish the prognosis in the case where the distinction between Duchenne, Becker, or intermediate muscular dystrophy is not obvious. As molecular treatments aimed at dystrophin restoration in DMD are increasingly available as commercialized drugs or within clinical trials, genetic diagnosis has become an indispensable tool in order to determine eligibility for these treatments. DMD patients in which multiplex ligation-dependent probe amplification (MLPA) or similar techniques show a deletion suitable to exon skipping of exons 44, 45, 51, or 53, may be currently treated with AONs targeting these exons, in the context of clinical trials, or, as is the case for exon 51 skipping in the United States, with the first commercialized drug (eteplirsen). Patients who test negative at MLPA, but in whom DMD gene sequencing shows a nonsense mutation, may be amenable for treatment with stop codon readthrough compounds such as ataluren. Novel molecular approaches such as CRISPR-Cas9 targeting of specific DMD mutations are still in the preclinical stages, but appear promising. In conclusion, an accurate genetic diagnosis represents the entrance into a new scenario of personalized medicine in DMD. PMID:28484312

Interplay between DMD Point Mutations and Splicing Signals in Dystrophinopathy Phenotypes

PubMed Central

Juan-Mateu, Jonàs; González-Quereda, Lidia; Rodríguez, Maria José; Verdura, Edgard; Lázaro, Kira; Jou, Cristina; Nascimento, Andrés; Jiménez-Mallebrera, Cecilia; Colomer, Jaume; Monges, Soledad; Lubieniecki, Fabiana; Foncuberta, Maria Eugenia; Pascual-Pascual, Samuel Ignacio; Molano, Jesús; Baiget, Montserrat; Gallano, Pia

2013-01-01

DMD nonsense and frameshift mutations lead to severe Duchenne muscular dystrophy while in-frame mutations lead to milder Becker muscular dystrophy. Exceptions are found in 10% of cases and the production of alternatively spliced transcripts is considered a key modifier of disease severity. Several exonic mutations have been shown to induce exon-skipping, while splice site mutations result in exon-skipping or activation of cryptic splice sites. However, factors determining the splicing pathway are still unclear. Point mutations provide valuable information regarding the regulation of pre-mRNA splicing and elements defining exon identity in the DMD gene. Here we provide a comprehensive analysis of 98 point mutations related to clinical phenotype and their effect on muscle mRNA and dystrophin expression. Aberrant splicing was found in 27 mutations due to alteration of splice sites or splicing regulatory elements. Bioinformatics analysis was performed to test the ability of the available algorithms to predict consequences on mRNA and to investigate the major factors that determine the splicing pathway in mutations affecting splicing signals. Our findings suggest that the splicing pathway is highly dependent on the interplay between splice site strength and density of regulatory elements. PMID:23536893

MutPred Splice: machine learning-based prediction of exonic variants that disrupt splicing

PubMed Central

2014-01-01

We have developed a novel machine-learning approach, MutPred Splice, for the identification of coding region substitutions that disrupt pre-mRNA splicing. Applying MutPred Splice to human disease-causing exonic mutations suggests that 16% of mutations causing inherited disease and 10 to 14% of somatic mutations in cancer may disrupt pre-mRNA splicing. For inherited disease, the main mechanism responsible for the splicing defect is splice site loss, whereas for cancer the predominant mechanism of splicing disruption is predicted to be exon skipping via loss of exonic splicing enhancers or gain of exonic splicing silencer elements. MutPred Splice is available at http://mutdb.org/mutpredsplice. PMID:24451234

A splicing mutation in Aryl Hydrocarbon Receptor associated with retinitis pigmentosa.

PubMed

Zhou, Yu; Li, Shijin; Huang, Lulin; Yang, Yeming; Zhang, Lin; Yang, Mu; Liu, Wenjing; Ramasamy, Kim; Jiang, Zhilin; Sundaresan, Periasamy; Zhu, Xianjun; Yang, Zhenglin

2018-05-02

Retinitis pigmentosa (RP) refers to a group of retinal degenerative diseases, which often lead to vision loss. Although 70 genes have been identified in RP patients, the genetic cause of approximately 30% of RP cases remains unknown. We aimed to identify the cause of the disease in a cohort of RP families by whole exome sequencing. A rare homozygous splicing variant, c.1160 + 1G>A, which introduced skipping of exon 9 of the aryl hydrocarbon receptor (AHR), was identified in family RD-134. This variant is very rare in several exome databases and leads to skipping of exon 9 in the transcript. AHR is expressed in the human retina and is a ligand-activated transcription factor with multiple functions. Mutant AHR failed to promote 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)-induced Xenobiotic Responsive Element (XRE) luciferase activity. In parallel, mutation in AHR abolished activation of its downstream target gene, such as CYP1A1 and CYP1A2. To investigate the in vivo roles of Ahr in the retina, we generated a retina-specific conditional knockout mouse model of Ahr. Comparing with wildtype mouse, Ahr knockout mice exhibited reduced electroretinogram responses at 9 months of age. Retinal histology revealed Retinal histology showed the degeneration of photoreceptors with a thinner outer nuclear layer. Thus, our data demonstrate that AHR is associated with RP.

Rescue of cardiomyopathy through U7snRNA-mediated exon skipping in Mybpc3-targeted knock-in mice.

PubMed

Gedicke-Hornung, Christina; Behrens-Gawlik, Verena; Reischmann, Silke; Geertz, Birgit; Stimpel, Doreen; Weinberger, Florian; Schlossarek, Saskia; Précigout, Guillaume; Braren, Ingke; Eschenhagen, Thomas; Mearini, Giulia; Lorain, Stéphanie; Voit, Thomas; Dreyfus, Patrick A; Garcia, Luis; Carrier, Lucie

2013-07-01

Exon skipping mediated by antisense oligoribonucleotides (AON) is a promising therapeutic approach for genetic disorders, but has not yet been evaluated for cardiac diseases. We investigated the feasibility and efficacy of viral-mediated AON transfer in a Mybpc3-targeted knock-in (KI) mouse model of hypertrophic cardiomyopathy (HCM). KI mice carry a homozygous G>A transition in exon 6, which results in three different aberrant mRNAs. We identified an alternative variant (Var-4) deleted of exons 5-6 in wild-type and KI mice. To enhance its expression and suppress aberrant mRNAs we designed AON-5 and AON-6 that mask splicing enhancer motifs in exons 5 and 6. AONs were inserted into modified U7 small nuclear RNA and packaged in adeno-associated virus (AAV-U7-AON-5+6). Transduction of cardiac myocytes or systemic administration of AAV-U7-AON-5+6 increased Var-4 mRNA/protein levels and reduced aberrant mRNAs. Injection of newborn KI mice abolished cardiac dysfunction and prevented left ventricular hypertrophy. Although the therapeutic effect was transient and therefore requires optimization to be maintained over an extended period, this proof-of-concept study paves the way towards a causal therapy of HCM. © 2013 The Authors. Published by John Wiley and Sons, Ltd on behalf of EMBO.

A novel point mutation (G[sup [minus]1] to T) in a 5[prime] splice donor site of intron 13 of the dystrophin gene results in exon skipping and is responsible for Becker Muscular Dystrophy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hagiwara, Yoko; Nishio, Hisahide; Kitoh, Yoshihiko

1994-01-01

The mutations in one-third of Duchenne and Becker muscular dystrophy patients remain unknown, as they do not involve gross rearrangements of the dystrophin gene. The authors now report a defect in the splicing of precursor mRNA (pre-mRNA), resulting from a maternally inherited mutation of the dystrophin gene in a patient with Becker muscular dystrophy. This defect results from a G-to-T transversion at the terminal nucleotide of exon 13, within the 5[prime] splice site of intron 13, and causes complete skipping of exon 13 during processing of dystrophin pre-mRNA. The predicted polypeptide encoded by the aberrant mRNA is a truncated dystrophinmore » lacking 40 amino acids from the amino-proximal end of the rod domain. This is the first report of an intraexon point mutation that completely inactivates a 5[prime] splice donor site in dystrophin pre-mRNA. Analysis of the genomic context of the G[sup [minus]1]-to-T mutation at the 5[prime] splice site supports the exon-definition model of pre-mRNA splicing and contributes to the understanding of splice-site selection. 48 refs., 5 figs.« less

Hereditary vitamin D resistant rickets: identification of a novel splice site mutation in the vitamin D receptor gene and successful treatment with oral calcium therapy.

PubMed

Ma, Nina S; Malloy, Peter J; Pitukcheewanont, Pisit; Dreimane, Daina; Geffner, Mitchell E; Feldman, David

2009-10-01

To study the vitamin D receptor (VDR) gene in a young girl with severe rickets and clinical features of hereditary vitamin D resistant rickets, including hypocalcemia, hypophosphatemia, partial alopecia, and elevated serum levels of 1,25-dihydroxyvitamin D. We amplified and sequenced DNA samples from blood from the patient, her mother, and the patient's two siblings. We also amplified and sequenced the VDR cDNA from RNA isolated from the patient's blood. DNA sequence analyses of the VDR gene showed that the patient was homozygous for a novel guanine to thymine substitution in the 5'-splice site in the exon 8-intron J junction. Analysis of the VDR cDNA using reverse transcriptase-polymerase chain reaction showed that exons 7 and 9 were fused, and that exon 8 was skipped. The mother was heterozygous for the mutation and the two siblings were unaffected. A novel splice site mutation was identified in the VDR gene that caused exon 8 to be skipped. The mutation deleted amino acids 303-341 in the VDR ligand-binding domain, which is expected to render the VDR non-functional. Nevertheless, successful outpatient treatment was achieved with frequent high doses of oral calcium.

Genetic diagnosis as a tool for personalized treatment of Duchenne muscular dystrophy.

PubMed

Bello, Luca; Pegoraro, Elena

2016-12-01

Accurate definition of genetic mutations causing Duchenne muscular dystrophy (DMD) has always been relevant in order to provide genetic counseling to patients and families, and helps to establish the prognosis in the case where the distinction between Duchenne, Becker, or intermediate muscular dystrophy is not obvious. As molecular treatments aimed at dystrophin restoration in DMD are increasingly available as commercialized drugs or within clinical trials, genetic diagnosis has become an indispensable tool in order to determine eligibility for these treatments. DMD patients in which multiplex ligation-dependent probe amplification (MLPA) or similar techniques show a deletion suitable to exon skipping of exons 44, 45, 51, or 53, may be currently treated with AONs targeting these exons, in the context of clinical trials, or, as is the case for exon 51 skipping in the United States, with the first commercialized drug (eteplirsen). Patients who test negative at MLPA, but in whom DMD gene sequencing shows a nonsense mutation, may be amenable for treatment with stop codon readthrough compounds such as ataluren. Novel molecular approaches such as CRISPR-Cas9 targeting of specific DMD mutations are still in the preclinical stages, but appear promising. In conclusion, an accurate genetic diagnosis represents the entrance into a new scenario of personalized medicine in DMD.

Alternative Splicing of a Novel Inducible Exon Diversifies the CASK Guanylate Kinase Domain

PubMed Central

Dembowski, Jill A.; An, Ping; Scoulos-Hanson, Maritsa; Yeo, Gene; Han, Joonhee; Fu, Xiang-Dong; Grabowski, Paula J.

2012-01-01

Alternative pre-mRNA splicing has a major impact on cellular functions and development with the potential to fine-tune cellular localization, posttranslational modification, interaction properties, and expression levels of cognate proteins. The plasticity of regulation sets the stage for cells to adjust the relative levels of spliced mRNA isoforms in response to stress or stimulation. As part of an exon profiling analysis of mouse cortical neurons stimulated with high KCl to induce membrane depolarization, we detected a previously unrecognized exon (E24a) of the CASK gene, which encodes for a conserved peptide insertion in the guanylate kinase interaction domain. Comparative sequence analysis shows that E24a appeared selectively in mammalian CASK genes as part of a >3,000 base pair intron insertion. We demonstrate that a combination of a naturally defective 5′ splice site and negative regulation by several splicing factors, including SC35 (SRSF2) and ASF/SF2 (SRSF1), drives E24a skipping in most cell types. However, this negative regulation is countered with an observed increase in E24a inclusion after neuronal stimulation and NMDA receptor signaling. Taken together, E24a is typically a skipped exon, which awakens during neuronal stimulation with the potential to diversify the protein interaction properties of the CASK polypeptide. PMID:23008758

Poly(ester amine) Composed of Polyethylenimine and Pluronic Enhance Delivery of Antisense Oligonucleotides In Vitro and in Dystrophic mdx Mice

PubMed Central

Wang, Mingxing; Wu, Bo; Tucker, Jason D; Bollinger, Lauren E; Lu, Peijuan; Lu, Qilong

2016-01-01

A series of poly(esteramine)s (PEAs) constructed from low molecular weight polyethyleneimine (LPEI) and Pluronic were evaluated for the delivery of antisense oligonuclotides (AOs), 2′-O-methyl phosphorothioate RNA (2′-OMePS) and phosphorodiamidate morpholino oligomer (PMO) in cell culture and dystrophic mdx mice. Improved exon-skipping efficiency of both 2′-OMePS and PMO was observed in the C2C12E50 cell line with all PEA polymers compared with PEI 25k or LF-2k. The degree of efficiency was found in the order of PEA 01, PEA 04 > PEA 05 > others. The in vivo study in mdx mice demonstrated enhanced exon-skipping of 2′-OMePS with the order of PEA 06 > PEA 04, PEA 07 > PEA 03 > PEA 01 > others, and much higher than PEI 25k formulated 2′-OMePS. Exon-skipping efficiency of PMO in formulation with the PEAs were significantly enhanced in the order of PEA 02 > PEA 10 > PEA 01, PEA 03 > PEA 05, PEA 07, PEA 08 > others, with PEA 02 reaching fourfold of Endo-porter formulated PMO. PEAs improve PMO delivery more effectively than 2′-OMePS delivery in vivo, and the systemic delivery evaluation further highlight the efficiency of PEA for PMO delivery in all skeletal muscle. The results suggest that the flexibility of PEA polymers could be explored for delivery of different AO chemistries, especially for antisense therapy. PMID:27483024

Intragenic motifs regulate the transcriptional complexity of Pkhd1/PKHD1

PubMed Central

Boddu, Ravindra; Yang, Chaozhe; O’Connor, Amber K.; Hendrickson, Robert Curtis; Boone, Braden; Cui, Xiangqin; Garcia-Gonzalez, Miguel; Igarashi, Peter; Onuchic, Luiz F.; Germino, Gregory G.

2014-01-01

Autosomal recessive polycystic kidney disease (ARPKD) results from mutations in the human PKHD1 gene. Both this gene, and its mouse ortholog, Pkhd1, are primarily expressed in renal and biliary ductal structures. The mouse protein product, fibrocystin/polyductin complex (FPC), is a 445-kDa protein encoded by a 67-exon transcript that spans >500 kb of genomic DNA. In the current study, we observed multiple alternatively spliced Pkhd1 transcripts that varied in size and exon composition in embryonic mouse kidney, liver, and placenta samples, as well as among adult mouse pancreas, brain, heart, lung, testes, liver, and kidney. Using reverse transcription PCR and RNASeq, we identified 22 novel Pkhd1 kidney transcripts with unique exon junctions. Various mechanisms of alternative splicing were observed, including exon skipping, use of alternate acceptor/donor splice sites, and inclusion of novel exons. Bioinformatic analyses identified, and exon-trapping minigene experiments validated, consensus binding sites for serine/arginine-rich proteins that modulate alternative splicing. Using site-directed mutagenesis, we examined the functional importance of selected splice enhancers. In addition, we demonstrated that many of the novel transcripts were polysome bound, thus likely translated. Finally, we determined that the human PKHD1 R760H missense variant alters a splice enhancer motif that disrupts exon splicing in vitro and is predicted to truncate the protein. Taken together, these data provide evidence of the complex transcriptional regulation of Pkhd1/PKHD1 and identified motifs that regulate its splicing. Our studies indicate that Pkhd1/PKHD1 transcription is modulated, in part by intragenic factors, suggesting that aberrant PKHD1 splicing represents an unappreciated pathogenic mechanism in ARPKD. PMID:24984783

New lessons from an old gene: complex splicing and a novel cryptic exon in VHL gene cause erythrocytosis and VHL disease.

PubMed

Lenglet, Marion; Robriquet, Florence; Schwarz, Klaus; Camps, Carme; Couturier, Anne; Hoogewijs, David; Buffet, Alexandre; Knight, Samantha Jl; Gad, Sophie; Couvé, Sophie; Chesnel, Franck; Pacault, Mathilde; Lindenbaum, Pierre; Job, Sylvie; Dumont, Solenne; Besnard, Thomas; Cornec, Marine; Dreau, Helene; Pentony, Melissa; Kvikstad, Erika; Deveaux, Sophie; Burnichon, Nelly; Ferlicot, Sophie; Vilaine, Mathias; Mazzella, Jean-Michaël; Airaud, Fabrice; Garrec, Céline; Heidet, Laurence; Irtan, Sabine; Mantadakis, Elpis; Bouchireb, Karim; Debatin, Klaus-Michael; Redon, Richard; Bezieau, Stéphane; Bressac-de Paillerets, Brigitte; Teh, Bin Tean; Girodon, François; Randi, Maria-Luigia; Putti, Maria Caterina; Bours, Vincent; Van Wijk, Richard; Göthert, Joachim R; Kattamis, Antonis; Janin, Nicolas; Bento, Celeste; Taylor, Jenny C; Arlot-Bonnemains, Yannick; Richard, Stéphane; Gimenez-Roqueplo, Anne-Paule; Cario, Holger; Gardie, Betty

2018-06-11

Chuvash polycythemia is an autosomal recessive form of erythrocytosis associated with a homozygous p.Arg200Trp mutation in the von Hippel-Lindau (VHL) gene. Since this discovery, additional VHL mutations have been identified in patients with congenital erythrocytosis, in a homozygous or compound-heterozygous state. VHL is a major tumor suppressor gene, mutations in which were first described in patients presenting with von Hippel-Lindau disease, which is characterized by the development of highly vascularized tumors. Here, we identified a new VHL cryptic-exon (termed E1') deep in intron 1 that is naturally expressed in many tissues. More importantly, we identified mutations in E1' in seven families with erythrocytosis (one homozygous case and six compound-heterozygous cases with a mutation in E1' in addition to a mutation in VHL coding sequences) and in one large family with typical VHL disease but without any alteration in the other VHL exons. In this study we have shown that the mutations induced a dysregulation of the VHL splicing with excessive retention of E1' and are associated with a downregulation of VHL protein expression. In addition, we have demonstrated a pathogenic role for synonymous mutations in VHL-Exon 2 that alter splicing through E2-skipping in five families with erythrocytosis or VHL disease. In all the studied cases, the mutations differentially impact splicing, correlating with phenotype severity. This study demonstrates that cryptic-exon-retention or exon-skipping are new VHL alterations and reveals a novel complex splicing regulation of the VHL gene. These findings open new avenues for diagnosis and research into the VHL-related-hypoxia-signaling pathway. Copyright © 2018 American Society of Hematology.

Combined genetic and splicing analysis of BRCA1 c.[594-2A>C; 641A>G] highlights the relevance of naturally occurring in-frame transcripts for developing disease gene variant classification algorithms

PubMed Central

de la Hoya, Miguel; Soukarieh, Omar; López-Perolio, Irene; Vega, Ana; Walker, Logan C.; van Ierland, Yvette; Baralle, Diana; Santamariña, Marta; Lattimore, Vanessa; Wijnen, Juul; Whiley, Philip; Blanco, Ana; Raponi, Michela; Hauke, Jan; Wappenschmidt, Barbara; Becker, Alexandra; Hansen, Thomas V. O.; Behar, Raquel; Investigators, KConFaB; Niederacher, Diether; Arnold, Norbert; Dworniczak, Bernd; Steinemann, Doris; Faust, Ulrike; Rubinstein, Wendy; Hulick, Peter J.; Houdayer, Claude; Caputo, Sandrine M.; Castera, Laurent; Pesaran, Tina; Chao, Elizabeth; Brewer, Carole; Southey, Melissa C.; van Asperen, Christi J.; Singer, Christian F.; Sullivan, Jan; Poplawski, Nicola; Mai, Phuong; Peto, Julian; Johnson, Nichola; Burwinkel, Barbara; Surowy, Harald; Bojesen, Stig E.; Flyger, Henrik; Lindblom, Annika; Margolin, Sara; Chang-Claude, Jenny; Rudolph, Anja; Radice, Paolo; Galastri, Laura; Olson, Janet E.; Hallberg, Emily; Giles, Graham G.; Milne, Roger L.; Andrulis, Irene L.; Glendon, Gord; Hall, Per; Czene, Kamila; Blows, Fiona; Shah, Mitul; Wang, Qin; Dennis, Joe; Michailidou, Kyriaki; McGuffog, Lesley; Bolla, Manjeet K.; Antoniou, Antonis C.; Easton, Douglas F.; Couch, Fergus J.; Tavtigian, Sean; Vreeswijk, Maaike P.; Parsons, Michael; Meeks, Huong D.; Martins, Alexandra; Goldgar, David E.; Spurdle, Amanda B.

2016-01-01

A recent analysis using family history weighting and co-observation classification modeling indicated that BRCA1 c.594-2A > C (IVS9-2A > C), previously described to cause exon 10 skipping (a truncating alteration), displays characteristics inconsistent with those of a high risk pathogenic BRCA1 variant. We used large-scale genetic and clinical resources from the ENIGMA, CIMBA and BCAC consortia to assess pathogenicity of c.594-2A > C. The combined odds for causality considering case-control, segregation and breast tumor pathology information was 3.23 × 10−8. Our data indicate that c.594-2A > C is always in cis with c.641A > G. The spliceogenic effect of c.[594-2A > C;641A > G] was characterized using RNA analysis of human samples and splicing minigenes. As expected, c.[594-2A > C; 641A > G] caused exon 10 skipping, albeit not due to c.594-2A > C impairing the acceptor site but rather by c.641A > G modifying exon 10 splicing regulatory element(s). Multiple blood-based RNA assays indicated that the variant allele did not produce detectable levels of full-length transcripts, with a per allele BRCA1 expression profile composed of ≈70–80% truncating transcripts, and ≈20–30% of in-frame Δ9,10 transcripts predicted to encode a BRCA1 protein with tumor suppression function. We confirm that BRCA1c.[594-2A > C;641A > G] should not be considered a high-risk pathogenic variant. Importantly, results from our detailed mRNA analysis suggest that BRCA-associated cancer risk is likely not markedly increased for individuals who carry a truncating variant in BRCA1 exons 9 or 10, or any other BRCA1 allele that permits 20–30% of tumor suppressor function. More generally, our findings highlight the importance of assessing naturally occurring alternative splicing for clinical evaluation of variants in disease-causing genes. PMID:27008870

Muscle function recovery in golden retriever muscular dystrophy after AAV1-U7 exon skipping.

PubMed

Vulin, Adeline; Barthélémy, Inès; Goyenvalle, Aurélie; Thibaud, Jean-Laurent; Beley, Cyriaque; Griffith, Graziella; Benchaouir, Rachid; le Hir, Maëva; Unterfinger, Yves; Lorain, Stéphanie; Dreyfus, Patrick; Voit, Thomas; Carlier, Pierre; Blot, Stéphane; Garcia, Luis

2012-11-01

Duchenne muscular dystrophy (DMD) is an X-linked recessive disorder resulting from lesions of the gene encoding dystrophin. These usually consist of large genomic deletions, the extents of which are not correlated with the severity of the phenotype. Out-of-frame deletions give rise to dystrophin deficiency and severe DMD phenotypes, while internal deletions that produce in-frame mRNAs encoding truncated proteins can lead to a milder myopathy known as Becker muscular dystrophy (BMD). Widespread restoration of dystrophin expression via adeno-associated virus (AAV)-mediated exon skipping has been successfully demonstrated in the mdx mouse model and in cardiac muscle after percutaneous transendocardial delivery in the golden retriever muscular dystrophy dog (GRMD) model. Here, a set of optimized U7snRNAs carrying antisense sequences designed to rescue dystrophin were delivered into GRMD skeletal muscles by AAV1 gene transfer using intramuscular injection or forelimb perfusion. We show sustained correction of the dystrophic phenotype in extended muscle areas and partial recovery of muscle strength. Muscle architecture was improved and fibers displayed the hallmarks of mature and functional units. A 5-year follow-up ruled out immune rejection drawbacks but showed a progressive decline in the number of corrected muscle fibers, likely due to the persistence of a mild dystrophic process such as occurs in BMD phenotypes. Although AAV-mediated exon skipping was shown safe and efficient to rescue a truncated dystrophin, it appears that recurrent treatments would be required to maintain therapeutic benefit ahead of the progression of the disease.

Premature chain termination is a unifying mechanism for COL1A1 null alleles in osteogenesis imperfecta type I cell strains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Willing, M.C.; Deschenes, S.P.; Roberts, E.J.

Nonsense and frameshift mutations, which predict premature termination of translation, often cause a dramatic reduction in the amount of transcript from the mutant allele (nonsense-mediated mRNA decay). In some genes, these mutations also influence RNA splicing and induce skipping of the exon that contains the nonsense codon. To begin to dissect how premature termination alters the metabolism of RNA from the COL1A1 gene, we studied nonsense and frameshift mutations distributed over exons 11-49 of the gene. These mutations were originally identified in 10 unrelated families with osteogenesis imperfecta (OI) type I. We observed marked reduction in steady-state amounts of mRNAmore » from the mutant allele in both total cellular and nuclear RNA extracts of cells from affected individuals, suggesting that nonsense-mediated decay of COL1A1 RNA is a nuclear phenomenon. Position of the mutation within the gene did not influence this observation. None of the mutations induced skipping of either the exon containing the mutation or, for the frameshifts, the downstream exons with the new termination sites. Our data suggest that nonsense and frameshift mutations throughout most of the COL1A1 gene result in a null allele, which is associated with the predictable mild clinical phenotype, OI type I. 42 refs., 6 figs., 1 tab.« less

Alternatively spliced Spalax heparanase inhibits extracellular matrix degradation, tumor growth, and metastasis

PubMed Central

Nasser, Nicola J.; Avivi, Aaron; Shafat, Itay; Edovitsky, Evgeny; Zcharia, Eyal; Ilan, Neta; Vlodavsky, Israel; Nevo, Eviatar

2009-01-01

Heparanase is an endoglycosidase that degrades heparan sulfate (HS) at the cell surface and in the extracellular matrix. Heparanase is expressed mainly by cancer cells, and its expression is correlated with increased tumor aggressiveness, metastasis, and angiogenesis. Here, we report the cloning of a unique splice variant (splice 36) of heparanase from the subterranean blind mole rat (Spalax). This splice variant results from skipping part of exon 3, exons 4 and 5, and part of exon 6 and functions as a dominant negative to the wild-type enzyme. It inhibits HS degradation, suppresses glioma tumor growth, and decreases experimental B16–BL6 lung colonization in a mouse model. Intriguingly, Spalax splice variant 7 of heparanase (which results from skipping of exon 7) is devoid of enzymatic activity, but unlike splice 36 it enhances tumor growth. Our results demonstrate that alternative splicing of heparanase regulates its enzymatic activity and might adapt the heparanase function to the fluctuating normoxic–hypoxic subterranean environment that Spalax experiences. Development of anticancer drugs designed to suppress tumor growth, angiogenesis, and metastasis is a major challenge, of which heparanase inhibition is a promising approach. We anticipate that the heparanase splicing model, evolved during 40 million years of Spalacid adaptation to underground life, would pave the way for the development of heparanase-based therapeutic modalities directed against angiogenesis, tumor growth, and metastasis. PMID:19164514

Functional changes in Becker muscular dystrophy: implications for clinical trials in dystrophinopathies.

PubMed

Bello, Luca; Campadello, Paola; Barp, Andrea; Fanin, Marina; Semplicini, Claudio; Sorarù, Gianni; Caumo, Luca; Calore, Chiara; Angelini, Corrado; Pegoraro, Elena

2016-09-01

We performed a 1-year longitudinal study of Six Minute Walk Test (6MWT), North Star Ambulatory Assessment (NSAA), and timed function tests in Becker muscular dystrophy (BMD). Skeletal muscle dystrophin was quantified by immunoblot. We grouped deletions ending on exon 45 ("del 45-x", n = 28) or 51 ("del x-51", n = 10); isolated exon 48 deletion ("del 48", n = 10); and other mutations (n = 21). Only patients in the "del 45-x" or "other" groups became non-ambulatory (n = 5, log-rank p = n.s.) or unable to run (n = 22, p < 0.001). All measures correlated positively with dystrophin quantity and negatively with age, and were significantly more impaired in the "del 45-x" and "other" groups. After one year, NSAA score decreased significantly (-0.9 ± 1.6, p < 0.001); in the "del 45-x" group, both NSAA (-1.3 ± 1.7, p = 0.001) and 6MWT (-12 ± 31 m, p = 0.059) decreased. We conclude that patients with "del x-51" or "del 48" mutations have mild or asymptomatic BMD, while "del 45-x" mutations cause comparatively severe weakness, and functional deterioration in 1 year. Furthermore, exon 51 skipping could be more effective than exon 45 skipping in Duchenne muscular dystrophy.

Gene therapies that restore dystrophin expression for the treatment of Duchenne muscular dystrophy

PubMed Central

Robinson-Hamm, Jacqueline N.; Gersbach, Charles A.

2016-01-01

Duchenne muscular dystrophy is one of the most common inherited genetic diseases and is caused by mutations to the DMD gene that encodes the dystrophin protein. Recent advances in genome editing and gene therapy offer hope for the development of potential therapeutics. Truncated versions of the DMD gene can be delivered to the affected tissues with viral vectors and show promising results in a variety of animal models. Genome editing with the CRISPR/Cas9 system has recently been used to restore dystrophin expression by deleting one or more exons of the DMD gene in patient cells and in a mouse model that led to functional improvement of muscle strength. Exon skipping with oligonucleotides has been successful in several animal models and evaluated in multiple clinical trials. Next-generation oligonucleotide formulations offer significant promise to build on these results. All these approaches to restoring dystrophin expression are encouraging, but many hurdles remain. This review summarizes the current state of these technologies and summarizes considerations for their future development. PMID:27542949

Emerging genetic therapies to treat Duchenne muscular dystrophy

PubMed Central

Nelson, Stanley F.; Crosbie, Rachelle H.; Miceli, M. Carrie; Spencer, Melissa J.

2010-01-01

Purpose of review Duchenne muscular dystrophy is a progressive muscle degenerative disease caused by dystrophin mutations. The purpose of this review is to highlight two emerging therapies designed to repair the primary genetic defect, called `exon skipping' and `nonsense codon suppression'. Recent findings A drug, PTC124, was identified that suppresses nonsense codon translation termination. PTC124 can lead to restoration of some dystrophin expression in human Duchenne muscular dystrophy muscles with mutations resulting in premature stops. Two drugs developed for exon skipping, PRO051 and AVI-4658, result in the exclusion of exon 51 from mature mRNA. They can restore the translational reading frame to dystrophin transcripts from patients with a particular subset of dystrophin gene deletions and lead to some restoration of dystrophin expression in affected boys' muscle in vivo. Both approaches have concluded phase I trials with no serious adverse events. Summary These novel therapies that act to correct the primary genetic defect of dystrophin deficiency are among the first generation of therapies tailored to correct specific mutations in humans. Thus, they represent paradigm forming approaches to personalized medicine with the potential to lead to life changing treatment for those affected by Duchenne muscular dystrophy. PMID:19745732

TNF-α-Induced microRNAs Control Dystrophin Expression in Becker Muscular Dystrophy.

PubMed

Fiorillo, Alyson A; Heier, Christopher R; Novak, James S; Tully, Christopher B; Brown, Kristy J; Uaesoontrachoon, Kitipong; Vila, Maria C; Ngheim, Peter P; Bello, Luca; Kornegay, Joe N; Angelini, Corrado; Partridge, Terence A; Nagaraju, Kanneboyina; Hoffman, Eric P

2015-09-08

The amount and distribution of dystrophin protein in myofibers and muscle is highly variable in Becker muscular dystrophy and in exon-skipping trials for Duchenne muscular dystrophy. Here, we investigate a molecular basis for this variability. In muscle from Becker patients sharing the same exon 45-47 in-frame deletion, dystrophin levels negatively correlate with microRNAs predicted to target dystrophin. Seven microRNAs inhibit dystrophin expression in vitro, and three are validated in vivo (miR-146b/miR-374a/miR-31). microRNAs are expressed in dystrophic myofibers and increase with age and disease severity. In exon-skipping-treated mdx mice, microRNAs are significantly higher in muscles with low dystrophin rescue. TNF-α increases microRNA levels in vitro whereas NFκB inhibition blocks this in vitro and in vivo. Collectively, these data show that microRNAs contribute to variable dystrophin levels in muscular dystrophy. Our findings suggest a model where chronic inflammation in distinct microenvironments induces pathological microRNAs, initiating a self-sustaining feedback loop that exacerbates disease progression. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Comprehensive splicing functional analysis of DNA variants of the BRCA2 gene by hybrid minigenes

PubMed Central

2012-01-01

Introduction The underlying pathogenic mechanism of a large fraction of DNA variants of disease-causing genes is the disruption of the splicing process. We aimed to investigate the effect on splicing of the BRCA2 variants c.8488-1G > A (exon 20) and c.9026_9030del (exon 23), as well as 41 BRCA2 variants reported in the Breast Cancer Information Core (BIC) mutation database. Methods DNA variants were analyzed with the splicing prediction programs NNSPLICE and Human Splicing Finder. Functional analyses of candidate variants were performed by lymphocyte RT-PCR and/or hybrid minigene assays. Forty-one BIC variants of exons 19, 20, 23 and 24 were bioinformatically selected and generated by PCR-mutagenesis of the wild type minigenes. Results Lymphocyte RT-PCR of c.8488-1G > A showed intron 19 retention and a 12-nucleotide deletion in exon 20, whereas c.9026_9030del did not show any splicing anomaly. Minigene analysis of c.8488-1G > A displayed the aforementioned aberrant isoforms but also exon 20 skipping. We further evaluated the splicing outcomes of 41 variants of four BRCA2 exons by minigene analysis. Eighteen variants presented splicing aberrations. Most variants (78.9%) disrupted the natural splice sites, whereas four altered putative enhancers/silencers and had a weak effect. Fluorescent RT-PCR of minigenes accurately detected 14 RNA isoforms generated by cryptic site usage, exon skipping and intron retention events. Fourteen variants showed total splicing disruptions and were predicted to truncate or eliminate essential domains of BRCA2. Conclusions A relevant proportion of BRCA2 variants are correlated with splicing disruptions, indicating that RNA analysis is a valuable tool to assess the pathogenicity of a particular DNA change. The minigene system is a straightforward and robust approach to detect variants with an impact on splicing and contributes to a better knowledge of this gene expression step. PMID:22632462

Molecular analysis of Hurler syndrome in Druze and Muslim Arab patients in Israel: Multiple allelic mutations of the IDUA gene in a small geographic area

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bach, G.; Moskowitz, S.M.; Tieu, P.T.

1993-08-01

The mutations underlying Hurler syndrome (mucopolysaccharidosis IH) in Druze and Muslim Israeli Arab patients have been characterized. Four alleles were identified, using a combination of (a) PCR amplification of reverse-transcribed RNA or genomic DNA segments, (b) cycle sequencing of PCR products, and (c) restriction-enzyme analysis. One allele has two amino acid substitutions, Gly[sub 409][yields]Arg in exon 9 and Ter[yields]Cys in exon 14. The other three alleles have mutations in exon 2 (Tyr[sub 64][yields]Ter), exon 7 (Gln[sub 310][yields]Ter), or exon 8 (Thr[sub 366][yields]Pro). Transfection of mutagenized cDNAs into Cos-1 cells showed that two missense mutations, Thr[sub 366][yields]Pro and Ter[yields]Cys, permitted themore » expression of only trace amounts of [alpha]-L-iduronidase activity, whereas Gly[sub 409][yields]Arg permitted the expression of 60% as much enzyme as did the normal cDNA. The nonsense mutations were associated with abnormalities of RNA processing: (1) both a very low level of mRNA and skipping of exon 2 for Tyr[sub 64][yields]Ter and (2) utilization of a cryptic splice site for Gln[sub 310][yields]Ter. In all instances, the probands were found homozygous, and the parents heterozygous, for the mutant alleles, as anticipated from the consanguinity in each family. The two-mutation allele was identified in a family from Gaza; the other three alleles were found in seven families, five of them Druze, residing in a very small area of northern Israel. Since such clustering suggests a classic founder effect, the presence of three mutant alleles of the IDUA gene was unexpected. 28 refs., 4 figs., 3 tabs.« less

Functional understanding of the diverse exon-intron structures of human GPCR genes.

PubMed

Hammond, Dorothy A; Olman, Victor; Xu, Ying

2014-02-01

The GPCR genes have a variety of exon-intron structures even though their proteins are all structurally homologous. We have examined all human GPCR genes with at least two functional protein isoforms, totaling 199, aiming to gain an understanding of what may have contributed to the large diversity of the exon-intron structures of the GPCR genes. The 199 genes have a total of 808 known protein splicing isoforms with experimentally verified functions. Our analysis reveals that 1301 (80.6%) adjacent exon-exon pairs out of the total of 1,613 in the 199 genes have either exactly one exon skipped or the intron in-between retained in at least one of the 808 protein splicing isoforms. This observation has a statistical significance p-value of 2.051762 * e(-09), assuming that the observed splicing isoforms are independent of the exon-intron structures. Our interpretation of this observation is that the exon boundaries of the GPCR genes are not randomly determined; instead they may be selected to facilitate specific alternative splicing for functional purposes.

Transcriptome instability as a molecular pan-cancer characteristic of carcinomas.

PubMed

Sveen, Anita; Johannessen, Bjarne; Teixeira, Manuel R; Lothe, Ragnhild A; Skotheim, Rolf I

2014-08-10

We have previously proposed transcriptome instability as a genome-wide, pre-mRNA splicing-related characteristic of colorectal cancer. Here, we explore the hypothesis of transcriptome instability being a general characteristic of cancer. Exon-level microarray expression data from ten cancer datasets were analyzed, including breast cancer, cervical cancer, colorectal cancer, gastric cancer, lung cancer, neuroblastoma, and prostate cancer (555 samples), as well as paired normal tissue samples from the colon, lung, prostate, and stomach (93 samples). Based on alternative splicing scores across the genomes, we calculated sample-wise relative amounts of aberrant exon skipping and inclusion. Strong and non-random (P < 0.001) correlations between these estimates and the expression levels of splicing factor genes (n = 280) were found in most cancer types analyzed (breast-, cervical-, colorectal-, lung- and prostate cancer). This suggests a biological explanation for the splicing variation. Surprisingly, these associations prevailed in pan-cancer analyses. This is in contrast to the tissue and cancer specific patterns observed in comparisons across healthy tissue samples from the colon, lung, prostate, and stomach, and between paired cancer-normal samples from the same four tissue types. Based on exon-level expression profiling and computational analyses of alternative splicing, we propose transcriptome instability as a molecular pan-cancer characteristic. The affected cancers show strong and non-random associations between low expression levels of splicing factor genes, and high amounts of aberrant exon skipping and inclusion, and vice versa, on a genome-wide scale.

PMO Delivery System Using Bubble Liposomes and Ultrasound Exposure for Duchenne Muscular Dystrophy Treatment.

PubMed

Negishi, Yoichi; Ishii, Yuko; Nirasawa, Kei; Sasaki, Eri; Endo-Takahashi, Yoko; Suzuki, Ryo; Maruyama, Kazuo

2018-01-01

Duchenne muscular dystrophy (DMD) is a genetic disorder characterized by progressive muscle degeneration, caused by nonsense or frameshift mutations in the dystrophin (DMD) gene. Antisense oligonucleotides can be used to induce specific exon skipping; recently, a phosphorodiamidate morpholino oligomer (PMO) has been approved for clinical use in DMD. However, an efficient PMO delivery strategy is required to improve the therapeutic efficacy in DMD patients. We previously developed polyethylene glycol (PEG)-modified liposomes containing ultrasound contrast gas, "Bubble liposomes" (BLs), and found that the combination of BLs with ultrasound exposure is a useful gene delivery tool. Here, we describe an efficient PMO delivery strategy using the combination of BLs and ultrasound exposure to treat muscles in a DMD mouse model (mdx). This ultrasound-mediated BL technique can increase the PMO-mediated exon-skipping efficiency, leading to significantly increased dystrophin expression. Thus, the combination of BLs and ultrasound exposure may be a feasible PMO delivery method to improve therapeutic efficacy and reduce the PMO dosage for DMD treatment.

A Novel Germline Mutation in BRCA1 Causes Exon 20 Skipping in a Korean Family with a History of Breast Cancer.

PubMed

Yoon, Kyong-Ah; Kong, Sun-Young; Lee, Eun Ji; Cho, Jeong Nam; Chang, Suhwan; Lee, Eun Sook

2017-09-01

Germline mutations in the BRCA1 and BRCA2 genes are strong genetic factors for predispositions to breast, ovarian, and other related cancers. This report describes a family with a history of breast and ovarian cancers that harbored a novel BRCA1 germline mutation. A single nucleotide deletion in intron 20, namely c.5332+4delA, was detected in a 43-year-old patient with breast cancer. This mutation led to the skipping of exon 20, which in turn resulted in the production of a truncated BRCA1 protein that was 1773 amino acids in length. The mother of the proband had died due to ovarian cancer and had harbored the same germline mutation. Ectopically expressed mutant BRCA1 protein interacted with the BARD1 protein, but showed a reduced transcriptional function, as demonstrated by the expression of cyclin B1 . This novel germline mutation in the BRCA1 gene caused familial breast and ovarian cancers.

Genomic structure and chromosomal mapping of the human CD22 gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wilson, G.L.; Kozlow, E.; Kehrl, J.H.

1993-06-01

The human CD22 gene is expressed specifically in B lymphocytes and likely has an important function in cell-cell interactions. A nearly full length human CD22 cDNA clone was used to isolate genomic clones that span the CD22 gene. The CD22 gene is spread over 22 kb of DNA and is composed of 15 exons. The first exon contains the major transcriptional start sites. The translation initiation codon is located in exon 3, which also encodes a portion of the signal peptide. Exons 4 to 10 encode the seven Ig domains of CD22, exon 11 encodes the transmembrane domain, exons 12more » to 15 encode the intracytoplasmic domain of CD22, and exon 15 also contains the 3' untranslated region. A minor form of CD22 mRNA likely results from splicing of exon 5 to exon 8, skipping exons 6 and 7. A 4.6-kb Xbal fragment of the CD22 gene was used to map the chromosomal location of CD22 by fluorescence in situ hybridization. The hybridization locus was identified by combining fluorescent images of the probe with the chromosomal banding pattern generated by an Alu probe. The results demonstrate the CD22 is located within the band region q13.1 of chromosome 19. Two closely clustered major transcription start sites and several minor start sites were mapped by primer extension. Similarly to many other lymphoid-specific genes, the CD22 promoter lacks an obvious TATA box. Approximately 4 kb of DNA 5' of the transcription start sites were sequenced and found to contain multiple Alu elements. Potential binding sites for the transcriptional factors NF-kB, AP-1, and Oct-2 are located within 300 bp 5' of the major transcription start sites. A 400-bp fragment (bp -339 through +71) of the CD22 promoter region was subcloned into a pGEM-chloramphenicol acetyltransferase vector and after transfection into B and T cells was found to be active in both B and T cells. 45 refs., 7 figs., 2 tabs.« less

Anti-tumor efficacy of a novel CLK inhibitor via targeting RNA splicing and MYC-dependent vulnerability.

PubMed

Iwai, Kenichi; Yaguchi, Masahiro; Nishimura, Kazuho; Yamamoto, Yukiko; Tamura, Toshiya; Nakata, Daisuke; Dairiki, Ryo; Kawakita, Yoichi; Mizojiri, Ryo; Ito, Yoshiteru; Asano, Moriteru; Maezaki, Hironobu; Nakayama, Yusuke; Kaishima, Misato; Hayashi, Kozo; Teratani, Mika; Miyakawa, Shuichi; Iwatani, Misa; Miyamoto, Maki; Klein, Michael G; Lane, Wes; Snell, Gyorgy; Tjhen, Richard; He, Xingyue; Pulukuri, Sai; Nomura, Toshiyuki

2018-06-01

The modulation of pre-mRNA splicing is proposed as an attractive anti-neoplastic strategy, especially for the cancers that exhibit aberrant pre-mRNA splicing. Here, we discovered that T-025 functions as an orally available and potent inhibitor of Cdc2-like kinases (CLKs), evolutionally conserved kinases that facilitate exon recognition in the splicing machinery. Treatment with T-025 reduced CLK-dependent phosphorylation, resulting in the induction of skipped exons, cell death, and growth suppression in vitro and in vivo Further, through growth inhibitory characterization, we identified high CLK2 expression or MYC amplification as a sensitive-associated biomarker of T-025. Mechanistically, the level of CLK2 expression correlated with the magnitude of global skipped exons in response to T-025 treatment. MYC activation, which altered pre-mRNA splicing without the transcriptional regulation of CLKs, rendered cancer cells vulnerable to CLK inhibitors with synergistic cell death. Finally, we demonstrated in vivo anti-tumor efficacy of T-025 in an allograft model of spontaneous, MYC-driven breast cancer, at well-tolerated dosage. Collectively, our results suggest that the novel CLK inhibitor could have therapeutic benefits, especially for MYC-driven cancer patients. © 2018 Takeda Pharmaceutical Company Published under the terms of the CC BY 4.0 license.

Moderation of phenotypic severity in dystrophic and junctional forms of epidermolysis bullosa through in-frame skipping of exons containing non-sense or frameshift mutations.

PubMed

McGrath, J A; Ashton, G H; Mellerio, J E; Salas-Alanis, J C; Swensson, O; McMillan, J R; Eady, R A

1999-09-01

Non-sense mutations on both alleles of either the type VII collagen gene (COL7A1) or the genes encoding laminin 5 (LAMA3, LAMB3, or LAMC2) usually result in clinically severe forms of recessive dystrophic or junctional epidermolysis bullosa, respectively. In this study we assessed two unrelated families whose mutations in genomic DNA predicted severe recessive dystrophic epidermolysis bullosa or junctional epidermolysis bullosa phenotypes but in whom the manifestations were milder than expected. The recessive dystrophic epidermolysis bullosa patients had a homozygous single base-pair frameshift mutation in exon 19 of COL7A1 (2470insG). Clinically, there was generalized blistering but only mild scarring. Skin biopsy revealed positive type VII collagen immunoreactivity and recognizable anchoring fibrils. The junctional epidermolysis bullosa patients were compound heterozygotes for a frameshift/non-sense combination of mutations in exons 3 and 17 of LAMB3 (29insC/Q834X). These patients did not have the lethal form of junctional epidermolysis bullosa but, as adults, displayed the milder generalized atrophic benign epidermolysis bullosa variant. There was undetectable laminin 5 staining at the dermal-epidermal junction using an antibody to the beta3 chain, but faintly positive alpha3 and gamma2 chain labeling, and there was variable hypoplasia of hemidesmosomes. To explain the milder recessive dystrophic epidermolysis bullosa and junctional epidermolysis bullosa phenotypes in these families, reverse transcription-polymerase chain reaction, using RNA extracted from frozen skin, was able to provide evidence for some rescue of mutant mRNA transcripts with restoration of the open- reading frame. In the recessive dystrophic epidermolysis bullosa patients, transcripts containing in-frame skipping of exon 19 of COL7A1 in the cDNA were detected, and in the junctional epidermolysis bullosa patients transcripts with in-frame skipping of exon 17 of LAMB3 were identified. The truncated proteins encoded by these transcripts are expected to lack certain critical domains involved in cell-matrix attachment, but may still be able to contribute to adhesion thereby moderating the severity of the skin blistering. This study shows the limitations in predicting phenotype in epidermolysis bullosa solely based on mutation analysis of genomic DNA and emphasizes the importance of immunohistochemistry, electron microscopy, and mRNA assessment as parallel investigations.

Analysis of aberrant pre-messenger RNA splicing resulting from mutations in ATP8B1 and efficient in vitro rescue by adapted U1 small nuclear RNA.

PubMed

van der Woerd, Wendy L; Mulder, Johanna; Pagani, Franco; Beuers, Ulrich; Houwen, Roderick H J; van de Graaf, Stan F J

2015-04-01

ATP8B1 deficiency is a severe autosomal recessive liver disease resulting from mutations in the ATP8B1 gene characterized by a continuous phenotypical spectrum from intermittent (benign recurrent intrahepatic cholestasis; BRIC) to progressive familial intrahepatic cholestasis (PFIC). Current therapeutic options are insufficient, and elucidating the molecular consequences of mutations could lead to personalized mutation-specific therapies. We investigated the effect on pre-messenger RNA splicing of 14 ATP8B1 mutations at exon-intron boundaries using an in vitro minigene system. Eleven mutations, mostly associated with a PFIC phenotype, resulted in aberrant splicing and a complete absence of correctly spliced product. In contrast, three mutations led to partially correct splicing and were associated with a BRIC phenotype. These findings indicate an inverse correlation between the level of correctly spliced product and disease severity. Expression of modified U1 small nuclear RNAs (snRNA) complementary to the splice donor sites strongly improved or completely rescued splicing for several ATP8B1 mutations located at donor, as well as acceptor, splice sites. In one case, we also evaluated exon-specific U1 snRNAs that, by targeting nonconserved intronic sequences, might reduce possible off-target events. Although very effective in correcting exon skipping, they also induced retention of the short downstream intron. We systematically characterized the molecular consequences of 14 ATP8B1 mutations at exon-intron boundaries associated with ATP8B1 deficiency and found that the majority resulted in total exon skipping. The amount of correctly spliced product inversely correlated with disease severity. Compensatory modified U1 snRNAs, complementary to mutated donor splice sites, were able to improve exon definition very efficiently and could be a novel therapeutic strategy in ATP8B1 deficiency as well as other genetic diseases. © 2014 by the American Association for the Study of Liver Diseases.

Splicing of designer exons informs a biophysical model for exon definition

PubMed Central

Arias, Mauricio A.; Chasin, Lawrence A.

2015-01-01

Pre-mRNA molecules in humans contain mostly short internal exons flanked by longer introns. To explain the removal of such introns, exon recognition instead of intron recognition has been proposed. We studied this exon definition using designer exons (DEs) made up of three prototype modules of our own design: an exonic splicing enhancer (ESE), an exonic splicing silencer (ESS), and a Reference Sequence (R) predicted to be neither. Each DE was examined as the central exon in a three-exon minigene. DEs made of R modules showed a sharp size dependence, with exons shorter than 14 nt and longer than 174 nt splicing poorly. Changing the strengths of the splice sites improved longer exon splicing but worsened shorter exon splicing, effectively displacing the curve to the right. For the ESE we found, unexpectedly, that its enhancement efficiency was independent of its position within the exon. For the ESS we found a step-wise positional increase in its effects; it was most effective at the 3′ end of the exon. To apply these results quantitatively, we developed a biophysical model for exon definition of internal exons undergoing cotranscriptional splicing. This model features commitment to inclusion before the downstream exon is synthesized and competition between skipping and inclusion fates afterward. Collision of both exon ends to form an exon definition complex was incorporated to account for the effect of size; ESE/ESS effects were modeled on the basis of stabilization/destabilization. This model accurately predicted the outcome of independent experiments on more complex DEs that combined ESEs and ESSs. PMID:25492963

Modulating Calcium Signals to Boost AON Exon Skipping for DMD

DTIC Science & Technology

2017-10-01

NINDS $488,500/y Title: Rapid Phenotyping for Rare Variant Discovery in Autism This project is intended to use web-based recruiting to greatly...expand DNA samples available for genetic analysis to determine the heterogeneous genetic causes of autism . ACTIVE P30 AR057230-01 (Spencer

Effects of systemic multiexon skipping with peptide-conjugated morpholinos in the heart of a dog model of Duchenne muscular dystrophy

PubMed Central

Echigoya, Yusuke; Nakamura, Akinori; Nagata, Tetsuya; Urasawa, Nobuyuki; Trieu, Nhu; Panesar, Dharminder; Kuraoka, Mutsuki; Moulton, Hong M.; Saito, Takashi; Aoki, Yoshitsugu; Iversen, Patrick; Sazani, Peter; Kole, Ryszard; Maruyama, Rika; Partridge, Terry; Takeda, Shin’ichi; Yokota, Toshifumi

2017-01-01

Duchenne muscular dystrophy (DMD) is a lethal genetic disorder caused by an absence of the dystrophin protein in bodywide muscles, including the heart. Cardiomyopathy is a leading cause of death in DMD. Exon skipping via synthetic phosphorodiamidate morpholino oligomers (PMOs) represents one of the most promising therapeutic options, yet PMOs have shown very little efficacy in cardiac muscle. To increase therapeutic potency in cardiac muscle, we tested a next-generation morpholino: arginine-rich, cell-penetrating peptide-conjugated PMOs (PPMOs) in the canine X-linked muscular dystrophy in Japan (CXMDJ) dog model of DMD. A PPMO cocktail designed to skip dystrophin exons 6 and 8 was injected intramuscularly, intracoronarily, or intravenously into CXMDJ dogs. Intravenous injections with PPMOs restored dystrophin expression in the myocardium and cardiac Purkinje fibers, as well as skeletal muscles. Vacuole degeneration of cardiac Purkinje fibers, as seen in DMD patients, was ameliorated in PPMO-treated dogs. Although symptoms and functions in skeletal muscle were not ameliorated by i.v. treatment, electrocardiogram abnormalities (increased Q-amplitude and Q/R ratio) were improved in CXMDJ dogs after intracoronary or i.v. administration. No obvious evidence of toxicity was found in blood tests throughout the monitoring period of one or four systemic treatments with the PPMO cocktail (12 mg/kg/injection). The present study reports the rescue of dystrophin expression and recovery of the conduction system in the heart of dystrophic dogs by PPMO-mediated multiexon skipping. We demonstrate that rescued dystrophin expression in the Purkinje fibers leads to the improvement/prevention of cardiac conduction abnormalities in the dystrophic heart. PMID:28373570

Effects of systemic multiexon skipping with peptide-conjugated morpholinos in the heart of a dog model of Duchenne muscular dystrophy.

PubMed

Echigoya, Yusuke; Nakamura, Akinori; Nagata, Tetsuya; Urasawa, Nobuyuki; Lim, Kenji Rowel Q; Trieu, Nhu; Panesar, Dharminder; Kuraoka, Mutsuki; Moulton, Hong M; Saito, Takashi; Aoki, Yoshitsugu; Iversen, Patrick; Sazani, Peter; Kole, Ryszard; Maruyama, Rika; Partridge, Terry; Takeda, Shin'ichi; Yokota, Toshifumi

2017-04-18

Duchenne muscular dystrophy (DMD) is a lethal genetic disorder caused by an absence of the dystrophin protein in bodywide muscles, including the heart. Cardiomyopathy is a leading cause of death in DMD. Exon skipping via synthetic phosphorodiamidate morpholino oligomers (PMOs) represents one of the most promising therapeutic options, yet PMOs have shown very little efficacy in cardiac muscle. To increase therapeutic potency in cardiac muscle, we tested a next-generation morpholino: arginine-rich, cell-penetrating peptide-conjugated PMOs (PPMOs) in the canine X-linked muscular dystrophy in Japan (CXMD J ) dog model of DMD. A PPMO cocktail designed to skip dystrophin exons 6 and 8 was injected intramuscularly, intracoronarily, or intravenously into CXMD J dogs. Intravenous injections with PPMOs restored dystrophin expression in the myocardium and cardiac Purkinje fibers, as well as skeletal muscles. Vacuole degeneration of cardiac Purkinje fibers, as seen in DMD patients, was ameliorated in PPMO-treated dogs. Although symptoms and functions in skeletal muscle were not ameliorated by i.v. treatment, electrocardiogram abnormalities (increased Q-amplitude and Q/R ratio) were improved in CXMD J dogs after intracoronary or i.v. administration. No obvious evidence of toxicity was found in blood tests throughout the monitoring period of one or four systemic treatments with the PPMO cocktail (12 mg/kg/injection). The present study reports the rescue of dystrophin expression and recovery of the conduction system in the heart of dystrophic dogs by PPMO-mediated multiexon skipping. We demonstrate that rescued dystrophin expression in the Purkinje fibers leads to the improvement/prevention of cardiac conduction abnormalities in the dystrophic heart.

G to A substitution in 5{prime} donor splice site of introns 18 and 48 of COL1A1 gene of type I collagen results in different splicing alternatives in osteogenesis imperfecta type I cell strains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Willing, M.; Deschenes, S.

We have identified a G to A substitution in the 5{prime} donor splice site of intron 18 of one COL1A1 allele in two unrelated families with osteogenesis imperfecta (OI) type I. A third OI type I family has a G to A substitution at the identical position in intron 48 of one COL1A1 allele. Both mutations abolish normal splicing and lead to reduced steady-state levels of mRNA from the mutant COL1A1 allele. The intron 18 mutation leads to both exon 18 skipping in the mRNA and to utilization of a single alternative splice site near the 3{prime} end of exonmore » 18. The latter results in deletion of the last 8 nucleotides of exon 18 from the mRNA, a shift in the translational reading-frame, and the creation of a premature termination codon in exon 19. Of the potential alternative 5{prime} splice sites in exon 18 and intron 18, the one utilized has a surrounding nucleotide sequence which most closely resembles that of the natural splice site. Although a G to A mutation was detected at the identical position in intron 48 of one COL1A1 allele in another OI type I family, nine complex alternative splicing patterns were identified by sequence analysis of cDNA clones derived from fibroblast mRNA from this cell strain. All result in partial or complete skipping of exon 48, with in-frame deletions of portions of exons 47 and/or 49. The different patterns of RNA splicing were not explained by their sequence homology with naturally occuring 5{prime} splice sites, but rather by recombination between highly homologous exon sequences, suggesting that we may not have identified the major splicing alternative(s) in this cell strain. Both G to A mutations result in decreased production of type I collagen, the common biochemical correlate of OI type I.« less

A G-to-A mutation in IVS-3 of the human gamma fibrinogen gene causing afibrinogenemia due to abnormal RNA splicing.

PubMed

Margaglione, M; Santacroce, R; Colaizzo, D; Seripa, D; Vecchione, G; Lupone, M R; De Lucia, D; Fortina, P; Grandone, E; Perricone, C; Di Minno, G

2000-10-01

Congenital afibrinogenemia is a rare autosomal recessive disorder characterized by a hemorrhagic diathesis of variable severity. Although more than 100 families with this disorder have been described, genetic defects have been characterized in few cases. An investigation of a young propositus, offspring of a consanguineous marriage, with undetectable levels of functional and quantitative fibrinogen, was conducted. Sequence analysis of the fibrinogen genes showed a homozygous G-to-A mutation at the fifth nucleotide (nt 2395) of the third intervening sequence (IVS) of the gamma-chain gene. Her first-degree relatives, who had approximately half the normal fibrinogen values and showed concordance between functional and immunologic levels, were heterozygtes. The G-to-A change predicts the disappearance of a donor splice site. After transfection with a construct, containing either the wild-type or the mutated sequence, cells with the mutant construct showed an aberrant messenger RNA (mRNA), consistent with skipping of exon 3, but not the expected mRNA. Sequencing of the abnormal mRNA showed the complete absence of exon 3. Skipping of exon 3 predicts the deletion of amino acid sequence from residue 16 to residue 75 and shifting of reading frame at amino acid 76 with a premature stop codon within exon 4 at position 77. Thus, the truncated gamma-chain gene product would not interact with other chains to form the mature fibrinogen molecule. The current findings show that mutations within highly conserved IVS regions of fibrinogen genes could affect the efficiency of normal splicing, giving rise to congenital afibrinogenemia.

Exon Skipping in the RET Gene Encodes Novel Isoforms That Differentially Regulate RET Protein Signal Transduction*

PubMed Central

Gabreski, Nicole A.; Vaghasia, Janki K.; Novakova, Silvia S.; McDonald, Neil Q.; Pierchala, Brian A.

2016-01-01

Rearranged during transfection (RET), a receptor tyrosine kinase that is activated by the glial cell line-derived neurotrophic factor family ligands (GFLs), plays a crucial role in the development and function of the nervous system and additionally is required for kidney development and spermatogenesis. RET encodes a transmembrane receptor that is 20 exons long and produces two known protein isoforms differing in C-terminal amino acid composition, referred to as RET9 and RET51. Studies of human pheochromocytomas identified two additional novel transcripts involving the skipping of exon 3 or exons 3, 4, and 5 and are referred to as RETΔE3 and RETΔE345, respectively. Here we report the presence of RetΔE3 and RetΔE345 in zebrafish, mice, and rats and show that these transcripts are dynamically expressed throughout development of the CNS, peripheral nervous system, and kidneys. We further explore the biochemical properties of these isoforms, demonstrating that, like full-length RET, RETΔE3 and RETΔE345 are trafficked to the cell surface, interact with all four GFRα co-receptors, and have the ability to heterodimerize with full-length RET. Signaling experiments indicate that RETΔE3 is phosphorylated in a similar manner to full-length RET. RETΔE345, in contrast, displays higher baseline autophosphorylation, specifically on the catalytic tyrosine, Tyr905, and also on one of the most important signaling residues, Tyr1062. These data provide the first evidence for a physiologic role of these isoforms in RET pathway function. PMID:27226544

Nonsyndromic recessive deafness DFNB18 and Usher syndrome type IC are allelic mutations of USHIC.

PubMed

Ahmed, Zubair M; Smith, Tenesha N; Riazuddin, Saima; Makishima, Tomoko; Ghosh, Manju; Bokhari, Sirosh; Menon, Puthezhath S N; Deshmukh, Dilip; Griffith, Andrew J; Riazuddin, Sheikh; Friedman, Thomas B; Wilcox, Edward R

2002-06-01

Human chromosome 11 harbors two Usher type I loci, USHIB and USHIC, which encode myosin VIIA and harmonin, respectively. The USHIC locus overlaps the reported critical interval for nonsyndromic deafness locus DFNB18. We found an IVS12+5G-->C mutation in the USHIC gene, which is associated with nonsyndromic recessive deafness ( DFNB18) segregating in the original family, S-11/12. No other disease-associated mutation was found in the other 27 exons or in the intron-exon boundaries, and the IVS12+5G-->C mutation was not present in 200 representative unaffected individuals ascertained from the same area of India. An exon-trapping assay with a construct harboring IVS12+5G-->C generated wildtype spliced mRNA having exons 11 and 12 and mRNA that skipped exon 12. We conclude that mutations of USHIC can cause both Usher syndrome type IC and nonsyndromic recessive deafness DFNB18.

Abnormal splicing switch of DMD's penultimate exon compromises muscle fibre maintenance in myotonic dystrophy.

PubMed

Rau, Frédérique; Lainé, Jeanne; Ramanoudjame, Laetitita; Ferry, Arnaud; Arandel, Ludovic; Delalande, Olivier; Jollet, Arnaud; Dingli, Florent; Lee, Kuang-Yung; Peccate, Cécile; Lorain, Stéphanie; Kabashi, Edor; Athanasopoulos, Takis; Koo, Taeyoung; Loew, Damarys; Swanson, Maurice S; Le Rumeur, Elisabeth; Dickson, George; Allamand, Valérie; Marie, Joëlle; Furling, Denis

2015-05-28

Myotonic Dystrophy type 1 (DM1) is a dominant neuromuscular disease caused by nuclear-retained RNAs containing expanded CUG repeats. These toxic RNAs alter the activities of RNA splicing factors resulting in alternative splicing misregulation and muscular dysfunction. Here we show that the abnormal splicing of DMD exon 78 found in dystrophic muscles of DM1 patients is due to the functional loss of MBNL1 and leads to the re-expression of an embryonic dystrophin in place of the adult isoform. Forced expression of embryonic dystrophin in zebrafish using an exon-skipping approach severely impairs the mobility and muscle architecture. Moreover, reproducing Dmd exon 78 missplicing switch in mice induces muscle fibre remodelling and ultrastructural abnormalities including ringed fibres, sarcoplasmic masses or Z-band disorganization, which are characteristic features of dystrophic DM1 skeletal muscles. Thus, we propose that splicing misregulation of DMD exon 78 compromises muscle fibre maintenance and contributes to the progressive dystrophic process in DM1.

Abnormal splicing switch of DMD's penultimate exon compromises muscle fibre maintenance in myotonic dystrophy

PubMed Central

Rau, Frédérique; Lainé, Jeanne; Ramanoudjame, Laetitita; Ferry, Arnaud; Arandel, Ludovic; Delalande, Olivier; Jollet, Arnaud; Dingli, Florent; Lee, Kuang-Yung; Peccate, Cécile; Lorain, Stéphanie; Kabashi, Edor; Athanasopoulos, Takis; Koo, Taeyoung; Loew, Damarys; Swanson, Maurice S.; Le Rumeur, Elisabeth; Dickson, George; Allamand, Valérie; Marie, Joëlle; Furling, Denis

2015-01-01

Myotonic Dystrophy type 1 (DM1) is a dominant neuromuscular disease caused by nuclear-retained RNAs containing expanded CUG repeats. These toxic RNAs alter the activities of RNA splicing factors resulting in alternative splicing misregulation and muscular dysfunction. Here we show that the abnormal splicing of DMD exon 78 found in dystrophic muscles of DM1 patients is due to the functional loss of MBNL1 and leads to the re-expression of an embryonic dystrophin in place of the adult isoform. Forced expression of embryonic dystrophin in zebrafish using an exon-skipping approach severely impairs the mobility and muscle architecture. Moreover, reproducing Dmd exon 78 missplicing switch in mice induces muscle fibre remodelling and ultrastructural abnormalities including ringed fibres, sarcoplasmic masses or Z-band disorganization, which are characteristic features of dystrophic DM1 skeletal muscles. Thus, we propose that splicing misregulation of DMD exon 78 compromises muscle fibre maintenance and contributes to the progressive dystrophic process in DM1. PMID:26018658

RNA-Seq profiling reveals aberrant RNA splicing in patient with adult acute myeloid leukemia during treatment.

PubMed

Li, X-y; Yao, X; Li, S-n; Suo, A-l; Ruan, Z-p; Liang, X; Kong, Y; Zhang, W-g; Yao, Y

2014-01-01

Multiple genetic alterations that affect the process of acute myeloid leukemia (AML) have been discovered, and more evidence also indicates that aberrant splicing plays an important role in cancer. We present a RNA-Seq profiling of an AML patient with complete remission after treatment, to analyze the aberrant splicing of genes during treatment. We sequenced 3.97 and 3.32 Gbp clean data of the AML and remission sample, respectively. Firstly, by analyzing biomarkers associated with AML, to assist normal clinical tests, we confirmed that the patient was anormal karyo type, with NPM1 and IDH2 mutations and deregulation patterns of related genes, such as BAALC, ERG, MN1 and HOX family. Then, we performed alternative splicing detection of the AML and remission sample. We detected 91 differentially splicing events in 68 differentially splicing genes (DSGs) by mixture of isoforms (MISO). Considering Psi values (Ψ) and confidence intervals, 25 differentially expressed isoforms were identified as more confident isoforms, which were associated with RNA processing, cellular macromolecule catabolic process and DNA binding according to GO enrichment analysis. An exon2-skipping event in oncogene FOS (FBJ murine osteosarcoma viral oncogene homolog) were detected and validated in this study. FOS has a critical function in regulating cell proliferation, differentiation and transformation. The exon2-skipping isoform of FOS was increased significantly after treatment. All the data and information of RNA-Seq provides highly accurate and comprehensive supplements to conventional clinical tests of AML. Moreover, the splicing aberrations would be another source for biomarker and even therapeutic target discovery. More information of splicing may also assist the better understanding of leukemogenesis.

Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

PubMed

Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko

2018-05-24

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

Haploinsufficiency of the NF-κB1 Subunit p50 in Common Variable Immunodeficiency.

PubMed

Fliegauf, Manfred; Bryant, Vanessa L; Frede, Natalie; Slade, Charlotte; Woon, See-Tarn; Lehnert, Klaus; Winzer, Sandra; Bulashevska, Alla; Scerri, Thomas; Leung, Euphemia; Jordan, Anthony; Keller, Baerbel; de Vries, Esther; Cao, Hongzhi; Yang, Fang; Schäffer, Alejandro A; Warnatz, Klaus; Browett, Peter; Douglass, Jo; Ameratunga, Rohan V; van der Meer, Jos W M; Grimbacher, Bodo

2015-09-03

Common variable immunodeficiency (CVID), characterized by recurrent infections, is the most prevalent symptomatic antibody deficiency. In ∼90% of CVID-affected individuals, no genetic cause of the disease has been identified. In a Dutch-Australian CVID-affected family, we identified a NFKB1 heterozygous splice-donor-site mutation (c.730+4A>G), causing in-frame skipping of exon 8. NFKB1 encodes the transcription-factor precursor p105, which is processed to p50 (canonical NF-κB pathway). The altered protein bearing an internal deletion (p.Asp191_Lys244delinsGlu; p105ΔEx8) is degraded, but is not processed to p50ΔEx8. Altered NF-κB1 proteins were also undetectable in a German CVID-affected family with a heterozygous in-frame exon 9 skipping mutation (c.835+2T>G) and in a CVID-affected family from New Zealand with a heterozygous frameshift mutation (c.465dupA) in exon 7. Given that residual p105 and p50—translated from the non-mutated alleles—were normal, and altered p50 proteins were absent, we conclude that the CVID phenotype in these families is caused by NF-κB1 p50 haploinsufficiency. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Human DBR1 modulates the recycling of snRNPs to affect alternative RNA splicing and contributes to the suppression of cancer development.

PubMed

Han, B; Park, H K; Ching, T; Panneerselvam, J; Wang, H; Shen, Y; Zhang, J; Li, L; Che, R; Garmire, L; Fei, P

2017-09-21

The contribution of RNA processing to tumorigenesis is understudied. Here, we report that the human RNA debranching enzyme (hDBR1), when inappropriately regulated, induces oncogenesis by causing RNA processing defects, for example, splicing defects. We found that wild-type p53 and hypoxia-inducible factor 1 co-regulate hDBR1 expression, and insufficient hDBR1 leads to a higher rate of exon skipping. Transcriptomic sequencing confirmed the effect of hDBR1 on RNA splicing, and metabolite profiling supported the observation that neoplasm is triggered by a decrease in hDBR1 expression both in vitro and in vivo. Most importantly, when modulating the expression of hDBR1, which was found to be generally low in malignant human tissues, higher expression of hDBR1 only affected exon-skipping activity in malignant cells. Together, our findings demonstrate previously unrecognized regulation and functions of hDBR1, with immediate clinical implications regarding the regulation of hDBR1 as an effective strategy for combating human cancer.

Analysis and Prediction of Exon Skipping Events from RNA-Seq with Sequence Information Using Rotation Forest.

PubMed

Du, Xiuquan; Hu, Changlin; Yao, Yu; Sun, Shiwei; Zhang, Yanping

2017-12-12

In bioinformatics, exon skipping (ES) event prediction is an essential part of alternative splicing (AS) event analysis. Although many methods have been developed to predict ES events, a solution has yet to be found. In this study, given the limitations of machine learning algorithms with RNA-Seq data or genome sequences, a new feature, called RS (RNA-seq and sequence) features, was constructed. These features include RNA-Seq features derived from the RNA-Seq data and sequence features derived from genome sequences. We propose a novel Rotation Forest classifier to predict ES events with the RS features (RotaF-RSES). To validate the efficacy of RotaF-RSES, a dataset from two human tissues was used, and RotaF-RSES achieved an accuracy of 98.4%, a specificity of 99.2%, a sensitivity of 94.1%, and an area under the curve (AUC) of 98.6%. When compared to the other available methods, the results indicate that RotaF-RSES is efficient and can predict ES events with RS features.

Adaptive Immune Response Impairs the Efficacy of Autologous Transplantation of Engineered Stem Cells in Dystrophic Dogs

PubMed Central

Sitzia, Clementina; Farini, Andrea; Jardim, Luciana; Razini, Paola; Belicchi, Marzia; Cassinelli, Letizia; Villa, Chiara; Erratico, Silvia; Parolini, Daniele; Bella, Pamela; da Silva Bizario, Joao Carlos; Garcia, Luis; Dias-Baruffi, Marcelo; Meregalli, Mirella; Torrente, Yvan

2016-01-01

Duchenne muscular dystrophy is the most common genetic muscular dystrophy. It is caused by mutations in the dystrophin gene, leading to absence of muscular dystrophin and to progressive degeneration of skeletal muscle. We have demonstrated that the exon skipping method safely and efficiently brings to the expression of a functional dystrophin in dystrophic CD133+ cells injected scid/mdx mice. Golden Retriever muscular dystrophic (GRMD) dogs represent the best preclinical model of Duchenne muscular dystrophy, mimicking the human pathology in genotypic and phenotypic aspects. Here, we assess the capacity of intra-arterial delivered autologous engineered canine CD133+ cells of restoring dystrophin expression in Golden Retriever muscular dystrophy. This is the first demonstration of five-year follow up study, showing initial clinical amelioration followed by stabilization in mild and severe affected Golden Retriever muscular dystrophy dogs. The occurrence of T-cell response in three Golden Retriever muscular dystrophy dogs, consistent with a memory response boosted by the exon skipped-dystrophin protein, suggests an adaptive immune response against dystrophin. PMID:27506452

Eteplirsen in the treatment of Duchenne muscular dystrophy

PubMed Central

Lim, Kenji Rowel Q; Maruyama, Rika; Yokota, Toshifumi

2017-01-01

Duchenne muscular dystrophy is a fatal neuromuscular disorder affecting around one in 3,500–5,000 male births that is characterized by progressive muscular deterioration. It is inherited in an X-linked recessive fashion and is caused by loss-of-function mutations in the DMD gene coding for dystrophin, a cytoskeletal protein that stabilizes the plasma membrane of muscle fibers. In September 2016, the US Food and Drug Administration granted accelerated approval for eteplirsen (or Exondys 51), a drug that acts to promote dystrophin production by restoring the translational reading frame of DMD through specific skipping of exon 51 in defective gene variants. Eteplirsen is applicable for approximately 14% of patients with DMD mutations. This article extensively reviews and discusses the available information on eteplirsen to date, focusing on pharmacological, efficacy, safety, and tolerability data from preclinical and clinical trials. Issues faced by eteplirsen, particularly those relating to its efficacy, will be identified. Finally, the place of eteplirsen and exon skipping as a general therapeutic strategy in Duchenne muscular dystrophy treatment will be discussed. PMID:28280301

26 CFR 26.2653-1 - Taxation of multiple skips.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 26 Internal Revenue 14 2010-04-01 2010-04-01 false Taxation of multiple skips. 26.2653-1 Section 26.2653-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE...-1 Taxation of multiple skips. (a) General rule. If property is held in trust immediately after a GST...

26 CFR 26.2653-1 - Taxation of multiple skips.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 26 Internal Revenue 14 2011-04-01 2010-04-01 true Taxation of multiple skips. 26.2653-1 Section 26.2653-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND... Taxation of multiple skips. (a) General rule. If property is held in trust immediately after a GST, solely...

Alternative splicing of mutually exclusive exons--a review.

PubMed

Pohl, Martin; Bortfeldt, Ralf H; Grützmann, Konrad; Schuster, Stefan

2013-10-01

Alternative splicing (AS) of pre-mRNAs in higher eukaryotes and several viruses is one major source of protein diversity. Usually, the following major subtypes of AS are distinguished: exon skipping, intron retention, and alternative 3' and 5' splice sites. Moreover, mutually exclusive exons (MXEs) represent a rare subtype. In the splicing of MXEs, two (or more) splicing events are not independent anymore, but are executed or disabled in a coordinated manner. In this review, several bioinformatics approaches for analyzing MXEs are presented and discussed. In particular, we revisit suitable definitions and nomenclatures, and bioinformatics tools for finding MXEs, adjacent and non-adjacent MXEs, clustered and grouped MXEs. Moreover, the molecular mechanisms for splicing MXEs proposed in the literature are reviewed and discussed. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Rare Autosomal Recessive Cardiac Valvular Form of Ehlers-Danlos Syndrome Results from Mutations in the COL1A2 Gene That Activate the Nonsense-Mediated RNA Decay Pathway

PubMed Central

Schwarze, Ulrike; Hata, Ryu-Ichiro; McKusick, Victor A.; Shinkai, Hiroshi; Hoyme, H. Eugene; Pyeritz, Reed E.; Byers, Peter H.

2004-01-01

Splice site mutations in the COL1A2 gene of type I collagen can give rise to forms of Ehlers-Danlos syndrome (EDS) because of partial or complete skipping of exon 6, as well as to mild, moderate, or lethal forms of osteogenesis imperfecta as a consequence of skipping of other exons. We identified three unrelated individuals with a rare recessively inherited form of EDS (characterized by joint hypermobility, skin hyperextensibility, and cardiac valvular defects); in two of them, COL1A2 messenger RNA (mRNA) instability results from compound heterozygosity for splice site mutations in the COL1A2 gene, and, in the third, it results from homozygosity for a nonsense codon. The splice site mutations led to use of cryptic splice donor sites, creation of a downstream premature termination codon, and extremely unstable mRNA. In the wild-type allele, the two introns (IVS11 and IVS24) in which these mutations occurred were usually spliced slowly in relation to their respective immediate upstream introns. In the mutant alleles, the upstream intron was removed, so that exon skipping could not occur. In the context of the mutation in IVS24, computer-generated folding of a short stretch of mRNA surrounding the mutation site demonstrated realignment of the relationships between the donor and acceptor sites that could facilitate use of a cryptic donor site. These findings suggest that the order of intron removal is an important variable in prediction of mutation outcome at splice sites and that folding of the nascent mRNA could be one element that contributes to determination of order of splicing. The complete absence of proα2(I) chains has the surprising effect of producing cardiac valvular disease without bone involvement. PMID:15077201

Rare autosomal recessive cardiac valvular form of Ehlers-Danlos syndrome results from mutations in the COL1A2 gene that activate the nonsense-mediated RNA decay pathway.

PubMed

Schwarze, Ulrike; Hata, Ryu-Ichiro; McKusick, Victor A; Shinkai, Hiroshi; Hoyme, H Eugene; Pyeritz, Reed E; Byers, Peter H

2004-05-01

Splice site mutations in the COL1A2 gene of type I collagen can give rise to forms of Ehlers-Danlos syndrome (EDS) because of partial or complete skipping of exon 6, as well as to mild, moderate, or lethal forms of osteogenesis imperfecta as a consequence of skipping of other exons. We identified three unrelated individuals with a rare recessively inherited form of EDS (characterized by joint hypermobility, skin hyperextensibility, and cardiac valvular defects); in two of them, COL1A2 messenger RNA (mRNA) instability results from compound heterozygosity for splice site mutations in the COL1A2 gene, and, in the third, it results from homozygosity for a nonsense codon. The splice site mutations led to use of cryptic splice donor sites, creation of a downstream premature termination codon, and extremely unstable mRNA. In the wild-type allele, the two introns (IVS11 and IVS24) in which these mutations occurred were usually spliced slowly in relation to their respective immediate upstream introns. In the mutant alleles, the upstream intron was removed, so that exon skipping could not occur. In the context of the mutation in IVS24, computer-generated folding of a short stretch of mRNA surrounding the mutation site demonstrated realignment of the relationships between the donor and acceptor sites that could facilitate use of a cryptic donor site. These findings suggest that the order of intron removal is an important variable in prediction of mutation outcome at splice sites and that folding of the nascent mRNA could be one element that contributes to determination of order of splicing. The complete absence of pro alpha 2(I) chains has the surprising effect of producing cardiac valvular disease without bone involvement.

Nuclear sequestration of COL1A1 mRNA transcript associated with type I osteogenesis imperfecta (OI)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Primorac, D.; Stover, M.L.; McKinstry, M.B.

Previously we identified an OI type I patient with a splice donor mutation that resulted in intron 26 retention instead of exon skipping and sequestration of normal levels of the mutant transcript in the nuclear compartment. Intron retention was consistent with the exon definition hypothesis for splice site selection since the size of the exon-intron-exon unit was less than 300 bp. Furthermore, the retained intron contained in-frame stop codons which is thought to cause the mutant RNA to remain within the nucleus rather than appearing in the cytoplasm. To test these hypotheses, genomic fragments containing the normal sequence or themore » donor mutation were cloned into a collagen minigene and expressed in stably tansfected NIH 3T3 cells. None of the modifications to the normal intron altered the level of RNA that accumulated in the cytoplasm, as expected. However none of the modifications to the mutant intron allowed accumulation of normal levels of mRNA in the cytoplasm. Moreover, in contrast to our findings in the patient`s cells only low levels of mutant transcript were found in the nucleus; a fraction of the transcript did appear in the cytoplasm which had spliced the mutant donor site correctly. Nuclear run-on experiments demonstrated equal levels of transcription from each transgene. Expression of another donor mutation known to cause in-frame exon skipping in OI type IV was accurately reproduced in the minigene in transfected 3T3 cells. Our experience suggests that either mechanism can lead to formation of a null allele possibly related to the type of splicing events surrounding the potential stop codons. Understanding the rules governing inactivation of a collagen RNA transcript may be important in designing a strategy to inactivate a dominate negative mutation associated with the more severe forms of OI.« less

Alternative splicing regulated by butyrate in bovine epithelial cells.

PubMed

Wu, Sitao; Li, Congjun; Huang, Wen; Li, Weizhong; Li, Robert W

2012-01-01

As a signaling molecule and an inhibitor of histone deacetylases (HDACs), butyrate exerts its impact on a broad range of biological processes, such as apoptosis and cell proliferation, in addition to its critical role in energy metabolism in ruminants. This study examined the effect of butyrate on alternative splicing in bovine epithelial cells using RNA-seq technology. Junction reads account for 11.28 and 12.32% of total mapped reads between the butyrate-treated (BT) and control (CT) groups. 201,326 potential splicing junctions detected were supported by ≥ 3 junction reads. Approximately 94% of these junctions conformed to the consensus sequence (GT/AG) while ~3% were GC/AG junctions. No AT/AC junctions were observed. A total of 2,834 exon skipping events, supported by a minimum of 3 junction reads, were detected. At least 7 genes, their mRNA expression significantly affected by butyrate, also had exon skipping events differentially regulated by butyrate. Furthermore, COL5A3, which was induced 310-fold by butyrate (FDR <0.001) at the gene level, had a significantly higher number of junction reads mapped to Exon#8 (Donor) and Exon#11 (Acceptor) in BT. This event had the potential to result in the formation of a COL5A3 mRNA isoform with 2 of the 69 exons missing. In addition, 216 differentially expressed transcript isoforms regulated by butyrate were detected. For example, Isoform 1 of ORC1 was strongly repressed by butyrate while Isoform 2 remained unchanged. Butyrate physically binds to and inhibits all zinc-dependent HDACs except HDAC6 and HDAC10. Our results provided evidence that butyrate also regulated deacetylase activities of classical HDACs via its transcriptional control. Moreover, thirteen gene fusion events differentially affected by butyrate were identified. Our results provided a snapshot into complex transcriptome dynamics regulated by butyrate, which will facilitate our understanding of the biological effects of butyrate and other HDAC inhibitors.

ANXA11 mutations prevail in Chinese ALS patients with and without cognitive dementia.

PubMed

Zhang, Kang; Liu, Qing; Liu, Keqiang; Shen, Dongchao; Tai, Hongfei; Shu, Shi; Ding, Qingyun; Fu, Hanhui; Liu, Shuangwu; Wang, Zhili; Li, Xiaoguang; Liu, Mingsheng; Zhang, Xue; Cui, Liying

2018-06-01

To investigate the genetic contribution of ANXA11 , a gene associated with amyotrophic lateral sclerosis (ALS), in Chinese ALS patients with and without cognitive dementia. Sequencing all the coding exons of ANXA11 and intron-exon boundaries in 18 familial amyotrophic lateral sclerosis (FALS), 353 unrelated sporadic amyotrophic lateral sclerosis (SALS), and 12 Chinese patients with ALS-frontotemporal lobar dementia (ALS-FTD). The transcripts in peripheral blood generated from a splicing mutation were examined by reverse transcriptase PCR. We identified 6 nonsynonymous heterozygous mutations (5 novel and 1 recurrent), 1 splice site mutation, and 1 deletion of 10 amino acids (not accounted in the mutant frequency) in 11 unrelated patients, accounting for a mutant frequency of 5.6% (1/18) in FALS, 2.3% (8/353) in SALS, and 8.3% (1/12) in ALS-FTD. The deletion of 10 amino acids was detected in 1 clinically undetermined male with an ALS family history who had atrophy in hand muscles and myotonic discharges revealed by EMG. The novel p. P36R mutation was identified in 1 FALS index, 1 patient with SALS, and 1 ALS-FTD. The splicing mutation (c.174-2A>G) caused in-frame skipping of the entire exon 6. The rest missense mutations including p.D40G, p.V128M, p.S229R, p.R302C and p.G491R were found in 6 unrelated patients with SALS. The ANXA11 gene is one of the most frequently mutated genes in Chinese patients with SALS. A canonical splice site mutation leading to skipping of the entire exon 6 further supports the loss-of-function mechanism. In addition, the study findings further expand the ANXA11 phenotype, first highlighting its pathogenic role in ALS-FTD.

Unusual Intron Conservation near Tissue-Regulated Exons Found by Splicing Microarrays

PubMed Central

Sugnet, Charles W; Srinivasan, Karpagam; Clark, Tyson A; O'Brien, Georgeann; Cline, Melissa S; Wang, Hui; Williams, Alan; Kulp, David; Blume, John E; Haussler, David; Ares, Manuel

2006-01-01

Alternative splicing contributes to both gene regulation and protein diversity. To discover broad relationships between regulation of alternative splicing and sequence conservation, we applied a systems approach, using oligonucleotide microarrays designed to capture splicing information across the mouse genome. In a set of 22 adult tissues, we observe differential expression of RNA containing at least two alternative splice junctions for about 40% of the 6,216 alternative events we could detect. Statistical comparisons identify 171 cassette exons whose inclusion or skipping is different in brain relative to other tissues and another 28 exons whose splicing is different in muscle. A subset of these exons is associated with unusual blocks of intron sequence whose conservation in vertebrates rivals that of protein-coding exons. By focusing on sets of exons with similar regulatory patterns, we have identified new sequence motifs implicated in brain and muscle splicing regulation. Of note is a motif that is strikingly similar to the branchpoint consensus but is located downstream of the 5′ splice site of exons included in muscle. Analysis of three paralogous membrane-associated guanylate kinase genes reveals that each contains a paralogous tissue-regulated exon with a similar tissue inclusion pattern. While the intron sequences flanking these exons remain highly conserved among mammalian orthologs, the paralogous flanking intron sequences have diverged considerably, suggesting unusually complex evolution of the regulation of alternative splicing in multigene families. PMID:16424921

Exon definition as a potential negative force against intron losses in evolution.

PubMed

Niu, Deng-Ke

2008-11-13

Previous studies have indicated that the wide variation in intron density (the number of introns per gene) among different eukaryotes largely reflects varying degrees of intron loss during evolution. The most popular model, which suggests that organisms lose introns through a mechanism in which reverse-transcribed cDNA recombines with the genomic DNA, concerns only one mutational force. Using exons as the units of splicing-site recognition, exon definition constrains the length of exons. An intron-loss event results in fusion of flanking exons and thus a larger exon. The large size of the newborn exon may cause splicing errors, i.e., exon skipping, if the splicing of pre-mRNAs is initiated by exon definition. By contrast, if the splicing of pre-mRNAs is initiated by intron definition, intron loss does not matter. Exon definition may thus be a selective force against intron loss. An organism with a high frequency of exon definition is expected to experience a low rate of intron loss throughout evolution and have a high density of spliceosomal introns. The majority of spliceosomal introns in vertebrates may be maintained during evolution not because of potential functions, but because of their splicing mechanism (i.e., exon definition). Further research is required to determine whether exon definition is a negative force in maintaining the high intron density of vertebrates. This article was reviewed by Dr. Scott W. Roy (nominated by Dr. John Logsdon), Dr.Eugene V. Koonin, and Dr. Igor B. Rogozin (nominated by Dr. Mikhail Gelfand). For the full reviews,please go to the Reviewers' comments section.

Translation from a DMD exon 5 IRES results in a functional dystrophin isoform that attenuates dystrophinopathy in humans and mice.

PubMed

Wein, Nicolas; Vulin, Adeline; Falzarano, Maria S; Szigyarto, Christina Al-Khalili; Maiti, Baijayanta; Findlay, Andrew; Heller, Kristin N; Uhlén, Mathias; Bakthavachalu, Baskar; Messina, Sonia; Vita, Giuseppe; Passarelli, Chiara; Brioschi, Simona; Bovolenta, Matteo; Neri, Marcella; Gualandi, Francesca; Wilton, Steve D; Rodino-Klapac, Louise R; Yang, Lin; Dunn, Diane M; Schoenberg, Daniel R; Weiss, Robert B; Howard, Michael T; Ferlini, Alessandra; Flanigan, Kevin M

2014-09-01

Most mutations that truncate the reading frame of the DMD gene cause loss of dystrophin expression and lead to Duchenne muscular dystrophy. However, amelioration of disease severity has been shown to result from alternative translation initiation beginning in DMD exon 6 that leads to expression of a highly functional N-truncated dystrophin. Here we demonstrate that this isoform results from usage of an internal ribosome entry site (IRES) within exon 5 that is glucocorticoid inducible. We confirmed IRES activity by both peptide sequencing and ribosome profiling in muscle from individuals with minimal symptoms despite the presence of truncating mutations. We generated a truncated reading frame upstream of the IRES by exon skipping, which led to synthesis of a functional N-truncated isoform in both human subject-derived cell lines and in a new DMD mouse model, where expression of the truncated isoform protected muscle from contraction-induced injury and corrected muscle force to the same level as that observed in control mice. These results support a potential therapeutic approach for patients with mutations within the 5' exons of DMD.

Brooke-Spiegler syndrome presenting multiple concurrent cutaneous and parotid gland neoplasms: cytologic findings on fine-needle sample and description of a novel mutation of the CYLD gene.

PubMed

Malzone, Maria Gabriella; Campanile, Anna Cipolletta; Losito, Nunzia Simona; Longo, Francesco; Perri, Francesco; Caponigro, Francesco; Schiavone, Concetta; Ionna, Franco; Maiello, Francesco; Martinuzzi, Claudia; Nasti, Sabina; Botti, Gerardo; Fulciniti, Franco

2015-08-01

Multiple dermal cylindromas and membranous basal cell adenoma of parotid gland in a 67-year-old woman with Brooke-Spiegler syndrome (BSS) were examined by fine-needle cytology. Histology, immunochemistry, and CYLD germline mutation testing were also performed. Cytomorphology and immunochemistry of the two lesions showed basaloid neoplasms, remarkably similar, composed by proliferating epithelial cells of basal type accompanied by a smaller proportion of myoepithelial cells. CYLD gene showed a novel germline splice acceptor site mutation (c.2042-1G>C) with skipping of the entire exon 15. The occurrence of analogous tumors, dermal cylindromas, and membranous basal cell adenoma of the parotid gland, in the same patient may result from the action of a single gene on ontogenetically similar stem cells. Therefore, patients with BSS should be offered a genetic counselling for an early and correct diagnosis. © 2015 Wiley Periodicals, Inc.

ABCA4 midigenes reveal the full splice spectrum of all reported noncanonical splice site variants in Stargardt disease.

PubMed

Sangermano, Riccardo; Khan, Mubeen; Cornelis, Stéphanie S; Richelle, Valerie; Albert, Silvia; Garanto, Alejandro; Elmelik, Duaa; Qamar, Raheel; Lugtenberg, Dorien; van den Born, L Ingeborgh; Collin, Rob W J; Cremers, Frans P M

2018-01-01

Stargardt disease is caused by variants in the ABCA4 gene, a significant part of which are noncanonical splice site (NCSS) variants. In case a gene of interest is not expressed in available somatic cells, small genomic fragments carrying potential disease-associated variants are tested for splice abnormalities using in vitro splice assays. We recently discovered that when using small minigenes lacking the proper genomic context, in vitro results do not correlate with splice defects observed in patient cells. We therefore devised a novel strategy in which a bacterial artificial chromosome was employed to generate midigenes, splice vectors of varying lengths (up to 11.7 kb) covering almost the entire ABCA4 gene. These midigenes were used to analyze the effect of all 44 reported and three novel NCSS variants on ABCA4 pre-mRNA splicing. Intriguingly, multi-exon skipping events were observed, as well as exon elongation and intron retention. The analysis of all reported NCSS variants in ABCA4 allowed us to reveal the nature of aberrant splicing events and to classify the severity of these mutations based on the residual fraction of wild-type mRNA. Our strategy to generate large overlapping splice vectors carrying multiple exons, creating a toolbox for robust and high-throughput analysis of splice variants, can be applied to all human genes. © 2018 Sangermano et al.; Published by Cold Spring Harbor Laboratory Press.

Bottom-up design of small molecules that stimulate exon 10 skipping in mutant MAPT pre-mRNA.

PubMed

Luo, Yiling; Disney, Matthew D

2014-09-22

One challenge in chemical biology is to develop small molecules that control cellular protein content. The amount and identity of proteins are influenced by the RNAs that encode them; thus, protein content in a cell could be affected by targeting mRNA. However, RNA has been traditionally difficult to target with small molecules. In this report, we describe controlling the protein products of the mutated microtubule-associated protein tau (MAPT) mature mRNA with a small molecule. MAPT mutations in exon 10 are associated with inherited frontotemporal dementia and Parkinsonism linked to chromosome 17 (FTDP-17), an incurable disease that is directly caused by increased inclusion of exon 10 in MAPT mRNA. Recent studies have shown that mutations within a hairpin at the MAPT exon 10-intron junction decrease the thermodynamic stability of the RNA, increasing binding to U1 snRNP and thus exon 10 inclusion. Therefore, we designed small molecules that bind and stabilize a mutant MAPT by using Inforna, a computational approach based on information about RNA-small-molecule interactions. The optimal compound selectively bound the mutant MAPT hairpin and thermodynamically stabilized its folding, facilitating exon 10 exclusion. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Exon Specific U1 snRNAs improve ELP1 exon 20 definition and rescue ELP1 protein expression in a Familial Dysautonomia mouse model.

PubMed

Donadon, Irving; Pinotti, Mirko; Rajkowska, Katarzyna; Pianigiani, Giulia; Barbon, Elena; Morini, Elisabetta; Motaln, Helena; Rogelj, Boris; Mingozzi, Federico; Slaugenhaupt, Susan A; Pagani, Franco

2018-04-25

Familial dysautonomia (FD) is a rare genetic disease with no treatment, caused by an intronic point mutation (c.2204 + 6T>C) that negatively affects the definition of exon 20 in the Elongator complex protein 1 gene (ELP1 also known as IKBKAP). This substitution modifies the 5' splice site and, in combination with regulatory splicing factors, induces different levels of exon 20 skipping, in various tissues. Here, we evaluated the therapeutic potential of a novel class of U1 snRNA molecules, Exon-Specific U1s (ExSpeU1s), in correcting ELP1 exon 20 recognition. Lentivirus-mediated expression of ELP1-ExSpeU1 in FD fibroblasts improved ELP1 splicing and protein levels. We next focused on a transgenic mouse model that recapitulates the same tissue-specific mis-splicing seen in FD patients. Intraperitoneal delivery of ELP1-ExSpeU1s-adeno-associated virus particles successfully increased the production of full-length human ELP1 transcript and protein. This splice-switching class of molecules is the first to specifically correct the ELP1 exon 20 splicing defect. Our data provide proof of principle of ExSpeU1s-adeno-associated virus particles as a novel therapeutic strategy for FD.

Two splice variants of the bovine lactoferrin gene identified in Staphylococcus aureus isolated from mastitis in dairy cattle.

PubMed

Huang, J M; Wang, Z Y; Ju, Z H; Wang, C F; Li, Q L; Sun, T; Hou, Q L; Hang, S Q; Hou, M H; Zhong, J F

2011-12-21

Bovine lactoferrin (bLF) is a member of the transferrin family; it plays an important role in the innate immune response. We identified novel splice variants of the bLF gene in mastitis-infected and healthy cows. Reverse transcription-polymerase chain reaction (RT-PCR) and clone sequencing analysis were used to screen the splice variants of the bLF gene in the mammary gland, spleen and liver tissues. One main transcript corresponding to the bLF reference sequence was found in three tissues in both healthy and mastitis-infected cows. Quantitative real-time PCR analysis showed that the expression levels of the LF gene's main transcript were not significantly different in tissues from healthy versus mastitis-infected cows. However, the new splice variant, LF-AS2, which has the exon-skipping alternative splicing pattern, was only identified in mammary glands infected with Staphylococcus aureus. Sequencing analysis showed that the new splice variant was 251 bp in length, including exon 1, part of exon 2, part of exon 16, and exon 17. We conclude that bLF may play a role in resistance to mastitis through alternative splicing mechanisms.

Morpholino oligomer-mediated exon skipping averts the onset of dystrophic pathology in the mdx mouse.

PubMed

Fletcher, Sue; Honeyman, Kaite; Fall, Abbie M; Harding, Penny L; Johnsen, Russell D; Steinhaus, Joshua P; Moulton, Hong M; Iversen, Patrick L; Wilton, Stephen D

2007-09-01

Duchenne and Becker muscular dystrophies are allelic disorders arising from mutations in the dystrophin gene. Duchenne muscular dystrophy is characterized by an absence of functional protein, whereas Becker muscular dystrophy, commonly caused by in-frame deletions, shows synthesis of partially functional protein. Anti-sense oligonucleotides can induce specific exon removal during processing of the dystrophin primary transcript, while maintaining or restoring the reading frame, and thereby overcome protein-truncating mutations. The mdx mouse has a non-sense mutation in exon 23 of the dystrophin gene that precludes functional dystrophin production, and this model has been used in the development of treatment strategies for dystrophinopathies. A phosphorodiamidate morpholino oligomer (PMO) has previously been shown to exclude exon 23 from the dystrophin gene transcript and induce dystrophin expression in the mdxmouse, in vivo and in vitro. In this report, a cell-penetrating peptide (CPP)-conjugated oligomer targeted to the mouse dystrophin exon 23 donor splice site was administered to mdxmice by intraperitoneal injection. We demonstrate dystrophin expression and near-normal muscle architecture in all muscles examined, except for cardiac muscle. The CPP greatly enhanced uptake of the PMO, resulting in widespread dystrophin expression.

MET exon 14 skipping mutation in triple-negative pulmonary adenocarcinomas and pleomorphic carcinomas: An analysis of intratumoral MET status heterogeneity and clinicopathological characteristics.

PubMed

Kwon, Dohee; Koh, Jaemoon; Kim, Sehui; Go, Heounjeong; Kim, Young A; Keam, Bhumsuk; Kim, Tae Min; Kim, Dong-Wan; Jeon, Yoon Kyung; Chung, Doo Hyun

2017-04-01

MET mutations leading to exon 14 skipping rarely occur in non-small cell lung cancer (NSCLC). Recently, small molecule inhibitors targeting MET mutations showed clinical benefit. However, the clinicopathological characteristics of NSCLC harboring MET mutations, and the correlation among mutations, protein expression, and gene copy number of MET in NSCLC remain unclear. Therefore, we address these issues. MET exon 14 skipping mutations were evaluated using real-time quantitative reverse-transcription-PCR (qRT-PCR) in 102 triple-negative (i.e., EGFR mutation (-)/ALK translocation (-)/KRAS mutation (-)) pulmonary adenocarcinomas, and 45 pleomorphic carcinomas. MET mutation and gene copy were also examined in microdissected tissues obtained from tumor areas with heterogeneous MET immunohistochemical expression. MET mutations were detected in 8.8% (9/102) of triple-negative adenocarcinomas and 20% (9/45) of pleomorphic carcinomas of the lung. Patients with MET-mutated adenocarcinomas was significantly older than those without MET mutations (P=0.015). The male to female and ever-to never-smoker ratios were 3:6 and 2:7, respectively, among patients with MET-mutated adenocarcinomas. All (9/9) of the MET-mutated adenocarcinomas showed acinar predominant histology with associated lepidic patterns. In contrast, the male to female and ever- to never-smoker ratios were 8:1 and 7:1, respectively, among patients with MET-mutated pleomorphic carcinomas. The carcinoma component of MET-mutated pleomorphic carcinomas was mostly adenocarcinoma of acinar pattern (8/9). MET mutation was detected by qRT-PCR in all samples with heterogeneous MET expression microdissected from five cases with MET-mutated adenocarcinoma, while MET gene amplification was detected in tumor areas expressing high MET protein levels among MET-mutated adenocarcinomas. MET-mutated NSCLC is characterized by older age in patients with adenocarcinoma and by an acinar histology and variable MET expression in patients with adenocarcinoma and pleomorphic carcinomas. Moreover, MET gene amplification might occur in the tumor cells harboring the MET mutation. Copyright © 2017 Elsevier B.V. All rights reserved.

Skipping of Exons by Premature Termination of Transcription and Alternative Splicing within Intron-5 of the Sheep SCF Gene: A Novel Splice Variant

PubMed Central

Saravanaperumal, Siva Arumugam; Pediconi, Dario; Renieri, Carlo; La Terza, Antonietta

2012-01-01

Stem cell factor (SCF) is a growth factor, essential for haemopoiesis, mast cell development and melanogenesis. In the hematopoietic microenvironment (HM), SCF is produced either as a membrane-bound (−) or soluble (+) forms. Skin expression of SCF stimulates melanocyte migration, proliferation, differentiation, and survival. We report for the first time, a novel mRNA splice variant of SCF from the skin of white merino sheep via cloning and sequencing. Reverse transcriptase (RT)-PCR and molecular prediction revealed two different cDNA products of SCF. Full-length cDNA libraries were enriched by the method of rapid amplification of cDNA ends (RACE-PCR). Nucleotide sequencing and molecular prediction revealed that the primary 1519 base pair (bp) cDNA encodes a precursor protein of 274 amino acids (aa), commonly known as ‘soluble’ isoform. In contrast, the shorter (835 and/or 725 bp) cDNA was found to be a ‘novel’ mRNA splice variant. It contains an open reading frame (ORF) corresponding to a truncated protein of 181 aa (vs 245 aa) with an unique C-terminus lacking the primary proteolytic segment (28 aa) right after the D175G site which is necessary to produce ‘soluble’ form of SCF. This alternative splice (AS) variant was explained by the complete nucleotide sequencing of splice junction covering exon 5-intron (5)-exon 6 (948 bp) with a premature termination codon (PTC) whereby exons 6 to 9/10 are skipped (Cassette Exon, CE 6–9/10). We also demonstrated that the Northern blot analysis at transcript level is mediated via an intron-5 splicing event. Our data refine the structure of SCF gene; clarify the presence (+) and/or absence (−) of primary proteolytic-cleavage site specific SCF splice variants. This work provides a basis for understanding the functional role and regulation of SCF in hair follicle melanogenesis in sheep beyond what was known in mice, humans and other mammals. PMID:22719917

X-linked Alport syndrome caused by splicing mutations in COL4A5.

PubMed

Nozu, Kandai; Vorechovsky, Igor; Kaito, Hiroshi; Fu, Xue Jun; Nakanishi, Koichi; Hashimura, Yuya; Hashimoto, Fusako; Kamei, Koichi; Ito, Shuichi; Kaku, Yoshitsugu; Imasawa, Toshiyuki; Ushijima, Katsumi; Shimizu, Junya; Makita, Yoshio; Konomoto, Takao; Yoshikawa, Norishige; Iijima, Kazumoto

2014-11-07

X-linked Alport syndrome is caused by mutations in the COL4A5 gene. Although many COL4A5 mutations have been detected, the mutation detection rate has been unsatisfactory. Some men with X-linked Alport syndrome show a relatively mild phenotype, but molecular basis investigations have rarely been conducted to clarify the underlying mechanism. In total, 152 patients with X-linked Alport syndrome who were suspected of having Alport syndrome through clinical and pathologic investigations and referred to the hospital for mutational analysis between January of 2006 and January of 2013 were genetically diagnosed. Among those patients, 22 patients had suspected splice site mutations. Transcripts are routinely examined when suspected splice site mutations for abnormal transcripts are detected; 11 of them showed expected exon skipping, but others showed aberrant splicing patterns. The mutation detection strategy had two steps: (1) genomic DNA analysis using PCR and direct sequencing and (2) mRNA analysis using RT-PCR to detect RNA processing abnormalities. Six splicing consensus site mutations resulting in aberrant splicing patterns, one exonic mutation leading to exon skipping, and four deep intronic mutations producing cryptic splice site activation were identified. Interestingly, one case produced a cryptic splice site with a single nucleotide substitution in the deep intron that led to intronic exonization containing a stop codon; however, the patient showed a clearly milder phenotype for X-linked Alport syndrome in men with a truncating mutation. mRNA extracted from the kidney showed both normal and abnormal transcripts, with the normal transcript resulting in the milder phenotype. This novel mechanism leads to mild clinical characteristics. This report highlights the importance of analyzing transcripts to enhance the mutation detection rate and provides insight into genotype-phenotype correlations. This approach can clarify the cause of atypically mild phenotypes in X-linked Alport syndrome. Copyright © 2014 by the American Society of Nephrology.

Therapy for Duchenne muscular dystrophy: renewed optimism from genetic approaches.

PubMed

Fairclough, Rebecca J; Wood, Matthew J; Davies, Kay E

2013-06-01

Duchenne muscular dystrophy (DMD) is a devastating progressive disease for which there is currently no effective treatment except palliative therapy. There are several promising genetic approaches, including viral delivery of the missing dystrophin gene, read-through of translation stop codons, exon skipping to restore the reading frame and increased expression of the compensatory utrophin gene. The lessons learned from these approaches will be applicable to many other disorders.

Regulation of Alternative Splicing in Vivo by Overexpression of Antagonistic Splicing Factors

NASA Astrophysics Data System (ADS)

Caceres, Javier F.; Stamm, Stefan; Helfman, David M.; Krainer, Adrian R.

1994-09-01

The opposing effects of SF2/ASF and heterogeneous nuclear ribonucleoprotein (hnRNP) A1 influence alternative splicing in vitro. SF2/ASF or hnRNP A1 complementary DNAs were transiently overexpressed in HeLa cells, and the effect on alternative splicing of several cotransfected reporter genes was measured. Increased expression of SF2/ASF activated proximal 5' splice sites, promoted inclusion of a neuron-specific exon, and prevented abnormal exon skipping. Increased expression of hnRNP A1 activated distal 5' splice sites. Therefore, variations in the intracellular levels of antagonistic splicing factors influence different modes of alternative splicing in vivo and may be a natural mechanism for tissue-specific or developmental regulation of gene expression.

Information theory-based analysis of CYP2C19, CYP2D6 and CYP3A5 splicing mutations.

PubMed

Rogan, Peter K; Svojanovsky, Stan; Leeder, J Steven

2003-04-01

Several mutations are known or suspected to affect mRNA splicing of CYP2C19, CYP2D6 and CYP3A5 genes; however, little experimental evidence exists to support these conclusions. The present study applies mathematical models that measure changes in information content of splice sites in these genes to demonstrate the relationship between the predicted phenotypes of these variants to the corresponding genotypes. Based on information analysis, the CYP2C19*2 variant activates a new cryptic site 40 nucleotides downstream of the natural splice site. CYP2C19*7 abolishes splicing at the exon 5 donor site. The CYP2D6*4 allele similarly inactivates splicing at the acceptor site of exon 4 and activates a new cryptic site one nucleotide downstream of the natural acceptor. CYP2D6*11 inactivates the acceptor site of exon 2. The CYP3A5*3 allele activates a new cryptic site 236 nucleotides upstream of the exon 4 natural acceptor site. CYP3A5*5 inactivates the exon 5 donor site and CYP3A5*6 strengthens a site upstream of the natural donor site, resulting in skipping of exon 7. Other previously described missense and nonsense mutations at terminal codons of exons in these genes affected splicing. CYP2D6*8 and CYP2D6*14 both decrease the strength of the exon 3 donor site, producing transcripts lacking this exon. The results of information analysis are consistent with the poor metabolizer phenotypes observed in patients with these mutations, and illustrate the potential value of these mathematical models to quantitatively evaluate the functional consequences of new mutations suspected of altering mRNA splicing.

Highly efficient in vivo delivery of PMO into regenerating myotubes and rescue in laminin-α2 chain-null congenital muscular dystrophy mice.

PubMed

Aoki, Yoshitsugu; Nagata, Tetsuya; Yokota, Toshifumi; Nakamura, Akinori; Wood, Matthew J A; Partridge, Terence; Takeda, Shin'ichi

2013-12-15

Phosphorodiamidate morpholino oligomer (PMO)-mediated exon skipping is among the more promising approaches to the treatment of several neuromuscular disorders including Duchenne muscular dystrophy. The main weakness of this approach arises from the low efficiency and sporadic nature of the delivery of charge-neutral PMO into muscle fibers, the mechanism of which is unknown. In this study, to test our hypothesis that muscle fibers take up PMO more efficiently during myotube formation, we induced synchronous muscle regeneration by injection of cardiotoxin into the tibialis anterior muscle of Dmd exon 52-deficient mdx52 and wild-type mice. Interestingly, by in situ hybridization, we detected PMO mainly in embryonic myosin heavy chain-positive regenerating fibers. In addition, we showed that PMO or 2'-O-methyl phosphorothioate is taken up efficiently into C2C12 myotubes when transfected 24-72 h after the induction of differentiation but is poorly taken up into undifferentiated C2C12 myoblasts suggesting efficient uptake of PMO in the early stages of C2C12 myotube formation. Next, we tested the therapeutic potential of PMO for laminin-α2 chain-null dy(3K)/dy(3K) mice: a model of merosin-deficient congenital muscular dystrophy (MDC1A) with active muscle regeneration. We confirmed the recovery of laminin-α2 chain and slightly prolonged life span following skipping of the mutated exon 4 in dy(3K)/dy(3K) mice. These findings support the idea that PMO entry into fibers is dependent on a developmental stage in myogenesis rather than on dystrophinless muscle membranes and provide a platform for developing PMO-mediated therapies for a variety of muscular disorders, such as MDC1A, that involve active muscle regeneration.

Water walking - an evolution of water surface skipping

NASA Astrophysics Data System (ADS)

Hurd, Randy; Belden, Jesse; Jandron, Michael; Bower, Allan; Holekamp, Sean; Truscott, Tadd

2017-11-01

Previous work has shown that elastomeric spheres skip more easily than disk-shaped stones. This is due to increased lift stemming from sphere deformation, which provides an increased cross-sectional area and favorable attack angle upon impact. We extend lift models developed for individual impacts to long-range multiple impact events and compare the estimates to experimental results, which show good agreement. Additionally, a surprising new mode of skipping is observed that resembles water-walking, wherein a quickly rotating sphere produces small successive impacts allowing it to move parallel to the water surface. The dynamics of this new multiple skip behavior are rationalized analytically and tested experimentally.

Rare splicing defects of FAS underly severe recessive autoimmune lymphoproliferative syndrome.

PubMed

Agrebi, N; Ben-Mustapha, I; Matoussi, N; Dhouib, N; Ben-Ali, M; Mekki, N; Ben-Ahmed, M; Larguèche, B; Ben Becher, S; Béjaoui, M; Barbouche, M R

2017-10-01

Autoimmune lymphoproliferative syndrome (ALPS) is a prototypic disorder of impaired apoptosis characterized by autoimmune features and lymphoproliferation. Heterozygous germline or somatic FAS mutations associated with preserved protein expression have been described. Very rare cases of homozygous germline FAS mutations causing severe autosomal recessive form of ALPS with a complete defect of Fas expression have been reported. We report two unrelated patients from highly inbred North African population showing a severe ALPS phenotype and an undetectable Fas surface expression. Two novel homozygous mutations have been identified underlying rare splicing defects mechanisms. The first mutation breaks a branch point sequence and the second alters a regulatory exonic splicing site. These splicing defects induce the skipping of exon 6 encoding the transmembrane domain of CD95. Our findings highlight the requirement of tight regulation of FAS exon 6 splicing for balanced alternative splicing and illustrate the importance of such studies in highly consanguineous populations. Copyright © 2017 Elsevier Inc. All rights reserved.

The Status of Exon Skipping as a Therapeutic Approach to Duchenne Muscular Dystrophy

PubMed Central

Lu, Qi-Long; Yokota, Toshifumi; Takeda, Shin'ichi; Garcia, Luis; Muntoni, Francesco; Partridge, Terence

2011-01-01

Duchenne muscular dystrophy (DMD) is associated with mutations in the dystrophin gene that disrupt the open reading frame whereas the milder Becker's form is associated with mutations which leave an in-frame mRNA transcript that can be translated into a protein that includes the N- and C- terminal functional domains. It has been shown that by excluding specific exons at, or adjacent to, frame-shifting mutations, open reading frame can be restored to an out-of-frame mRNA, leading to the production of a partially functional Becker-like dystrophin protein. Such targeted exclusion can be achieved by administration of oligonucleotides that are complementary to sequences that are crucial to normal splicing of the exon into the transcript. This principle has been validated in mouse and canine models of DMD with a number of variants of oligonucleotide analogue chemistries and by transduction with adeno-associated virus (AAV)-small nuclear RNA (snRNA) reagents encoding the antisense sequence. Two different oligonucleotide agents are now being investigated in human trials for splicing out of exon 51 with some early indications of success at the biochemical level. PMID:20978473

A mechanism underlying position-specific regulation of alternative splicing

PubMed Central

Hamid, Fursham M.

2017-01-01

Abstract Many RNA-binding proteins including a master regulator of splicing in developing brain and muscle, polypyrimidine tract-binding protein 1 (PTBP1), can either activate or repress alternative exons depending on the pre-mRNA recruitment position. When bound upstream or within regulated exons PTBP1 tends to promote their skipping, whereas binding to downstream sites often stimulates inclusion. How this switch is orchestrated at the molecular level is poorly understood. Using bioinformatics and biochemical approaches we show that interaction of PTBP1 with downstream intronic sequences can activate natural cassette exons by promoting productive docking of the spliceosomal U1 snRNP to a suboptimal 5′ splice site. Strikingly, introducing upstream PTBP1 sites to this circuitry leads to a potent splicing repression accompanied by the assembly of an exonic ribonucleoprotein complex with a tightly bound U1 but not U2 snRNP. Our data suggest a molecular mechanism underlying the transition between a better-known repressive function of PTBP1 and its role as a bona fide splicing activator. More generally, we argue that the functional outcome of individual RNA contacts made by an RNA-binding protein is subject to extensive context-specific modulation.

Exon skipping and dystrophin restoration in patients with Duchenne muscular dystrophy after systemic phosphorodiamidate morpholino oligomer treatment: an open-label, phase 2, dose-escalation study

PubMed Central

Cirak, Sebahattin; Arechavala-Gomeza, Virginia; Guglieri, Michela; Feng, Lucy; Torelli, Silvia; Anthony, Karen; Abbs, Stephen; Garralda, Maria Elena; Bourke, John; Wells, Dominic J; Dickson, George; Wood, Matthew JA; Wilton, Steve D; Straub, Volker; Kole, Ryszard; Shrewsbury, Stephen B; Sewry, Caroline; Morgan, Jennifer E; Bushby, Kate; Muntoni, Francesco

2011-01-01

Summary Background We report clinical safety and biochemical efficacy from a dose-ranging study of intravenously administered AVI-4658 phosphorodiamidate morpholino oligomer (PMO) in patients with Duchenne muscular dystrophy. Method We undertook an open-label, phase 2, dose-escalation study (0·5, 1·0, 2·0, 4·0, 10·0, and 20·0 mg/kg bodyweight) in ambulant patients with Duchenne muscular dystrophy aged 5–15 years with amenable deletions in DMD. Participants had a muscle biopsy before starting treatment and after 12 weekly intravenous infusions of AVI-4658. The primary study objective was to assess safety and tolerability of AVI-4658. The secondary objectives were pharmacokinetic properties and the ability of AVI-4658 to induce exon 51 skipping and dystrophin restoration by RT-PCR, immunohistochemistry, and immunoblotting. The study is registered, number NCT00844597. Findings 19 patients took part in the study. AVI-4658 was well tolerated with no drug-related serious adverse events. AVI-4658 induced exon 51 skipping in all cohorts and new dystrophin protein expression in a significant dose-dependent (p=0·0203), but variable, manner in boys from cohort 3 (dose 2 mg/kg) onwards. Seven patients responded to treatment, in whom mean dystrophin fluorescence intensity increased from 8·9% (95% CI 7·1–10·6) to 16·4% (10·8–22·0) of normal control after treatment (p=0·0287). The three patients with the greatest responses to treatment had 21%, 15%, and 55% dystrophin-positive fibres after treatment and these findings were confirmed with western blot, which showed an increase after treatment of protein levels from 2% to 18%, from 0·9% to 17%, and from 0% to 7·7% of normal muscle, respectively. The dystrophin-associated proteins α-sarcoglycan and neuronal nitric oxide synthase were also restored at the sarcolemma. Analysis of the inflammatory infiltrate indicated a reduction of cytotoxic T cells in the post-treatment muscle biopsies in the two high-dose cohorts. Interpretation The safety and biochemical efficacy that we present show the potential of AVI-4658 to become a disease-modifying drug for Duchenne muscular dystrophy. Funding UK Medical Research Council; AVI BioPharma. PMID:21784508

Novel compound heterozygous Thyroglobulin mutations c.745+1G>A/c.7036+2T>A associated with congenital goiter and hypothyroidism in a Vietnamese family. Identification of a new cryptic 5' splice site in the exon 6.

PubMed

Citterio, Cintia E; Morales, Cecilia M; Bouhours-Nouet, Natacha; Machiavelli, Gloria A; Bueno, Elena; Gatelais, Frédérique; Coutant, Regis; González-Sarmiento, Rogelio; Rivolta, Carina M; Targovnik, Héctor M

2015-03-15

Several patients were identified with dyshormonogenesis caused by mutations in the thyroglobulin (TG) gene. These defects are inherited in an autosomal recessive manner and affected individuals are either homozygous or compound heterozygous for the mutations. The aim of the present study was to identify new TG mutations in a patient of Vietnamese origin affected by congenital hypothyroidism, goiter and low levels of serum TG. DNA sequencing identified the presence of compound heterozygous mutations in the TG gene: the maternal mutation consists of a novel c.745+1G>A (g.IVS6 + 1G>A), whereas the hypothetical paternal mutation consists of a novel c.7036+2T>A (g.IVS40 + 2T>A). The father was not available for segregation analysis. Ex-vivo splicing assays and subsequent RT-PCR analyses were performed on mRNA isolated from the eukaryotic-cells transfected with normal and mutant expression vectors. Minigene analysis of the c.745+1G>A mutant showed that the exon 6 is skipped during pre-mRNA splicing or partially included by use of a cryptic 5' splice site located to 55 nucleotides upstream of the authentic exon 6/intron 6 junction site. The functional analysis of c.7036+2T>A mutation showed a complete skipping of exon 40. The theoretical consequences of splice site mutations, predicted with the bioinformatics tool NNSplice, Fsplice, SPL, SPLM and MaxEntScan programs were investigated and evaluated in relation with the experimental evidence. These analyses predicted that both mutant alleles would result in the abolition of the authentic splice donor sites. The c.745+1G>A mutation originates two putative truncated proteins of 200 and 1142 amino acids, whereas c.7036+2T>A mutation results in a putative truncated protein of 2277 amino acids. In conclusion, we show that the c.745+1G>A mutation promotes the activation of a new cryptic donor splice site in the exon 6 of the TG gene. The functional consequences of these mutations could be structural changes in the protein molecule that alter the biosynthesis of thyroid hormones. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Splicing analysis for exonic and intronic mismatch repair gene variants associated with Lynch syndrome confirms high concordance between minigene assays and patient RNA analyses

PubMed Central

van der Klift, Heleen M; Jansen, Anne M L; van der Steenstraten, Niki; Bik, Elsa C; Tops, Carli M J; Devilee, Peter; Wijnen, Juul T

2015-01-01

A subset of DNA variants causes genetic disease through aberrant splicing. Experimental splicing assays, either RT-PCR analyses of patient RNA or functional splicing reporter minigene assays, are required to evaluate the molecular nature of the splice defect. Here, we present minigene assays performed for 17 variants in the consensus splice site regions, 14 exonic variants outside these regions, and two deep intronic variants, all in the DNA mismatch-repair (MMR) genes MLH1, MSH2, MSH6, and PMS2, associated with Lynch syndrome. We also included two deep intronic variants in APC and PKD2. For one variant (MLH1 c.122A>G), our minigene assay and patient RNA analysis could not confirm the previously reported aberrant splicing. The aim of our study was to further investigate the concordance between minigene splicing assays and patient RNA analyses. For 30 variants results from patient RNA analyses were available, either performed by our laboratory or presented in literature. Some variants were deliberately included in this study because they resulted in multiple aberrant transcripts in patient RNA analysis, or caused a splice effect other than the prevalent exon skip. While both methods were completely concordant in the assessment of splice effects, four variants exhibited major differences in aberrant splice patterns. Based on the present and earlier studies, together showing an almost 100% concordance of minigene assays with patient RNA analyses, we discuss the weight given to minigene splicing assays in the current criteria proposed by InSiGHT for clinical classification of MMR variants. PMID:26247049

Mechanistic Evaluation for Mixed-field Agglutination in the K562 Cell Study Model with Exon 3 Deletion of A1 Gene.

PubMed

Chen, Ding-Ping; Tseng, Ching-Ping; Lin, Chi-Jui; Wang, Wei-Ting; Sun, Chien-Feng

2015-01-01

In the case of blood type B3 with typical mixed-field agglutination of RBCs in the presence of anti-B or anti-AB antibody, a number of genetic alternations have been reported. It is well known that the IVS3+5G→A mutation in the B gene destroys the consensus of the splice donor site leading to exon 3 skipping during mRNA splicing. The lack of exon 3 likely causes a short stem region, producing an unstable B3 protein, and is concomitant with a decrease in B3 protein expression. Whether the phenomenon also appears in the type A blood group is of question. In this study, we evaluate whether exon 3 deletion in the blood type A gene also results in mixed-field phenotype. Site-directed mutagenesis was used to generate cDNA encoding A1 gene with exon 3 deletion. The cDNA was stably expressed in K562 cells. The expression of A antigen was compared with expression in parental K562 cells that did not express A antigen and in the stable K562 cell line expressing A(1) cDNA by flow cytometry analyses. The expression of A antigen in A1 stable cells and parental K562 cells was set as 100% and 0%, respectively. The mean relative percentage of A antigen expression for the cells of A1 with exon 3 deletion was 59.9% of A1 stable cells. Consistent with the observations of B3, which is B gene with exon 3 deletion, mixed field agglutination was observed for the cells expressing A1 with exon 3 deletion. Exon 3 deletion results in mixed field phenotype in both type A and B RBCs. However, the degree of antigen expression change for exon 3 deletion in A gene was less severe when compared with the deletion occurred in B gene. © 2015 by the Association of Clinical Scientists, Inc.

STAR splicing mutations cause the severe phenotype of lipoid congenital adrenal hyperplasia: insights from a novel splice mutation and review of reported cases.

PubMed

Camats, Núria; Pandey, Amit V; Fernández-Cancio, Mónica; Fernández, Juan M; Ortega, Ana M; Udhane, Sameer; Andaluz, Pilar; Audí, Laura; Flück, Christa E

2014-02-01

The steroidogenic acute regulatory protein (StAR) transports cholesterol to the mitochondria for steroidogenesis. Loss of StAR function causes lipoid congenital adrenal hyperplasia (LCAH) which is characterized by impaired synthesis of adrenal and gonadal steroids causing adrenal insufficiency, 46,XY disorder of sex development (DSD) and failure of pubertal development. Partial loss of StAR activity may cause adrenal insufficiency only. A newborn girl was admitted for mild dehydration, hyponatremia, hyperkalemia and hypoglycaemia and had normal external female genitalia without hyperpigmentation. Plasma cortisol, 17OH-progesterone, DHEA-S, androstendione and aldosterone were low, while ACTH and plasma renin activity were elevated, consistent with the diagnosis of primary adrenal insufficiency. Imaging showed normal adrenals, and cytogenetics revealed a 46,XX karyotype. She was treated with fluids, hydrocortisone and fludrocortisone. Genetic studies revealed a novel homozygous STAR mutation in the 3' acceptor splice site of intron 4, c.466-1G>A (IVS4-1G>A). To test whether this mutation would affect splicing, we performed a minigene experiment with a plasmid construct containing wild-type or mutant StAR gDNA of exons-introns 4-6 in COS-1 cells. The splicing was assessed on total RNA using RT-PCR for STAR cDNAs. The mutant STAR minigene skipped exon 5 completely and changed the reading frame. Thus, it is predicted to produce an aberrant and shorter protein (p.V156GfsX19). Computational analysis revealed that this mutant protein lacks wild-type exons 5-7 which are essential for StAR-cholesterol interaction. STAR c.466-1A skips exon 5 and causes a dramatic change in the C-terminal sequence of the protein, which is essential for StAR-cholesterol interaction. This splicing mutation is a loss-of-function mutation explaining the severe phenotype of our patient. Thus far, all reported splicing mutations of STAR cause a severe impairment of protein function and phenotype. © 2013 John Wiley & Sons Ltd.

Idiopathic hypogonadotropic hypogonadism in a mother and her monozygotic twins born after a single embryo transfer.

PubMed

Laitinen, Eeva-Maria; Tommiska, Johanna; Dunkel, Leo; Sankilampi, Ulla; Vaaralahti, Kirsi; Raivio, Taneli

2010-04-01

To describe a mother with idiopathic hypogonadotropic hypogonadism (IHH) and her monozygotic (MZ) twin boys who all have the same heterozygous fibroblast growth factor receptor-1 (FGFR1) gene mutation. Case report. University hospital. A 28-year-old mother with normosmic IHH gave birth to MZ twin boys after a transfer of a single frozen-thawed embryo. Clinical and biochemical evaluation of IHH. Sequence analysis of the 17 coding exons (exons 2-18) and exon-intron boundaries of FGFR1 from polymerase chain reaction-amplified genomic DNA from peripheral blood leukocytes of the subjects. Phenotypic features of the subjects. All subjects harbored a previously undescribed heterozygous FGFR1 mutation (c.2049-1 G-->C), leading to the skipping of exon 16 and thus a loss of amino acids 684-726 in the tyrosine kinase domain of the receptor. The absence of exon 16 was verified at the cDNA level. The twins manifested with microphallus, cryptorchidism, and deficient postnatal activation of the hypothalamic-pituitary-gonadal axis, findings consistent with IHH. Our report underlines that assisted reproductive techniques enable the inheritance of gene mutations causing infertility. This is the first report on the phenotypic features of MZ twins with an FGFR1 mutation. Copyright 2010 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

Decoding of exon splicing patterns in the human RUNX1-RUNX1T1 fusion gene.

PubMed

Grinev, Vasily V; Migas, Alexandr A; Kirsanava, Aksana D; Mishkova, Olga A; Siomava, Natalia; Ramanouskaya, Tatiana V; Vaitsiankova, Alina V; Ilyushonak, Ilia M; Nazarov, Petr V; Vallar, Laurent; Aleinikova, Olga V

2015-11-01

The t(8;21) translocation is the most widespread genetic defect found in human acute myeloid leukemia. This translocation results in the RUNX1-RUNX1T1 fusion gene that produces a wide variety of alternative transcripts and influences the course of the disease. The rules of combinatorics and splicing of exons in the RUNX1-RUNX1T1 transcripts are not known. To address this issue, we developed an exon graph model of the fusion gene organization and evaluated its local exon combinatorics by the exon combinatorial index (ECI). Here we show that the local exon combinatorics of the RUNX1-RUNX1T1 gene follows a power-law behavior and (i) the vast majority of exons has a low ECI, (ii) only a small part is represented by "exons-hubs" of splicing with very high ECI values, and (iii) it is scale-free and very sensitive to targeted skipping of "exons-hubs". Stochasticity of the splicing machinery and preferred usage of exons in alternative splicing can explain such behavior of the system. Stochasticity may explain up to 12% of the ECI variance and results in a number of non-coding and unproductive transcripts that can be considered as a noise. Half-life of these transcripts is increased due to the deregulation of some key genes of the nonsense-mediated decay system in leukemia cells. On the other hand, preferred usage of exons may explain up to 75% of the ECI variability. Our analysis revealed a set of splicing-related cis-regulatory motifs that can explain "attractiveness" of exons in alternative splicing but only when they are considered together. Cis-regulatory motifs are guides for splicing trans-factors and we observed a leukemia-specific profile of expression of the splicing genes in t(8;21)-positive blasts. Altogether, our results show that alternative splicing of the RUNX1-RUNX1T1 transcripts follows strict rules and that the power-law component of the fusion gene organization confers a high flexibility to this process. Copyright © 2015 Elsevier Ltd. All rights reserved.

Diagnosis of Xeroderma pigmentosum variant in a young patient with two novel mutations in the POLH gene.

PubMed

De Palma, Armando; Morren, Marie-Anne; Ged, Cécile; Pouvelle, Caroline; Taïeb, Alain; Aoufouchi, Said; Sarasin, Alain

2017-09-01

We describe the characterization of Xeroderma Pigmentosum variant (XPV) in a young Caucasian patient with phototype I, who exhibited a high sensitivity to sunburn and multiple cutaneous tumors at the age of 15 years. Two novel mutations in the POLH gene, which encodes the translesion DNA polymerase η, with loss of function due to two independent exon skippings, are reported to be associated as a compound heterozygous state in the patient. Western blot analysis performed on proteins from dermal fibroblasts derived from the patient and analysis of the mutation spectrum on immunoglobulin genes produced during the somatic hypermutation process in his memory B cells, show the total absence of translesion polymerase η activity in the patient. The total lack of Polη activity, necessary to bypass in an error-free manner UVR-induced pyrimidine dimers following sun exposure, explains the early unusual clinical appearance of this patient. © 2017 Wiley Periodicals, Inc.

Precise correction of the dystrophin gene in duchenne muscular dystrophy patient induced pluripotent stem cells by TALEN and CRISPR-Cas9.

PubMed

Li, Hongmei Lisa; Fujimoto, Naoko; Sasakawa, Noriko; Shirai, Saya; Ohkame, Tokiko; Sakuma, Tetsushi; Tanaka, Michihiro; Amano, Naoki; Watanabe, Akira; Sakurai, Hidetoshi; Yamamoto, Takashi; Yamanaka, Shinya; Hotta, Akitsu

2015-01-13

Duchenne muscular dystrophy (DMD) is a severe muscle-degenerative disease caused by a mutation in the dystrophin gene. Genetic correction of patient-derived induced pluripotent stem cells (iPSCs) by TALENs or CRISPR-Cas9 holds promise for DMD gene therapy; however, the safety of such nuclease treatment must be determined. Using a unique k-mer database, we systematically identified a unique target region that reduces off-target sites. To restore the dystrophin protein, we performed three correction methods (exon skipping, frameshifting, and exon knockin) in DMD-patient-derived iPSCs, and found that exon knockin was the most effective approach. We further investigated the genomic integrity by karyotyping, copy number variation array, and exome sequencing to identify clones with a minimal mutation load. Finally, we differentiated the corrected iPSCs toward skeletal muscle cells and successfully detected the expression of full-length dystrophin protein. These results provide an important framework for developing iPSC-based gene therapy for genetic disorders using programmable nucleases. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

The TREAT-NMD DMD Global Database: Analysis of More than 7,000 Duchenne Muscular Dystrophy Mutations

PubMed Central

Bladen, Catherine L; Salgado, David; Monges, Soledad; Foncuberta, Maria E; Kekou, Kyriaki; Kosma, Konstantina; Dawkins, Hugh; Lamont, Leanne; Roy, Anna J; Chamova, Teodora; Guergueltcheva, Velina; Chan, Sophelia; Korngut, Lawrence; Campbell, Craig; Dai, Yi; Wang, Jen; Barišić, Nina; Brabec, Petr; Lahdetie, Jaana; Walter, Maggie C; Schreiber-Katz, Olivia; Karcagi, Veronika; Garami, Marta; Viswanathan, Venkatarman; Bayat, Farhad; Buccella, Filippo; Kimura, En; Koeks, Zaïda; van den Bergen, Janneke C; Rodrigues, Miriam; Roxburgh, Richard; Lusakowska, Anna; Kostera-Pruszczyk, Anna; Zimowski, Janusz; Santos, Rosário; Neagu, Elena; Artemieva, Svetlana; Rasic, Vedrana Milic; Vojinovic, Dina; Posada, Manuel; Bloetzer, Clemens; Jeannet, Pierre-Yves; Joncourt, Franziska; Díaz-Manera, Jordi; Gallardo, Eduard; Karaduman, A Ayşe; Topaloğlu, Haluk; El Sherif, Rasha; Stringer, Angela; Shatillo, Andriy V; Martin, Ann S; Peay, Holly L; Bellgard, Matthew I; Kirschner, Jan; Flanigan, Kevin M; Straub, Volker; Bushby, Kate; Verschuuren, Jan; Aartsma-Rus, Annemieke; Béroud, Christophe; Lochmüller, Hanns

2015-01-01

Analyzing the type and frequency of patient-specific mutations that give rise to Duchenne muscular dystrophy (DMD) is an invaluable tool for diagnostics, basic scientific research, trial planning, and improved clinical care. Locus-specific databases allow for the collection, organization, storage, and analysis of genetic variants of disease. Here, we describe the development and analysis of the TREAT-NMD DMD Global database (http://umd.be/TREAT_DMD/). We analyzed genetic data for 7,149 DMD mutations held within the database. A total of 5,682 large mutations were observed (80% of total mutations), of which 4,894 (86%) were deletions (1 exon or larger) and 784 (14%) were duplications (1 exon or larger). There were 1,445 small mutations (smaller than 1 exon, 20% of all mutations), of which 358 (25%) were small deletions and 132 (9%) small insertions and 199 (14%) affected the splice sites. Point mutations totalled 756 (52% of small mutations) with 726 (50%) nonsense mutations and 30 (2%) missense mutations. Finally, 22 (0.3%) mid-intronic mutations were observed. In addition, mutations were identified within the database that would potentially benefit from novel genetic therapies for DMD including stop codon read-through therapies (10% of total mutations) and exon skipping therapy (80% of deletions and 55% of total mutations). PMID:25604253

Altered Splicing of the BIN1 Muscle-Specific Exon in Humans and Dogs with Highly Progressive Centronuclear Myopathy

PubMed Central

Böhm, Johann; Vasli, Nasim; Maurer, Marie; Cowling, Belinda; Shelton, G. Diane; Kress, Wolfram; Toussaint, Anne; Prokic, Ivana; Schara, Ulrike; Anderson, Thomas James; Weis, Joachim; Tiret, Laurent; Laporte, Jocelyn

2013-01-01

Amphiphysin 2, encoded by BIN1, is a key factor for membrane sensing and remodelling in different cell types. Homozygous BIN1 mutations in ubiquitously expressed exons are associated with autosomal recessive centronuclear myopathy (CNM), a mildly progressive muscle disorder typically showing abnormal nuclear centralization on biopsies. In addition, misregulation of BIN1 splicing partially accounts for the muscle defects in myotonic dystrophy (DM). However, the muscle-specific function of amphiphysin 2 and its pathogenicity in both muscle disorders are not well understood. In this study we identified and characterized the first mutation affecting the splicing of the muscle-specific BIN1 exon 11 in a consanguineous family with rapidly progressive and ultimately fatal centronuclear myopathy. In parallel, we discovered a mutation in the same BIN1 exon 11 acceptor splice site as the genetic cause of the canine Inherited Myopathy of Great Danes (IMGD). Analysis of RNA from patient muscle demonstrated complete skipping of exon 11 and BIN1 constructs without exon 11 were unable to promote membrane tubulation in differentiated myotubes. Comparative immunofluorescence and ultrastructural analyses of patient and canine biopsies revealed common structural defects, emphasizing the importance of amphiphysin 2 in membrane remodelling and maintenance of the skeletal muscle triad. Our data demonstrate that the alteration of the muscle-specific function of amphiphysin 2 is a common pathomechanism for centronuclear myopathy, myotonic dystrophy, and IMGD. The IMGD dog is the first faithful model for human BIN1-related CNM and represents a mammalian model available for preclinical trials of potential therapies. PMID:23754947

Alternative Splice in Alternative Lice

PubMed Central

Tovar-Corona, Jaime M.; Castillo-Morales, Atahualpa; Chen, Lu; Olds, Brett P.; Clark, John M.; Reynolds, Stuart E.; Pittendrigh, Barry R.; Feil, Edward J.; Urrutia, Araxi O.

2015-01-01

Genomic and transcriptomics analyses have revealed human head and body lice to be almost genetically identical; although con-specific, they nevertheless occupy distinct ecological niches and have differing feeding patterns. Most importantly, while head lice are not known to be vector competent, body lice can transmit three serious bacterial diseases; epidemictyphus, trench fever, and relapsing fever. In order to gain insights into the molecular bases for these differences, we analyzed alternative splicing (AS) using next-generation sequencing data for one strain of head lice and one strain of body lice. We identified a total of 3,598 AS events which were head or body lice specific. Exon skipping AS events were overrepresented among both head and body lice, whereas intron retention events were underrepresented in both. However, both the enrichment of exon skipping and the underrepresentation of intron retention are significantly stronger in body lice compared with head lice. Genes containing body louse-specific AS events were found to be significantly enriched for functions associated with development of the nervous system, salivary gland, trachea, and ovarian follicle cells, as well as regulation of transcription. In contrast, no functional categories were overrepresented among genes with head louse-specific AS events. Together, our results constitute the first evidence for transcript pool differences in head and body lice, providing insights into molecular adaptations that enabled human lice to adapt to clothing, and representing a powerful illustration of the pivotal role AS can play in functional adaptation. PMID:26169943

MRI roadmap-guided transendocardial delivery of exon-skipping recombinant adeno-associated virus restores dystrophin expression in a canine model of Duchenne muscular dystrophy.

PubMed

Barbash, I M; Cecchini, S; Faranesh, A Z; Virag, T; Li, L; Yang, Y; Hoyt, R F; Kornegay, J N; Bogan, J R; Garcia, L; Lederman, R J; Kotin, R M

2013-03-01

Duchenne muscular dystrophy (DMD) cardiomyopathy patients currently have no therapeutic options. We evaluated catheter-based transendocardial delivery of a recombinant adeno-associated virus (rAAV) expressing a small nuclear U7 RNA (U7smOPT) complementary to specific cis-acting splicing signals. Eliminating specific exons restores the open reading frame resulting in translation of truncated dystrophin protein. To test this approach in a clinically relevant DMD model, golden retriever muscular dystrophy (GRMD) dogs received serotype 6 rAAV-U7smOPT via the intracoronary or transendocardial route. Transendocardial injections were administered with an injection-tipped catheter and fluoroscopic guidance using X-ray fused with magnetic resonance imaging (XFM) roadmaps. Three months after treatment, tissues were analyzed for DNA, RNA, dystrophin protein, and histology. Whereas intracoronary delivery did not result in effective transduction, transendocardial injections, XFM guidance, enabled 30±10 non-overlapping injections per animal. Vector DNA was detectable in all samples tested and ranged from <1 to >3000 vector genome copies per cell. RNA analysis, western blot analysis, and immunohistology demonstrated extensive expression of skipped RNA and dystrophin protein in the treated myocardium. Left ventricular function remained unchanged over a 3-month follow-up. These results demonstrated that effective transendocardial delivery of rAAV-U7smOPT was achieved using XFM. This approach restores an open reading frame for dystrophin in affected dogs and has potential clinical utility.

RNA-Seq analysis identifies aberrant RNA splicing of TRIP12 in acute myeloid leukemia patients at remission.

PubMed

Gao, Panke; Jin, Zhen; Cheng, Yingying; Cao, Xiangshan

2014-10-01

Aberrant splicing events play important roles in the pathogenesis of acute myeloid leukemia (AML). To investigate the aberrant splicing events in AML during treatment, we carried out RNA sequencing in peripheral mononuclear cell samples from a patient with complete remission. In addition to the sequencing samples, selected splicing events were confirmed and validated with real-time quantitative RT-PCR in another seven pairs of samples. A total of 4.05 and 3.39 GB clean data of the AML and remission sample were generated, respectively, and 2,223 differentially expressed genes (DEGs) were identified. Integrated with gene expression profiling on T cells from AML patients compared with healthy donors, 82 DEGs were also differentially expressed in AML CD4 T cells and CD8 T cells. Twenty-three alternative splicing events were considered to be confidential, and they were involved in many biological processes, such as RNA processing, cellular macromolecule catabolic process, and DNA binding process. An exon3-skipping event in TRIP12 was detected in patients at remission and further validated in another three independent samples. TRIP12 is an ubiquitin ligase of ARF, which suppresses aberrant cell growth by activating p53 responses. The exon3-skipping isoform of TRIP12 increased significantly after treatment. Our results may provide new understanding of AML, and the confirmed alternative splicing event of TRIP12 may be used as potential target for future investigations.

FAS-antisense 1 lncRNA and production of soluble versus membrane Fas in B-cell lymphoma

PubMed Central

Sehgal, Lalit; Mathur, Rohit; Braun, Frank K.; Wise, Jillian F.; Berkova, Zuzana; Neelapu, Sattva; Kwak, Larry W.; Samaniego, Felipe

2018-01-01

Impaired Fas-mediated apoptosis is associated with poor clinical outcomes and cancer chemoresistance. Soluble Fas receptor (sFas), produced by skipping of exon 6, inhibits apoptosis by sequestering Fas ligand. Serum sFas is associated with poor prognosis of non-Hodgkin's lymphomas. We found that the alternative splicing of Fas in lymphomas is tightly regulated by a lncRNA corresponding to an antisense transcript of Fas (FAS-AS1). Levels of FAS-AS1 correlate inversely with production of sFas and FAS-AS1 binding to the RBM5 inhibits RBM5-mediated exon 6 skipping. EZH2, often mutated or overexpressed in lymphomas, hyper-methylates the FAS-AS1 promoter and represses the FAS-AS1 expression. EZH2-mediated repression of FAS-AS1 promoter can be released by DZNeP or overcome by ectopic expression of FAS-AS1, both of which increase levels of FAS-AS1 and correspondingly decrease expression of sFas. Treatment with Bruton’s tyrosine kinase (BTK) inhibitor or EZH2 knockdown decreases the levels of EZH2, RBM5 and sFas thereby enhances Fas-mediated apoptosis. This is the first report showing functional regulation of Fas repression by its antisense RNA. Our results reveal new therapeutic targets in lymphomas and provide a rationale for the use of EZH2 inhibitors or ibrutinib in combination with chemotherapeutic agents that recruit Fas for effective cell killing. PMID:24811343

Assessing the residual CFTR gene expression in human nasal epithelium cells bearing CFTR splicing mutations causing cystic fibrosis

PubMed Central

Masvidal, Laia; Igreja, Susana; Ramos, Maria D; Alvarez, Antoni; de Gracia, Javier; Ramalho, Anabela; Amaral, Margarida D; Larriba, Sara; Casals, Teresa

2014-01-01

The major purpose of the present study was to quantify correctly spliced CFTR transcripts in human nasal epithelial cells from cystic fibrosis (CF) patients carrying the splicing mutations c.580-1G>T (712-1G>T) and c.2657+5G>A (2789+5G>A) and to assess the applicability of this model in CFTR therapeutic approaches. We performed the relative quantification of CFTR mRNA by reverse transcription quantitative PCR (RT-qPCR) of these splicing mutations in four groups (wild type, CF-F508del controls, CF patients and CF carriers) of individuals. In addition, in vitro assays using minigene constructs were performed to evaluate the effect of a new CF complex allele c.[2657+5G>A; 2562T>G]. Ex vivo qPCR data show that the primary consequence of both mutations at the RNA level is the skipping of their neighboring exon (6 and 16, respectively). The CFTR minigenes results mimicked the ex vivo data, as exon 16 skipping is the main aberrant transcript, and the correctly spliced transcript level was observed in a similar proportion when the c.2657+5G>A mutation is present. In summary, we provide evidence that ex vivo quantitative transcripts analysis using RT/qPCR is a robust technology that could be useful for measuring the efficacy of therapeutic approaches that attempt to achieve an increase in CFTR gene expression. PMID:24129438

Water Surface Impact and Ricochet of Deformable Elastomeric Spheres

NASA Astrophysics Data System (ADS)

Hurd, Randy C.

Soft and deformable silicone rubber spheres ricochet from a water surface when rigid spheres and disks (or skipping stones) cannot. This dissertation investigates why these objects are able to skip so successfully. High speed cameras allow us to see that these unique spheres deform significantly as they impact the water surface, flattening into pancake-like shapes with greater area. Though the water entry behavior of deformable spheres deviates from that of rigid spheres, our research shows that if this deformation is accounted for, their behavior can be predicted from previously established methods. Soft spheres skip more easily because they deform significantly when impacting the water surface. We present a diagram which enables the prediction of a ricochet from sphere impact conditions such as speed and angle. Experiments and mathematical representations of the sphere skipping both show that these deformable spheres skip more readily because deformation momentarily increases sphere area and produces an attack angle with the water which is favorable to skipping. Predictions from our mathematical representation of sphere skipping agree strongly with observations from experiments. Even when a sphere was allowed to skip multiple times in the laboratory, the mathematical predictions show good agreement with measured impact conditions through subsequent skipping events. While studying multiple impact events in an outdoor setting, we discovered a previously unidentified means of skipping, which is unique to deformable spheres. This new skipping occurs when a relatively soft sphere first hits the water at a high speed and low impact angle and the sphere begins to rotate very quickly. This quick rotation causes the sphere to stretch into a shape similar to an American football and maintain this shape while it spins. The sphere is observed to move nearly parallel with the water surface with the tips of this "football" dipping into the water as it rotates and the sides passing just over the surface. This sequence of rapid impact events give the impression that the sphere is walking across the water surface.

Generation and analysis of knock-in mice carrying pseudohypoaldosteronism type II-causing mutations in the cullin 3 gene.

PubMed

Araki, Yuya; Rai, Tatemitsu; Sohara, Eisei; Mori, Takayasu; Inoue, Yuichi; Isobe, Kiyoshi; Kikuchi, Eriko; Ohta, Akihito; Sasaki, Sei; Uchida, Shinichi

2015-10-21

Pseudohypoaldosteronism type II (PHAII) is a hereditary hypertensive disease caused by mutations in four different genes: with-no-lysine kinases (WNK) 1 and 4, Kelch-like family member 3 (KLHL3), and cullin 3 (Cul3). Cul3 and KLHL3 form an E3 ligase complex that ubiquitinates and reduces the expression level of WNK4. PHAII-causing mutations in WNK4 and KLHL3 impair WNK4 ubiquitination. However, the molecular pathogenesis of PHAII caused by Cul3 mutations is unclear. In cultured cells and human leukocytes, PHAII-causing Cul3 mutations result in the skipping of exon 9, producing mutant Cul3 protein lacking 57 amino acids. However, whether this phenomenon occurs in the kidneys and is responsible for the pathogenesis of PHAII in vivo is unknown. We generated knock-in mice carrying a mutation in the C-terminus of intron 8 of Cul3, c.1207-1G>A, which corresponds to a PHAII-causing mutation in the human Cul3 gene. Heterozygous Cul3(G(-1)A/+) knock-in mice did not exhibit PHAII phenotypes, and the skipping of exon 9 was not evident in their kidneys. However, the level of Cul3 mRNA expression in the kidneys of heterozygous knock-in mice was approximately half that of wild-type mice. Furthermore, homozygous knock-in mice were nonviable. It suggested that the mutant allele behaved like a knockout allele and did not produce Cul3 mRNA lacking exon 9. A reduction in Cul3 expression alone was not sufficient to develop PHAII in the knock-in mice. Our findings highlighted the pathogenic role of mutant Cul3 protein and provided insight to explain why PHAII-causing mutations in Cul3 cause kidney-predominant PHAII phenotypes. © 2015. Published by The Company of Biologists Ltd.

A comprehensive analysis of clinical outcomes in lung cancer patients harboring a MET exon 14 skipping mutation compared to other driver mutations in an East Asian population.

PubMed

Gow, Chien-Hung; Hsieh, Min-Shu; Wu, Shang-Gin; Shih, Jin-Yuan

2017-01-01

Recurrent somatic splice-site alterations at MET exon 14 (MET Δ14 ), which result in exon skipping and MET proto-oncogene, receptor tyrosine kinase (MET) activation, have been characterised. However, their demographic features and clinical outcomes in East Asian lung cancer patients have yet to be determined. A one-step reverse transcription-polymerase chain reaction (RT-PCR), using RNA samples from 850 East Asian lung cancer patients, was performed in order to detect MET Δ14 and five other major driver mutations, including those in the EGFR, KRAS, ALK, HER2, and ROS1 genes. Immunohistochemistry (IHC) was used to confirm the overexpression of MET in patients harbouring the MET Δ14 mutation. We analysed the demographic data and clinical outcomes of MET Δ14 mutation positive lung cancer patients and compared them to those of MET Δ14 mutation negative lung cancer patients. In total, 27 lung adenocarcinoma (ADC) patients and 1 squamous cell carcinoma patient with the MET Δ14 mutation were identified. The overall incidence was 3.3% for lung cancer and 4.0% for lung ADC. IHC demonstrated that the majority of lung cancer patients harboring a MET Δ14 mutation exhibited a strong cytoplasmic expression of MET. MET Δ14 mutation positive patients were generally quite elderly individuals. Stage IV MET Δ14 mutation positive lung cancer patients receiving no specific anti-MET therapy were observed to have a similar overall survival (OS) compared to patients in the all negative group (P>0.05). In the multivariate analysis, mutation status was found not to be a major risk factor for OS in lung cancer patients without appropriate tyrosine kinase inhibitors treatment. The OS of MET Δ14 mutation positive lung cancer patients is comparable to that of the major driver gene mutation negative lung cancer patients. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Modeling the human MTM1 p.R69C mutation in murine Mtm1 results in exon 4 skipping and a less severe myotubular myopathy phenotype

PubMed Central

Pierson, Christopher R.; Dulin-Smith, Ashley N.; Durban, Ashley N.; Marshall, Morgan L.; Marshall, Jordan T.; Snyder, Andrew D.; Naiyer, Nada; Gladman, Jordan T.; Chandler, Dawn S.; Lawlor, Michael W.; Buj-Bello, Anna; Dowling, James J.; Beggs, Alan H.

2012-01-01

X-linked myotubular myopathy (MTM) is a severe neuromuscular disease of infancy caused by mutations of MTM1, which encodes the phosphoinositide lipid phosphatase, myotubularin. The Mtm1 knockout (KO) mouse has a severe phenotype and its short lifespan (8 weeks) makes it a challenge to use as a model in the testing of certain preclinical therapeutics. Many MTM patients succumb early in life, but some have a more favorable prognosis. We used human genotype–phenotype correlation data to develop a myotubularin-deficient mouse model with a less severe phenotype than is seen in Mtm1 KO mice. We modeled the human c.205C>T point mutation in Mtm1 exon 4, which is predicted to introduce the p.R69C missense change in myotubularin. Hemizygous male Mtm1 p.R69C mice develop early muscle atrophy prior to the onset of weakness at 2 months. The median survival period is 66 weeks. Histopathology shows small myofibers with centrally placed nuclei. Myotubularin protein is undetectably low because the introduced c.205C>T base change induced exon 4 skipping in most mRNAs, leading to premature termination of myotubularin translation. Some full-length Mtm1 mRNA bearing the mutation is present, which provides enough myotubularin activity to account for the relatively mild phenotype, as Mtm1 KO and Mtm1 p.R69C mice have similar muscle phosphatidylinositol 3-phosphate levels. These data explain the basis for phenotypic variability among human patients with MTM1 p.R69C mutations and establish the Mtm1 p.R69C mouse as a valuable model for the disease, as its less severe phenotype will expand the scope of testable preclinical therapies. PMID:22068590

Antisense Masking of an hnRNP A1/A2 Intronic Splicing Silencer Corrects SMN2 Splicing in Transgenic Mice

PubMed Central

Hua, Yimin; Vickers, Timothy A.; Okunola, Hazeem L.; Bennett, C. Frank; Krainer, Adrian R.

2008-01-01

survival of motor neuron 2, centromeric (SMN2) is a gene that modifies the severity of spinal muscular atrophy (SMA), a motor-neuron disease that is the leading genetic cause of infant mortality. Increasing inclusion of SMN2 exon 7, which is predominantly skipped, holds promise to treat or possibly cure SMA; one practical strategy is the disruption of splicing silencers that impair exon 7 recognition. By using an antisense oligonucleotide (ASO)-tiling method, we systematically screened the proximal intronic regions flanking exon 7 and identified two intronic splicing silencers (ISSs): one in intron 6 and a recently described one in intron 7. We analyzed the intron 7 ISS by mutagenesis, coupled with splicing assays, RNA-affinity chromatography, and protein overexpression, and found two tandem hnRNP A1/A2 motifs within the ISS that are responsible for its inhibitory character. Mutations in these two motifs, or ASOs that block them, promote very efficient exon 7 inclusion. We screened 31 ASOs in this region and selected two optimal ones to test in human SMN2 transgenic mice. Both ASOs strongly increased hSMN2 exon 7 inclusion in the liver and kidney of the transgenic animals. Our results show that the high-resolution ASO-tiling approach can identify cis-elements that modulate splicing positively or negatively. Most importantly, our results highlight the therapeutic potential of some of these ASOs in the context of SMA. PMID:18371932

Novel LAMP2 mutations in Chinese patients with Danon disease cause varying degrees of clinical severity.

PubMed

Luo, Su-shan; Xi, Jian-ying; Cai, Shuang; Zhao, Chong-bo; Lu, Jia-hong; Zhu, Wen-hua; Lin, Jie; Qiao, Kai; Wang, Yin; Ye, Zhu-rong

2014-01-01

Danon disease is an Xlinked dominant lysosomal glycogen storage disorder characterized by cardiomyopathy, skeletal myopathy, and mental retardation. This study described two Chinese cases of Danon disease in order to broaden the phenotypic and genetic spectrum. Clinical data were collected and LAMP2 mutations were analyzed. Patient A had fluctuating limb weakness during 6 months follow-up and was diagnosed with drug-induced myopathy due to anti-hepatitis B therapy with lamivudine. However, the first muscle biopsy with large cytoplasmic vacuoles confused the diagnosis and led to the second biopsy that allowed for the final diagnosis. Patient B had severe cardiac disturbances leading to sudden death. Molecularly, patient A harbored a synonymous mutation adjacent to the exon 6-intron 6 junction; mRNA analysis provided evidence that totally abolished the donor site and caused skipping of exon 6. Patient B harbored a frame-shift deletion mutation in exon 3 (c.396delA) leading to a truncated protein. To our knowledge, this is the first report of Danon disease caused by a synonymous exon mutation that affected mRNA splicing, which indicates that a synonymous substitution may not be silent when it is in the exon sequences close to the splice sites. It is also the first description of Danon disease clinically presenting as druginduced myopathy at onset; the pathological changes might be the key point for making a differential diagnosis. *These two authors contributed equally to this work.

Computational Identification of Tissue-Specific Splicing Regulatory Elements in Human Genes from RNA-Seq Data.

PubMed

Badr, Eman; ElHefnawi, Mahmoud; Heath, Lenwood S

2016-01-01

Alternative splicing is a vital process for regulating gene expression and promoting proteomic diversity. It plays a key role in tissue-specific expressed genes. This specificity is mainly regulated by splicing factors that bind to specific sequences called splicing regulatory elements (SREs). Here, we report a genome-wide analysis to study alternative splicing on multiple tissues, including brain, heart, liver, and muscle. We propose a pipeline to identify differential exons across tissues and hence tissue-specific SREs. In our pipeline, we utilize the DEXSeq package along with our previously reported algorithms. Utilizing the publicly available RNA-Seq data set from the Human BodyMap project, we identified 28,100 differentially used exons across the four tissues. We identified tissue-specific exonic splicing enhancers that overlap with various previously published experimental and computational databases. A complicated exonic enhancer regulatory network was revealed, where multiple exonic enhancers were found across multiple tissues while some were found only in specific tissues. Putative combinatorial exonic enhancers and silencers were discovered as well, which may be responsible for exon inclusion or exclusion across tissues. Some of the exonic enhancers are found to be co-occurring with multiple exonic silencers and vice versa, which demonstrates a complicated relationship between tissue-specific exonic enhancers and silencers.

A mutation in an alternative untranslated exon of hexokinase 1 associated with hereditary motor and sensory neuropathy -- Russe (HMSNR).

PubMed

Hantke, Janina; Chandler, David; King, Rosalind; Wanders, Ronald J A; Angelicheva, Dora; Tournev, Ivailo; McNamara, Elyshia; Kwa, Marcel; Guergueltcheva, Velina; Kaneva, Radka; Baas, Frank; Kalaydjieva, Luba

2009-12-01

Hereditary Motor and Sensory Neuropathy -- Russe (HMSNR) is a severe autosomal recessive disorder, identified in the Gypsy population. Our previous studies mapped the gene to 10q22-q23 and refined the gene region to approximately 70 kb. Here we report the comprehensive sequencing analysis and fine mapping of this region, reducing it to approximately 26 kb of fully characterised sequence spanning the upstream exons of Hexokinase 1 (HK1). We identified two sequence variants in complete linkage disequilibrium, a G>C in a novel alternative untranslated exon (AltT2) and a G>A in the adjacent intron, segregating with the disease in affected families and present in the heterozygote state in only 5/790 population controls. Sequence conservation of the AltT2 exon in 16 species with invariable preservation of the G allele at the mutated site, strongly favour the exonic change as the pathogenic mutation. Analysis of the Hk1 upstream region in mouse mRNA from testis and neural tissues showed an abundance of AltT2-containing transcripts generated by extensive, developmentally regulated alternative splicing. Expression is very low compared with ubiquitous Hk1 and all transcripts skip exon1, which encodes the protein domain responsible for binding to the outer mitochondrial membrane, and regulation of energy production and apoptosis. Hexokinase activity measurement and immunohistochemistry of the peripheral nerve showed no difference between patients and controls. The mutational mechanism and functional effects remain unknown and could involve disrupted translational regulation leading to increased anti-apoptotic activity (suggested by the profuse regenerative activity in affected nerves), or impairment of an unknown HK1 function in the peripheral nervous system (PNS).

A mutation in an alternative untranslated exon of hexokinase 1 associated with Hereditary Motor and Sensory Neuropathy – Russe (HMSNR)

PubMed Central

Hantke, Janina; Chandler, David; King, Rosalind; Wanders, Ronald JA; Angelicheva, Dora; Tournev, Ivailo; McNamara, Elyshia; Kwa, Marcel; Guergueltcheva, Velina; Kaneva, Radka; Baas, Frank; Kalaydjieva, Luba

2009-01-01

Hereditary Motor and Sensory Neuropathy – Russe (HMSNR) is a severe autosomal recessive disorder, identified in the Gypsy population. Our previous studies mapped the gene to 10q22-q23 and refined the gene region to ∼70 kb. Here we report the comprehensive sequencing analysis and fine mapping of this region, reducing it to ∼26 kb of fully characterised sequence spanning the upstream exons of Hexokinase 1 (HK1). We identified two sequence variants in complete linkage disequilibrium, a G>C in a novel alternative untranslated exon (AltT2) and a G>A in the adjacent intron, segregating with the disease in affected families and present in the heterozygote state in only 5/790 population controls. Sequence conservation of the AltT2 exon in 16 species with invariable preservation of the G allele at the mutated site, strongly favour the exonic change as the pathogenic mutation. Analysis of the Hk1 upstream region in mouse mRNA from testis and neural tissues showed an abundance of AltT2-containing transcripts generated by extensive, developmentally regulated alternative splicing. Expression is very low compared with ubiquitous Hk1 and all transcripts skip exon1, which encodes the protein domain responsible for binding to the outer mitochondrial membrane, and regulation of energy production and apoptosis. Hexokinase activity measurement and immunohistochemistry of the peripheral nerve showed no difference between patients and controls. The mutational mechanism and functional effects remain unknown and could involve disrupted translational regulation leading to increased anti-apoptotic activity (suggested by the profuse regenerative activity in affected nerves), or impairment of an unknown HK1 function in the peripheral nervous system (PNS). PMID:19536174

Molecular Characterization of the Llamas (Lama glama) Casein Cluster Genes Transcripts (CSN1S1, CSN2, CSN1S2, CSN3) and Regulatory Regions

PubMed Central

Pauciullo, Alfredo; Erhardt, Georg

2015-01-01

In the present paper, we report for the first time the characterization of llama (Lama glama) caseins at transcriptomic and genetic level. A total of 288 casein clones transcripts were analysed from two lactating llamas. The most represented mRNA populations were those correctly assembled (85.07%) and they encoded for mature proteins of 215, 217, 187 and 162 amino acids respectively for the CSN1S1, CSN2, CSN1S2 and CSN3 genes. The exonic subdivision evidenced a structure made of 21, 9, 17 and 6 exons for the αs1-, β-, αs2- and κ-casein genes respectively. Exon skipping and duplication events were evidenced. Two variants A and B were identified in the αs1-casein gene as result of the alternative out-splicing of the exon 18. An additional exon coding for a novel esapeptide was found to be cryptic in the κ-casein gene, whereas one extra exon was found in the αs2-casein gene by the comparison with the Camelus dromedaries sequence. A total of 28 putative phosphorylated motifs highlighted a complex heterogeneity and a potential variable degree of post-translational modifications. Ninety-six polymorphic sites were found through the comparison of the lama casein cDNAs with the homologous camel sequences, whereas the first description and characterization of the 5’- and 3’-regulatory regions allowed to identify the main putative consensus sequences involved in the casein genes expression, thus opening the way to new investigations -so far- never achieved in this species. PMID:25923814

Molecular Characterization of the Llamas (Lama glama) Casein Cluster Genes Transcripts (CSN1S1, CSN2, CSN1S2, CSN3) and Regulatory Regions.

PubMed

Pauciullo, Alfredo; Erhardt, Georg

2015-01-01

In the present paper, we report for the first time the characterization of llama (Lama glama) caseins at transcriptomic and genetic level. A total of 288 casein clones transcripts were analysed from two lactating llamas. The most represented mRNA populations were those correctly assembled (85.07%) and they encoded for mature proteins of 215, 217, 187 and 162 amino acids respectively for the CSN1S1, CSN2, CSN1S2 and CSN3 genes. The exonic subdivision evidenced a structure made of 21, 9, 17 and 6 exons for the αs1-, β-, αs2- and κ-casein genes respectively. Exon skipping and duplication events were evidenced. Two variants A and B were identified in the αs1-casein gene as result of the alternative out-splicing of the exon 18. An additional exon coding for a novel esapeptide was found to be cryptic in the κ-casein gene, whereas one extra exon was found in the αs2-casein gene by the comparison with the Camelus dromedaries sequence. A total of 28 putative phosphorylated motifs highlighted a complex heterogeneity and a potential variable degree of post-translational modifications. Ninety-six polymorphic sites were found through the comparison of the lama casein cDNAs with the homologous camel sequences, whereas the first description and characterization of the 5'- and 3'-regulatory regions allowed to identify the main putative consensus sequences involved in the casein genes expression, thus opening the way to new investigations -so far- never achieved in this species.

Molecular Cloning and Characterization of the Human ErbB4 Gene: Identification of Novel Splice Isoforms in the Developing and Adult Brain

PubMed Central

Tan, Wei; Dean, Michael; Law, Amanda J.

2010-01-01

ErbB4 is a growth factor receptor tyrosine kinase essential for neurodevelopment. Genetic variation in ErbB4 is associated with schizophrenia and risk-associated polymorphisms predict overexpression of ErbB4 CYT-1 isoforms in the brain in the disorder. The molecular mechanism of association is unclear because the polymorphisms flank exon 3 of the gene and reside 700 kb distal to the CYT-1 defining exon. We hypothesized that the polymorphisms are indirectly associated with ErbB4 CYT-1 via splicing of exon 3 on the CYT-1 background. We report via cloning and sequencing of adult and fetal human brain cDNA libraries the identification of novel splice isoforms of ErbB4, whereby exon 3 is skipped (del.3). ErbB4 del.3 transcripts exist as CYT-2 isoforms and are predicted to produce truncated proteins. Furthermore, our data refine the structure of the human ErbB4 gene, clarify that juxtamembrane (JM) splice variants of ErbB4, JM-a and JM-b respectively, are characterized by the replacement of a 75 nucleotide (nt) sequence with a 45-nt insertion, and demonstrate that there are four alternative exons in the gene. Our analyses reveal that novel splice variants of ErbB4 exist in the developing and adult human brain and, given the failure to identify ErbB4 del.3 CYT-1 transcripts, suggest that the association of risk polymorphisms in the ErbB4 gene with CYT-1 transcript levels is not mediated via an exon 3 splicing event. PMID:20886074

Global Profiling and Molecular Characterization of Alternative Splicing Events Misregulated in Lung Cancer ▿ †

PubMed Central

Misquitta-Ali, Christine M.; Cheng, Edith; O'Hanlon, Dave; Liu, Ni; McGlade, C. Jane; Tsao, Ming Sound; Blencowe, Benjamin J.

2011-01-01

Alternative splicing (AS) is a widespread mechanism underlying the generation of proteomic and regulatory complexity. However, which of the myriad of human AS events play important roles in disease is largely unknown. To identify frequently occurring AS events in lung cancer, we used AS microarray profiling and reverse transcription-PCR (RT-PCR) assays to survey patient-matched normal and adenocarcinoma tumor tissues from the lungs of 29 individuals diagnosed with non-small cell lung cancer (NSCLC). Of 5,183 profiled alternative exons, four displayed tumor-associated changes in the majority of the patients. These events affected transcripts from the VEGFA, MACF1, APP, and NUMB genes. Similar AS changes were detected in NUMB and APP transcripts in primary breast and colon tumors. Tumor-associated increases in NUMB exon 9 inclusion correlated with reduced levels of NUMB protein expression and activation of the Notch signaling pathway, an event that has been linked to tumorigenesis. Moreover, short hairpin RNA (shRNA) knockdown of NUMB followed by isoform-specific rescue revealed that expression of the exon 9-skipped (nontumor) isoform represses Notch target gene activation whereas expression of the exon 9-included (tumor) isoform lacks this activity and is capable of promoting cell proliferation. The results thus reveal widespread AS changes in NSCLC that impact cell signaling in a manner that likely contributes to tumorigenesis. PMID:21041478

Common pathological mutations in PQBP1 induce nonsense-mediated mRNA decay and enhance exclusion of the mutant exon.

PubMed

Musante, Luciana; Kunde, Stella-Amrei; Sulistio, Tina O; Fischer, Ute; Grimme, Astrid; Frints, Suzanna G M; Schwartz, Charles E; Martínez, Francisco; Romano, Corrado; Ropers, Hans-Hilger; Kalscheuer, Vera M

2010-01-01

The polyglutamine binding protein 1 (PQBP1) gene plays an important role in X-linked mental retardation (XLMR). Nine of the thirteen PQBP1 mutations known to date affect the AG hexamer in exon 4 and cause frameshifts introducing premature termination codons (PTCs). However, the phenotype in this group of patients is variable. To investigate the pathology of these PQBP1 mutations, we evaluated their consequences on mRNA and protein expression. RT-PCRs revealed mutation-specific reduction of PQBP1 mRNAs carrying the PTCs that can be partially restored by blocking translation, thus indicating a role for the nonsense-mediated mRNA decay pathway. In addition, these mutations resulted in altered levels of PQBP1 transcripts that skipped exon 4, probably as a result of altering important splicing motifs via nonsense-associated altered splicing (NAS). This hypothesis is supported by transfection experiments using wild-type and mutant PQBP1 minigenes. Moreover, we show that a truncated PQBP1 protein is indeed present in the patients. Remarkably, patients with insertion/deletion mutations in the AG hexamer express significantly increased levels of a PQBP1 isoform, which is very likely encoded by the transcripts without exon 4, confirming the findings at the mRNA level. Our study provides significant insight into the early events contributing to the pathogenesis of the PQBP1 related XLMR disease.

Global profiling and molecular characterization of alternative splicing events misregulated in lung cancer.

PubMed

Misquitta-Ali, Christine M; Cheng, Edith; O'Hanlon, Dave; Liu, Ni; McGlade, C Jane; Tsao, Ming Sound; Blencowe, Benjamin J

2011-01-01

Alternative splicing (AS) is a widespread mechanism underlying the generation of proteomic and regulatory complexity. However, which of the myriad of human AS events play important roles in disease is largely unknown. To identify frequently occurring AS events in lung cancer, we used AS microarray profiling and reverse transcription-PCR (RT-PCR) assays to survey patient-matched normal and adenocarcinoma tumor tissues from the lungs of 29 individuals diagnosed with non-small cell lung cancer (NSCLC). Of 5,183 profiled alternative exons, four displayed tumor-associated changes in the majority of the patients. These events affected transcripts from the VEGFA, MACF1, APP, and NUMB genes. Similar AS changes were detected in NUMB and APP transcripts in primary breast and colon tumors. Tumor-associated increases in NUMB exon 9 inclusion correlated with reduced levels of NUMB protein expression and activation of the Notch signaling pathway, an event that has been linked to tumorigenesis. Moreover, short hairpin RNA (shRNA) knockdown of NUMB followed by isoform-specific rescue revealed that expression of the exon 9-skipped (nontumor) isoform represses Notch target gene activation whereas expression of the exon 9-included (tumor) isoform lacks this activity and is capable of promoting cell proliferation. The results thus reveal widespread AS changes in NSCLC that impact cell signaling in a manner that likely contributes to tumorigenesis.

A novel deletion in the splice donor site of MLH1 exon 6 in a Japanese colon cancer patient with Lynch syndrome.

PubMed

Yamaguchi, Junya; Sato, Yuri; Kita, Mizuho; Nomura, Sachio; Yamamoto, Noriko; Kato, Yo; Ishikawa, Yuichi; Arai, Masami

2015-10-01

Lynch syndrome is an autosomal dominantly inherited disease that is characterized by a predisposition to cancers, mainly colorectal cancer. Germline mutations of DNA mismatch repair genes such as MLH1, MSH2, MSH6 and PMS2 have been described in patients with Lynch syndrome. Here, we report deletion of 2 bp in the splice donor site of the MLH1 exon 6 (c.545+4_545+5delCA) in a 48-year-old Japanese woman with Lynch syndrome. RT-PCR direct sequencing analysis revealed that this mutation led to an increase in the level of an MLH1 transcript in which exon 6 was skipped, and may cause a frameshift (p.E153FfsX8). Therefore, this mutation appears to be pathogenic and is responsible for Lynch syndrome. Additionally, analysis of the patient's tumor cells indicated microsatellite instability high phenotype and loss of the MLH1 and PMS2 proteins. To our knowledge, this is a germline splice site mutation of MLH1 that has not been reported previously. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Genome-wide association between DNA methylation and alternative splicing in an invertebrate

PubMed Central

2012-01-01

Background Gene bodies are the most evolutionarily conserved targets of DNA methylation in eukaryotes. However, the regulatory functions of gene body DNA methylation remain largely unknown. DNA methylation in insects appears to be primarily confined to exons. Two recent studies in Apis mellifera (honeybee) and Nasonia vitripennis (jewel wasp) analyzed transcription and DNA methylation data for one gene in each species to demonstrate that exon-specific DNA methylation may be associated with alternative splicing events. In this study we investigated the relationship between DNA methylation, alternative splicing, and cross-species gene conservation on a genome-wide scale using genome-wide transcription and DNA methylation data. Results We generated RNA deep sequencing data (RNA-seq) to measure genome-wide mRNA expression at the exon- and gene-level. We produced a de novo transcriptome from this RNA-seq data and computationally predicted splice variants for the honeybee genome. We found that exons that are included in transcription are higher methylated than exons that are skipped during transcription. We detected enrichment for alternative splicing among methylated genes compared to unmethylated genes using fisher’s exact test. We performed a statistical analysis to reveal that the presence of DNA methylation or alternative splicing are both factors associated with a longer gene length and a greater number of exons in genes. In concordance with this observation, a conservation analysis using BLAST revealed that each of these factors is also associated with higher cross-species gene conservation. Conclusions This study constitutes the first genome-wide analysis exhibiting a positive relationship between exon-level DNA methylation and mRNA expression in the honeybee. Our finding that methylated genes are enriched for alternative splicing suggests that, in invertebrates, exon-level DNA methylation may play a role in the construction of splice variants by positively influencing exon inclusion during transcription. The results from our cross-species homology analysis suggest that DNA methylation and alternative splicing are genetic mechanisms whose utilization could contribute to a longer gene length and a slower rate of gene evolution. PMID:22978521

Maple Syrup Urine Disease in Cypriot Families: Identification of Three Novel Mutations and Biochemical Characterization of the p.Thr211Met Mutation in the E1α Subunit

PubMed Central

Georgiou, Theodoros; Chuang, Jacinta L.; Wynn, R. Max; Stylianidou, Goula; Korson, Mark; Chuang, David T.

2009-01-01

We report five mutations, three of them novel, responsible for maple syrup urine disease in four unrelated Cypriot families. The five children studied are the first cases of classic maple syrup urine disease to be reported among Cypriots. The first novel mutation identified is a single-base deletion in exon 6 of the Elα gene (c.718delG), which leads to a frameshift after Ala240 and to a stop codon 89 residues further downstream. The other two novel mutations identified are in the Elβ subunit: a two-base deletion in exon 6, c.662_663delCC, which leads to a frameshift after Ala221 and creates a stop codon 17 residues further downstream, as well as a splice mutation, IVS3[+3]delA, which results in the skipping of exon 3. The two known mutations identified are in the Elα gene: the G > C transversion at the 3′-splice acceptor site, (IVS5-1G > C), which results in the deletion of the entire exon 6, and the missense mutation in exon 5 (c.632C > T), which corresponds to a p.Thr211Met substitution. The p.Thr211Met substitution is located in a potassium-ion pocket in the E1 component required for stability of the bound cofactor thiamine diphosphate. The mutant E1 protein harboring the p.Thr211Met substitution was shown unable to bind thiamine diphosphate, leading to undetectable E1 activity. PMID:19715473

Mutation in Pyrroline-5-Carboxylate Reductase 1 Gene in Families with Cutis Laxa Type 2

PubMed Central

Guernsey, Duane L.; Jiang, Haiyan; Evans, Susan C.; Ferguson, Meghan; Matsuoka, Makoto; Nightingale, Mathew; Rideout, Andrea L.; Provost, Sylvie; Bedard, Karen; Orr, Andrew; Dubé, Marie-Pierre; Ludman, Mark; Samuels, Mark E.

2009-01-01

Autosomal-recessive cutis laxa type 2 (ARCL2) is a multisystem disorder characterized by the appearance of premature aging, wrinkled and lax skin, joint laxity, and a general developmental delay. Cutis laxa includes a family of clinically overlapping conditions with confusing nomenclature, generally requiring molecular analyses for definitive diagnosis. Six genes are currently known to mutate to yield one of these related conditions. We ascertained a cohort of typical ARCL2 patients from a subpopulation isolate within eastern Canada. Homozygosity mapping with high-density SNP genotyping excluded all six known genes, and instead identified a single homozygous region near the telomere of chromosome 17, shared identically by state by all genotyped affected individuals from the families. A putative pathogenic variant was identified by direct DNA sequencing of genes within the region. The single nucleotide change leads to a missense mutation adjacent to a splice junction in the gene encoding pyrroline-5-carboxylate reductase 1 (PYCR1). Bioinformatic analysis predicted a pathogenic effect of the variant on splice donor site function. Skipping of the associated exon was confirmed in RNA from blood lymphocytes of affected homozygotes and heterozygous mutation carriers. Exon skipping leads to deletion of the reductase functional domain-coding region and an obligatory downstream frameshift. PYCR1 plays a critical role in proline biosynthesis. Pathogenicity of the genetic variant in PYCR1 is likely, given that a similar clinical phenotype has been documented for mutation carriers of another proline biosynthetic enzyme, pyrroline-5-carboxylate synthase. Our results support a significant role for proline in normal development. PMID:19576563

Alternative Splice in Alternative Lice.

PubMed

Tovar-Corona, Jaime M; Castillo-Morales, Atahualpa; Chen, Lu; Olds, Brett P; Clark, John M; Reynolds, Stuart E; Pittendrigh, Barry R; Feil, Edward J; Urrutia, Araxi O

2015-10-01

Genomic and transcriptomics analyses have revealed human head and body lice to be almost genetically identical; although con-specific, they nevertheless occupy distinct ecological niches and have differing feeding patterns. Most importantly, while head lice are not known to be vector competent, body lice can transmit three serious bacterial diseases; epidemictyphus, trench fever, and relapsing fever. In order to gain insights into the molecular bases for these differences, we analyzed alternative splicing (AS) using next-generation sequencing data for one strain of head lice and one strain of body lice. We identified a total of 3,598 AS events which were head or body lice specific. Exon skipping AS events were overrepresented among both head and body lice, whereas intron retention events were underrepresented in both. However, both the enrichment of exon skipping and the underrepresentation of intron retention are significantly stronger in body lice compared with head lice. Genes containing body louse-specific AS events were found to be significantly enriched for functions associated with development of the nervous system, salivary gland, trachea, and ovarian follicle cells, as well as regulation of transcription. In contrast, no functional categories were overrepresented among genes with head louse-specific AS events. Together, our results constitute the first evidence for transcript pool differences in head and body lice, providing insights into molecular adaptations that enabled human lice to adapt to clothing, and representing a powerful illustration of the pivotal role AS can play in functional adaptation. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Gaucher disease: A G[sup +1][yields]A[sup +1] IVS2 splice donor site mutation causing exon 2 skipping in the acid [beta]-glucosidase mRNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

He, Guo-Shun; Grabowski, G.A.

1992-10-01

Gaucher disease is the most frequent lysosomal storage disease and the most prevalent Jewish genetic disease. About 30 identified missense mutations are causal to the defective activity of acid [beta]-glucosidase in this disease. cDNAs were characterized from a moderately affected 9-year-old Ashkenazi Jewish Gaucher disease type 1 patient whose 80-years-old, enzyme-deficient, 1226G (Asn[sup 370][yields]Ser [N370S]) homozygous grandfather was nearly asymptomatic. Sequence analyses revealed four populations of cDNAs with either the 1226G mutation, an exact exon 2 ([Delta] EX2) deletion, a deletion of exon 2 and the first 115 bp of exon 3 ([Delta] EX2-3), or a completely normal sequence. Aboutmore » 50% of the cDNAs were the [Delta] EX2, the [Delta] EX2-3, and the normal cDNAs, in a ratio of 6:3:1. Specific amplification and characterization of exon 2 and 5[prime] and 3[prime] intronic flanking sequences from the structural gene demonstrated clones with either the normal sequence or with a G[sup +1][yields]A[sup +1] transition at the exon 2/intron 2 boundary. This mutation destroyed the splice donor consensus site (U1 binding site) for mRNA processing. This transition also was present at the corresponding exon/intron boundary of the highly homologous pseudogene. This new mutation, termed [open quotes]IVS2 G[sup +1],[close quotes] is the first in the Ashkenazi Jewish population. The occurrence of this [open quotes]pseudogene[close quotes]-type mutation in the structural gene indicates the role of acid [beta]-glucosidase pseudogene and structural gene rearrangements in the pathogenesis of this disease. 33 refs., 8 figs., 1 tab.« less

A Bioinformatics-Based Alternative mRNA Splicing Code that May Explain Some Disease Mutations Is Conserved in Animals.

PubMed

Qu, Wen; Cingolani, Pablo; Zeeberg, Barry R; Ruden, Douglas M

2017-01-01

Deep sequencing of cDNAs made from spliced mRNAs indicates that most coding genes in many animals and plants have pre-mRNA transcripts that are alternatively spliced. In pre-mRNAs, in addition to invariant exons that are present in almost all mature mRNA products, there are at least 6 additional types of exons, such as exons from alternative promoters or with alternative polyA sites, mutually exclusive exons, skipped exons, or exons with alternative 5' or 3' splice sites. Our bioinformatics-based hypothesis is that, in analogy to the genetic code, there is an "alternative-splicing code" in introns and flanking exon sequences, analogous to the genetic code, that directs alternative splicing of many of the 36 types of introns. In humans, we identified 42 different consensus sequences that are each present in at least 100 human introns. 37 of the 42 top consensus sequences are significantly enriched or depleted in at least one of the 36 types of introns. We further supported our hypothesis by showing that 96 out of 96 analyzed human disease mutations that affect RNA splicing, and change alternative splicing from one class to another, can be partially explained by a mutation altering a consensus sequence from one type of intron to that of another type of intron. Some of the alternative splicing consensus sequences, and presumably their small-RNA or protein targets, are evolutionarily conserved from 50 plant to animal species. We also noticed the set of introns within a gene usually share the same splicing codes, thus arguing that one sub-type of splicesosome might process all (or most) of the introns in a given gene. Our work sheds new light on a possible mechanism for generating the tremendous diversity in protein structure by alternative splicing of pre-mRNAs.

The effects of larval habitat quality on Aedes albopictus skip oviposition

USDA-ARS?s Scientific Manuscript database

Aedes albopictus, an invasive mosquito species that transmits disease-causing pathogens, oviposits in containers in resource-limited habitats. To mitigate larval competition, Ae. albopictus females may choose to distribute eggs from a single gonotrophic cycle among multiple containers through skip o...

Correlates of meal skipping in young adults: a systematic review.

PubMed

Pendergast, Felicity J; Livingstone, Katherine M; Worsley, Anthony; McNaughton, Sarah A

2016-12-01

Meal skipping rates may be highest during young adulthood, a period of transition and development. Although these dietary behaviours may increase future risk of chronic disease, limited research has investigated correlates of meal skipping in young adults. A systematic literature search was conducted to identify studies that investigated correlates of meal skipping behaviours in young adults (aged 18-30 years). EBSCO host, MEDLINE Complete, Global Health, Scopus, EMBASE, Web of Science and Informit platforms were searched for eligible articles. Correlates were defined as any factor that was either associated with meal skipping or was self-reported by the participant to have an influence on meal skipping. Randomised controlled trials, prospective cohort studies, case-control studies, nested case-control studies, cross-sectional studies, and longitudinal studies were eligible for inclusion. Three-hundred and thirty-one articles were identified, 141 full-text articles assessed for eligibility, resulting in 35 included studies. Multiple methodological and reporting weaknesses were apparent in the reviewed studies with 28 of the 35 studies scoring a negative rating in the risk of bias assessment. Meal skipping (any meal), defined as the skipping of any meal throughout the day, was reported in 12 studies with prevalence ranging between 5 and 83%. The remaining 25 studies identified specific meals and their skipping rates, with breakfast the most frequently skipped meal 14-88% compared to lunch 8-57% and dinner 4-57%. Lack of time was consistently reported as an important correlate of meal skipping, compared with correlates such as cost and weight control, while sex was the most commonly reported associated correlate. Breakfast skipping was more common among men while lunch or dinner skipping being more common among women. This review is the first to examine potential correlates of meal skipping in young adults. Future research would benefit from stronger design and reporting strategies, using a standardised approach for measuring and defining meal skipping.

Mutations Preventing Regulated Exon Skipping in MET Cause Osteofibrous Dysplasia

PubMed Central

Gray, Mary J.; Kannu, Peter; Sharma, Swarkar; Neyt, Christine; Zhang, Dongping; Paria, Nandina; Daniel, Philip B.; Whetstone, Heather; Sprenger, Hans-Georg; Hammerschmidt, Philipp; Weng, Angela; Dupuis, Lucie; Jobling, Rebekah; Mendoza-Londono, Roberto; Dray, Michael; Su, Peiqiang; Wilson, Megan J.; Kapur, Raj P.; McCarthy, Edward F.; Alman, Benjamin A.; Howard, Andrew; Somers, Gino R.; Marshall, Christian R.; Manners, Simon; Flanagan, Adrienne M.; Rathjen, Karl E.; Karol, Lori A.; Crawford, Haemish; Markie, David M.; Rios, Jonathan J.; Wise, Carol A.; Robertson, Stephen P.

2015-01-01

The periosteum contributes to bone repair and maintenance of cortical bone mass. In contrast to the understanding of bone development within the epiphyseal growth plate, factors that regulate periosteal osteogenesis have not been studied as intensively. Osteofibrous dysplasia (OFD) is a congenital disorder of osteogenesis and is typically sporadic and characterized by radiolucent lesions affecting the cortical bone immediately under the periosteum of the tibia and fibula. We identified germline mutations in MET, encoding a receptor tyrosine kinase, that segregate with an autosomal-dominant form of OFD in three families and a mutation in a fourth affected subject from a simplex family and with bilateral disease. Mutations identified in all families with dominant inheritance and in the one simplex subject with bilateral disease abolished the splice inclusion of exon 14 in MET transcripts, which resulted in a MET receptor (METΔ14) lacking a cytoplasmic juxtamembrane domain. Splice exclusion of this domain occurs during normal embryonic development, and forced induction of this exon-exclusion event retarded osteoblastic differentiation in vitro and inhibited bone-matrix mineralization. In an additional subject with unilateral OFD, we identified a somatic MET mutation, also affecting exon 14, that substituted a tyrosine residue critical for MET receptor turnover and, as in the case of the METΔ14 mutations, had a stabilizing effect on the mature protein. Taken together, these data show that aberrant MET regulation via the juxtamembrane domain subverts core MET receptor functions that regulate osteogenesis within cortical diaphyseal bone. PMID:26637977

Genome-wide and caste-specific DNA methylomes of the ants Camponotus floridanus and Harpegnathos saltator

PubMed Central

Bonasio, Roberto; Li, Qiye; Lian, Jinmin; Mutti, Navdeep S.; Jin, Lijun; Zhao, Hongmei; Zhang, Pei; Wen, Ping; Xiang, Hui; Ding, Yun; Jin, Zonghui; Shen, Steven S.; Wang, Zongji; Wang, Wen; Wang, Jun; Berger, Shelley L.; Liebig, Jürgen; Zhang, Guojie; Reinberg, Danny

2012-01-01

SUMMARY Background Ant societies comprise individuals belonging to different castes characterized by specialized morphologies and behaviors. Because ant embryos can follow different developmental trajectories, epigenetic mechanisms must play a role in caste determination. Ants have a full set of DNA methyltransferase and their genomes contain methylcytosine. To determine the relationship between DNA methylation and phenotypic plasticity in ants, we obtained and compared the genome-wide methylomes of different castes and developmental stages of Camponotus floridanus and Harpegnathos saltator. Results In the ant genomes, methylcytosines are found both in CpG and non-CpG contexts and are strongly enriched at exons of active genes. Changes in exonic DNA methylation correlate with alternative splicing events such as exon skipping and alternative splice site selection. Several genes exhibit caste-specific and developmental changes in DNA methylation that are conserved between the two species, including genes involved in reproduction, telomere maintenance, and noncoding RNA metabolism. Several loci are methylated and expressed monoallelically, and in some cases the choice of methylated allele depends on the caste. Conclusions These first ant methylomes and their intra- and inter-species comparison reveal an exonic methylation pattern that points to a connection between DNA methylation and splicing. The presence of monoallelic DNA methylation and the methylation of non-CpG sites in all samples suggest roles in genome regulation in these social insects, including the intriguing possibility of parental or caste-specific genomic imprinting. PMID:22885060

A syndrome of microcephaly, short stature, polysyndactyly, and dental anomalies caused by a homozygous KATNB1 mutation.

PubMed

Yigit, Gökhan; Wieczorek, Dagmar; Bögershausen, Nina; Beleggia, Filippo; Möller-Hartmann, Claudia; Altmüller, Janine; Thiele, Holger; Nürnberg, Peter; Wollnik, Bernd

2016-03-01

Using whole-exome sequencing, we identified a homozygous acceptor splice-site mutation in intron 6 of the KATNB1 gene in a patient from a consanguineous Turkish family who presented with congenital microcephaly, lissencephaly, short stature, polysyndactyly, and dental abnormalities. cDNA analysis revealed complete loss of the natural acceptor splice-site resulting either in the usage of an alternative, exonic acceptor splice-site inducing a frame-shift and premature protein truncation or, to a minor extent, in complete skipping of exon 7. Both effects most likely lead to complete loss of KATNB1 function. Homozygous and compound heterozygous mutations in KATNB1 have very recently been described as a cause of microcephaly with brain malformations and seizures. We extend the KATNB1 associated phenotype by describing a syndrome characterized by primordial dwarfism, lissencephaly, polysyndactyly, and dental anomalies, which is caused by a homozygous truncating KATNB1 mutation. © 2015 Wiley Periodicals, Inc.

Characterization of three types of human alpha s1-casein mRNA transcripts.

PubMed Central

Johnsen, L B; Rasmussen, L K; Petersen, T E; Berglund, L

1995-01-01

Here we report the molecular cloning and sequencing of three types of human alpha s1-casein transcripts and present evidence indicating that exon skipping is responsible for deleted mRNA transcripts. The largest transcript comprised 981 bp encoding a signal peptide of 15 amino acids followed by the mature alpha s1-casein sequence of 170 amino acids. Human alpha s1-casein has been reported to exist naturally as a multimer in complex with kappa-casein in mature human milk, thereby being unique among alpha s1-caseins [Rasmussen, Due and Petersen (1995) Comp. Biochem. Physiol., in the press]. The present demonstration of three cysteines in the mature protein provides a molecular explanation of the interactions in this complex. Tissue-specific expression of human alpha s1-casein was indicated by Northern-blot analysis. In addition, two cryptic exons were localized in the bovine alpha s1-casein gene. Images Figure 3 PMID:7619062

A Dentin Sialophosphoprotein Mutation That Partially Disrupts a Splice Acceptor Site Causes Type II Dentin Dysplasia

PubMed Central

Lee, Sook-Kyung; Hu, Jan C.-C.; Lee, Kyung-Eun; Simmer, James P.; Kim, Jung-Wook

2009-01-01

The dentin sialophosphoprotein (DSPP) gene on chromosome 4q21.3 encodes the major noncollagenous protein in tooth dentin. DSPP mutations are the principal cause of dentin dysplasia type II, dentinogenesis imperfecta type II, and dentinogenesis imperfecta type III. We have identified a DSPP splice junction mutation (IVS2-6T>G) in a family with dentin dysplasia type II. The primary dentition is discolored brown with severe attrition. The mildly discolored permanent dentition has thistle-shaped pulp chambers, pulp stones, and eventual pulp obliteration. The mutation is in the sixth nucleotide from the end of intron 2, perfectly segregates with the disease phenotype, and is absent in 200 normal control chromosomes. An in vitro splicing assay shows that pre-mRNA splicing of the mutant allele generates wild-type mRNA and mRNA lacking exon 3 in approximately equal amounts. Skipping exon 3 might interfere with signal peptide cleavage, causing endoplasmic reticulum stress, and also reduce DSPP secretion, leading to haploinsufficiency. PMID:19026876

Splice junction mutations at the Menkes locus that maintain some proper splicing are associated with milder clinical phenotypes, including typical occipital horn syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kaler, S.G.; Gahl, W.A.

1994-09-01

Menkes disease is an X linked recessive disorder of copper metabolism produced by abnormalities in a gene that encodes a copper transporting ATPase. The clinical spectrum of Menkes disease includes a range of neurological severity from the classical type to the occipital horn syndrome (OHS) in which slightly subnormal intelligence or signs of autonomic dysfunction are the only neurologic abnormalities. We previously documented a distinctive, less severe Menkes phenotype associated with a +3 intronic splice donor mutation at the 3{prime} end of the gene in which exon skipping occurred but some normally spliced message was also detectable. We now reportmore » a similar splicing mutation in a patient with a typical OHS phenotype an A to G transition at the 2 exonic position of a splice donor site in the middle of the Menkes coding sequence. Some normally sized transcripts are evident by RT-PCR of lymphoblast mRNA from this individual, as well as 2 truncated fragments generated by exon skipping and activation of a cryptic splice acceptor site, respectively. The predicted effect of the mutation on the gene product involves a serine to glycine substitution in a noncritical region of the Menkes ATPase from the patient`s normally sized message, and premature termination due to translational frameshift in both truncated transcripts. The mutation eliminates a Dde 1 restriction site in the gene which provided a method to rapidly screen other family members, and revealed that the patient`s mother is a non-carrier. The mutational base change was not present in 25 normal X chromosomes studied. Preliminary analysis of the Menkes locus in 5 other Menkes disease families indicates aberrant mRNA splicing in 2. Our findings confirm allelism at the Menkes locus, indicate that splice mutations are relatively common mutational event in Menkes disease, and suggest that splice mutations in which some normal splicing is preserved may underlie milder Menkes disease variants, including OHS.« less

26 CFR 26.2653-1 - Taxation of multiple skips.

Code of Federal Regulations, 2013 CFR

2013-04-01

... AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2653... thereafter deemed to occupy the generation immediately above the highest generation of any person holding an... immediately after the GST, the transferor is treated as occupying the generation above the highest generation...

26 CFR 26.2653-1 - Taxation of multiple skips.

Code of Federal Regulations, 2012 CFR

2012-04-01

... AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2653... thereafter deemed to occupy the generation immediately above the highest generation of any person holding an... immediately after the GST, the transferor is treated as occupying the generation above the highest generation...

26 CFR 26.2653-1 - Taxation of multiple skips.

Code of Federal Regulations, 2014 CFR

2014-04-01

... GIFT TAXES GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2653-1... deemed to occupy the generation immediately above the highest generation of any person holding an... immediately after the GST, the transferor is treated as occupying the generation above the highest generation...

Seven novel mutations in the factor XIII A-subunit gene causing hereditary factor XIII deficiency in 10 unrelated families.

PubMed

Vysokovsky, A; Saxena, R; Landau, M; Zivelin, A; Eskaraev, R; Rosenberg, N; Seligsohn, U; Inbal, A

2004-10-01

Hereditary factor (F)XIII deficiency is a rare bleeding disorder mostly due to mutations in FXIII A subunit. We studied the molecular basis of FXIII deficiency in patients from 10 unrelated families originating from Israel, India and Tunisia. Exons 2-15 of genomic DNA consisting of coding regions and intron/exon boundaries were amplified and sequenced. Structural analysis of the mutations was undertaken by computer modeling. Seven novel mutations were identified in the FXIIIA gene. The propositus from the Ethiopian-Jewish family was found to be a compound heterozygote for two novel mutations: a 10-bp deletion in exon 12 at nucleotides 1652-1661 (followed by 22 altered amino acids and termination codon) and Ala318Val mutation. The propositus of the Tunisian family was homozygous for C insertion after nucleotide 863 within a stretch of six cytosines of exon 7. This insertion results in generation of eight altered amino acids followed by a termination codon downstream. The propositus from Indian-Jewish origin was found to be homozygous for G to T substitution at IVS 11 [+1] resulting in skipping of exons 10 and 11. In addition to the Ala318Val mutation, three of the novel mutations identified are missense mutations: Arg260Leu, Thr398Asn and Gly210Arg each occurring in a homozygous state in an Israeli-Arab and two Indian families, respectively. Structure-function correlation analysis by computer modeling of the new missense mutations predicted that Gly210Arg will cause protein misfolding, Ala318Val and Thr398Asn will interfere with the catalytic process or protein stability, and Arg260Leu will impair dimerization.

Genetic Testing Confirmed the Early Diagnosis of X-Linked Hypophosphatemic Rickets in a 7-Month-Old Infant

PubMed Central

Poon, Kok Siong; Sng, Andrew Anjian; Ho, Cindy Weili; Koay, Evelyn Siew-Chuan

2015-01-01

Loss-of-function mutations in the phosphate regulating gene with homologies to endopeptidases on the X-chromosome (PHEX) have been causally associated with X-linked hypophosphatemic rickets (XLHR). The early diagnosis of XLHR in infants is challenging when it is based solely on clinical features and biochemical findings. We report a 7-month-old boy with a family history of hypophosphatemic rickets., who demonstrated early clinical evidence of rickets, although serial biochemical findings could not definitively confirm rickets. A sequencing assay targeting the PHEX gene was first performed on the mother’s DNA to screen for mutations in the 5′UTR, 22 coding exons, and the exon-intron junctions. Targeted mutation analysis and mRNA studies were subsequently performed on the boys’ DNA to investigate the pathogenicity of the identified mutation. Genetic screening of the PHEX gene revealed a novel mutation, c.1080-2A>C, at the splice acceptor site in intron 9. The detection of an aberrant mRNA transcript with skipped (loss of) exon 10 establishes its pathogenicity and confirms the diagnosis of XLHR in this infant. Genetic testing of the PHEX gene resulted in early diagnosis of XLHR, thus enabling initiation of therapy and prevention of progressive rachitic changes in the infant. PMID:26904698

Novel MSH2 splice-site mutation in a young patient with Lynch syndrome

PubMed Central

Liccardo, Raffaella; De Rosa, Marina; Izzo, Paola; Duraturo, Francesca

2018-01-01

Lynch Syndrome (LS) is associated with germline mutations in one of the mismatch repair (MMR) genes, including MutL homolog 1 (MLH1), MutS homolog 2 (MSH2), MSH6, PMS1 homolog 2, mismatch repair system component (PMS2), MLH3 and MSH3. The mutations identified in MMR genes are point mutations or large rearrangements. The point mutations are certainly pathogenetic whether they determine formation of truncated protein. The mutations that arise in splice sites are classified as ‘likely pathogenic’ variants. In the present study, a novel splicing mutation was identified, (named c.212-1g>a), in the MSH2 gene. This novel mutation in the consensus splice site of MSH2 exon 2 leads to the loss of the canonical splice site, without skipping in-frame of exon 2; also with the formation of 2 aberrant transcripts, due to the activation of novel splice sites in exon 2. This mutation was identified in a young patient who developed colon cancer at the age of 26 years and their belongs to family that met the ‘Revised Amsterdam Criteria’. The present study provided insight into the molecular mechanism determining the pathogenicity of this novel MSH2 mutation and it reaffirms the importance of genetic testing in LS. PMID:29568967

Differential HFE Gene Expression Is Regulated by Alternative Splicing in Human Tissues

PubMed Central

Proença, Daniela; Faustino, Paula

2011-01-01

Background The pathophysiology of HFE-derived Hereditary Hemochromatosis and the function of HFE protein in iron homeostasis remain uncertain. Also, the role of alternative splicing in HFE gene expression regulation and the possible function of the corresponding protein isoforms are still unknown. The aim of this study was to gain insights into the physiological significance of these alternative HFE variants. Methodology/Principal Findings Alternatively spliced HFE transcripts in diverse human tissues were identified by RT-PCR, cloning and sequencing. Total HFE transcripts, as well as two alternative splicing transcripts were quantified using a real-time PCR methodology. Intracellular localization, trafficking and protein association of GFP-tagged HFE protein variants were analysed in transiently transfected HepG2 cells by immunoprecipitation and immunofluorescence assays. Alternatively spliced HFE transcripts present both level- and tissue-specificity. Concerning the exon 2 skipping and intron 4 inclusion transcripts, the liver presents the lowest relative level, while duodenum presents one of the highest amounts. The protein resulting from exon 2 skipping transcript is unable to associate with β2M and TfR1 and reveals an ER retention. Conversely, the intron 4 inclusion transcript gives rise to a truncated, soluble protein (sHFE) that is mostly secreted by cells to the medium in association with β2M. Conclusions/Significance HFE gene post-transcriptional regulation is clearly affected by a tissue-dependent alternative splicing mechanism. Among the corresponding proteins, a sHFE isoform stands out, which upon being secreted into the bloodstream, may act in remote tissues. It could be either an agonist or antagonist of the full length HFE, through hepcidin expression regulation in the liver or by controlling dietary iron absorption in the duodenum. PMID:21407826

Differential HFE gene expression is regulated by alternative splicing in human tissues.

PubMed

Martins, Rute; Silva, Bruno; Proença, Daniela; Faustino, Paula

2011-03-03

The pathophysiology of HFE-derived Hereditary Hemochromatosis and the function of HFE protein in iron homeostasis remain uncertain. Also, the role of alternative splicing in HFE gene expression regulation and the possible function of the corresponding protein isoforms are still unknown. The aim of this study was to gain insights into the physiological significance of these alternative HFE variants. Alternatively spliced HFE transcripts in diverse human tissues were identified by RT-PCR, cloning and sequencing. Total HFE transcripts, as well as two alternative splicing transcripts were quantified using a real-time PCR methodology. Intracellular localization, trafficking and protein association of GFP-tagged HFE protein variants were analysed in transiently transfected HepG2 cells by immunoprecipitation and immunofluorescence assays. Alternatively spliced HFE transcripts present both level- and tissue-specificity. Concerning the exon 2 skipping and intron 4 inclusion transcripts, the liver presents the lowest relative level, while duodenum presents one of the highest amounts. The protein resulting from exon 2 skipping transcript is unable to associate with β2M and TfR1 and reveals an ER retention. Conversely, the intron 4 inclusion transcript gives rise to a truncated, soluble protein (sHFE) that is mostly secreted by cells to the medium in association with β2M. HFE gene post-transcriptional regulation is clearly affected by a tissue-dependent alternative splicing mechanism. Among the corresponding proteins, a sHFE isoform stands out, which upon being secreted into the bloodstream, may act in remote tissues. It could be either an agonist or antagonist of the full length HFE, through hepcidin expression regulation in the liver or by controlling dietary iron absorption in the duodenum.

A TALEN-Exon Skipping Design for a Bethlem Myopathy Model in Zebrafish.

PubMed

Radev, Zlatko; Hermel, Jean-Michel; Elipot, Yannick; Bretaud, Sandrine; Arnould, Sylvain; Duchateau, Philippe; Ruggiero, Florence; Joly, Jean-Stéphane; Sohm, Frédéric

2015-01-01

Presently, human collagen VI-related diseases such as Ullrich congenital muscular dystrophy (UCMD) and Bethlem myopathy (BM) remain incurable, emphasizing the need to unravel their etiology and improve their treatments. In UCMD, symptom onset occurs early, and both diseases aggravate with ageing. In zebrafish fry, morpholinos reproduced early UCMD and BM symptoms but did not allow to study the late phenotype. Here, we produced the first zebrafish line with the human mutation frequently found in collagen VI-related disorders such as UCMD and BM. We used a transcription activator-like effector nuclease (TALEN) to design the col6a1ama605003-line with a mutation within an essential splice donor site, in intron 14 of the col6a1 gene, which provoke an in-frame skipping of exon 14 in the processed mRNA. This mutation at a splice donor site is the first example of a template-independent modification of splicing induced in zebrafish using a targetable nuclease. This technique is readily expandable to other organisms and can be instrumental in other disease studies. Histological and ultrastructural analyzes of homozygous and heterozygous mutant fry and 3 months post-fertilization (mpf) fish revealed co-dominantly inherited abnormal myofibers with disorganized myofibrils, enlarged sarcoplasmic reticulum, altered mitochondria and misaligned sarcomeres. Locomotion analyzes showed hypoxia-response behavior in 9 mpf col6a1 mutant unseen in 3 mpf fish. These symptoms worsened with ageing as described in patients with collagen VI deficiency. Thus, the col6a1ama605003-line is the first adult zebrafish model of collagen VI-related diseases; it will be instrumental both for basic research and drug discovery assays focusing on this type of disorders.

Exon skipping of AGAMOUS homolog PrseAG in developing double flowers of Prunus lannesiana (Rosaceae).

PubMed

Liu, Zhixiong; Zhang, Dandan; Liu, Di; Li, Fenglan; Lu, Hai

2013-02-01

KEY MESSAGE : Two transcript isoforms of AGAMOUS homologs, from single and double flower Prunus lannesiana, respectively, showed different functions. The Arabidopsis floral homeotic C function gene AGAMOUS (AG) confers stamen and carpel identity. Loss of AG function results in homeotic conversions of stamens into petals and formation of double flowers. In order to present a molecular dissection of a double-flower cultivar in Prunus lannesiana (Rosaceae), we isolated and identified a single-copy gene, AG homolog from two genetically cognate P. lannesiana bearing single and double flowers, respectively. Sequence analysis revealed that the AG homolog, prseag-1, from double flowers showed a 170-bp exon skipping as compared to PrseAG (Prunus serrulata AGAMOUS) from the single flowers. Genomic DNA sequence revealed that abnormal splicing resulted in mutant prseag-1 protein with the C-terminal AG motifs I and II deletions. In addition, protein sequence alignment and phylogenetic analyses revealed that the PrseAG was grouped into the euAG lineage. A semi-quantitative PCR analysis showed that the expression of PrseAG was restricted to reproductive organs of stamens and carpels in single flowers of P. lannesiana 'speciosa', while the prseag-1 mRNA was highly transcribed throughout the petals, stamens, and carpels in double flowers from 'Albo-rosea'. The transgenic Arabidopsis containing 35S::PrseAG displayed extremely early flowering, bigger stamens and carpels and homeotic conversion of petals into staminoid organs, but ectopic expression of prseag-1 could not mimic the phenotypic ectopic expression of PrseAG in Arabidopsis. In general, this study provides evidences to show that double flower 'Albo-rosea' is a putative C functional ag mutant in P. lannesiana.

A TALEN-Exon Skipping Design for a Bethlem Myopathy Model in Zebrafish

PubMed Central

Elipot, Yannick; Bretaud, Sandrine; Arnould, Sylvain; Duchateau, Philippe; Ruggiero, Florence; Joly, Jean-Stéphane; Sohm, Frédéric

2015-01-01

Presently, human collagen VI-related diseases such as Ullrich congenital muscular dystrophy (UCMD) and Bethlem myopathy (BM) remain incurable, emphasizing the need to unravel their etiology and improve their treatments. In UCMD, symptom onset occurs early, and both diseases aggravate with ageing. In zebrafish fry, morpholinos reproduced early UCMD and BM symptoms but did not allow to study the late phenotype. Here, we produced the first zebrafish line with the human mutation frequently found in collagen VI-related disorders such as UCMD and BM. We used a transcription activator-like effector nuclease (TALEN) to design the col6a1ama605003-line with a mutation within an essential splice donor site, in intron 14 of the col6a1 gene, which provoke an in-frame skipping of exon 14 in the processed mRNA. This mutation at a splice donor site is the first example of a template-independent modification of splicing induced in zebrafish using a targetable nuclease. This technique is readily expandable to other organisms and can be instrumental in other disease studies. Histological and ultrastructural analyzes of homozygous and heterozygous mutant fry and 3 months post-fertilization (mpf) fish revealed co-dominantly inherited abnormal myofibers with disorganized myofibrils, enlarged sarcoplasmic reticulum, altered mitochondria and misaligned sarcomeres. Locomotion analyzes showed hypoxia-response behavior in 9 mpf col6a1 mutant unseen in 3 mpf fish. These symptoms worsened with ageing as described in patients with collagen VI deficiency. Thus, the col6a1ama605003-line is the first adult zebrafish model of collagen VI-related diseases; it will be instrumental both for basic research and drug discovery assays focusing on this type of disorders. PMID:26221953

Maternal and best friends' influences on meal-skipping behaviours.

PubMed

Pearson, Natalie; Williams, Lauren; Crawford, David; Ball, Kylie

2012-09-01

Skipping meals is particularly common during adolescence and can have a detrimental effect on multiple aspects of adolescent health. Understanding the correlates of meal-skipping behaviours is important for the design of nutrition interventions. The present study examined maternal and best friends' influences on adolescent meal-skipping behaviours. Frequency of skipping breakfast, lunch and dinner was assessed using a Web-based survey completed by 3001 adolescent boys and girls from years 7 and 9 of secondary schools in Victoria, Australia. Perceived best friend and maternal meal skipping, modelling of healthy eating (eating healthy food, limiting junk food, eating fruit and vegetables) and weight watching were assessed. Best friend and maternal factors were differentially associated with meal-skipping behaviours. For example, boys and girls who perceived that their best friend often skipped meals were more likely to skip lunch (OR = 2·01, 95 % CI 1·33, 3·04 and OR = 1·93, 95 % CI 1·41, 2·65; P < 0·001). Boys and girls who perceived that their mother often skipped meals were more likely to skip breakfast (OR = 1·48, 95 % CI 1·01, 2·15; P < 0·05 and OR = 1·93, 95 % CI 1·42, 2·59; P < 0·001) and lunch (OR = 2·05, 95 % CI 1·35, 3·12 and OR = 2·02, 95 % CI 1·43, 2·86; P < 0·001). Educating adolescents on how to assess and interpret unhealthy eating behaviours that they observe from significant others may be one nutrition promotion strategy to reduce meal-skipping behaviour. The involvement of mothers may be particularly important in such efforts. Encouraging a peer subculture that promotes regular consumption of meals and educates adolescents on the detrimental impact of meal-skipping behaviour on health may also offer a promising nutrition promotion strategy.

Is breakfast skipping associated with physical activity among U.S. adolescents? A cross-sectional study of adolescents aged 12-19 years, National Health and Nutrition Examination Survey (NHANES).

PubMed

Lyerly, Jordan E; Huber, Larissa R; Warren-Findlow, Jan; Racine, Elizabeth F; Dmochowski, Jacek

2014-04-01

To examine the association between breakfast skipping and physical activity among US adolescents aged 12-19 years. A cross-sectional study of nationally representative 2007-2008 National Health and Nutrition Examination Survey (NHANES) data. Breakfast skipping was assessed by two 24 h dietary recalls. Physical activity was self-reported by participants and classified based on meeting national recommendations for physical activity for the appropriate age group. Multiple logistic regression analysis was used to model the association between breakfast skipping and physical activity while controlling for confounders. A total of 936 adolescents aged 12-19 years in the USA. After adjusting for family income, there was no association between breakfast skipping and meeting physical activity guidelines for age among adolescents aged 12-19 years (OR = 0.95, 95% CI 0.56, 1.32). Findings from the study differ from previous research findings on breakfast skipping and physical activity. Therefore, further research that uses large, nationally representative US samples and national recommended guidelines for physical activity is needed.

Social Inequalities in Young Children’s Meal Skipping Behaviors: The Generation R Study

PubMed Central

Wijtzes, Anne I.; Jansen, Wilma; Jaddoe, Vincent W. V.; Franco, Oscar H.; Hofman, Albert; van Lenthe, Frank J.; Raat, Hein

2015-01-01

Background Regular meal consumption is considered an important aspect of a healthy diet. While ample evidence shows social inequalities in breakfast skipping among adolescents, little is known about social inequalities in breakfast skipping and skipping of other meals among young school-aged children. Such information is crucial in targeting interventions aimed to promote a healthy diet in children. Methods We examined data from 4704 ethnically diverse children participating in the Generation R Study, a population-based prospective cohort study in Rotterdam, the Netherlands. Information on family socioeconomic position (SEP), ethnic background, and meal skipping behaviors was assessed by parent-reported questionnaire when the child was 6 years old. Multiple logistic regression analyses were performed to assess the associations of family SEP (educational level, household income, employment status, family composition) and ethnic background with meal skipping behaviors, using high SEP children and native Dutch children as reference groups. Results Meal skipping prevalence ranged from 3% (dinner) to 11% (lunch). The prevalence of meal skipping was higher among low SEP children and ethnic minority children. Maternal educational level was independently associated with breakfast skipping ([low maternal educational level] OR: 2.21; 95% CI: 1.24,3.94). Paternal educational level was independently associated with lunch skipping ([low paternal educational level] OR: 1.53; 95% CI: 1.06,2.20) and dinner skipping ([mid-high paternal educational level] OR: 0.39; 95% CI: 0.20,0.76). Household income was independently associated with breakfast skipping ([low income] OR: 2.43, 95% CI: 1.40,4.22) and dinner skipping ([low income] OR: 2.44; 95% CI: 1.22,4.91). In general, ethnic minority children were more likely to skip breakfast, lunch, and dinner compared with native Dutch children. Adjustment for family SEP attenuated the associations of ethnic minority background with meal skipping behaviors considerably. Conclusion Low SEP children and ethnic minority children are at an increased risk of breakfast, lunch, and dinner skipping compared with high SEP children and native Dutch children, respectively. Given these inequalities, interventions aimed to promote regular meal consumption, breakfast consumption in particular, should target children from low socioeconomic groups and ethnic minority children. More qualitative research to investigate the pathways underlying social inequalities in children’s meal skipping behaviors is warranted. PMID:26225757

Social Inequalities in Young Children's Meal Skipping Behaviors: The Generation R Study.

PubMed

Wijtzes, Anne I; Jansen, Wilma; Jaddoe, Vincent W V; Franco, Oscar H; Hofman, Albert; van Lenthe, Frank J; Raat, Hein

2015-01-01

Regular meal consumption is considered an important aspect of a healthy diet. While ample evidence shows social inequalities in breakfast skipping among adolescents, little is known about social inequalities in breakfast skipping and skipping of other meals among young school-aged children. Such information is crucial in targeting interventions aimed to promote a healthy diet in children. We examined data from 4704 ethnically diverse children participating in the Generation R Study, a population-based prospective cohort study in Rotterdam, the Netherlands. Information on family socioeconomic position (SEP), ethnic background, and meal skipping behaviors was assessed by parent-reported questionnaire when the child was 6 years old. Multiple logistic regression analyses were performed to assess the associations of family SEP (educational level, household income, employment status, family composition) and ethnic background with meal skipping behaviors, using high SEP children and native Dutch children as reference groups. Meal skipping prevalence ranged from 3% (dinner) to 11% (lunch). The prevalence of meal skipping was higher among low SEP children and ethnic minority children. Maternal educational level was independently associated with breakfast skipping ([low maternal educational level] OR: 2.21; 95% CI: 1.24,3.94). Paternal educational level was independently associated with lunch skipping ([low paternal educational level] OR: 1.53; 95% CI: 1.06,2.20) and dinner skipping ([mid-high paternal educational level] OR: 0.39; 95% CI: 0.20,0.76). Household income was independently associated with breakfast skipping ([low income] OR: 2.43, 95% CI: 1.40,4.22) and dinner skipping ([low income] OR: 2.44; 95% CI: 1.22,4.91). In general, ethnic minority children were more likely to skip breakfast, lunch, and dinner compared with native Dutch children. Adjustment for family SEP attenuated the associations of ethnic minority background with meal skipping behaviors considerably. Low SEP children and ethnic minority children are at an increased risk of breakfast, lunch, and dinner skipping compared with high SEP children and native Dutch children, respectively. Given these inequalities, interventions aimed to promote regular meal consumption, breakfast consumption in particular, should target children from low socioeconomic groups and ethnic minority children. More qualitative research to investigate the pathways underlying social inequalities in children's meal skipping behaviors is warranted.

Lnx2 ubiquitin ligase is essential for exocrine cell differentiation in the early zebrafish pancreas

PubMed Central

Won, Minho; Ro, Hyunju; Dawid, Igor B.

2015-01-01

The gene encoding the E3 ubiquitin ligase Ligand of Numb protein-X (Lnx)2a is expressed in the ventral-anterior pancreatic bud of zebrafish embryos in addition to its expression in the brain. Knockdown of Lnx2a by using an exon 2/intron 2 splice morpholino resulted in specific inhibition of the differentiation of ventral bud derived exocrine cell types, with little effect on endocrine cell types. A frame shifting null mutation in lnx2a did not mimic this phenotype, but a mutation that removed the exon 2 splice donor site did. We found that Lnx2b functions in a redundant manner with its paralog Lnx2a. Inhibition of lnx2a exon 2/3 splicing causes exon 2 skipping and leads to the production of an N-truncated protein that acts as an interfering molecule. Thus, the phenotype characterized by inhibition of exocrine cell differentiation requires inactivation of both Lnx2a and Lnx2b. Human LNX1 is known to destabilize Numb, and we show that inhibition of Numb expression rescues the Lnx2a/b-deficient phenotype. Further, Lnx2a/b inhibition leads to a reduction in the number of Notch active cells in the pancreas. We suggest that Lnx2a/b function to fine tune the regulation of Notch through Numb in the differentiation of cell types in the early zebrafish pancreas. Further, the complex relationships among genotype, phenotype, and morpholino effect in this case may be instructive in the ongoing consideration of morpholino use. PMID:26392552

Lnx2 ubiquitin ligase is essential for exocrine cell differentiation in the early zebrafish pancreas.

PubMed

Won, Minho; Ro, Hyunju; Dawid, Igor B

2015-10-06

The gene encoding the E3 ubiquitin ligase Ligand of Numb protein-X (Lnx)2a is expressed in the ventral-anterior pancreatic bud of zebrafish embryos in addition to its expression in the brain. Knockdown of Lnx2a by using an exon 2/intron 2 splice morpholino resulted in specific inhibition of the differentiation of ventral bud derived exocrine cell types, with little effect on endocrine cell types. A frame shifting null mutation in lnx2a did not mimic this phenotype, but a mutation that removed the exon 2 splice donor site did. We found that Lnx2b functions in a redundant manner with its paralog Lnx2a. Inhibition of lnx2a exon 2/3 splicing causes exon 2 skipping and leads to the production of an N-truncated protein that acts as an interfering molecule. Thus, the phenotype characterized by inhibition of exocrine cell differentiation requires inactivation of both Lnx2a and Lnx2b. Human LNX1 is known to destabilize Numb, and we show that inhibition of Numb expression rescues the Lnx2a/b-deficient phenotype. Further, Lnx2a/b inhibition leads to a reduction in the number of Notch active cells in the pancreas. We suggest that Lnx2a/b function to fine tune the regulation of Notch through Numb in the differentiation of cell types in the early zebrafish pancreas. Further, the complex relationships among genotype, phenotype, and morpholino effect in this case may be instructive in the ongoing consideration of morpholino use.

SplicingTypesAnno: annotating and quantifying alternative splicing events for RNA-Seq data.

PubMed

Sun, Xiaoyong; Zuo, Fenghua; Ru, Yuanbin; Guo, Jiqiang; Yan, Xiaoyan; Sablok, Gaurav

2015-04-01

Alternative splicing plays a key role in the regulation of the central dogma. Four major types of alternative splicing have been classified as intron retention, exon skipping, alternative 5 splice sites or alternative donor sites, and alternative 3 splice sites or alternative acceptor sites. A few algorithms have been developed to detect splice junctions from RNA-Seq reads. However, there are few tools targeting at the major alternative splicing types at the exon/intron level. This type of analysis may reveal subtle, yet important events of alternative splicing, and thus help gain deeper understanding of the mechanism of alternative splicing. This paper describes a user-friendly R package, extracting, annotating and analyzing alternative splicing types for sequence alignment files from RNA-Seq. SplicingTypesAnno can: (1) provide annotation for major alternative splicing at exon/intron level. By comparing the annotation from GTF/GFF file, it identifies the novel alternative splicing sites; (2) offer a convenient two-level analysis: genome-scale annotation for users with high performance computing environment, and gene-scale annotation for users with personal computers; (3) generate a user-friendly web report and additional BED files for IGV visualization. SplicingTypesAnno is a user-friendly R package for extracting, annotating and analyzing alternative splicing types at exon/intron level for sequence alignment files from RNA-Seq. It is publically available at https://sourceforge.net/projects/splicingtypes/files/ or http://genome.sdau.edu.cn/research/software/SplicingTypesAnno.html. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

SEPTIN12 Genetic Variants Confer Susceptibility to Teratozoospermia

PubMed Central

Lin, Ying-Hung; Wang, Ya-Yun; Chen, Hau-Inh; Kuo, Yung-Che; Chiou, Yu-Wei; Lin, Hsi-Hui; Wu, Ching-Ming; Hsu, Chao-Chin; Chiang, Han-Sun; Kuo, Pao-Lin

2012-01-01

It is estimated that 10–15% of couples are infertile and male factors account for about half of these cases. With the advent of intracytoplasmic sperm injection (ICSI), many infertile men have been able to father offspring. However, teratozoospermia still remains a big challenge to tackle. Septins belong to a family of cytoskeletal proteins with GTPase activity and are involved in various biological processes e.g. morphogenesis, compartmentalization, apoptosis and cytokinesis. SEPTIN12, identified by c-DNA microarray analysis of infertile men, is exclusively expressed in the post meiotic male germ cells. Septin12+/+/Septin12+/− chimeric mice have multiple reproductive defects including the presence of immature sperm in the semen, and sperm with bent neck (defect of the annulus) and nuclear DNA damage. These facts make SEPTIN12 a potential sterile gene in humans. In this study, we sequenced the entire coding region of SEPTIN12 in infertile men (n = 160) and fertile controls (n = 200) and identified ten variants. Among them is the c.474 G>A variant within exon 5 that encodes part of the GTP binding domain. The variant creates a novel splice donor site that causes skipping of a portion of exon 5, resulting in a truncated protein lacking the C-terminal half of SEPTIN12. Most individuals homozygous for the c.474 A allele had teratozoospermia (abnormal sperm <14%) and their sperm showed bent tail and de-condensed nucleus with significant DNA damage. Ex vivo experiment showed truncated SEPT12 inhibits filament formation in a dose-dependent manner. This study provides the first causal link between SEPTIN12 genetic variant and male infertility with distinctive sperm pathology. Our finding also suggests vital roles of SEPT12 in sperm nuclear integrity and tail development. PMID:22479503

Local restoration of dystrophin expression with the morpholino oligomer AVI-4658 in Duchenne muscular dystrophy: a single-blind, placebo-controlled, dose-escalation, proof-of-concept study

PubMed Central

Kinali, Maria; Arechavala-Gomeza, Virginia; Feng, Lucy; Cirak, Sebahattin; Hunt, David; Adkin, Carl; Guglieri, Michela; Ashton, Emma; Abbs, Stephen; Nihoyannopoulos, Petros; Garralda, Maria Elena; Rutherford, Mary; Mcculley, Caroline; Popplewell, Linda; Graham, Ian R; Dickson, George; Wood, Matthew JA; Wells, Dominic J; Wilton, Steve D; Kole, Ryszard; Straub, Volker; Bushby, Kate; Sewry, Caroline; Morgan, Jennifer E; Muntoni, Francesco

2009-01-01

Summary Background Mutations that disrupt the open reading frame and prevent full translation of DMD, the gene that encodes dystrophin, underlie the fatal X-linked disease Duchenne muscular dystrophy. Oligonucleotides targeted to splicing elements (splice switching oligonucleotides) in DMD pre-mRNA can lead to exon skipping, restoration of the open reading frame, and the production of functional dystrophin in vitro and in vivo, which could benefit patients with this disorder. Methods We did a single-blind, placebo-controlled, dose-escalation study in patients with DMD recruited nationally, to assess the safety and biochemical efficacy of an intramuscular morpholino splice-switching oligonucleotide (AVI-4658) that skips exon 51 in dystrophin mRNA. Seven patients with Duchenne muscular dystrophy with deletions in the open reading frame of DMD that are responsive to exon 51 skipping were selected on the basis of the preservation of their extensor digitorum brevis (EDB) muscle seen on MRI and the response of cultured fibroblasts from a skin biopsy to AVI-4658. AVI-4658 was injected into the EDB muscle; the contralateral muscle received saline. Muscles were biopsied between 3 and 4 weeks after injection. The primary endpoint was the safety of AVI-4658 and the secondary endpoint was its biochemical efficacy. This trial is registered, number NCT00159250. Findings Two patients received 0·09 mg AVI-4658 in 900 μL (0·9%) saline and five patients received 0·9 mg AVI-4658 in 900 μL saline. No adverse events related to AVI-4658 administration were reported. Intramuscular injection of the higher-dose of AVI-4658 resulted in increased dystrophin expression in all treated EDB muscles, although the results of the immunostaining of EDB-treated muscle for dystrophin were not uniform. In the areas of the immunostained sections that were adjacent to the needle track through which AVI-4658 was given, 44–79% of myofibres had increased expression of dystrophin. In randomly chosen sections of treated EDB muscles, the mean intensity of dystrophin staining ranged from 22% to 32% of the mean intensity of dystrophin in healthy control muscles (mean 26·4%), and the mean intensity was 17% (range 11–21%) greater than the intensity in the contralateral saline-treated muscle (one-sample paired t test p=0·002). In the dystrophin-positive fibres, the intensity of dystrophin staining was up to 42% of that in healthy muscle. We showed expression of dystrophin at the expected molecular weight in the AVI-4658-treated muscle by immunoblot. Interpretation Intramuscular AVI-4658 was safe and induced the expression of dystrophin locally within treated muscles. This proof-of-concept study has led to an ongoing systemic clinical trial of AVI-4658 in patients with DMD. Funding UK Department of Health. PMID:19713152

Nonparametric Multiple Imputation for Questionnaires with Individual Skip Patterns and Constraints: The Case of Income Imputation in The National Educational Panel Study

ERIC Educational Resources Information Center

Aßmann, Christian; Würbach, Ariane; Goßmann, Solange; Geissler, Ferdinand; Bela, Anika

2017-01-01

Large-scale surveys typically exhibit data structures characterized by rich mutual dependencies between surveyed variables and individual-specific skip patterns. Despite high efforts in fieldwork and questionnaire design, missing values inevitably occur. One approach for handling missing values is to provide multiply imputed data sets, thus…

Bi-specific splice-switching PMO oligonucleotides conjugated via a single peptide active in a mouse model of Duchenne muscular dystrophy

PubMed Central

Shabanpoor, Fazel; McClorey, Graham; Saleh, Amer F.; Järver, Peter; Wood, Matthew J.A.; Gait, Michael J.

2015-01-01

The potential for therapeutic application of splice-switching oligonucleotides (SSOs) to modulate pre-mRNA splicing is increasingly evident in a number of diseases. However, the primary drawback of this approach is poor cell and in vivo oligonucleotide uptake efficacy. Biological activities can be significantly enhanced through the use of synthetically conjugated cationic cell penetrating peptides (CPPs). Studies to date have focused on the delivery of a single SSO conjugated to a CPP, but here we describe the conjugation of two phosphorodiamidate morpholino oligonucleotide (PMO) SSOs to a single CPP for simultaneous delivery and pre-mRNA targeting of two separate genes, exon 23 of the Dmd gene and exon 5 of the Acvr2b gene, in a mouse model of Duchenne muscular dystrophy. Conjugations of PMOs to a single CPP were carried out through an amide bond in one case and through a triazole linkage (‘click chemistry’) in the other. The most active bi-specific CPP–PMOs demonstrated comparable exon skipping levels for both pre-mRNA targets when compared to individual CPP–PMO conjugates both in cell culture and in vivo in the mdx mouse model. Thus, two SSOs with different target sequences conjugated to a single CPP are biologically effective and potentially suitable for future therapeutic exploitation. PMID:25468897

A novel whole exon deletion in WWOX gene causes early epilepsy, intellectual disability and optic atrophy.

PubMed

Ben-Salem, Salma; Al-Shamsi, Aisha M; John, Anne; Ali, Bassam R; Al-Gazali, Lihadh

2015-05-01

Recent studies have implicated the WW domain-containing oxidoreductase encoding gene (WWOX) in a severe form of autosomal recessive neurological disorder. This condition showed an overlapping spectrum of clinical features including spinocerebellar ataxia associated with generalized seizures and delayed psychomotor development to growth retardation, spasticity, and microcephaly. We evaluated a child from a consanguineous Emirati family that presented at birth with growth retardation, microcephaly, epileptic seizures, and later developed spasticity and delayed psychomotor development. Screening for deletions and duplications using whole-chromosomal microarray analysis identified a novel homozygous microdeletion encompassing exon 5 of the WWOX gene. Analysis of parental DNA indicated that this deletion was inherited from both parents and lies within a large region of homozygosity. Sanger sequencing of the cDNA showed that the deletion resulted in exon 5 skipping leading to a frame-shift and creating a premature stop codon at amino acid position 212. Quantification of mRNA revealed striking low level of WWOX expression in the child and moderate level of expression in the mother compared to a healthy control. To the best of our knowledge, this is the first homozygous germline structural variation in WWOX gene resulting in truncated transcripts that were presumably subject to NMD pathway. Our findings extend the clinical and genetic spectrum of WWOX mutations and support a crucial role of this gene in neurological development.

Splicing predictions reliably classify different types of alternative splicing

PubMed Central

Busch, Anke; Hertel, Klemens J.

2015-01-01

Alternative splicing is a key player in the creation of complex mammalian transcriptomes and its misregulation is associated with many human diseases. Multiple mRNA isoforms are generated from most human genes, a process mediated by the interplay of various RNA signature elements and trans-acting factors that guide spliceosomal assembly and intron removal. Here, we introduce a splicing predictor that evaluates hundreds of RNA features simultaneously to successfully differentiate between exons that are constitutively spliced, exons that undergo alternative 5′ or 3′ splice-site selection, and alternative cassette-type exons. Surprisingly, the splicing predictor did not feature strong discriminatory contributions from binding sites for known splicing regulators. Rather, the ability of an exon to be involved in one or multiple types of alternative splicing is dictated by its immediate sequence context, mainly driven by the identity of the exon's splice sites, the conservation around them, and its exon/intron architecture. Thus, the splicing behavior of human exons can be reliably predicted based on basic RNA sequence elements. PMID:25805853

Ten Novel Mutations in Chinese Patients with Megalencephalic Leukoencephalopathy with Subcortical Cysts and a Long-Term Follow-Up Research

PubMed Central

Cao, Binbin; Yan, Huifang; Guo, Mangmang; Xie, Han; Wu, Ye; Gu, Qiang; Xiao, Jiangxi; Shang, Jing; Yang, Yanling; Xiong, Hui; Niu, Zhengping; Wu, Xiru; Jiang, Yuwu; Wang, Jingmin

2016-01-01

Objective Megalencephalic leukoencephalopathy with subcortical cysts (MLC, OMIM 604004) is a rare neurological deterioration disease. We aimed to clarify clinical and genetic features of Chinese MLC patients. Methods Clinical information and peripheral venous blood of 20 patients and their families were collected, Sanger-sequencing and Multiple Ligation-dependent Probe Amplification were performed to make genetic analysis. Splicing-site mutation was confirmed with RT-PCR. UPD was detected by haplotype analysis. Follow-up study was performed through telephone for 27 patients. Results Out of 20 patients, macrocephaly, classic MRI features, motor development delay and cognitive impairment were detected in 20(100%), 20(100%), 17(85%) and 4(20%) patients, respectively. 20(100%) were clinically diagnosed with MLC. 19(95%) were genetically diagnosed with 10 novel mutations in MLC1, MLC1 and GlialCAM mutations were identified in 15 and 4 patients, respectively. Deletion mutation from exon4 to exon9 and a homozygous point mutation due to maternal UPD of chromosome22 in MLC1 were found firstly. c.598-2A>C in MLC1 leads to the skip of exon8. c.772-1G>C in MLC1 accounting for 15.5%(9/58) alleles in Chinese patients might be a founder or a hot-spot mutation. Out of 27 patients in the follow-up study, head circumference was ranged from 56cm to 61cm in patients older than 5yeas old, with a median of 57cm. Motor development delay and cognitive impairment were detected in 22(81.5%) and 5(18.5%) patients, respectively. Motor and cognitive deterioration was found in 5 (18.5%) and 2 patients (7.4%), respectively. Improvements and MRI recovery were first found in Chinese patients. Rate of seizures (45.5%), transient motor retrogress (45.5%) and unconsciousness (13.6%) after head trauma was much higher than that after fever (18.2%, 9.1%, 0%, respectively). Significance It’s a clinical and genetic analysis and a follow-up study for largest sample of Chinese MLC patients, identifying 10 novel mutations, expanding mutation spectrums and discovering clinical features of Chinese MLC patients. PMID:27322623

SAM68 is a physiological regulator of SMN2 splicing in spinal muscular atrophy

PubMed Central

Pagliarini, Vittoria; Pelosi, Laura; Bustamante, Maria Blaire; Nobili, Annalisa; Berardinelli, Maria Grazia; D’Amelio, Marcello; Musarò, Antonio

2015-01-01

Spinal muscular atrophy (SMA) is a neurodegenerative disease caused by loss of motor neurons in patients with null mutations in the SMN1 gene. The almost identical SMN2 gene is unable to compensate for this deficiency because of the skipping of exon 7 during pre–messenger RNA (mRNA) processing. Although several splicing factors can modulate SMN2 splicing in vitro, the physiological regulators of this disease-causing event are unknown. We found that knockout of the splicing factor SAM68 partially rescued body weight and viability of SMAΔ7 mice. Ablation of SAM68 function promoted SMN2 splicing and expression in SMAΔ7 mice, correlating with amelioration of SMA-related defects in motor neurons and skeletal muscles. Mechanistically, SAM68 binds to SMN2 pre-mRNA, favoring recruitment of the splicing repressor hnRNP A1 and interfering with that of U2AF65 at the 3′ splice site of exon 7. These findings identify SAM68 as the first physiological regulator of SMN2 splicing in an SMA mouse model. PMID:26438828

Novel mechanism of conjoined gene formation in the human genome.

PubMed

Kim, Ryong Nam; Kim, Aeri; Choi, Sang-Haeng; Kim, Dae-Soo; Nam, Seong-Hyeuk; Kim, Dae-Won; Kim, Dong-Wook; Kang, Aram; Kim, Min-Young; Park, Kun-Hyang; Yoon, Byoung-Ha; Lee, Kang Seon; Park, Hong-Seog

2012-03-01

Recently, conjoined genes (CGs) have emerged as important genetic factors necessary for understanding the human genome. However, their formation mechanism and precise structures have remained mysterious. Based on a detailed structural analysis of 57 human CG transcript variants (CGTVs, discovered in this study) and all (833) known CGs in the human genome, we discovered that the poly(A) signal site from the upstream parent gene region is completely removed via the skipping or truncation of the final exon; consequently, CG transcription is terminated at the poly(A) signal site of the downstream parent gene. This result led us to propose a novel mechanism of CG formation: the complete removal of the poly(A) signal site from the upstream parent gene is a prerequisite for the CG transcriptional machinery to continue transcribing uninterrupted into the intergenic region and downstream parent gene. The removal of the poly(A) signal sequence from the upstream gene region appears to be caused by a deletion or truncation mutation in the human genome rather than post-transcriptional trans-splicing events. With respect to the characteristics of CG sequence structures, we found that intergenic regions are hot spots for novel exon creation during CGTV formation and that exons farther from the intergenic regions are more highly conserved in the CGTVs. Interestingly, many novel exons newly created within the intergenic and intragenic regions originated from transposable element sequences. Additionally, the CGTVs showed tumor tissue-biased expression. In conclusion, our study provides novel insights into the CG formation mechanism and expands the present concepts of the genetic structural landscape, gene regulation, and gene formation mechanisms in the human genome.

Altered Pre-mRNA Splicing Caused by a Novel Intronic Mutation c.1443+5G>A in the Dihydropyrimidinase (DPYS) Gene

PubMed Central

Nakajima, Yoko; Meijer, Judith; Zhang, Chunhua; Wang, Xu; Kondo, Tomomi; Ito, Tetsuya; Dobritzsch, Doreen; Van Kuilenburg, André B. P.

2016-01-01

Dihydropyrimidinase (DHP) deficiency is an autosomal recessive disease caused by mutations in the DPYS gene. Patients present with highly elevated levels of dihydrouracil and dihydrothymine in their urine, blood and cerebrospinal fluid. The analysis of the effect of mutations in DPYS on pre-mRNA splicing is hampered by the fact that DHP is primarily expressed in liver and kidney cells. The minigene approach can detect mRNA splicing aberrations using cells that do not express the endogenous mRNA. We have used a minigene-based approach to analyze the effects of a presumptive pre-mRNA splicing mutation in two newly identified Chinese pediatric patients with DHP deficiency. Mutation analysis of DPYS showed that both patients were compound heterozygous for a novel intronic mutation c.1443+5G>A in intron 8 and a previously described missense mutation c.1001A>G (p.Q334R) in exon 6. Wild-type and the mutated minigene constructs, containing exons 7, 8 and 9 of DPYS, yielded different splicing products after expression in HEK293 cells. The c.1443+5G>A mutation resulted in altered pre-mRNA splicing of the DPYS minigene construct with full skipping of exon 8. Analysis of the DHP crystal structure showed that the deletion of exon 8 severely affects folding, stability and homooligomerization of the enzyme as well as disruption of the catalytic site. Thus, the analysis suggests that the c.1443+5G>A mutation results in aberrant splicing of the pre-mRNA encoding DHP, underlying the DHP deficiency in two unrelated Chinese patients. PMID:26771602

Altered Pre-mRNA Splicing Caused by a Novel Intronic Mutation c.1443+5G>A in the Dihydropyrimidinase (DPYS) Gene.

PubMed

Nakajima, Yoko; Meijer, Judith; Zhang, Chunhua; Wang, Xu; Kondo, Tomomi; Ito, Tetsuya; Dobritzsch, Doreen; Van Kuilenburg, André B P

2016-01-12

Dihydropyrimidinase (DHP) deficiency is an autosomal recessive disease caused by mutations in the DPYS gene. Patients present with highly elevated levels of dihydrouracil and dihydrothymine in their urine, blood and cerebrospinal fluid. The analysis of the effect of mutations in DPYS on pre-mRNA splicing is hampered by the fact that DHP is primarily expressed in liver and kidney cells. The minigene approach can detect mRNA splicing aberrations using cells that do not express the endogenous mRNA. We have used a minigene-based approach to analyze the effects of a presumptive pre-mRNA splicing mutation in two newly identified Chinese pediatric patients with DHP deficiency. Mutation analysis of DPYS showed that both patients were compound heterozygous for a novel intronic mutation c.1443+5G>A in intron 8 and a previously described missense mutation c.1001A>G (p.Q334R) in exon 6. Wild-type and the mutated minigene constructs, containing exons 7, 8 and 9 of DPYS, yielded different splicing products after expression in HEK293 cells. The c.1443+5G>A mutation resulted in altered pre-mRNA splicing of the DPYS minigene construct with full skipping of exon 8. Analysis of the DHP crystal structure showed that the deletion of exon 8 severely affects folding, stability and homooligomerization of the enzyme as well as disruption of the catalytic site. Thus, the analysis suggests that the c.1443+5G>A mutation results in aberrant splicing of the pre-mRNA encoding DHP, underlying the DHP deficiency in two unrelated Chinese patients.

ATP-binding cassette subfamily A, member 4 intronic variants c.4773+3A>G and c.5461-10T>C cause Stargardt disease due to defective splicing.

PubMed

Jonsson, Frida; Westin, Ida Maria; Österman, Lennart; Sandgren, Ola; Burstedt, Marie; Holmberg, Monica; Golovleva, Irina

2018-02-20

Inherited retinal dystrophies (IRDs) represent a group of progressive conditions affecting the retina. There is a great genetic heterogeneity causing IRDs, and to date, more than 260 genes are associated with IRDs. Stargardt disease, type 1 (STGD1) or macular degeneration with flecks, STGD1 represents a disease with early onset, central visual impairment, frequent appearance of yellowish flecks and mutations in the ATP-binding cassette subfamily A, member 4 (ABCA4) gene. A large number of intronic sequence variants in ABCA4 have been considered pathogenic although their functional effect was seldom demonstrated. In this study, we aimed to reveal how intronic variants present in patients with Stargardt from the same Swedish family affect splicing. The splicing of the ABCA4 gene was studied in human embryonic kidney cells, HEK293T, and in human retinal pigment epithelium cells, ARPE-19, using a minigene system containing variants c.4773+3A>G and c.5461-10T>C. We showed that both ABCA4 variants, c.4773+3A>G and c.5461-10T>C, cause aberrant splicing of the ABCA4 minigene resulting in exon skipping. We also demonstrated that splicing of ABCA4 has different outcomes depending on transfected cell type. Two intronic variants c.4773+3A>G and c.5461-10T>C, both predicted to affect splicing, are indeed disease-causing mutations due to skipping of exons 33, 34, 39 and 40 of ABCA4 gene. The experimental proof that ABCA4 mutations in STGD patients affect protein function is crucial for their inclusion to future clinical trials; therefore, functional testing of all ABCA4 intronic variants associated with Stargardt disease by minigene technology is desirable. © 2018 Acta Ophthalmologica Scandinavica Foundation. Published by John Wiley & Sons Ltd.

Genetic diagnosis of familial hypercholesterolaemia: the importance of functional analysis of potential splice-site mutations.

PubMed

Bourbon, M; Duarte, M A; Alves, A C; Medeiros, A M; Marques, L; Soutar, A K

2009-05-01

Familial hypercholesterolemia (FH) results from defective low-density lipoprotein receptor (LDLR) activity, mainly due to LDLR gene defects. Of the many different LDLR mutations found in patients with FH, about 6% of single base substitutions are located near or within introns, and are predicted to result in exon skipping, retention of an intron, or activation of cryptic sites during mRNA splicing. This paper reports on the Portuguese FH Study, which found 10 such mutations, 6 of them novel. For the mutations that have not been described before or those whose effect on function have not been analysed, their effect on splicing was investigated, using reverse transcriptase PCR analysis of LDLR mRNA from freshly isolated blood mononuclear cells. Two of these variants (c.313+6 T-->C, c.2389G-->T (p.V776L)) caused exon skipping, and one caused retention of an intron (c.1359-5C-->G), whereas two others (c.2140+5 G-->A and c.1061-8T-->C) had no apparent effect. Any effect of c.1185G-->C (p.V374V) on splicing could not be determined because it was on an allele with a promoter mutation (-42C-->G) that was probably not transcribed. Variants in four patients lost to follow-up could not be tested experimentally, but they almost certainly affect splicing because they disrupt the invariant AG or GT in acceptor (c.818-2A-->G) or donor (c.1060+1G-->A, c.1845+1delG and c.2547+1G-->A) spice sites. These findings emphasise that care must be taken before reporting the presence or absence of a splice-site mutation in the LDLR gene for diagnostic purposes. The study also shows that relatively simple, quick and inexpensive RNA assays can evaluate putative splicing mutations that are not always predictable by available software, thereby reducing genetic misdiagnosis of patients with FH.

The sequence, structure and evolutionary features of HOTAIR in mammals

PubMed Central

2011-01-01

Background An increasing number of long noncoding RNAs (lncRNAs) have been identified recently. Different from all the others that function in cis to regulate local gene expression, the newly identified HOTAIR is located between HoxC11 and HoxC12 in the human genome and regulates HoxD expression in multiple tissues. Like the well-characterised lncRNA Xist, HOTAIR binds to polycomb proteins to methylate histones at multiple HoxD loci, but unlike Xist, many details of its structure and function, as well as the trans regulation, remain unclear. Moreover, HOTAIR is involved in the aberrant regulation of gene expression in cancer. Results To identify conserved domains in HOTAIR and study the phylogenetic distribution of this lncRNA, we searched the genomes of 10 mammalian and 3 non-mammalian vertebrates for matches to its 6 exons and the two conserved domains within the 1800 bp exon6 using Infernal. There was just one high-scoring hit for each mammal, but many low-scoring hits were found in both mammals and non-mammalian vertebrates. These hits and their flanking genes in four placental mammals and platypus were examined to determine whether HOTAIR contained elements shared by other lncRNAs. Several of the hits were within unknown transcripts or ncRNAs, many were within introns of, or antisense to, protein-coding genes, and conservation of the flanking genes was observed only between human and chimpanzee. Phylogenetic analysis revealed discrete evolutionary dynamics for orthologous sequences of HOTAIR exons. Exon1 at the 5' end and a domain in exon6 near the 3' end, which contain domains that bind to multiple proteins, have evolved faster in primates than in other mammals. Structures were predicted for exon1, two domains of exon6 and the full HOTAIR sequence. The sequence and structure of two fragments, in exon1 and the domain B of exon6 respectively, were identified to robustly occur in predicted structures of exon1, domain B of exon6 and the full HOTAIR in mammals. Conclusions HOTAIR exists in mammals, has poorly conserved sequences and considerably conserved structures, and has evolved faster than nearby HoxC genes. Exons of HOTAIR show distinct evolutionary features, and a 239 bp domain in the 1804 bp exon6 is especially conserved. These features, together with the absence of some exons and sequences in mouse, rat and kangaroo, suggest ab initio generation of HOTAIR in marsupials. Structure prediction identifies two fragments in the 5' end exon1 and the 3' end domain B of exon6, with sequence and structure invariably occurring in various predicted structures of exon1, the domain B of exon6 and the full HOTAIR. PMID:21496275

Congenital analbuminemia caused by a novel aberrant splicing in the albumin gene.

PubMed

Caridi, Gianluca; Dagnino, Monica; Erdeve, Omer; Di Duca, Marco; Yildiz, Duran; Alan, Serdar; Atasay, Begum; Arsan, Saadet; Campagnoli, Monica; Galliano, Monica; Minchiotti, Lorenzo

2014-01-01

Congenital analbuminemia is a rare autosomal recessive disorder manifested by the presence of a very low amount of circulating serum albumin. It is an allelic heterogeneous defect, caused by variety of mutations within the albumin gene in homozygous or compound heterozygous state. Herein we report the clinical and molecular characterization of a new case of congenital analbuminemia diagnosed in a female newborn of consanguineous (first degree cousins) parents from Ankara, Turkey, who presented with a low albumin concentration (< 8 g/L) and severe clinical symptoms. The albumin gene of the index case was screened by single-strand conformation polymorphism, heteroduplex analysis, and direct DNA sequencing. The effect of the splicing mutation was evaluated by examining the cDNA obtained by reverse transcriptase - polymerase chain reaction (RT-PCR) from the albumin mRNA extracted from proband's leukocytes. DNA sequencing revealed that the proband is homozygous, and both parents are heterozygous, for a novel G>A transition at position c.1652+1, the first base of intron 12, which inactivates the strongly conserved GT dinucleotide at the 5' splice site consensus sequence of this intron. The splicing defect results in the complete skipping of the preceding exon (exon 12) and in a frame-shift within exon 13 with a premature stop codon after the translation of three mutant amino acid residues. Our results confirm the clinical diagnosis of congenital analbuminemia in the proband and the inheritance of the trait and contribute to shed light on the molecular genetics of analbuminemia.

Identification of an elaborate NK-specific system regulating HLA-C expression

PubMed Central

Ivarsson, Martin A.; Walker-Sperling, Victoria E.; Subleski, Jeff; Johnson, Jenna K.; Wright, Paul W.; Carrington, Mary; McVicar, Daniel W.

2018-01-01

The HLA-C gene appears to have evolved in higher primates to serve as a dominant source of ligands for the KIR2D family of inhibitory MHC class I receptors. The expression of NK cell-intrinsic MHC class I has been shown to regulate the murine Ly49 family of MHC class I receptors due to the interaction of these receptors with NK cell MHC in cis. However, cis interactions have not been demonstrated for the human KIR and HLA proteins. We report the discovery of an elaborate NK cell-specific system regulating HLA-C expression, indicating an important role for HLA-C in the development and function of NK cells. A large array of alternative transcripts with differences in intron/exon content are generated from an upstream NK-specific HLA-C promoter, and exon content varies between HLA-C alleles due to SNPs in splice donor/acceptor sites. Skipping of the first coding exon of HLA-C generates a subset of untranslatable mRNAs, and the proportion of untranslatable HLA-C mRNA decreases as NK cells mature, correlating with increased protein expression by mature NK cells. Polymorphism in a key Ets-binding site of the NK promoter has generated HLA-C alleles that lack significant promoter activity, resulting in reduced HLA-C expression and increased functional activity. The NK-intrinsic regulation of HLA-C thus represents a novel mechanism controlling the lytic activity of NK cells during development. PMID:29329284

A Splice Defect in the EDA Gene in Dogs with an X-Linked Hypohidrotic Ectodermal Dysplasia (XLHED) Phenotype.

PubMed

Waluk, Dominik P; Zur, Gila; Kaufmann, Ronnie; Welle, Monika M; Jagannathan, Vidhya; Drögemüller, Cord; Müller, Eliane J; Leeb, Tosso; Galichet, Arnaud

2016-09-08

X-linked hypohidrotic ectodermal dysplasia (XLHED) caused by variants in the EDA gene represents the most common ectodermal dysplasia in humans. We investigated three male mixed-breed dogs with an ectodermal dysplasia phenotype characterized by marked hypotrichosis and multifocal complete alopecia, almost complete absence of sweat and sebaceous glands, and altered dentition with missing and abnormally shaped teeth. Analysis of SNP chip genotypes and whole genome sequence data from the three affected dogs revealed that the affected dogs shared the same haplotype on a large segment of the X-chromosome, including the EDA gene. Unexpectedly, the whole genome sequence data did not reveal any nonsynonymous EDA variant in the affected dogs. We therefore performed an RNA-seq experiment on skin biopsies to search for changes in the transcriptome. This analysis revealed that the EDA transcript in the affected dogs lacked 103 nucleotides encoded by exon 2. We speculate that this exon skipping is caused by a genetic variant located in one of the large introns flanking this exon, which was missed by whole genome sequencing with the illumina short read technology. The altered EDA transcript splicing most likely causes the observed ectodermal dysplasia in the affected dogs. These dogs thus offer an excellent opportunity to gain insights into the complex splicing processes required for expression of the EDA gene, and other genes with large introns. Copyright © 2016 Waluk et al.

Tannic acid facilitates expression of the polypyrimidine tract binding protein and alleviates deleterious inclusion of CHRNA1 exon P3A due to an hnRNP H-disrupting mutation in congenital myasthenic syndrome

PubMed Central

Bian, Yang; Masuda, Akio; Matsuura, Tohru; Ito, Mikako; Okushin, Kazuya; Engel, Andrew G.; Ohno, Kinji

2009-01-01

We recently reported that the intronic splice-site mutation IVS3-8G>A of CHRNA1 that encodes the muscle nicotinic acetylcholine receptor α subunit disrupts binding of a splicing repressor, hnRNP H. This, in turn, results in exclusive inclusion of the downstream exon P3A. The P3A(+) transcript encodes a non-functional α subunit that comprises 50% of the transcripts in normal human skeletal muscle, but its functional significance remains undetermined. In an effort to search for a potential therapy, we screened off-label effects of 960 bioactive chemical compounds and found that tannic acid ameliorates the aberrant splicing due to IVS3-8G>A but without altering the expression of hnRNP H. Therefore, we searched for another splicing trans-factor. We found that the polypyrimidine tract binding protein (PTB) binds close to the 3′ end of CHRNA1 intron 3, that PTB induces skipping of exon P3A and that tannic acid increases the expression of PTB in a dose-dependent manner. Deletion assays of the PTB promoter region revealed that the tannic acid-responsive element is between positions −232 and −74 from the translation initiation site. These observations open the door to the discovery of novel therapies based on PTB overexpression and to detecting possible untoward effects of the overexpression. PMID:19147685

Early Clinical Diagnosis of PC1/3 Deficiency in a Patient With a Novel Homozygous PCSK1 Splice-Site Mutation.

PubMed

Härter, Bettina; Fuchs, Irene; Müller, Thomas; Akbulut, Ulas Emre; Cakir, Murat; Janecke, Andreas R

2016-04-01

Autosomal recessive proprotein convertase 1/3 (PC1/3) deficiency, caused by mutations in the PCSK1 gene, is characterized by severe congenital malabsorptive diarrhea, early-onset obesity, and certain endocrine abnormalities. We suspected PC1/3 deficiency in a 4-month-old girl based on the presence of congenital diarrhea and polyuria. Sequencing the whole coding region and splice sites detected a novel homozygous PCSK1 splice-site mutation, c.544-2A>G, in the patient. The mutation resulted in the skipping of exon 5, the generation of a premature termination codon, and nonsense-mediated PCSK1 messenger ribonucleic acid decay, which was demonstrated in complementary DNA derived from fibroblasts.

Neonatal Marfan Syndrome: Report of a Case with an Inherited Splicing Mutation outside the Neonatal Domain

PubMed Central

Le Gloan, Laurianne; Hauet, Quentin; David, Albert; Hanna, Nadine; Arfeuille, Chloé; Arnaud, Pauline; Boileau, Catherine; Romefort, Bénédicte; Benbrik, Nadir; Gournay, Véronique; Joram, Nicolas; Baron, Olivier; Isidor, Bertrand

2016-01-01

We report a child and her mother affected by Marfan syndrome. The child presented with a phenotype of neonatal Marfan syndrome, revealed by acute and refractory heart failure, finally leading to death within the first 4 months of life. Her mother had a common clinical presentation. Genetic analysis revealed an inherited FBN1 mutation. This intronic mutation (c.6163+3_6163+6del), undescribed to date, leads to exon 49 skipping, corresponding to in-frame deletion of 42 amino acids (p.Ile2014_Asp2055del). FBN1 next-generation sequencing did not show any argument for mosaicism. Association in the same family of severe neonatal and classical Marfan syndrome illustrates the intrafamilial phenotype variability. PMID:27022329

Neonatal Marfan Syndrome: Report of a Case with an Inherited Splicing Mutation outside the Neonatal Domain.

PubMed

Le Gloan, Laurianne; Hauet, Quentin; David, Albert; Hanna, Nadine; Arfeuille, Chloé; Arnaud, Pauline; Boileau, Catherine; Romefort, Bénédicte; Benbrik, Nadir; Gournay, Véronique; Joram, Nicolas; Baron, Olivier; Isidor, Bertrand

2016-02-01

We report a child and her mother affected by Marfan syndrome. The child presented with a phenotype of neonatal Marfan syndrome, revealed by acute and refractory heart failure, finally leading to death within the first 4 months of life. Her mother had a common clinical presentation. Genetic analysis revealed an inherited FBN1 mutation. This intronic mutation (c.6163+3_6163+6del), undescribed to date, leads to exon 49 skipping, corresponding to in-frame deletion of 42 amino acids (p.Ile2014_Asp2055del). FBN1 next-generation sequencing did not show any argument for mosaicism. Association in the same family of severe neonatal and classical Marfan syndrome illustrates the intrafamilial phenotype variability.

The MicroRNA miR-124 promotes neuronal differentiation by triggering brain-specific alternative pre-mRNA splicing.

PubMed

Makeyev, Eugene V; Zhang, Jiangwen; Carrasco, Monica A; Maniatis, Tom

2007-08-03

Both microRNAs and alternative pre-mRNA splicing have been implicated in the development of the nervous system (NS), but functional interactions between these two pathways are poorly understood. We demonstrate that the neuron-specific microRNA miR-124 directly targets PTBP1 (PTB/hnRNP I) mRNA, which encodes a global repressor of alternative pre-mRNA splicing in nonneuronal cells. Among the targets of PTBP1 is a critical cassette exon in the pre-mRNA of PTBP2 (nPTB/brPTB/PTBLP), an NS-enriched PTBP1 homolog. When this exon is skipped, PTBP2 mRNA is subject to nonsense-mediated decay (NMD). During neuronal differentiation, miR-124 reduces PTBP1 levels, leading to the accumulation of correctly spliced PTBP2 mRNA and a dramatic increase in PTBP2 protein. These events culminate in the transition from non-NS to NS-specific alternative splicing patterns. We also present evidence that miR-124 plays a key role in the differentiation of progenitor cells to mature neurons. Thus, miR-124 promotes NS development, at least in part by regulating an intricate network of NS-specific alternative splicing.

Becker muscular dystrophy due to an intronic splicing mutation inducing a dual dystrophin transcript.

PubMed

Todeschini, Alice; Gualandi, Francesca; Trabanelli, Cecilia; Armaroli, Annarita; Ravani, Anna; Fanin, Marina; Rota, Silvia; Bello, Luca; Ferlini, Alessandra; Pegoraro, Elena; Padovani, Alessandro; Filosto, Massimiliano

2016-10-01

We describe a 29-year-old patient who complained of left thigh muscle weakness since he was 23 and of moderate proximal weakness of both lower limbs with difficulty in climbing stairs and running since he was 27. Mild weakness of iliopsoas and quadriceps muscles and muscle atrophy of both the distal forearm and thigh were observed upon clinical examination. He harboured a novel c.1150-3C>G substitution in the DMD gene, affecting the intron 10 acceptor splice site and causing exon 11 skipping and an out-of-frame transcript. However, protein of normal molecular weight but in reduced amounts was observed on Western Blot analysis. Reverse transcription analysis on muscle RNA showed production, via alternative splicing, of a transcript missing exon 11 as well as a low abundant full-length transcript which is enough to avoid the severe Duchenne phenotype. Our study showed that a reduced amount of full length dystrophin leads to a mild form of Becker muscular dystrophy. These results confirm earlier findings that low amounts of dystrophin can be associated with a milder phenotype, which is promising for therapies aiming at dystrophin restoration. Copyright © 2016 Elsevier B.V. All rights reserved.

Correlating In Vitro Splice Switching Activity With Systemic In Vivo Delivery Using Novel ZEN-modified Oligonucleotides.

PubMed

Hammond, Suzan M; McClorey, Graham; Nordin, Joel Z; Godfrey, Caroline; Stenler, Sofia; Lennox, Kim A; Smith, C I Edvard; Jacobi, Ashley M; Varela, Miguel A; Lee, Yi; Behlke, Mark A; Wood, Matthew J A; Andaloussi, Samir E L

2014-11-25

Splice switching oligonucleotides (SSOs) induce alternative splicing of pre-mRNA and typically employ chemical modifications to increase nuclease resistance and binding affinity to target pre-mRNA. Here we describe a new SSO non-base modifier (a naphthyl-azo group, "ZEN™") to direct exon exclusion in mutant dystrophin pre-mRNA to generate functional dystrophin protein. The ZEN modifier is placed near the ends of a 2'-O-methyl (2'OMe) oligonucleotide, increasing melting temperature and potency over unmodified 2'OMe oligonucleotides. In cultured H2K cells, a ZEN-modified 2'OMe phosphorothioate (PS) oligonucleotide delivered by lipid transfection greatly enhanced dystrophin exon skipping over the same 2'OMePS SSO lacking ZEN. However, when tested using free gymnotic uptake in vitro and following systemic delivery in vivo in dystrophin deficient mdx mice, the same ZEN-modified SSO failed to enhance potency. Importantly, we show for the first time that in vivo activity of anionic SSOs is modelled in vitro only when using gymnotic delivery. ZEN is thus a novel modifier that enhances activity of SSOs in vitro but will require improved delivery methods before its in vivo clinical potential can be realized.

SMARCB1/INI1 maternal germ line mosaicism in schwannomatosis.

PubMed

Hulsebos, T J M; Kenter, S B; Jakobs, M E; Baas, F; Chong, B; Delatycki, M B

2010-01-01

Schwannomatosis is characterized by the development of multiple schwannomas of the nervous system, but without the occurrence of vestibular schwannomas. Most cases of schwannomatosis are thought to be sporadic, representing the first case in a family due to a new mutation in the causative gene. We recently identified SMARCB1/INI1 as a schwannomatosis-predisposing gene. Here, we analyzed this gene in a schwannomatosis family with two affected children, but with clinically unaffected parents. Both affected individuals carried a constitutional SMARCB1 mutation, c.1118+ 1G>A, that changes the donor splice site sequence of intron 8, causing skipping of exon 8 and resulting in the in-frame deletion of 132 nucleotides in the transcript. The mutation was not evident in constitutional DNA of the parents. Haplotyping revealed that the chromosome 22 segment that carries the mutant SMARCB1 allele originated from the mother. She transferred the same chromosome 22 segment, however, with a wild-type SMARCB1 copy, to a third unaffected child. Our findings indicate that the mother is germ line mosaic for the SMARCB1 mutation. In conclusion, our study shows for the first time that germ line mosaicism may occur in schwannomatosis, which has implications for genetic counseling in this disease.

Factors associated with skipping breakfast among Inner Mongolia medical students in China.

PubMed

Sun, Juan; Yi, He; Liu, Zhiyue; Wu, Yan; Bian, Jiang; Wu, Yanyan; Eshita, Yuki; Li, Gaimei; Zhang, Qing; Yang, Ying

2013-01-17

Few studies on the breakfast consumption habits of medical students in China have been carried out. The aim of the present study was to determine the prevalence of skipping breakfast and factors associated with skipping breakfast among medical students in Inner Mongolia of China, and to assist in the design of interventions to improve breakfast consumption habits of medical college students in this region. From December 2010 to January 2011 a cross-sectional survey was conducted among medical students in the Inner Mongolia Medical College using a self-administered questionnaire. The prevalence of skipping breakfast in relation to lifestyle habits was described and factors associated with breakfast consumption were identified using multiple logistic regression analysis. The overall prevalence of skipping breakfast was 41.7% and 23.5% for males and females, respectively. The Faculty of Medicine Information Management had the highest breakfast skipping prevalence. Logistic regression models found that the main factors associated with breakfast consumption habits among medical students were gender, class years of education, monthly expenses, faculty, appetite, sleeping quality, and the learning process; monthly expenses, sleeping quality, and the learning process showed a dose-dependent relationship. Breakfast consumption was associated with many factors, most importantly monthly expenses, sleeping quality and the learning process. The prevalence of skipping breakfast is significantly higher compared recently reported figures for medical students in western countries and other areas of China. Improvement of breakfast education should be considered for students in which higher monthly expenses, poor sleeping quality, or a laborious learning process have been identified.

Functional importance of different patterns of correlation between adjacent cassette exons in human and mouse.

PubMed

Peng, Tao; Xue, Chenghai; Bi, Jianning; Li, Tingting; Wang, Xiaowo; Zhang, Xuegong; Li, Yanda

2008-04-26

Alternative splicing expands transcriptome diversity and plays an important role in regulation of gene expression. Previous studies focus on the regulation of a single cassette exon, but recent experiments indicate that multiple cassette exons within a gene may interact with each other. This interaction can increase the potential to generate various transcripts and adds an extra layer of complexity to gene regulation. Several cases of exon interaction have been discovered. However, the extent to which the cassette exons coordinate with each other remains unknown. Based on EST data, we employed a metric of correlation coefficients to describe the interaction between two adjacent cassette exons and then categorized these exon pairs into three different groups by their interaction (correlation) patterns. Sequence analysis demonstrates that strongly-correlated groups are more conserved and contain a higher proportion of pairs with reading frame preservation in a combinatorial manner. Multiple genome comparison further indicates that different groups of correlated pairs have different evolutionary courses: (1) The vast majority of positively-correlated pairs are old, (2) most of the weakly-correlated pairs are relatively young, and (3) negatively-correlated pairs are a mixture of old and young events. We performed a large-scale analysis of interactions between adjacent cassette exons. Compared with weakly-correlated pairs, the strongly-correlated pairs, including both the positively and negatively correlated ones, show more evidence that they are under delicate splicing control and tend to be functionally important. Additionally, the positively-correlated pairs bear strong resemblance to constitutive exons, which suggests that they may evolve from ancient constitutive exons, while negatively and weakly correlated pairs are more likely to contain newly emerging exons.

A single digital droplet PCR assay to detect multiple KIT exon 11 mutations in tumor and plasma from patients with gastrointestinal stromal tumors.

PubMed

Boonstra, Pieter A; Ter Elst, Arja; Tibbesma, Marco; Bosman, Lisette J; Mathijssen, Ron; Atrafi, Florence; van Coevorden, Frits; Steeghs, Neeltje; Farag, Sheima; Gelderblom, Hans; van der Graaf, Winette T A; Desar, Ingrid M E; Maier, Jacqueline; Overbosch, Jelle; Suurmeijer, Albert J H; Gietema, Jourik; Schuuring, Ed; Reyners, Anna K L

2018-03-02

Gastrointestinal stromal tumors (GISTs) are characterized by oncogenic KIT mutations that cluster in two exon 11 hotspots. The aim of this study was to develop a single, sensitive, quantitative digital droplet PCR (ddPCR) assay for the detection of common exon 11 mutations in both GIST tumor tissue and in circulating tumor DNA (ctDNA) isolated from GIST patients' plasma. A ddPCR assay was designed using two probes that cover both hotspots. Available archival FFPE tumor tissue from 27 consecutive patients with known KIT exon 11 mutations and 9 randomly selected patients without exon 11 mutations were tested. Plasma samples were prospectively collected in a multicenter bio-databank from December 2014. ctDNA was analyzed of 22 patients with an exon 11 mutation and a baseline plasma sample. The ddPCR assay detected the exon 11 mutation in 21 of 22 tumors with exon 11 mutations covered by the assay. Mutations in ctDNA were detected at baseline in 13 of 14 metastasized patients, but in only 1 of 8 patients with localized disease. In serial plasma samples from 11 patients with metastasized GIST, a decrease in mutant droplets was detected during treatment. According to RECIST 1.1, 10 patients had radiological treatment response and one patient stable disease. A single ddPCR assay for the detection of multiple exon 11 mutations in ctDNA is a feasible, promising tool for monitoring treatment response in patients with metastasized GIST and should be further evaluated in a larger cohort.

DHPLC-based mutation analysis of ENG and ALK-1 genes in HHT Italian population.

PubMed

Lenato, Gennaro M; Lastella, Patrizia; Di Giacomo, Marilena C; Resta, Nicoletta; Suppressa, Patrizia; Pasculli, Giovanna; Sabbà, Carlo; Guanti, Ginevra

2006-02-01

Hereditary haemorrhagic telangiectasia (HHT or Rendu-Osler-Weber syndrome) is an autosomal dominant disorder characterized by localized angiodysplasia due to mutations in endoglin, ALK-1 gene, and a still unidentified locus. The lack of highly recurrent mutations, locus heterogeneity, and the presence of mutations in almost all coding exons of the two genes makes the screening for mutations time-consuming and costly. In the present study, we developed a DHPLC-based protocol for mutation detection in ALK1 and ENG genes through retrospective analysis of known sequence variants, 20 causative mutations and 11 polymorphisms, and a prospective analysis on 47 probands with unknown mutation. Overall DHPLC analysis identified the causative mutation in 61 out 66 DNA samples (92.4%). We found 31 different mutations in the ALK1 gene, of which 15 are novel, and 20, of which 12 are novel, in the ENG gene, thus providing for the first time the mutational spectrum in a cohort of Italian HHT patients. In addition, we characterized the splicing pattern of ALK1 gene in lymphoblastoid cells, both in normal controls and in two individuals carrying a mutation in the non-invariant -3 position of the acceptor splice site upstream exon 6 (c.626-3C>G). Functional essay demonstrated the existence, also in normal individuals, of a small proportion of ALK1 alternative splicing, due to exon 5 skipping, and the presence of further aberrant splicing isoforms in the individuals carrying the c.626-3C>G mutation. 2006 Wiley-Liss, Inc.

Congenital analbuminemia caused by a novel aberrant splicing in the albumin gene

PubMed Central

Caridi, Gianluca; Dagnino, Monica; Erdeve, Omer; Di Duca, Marco; Yildiz, Duran; Alan, Serdar; Atasay, Begum; Arsan, Saadet; Campagnoli, Monica; Galliano, Monica; Minchiotti, Lorenzo

2014-01-01

Introduction: Congenital analbuminemia is a rare autosomal recessive disorder manifested by the presence of a very low amount of circulating serum albumin. It is an allelic heterogeneous defect, caused by variety of mutations within the albumin gene in homozygous or compound heterozygous state. Herein we report the clinical and molecular characterization of a new case of congenital analbuminemia diagnosed in a female newborn of consanguineous (first degree cousins) parents from Ankara, Turkey, who presented with a low albumin concentration (< 8 g/L) and severe clinical symptoms. Materials and methods: The albumin gene of the index case was screened by single-strand conformation polymorphism, heteroduplex analysis, and direct DNA sequencing. The effect of the splicing mutation was evaluated by examining the cDNA obtained by reverse transcriptase - polymerase chain reaction (RT-PCR) from the albumin mRNA extracted from proband’s leukocytes. Results: DNA sequencing revealed that the proband is homozygous, and both parents are heterozygous, for a novel G>A transition at position c.1652+1, the first base of intron 12, which inactivates the strongly conserved GT dinucleotide at the 5′ splice site consensus sequence of this intron. The splicing defect results in the complete skipping of the preceding exon (exon 12) and in a frame-shift within exon 13 with a premature stop codon after the translation of three mutant amino acid residues. Conclusions: Our results confirm the clinical diagnosis of congenital analbuminemia in the proband and the inheritance of the trait and contribute to shed light on the molecular genetics of analbuminemia. PMID:24627724

Infertility due to congenital absence of vas deferens in mainly caused by variable exon 9 skipping of the CFTR gene in heterozygous males for cystic fibrosis mutations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chillon, M.; Casals, T.; Nunes, V.

1994-09-01

About 65% or the individuals with congenital bilateral absence of the vas deferens (CBAVD) have mutations in at least one of the CFTR alleles. We have studied the phenotypic effects of the CFTR gene intron 8 polyT tract 5T allele in 90 CBAVD subjects and in parents of CF patients. This group was compared with normal individuals, and with fathers and mothers of CF patients. Allele 5T was significantly associated with CBAVD (19.6%) when compared to the general population (5.2%) ({chi}{sup 2} = 33.3%; p<<0.0001). It was represented poorly in fathers of CF patients (1.3%). Mutations were identified in onemore » (60%) or both CFTR alleles (8.9%) of CBAVD patients. Heterozygosity for the 5T allele was strongly associated with heterozygosity for CF mutations ({chi}{sup 2} = 10.9; p<0.0004). The strong correlation between allele 5T and CBAVD, together with the low frequency of this allele in fathers of CF patients, demonstrates that variable {Delta}exon 9 produces infertility in males if associated with a CF mutation on the other chromosome. The 30% of CBAVD cases with only one CFTR mutation and without a 5T-allele may be due to other molecular mechanisms involving CFTR, distinct from {Delta}exon 9. Since there is a relatively high proportion of CBAVD without CF mutations (25%), other gene(s), distinct from CFTR, may have a role in the CBAVD phenotype.« less

Splicing-related single nucleotide polymorphism of RAB, member of RAS oncogene family like 2B (RABL2B) jeopardises semen quality in Chinese Holstein bulls.

PubMed

Wang, Xiuge; Cui, Xiaohui; Zhang, Yan; Hao, Haisheng; Ju, Zhihua; Liu, Deyu; Jiang, Qiang; Yang, Chunhong; Sun, Yan; Wang, Changfa; Huang, Jinming; Zhu, Huabin

2017-11-01

RAB, member of RAS oncogene family like 2B (RABL2B) is a member of a poorly characterised clade of the RAS GTPase superfamily, which plays an essential role in male fertility, sperm intraflagellar transport and tail assembly. In the present study, we identified a novel RABL2B splice variant in bovine testis and spermatozoa. This splice variant, designated RABL2B-TV, is characterised by exon 2 skipping. Moreover, a single nucleotide polymorphism (SNP), namely c.125G>A, was found within the exonic splicing enhancer (ESE) motif, indicating that the SNP caused the production of the RABL2B-TV aberrant splice variant. This was demonstrated by constructing a pSPL3 exon capturing vector with different genotypes and transfecting these vectors into murine Leydig tumour cell line (MLTC-1) cells. Expression of the RABL2B-TV transcript was lower in semen from high- versus low-performance bulls. Association analysis showed that sperm deformity rate was significantly lower in Chinese Holstein bulls with the GG or GA genotype than in bulls with the AA genotype (P<0.05). In addition, initial sperm motility was significantly higher in individuals with the GG or GA genotype than in individuals with the AA genotype (P<0.05). The findings of the present study suggest that the difference in semen quality in bulls with different RABL2B genotypes is generated via an alternative splicing mechanism caused by a functional SNP within the ESE motif.

A novel ALMS1 splice mutation in a non-obese juvenile-onset insulin-dependent syndromic diabetic patient

PubMed Central

Sanyoura, May; Woudstra, Cédric; Halaby, George; Baz, Patrick; Senée, Valérie; Guillausseau, Pierre-Jean; Zalloua, Pierre; Julier, Cécile

2014-01-01

Insulin-dependent juvenile-onset diabetes may occur in the context of rare syndromic presentations suggesting monogenic inheritance rather than common multifactorial autoimmune type 1 diabetes. Here, we report the case of a Lebanese patient diagnosed with juvenile-onset insulin-dependent diabetes presenting ketoacidosis, early-onset retinopathy with optic atrophy, hearing loss, diabetes insipidus, epilepsy, and normal weight and stature, who later developed insulin resistance. Despite similarities with Wolfram syndrome, we excluded the WFS1 gene as responsible for this disease. Using combined linkage and candidate gene study, we selected ALMS1, responsible for Alström syndrome, as a candidate gene. We identified a novel splice mutation in intron 18 located 3 bp before the intron–exon junction (IVS18-3T>G), resulting in exon 19 skipping and consequent frameshift generating a truncated protein (V3958fs3964X). The clinical presentation of the patient significantly differed from typical Alström syndrome by the absence of truncal obesity and short stature, and by the presence of ketoacidotic insulin-dependent diabetes, optic atrophy and diabetes insipidus. Our observation broadens the clinical spectrum of Alström syndrome and suggests that ALMS1 mutations may be considered in patients who initially present with an acute onset of insulin-dependent diabetes. PMID:23652376

Human Splicing Finder: an online bioinformatics tool to predict splicing signals.

PubMed

Desmet, François-Olivier; Hamroun, Dalil; Lalande, Marine; Collod-Béroud, Gwenaëlle; Claustres, Mireille; Béroud, Christophe

2009-05-01

Thousands of mutations are identified yearly. Although many directly affect protein expression, an increasing proportion of mutations is now believed to influence mRNA splicing. They mostly affect existing splice sites, but synonymous, non-synonymous or nonsense mutations can also create or disrupt splice sites or auxiliary cis-splicing sequences. To facilitate the analysis of the different mutations, we designed Human Splicing Finder (HSF), a tool to predict the effects of mutations on splicing signals or to identify splicing motifs in any human sequence. It contains all available matrices for auxiliary sequence prediction as well as new ones for binding sites of the 9G8 and Tra2-beta Serine-Arginine proteins and the hnRNP A1 ribonucleoprotein. We also developed new Position Weight Matrices to assess the strength of 5' and 3' splice sites and branch points. We evaluated HSF efficiency using a set of 83 intronic and 35 exonic mutations known to result in splicing defects. We showed that the mutation effect was correctly predicted in almost all cases. HSF could thus represent a valuable resource for research, diagnostic and therapeutic (e.g. therapeutic exon skipping) purposes as well as for global studies, such as the GEN2PHEN European Project or the Human Variome Project.

Human Splicing Finder: an online bioinformatics tool to predict splicing signals

PubMed Central

Desmet, François-Olivier; Hamroun, Dalil; Lalande, Marine; Collod-Béroud, Gwenaëlle; Claustres, Mireille; Béroud, Christophe

2009-01-01

Thousands of mutations are identified yearly. Although many directly affect protein expression, an increasing proportion of mutations is now believed to influence mRNA splicing. They mostly affect existing splice sites, but synonymous, non-synonymous or nonsense mutations can also create or disrupt splice sites or auxiliary cis-splicing sequences. To facilitate the analysis of the different mutations, we designed Human Splicing Finder (HSF), a tool to predict the effects of mutations on splicing signals or to identify splicing motifs in any human sequence. It contains all available matrices for auxiliary sequence prediction as well as new ones for binding sites of the 9G8 and Tra2-β Serine-Arginine proteins and the hnRNP A1 ribonucleoprotein. We also developed new Position Weight Matrices to assess the strength of 5′ and 3′ splice sites and branch points. We evaluated HSF efficiency using a set of 83 intronic and 35 exonic mutations known to result in splicing defects. We showed that the mutation effect was correctly predicted in almost all cases. HSF could thus represent a valuable resource for research, diagnostic and therapeutic (e.g. therapeutic exon skipping) purposes as well as for global studies, such as the GEN2PHEN European Project or the Human Variome Project. PMID:19339519

ISS-N1 makes the First FDA-approved Drug for Spinal Muscular Atrophy

PubMed Central

Ottesen, Eric W.

2017-01-01

Abstract Spinal muscular atrophy (SMA) is one of the leading genetic diseases of children and infants. SMA is caused by deletions or mutations of Survival Motor Neuron 1 (SMN1) gene. SMN2, a nearly identical copy of SMN1, cannot compensate for the loss of SMN1 due to predominant skipping of exon 7. While various regulatory elements that modulate SMN2 exon 7 splicing have been proposed, intronic splicing silencer N1 (ISS-N1) has emerged as the most promising target thus far for antisense oligonucleotide-mediated splicing correction in SMA. Upon procuring exclusive license from the University of Massachussets Medical School in 2010, Ionis Pharmaceuticals (formerly ISIS Pharamaceuticals) began clinical development of Spinraza™ (synonyms: Nusinersen, IONIS-SMNRX, ISIS-SMNRX), an antisense drug based on ISS-N1 target. Spinraza™ showed very promising results at all steps of the clinical development and was approved by US Food and Drug Administration (FDA) on December 23, 2016. Spinraza™ is the first FDA-approved treatment for SMA and the first antisense drug to restore expression of a fully functional protein via splicing correction. The success of Spinraza™ underscores the potential of intronic sequences as promising therapeutic targets and sets the stage for further improvement of antisense drugs based on advanced oligonucleotide chemistries and delivery protocols. PMID:28400976

The MicroRNA miR-124 Promotes Neuronal Differentiation by Triggering Brain-Specific Alternative Pre-mRNA Splicing

PubMed Central

Makeyev, Eugene V.; Zhang, Jiangwen; Carrasco, Monica A.; Maniatis, Tom

2011-01-01

SUMMARY Both microRNAs and alternative pre-mRNA splicing have been implicated in the development of the nervous system (NS), but functional interactions between these two pathways are poorly understood. We demonstrate that the neuron-specific microRNA miR-124 directly targets PTBP1 (PTB/hnRNP I) mRNA, which encodes a global repressor of alternative pre-mRNA splicing in nonneuronal cells. Among the targets of PTBP1 is a critical cassette exon in the pre-mRNA of PTBP2 (nPTB/brPTB/PTBLP), an NS-enriched PTBP1 homolog. When this exon is skipped, PTBP2 mRNA is subject to nonsense-mediated decay (NMD). During neuronal differentiation, miR-124 reduces PTBP1 levels, leading to the accumulation of correctly spliced PTBP2 mRNA and a dramatic increase in PTBP2 protein. These events culminate in the transition from non-NS to NS-specific alternative splicing patterns. We also present evidence that miR-124 plays a key role in the differentiation of progenitor cells to mature neurons. Thus, miR-124 promotes NS development, at least in part by regulating an intricate network of NS-specific alternative splicing. PMID:17679093

Cationic PMMA nanoparticles bind and deliver antisense oligoribonucleotides allowing restoration of dystrophin expression in the mdx mouse.

PubMed

Rimessi, Paola; Sabatelli, Patrizia; Fabris, Marina; Braghetta, Paola; Bassi, Elena; Spitali, Pietro; Vattemi, Gaetano; Tomelleri, Giuliano; Mari, Lara; Perrone, Daniela; Medici, Alessandro; Neri, Marcella; Bovolenta, Matteo; Martoni, Elena; Maraldi, Nadir M; Gualandi, Francesca; Merlini, Luciano; Ballestri, Marco; Tondelli, Luisa; Sparnacci, Katia; Bonaldo, Paolo; Caputo, Antonella; Laus, Michele; Ferlini, Alessandra

2009-05-01

For subsets of Duchenne muscular dystrophy (DMD) mutations, antisense oligoribonucleotide (AON)-mediated exon skipping has proven to be efficacious in restoring the expression of dystrophin protein. In the mdx murine model systemic delivery of AON, recognizing the splice donor of dystrophin exon 23, has shown proof of concept. Here, we show that using cationic polymethylmethacrylate (PMMA) (marked as T1) nanoparticles loaded with a low dose of 2'-O-methyl-phosphorothioate (2'OMePS) AON delivered by weekly intraperitoneal (IP) injection (0.9 mg/kg/week), could restore dystrophin expression in body-wide striated muscles. Delivery of an identical dose of naked AON did not result in detectable dystrophin expression. Transcription, western, and immunohistochemical analysis showed increased levels of dystrophin transcript and protein, and correct localization at the sarcolemma. This study shows that T1 nanoparticles have the capacity to bind and convoy AONs in body-wide muscle tissues and to reduce the dose required for dystrophin rescue. By immunofluorescence and electron microscopy studies, we highlighted the diffusion pathways of this compound. This nonviral approach may valuably improve the therapeutic usage of AONs in DMD as well as the delivery of RNA molecules with many implications in both basic research and medicine.

A comprehensive approach to identification of pathogenic FANCA variants in Fanconi anemia patients and their families.

PubMed

Kimble, Danielle C; Lach, Francis P; Gregg, Siobhan Q; Donovan, Frank X; Flynn, Elizabeth K; Kamat, Aparna; Young, Alice; Vemulapalli, Meghana; Thomas, James W; Mullikin, James C; Auerbach, Arleen D; Smogorzewska, Agata; Chandrasekharappa, Settara C

2018-02-01

Fanconi anemia (FA) is a rare recessive DNA repair deficiency resulting from mutations in one of at least 22 genes. Two-thirds of FA families harbor mutations in FANCA. To genotype patients in the International Fanconi Anemia Registry (IFAR) we employed multiple methodologies, screening 216 families for FANCA mutations. We describe identification of 57 large deletions and 261 sequence variants, in 159 families. All but seven families harbored distinct combinations of two mutations demonstrating high heterogeneity. Pathogenicity of the 18 novel missense variants was analyzed functionally by determining the ability of the mutant cDNA to improve the survival of a FANCA-null cell line when treated with MMC. Overexpressed pathogenic missense variants were found to reside in the cytoplasm, and nonpathogenic in the nucleus. RNA analysis demonstrated that two variants (c.522G > C and c.1565A > G), predicted to encode missense variants, which were determined to be nonpathogenic by a functional assay, caused skipping of exons 5 and 16, respectively, and are most likely pathogenic. We report 48 novel FANCA sequence variants. Defining both variants in a large patient cohort is a major step toward cataloging all FANCA variants, and permitting studies of genotype-phenotype correlations. © Published 2017. This article is a U.S. Government work and is in the public domain in the USA.

Pharmacokinetics and safety of single doses of drisapersen in non-ambulant subjects with Duchenne muscular dystrophy: Results of a double-blind randomized clinical trial

PubMed Central

Flanigan, Kevin M.; Voit, Thomas; Rosales, Xiomara Q.; Servais, Laurent; Kraus, John E.; Wardell, Claire; Morgan, Allison; Dorricott, Susie; Nakielny, Joanna; Quarcoo, Naashika; Liefaard, Lia; Drury, Tom; Campion, Giles; Wright, Padraig

2014-01-01

Duchenne muscular dystrophy (DMD) is a progressive, lethal neuromuscular disorder caused by the absence of dystrophin protein due to mutations of the dystrophin gene. Drisapersen is a 2′-O-methyl-phosphorothioate oligonucleotide designed to skip exon 51 in dystrophin pre-mRNA to restore the reading frame of the mRNA. This study assessed safety, tolerability, and pharmacokinetics of drisapersen after a single subcutaneous administration in non-ambulatory subjects. Eligible subjects were non-ambulant boys aged ≥9 years, in wheelchairs for ≥1 to ≤4 years, with a diagnosis of DMD resulting from a mutation correctable by drisapersen treatment. Four dose cohorts were planned (3, 6, 9 and 12 mg/kg), but study objectives were met with the 9 mg/kg dose. Less than proportional increase in exposure was demonstrated over the 3–9 mg/kg dose range, though post hoc analysis showed dose proportionality was more feasible over the 3–6 mg/kg range. Single doses of drisapersen at 3 and 6 mg/kg did not result in significant safety or tolerability concerns; however, at the 9 mg/kg dose, pyrexia and transient elevations in inflammatory parameters were seen. The maximum tolerated dose of 6 mg/kg drisapersen was identified for further characterization in multiple dose studies in the non-ambulant DMD population. PMID:24321374

A composite step conjugate gradients squared algorithm for solving nonsymmetric linear systems

NASA Astrophysics Data System (ADS)

Chan, Tony; Szeto, Tedd

1994-03-01

We propose a new and more stable variant of the CGS method [27] for solving nonsymmetric linear systems. The method is based on squaring the Composite Step BCG method, introduced recently by Bank and Chan [1,2], which itself is a stabilized variant of BCG in that it skips over steps for which the BCG iterate is not defined and causes one kind of breakdown in BCG. By doing this, we obtain a method (Composite Step CGS or CSCGS) which not only handles the breakdowns described above, but does so with the advantages of CGS, namely, no multiplications by the transpose matrix and a faster convergence rate than BCG. Our strategy for deciding whether to skip a step does not involve any machine dependent parameters and is designed to skip near breakdowns as well as produce smoother iterates. Numerical experiments show that the new method does produce improved performance over CGS on practical problems.

Dynamics of Leading-strand Lesion Skipping by the Replisome

PubMed Central

Yeeles, Joseph T.P.; Marians, Kenneth J.

2013-01-01

SUMMARY The E. coli replisome stalls transiently when it encounters a lesion in the leading-strand template, skipping over the damage by reinitiating replication at a new primer synthesized downstream by the primase. We report here that template unwinding and lagging-strand synthesis continue downstream of the lesion at a reduced rate after replisome stalling, that one replisome is capable of skipping multiple lesions, and that the rate limiting steps of replication restart involve the synthesis and activation of the new primer downstream. We also find little support for the concept that polymerase uncoupling, where extensive lagging-strand synthesis proceeds downstream in the absence of leading-strand synthesis, involves physical separation of the leading-strand polymerase from the replisome. Instead, our data indicate that extensive uncoupled replication likely results from a failure of the leading-strand polymerase still associated with the DNA helicase and the lagging-strand polymerase that are proceeding downstream to reinitiate synthesis. PMID:24268579

An RNA-splicing mutation (G{sup +51VS20}) in the Type II collagen gene (COL2A1) in a family with spondyloepiphyseal dysplasia congenita

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tiller, G.E.; Polumbo, P.A.; Weis, M.A.

1995-02-01

Defects in type II collagen have been demonstrated in a phenotypic continuum of chondrodysplasias that includes achondrogenesis II, hypochondrogenesis, spondyloepiphyseal dysplasia congenita (SEDC), Kniest dysplasia, and Stickler syndrome. We have determined that cartilage from a terminated fetus with an inherited form of SEDC contained both normal {alpha}1(II) collagen chains and chains that lacked amino acids 256-273 of the triple-helical domain. PCR amplification of this region of COL2A1, from genomic DNA, yielded products of normal size, while amplification of cDNA yielded a normal sized species and a shorter fragment missing exon 20. Sequence analysis of genomic DNA from the fetus revealedmore » a G{yields}T transversion at position +5 of intron 20; the affected father was also heterozygous for the mutation. Allele-specific PCR and heteroduplex analysis of a VNTR in COL2A1 independently confirmed the unaffected status of a fetus in a subsequent pregnancy. Thermodynamic calculations suggest that the mutation prevents normal splicing of exon 20 by interfering with binding of U{sub 1} small-nuclear RNA to pre-mRNA, thus leading to skipping of exon 20 in transcripts from the mutant allele. Electron micrographs of diseased cartilage showed intracellular inclusion bodies, which were stained by an antibody to {alpha}1(II) procollagen. Our findings support the hypothesis that {alpha}-chain length alterations that preserve the Gly-X-Y repeat motif of the triple helix result in partial intracellular retention of {alpha}1(II) procollagen and produce mild to moderate chondrodysplasia phenotypes. 50 refs., 6 figs., 1 tab.« less

HnRNP L and L-like cooperate in multiple-exon regulation of CD45 alternative splicing

PubMed Central

Preußner, Marco; Schreiner, Silke; Hung, Lee-Hsueh; Porstner, Martina; Jäck, Hans-Martin; Benes, Vladimir; Rätsch, Gunnar; Bindereif, Albrecht

2012-01-01

CD45 encodes a trans-membrane protein-tyrosine phosphatase expressed in diverse cells of the immune system. By combinatorial use of three variable exons 4–6, isoforms are generated that differ in their extracellular domain, thereby modulating phosphatase activity and immune response. Alternative splicing of these CD45 exons involves two heterogeneous ribonucleoproteins, hnRNP L and its cell-type specific paralog hnRNP L-like (LL). To address the complex combinatorial splicing of exons 4–6, we investigated hnRNP L/LL protein expression in human B-cells in relation to CD45 splicing patterns, applying RNA-Seq. In addition, mutational and RNA-binding analyses were carried out in HeLa cells. We conclude that hnRNP LL functions as the major CD45 splicing repressor, with two CA elements in exon 6 as its primary target. In exon 4, one element is targeted by both hnRNP L and LL. In contrast, exon 5 was never repressed on its own and only co-regulated with exons 4 and 6. Stable L/LL interaction requires CD45 RNA, specifically exons 4 and 6. We propose a novel model of combinatorial alternative splicing: HnRNP L and LL cooperate on the CD45 pre-mRNA, bridging exons 4 and 6 and looping out exon 5, thereby achieving full repression of the three variable exons. PMID:22402488

Accelerating non-contrast-enhanced MR angiography with inflow inversion recovery imaging by skipped phase encoding and edge deghosting (SPEED).

PubMed

Chang, Zheng; Xiang, Qing-San; Shen, Hao; Yin, Fang-Fang

2010-03-01

To accelerate non-contrast-enhanced MR angiography (MRA) with inflow inversion recovery (IFIR) with a fast imaging method, Skipped Phase Encoding and Edge Deghosting (SPEED). IFIR imaging uses a preparatory inversion pulse to reduce signals from static tissue, while leaving inflow arterial blood unaffected, resulting in sparse arterial vasculature on modest tissue background. By taking advantage of vascular sparsity, SPEED can be simplified with a single-layer model to achieve higher efficiency in both scan time reduction and image reconstruction. SPEED can also make use of information available in multiple coils for further acceleration. The techniques are demonstrated with a three-dimensional renal non-contrast-enhanced IFIR MRA study. Images are reconstructed by SPEED based on a single-layer model to achieve an undersampling factor of up to 2.5 using one skipped phase encoding direction. By making use of information available in multiple coils, SPEED can achieve an undersampling factor of up to 8.3 with four receiver coils. The reconstructed images generally have comparable quality as that of the reference images reconstructed from full k-space data. As demonstrated with a three-dimensional renal IFIR scan, SPEED based on a single-layer model is able to reduce scan time further and achieve higher computational efficiency than the original SPEED.

Why Students Do and Do Not Attend Classes: Myths and Realities.

ERIC Educational Resources Information Center

Friedman, Paul; Rodriguez, Fred; McComb, Joe

2001-01-01

Explored student characteristics and course characteristics influencing why college students skip class. Found that attendance behavior cannot be easily explained and that the decision to attend is influenced by multiple factors. (EV)

Phaeochromocytoma in multiple endocrine neoplasia type 2: RET codon-specific penetrance and changes in management during the last four decades.

PubMed

Mucha, L; Leidig-Bruckner, G; Frank-Raue, K; Bruckner, Th; Kroiss, M; Raue, F

2017-10-01

We describe phaeochromocytoma (phaeo) penetrance in multiple endocrine neoplasia type 2 (MEN2) according to RET protooncogene-specific mutations and report changes in phaeo diagnosis and management from 1968 to 2015. This retrospective chart review included 309 MEN2 patients from one specialized ambulatory care centre. Phaeo patients were categorized by diagnosis date: early, 1968-1996, n=40, and recent, 1997-2015, n=45. Phaeochromocytoma was diagnosed in 85/309 patients with RET mutations in the following exons (phaeos/all carriers, %): exon 11 (56/120, 46.6%); exon 16 (7/17, 41.2%), exon 10 (14/47, 29.8%), and exon 13-15 (2/116, 1.7%). Age at phaeo diagnosis differed according to affected exon: 21.9±1.5 years, exon 16; 34.1±11.6 years, exon 11; and 41.8±8.8 years, exon 10. Age-related phaeo penetrance differed among five amino acid substitutions at codon 634 and was highest for Cys634Arg and Cys634Tyr. Age at diagnosis was 34.4±11.6 years in the early and recent groups. Phaeochromocytoma and medullary thyroid carcinoma (MTC) were diagnosed synchronously in 21/40 (early) vs 8/45 (recent) and metachronously in 19/40 vs 37/45 cases. Diagnostic methods significantly changed from clinical (22/40 vs 4/45) to biochemical and/or imaging based (14/40 vs 35/45). Phaeochromocytoma diameter at diagnosis was 4.6 vs 2.6 cm. Phaeochromocytoma penetrance and age of diagnosis are highly correlated with MTC aggressiveness based on RET mutation status, with higher penetrance and younger age of diagnosis associated with more aggressive MTC. Penetrance steadily increases with age. At-risk patients require lifelong follow-up. © 2017 John Wiley & Sons Ltd.

ORMAN: optimal resolution of ambiguous RNA-Seq multimappings in the presence of novel isoforms.

PubMed

Dao, Phuong; Numanagić, Ibrahim; Lin, Yen-Yi; Hach, Faraz; Karakoc, Emre; Donmez, Nilgun; Collins, Colin; Eichler, Evan E; Sahinalp, S Cenk

2014-03-01

RNA-Seq technology is promising to uncover many novel alternative splicing events, gene fusions and other variations in RNA transcripts. For an accurate detection and quantification of transcripts, it is important to resolve the mapping ambiguity for those RNA-Seq reads that can be mapped to multiple loci: >17% of the reads from mouse RNA-Seq data and 50% of the reads from some plant RNA-Seq data have multiple mapping loci. In this study, we show how to resolve the mapping ambiguity in the presence of novel transcriptomic events such as exon skipping and novel indels towards accurate downstream analysis. We introduce ORMAN ( O ptimal R esolution of M ultimapping A mbiguity of R N A-Seq Reads), which aims to compute the minimum number of potential transcript products for each gene and to assign each multimapping read to one of these transcripts based on the estimated distribution of the region covering the read. ORMAN achieves this objective through a combinatorial optimization formulation, which is solved through well-known approximation algorithms, integer linear programs and heuristics. On a simulated RNA-Seq dataset including a random subset of transcripts from the UCSC database, the performance of several state-of-the-art methods for identifying and quantifying novel transcripts, such as Cufflinks, IsoLasso and CLIIQ, is significantly improved through the use of ORMAN. Furthermore, in an experiment using real RNA-Seq reads, we show that ORMAN is able to resolve multimapping to produce coverage values that are similar to the original distribution, even in genes with highly non-uniform coverage. ORMAN is available at http://orman.sf.net

Potentially pathogenic germline CHEK2 c.319+2T>A among multiple early-onset cancer families.

PubMed

Dominguez-Valentin, Mev; Nakken, Sigve; Tubeuf, Hélène; Vodak, Daniel; Ekstrøm, Per Olaf; Nissen, Anke M; Morak, Monika; Holinski-Feder, Elke; Martins, Alexandra; Møller, Pål; Hovig, Eivind

2018-01-01

To study the potential contribution of genes other than BRCA1/2, PTEN, and TP53 to the biological and clinical characteristics of multiple early-onset cancers in Norwegian families, including early-onset breast cancer, Cowden-like and Li-Fraumeni-like syndromes (BC, CSL and LFL, respectively). The Hereditary Cancer Biobank from the Norwegian Radium Hospital was used to identify early-onset BC, CSL or LFL for whom no pathogenic variants in BRCA1/2, PTEN, or TP53 had been found in routine diagnostic DNA sequencing. Forty-four cancer susceptibility genes were selected and analyzed by our in-house designed TruSeq amplicon-based assay for targeted sequencing. Protein- and RNA splicing-dedicated in silico analyses were performed for all variants of unknown significance (VUS). Variants predicted as the more likely to affect splicing were experimentally analyzed by minigene assay. We identified a CSL individual carrying a variant in CHEK2 (c.319+2T>A, IVS2), here considered as likely pathogenic. Out of the five VUS (BRCA2, CDH1, CHEK2, MAP3K1, NOTCH3) tested in the minigene splicing assay, only NOTCH3 c.14090C>T (p.Ser497Leu) showed a significant effect on RNA splicing, notably by inducing partial skipping of exon 9. Among 13 early-onset BC, CSL and LFL patients, gene panel sequencing identified a potentially pathogenic variant in CHEK2 that affects a canonical RNA splicing signal. Our study provides new information on genetic loci that may affect the risk of developing cancer in these patients and their families, demonstrating that genes presently not routinely tested in molecular diagnostic settings may be important for capturing cancer predisposition in these families.

FULL-GENOME ANALYSIS OF ALTERNATIVE SPLICING IN MOUSE LIVER AFTER HEPATOTOXICANT EXPOSURE

EPA Science Inventory

Alternative splicing plays a role in determining gene function and protein diversity. We have employed whole genome exon profiling using Affymetrix Mouse Exon 1.0 ST arrays to understand the significance of alternative splicing on a genome-wide scale in response to multiple toxic...

ACTG: novel peptide mapping onto gene models.

PubMed

Choi, Seunghyuk; Kim, Hyunwoo; Paek, Eunok

2017-04-15

In many proteogenomic applications, mapping peptide sequences onto genome sequences can be very useful, because it allows us to understand origins of the gene products. Existing software tools either take the genomic position of a peptide start site as an input or assume that the peptide sequence exactly matches the coding sequence of a given gene model. In case of novel peptides resulting from genomic variations, especially structural variations such as alternative splicing, these existing tools cannot be directly applied unless users supply information about the variant, either its genomic position or its transcription model. Mapping potentially novel peptides to genome sequences, while allowing certain genomic variations, requires introducing novel gene models when aligning peptide sequences to gene structures. We have developed a new tool called ACTG (Amino aCids To Genome), which maps peptides to genome, assuming all possible single exon skipping, junction variation allowing three edit distances from the original splice sites, exon extension and frame shift. In addition, it can also consider SNVs (single nucleotide variations) during mapping phase if a user provides the VCF (variant call format) file as an input. Available at http://prix.hanyang.ac.kr/ACTG/search.jsp . eunokpaek@hanyang.ac.kr. Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

A novel heterozygous intronic mutation in POU1F1 is associated with combined pituitary hormone deficiency.

PubMed

Takagi, Masaki; Kamasaki, Hotaka; Yagi, Hiroko; Fukuzawa, Ryuji; Narumi, Satoshi; Hasegawa, Tomonobu

2017-02-27

POU class 1 homeobox 1 (POU1F1) regulates pituitary cell-specific gene expression of somatotropes, lactotropes, and thyrotropes. In humans, two POU1F1 isoforms (long and short isoform), which are generated by the alternative use of the splice acceptor site for exon 2, have been identified. To date, more than 30 POU1F1 mutations in patients with combined pituitary hormone deficiency (CPHD) have been described. All POU1F1 variants reported to date affect both the short and long isoforms of the POU1F1 protein; therefore, it is unclear at present whether a decrease in the function of only one of these two isoforms is sufficient for disease onset in humans. Here, we described a sibling case of CPHD carrying a heterozygous mutation in intron 1 of POU1F1. In vitro experiments showed that this mutation resulted in exon 2-skipping of only in the short isoform of POU1F1, while the long isoform remained intact. This result strongly suggests the possibility, for the first time, that isolated mutations in the short isoform of POU1F1 could be sufficient for induction of POU1F1-related CPHD. This finding improves our understanding of the molecular mechanisms, and developmental course associated with mutations in POU1F1.

ISS-N1 makes the First FDA-approved Drug for Spinal Muscular Atrophy.

PubMed

Ottesen, Eric W

2017-01-01

Spinal muscular atrophy (SMA) is one of the leading genetic diseases of children and infants. SMA is caused by deletions or mutations of Survival Motor Neuron 1 ( SMN1 ) gene. SMN2 , a nearly identical copy of SMN1 , cannot compensate for the loss of SMN1 due to predominant skipping of exon 7. While various regulatory elements that modulate SMN2 exon 7 splicing have been proposed, intronic splicing silencer N1 (ISS-N1) has emerged as the most promising target thus far for antisense oligonucleotide-mediated splicing correction in SMA. Upon procuring exclusive license from the University of Massachussets Medical School in 2010, Ionis Pharmaceuticals (formerly ISIS Pharamaceuticals) began clinical development of Spinraza ™ (synonyms: Nusinersen, IONIS-SMN RX , ISIS-SMN RX ), an antisense drug based on ISS-N1 target. Spinraza ™ showed very promising results at all steps of the clinical development and was approved by US Food and Drug Administration (FDA) on December 23, 2016. Spinraza ™ is the first FDA-approved treatment for SMA and the first antisense drug to restore expression of a fully functional protein via splicing correction. The success of Spinraza ™ underscores the potential of intronic sequences as promising therapeutic targets and sets the stage for further improvement of antisense drugs based on advanced oligonucleotide chemistries and delivery protocols.

Repair of pre-mRNA splicing

PubMed Central

Nlend, Rachel Nlend; Meyer, Kathrin

2010-01-01

Recent analyses of complete genomes have revealed that alternative splicing became more prevalent and important during eukaryotic evolution. Alternative splicing augments the protein repertoire—particularly that of the human genome—and plays an important role in the development and function of differentiated cell types. However, splicing is also extremely vulnerable, and defects in the proper recognition of splicing signals can give rise to a variety of diseases. In this review, we discuss splicing correction therapies, by using the inherited disease Spinal Muscular Atrophy (SMA) as an example. This lethal early childhood disorder is caused by deletions or other severe mutations of SMN1, a gene coding for the essential survival of motoneurons protein. A second gene copy present in humans and few non-human primates, SMN2, can only partly compensate for the defect because of a single nucleotide change in exon 7 that causes this exon to be skipped in the majority of mRNAs. Thus SMN2 is a prime therapeutic target for SMA. In recent years, several strategies based on small molecule drugs, antisense oligonucleotides or in vivo expressed RNAs have been developed that allow a correction of SMN2 splicing. For some of these, a therapeutic benefit has been demonstrated in mouse models for SMA. This means that clinical trials of such splicing therapies for SMA may become possible in the near future. PMID:20523126

X-exome sequencing identifies a HDAC8 variant in a large pedigree with X-linked intellectual disability, truncal obesity, gynaecomastia, hypogonadism and unusual face.

PubMed

Harakalova, Magdalena; van den Boogaard, Marie-Jose; Sinke, Richard; van Lieshout, Stef; van Tuil, Marc C; Duran, Karen; Renkens, Ivo; Terhal, Paulien A; de Kovel, Carolien; Nijman, Ies J; van Haelst, Mieke; Knoers, Nine V A M; van Haaften, Gijs; Kloosterman, Wigard; Hennekam, Raoul C M; Cuppen, Edwin; Ploos van Amstel, Hans Kristian

2012-08-01

We present a large Dutch family with seven males affected by a novel syndrome of X-linked intellectual disability, hypogonadism, gynaecomastia, truncal obesity, short stature and recognisable craniofacial manifestations resembling but not identical to Wilson-Turner syndrome. Seven female relatives show a much milder expression of the phenotype. We performed X chromosome exome (X-exome) sequencing in five individuals from this family and identified a novel intronic variant in the histone deacetylase 8 gene (HDAC8), c.164+5G>A, which disturbs the normal splicing of exon 2 resulting in exon skipping, and introduces a premature stop at the beginning of the histone deacetylase catalytic domain. The identified variant completely segregates in this family and was absent in 96 Dutch controls and available databases. Affected female carriers showed a notably skewed X-inactivation pattern in lymphocytes in which the mutated X-chromosome was completely inactivated. HDAC8 is a member of the protein family of histone deacetylases that play a major role in epigenetic gene silencing during development. HDAC8 specifically controls the patterning of the skull with the mouse HDAC8 knock-out showing craniofacial deformities of the skull. The present family provides the first evidence for involvement of HDAC8 in a syndromic form of intellectual disability.

Identification of four novel HLA-B alleles, B*1590, B*1591, B*2726, and B*4705, from an East African population by high-resolution sequence-based typing.

PubMed

Luo, M; Mao, X; Plummer, F A

2005-02-01

We report here four novel HLA-B alleles, B*1590, B*1591, B*2726, and B*4705, identified from an East African population during sequence-based HLA-B typing. The novel alleles were confirmed by sequencing two separate polymerase chain reaction products, and by molecular cloning and sequencing multiple clones. B*1590 is identical to B*1510 at exon 2 and exon 3, except for a difference (GCCGTC) at codon 158. Sequence differences at codon 152 (GAGGTG) and codon 167 (TGGTCG) differentiate B*1591 from B*1503 at exon 3. B*2726 is identical to B*2708 at exon 2 and exon 3, except for a difference (AAGCAG) at codon 70. B*4705 was identified in three Kenyan women. The allele is identical to B*47010101/02 at exon 2 and exon 3, except for differences at codon 97 (AGGAAT) and codon 99 (TTTTAT). These new alleles have been named by the WHO Nomenclature Committee. Identification of these novel HLA-B alleles reflects the genetic diversity of this East African population.

Multiple splicing events involved in regulation of human aromatase expression by a novel promoter, I.6.

PubMed

Shozu, M; Zhao, Y; Bulun, S E; Simpson, E R

1998-04-01

The expression of aromatase is regulated in a tissue-specific fashion through alternative use of multiple promoter-specific first exons. To date, eight different first exons have been reported in human aromatase, namely I.1., I.2, I.3. I.4, I.5, PII, 2a, and 1f. Recently, we have found a new putative exon I in a RACE-generated library of THP-1 cells and have conducted studies to characterize this new exon I. We confirmed that the constructs containing -1552/+17 or less flanking sequence of this exon function as a promoter in THP-1 cells, JEG-3 cells and osteoblast-like cells obtained from a human fetus. Results of transfection assays using a series of deletion constructs and mutation constructs indicate that a 1-bp mismatch of the consensus TATA-like box (TTTAAT) and the consensus sequence of the initiator site, which is located 45 bp downstream of the putative TATA box, were functioning cooperatively as a core promoter. The putative transcription site was confirmed by the results of RT-PCR southern blot analysis. We examined the regulation and the expression of this exon, I.6, in several human cells and tissues by RT-PCR Southern blot analysis. THP-1 cells (mononuclear leukemic origin) and JEG-3 cells (choriocarcinoma origin) expressed exon I.6 in serum-free media. The level of expression was increased by serum and phorbol myristyl acetate (PMA) in both cell lines. Adipose stromal cells also expressed exon I.6 in the presence of PMA. In fetal osteoblasts, the expression of exon I.6 was increased most effectively by serum and less so by dexamethasone (DEX) + IL-1beta and DEX + IL-11, whereas induction by serum was suppressed by the addition of DEX. The level of expression was low in granulosa cells in culture and did not change with forskolin. On the other hand, dibutyryl cAMP suppressed PMA-stimulated expression of exon I.6 in THP-1 cells and adipose stromal cells. This result supports the hypothesis that the expression of exon I.6 is regulated mainly via an AP-1 binding site that is found upstream of the initiator site of the promoter region. Expression of exon I.6-specific transcripts was examined in several human tissues. Testis and bone obtained from normal adults expressed exon I.6. Testicular tumor and hepatic carcinoma expressed high levels of exon I.6, whereas granulosa cell tumor did not. Fetal liver and bone also showed a significant level of exon I.6 expression, but not so much as testicular tumor and hepatic tumor. Several splicing variants of exon I.6 were detected especially in THP-1 and JEG-3 cells, and to a lesser extent in primary cultures and tissue samples. These variants were identified as an unspliced form, a form spliced at the end of exon I.4, a form spliced at the end of exon I.3 (truncated) and a form spliced 220 bp downstream of the 3' end of exon I.6. The last variant revealed a new splicing site. Because most of the splicing variants contain the sequence specific for exon I.3, RT-PCR specific for exon I.3 can coamplify these splicing variants of exon I.6 transcripts. These results suggests that it is necessary to examine the expression of I.6 in tissues that are known to express exon I.3 such as breast adipose tissue, in which promoter usage of exon I of the aromatase gene switches from exon I.4 to I.3 in the course of malignant transformation.

An Overview of Recent Therapeutics Advances for Duchenne Muscular Dystrophy.

PubMed

Mah, Jean K

2018-01-01

Duchenne muscular dystrophy (DMD) is the most common form of muscular dystrophy in childhood. Mutations of the DMD gene destabilize the dystrophin associated glycoprotein complex in the sarcolemma. Ongoing mechanical stress leads to unregulated influx of calcium ions into the sarcoplasm, with activation of proteases, release of proinflammatory cytokines, and mitochondrial dysfunction. Cumulative damage and reparative failure leads to progressive muscle necrosis, fibrosis, and fatty replacement. Although there is presently no cure for DMD, scientific advances have led to many potential disease-modifying treatments, including dystrophin replacement therapies, upregulation of compensatory proteins, anti-inflammatory agents, and other cellular targets. Recently approved therapies include ataluren for stop codon read-through and eteplirsen for exon 51 skipping of eligible individuals. The purpose of this chapter is to summarize the clinical features of DMD, to describe current outcome measures used in clinical studies, and to highlight new emerging therapies for affected individuals.

New approaches to the treatment of orphan genetic disorders: Mitigating molecular pathologies using chemicals.

PubMed

Velho, Renata V; Sperb-Ludwig, Fernanda; Schwartz, Ida V D

2015-08-01

With the advance and popularization of molecular techniques, the identification of genetic mutations that cause diseases has increased dramatically. Thus, the number of laboratories available to investigate a given disorder and the number of subsequent diagnosis have increased over time. Although it is necessary to identify mutations and provide diagnosis, it is also critical to develop specific therapeutic approaches based on this information. This review aims to highlight recent advances in mutation-targeted therapies with chemicals that mitigate mutational pathology at the molecular level, for disorders that, for the most part, have no effective treatment. Currently, there are several strategies being used to correct different types of mutations, including the following: the identification and characterization of translational readthrough compounds; antisense oligonucleotide-mediated splicing redirection; mismatch repair; and exon skipping. These therapies and other approaches are reviewed in this paper.

A newly detected mutation of the RET protooncogene in exon 8 as a cause of multiple endocrine neoplasia type 2A.

PubMed

Bethanis, Sotirios; Koutsodontis, George; Palouka, Theodosia; Avgoustis, Christos; Yannoukakos, Drakoulis; Bei, Thalia; Papadopoulos, Savas; Linos, Dimitrios; Tsagarakis, Stylianos

2007-01-01

Multiple endocrine neoplasia type 2A (MEN2A) is a syndrome of familial neoplasias characterized by medullary thyroid carcinoma (MTC), pheochromocytoma and hyperplasia of the parathyroid glands. RET protooncogene mutations are responsible for MEN 2A. Mutations in exons 10 or 11 have been identified in more than 96% of patients with MEN 2A. We herein report for the first time a patient with MEN 2A harboring a mutation (Gly(533)Cys) in exon 8. A 66-year old male patient was referred to our department for bilateral adrenal nodules. The patient's family history was remarkable in that his mother had pheochromocytoma. Biochemical evaluation and findings of the magnetic resonance imaging of the adrenals were compatible with the diagnosis of bilateral pheochromocytomas. The patient underwent laparoscopic bilateral adrenalectomy and histological examination confirmed the preoperative diagnosis of pheochromocytoma. Absence of phenotypic characteristics of VHL or NF1 and elevated calcitonin levels both basal and post pentagastrin stimulation, raised the possibility of MEN 2A syndrome. Total thyroidectomy was performed and histological examination showed the presence of MTC. Direct sequencing of exon 8 from the patient's genomic DNA revealed the mutation c.1,597G-->T (Gly533Cys). Although this missense point mutation has been associated with familial MTC (FMTC), to the best of our knowledge mutations in exon 8 have not previously been identified in patients with MEN 2A. In conclusion, in patients with clinical suspicion of MEN 2A syndrome, analysis of RET exon 8 should be considered when the routine evaluation of MEN 2A-associated mutations is negative. Furthermore, patients with FMTC and exon 8 mutations should also be screened for pheochromocytoma.

Global analysis of exon creation versus loss and the role of alternative splicing in 17 vertebrate genomes

PubMed Central

Alekseyenko, Alexander V.; Kim, Namshin; Lee, Christopher J.

2007-01-01

Association of alternative splicing (AS) with accelerated rates of exon evolution in some organisms has recently aroused widespread interest in its role in evolution of eukaryotic gene structure. Previous studies were limited to analysis of exon creation or lost events in mouse and/or human only. Our multigenome approach provides a way for (1) distinguishing creation and loss events on the large scale; (2) uncovering details of the evolutionary mechanisms involved; (3) estimating the corresponding rates over a wide range of evolutionary times and organisms; and (4) assessing the impact of AS on those evolutionary rates. We use previously unpublished independent analyses of alternative splicing in five species (human, mouse, dog, cow, and zebrafish) from the ASAP database combined with genomewide multiple alignment of 17 genomes to analyze exon creation and loss of both constitutively and alternatively spliced exons in mammals, fish, and birds. Our analysis provides a comprehensive database of exon creation and loss events over 360 million years of vertebrate evolution, including tens of thousands of alternative and constitutive exons. We find that exon inclusion level is inversely related to the rate of exon creation. In addition, we provide a detailed in-depth analysis of mechanisms of exon creation and loss, which suggests that a large fraction of nonrepetitive created exons are results of ab initio creation from purely intronic sequences. Our data indicate an important role for alternative splicing in creation of new exons and provide a useful novel database resource for future genome evolution research. PMID:17369312

ExoLocator--an online view into genetic makeup of vertebrate proteins.

PubMed

Khoo, Aik Aun; Ogrizek-Tomas, Mario; Bulovic, Ana; Korpar, Matija; Gürler, Ece; Slijepcevic, Ivan; Šikic, Mile; Mihalek, Ivana

2014-01-01

ExoLocator (http://exolocator.eopsf.org) collects in a single place information needed for comparative analysis of protein-coding exons from vertebrate species. The main source of data--the genomic sequences, and the existing exon and homology annotation--is the ENSEMBL database of completed vertebrate genomes. To these, ExoLocator adds the search for ostensibly missing exons in orthologous protein pairs across species, using an extensive computational pipeline to narrow down the search region for the candidate exons and find a suitable template in the other species, as well as state-of-the-art implementations of pairwise alignment algorithms. The resulting complements of exons are organized in a way currently unique to ExoLocator: multiple sequence alignments, both on the nucleotide and on the peptide levels, clearly indicating the exon boundaries. The alignments can be inspected in the web-embedded viewer, downloaded or used on the spot to produce an estimate of conservation within orthologous sets, or functional divergence across paralogues.

NOTCH3 variants and risk of ischemic stroke.

PubMed

Ross, Owen A; Soto-Ortolaza, Alexandra I; Heckman, Michael G; Verbeeck, Christophe; Serie, Daniel J; Rayaprolu, Sruti; Rich, Stephen S; Nalls, Michael A; Singleton, Andrew; Guerreiro, Rita; Kinsella, Emma; Wszolek, Zbigniew K; Brott, Thomas G; Brown, Robert D; Worrall, Bradford B; Meschia, James F

2013-01-01

Mutations within the NOTCH3 gene cause cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL). CADASIL mutations appear to be restricted to the first twenty-four exons, resulting in the gain or loss of a cysteine amino acid. The role of other exonic NOTCH3 variation not involving cysteine residues and mutations in exons 25-33 in ischemic stroke remains unresolved. All 33 exons of NOTCH3 were sequenced in 269 Caucasian probands from the Siblings With Ischemic Stroke Study (SWISS), a 70-center North American affected sibling pair study and 95 healthy Caucasian control subjects. Variants identified by sequencing in the SWISS probands were then tested for association with ischemic stroke using US Caucasian controls collected at the Mayo Clinic (n=654), and further assessed in a Caucasian (n=802) and African American (n=298) patient-control series collected through the Ischemic Stroke Genetics Study (ISGS). Sequencing of the 269 SWISS probands identified one (0.4%) with small vessel type stroke carrying a known CADASIL mutation (p.R558C; Exon 11). Of the 19 common NOTCH3 variants identified, the only variant significantly associated with ischemic stroke after multiple testing adjustment was p.R1560P (rs78501403; Exon 25) in the combined SWISS and ISGS Caucasian series (Odds Ratio [OR] 0.50, P=0.0022) where presence of the minor allele was protective against ischemic stroke. Although only significant prior to adjustment for multiple testing, p.T101T (rs3815188; Exon 3) was associated with an increased risk of small-vessel stroke (OR: 1.56, P=0.008) and p.P380P (rs61749020; Exon 7) was associated with decreased risk of large-vessel stroke (OR: 0.35, P=0.047) in Caucasians. No significant associations were observed in the small African American series. Cysteine-affecting NOTCH3 mutations are rare in patients with typical ischemic stroke, however our observation that common NOTCH3 variants may be associated with risk of ischemic stroke warrants further study.

Comprehensive analysis of pyrimidine metabolism in 450 children with unspecific neurological symptoms using high-pressure liquid chromatography-electrospray ionization tandem mass spectrometry.

PubMed

Schmidt, C; Hofmann, U; Kohlmüller, D; Mürdter, T; Zanger, U M; Schwab, M; Hoffmann, G F

2005-01-01

To evaluate the significance of inborn metabolic disorders of the pyrimidine degradation pathway, 450 children with unspecific neurological symptoms were comprehensively studied; 200 healthy children were recruited as controls. Uracil and thymine as well as their degradation products in urine were determined with an improved method based on reversed-phase HPLC coupled with electrospray ionization tandem mass spectrometry and detection by multiple-reaction monitoring using stable-isotope-labelled reference compounds as internal standards. From the results of the control group we established age-related reference ranges of all pyrimidine degradation products. In the patient group, two children with dihydropyrimidine dehydrogenase (DPYD) deficiency were identified; one of these was homozygous for the exon 14-skipping mutation of the DPYD gene. In addition, two patients with high uracil, dihydrouracil and beta-ureidopropionate were found to have ornithine transcarbamylase deficiency. In the urine of 9 patients, beta-alanine was markedly elevated owing to treatment with vigabatrin, an irreversible inhibitor of GABA transaminase, which interferes with beta-alanine breakdown. Four patients had exclusively high levels of beta-aminoisobutyrate (beta-AIB) due to a low activity of the D-beta-AIB-pyruvate aminotransferase, probably without clinical significance. In conclusion, quantitative investigation of pyrimidine metabolites in children with unexplained neurological symptoms, particularly epileptic seizures with or without psychomotor retardation, can be recommended as a helpful tool for diagnosis in clinical practice. Sensitive methods and age-related reference ranges enable the detection of partial enzyme deficiencies.

Improved methods of AAV-mediated gene targeting for human cell lines using ribosome-skipping 2A peptide

PubMed Central

Karnan, Sivasundaram; Ota, Akinobu; Konishi, Yuko; Wahiduzzaman, Md; Hosokawa, Yoshitaka; Konishi, Hiroyuki

2016-01-01

The adeno-associated virus (AAV)-based targeting vector has been one of the tools commonly used for genome modification in human cell lines. It allows for relatively efficient gene targeting associated with 1–4-log higher ratios of homologous-to-random integration of targeting vectors (H/R ratios) than plasmid-based targeting vectors, without actively introducing DNA double-strand breaks. In this study, we sought to improve the efficiency of AAV-mediated gene targeting by introducing a 2A-based promoter-trap system into targeting constructs. We generated three distinct AAV-based targeting vectors carrying 2A for promoter trapping, each targeting a GFP-based reporter module incorporated into the genome, PIGA exon 6 or PIGA intron 5. The absolute gene targeting efficiencies and H/R ratios attained using these vectors were assessed in multiple human cell lines and compared with those attained using targeting vectors carrying internal ribosome entry site (IRES) for promoter trapping. We found that the use of 2A for promoter trapping increased absolute gene targeting efficiencies by 3.4–28-fold and H/R ratios by 2–5-fold compared to values obtained with IRES. In CRISPR-Cas9-assisted gene targeting using plasmid-based targeting vectors, the use of 2A did not enhance the H/R ratios but did upregulate the absolute gene targeting efficiencies compared to the use of IRES. PMID:26657635

Isolated autosomal dominant growth hormone deficiency: an evolving pituitary deficit? A multicenter follow-up study.

PubMed

Mullis, Primus E; Robinson, Iain C A F; Salemi, Souzan; Eblé, Andrée; Besson, Amélie; Vuissoz, Jean-Marc; Deladoey, Johnny; Simon, Dominique; Czernichow, Paul; Binder, Gerhard

2005-04-01

Four distinct familial types of isolated GH deficiency have been described so far, of which type II is the autosomal dominant inherited form. It is mainly caused by mutations within the first 6 bp of intervening sequence 3. However, other splice site and missense mutations have been reported. Based on in vitro experiments and transgenic animal data, there is strong evidence that there is a wide variability in phenotype in terms of the severity of GH deficiency. Therefore, we studied a total of 57 subjects belonging to 19 families suffering from different splice site as well as missense mutations within the GH-1 gene. The subjects presenting with a splice site mutation within the first 2 bp of intervening sequence 3 (5'IVS +1/+2 bp) leading to a skipping of exon 3 were found to be more likely to present in the follow-up with other pituitary hormone deficiencies. In addition, although the patients with missense mutations have previously been reported to be less affected, a number of patients presenting with the P89L missense GH form, showed some pituitary hormone impairment. The development of multiple hormonal deficiencies is not age dependent, and there is a clear variability in onset, severity, and progression, even within the same families. The message of clinical importance from these studies is that the pituitary endocrine status of all such patients should continue to be monitored closely over the years because further hormonal deficiencies may evolve with time.

Case report of a novel homozygous splice site mutation in PLA2G6 gene causing infantile neuroaxonal dystrophy in a Sudanese family.

PubMed

Elsayed, Liena E O; Mohammed, Inaam N; Hamed, Ahlam A A; Elseed, Maha A; Salih, Mustafa A M; Yahia, Ashraf; Siddig, Rayan A; Amin, Mutaz; Koko, Mahmoud; Elbashir, Mustafa I; Ibrahim, Muntaser E; Brice, Alexis; Ahmed, Ammar E; Stevanin, Giovanni

2018-05-08

Infantile neuroaxonal dystrophy (INAD) is a rare hereditary neurological disorder caused by mutations in PLA2G6. The disease commonly affects children below 3 years of age and presents with delay in motor skills, optic atrophy and progressive spastic tetraparesis. Studies of INAD in Africa are extremely rare, and genetic studies from Sub Saharan Africa are almost non-existent. Two Sudanese siblings presented, at ages 18 and 24 months, with regression in both motor milestones and speech development and hyper-reflexia. Brain MRI showed bilateral and symmetrical T2/FLAIR hyperintense signal changes in periventricular areas and basal ganglia and mild cerebellar atrophy. Whole exome sequencing with confirmatory Sanger sequencing were performed for the two patients and healthy family members. A novel variant (NM_003560.2 c.1427 + 2 T > C) acting on a splice donor site and predicted to lead to skipping of exon 10 was found in PLA2G6. It was found in a homozygous state in the two patients and homozygous reference or heterozygous in five healthy family members. This variant has one very strong (loss of function mutation) and three supporting evidences for its pathogenicity (segregation with the disease, multiple computational evidence and specific patients' phenotype). Therefore this variant can be currently annotated as "pathogenic". This is the first study to report mutations in PLA2G6 gene in patients from Sudan.

Consortium for Osteogenesis Imperfecta Mutations in the Helical Domain of Type I Collagen: Regions Rich in Lethal Mutations Align With Collagen Binding Sites for Integrins and Proteoglycans

PubMed Central

Marini, Joan C.; Forlino, Antonella; Cabral, Wayne A.; Barnes, Aileen M.; San Antonio, James D.; Milgrom, Sarah; Hyland, James C.; Körkkö, Jarmo; Prockop, Darwin J.; De Paepe, Anne; Coucke, Paul; Symoens, Sofie; Glorieux, Francis H.; Roughley, Peter J.; Lund, Alan M.; Kuurila-Svahn, Kaija; Hartikka, Heini; Cohn, Daniel H.; Krakow, Deborah; Mottes, Monica; Schwarze, Ulrike; Chen, Diana; Yang, Kathleen; Kuslich, Christine; Troendle, James; Dalgleish, Raymond; Byers, Peter H.

2014-01-01

Osteogenesis imperfecta (OI) is a generalized disorder of connective tissue characterized by fragile bones and easy susceptibility to fracture. Most cases of OI are caused by mutations in type I collagen. We have identified and assembled structural mutations in type I collagen genes (COL1A1 and COL1A2, encoding the proα1(I) and proα2(I) chains, respectively) that result in OI. Quantitative defects causing type I OI were not included. Of these 832 independent mutations, 682 result in substitution for glycine residues in the triple helical domain of the encoded protein and 150 alter splice sites. Distinct genotype–phenotype relationships emerge for each chain. One-third of the mutations that result in glycine substitutions in α1(I) are lethal, especially when the substituting residues are charged or have a branched side chain. Substitutions in the first 200 residues are nonlethal and have variable outcome thereafter, unrelated to folding or helix stability domains. Two exclusively lethal regions (helix positions 691–823 and 910–964) align with major ligand binding regions (MLBRs), suggesting crucial interactions of collagen monomers or fibrils with integrins, matrix metalloproteinases (MMPs), fibronectin, and cartilage oligomeric matrix protein (COMP). Mutations in COL1A2 are predominantly nonlethal (80%). Lethal substitutions are located in eight regularly spaced clusters along the chain, supporting a regional model. The lethal regions align with proteoglycan binding sites along the fibril, suggesting a role in fibril–matrix interactions. Recurrences at the same site in α2(I) are generally concordant for outcome, unlike α1(I). Splice site mutations comprise 20% of helical mutations identified in OI patients, and may lead to exon skipping, intron inclusion, or the activation of cryptic splice sites. Splice site mutations in COL1A1 are rarely lethal; they often lead to frameshifts and the mild type I phenotype. In α2(I), lethal exon skipping events are located in the carboxyl half of the chain. Our data on genotype–phenotype relationships indicate that the two collagen chains play very different roles in matrix integrity and that phenotype depends on intracellular and extracellular events. PMID:17078022

SEASTAR: systematic evaluation of alternative transcription start sites in RNA.

PubMed

Qin, Zhiyi; Stoilov, Peter; Zhang, Xuegong; Xing, Yi

2018-05-04

Alternative first exons diversify the transcriptomes of eukaryotes by producing variants of the 5' Untranslated Regions (5'UTRs) and N-terminal coding sequences. Accurate transcriptome-wide detection of alternative first exons typically requires specialized experimental approaches that are designed to identify the 5' ends of transcripts. We developed a computational pipeline SEASTAR that identifies first exons from RNA-seq data alone then quantifies and compares alternative first exon usage across multiple biological conditions. The exons inferred by SEASTAR coincide with transcription start sites identified directly by CAGE experiments and bear epigenetic hallmarks of active promoters. To determine if differential usage of alternative first exons can yield insights into the mechanism controlling gene expression, we applied SEASTAR to an RNA-seq dataset that tracked the reprogramming of mouse fibroblasts into induced pluripotent stem cells. We observed dynamic temporal changes in the usage of alternative first exons, along with correlated changes in transcription factor expression. Using a combined sequence motif and gene set enrichment analysis we identified N-Myc as a regulator of alternative first exon usage in the pluripotent state. Our results demonstrate that SEASTAR can leverage the available RNA-seq data to gain insights into the control of gene expression and alternative transcript variation in eukaryotic transcriptomes.

Loss of the Gata1 Gene IE Exon Leads to Variant Transcript Expression and the Production of a GATA1 Protein Lacking the N-terminal Domain*

PubMed Central

Kobayashi, Eri; Shimizu, Ritsuko; Kikuchi, Yuko; Takahashi, Satoru; Yamamoto, Masayuki

2010-01-01

GATA1 is essential for the differentiation of erythroid cells and megakaryocytes. The Gata1 gene is composed of multiple untranslated first exons and five common coding exons. The erythroid first exon (IE exon) is important for Gata1 gene expression in hematopoietic lineages. Because previous IE exon knockdown analyses resulted in embryonic lethality, less is understood about the contribution of the IE exon to adult hematopoiesis. Here, we achieved specific deletion of the floxed IE exon in adulthood using an inducible Cre expression system. In this conditional knock-out mouse line, the Gata1 mRNA level was significantly down-regulated in the megakaryocyte lineage, resulting in thrombocytopenia with a marked proliferation of megakaryocytes. By contrast, in the erythroid lineage, Gata1 mRNA was expressed abundantly utilizing alternative first exons. Especially, the IEb/c and newly identified IEd exons were transcribed at a level comparable with that of the IE exon in control mice. Surprisingly, in the IE-null mouse, these transcripts failed to produce full-length GATA1 protein, but instead yielded GATA1 lacking the N-terminal domain inefficiently. With low level expression of the short form of GATA1, IE-null mice showed severe anemia with skewed erythroid maturation. Notably, the hematological phenotypes of adult IE-null mice substantially differ from those observed in mice harboring conditional ablation of the entire Gata1 gene. The present study demonstrates that the IE exon is instrumental to adult erythropoiesis by regulating the proper level of transcription and selecting the correct transcription start site of the Gata1 gene. PMID:19854837

Ankyrin-G isoform imbalance and interneuronopathy link epilepsy and bipolar disorder.

PubMed

Lopez, A Y; Wang, X; Xu, M; Maheshwari, A; Curry, D; Lam, S; Adesina, A M; Noebels, J L; Sun, Q-Q; Cooper, E C

2017-10-01

ANK3, encoding the adaptor protein Ankyrin-G (AnkG), has been implicated in bipolar disorder by genome-wide association studies. ANK3 has multiple alternative first exons, and a bipolar disorder-associated ANK3 variant has been shown to reduce the expression of exon 1b. Here we identify mechanisms through which reduced ANK3 exon 1b isoform expression disrupts neuronal excitation-inhibition balance. We find that parvalbumin (PV) interneurons and principal cells differentially express ANK3 first exon subtypes. PV interneurons express only isoforms containing exon 1b, whereas excitatory principal cells express exon 1e alone or both 1e and 1b. In transgenic mice deficient for exon 1b, PV interneurons lack voltage-gated sodium channels at their axonal initial segments and have increased firing thresholds and diminished action potential dynamic range. These mice exhibit an Ank3 gene dosage-dependent phenotype including behavior changes modeling bipolar disorder, epilepsy and sudden death. Thus ANK3's important association with human bipolar susceptibility may arise from imbalance between AnkG function in interneurons and principal cells and resultant excessive circuit sensitivity and output. AnkG isoform imbalance is a novel molecular endophenotype and potential therapeutic target.

Ankyrin-G isoform imbalance and interneuronopathy link epilepsy and bipolar disorder

PubMed Central

Lopez, Angel Y.; Wang, Xinjun; Xu, Mingxuan; Maheshwari, Atul; Curry, Daniel; Lam, Sandi; Adesina, Adekunle M.; Noebels, Jeffrey L.; Sun, Qian-Quan; Cooper, Edward C.

2016-01-01

ANK3, encoding the adaptor protein Ankyrin-G, has been implicated in bipolar disorder by genome wide association studies. ANK3 has multiple alternative first exons, and a bipolar disorder-associated ANK3 variant has been shown to reduce expression of exon 1b. Here we identify mechanisms through which reduced ANK3 exon 1b isoform expression disrupts neuronal excitation-inhibition balance. We find that parvalbumin interneurons and principal cells differentially express ANK3 first exon subtypes. Parvalbumin interneurons express only isoforms containing exon 1b, whereas excitatory principal cells express exon 1e alone, or both 1e and 1b. In transgenic mice deficient for exon 1b, parvalbumin interneurons lack voltage-gated sodium channels at their axonal initial segments and have increased firing thresholds and diminished action potential dynamic range. These mice exhibit an Ank3 gene dosage-dependent phenotype including behavior changes modeling bipolar disorder, epilepsy, and sudden death. Thus, ANK3’s important association with human bipolar susceptibility may arise from imbalance between ankyrin-G function in interneurons and principal cells and resultant excessive circuit sensitivity and output. Ankyrin-G isoform imbalance is a novel molecular endophenotype and potential therapeutic target. PMID:27956739

3-Hydroxy-3-methylglutaryl CoA lyase (HL): Mouse and human HL gene (HMGCL) cloning and detection of large gene deletions in two unrelated HL-deficient patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, S.P.; Robert, M.F.; Mitchell, G.A.

1996-04-01

3-hydroxy-3-methylglutaryl CoA lyase (HL, EC 4.1.3.4) catalyzes the cleavage of 3-hydroxy-3-methylglutaryl CoA to acetoacetic acid and acetyl CoA, the final reaction of both ketogenesis and leucine catabolism. Autosomal-recessive HL deficiency in humans results in episodes of hypoketotic hypoglycemia and coma. Using a mouse HL cDNA as a probe, we isolated a clone containing the full-length mouse HL gene that spans about 15 kb of mouse chromosome 4 and contains nine exons. The promoter region of the mouse HL gene contains elements characteristic of a housekeeping gene: a CpG island containing multiple Sp1 binding sites surrounds exon 1, and neither amore » TATA nor a CAAT box are present. We identified multiple transcription start sites in the mouse HL gene, 35 to 9 bases upstream of the translation start codon. We also isolated two human HL genomic clones that include HL exons 2 to 9 within 18 kb. The mouse and human HL genes (HGMW-approved symbol HMGCL) are highly homologous, with identical locations of intron-exon junctions. By genomic Southern blot analysis and exonic PCR, was found 2 of 33 HL-deficient probands to be homozygous for large deletions in the HL gene. 26 refs., 4 figs., 2 tabs.« less

Long Term Agroecosystem Research Landing | National Agricultural Library

Science.gov Websites

Skip to main content Home National Agricultural Library United States Department of Agriculture Ag Agroecosystem Research Overview Agriculture faces tremendous challenges in meeting multiple, diverse societal > ENVIRONMENTAL ASSESSMENTS filter EARTH SCIENCE > AGRICULTURE > SOILS (1) Apply EARTH

Multiple primary tumors of the upper aerodigestive tract: is there a role for constitutional mutations in the p53 gene?

PubMed

Gallo, O; Sardi, I; Pepe, G; Franchi, A; Attanasio, M; Giusti, B; Bocciolini, C; Abbate, R

1999-07-19

Head-and-neck cancer (HNC) patients have a high risk of developing second primary tumors of the upper aerodigestive tract, the main cause of death. Although the roles of tobacco and diet in multiple head-and-neck carcinogenesis have been thoroughly investigated, little is known about individual genetic susceptibility factors involved in this process. Genomic instability, reflecting the propensity and the susceptibility of the genome to acquire multiple alterations, could be considered a driving force behind multiple carcinogenesis. Mutation of the p53 tumor-suppressor gene has been proposed to play an important role in this process. Therefore, we evaluated the incidence of inherited p53 germ-line alteration(s) in a population of 24 consecutive HNC patients and their first-degree relatives affected by multiple malignancies as well as the occurrence of p53 somatic acquired mutation(s) in 16 cancers, including first and second primaries from 5 HNCs of the same group. Mutations in exons 4-11 of the p53 gene were investigated using SSCP-PCR analysis and DNA sequencing. Analysis was extended to the peripheral blood and cancer biopsies available from first-degree relatives of cancer-prone families with p53 germ-line mutations. p53 germ-line mutations were identified in the peripheral blood and corresponding cancers of 3 HNC patients who had multiple malignancies. The only missense mutation detected was mapped in exon 6; it is a GTG to GAG substitution with an amino acid change from Val to Glu at codon 197. The remaining 2 p53 germ-line mutations were single-nucleotide substitutions without amino acid change in exon 6 (codon 213, CGA to CGG) and in exon 8 (codon 295, CCT to CCC), respectively. These mutations were found in HNC patients with a family history of cancer. Abnormal expression of wild-type p53 protein in normal and pathological tissues from patients with the same sense single-nucleotide substitutions was detected by immuno-histochemistry.

Inferring the expression variability of human transposable element-derived exons by linear model analysis of deep RNA sequencing data.

PubMed

Zhang, Wensheng; Edwards, Andrea; Fan, Wei; Fang, Zhide; Deininger, Prescott; Zhang, Kun

2013-08-28

The exonization of transposable elements (TEs) has proven to be a significant mechanism for the creation of novel exons. Existing knowledge of the retention patterns of TE exons in mRNAs were mainly established by the analysis of Expressed Sequence Tag (EST) data and microarray data. This study seeks to validate and extend previous studies on the expression of TE exons by an integrative statistical analysis of high throughput RNA sequencing data. We collected 26 RNA-seq datasets spanning multiple tissues and cancer types. The exon-level digital expressions (indicating retention rates in mRNAs) were quantified by a double normalized measure, called the rescaled RPKM (Reads Per Kilobase of exon model per Million mapped reads). We analyzed the distribution profiles and the variability (across samples and between tissue/disease groups) of TE exon expressions, and compared them with those of other constitutive or cassette exons. We inferred the effects of four genomic factors, including the location, length, cognate TE family and TE nucleotide proportion (RTE, see Methods section) of a TE exon, on the exons' expression level and expression variability. We also investigated the biological implications of an assembly of highly-expressed TE exons. Our analysis confirmed prior studies from the following four aspects. First, with relatively high expression variability, most TE exons in mRNAs, especially those without exact counterparts in the UCSC RefSeq (Reference Sequence) gene tables, demonstrate low but still detectable expression levels in most tissue samples. Second, the TE exons in coding DNA sequences (CDSs) are less highly expressed than those in 3' (5') untranslated regions (UTRs). Third, the exons derived from chronologically ancient repeat elements, such as MIRs, tend to be highly expressed in comparison with those derived from younger TEs. Fourth, the previously observed negative relationship between the lengths of exons and the inclusion levels in transcripts is also true for exonized TEs. Furthermore, our study resulted in several novel findings. They include: (1) for the TE exons with non-zero expression and as shown in most of the studied biological samples, a high TE nucleotide proportion leads to their lower retention rates in mRNAs; (2) the considered genomic features (i.e. a continuous variable such as the exon length or a category indicator such as 3'UTR) influence the expression level and the expression variability (CV) of TE exons in an inverse manner; (3) not only the exons derived from Alu elements but also the exons from the TEs of other families were preferentially established in zinc finger (ZNF) genes.

Ultrasonic multi-skip tomography for pipe inspection

NASA Astrophysics Data System (ADS)

Volker, Arno; Vos, Rik; Hunter, Alan; Lorenz, Maarten

2012-05-01

The inspection of wall loss corrosion is difficult at pipe support locations due to limited accessibility. However, the recently developed ultrasonic Multi-Skip screening technique is suitable for this problem. The method employs ultrasonic transducers in a pitch-catch geometry positioned on opposite sides of the pipe support. Shear waves are transmitted in the axial direction within the pipe wall, reflecting multiple times between the inner and outer surfaces before reaching the receivers. Along this path, the signals accumulate information on the integral wall thickness (e.g., via variations in travel time). The method is very sensitive in detecting the presence of wall loss, but it is difficult to quantify both the extent and depth of the loss. If the extent is unknown, then only a conservative estimate of the depth can be made due to the cumulative nature of the travel time variations. Multi-Skip tomography is an extension of Multi-Skip screening and has shown promise as a complimentary follow-up inspection technique. In recent work, we have developed the technique and demonstrated its use for reconstructing high-resolution estimates of pipe wall thickness profiles. The method operates via a model-based full wave field inversion; this consists of a forward model for predicting the measured wave field and an iterative process that compares the predicted and measured wave fields and minimizes the differences with respect to the model parameters (i.e., the wall thickness profile). This paper presents our recent developments in Multi-Skip tomographic inversion, focusing on the initial localization of corrosion regions for efficient parameterization of the surface profile model and utilization of the signal phase information for improving resolution.

Predictive simulation of gait at low gravity reveals skipping as the preferred locomotion strategy

PubMed Central

Ackermann, Marko; van den Bogert, Antonie J.

2012-01-01

The investigation of gait strategies at low gravity environments gained momentum recently as manned missions to the Moon and to Mars are reconsidered. Although reports by astronauts of the Apollo missions indicate alternative gait strategies might be favored on the Moon, computational simulations and experimental investigations have been almost exclusively limited to the study of either walking or running, the locomotion modes preferred under Earth's gravity. In order to investigate the gait strategies likely to be favored at low gravity a series of predictive, computational simulations of gait are performed using a physiological model of the musculoskeletal system, without assuming any particular type of gait. A computationally efficient optimization strategy is utilized allowing for multiple simulations. The results reveal skipping as more efficient and less fatiguing than walking or running and suggest the existence of a walk-skip rather than a walk-run transition at low gravity. The results are expected to serve as a background to the design of experimental investigations of gait under simulated low gravity. PMID:22365845

Predictive simulation of gait at low gravity reveals skipping as the preferred locomotion strategy.

PubMed

Ackermann, Marko; van den Bogert, Antonie J

2012-04-30

The investigation of gait strategies at low gravity environments gained momentum recently as manned missions to the Moon and to Mars are reconsidered. Although reports by astronauts of the Apollo missions indicate alternative gait strategies might be favored on the Moon, computational simulations and experimental investigations have been almost exclusively limited to the study of either walking or running, the locomotion modes preferred under Earth's gravity. In order to investigate the gait strategies likely to be favored at low gravity a series of predictive, computational simulations of gait are performed using a physiological model of the musculoskeletal system, without assuming any particular type of gait. A computationally efficient optimization strategy is utilized allowing for multiple simulations. The results reveal skipping as more efficient and less fatiguing than walking or running and suggest the existence of a walk-skip rather than a walk-run transition at low gravity. The results are expected to serve as a background to the design of experimental investigations of gait under simulated low gravity. Copyright © 2012 Elsevier Ltd. All rights reserved.

Alternative RNA splicing and gastric cancer.

PubMed

Li, Ying; Yuan, Yuan

2017-07-01

Alternative splicing (AS) linked to diseases, especially to tumors. Recently, more and more studies focused on the relationship between AS and gastric cancer (GC). This review surveyed the hot topic from four aspects: First, the common types of AS in cancer, including exon skipping, intron retention, mutually exclusive exon, alternative 5 ' or 3' splice site, alternative first or last exon and alternative 3' untranslated regions. Second, basic mechanisms of AS and its relationship with cancer. RNA splicing in eukaryotes follows the GT-AG rule by both cis-elements and trans-acting factors regulatory. Through RNA splicing, different proteins with different forms and functions can be produced and may be associated with carcinogenesis. Third, AS types of GC-related genes and their splicing variants. In this paper, we listed 10 common genes with AS and illustrated its possible molecular mechanisms owing to genetic variation (mutation and /or polymorphism). Fourth, the splicing variants of GC-associated genes and gastric carcinogenesis, invasion and metastasis. Many studies have found that the different splicing variants of the same gene are differentially expressed in GC and its precancerous diseases, suggesting AS has important implications in GC development. Taking together, this review highlighted the role of AS and splicing variants in the process of GC. We hope that this is not only beneficial to advances in the study field of GC, but also can provide valuable information to other similar tumor research.Although we already know some gene splicing and splicing variants play an important role in the development of GC, but many phenomena and mechanisms are still unknown. For example, how the tumor microenvironment and signal transduction pathway effect the forming and function of AS? Unfortunately, this review did not cover the contents because the current study is limited. It is no doubt that clarifying the phenomena and mechanisms of these unknown may help to reveal the relationship of AS with complex tumor genetic variation and the occurrence and development of tumors. Copyright © 2016 Elsevier B.V. All rights reserved.

Multidrug resistance in epilepsy and polymorphisms in the voltage-gated sodium channel genes SCN1A, SCN2A, and SCN3A: correlation among phenotype, genotype, and mRNA expression.

PubMed

Kwan, Patrick; Poon, Wai Sang; Ng, Ho-Keung; Kang, David E; Wong, Virginia; Ng, Ping Wing; Lui, Colin H T; Sin, Ngai Chuen; Wong, Ka S; Baum, Larry

2008-11-01

Many antiepileptic drugs (AEDs) prevent seizures by blocking voltage-gated brain sodium channels. However, treatment is ineffective in 30% of epilepsy patients, which might, at least in part, result from polymorphisms of the sodium channel genes. We investigated the association of AED responsiveness with genetic polymorphisms and correlated any association with mRNA expression of the neuronal sodium channels. We performed genotyping of tagging and candidate single nucleotide polymorphisms (SNPs) of SCN1A, 2A, and 3A in 471 Chinese epilepsy patients (272 drug responsive and 199 drug resistant). A total of 27 SNPs were selected based on the HapMap database. Genotype distributions in drug-responsive and drug-resistant patients were compared. SCN2A mRNA was quantified by real-time PCR in 24 brain and 57 blood samples. Its level was compared between patients with different genotypes of an SCN2A SNP found to be associated with drug responsiveness. SCN2A IVS7-32A>G (rs2304016) A alleles were associated with drug resistance (odds ratio = 2.1, 95% confidence interval: 1.2-3.7, P=0.007). Haplotypes containing the IVS7-32A>G allele A were also associated with drug resistance. IVS7-32A>G is located within the putative splicing branch site for splicing exons 7 and 9. PCR of reverse-transcribed RNA from blood or brain of patients with different IVS7-32A>G genotypes using primers in exons 7 and 9 showed no skipping of exon 8, and real-time PCR showed no difference in SCN2A mRNA levels among genotypes. Results of this study suggest an association between SCN2A IVS7-32A>G and AED responsiveness, without evidence of an effect on splicing or mRNA expression.

Overcoming imatinib resistance conferred by the BIM deletion polymorphism in chronic myeloid leukemia with splice-switching antisense oligonucleotides

PubMed Central

Liu, Jun; Bhadra, Malini; Sinnakannu, Joanna Rajeswary; Yue, Wan Lin; Tan, Cheryl Weiqi; Rigo, Frank; Ong, S.Tiong; Roca, Xavier

2017-01-01

Many tyrosine kinase-driven cancers, including chronic myeloid leukemia (CML), are characterized by high response rates to specific tyrosine kinase inhibitors (TKIs) like imatinib. In East Asians, primary imatinib resistance is caused by a deletion polymorphism in Intron 2 of the BIM gene, whose product is required for TKI-induced apoptosis. The deletion biases BIM splicing from exon 4 to exon 3, generating splice isoforms lacking the exon 4-encoded pro-apoptotic BH3 domain, which impairs the ability of TKIs to induce apoptosis. We sought to identify splice-switching antisense oligonucleotides (ASOs) that block exon 3 but enhance exon 4 splicing, and thereby resensitize BIM deletion-containing cancers to imatinib. First, we mapped multiple cis-acting splicing elements around BIM exon 3 by minigene mutations, and found an exonic splicing enhancer acting via SRSF1. Second, by a systematic ASO walk, we isolated ASOs that corrected the aberrant BIM splicing. Eight of 67 ASOs increased exon 4 levels in BIM deletion-containing cells, and restored imatinib-induced apoptosis and TKI sensitivity. This proof-of-principle study proves that resistant CML cells by BIM deletion polymorphism can be resensitized to imatinib via splice-switching BIM ASOs. Future optimizations might yield a therapeutic ASO as precision-medicine adjuvant treatment for BIM-polymorphism-associated TKI-resistant CML and other cancers. PMID:29100409

Overcoming imatinib resistance conferred by the BIM deletion polymorphism in chronic myeloid leukemia with splice-switching antisense oligonucleotides.

PubMed

Liu, Jun; Bhadra, Malini; Sinnakannu, Joanna Rajeswary; Yue, Wan Lin; Tan, Cheryl Weiqi; Rigo, Frank; Ong, S Tiong; Roca, Xavier

2017-09-29

Many tyrosine kinase-driven cancers, including chronic myeloid leukemia (CML), are characterized by high response rates to specific tyrosine kinase inhibitors (TKIs) like imatinib. In East Asians, primary imatinib resistance is caused by a deletion polymorphism in Intron 2 of the BIM gene, whose product is required for TKI-induced apoptosis. The deletion biases BIM splicing from exon 4 to exon 3, generating splice isoforms lacking the exon 4-encoded pro-apoptotic BH3 domain, which impairs the ability of TKIs to induce apoptosis. We sought to identify splice-switching antisense oligonucleotides (ASOs) that block exon 3 but enhance exon 4 splicing, and thereby resensitize BIM deletion-containing cancers to imatinib. First, we mapped multiple cis -acting splicing elements around BIM exon 3 by minigene mutations, and found an exonic splicing enhancer acting via SRSF1. Second, by a systematic ASO walk, we isolated ASOs that corrected the aberrant BIM splicing. Eight of 67 ASOs increased exon 4 levels in BIM deletion-containing cells, and restored imatinib-induced apoptosis and TKI sensitivity. This proof-of-principle study proves that resistant CML cells by BIM deletion polymorphism can be resensitized to imatinib via splice-switching BIM ASOs. Future optimizations might yield a therapeutic ASO as precision-medicine adjuvant treatment for BIM -polymorphism-associated TKI-resistant CML and other cancers.

A novel TFF2 splice variant (ΔEX2TFF2) correlates with longer overall survival time in cholangiocarcinoma

PubMed Central

KAMLUA, SURASEE; PATRAKITKOMJORN, SIRIPORN; JEARANAIKOON, PATCHAREE; MENHENIOTT, TREVELYAN R.; GIRAUD, ANDREW S.; LIMPAIBOON, TEMDUANG

2012-01-01

Trefoil factor 2 (TFF2) is a member of trefoil factor family found to be overexpressed in many cancers including cholangiocarcinoma (CCA). The majority of studies have focused on wild-type TFF2 (wtTFF2) expression, but information regarding alternative splicing variants of TFF2 mRNA has not been reported. In this study, we aimed to identify and quantify a novel TFF2 splice variant in cholangiocarcinoma (CCA). Seventy-eight tumors and 15 normal adjacent tissues were quantified for the expression of the TFF2 splice variant relative to wild-type (wt) TFF2 mRNA using quantitative reverse transcriptase polymerase chain reaction (QRT-PCR). The ratio of TFF2 splice variant against wtTFF2 was analyzed for associations with clinical parameters. We found a novel TFF2 splice variant, exon 2 skipping (ΔEX2TFF2), resulting in a stop codon (TAG) at exon 1. The ΔEX2TFF2/wtTFF2 ratio in tumors was significantly higher than in normal tissue (P<0.01). Interestingly, high ΔEX2TFF2/wtTFF2 ratio was significantly associated with good prognosis compared with low ratio (P=0.017). In contrast, the presence of wtTFF2 protein was associated with poor survival of CCA patients (P=0.034). This is the first report of a trefoil factor splice variant and its potential application as a prognostic biomarker in CCA. PMID:22159958

How the discovery of ISS-N1 led to the first medical therapy for spinal muscular atrophy

PubMed Central

Singh, Natalia N.; Howell, Matthew D.; Androphy, Elliot J.; Singh, Ravindra N.

2017-01-01

Spinal muscular atrophy (SMA), a prominent genetic disease of infant mortality, is caused by low levels of survival motor neuron (SMN) protein owing to deletions or mutations of the SMN1 gene. SMN2, a nearly identical copy of SMN1 present in humans, cannot compensate for the loss of SMN1 due to predominant skipping of exon 7 during pre-mRNA splicing. With the recent FDA approval of nusinersen (Spinraza™), the potential for correction of SMN2 exon 7 splicing as a SMA therapy has been affirmed. Nusinersen is an antisense oligonucleotide that targets intronic splicing silencer N1 (ISS-N1) discovered in 2004 at the University of Massachusetts Medical School. ISS-N1 has emerged as the model target for testing the therapeutic efficacy of antisense oligonucleotides using different chemistries as well as different mouse models of SMA. Here we provide a historical account of events that led to the discovery of ISS-N1 and describe the impact of independent validations that raised the profile of ISS-N1 as one of the most potent antisense targets for the treatment of a genetic disease. Recent approval of nusinersen provides a much-needed boost for antisense technology that is just beginning to realize its potential. Beyond treating SMA, the ISS-N1 target offers myriad potentials for perfecting various aspects of the nucleic-acid-based technology for the amelioration of the countless number of pathological conditions. PMID:28485722

How the discovery of ISS-N1 led to the first medical therapy for spinal muscular atrophy.

PubMed

Singh, N N; Howell, M D; Androphy, E J; Singh, R N

2017-09-01

Spinal muscular atrophy (SMA), a prominent genetic disease of infant mortality, is caused by low levels of survival motor neuron (SMN) protein owing to deletions or mutations of the SMN1 gene. SMN2, a nearly identical copy of SMN1 present in humans, cannot compensate for the loss of SMN1 because of predominant skipping of exon 7 during pre-mRNA splicing. With the recent US Food and Drug Administration approval of nusinersen (Spinraza), the potential for correction of SMN2 exon 7 splicing as an SMA therapy has been affirmed. Nusinersen is an antisense oligonucleotide that targets intronic splicing silencer N1 (ISS-N1) discovered in 2004 at the University of Massachusetts Medical School. ISS-N1 has emerged as the model target for testing the therapeutic efficacy of antisense oligonucleotides using different chemistries as well as different mouse models of SMA. Here, we provide a historical account of events that led to the discovery of ISS-N1 and describe the impact of independent validations that raised the profile of ISS-N1 as one of the most potent antisense targets for the treatment of a genetic disease. Recent approval of nusinersen provides a much-needed boost for antisense technology that is just beginning to realize its potential. Beyond treating SMA, the ISS-N1 target offers myriad potentials for perfecting various aspects of the nucleic-acid-based technology for the amelioration of the countless number of pathological conditions.

A de novo mosaic mutation of PHEX in a boy with hypophosphatemic rickets.

PubMed

Weng, Chen; Chen, Jiao; Sun, Li; Zhou, Zhong-Wei; Feng, Xue; Sun, Jun-Hui; Lu, Ling-Ping; Yu, Ping; Qi, Ming

2016-03-01

X-linked dominant hypophosphatemic rickets (XLHR), is characterized mainly by renal phosphate wasting with hypophosphatemia, short stature and abnormal bone mineralization. PHEX, located at Xp22.1-p22.2, is the gene causing XLHR. We aim to characterize the pathogenesis of a Chinese boy who is apparently 'heterozygous' in PHEX gene. Direct sequencing showed two peaks: one was a wild-type 'G' and the other was one base substitution to 'A', though the patient was a male. TA clone assay clearly showed each sequences and the ratios. The mutation effect was predicted via bioinformatics and validated by exon-trapping assay. Real-time PCR was applied to determine the copy number of PHEX. TA clone assay showed the frequency of normal (G) to mutant allele (A) as 19:13. Normal karyotype and real-time PCR results indicate the normal copy number of PHEX. This splice site mutation leads to 4 bp of exon 18 skipping out causing frame shift p.Gly590Glufs*28 that ends up with a loss of active site and Zn(2+)-binding site of PHEX, which probably interfere with renal phosphate reabsorption and bone mineralization. In conclusion, mutation at conserved splice acceptor site resulted in aberrant splicing, ending up with a damaged protein product. This novel mutation is de novo in mosaic pattern that may be induced during early postzygotic period. Taking mosaic somatic mutation of PHEX into consideration is strongly suggested in genetic counseling and etiology research for XLHR.

Identification of Alternative Splicing and Fusion Transcripts in Non-Small Cell Lung Cancer by RNA Sequencing.

PubMed

Hong, Yoonki; Kim, Woo Jin; Bang, Chi Young; Lee, Jae Cheol; Oh, Yeon-Mok

2016-04-01

Lung cancer is the most common cause of cancer related death. Alterations in gene sequence, structure, and expression have an important role in the pathogenesis of lung cancer. Fusion genes and alternative splicing of cancer-related genes have the potential to be oncogenic. In the current study, we performed RNA-sequencing (RNA-seq) to investigate potential fusion genes and alternative splicing in non-small cell lung cancer. RNA was isolated from lung tissues obtained from 86 subjects with lung cancer. The RNA samples from lung cancer and normal tissues were processed with RNA-seq using the HiSeq 2000 system. Fusion genes were evaluated using Defuse and ChimeraScan. Candidate fusion transcripts were validated by Sanger sequencing. Alternative splicing was analyzed using multivariate analysis of transcript sequencing and validated using quantitative real time polymerase chain reaction. RNA-seq data identified oncogenic fusion genes EML4-ALK and SLC34A2-ROS1 in three of 86 normal-cancer paired samples. Nine distinct fusion transcripts were selected using DeFuse and ChimeraScan; of which, four fusion transcripts were validated by Sanger sequencing. In 33 squamous cell carcinoma, 29 tumor specific skipped exon events and six mutually exclusive exon events were identified. ITGB4 and PYCR1 were top genes that showed significant tumor specific splice variants. In conclusion, RNA-seq data identified novel potential fusion transcripts and splice variants. Further evaluation of their functional significance in the pathogenesis of lung cancer is required.

Dystrophin-deficient large animal models: translational research and exon skipping

PubMed Central

Yu, Xinran; Bao, Bo; Echigoya, Yusuke; Yokota, Toshifumi

2015-01-01

Duchenne muscular dystrophy (DMD) is an X-linked recessive genetic disorder caused by mutations in the dystrophin gene. Affecting approximately 1 in 3,600-9337 boys, DMD patients exhibit progressive muscle degeneration leading to fatality as a result of heart or respiratory failure. Despite the severity and prevalence of the disease, there is no cure available. While murine models have been successfully used in illustrating the mechanisms of DMD, their utility in DMD research is limited due to their mild disease phenotypes such as lack of severe skeletal muscle and cardiac symptoms. To address the discrepancy between the severity of disease displayed by murine models and human DMD patients, dystrophin-deficient dog models with a splice site mutation in intron 6 were established. Examples of these are Golden Retriever muscular dystrophy and beagle-based Canine X-linked muscular dystrophy. These large animal models are widely employed in therapeutic DMD research due to their close resemblance to the severity of human patient symptoms. Recently, genetically tailored porcine models of DMD with deleted exon 52 were developed by our group and others, and can potentially act as a new large animal model. While therapeutic outcomes derived from these large animal models can be more reliably extrapolated to DMD patients, a comprehensive understanding of these models is still needed. This paper will discuss recent progress and future directions of DMD studies with large animal models such as canine and porcine models. PMID:26396664

A contracted DNA repeat in LHX3 intron 5 is associated with aberrant splicing and pituitary dwarfism in German shepherd dogs.

PubMed

Voorbij, Annemarie M W Y; van Steenbeek, Frank G; Vos-Loohuis, Manon; Martens, Ellen E C P; Hanson-Nilsson, Jeanette M; van Oost, Bernard A; Kooistra, Hans S; Leegwater, Peter A

2011-01-01

Dwarfism in German shepherd dogs is due to combined pituitary hormone deficiency of unknown genetic cause. We localized the recessively inherited defect by a genome wide approach to a region on chromosome 9 with a lod score of 9.8. The region contains LHX3, which codes for a transcription factor essential for pituitary development. Dwarfs have a deletion of one of six 7 bp repeats in intron 5 of LHX3, reducing the intron size to 68 bp. One dwarf was compound heterozygous for the deletion and an insertion of an asparagine residue in the DNA-binding homeodomain of LHX3, suggesting involvement of the gene in the disorder. An exon trapping assay indicated that the shortened intron is not spliced efficiently, probably because it is too small. We applied bisulfite conversion of cytosine to uracil in RNA followed by RT-PCR to analyze the splicing products. The aberrantly spliced RNA molecules resulted from either skipping of exon 5 or retention of intron 5. The same splicing defects were observed in cDNA derived from the pituitary of dwarfs. A survey of similarly mutated introns suggests that there is a minimal distance requirement between the splice donor and branch site of 50 nucleotides. In conclusion, a contraction of a DNA repeat in intron 5 of canine LHX3 leads to deficient splicing and is associated with pituitary dwarfism.

A Contracted DNA Repeat in LHX3 Intron 5 Is Associated with Aberrant Splicing and Pituitary Dwarfism in German Shepherd Dogs

PubMed Central

Voorbij, Annemarie M. W. Y.; van Steenbeek, Frank G.; Vos-Loohuis, Manon; Martens, Ellen E. C. P.; Hanson-Nilsson, Jeanette M.; van Oost, Bernard A.; Kooistra, Hans S.; Leegwater, Peter A.

2011-01-01

Dwarfism in German shepherd dogs is due to combined pituitary hormone deficiency of unknown genetic cause. We localized the recessively inherited defect by a genome wide approach to a region on chromosome 9 with a lod score of 9.8. The region contains LHX3, which codes for a transcription factor essential for pituitary development. Dwarfs have a deletion of one of six 7 bp repeats in intron 5 of LHX3, reducing the intron size to 68 bp. One dwarf was compound heterozygous for the deletion and an insertion of an asparagine residue in the DNA-binding homeodomain of LHX3, suggesting involvement of the gene in the disorder. An exon trapping assay indicated that the shortened intron is not spliced efficiently, probably because it is too small. We applied bisulfite conversion of cytosine to uracil in RNA followed by RT-PCR to analyze the splicing products. The aberrantly spliced RNA molecules resulted from either skipping of exon 5 or retention of intron 5. The same splicing defects were observed in cDNA derived from the pituitary of dwarfs. A survey of similarly mutated introns suggests that there is a minimal distance requirement between the splice donor and branch site of 50 nucleotides. In conclusion, a contraction of a DNA repeat in intron 5 of canine LHX3 leads to deficient splicing and is associated with pituitary dwarfism. PMID:22132174

Performance enhancing water skipping: successive free surface impacts of elastic spheres

NASA Astrophysics Data System (ADS)

Hurd, Randy; Truscott, Tadd; Belden, Jesse

2014-11-01

From naval gunners skipping cannonballs to children skipping stones, physicists have long been enamored with the repeated ricochet of objects on the water surface. Elastic spheres, such as the toy Waboba ball, make water skipping more accessible to the masses by expanding the range of impact parameters over which objects can be skipped. For example, it is not difficult to achieve more than twenty skips with such spheres, where skipping a stone twenty times is very difficult. In this talk we discuss the dynamics of water skipping elastic spheres over several successive skips. High-speed video captured using a unique experimental setup reveals how dynamics change with each skip as a result of lost kinetic energy. We place these observations in the context of previous work on single oblique impacts to identify material vibration modes that are excited during ricochet. The material modes excited with each successive impact are seen to decay from high-energy modes to low energy modes until water entry finally occurs. A model for estimating skipping outcome from initial conditions is proposed.

Skipping of Chinese characters does not rely on word-based processing.

PubMed

Lin, Nan; Angele, Bernhard; Hua, Huimin; Shen, Wei; Zhou, Junyi; Li, Xingshan

2018-02-01

Previous eye-movement studies have indicated that people tend to skip extremely high-frequency words in sentence reading, such as "the" in English and "/de" in Chinese. Two alternative hypotheses have been proposed to explain how this frequent skipping happens in Chinese reading: one assumes that skipping happens when the preview has been fully identified at the word level (word-based skipping); the other assumes that skipping happens whenever the preview character is easy to identify regardless of whether lexical processing has been completed or not (character-based skipping). Using the gaze-contingent display change paradigm, we examined the two hypotheses by substituting the preview of the third character of a four-character Chinese word with the high-frequency Chinese character "/de", which should disrupt the ongoing word-level processing. The character-based skipping hypothesis predicts that this manipulation will enhance the skipping probability of the target character (i.e., the third character of the target word), because the character "/de" has much higher character frequency than the original character. The word-based skipping hypothesis instead predicts a reduction of the skipping probability of the target character because the presence of the character "/de" is lexically infelicitous at word level. The results supported the character-based skipping hypothesis, indicating that in Chinese reading the decision of skipping a character can be made before integrating it into a word.

Clinical and genetic spectrum of Birt–Hogg–Dubé syndrome patients in whom pneumothorax and/or multiple lung cysts are the presenting feature

PubMed Central

Kunogi, Makiko; Kurihara, Masatoshi; Ikegami, Takako Shigihara; Kobayashi, Toshiyuki; Shindo, Noriko; Kumasaka, Toshio; Gunji, Yoko; Kikkawa, Mika; Iwakami, Shin-ichiro; Hino, Okio; Takahashi, Kazuhisa

2010-01-01

Background Birt–Hogg–Dubé syndrome (BHDS) is an inherited autosomal genodermatosis characterised by fibrofolliculomas of the skin, renal tumours and multiple lung cysts. Genetic studies have disclosed that the clinical picture as well as responsible germline FLCN mutations are diverse. Objectives BHDS may be caused by a germline deletion which cannot be detected by a conventional genetic approach. Real-time quantitative polymerase chain reaction (qPCR) may be able to identify such a mutation and thus provide us with a more accurate clinical picture of BHDS. Methods This study analysed 36 patients with multiple lung cysts of undetermined causes. Denaturing high performance liquid chromatography (DHPLC) was applied for mutation screening. If no abnormality was detected by DHPLC, the amount of each FLCN exon in genome was quantified by qPCR. Results An FLCN germline mutation was found in 23 (63.9%) of the 36 patients by DHPLC and direct sequencing (13 unique small nucleotide alterations which included 11 novel mutations). A large genomic deletion was identified in two of the remaining 13 patients by qPCR (one patient with exon 14 deletion and one patient with a deletion encompassing exons 9 to 14). Mutations including genomic deletions were most frequently identified in the 3′-end of the FLCN gene including exons 12 and 13 (13/25=52.0%). The BHDS patients whose multiple cysts prompted the diagnosis in this study showed a very low incidence of skin and renal involvement. Conclusions BHDS is due to large deletions as well as small nucleotide alterations. Racial differences may occur between Japanese and patients of European decent in terms of FLCN mutations and clinical manifestations. PMID:20413710

The kinetics of pre-mRNA splicing in the Drosophila genome and the influence of gene architecture.

PubMed

Pai, Athma A; Henriques, Telmo; McCue, Kayla; Burkholder, Adam; Adelman, Karen; Burge, Christopher B

2017-12-27

Production of most eukaryotic mRNAs requires splicing of introns from pre-mRNA. The splicing reaction requires definition of splice sites, which are initially recognized in either intron-spanning ('intron definition') or exon-spanning ('exon definition') pairs. To understand how exon and intron length and splice site recognition mode impact splicing, we measured splicing rates genome-wide in Drosophila , using metabolic labeling/RNA sequencing and new mathematical models to estimate rates. We found that the modal intron length range of 60-70 nt represents a local maximum of splicing rates, but that much longer exon-defined introns are spliced even faster and more accurately. We observed unexpectedly low variation in splicing rates across introns in the same gene, suggesting the presence of gene-level influences, and we identified multiple gene level variables associated with splicing rate. Together our data suggest that developmental and stress response genes may have preferentially evolved exon definition in order to enhance the rate or accuracy of splicing.

Alternative splicing of anciently exonized 5S rRNA regulates plant transcription factor TFIIIA

PubMed Central

Fu, Yan; Bannach, Oliver; Chen, Hao; Teune, Jan-Hendrik; Schmitz, Axel; Steger, Gerhard; Xiong, Liming; Barbazuk, W. Brad

2009-01-01

Identifying conserved alternative splicing (AS) events among evolutionarily distant species can prioritize AS events for functional characterization and help uncover relevant cis- and trans-regulatory factors. A genome-wide search for conserved cassette exon AS events in higher plants revealed the exonization of 5S ribosomal RNA (5S rRNA) within the gene of its own transcription regulator, TFIIIA (transcription factor for polymerase III A). The 5S rRNA-derived exon in TFIIIA gene exists in all representative land plant species but not in green algae and nonplant species, suggesting it is specific to land plants. TFIIIA is essential for RNA polymerase III-based transcription of 5S rRNA in eukaryotes. Integrating comparative genomics and molecular biology revealed that the conserved cassette exon derived from 5S rRNA is coupled with nonsense-mediated mRNA decay. Utilizing multiple independent Arabidopsis overexpressing TFIIIA transgenic lines under osmotic and salt stress, strong accordance between phenotypic and molecular evidence reveals the biological relevance of AS of the exonized 5S rRNA in quantitative autoregulation of TFIIIA homeostasis. Most significantly, this study provides the first evidence of ancient exaptation of 5S rRNA in plants, suggesting a novel gene regulation model mediated by the AS of an anciently exonized noncoding element. PMID:19211543

Water Bouncing Balls: how material stiffness affects water entry

NASA Astrophysics Data System (ADS)

Truscott, Tadd

2014-03-01

It is well known that one can skip a stone across the water surface, but less well known that a ball can also be skipped on water. Even though 17th century ship gunners were aware that cannonballs could be skipped on the water surface, they did not know that using elastic spheres rather than rigid ones could greatly improve skipping performance (yet would have made for more peaceful volleys). The water bouncing ball (Waboba®) is an elastic ball used in a game of aquatic keep away in which players pass the ball by skipping it along the water surface. The ball skips easily along the surface creating a sense that breaking the world record for number of skips could easily be achieved (51 rock skips Russell Byers 2007). We investigate the physics of skipping elastic balls to elucidate the mechanisms by which they bounce off of the water. High-speed video reveals that, upon impact with the water, the balls create a cavity and deform significantly due to the extreme elasticity; the flattened spheres resemble skipping stones. With an increased wetted surface area, a large hydrodynamic lift force is generated causing the ball to launch back into the air. Unlike stone skipping, the elasticity of the ball plays an important roll in determining the success of the skip. Through experimentation, we demonstrate that the deformation timescale during impact must be longer than the collision time in order to achieve a successful skip. Further, several material deformation modes can be excited upon free surface impact. The effect of impact velocity and angle on the two governing timescales and material wave modes are also experimentally investigated. Scaling for the deformation and collision times are derived and used to establish criteria for skipping in terms of relevant physical parameters.

The genomic structure of the human Charcot-Leyden crystal protein gene is analogous to those of the galectin genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dyer, K.D.; Handen, J.S.; Rosenberg, H.F.

The Charcot-Leyden crystal (CLC) protein, or eosinophil lysophospholipase, is a characteristic protein of human eosinophils and basophils; recent work has demonstrated that the CLC protein is both structurally and functionally related to the galectin family of {beta}-galactoside binding proteins. The galectins as a group share a number of features in common, including a linear ligand binding site encoded on a single exon. In this work, we demonstrate that the intron-exon structure of the gene encoding CLC is analogous to those encoding the galectins. The coding sequence of the CLC gene is divided into four exons, with the entire {beta}-galactoside bindingmore » site encoded by exon III. We have isolated CLC {beta}-galactoside binding sites from both orangutan (Pongo pygmaeus) and murine (Mus musculus) genomic DNAs, both encoded on single exons, and noted conservation of the amino acids shown to interact directly with the {beta}-galactoside ligand. The most likely interpretation of these results suggests the occurrence of one or more exon duplication and insertion events, resulting in the distribution of this lectin domain to CLC as well as to the multiple galectin genes. 35 refs., 3 figs.« less

Potential Association between Breakfast Skipping and Concomitant Late-Night-Dinner Eating with Metabolic Syndrome and Proteinuria in the Japanese Population.

PubMed

Kutsuma, Ayano; Nakajima, Kei; Suwa, Kaname

2014-01-01

Skipping breakfast is considered to be an unhealthy eating habit linked to predispositions to obesity and type 2 diabetes. Because eating dinner late at night can elicit subsequent breakfast skipping, we investigated if skipping breakfast concomitant with late-night-dinner eating (LNDE) was associated with metabolic syndrome (MetS) and proteinuria in the general Japanese population. We examined self-reported habitual breakfast skipping and LNDE, MetS (modified ATP-III criteria), and proteinuria in a cross-sectional study of 60,800 Japanese adults aged 20-75 years. A total of 14,068 subjects (23.1%) skipped breakfast, of whom approximately half (52.8%) skipped breakfast alone (without LNDE). The percentages of subjects who skipped breakfast showed a J-shaped relationship with body mass index (BMI). Multivariate logistic regression analysis showed that skipping breakfast concomitant with LNDE (n = 6,645) was significantly associated with MetS and proteinuria, even after adjusting for relevant confounders (odds ratio (95% CI), 1.17 (1.08-1.28), P = 0.0003, and 1.37 (1.24-1.52), P < 0.0001, resp.). Skipping breakfast alone and LNDE alone were not associated with MetS and proteinuria, respectively. In conclusion, habitual breakfast skipping concomitant with LNDE may represent poorer eating behavior than skipping breakfast alone, associated with MetS, asymptomatic proteinuria, obesity, and low body weight in the general Japanese population.

Reading skill and word skipping: Implications for visual and linguistic accounts of word skipping.

PubMed

Eskenazi, Michael A; Folk, Jocelyn R

2015-11-01

We investigated whether high-skill readers skip more words than low-skill readers as a result of parafoveal processing differences based on reading skill. We manipulated foveal load and word length, two variables that strongly influence word skipping, and measured reading skill using the Nelson-Denny Reading Test. We found that reading skill did not influence the probability of skipping five-letter words, but low-skill readers were less likely to skip three-letter words when foveal load was high. Thus, reading skill is likely to influence word skipping when the amount of information in the parafovea falls within the word identification span. We interpret the data in the context of visual-based (extended optimal viewing position model) and linguistic based (E-Z Reader model) accounts of word skipping. The models make different predictions about how and why a word and skipped; however, the data indicate that both models should take into account the fact that different factors influence skipping rates for high- and low-skill readers. (c) 2015 APA, all rights reserved).

Skipped Stage Modeling and Testing of the CPAS Main Parachutes

NASA Technical Reports Server (NTRS)

Varela, Jose G.; Ray, Eric S.

2013-01-01

The Capsule Parachute Assembly System (CPAS) has undergone the transition from modeling a skipped stage event using a simulation that treats a cluster of parachutes as a single composite canopy to the capability of simulating each parachute individually. This capability along with data obtained from skipped stage flight tests has been crucial in modeling the behavior of a skipping canopy as well as the crowding effect on non-skipping ("lagging") neighbors. For the finite mass inflation of CPAS Main parachutes, the cluster is assumed to inflate nominally through the nominal fill time, at which point the skipping parachute continues inflating. This sub-phase modeling method was used to reconstruct three flight tests involving skipped stages. Best fit inflation parameters were determined for both the skipping and lagging canopies.

[Variational structure and function of products from IGF-1 gene].

PubMed

Zhang, Bing-Bing; Wang, Yuan-Liang; Fan, Kai

2008-07-01

The IGF-1 gene, containing six exons, is characterized by the generation of multiple heterogeneous mRNA transcripts and translations. The IGF-1 isoforms being produced arise from the combination of multiple transcription initiation sites, alternate splicing, and different polyadenylation signals. These different mRNAs are translated to distinct circulating and local isoforms. The circulating mature IGF-1 is encoded by exons 3 and 4, and its biological function in growth and development has been intensively studied. The local isoforms of IGF-1 contains the part encoded by exons 3 and 4, and moreover the alternate extension peptide at carboxy-terminal, encoded by exons 5 and 6, is also included in the isoforms. And the functions of local IGF-1 isoforms and E-peptides have been overlooked until recently. Recently investigation shows that cell discrepant response to the overexpression of different IGF-1 isoforms and the E-peptides, and more interestingly, IGF-1Ea, IGF-1Eb (MGF) and MGF E-peptide have potential to promote skeletal muscle regeneration, to prevent cardiac muscle loss and neural damage. The acting mechanism of IGF-1 isoforms differ from the IGF-1, and the isoforms functioned probably by binding to specific E-peptide receptor, instead of binding to the IGF-1R.

Processing "the" in the Parafovea: Are Articles Skipped Automatically?

ERIC Educational Resources Information Center

Angele, Bernhard; Rayner, Keith

2013-01-01

One of the words that readers of English skip most often is the definite article "the". Most accounts of reading assume that in order for a reader to skip a word, it must have received some lexical processing. The definite article is skipped so regularly, however, that the oculomotor system might have learned to skip the letter string…

Isolation and characterization of alternatively spliced variants of the mouse sigma1 receptor gene, Sigmar1.

PubMed

Pan, Ling; Pasternak, David A; Xu, Jin; Xu, Mingming; Lu, Zhigang; Pasternak, Gavril W; Pan, Ying-Xian

2017-01-01

The sigma1 receptor acts as a chaperone at the endoplasmic reticulum, associates with multiple proteins in various cellular systems, and involves in a number of diseases, such as addiction, pain, cancer and psychiatric disorders. The sigma1 receptor is encoded by the single copy SIGMAR1 gene. The current study identifies five alternatively spliced variants of the mouse sigma1 receptor gene using a polymerase chain reaction cloning approach. All the splice variants are generated by exon skipping or alternative 3' or 5' splicing, producing the truncated sigma1 receptor. Similar alternative splicing has been observed in the human SIGMAR1 gene based on the molecular cloning or genome sequence prediction, suggesting conservation of alternative splicing of SIGMAR1 gene. Using quantitative polymerase chain reactions, we demonstrate differential expression of several splice variants in mouse tissues and brain regions. When expressed in HEK293 cells, all the splice variants fail to bind sigma ligands, implicating that each truncated region in these splice variants is important for ligand binding. However, co-immunoprecipitation (Co-IP) study in HEK293 cells co-transfected with tagged constructs reveals that all the splice variants maintain their ability to physically associate with a mu opioid receptor (mMOR-1), providing useful information to correlate the motifs/sequences necessary for their physical association. Furthermore, a competition Co-IP study showed that all the variants can disrupt in a dose-dependent manner the dimerization of the original sigma1 receptor with mMOR-1, suggesting a potential dominant negative function and providing significant insights into their function.

Circular RNAs: Unexpected outputs of many protein-coding genes

PubMed Central

Wilusz, Jeremy E.

2017-01-01

ABSTRACT Pre-mRNAs from thousands of eukaryotic genes can be non-canonically spliced to generate circular RNAs, some of which accumulate to higher levels than their associated linear mRNA. Recent work has revealed widespread mechanisms that dictate whether the spliceosome generates a linear or circular RNA. For most genes, circular RNA biogenesis via backsplicing is far less efficient than canonical splicing, but circular RNAs can accumulate due to their long half-lives. Backsplicing is often initiated when complementary sequences from different introns base pair and bring the intervening splice sites close together. This process is further regulated by the combinatorial action of RNA binding proteins, which allow circular RNAs to be expressed in unique patterns. Some genes do not require complementary sequences to generate RNA circles and instead take advantage of exon skipping events. It is still unclear what most mature circular RNAs do, but future investigations into their functions will be facilitated by recently described methods to modulate circular RNA levels. PMID:27571848

Transcriptome Meta-Analysis of Lung Cancer Reveals Recurrent Aberrations in NRG1 and Hippo Pathway Genes

PubMed Central

Dhanasekaran, Saravana M.; Balbin, O. Alejandro; Chen, Guoan; Nadal, Ernest; Kalyana-Sundaram, Shanker; Pan, Jincheng; Veeneman, Brendan; Cao, Xuhong; Malik, Rohit; Vats, Pankaj; Wang, Rui; Huang, Stephanie; Zhong, Jinjie; Jing, Xiaojun; Iyer, Matthew; Wu, Yi-Mi; Harms, Paul W.; Lin, Jules; Reddy, Rishindra; Brennan, Christine; Palanisamy, Nallasivam; Chang, Andrew C.; Truini, Anna; Truini, Mauro; Robinson, Dan R.; Beer, David G.; Chinnaiyan, Arul M.

2014-01-01

Lung cancer is emerging as a paradigm for disease molecular subtyping, facilitating targeted therapy based on driving somatic alterations. Here, we perform transcriptome analysis of 153 samples representing lung adenocarcinomas, squamous cell carcinomas, large cell lung cancer, adenoid cystic carcinomas and cell lines. By integrating our data with The Cancer Genome Atlas and published sources, we analyze 753 lung cancer samples for gene fusions and other transcriptomic alterations. We show that higher numbers of gene fusions is an independent prognostic factor for poor survival in lung cancer. Our analysis confirms the recently reported CD74-NRG1 fusion and suggests that NRG1, NF1 and Hippo pathway fusions may play important roles in tumors without known driver mutations. In addition, we observe exon skipping events in c-MET, which are attributable to splice site mutations. These classes of genetic aberrations may play a significant role in the genesis of lung cancers lacking known driver mutations. PMID:25531467

Diverse functions of myosin VI elucidated by an isoform-specific α-helix domain

PubMed Central

Magistrati, Elisa; Molteni, Erika; Lupia, Michela; Soffientini, Paolo; Rottner, Klemens; Cavallaro, Ugo; Pozzoli, Uberto; Mapelli, Marina; Walters, Kylie J.; Polo, Simona

2016-01-01

Myosin VI functions in endocytosis and cell motility. Alternative splicing of myosin VI mRNA generates two distinct isoform types, myosin VIshort and myosin VIlong, which differ in the C-terminal region. Their physiological and pathological role remains unknown. Here we identified an isoform-specific regulatory helix, named α2-linker that defines specific conformations and hence determines the target selectivity of human myosin VI. The presence of the α2-linker structurally defines a novel clathrin-binding domain that is unique to myosin VIlong and masks the known RRL interaction motif. This finding is relevant to ovarian cancer, where alternative myosin VI splicing is aberrantly regulated, and exon skipping dictates cell addiction to myosin VIshort for tumor cell migration. The RRL interactor optineurin contributes to this process by selectively binding myosin VIshort. Thus the α2-linker acts like a molecular switch that assigns myosin VI to distinct endocytic (myosin VIlong) or migratory (myosin VIshort) functional roles. PMID:26950368

Diverse functions of myosin VI elucidated by an isoform-specific α-helix domain.

PubMed

Wollscheid, Hans-Peter; Biancospino, Matteo; He, Fahu; Magistrati, Elisa; Molteni, Erika; Lupia, Michela; Soffientini, Paolo; Rottner, Klemens; Cavallaro, Ugo; Pozzoli, Uberto; Mapelli, Marina; Walters, Kylie J; Polo, Simona

2016-04-01

Myosin VI functions in endocytosis and cell motility. Alternative splicing of myosin VI mRNA generates two distinct isoform types, myosin VI(short) and myosin VI(long), which differ in the C-terminal region. Their physiological and pathological roles remain unknown. Here we identified an isoform-specific regulatory helix, named the α2-linker, that defines specific conformations and hence determines the target selectivity of human myosin VI. The presence of the α2-linker structurally defines a new clathrin-binding domain that is unique to myosin VI(long) and masks the known RRL interaction motif. This finding is relevant to ovarian cancer, in which alternative myosin VI splicing is aberrantly regulated, and exon skipping dictates cell addiction to myosin VI(short) in tumor-cell migration. The RRL interactor optineurin contributes to this process by selectively binding myosin VI(short). Thus, the α2-linker acts like a molecular switch that assigns myosin VI to distinct endocytic (myosin VI(long)) or migratory (myosin VI(short)) functional roles.

Multiple gastrointestinal stromal tumors in type I neurofibromatosis: a pathologic and molecular study.

PubMed

Yantiss, Rhonda K; Rosenberg, Andrew E; Sarran, Lisa; Besmer, Peter; Antonescu, Cristina R

2005-04-01

Multiple gastrointestinal stromal tumors typically occur in familial form associated with KIT receptor tyrosine kinase or platelet-derived growth factor receptor-alpha (PDGFRA) germline mutations, but may also develop in the setting of type 1 neurofibromatosis. The molecular abnormalities of gastrointestinal stromal tumors arising in neurofibromatosis have not been extensively studied. We identified three patients with type 1 neuro-fibromatosis and multiple small intestinal stromal tumors. Immunostains for CD117, CD34, desmin, actins, S-100 protein, and keratins were performed on all of the tumors. DNA was extracted from representative paraffin blocks from separate tumor nodules in each case and subjected to a nested polymerase chain reaction, using primers for KIT exons 9, 11, 13, and 17 and PDGFRA exons 12 and 18, followed by direct sequencing. The mean patient age was 56 years (range: 37-86 years, male/female ratio: 2/1). One patient had three tumors, one had five, and one had greater than 10 tumor nodules, all of which demonstrated histologic features characteristic of gastrointestinal stromal tumors and stained strongly for CD117 and CD34. One patient died of disease at 35 months, one was disease free at 12 months and one was lost to follow-up. DNA extracts from 10 gastrointestinal stromal tumors (three from each of two patients and four from one patient) were subjected to polymerase chain reactions and assessed for mutations. All of the tumors were wild type for KIT exons 9, 13, and 17 and PDGFRA exons 12 and 18. Three tumors from one patient had identical point mutations in KIT exon 11, whereas the other tumors were wild type at this locus. We conclude that, although most patients with type 1 neurofibromatosis and gastrointestinal stromal tumors do not have KIT or PDGFRA mutations, KIT germline mutations might be implicated in the pathogenesis of gastrointestinal stromal tumors in some patients.

Stabilization of the μ-opioid receptor by truncated single transmembrane splice variants through a chaperone-like action.

PubMed

Xu, Jin; Xu, Ming; Brown, Taylor; Rossi, Grace C; Hurd, Yasmin L; Inturrisi, Charles E; Pasternak, Gavril W; Pan, Ying-Xian

2013-07-19

The μ-opioid receptor gene, OPRM1, undergoes extensive alternative pre-mRNA splicing, as illustrated by the identification of an array of splice variants generated by both 5' and 3' alternative splicing. The current study reports the identification of another set of splice variants conserved across species that are generated through exon skipping or insertion that encodes proteins containing only a single transmembrane (TM) domain. Using a Tet-Off system, we demonstrated that the truncated single TM variants can dimerize with the full-length 7-TM μ-opioid receptor (MOR-1) in the endoplasmic reticulum, leading to increased expression of MOR-1 at the protein level by a chaperone-like function that minimizes endoplasmic reticulum-associated degradation. In vivo antisense studies suggested that the single TM variants play an important role in morphine analgesia, presumably through modulation of receptor expression levels. Our studies suggest the functional roles of truncated receptors in other G protein-coupled receptor families.

Mutations of the RTEL1 Helicase in a Hoyeraal-Hreidarsson Syndrome Patient Highlight the Importance of the ARCH Domain.

PubMed

Jullien, Laurent; Kannengiesser, Caroline; Kermasson, Laetitia; Cormier-Daire, Valérie; Leblanc, Thierry; Soulier, Jean; Londono-Vallejo, Arturo; de Villartay, Jean-Pierre; Callebaut, Isabelle; Revy, Patrick

2016-05-01

The DNA helicase RTEL1 participates in telomere maintenance and genome stability. Biallelic mutations in the RTEL1 gene account for the severe telomere biology disorder characteristic of the Hoyeraal-Hreidarsson syndrome (HH). Here, we report a HH patient (P4) carrying two novel compound heterozygous mutations in RTEL1: a premature stop codon (c.949A>T, p.Lys317*) and an intronic deletion leading to an exon skipping and an in-frame deletion of 25 amino-acids (p.Ile398_Lys422). P4's cells exhibit short and dysfunctional telomeres similarly to other RTEL1-deficient patients. 3D structure predictions indicated that the p.Ile398_Lys422 deletion affects a part of the helicase ARCH domain, which lines the pore formed with the core HD and the iron-sulfur cluster domains and is highly specific of sequences from the eukaryotic XPD family members. © 2016 WILEY PERIODICALS, INC.

Selection response to DNA testing for canine ceroid lipofuscinosis in Tibetan terriers.

PubMed

Kluth, Susanne; Eckardt, Judith; Distl, Ottmar

2014-09-01

A late onset form of canine ceroid lipofuscinosis (CCL) is prevalent in Tibetan terriers. The disease is inherited as a monogenic recessive trait caused by aberrant exon skipping in ATP13A2. The aim of the present study was to analyse the frequencies of this mutation in Tibetan terriers registered with the German club for Tibetan dog breeds (Internationaler Klub für Tibetische Hunderassen, KTR) from 1987 to 2012 and to determine responses to selection following the introduction of DNA testing in 2010. The study included DNA extracted from blood samples from 1120/1240 (90.3%) Tibetan terriers registered with the KTR, including 405/420 (96.4%) registered breeding dogs. Mutant allele frequencies before the introduction of DNA testing were 0.20-0.28 in the registered and breeding dog populations, respectively, decreasing to 0.09 and 0.14, respectively, following the introduction of DNA testing. Copyright © 2014 Elsevier Ltd. All rights reserved.

Potential Association between Breakfast Skipping and Concomitant Late-Night-Dinner Eating with Metabolic Syndrome and Proteinuria in the Japanese Population

PubMed Central

Kutsuma, Ayano; Suwa, Kaname

2014-01-01

Skipping breakfast is considered to be an unhealthy eating habit linked to predispositions to obesity and type 2 diabetes. Because eating dinner late at night can elicit subsequent breakfast skipping, we investigated if skipping breakfast concomitant with late-night-dinner eating (LNDE) was associated with metabolic syndrome (MetS) and proteinuria in the general Japanese population. We examined self-reported habitual breakfast skipping and LNDE, MetS (modified ATP-III criteria), and proteinuria in a cross-sectional study of 60,800 Japanese adults aged 20–75 years. A total of 14,068 subjects (23.1%) skipped breakfast, of whom approximately half (52.8%) skipped breakfast alone (without LNDE). The percentages of subjects who skipped breakfast showed a J-shaped relationship with body mass index (BMI). Multivariate logistic regression analysis showed that skipping breakfast concomitant with LNDE (n = 6,645) was significantly associated with MetS and proteinuria, even after adjusting for relevant confounders (odds ratio (95% CI), 1.17 (1.08–1.28), P = 0.0003, and 1.37 (1.24–1.52), P < 0.0001, resp.). Skipping breakfast alone and LNDE alone were not associated with MetS and proteinuria, respectively. In conclusion, habitual breakfast skipping concomitant with LNDE may represent poorer eating behavior than skipping breakfast alone, associated with MetS, asymptomatic proteinuria, obesity, and low body weight in the general Japanese population. PMID:24982814

Regulation of alternative splicing in Drosophila by 56 RNA binding proteins

DOE PAGES

Brooks, Angela N.; Duff, Michael O.; May, Gemma; ...

2015-08-20

Alternative splicing is regulated by RNA binding proteins (RBPs) that recognize pre-mRNA sequence elements and activate or repress adjacent exons. Here, we used RNA interference and RNA-seq to identify splicing events regulated by 56 Drosophila proteins, some previously unknown to regulate splicing. Nearly all proteins affected alternative first exons, suggesting that RBPs play important roles in first exon choice. Half of the splicing events were regulated by multiple proteins, demonstrating extensive combinatorial regulation. We observed that SR and hnRNP proteins tend to act coordinately with each other, not antagonistically. We also identified a cross-regulatory network where splicing regulators affected themore » splicing of pre-mRNAs encoding other splicing regulators. In conclusion, this large-scale study substantially enhances our understanding of recent models of splicing regulation and provides a resource of thousands of exons that are regulated by 56 diverse RBPs.« less

Thrombopoietin-induced Polyploidization of Bone Marrow Megakaryocytes Is Due to a Unique Regulatory Mechanism in Late Mitosis

PubMed Central

Nagata, Yuka; Muro, Yoshinao; Todokoro, Kazuo

1997-01-01

Megakaryocytes undergo a unique differentiation program, becoming polyploid through repeated cycles of DNA synthesis without concomitant cell division. However, the mechanism underlying this polyploidization remains totally unknown. It has been postulated that polyploidization is due to a skipping of mitosis after each round of DNA replication. We carried out immunohistochemical studies on mouse bone marrow megakaryocytes during thrombopoietin- induced polyploidization and found that during this process megakaryocytes indeed enter mitosis and progress through normal prophase, prometaphase, metaphase, and up to anaphase A, but not to anaphase B, telophase, or cytokinesis. It was clearly observed that multiple spindle poles were formed as the polyploid megakaryocytes entered mitosis; the nuclear membrane broke down during prophase; the sister chromatids were aligned on a multifaced plate, and the centrosomes were symmetrically located on either side of each face of the plate at metaphase; and a set of sister chromatids moved into the multiple centrosomes during anaphase A. We further noted that the pair of spindle poles in anaphase were located in close proximity to each other, probably because of the lack of outward movement of spindle poles during anaphase B. Thus, the reassembling nuclear envelope may enclose all the sister chromatids in a single nucleus at anaphase and then skip telophase and cytokinesis. These observations clearly indicate that polyploidization of megakaryocytes is not simply due to a skipping of mitosis, and that the megakaryocytes must have a unique regulatory mechanism in anaphase, e.g., factors regulating anaphase such as microtubule motor proteins might be involved in this polyploidization process. PMID:9334347

Irreproducible and uninterpretable Polymyxin B MICs for Enterobacter cloacae and Enterobacter aerogenes.

PubMed

Landman, David; Salamera, Julius; Quale, John

2013-12-01

Carbapenem-resistant Enterobacter species are emerging nosocomial pathogens. As with most multidrug-resistant Gram-negative pathogens, the polymyxins are often the only therapeutic option. In this study involving clinical isolates of E. cloacae and E. aerogenes, susceptibility testing methods with polymyxin B were analyzed. All isolates underwent testing by the broth microdilution (in duplicate) and agar dilution (in duplicate) methods, and select isolates were examined by the Etest method. Selected isolates were also examined for heteroresistance by population analysis profiling. Using a susceptibility breakpoint of ≤2 μg/ml, categorical agreement by all four dilution tests (two broth microdilution and two agar dilution) was achieved in only 76/114 (67%) of E. cloacae isolates (65 susceptible, 11 resistant). Thirty-eight (33%) had either conflicting or uninterpretable results (multiple skip wells, i.e., wells that exhibit no growth although growth does occur at higher concentrations). Of the 11 consistently resistant isolates, five had susceptible MICs as determined by Etest. Heteroresistant subpopulations were detected in eight of eight isolates tested, with greater percentages in isolates with uninterpretable MICs. For E. aerogenes, categorical agreement between the four dilution tests was obtained in 48/56 (86%), with conflicting and/or uninterpretable results in 8/56 (14%). For polymyxin susceptibility testing of Enterobacter species, close attention must be paid to the presence of multiple skip wells, leading to uninterpretable results. Susceptibility also should not be assumed based on the results of a single test. Until the clinical relevance of skip wells is defined, interpretation of polymyxin susceptibility tests for Enterobacter species should be undertaken with extreme caution.

Irreproducible and Uninterpretable Polymyxin B MICs for Enterobacter cloacae and Enterobacter aerogenes

PubMed Central

Landman, David; Salamera, Julius

2013-01-01

Carbapenem-resistant Enterobacter species are emerging nosocomial pathogens. As with most multidrug-resistant Gram-negative pathogens, the polymyxins are often the only therapeutic option. In this study involving clinical isolates of E. cloacae and E. aerogenes, susceptibility testing methods with polymyxin B were analyzed. All isolates underwent testing by the broth microdilution (in duplicate) and agar dilution (in duplicate) methods, and select isolates were examined by the Etest method. Selected isolates were also examined for heteroresistance by population analysis profiling. Using a susceptibility breakpoint of ≤2 μg/ml, categorical agreement by all four dilution tests (two broth microdilution and two agar dilution) was achieved in only 76/114 (67%) of E. cloacae isolates (65 susceptible, 11 resistant). Thirty-eight (33%) had either conflicting or uninterpretable results (multiple skip wells, i.e., wells that exhibit no growth although growth does occur at higher concentrations). Of the 11 consistently resistant isolates, five had susceptible MICs as determined by Etest. Heteroresistant subpopulations were detected in eight of eight isolates tested, with greater percentages in isolates with uninterpretable MICs. For E. aerogenes, categorical agreement between the four dilution tests was obtained in 48/56 (86%), with conflicting and/or uninterpretable results in 8/56 (14%). For polymyxin susceptibility testing of Enterobacter species, close attention must be paid to the presence of multiple skip wells, leading to uninterpretable results. Susceptibility also should not be assumed based on the results of a single test. Until the clinical relevance of skip wells is defined, interpretation of polymyxin susceptibility tests for Enterobacter species should be undertaken with extreme caution. PMID:24088860

The kinetics of pre-mRNA splicing in the Drosophila genome and the influence of gene architecture

PubMed Central

Pai, Athma A; Henriques, Telmo; McCue, Kayla; Burkholder, Adam; Adelman, Karen

2017-01-01

Production of most eukaryotic mRNAs requires splicing of introns from pre-mRNA. The splicing reaction requires definition of splice sites, which are initially recognized in either intron-spanning (‘intron definition’) or exon-spanning (‘exon definition’) pairs. To understand how exon and intron length and splice site recognition mode impact splicing, we measured splicing rates genome-wide in Drosophila, using metabolic labeling/RNA sequencing and new mathematical models to estimate rates. We found that the modal intron length range of 60–70 nt represents a local maximum of splicing rates, but that much longer exon-defined introns are spliced even faster and more accurately. We observed unexpectedly low variation in splicing rates across introns in the same gene, suggesting the presence of gene-level influences, and we identified multiple gene level variables associated with splicing rate. Together our data suggest that developmental and stress response genes may have preferentially evolved exon definition in order to enhance the rate or accuracy of splicing. PMID:29280736

The kinetics of pre-mRNA splicing in the Drosophila genome and the influence of gene architecture

DOE PAGES

Pai, Athma A.; Henriques, Telmo; McCue, Kayla; ...

2017-12-27

Production of most eukaryotic mRNAs requires splicing of introns from pre-mRNA. The splicing reaction requires definition of splice sites, which are initially recognized in either intron-spanning (‘intron definition’) or exon-spanning (‘exon definition’) pairs. To understand how exon and intron length and splice site recognition mode impact splicing, we measured splicing rates genome-wide in Drosophila, using metabolic labeling/RNA sequencing and new mathematical models to estimate rates. We found that the modal intron length range of 60–70 nt represents a local maximum of splicing rates, but that much longer exon-defined introns are spliced even faster and more accurately. We observed unexpectedly lowmore » variation in splicing rates across introns in the same gene, suggesting the presence of gene-level influences, and we identified multiple gene level variables associated with splicing rate. Together our data suggest that developmental and stress response genes may have preferentially evolved exon definition in order to enhance the rate or accuracy of splicing.« less

The kinetics of pre-mRNA splicing in the Drosophila genome and the influence of gene architecture

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pai, Athma A.; Henriques, Telmo; McCue, Kayla

Production of most eukaryotic mRNAs requires splicing of introns from pre-mRNA. The splicing reaction requires definition of splice sites, which are initially recognized in either intron-spanning (‘intron definition’) or exon-spanning (‘exon definition’) pairs. To understand how exon and intron length and splice site recognition mode impact splicing, we measured splicing rates genome-wide in Drosophila, using metabolic labeling/RNA sequencing and new mathematical models to estimate rates. We found that the modal intron length range of 60–70 nt represents a local maximum of splicing rates, but that much longer exon-defined introns are spliced even faster and more accurately. We observed unexpectedly lowmore » variation in splicing rates across introns in the same gene, suggesting the presence of gene-level influences, and we identified multiple gene level variables associated with splicing rate. Together our data suggest that developmental and stress response genes may have preferentially evolved exon definition in order to enhance the rate or accuracy of splicing.« less

The analysis of genomic structures in the L1 family of cell adhesion molecules provides no evidence for exon shuffling events after the separation of arthropod and chordate lineages.

PubMed

Zhao, G; Hortsch, M

1998-07-17

Members of the L1 family of neural cell adhesion molecules consist of multiple extracellular immunoglobulin and fibronectin type III domains that mediate the adhesive properties of this group of transmembrane proteins. In vertebrate genomes, these protein domains are separated by introns, and it has been suggested that L1-type genes might have been subject to exon-shuffling events during evolution. However, comparison of the human L1-CAM and the chicken neurofascin gene with the genomic structure of their Drosophila homologue, neuroglian, indicates that no major rearrangement of protein domains has taken place subsequent to the split of the arthropod and chordate phyla. The Drosophila neuroglian gene appears to have lost most of the introns that have been conserved in the human L1-CAM and the chicken neurofascin gene. Nevertheless, exon shuffling or the generation of new exons by mutational changes might have been responsible for the generation of additional, alternatively spliced exons in L1-type genes.

Television viewing, computer game play and book reading during meals are predictors of meal skipping in a cross-sectional sample of 12-, 14- and 16-year-olds.

PubMed

Custers, Kathleen; Van den Bulck, Jan

2010-04-01

To examine whether television viewing, computer game playing or book reading during meals predicts meal skipping with the aim of watching television, playing computer games or reading books (media meal skipping). A cross-sectional study was conducted using a standardized self-administered questionnaire. Analyses were controlled for age, gender and BMI. Data were obtained from a random sample of adolescents in Flanders, Belgium. Seven hundred and ten participants aged 12, 14 and 16 years. Of the participants, 11.8 % skipped meals to watch television, 10.5 % skipped meals to play computer games and 8.2 % skipped meals to read books. Compared with those who did not use these media during meals, the risk of skipping meals in order to watch television was significantly higher for those children who watched television during meals (2.9 times higher in those who watched television during at least one meal a day). The risk of skipping meals for computer game playing was 9.5 times higher in those who played computer games weekly or more while eating, and the risk of meal skipping in order to read books was 22.9 times higher in those who read books during meals less than weekly. The more meals the respondents ate with the entire family, the less likely they were to skip meals to watch television. The use of media during meals predicts meal skipping for using that same medium. Family meals appear to be inversely related to meal skipping for television viewing.

Different EGFR gene mutations in two patients with synchronous multiple lung cancers: A case report

PubMed Central

Sakai, Hiroki; Kimura, Hiroyuki; Tsuda, Masataka; Wakiyama, Yoichi; Miyazawa, Tomoyuki; Marushima, Hideki; Kojima, Koji; Hoshikawa, Masahiro; Takagi, Masayuki; Nakamura, Haruhiko

2017-01-01

Routine clinical and pathological evaluations to determine the relationship between different lesions are often not completely conclusive. Interestingly, detailed genetic analysis of tumor samples may provide important additional information and identify second primary lung cancers. In the present study, we report cases of two synchronous lung adenocarcinomas composed of two distinct pathological subtypes with different EGFR gene mutations: a homozygous deletion in exon 19 of the papillary adenocarcinoma subtype and a point mutation of L858R in exon 21 of the tubular adenocarcinoma. The present report highlights the clinical importance of molecular cancer biomarkers to guide management decisions in cases involving multiple lung tumors. PMID:29090842

Nanopolymers improve delivery of exon skipping oligonucleotides and concomitant dystrophin expression in skeletal muscle of mdx mice

PubMed Central

Williams, Jason H; Schray, Rebecca C; Sirsi, Shashank R; Lutz, Gordon J

2008-01-01

Background Exon skipping oligonucleotides (ESOs) of 2'O-Methyl (2'OMe) and morpholino chemistry have been shown to restore dystrophin expression in muscle fibers from the mdx mouse, and are currently being tested in phase I clinical trials for Duchenne Muscular Dystrophy (DMD). However, ESOs remain limited in their effectiveness because of an inadequate delivery profile. Synthetic cationic copolymers of poly(ethylene imine) (PEI) and poly(ethylene glycol) (PEG) are regarded as effective agents for enhanced delivery of nucleic acids in various applications. Results We examined whether PEG-PEI copolymers can facilitate ESO-mediated dystrophin expression after intramuscular injections into tibialis anterior (TA) muscles of mdx mice. We utilized a set of PEG-PEI copolymers containing 2 kDa PEI and either 550 Da or 5 kDa PEG, both of which bind 2'OMe ESOs with high affinity and form stable nanoparticulates with a relatively low surface charge. Three weekly intramuscular injections of 5 μg of ESO complexed with PEI2K-PEG550 copolymers resulted in about 500 dystrophin-positive fibers and about 12% of normal levels of dystrophin expression at 3 weeks after the initial injection, which is significantly greater than for injections of ESO alone, which are known to be almost completely ineffective. In an effort to enhance biocompatibility and cellular uptake, the PEI2K-PEG550 and PEI2K-PEG5K copolymers were functionalized by covalent conjugation with nanogold (NG) or adsorbtion of colloidal gold (CG), respectively. Surprisingly, using the same injection and dosing regimen, we found no significant difference in dystrophin expression by Western blot between the NG-PEI2K-PEG550, CG-PEI2K-PEG5K, and non-functionalized PEI2K-PEG550 copolymers. Dose-response experiments using the CG-PEI2K-PEG5K copolymer with total ESO ranging from 3–60 μg yielded a maximum of about 15% dystrophin expression. Further improvements in dystrophin expression up to 20% of normal levels were found at 6 weeks after 10 twice-weekly injections of the NG-PEI2K-PEG550 copolymer complexed with 5 μg of ESO per injection. This injection and dosing regimen showed over 1000 dystrophin-positive fibers. H&E staining of all treated muscle groups revealed no overt signs of cytotoxicity. Conclusion We conclude that PEGylated PEI2K copolymers are efficient carriers for local delivery of 2'OMe ESOs and warrant further development as potential therapeutics for treatment of DMD. PMID:18384691

Photos

Science.gov Websites

Skip to Content Skip to Search Skip to Utility Navigation Skip to Top Navigation Los Alamos National Laboratory Search Site submit About Mission Business Newsroom Publications Los Alamos National Innovation Research Capabilities Deploying Innovation Technology Opportunities Innovation in New Mexico Los

Newsroom

Science.gov Websites

Skip to Content Skip to Search Skip to Utility Navigation Skip to Top Navigation Los Alamos National Laboratory Search Site submit About Mission Business Newsroom Publications Los Alamos National Innovation Research Capabilities Deploying Innovation Technology Opportunities Innovation in New Mexico Los

Platinum coat color in red fox (Vulpes vulpes) is caused by a mutation in an autosomal copy of KIT.

PubMed

Johnson, J L; Kozysa, A; Kharlamova, A V; Gulevich, R G; Perelman, P L; Fong, H W F; Vladimirova, A V; Oskina, I N; Trut, L N; Kukekova, A V

2015-04-01

The red fox (Vulpes vulpes) demonstrates a variety of coat colors including platinum, a common phenotype maintained in farm-bred fox populations. Foxes heterozygous for the platinum allele have a light silver coat and extensive white spotting, whereas homozygosity is embryonic lethal. Two KIT transcripts were identified in skin cDNA from platinum foxes. The long transcript was identical to the KIT transcript of silver foxes, whereas the short transcript, which lacks exon 17, was specific to platinum. The KIT gene has several copies in the fox genome: an autosomal copy on chromosome 2 and additional copies on the B chromosomes. To identify the platinum-specific KIT sequence, the genomes of one platinum and one silver fox were sequenced. A single nucleotide polymorphism (SNP) was identified at the first nucleotide of KIT intron 17 in the platinum fox. In platinum foxes, the A allele of the SNP disrupts the donor splice site and causes exon 17, which is part of a segment that encodes a conserved tyrosine kinase domain, to be skipped. Complete cosegregation of the A allele with the platinum phenotype was confirmed by linkage mapping (LOD 25.59). All genotyped farm-bred platinum foxes from Russia and the US were heterozygous for the SNP (A/G), whereas foxes with different coat colors were homozygous for the G allele. Identification of the platinum mutation suggests that other fox white-spotting phenotypes, which are allelic to platinum, would also be caused by mutations in the KIT gene. © 2015 Stichting International Foundation for Animal Genetics.

Transcriptome Bioinformatical Analysis of Vertebrate Stages of Schistosoma japonicum Reveals Alternative Splicing Events

PubMed Central

Wang, Xinye; Xu, Xindong; Lu, Xingyu; Zhang, Yuanbin; Pan, Weiqing

2015-01-01

Alternative splicing is a molecular process that contributes greatly to the diversification of proteome and to gene functions. Understanding the mechanisms of stage-specific alternative splicing can provide a better understanding of the development of eukaryotes and the functions of different genes. Schistosoma japonicum is an infectious blood-dwelling trematode with a complex lifecycle that causes the tropical disease schistosomiasis. In this study, we analyzed the transcriptome of Schistosoma japonicum to discover alternative splicing events in this parasite, by applying RNA-seq to cDNA library of adults and schistosomula. Results were validated by RT-PCR and sequencing. We found 11,623 alternative splicing events among 7,099 protein encoding genes and average proportion of alternative splicing events per gene was 42.14%. We showed that exon skip is the most common type of alternative splicing events as found in high eukaryotes, whereas intron retention is the least common alternative splicing type. According to intron boundary analysis, the parasite possesses same intron boundaries as other organisms, namely the classic “GT-AG” rule. And in alternative spliced introns or exons, this rule is less strict. And we have attempted to detect alternative splicing events in genes encoding proteins with signal peptides and transmembrane helices, suggesting that alternative splicing could change subcellular locations of specific gene products. Our results indicate that alternative splicing is prevalent in this parasitic worm, and that the worm is close to its hosts. The revealed secretome involved in alternative splicing implies new perspective into understanding interaction between the parasite and its host. PMID:26407301

A base substitution in the donor site of intron 12 of KIT gene is responsible for the dominant white coat colour of blue fox (Alopex lagopus).

PubMed

Yan, S Q; Hou, J N; Bai, C Y; Jiang, Y; Zhang, X J; Ren, H L; Sun, B X; Zhao, Z H; Sun, J H

2014-04-01

The dominant white coat colour of farmed blue fox is inherited as a monogenic autosomal dominant trait and is suggested to be embryonic lethal in the homozygous state. In this study, the transcripts of KIT were identified by RT-PCR for a dominant white fox and a normal blue fox. Sequence analysis showed that the KIT transcript in normal blue fox contained the full-length coding sequence of 2919 bp (GenBank Acc. No KF530833), but in the dominant white individual, a truncated isoform lacking the entire exon 12 specifically co-expressed with the normal transcript. Genomic DNA sequencing revealed that a single nucleotide polymorphism (c.1867+1G>T) in intron 12 appeared only in the dominant white individuals and a 1-bp ins/del polymorphism in the same intron showed in individuals representing two different coat colours. Genotyping results of the SNP with PCR-RFLP in 185 individuals showed all 90 normal blue foxes were homozygous for the G allele, and all dominant white individuals were heterozygous. Due to the truncated protein with a deletion of 35 amino acids and an amino acid replacement (p.Pro623Ala) located in the conserved ATP binding domain, we propose that the mutant receptor had absent tyrosine kinase activity. These findings reveal that the base substitution at the first nucleotide of intron 12 of KIT gene, resulting in skipping of exon 12, is a causative mutation responsible for the dominant white phenotype of blue fox. © 2013 Stichting International Foundation for Animal Genetics.

Genome-Wide Associations of CD46 and IFI44L Genetic Variants with Neutralizing Antibody Response to Measles Vaccine

PubMed Central

Haralambieva, Iana H.; Ovsyannikova, Inna G.; Kennedy, Richard B.; Larrabee, Beth R.; Zimmermann, Michael T.; Grill, Diane E.; Schaid, Daniel J.; Poland, Gregory A.

2017-01-01

Background Population-based studies have revealed 2 to 10% measles vaccine failure rate even after two vaccine doses. While the mechanisms behind this remain unknown, we hypothesized that host genetic factors are likely to be involved. Methods We performed a genome-wide association study of measles specific neutralizing antibody and IFNγ ELISPOT response in a combined sample of 2,872 subjects. Results We identified two distinct chromosome 1 regions (previously associated with MMR-related febrile seizures), associated with vaccine-induced measles neutralizing antibody titers. The 1q32 region contained 20 significant SNPs in/around the measles virus receptor-encoding CD46 gene, including the intronic rs2724384 (p-value = 2.64x10−09) and rs2724374 (p-value = 3.16x10−09) SNPs. The 1q31.1 region contained nine significant SNPs in/around IFI44L, including the intronic rs1333973 (p-value = 1.41x10−10) and the missense rs273259 (His73Arg, p-value = 2.87x10−10) SNPs. Analysis of differential exon usage with mRNA-Seq data and RT-PCR suggests the involvement of rs2724374 minor G allele in the CD46 STP region exon B skipping, resulting in shorter CD46 isoforms. Conclusions Our study reveals common CD46 and IFI44L SNPs associated with measles-specific humoral immunity, and highlights the importance of alternative splicing/virus cellular receptor isoform usage as a mechanism explaining inter-individual variation in immune response after live measles vaccine. PMID:28289848

Delineation of C12orf65-related phenotypes: a genotype-phenotype relationship.

PubMed

Spiegel, Ronen; Mandel, Hanna; Saada, Ann; Lerer, Issy; Burger, Ayala; Shaag, Avraham; Shalev, Stavit A; Jabaly-Habib, Haneen; Goldsher, Dorit; Gomori, John M; Lossos, Alex; Elpeleg, Orly; Meiner, Vardiella

2014-08-01

C12orf65 participates in the process of mitochondrial translation and has been shown to be associated with a spectrum of phenotypes, including early onset optic atrophy, progressive encephalomyopathy, peripheral neuropathy, and spastic paraparesis.We used whole-genome homozygosity mapping as well as exome sequencing and targeted gene sequencing to identify novel C12orf65 disease-causing mutations in seven affected individuals originating from two consanguineous families. In four family members affected with childhood-onset optic atrophy accompanied by slowly progressive peripheral neuropathy and spastic paraparesis, we identified a homozygous frame shift mutation c.413_417 delAACAA, which predicts a truncated protein lacking the C-terminal portion. In the second family, we studied three affected individuals who presented with early onset optic atrophy, peripheral neuropathy, and spastic gait in addition to moderate intellectual disability. Muscle biopsy in two of the patients revealed decreased activities of the mitochondrial respiratory chain complexes I and IV. In these patients, we identified a homozygous splice mutation, g.21043 T>A (c.282+2 T>A) which leads to skipping of exon 2. Our study broadens the phenotypic spectrum of C12orf65 defects and highlights the triad of optic atrophy, axonal neuropathy and spastic paraparesis as its key clinical features. In addition, a clear genotype-phenotype correlation is anticipated in which deleterious mutations which disrupt the GGQ-containing domain in the first coding exon are expected to result in a more severe phenotype, whereas down-stream C-terminal mutations may result in a more favorable phenotype, typically lacking cognitive impairment.

Identification of two novel critical mutations in PCNT gene resulting in microcephalic osteodysplastic primordial dwarfism type II associated with multiple intracranial aneurysms.

PubMed

Li, Fei-Feng; Wang, Xu-Dong; Zhu, Min-Wei; Lou, Zhi-Hong; Zhang, Qiong; Zhu, Chun-Yu; Feng, Hong-Lin; Lin, Zhi-Guo; Liu, Shu-Lin

2015-12-01

Microcephalic osteodysplastic primordial dwarfism type II (MOPD II) is a highly detrimental human autosomal inherited recessive disorder. The hallmark characteristics of this disease are intrauterine and postnatal growth restrictions, with some patients also having cerebrovascular problems such as cerebral aneurysms. The genomic basis behind most clinical features of MOPD II remains largely unclear. The aim of this work was to identify the genetic defects in a Chinese family with MOPD II associated with multiple intracranial aneurysms. The patient had typical MOPD II syndrome, with subarachnoid hemorrhage and multiple intracranial aneurysms. We identified three novel mutations in the PCNT gene, including one single base alteration (9842A>C in exon 45) and two deletions (Del-C in exon 30 and Del-16 in exon 41). The deletions were co-segregated with the affected individual in the family and were not present in the control population. Computer modeling demonstrated that the deletions may cause drastic changes on the secondary and tertiary structures, affecting the hydrophilicity and hydrophobicity of the mutant proteins. In conclusion, we identified two novel mutations in the PCNT gene associated with MOPD II and intracranial aneurysms, and the mutations were expected to alter the stability and functioning of the protein by computer modeling.

Stability in skipping gaits

NASA Astrophysics Data System (ADS)

Andrada, Emanuel; Müller, Roy; Blickhan, Reinhard

2016-11-01

As an alternative to walking and running, humans are able to skip. However, adult humans avoid it. This fact seems to be related to the higher energetic costs associated with skipping. Still, children, some birds, lemurs and lizards use skipping gaits during daily locomotion. We combined experimental data on humans with numerical simulations to test whether stability and robustness motivate this choice. Parameters for modelling were obtained from 10 male subjects. They locomoted using unilateral skipping along a 12 m runway. We used a bipedal spring loaded inverted pendulum to model and to describe the dynamics of skipping. The subjects displayed higher peak ground reaction forces and leg stiffness in the first landing leg (trailing leg) compared to the second landing leg (leading leg). In numerical simulations, we found that skipping is stable across an amazing speed range from skipping on the spot to fast running speeds. Higher leg stiffness in the trailing leg permits longer strides at same system energy. However, this strategy is at the same time less robust to sudden drop perturbations than skipping with a stiffer leading leg. A slightly higher stiffness in the leading leg is most robust, but might be costlier.

Processing the in the parafovea: are articles skipped automatically?

PubMed

Angele, Bernhard; Rayner, Keith

2013-03-01

One of the words that readers of English skip most often is the definite article the. Most accounts of reading assume that in order for a reader to skip a word, it must have received some lexical processing. The definite article is skipped so regularly, however, that the oculomotor system might have learned to skip the letter string t-h-e automatically. We tested whether skipping of articles in English is sensitive to context information or whether it is truly automatic in the sense that any occurrence of the letter string the will trigger a skip. This was done using the gaze-contingent boundary paradigm (Rayner, 1975) to provide readers with false parafoveal previews of the article the. All experimental sentences contained a short target verb, the preview of which could be correct (i.e., identical to the actual subsequent word in the sentence; e.g., ace), a nonword (tda), or an infelicitous article preview (the). Our results indicated that readers tended to skip the infelicitous the previews frequently, suggesting that, in many cases, they seemed to be unable to detect the syntactic anomaly in the preview and based their skipping decision solely on the orthographic properties of the article. However, there was some evidence that readers sometimes detected the anomaly, as they also showed increased skipping of the pretarget word in the the preview condition. (c) 2013 APA, all rights reserved.

Preimplantation genetic diagnosis for Duchenne muscular dystrophy by multiple displacement amplification.

PubMed

Ren, Zi; Zeng, Hai-tao; Xu, Yan-wen; Zhuang, Guang-lun; Deng, Jie; Zhang, Cheng; Zhou, Can-quan

2009-02-01

To evaluate the use of multiple displacement amplification (MDA) in preimplantation genetic diagnosis (PGD) for female carriers with Duchenne muscular dystrophy (DMD). MDA was used to amplify a whole genome of single cells. Following the setup on single cells, the test was applied in two clinical cases of PGD. One mutant exon, six short tandem repeats (STR) markers within the dystrophin gene, and amelogenin were incorporated into singleplex polymerase chain reaction (PCR) assays on MDA products of single blastomeres. Center for reproductive medicine in First Affiliated Hospital, Sun Yat-sen University, China. Two female carriers with a duplication of exons 3-11 and a deletion of exons 47-50, respectively. The MDA of single cells and fluorescent PCR assays for PGD. The ability to analyze single blastomeres for DMD using MDA. The protocol setup previously allowed for the accurate diagnosis of each embryo. Two clinical cases resulted in a healthy girl, which was the first successful clinical application of MDA in PGD for DMD. We suggest that this protocol is reliable to increase the accuracy of the PGD for DMD.

CINT - Center for Integrated Nanotechnologies

Science.gov Websites

Skip to Content Skip to Search Skip to Utility Navigation Skip to Top Navigation Search Site submit Facilities Discovery Platform Integration Lab User Facilities LUMOS Research Science Thrusts Integration Challenges Accepted User Proposals Data Management Becoming a User Call for Proposals Proposal Guidelines

Detection of EGFR and KRAS mutations in fine-needle aspirates stored on Whatman FTA cards: is this the tool for biobanking cytological samples in the molecular era?

PubMed

da Cunha Santos, Gilda; Liu, Ni; Tsao, Ming-Sound; Kamel-Reid, Suzanne; Chin, Kayu; Geddie, William R

2010-12-25

The aims of this study were to compare the quality of DNA recovered from fine-needle aspirates (FNAs) stored on Whatman FTA cards with that retrieved from corresponding cell blocks and to determine whether the DNA extracted from the cards is suitable for multiple mutation analyses. FNAs collected from 18 resected lung tumors and cell suspensions from 4 lung cancer cell lines were placed on FTA Indicating Micro Cards and further processed to produce paired formalin-fixed paraffin-embedded (FFPE) cell blocks. Fragment analysis was used for the detection of EGFR exon 19 deletion, and direct sequencing for detection of EGFR exon 21 L858R mutation and exon 2 deletion of KRAS. Corresponding FFPE tissue sections from 2 resection specimens were also tested. Analyses were successful with all FNAs and lung cancer-derived cell lines collected on cards. Polymerase chain reaction failed in 2 cell blocks. For FNAs collected on cards, 5 cases showed EGFR and 3 showed KRAS mutations. Eleven cases were wild type. With cell blocks, 4 cases were found to harbor KRAS and 4 harbored EGFR mutations. All lung cancer-derived cell lines tested positive for their respective mutations, and there was complete agreement between card and cell block FNA samples for EGFR exon 21. For EGFR exon 19, 1 of 18 cases showed discordant results between the card and cell block, and for KRAS 1 of 17. The two resection specimens tested gave concordant results with the FTA card. Storage of cytologic material on FTA cards can maximize and simplify sample procurement for multiple mutational analyses with results similar to those from cell blocks.

Genetic and molecular risk factors within the newly identified primate-specific exon of the SAP97/DLG1 gene in the 3q29 schizophrenia-associated locus.

PubMed

Uezato, Akihito; Yamamoto, Naoki; Jitoku, Daisuke; Haramo, Emiko; Hiraaki, Eri; Iwayama, Yoshimi; Toyota, Tomoko; Umino, Masakazu; Umino, Asami; Iwata, Yasuhide; Suzuki, Katsuaki; Kikuchi, Mitsuru; Hashimoto, Tasuku; Kanahara, Nobuhisa; Kurumaji, Akeo; Yoshikawa, Takeo; Nishikawa, Toru

2017-12-01

The synapse-associated protein 97/discs, large homolog 1 of Drosophila (DLG1) gene encodes synaptic scaffold PDZ proteins interacting with ionotropic glutamate receptors including the N-methyl-D-aspartate type glutamate receptor (NMDAR) that is presumed to be hypoactive in brains of patients with schizophrenia. The DLG1 gene resides in the chromosomal position 3q29, the microdeletion of which confers a 40-fold increase in the risk for schizophrenia. In the present study, we performed genetic association analyses for DLG1 gene using a Japanese cohort with 1808 schizophrenia patients and 2170 controls. We detected an association which remained significant after multiple comparison testing between schizophrenia and the single nucleotide polymorphism (SNP) rs3915512 that is located within the newly identified primate-specific exon (exon 3b) of the DLG1 gene and constitutes the exonic splicing enhancer sequence. When stratified by onset age, although it did not survive multiple comparisons, the association was observed in non-early onset schizophrenia, whose onset-age selectivity is consistent with our recent postmortem study demonstrating a decrease in the expression of the DLG1 variant in early-onset schizophrenia. Although the present study did not demonstrate the previously reported association of the SNP rs9843659 by itself, a meta-analysis revealed a significant association between DLG1 gene and schizophrenia. These findings provide a valuable clue for molecular mechanisms on how genetic variations in the primate-specific exon of the gene in the schizophrenia-associated 3q29 locus affect its regulation in the glutamate system and lead to the disease onset around a specific stage of brain development. © 2017 Wiley Periodicals, Inc.

Schwannomatosis associated with multiple meningiomas due to a familial SMARCB1 mutation.

PubMed

Bacci, Costanza; Sestini, Roberta; Provenzano, Aldesia; Paganini, Irene; Mancini, Irene; Porfirio, Berardino; Vivarelli, Rossella; Genuardi, Maurizio; Papi, Laura

2010-02-01

Schwannomatosis (MIM 162091) is a condition predisposing to the development of central and peripheral schwannomas; most cases are sporadic without a clear family history but a few families with a clear autosomal dominant pattern of transmission have been described. Germline mutations in SMARCB1 are associated with schwannomatosis. We report a family with multiple schwannomas and meningiomas. A SMARCB1 germline mutation in exon 1 was identified. The mutation, c.92A>T (p.Glu31Val), occurs in a highly conserved amino acid in the SMARCB1 protein. In addition, in silico analysis demonstrated that the mutation disrupts the donor consensus sequence of exon 1. RNA studies verified the absence of mRNA transcribed by the mutant allele. This is the first report of a SMARCB1 germline mutation in a family with schwannomatosis characterized by the development of multiple meningiomas.

A protocol of rope skipping exercise for primary school children: A pilot test

NASA Astrophysics Data System (ADS)

Radzi, A. N. M.; Rambely, A. S.; Chellapan, K.

2014-06-01

This paper aims to investigate the methods and sample used in rope skipping as an exercise approach. A systematic literature review was approached in identifying skipping performance in the related researches. The methods were compared to determine the best methodological approach for the targeted skipping based research measure. A pilot test was performed among seven students below 12 years old. As the outcome of the review, a skipping protocol design has been proposed for 10 years old primary school students. The proposed protocol design is to be submitted to PPUKM Ethical Committee for approval prior to its implementation in investigation memory enhancement in relation to designed skipping activities.

The effect of high- and low-frequency previews and sentential fit on word skipping during reading

PubMed Central

Angele, Bernhard; Laishley, Abby; Rayner, Keith; Liversedge, Simon P.

2014-01-01

In a previous gaze-contingent boundary experiment, Angele and Rayner (2012) found that readers are likely to skip a word that appears to be the definite article the even when syntactic constraints do not allow for articles to occur in that position. In the present study, we investigated whether the word frequency of the preview of a three-letter target word influences a reader’s decision to fixate or skip that word. We found that the word frequency rather than the felicitousness (syntactic fit) of the preview affected how often the upcoming word was skipped. These results indicate that visual information about the upcoming word trumps information from the sentence context when it comes to making a skipping decision. Skipping parafoveal instances of the therefore may simply be an extreme case of skipping high-frequency words. PMID:24707791

The Relation between Breakfast Skipping and School Performance in Adolescents

ERIC Educational Resources Information Center

Boschloo, Annemarie; Ouwehand, Carolijn; Dekker, Sanne; Lee, Nikki; de Groot, Renate; Krabbendam, Lydia; Jolles, Jelle

2012-01-01

Breakfast skipping is common in adolescents, but research on the effects of breakfast skipping on school performance is scarce. This current cross-sectional survey study of 605 adolescents aged 11-18 years investigated whether adolescents who habitually skip breakfast have lower end-of-term grades than adolescents who eat breakfast daily.…

Is snack consumption associated with meal skipping in children and adolescents? The CASPIAN-IV study.

PubMed

Kelishadi, Roya; Mozafarian, Nafiseh; Qorbani, Mostafa; Motlagh, Mohammad Esmaeil; Safiri, Saeid; Ardalan, Gelayol; Keikhah, Mojtaba; Rezaei, Fatemeh; Heshmat, Ramin

2017-06-01

The present inquiry set to assess the relationship between snack consumption and meal skipping in Iranian children and adolescents. Overall, 14,880 students, aged 6-18 years, were selected via multistage cluster sampling method from rural and urban areas of 30 provinces of Iran. A validated questionnaire of food behaviors including questions on snacks consumption and taking/skipping meals was completed. Consuming and skipping meals and their related factors were reported in both crude and adjusted models. Overall, 13,486 students with a mean age of 12.47 ± 3.36 years completed the study (90.6% participation rate). Among them, 32.08, 8.89, and 10.90% skipped breakfast, lunch, and dinner, respectively. Compared to their counterpart groups, the frequency of meal skipping was higher in girls, urban inhabitants, and students in higher school grades (P < 0.05). Snack consumption was associated with an increased odds ratio of meal skipping in many types of snack groups. Meal skipping and snack consumption were frequent among Iranian children and adolescents. Evidence based interventions are proposed to improve the students' eating habits.

Mutations and new polymorphic changes in the TCOF1 gene of patients with oculo-auriculo-vertebral spectrum and Treacher-Collins syndrome.

PubMed

Su, Pen-Hua; Yu, Ju-Shan; Chen, Jia-Yuh; Chen, Suh-Jen; Li, Shuan-Yow; Chen, Hsiao-Neng

2007-10-01

Oculo-auriculo-vertebral spectrum, the exact genetic predisposition of which has not yet been resolved, is characterized by varying degrees of the prevalently unilateral underdevelopment of craniofacial structures and spinal anomalies. Here, we analyzed four cases exhibiting multiple features of oculo-auriculo-vertebral spectrum and one case with Treacher-Collins syndrome. The cranium was analyzed using three-dimensional computed tomography, which reliably identifies craniofacial malformations. We detected one typical oculo-auriculo-vertebral spectrum patient who had a missense mutation in exon 9 of the TCOF1 gene complex and two silent mutations in exons 10 and 23, three partial oculo-auriculo-vertebral spectrum patients who had no detectable mutations in the TCOF1 gene complex, and one Treacher-Collins syndrome patient who had a nonsense mutation in exon 14. All five patients had eight previously reported polymorphic changes in the TCOF1 exons 10, 11, 12, 16, 21, 22, and 23, and four unreported polymorphisms in exons 9, 17, and 22 that were also detected in 51 Taiwanese control patients. These observations strongly suggest that the TCOF1 genetic changes observed in these five patients might be related to oculo-auriculo-vertebral spectrum symptoms.

Structure of the human myelin/oligodendrocyte glycoprotein gene and multiple alternative spliced isoforms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pham-Dinh, D.; Gaspera, D.B.; Dautigny, A.

1995-09-20

Myelin/oligodendrocyte glycoprotein (MOG), a special component of the central nervous system localization on the outermost lamellae of mature myelin, is a member of the immunoglobulin superfamily. We report here the organization of the human MOG gene, which spans approximately 17 kb, and the characterization of six MOG mRNA splicing variants. The intron/exon structure of the human MOG gene confirmed the splicing pattern, supporting the hypothesis that mRNA isoforms could arise by alternative splicing of a single gene. In addition to the eight exons coding for the major MOG isoform, the human MOG gene also contains 3` region, a previously unknownmore » alternatively spliced coding exon, VIA. Alternative utilization of two acceptor splicing sites for exon VIII could produce two different C-termini. The nucleotide sequences presented here may be a useful tool to study further possible involvement if the MOG gene in hereditary neurological disorders. 23 refs., 5 figs.« less

Fibril polymorphism affects immobilized non-amyloid flanking domains of huntingtin exon1 rather than its polyglutamine core

PubMed Central

Lin, Hsiang-Kai; Boatz, Jennifer C.; Krabbendam, Inge E.; Kodali, Ravindra; Hou, Zhipeng; Wetzel, Ronald; Dolga, Amalia M.; Poirier, Michelle A.; van der Wel, Patrick C. A.

2017-01-01

Polyglutamine expansion in the huntingtin protein is the primary genetic cause of Huntington's disease (HD). Fragments coinciding with mutant huntingtin exon1 aggregate in vivo and induce HD-like pathology in mouse models. The resulting aggregates can have different structures that affect their biochemical behaviour and cytotoxic activity. Here we report our studies of the structure and functional characteristics of multiple mutant htt exon1 fibrils by complementary techniques, including infrared and solid-state NMR spectroscopies. Magic-angle-spinning NMR reveals that fibrillar exon1 has a partly mobile α-helix in its aggregation-accelerating N terminus, and semi-rigid polyproline II helices in the proline-rich flanking domain (PRD). The polyglutamine-proximal portions of these domains are immobilized and clustered, limiting access to aggregation-modulating antibodies. The polymorphic fibrils differ in their flanking domains rather than the polyglutamine amyloid structure. They are effective at seeding polyglutamine aggregation and exhibit cytotoxic effects when applied to neuronal cells. PMID:28537272

Fibril polymorphism affects immobilized non-amyloid flanking domains of huntingtin exon1 rather than its polyglutamine core

NASA Astrophysics Data System (ADS)

Lin, Hsiang-Kai; Boatz, Jennifer C.; Krabbendam, Inge E.; Kodali, Ravindra; Hou, Zhipeng; Wetzel, Ronald; Dolga, Amalia M.; Poirier, Michelle A.; van der Wel, Patrick C. A.

2017-05-01

Polyglutamine expansion in the huntingtin protein is the primary genetic cause of Huntington's disease (HD). Fragments coinciding with mutant huntingtin exon1 aggregate in vivo and induce HD-like pathology in mouse models. The resulting aggregates can have different structures that affect their biochemical behaviour and cytotoxic activity. Here we report our studies of the structure and functional characteristics of multiple mutant htt exon1 fibrils by complementary techniques, including infrared and solid-state NMR spectroscopies. Magic-angle-spinning NMR reveals that fibrillar exon1 has a partly mobile α-helix in its aggregation-accelerating N terminus, and semi-rigid polyproline II helices in the proline-rich flanking domain (PRD). The polyglutamine-proximal portions of these domains are immobilized and clustered, limiting access to aggregation-modulating antibodies. The polymorphic fibrils differ in their flanking domains rather than the polyglutamine amyloid structure. They are effective at seeding polyglutamine aggregation and exhibit cytotoxic effects when applied to neuronal cells.

Novel splice-site and missense mutations in the ALDH1A3 gene underlying autosomal recessive anophthalmia/microphthalmia.

PubMed

Semerci, C Nur; Kalay, Ersan; Yıldırım, Cem; Dinçer, Tuba; Olmez, Akgün; Toraman, Bayram; Koçyiğit, Ali; Bulgu, Yunus; Okur, Volkan; Satıroğlu-Tufan, Lale; Akarsu, Nurten A

2014-06-01

This study aimed to identify the underlying genetic defect responsible for anophthalmia/microphthalmia. In total, two Turkish families with a total of nine affected individuals were included in the study. Affymetrix 250 K single nucleotide polymorphism genotyping and homozygosity mapping were used to identify the localisation of the genetic defect in question. Coding region of the ALDH1A3 gene was screened via direct sequencing. cDNA samples were generated from primary fibroblast cell cultures for expression analysis. Reverse transcriptase PCR (RT-PCR) analysis was performed using direct sequencing of the obtained fragments. The causative genetic defect was mapped to chromosome 15q26.3. A homozygous G>A substitution (c.666G>A) at the last nucleotide of exon 6 in the ALDH1A3 gene was identified in the first family. Further cDNA sequencing of ALDH1A3 showed that the c.666G>A mutation caused skipping of exon 6, which predicted in-frame loss of 43 amino acids (p.Trp180_Glu222del). A novel missense c.1398C>A mutation in exon 12 of ALDH1A3 that causes the substitution of a conserved asparagine by lysine at amino acid position 466 (p.Asn466Lys) was observed in the second family. No extraocular findings-except for nevus flammeus in one affected individual and a variant of Dandy-Walker malformation in another affected individual-were observed. Autistic-like behaviour and mental retardation were observed in three cases. In conclusion, novel ALDH1A3 mutations identified in the present study confirm the pivotal role of ALDH1A3 in human eye development. Autistic features, previously reported as an associated finding, were considered to be the result of social deprivation and inadequate parenting during early infancy in the presented families. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Identification of cis-Acting Elements and Splicing Factors Involved in the Regulation of BIM Pre-mRNA Splicing

PubMed Central

Juan, Wen Chun; Roca, Xavier; Ong, S. Tiong

2014-01-01

Aberrant changes in the expression of the pro-apoptotic protein, BCL-2-like 11 (BIM), can result in either impaired or excessive apoptosis, which can contribute to tumorigenesis and degenerative disorders, respectively. Altering BIM pre-mRNA splicing is an attractive approach to modulate apoptosis because BIM activity is partly determined by the alternative splicing of exons 3 or 4, whereby exon 3-containing transcripts are not apoptotic. Here we identified several cis-acting elements and splicing factors involved in BIM alternative splicing, as a step to better understand the regulation of BIM expression. We analyzed a recently discovered 2,903-bp deletion polymorphism within BIM intron 2 that biased splicing towards exon 3, and which also impaired BIM-dependent apoptosis. We found that this region harbors multiple redundant cis-acting elements that repress exon 3 inclusion. Furthermore, we have isolated a 23-nt intronic splicing silencer at the 3′ end of the deletion that is important for excluding exon 3. We also show that PTBP1 and hnRNP C repress exon 3 inclusion, and that downregulation of PTBP1 inhibited BIM-mediated apoptosis. Collectively, these findings start building our understanding of the cis-acting elements and splicing factors that regulate BIM alternative splicing, and also suggest potential approaches to alter BIM splicing for therapeutic purposes. PMID:24743263

Identification of cis-acting elements and splicing factors involved in the regulation of BIM Pre-mRNA splicing.

PubMed

Juan, Wen Chun; Roca, Xavier; Ong, S Tiong

2014-01-01

Aberrant changes in the expression of the pro-apoptotic protein, BCL-2-like 11 (BIM), can result in either impaired or excessive apoptosis, which can contribute to tumorigenesis and degenerative disorders, respectively. Altering BIM pre-mRNA splicing is an attractive approach to modulate apoptosis because BIM activity is partly determined by the alternative splicing of exons 3 or 4, whereby exon 3-containing transcripts are not apoptotic. Here we identified several cis-acting elements and splicing factors involved in BIM alternative splicing, as a step to better understand the regulation of BIM expression. We analyzed a recently discovered 2,903-bp deletion polymorphism within BIM intron 2 that biased splicing towards exon 3, and which also impaired BIM-dependent apoptosis. We found that this region harbors multiple redundant cis-acting elements that repress exon 3 inclusion. Furthermore, we have isolated a 23-nt intronic splicing silencer at the 3' end of the deletion that is important for excluding exon 3. We also show that PTBP1 and hnRNP C repress exon 3 inclusion, and that downregulation of PTBP1 inhibited BIM-mediated apoptosis. Collectively, these findings start building our understanding of the cis-acting elements and splicing factors that regulate BIM alternative splicing, and also suggest potential approaches to alter BIM splicing for therapeutic purposes.

Children's Perceptions of Parental Attitude Affecting Breakfast Skipping in Primary Sixth-Grade Students

ERIC Educational Resources Information Center

Cheng, Tereza Sy; Tse, Lap Ah; Yu, Ignatius Tak-Sun; Griffiths, Sian

2008-01-01

Background: Breakfast skipping is an international public health concern. This study investigated the prevalence of breakfast skipping among primary sixth-grade students in Hong Kong and the impact of students' perceptions of parental attitudes on breakfast skipping. Methods: A total of 426 students aged 10-14 years in 4 local schools participated…

Metabolic and Cardiorespiratory Responses of Young Women to Skipping and Jogging.

ERIC Educational Resources Information Center

Allen, T. Earl; And Others

1987-01-01

Nine 18- to 29-year-old females were studied while jogging and skipping at treadmill speeds of 4.0, 4.8, and 5.4 miles per hour. Comparison of metabolic demand, musculoskeletal stress, and perceived exertion indicated skipping imposed significantly greater metabolic demands and caused higher heart rates than jogging. Skipping was also rated more…

Sleep variability and fatigue in adolescents: Associations with school-related features.

PubMed

Matos, M G; Gaspar, T; Tomé, G; Paiva, T

2016-10-01

This study aims to evaluate the influences of sleep duration and sleep variability (SleepV), upon adolescents' school-related situations. The Health Behaviour in School-Aged Children (HBSC) survey is based on a self-completed questionnaire. The participants were 3164 pupils (53.7% girls), attending the 8th and 10th grades, 14.9 years old, and were inquired about subjective sleep duration during the week and weekends, SleepV, fatigue, difficulties in sleep initiation, school achievement, feelings towards schools, pressure with school work and skipping classes. Multiple regression models used, as dependent variables: (a) school achievement, (b) disliking school, (c) pressure with school work and (d) skipping classes, using as independent variables, each of the remaining school-related variables, fatigue, total sleep duration and difficulties in sleep initiation. The average sleep duration in the week and during weekdays was lower than recommended for these age groups, and almost half of students had high SleepV between weekdays and weekends. A logistic model revealed that the absence of SleepV was associated with lower perception of school work pressure, less frequent skipping classes, more infrequent fatigue and more infrequent difficulties in sleep initiation. Poor sleep quality, SleepV and insufficient sleep duration affected negatively school-related variables. © 2015 International Union of Psychological Science.

BEAT: Bioinformatics Exon Array Tool to store, analyze and visualize Affymetrix GeneChip Human Exon Array data from disease experiments

PubMed Central

2012-01-01

Background It is known from recent studies that more than 90% of human multi-exon genes are subject to Alternative Splicing (AS), a key molecular mechanism in which multiple transcripts may be generated from a single gene. It is widely recognized that a breakdown in AS mechanisms plays an important role in cellular differentiation and pathologies. Polymerase Chain Reactions, microarrays and sequencing technologies have been applied to the study of transcript diversity arising from alternative expression. Last generation Affymetrix GeneChip Human Exon 1.0 ST Arrays offer a more detailed view of the gene expression profile providing information on the AS patterns. The exon array technology, with more than five million data points, can detect approximately one million exons, and it allows performing analyses at both gene and exon level. In this paper we describe BEAT, an integrated user-friendly bioinformatics framework to store, analyze and visualize exon arrays datasets. It combines a data warehouse approach with some rigorous statistical methods for assessing the AS of genes involved in diseases. Meta statistics are proposed as a novel approach to explore the analysis results. BEAT is available at http://beat.ba.itb.cnr.it. Results BEAT is a web tool which allows uploading and analyzing exon array datasets using standard statistical methods and an easy-to-use graphical web front-end. BEAT has been tested on a dataset with 173 samples and tuned using new datasets of exon array experiments from 28 colorectal cancer and 26 renal cell cancer samples produced at the Medical Genetics Unit of IRCCS Casa Sollievo della Sofferenza. To highlight all possible AS events, alternative names, accession Ids, Gene Ontology terms and biochemical pathways annotations are integrated with exon and gene level expression plots. The user can customize the results choosing custom thresholds for the statistical parameters and exploiting the available clinical data of the samples for a multivariate AS analysis. Conclusions Despite exon array chips being widely used for transcriptomics studies, there is a lack of analysis tools offering advanced statistical features and requiring no programming knowledge. BEAT provides a user-friendly platform for a comprehensive study of AS events in human diseases, displaying the analysis results with easily interpretable and interactive tables and graphics. PMID:22536968

High prevalence of exon 8 G533C mutation in apparently sporadic medullary thyroid carcinoma in Greece.

PubMed

Sarika, H L; Papathoma, A; Garofalaki, M; Vasileiou, V; Vlassopoulou, B; Anastasiou, E; Alevizaki, M

2012-12-01

Genetic screening for ret mutation has become routine practice in the evaluation of medullary thyroid carcinoma (MTC). Approximately 25% of these tumours are familial, and they occur as components of the multiple endocrine neoplasia type 2 syndromes (MEN 2A and 2B) or familial MTC. In familial cases, the majority of mutations are found in exons 10, 11, 13, 14 or 15 of the ret gene. A rare mutation involving exon 8 (G533C) has recently been reported in familial cases of MTC in Brazil and Greece; some of these cases were originally thought to be sporadic. The aim of this study was to re-evaluate a series of sporadic cases of MTC, with negative family history, and screen them for germline mutations in exon 8. Genomic DNA was extracted from peripheral lymphocytes in 129 unrelated individuals who had previously been characterized as 'sporadic' based on the negative family history and negative screening for ret gene mutations. Samples were analysed in Applied Biosystems 7500 real-time PCR and confirmed by sequencing. The G533C exon 8 mutation was identified in 10 of 129 patients with sporadic MTC. Asymptomatic gene carriers were subsequently identified in other family members. In our study, we found that 7·75% patients with apparently sporadic MTC do carry G533C mutation involving exon 8 of ret. We feel that there is now a need to include exon 8 mutation screening in all patients diagnosed as sporadic MTC, in Greece. © 2012 Blackwell Publishing Ltd.

Genome-Wide Transcriptome Analysis Reveals Extensive Alternative Splicing Events in the Protoscoleces of Echinococcus granulosus and Echinococcus multilocularis

PubMed Central

Liu, Shuai; Zhou, Xiaosu; Hao, Lili; Piao, Xianyu; Hou, Nan; Chen, Qijun

2017-01-01

Alternative splicing (AS), as one of the most important topics in the post-genomic era, has been extensively studied in numerous organisms. However, little is known about the prevalence and characteristics of AS in Echinococcus species, which can cause significant health problems to humans and domestic animals. Based on high-throughput RNA-sequencing data, we performed a genome-wide survey of AS in two major pathogens of echinococcosis-Echinococcus granulosus and Echinococcus multilocularis. Our study revealed that the prevalence and characteristics of AS in protoscoleces of the two parasites were generally consistent with each other. A total of 6,826 AS events from 3,774 E. granulosus genes and 6,644 AS events from 3,611 E. multilocularis genes were identified in protoscolex transcriptomes, indicating that 33–36% of genes were subject to AS in the two parasites. Strikingly, intron retention instead of exon skipping was the predominant type of AS in Echinococcus species. Moreover, analysis of the Kyoto Encyclopedia of Genes and Genomes pathway indicated that genes that underwent AS events were significantly enriched in multiple pathways mainly related to metabolism (e.g., purine, fatty acid, galactose, and glycerolipid metabolism), signal transduction (e.g., Jak-STAT, VEGF, Notch, and GnRH signaling pathways), and genetic information processing (e.g., RNA transport and mRNA surveillance pathways). The landscape of AS obtained in this study will not only facilitate future investigations on transcriptome complexity and AS regulation during the life cycle of Echinococcus species, but also provide an invaluable resource for future functional and evolutionary studies of AS in platyhelminth parasites. PMID:28588571

Isolation and characterization of alternatively spliced variants of the mouse sigma1 receptor gene, Sigmar1

PubMed Central

Pan, Ling; Pasternak, David A.; Xu, Jin; Xu, Mingming; Lu, Zhigang; Pasternak, Gavril W.

2017-01-01

The sigma1 receptor acts as a chaperone at the endoplasmic reticulum, associates with multiple proteins in various cellular systems, and involves in a number of diseases, such as addiction, pain, cancer and psychiatric disorders. The sigma1 receptor is encoded by the single copy SIGMAR1 gene. The current study identifies five alternatively spliced variants of the mouse sigma1 receptor gene using a polymerase chain reaction cloning approach. All the splice variants are generated by exon skipping or alternative 3’ or 5’ splicing, producing the truncated sigma1 receptor. Similar alternative splicing has been observed in the human SIGMAR1 gene based on the molecular cloning or genome sequence prediction, suggesting conservation of alternative splicing of SIGMAR1 gene. Using quantitative polymerase chain reactions, we demonstrate differential expression of several splice variants in mouse tissues and brain regions. When expressed in HEK293 cells, all the splice variants fail to bind sigma ligands, implicating that each truncated region in these splice variants is important for ligand binding. However, co-immunoprecipitation (Co-IP) study in HEK293 cells co-transfected with tagged constructs reveals that all the splice variants maintain their ability to physically associate with a mu opioid receptor (mMOR-1), providing useful information to correlate the motifs/sequences necessary for their physical association. Furthermore, a competition Co-IP study showed that all the variants can disrupt in a dose-dependent manner the dimerization of the original sigma1 receptor with mMOR-1, suggesting a potential dominant negative function and providing significant insights into their function. PMID:28350844

A Case Study Using CRA to Teach Students with Disabilities to Count Using Flexible Numbers: Applying Skip Counting to Multiplication

ERIC Educational Resources Information Center

Gibbs, Anna S.; Hinton, Vanessa M.; Flores, Margaret M.

2018-01-01

Children who struggle in mathematics have a limited understanding of the foundational processes of mathematics. A lack of conceptual understanding causes students to fall behind as they progress through the core curriculum. Children at high risk for developing mathematics disabilities fail to gain numeracy knowledge. The purpose of this case study…

Reading Skill and Word Skipping: Implications for Visual and Linguistic Accounts of Word Skipping

ERIC Educational Resources Information Center

Eskenazi, Michael A.; Folk, Jocelyn R.

2015-01-01

We investigated whether high-skill readers skip more words than low-skill readers as a result of parafoveal processing differences based on reading skill. We manipulated foveal load and word length, two variables that strongly influence word skipping, and measured reading skill using the Nelson-Denny Reading Test. We found that reading skill did…

Evidence for skipped spawning in a potamodromous cyprinid, humpback chub (Gila cypha), with implications for demographic parameter estimates

USGS Publications Warehouse

Pearson, Kristen Nicole; Kendall, William L.; Winkelman, Dana L.; Persons, William R.

2015-01-01

Our findings reveal evidence for skipped spawning in a potamodromous cyprinid, humpback chub (HBC; Gila cypha  ). Using closed robust design mark-recapture models, we found, on average, spawning HBC transition to the skipped spawning state () with a probability of 0.45 (95% CRI (i.e. credible interval): 0.10, 0.80) and skipped spawners remain in the skipped spawning state () with a probability of 0.60 (95% CRI: 0.26, 0.83), yielding an average spawning cycle of every 2.12 years, conditional on survival. As a result, migratory skipped spawners are unavailable for detection during annual sampling events. If availability is unaccounted for, survival and detection probability estimates will be biased. Therefore, we estimated annual adult survival probability (S), while accounting for skipped spawning, and found S remained reasonably stable throughout the study period, with an average of 0.75 ((95% CRI: 0.66, 0.82), process varianceσ2 = 0.005), while skipped spawning probability was highly dynamic (σ2 = 0.306). By improving understanding of HBC spawning strategies, conservation decisions can be based on less biased estimates of survival and a more informed population model structure.

Risk of mental health problems in adolescents skipping meals: The Korean National Health and Nutrition Examination Survey 2010 to 2012.

PubMed

Lee, Gyungjoo; Han, Kyungdo; Kim, Hyunju

Adolescents frequently skip meals, doing so even more than once per day. This is associated with more mental health problems. This study identified mental health problems' associations with skipping meals and the frequency thereof among adolescents. This cross-sectional population-based study used a data set of 1,413 adolescents from the 2010 to 2012 Korean National Health and Nutrition Examination Survey. Hierarchical multivariable logistic regression was conducted to determine the risk of mental health problems, including stress, depressive mood, and suicidal ideation in relation to skipping meals and the frequency thereof per day. Breakfast skipping significantly increased the risks of stress and depressive mood. Stress, depressive mood, and suicidal ideation were significantly prevalent as the daily frequency of skipping meals increased. Specific strategies should be developed at government or school level to decrease the frequency of skipping meals per day, associated with serious mental health problems in adolescents. Copyright © 2017 Elsevier Inc. All rights reserved.

Skipping breakfast and 5‐year changes in body mass index and waist circumference in Japanese men and women

PubMed Central

Yoshita, K.; Nakamura, K.; Miura, K.; Takamura, T.; Nagasawa, S.Y.; Morikawa, Y.; Kido, T.; Naruse, Y.; Nogawa, K.; Suwazono, Y.; Sasaki, S.; Ishizaki, M.; Nakagawa, H.

2017-01-01

Summary Objective This study investigated the relationship between frequency of skipping breakfast and annual changes in body mass index (BMI) and waist circumference (WC). Methods The participants were 4,430 factory employees. BMI and WC were measured repeatedly at annual medical examinations over a 5‐year period. The association between frequency of skipping breakfast at the baseline examination and annual changes in anthropometric indices was evaluated using the generalized estimating equation method. Results The mean (standard deviation) BMI was 23.3 (3.0) kg m−2 for men and 21.9 (3.6) kg m−2 for women; and the mean WC was 82.6 (8.7) cm for men and 77.8 (9.8) cm for women. During the follow‐up period, mean BMI increased by 0.2 kg m−2 for men and women, and mean WC increased by 1.1 cm for men and 1.0 cm for women. The annual change in the BMI of men who skipped breakfast four to six times per week was 0.061 kg m−2 higher, and that of those who skipped breakfast seven times per week was 0.046 kg m−2 higher, compared with those who did not skip breakfast. Annual changes in the WC of male participants who skipped breakfast seven times per week was 0.248 cm higher than that of those who did not skip breakfast. Skipping breakfast was not associated with changes in BMI or WC in women. Conclusions Skipping breakfast was closely associated with annual changes in BMI and WC among men, and eating breakfast more than four times per week may prevent the excessive body weight gain associated with skipping breakfast. PMID:28702211

Mutations in KIAA0753 cause Joubert syndrome associated with growth hormone deficiency

PubMed Central

Stephen, Joshi; Vilboux, Thierry; Mian, Luhe; Kuptanon, Chulaluck; Sinclair, Courtney M.; Yildirimli, Deniz; Maynard, Dawn M.; Bryant, Joy; Fischer, Roxanne; Vemulapalli, Meghana; Mullikin, James C.; Huizing, Marjan; Gahl, William A.

2017-01-01

Joubert syndrome and related disorders (JSRD) are a heterogeneous group of ciliopathies defined based on the mid-hindbrain abnormalities that result in the characteristic “molar tooth sign” on brain imaging. The core clinical findings of JSRD are hypotonia, developmental delay, abnormal eye movements and breathing abnormalities. To date, more than 30 JSRD genes that encode proteins important for structure and/or function of cilia have been identified. Here, we present 2 siblings with Joubert syndrome associated with growth hormone deficiency. Whole exome sequencing of the family identified compound heterozygous mutations in KIAA0753, i.e., a missense mutation (p.Arg257Gly) and an intronic mutation (c.2359-1G>C). The intronic mutation alters normal splicing by activating a cryptic acceptor splice site in exon 16. The novel acceptor site skips nine nucleotides, deleting three amino acids from the protein coding frame. KIAA0753 (OFIP) is a centrosome and pericentriolar satellite protein, previously not known to cause Joubert syndrome. We present comprehensive clinical descriptions of the Joubert syndrome patients as well as the cellular phenotype of defective ciliogenesis in the patients’ fibroblasts. PMID:28220259

Mutations in KIAA0753 cause Joubert syndrome associated with growth hormone deficiency.

PubMed

Stephen, Joshi; Vilboux, Thierry; Mian, Luhe; Kuptanon, Chulaluck; Sinclair, Courtney M; Yildirimli, Deniz; Maynard, Dawn M; Bryant, Joy; Fischer, Roxanne; Vemulapalli, Meghana; Mullikin, James C; Huizing, Marjan; Gahl, William A; Malicdan, May Christine V; Gunay-Aygun, Meral

2017-04-01

Joubert syndrome and related disorders (JSRD) are a heterogeneous group of ciliopathies defined based on the mid-hindbrain abnormalities that result in the characteristic "molar tooth sign" on brain imaging. The core clinical findings of JSRD are hypotonia, developmental delay, abnormal eye movements and breathing abnormalities. To date, more than 30 JSRD genes that encode proteins important for structure and/or function of cilia have been identified. Here, we present 2 siblings with Joubert syndrome associated with growth hormone deficiency. Whole exome sequencing of the family identified compound heterozygous mutations in KIAA0753, i.e., a missense mutation (p.Arg257Gly) and an intronic mutation (c.2359-1G>C). The intronic mutation alters normal splicing by activating a cryptic acceptor splice site in exon 16. The novel acceptor site skips nine nucleotides, deleting three amino acids from the protein coding frame. KIAA0753 (OFIP) is a centrosome and pericentriolar satellite protein, previously not known to cause Joubert syndrome. We present comprehensive clinical descriptions of the Joubert syndrome patients as well as the cellular phenotype of defective ciliogenesis in the patients' fibroblasts.

Germline mutations in ETV6 are associated with thrombocytopenia, red cell macrocytosis and predisposition to lymphoblastic leukemia

PubMed Central

Lee-Sherick, Alisa B.; Callaghan, Michael; Noris, Patrizia; Savoia, Anna; Rajpurkar, Madhvi; Jones, Kenneth; Gowan, Katherine; Balduini, Carlo; Pecci, Alessandro; Gnan, Chiara; De Rocco, Daniela; Doubek, Michael; Li, Ling; Lu, Lily; Leung, Richard; Landolt-Marticorena, Carolina; Hunger, Stephen; Heller, Paula; Gutierrez-Hartmann, Arthur; Xiayuan, Liang; Pluthero, Fred G.; Rowley, Jesse W.; Weyrich, Andrew S.

2015-01-01

Some familial platelet disorders are associated with predisposition to leukemia, myelodysplastic syndrome (MDS) or dyserythropoietic anemia.1,2 We identified a family with autosomal dominant thrombocytopenia, high erythrocyte mean corpuscular volume (MCV) and two occurrences of B-cell precursor acute lymphoblastic leukemia (ALL). Whole exome sequencing identified a heterozygous single nucleotide change in ETV6 (Ets Variant Gene 6), c.641C>T, encoding a p.Pro214Leu substitution in the central domain, segregating with thrombocytopenia and elevated MCV. A screen of 23 families with similar phenotype found two with ETV6 mutations. One family had the p.Pro214Leu mutation and one individual with ALL. The other family had a c.1252A>G transition producing a p.Arg418Gly substitution in the DNA binding domain, with alternative splicing and exon-skipping. Functional characterization of these mutations showed aberrant cellular localization of mutant and endogenous ETV6, decreased transcriptional repression and altered megakaryocyte maturation. Our findings underscore a key role for ETV6 in platelet formation and leukemia predisposition. PMID:25807284

Nemaline myopathy and distal arthrogryposis associated with an autosomal recessive TNNT3 splice variant.

PubMed

Sandaradura, Sarah A; Bournazos, Adam; Mallawaarachchi, Amali; Cummings, Beryl B; Waddell, Leigh B; Jones, Kristi J; Troedson, Christopher; Sudarsanam, Annapurna; Nash, Benjamin M; Peters, Gregory B; Algar, Elizabeth M; MacArthur, Daniel G; North, Kathryn N; Brammah, Susan; Charlton, Amanda; Laing, Nigel G; Wilson, Meredith J; Davis, Mark R; Cooper, Sandra T

2018-03-01

A male neonate presented with severe weakness, hypotonia, contractures and congenital scoliosis. Skeletal muscle specimens showed marked atrophy and degeneration of fast fibers with striking nemaline rods and hypertrophy of slow fibers that were ultrastructurally normal. A neuromuscular gene panel identified a homozygous essential splice variant in TNNT3 (chr11:1956150G > A, NM_006757.3:c.681+1G > A). TNNT3 encodes skeletal troponin-T fast and is associated with autosomal dominant distal arthrogryposis. TNNT3 has not previously been associated with nemaline myopathy (NM), a rare congenital myopathy linked to defects in proteins associated with thin filament structure and regulation. cDNA studies confirmed pathogenic consequences of the splice variant, eliciting exon-skipping and intron retention events leading to a frameshift. Western blot showed deficiency of troponin-T fast protein with secondary loss of troponin-I fast . We establish a homozygous splice variant in TNNT3 as the likely cause of severe congenital NM with distal arthrogryposis, characterized by specific involvement of Type-2 fibers and deficiency of troponin-T fast . © 2017 Wiley Periodicals, Inc.

Multi-level omics analysis in a murine model of dystrophin loss and therapeutic restoration.

PubMed

Roberts, Thomas C; Johansson, Henrik J; McClorey, Graham; Godfrey, Caroline; Blomberg, K Emelie M; Coursindel, Thibault; Gait, Michael J; Smith, C I Edvard; Lehtiö, Janne; El Andaloussi, Samir; Wood, Matthew J A

2015-12-01

Duchenne muscular dystrophy (DMD) is a classical monogenic disorder, a model disease for genomic studies and a priority candidate for regenerative medicine and gene therapy. Although the genetic cause of DMD is well known, the molecular pathogenesis of disease and the response to therapy are incompletely understood. Here, we describe analyses of protein, mRNA and microRNA expression in the tibialis anterior of the mdx mouse model of DMD. Notably, 3272 proteins were quantifiable and 525 identified as differentially expressed in mdx muscle (P < 0.01). Therapeutic restoration of dystrophin by exon skipping induced widespread shifts in protein and mRNA expression towards wild-type expression levels, whereas the miRNome was largely unaffected. Comparison analyses between datasets showed that protein and mRNA ratios were only weakly correlated (r = 0.405), and identified a multitude of differentially affected cellular pathways, upstream regulators and predicted miRNA-target interactions. This study provides fundamental new insights into gene expression and regulation in dystrophic muscle. © The Author 2015. Published by Oxford University Press.

Breakfast skipping is associated with cyberbullying and school bullying victimization. A school-based cross-sectional study.

PubMed

Sampasa-Kanyinga, Hugues; Roumeliotis, Paul; Farrow, Claire V; Shi, Yuanfeng F

2014-08-01

Breakfast skipping is a health concern that has well-known negative consequences physically and psychologically. It is therefore important to understand why children skip breakfast. The purpose of this study was to establish whether the experience of bullying and cyberbullying impacts upon breakfast skipping and to further evaluate whether the inability for youths to cope with bullying victimization affects their mental health (depression), and in turn predicts breakfast skipping. Data were obtained from the Eastern Ontario 2011 Youth Risk Behaviour Survey, a cross-sectional regional school-based survey of middle and high school students (11-20 years old) across the five counties of Eastern Ontario, Canada (N = 3035). Self-reported data about children's experiences of bullying victimization, breakfast eating habits, socio-economical status, depression, and other risk behaviours were analysed. Approximately half of the participants (50.4%) reported not eating breakfast on a regular basis: 26.3% and 24.1% reported often (usually eat breakfast three times or more per week) and frequent (usually eat breakfast twice a week or less) breakfast skipping behaviour, respectively. Victims of both cyberbullying and school bullying presented greater likelihood of often (adjusted relative risk ratio (RR) = 1.55; 95% confidence interval (CI) = 1.17-2.06) and frequent (RR = 1.97; 95% CI = 1.28-3.03) breakfast skipping. Mediation analysis further showed that depression fully mediated the relationship between school bullying victimization and frequent breakfast skipping. Moreover, depression partially mediated the associations between both cyberbullying and school bullying with frequent breakfast skipping. These findings highlight the potential interrelationships between cyberbullying, school bullying and depression in predicting unhealthy breakfast skipping behaviour in children. Copyright © 2014 Elsevier Ltd. All rights reserved.

Rice cyclophilin OsCYP18-2 is translocated to the nucleus by an interaction with SKIP and enhances drought tolerance in rice and Arabidopsis.

PubMed

Lee, Sang Sook; Park, Hyun Ji; Yoon, Dae Hwa; Kim, Beom-Gi; Ahn, Jun Cheul; Luan, Sheng; Cho, Hye Sun

2015-10-01

Cyclophilin 18-2 (CYP18-2) genes, homologues of human peptidyl-prolyl isomerase-like 1 (PPiL1), are conserved across multicellular organisms and Schizosaccharomyces pombe. Although PPiL1 is known to interact with ski-interacting protein (SKIP), a transcriptional co-regulator and spliceosomal component, there have been no functional analyses of PPiL1 homologues in plants. Rice cyclophilin 18-2 (OsCYP18-2) bound directly to amino acids 56-95 of OsSKIP and its binding was independent of cyclosporin A, a cyclophilin-binding drug. Moreover, OsCYP18-2 exhibited PPIase activity regardless of its interaction with OsSKIP. Therefore, the binding site for OsCYP18-2's interaction with SKIP was distinct from the PPIase active site. OsCYP18-2's interaction with SKIP full-length protein enabled OsCYP18-2's translocation from the cytoplasm into the nucleus and AtSKIP interacted in planta with both AtCYP18-2 and OsCYP18-2. Drought and salt stress induced similar expression of OsCYP18-2 and OsSKIP. Overexpression of OsCYP18-2 in transgenic rice and Arabidopsis thaliana plants enhanced drought tolerance and altered expression and pre-mRNA splicing patterns of stress-related genes in Arabidopsis under drought conditions. Furthermore, OsCYP18-2 caused transcriptional activation with/without OsSKIP in the GAL4 system of yeast; thus the OsSKIP-OsCYP18-2 interaction has an important role in the transcriptional and post-transcriptional regulation of stress-related genes and increases tolerance to drought stress. © 2015 John Wiley & Sons Ltd.

Associations between perceived friends' support of healthy eating and meal skipping in adolescence.

PubMed

Rosenrauch, Sharon; Ball, Kylie; Lamb, Karen E

2017-12-01

Meal skipping is a relatively common behaviour during adolescence. As peer influence increases during adolescence, friendship groups may play a role in determining eating patterns such as meal skipping. The current study examined cross-sectional and longitudinal associations between perceived friends' support of healthy eating and breakfast and lunch skipping among adolescents. Survey of intrapersonal, social and environmental factors that may influence eating patterns at baseline (2004/05) and follow-up (2006/07). Thirty-seven secondary schools in Victoria, Australia. Sample of 1785 students aged 12-15 years at baseline. Adolescents who reported that their friends sometimes or often ate healthy foods with them were less likely (adjusted OR; 95 % CI) to skip breakfast (sometimes: 0·71; 0·57, 0·90; often: 0·54; 0·38, 0·76) or lunch (sometimes: 0·61; 0·41, 0·89; often: 0·59; 0·37, 0·94) at baseline than those who reported their friends never or rarely displayed this behaviour. Although this variable was associated with lunch skipping at follow-up, there was no evidence of an association with breakfast skipping at follow-up. There was no evidence of an association between perceived encouragement of healthy eating, and an inconsistent relationship between perceived discouragement of junk food consumption, and meal skipping. Friends eating healthy foods together may serve to reduce meal skipping during early adolescence, possibly due to the influence of directly observable behaviour and shared beliefs held by those in the same friendship group. Verbal encouragement or discouragement from friends may be less impactful an influence on meal skipping (than directly observable behaviours) in adolescents.

The combined unhealthy behaviors of breakfast skipping and smoking are associated with the prevalence of diabetes mellitus.

PubMed

Nishiyama, Midori; Muto, Takashi; Minakawa, Toshihiro; Shibata, Toshie

2009-08-01

Skipping breakfast has been considered a representative unhealthy behavior, but there is little information about the combined effects of breakfast skipping and other unhealthy health habits, especially smoking. First this cross-sectional study investigated unhealthy behaviors among breakfast skippers, and then examined the impact of the combined association of skipping breakfast and smoking on health. A total of 1,200 adults living in one Japanese community were sent questionnaires to elicit data on age, gender, breakfast-eating frequency, and other lifestyle habits. A total 603 of people returned their questionnaires (response rate: 50.3%), and 493 (230 men and 263 women) questionnaires were considered appropriate for analysis. Smoking rate in men (mean age, 53.7 years) and women (mean age, 50.4 years) was 41.3%, and 9.5%, respectively. Skipping breakfast was more prevalent in people under age 50 years (p < 0.001), and was related to other unhealthy behaviors. Binary logistic regression identified current smoking as the most significant factor related to breakfast skipping (3.10, 95%CI 1.50-6.39). Other factors included, age younger than 50 years (3.04, 95%CI 1.31-7.06) and poor sleeping quality (2.06, 95%CI 1.00-4.25). After examining the combined impact of skipping breakfast and smoking, the highest odds ratio for a diagnosis of diabetes mellitus was found among those who smoked and skipped breakfast (4.68, 95% CI: 1.46-15.05). Moreover, skipping breakfast among non-smokers showed a high association with perceived stress (2.83, 95% CI: 1.05-7.61). In conclusion, the combined unhealthy behaviors of skipping breakfast and smoking are associated with the prevalence of diabetes mellitus.

Modeling the ferrochelatase c.315-48C modifier mutation for erythropoietic protoporphyria (EPP) in mice

PubMed Central

Bansode, Vijay B.; Koentgen, Frank; Trüb, Judith; Pelczar, Pawel; Schneider-Yin, Xiaoye; Minder, Elisabeth I.

2017-01-01

ABSTRACT Erythropoietic protoporphyria (EPP) is caused by deficiency of ferrochelatase (FECH), which incorporates iron into protoporphyrin IX (PPIX) to form heme. Excitation of accumulated PPIX by light generates oxygen radicals that evoke excessive pain and, after longer light exposure, cause ulcerations in exposed skin areas of individuals with EPP. Moreover, ∼5% of the patients develop a liver dysfunction as a result of PPIX accumulation. Most patients (∼97%) have a severe FECH mutation (Mut) in trans to an intronic polymorphism (c.315-48C), which reduces ferrochelatase synthesis by stimulating the use of an aberrant 3′ splice site 63 nt upstream of the normal site for exon 4. In contrast, with the predominant c.315-48T allele, the correct splice site is mostly used, and individuals with a T/Mut genotype do not develop EPP symptoms. Thus, the C allele is a potential target for therapeutic approaches that modify this splicing decision. To provide a model for pre-clinical studies of such approaches, we engineered a mouse containing a partly humanized Fech gene with the c.315-48C polymorphism. F1 hybrids obtained by crossing these mice with another inbred line carrying a severe Fech mutation (named m1Pas) show a very strong EPP phenotype that includes elevated PPIX in the blood, enlargement of liver and spleen, anemia, as well as strong pain reactions and skin lesions after a short period of light exposure. In addition to the expected use of the aberrant splice site, the mice also show a strong skipping of the partly humanized exon 3. This will limit the use of this model for certain applications and illustrates that engineering of a hybrid gene may have unforeseeable consequences on its splicing. PMID:28093505

IBTK Differently Modulates Gene Expression and RNA Splicing in HeLa and K562 Cells.

PubMed

Fiume, Giuseppe; Scialdone, Annarita; Rizzo, Francesca; De Filippo, Maria Rosaria; Laudanna, Carmelo; Albano, Francesco; Golino, Gaetanina; Vecchio, Eleonora; Pontoriero, Marilena; Mimmi, Selena; Ceglia, Simona; Pisano, Antonio; Iaccino, Enrico; Palmieri, Camillo; Paduano, Sergio; Viglietto, Giuseppe; Weisz, Alessandro; Scala, Giuseppe; Quinto, Ileana

2016-11-07

The IBTK gene encodes the major protein isoform IBTKα that was recently characterized as substrate receptor of Cul3-dependent E3 ligase, regulating ubiquitination coupled to proteasomal degradation of Pdcd4, an inhibitor of translation. Due to the presence of Ankyrin-BTB-RCC1 domains that mediate several protein-protein interactions, IBTKα could exert expanded regulatory roles, including interaction with transcription regulators. To verify the effects of IBTKα on gene expression, we analyzed HeLa and K562 cell transcriptomes by RNA-Sequencing before and after IBTK knock-down by shRNA transduction. In HeLa cells, 1285 (2.03%) of 63,128 mapped transcripts were differentially expressed in IBTK -shRNA-transduced cells, as compared to cells treated with control-shRNA, with 587 upregulated (45.7%) and 698 downregulated (54.3%) RNAs. In K562 cells, 1959 (3.1%) of 63128 mapped RNAs were differentially expressed in IBTK -shRNA-transduced cells, including 1053 upregulated (53.7%) and 906 downregulated (46.3%). Only 137 transcripts (0.22%) were commonly deregulated by IBTK silencing in both HeLa and K562 cells, indicating that most IBTKα effects on gene expression are cell type-specific. Based on gene ontology classification, the genes responsive to IBTK are involved in different biological processes, including in particular chromatin and nucleosomal organization, gene expression regulation, and cellular traffic and migration. In addition, IBTK RNA interference affected RNA maturation in both cell lines, as shown by the evidence of alternative 3'- and 5'-splicing, mutually exclusive exons, retained introns, and skipped exons. Altogether, these results indicate that IBTK differently modulates gene expression and RNA splicing in HeLa and K562 cells, demonstrating a novel biological role of this protein.

The molecular basis of Canavan (Aspartoacylase deficiency) disease in European non-Jewish patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shaag, A.; Anikster, Y.; Glustein, J.Z.

Canavan disease is an infantile neurodegenerative disease that is due to aspartoacylase deficiency. The disease has been reported mainly in Ashkenazi Jews but also occurs in other ethnic groups. Determination of enzymatic activity for carrier detection and prenatal diagnosis is considered unreliable. In the present study, nine mutations were found in the aspartoacylase gene of 19 non-Jewish patients. These included four point mutations (A305E [39.5% of the mutated alleles], C218X [15.8%], F2955 [2.6%], and G274R [5.3%]); four deletion mutations (827delGT [5.3%], 870del4 [2.6%], 566del7 [2.6%], and 527del6 [2.6%]); and one exon skip (527del108 [5.3%]). The A305E mutation is pan-European andmore » probably the most ancient mutation, identified in patients of Greek, Polish, Danish, French, Spanish, Italian, and British origin. In contrast, the G274R and 527del108 mutations were found only in patients of Turkish origin, and the C218X mutation was identified only in patients of Gypsy origin. Homozygosity for the A305E mutation was identified in patients with both the severe and the mild forms of Canavan disease. Mutations were identified in 31 of the 38 alleles, resulting in an overall detection rate of 81.6%. All nine mutations identified in non-Jewish patients reside in exons 4-6 of the aspartoacylase gene. The results would enable accurate genetic counseling in the families of 13 (68.4%) of 19 patients, in whom two mutations were identified in the aspartoacylase cDNA. 19 refs., 9 figs., 3 tabs.« less

Deep developmental transcriptome sequencing uncovers numerous new genes and enhances gene annotation in the sponge Amphimedon queenslandica.

PubMed

Fernandez-Valverde, Selene L; Calcino, Andrew D; Degnan, Bernard M

2015-05-15

The demosponge Amphimedon queenslandica is amongst the few early-branching metazoans with an assembled and annotated draft genome, making it an important species in the study of the origin and early evolution of animals. Current gene models in this species are largely based on in silico predictions and low coverage expressed sequence tag (EST) evidence. Amphimedon queenslandica protein-coding gene models are improved using deep RNA-Seq data from four developmental stages and CEL-Seq data from 82 developmental samples. Over 86% of previously predicted genes are retained in the new gene models, although 24% have additional exons; there is also a marked increase in the total number of annotated 3' and 5' untranslated regions (UTRs). Importantly, these new developmental transcriptome data reveal numerous previously unannotated protein-coding genes in the Amphimedon genome, increasing the total gene number by 25%, from 30,060 to 40,122. In general, Amphimedon genes have introns that are markedly smaller than those in other animals and most of the alternatively spliced genes in Amphimedon undergo intron-retention; exon-skipping is the least common mode of alternative splicing. Finally, in addition to canonical polyadenylation signal sequences, Amphimedon genes are enriched in a number of unique AT-rich motifs in their 3' UTRs. The inclusion of developmental transcriptome data has substantially improved the structure and composition of protein-coding gene models in Amphimedon queenslandica, providing a more accurate and comprehensive set of genes for functional and comparative studies. These improvements reveal the Amphimedon genome is comprised of a remarkably high number of tightly packed genes. These genes have small introns and there is pervasive intron retention amongst alternatively spliced transcripts. These aspects of the sponge genome are more similar unicellular opisthokont genomes than to other animal genomes.

Using a minigene approach to characterize a novel splice site mutation in human F7 gene causing inherited factor VII deficiency in a Chinese pedigree.

PubMed

Yu, T; Wang, X; Ding, Q; Fu, Q; Dai, J; Lu, Y; Xi, X; Wang, H

2009-11-01

Factor VII deficiency which transmitted as an autosomal recessive disorder is a rare haemorrhagic condition. The aim of this study was to identify the molecular genetic defect and determine its functional consequences in a Chinese pedigree with FVII deficiency. The proband was diagnosed as inherited coagulation FVII deficiency by reduced plasma levels of FVII activity (4.4%) and antigen (38.5%). All nine exons and their flanking sequence of F7 gene were amplified by polymerase chain reaction (PCR) for the proband and the PCR products were directly sequenced. The compound heterozygous mutations of F7 (NM_000131.3) c.572-1G>A and F7 (NM_000131.3) c.1165T>G; p.Cys389Gly were identified in the proband's F7 gene. To investigate the splicing patterns associated with F7 c.572-1G>A, ectopic transcripts in leucocytes of the proband were analyzed. F7 minigenes, spanning from intron 4 to intron 7 and carrying either an A or a G at position -1 of intron 5, were constructed and transiently transfected into human embryonic kidney (HEK) 293T cells, followed by RT-PCR analysis. The aberrant transcripts from the F7 c.572-1G>A mutant allele were not detected by ectopic transcription study. Sequencing of the RT-PCR products from the mutant transfectant demonstrated the production of an erroneously spliced mRNA with exon 6 skipping, whereas a normal splicing occurred in the wide type transfectant. The aberrant mRNA produced from the F7 c.572-1G>A mutant allele is responsible for the factor VII deficiency in this pedigree.

Identification and characterization of ALK kinase splicing isoforms in non-small-cell lung cancer

PubMed Central

de Figueiredo-Pontes, Lorena Lobo; Wong, Daisy Wing-Sze; Tin, Vick Pui-Chi; Chung, Lap-Ping; Yasuda, Hiroyuki; Yamaguchi, Norihiro; Nakayama, Sohei; Jänne, Pasi Antero; Wong, Maria Pik; Kobayashi, Susumu Soeda; Costa, Daniel Botelho

2014-01-01

Purpose: Anaplastic lymphoma kinase (ALK) rearrangements are present in an important subset of non-small-cell lung cancer (NSCLC) and predict for response to the tyrosine kinase inhibitor crizotinib. In this study, we evaluated the yet unknown frequency and functional role of ALK splicing isoforms in NSCLC. Experimental Design: We analyzed 270 cases of NSCLC for ALK kinase domain splicing aberrations, and in addition generated constructs with full length EML4-ALK (E13;A20) and a splicing isoform. Results: Splicing isoforms of the kinase domain of ALK - including complete skipping of exon 23 (ALKdel23, ALK p.I1171fs*42) and exon 27 (ALKdel27, ALK p.T1312fs*0) - were identified in 11.1% (30/270 cases) of NSCLC, and these changes co-existed with ALK rearrangements, KRAS mutations and EGFR mutations. ALK splicing isoforms were observed with full length EML4-ALK in crizotinib-naïve and treated NSCLCs. ALK T1312fs*0 was unable to render cells solely dependent on ALK signaling. Unlike EML4-ALK and EML4-ALK p.L1196M, EML4-ALK T1312fs*0 did not autophosphorylate ALK or other phospho-tyrosine sites. Co-expression of equal amounts of EML4-ALK T1312fs*0 and EML4-ALK did not result in resistance to crizotinib, while co-expression of EML4-ALK L1196M with EML4-ALK resulted in resistance to inhibition of ALK by crizotinib. Conclusions: ALK kinase splicing isoforms were present in NSCLC and even if translated seemed to be non-functional variants of ALK. PMID:24419423

IBTK Differently Modulates Gene Expression and RNA Splicing in HeLa and K562 Cells

PubMed Central

Fiume, Giuseppe; Scialdone, Annarita; Rizzo, Francesca; De Filippo, Maria Rosaria; Laudanna, Carmelo; Albano, Francesco; Golino, Gaetanina; Vecchio, Eleonora; Pontoriero, Marilena; Mimmi, Selena; Ceglia, Simona; Pisano, Antonio; Iaccino, Enrico; Palmieri, Camillo; Paduano, Sergio; Viglietto, Giuseppe; Weisz, Alessandro; Scala, Giuseppe; Quinto, Ileana

2016-01-01

The IBTK gene encodes the major protein isoform IBTKα that was recently characterized as substrate receptor of Cul3-dependent E3 ligase, regulating ubiquitination coupled to proteasomal degradation of Pdcd4, an inhibitor of translation. Due to the presence of Ankyrin-BTB-RCC1 domains that mediate several protein-protein interactions, IBTKα could exert expanded regulatory roles, including interaction with transcription regulators. To verify the effects of IBTKα on gene expression, we analyzed HeLa and K562 cell transcriptomes by RNA-Sequencing before and after IBTK knock-down by shRNA transduction. In HeLa cells, 1285 (2.03%) of 63,128 mapped transcripts were differentially expressed in IBTK-shRNA-transduced cells, as compared to cells treated with control-shRNA, with 587 upregulated (45.7%) and 698 downregulated (54.3%) RNAs. In K562 cells, 1959 (3.1%) of 63128 mapped RNAs were differentially expressed in IBTK-shRNA-transduced cells, including 1053 upregulated (53.7%) and 906 downregulated (46.3%). Only 137 transcripts (0.22%) were commonly deregulated by IBTK silencing in both HeLa and K562 cells, indicating that most IBTKα effects on gene expression are cell type-specific. Based on gene ontology classification, the genes responsive to IBTK are involved in different biological processes, including in particular chromatin and nucleosomal organization, gene expression regulation, and cellular traffic and migration. In addition, IBTK RNA interference affected RNA maturation in both cell lines, as shown by the evidence of alternative 3′- and 5′-splicing, mutually exclusive exons, retained introns, and skipped exons. Altogether, these results indicate that IBTK differently modulates gene expression and RNA splicing in HeLa and K562 cells, demonstrating a novel biological role of this protein. PMID:27827994

Transcript levels, alternative splicing and proteolytic cleavage of TFIIIA control 5S rRNA accumulation during Arabidopsis thaliana development.

PubMed

Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette

2012-07-01

Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

Peripheral type of choline acetyltransferase: biological and evolutionary implications for novel mechanisms in cholinergic system.

PubMed

Bellier, J-P; Kimura, H

2011-12-01

The peripheral type of choline acetyltransferase (pChAT) is an isoform of the well-studied common type of choline acetyltransferase (cChAT), the synthesizing enzyme of acetylcholine. Since pChAT arises by exons skipping, its amino acid sequence is similar to that of cChAT, except the lack of a continuous peptide sequence encoded by all the four exons from 6 to 9. While cChAT expression has been observed in both the central and peripheral nervous systems, pChAT is preferentially expressed in the peripheral nervous system. pChAT appears to be a reliable marker for the visualization of peripheral cholinergic neurons and their processes, whereas other conventional markers including cChAT have not been used successfully for it. In mammals like rodents, pChAT immunoreactivity has been observed in most, if not all, physiologically identified peripheral cholinergic structures such as all parasympathetic postganglionic neurons and most neurons of the enteric nervous system. In addition, pChAT has been found in many peripheral neurons that are derived from the neural crest. These include sensory neurons of the trigeminal ganglion and the dorsal root ganglion, and sympathetic postganglionic neurons. Recent studies moreover indicate that pChAT, as well as cChAT, appears ubiquitously expressed among various species not only of vertebrate mammals but also of invertebrate mollusks. This finding implies that the alternative splicing mechanism to generate pChAT and cChAT has been preserved during evolution, probably for some functional benefits. Copyright © 2011 Elsevier B.V. All rights reserved.

Tissue-Specific Reduction in Splicing Efficiency of IKBKAP Due to the Major Mutation Associated with Familial Dysautonomia

PubMed Central

Cuajungco, Math P.; Leyne, Maire; Mull, James; Gill, Sandra P.; Lu, Weining; Zagzag, David; Axelrod, Felicia B.; Maayan, Channa; Gusella, James F.; Slaugenhaupt, Susan A.

2003-01-01

We recently identified a mutation in the I-κB kinase associated protein (IKBKAP) gene as the major cause of familial dysautonomia (FD), a recessive sensory and autonomic neuropathy. This alteration, located at base pair 6 of the intron 20 donor splice site, is present on >99.5% of FD chromosomes and results in tissue-specific skipping of exon 20. A second FD mutation, a missense change in exon 19 (R696P), was seen in only four patients heterozygous for the major mutation. Here, we have further characterized the consequences of the major mutation by examining the ratio of wild-type to mutant (WT:MU) IKBKAP transcript in EBV-transformed lymphoblast lines, primary fibroblasts, freshly collected blood samples, and postmortem tissues from patients with FD. We consistently found that WT IKBKAP transcripts were present, albeit to varying extents, in all cell lines, blood, and postmortem FD tissues. Further, a corresponding decrease in the level of WT protein is seen in FD cell lines and tissues. The WT:MU ratio in cultured lymphoblasts varied with growth phase but not with serum concentration or inclusion of antibiotics. Using both densitometry and real-time quantitative polymerase chain reaction, we found that relative WT:MU IKBKAP RNA levels were highest in cultured patient lymphoblasts and lowest in postmortem central and peripheral nervous tissues. These observations suggest that the relative inefficiency of WT IKBKAP mRNA production from the mutant alleles in the nervous system underlies the selective degeneration of sensory and autonomic neurons in FD.Therefore, exploration of methods to increase the WT:MU IKBKAP transcript ratio in the nervous system offers a promising approach for developing an effective therapy for patients with FD. PMID:12577200

Word skipping: effects of word length, predictability, spelling and reading skill.

PubMed

Slattery, Timothy J; Yates, Mark

2017-08-31

Readers eyes often skip over words as they read. Skipping rates are largely determined by word length; short words are skipped more than long words. However, the predictability of a word in context also impacts skipping rates. Rayner, Slattery, Drieghe and Liversedge (2011) reported an effect of predictability on word skipping for even long words (10-13 characters) that extend beyond the word identification span. Recent research suggests that better readers and spellers have an enhanced perceptual span (Veldre & Andrews, 2014). We explored whether reading and spelling skill interact with word length and predictability to impact word skipping rates in a large sample (N=92) of average and poor adult readers. Participants read the items from Rayner et al. (2011) while their eye movements were recorded. Spelling skill (zSpell) was assessed using the dictation and recognition tasks developed by Sally Andrews and colleagues. Reading skill (zRead) was assessed from reading speed (words per minute) and accuracy of three 120 word passages each with 10 comprehension questions. We fit linear mixed models to the target gaze duration data and generalized linear mixed models to the target word skipping data. Target word gaze durations were significantly predicted by zRead while, the skipping likelihoods were significantly predicted by zSpell. Additionally, for gaze durations, zRead significantly interacted with word predictability as better readers relied less on context to support word processing. These effects are discussed in relation to the lexical quality hypothesis and eye movement models of reading.

Control of calcitonin/calcitonin gene-related peptide pre-mRNA processing by constitutive intron and exon elements.

PubMed Central

Yeakley, J M; Hedjran, F; Morfin, J P; Merillat, N; Rosenfeld, M G; Emeson, R B

1993-01-01

The calcitonin/calcitonin gene-related peptide (CGRP) primary transcript is alternatively spliced in thyroid C cells and neurons, resulting in the tissue-specific production of calcitonin and CGRP mRNAs. Analyses of mutated calcitonin/CGRP transcription units in permanently transfected cell lines have indicated that alternative splicing is regulated by a differential capacity to utilize the calcitonin-specific splice acceptor. The analysis of an extensive series of mutations suggests that tissue-specific regulation of calcitonin mRNA production does not depend on the presence of a single, unique cis-active element but instead appears to be a consequence of suboptimal constitutive splicing signals. While only those mutations that altered constitutive splicing signals affected splice choices, the action of multiple regulatory sequences cannot be formally excluded. Further, we have identified a 13-nucleotide purine-rich element from a constitutive exon that, when placed in exon 4, entirely switches splice site usage in CGRP-producing cells. These data suggest that specific exon recruitment sequences, in combination with other constitutive elements, serve an important function in exon recognition. These results are consistent with the hypothesis that tissue-specific alternative splicing of the calcitonin/CGRP primary transcript is mediated by cell-specific differences in components of the constitutive splicing machinery. Images PMID:8413203

Interactive web-based identification and visualization of transcript shared sequences.

PubMed

Azhir, Alaleh; Merino, Louis-Henri; Nauen, David W

2018-05-12

We have developed TraC (Transcript Consensus), a web-based tool for detecting and visualizing shared sequences among two or more mRNA transcripts such as splice variants. Results including exon-exon boundaries are returned in a highly intuitive, data-rich, interactive plot that permits users to explore the similarities and differences of multiple transcript sequences. The online tool (http://labs.pathology.jhu.edu/nauen/trac/) is free to use. The source code is freely available for download (https://github.com/nauenlab/TraC). Copyright © 2018 Elsevier Inc. All rights reserved.

Organization and alternative splicing of the Caenorhabditis elegans cAMP-dependent protein kinase catalytic-subunit gene (kin-1).

PubMed

Tabish, M; Clegg, R A; Rees, H H; Fisher, M J

1999-04-01

The cAMP-dependent protein kinase (protein kinase A, PK-A) is multifunctional in nature, with key roles in the control of diverse aspects of eukaryotic cellular activity. In the case of the free-living nematode, Caenorhabditis elegans, a gene encoding the PK-A catalytic subunit has been identified and two isoforms of this subunit, arising from a C-terminal alternative-splicing event, have been characterized [Gross, Bagchi, Lu and Rubin (1990) J. Biol. Chem. 265, 6896-6907]. Here we report the occurrence of N-terminal alternative-splicing events that, in addition to generating a multiplicity of non-myristoylatable isoforms, also generate the myristoylated variant(s) of the catalytic subunit that we have recently characterized [Aspbury, Fisher, Rees and Clegg (1997) Biochem. Biophys. Res. Commun. 238, 523-527]. The gene spans more than 36 kb and is divided into a total of 13 exons. Each of the mature transcripts contains only 7 exons. In addition to the already characterized exon 1, the 5'-untranslated region and first intron actually contain 5 other exons, any one of which may be alternatively spliced on to exon 2 at the 5' end of the pre-mRNA. This N-terminal alternative splicing occurs in combination with either of the already characterized C-terminal alternative exons. Thus, C. elegans expresses at least 12 different isoforms of the catalytic subunit of PK-A. The significance of this unprecedented structural diversity in the family of PK-A catalytic subunits is discussed.

Characterization and mapping of the mouse NDP (Norrie disease) locus (Ndp).

PubMed

Battinelli, E M; Boyd, Y; Craig, I W; Breakefield, X O; Chen, Z Y

1996-02-01

Norrie disease is a severe X-linked recessive neurological disorder characterized by congenital blindness with progressive loss of hearing. Over half of Norrie patients also manifest different degrees of mental retardation. The gene for Norrie disease (NDP) has recently been cloned and characterized. With the human NDP cDNA, mouse genomic phage libraries were screened for the homolog of the gene. Comparison between mouse and human genomic DNA blots hybridized with the NDP cDNA, as well as analysis of phage clones, shows that the mouse NDP gene is 29 kb in size (28 kb for the human gene). The organization in the two species is very similar. Both have three exons with similar-sized introns and identical exon-intron boundaries between exon 2 and 3. The mouse open reading frame is 393 bp and, like the human coding sequence, is encoded in exons 2 and 3. The absence of six nucleotides in the second mouse exon results in the encoded protein being two amino acids smaller than its human counterpart. The overall homology between the human and mouse NDP protein is 95% and is particularly high (99%) in exon 3, consistent with the apparent functional importance of this region. Analysis of transcription initiation sites suggests the presence of multiple start sites associated with expression of the mouse NDP gene. Pedigree analysis of an interspecific mouse backcross localizes the mouse NDP gene close to Maoa in the conserved segment, which runs from CYBB to PFC in both human and mouse.

Gaucher disease: molecular heterogeneity and phenotype-genotype correlations.

PubMed

Theophilus, B; Latham, T; Grabowski, G A; Smith, F I

1989-08-01

Gaucher disease (GD) is the most prevalent lysosomal storage disease. This autosomal recessive trait results from the defective activity of acid beta-glucosidase (beta-Glc). Four different exonic point mutations have been identified as causal alleles for GD. To facilitate screening for these alleles, assays were developed using allele-specific oligonucleotide hybridization to amplified genomic DNA sequences. Specifically, intron bases flanking exons 5, 9, and 10 were determined, and conditions for PCR amplification of these exons were obtained. Two different procedures were developed to distinguish signals obtained from the structural beta-Glc gene exons and those from the pseudogene. These procedures were used to determine the distribution of all known GD alleles in a population of 44 affected patients of varying phenotypes and ethnicity. The high frequency of one of the exon 9 mutations in Ashkenazi Jewish GD type 1 patients was confirmed, and, in addition, this mutation was present in ethnically diverse non-Jewish type 1 GD patients. Homozygotes (N = 5) for this allele were midly affected older individuals, and this mutant allele was not found in any patient with neuronopathic disease. The exon 10 mutation was confirmed as the predominant allele in types 2 and 3 GD. However, several type 1 GD patients, including one of Ashkenazi-Jewish heritage, also were heterozygous for this allele. The presence of this allele in type 1 patients did not correlate with the severity of clinical symptoms. The second exon 9 mutation and the exon 5 mutation were rare, since they occurred only heterozygously either in one type 2 GD patient or in two related Ashkenazi-Jewish GD patients, respectively. Although most GD patients (38 of 44) had at least one of the known mutant alleles, 57% were heterozygotes for only one of these mutations. Fourteen percent of patients were negative for all mutations. A total of 73% of GD patients had at least one unknown allele. The varying clinical phenotypes and ethnic origins of these incompletely characterized patients suggest that multiple other GD alleles exist.

Skip residues modulate the structural properties of the myosin rod and guide thick filament assembly

DOE PAGES

Taylor, Keenan C.; Buvoli, Massimo; Korkmaz, Elif Nihal; ...

2015-07-06

The rod of sarcomeric myosins directs thick filament assembly and is characterized by the insertion of four skip residues that introduce discontinuities in the coiled-coil heptad repeats. We report in this paper that the regions surrounding the first three skip residues share high structural similarity despite their low sequence homology. Near each of these skip residues, the coiled-coil transitions to a nonclose-packed structure inducing local relaxation of the superhelical pitch. Moreover, molecular dynamics suggest that these distorted regions can assume different conformationally stable states. In contrast, the last skip residue region constitutes a true molecular hinge, providing C-terminal rod flexibility.more » Assembly of myosin with mutated skip residues in cardiomyocytes shows that the functional importance of each skip residue is associated with rod position and reveals the unique role of the molecular hinge in promoting myosin antiparallel packing. By defining the biophysical properties of the rod, the structures and molecular dynamic calculations presented here provide insight into thick filament formation, and highlight the structural differences occurring between the coiled-coils of myosin and the stereotypical tropomyosin. Finally, in addition to extending our knowledge into the conformational and biological properties of coiled-coil discontinuities, the molecular characterization of the four myosin skip residues also provides a guide to modeling the effects of rod mutations causing cardiac and skeletal myopathies.« less

Ultrasonic multi-skip tomography for pipe inspection

DOE Office of Scientific and Technical Information (OSTI.GOV)

Volker, Arno; Zon, Tim van

The inspection of wall loss corrosion is difficult at pipe supports due to limited accessibility. The recently developed ultrasonic Multi-Skip screening technique is suitable for this problem. The method employs ultrasonic transducers in a pitch-catch geometry positioned on opposite sides of the pipe support. Shear waves are transmitted in the axial direction within the pipe wall, reflecting multiple times between the inner and outer surfaces before reaching the receivers. Along this path, the signals accumulate information on the integral wall thickness (e.g., via variations in travel time). The method is very sensitive in detecting the presence of wall loss, butmore » it is difficult to quantify both the extent and depth of the loss. Multi-skip tomography has been developed to reconstruct the wall thickness profile along the axial direction of the pipe. The method uses model-based full wave field inversion; this consists of a forward model for predicting the measured wave field and an iterative process that compares the predicted and measured wave fields and minimizes the differences with respect to the model parameters (i.e., the wall thickness profile). Experimental results are very encouraging. Various defects (slot and flat bottom hole) are reconstructed using the tomographic inversion. The general shape and width are well recovered. The current sizing accuracy is in the order of 1 mm.« less

A Healthy Eating Identity is Associated with Healthier Food Choice Behaviors Among U.S. Army Soldiers.

PubMed

Jayne, Julianna M; Frongillo, Edward A; Torres-McGehee, Toni M; Emerson, Dawn M; Glover, Saundra H; Blake, Christine E

2018-04-04

Promoting healthy eating among Soldiers is a priority to the Army due to the link between nutrition and performance. The Army typically uses nutrition education to encourage Soldiers to make healthier food choices with low emphasis on other psychosocial determinants of food choice behaviors. Drill Sergeant Candidates (n = 575) completed surveys assessing nutrition knowledge, eating identity type, and food choice behaviors including fruit and vegetable intake, skipping meals, and eating out frequency. In multiple linear regression models using full-information maximum likelihood estimation while controlling for race/ethnicity, education, and marital status, we examined relationships between nutrition knowledge, a healthy eating identity, and Soldiers' food choice behaviors. The study was approved by the Department of Defense and University of South Carolina's Institutional Review Boards. A healthy eating identity was positively associated with greater fruit and vegetable consumption (p < 0.05), and negatively associated with skipping meals and eating out frequency (p < 0.05). Nutrition knowledge was negatively associated with skipping meals (p < 0.05). Findings suggest that fostering a healthy eating identity may be more effective for promoting healthy food choice behaviors than nutrition education alone. Determining if various points in a Soldier's career could be leveraged to influence a healthy eating identity and behaviors could be an important strategy to improve compliance with health promotion programs.

Amitriptyline induces brain-derived neurotrophic factor (BDNF) mRNA expression through ERK-dependent modulation of multiple BDNF mRNA variants in primary cultured rat cortical astrocytes and microglia.

PubMed

Hisaoka-Nakashima, Kazue; Kajitani, Naoto; Kaneko, Masahiro; Shigetou, Takahiro; Kasai, Miho; Matsumoto, Chie; Yokoe, Toshiki; Azuma, Honami; Takebayashi, Minoru; Morioka, Norimitsu; Nakata, Yoshihiro

2016-03-01

A significant role of brain-derived neurotrophic factor (BDNF) has been previously implicated in the therapeutic effect of antidepressants. To ascertain the contribution of specific cell types in the brain that produce BDNF following antidepressant treatment, the effects of the tricyclic antidepressant amitriptyline on rat primary neuronal, astrocytic and microglial cortical cultures were examined. Amitriptyline increased the expression of BDNF mRNA in astrocytic and microglial cultures but not neuronal cultures. Antidepressants with distinct mechanisms of action, such as clomipramine, duloxetine and fluvoxamine, also increased BDNF mRNA expression in astrocytic and microglial cultures. There are multiple BDNF mRNA variants (exon I, IIA, IV and VI) expressed in astrocytes and microglia and the variant induced by antidepressants has yet to be elaborated. Treatment with antidepressants increased the expression of exon I, IV and VI in astrocyte and microglia. Clomipramine alone significantly upregulated expression of exon IIA. The amitriptyline-induced expression of both total and individual BDNF mRNA variants (exon I, IV and VI) were blocked by MEK inhibitor U0126, indicating MEK/ERK signaling is required in the expression of BDNF. These findings indicate that non-neural cells are a significant target of antidepressants and further support the contention that glial production of BDNF is crucial role in the therapeutic effect of antidepressants. The current data suggest that targeting of glial function could lead to the development of antidepressants with a truly novel mechanism of action. Copyright © 2016 Elsevier B.V. All rights reserved.

Mathematical modeling for optimizing skip-stop rail transit operation strategy using genetic algorithm.

DOT National Transportation Integrated Search

2012-03-01

"With skip-stop rail transit operation, transit agencies can reduce their operating costs and fleet size, : and passengers can experience reduced in-transit travel times without extra track and technological : improvement. However, since skip-stop op...

Characterization of porcine SKIP gene in skeletal muscle development: polymorphisms, association analysis, expression and regulation of cell growth in C2C12 cells.

PubMed

Xiong, Qi; Chai, Jin; Deng, Changyan; Jiang, Siwen; Liu, Yang; Huang, Tao; Suo, Xiaojun; Zhang, Nian; Li, Xiaofeng; Yang, Qianping; Chen, Mingxin; Zheng, Rong

2012-12-01

Skeletal muscle and kidney-enriched inositol phosphatase (SKIP) was identified as a 5'-inositol phosphatase that hydrolyzes phosphatidylinositol (3,4,5)-triphosphate (PI(3,4,5)P3) to PI(3,4)P2 and negatively regulates insulin-induced phosphatidylinositol 3-kinase signaling in skeletal muscle. In this study, two new single nucleotide polymorphisms (SNPs) in porcine SKIP introns 1 and 6 were detected. The C1092T locus in intron 1 showed significant associations with some meat traits, whereas the A17G locus in intron 6 showed significant associations with some carcass traits. Expression analysis showed that porcine SKIP is upregulated at d 65 of gestation and Meishan fetuses have higher and prolonged expression of SKIP compared to Large White at d 100 of gestation. Ectopic expression of porcine SKIP decreased insulin-induced cell proliferation and promoted serum starvation-induced cell cycle arrest in G0/G1 phase in C2C12. Our results suggest that SKIP plays a negative regulatory role in skeletal muscle development partly by preventing cell proliferation. Crown Copyright © 2012. Published by Elsevier Ltd. All rights reserved.

Gait biomechanics of skipping are substantially different than those of running.

PubMed

McDonnell, Jessica; Willson, John D; Zwetsloot, Kevin A; Houmard, Joseph; DeVita, Paul

2017-11-07

The inherit injury risk associated with high-impact exercises calls for alternative ways to achieve the benefits of aerobic exercise while minimizing excessive stresses to body tissues. Skipping presents such an alternative, incorporating double support, flight, and single support phases. We used ground reaction forces (GRFs), lower extremity joint torques and powers to compare skipping and running in 20 healthy adults. The two consecutive skipping steps on each limb differed significantly from each other, and from running. Running had the longest step length, the highest peak vertical GRF, peak knee extensor torque, and peak knee negative and positive power and negative and positive work. Skipping had the greater cadence, peak horizontal GRF, peak hip and ankle extensor torques, peak ankle negative power and work, and peak ankle positive power. The second vs first skipping step had the shorter step length, higher cadence, peak horizontal GRF, peak ankle extensor torque, and peak ankle negative power, negative work, and positive power and positive work. The first skipping step utilized predominately net negative joint work (eccentric muscle action) while the second utilized predominately net positive joint work (concentric muscle action). The skipping data further highlight the persistence of net negative work performed at the knee and net positive work performed at the ankle across locomotion gaits. Evidence of step segregation was seen in distribution of the braking and propelling impulses and net work produced across the hip, knee, and ankle joints. Skipping was substantially different than running and was temporally and spatially asymmetrical with successive foot falls partitioned into a dominant function, either braking or propelling whereas running had a single, repeated step in which both braking and propelling actions were performed equally. Copyright © 2017 Elsevier Ltd. All rights reserved.

The relationship between breakfast skipping, chronotype, and glycemic control in type 2 diabetes.

PubMed

Reutrakul, Sirimon; Hood, Megan M; Crowley, Stephanie J; Morgan, Mary K; Teodori, Marsha; Knutson, Kristen L

2014-02-01

Breakfast skipping is associated with obesity and an increased risk of type 2 diabetes. Later chronotypes, individuals who have a preference for later bed and wake times, often skip breakfast. The aim of the study was to explore the relationships among breakfast skipping, chronotype, and glycemic control in type 2 diabetes patients. We collected sleep timing and 24-h dietary recall from 194 non-shift-working type 2 diabetes patients who were being followed in outpatient clinics. Mid-sleep time on free days (MSF) was used as an indicator of chronotype. Hemoglobin A1C (HbA1C) values were obtained from medical records. Hierarchical linear regression analyses controlling for demographic, sleep, and dietary variables were computed to determine whether breakfast skipping was associated with HbA1C. Additional regression analyses were performed to test if this association was mediated by chronotype. There were 22 participants (11.3%) who self-reported missing breakfast. Breakfast skippers had significantly higher HbA1C levels, higher body mass indices (BMI), and later MSF than breakfast eaters. Breakfast skipping was significantly associated with higher HbA1C values (B = 0.108, p = 0.01), even after adjusting for age, sex, race, BMI, number of diabetes complications, insulin use, depressive symptoms, perceived sleep debt, and percentage of daily caloric intake at dinner. The relationship between breakfast skipping and HbA1C was partially mediated by chronotype. In summary, breakfast skipping is associated with a later chronotype. Later chronotype and breakfast skipping both contribute to poorer glycemic control, as indicated by higher HbA1C levels. Future studies are needed to confirm these findings and determine whether behavioral interventions targeting breakfast eating or sleep timing may improve glycemic control in patients with type 2 diabetes.

Allelic Heterogeneity at the Equine KIT Locus in Dominant White (W) Horses

PubMed Central

Haase, Bianca; Brooks, Samantha A; Schlumbaum, Angela; Azor, Pedro J; Bailey, Ernest; Alaeddine, Ferial; Mevissen, Meike; Burger, Dominik; Poncet, Pierre-André; Rieder, Stefan; Leeb, Tosso

2007-01-01

White coat color has been a highly valued trait in horses for at least 2,000 years. Dominant white (W) is one of several known depigmentation phenotypes in horses. It shows considerable phenotypic variation, ranging from ∼50% depigmented areas up to a completely white coat. In the horse, the four depigmentation phenotypes roan, sabino, tobiano, and dominant white were independently mapped to a chromosomal region on ECA 3 harboring the KIT gene. KIT plays an important role in melanoblast survival during embryonic development. We determined the sequence and genomic organization of the ∼82 kb equine KIT gene. A mutation analysis of all 21 KIT exons in white Franches-Montagnes Horses revealed a nonsense mutation in exon 15 (c.2151C>G, p.Y717X). We analyzed the KIT exons in horses characterized as dominant white from other populations and found three additional candidate causative mutations. Three almost completely white Arabians carried a different nonsense mutation in exon 4 (c.706A>T, p.K236X). Six Camarillo White Horses had a missense mutation in exon 12 (c.1805C>T, p.A602V), and five white Thoroughbreds had yet another missense mutation in exon 13 (c.1960G>A, p.G654R). Our results indicate that the dominant white color in Franches-Montagnes Horses is caused by a nonsense mutation in the KIT gene and that multiple independent mutations within this gene appear to be responsible for dominant white in several other modern horse populations. PMID:17997609

78 FR 42819 - Proposed Collection; Comment Request for Form 709

Federal Register 2010, 2011, 2012, 2013, 2014

2013-07-17

... 709, United States Gift (and Generation-Skipping Transfer) Tax Return. DATES: Written comments should....gov . SUPPLEMENTARY INFORMATION: Title: United States Gift (and Generation-Skipping Transfer) Tax... transfers subject to the gift and generation-skipping transfer taxes and to compute these taxes. The IRS...

75 FR 38179 - Proposed Collection; Comment Request for Form 709

Federal Register 2010, 2011, 2012, 2013, 2014

2010-07-01

... 709, United States Gift (and Generation-Skipping Transfer) Tax Return. DATES: Written comments should....gov . SUPPLEMENTARY INFORMATION: Title: United States Gift (and Generation-Skipping Transfer) Tax... transfers subject to the gift and generation-skipping transfer taxes and to compute these taxes. The IRS...

78 FR 46688 - Proposed Collection; Comment Request for Form 706

Federal Register 2010, 2011, 2012, 2013, 2014

2013-08-01

... 706, United States Estate (and Generation-Skipping Transfer) Tax Return. DATES: Written comments... INFORMATION: Title: United States Estate (and Generation-Skipping Transfer) Tax Return. OMB Number: 1545-0015... imposed by Internal Revenue Code section 2001 and the Federal generation-skipping transfer (GST) tax...

Eye movements and word skipping during reading: Effects of word length and predictability

PubMed Central

Rayner, Keith; Slattery, Timothy J.; Drieghe, Denis; Liversedge, Simon P.

2012-01-01

The extent to which target words were predictable from prior context was varied: half of the target words were predictable and the other half were unpredictable. In addition, the length of the target word varied: the target words were short (4–6 letters), medium (7–9 letters), or long (10–12 letters). Length and predictability both yielded strong effects on the probability of skipping the target words and on the amount of time readers fixated the target words (when they were not skipped). However, there was no interaction in any of the measures examined for either skipping or fixation time. The results demonstrate that word predictability (due to contextual constraint) and word length have strong and independent influences on word skipping and fixation durations. Furthermore, since the long words extended beyond the word identification span, the data indicate that skipping can occur on the basis of partial information in relation to word identity. PMID:21463086

26 CFR 26.2612-1 - Definitions.

Code of Federal Regulations, 2013 CFR

2013-04-01

... GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2612-1 Definitions. (a... person. Only one direct skip occurs when a single transfer of property skips two or more generations. See... termination is a taxable termination with respect to the distributed property. (3) Simultaneous terminations...

26 CFR 26.2612-1 - Definitions.

Code of Federal Regulations, 2014 CFR

2014-04-01

... GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2612-1 Definitions. (a... person. Only one direct skip occurs when a single transfer of property skips two or more generations. See... termination is a taxable termination with respect to the distributed property. (3) Simultaneous terminations...

The Timing of Grade Skipping

ERIC Educational Resources Information Center

Kuo, Yi-Lung; Lohman, David F.

2011-01-01

The purposes of this study were to investigate the following: (a) the impact of sex, ethnicity, socioeconomic status, and family income on the likelihood of whole-grade skipping between kindergarten and Grade 7 and (b) the effects of grade skipping during elementary or middle school on students' academic achievement in high school. The authors…

1999 Survey of Active Duty Personnel: Administration, Datasets, and Codebook. Appendix G: Frequency and Percentage Distributions for Variables in the Survey Analysis Files.

DTIC Science & Technology

2000-12-01

A SKIP FLAG INDICATING THE RESULT OF CHECKING THE RESPONSE ON THE PARENT (SCREENING) ITEM AGAINST THE RESPONSE(S) ON THE ITEMS WITHIN THE SKIP...RESPONSE ON THE PARENT (SCREENING) ITEM AGAINST THE RESPONSE(S) ON THE ITEMS WITHIN THE SKIP PATTERN. SEE TABLE D-5, NOTE 2, IN APPENDIX D. G-52...RESULT OF CHECKING THE RESPONSE ON THE PARENT (SCREENING) ITEM AGAINST THE RESPONSE(S) ON THE ITEMS WITHIN THE SKIP PATTERN. SEE TABLE D-5

Dramatic intracranial response to osimertinib in a poor performance status patient with lung adenocarcinoma harboring the epidermal growth factor receptor T790M mutation: A case report.

PubMed

Uemura, Takehiro; Oguri, Tetsuya; Okayama, Minami; Furuta, Hiromi; Kanemitsu, Yoshihiro; Takakuwa, Osamu; Ohkubo, Hirotsugu; Takemura, Masaya; Maeno, Ken; Ito, Yutaka; Niimi, Akio

2017-04-01

We herein report a case of dramatic intracranial response to osimertinib in a poor performance status patient with lung adenocarcinoma harboring the epidermal growth factor receptor ( EGFR ) T790M mutation encoded in exon 20. The patient was a 59-year-old woman with EGFR exon 19 deletion-positive lung adenocarcinoma, who relapsed with multiple brain metastases. Computed tomography-guided biopsy of the left pleural tumor revealed adenocarcinoma harboring an EGFR exon 19 deletion and an EGFR T790M mutation encoded in exon 20. The patient was treated with osimertinib, a third-generation EGFR tyrosine kinase inhibitor. Two days after treatment initiation, the patient displayed profound disturbance of consciousness, possibly due to carcinomatous meningitis, and treatment had to be discontinued due to difficulty in taking osimertinib. However, the patient gradually started to recover consciousness and, after 3 days, she was again able to take osimertinib. One month after the initiation of osimertinib treatment, magnetic resonance imaging revealed an apparent reduction in brain metastases. The patient is currently under continued treatment with osimertinib. At the last follow-up (February, 2017) she exhibited partial response to the treatment.

Mutation in an alternative transcript of CDKL5 in a boy with early-onset seizures.

PubMed

Bodian, Dale L; Schreiber, John M; Vilboux, Thierry; Khromykh, Alina; Hauser, Natalie S

2018-06-01

Infantile-onset epilepsies are a set of severe, heterogeneous disorders for which clinical genetic testing yields causative mutations in ∼20%-50% of affected individuals. We report the case of a boy presenting with intractable seizures at 2 wk of age, for whom gene panel testing was unrevealing. Research-based whole-genome sequencing of the proband and four unaffected family members identified a de novo mutation, NM_001323289.1:c.2828_2829delGA in CDKL5, a gene associated with X-linked early infantile epileptic encephalopathy 2. CDKL5 has multiple alternative transcripts, and the mutation lies in an exon in the brain-expressed forms. The mutation was undetected by gene panel sequencing because of its intronic location in the CDKL5 transcript typically used to define the exons of this gene for clinical exon-based tests (NM_003159). This is the first report of a patient with a mutation in an alternative transcript of CDKL5 This finding suggests that incorporating alternative transcripts into the design and variant interpretation of exon-based tests, including gene panel and exome sequencing, could improve the diagnostic yield. © 2018 Bodian et al.; Published by Cold Spring Harbor Laboratory Press.

Mutation in an alternative transcript of CDKL5 in a boy with early-onset seizures

PubMed Central

Bodian, Dale L.; Schreiber, John M.; Vilboux, Thierry; Khromykh, Alina; Hauser, Natalie S.

2018-01-01

Infantile-onset epilepsies are a set of severe, heterogeneous disorders for which clinical genetic testing yields causative mutations in ∼20%–50% of affected individuals. We report the case of a boy presenting with intractable seizures at 2 wk of age, for whom gene panel testing was unrevealing. Research-based whole-genome sequencing of the proband and four unaffected family members identified a de novo mutation, NM_001323289.1:c.2828_2829delGA in CDKL5, a gene associated with X-linked early infantile epileptic encephalopathy 2. CDKL5 has multiple alternative transcripts, and the mutation lies in an exon in the brain-expressed forms. The mutation was undetected by gene panel sequencing because of its intronic location in the CDKL5 transcript typically used to define the exons of this gene for clinical exon-based tests (NM_003159). This is the first report of a patient with a mutation in an alternative transcript of CDKL5. This finding suggests that incorporating alternative transcripts into the design and variant interpretation of exon-based tests, including gene panel and exome sequencing, could improve the diagnostic yield. PMID:29444904

Alternative splicing by participation of the group II intron ORF in extremely halotolerant and alkaliphilic Oceanobacillus iheyensis.

PubMed

Chee, Gab-Joo; Takami, Hideto

2011-01-01

Group II introns inserted into genes often undergo splicing at unexpected sites, and participate in the transcription of host genes. We identified five copies of a group II intron, designated Oi.Int, in the genome of an extremely halotolerant and alkaliphilic bacillus, Oceanobacillus iheyensis. The Oi.Int4 differs from the Oi.Int3 at four bases. The ligated exons of the Oi.Int4 could not be detected by RT-PCR assays in vivo or in vitro although group II introns can generally self-splice in vitro without the involvement of an intron-encoded open reading frame (ORF). In the Oi.Int4 mutants with base substitutions within the ORF, ligated exons were detected by in vitro self-splicing. It was clear that the ligation of exons during splicing is affected by the sequence of the intron-encoded ORF since the splice sites corresponded to the joining sites of the intron. In addition, the mutant introns showed unexpected multiple products with alternative 5' splice sites. These findings imply that alternative 5' splicing which causes a functional change of ligated exons presumably has influenced past adaptations of O. iheyensis to various environmental changes.

SKIPing With Head Start Teachers: Influence of T-SKIP on Object-Control Skills.

PubMed

Brian, Ali; Goodway, Jacqueline D; Logan, Jessica A; Sutherland, Sue

2017-12-01

Children from disadvantaged settings are at risk for delays in their object-control (OC) skills. Fundamental motor skill interventions, such as the Successful Kinesthetic Instruction for Preschoolers (SKIP) Program, are highly successful when led by motor development experts. However, few preschools employ such experts. This study examined the extent to which Head Start teachers delivering an 8-week teacher-led SKIP (T-SKIP) intervention elicited learning of OC skills for Head Start children. Head Start teachers (n = 5) delivered T-SKIP for 8 weeks (450 min). Control teachers (n = 5) implemented the typical standard of practice, or well-equipped free play. All children (N = 122) were pretested and posttested on the OC Skill subscale of the Test of Gross Motor Development-2. Descriptive analyses at pretest identified 81% of the children were developmentally delayed in OC skills (below the 30th percentile). A 2-level hierarchical linear model demonstrated the effectiveness of T-SKIP with significant differences (β = 4.70), t(8) = 7.02, p < .001, η2 = .56, between T-SKIP children (n = 63) and control children (n = 59) at posttest. Head Start teachers who delivered T-SKIP could bring about positive changes in children's OC skills, thereby remediating the initial developmental delays presented. Control children remained delayed in their OC skills in spite of daily well-equipped free play, giving rise to concerns about their future motor competence and physical activity levels.

Association of polymorphisms in genes of factors involved in regulation of splicing of cystic fibrosis transmembrane conductance regulator mRNA with acute respiratory distress syndrome in children with pneumonia.

PubMed

Perez-Marques, Francesca; Simpson, Pippa; Yan, Ke; Quasney, Michael W; Halligan, Nadine; Merchant, Daniel; Dahmer, Mary K

2016-09-05

Previous work has demonstrated a strong association between lung injury in African American children with pneumonia and a polymorphic (TG)mTn region in cystic fibrosis transmembrane conductance (CFTR) involved in the generation of a nonfunctional CFTR protein lacking exon 9. A number of splicing factors that regulate the inclusion/exclusion of exon 9 have been identified. The objective of this study was to determine whether genetic variants in these splicing factors were associated with acute respiratory distress syndrome (ARDS) in children with pneumonia. This is a prospective cohort genetic association study of lung injury in African American and non-Hispanic Caucasian children with community-acquired pneumonia evaluated in the emergency department or admitted to the hospital. Linkage-disequilibrium-tag single nucleotide polymorphisms (LD-tag SNPs) in genes of the following splicing factors (followed by gene name) involved in exon 9 skipping PTB1 (PTBP1), SRp40 (SFRS1), SR2/ASF (SFRS5), TDP-43 (TARDBP), TIA-1 (TIA1), and U2AF(65) (U2AF2) were genotyped. SNPs in the gene of the splicing factor CELF2 (CELF2) were selected by conservation score. Multivariable analysis was used to examine association between genotypes and ARDS. The African American cohort (n = 474) had 29 children with ARDS and the non-Hispanic Caucasian cohort (n = 304) had 32 children with ARDS. In the African American group multivariable analysis indicated that three variants in CELF2, rs7068124 (p = 0.004), rs3814634 (p = 0.032) and rs10905928 (p = 0.044), and two in TIA1, rs2592178 (p = 0.005) and rs13402990 (p = 0.018) were independently associated with ARDS. In the non-Hispanic Caucasian group, a single variant in CELF2, rs2277212 (p = 0.014), was associated with increased risk of developing ARDS. The data indicate that SNPs in CELF2 may be associated with the risk of developing ARDS in both African American and non-Hispanic Caucasian children with pneumonia and suggest that the potential role of the splicing factor CELF2 in ARDS should be explored further.

26 CFR 26.2632-1 - Allocation of GST exemption.

Code of Federal Regulations, 2011 CFR

2011-04-01

... AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2632... United States Gift (and Generation-Skipping Transfer) Tax Return (Form 709) the transfer and the extent... generation-skipping potential, the initial allocation under paragraph (b)(4)(ii)(A)(1)(i) of this section is...

26 CFR 26.2632-1 - Allocation of GST exemption.

Code of Federal Regulations, 2014 CFR

2014-04-01

... AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2632... United States Gift (and Generation-Skipping Transfer) Tax Return (Form 709) the transfer and the extent... generation-skipping potential, the initial allocation under paragraph (b)(4)(ii)(A)(1)(i) of this section is...

26 CFR 26.2632-1 - Allocation of GST exemption.

Code of Federal Regulations, 2013 CFR

2013-04-01

... AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2632... United States Gift (and Generation-Skipping Transfer) Tax Return (Form 709) the transfer and the extent... generation-skipping potential, the initial allocation under paragraph (b)(4)(ii)(A)(1)(i) of this section is...

26 CFR 26.2632-1 - Allocation of GST exemption.

Code of Federal Regulations, 2012 CFR

2012-04-01

... AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2632... United States Gift (and Generation-Skipping Transfer) Tax Return (Form 709) the transfer and the extent... generation-skipping potential, the initial allocation under paragraph (b)(4)(ii)(A)(1)(i) of this section is...

26 CFR 26.6081-1 - Automatic extension of time for filing generation-skipping transfer tax returns.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 26 Internal Revenue 14 2011-04-01 2010-04-01 true Automatic extension of time for filing generation-skipping transfer tax returns. 26.6081-1 Section 26.6081-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX...

26 CFR 26.6081-1 - Automatic extension of time for filing generation-skipping transfer tax returns.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 26 Internal Revenue 14 2010-04-01 2010-04-01 false Automatic extension of time for filing generation-skipping transfer tax returns. 26.6081-1 Section 26.6081-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX...

26 CFR 26.6081-1 - Automatic extension of time for filing generation-skipping transfer tax returns.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 26 Internal Revenue 14 2013-04-01 2013-04-01 false Automatic extension of time for filing generation-skipping transfer tax returns. 26.6081-1 Section 26.6081-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX...

26 CFR 26.6081-1 - Automatic extension of time for filing generation-skipping transfer tax returns.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 26 Internal Revenue 14 2014-04-01 2013-04-01 true Automatic extension of time for filing generation-skipping transfer tax returns. 26.6081-1 Section 26.6081-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX...

26 CFR 26.6081-1 - Automatic extension of time for filing generation-skipping transfer tax returns.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 26 Internal Revenue 14 2012-04-01 2012-04-01 false Automatic extension of time for filing generation-skipping transfer tax returns. 26.6081-1 Section 26.6081-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX...

Spinal Neurofibromatosis without Café-au-Lait Macules in Two Families with Null Mutations of the NF1 Gene

PubMed Central

Kaufmann, Dieter; Müller, Ralf; Bartelt, Britta; Wolf, Michael; Kunzi-Rapp, Karin; Hanemann, Clemens Oliver; Fahsold, Raimund; Hein, Christian; Vogel, Walther; Assum, Günter

2001-01-01

Spinal neurofibromatosis (SNF) is considered to be an alternative form of neurofibromatosis, showing multiple spinal tumors and café-au-lait macules. Involvement of the neurofibromatosis type 1 (NF1) locus has been demonstrated, by linkage analysis, for three families with SNF. In one of them, a cosegregating frameshift mutation in exon 46 of the NF1 gene was identified. In the present study, we report four individuals from two families who carry NF1 null mutations that would be expected to cause NF1. Three patients have multiple spinal tumors and no café-au-lait macules, and the fourth has no clinical signs of NF1. In the first family, a missense mutation (Leu2067Pro) in NF1 exon 33 was found, and, in the second, a splice-site mutation (IVS31-5A→G) enlarging exon 32 by 4 bp at the 5′ end was found. The latter mutation has also been observed in an unrelated patient with classical NF1. Both NF1 mutations cause a reduction in neurofibromin of ∼50%, with no truncated protein present in the cells. This demonstrates that typical NF1 null mutations can result in a phenotype that is distinct from classical NF1, showing only a small spectrum of the NF1 symptoms, such as multiple spinal tumors, but not completely fitting the current clinical criteria for SNF. We speculate that this phenotype is caused by an unknown modifying gene that compensates for some, but not all, of the effects caused by neurofibromin deficiency. PMID:11704931

One Way to Design a Valence-Skip Compound.

PubMed

Hase, I; Yanagisawa, T; Kawashima, K

2017-12-01

Valence-skip compound is a good candidate with high T c and low anisotropy because it has a large attractive interaction at the site of valence-skip atom. However, it is not easy to synthesize such compound because of (i) the instability of the skipping valence state, (ii) the competing charge order, and (iii) that formal valence may not be true in some compounds. In the present study, we show several examples of the valence-skip compounds and discuss how we can design them by first principles calculations. Furthermore, we calculated the electronic structure of a promising candidate of valence skipping compound RbTlCl 3 from first principles. We confirmed that the charge-density wave (CDW) is formed in this compound, and the Tl atoms in two crystallographic different sites take the valence Tl 1+ and Tl 3+ . Structure optimization study reveals that this CDW is stable at the ambient pressure, while this CDW gap can be collapsed when we apply pressure with several gigapascals. In this metallic phase, we can expect a large charge fluctuation and a large electron-phonon interaction.

Accurate predictor-corrector skip entry guidance for low lift-to-drag ratio spacecraft

NASA Astrophysics Data System (ADS)

Enmi, Y.; Qian, W.; He, K.; Di, D.

2018-06-01

This paper develops numerical predictor-corrector skip en try guidance for vehicles with low lift-to-drag L/D ratio during the skip entry phase of a Moon return mission. The guidance method is composed of two parts: trajectory planning before entry and closed-loop gu idance during skip entry. The result of trajectory planning before entry is able to present an initial value for predictor-corrector algorithm in closed-loop guidance for fast convergence. The magnitude of bank angle, which is parameterized as a linear function of the range-to-go, is modulated to satisfy the downrange requirements. The sign of the bank ang le is determined by the bank-reversal logic. The predictor-corrector algorithm repeatedly applied onboard in each guidance cycle to realize closed-loop guidance in the skip entry phase. The effectivity of the proposed guidance is validated by simulations in nominal conditions, including skip entry, loft entry, and direct entry, as well as simulations in dispersion conditions considering the combination disturbance of the entry interface, the aerodynamic coefficients, the air density, and the mass of the vehicle.

Breakfast Skipping, Extreme Commutes, and the Sex Composition at Birth.

PubMed

Mazumder, Bhashkar; Seeskin, Zachary

2015-01-01

A growing body of literature has shown that environmental exposures in the period around conception can affect the sex ratio at birth through selective attrition that favors the survival of female conceptuses. Glucose availability is considered a key indicator of the fetal environment, and its absence as a result of meal skipping may inhibit male survival. We hypothesize that breakfast skipping during pregnancy may lead to a reduction in the fraction of male births. Using time use data from the United States we show that women with commute times of 90 minutes or longer are 20 percentage points more likely to skip breakfast. Using U.S. census data we show that women with commute times of 90 minutes or longer are 1.2 percentage points less likely to have a male child under the age of 2. Under some assumptions, this implies that routinely skipping breakfast around the time of conception leads to a 6 percentage point reduction in the probability of a male child. Skipping breakfast during pregnancy may therefore constitute a poor environment for fetal health more generally.

Potent inhibition of angiotensin AT1 receptor signaling by RGS8: importance of the C-terminal third exon part of its RGS domain.

PubMed

Song, Dan; Nishiyama, Mariko; Kimura, Sadao

2016-10-01

R4/B subfamily RGS (regulator of G protein signaling) proteins play roles in regulation of many GPCR-mediated responses. Multiple RGS proteins are usually expressed in a cell, and it is difficult to point out which RGS protein species are functionally important in the cell. To evaluate intrinsic potency of these RGS proteins, we compared inhibitory effects of RGS1, RGS2, RGS3, RGS4, RGS5, RGS8 and RGS16 on AT1 receptor signaling. Intracellular Ca(2+) responses to angiotensin II were markedly attenuated by transiently expressed RGS2, RGS3 and RGS8, compared to weak inhibition by RGS1, RGS4, RGS5 and RGS16. N-terminally deleted RGS2 (RGS2 domain) lost this potent inhibitory effect, whereas RGS domains of RGS3 and RGS8 showed strong inhibition similar to those of the full-length proteins. To investigate key determinants that specify the differences in potency, we constructed chimeric domains by replacing one or two of three exon parts of RGS8 domain with the corresponding part of RGS5. The chimeric RGS8 domains containing the first or the second exon part of RGS5 showed strong inhibitory effects similar to that of wild type RGS8, but the chimeric domain with the third exon part of RGS5 lost its activity. On the contrary, replacement of the third exon part of RGS5 with the corresponding residues of RGS8 increased the inhibitory effect. The role of the third exon part of RGS8 domain was further confirmed with the chimeric RGS8/RGS4 domains. These results indicate the potent inhibitory activity of RGS8 among R4/B subfamily proteins and importance of the third exon.

ATRX binds to atypical chromatin domains at the 3′ exons of zinc finger genes to preserve H3K9me3 enrichment

PubMed Central

Chowdhury, Asif H.; Hasson, Dan; Dyer, Michael A.

2016-01-01

ABSTRACT ATRX is a SWI/SNF chromatin remodeler proposed to govern genomic stability through the regulation of repetitive sequences, such as rDNA, retrotransposons, and pericentromeric and telomeric repeats. However, few direct ATRX target genes have been identified and high-throughput genomic approaches are currently lacking for ATRX. Here we present a comprehensive ChIP-sequencing study of ATRX in multiple human cell lines, in which we identify the 3′ exons of zinc finger genes (ZNFs) as a new class of ATRX targets. These 3′ exonic regions encode the zinc finger motifs, which can range from 1–40 copies per ZNF gene and share large stretches of sequence similarity. These regions often contain an atypical chromatin signature: they are transcriptionally active, contain high levels of H3K36me3, and are paradoxically enriched in H3K9me3. We find that these ZNF 3′ exons are co-occupied by SETDB1, TRIM28, and ZNF274, which form a complex with ATRX. CRISPR/Cas9-mediated loss-of-function studies demonstrate (i) a reduction of H3K9me3 at the ZNF 3′ exons in the absence of ATRX and ZNF274 and, (ii) H3K9me3 levels at atypical chromatin regions are particularly sensitive to ATRX loss compared to other H3K9me3-occupied regions. As a consequence of ATRX or ZNF274 depletion, cells with reduced levels of H3K9me3 show increased levels of DNA damage, suggesting that ATRX binds to the 3′ exons of ZNFs to maintain their genomic stability through preservation of H3K9me3. PMID:27029610

SNP discovery in candidate adaptive genes using exon capture in a free-ranging alpine ungulate

USGS Publications Warehouse

Roffler, Gretchen H.; Amish, Stephen J.; Smith, Seth; Cosart, Ted F.; Kardos, Marty; Schwartz, Michael K.; Luikart, Gordon

2016-01-01

Identification of genes underlying genomic signatures of natural selection is key to understanding adaptation to local conditions. We used targeted resequencing to identify SNP markers in 5321 candidate adaptive genes associated with known immunological, metabolic and growth functions in ovids and other ungulates. We selectively targeted 8161 exons in protein-coding and nearby 5′ and 3′ untranslated regions of chosen candidate genes. Targeted sequences were taken from bighorn sheep (Ovis canadensis) exon capture data and directly from the domestic sheep genome (Ovis aries v. 3; oviAri3). The bighorn sheep sequences used in the Dall's sheep (Ovis dalli dalli) exon capture aligned to 2350 genes on the oviAri3 genome with an average of 2 exons each. We developed a microfluidic qPCR-based SNP chip to genotype 476 Dall's sheep from locations across their range and test for patterns of selection. Using multiple corroborating approaches (lositan and bayescan), we detected 28 SNP loci potentially under selection. We additionally identified candidate loci significantly associated with latitude, longitude, precipitation and temperature, suggesting local environmental adaptation. The three methods demonstrated consistent support for natural selection on nine genes with immune and disease-regulating functions (e.g. Ovar-DRA, APC, BATF2, MAGEB18), cell regulation signalling pathways (e.g. KRIT1, PI3K, ORRC3), and respiratory health (CYSLTR1). Characterizing adaptive allele distributions from novel genetic techniques will facilitate investigation of the influence of environmental variation on local adaptation of a northern alpine ungulate throughout its range. This research demonstrated the utility of exon capture for gene-targeted SNP discovery and subsequent SNP chip genotyping using low-quality samples in a nonmodel species.

The influence of the metastasis pattern of mediastinal lymph nodes on the postoperative radiotherapy’s efficacy for the IIIA-pN2 non-small-cell lung cancer: a retrospective analysis of 220 patients

PubMed Central

Zhang, Baozhong; Zhao, Lujun; Yuan, Zhiyong; Pang, Qingsong; Wang, Ping

2016-01-01

Objective The use of postoperative radiotherapy (PORT) remains controversial for Stage IIIA-N2 non-small-cell lung cancer (NSCLC) patients, a possible reason is that IIIA-pN2 NSCLC diseases are a heterogeneous group with different clinicopathologic features. The aim of this research was to prove whether the mediastinal lymph nodes’ (LNs) skipping status could indicate the necessity of the PORT for the pN2 NSCLC patients. Methods The skip metastasis was defined as pN0N2 (no N1 LN involved), and nonskip metastasis was pN1N2 (one or more N1 LNs involved). Patients were divided into two groups: LNs nonskip and LNs skip, and postoperative chemoradiotherapy (POCRT) and postoperative chemotherapy. Then, the LN nonskip and LN skip groups were further divided into subgroups: POCRT and point of care testing (POCT) for subgroup analysis. Results There were 220 cases included in the analysis, and 43 of them received PORT. On univariate analysis, the median 3-year progression-free survival (PFS) was, respectively, 16 months (27.7%) for the LN skip group and 11 months (15.3%) for the LN nonskip group (P=0.001). The median 3-year overall survival (OS) was, respectively, 35 months (47.0%) for the LN skip group and 27 months (38.7%) for the LN nonskip group (P=0.025). The median 3-year local recurrence-free survival (LRFS) was, respectively, 25 months (41.0%) for the LN skip group and19 months (29.9%) for the LN nonskip group (P=0.014). The median 3-year distant metastasis-free survival (DMFS) was, respectively, 22 months (32.5%) for the LN skip group and 15 months (20.4%) for the LN nonskip group (P=0.013). The median 3-year PFS was, respectively, 17 months (25.6%) for the POCRT group and 12 months (18.6%) for the POCT group (P=0.037). Although the POCRT group showed better OS, LRFS, and DMFS than the POCT group, the results showed no statistical significance. In subgroup analysis, there was no statistical significance in the Kaplan–Meier analysis between subgroups, but it showed that POCRT resulted in better PFS, OS, and DMFS in both LN skip and LN nonskip subgroups; this advantage was more obvious in the LN skip subgroup. Conclusion The LN skip status is closely related to the survival of the IIIA-N2 NSCLC disease, and the LN skip patients may get more benefit in PFS and LRFS than the LN nonskip patients from PORT. PMID:27785064

26 CFR 26.2663-2 - Application of chapter 13 to transfers by nonresidents not citizens of the United States.

Code of Federal Regulations, 2012 CFR

2012-04-01

... SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX... generation-skipping trust. Of the property transferred to the trust, property having a value of $200 is... exemption to the trust on a timely filed United States Gift (and Generation-Skipping Transfer) Tax Return...

26 CFR 26.2663-2 - Application of chapter 13 to transfers by nonresidents not citizens of the United States.

Code of Federal Regulations, 2013 CFR

2013-04-01

... SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX... generation-skipping trust. Of the property transferred to the trust, property having a value of $200 is... exemption to the trust on a timely filed United States Gift (and Generation-Skipping Transfer) Tax Return...

26 CFR 26.2663-2 - Application of chapter 13 to transfers by nonresidents not citizens of the United States.

Code of Federal Regulations, 2014 CFR

2014-04-01

... SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX... generation-skipping trust. Of the property transferred to the trust, property having a value of $200 is... exemption to the trust on a timely filed United States Gift (and Generation-Skipping Transfer) Tax Return...

26 CFR 26.2663-2 - Application of chapter 13 to transfers by nonresidents not citizens of the United States.

Code of Federal Regulations, 2011 CFR

2011-04-01

... SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX... generation-skipping trust. Of the property transferred to the trust, property having a value of $200 is... exemption to the trust on a timely filed United States Gift (and Generation-Skipping Transfer) Tax Return...

26 CFR 26.2611-1 - Generation-skipping transfer defined.

Code of Federal Regulations, 2010 CFR

2010-04-01

... AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2611... either a direct skip, a taxable distribution, or a taxable termination. See § 26.2612-1 for the definition of these terms. The determination as to whether an event is a GST is made by reference to the most...

7 CFR 42.123 - Flow diagram for skip lot sampling and inspection.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 7 Agriculture 2 2014-01-01 2014-01-01 false Flow diagram for skip lot sampling and inspection. 42.123 Section 42.123 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING... Procedures § 42.123 Flow diagram for skip lot sampling and inspection. EC02SE91.000 Notes: 1. Only normal...

7 CFR 42.123 - Flow diagram for skip lot sampling and inspection.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 7 Agriculture 2 2011-01-01 2011-01-01 false Flow diagram for skip lot sampling and inspection. 42.123 Section 42.123 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING... Procedures § 42.123 Flow diagram for skip lot sampling and inspection. EC02SE91.000 Notes: 1. Only normal...

7 CFR 42.123 - Flow diagram for skip lot sampling and inspection.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 7 Agriculture 2 2013-01-01 2013-01-01 false Flow diagram for skip lot sampling and inspection. 42.123 Section 42.123 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING... Procedures § 42.123 Flow diagram for skip lot sampling and inspection. EC02SE91.000 Notes: 1. Only normal...

7 CFR 42.123 - Flow diagram for skip lot sampling and inspection.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 7 Agriculture 2 2012-01-01 2012-01-01 false Flow diagram for skip lot sampling and inspection. 42.123 Section 42.123 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING... Procedures § 42.123 Flow diagram for skip lot sampling and inspection. EC02SE91.000 Notes: 1. Only normal...

Characterization of variegate porphyria mutations using a minigene approach.

PubMed

Granata, Barbara Xoana; Baralle, Marco; De Conti, Laura; Parera, Victoria; Rossetti, Maria Victoria

2015-01-01

Porphyrias are a group of metabolic diseases that affect the skin and/or nervous system. In 2008, three unrelated patients were diagnosed with variegate porphyria at the CIPYP (Centro de Investigaciones sobre Porfirinas y Porfirias). Sequencing of the protoporphyrinogen oxidase gene, the gene altered in this type of porphyria, revealed three previously undescribed mutations: c.338+3insT, c.807G>A, and c.808-1G>C. As these mutations do not affect the protein sequence, we hypothesized that they might be splicing mutations. RT-PCRs performed on the patient's mRNAs showed normal mRNA or no amplification at all. This result indicated that the aberrant spliced transcript is possibly being degraded. In order to establish whether they were responsible or not for the patient's disease by causing aberrant splicing, we utilized a minigene approach. We found that the three mutations lead to exon skipping; therefore, the abnormal mRNAs are most likely degraded by a mechanism such as nonsense-mediated decay. In conclusion, these mutations are responsible for the disease because they alter the normal splicing pathway, thus providing a functional explanation for the appearance of disease and highlighting the use of minigene assays to complement transcript analysis.

Antisense pre-treatment increases gene therapy efficacy in dystrophic muscles.

PubMed

Peccate, Cécile; Mollard, Amédée; Le Hir, Maëva; Julien, Laura; McClorey, Graham; Jarmin, Susan; Le Heron, Anita; Dickson, George; Benkhelifa-Ziyyat, Sofia; Piétri-Rouxel, France; Wood, Matthew J; Voit, Thomas; Lorain, Stéphanie

2016-08-15

In preclinical models for Duchenne muscular dystrophy, dystrophin restoration during adeno-associated virus (AAV)-U7-mediated exon-skipping therapy was shown to decrease drastically after six months in treated muscles. This decline in efficacy is strongly correlated with the loss of the therapeutic AAV genomes, probably due to alterations of the dystrophic myofiber membranes. To improve the membrane integrity of the dystrophic myofibers at the time of AAV-U7 injection, mdx muscles were pre-treated with a single dose of the peptide-phosphorodiamidate morpholino (PPMO) antisense oligonucleotides that induced temporary dystrophin expression at the sarcolemma. The PPMO pre-treatment allowed efficient maintenance of AAV genomes in mdx muscles and enhanced the AAV-U7 therapy effect with a ten-fold increase of the protein level after 6 months. PPMO pre-treatment was also beneficial to AAV-mediated gene therapy with transfer of micro-dystrophin cDNA into muscles. Therefore, avoiding vector genome loss after AAV injection by PPMO pre-treatment would allow efficient long-term restoration of dystrophin and the use of lower and thus safer vector doses for Duchenne patients. © The Author 2016. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Beta-ketothiolase deficiency: An unusual cause of recurrent ketoacidosis.

PubMed

Kılıç-Yıldırım, Gonca; Durmuş-Aydoğdu, Sultan; Ceylaner, Serdar; Sass, Jörn Oliver

2017-01-01

Kılıç-Yıldırım G, Durmuş-Aydoğdu S, Ceylaner S, Sass JO. Beta-ketothiolase deficiency: An unusual cause of recurrent ketoacidosis. Turk J Pediatr 2017; 59: 471-474. Beta-ketothiolase deficiency (mitochondrial acetoacetyl-CoA thiolase, MAT or T2 deficiency) is a rare autosomal recessive disorder of isoleucine and ketone body metabolism due to acetyl-CoA acetyltransferase-1 (ACAT1) gene mutations. The disease is characterized by recurrent episodes of ketoasidosis which starts with vomiting and followed by dehydration and tachypnea. Here, we present a patient who was admitted to the hospital with severe acidosis and dehydration because of vomiting induced by protein rich nutrient and was diagnosed with MAT deficiency. 3-hydroxy-butyric acid, acetoacetic acid and 3-hydroxy-iso-valeric acid levels were significantly increased and tiglyglycine as trace amount in the urine organic acid analysis of the patient. Genetic analysis for ACAT-1 showed compound heterozygosity for the mutations c.949G > A (p.D317N) and c.951C > T (p.D317D), which both are known to cause exon 10 skipping and to be pathogenic missense mutations.

PubMed Central

DE LOS ANGELES BEYTÍA, MARIA; VRY, JULIA; KIRSCHNER, JANBERND

2012-01-01

Duchenne muscular dystrophy (DMD) is a disease linked to the X-chromosome which affects 1 in 3,600-6,000 newborn males. It is manifested by the absence of the dystrophin protein in muscle fibres, which causes progressive damage leading to death in the third decade of life. The only medication so far shown to be effective in delaying the progression of this illness are corticosteroids, which have been shown to increase muscle strength in randomised controlled studies; long-term studies have demonstrated that they prolong walking time and retard the progression of respiratory dysfunction, dilated cardiomyopathy and scoliosis. Several potential drugs are now being investigated. Genetic therapy, involving the insertion of a dystrophin gene through a vector, has proven effective in animals but not humans. Currently under clinical study is Ataluren, a molecule that binds with ribosomes and may allow the insertion of an aminoacid in the premature termination codon, and exon-skipping, which binds with RNA and excludes specific sites of RNA splicing, producing a dystrophin that is smaller but functional. There are also studies attempting to modulate other muscular proteins, such as myostatin and utrophin, to reduce symptoms. This paper does not address cardiomyopathy treatment in DMD patients. PMID:22655510

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gehrmann, Thies; Pelkmans, Jordi F.; Lugones, Luis G.

Recent genome-wide studies have demonstrated that fungi possess the machinery to alternatively splice pre-mRNA. However, there has not been a systematic categorization of the functional impact of alternative splicing in a fungus. We investigate alternative splicing and its functional consequences in the model mushroom forming fungus Schizophyllum commune. Alternative splicing was demonstrated for 2,285 out of 12,988 expressed genes, resulting in 20% additional transcripts. Intron retentions were the most common alternative splicing events, accounting for 33% of all splicing events, and 43% of the events in coding regions. On the other hand, exon skipping events were rare in coding regionsmore » (1%) but enriched in UTRs where they accounted for 57% of the events. Specific functional groups, including transcription factors, contained alternatively spliced genes. Alternatively spliced transcripts were regulated differently throughout development in 19% of the 2,285 alternatively spliced genes. Notably, 69% of alternatively spliced genes have predicted alternative functionality by loss or gain of functional domains, or by acquiring alternative subcellular locations. S. commune exhibits more alternative splicing than any other studied fungus. Finally, taken together, alternative splicing increases the complexity of the S. commune proteome considerably and provides it with a rich repertoire of alternative functionality that is exploited dynamically.« less

Genetic therapeutic approaches for Duchenne muscular dystrophy.

PubMed

Foster, Helen; Popplewell, Linda; Dickson, George

2012-07-01

Despite an expansive wealth of research following the discovery of the DMD gene 25 years ago, there is still no curative treatment for Duchenne muscular dystrophy. However, there are currently many promising lines of research, including cell-based therapies and pharmacological reagents to upregulate dystrophin via readthrough of nonsense mutations or by upregulation of the dystrophin homolog utrophin. Here we review genetic-based therapeutic strategies aimed at the amelioration of the DMD phenotype. These include the reintroduction of a copy of the DMD gene into an affected tissue by means of a viral vector; correction of the mutated DMD transcript by antisense oligonucleotide-induced exon skipping to restore the open reading frame; and direct modification of the DMD gene at a chromosomal level through genome editing. All these approaches are discussed in terms of the more recent advances, and the hurdles to be overcome if a comprehensive and effective treatment for DMD is to be found. These hurdles include the need to target all musculature of the body. Therefore any potential treatment would need to be administered systemically. In addition, any treatment needs to have a long-term effect, with the possibility of readministration, while avoiding any potentially detrimental immune response to the vector or transgene.

A 76-bp deletion in the Mip gene causes autosomal dominant cataract in Hfi mice.

PubMed

Sidjanin, D J; Parker-Wilson, D M; Neuhäuser-Klaus, A; Pretsch, W; Favor, J; Deen, P M; Ohtaka-Maruyama, C; Lu, Y; Bragin, A; Skach, W R; Chepelinsky, A B; Grimes, P A; Stambolian, D E

2001-06-15

Hfi is a dominant cataract mutation where heterozygotes show hydropic lens fibers and homozygotes show total lens opacity. The Hfi locus was mapped to the distal part of mouse chromosome 10 close to the major intrinsic protein (Mip), which is expressed only in cell membranes of lens fibers. Molecular analysis of Mip revealed a 76-bp deletion that resulted in exon 2 skipping in Mip mRNA. In Hfi/Hfi this deletion resulted in a complete absence of the wildtype Mip. In contrast, Hfi/+ animals had the same amount of wildtype Mip as +/+. Results from pulse-chase expression studies excluded hetero-oligomerization of wildtype and mutant Mip as a possible mechanism for cataract formation in the Hfi/+. We propose that the cataract phenotype in the Hfi heterozygote mutant is due to a detrimental gain of function by the mutant Mip resulting in either cytotoxicity or disruption in processing of other proteins important for the lens. Cataract formation in the Hfi/Hfi mouse is probably a combined result of both the complete loss of wildtype Mip and a gain of function of the mutant Mip. Copyright 2001 Academic Press.

Clinical utility of routine MPL exon 10 analysis in the diagnosis of essential thrombocythaemia and primary myelofibrosis.

PubMed

Boyd, Elaine M; Bench, Anthony J; Goday-Fernández, Andrea; Anand, Shubha; Vaghela, Krishna J; Beer, Phillip; Scott, Mike A; Bareford, David; Green, Anthony R; Huntly, Brian; Erber, Wendy N

2010-04-01

Approximately 50% of essential thrombocythaemia and primary myelo-fibrosis patients do not have a JAK2 V617F mutation. Up to 5% of these are reported to have a MPL exon 10 mutation but testing for MPL is not routine as there are multiple mutation types. The ability to routinely assess both JAK2 and MPL mutations would be beneficial in the differential diagnosis of unexplained thrombocytosis or myelofibrosis. We developed and applied a high resolution melt (HRM) assay, capable of detecting all known MPL mutations in a single analysis, for the detection of MPL exon 10 mutations. We assessed 175 ET and PMF patients, including 67 that were JAK2 V617F-negative by real time polymerase chain reaction (PCR). Overall, 19/175 (11%) patients had a MPL exon 10 mutation, of whom 16 were JAK2 V617F-negative (16/67; 24%). MPL mutation types were W515L (11), W515K (4), W515R (2) and W515A (1). One patient had both W515L and S505N MPL mutations and these were present in the same haemopoietic colonies. Real time PCR for JAK2 V617F analysis and HRM for MPL exon 10 status identified one or more clonal marker in 71% of patients. This combined genetic approach increases the sensitivity of meeting the World Health Organization diagnostic criteria for these myeloproliferative neoplasms.

Sweets, snacking habits, and skipping meals in children and adolescents on intensive insulin treatment.

PubMed

Øverby, N C; Margeirsdottir, H D; Brunborg, C; Dahl-Jørgensen, K; Andersen, L F

2008-08-01

To examine the association between skipping meals and snacking events and dietary and clinical characteristics in children and adolescents using modern insulin treatment. Dietary intake was recorded for 4 d in food diaries in 655 young diabetic patients. Number of meals and snacking events was recorded in a separated questionnaire, while clinical data were obtained from case record forms. Skipping meals refer to consuming a main meal (e.g., breakfast) five times a week or less. Modern insulin treatment may favor a more flexible lifestyle. This study shows that there are fewer young diabetic patients who skip meals than non-diabetic controls (p < 0.001) even when using modern intensified insulin treatment. However, skipping meals among young diabetic patients was associated with negative characteristics such as having suboptimal hemoglobin A1c (HbA1c) (OR 4.7, p = 0.02), higher low-density lipoprotein (LDL) cholesterol levels (OR 4.0, p < 0.001), watching more TV (OR 3.6, p < 0.001), being overweight (OR 2.8, p = 0.03), as well as having a higher intake of added sugar (OR 2.1, p = 0.01) and lower intake of fiber (OR 0.2, p = 0.04) compared with those not skipping meals. Having more than two snacking events during the day was associated with higher HbA1c, higher intake of added sugar and sweets, and spending more hours in front of the TV or personal computer. In general, fewer children and adolescents with type 1 diabetes skip meals compared with healthy peers. Those who skip meals and have more snacking events have poorer glycemic control and less healthy dietary and leisure habits.

Elastic spheres can walk on water.

PubMed

Belden, Jesse; Hurd, Randy C; Jandron, Michael A; Bower, Allan F; Truscott, Tadd T

2016-02-04

Incited by public fascination and engineering application, water-skipping of rigid stones and spheres has received considerable study. While these objects can be coaxed to ricochet, elastic spheres demonstrate superior water-skipping ability, but little is known about the effect of large material compliance on water impact physics. Here we show that upon water impact, very compliant spheres naturally assume a disk-like geometry and dynamic orientation that are favourable for water-skipping. Experiments and numerical modelling reveal that the initial spherical shape evolves as elastic waves propagate through the material. We find that the skipping dynamics are governed by the wave propagation speed and by the ratio of material shear modulus to hydrodynamic pressure. With these insights, we explain why softer spheres skip more easily than stiffer ones. Our results advance understanding of fluid-elastic body interaction during water impact, which could benefit inflatable craft modelling and, more playfully, design of elastic aquatic toys.

Elastic spheres can walk on water

PubMed Central

Belden, Jesse; Hurd, Randy C.; Jandron, Michael A.; Bower, Allan F.; Truscott, Tadd T.

2016-01-01

Incited by public fascination and engineering application, water-skipping of rigid stones and spheres has received considerable study. While these objects can be coaxed to ricochet, elastic spheres demonstrate superior water-skipping ability, but little is known about the effect of large material compliance on water impact physics. Here we show that upon water impact, very compliant spheres naturally assume a disk-like geometry and dynamic orientation that are favourable for water-skipping. Experiments and numerical modelling reveal that the initial spherical shape evolves as elastic waves propagate through the material. We find that the skipping dynamics are governed by the wave propagation speed and by the ratio of material shear modulus to hydrodynamic pressure. With these insights, we explain why softer spheres skip more easily than stiffer ones. Our results advance understanding of fluid-elastic body interaction during water impact, which could benefit inflatable craft modelling and, more playfully, design of elastic aquatic toys. PMID:26842860

40 CFR 61.243-2 - Alternative standards for valves in VHAP service-skip period leak detection and repair.

Code of Federal Regulations, 2010 CFR

2010-07-01

... VHAP service-skip period leak detection and repair. 61.243-2 Section 61.243-2 Protection of Environment... AIR POLLUTANTS National Emission Standard for Equipment Leaks (Fugitive Emission Sources) § 61.243-2 Alternative standards for valves in VHAP service—skip period leak detection and repair. (a)(1) An owner or...

40 CFR 264.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

Code of Federal Regulations, 2010 CFR

2010-07-01

... gas/vapor service or in light liquid service: skip period leak detection and repair. 264.1062 Section... Emission Standards for Equipment Leaks § 264.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or operator subject to...

40 CFR 264.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

Code of Federal Regulations, 2011 CFR

2011-07-01

... gas/vapor service or in light liquid service: skip period leak detection and repair. 264.1062 Section... Emission Standards for Equipment Leaks § 264.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or operator subject to...

40 CFR 265.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

Code of Federal Regulations, 2014 CFR

2014-07-01

... gas/vapor service or in light liquid service: skip period leak detection and repair. 265.1062 Section... FACILITIES Air Emission Standards for Equipment Leaks § 265.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or...

40 CFR 264.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

Code of Federal Regulations, 2012 CFR

2012-07-01

... gas/vapor service or in light liquid service: skip period leak detection and repair. 264.1062 Section... Emission Standards for Equipment Leaks § 264.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or operator subject to...

40 CFR 265.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

Code of Federal Regulations, 2011 CFR

2011-07-01

... gas/vapor service or in light liquid service: skip period leak detection and repair. 265.1062 Section... FACILITIES Air Emission Standards for Equipment Leaks § 265.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or...

40 CFR 265.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

Code of Federal Regulations, 2010 CFR

2010-07-01

... gas/vapor service or in light liquid service: skip period leak detection and repair. 265.1062 Section... FACILITIES Air Emission Standards for Equipment Leaks § 265.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or...

40 CFR 264.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

Code of Federal Regulations, 2013 CFR

2013-07-01

... gas/vapor service or in light liquid service: skip period leak detection and repair. 264.1062 Section... Emission Standards for Equipment Leaks § 264.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or operator subject to...

40 CFR 265.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

Code of Federal Regulations, 2013 CFR

2013-07-01

... gas/vapor service or in light liquid service: skip period leak detection and repair. 265.1062 Section... FACILITIES Air Emission Standards for Equipment Leaks § 265.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or...

40 CFR 265.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

Code of Federal Regulations, 2012 CFR

2012-07-01

... gas/vapor service or in light liquid service: skip period leak detection and repair. 265.1062 Section... FACILITIES Air Emission Standards for Equipment Leaks § 265.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or...

40 CFR 264.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

Code of Federal Regulations, 2014 CFR

2014-07-01

... gas/vapor service or in light liquid service: skip period leak detection and repair. 264.1062 Section... Emission Standards for Equipment Leaks § 264.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or operator subject to...

New scene change control scheme based on pseudoskipped picture

NASA Astrophysics Data System (ADS)

Lee, Youngsun; Lee, Jinwhan; Chang, Hyunsik; Nam, Jae Y.

1997-01-01

A new scene change control scheme which improves the video coding performance for sequences that have many scene changed pictures is proposed in this paper. The scene changed pictures except intra-coded picture usually need more bits than normal pictures in order to maintain constant picture quality. The major idea of this paper is how to obtain extra bits which are needed to encode scene changed pictures. We encode a B picture which is located before a scene changed picture like a skipped picture. We call such a B picture as a pseudo-skipped picture. By generating the pseudo-skipped picture like a skipped picture. We call such a B picture as a pseudo-skipped picture. By generating the pseudo-skipped picture, we can save some bits and they are added to the originally allocated target bits to encode the scene changed picture. The simulation results show that the proposed algorithm improves encoding performance about 0.5 to approximately 2.0 dB of PSNR compared to MPEG-2 TM5 rate controls scheme. In addition, the suggested algorithm is compatible with MPEG-2 video syntax and the picture repetition is not recognizable.

Performance Analysis of Stop-Skipping Scheduling Plans in Rail Transit under Time-Dependent Demand

PubMed Central

Cao, Zhichao; Yuan, Zhenzhou; Zhang, Silin

2016-01-01

Stop-skipping is a key method for alleviating congestion in rail transit, where schedules are sometimes difficult to implement. Several mechanisms have been proposed and analyzed in the literature, but very few performance comparisons are available. This study formulated train choice behavior estimation into the model considering passengers’ perception. If a passenger’s train path can be identified, this information would be useful for improving the stop-skipping schedule service. Multi-performance is a key characteristic of our proposed five stop-skipping schedules, but quantified analysis can be used to illustrate the different effects of well-known deterministic and stochastic forms. Problems in the novel category of forms were justified in the context of a single line rather than transit network. We analyzed four deterministic forms based on the well-known A/B stop-skipping operating strategy. A stochastic form was innovatively modeled as a binary integer programming problem. We present a performance analysis of our proposed model to demonstrate that stop-skipping can feasibly be used to improve the service of passengers and enhance the elasticity of train operations under demand variations along with an explicit parametric discussion. PMID:27420087

Performance Analysis of Stop-Skipping Scheduling Plans in Rail Transit under Time-Dependent Demand.

PubMed

Cao, Zhichao; Yuan, Zhenzhou; Zhang, Silin

2016-07-13

Stop-skipping is a key method for alleviating congestion in rail transit, where schedules are sometimes difficult to implement. Several mechanisms have been proposed and analyzed in the literature, but very few performance comparisons are available. This study formulated train choice behavior estimation into the model considering passengers' perception. If a passenger's train path can be identified, this information would be useful for improving the stop-skipping schedule service. Multi-performance is a key characteristic of our proposed five stop-skipping schedules, but quantified analysis can be used to illustrate the different effects of well-known deterministic and stochastic forms. Problems in the novel category of forms were justified in the context of a single line rather than transit network. We analyzed four deterministic forms based on the well-known A/B stop-skipping operating strategy. A stochastic form was innovatively modeled as a binary integer programming problem. We present a performance analysis of our proposed model to demonstrate that stop-skipping can feasibly be used to improve the service of passengers and enhance the elasticity of train operations under demand variations along with an explicit parametric discussion.

Breakfast skipping as a risk correlate of overweight and obesity in school-going ethnic Fijian adolescent girls

PubMed Central

Thompson-McCormick, Jonas J; Thomas, Jennifer J; Bainivualiku, Asenaca; Khan, A Nisha; Becker, Anne E

2013-01-01

The prevalence of overweight and obesity has increased globally, and population data suggest that it is also increasing among ethnic Fijian youth. Among numerous behavioural changes contributing to overweight in youth residing in nations undergoing rapid economic and social change, meal skipping has not been examined as a potential risk factor. The study objectives were to assess the prevalence of overweight, obesity, and breakfast skipping and examine their cross-sectional association in a community sample of school-going ethnic Fijian adolescent girls (n=523). We measured height and weight, and assessed dietary patterns, eating pathology, dimensions of acculturation, and other socio-demographic and cultural data by self-report. We observed a high prevalence of both overweight (41%, including 15% who were obese) and breakfast skipping (68%). In addition, in multivariable analyses unadjusted for eating pathology, we found that more frequent breakfast skipping was associated with greater odds of overweight (odds ratio (OR)=1.15, confidence interval (CI)=1.06, 1.26, p<0.01) and obesity (OR=1.18, CI=1.05, 1.33, p<0.01). Regression models adjusting for eating pathology attenuated this relation so that it was non-significant, but demonstrated that greater eating pathology was associated with greater odds of both overweight and obesity. Future research is necessary to clarify the relation among breakfast skipping, eating pathology, and overweight in ethnic Fijian girls, and to identify whether breakfast skipping may be a modifiable risk factor for overweight in this population. PMID:20805082

Relationship between Breakfast Skipping and Obesity among Elderly: Cross-Sectional Analysis of the HEIJO-KYO Study.

PubMed

Otaki, N; Obayashi, K; Saeki, K; Kitagawa, M; Tone, N; Kurumatani, N

2017-01-01

Breakfast skipping is reported to be associated with obesity in children and younger populations; however, few studies report the association among elderly. The purpose of this study was to investigate the relationships between breakfast skipping and obesity prevalence among elderly. Cross-sectional study. Community-dwelling elderly in Nara, Japan. 1052 elderly participants (mean age: 71.6 years). Obesity and breakfast skipping were defined as body mass index of ≥25 kg/m2 and skipping breakfast one or more times per week, respectively. Two hundred and seventy-two participants (25.9%) were classified as obese and forty-one (3.9%) were as breakfast skippers. Obesity prevalence was significantly higher in breakfast skippers than in breakfast eaters (43.9% vs. 25.1%, P = 0.007). In multivariable logistic regression analysis adjusted for potential confounders (age, sex and alcohol consumption), breakfast skippers showed significantly higher odds ratio (OR) for obesity than breakfast eaters (OR, 2.23; 95% confidence interval, 1.17-4.27; P = 0.015), which continued to be significant after further adjustment for socioeconomic status. In addition, breakfast skippers showed significantly lower daily potassium (P <0.001) and dietary fibre intakes (P = 0.001) and lower subjective physical activity (P = 0.035) than breakfast eaters. Breakfast skipping was significantly associated with obesity among elderly. Poor diet quality and physical inactivity may be potential intermediators underlying the association between breakfast skipping and obesity.

Dramatic intracranial response to osimertinib in a poor performance status patient with lung adenocarcinoma harboring the epidermal growth factor receptor T790M mutation: A case report

PubMed Central

Uemura, Takehiro; Oguri, Tetsuya; Okayama, Minami; Furuta, Hiromi; Kanemitsu, Yoshihiro; Takakuwa, Osamu; Ohkubo, Hirotsugu; Takemura, Masaya; Maeno, Ken; Ito, Yutaka; Niimi, Akio

2017-01-01

We herein report a case of dramatic intracranial response to osimertinib in a poor performance status patient with lung adenocarcinoma harboring the epidermal growth factor receptor (EGFR) T790M mutation encoded in exon 20. The patient was a 59-year-old woman with EGFR exon 19 deletion-positive lung adenocarcinoma, who relapsed with multiple brain metastases. Computed tomography-guided biopsy of the left pleural tumor revealed adenocarcinoma harboring an EGFR exon 19 deletion and an EGFR T790M mutation encoded in exon 20. The patient was treated with osimertinib, a third-generation EGFR tyrosine kinase inhibitor. Two days after treatment initiation, the patient displayed profound disturbance of consciousness, possibly due to carcinomatous meningitis, and treatment had to be discontinued due to difficulty in taking osimertinib. However, the patient gradually started to recover consciousness and, after 3 days, she was again able to take osimertinib. One month after the initiation of osimertinib treatment, magnetic resonance imaging revealed an apparent reduction in brain metastases. The patient is currently under continued treatment with osimertinib. At the last follow-up (February, 2017) she exhibited partial response to the treatment. PMID:28413660

Human-specific protein isoforms produced by novel splice sites in the human genome after the human-chimpanzee divergence.

PubMed

Kim, Dong Seon; Hahn, Yoonsoo

2012-11-13

Evolution of splice sites is a well-known phenomenon that results in transcript diversity during human evolution. Many novel splice sites are derived from repetitive elements and may not contribute to protein products. Here, we analyzed annotated human protein-coding exons and identified human-specific splice sites that arose after the human-chimpanzee divergence. We analyzed multiple alignments of the annotated human protein-coding exons and their respective orthologous mammalian genome sequences to identify 85 novel splice sites (50 splice acceptors and 35 donors) in the human genome. The novel protein-coding exons, which are expressed either constitutively or alternatively, produce novel protein isoforms by insertion, deletion, or frameshift. We found three cases in which the human-specific isoform conferred novel molecular function in the human cells: the human-specific IMUP protein isoform induces apoptosis of the trophoblast and is implicated in pre-eclampsia; the intronization of a part of SMOX gene exon produces inactive spermine oxidase; the human-specific NUB1 isoform shows reduced interaction with ubiquitin-like proteins, possibly affecting ubiquitin pathways. Although the generation of novel protein isoforms does not equate to adaptive evolution, we propose that these cases are useful candidates for a molecular functional study to identify proteomic changes that might bring about novel phenotypes during human evolution.

Agouti sequence polymorphisms in coyotes, wolves and dogs suggest hybridization.

PubMed

Schmutz, Sheila M; Berryere, Thomas G; Barta, Jodi L; Reddick, Kimberley D; Schmutz, Josef K

2007-01-01

Domestic dogs have been shown to have multiple alleles of the Agouti Signal Peptide (ASIP) in exon 4 and we wished to determine the level of polymorphism in the common wild canids of Canada, wolves and coyotes, in comparison. All Canadian coyotes and most wolves have banded hairs. The ASIP coding sequence of the wolf did not vary from the domestic dog but one variant was detected in exon 4 of coyotes that did not alter the arginine at this position. Two other differences were found in the sequence flanking exon 4 of coyotes compared with the 45 dogs and 1 wolf. The coyotes also demonstrated a relatively common polymorphism in the 3' UTR sequence that could be used for population studies. One of the ASIP alleles (R96C) in domestic dogs causes a solid black coat color in homozygotes. Although some wolves are melanistic, this phenotype does not appear to be caused by this same mutation. However, one wolf, potentially a dog-wolf hybrid or descendant thereof, was heterozygous for this allele. Likewise 2 coyotes, potentially dog-coyote or wolf-coyote hybrid descendants, were heterozygous for the several polymorphisms in and flanking exon 4. We could conclude that these were coyote-dog hybrids because both were heterozygous for 2 mutations causing fawn coat color in dogs.

Analysis of human articular chondrocyte CD44 isoform expression and function in health and disease.

PubMed

Salter, D M; Godolphin, J L; Gourlay, M S; Lawson, M F; Hughes, D E; Dunne, E

1996-08-01

Interactions between articular chondrocytes and components of the extracellular matrix are of potential importance in the normal function of cartilage and in the pathophysiology of arthritis. Little is known of the basis of these interactions, but cell adhesive molecules such as CD44 are likely to be involved. Immunohistology using six well-characterized anti-CD44 monoclonal antibodies demonstrated standard CD44 isoform (CD44H) expression by all chondrocytes in normal and osteoarthrotic (OA) cartilage but absence of the CD44E variant. Polymerase chain reaction (PCR) of reverse transcribed mRNA from monolayer cultures of normal and OA chondrocytes using primer sequences which span the region containing variably spliced exons produced a predominant band representing the standard form of CD44, which lacks the variable exons 6-15 (v1-v10). No product was seen at the expected size of the epithelial variant of CD44 (CD44v8-10). Use of exon-specific primers, however, showed expression of variant exons resulting in multiple minor isoforms. Standard CD44 was also shown to be the predominantly expressed isoform identified by immunoprecipitation, but human articular chondrocytes did not adhere to hyaluronan in vitro. Chondrocyte CD44 may function as an adhesion receptor for other matrix molecules such as fibronectin or collagen.

The relationship of breakfast skipping and type of breakfast consumption with nutrient intake and weight status in children and adolescents: the National Health and Nutrition Examination Survey 1999-2006

USDA-ARS?s Scientific Manuscript database

National data comparing nutrient intakes and anthropometric measures in children and adolescents in the United States who skip breakfast or consume different types of breakfasts are limited. The objective was to examine the relationship between breakfast skipping and type of breakfast consumed with ...

Skip trajectory flight of a ramjet-powered hypersonic vehicle

NASA Astrophysics Data System (ADS)

Fomin, V. M.; Aulchenko, S. M.; Zvegintsev, V. I.

2010-07-01

Possible skip trajectories of a flying vehicle with a periodically actuated ramjet are numerically simulated. An optimal choice of ramjet actuation areas and duration is demonstrated to ensure the maximum flight range with a given amount of the fuel. The main advantage of skip trajectories is found to be a significant (by an order of magnitude) decrease in thermal loads on the flying vehicle.

An examination of the role of feeding regimens in regulating metabolism during the broiler breeder grower period. 1. Hepatic lipid metabolism.

PubMed

de Beer, M; Rosebrough, R W; Russell, B A; Poch, S M; Richards, M P; Coon, C N

2007-08-01

A trial was conducted to determine the effects of feeding regimens on hepatic lipid metabolism in 16-wk-old broiler breeder pullets. A flock of 350 Cobb 500 breeder pullets was divided into 2 at 4 wk of age and fed either every day (ED) or skip-a-day (SKIP) from 4 to 16 wk of age. Total feed intake did not differ between the 2 groups. At 112 d, 52 randomly selected ED-fed pullets, and 76 SKIP-fed pullets were individually caged and fed a 74-g (ED) or 148-g (SKIP) meal. Four pullets from each group were killed at intervals after feeding and livers were collected, weighed, and snap-frozen for determination of lipogenic gene expression. Total RNA was isolated from livers using Trizol reagent and then quantitatively measured by noting the optical density 260:280 ratio and qualitatively measured by gel electrophoresis. The expression of certain regulatory genes in metabolism [acetyl coenzyme A carboxylase; fatty acid synthase; malic enzyme (MAE); isocitrate dehydrogenase (ICDH); and aspartate aminotransferase (AAT)] were determined by real-time reverse-transcription PCR. Remaining liver portions were analyzed for enzyme activity of MAE, ICDH, and AAT as well as glycogen and lipid contents. Liver weight was higher in SKIP than in ED birds. Feeding caused dramatic increases in liver weight, glycogen, and lipids of SKIP birds. Expression of acetyl coenzyme A carboxylase, FAS, and MAE genes were increased in SKIP birds 12 and 24 h after feeding, with the increases in MAE expression from 0 to 24 h after feeding being of the greatest magnitude. In contrast, SKIP decreased ICDH and AAT gene expression, which parallels findings noted in fasting-refeeding experiments conducted with much younger birds. Skip-a-day feeding resulted in far greater changes in gene expression compared with ED, which was indicative of the inconsistent supply of nutrients in such regimens. Enzyme activity of MAE, ICDH, and AAT was reflective of noted changes in gene expression. In summary, the feeding regimen greatly affected hepatic gene expression in breeder pullets.

Media use as a reason for meal skipping and fast eating in secondary school children.

PubMed

Van den Bulck, J; Eggermont, S

2006-04-01

This study examined self-reported meal skipping and eating faster than usual with the goal of watching television or playing computer games. Respondents reported their media use and indicated how often they skipped a meal to watch a favourite television programme or to play a computer game, and how often they ate faster than usual in order to watch television or play a computer game. Respondents were 2546 adolescents of 13 (first year of secondary school) and 16 years (fourth year of secondary school) of age. About one respondent in 10 skipped at least one meal every week for either television viewing or computer game playing. Weekly meal skipping for television viewing occurs more regularly in boys and first-year students, but particularly in teenagers who view 5 h or more daily (15% of the sample). The category of teenagers who play computer games four times a week or more (25.3% of the sample) is at increased risk of meal skipping; those who play more than four times a week are 10 times more likely weekly to skip a meal. A quarter of the adolescents eat faster at least once a week to be able to watch television or play a computer game. Regardless of gender and school year, teenagers' risk of eating faster progressively increases with their use of the media. Those who watch 4 h or more daily are about seven times more likely to skip a meal for television and those who play computer games at least four times a week are nine times more likely weekly to skip a meal. Unhealthy eating habits can be a side effect of heavy or excessive media use. Teenagers' use of television or game computers during nonworking or out-of-school hours partly displaces the amount of time that needs to be spent at meals. Practitioners and educators may try to encourage or restore a pattern of healthful meal consumption habits by reducing the amount of media use, and by supporting parental rule-making regarding children's eating habits and media use.

A Somatic HIF2α Mutation-Induced Multiple and Recurrent Pheochromocytoma/Paraganglioma with Polycythemia: Clinical Study with Literature Review.

PubMed

Liu, Qiuli; Wang, Yan; Tong, Dali; Liu, Gaolei; Yuan, Wenqiang; Zhang, Jun; Ye, Jin; Zhang, Yao; Yuan, Gang; Feng, Qingxing; Zhang, Dianzheng; Jiang, Jun

2017-03-01

A syndrome known as pheochromocytomas (PCC)/paragangliomas (PGL) and polycythemia resulted from gain-of-function mutation of hypoxia-inducible factor 2α (HIF2α) has been reported recently. However, clinical features of this syndrome vary from patient to patient. In our study, we described the clinical features of the patient within 15-year follow-up with a literature review. The patient presented with "red face" since childhood and was diagnosed with polycythemia and pheochromocytoma in 2000, and then, tumor was removed at his age of 27 (year 2000). However, 13 years later (2013), he was diagnosed with multiple paragangliomas. Moreover, 2 years later (2015), another two paragangaliomas were also confirmed. Genetic analysis of hereditary PCC/PGL-related genes was conducted. A somatic heterozygous missense mutation of HIF2α (c.1589C>T) was identified at exon 12, which is responsible for the elevated levels of HIF2α and erythropoietin (EPO) and subsequent development of paragangaliomas. However, this mutation was only found in the tumors from three different areas, not in the blood. So far, 13 cases of PCC/PGL with polycythemia have been reported. Among them, somatic mutations of HIF2α at exon 12 are responsible for 12 cases, and only 1 case was caused by germline mutation of HIF2α at exon 9. The HIF2α mutation-induced polycythemia with PCC/PGL is a rare syndrome with no treatment for cure. Comprehensive therapies for this disease include removal of the tumors and intermittent phlebotomies; administration of medications to control blood pressure and to prevent complications or death resulted from high concentration of red blood cell (RBC). Genetic test is strongly recommended for patients with early onset of polycythemia and multiple/recurrent PCC/PGL.

Optimized P2A for reporter gene insertion into Nipah virus results in efficient ribosomal skipping and wild-type lethality.

PubMed

Park, Arnold; Yun, Tatyana; Hill, Terence E; Ikegami, Tetsuro; Juelich, Terry L; Smith, Jennifer K; Zhang, Lihong; Freiberg, Alexander N; Lee, Benhur

2016-04-01

Incorporation of reporter genes within virus genomes is an indispensable tool for interrogation of virus biology and pathogenesis. In previous work, we incorporated a fluorophore into a viral ORF by attaching it to the viral gene via a P2A ribosomal skipping sequence. This recombinant Nipah virus, however, was attenuated in vitro relative to WT virus. In this work, we determined that inefficient ribosomal skipping was a major contributing factor to this attenuation. Inserting a GSG linker before the P2A sequence resulted in essentially complete skipping, significantly improved growth in vitro, and WT lethality in vivo. To the best of our knowledge, this represents the first time a recombinant virus of Mononegavirales with integration of a reporter into a viral ORF has been compared with the WT virus in vivo. Incorporating the GSG linker for improved skipping efficiency whenever functionally important is a critical consideration for recombinant virus design.

Autosomal-recessive congenital cerebellar ataxia is caused by mutations in metabotropic glutamate receptor 1.

PubMed

Guergueltcheva, Velina; Azmanov, Dimitar N; Angelicheva, Dora; Smith, Katherine R; Chamova, Teodora; Florez, Laura; Bynevelt, Michael; Nguyen, Thai; Cherninkova, Sylvia; Bojinova, Veneta; Kaprelyan, Ara; Angelova, Lyudmila; Morar, Bharti; Chandler, David; Kaneva, Radka; Bahlo, Melanie; Tournev, Ivailo; Kalaydjieva, Luba

2012-09-07

Autosomal-recessive congenital cerebellar ataxia was identified in Roma patients originating from a small subisolate with a known strong founder effect. Patients presented with global developmental delay, moderate to severe stance and gait ataxia, dysarthria, mild dysdiadochokinesia, dysmetria and tremors, intellectual deficit, and mild pyramidal signs. Brain imaging revealed progressive generalized cerebellar atrophy, and inferior vermian hypoplasia and/or a constitutionally small brain were observed in some patients. Exome sequencing, used for linkage analysis on extracted SNP genotypes and for mutation detection, identified two novel (i.e., not found in any database) variants located 7 bp apart within a unique 6q24 linkage region. Both mutations cosegregated with the disease in five affected families, in which all ten patients were homozygous. The mutated gene, GRM1, encodes metabotropic glutamate receptor mGluR1, which is highly expressed in cerebellar Purkinje cells and plays an important role in cerebellar development and synaptic plasticity. The two mutations affect a gene region critical for alternative splicing and the generation of receptor isoforms; they are a 3 bp exon 8 deletion and an intron 8 splicing mutation (c.2652_2654del and c.2660+2T>G, respectively [RefSeq accession number NM_000838.3]). The functional impact of the deletion is unclear and is overshadowed by the splicing defect. Although ataxia lymphoblastoid cell lines expressed GRM1 at levels comparable to those of control cells, the aberrant transcripts skipped exon 8 or ended in intron 8 and encoded various species of nonfunctional receptors either lacking the transmembrane domain and containing abnormal intracellular tails or completely missing the tail. The study implicates mGluR1 in human hereditary ataxia. It also illustrates the potential of the Roma founder populations for mutation identification by exome sequencing. Copyright © 2012 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Transcriptomic profile analysis of mouse neural tube development by RNA-Seq.

PubMed

Yu, Juan; Mu, Jianbing; Guo, Qian; Yang, Lihong; Zhang, Juan; Liu, Zhizhen; Yu, Baofeng; Zhang, Ting; Xie, Jun

2017-09-01

The neural tube is the primordium of the central nervous system (CNS) in which its development is not entirely clear. Understanding the cellular and molecular basis of neural tube development could, therefore, provide vital clues to the mechanism of neural tube defects (NTDs). Here, we investigated the gene expression profiles of three different time points (embryonic day (E) 8.5, 9.5 and 10.5) of mouse neural tube by using RNA-seq approach. About 391 differentially expressed genes (DEGs) were screened during mouse neural tube development, including 45 DEGs involved in CNS development, among which Bmp2, Ascl1, Olig2, Lhx1, Wnt7b and Eomes might play the important roles. Of 45 DEGs, Foxp2, Eomes, Hoxb3, Gpr56, Hap1, Nkx2-1, Sez6l2, Wnt7b, Tbx20, Nfib, Cntn1 and Dcx had different isoforms, and the opposite expression pattern of different isoforms was observed for Gpr56, Nkx2-1 and Sez6l2. In addition, alternative splicing, such as mutually exclusive exon, retained intron, skipped exon and alternative 3' splice site was identified in 10 neural related differentially splicing genes, including Ngrn, Ddr1, Dctn1, Dnmt3b, Ect2, Map2, Mbnl1, Meis2, Vcan and App. Moreover, seven neural splicing factors, such as Nova1/2, nSR100/Srrm4, Elavl3/4, Celf3 and Rbfox1 were differentially expressed during mouse neural tube development. Interestingly, nine DEGs identified above were dysregulated in retinoic acid-induced NTDs model, indicating the possible important role of these genes in NTDs. Taken together, our study provides more comprehensive information on mouse neural tube development, which might provide new insights on NTDs occurrence. © 2017 IUBMB Life, 69(9):706-719, 2017. © 2017 International Union of Biochemistry and Molecular Biology.

Genomic organization of the human mi-er1 gene and characterization of alternatively spliced isoforms: regulated use of a facultative intron determines subcellular localization.

PubMed

Paterno, Gary D; Ding, Zhihu; Lew, Yuan-Y; Nash, Gord W; Mercer, F Corinne; Gillespie, Laura L

2002-07-24

mi-er1 (previously called er1) is a fibroblast growth factor-inducible early response gene activated during mesoderm induction in Xenopus embryos and encoding a nuclear protein that functions as a transcriptional activator. The human orthologue of mi-er1 was shown to be upregulated in breast carcinoma cell lines and breast tumours when compared to normal breast cells. In this report, we investigate the structure of the human mi-er1 (hmi-er1) gene and characterize the alternatively spliced transcripts and protein isoforms. hmi-er1 is a single copy gene located at 1p31.2 and spanning 63 kb. It contains 17 exons and includes one skipped exon, a facultative intron and three polyadenylation signals to produce 12 transcripts encoding six distinct proteins. hmi-er1 transcripts were expressed at very low levels in most human adult tissues and the mRNA isoform pattern varied with the tissue. The 12 transcripts encode proteins containing a common internal sequence with variable N- and C-termini. Three distinct N- and two distinct C-termini were identified, giving rise to six protein isoforms. The two C-termini differ significantly in size and sequence and arise from alternate use of a facultative intron to produce hMI-ER1alpha and hMI-ER1beta. In all tissues except testis, transcripts encoding the beta isoform were predominant. hMI-ER1alpha lacks the predicted nuclear localization signal and transfection assays revealed that, unlike hMI-ER1beta, it is not a nuclear protein, but remains in the cytoplasm. Our results demonstrate that alternate use of a facultative intron regulates the subcellular localization of hMI-ER1 proteins and this may have important implications for hMI-ER1 function.

Looking the cow in the eye: deletion in the NID1 gene is associated with recessive inherited cataract in Romagnola cattle.

PubMed

Murgiano, Leonardo; Jagannathan, Vidhya; Calderoni, Valerio; Joechler, Monika; Gentile, Arcangelo; Drögemüller, Cord

2014-01-01

Cataract is a known condition leading to opacification of the eye lens causing partial or total blindness. Mutations are known to cause autosomal dominant or recessive inherited forms of cataracts in humans, mice, rats, guinea pigs and dogs. The use of large-sized animal models instead of those using mice for the study of this condition has been discussed due to the small size of rodent lenses. Four juvenile-onset cases of bilateral incomplete immature nuclear cataract were recently observed in Romagnola cattle. Pedigree analysis suggested a monogenic autosomal recessive inheritance. In addition to the cataract, one of the cases displayed abnormal head movements. Genome-wide association and homozygosity mapping and subsequent whole genome sequencing of a single case identified two perfectly associated sequence variants in a critical interval of 7.2 Mb on cattle chromosome 28: a missense point mutation located in an uncharacterized locus and an 855 bp deletion across the exon 19/intron 19 border of the bovine nidogen 1 (NID1) gene (c.3579_3604+829del). RT-PCR showed that NID1 is expressed in bovine lenses while the transcript of the second locus was absent. The NID1 deletion leads to the skipping of exon 19 during transcription and is therefore predicted to cause a frameshift and premature stop codon (p.1164fs27X). The truncated protein lacks a C-terminal domain essential for binding with matrix assembly complexes. Nidogen 1 deficient mice show neurological abnormalities and highly irregular crystal lens alterations. This study adds NID1 to the list of candidate genes for inherited cataract in humans and is the first report of a naturally occurring mutation leading to non-syndromic catarct in cattle provides a potential large animal model for human cataract.

Functional Studies and In Silico Analyses to Evaluate Non-Coding Variants in Inherited Cardiomyopathies.

PubMed

Frisso, Giulia; Detta, Nicola; Coppola, Pamela; Mazzaccara, Cristina; Pricolo, Maria Rosaria; D'Onofrio, Antonio; Limongelli, Giuseppe; Calabrò, Raffaele; Salvatore, Francesco

2016-11-10

Point mutations are the most common cause of inherited diseases. Bioinformatics tools can help to predict the pathogenicity of mutations found during genetic screening, but they may work less well in determining the effect of point mutations in non-coding regions. In silico analysis of intronic variants can reveal their impact on the splicing process, but the consequence of a given substitution is generally not predictable. The aim of this study was to functionally test five intronic variants ( MYBPC3 -c.506-2A>C, MYBPC3 -c.906-7G>T, MYBPC3 -c.2308+3G>C, SCN5A -c.393-5C>A, and ACTC1 -c.617-7T>C) found in five patients affected by inherited cardiomyopathies in the attempt to verify their pathogenic role. Analysis of the MYBPC3 -c.506-2A>C mutation in mRNA from the peripheral blood of one of the patients affected by hypertrophic cardiac myopathy revealed the loss of the canonical splice site and the use of an alternative splicing site, which caused the loss of the first seven nucleotides of exon 5 ( MYBPC3 -G169AfsX14). In the other four patients, we generated minigene constructs and transfected them in HEK-293 cells. This minigene approach showed that MYBPC3 -c.2308+3G>C and SCN5A -c.393-5C>A altered pre-mRNA processing, thus resulting in the skipping of one exon. No alterations were found in either MYBPC3 -c.906-7G>T or ACTC1 -c.617-7T>C. In conclusion, functional in vitro analysis of the effects of potential splicing mutations can confirm or otherwise the putative pathogenicity of non-coding mutations, and thus help to guide the patient's clinical management and improve genetic counseling in affected families.

cDNA cloning and initial characterization of CYP3A43, a novel human cytochrome P450.

PubMed

Domanski, T L; Finta, C; Halpert, J R; Zaphiropoulos, P G

2001-02-01

The RACE amplification technology was used on a novel CYP3A-like exon 1 sequence detected during the reverse transcriptase/polymerase chain reaction analysis of human CYP3A gene expression. This resulted in the identification of cDNAs encompassing the complete coding sequence of a new member of the CYP3A gene subfamily, CYP3A43. Interestingly, the majority of the cDNAs identified were characterized by alternative splicing events such as exon skipping and complete or partial intron inclusion. CYP3A43 expression was detected in liver, kidney, pancreas, and prostate. The amino acid sequence is 75% identical to that of CYP3A4 and CYP3A5 and 71% identical to CYP3A7. CYP3A43 differs from CYP3A4 at six amino acid residues, found within the putative substrate recognition sites of CYP3A4, that are known to be determinants of substrate selectivity. The N terminus of CYP3A43 was modified for efficient expression of the protein in Escherichia coli, and a 6X histidine tag was added at the C terminus to facilitate purification. CYP3A43 gave a reduced carbon monoxide difference spectra with an absorbance maximum at 450 nm. The level of heterologous expression was significantly lower than that observed for CYP3A4 and CYP3A5. Immunoblot analyses revealed that CYP3A43 comigrates with CYP3A4 in polyacrylamide gel electrophoresis but does separate from CYP3A5. Monooxygenase assays were performed under a variety of conditions, several of which yielded reproducible, albeit low, testosterone hydroxylase activity. The findings from this study demonstrate that there is a novel CYP3A member expressed in human tissues, although its relative contribution to drug metabolism has yet to be ascertained.

A Large Scale Code Resolution Service Network in the Internet of Things

PubMed Central

Yu, Haining; Zhang, Hongli; Fang, Binxing; Yu, Xiangzhan

2012-01-01

In the Internet of Things a code resolution service provides a discovery mechanism for a requester to obtain the information resources associated with a particular product code immediately. In large scale application scenarios a code resolution service faces some serious issues involving heterogeneity, big data and data ownership. A code resolution service network is required to address these issues. Firstly, a list of requirements for the network architecture and code resolution services is proposed. Secondly, in order to eliminate code resolution conflicts and code resolution overloads, a code structure is presented to create a uniform namespace for code resolution records. Thirdly, we propose a loosely coupled distributed network consisting of heterogeneous, independent; collaborating code resolution services and a SkipNet based code resolution service named SkipNet-OCRS, which not only inherits DHT's advantages, but also supports administrative control and autonomy. For the external behaviors of SkipNet-OCRS, a novel external behavior mode named QRRA mode is proposed to enhance security and reduce requester complexity. For the internal behaviors of SkipNet-OCRS, an improved query algorithm is proposed to increase query efficiency. It is analyzed that integrating SkipNet-OCRS into our resolution service network can meet our proposed requirements. Finally, simulation experiments verify the excellent performance of SkipNet-OCRS. PMID:23202207

A large scale code resolution service network in the Internet of Things.

PubMed

Yu, Haining; Zhang, Hongli; Fang, Binxing; Yu, Xiangzhan

2012-11-07

In the Internet of Things a code resolution service provides a discovery mechanism for a requester to obtain the information resources associated with a particular product code immediately. In large scale application scenarios a code resolution service faces some serious issues involving heterogeneity, big data and data ownership. A code resolution service network is required to address these issues. Firstly, a list of requirements for the network architecture and code resolution services is proposed. Secondly, in order to eliminate code resolution conflicts and code resolution overloads, a code structure is presented to create a uniform namespace for code resolution records. Thirdly, we propose a loosely coupled distributed network consisting of heterogeneous, independent; collaborating code resolution services and a SkipNet based code resolution service named SkipNet-OCRS, which not only inherits DHT’s advantages, but also supports administrative control and autonomy. For the external behaviors of SkipNet-OCRS, a novel external behavior mode named QRRA mode is proposed to enhance security and reduce requester complexity. For the internal behaviors of SkipNet-OCRS, an improved query algorithm is proposed to increase query efficiency. It is analyzed that integrating SkipNet-OCRS into our resolution service network can meet our proposed requirements. Finally, simulation experiments verify the excellent performance of SkipNet-OCRS.

Skipped words and fixated words are processed differently during reading.

PubMed

Eskenazi, Michael A; Folk, Jocelyn R

2015-04-01

The purpose of this study was to investigate whether words are processed differently when they are fixated during silent reading than when they are skipped. According to a serial processing model of eye movement control (e.g., EZ Reader) skipped words are fully processed (Reichle, Rayner, Pollatsek, Behavioral and Brain Sciences, 26(04):445-476, 2003), whereas in a parallel processing model (e.g., SWIFT) skipped words do not need to be fully processed (Engbert, Nuthmann, Richter, Kliegl, Psychological Review, 112(4):777-813, 2005). Participants read 34 sentences with target words embedded in them while their eye movements were recorded. All target words were three-letter, low-frequency, and unpredictable nouns. After the reading session, participants completed a repetition priming lexical decision task with the target words from the reading session included as the repetition prime targets, with presentation of those same words during the reading task acting as the prime. When participants skipped a word during the reading session, their reaction times on the lexical decision task were significantly longer (M = 656.42 ms) than when they fixated the word (M = 614.43 ms). This result provides evidence that skipped words are sometimes not processed to the same degree as fixated words during reading.

Germline Mutation of INI1/SMARCB1 in Familial Schwannomatosis

PubMed Central

Hulsebos, Theo J. M.; Plomp, Astrid S.; Wolterman, Ruud A.; Robanus-Maandag, Els C.; Baas, Frank; Wesseling, Pieter

2007-01-01

Patients with schwannomatosis develop multiple schwannomas but no vestibular schwannomas diagnostic of neurofibromatosis type 2. We report an inactivating germline mutation in exon 1 of the tumor-suppressor gene INI1 in a father and daughter who both had schwannomatosis. Inactivation of the wild-type INI1 allele, by a second mutation in exon 5 or by clear loss, was found in two of four investigated schwannomas from these patients. All four schwannomas displayed complete loss of nuclear INI1 protein expression in part of the cells. Although the exact oncogenetic mechanism in these schwannomas remains to be elucidated, our findings suggest that INI1 is the predisposing gene in familial schwannomatosis. PMID:17357086

Alternative splicing and nonsense-mediated decay of circadian clock genes under environmental stress conditions in Arabidopsis

PubMed Central

2014-01-01

Background The circadian clock enables living organisms to anticipate recurring daily and seasonal fluctuations in their growth habitats and synchronize their biology to the environmental cycle. The plant circadian clock consists of multiple transcription-translation feedback loops that are entrained by environmental signals, such as light and temperature. In recent years, alternative splicing emerges as an important molecular mechanism that modulates the clock function in plants. Several clock genes are known to undergo alternative splicing in response to changes in environmental conditions, suggesting that the clock function is intimately associated with environmental responses via the alternative splicing of the clock genes. However, the alternative splicing events of the clock genes have not been studied at the molecular level. Results We systematically examined whether major clock genes undergo alternative splicing under various environmental conditions in Arabidopsis. We also investigated the fates of the RNA splice variants of the clock genes. It was found that the clock genes, including EARLY FLOWERING 3 (ELF3) and ZEITLUPE (ZTL) that have not been studied in terms of alternative splicing, undergo extensive alternative splicing through diverse modes of splicing events, such as intron retention, exon skipping, and selection of alternative 5′ splice site. Their alternative splicing patterns were differentially influenced by changes in photoperiod, temperature extremes, and salt stress. Notably, the RNA splice variants of TIMING OF CAB EXPRESSION 1 (TOC1) and ELF3 were degraded through the nonsense-mediated decay (NMD) pathway, whereas those of other clock genes were insensitive to NMD. Conclusion Taken together, our observations demonstrate that the major clock genes examined undergo extensive alternative splicing under various environmental conditions, suggesting that alternative splicing is a molecular scheme that underlies the linkage between the clock and environmental stress adaptation in plants. It is also envisioned that alternative splicing of the clock genes plays more complex roles than previously expected. PMID:24885185

Combined array CGH plus SNP genome analyses in a single assay for optimized clinical testing

PubMed Central

Wiszniewska, Joanna; Bi, Weimin; Shaw, Chad; Stankiewicz, Pawel; Kang, Sung-Hae L; Pursley, Amber N; Lalani, Seema; Hixson, Patricia; Gambin, Tomasz; Tsai, Chun-hui; Bock, Hans-Georg; Descartes, Maria; Probst, Frank J; Scaglia, Fernando; Beaudet, Arthur L; Lupski, James R; Eng, Christine; Wai Cheung, Sau; Bacino, Carlos; Patel, Ankita

2014-01-01

In clinical diagnostics, both array comparative genomic hybridization (array CGH) and single nucleotide polymorphism (SNP) genotyping have proven to be powerful genomic technologies utilized for the evaluation of developmental delay, multiple congenital anomalies, and neuropsychiatric disorders. Differences in the ability to resolve genomic changes between these arrays may constitute an implementation challenge for clinicians: which platform (SNP vs array CGH) might best detect the underlying genetic cause for the disease in the patient? While only SNP arrays enable the detection of copy number neutral regions of absence of heterozygosity (AOH), they have limited ability to detect single-exon copy number variants (CNVs) due to the distribution of SNPs across the genome. To provide comprehensive clinical testing for both CNVs and copy-neutral AOH, we enhanced our custom-designed high-resolution oligonucleotide array that has exon-targeted coverage of 1860 genes with 60 000 SNP probes, referred to as Chromosomal Microarray Analysis – Comprehensive (CMA-COMP). Of the 3240 cases evaluated by this array, clinically significant CNVs were detected in 445 cases including 21 cases with exonic events. In addition, 162 cases (5.0%) showed at least one AOH region >10 Mb. We demonstrate that even though this array has a lower density of SNP probes than other commercially available SNP arrays, it reliably detected AOH events >10 Mb as well as exonic CNVs beyond the detection limitations of SNP genotyping. Thus, combining SNP probes and exon-targeted array CGH into one platform provides clinically useful genetic screening in an efficient manner. PMID:23695279

Combinatorial activation and concentration-dependent repression of the Drosophila even skipped stripe 3+7 enhancer

PubMed Central

Struffi, Paolo; Corado, Maria; Kaplan, Leah; Yu, Danyang; Rushlow, Christine; Small, Stephen

2011-01-01

Despite years of study, the precise mechanisms that control position-specific gene expression during development are not understood. Here, we analyze an enhancer element from the even skipped (eve) gene, which activates and positions two stripes of expression (stripes 3 and 7) in blastoderm stage Drosophila embryos. Previous genetic studies showed that the JAK-STAT pathway is required for full activation of the enhancer, whereas the gap genes hunchback (hb) and knirps (kni) are required for placement of the boundaries of both stripes. We show that the maternal zinc-finger protein Zelda (Zld) is absolutely required for activation, and present evidence that Zld binds to multiple non-canonical sites. We also use a combination of in vitro binding experiments and bioinformatics analysis to redefine the Kni-binding motif, and mutational analysis and in vivo tests to show that Kni and Hb are dedicated repressors that function by direct DNA binding. These experiments significantly extend our understanding of how the eve enhancer integrates positive and negative transcriptional activities to generate sharp boundaries in the early embryo. PMID:21865322

Basic anatomy and tumor biology of the RPS6KA6 gene that encodes the p90 ribosomal S6 kinase-4

PubMed Central

Sun, Yuan; Cao, Shousong; Yang, Min; Wu, Sihong; Wang, Zhe; Lin, Xiukun; Song, Xiangrang; Liao, D.J.

2012-01-01

The RPS6KA6 gene encodes the p90 ribosomal S6 kinase-4 (RSK4) that is still largely uncharacterized. In this study we identified a new RSK4 transcription initiation site and several alternative splice sites with a 5’RACE approach. The resulting mRNA variants encompass four possible first start codons. The first 15 nucleotides (nt) of exon 22 in mouse and the penultimate exon in both human (exon 21) and mouse (exon 24) RSK4 underwent alternative splicing, although the penultimate exon deleted variant appeared mainly in cell clines, but not in most normal tissues. Demethylation agent 5-azacytidine inhibited the deletion of the penultimate exon whereas two indolocarbazole-derived inhibitors of cyclin dependent kinase 4 or 6 induced deletion of the first 39 nt from exon 21 of human RSK4. In all human cancer cell lines studied, the 90-kD wild type RSK4 was sparse but, surprisingly, several isoforms at or smaller than 72-kD were expressed as detected by seven different antibodies. On immunoblots, each of these smaller isoforms often appeared as a duplet or triplet and the levels of these isoforms varied greatly among different cell lines and culture conditions. Cyclin D1 inhibited RSK4 expression and serum starvation enhanced the inhibition, whereas c-Myc and RSK4 inhibited cyclin D1. The effects of RSK4 on cell growth, cell death and chemoresponse depended on the mRNA variant or the protein isoform expressed, on the specificity of the cell lines, as well as on the anchorage-dependent or -independent growth conditions and the in vivo situation. Moreover, we also observed that even a given cDNA might be expressed to multiple proteins; therefore, when using a cDNA, one needs to exclude this possibility before attribution of the biological results from the cDNA to the anticipated protein. Collectively, our results suggest that whether RSK4 is oncogenic or tumor suppressive depends on many factors. PMID:22614021