Sample records for multiple gene loci

  1. SATB1 tethers multiple gene loci to reprogram expression profiledriving breast cancer metastasis

    SciTech Connect

    Han, Hye-Jung; Kohwi, Yoshinori; Kohwi-Shigematsu, Terumi


    Global changes in gene expression occur during tumor progression, as indicated by expression profiling of metastatic tumors. How this occurs is poorly understood. SATB1 functions as a genome organizer by folding chromatin via tethering multiple genomic loci and recruiting chromatin remodeling enzymes to regulate chromatin structure and expression of a large number of genes. Here we show that SATB1 is expressed at high levels in aggressive breast cancer cells, and is undetectable in non-malignant breast epithelial cells. Importantly, RNAi-mediated removal of SATB1 from highly-aggressive MDA-MB-231 cells altered the expression levels of over 1200 genes, restored breast-like acinar polarity in three-dimensional cultures, and prevented the metastastic phenotype in vivo. Conversely, overexpression of SATB1 in the less-aggressive breast cancer cell line Hs578T altered the gene expression profile and increased metastasis dramatically in vivo. Thus, SATB1 is a global regulator of gene expression in breast cancer cells, directly regulating crucial metastasis-associated genes, including ERRB2 (HER2/NEU), TGF-{beta}1, matrix metalloproteinase 3, and metastasin. The identification of SATB1 as a protein that re-programs chromatin organization and transcription profiles to promote breast cancer metastasis suggests a new model for metastasis and may provide means of therapeutic intervention.

  2. Large-Scale Gene-Centric Meta-analysis across 32 Studies Identifies Multiple Lipid Loci

    PubMed Central

    Asselbergs, Folkert W.; Guo, Yiran; van Iperen, Erik P.A.; Sivapalaratnam, Suthesh; Tragante, Vinicius; Lanktree, Matthew B.; Lange, Leslie A.; Almoguera, Berta; Appelman, Yolande E.; Barnard, John; Baumert, Jens; Beitelshees, Amber L.; Bhangale, Tushar R.; Chen, Yii-Der Ida; Gaunt, Tom R.; Gong, Yan; Hopewell, Jemma C.; Johnson, Toby; Kleber, Marcus E.; Langaee, Taimour Y.; Li, Mingyao; Li, Yun R.; Liu, Kiang; McDonough, Caitrin W.; Meijs, Matthijs F.L.; Middelberg, Rita P.S.; Musunuru, Kiran; Nelson, Christopher P.; O’Connell, Jeffery R.; Padmanabhan, Sandosh; Pankow, James S.; Pankratz, Nathan; Rafelt, Suzanne; Rajagopalan, Ramakrishnan; Romaine, Simon P.R.; Schork, Nicholas J.; Shaffer, Jonathan; Shen, Haiqing; Smith, Erin N.; Tischfield, Sam E.; van der Most, Peter J.; van Vliet-Ostaptchouk, Jana V.; Verweij, Niek; Volcik, Kelly A.; Zhang, Li; Bailey, Kent R.; Bailey, Kristian M.; Bauer, Florianne; Boer, Jolanda M.A.; Braund, Peter S.; Burt, Amber; Burton, Paul R.; Buxbaum, Sarah G.; Chen, Wei; Cooper-DeHoff, Rhonda M.; Cupples, L. Adrienne; deJong, Jonas S.; Delles, Christian; Duggan, David; Fornage, Myriam; Furlong, Clement E.; Glazer, Nicole; Gums, John G.; Hastie, Claire; Holmes, Michael V.; Illig, Thomas; Kirkland, Susan A.; Kivimaki, Mika; Klein, Ronald; Klein, Barbara E.; Kooperberg, Charles; Kottke-Marchant, Kandice; Kumari, Meena; LaCroix, Andrea Z.; Mallela, Laya; Murugesan, Gurunathan; Ordovas, Jose; Ouwehand, Willem H.; Post, Wendy S.; Saxena, Richa; Scharnagl, Hubert; Schreiner, Pamela J.; Shah, Tina; Shields, Denis C.; Shimbo, Daichi; Srinivasan, Sathanur R.; Stolk, Ronald P.; Swerdlow, Daniel I.; Taylor, Herman A.; Topol, Eric J.; Toskala, Elina; van Pelt, Joost L.; van Setten, Jessica; Yusuf, Salim; Whittaker, John C.; Zwinderman, A.H.; Anand, Sonia S.; Balmforth, Anthony J.; Berenson, Gerald S.; Bezzina, Connie R.; Boehm, Bernhard O.; Boerwinkle, Eric; Casas, Juan P.; Caulfield, Mark J.; Clarke, Robert; Connell, John M.; Cruickshanks, Karen J.; Davidson, Karina W.; Day, Ian N.M.; de Bakker, Paul I.W.; Doevendans, Pieter A.; Dominiczak, Anna F.; Hall, Alistair S.; Hartman, Catharina A.; Hengstenberg, Christian; Hillege, Hans L.; Hofker, Marten H.; Humphries, Steve E.; Jarvik, Gail P.; Johnson, Julie A.; Kaess, Bernhard M.; Kathiresan, Sekar; Koenig, Wolfgang; Lawlor, Debbie A.; März, Winfried; Melander, Olle; Mitchell, Braxton D.; Montgomery, Grant W.; Munroe, Patricia B.; Murray, Sarah S.; Newhouse, Stephen J.; Onland-Moret, N. Charlotte; Poulter, Neil; Psaty, Bruce; Redline, Susan; Rich, Stephen S.; Rotter, Jerome I.; Schunkert, Heribert; Sever, Peter; Shuldiner, Alan R.; Silverstein, Roy L.; Stanton, Alice; Thorand, Barbara; Trip, Mieke D.; Tsai, Michael Y.; van der Harst, Pim; van der Schoot, Ellen; van der Schouw, Yvonne T.; Verschuren, W.M. Monique; Watkins, Hugh; Wilde, Arthur A.M.; Wolffenbuttel, Bruce H.R.; Whitfield, John B.; Hovingh, G. Kees; Ballantyne, Christie M.; Wijmenga, Cisca; Reilly, Muredach P.; Martin, Nicholas G.; Wilson, James G.; Rader, Daniel J.; Samani, Nilesh J.; Reiner, Alex P.; Hegele, Robert A.; Kastelein, John J.P.; Hingorani, Aroon D.; Talmud, Philippa J.; Hakonarson, Hakon; Elbers, Clara C.; Keating, Brendan J.; Drenos, Fotios


    Genome-wide association studies (GWASs) have identified many SNPs underlying variations in plasma-lipid levels. We explore whether additional loci associated with plasma-lipid phenotypes, such as high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), total cholesterol (TC), and triglycerides (TGs), can be identified by a dense gene-centric approach. Our meta-analysis of 32 studies in 66,240 individuals of European ancestry was based on the custom ∼50,000 SNP genotyping array (the ITMAT-Broad-CARe array) covering ∼2,000 candidate genes. SNP-lipid associations were replicated either in a cohort comprising an additional 24,736 samples or within the Global Lipid Genetic Consortium. We identified four, six, ten, and four unreported SNPs in established lipid genes for HDL-C, LDL-C, TC, and TGs, respectively. We also identified several lipid-related SNPs in previously unreported genes: DGAT2, HCAR2, GPIHBP1, PPARG, and FTO for HDL-C; SOCS3, APOH, SPTY2D1, BRCA2, and VLDLR for LDL-C; SOCS3, UGT1A1, BRCA2, UBE3B, FCGR2A, CHUK, and INSIG2 for TC; and SERPINF2, C4B, GCK, GATA4, INSR, and LPAL2 for TGs. The proportion of explained phenotypic variance in the subset of studies providing individual-level data was 9.9% for HDL-C, 9.5% for LDL-C, 10.3% for TC, and 8.0% for TGs. This large meta-analysis of lipid phenotypes with the use of a dense gene-centric approach identified multiple SNPs not previously described in established lipid genes and several previously unknown loci. The explained phenotypic variance from this approach was comparable to that from a meta-analysis of GWAS data, suggesting that a focused genotyping approach can further increase the understanding of heritability of plasma lipids. PMID:23063622

  3. Prostate cancer susceptibility loci: finding the genes.


    Ostrander, Elanie A; Johannesson, Bo


    Studies to date suggest that PC is a genetically very heterogeneous disease. High-risk families, in which multiple men are affected likely, reflect the contributions of a number of genes, some that are rare and highly penetrant, while others are more common and weakly penetrant. In this review, we have discussed only the first type of loci, and found that the identification of such genomic regions is a formidable problem. Replication between seemingly similar data sets is weak, likely reflecting the older age of onset associated with the disease, the inability to collect affected individuals from more than two generations in a family, and the variation seen in disease presentation, in addition to the underlying locus heterogeneity. Indeed, the definition of PC is ever changing, as diagnostic criteria and tools for pinpointing early lesions improve. Are we making progress? Clearly the answer is yes. The ability to divide large data sets into homogenous subset of families likely to share common genetic under-pinnings has improved power to identify loci and reproducibility between loci is now more common. Indeed, several groups report linkage to loci on chromosomes 1, 17, 19, and 22. Key to our continued success is our ever increasing ability to understand the disease. Identifying the subset of men who are likely to get clinically significant disease is the goal of genetic studies like these, and identifying the underlying loci is the key for developing diagnostics. The willingness of the community to work together has been an important factor in the successes the community has enjoyed to date, and will likely be as important as we move forward to untangle the genetics of this complex and common disorder.

  4. Novel multiple sclerosis susceptibility loci implicated in epigenetic regulation.


    Andlauer, Till F M; Buck, Dorothea; Antony, Gisela; Bayas, Antonios; Bechmann, Lukas; Berthele, Achim; Chan, Andrew; Gasperi, Christiane; Gold, Ralf; Graetz, Christiane; Haas, Jürgen; Hecker, Michael; Infante-Duarte, Carmen; Knop, Matthias; Kümpfel, Tania; Limmroth, Volker; Linker, Ralf A; Loleit, Verena; Luessi, Felix; Meuth, Sven G; Mühlau, Mark; Nischwitz, Sandra; Paul, Friedemann; Pütz, Michael; Ruck, Tobias; Salmen, Anke; Stangel, Martin; Stellmann, Jan-Patrick; Stürner, Klarissa H; Tackenberg, Björn; Then Bergh, Florian; Tumani, Hayrettin; Warnke, Clemens; Weber, Frank; Wiendl, Heinz; Wildemann, Brigitte; Zettl, Uwe K; Ziemann, Ulf; Zipp, Frauke; Arloth, Janine; Weber, Peter; Radivojkov-Blagojevic, Milena; Scheinhardt, Markus O; Dankowski, Theresa; Bettecken, Thomas; Lichtner, Peter; Czamara, Darina; Carrillo-Roa, Tania; Binder, Elisabeth B; Berger, Klaus; Bertram, Lars; Franke, Andre; Gieger, Christian; Herms, Stefan; Homuth, Georg; Ising, Marcus; Jöckel, Karl-Heinz; Kacprowski, Tim; Kloiber, Stefan; Laudes, Matthias; Lieb, Wolfgang; Lill, Christina M; Lucae, Susanne; Meitinger, Thomas; Moebus, Susanne; Müller-Nurasyid, Martina; Nöthen, Markus M; Petersmann, Astrid; Rawal, Rajesh; Schminke, Ulf; Strauch, Konstantin; Völzke, Henry; Waldenberger, Melanie; Wellmann, Jürgen; Porcu, Eleonora; Mulas, Antonella; Pitzalis, Maristella; Sidore, Carlo; Zara, Ilenia; Cucca, Francesco; Zoledziewska, Magdalena; Ziegler, Andreas; Hemmer, Bernhard; Müller-Myhsok, Bertram


    We conducted a genome-wide association study (GWAS) on multiple sclerosis (MS) susceptibility in German cohorts with 4888 cases and 10,395 controls. In addition to associations within the major histocompatibility complex (MHC) region, 15 non-MHC loci reached genome-wide significance. Four of these loci are novel MS susceptibility loci. They map to the genes L3MBTL3, MAZ, ERG, and SHMT1. The lead variant at SHMT1 was replicated in an independent Sardinian cohort. Products of the genes L3MBTL3, MAZ, and ERG play important roles in immune cell regulation. SHMT1 encodes a serine hydroxymethyltransferase catalyzing the transfer of a carbon unit to the folate cycle. This reaction is required for regulation of methylation homeostasis, which is important for establishment and maintenance of epigenetic signatures. Our GWAS approach in a defined population with limited genetic substructure detected associations not found in larger, more heterogeneous cohorts, thus providing new clues regarding MS pathogenesis.

  5. Genomewide meta-analysis identifies novel multiple sclerosis susceptibility loci

    PubMed Central

    Patsopoulos, Nikolaos A.; de Bakker, Paul I.W.


    Objective To perform a one-stage meta-analysis of genome-wide association studies (GWAS) of multiple sclerosis (MS) susceptibility and explore functional consequences of new susceptibility loci. Methods We synthesized 7 MS GWAS. Each dataset was imputed using HapMap phase II and a per-SNP meta-analysis was performed across the 7 datasets. We explored RNA expression data using a quantitative trait analysis in peripheral blood mononuclear cells (PBMCs) of 228 subjects with demyelinating disease. Results We meta-analyzed 2,529,394 unique SNPs in 5,545 cases and 12,153 controls. We identified three novel susceptibility alleles: rs170934T at 3p24.1 (OR=1.17, P = 1.6 × 10−8) near EOMES, rs2150702G in the second intron of MLANA on chromosome 9p24.1 (OR = 1.16, P = 3.3 × 10−8), and rs6718520A in an intergenic region on chromosome 2p21, with THADA as the nearest flanking gene (OR = 1.17, P = 3.4 × 10−8). The three new loci do not have a strong “cis” effect on RNA expression in PBMCs. Ten other susceptibility loci had a suggestive P<1×10−6, some of which have evidence of association in other inflammatory diseases, i.e. IL12B, TAGAP, PLEK, and ZMIZ1. Interpretation We have performed a meta-analysis of GWAS in MS that more than doubles the size of previous gene discovery efforts and highlights three novel MS susceptibility loci. These and additional loci with suggestive evidence of association are excellent candidates for further investigations to refine and validate their role in the genetic architecture of MS. PMID:22190364

  6. Novel multiple sclerosis susceptibility loci implicated in epigenetic regulation

    PubMed Central

    Andlauer, Till F. M.; Buck, Dorothea; Antony, Gisela; Bayas, Antonios; Bechmann, Lukas; Berthele, Achim; Chan, Andrew; Gasperi, Christiane; Gold, Ralf; Graetz, Christiane; Haas, Jürgen; Hecker, Michael; Infante-Duarte, Carmen; Knop, Matthias; Kümpfel, Tania; Limmroth, Volker; Linker, Ralf A.; Loleit, Verena; Luessi, Felix; Meuth, Sven G.; Mühlau, Mark; Nischwitz, Sandra; Paul, Friedemann; Pütz, Michael; Ruck, Tobias; Salmen, Anke; Stangel, Martin; Stellmann, Jan-Patrick; Stürner, Klarissa H.; Tackenberg, Björn; Then Bergh, Florian; Tumani, Hayrettin; Warnke, Clemens; Weber, Frank; Wiendl, Heinz; Wildemann, Brigitte; Zettl, Uwe K.; Ziemann, Ulf; Zipp, Frauke; Arloth, Janine; Weber, Peter; Radivojkov-Blagojevic, Milena; Scheinhardt, Markus O.; Dankowski, Theresa; Bettecken, Thomas; Lichtner, Peter; Czamara, Darina; Carrillo-Roa, Tania; Binder, Elisabeth B.; Berger, Klaus; Bertram, Lars; Franke, Andre; Gieger, Christian; Herms, Stefan; Homuth, Georg; Ising, Marcus; Jöckel, Karl-Heinz; Kacprowski, Tim; Kloiber, Stefan; Laudes, Matthias; Lieb, Wolfgang; Lill, Christina M.; Lucae, Susanne; Meitinger, Thomas; Moebus, Susanne; Müller-Nurasyid, Martina; Nöthen, Markus M.; Petersmann, Astrid; Rawal, Rajesh; Schminke, Ulf; Strauch, Konstantin; Völzke, Henry; Waldenberger, Melanie; Wellmann, Jürgen; Porcu, Eleonora; Mulas, Antonella; Pitzalis, Maristella; Sidore, Carlo; Zara, Ilenia; Cucca, Francesco; Zoledziewska, Magdalena; Ziegler, Andreas; Hemmer, Bernhard; Müller-Myhsok, Bertram


    We conducted a genome-wide association study (GWAS) on multiple sclerosis (MS) susceptibility in German cohorts with 4888 cases and 10,395 controls. In addition to associations within the major histocompatibility complex (MHC) region, 15 non-MHC loci reached genome-wide significance. Four of these loci are novel MS susceptibility loci. They map to the genes L3MBTL3, MAZ, ERG, and SHMT1. The lead variant at SHMT1 was replicated in an independent Sardinian cohort. Products of the genes L3MBTL3, MAZ, and ERG play important roles in immune cell regulation. SHMT1 encodes a serine hydroxymethyltransferase catalyzing the transfer of a carbon unit to the folate cycle. This reaction is required for regulation of methylation homeostasis, which is important for establishment and maintenance of epigenetic signatures. Our GWAS approach in a defined population with limited genetic substructure detected associations not found in larger, more heterogeneous cohorts, thus providing new clues regarding MS pathogenesis. PMID:27386562

  7. Novel multiple sclerosis susceptibility loci implicated in epigenetic regulation.


    Andlauer, Till F M; Buck, Dorothea; Antony, Gisela; Bayas, Antonios; Bechmann, Lukas; Berthele, Achim; Chan, Andrew; Gasperi, Christiane; Gold, Ralf; Graetz, Christiane; Haas, Jürgen; Hecker, Michael; Infante-Duarte, Carmen; Knop, Matthias; Kümpfel, Tania; Limmroth, Volker; Linker, Ralf A; Loleit, Verena; Luessi, Felix; Meuth, Sven G; Mühlau, Mark; Nischwitz, Sandra; Paul, Friedemann; Pütz, Michael; Ruck, Tobias; Salmen, Anke; Stangel, Martin; Stellmann, Jan-Patrick; Stürner, Klarissa H; Tackenberg, Björn; Then Bergh, Florian; Tumani, Hayrettin; Warnke, Clemens; Weber, Frank; Wiendl, Heinz; Wildemann, Brigitte; Zettl, Uwe K; Ziemann, Ulf; Zipp, Frauke; Arloth, Janine; Weber, Peter; Radivojkov-Blagojevic, Milena; Scheinhardt, Markus O; Dankowski, Theresa; Bettecken, Thomas; Lichtner, Peter; Czamara, Darina; Carrillo-Roa, Tania; Binder, Elisabeth B; Berger, Klaus; Bertram, Lars; Franke, Andre; Gieger, Christian; Herms, Stefan; Homuth, Georg; Ising, Marcus; Jöckel, Karl-Heinz; Kacprowski, Tim; Kloiber, Stefan; Laudes, Matthias; Lieb, Wolfgang; Lill, Christina M; Lucae, Susanne; Meitinger, Thomas; Moebus, Susanne; Müller-Nurasyid, Martina; Nöthen, Markus M; Petersmann, Astrid; Rawal, Rajesh; Schminke, Ulf; Strauch, Konstantin; Völzke, Henry; Waldenberger, Melanie; Wellmann, Jürgen; Porcu, Eleonora; Mulas, Antonella; Pitzalis, Maristella; Sidore, Carlo; Zara, Ilenia; Cucca, Francesco; Zoledziewska, Magdalena; Ziegler, Andreas; Hemmer, Bernhard; Müller-Myhsok, Bertram


    We conducted a genome-wide association study (GWAS) on multiple sclerosis (MS) susceptibility in German cohorts with 4888 cases and 10,395 controls. In addition to associations within the major histocompatibility complex (MHC) region, 15 non-MHC loci reached genome-wide significance. Four of these loci are novel MS susceptibility loci. They map to the genes L3MBTL3, MAZ, ERG, and SHMT1. The lead variant at SHMT1 was replicated in an independent Sardinian cohort. Products of the genes L3MBTL3, MAZ, and ERG play important roles in immune cell regulation. SHMT1 encodes a serine hydroxymethyltransferase catalyzing the transfer of a carbon unit to the folate cycle. This reaction is required for regulation of methylation homeostasis, which is important for establishment and maintenance of epigenetic signatures. Our GWAS approach in a defined population with limited genetic substructure detected associations not found in larger, more heterogeneous cohorts, thus providing new clues regarding MS pathogenesis. PMID:27386562

  8. Multiple interval mapping for quantitative trait loci.

    PubMed Central

    Kao, C H; Zeng, Z B; Teasdale, R D


    A new statistical method for mapping quantitative trait loci (QTL), called multiple interval mapping (MIM), is presented. It uses multiple marker intervals simultaneously to fit multiple putative QTL directly in the model for mapping QTL. The MIM model is based on Cockerham's model for interpreting genetic parameters and the method of maximum likelihood for estimating genetic parameters. With the MIM approach, the precision and power of QTL mapping could be improved. Also, epistasis between QTL, genotypic values of individuals, and heritabilities of quantitative traits can be readily estimated and analyzed. Using the MIM model, a stepwise selection procedure with likelihood ratio test statistic as a criterion is proposed to identify QTL. This MIM method was applied to a mapping data set of radiata pine on three traits: brown cone number, tree diameter, and branch quality scores. Based on the MIM result, seven, six, and five QTL were detected for the three traits, respectively. The detected QTL individually contributed from approximately 1 to 27% of the total genetic variation. Significant epistasis between four pairs of QTL in two traits was detected, and the four pairs of QTL contributed approximately 10.38 and 14.14% of the total genetic variation. The asymptotic variances of QTL positions and effects were also provided to construct the confidence intervals. The estimated heritabilities were 0.5606, 0.5226, and 0. 3630 for the three traits, respectively. With the estimated QTL effects and positions, the best strategy of marker-assisted selection for trait improvement for a specific purpose and requirement can be explored. The MIM FORTRAN program is available on the worldwide web ( PMID:10388834

  9. Unguided species delimitation using DNA sequence data from multiple Loci.


    Yang, Ziheng; Rannala, Bruce


    A method was developed for simultaneous Bayesian inference of species delimitation and species phylogeny using the multispecies coalescent model. The method eliminates the need for a user-specified guide tree in species delimitation and incorporates phylogenetic uncertainty in a Bayesian framework. The nearest-neighbor interchange algorithm was adapted to propose changes to the species tree, with the gene trees for multiple loci altered in the proposal to avoid conflicts with the newly proposed species tree. We also modify our previous scheme for specifying priors for species delimitation models to construct joint priors for models of species delimitation and species phylogeny. As in our earlier method, the modified algorithm integrates over gene trees, taking account of the uncertainty of gene tree topology and branch lengths given the sequence data. We conducted a simulation study to examine the statistical properties of the method using six populations (two sequences each) and a true number of three species, with values of divergence times and ancestral population sizes that are realistic for recently diverged species. The results suggest that the method tends to be conservative with high posterior probabilities being a confident indicator of species status. Simulation results also indicate that the power of the method to delimit species increases with an increase of the divergence times in the species tree, and with an increased number of gene loci. Reanalyses of two data sets of cavefish and coast horned lizards suggest considerable phylogenetic uncertainty even though the data are informative about species delimitation. We discuss the impact of the prior on models of species delimitation and species phylogeny and of the prior on population size parameters (θ) on Bayesian species delimitation. PMID:25274273

  10. Unguided Species Delimitation Using DNA Sequence Data from Multiple Loci

    PubMed Central

    Yang, Ziheng; Rannala, Bruce


    A method was developed for simultaneous Bayesian inference of species delimitation and species phylogeny using the multispecies coalescent model. The method eliminates the need for a user-specified guide tree in species delimitation and incorporates phylogenetic uncertainty in a Bayesian framework. The nearest-neighbor interchange algorithm was adapted to propose changes to the species tree, with the gene trees for multiple loci altered in the proposal to avoid conflicts with the newly proposed species tree. We also modify our previous scheme for specifying priors for species delimitation models to construct joint priors for models of species delimitation and species phylogeny. As in our earlier method, the modified algorithm integrates over gene trees, taking account of the uncertainty of gene tree topology and branch lengths given the sequence data. We conducted a simulation study to examine the statistical properties of the method using six populations (two sequences each) and a true number of three species, with values of divergence times and ancestral population sizes that are realistic for recently diverged species. The results suggest that the method tends to be conservative with high posterior probabilities being a confident indicator of species status. Simulation results also indicate that the power of the method to delimit species increases with an increase of the divergence times in the species tree, and with an increased number of gene loci. Reanalyses of two data sets of cavefish and coast horned lizards suggest considerable phylogenetic uncertainty even though the data are informative about species delimitation. We discuss the impact of the prior on models of species delimitation and species phylogeny and of the prior on population size parameters (θ) on Bayesian species delimitation. PMID:25274273

  11. Genetic evidence of multiple loci in dystocia - difficult labour

    PubMed Central


    Background Dystocia, difficult labour, is a common but also complex problem during childbirth. It can be attributed to either weak contractions of the uterus, a large infant, reduced capacity of the pelvis or combinations of these. Previous studies have indicated that there is a genetic component in the susceptibility of experiencing dystocia. The purpose of this study was to identify susceptibility genes in dystocia. Methods A total of 104 women in 47 families were included where at least two sisters had undergone caesarean section at a gestational length of 286 days or more at their first delivery. Study of medical records and a telephone interview was performed to identify subjects with dystocia. Whole-genome scanning using Affymetrix genotyping-arrays and non-parametric linkage (NPL) analysis was made in 39 women exhibiting the phenotype of dystocia from 19 families. In 68 women re-sequencing was performed of candidate genes showing suggestive linkage: oxytocin (OXT) on chromosome 20 and oxytocin-receptor (OXTR) on chromosome 3. Results We found a trend towards linkage with suggestive NPL-score (3.15) on chromosome 12p12. Suggestive linkage peaks were observed on chromosomes 3, 4, 6, 10, 20. Re-sequencing of OXT and OXTR did not reveal any causal variants. Conclusions Dystocia is likely to have a genetic component with variations in multiple genes affecting the patient outcome. We found 6 loci that could be re-evaluated in larger patient cohorts. PMID:20587075

  12. Identifying Loci Under Selection Against Gene Flow in Isolation-with-Migration Models

    PubMed Central

    Sousa, Vitor C.; Carneiro, Miguel; Ferrand, Nuno; Hey, Jody


    When divergence occurs in the presence of gene flow, there can arise an interesting dynamic in which selection against gene flow, at sites associated with population-specific adaptations or genetic incompatibilities, can cause net gene flow to vary across the genome. Loci linked to sites under selection may experience reduced gene flow and may experience genetic bottlenecks by the action of nearby selective sweeps. Data from histories such as these may be poorly fitted by conventional neutral model approaches to demographic inference, which treat all loci as equally subject to forces of genetic drift and gene flow. To allow for demographic inference in the face of such histories, as well as the identification of loci affected by selection, we developed an isolation-with-migration model that explicitly provides for variation among genomic regions in migration rates and/or rates of genetic drift. The method allows for loci to fall into any of multiple groups, each characterized by a different set of parameters, thus relaxing the assumption that all loci share the same demography. By grouping loci, the method can be applied to data with multiple loci and still have tractable dimensionality and statistical power. We studied the performance of the method using simulated data, and we applied the method to study the divergence of two subspecies of European rabbits (Oryctolagus cuniculus). PMID:23457232

  13. Prediction of causal candidate genes in coronary artery disease loci

    PubMed Central

    Brænne, Ingrid; Civelek, Mete; Vilne, Baiba; Di Narzo, Antonio; Johnson, Andrew D.; Zhao, Yuqi; Reiz, Benedikt; Codoni, Veronica; Webb, Thomas R.; Asl, Hassan Foroughi; Hamby, Stephen E.; Zeng, Lingyao; Trégouët, David-Alexandre; Hao, Ke; Topol, Eric J.; Schadt, Eric E.; Yang, Xia; Samani, Nilesh J.; Björkegren, Johan L.M.; Erdmann, Jeanette; Schunkert, Heribert; Lusis, Aldons J.


    Objective Genome-wide association studies (GWAS) have so far identified 159 significant and suggestive loci for coronary artery disease (CAD). We now report comprehensive bioinformatics analyses of sequence variation in these loci to predict candidate causal genes. Approach and Results All annotated genes in the loci were evaluated with respect to protein coding SNPs and gene expression parameters. The latter included expression quantitative trait loci, tissue specificity, and miRNA binding. High priority candidate genes were further identified based on literature searches and our experimental data. We conclude that the great majority of causal variations affecting CAD risk occur in non-coding regions, with 41 % affecting gene expression robustly versus 6% leading to amino acid changes. Many of these genes differed from the traditionally annotated genes, which was usually based on proximity to the lead SNP. Indeed, we obtained evidence that genetic variants at CAD loci affect 98 genes which had not been linked to CAD previously. Conclusions Our results substantially revise the list of likely candidates for CAD and suggest that GWAS efforts in other diseases may benefit from similar bioinformatics analyses. PMID:26293461

  14. Protein-Protein Interaction Analysis Highlights Additional Loci of Interest for Multiple Sclerosis

    PubMed Central

    Ragnedda, Giammario; Disanto, Giulio; Giovannoni, Gavin; Ebers, George C.; Sotgiu, Stefano; Ramagopalan, Sreeram V.


    Genetic factors play an important role in determining the risk of multiple sclerosis (MS). The strongest genetic association in MS is located within the major histocompatibility complex class II region (MHC), but more than 50 MS loci of modest effect located outside the MHC have now been identified. However, the relative candidate genes that underlie these associations and their functions are largely unknown. We conducted a protein-protein interaction (PPI) analysis of gene products coded in loci recently reported to be MS associated at the genome-wide significance level and in loci suggestive of MS association. Our aim was to identify which suggestive regions are more likely to be truly associated, which genes are mostly implicated in the PPI network and their expression profile. From three recent independent association studies, SNPs were considered and divided into significant and suggestive depending on the strength of the statistical association. Using the Disease Association Protein-Protein Link Evaluator tool we found that direct interactions among genetic products were significantly higher than expected by chance when considering both significant regions alone (p<0.0002) and significant plus suggestive (p<0.007). The number of genes involved in the network was 43. Of these, 23 were located within suggestive regions and many of them directly interacted with proteins coded within significant regions. These included genes such as SYK, IL-6, CSF2RB, FCLR3, EIF4EBP2 and CHST12. Using the gene portal BioGPS, we tested the expression of these genes in 24 different tissues and found the highest values among immune-related cells as compared to non-immune tissues (p<0.001). A gene ontology analysis confirmed the immune-related functions of these genes. In conclusion, loci currently suggestive of MS association interact with and have similar expression profiles and function as those significantly associated, highlighting the fact that more common variants remain to be

  15. Multiple newly identified loci associated with prostate cancer susceptibility.


    Eeles, Rosalind A; Kote-Jarai, Zsofia; Giles, Graham G; Olama, Ali Amin Al; Guy, Michelle; Jugurnauth, Sarah K; Mulholland, Shani; Leongamornlert, Daniel A; Edwards, Stephen M; Morrison, Jonathan; Field, Helen I; Southey, Melissa C; Severi, Gianluca; Donovan, Jenny L; Hamdy, Freddie C; Dearnaley, David P; Muir, Kenneth R; Smith, Charmaine; Bagnato, Melisa; Ardern-Jones, Audrey T; Hall, Amanda L; O'Brien, Lynne T; Gehr-Swain, Beatrice N; Wilkinson, Rosemary A; Cox, Angie; Lewis, Sarah; Brown, Paul M; Jhavar, Sameer G; Tymrakiewicz, Malgorzata; Lophatananon, Artitaya; Bryant, Sarah L; Horwich, Alan; Huddart, Robert A; Khoo, Vincent S; Parker, Christopher C; Woodhouse, Christopher J; Thompson, Alan; Christmas, Tim; Ogden, Chris; Fisher, Cyril; Jamieson, Charles; Cooper, Colin S; English, Dallas R; Hopper, John L; Neal, David E; Easton, Douglas F


    Prostate cancer is the most common cancer affecting males in developed countries. It shows consistent evidence of familial aggregation, but the causes of this aggregation are mostly unknown. To identify common alleles associated with prostate cancer risk, we conducted a genome-wide association study (GWAS) using blood DNA samples from 1,854 individuals with clinically detected prostate cancer diagnosed at loci associated with prostate cancer on chromosomes 3, 6, 7, 10, 11, 19 and X (P = 2.7 x 10(-8) to P = 8.7 x 10(-29)). We confirmed previous reports of common loci associated with prostate cancer at 8q24 and 17q. Moreover, we found that three of the newly identified loci contain candidate susceptibility genes: MSMB, LMTK2 and KLK3.

  16. Linkage Mapping of 1454 New Maize Candidate Gene Loci

    PubMed Central

    Falque, Matthieu; Décousset, Laurent; Dervins, Delphine; Jacob, Anne-Marie; Joets, Johann; Martinant, Jean-Pierre; Raffoux, Xavier; Ribière, Nicolas; Ridel, Céline; Samson, Delphine; Charcosset, Alain; Murigneux, Alain


    Bioinformatic analyses of maize EST sequences have highlighted large numbers of candidate genes putatively involved in agriculturally important traits. To contribute to ongoing efforts toward mapping of these genes, we used two populations of intermated recombinant inbred lines (IRILs), which allow a higher map resolution than nonintermated RILs. The first panel (IBM), derived from B73 × Mo17, is publicly available from the Maize Genetics Cooperation Stock Center. The second panel (LHRF) was developed from F2 × F252 to map loci monomorphic on IBM. We built framework maps of 237 loci from the IBM panel and 271 loci from the LHRF panel. Both maps were used to place 1454 loci (1056 on map IBM_Gnp2004 and 398 on map LHRF_Gnp2004) that corresponded to 954 cDNA probes previously unmapped. RFLP was mostly used, but PCR-based methods were also performed for some cDNAs to map SNPs. Unlike in usual IRIL-based maps published so far, corrected meiotic centimorgan distances were calculated, taking into account the number of intermating generations undergone by the IRILs. The corrected sizes of our framework maps were 1825 cM for IBM_Gnp2004 and 1862 cM for LHRF_Gnp2004. All loci mapped on LHRF_Gnp2004 were also projected on a consensus map IBMconsensus_Gnp2004. cDNA loci formed clusters near the centromeres except for chromosomes 1 and 8. PMID:15937132

  17. Linkage mapping of 1454 new maize candidate gene Loci.


    Falque, Matthieu; Décousset, Laurent; Dervins, Delphine; Jacob, Anne-Marie; Joets, Johann; Martinant, Jean-Pierre; Raffoux, Xavier; Ribière, Nicolas; Ridel, Céline; Samson, Delphine; Charcosset, Alain; Murigneux, Alain


    Bioinformatic analyses of maize EST sequences have highlighted large numbers of candidate genes putatively involved in agriculturally important traits. To contribute to ongoing efforts toward mapping of these genes, we used two populations of intermated recombinant inbred lines (IRILs), which allow a higher map resolution than nonintermated RILs. The first panel (IBM), derived from B73 x Mo17, is publicly available from the Maize Genetics Cooperation Stock Center. The second panel (LHRF) was developed from F2 x F252 to map loci monomorphic on IBM. We built framework maps of 237 loci from the IBM panel and 271 loci from the LHRF panel. Both maps were used to place 1454 loci (1056 on map IBM_Gnp2004 and 398 on map LHRF_Gnp2004) that corresponded to 954 cDNA probes previously unmapped. RFLP was mostly used, but PCR-based methods were also performed for some cDNAs to map SNPs. Unlike in usual IRIL-based maps published so far, corrected meiotic centimorgan distances were calculated, taking into account the number of intermating generations undergone by the IRILs. The corrected sizes of our framework maps were 1825 cM for IBM_Gnp2004 and 1862 cM for LHRF_Gnp2004. All loci mapped on LHRF_Gnp2004 were also projected on a consensus map IBMconsensus_Gnp2004. cDNA loci formed clusters near the centromeres except for chromosomes 1 and 8.

  18. Evolution of V genes from the TRV loci of mammals.


    Olivieri, David N; Gambón-Cerdá, Santiago; Gambón-Deza, Francisco


    Information concerning the evolution of T lymphocyte receptors (TCR) can be deciphered from that part of the molecule that recognizes antigen presented by major histocompatibility complex (MHC), namely the variable (V) regions. The genes that code for these variable regions are found within the TCR loci. Here, we describe a study of the evolutionary origin of V genes that code for the α and β chains of the TCR loci of mammals. In particular, we demonstrate that most of the 35 TRAV and 25 TRBV conserved genes found in Primates are also found in other Eutheria, while in Marsupials, Monotremes, and Reptiles, these genes diversified in a different manner. We also show that in mammals, all TRAV genes are derived from five ancestral genes, while all TRBV genes originate from four such genes. In Reptiles, the five TRAV and three out of the four TRBV ancestral genes exist, as well as other V genes not found in mammals. We also studied the TRGV and TRDV loci from all mammals, and we show a relationship of the TRDV to the TRAV locus throughout evolutionary time. PMID:26024913

  19. Evolution of V genes from the TRV loci of mammals.


    Olivieri, David N; Gambón-Cerdá, Santiago; Gambón-Deza, Francisco


    Information concerning the evolution of T lymphocyte receptors (TCR) can be deciphered from that part of the molecule that recognizes antigen presented by major histocompatibility complex (MHC), namely the variable (V) regions. The genes that code for these variable regions are found within the TCR loci. Here, we describe a study of the evolutionary origin of V genes that code for the α and β chains of the TCR loci of mammals. In particular, we demonstrate that most of the 35 TRAV and 25 TRBV conserved genes found in Primates are also found in other Eutheria, while in Marsupials, Monotremes, and Reptiles, these genes diversified in a different manner. We also show that in mammals, all TRAV genes are derived from five ancestral genes, while all TRBV genes originate from four such genes. In Reptiles, the five TRAV and three out of the four TRBV ancestral genes exist, as well as other V genes not found in mammals. We also studied the TRGV and TRDV loci from all mammals, and we show a relationship of the TRDV to the TRAV locus throughout evolutionary time.

  20. CREB Binds to Multiple Loci on Human Chromosome 22

    PubMed Central

    Euskirchen, Ghia; Royce, Thomas E.; Bertone, Paul; Martone, Rebecca; Rinn, John L.; Nelson, F. Kenneth; Sayward, Fred; Luscombe, Nicholas M.; Miller, Perry; Gerstein, Mark; Weissman, Sherman; Snyder, Michael


    The cyclic AMP-responsive element-binding protein (CREB) is an important transcription factor that can be activated by hormonal stimulation and regulates neuronal function and development. An unbiased, global analysis of where CREB binds has not been performed. We have mapped for the first time the binding distribution of CREB along an entire human chromosome. Chromatin immunoprecipitation of CREB-associated DNA and subsequent hybridization of the associated DNA to a genomic DNA microarray containing all of the nonrepetitive DNA of human chromosome 22 revealed 215 binding sites corresponding to 192 different loci and 100 annotated potential gene targets. We found binding near or within many genes involved in signal transduction and neuronal function. We also found that only a small fraction of CREB binding sites lay near well-defined 5′ ends of genes; the majority of sites were found elsewhere, including introns and unannotated regions. Several of the latter lay near novel unannotated transcriptionally active regions. Few CREB targets were found near full-length cyclic AMP response element sites; the majority contained shorter versions or close matches to this sequence. Several of the CREB targets were altered in their expression by treatment with forskolin; interestingly, both induced and repressed genes were found. Our results provide novel molecular insights into how CREB mediates its functions in humans. PMID:15082775

  1. Evidence of selection at insulin receptor substrate-1 gene loci.


    Yoshiuchi, Issei


    Type 2 diabetes mellitus (T2DM) is a complex disease characterized by insulin resistance and defect of insulin secretion. The worldwide prevalence of T2DM is steadily increasing. T2DM is also significantly associated with obesity, coronary artery disease (CAD), and metabolic syndrome. There is a clear difference in the prevalence of T2DM among populations, and T2DM is highly heritable. Human adaptations to environmental changes in food supply, lifestyle, and geography may have pressured the selection of genes associated with the metabolism of glucose, lipids, carbohydrates, and energy. The insulin receptor substrate-1 (IRS1) gene is considered a major T2DM gene, and common genetic variations near the IRS1 gene were found to be associated with T2DM, insulin resistance, adiposity, and CAD. Here, we aimed to find evidence of selection at the IRS1 gene loci using the HapMap population data. We investigated a 3-step test procedure-Wright's F statistics (Fst), the long-range haplotype (LRH) test, and the integrated haplotype score (iHS) test-to detect selection at the IRS1 gene loci using the HapMap population data. We observed that 1 CAD-associated SNP (rs2943634) and 1 adiposity- and insulin resistance-associated SNP (rs2943650) exhibited high Fst values. We also found selection at the IRS1 gene loci by the LRH test and the iHS test. These findings suggest evidence of selection at the IRS1 gene loci and that further studies should examine the adaptive evolution of T2DM genes. PMID:22797928

  2. Multiple Trait Analysis of Genetic Mapping for Quantitative Trait Loci

    PubMed Central

    Jiang, C.; Zeng, Z. B.


    We present in this paper models and statistical methods for performing multiple trait analysis on mapping quantitative trait loci (QTL) based on the composite interval mapping method. By taking into account the correlated structure of multiple traits, this joint analysis has several advantages, compared with separate analyses, for mapping QTL, including the expected improvement on the statistical power of the test for QTL and on the precision of parameter estimation. Also this joint analysis provides formal procedures to test a number of biologically interesting hypotheses concerning the nature of genetic correlations between different traits. Among the testing procedures considered are those for joint mapping, pleiotropy, QTL by environment interaction, and pleiotropy vs. close linkage. The test of pleiotropy (one pleiotropic QTL at a genome position) vs. close linkage (multiple nearby nonpleiotropic QTL) can have important implications for our understanding of the nature of genetic correlations between different traits in certain regions of a genome and also for practical applications in animal and plant breeding because one of the major goals in breeding is to break unfavorable linkage. Results of extensive simulation studies are presented to illustrate various properties of the analyses. PMID:7672582

  3. Identification of Multiple Loci Associated with Social Parasitism in Honeybees.


    Wallberg, Andreas; Pirk, Christian W; Allsopp, Mike H; Webster, Matthew T


    In colonies of the honeybee Apis mellifera, the queen is usually the only reproductive female, which produces new females (queens and workers) by laying fertilized eggs. However, in one subspecies of A. mellifera, known as the Cape bee (A. m. capensis), worker bees reproduce asexually by thelytoky, an abnormal form of meiosis where two daughter nucleii fuse to form single diploid eggs, which develop into females without being fertilized. The Cape bee also exhibits a suite of phenotypes that facilitate social parasitism whereby workers lay such eggs in foreign colonies so their offspring can exploit their resources. The genetic basis of this switch to social parasitism in the Cape bee is unknown. To address this, we compared genome variation in a sample of Cape bees with other African populations. We find genetic divergence between these populations to be very low on average but identify several regions of the genome with extreme differentiation. The regions are strongly enriched for signals of selection in Cape bees, indicating that increased levels of positive selection have produced the unique set of derived phenotypic traits in this subspecies. Genetic variation within these regions allows unambiguous genetic identification of Cape bees and likely underlies the genetic basis of social parasitism. The candidate loci include genes involved in ecdysteroid signaling and juvenile hormone and dopamine biosynthesis, which may regulate worker ovary activation and others whose products localize at the centrosome and are implicated in chromosomal segregation during meiosis. Functional analysis of these loci will yield insights into the processes of reproduction and chemical signaling in both parasitic and non-parasitic populations and advance understanding of the process of normal and atypical meiosis. PMID:27280405

  4. Identification of Multiple Loci Associated with Social Parasitism in Honeybees

    PubMed Central

    Pirk, Christian W.; Allsopp, Mike H.


    In colonies of the honeybee Apis mellifera, the queen is usually the only reproductive female, which produces new females (queens and workers) by laying fertilized eggs. However, in one subspecies of A. mellifera, known as the Cape bee (A. m. capensis), worker bees reproduce asexually by thelytoky, an abnormal form of meiosis where two daughter nucleii fuse to form single diploid eggs, which develop into females without being fertilized. The Cape bee also exhibits a suite of phenotypes that facilitate social parasitism whereby workers lay such eggs in foreign colonies so their offspring can exploit their resources. The genetic basis of this switch to social parasitism in the Cape bee is unknown. To address this, we compared genome variation in a sample of Cape bees with other African populations. We find genetic divergence between these populations to be very low on average but identify several regions of the genome with extreme differentiation. The regions are strongly enriched for signals of selection in Cape bees, indicating that increased levels of positive selection have produced the unique set of derived phenotypic traits in this subspecies. Genetic variation within these regions allows unambiguous genetic identification of Cape bees and likely underlies the genetic basis of social parasitism. The candidate loci include genes involved in ecdysteroid signaling and juvenile hormone and dopamine biosynthesis, which may regulate worker ovary activation and others whose products localize at the centrosome and are implicated in chromosomal segregation during meiosis. Functional analysis of these loci will yield insights into the processes of reproduction and chemical signaling in both parasitic and non-parasitic populations and advance understanding of the process of normal and atypical meiosis. PMID:27280405

  5. Identification of Multiple Loci Associated with Social Parasitism in Honeybees.


    Wallberg, Andreas; Pirk, Christian W; Allsopp, Mike H; Webster, Matthew T


    In colonies of the honeybee Apis mellifera, the queen is usually the only reproductive female, which produces new females (queens and workers) by laying fertilized eggs. However, in one subspecies of A. mellifera, known as the Cape bee (A. m. capensis), worker bees reproduce asexually by thelytoky, an abnormal form of meiosis where two daughter nucleii fuse to form single diploid eggs, which develop into females without being fertilized. The Cape bee also exhibits a suite of phenotypes that facilitate social parasitism whereby workers lay such eggs in foreign colonies so their offspring can exploit their resources. The genetic basis of this switch to social parasitism in the Cape bee is unknown. To address this, we compared genome variation in a sample of Cape bees with other African populations. We find genetic divergence between these populations to be very low on average but identify several regions of the genome with extreme differentiation. The regions are strongly enriched for signals of selection in Cape bees, indicating that increased levels of positive selection have produced the unique set of derived phenotypic traits in this subspecies. Genetic variation within these regions allows unambiguous genetic identification of Cape bees and likely underlies the genetic basis of social parasitism. The candidate loci include genes involved in ecdysteroid signaling and juvenile hormone and dopamine biosynthesis, which may regulate worker ovary activation and others whose products localize at the centrosome and are implicated in chromosomal segregation during meiosis. Functional analysis of these loci will yield insights into the processes of reproduction and chemical signaling in both parasitic and non-parasitic populations and advance understanding of the process of normal and atypical meiosis.

  6. Complex germline architecture: two genes intertwined on two loci.


    Kuo, Shiuhyang; Chang, Wei-Jen; Landweber, Laura F


    The germline micronuclear genome of some ciliated protists can be scrambled, with coding segments disordered relative to the expressed macronuclear genome. Here, we report a surprisingly complex pair of genes that assemble from interwoven segments on two germline loci in the ciliate Uroleptus. This baroque organization requires two scrambled genes to be disentangled from each other from two clusters in the genome, one containing segments 1-2-4-5-6-8-11-13-15-16 and the other 7-9-3-10-12-14, with pieces 1-5 comprising the first gene and 6-16 the second gene. Both genes remain linked in the somatic genome on a 1.5-kb "nanochromosome." This study is the first to reveal that two genes can become scrambled during evolution with their coding segments intertwined. These twin scrambled genes underscore the beauty and exceptions of protist genome architecture, pointing to the critical need for evolutionary biologists to survey protist genomes broadly.

  7. Multiple loci for synapse protein SNAP-25 in the tetraploid goldfish.

    PubMed Central

    Risinger, C; Larhammar, D


    The common goldfish Carassius auratus is tetraploid and has 100 chromosomes. We describe here goldfish cDNA clones for SNAP-25, a 200-amino-acid synaptosome-associated protein that has remained highly conserved during evolution. SNAP-25 occurs as a single-copy gene in mouse, chicken, and Drosophila melanogaster. Sequences of six distinct goldfish cDNA clones and Southern hybridizations show that the goldfish has three, or possibly four, SNAP-25 loci rather than two as expected. A gene duplication early in actinopterygian fish evolution gave rise to the loci SnapA and SnapB. The proteins SNAP-A and SNAP-B are 94% and 91% identical to the mouse protein but are only 91% identical to each other. SNAP-B has a larger number of unique amino acid replacements than SNAP-A and also has more dramatic replacements. The tetraploidization resulted in two SnapB loci whose divergence from each other is consistent with a tetraploidization event 15-20 million years ago. The presence of duplicate SnapA loci has not yet been possible to confirm, possibly because they are still very similar to each other. Two of the SnapA cDNA clones and one SnapB cDNA clone have frameshift mutations. As these aberrant alleles otherwise display high sequence identity to the functional alleles, they probably became nonfunctional recently. The findings of allelic variability and aberrant alleles emphasize the importance of characterizing multiple DNA clones in tetraploid species. Images Fig. 4 PMID:8248151

  8. Tissue Restricted Splice Junctions Originate Not Only from Tissue-Specific Gene Loci, but Gene Loci with a Broad Pattern of Expression

    PubMed Central

    Hestand, Matthew S.; Zeng, Zheng; Coleman, Stephen J.; Liu, Jinze; MacLeod, James N.


    Cellular mechanisms that achieve protein diversity in eukaryotes are multifaceted, including transcriptional components such as RNA splicing. Through alternative splicing, a single protein-coding gene can generate multiple mRNA transcripts and protein isoforms, some of which are tissue-specific. We have conducted qualitative and quantitative analyses of the Bodymap 2.0 messenger RNA-sequencing data from 16 human tissue samples and identified 209,363 splice junctions. Of these, 22,231 (10.6%) were not previously annotated and 21,650 (10.3%) were expressed in a tissue-restricted pattern. Tissue-restricted alternative splicing was found to be widespread, with approximately 65% of expressed multi-exon genes containing at least one tissue-specific splice junction. Interestingly, we observed many tissue-specific splice junctions not only in genes expressed in one or a few tissues, but also from gene loci with a broad pattern of expression. PMID:26713731

  9. Identifying Autism Loci and Genes by Tracing Recent Shared Ancestry

    PubMed Central

    Morrow, Eric M.; Yoo, Seung-Yun; Flavell, Steven W.; Kim, Tae-Kyung; Lin, Yingxi; Hill, Robert Sean; Mukaddes, Nahit M.; Balkhy, Soher; Gascon, Generoso; Hashmi, Asif; Al-Saad, Samira; Ware, Janice; Joseph, Robert M.; Greenblatt, Rachel; Gleason, Danielle; Ertelt, Julia A.; Apse, Kira A.; Bodell, Adria; Partlow, Jennifer N.; Barry, Brenda; Yao, Hui; Markianos, Kyriacos; Ferland, Russell J.; Greenberg, Michael E.; Walsh, Christopher A.


    To find inherited causes of autism-spectrum disorders, we studied families in which parents share ancestors, enhancing the role of inherited factors. We mapped several loci, some containing large, inherited, homozygous deletions that are likely mutations. The largest deletions implicated genes, including PCDH10 (protocadherin 10) and DIA1 (deleted in autism1, or c3orf58), whose level of expression changes in response to neuronal activity, a marker of genes involved in synaptic changes that underlie learning. A subset of genes, including NHE9 (Na+/H+ exchanger 9), showed additional potential mutations in patients with unrelated parents. Our findings highlight the utility of “homozygosity mapping” in heterogeneous disorders like autism but also suggest that defective regulation of gene expression after neural activity may be a mechanism common to seemingly diverse autism mutations. PMID:18621663

  10. Genetic control of gene expression at novel and established chronic obstructive pulmonary disease loci

    PubMed Central

    Castaldi, Peter J.; Cho, Michael H.; Zhou, Xiaobo; Qiu, Weiliang; Mcgeachie, Michael; Celli, Bartolome; Bakke, Per; Gulsvik, Amund; Lomas, David A.; Crapo, James D.; Beaty, Terri H.; Rennard, Stephen; Harshfield, Benjamin; Lange, Christoph; Singh, Dave; Tal-Singer, Ruth; Riley, John H.; Quackenbush, John; Raby, Benjamin A.; Carey, Vincent J.; Silverman, Edwin K.; Hersh, Craig P.


    Genetic risk loci have been identified for a wide range of diseases through genome-wide association studies (GWAS), but the relevant functional mechanisms have been identified for only a small proportion of these GWAS-identified loci. By integrating results from the largest current GWAS of chronic obstructive disease (COPD) with expression quantitative trait locus (eQTL) analysis in whole blood and sputum from 121 subjects with COPD from the ECLIPSE Study, this analysis identifies loci that are simultaneously associated with COPD and the expression of nearby genes (COPD eQTLs). After integrative analysis, 19 COPD eQTLs were identified, including all four previously identified genome-wide significant loci near HHIP, FAM13A, and the 15q25 and 19q13 loci. For each COPD eQTL, fine mapping and colocalization analysis to identify causal shared eQTL and GWAS variants identified a subset of sites with moderate-to-strong evidence of harboring at least one shared variant responsible for both the eQTL and GWAS signals. Transcription factor binding site (TFBS) analysis confirms that multiple COPD eQTL lead SNPs disrupt TFBS, and enhancer enrichment analysis for loci with the strongest colocalization signals showed enrichment for blood-related cell types (CD3 and CD4+ T cells, lymphoblastoid cell lines). In summary, integrative eQTL and GWAS analysis confirms that genetic control of gene expression plays a key role in the genetic architecture of COPD and identifies specific blood-related cell types as likely participants in the functional pathway from GWAS-associated variant to disease phenotype. PMID:25315895

  11. Multiple loci affect genetic predisposition to hepatocarcinogenesis in mice

    SciTech Connect

    Manenti, G.; Gariboldi, M.; Canzian, F.


    The C3H/He mouse represents a good experimental model of genetic predispositoin to hepatocellular tumor development. We analyzed an interspecific test-cross population of 106 urethane-treated male (C3H/He x Mus spretus) x C57BL/6J mice, typed with 222 genetic markers to locate precisely the hepatocellular tumor susceptibility (Hcs) loci. Three regions, on chromosomes 2, 5, and 19, showed a significant linkage with hepatocellular tumor development, as indicated by different quantitative indexes estimating liver tumor size. Liver tumor frequency was not genetically controlled. These loci are different from three other Hcs loci that we have previously mapped in an F2 progeny of the C3H/He mouse crossed with the resistant laboratory strain A/J. The present result indicates a multigenic model of inheritance for hepatocellular tumor susceptibility.

  12. Genome-wide association study identifies multiple susceptibility loci for multiple myeloma

    PubMed Central

    Mitchell, Jonathan S.; Li, Ni; Weinhold, Niels; Försti, Asta; Ali, Mina; van Duin, Mark; Thorleifsson, Gudmar; Johnson, David C.; Chen, Bowang; Halvarsson, Britt-Marie; Gudbjartsson, Daniel F.; Kuiper, Rowan; Stephens, Owen W.; Bertsch, Uta; Broderick, Peter; Campo, Chiara; Einsele, Hermann; Gregory, Walter A.; Gullberg, Urban; Henrion, Marc; Hillengass, Jens; Hoffmann, Per; Jackson, Graham H.; Johnsson, Ellinor; Jöud, Magnus; Kristinsson, Sigurður Y.; Lenhoff, Stig; Lenive, Oleg; Mellqvist, Ulf-Henrik; Migliorini, Gabriele; Nahi, Hareth; Nelander, Sven; Nickel, Jolanta; Nöthen, Markus M.; Rafnar, Thorunn; Ross, Fiona M.; da Silva Filho, Miguel Inacio; Swaminathan, Bhairavi; Thomsen, Hauke; Turesson, Ingemar; Vangsted, Annette; Vogel, Ulla; Waage, Anders; Walker, Brian A.; Wihlborg, Anna-Karin; Broyl, Annemiek; Davies, Faith E.; Thorsteinsdottir, Unnur; Langer, Christian; Hansson, Markus; Kaiser, Martin; Sonneveld, Pieter; Stefansson, Kari; Morgan, Gareth J.; Goldschmidt, Hartmut; Hemminki, Kari; Nilsson, Björn; Houlston, Richard S.


    Multiple myeloma (MM) is a plasma cell malignancy with a significant heritable basis. Genome-wide association studies have transformed our understanding of MM predisposition, but individual studies have had limited power to discover risk loci. Here we perform a meta-analysis of these GWAS, add a new GWAS and perform replication analyses resulting in 9,866 cases and 239,188 controls. We confirm all nine known risk loci and discover eight new loci at 6p22.3 (rs34229995, P=1.31 × 10−8), 6q21 (rs9372120, P=9.09 × 10−15), 7q36.1 (rs7781265, P=9.71 × 10−9), 8q24.21 (rs1948915, P=4.20 × 10−11), 9p21.3 (rs2811710, P=1.72 × 10−13), 10p12.1 (rs2790457, P=1.77 × 10−8), 16q23.1 (rs7193541, P=5.00 × 10−12) and 20q13.13 (rs6066835, P=1.36 × 10−13), which localize in or near to JARID2, ATG5, SMARCD3, CCAT1, CDKN2A, WAC, RFWD3 and PREX1. These findings provide additional support for a polygenic model of MM and insight into the biological basis of tumour development. PMID:27363682

  13. Genome-wide association study identifies multiple susceptibility loci for multiple myeloma.


    Mitchell, Jonathan S; Li, Ni; Weinhold, Niels; Försti, Asta; Ali, Mina; van Duin, Mark; Thorleifsson, Gudmar; Johnson, David C; Chen, Bowang; Halvarsson, Britt-Marie; Gudbjartsson, Daniel F; Kuiper, Rowan; Stephens, Owen W; Bertsch, Uta; Broderick, Peter; Campo, Chiara; Einsele, Hermann; Gregory, Walter A; Gullberg, Urban; Henrion, Marc; Hillengass, Jens; Hoffmann, Per; Jackson, Graham H; Johnsson, Ellinor; Jöud, Magnus; Kristinsson, Sigurður Y; Lenhoff, Stig; Lenive, Oleg; Mellqvist, Ulf-Henrik; Migliorini, Gabriele; Nahi, Hareth; Nelander, Sven; Nickel, Jolanta; Nöthen, Markus M; Rafnar, Thorunn; Ross, Fiona M; da Silva Filho, Miguel Inacio; Swaminathan, Bhairavi; Thomsen, Hauke; Turesson, Ingemar; Vangsted, Annette; Vogel, Ulla; Waage, Anders; Walker, Brian A; Wihlborg, Anna-Karin; Broyl, Annemiek; Davies, Faith E; Thorsteinsdottir, Unnur; Langer, Christian; Hansson, Markus; Kaiser, Martin; Sonneveld, Pieter; Stefansson, Kari; Morgan, Gareth J; Goldschmidt, Hartmut; Hemminki, Kari; Nilsson, Björn; Houlston, Richard S


    Multiple myeloma (MM) is a plasma cell malignancy with a significant heritable basis. Genome-wide association studies have transformed our understanding of MM predisposition, but individual studies have had limited power to discover risk loci. Here we perform a meta-analysis of these GWAS, add a new GWAS and perform replication analyses resulting in 9,866 cases and 239,188 controls. We confirm all nine known risk loci and discover eight new loci at 6p22.3 (rs34229995, P=1.31 × 10(-8)), 6q21 (rs9372120, P=9.09 × 10(-15)), 7q36.1 (rs7781265, P=9.71 × 10(-9)), 8q24.21 (rs1948915, P=4.20 × 10(-11)), 9p21.3 (rs2811710, P=1.72 × 10(-13)), 10p12.1 (rs2790457, P=1.77 × 10(-8)), 16q23.1 (rs7193541, P=5.00 × 10(-12)) and 20q13.13 (rs6066835, P=1.36 × 10(-13)), which localize in or near to JARID2, ATG5, SMARCD3, CCAT1, CDKN2A, WAC, RFWD3 and PREX1. These findings provide additional support for a polygenic model of MM and insight into the biological basis of tumour development.

  14. Genome-wide association study for Crohn's disease in the Quebec Founder Population identifies multiple validated disease loci

    PubMed Central

    Raelson, John V.; Little, Randall D.; Ruether, Andreas; Fournier, Hélène; Paquin, Bruno; Van Eerdewegh, Paul; Bradley, W. E. C.; Croteau, Pascal; Nguyen-Huu, Quynh; Segal, Jonathan; Debrus, Sophie; Allard, René; Rosenstiel, Philip; Franke, Andre; Jacobs, Gunnar; Nikolaus, Susanna; Vidal, Jean-Michel; Szego, Peter; Laplante, Nathalie; Clark, Hilary F.; Paulussen, René J.; Hooper, John W.; Keith, Tim P.; Belouchi, Abdelmajid; Schreiber, Stefan


    Genome-wide association (GWA) studies offer a powerful unbiased method for the identification of multiple susceptibility genes for complex diseases. Here we report the results of a GWA study for Crohn's disease (CD) using family trios from the Quebec Founder Population (QFP). Haplotype-based association analyses identified multiple regions associated with the disease that met the criteria for genome-wide significance, with many containing a gene whose function appears relevant to CD. A proportion of these were replicated in two independent German Caucasian samples, including the established CD loci NOD2 and IBD5. The recently described IL23R locus was also identified and replicated. For this region, multiple individuals with all major haplotypes in the QFP were sequenced and extensive fine mapping performed to identify risk and protective alleles. Several additional loci, including a region on 3p21 containing several plausible candidate genes, a region near JAKMIP1 on 4p16.1, and two larger regions on chromosome 17 were replicated. Together with previously published loci, the spectrum of CD genes identified to date involves biochemical networks that affect epithelial defense mechanisms, innate and adaptive immune response, and the repair or remodeling of tissue. PMID:17804789

  15. Complex germline architecture: two genes intertwined on two loci.


    Kuo, Shiuhyang; Chang, Wei-Jen; Landweber, Laura F


    The germline micronuclear genome of some ciliated protists can be scrambled, with coding segments disordered relative to the expressed macronuclear genome. Here, we report a surprisingly complex pair of genes that assemble from interwoven segments on two germline loci in the ciliate Uroleptus. This baroque organization requires two scrambled genes to be disentangled from each other from two clusters in the genome, one containing segments 1-2-4-5-6-8-11-13-15-16 and the other 7-9-3-10-12-14, with pieces 1-5 comprising the first gene and 6-16 the second gene. Both genes remain linked in the somatic genome on a 1.5-kb "nanochromosome." This study is the first to reveal that two genes can become scrambled during evolution with their coding segments intertwined. These twin scrambled genes underscore the beauty and exceptions of protist genome architecture, pointing to the critical need for evolutionary biologists to survey protist genomes broadly. PMID:16162864

  16. Blood Pressure Loci Identified with a Gene-Centric Array

    PubMed Central

    Johnson, Toby; Gaunt, Tom R.; Newhouse, Stephen J.; Padmanabhan, Sandosh; Tomaszewski, Maciej; Kumari, Meena; Morris, Richard W.; Tzoulaki, Ioanna; O'Brien, Eoin T.; Poulter, Neil R.; Sever, Peter; Shields, Denis C.; Thom, Simon; Wannamethee, Sasiwarang G.; Whincup, Peter H.; Brown, Morris J.; Connell, John M.; Dobson, Richard J.; Howard, Philip J.; Mein, Charles A.; Onipinla, Abiodun; Shaw-Hawkins, Sue; Zhang, Yun; Smith, George Davey; Day, Ian N.M.; Lawlor, Debbie A.; Goodall, Alison H.; Fowkes, F. Gerald; Abecasis, Gonçalo R.; Elliott, Paul; Gateva, Vesela; Braund, Peter S.; Burton, Paul R.; Nelson, Christopher P.; Tobin, Martin D.; van der Harst, Pim; Glorioso, Nicola; Neuvrith, Hani; Salvi, Erika; Staessen, Jan A.; Stucchi, Andrea; Devos, Nabila; Jeunemaitre, Xavier; Plouin, Pierre-François; Tichet, Jean; Juhanson, Peeter; Org, Elin; Putku, Margus; Sõber, Siim; Veldre, Gudrun; Viigimaa, Margus; Levinsson, Anna; Rosengren, Annika; Thelle, Dag S.; Hastie, Claire E.; Hedner, Thomas; Lee, Wai K.; Melander, Olle; Wahlstrand, Björn; Hardy, Rebecca; Wong, Andrew; Cooper, Jackie A.; Palmen, Jutta; Chen, Li; Stewart, Alexandre F.R.; Wells, George A.; Westra, Harm-Jan; Wolfs, Marcel G.M.; Clarke, Robert; Franzosi, Maria Grazia; Goel, Anuj; Hamsten, Anders; Lathrop, Mark; Peden, John F.; Seedorf, Udo; Watkins, Hugh; Ouwehand, Willem H.; Sambrook, Jennifer; Stephens, Jonathan; Casas, Juan-Pablo; Drenos, Fotios; Holmes, Michael V.; Kivimaki, Mika; Shah, Sonia; Shah, Tina; Talmud, Philippa J.; Whittaker, John; Wallace, Chris; Delles, Christian; Laan, Maris; Kuh, Diana; Humphries, Steve E.; Nyberg, Fredrik; Cusi, Daniele; Roberts, Robert; Newton-Cheh, Christopher; Franke, Lude; Stanton, Alice V.; Dominiczak, Anna F.; Farrall, Martin; Hingorani, Aroon D.; Samani, Nilesh J.; Caulfield, Mark J.; Munroe, Patricia B.


    Raised blood pressure (BP) is a major risk factor for cardiovascular disease. Previous studies have identified 47 distinct genetic variants robustly associated with BP, but collectively these explain only a few percent of the heritability for BP phenotypes. To find additional BP loci, we used a bespoke gene-centric array to genotype an independent discovery sample of 25,118 individuals that combined hypertensive case-control and general population samples. We followed up four SNPs associated with BP at our p < 8.56 × 10−7 study-specific significance threshold and six suggestively associated SNPs in a further 59,349 individuals. We identified and replicated a SNP at LSP1/TNNT3, a SNP at MTHFR-NPPB independent (r2 = 0.33) of previous reports, and replicated SNPs at AGT and ATP2B1 reported previously. An analysis of combined discovery and follow-up data identified SNPs significantly associated with BP at p < 8.56 × 10−7 at four further loci (NPR3, HFE, NOS3, and SOX6). The high number of discoveries made with modest genotyping effort can be attributed to using a large-scale yet targeted genotyping array and to the development of a weighting scheme that maximized power when meta-analyzing results from samples ascertained with extreme phenotypes, in combination with results from nonascertained or population samples. Chromatin immunoprecipitation and transcript expression data highlight potential gene regulatory mechanisms at the MTHFR and NOS3 loci. These results provide candidates for further study to help dissect mechanisms affecting BP and highlight the utility of studying SNPs and samples that are independent of those studied previously even when the sample size is smaller than that in previous studies. PMID:22100073

  17. Immunochip analysis identifies multiple susceptibility loci for systemic sclerosis.


    Mayes, Maureen D; Bossini-Castillo, Lara; Gorlova, Olga; Martin, José Ezequiel; Zhou, Xiaodong; Chen, Wei V; Assassi, Shervin; Ying, Jun; Tan, Filemon K; Arnett, Frank C; Reveille, John D; Guerra, Sandra; Teruel, María; Carmona, Francisco David; Gregersen, Peter K; Lee, Annette T; López-Isac, Elena; Ochoa, Eguzkine; Carreira, Patricia; Simeón, Carmen Pilar; Castellví, Iván; González-Gay, Miguel Ángel; Zhernakova, Alexandra; Padyukov, Leonid; Alarcón-Riquelme, Marta; Wijmenga, Cisca; Brown, Matthew; Beretta, Lorenzo; Riemekasten, Gabriela; Witte, Torsten; Hunzelmann, Nicolas; Kreuter, Alexander; Distler, Jörg H W; Voskuyl, Alexandre E; Schuerwegh, Annemie J; Hesselstrand, Roger; Nordin, Annika; Airó, Paolo; Lunardi, Claudio; Shiels, Paul; van Laar, Jacob M; Herrick, Ariane; Worthington, Jane; Denton, Christopher; Wigley, Fredrick M; Hummers, Laura K; Varga, John; Hinchcliff, Monique E; Baron, Murray; Hudson, Marie; Pope, Janet E; Furst, Daniel E; Khanna, Dinesh; Phillips, Kristin; Schiopu, Elena; Segal, Barbara M; Molitor, Jerry A; Silver, Richard M; Steen, Virginia D; Simms, Robert W; Lafyatis, Robert A; Fessler, Barri J; Frech, Tracy M; Alkassab, Firas; Docherty, Peter; Kaminska, Elzbieta; Khalidi, Nader; Jones, Henry Niall; Markland, Janet; Robinson, David; Broen, Jasper; Radstake, Timothy R D J; Fonseca, Carmen; Koeleman, Bobby P; Martin, Javier


    In this study, 1,833 systemic sclerosis (SSc) cases and 3,466 controls were genotyped with the Immunochip array. Classical alleles, amino acid residues, and SNPs across the human leukocyte antigen (HLA) region were imputed and tested. These analyses resulted in a model composed of six polymorphic amino acid positions and seven SNPs that explained the observed significant associations in the region. In addition, a replication step comprising 4,017 SSc cases and 5,935 controls was carried out for several selected non-HLA variants, reaching a total of 5,850 cases and 9,401 controls of European ancestry. Following this strategy, we identified and validated three SSc risk loci, including DNASE1L3 at 3p14, the SCHIP1-IL12A locus at 3q25, and ATG5 at 6q21, as well as a suggested association of the TREH-DDX6 locus at 11q23. The associations of several previously reported SSc risk loci were validated and further refined, and the observed peak of association in PXK was related to DNASE1L3. Our study has increased the number of known genetic associations with SSc, provided further insight into the pleiotropic effects of shared autoimmune risk factors, and highlighted the power of dense mapping for detecting previously overlooked susceptibility loci.

  18. Immunochip Analysis Identifies Multiple Susceptibility Loci for Systemic Sclerosis

    PubMed Central

    Mayes, Maureen D.; Bossini-Castillo, Lara; Gorlova, Olga; Martin, José Ezequiel; Zhou, Xiaodong; Chen, Wei V.; Assassi, Shervin; Ying, Jun; Tan, Filemon K.; Arnett, Frank C.; Reveille, John D.; Guerra, Sandra; Teruel, María; Carmona, Francisco David; Gregersen, Peter K.; Lee, Annette T.; López-Isac, Elena; Ochoa, Eguzkine; Carreira, Patricia; Simeón, Carmen Pilar; Castellví, Iván; González-Gay, Miguel Ángel; Ortego-Centeno, Norberto; Ríos, Raquel; Callejas, José Luis; Navarrete, Nuria; García Portales, Rosa; Camps, María Teresa; Fernández-Nebro, Antonio; González-Escribano, María F.; Sánchez-Román, Julio; García-Hernández, Francisco José; Castillo, María Jesús; Aguirre, María Ángeles; Gómez-Gracia, Inmaculada; Fernández-Gutiérrez, Benjamín; Rodríguez-Rodríguez, Luis; Vicente, Esther; Andreu, José Luis; Fernández de Castro, Mónica; García de la Peña, Paloma; López-Longo, Francisco Javier; Martínez, Lina; Fonollosa, Vicente; Espinosa, Gerard; Tolosa, Carlos; Pros, Anna; Rodríguez Carballeira, Mónica; Narváez, Francisco Javier; Rubio Rivas, Manel; Ortiz Santamaría, Vera; Díaz, Bernardino; Trapiella, Luis; Freire, María del Carmen; Sousa, Adrián; Egurbide, María Victoria; Fanlo Mateo, Patricia; Sáez-Comet, Luis; Díaz, Federico; Hernández, Vanesa; Beltrán, Emma; Román-Ivorra, José Andrés; Grau, Elena; Alegre Sancho, Juan José; Blanco García, Francisco J.; Oreiro, Natividad; Fernández Sueiro, Luis; Zhernakova, Alexandra; Padyukov, Leonid; Alarcón-Riquelme, Marta; Wijmenga, Cisca; Brown, Matthew; Beretta, Lorenzo; Riemekasten, Gabriela; Witte, Torsten; Hunzelmann, Nicolas; Kreuter, Alexander; Distler, Jörg H.W.; Voskuyl, Alexandre E.; Schuerwegh, Annemie J.; Hesselstrand, Roger; Nordin, Annika; Airó, Paolo; Lunardi, Claudio; Shiels, Paul; van Laar, Jacob M.; Herrick, Ariane; Worthington, Jane; Denton, Christopher; Wigley, Fredrick M.; Hummers, Laura K.; Varga, John; Hinchcliff, Monique E.; Baron, Murray; Hudson, Marie; Pope, Janet E.; Furst, Daniel E.; Khanna, Dinesh; Phillips, Kristin; Schiopu, Elena; Segal, Barbara M.; Molitor, Jerry A.; Silver, Richard M.; Steen, Virginia D.; Simms, Robert W.; Lafyatis, Robert A.; Fessler, Barri J.; Frech, Tracy M.; AlKassab, Firas; Docherty, Peter; Kaminska, Elzbieta; Khalidi, Nader; Jones, Henry Niall; Markland, Janet; Robinson, David; Broen, Jasper; Radstake, Timothy R.D.J.; Fonseca, Carmen; Koeleman, Bobby P.; Martin, Javier


    In this study, 1,833 systemic sclerosis (SSc) cases and 3,466 controls were genotyped with the Immunochip array. Classical alleles, amino acid residues, and SNPs across the human leukocyte antigen (HLA) region were imputed and tested. These analyses resulted in a model composed of six polymorphic amino acid positions and seven SNPs that explained the observed significant associations in the region. In addition, a replication step comprising 4,017 SSc cases and 5,935 controls was carried out for several selected non-HLA variants, reaching a total of 5,850 cases and 9,401 controls of European ancestry. Following this strategy, we identified and validated three SSc risk loci, including DNASE1L3 at 3p14, the SCHIP1-IL12A locus at 3q25, and ATG5 at 6q21, as well as a suggested association of the TREH-DDX6 locus at 11q23. The associations of several previously reported SSc risk loci were validated and further refined, and the observed peak of association in PXK was related to DNASE1L3. Our study has increased the number of known genetic associations with SSc, provided further insight into the pleiotropic effects of shared autoimmune risk factors, and highlighted the power of dense mapping for detecting previously overlooked susceptibility loci. PMID:24387989

  19. Quantitative trait loci for flowering time and morphological traits in multiple populations of Brassica rapa.


    Lou, Ping; Zhao, Jianjun; Kim, Jung Sun; Shen, Shuxing; Del Carpio, Dunia Pino; Song, Xiaofei; Jin, Mina; Vreugdenhil, Dick; Wang, Xiaowu; Koornneef, Maarten; Bonnema, Guusje


    Wide variation for morphological traits exists in Brassica rapa and the genetic basis of this morphological variation is largely unknown. Here is a report on quantitative trait loci (QTL) analysis of flowering time, seed and pod traits, growth-related traits, leaf morphology, and turnip formation in B. rapa using multiple populations. The populations resulted from crosses between the following accessions: Rapid cycling, Chinese cabbage, Yellow sarson, Pak choi, and a Japanese vegetable turnip variety. A total of 27 QTL affecting 20 morphological traits were detected, including eight QTL for flowering time, six for seed traits, three for growth-related traits and 10 for leaf traits. One major QTL was found for turnip formation. Principal component analysis and co-localization of QTL indicated that some loci controlling leaf and seed-related traits and those for flowering time and turnip formation might be the same. The major flowering time QTL detected in all populations on linkage group R02 co-localized with BrFLC2. One major QTL, controlling turnip formation, was also mapped at this locus. The genes that may underly this QTL and comparative analyses between the four populations and with Arabidopsis thaliana are discussed.

  20. Multiple loci on 8q24 associated with prostate cancer susceptibility.


    Al Olama, Ali Amin; Kote-Jarai, Zsofia; Giles, Graham G; Guy, Michelle; Morrison, Jonathan; Severi, Gianluca; Leongamornlert, Daniel A; Tymrakiewicz, Malgorzata; Jhavar, Sameer; Saunders, Ed; Hopper, John L; Southey, Melissa C; Muir, Kenneth R; English, Dallas R; Dearnaley, David P; Ardern-Jones, Audrey T; Hall, Amanda L; O'Brien, Lynne T; Wilkinson, Rosemary A; Sawyer, Emma; Lophatananon, Artitaya; Horwich, Alan; Huddart, Robert A; Khoo, Vincent S; Parker, Christopher C; Woodhouse, Christopher J; Thompson, Alan; Christmas, Tim; Ogden, Chris; Cooper, Colin; Donovan, Jenny L; Hamdy, Freddie C; Neal, David E; Eeles, Rosalind A; Easton, Douglas F


    Previous studies have identified multiple loci on 8q24 associated with prostate cancer risk. We performed a comprehensive analysis of SNP associations across 8q24 by genotyping tag SNPs in 5,504 prostate cancer cases and 5,834 controls. We confirmed associations at three previously reported loci and identified additional loci in two other linkage disequilibrium blocks (rs1006908: per-allele OR = 0.87, P = 7.9 x 10(-8); rs620861: OR = 0.90, P = 4.8 x 10(-8)). Eight SNPs in five linkage disequilibrium blocks were independently associated with prostate cancer susceptibility. PMID:19767752

  1. Multiple loci on 8q24 associated with prostate cancer susceptibility.


    Al Olama, Ali Amin; Kote-Jarai, Zsofia; Giles, Graham G; Guy, Michelle; Morrison, Jonathan; Severi, Gianluca; Leongamornlert, Daniel A; Tymrakiewicz, Malgorzata; Jhavar, Sameer; Saunders, Ed; Hopper, John L; Southey, Melissa C; Muir, Kenneth R; English, Dallas R; Dearnaley, David P; Ardern-Jones, Audrey T; Hall, Amanda L; O'Brien, Lynne T; Wilkinson, Rosemary A; Sawyer, Emma; Lophatananon, Artitaya; Horwich, Alan; Huddart, Robert A; Khoo, Vincent S; Parker, Christopher C; Woodhouse, Christopher J; Thompson, Alan; Christmas, Tim; Ogden, Chris; Cooper, Colin; Donovan, Jenny L; Hamdy, Freddie C; Neal, David E; Eeles, Rosalind A; Easton, Douglas F


    Previous studies have identified multiple loci on 8q24 associated with prostate cancer risk. We performed a comprehensive analysis of SNP associations across 8q24 by genotyping tag SNPs in 5,504 prostate cancer cases and 5,834 controls. We confirmed associations at three previously reported loci and identified additional loci in two other linkage disequilibrium blocks (rs1006908: per-allele OR = 0.87, P = 7.9 x 10(-8); rs620861: OR = 0.90, P = 4.8 x 10(-8)). Eight SNPs in five linkage disequilibrium blocks were independently associated with prostate cancer susceptibility.

  2. Fast and Accurate Detection of Multiple Quantitative Trait Loci

    PubMed Central

    Nettelblad, Carl; Holmgren, Sverker


    Abstract We present a new computational scheme that enables efficient and reliable quantitative trait loci (QTL) scans for experimental populations. Using a standard brute-force exhaustive search effectively prohibits accurate QTL scans involving more than two loci to be performed in practice, at least if permutation testing is used to determine significance. Some more elaborate global optimization approaches, for example, DIRECT have been adopted earlier to QTL search problems. Dramatic speedups have been reported for high-dimensional scans. However, since a heuristic termination criterion must be used in these types of algorithms, the accuracy of the optimization process cannot be guaranteed. Indeed, earlier results show that a small bias in the significance thresholds is sometimes introduced. Our new optimization scheme, PruneDIRECT, is based on an analysis leading to a computable (Lipschitz) bound on the slope of a transformed objective function. The bound is derived for both infinite- and finite-size populations. Introducing a Lipschitz bound in DIRECT leads to an algorithm related to classical Lipschitz optimization. Regions in the search space can be permanently excluded (pruned) during the optimization process. Heuristic termination criteria can thus be avoided. Hence, PruneDIRECT has a well-defined error bound and can in practice be guaranteed to be equivalent to a corresponding exhaustive search. We present simulation results that show that for simultaneous mapping of three QTLS using permutation testing, PruneDIRECT is typically more than 50 times faster than exhaustive search. The speedup is higher for stronger QTL. This could be used to quickly detect strong candidate eQTL networks. PMID:23919387

  3. Identification of Multiple Genetic Susceptibility Loci in Takayasu Arteritis

    PubMed Central

    Saruhan-Direskeneli, Güher; Hughes, Travis; Aksu, Kenan; Keser, Gokhan; Coit, Patrick; Aydin, Sibel Z.; Alibaz-Oner, Fatma; Kamalı, Sevil; Inanc, Murat; Carette, Simon; Hoffman, Gary S.; Akar, Servet; Onen, Fatos; Akkoc, Nurullah; Khalidi, Nader A.; Koening, Curry; Karadag, Omer; Kiraz, Sedat; Langford, Carol A.; McAlear, Carol A.; Ozbalkan, Zeynep; Ates, Askin; Karaaslan, Yasar; Maksimowicz-McKinnon, Kathleen; Monach, Paul A.; Ozer, Hüseyin T.; Seyahi, Emire; Fresko, Izzet; Cefle, Ayse; Seo, Philip; Warrington, Kenneth J.; Ozturk, Mehmet A.; Ytterberg, Steven R.; Cobankara, Veli; Onat, A. Mesut; Guthridge, Joel M.; James, Judith A.; Tunc, Ercan; Duzgun, Nurşen; Bıcakcıgil, Muge; Yentür, Sibel P.; Merkel, Peter A.; Direskeneli, Haner; Sawalha, Amr H.


    Takayasu arteritis is a rare inflammatory disease of large arteries. The etiology of Takayasu arteritis remains poorly understood, but genetic contribution to the disease pathogenesis is supported by the genetic association with HLA-B∗52. We genotyped ∼200,000 genetic variants in two ethnically divergent Takayasu arteritis cohorts from Turkey and North America by using a custom-designed genotyping platform (Immunochip). Additional genetic variants and the classical HLA alleles were imputed and analyzed. We identified and confirmed two independent susceptibility loci within the HLA region (r2 < 0.2): HLA-B/MICA (rs12524487, OR = 3.29, p = 5.57 × 10−16) and HLA-DQB1/HLA-DRB1 (rs113452171, OR = 2.34, p = 3.74 × 10−9; and rs189754752, OR = 2.47, p = 4.22 × 10−9). In addition, we identified and confirmed a genetic association between Takayasu arteritis and the FCGR2A/FCGR3A locus on chromosome 1 (rs10919543, OR = 1.81, p = 5.89 × 10−12). The risk allele in this locus results in increased mRNA expression of FCGR2A. We also established the genetic association between IL12B and Takayasu arteritis (rs56167332, OR = 1.54, p = 2.18 × 10−8). PMID:23830517

  4. Temporal and multiple quantitative trait loci analyses of resistance to bacterial wilt in tomato permit the resolution of linked loci.


    Mangin, B; Thoquet, P; Olivier, J; Grimsley, N H


    Ralstonia solanacearum is a soil-borne bacterium that causes the serious disease known as bacterial wilt in many plant species. In tomato, several QTL controlling resistance have been found, but in different studies, markers spanning a large region of chromosome 6 showed strong association with the resistance. By using two different approaches to analyze the data from a field test F3 population, we show that at least two separate loci approximately 30 cM apart on this chromosome are most likely involved in the resistance. First, a temporal analysis of the progression of symptoms reveals a distal locus early in the development of the disease. As the disease progresses, the maximum LOD peak observed shifts toward the proximal end of the chromosome, obscuring the distal locus. Second, although classical interval mapping could only detect the presence of one locus, a statistical "two-QTL model" test, specifically adapted for the resolution of linked QTL, strongly supported the hypothesis for the presence of two loci. These results are discussed in the context of current molecular knowledge about disease resistance genes on chromosome 6 and observations made by tomato breeders during the production of bacterial wilt-resistant varieties. PMID:10049932

  5. Temporal and multiple quantitative trait loci analyses of resistance to bacterial wilt in tomato permit the resolution of linked loci.

    PubMed Central

    Mangin, B; Thoquet, P; Olivier, J; Grimsley, N H


    Ralstonia solanacearum is a soil-borne bacterium that causes the serious disease known as bacterial wilt in many plant species. In tomato, several QTL controlling resistance have been found, but in different studies, markers spanning a large region of chromosome 6 showed strong association with the resistance. By using two different approaches to analyze the data from a field test F3 population, we show that at least two separate loci approximately 30 cM apart on this chromosome are most likely involved in the resistance. First, a temporal analysis of the progression of symptoms reveals a distal locus early in the development of the disease. As the disease progresses, the maximum LOD peak observed shifts toward the proximal end of the chromosome, obscuring the distal locus. Second, although classical interval mapping could only detect the presence of one locus, a statistical "two-QTL model" test, specifically adapted for the resolution of linked QTL, strongly supported the hypothesis for the presence of two loci. These results are discussed in the context of current molecular knowledge about disease resistance genes on chromosome 6 and observations made by tomato breeders during the production of bacterial wilt-resistant varieties. PMID:10049932

  6. Multiple mouse chromosomal loci for dynein-based motility

    SciTech Connect

    Vaughan, K.T.; Mikami, Atsushi; Paschal, B.M.


    Dyneins are multisubunit mechanochemical enzymes capable of interacting with microtubules to generate force. Axonemal dyneins produce the motive force for ciliary and flagellar beating by inducing sliding between adjacent microtubules within the axoneme. Cytoplasmic dyneins translocate membranous organelles and chromosomes toward the minus ends of cytoplasmic microtubules. Dynactin is an accessory complex implicated in tethering cytoplasmic dynein to membranous organelles and mitotic kinetochores. In the studies described here, we have identified a number of new dynein genes and determined their mouse chromosomal locations by interspecific backcross analysis. We have also mapped several dynein and dynactin genes cloned previously. Our studies provide the first comprehensive attempt to map dynein and dynactin genes in mammals and provide a basis for the further analysis of dynein function in development and disease. 65 refs., 6 figs., 1 tab.

  7. Evidence for multiple MHC class II β loci in New Zealand's critically endangered kakapo, Strigops habroptilus.


    Knafler, Gabrielle J; Fidler, Andrew; Jamieson, Ian G; Robertson, Bruce C


    Immunologically important genes of the major histocompatibility complex (MHC) have been characterized in a number of avian species with the general finding of considerable variation in size and structural organization among organisms. A range of nonpasserines which represent early-diverging Neoave lineages have been described as having only one MHC class II β locus potentially leading to the conclusion that this is the ancestral condition. Here, we examine the monotypic, early-diverging, critically endangered kakapo, Strigops habroptilus, for allelic variation at MHC class II β exon 2, as part of species' recovery efforts. We found two to four confirmed sequence variants per individual indicating the presence of more than one MHC class II β locus. Given the kakapo's basal evolutionary status, evidence for multiple MHC class II β loci seems to counter the proposed mono-locus history of modern birds. However, MHC gene duplication, maintenance, and loss among and within bird species may confound avian relationships making it difficult to elucidate the ancestral state. This study adds essential data for disentangling the course of MHC structural evolution in birds.

  8. Analysis of putative resistance gene loci in UK field populations of Haemonchus contortus after 6years of macrocyclic lactone use.


    Laing, Roz; Maitland, Kirsty; Lecová, Lenka; Skuce, Philip J; Tait, Andy; Devaney, Eileen


    Sheep farmers in the UK rely on strategic anthelmintic use to treat and control gastrointestinal roundworms in their flocks. However, resistance to these drugs is now widespread and threatens the sustainability of sheep production. The mechanisms underlying resistance to the most commonly used class, the macrocyclic lactones, are not known and sensitive diagnostic tools based on molecular markers are not currently available. This prohibits accurate surveillance of resistance or assessment of strategies aimed at controlling its spread. In this study, we examined four UK field populations of Haemonchus contortus, differing in macrocyclic lactone treatment history, for evidence of selection at 'candidate gene' loci identified as determining macrocyclic lactone resistance in previously published research. Individual worms were genotyped at Hc-lgc-37, Hc-glc-5, Hc-avr-14 and Hc-dyf-7, and four microsatellite loci. High levels of polymorphism were identified at the first three candidate gene loci with remarkably little polymorphism at Hc-dyf-7. While some between-population comparisons of individual farms with and without long-term macrocyclic lactone use identified statistically significant differences in allele frequency and/or fixation index at the Hc-lgc-37, Hc-glc-5 or Hc-avr-14 loci, we found no consistent evidence of selection in other equivalent comparisons. While it is possible that different mechanisms are important in different populations or that resistance may be conferred by small changes at multiple loci, our findings suggest that these are unlikely to be major loci conferring macrocyclic lactone resistance on UK farms or suitable for diagnostic marker development. More powerful approaches, using genome-wide or whole genome sequencing, may be required to define macrocyclic lactone resistance loci in such genetically variable populations. PMID:27179994

  9. Gene duplication in tetraploid fish: model for gene silencing at unlinked duplicated loci.

    PubMed Central

    Bailey, G S; Poulter, R T; Stockwell, P A


    Several groups of fishes, including salmonids and catastomids, appear to have originated through genome duplication events. However, these two groups retain approximately 50% of the loci examined as functioning duplicates, despite the passage of 50 million years or more of mutation and selection. Although other effects are not excluded, this apparently slow rate of duplicate silencing can be explained in terms of the effects of selection against defective double homozygotes to unlinked duplicates. We have derived a computer simulation of genetic drift that affords direct evaluation of the effects of population size (N), mutation rate (micron), initial allele frequencies, back mutation, fitness, and time on the probability of fixation for null alleles at unlinked duplicate loci. The results show that this probability is approximately linearly related to population size for N greater than or equal to 10(3). Specifically, for naive populations, the time for 50% probability of gene silencing is approximately equal to 15N + micron-3/4 generations. The retention of 50% of the loci as functional duplicates may therefore result from the large effective size of salmonid and catastomid populations. The results also show that, under most conditions for populations of 2000--3000 or larger, unlinked duplicate loci will be sustained in the functional state longer than tandem (linked) duplicates and hence are available for evolution of new functions for a longer time. PMID:281706

  10. Association of single nucleotide polymorphisms in candidate genes residing under quantitative trait loci in beef cattle

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The objective was to assess the association of single nucleotide polymorphisms (SNP) developed on candidate genes residing under previously identified quantitative trait loci for marbling score and meat tenderness. Two hundred five SNP were identified on twenty candidate genes. Genes selected under ...

  11. Combining Data From Multiple Inbred Line Crosses Improves the Power and Resolution of Quantitative Trait Loci Mapping

    PubMed Central

    Li, Renhua; Lyons, Malcolm A.; Wittenburg, Henning; Paigen, Beverly; Churchill, Gary A.


    Rodent inbred line crosses are widely used to map genetic loci associated with complex traits. This approach has proven to be powerful for detecting quantitative trait loci (QTL); however, the resolution of QTL locations, typically ∼20 cM, means that hundreds of genes are implicated as potential candidates. We describe analytical methods based on linear models to combine information available in two or more inbred line crosses. Our strategy is motivated by the hypothesis that common inbred strains of the laboratory mouse are derived from a limited ancestral gene pool and thus QTL detected in multiple crosses are likely to represent shared ancestral polymorphisms. We demonstrate that the combined-cross analysis can improve the power to detect weak QTL, can narrow support intervals for QTL regions, and can be used to separate multiple QTL that colocalize by chance. Moreover, combined-cross analysis can establish the allelic states of a QTL among a set of parental lines, thus providing critical information for narrowing QTL regions by haplotype analysis. PMID:15654110

  12. Candidate gene loci in asthmatic and allergic inflammation.

    PubMed Central

    Wilkinson, J.; Holgate, S. T.


    New techniques for scanning the human genome promise great advances in tracking the origins of disorders caused by multiple genes. However, it is clear from the studies presented in this overview that we are far from understanding the genetic basis of asthma and atopy and their interaction with the environment. It is also clear that agreement must be reached on definition of the phenotype and methods of ascertainment in order to carry out large multicentre collaborative studies. Positive findings need to be validated in different populations selected for the presence of the disease and then confirmed in a random population where the prevalence of asthma and atopy will also be expected to be significant. PMID:8658365

  13. Highly expressed loci are vulnerable to misleading ChIP localization of multiple unrelated proteins.


    Teytelman, Leonid; Thurtle, Deborah M; Rine, Jasper; van Oudenaarden, Alexander


    Chromatin immunoprecipitation (ChIP) is the gold-standard technique for localizing nuclear proteins in the genome. We used ChIP, in combination with deep sequencing (Seq), to study the genome-wide distribution of the Silent information regulator (Sir) complex in Saccharomyces cerevisiae. We analyzed ChIP-Seq peaks of the Sir2, Sir3, and Sir4 silencing proteins and discovered 238 unexpected euchromatic loci that exhibited enrichment of all three. Surprisingly, published ChIP-Seq datasets for the Ste12 transcription factor and the centromeric Cse4 protein indicated that these proteins were also enriched in the same euchromatic regions with the high Sir protein levels. The 238 loci, termed "hyper-ChIPable", were in highly expressed regions with strong polymerase II and polymerase III enrichment signals, and the correlation between transcription level and ChIP enrichment was not limited to these 238 loci but extended genome-wide. The apparent enrichment of various proteins at hyper-ChIPable loci was not a consequence of artifacts associated with deep sequencing methods, as confirmed by ChIP-quantitative PCR. The localization of unrelated proteins, including the entire silencing complex, to the most highly transcribed genes was highly suggestive of a technical issue with the immunoprecipitations. ChIP-Seq on chromatin immunoprecipitated with a nuclear-localized GFP reproduced the above enrichment in an expression-dependent manner: induction of the GAL genes resulted in an increased ChIP signal of the GFP protein at these loci, with presumably no biological relevance. Whereas ChIP is a broadly valuable technique, some published conclusions based upon ChIP procedures may merit reevaluation in light of these findings.

  14. Genome-wide association study identifies multiple susceptibility loci for craniofacial microsomia.


    Zhang, Yong-Biao; Hu, Jintian; Zhang, Jiao; Zhou, Xu; Li, Xin; Gu, Chaohao; Liu, Tun; Xie, Yangchun; Liu, Jiqiang; Gu, Mingliang; Wang, Panpan; Wu, Tingting; Qian, Jin; Wang, Yue; Dong, Xiaoqun; Yu, Jun; Zhang, Qingguo


    Craniofacial microsomia (CFM) is a rare congenital anomaly that involves immature derivatives from the first and second pharyngeal arches. The genetic pathogenesis of CFM is still unclear. Here we interrogate 0.9 million genetic variants in 939 CFM cases and 2,012 controls from China. After genotyping of an additional 443 cases and 1,669 controls, we identify 8 significantly associated loci with the most significant SNP rs13089920 (logistic regression P=2.15 × 10(-120)) and 5 suggestive loci. The above 13 associated loci, harboured by candidates of ROBO1, GATA3, GBX2, FGF3, NRP2, EDNRB, SHROOM3, SEMA7A, PLCD3, KLF12 and EPAS1, are found to be enriched for genes involved in neural crest cell (NCC) development and vasculogenesis. We then perform whole-genome sequencing on 21 samples from the case cohort, and identify several novel loss-of-function mutations within the associated loci. Our results provide new insights into genetic background of craniofacial microsomia. PMID:26853712

  15. Genome-wide association study identifies multiple susceptibility loci for craniofacial microsomia

    PubMed Central

    Zhang, Yong-Biao; Hu, Jintian; Zhang, Jiao; Zhou, Xu; Li, Xin; Gu, Chaohao; Liu, Tun; Xie, Yangchun; Liu, Jiqiang; Gu, Mingliang; Wang, Panpan; Wu, Tingting; Qian, Jin; Wang, Yue; Dong, Xiaoqun; Yu, Jun; Zhang, Qingguo


    Craniofacial microsomia (CFM) is a rare congenital anomaly that involves immature derivatives from the first and second pharyngeal arches. The genetic pathogenesis of CFM is still unclear. Here we interrogate 0.9 million genetic variants in 939 CFM cases and 2,012 controls from China. After genotyping of an additional 443 cases and 1,669 controls, we identify 8 significantly associated loci with the most significant SNP rs13089920 (logistic regression P=2.15 × 10−120) and 5 suggestive loci. The above 13 associated loci, harboured by candidates of ROBO1, GATA3, GBX2, FGF3, NRP2, EDNRB, SHROOM3, SEMA7A, PLCD3, KLF12 and EPAS1, are found to be enriched for genes involved in neural crest cell (NCC) development and vasculogenesis. We then perform whole-genome sequencing on 21 samples from the case cohort, and identify several novel loss-of-function mutations within the associated loci. Our results provide new insights into genetic background of craniofacial microsomia. PMID:26853712

  16. Synteny conservation of the Huntington's disease gene and surrounding loci on mouse Chromosome 5.


    Grosson, C L; MacDonald, M E; Duyao, M P; Ambrose, C M; Roffler-Tarlov, S; Gusella, J F


    The mouse homologs of the Huntington's disease (HD) gene and 17 other human Chromosome (Chr) 4 loci (including six previously unmapped) were localized by use of an interspecific cross. All loci mapped in a continuous linkage group on mouse Chr 5, distal to En2 and I16, whose human counterparts are located on Chr 7. The relative order of the loci on human Chr 4 and mouse Chr 5 was maintained, except for a break between D5H4S115E and Idua/rd, with relocation of the latter to the opposite end of the map. The mouse HD homolog (Hdh) mapped within a cluster of seven genes that were completely linked in our data set. In human these loci span a approximately 1.8 Mb stretch of human 4p16.3 that has been entirely cloned. To date, there is no phenotypic correspondence between human and mouse mutations mapping to this region of synteny conservation.

  17. Loci influencing blood pressure identified using a cardiovascular gene-centric array

    PubMed Central

    Ganesh, Santhi K.; Tragante, Vinicius; Guo, Wei; Guo, Yiran; Lanktree, Matthew B.; Smith, Erin N.; Johnson, Toby; Castillo, Berta Almoguera; Barnard, John; Baumert, Jens; Chang, Yen-Pei Christy; Elbers, Clara C.; Farrall, Martin; Fischer, Mary E.; Franceschini, Nora; Gaunt, Tom R.; Gho, Johannes M.I.H.; Gieger, Christian; Gong, Yan; Isaacs, Aaron; Kleber, Marcus E.; Leach, Irene Mateo; McDonough, Caitrin W.; Meijs, Matthijs F.L.; Mellander, Olle; Molony, Cliona M.; Nolte, Ilja M.; Padmanabhan, Sandosh; Price, Tom S.; Rajagopalan, Ramakrishnan; Shaffer, Jonathan; Shah, Sonia; Shen, Haiqing; Soranzo, Nicole; van der Most, Peter J.; Van Iperen, Erik P.A.; Van Setten, Jessic A.; Vonk, Judith M.; Zhang, Li; Beitelshees, Amber L.; Berenson, Gerald S.; Bhatt, Deepak L.; Boer, Jolanda M.A.; Boerwinkle, Eric; Burkley, Ben; Burt, Amber; Chakravarti, Aravinda; Chen, Wei; Cooper-DeHoff, Rhonda M.; Curtis, Sean P.; Dreisbach, Albert; Duggan, David; Ehret, Georg B.; Fabsitz, Richard R.; Fornage, Myriam; Fox, Ervin; Furlong, Clement E.; Gansevoort, Ron T.; Hofker, Marten H.; Hovingh, G. Kees; Kirkland, Susan A.; Kottke-Marchant, Kandice; Kutlar, Abdullah; LaCroix, Andrea Z.; Langaee, Taimour Y.; Li, Yun R.; Lin, Honghuang; Liu, Kiang; Maiwald, Steffi; Malik, Rainer; Murugesan, Gurunathan; Newton-Cheh, Christopher; O'Connell, Jeffery R.; Onland-Moret, N. Charlotte; Ouwehand, Willem H.; Palmas, Walter; Penninx, Brenda W.; Pepine, Carl J.; Pettinger, Mary; Polak, Joseph F.; Ramachandran, Vasan S.; Ranchalis, Jane; Redline, Susan; Ridker, Paul M.; Rose, Lynda M.; Scharnag, Hubert; Schork, Nicholas J.; Shimbo, Daichi; Shuldiner, Alan R.; Srinivasan, Sathanur R.; Stolk, Ronald P.; Taylor, Herman A.; Thorand, Barbara; Trip, Mieke D.; van Duijn, Cornelia M.; Verschuren, W. Monique; Wijmenga, Cisca; Winkelmann, Bernhard R.; Wyatt, Sharon; Young, J. Hunter; Boehm, Bernhard O.; Caulfield, Mark J.; Chasman, Daniel I.; Davidson, Karina W.; Doevendans, Pieter A.; FitzGerald, Garret A.; Gums, John G.; Hakonarson, Hakon; Hillege, Hans L.; Illig, Thomas; Jarvik, Gail P.; Johnson, Julie A.; Kastelein, John J.P.; Koenig, Wolfgang; März, Winfried; Mitchell, Braxton D.; Murray, Sarah S.; Oldehinkel, Albertine J.; Rader, Daniel J.; Reilly, Muredach P.; Reiner, Alex P.; Schadt, Eric E.; Silverstein, Roy L.; Snieder, Harold; Stanton, Alice V.; Uitterlinden, André G.; van der Harst, Pim; van der Schouw, Yvonne T.; Samani, Nilesh J.; Johnson, Andrew D.; Munroe, Patricia B.; de Bakker, Paul I.W.; Zhu, Xiaofeng; Levy, Daniel; Keating, Brendan J.; Asselbergs, Folkert W.


    Blood pressure (BP) is a heritable determinant of risk for cardiovascular disease (CVD). To investigate genetic associations with systolic BP (SBP), diastolic BP (DBP), mean arterial pressure (MAP) and pulse pressure (PP), we genotyped ∼50 000 single-nucleotide polymorphisms (SNPs) that capture variation in ∼2100 candidate genes for cardiovascular phenotypes in 61 619 individuals of European ancestry from cohort studies in the USA and Europe. We identified novel associations between rs347591 and SBP (chromosome 3p25.3, in an intron of HRH1) and between rs2169137 and DBP (chromosome1q32.1 in an intron of MDM4) and between rs2014408 and SBP (chromosome 11p15 in an intron of SOX6), previously reported to be associated with MAP. We also confirmed 10 previously known loci associated with SBP, DBP, MAP or PP (ADRB1, ATP2B1, SH2B3/ATXN2, CSK, CYP17A1, FURIN, HFE, LSP1, MTHFR, SOX6) at array-wide significance (P < 2.4 × 10−6). We then replicated these associations in an independent set of 65 886 individuals of European ancestry. The findings from expression QTL (eQTL) analysis showed associations of SNPs in the MDM4 region with MDM4 expression. We did not find any evidence of association of the two novel SNPs in MDM4 and HRH1 with sequelae of high BP including coronary artery disease (CAD), left ventricular hypertrophy (LVH) or stroke. In summary, we identified two novel loci associated with BP and confirmed multiple previously reported associations. Our findings extend our understanding of genes involved in BP regulation, some of which may eventually provide new targets for therapeutic intervention. PMID:23303523

  18. Association analysis of GWAS and candidate gene loci in a Chinese population with coronary heart disease

    PubMed Central

    Gao, Min; Tang, Haiqin; Zheng, Xiaodong; Zhou, Fusheng; Lu, Wensheng


    Objective: Coronary heart disease (CHD), the most severe form of coronary artery disease (CAD), is a complex disease that involves a variety of genetic and environmental factors. Recently, multiple single nucleotide polymorphisms (SNPs) have been associated with CAD in Caucasians by genome-wide association (GWA) studies.However, the association of these SNPs with CHD in Asian populations has not yet been established. Here, we aim to investigate the genetic etiology of CHD in a Chinese population by genotyping SNPs previously been associated with CHD in other ethic origin in GWAS or candidate gene studies. Methods: Five SNPs, rs17114036, rs9369640, rs515135, rs579459 and rs8055236, from 5 different loci were genotyped using a sequenom Mass array system in 545CHD patients and 1008 unrelated controls from a Chinese population. Results: Our study showed that SNP rs515135 is strongly associated with CHD in a Chinese Han population (P-value=0.00333, OR=1.48). We also detected significant difference of SNP rs579459 in APOB gene in patients withsevere CAD compared to patients with mild CAD. Conclusion: SNP rs515135 is associated with the susceptibility of CHD in Chinese Han population. The location of rs515135 in the APOB gene supports its potential involvement in the pathogenesis of CAD. Our study data also support that SNP rs579459 may be associated with the severity of CHD. PMID:26221293

  19. Characterization of three loci for homologous gene targeting and transgene expression.


    Eyquem, Justin; Poirot, Laurent; Galetto, Roman; Scharenberg, Andrew M; Smith, Julianne


    Integrative gene transfer is widely used for bioproduction, drug screening, and therapeutic applications but usual viral methods lead to random and multicopy insertions, contribute to unstable transgene expression and can disturb endogenous gene expression. Homologous targeting of an expression cassette using rare-cutting endonucleases is a potential solution; however the number of studied loci remains limited. Furthermore, the behavior and performance of various types of gene cassettes following gene targeting is poorly defined. Here we have evaluated three loci for gene targeting, including one locus compatible with the proposed Safe Harbor criteria for human translational applications. Using optimized conditions for homologous gene targeting, reporter genes under the control of different promoters were efficiently inserted at each locus in both sense and antisense orientations. Sustainable expression was achieved at all three loci without detectable disturbance of flanking gene expression. However, the promoter, the integration locus and the cassette orientation have a strong impact on transgene expression. Finally, single targeted integrations exhibited greatly improved transgene expression stability versus multicopy or random integration. Taken together, our data suggest a potential set of loci for site-specific transgene integration, suitable for a variety of biotechnological applications.

  20. Genetic identification of multiple loci that control breast cancer susceptibility in the rat.

    PubMed Central

    Shepel, L A; Lan, H; Haag, J D; Brasic, G M; Gheen, M E; Simon, J S; Hoff, P; Newton, M A; Gould, M N


    We have used a rat model of induced mammary carcinomas in an effort to identify breast cancer susceptibility genes. Using genetic crosses between the carcinoma-resistant Copenhagen (COP) and carcinoma-sensitive Wistar-Furth rats, we have confirmed the identification of the Mcs1 locus that modulates tumor number. We have now also identified two additional loci, Mcs2 and Mcs3. These three loci map to chromosomes 2, 7, and 1, respectively, and interact additively to suppress mammary carcinoma development in the COP strain. They are responsible for a major portion of the tumor-resistant phenotype of the COP rat. No loss of heterozygosity was observed surrounding the three loci. A fourth COP locus, Mcs4, has also been identified on chromosome 8 and acts in contrast to increase the number of carcinomas. These results show that mammary carcinoma susceptibility in the COP rat is a polygenic trait. Interestingly, a polymorphism in the human genomic region homologous to the rat Mcs4 region is associated with an increased breast cancer risk in African-American women. The isolation of the Mcs genes may help elucidate novel mechanisms of carcinogenesis, provide information important for human breast cancer risk estimation, and also provide unique drug discovery targets for breast cancer prevention. PMID:9584103

  1. Monte Carlo comparison of preliminary methods for ordering multiple genetic loci.

    PubMed Central

    Olson, J M; Boehnke, M


    We carried out a simulation study to compare the power of eight methods for preliminary ordering of multiple genetic loci. Using linkage groups of six loci and a simple pedigree structure, we considered the effects on method performance of locus informativity, interlocus spacing, total distance along the chromosome, and sample size. Method performance was assessed using the mean rank of the true order, the proportion of replicates in which the true order was the best order, and the number of orders that needed to be considered for subsequent multipoint linkage analysis in order to include the true order with high probability. A new method which maximizes the sum of adjacent two-point maximum lod scores divided by the equivalent number of informative meioses and the previously described method which minimizes the sum of adjacent recombination fraction estimates were found to be the best overall locus-ordering methods for the situations considered, although several other methods also performed well. PMID:2393021

  2. Extended Analysis of a Genome-Wide Association Study in Primary Sclerosing Cholangitis Detects Multiple Novel Risk Loci

    PubMed Central

    Folseraas, Trine; Melum, Espen; Rausch, Philipp; Juran, Brian D.; Ellinghaus, Eva; Shiryaev, Alexey; Laerdahl, Jon K.; Ellinghaus, David; Schramm, Christoph; Weismüller, Tobias J.; Gotthardt, Daniel Nils; Hov, Johannes Roksund; Clausen, Ole Petter; Weersma, Rinse K.; Janse, Marcel; Boberg, Kirsten Muri; Björnsson, Einar; Marschall, Hanns-Ulrich; Cleynen, Isabelle; Rosenstiel, Philip; Holm, Kristian; Teufel, Andreas; Rust, Christian; Gieger, Christian; Wichmann, H-Erich; Bergquist, Annika; Ryu, Euijung; Ponsioen, Cyriel Y.; Runz, Heiko; Sterneck, Martina; Vermeire, Severine; Beuers, Ulrich; Wijmenga, Cisca; Schrumpf, Erik; Manns, Michael P.; Lazaridis, Konstantinos N.; Schreiber, Stefan; Baines, John F.; Franke, Andre; Karlsen, Tom H.


    Background & Aims A limited number of genetic risk factors have been reported in primary sclerosing cholangitis (PSC). To discover further genetic susceptibility factors for PSC, we followed up on a second tier of single nucleotide polymorphisms (SNPs) from a genome-wide association study (GWAS). Methods We analyzed 45 SNPs in 1221 PSC cases and 3508 controls. The association results from the replication analysis and the original GWAS (715 PSC cases and 2962 controls) were combined in a meta-analysis comprising 1936 PSC cases and 6470 controls. We performed an analysis of bile microbial community composition in 39 PSC patients by 16S rRNA sequencing. Results Seventeen SNPs representing 12 distinct genetic loci achieved nominal significance (Preplication<0.05) in the replication. The most robust novel association was detected at chromosome 1p36 (rs3748816; Pcombined=2.1×10−8) where the MMEL1 and TNFRSF14 genes represent potential disease genes. Eight additional novel loci showed suggestive evidence of association (Prepl<0.05). FUT2 at chromosome 19q13 (rs602662; Pcomb=1.9×10−6, rs281377; Pcomb = 2.1×10−6 and rs601338; Pcomb=2.7×10−6) is notable due to its implication in altered susceptibility to infectious agents. We found that FUT2 secretor status and genotype defined by rs601338 significantly influences biliary microbial community composition in PSC patients. Conclusions We identify multiple new PSC risk loci by extended analysis of a PSC GWAS. FUT2 genotype needs to be taken into account when assessing the influence from microbiota on biliary pathology in PSC. PMID:22521342

  3. Assignment of Functional Relevance to Genes at Type 2 Diabetes-Associated Loci Through Investigation of β-Cell Mass Deficits.


    O'Hare, Elizabeth A; Yerges-Armstrong, Laura M; Perry, James A; Shuldiner, Alan R; Zaghloul, Norann A


    Type 2 diabetes (T2D) has been associated with a large number of genomic loci, many of which encompass multiple genes without a definitive causal gene. This complexity has hindered efforts to clearly identify functional candidate genes and interpret their role in mediating susceptibility to disease. Here we examined the relevance of individual genes found at T2D-associated loci by assessing their potential contribution to a phenotype relevant to the disease state: production and maintenance of β-cell mass. Using transgenic zebrafish in which β-cell mass could be rapidly visualized in vivo, we systematically suppressed the expression of orthologs of genes found at T2D-associated genomic loci. Overall, we tested 67 orthologs, many of which had no known relevance to β-cell mass, at 62 human T2D-associated loci, including eight loci with multiple candidate genes. In total we identified 25 genes that were necessary for proper β-cell mass, providing functional evidence for their role in a physiological phenotype directly related to T2D. Of these, 16 had not previously been implicated in the regulation of β-cell mass. Strikingly, we identified single functional candidate genes at the majority of the loci for which multiple genes were analyzed. Further investigation into the contribution of the 25 genes to the adaptive capacity of β-cells suggested that the majority of genes were not required for glucose-induced expansion of β-cell mass but were significantly necessary for the regeneration of β-cells. These findings suggest that genetically programmed deficiencies in β-cell mass may be related to impaired maintenance. Finally, we investigated the relevance of our findings to human T2D onset in diabetic individuals from the Old Order Amish and found that risk alleles in β-cell mass genes were associated with significantly younger age of onset and lower body mass index. Taken together, our study offers a functional approach to assign relevance to genes at T2D

  4. Multiple loci govern the bone marrow-derived immunoregulatory mechanism controlling dominant resistance to autoimmune orchitis.

    PubMed Central

    Meeker, N D; Hickey, W F; Korngold, R; Hansen, W K; Sudweeks, J D; Wardell, B B; Griffith, J S; Teuscher, C


    The existence of immunoregulatory genes conferring dominant resistance to autoimmunity is well documented. In an effort to better understand the nature and mechanisms of action of these genes, we utilized the murine model of autoimmune orchitis as a prototype. When the orchitis-resistant strain DBA/2J is crossed with the orchitis-susceptible strain BALB/cByJ, the F1 hybrid is completely resistant to the disease. By using reciprocal radiation bone marrow chimeras, the functional component mediating this resistance was mapped to the bone marrow-derived compartment. Resistance is not a function of either low-dose irradiation- or cyclophosphamide (20 mg/kg)-sensitive immunoregulatory cells, but can be adoptively transferred by primed splenocytes. Genome exclusion mapping identified three loci controlling the resistant phenotype. Orch3 maps to chromosome 11, whereas Orch4 and Orch5 map to the telomeric and centromeric regions of chromosome 1, respectively. All three genes are linked to a number of immunologically relevant candidate loci. Most significant, however, is the linkage of Orch3 to Idd4 and Orch5 to Idd5, two susceptibility genes which play a role in autoimmune insulin-dependent type 1 diabetes mellitus in the nonobese diabetic mouse. PMID:7777570

  5. Quantitative Trait Loci for Morphological Traits and their Association with Functional Genes in Raphanus sativus

    PubMed Central

    Yu, Xiaona; Choi, Su Ryun; Dhandapani, Vignesh; Rameneni, Jana Jeevan; Li, Xiaonan; Pang, Wenxing; Lee, Ji-Young; Lim, Yong Pyo


    Identification of quantitative trait loci (QTLs) governing morphologically important traits enables to comprehend their potential genetic mechanisms in the genetic breeding program. In this study, we used 210 F2 populations derived from a cross between two radish inbred lines (Raphanus sativus) “835” and “B2,” including 258 SSR markers were used to detect QTLs for 11 morphological traits that related to whole plant, leaf, and root yield in 3 years of replicated field test. Total 55 QTLs were detected which were distributed on each linkage group of the Raphanus genome. Individual QTLs accounted for 2.69–12.6 of the LOD value, and 0.82–16.25% of phenotypic variation. Several genomic regions have multiple traits that clustered together, suggested the existence of pleiotropy linkage. Synteny analysis of the QTL regions with A. thaliana genome selected orthologous genes in radish. InDels and SNPs in the parental lines were detected in those regions by Illumina genome sequence. Five identified candidate gene-based markers were validated by co-mapping with underlying QTLs affecting different traits. Semi-quantitative reverse transcriptase PCR analysis showed the different expression levels of these five genes in parental lines. In addition, comparative QTL analysis with B. rapa revealed six common QTL regions and four key major evolutionarily conserved crucifer blocks (J, U, R, and W) harboring QTL for morphological traits. The QTL positions identified in this study will provide a valuable resource for identifying more functional genes when whole radish genome sequence is released. Candidate genes identified in this study that co-localized in QTL regions are expected to facilitate in radish breeding programs. PMID:26973691

  6. Quantitative Trait Loci for Morphological Traits and their Association with Functional Genes in Raphanus sativus.


    Yu, Xiaona; Choi, Su Ryun; Dhandapani, Vignesh; Rameneni, Jana Jeevan; Li, Xiaonan; Pang, Wenxing; Lee, Ji-Young; Lim, Yong Pyo


    Identification of quantitative trait loci (QTLs) governing morphologically important traits enables to comprehend their potential genetic mechanisms in the genetic breeding program. In this study, we used 210 F2 populations derived from a cross between two radish inbred lines (Raphanus sativus) "835" and "B2," including 258 SSR markers were used to detect QTLs for 11 morphological traits that related to whole plant, leaf, and root yield in 3 years of replicated field test. Total 55 QTLs were detected which were distributed on each linkage group of the Raphanus genome. Individual QTLs accounted for 2.69-12.6 of the LOD value, and 0.82-16.25% of phenotypic variation. Several genomic regions have multiple traits that clustered together, suggested the existence of pleiotropy linkage. Synteny analysis of the QTL regions with A. thaliana genome selected orthologous genes in radish. InDels and SNPs in the parental lines were detected in those regions by Illumina genome sequence. Five identified candidate gene-based markers were validated by co-mapping with underlying QTLs affecting different traits. Semi-quantitative reverse transcriptase PCR analysis showed the different expression levels of these five genes in parental lines. In addition, comparative QTL analysis with B. rapa revealed six common QTL regions and four key major evolutionarily conserved crucifer blocks (J, U, R, and W) harboring QTL for morphological traits. The QTL positions identified in this study will provide a valuable resource for identifying more functional genes when whole radish genome sequence is released. Candidate genes identified in this study that co-localized in QTL regions are expected to facilitate in radish breeding programs.

  7. Quantitative Trait Loci for Morphological Traits and their Association with Functional Genes in Raphanus sativus.


    Yu, Xiaona; Choi, Su Ryun; Dhandapani, Vignesh; Rameneni, Jana Jeevan; Li, Xiaonan; Pang, Wenxing; Lee, Ji-Young; Lim, Yong Pyo


    Identification of quantitative trait loci (QTLs) governing morphologically important traits enables to comprehend their potential genetic mechanisms in the genetic breeding program. In this study, we used 210 F2 populations derived from a cross between two radish inbred lines (Raphanus sativus) "835" and "B2," including 258 SSR markers were used to detect QTLs for 11 morphological traits that related to whole plant, leaf, and root yield in 3 years of replicated field test. Total 55 QTLs were detected which were distributed on each linkage group of the Raphanus genome. Individual QTLs accounted for 2.69-12.6 of the LOD value, and 0.82-16.25% of phenotypic variation. Several genomic regions have multiple traits that clustered together, suggested the existence of pleiotropy linkage. Synteny analysis of the QTL regions with A. thaliana genome selected orthologous genes in radish. InDels and SNPs in the parental lines were detected in those regions by Illumina genome sequence. Five identified candidate gene-based markers were validated by co-mapping with underlying QTLs affecting different traits. Semi-quantitative reverse transcriptase PCR analysis showed the different expression levels of these five genes in parental lines. In addition, comparative QTL analysis with B. rapa revealed six common QTL regions and four key major evolutionarily conserved crucifer blocks (J, U, R, and W) harboring QTL for morphological traits. The QTL positions identified in this study will provide a valuable resource for identifying more functional genes when whole radish genome sequence is released. Candidate genes identified in this study that co-localized in QTL regions are expected to facilitate in radish breeding programs. PMID:26973691

  8. Genome-wide association study identifies multiple loci associated with bladder cancer risk

    PubMed Central

    Figueroa, Jonine D.; Ye, Yuanqing; Siddiq, Afshan; Garcia-Closas, Montserrat; Chatterjee, Nilanjan; Prokunina-Olsson, Ludmila; Cortessis, Victoria K.; Kooperberg, Charles; Cussenot, Olivier; Benhamou, Simone; Prescott, Jennifer; Porru, Stefano; Dinney, Colin P.; Malats, Núria; Baris, Dalsu; Purdue, Mark; Jacobs, Eric J.; Albanes, Demetrius; Wang, Zhaoming; Deng, Xiang; Chung, Charles C.; Tang, Wei; Bas Bueno-de-Mesquita, H.; Trichopoulos, Dimitrios; Ljungberg, Börje; Clavel-Chapelon, Françoise; Weiderpass, Elisabete; Krogh, Vittorio; Dorronsoro, Miren; Travis, Ruth; Tjønneland, Anne; Brenan, Paul; Chang-Claude, Jenny; Riboli, Elio; Conti, David; Gago-Dominguez, Manuela; Stern, Mariana C.; Pike, Malcolm C.; Van Den Berg, David; Yuan, Jian-Min; Hohensee, Chancellor; Rodabough, Rebecca; Cancel-Tassin, Geraldine; Roupret, Morgan; Comperat, Eva; Chen, Constance; De Vivo, Immaculata; Giovannucci, Edward; Hunter, David J.; Kraft, Peter; Lindstrom, Sara; Carta, Angela; Pavanello, Sofia; Arici, Cecilia; Mastrangelo, Giuseppe; Kamat, Ashish M.; Lerner, Seth P.; Barton Grossman, H.; Lin, Jie; Gu, Jian; Pu, Xia; Hutchinson, Amy; Burdette, Laurie; Wheeler, William; Kogevinas, Manolis; Tardón, Adonina; Serra, Consol; Carrato, Alfredo; García-Closas, Reina; Lloreta, Josep; Schwenn, Molly; Karagas, Margaret R.; Johnson, Alison; Schned, Alan; Armenti, Karla R.; Hosain, G.M.; Andriole, Gerald; Grubb, Robert; Black, Amanda; Ryan Diver, W.; Gapstur, Susan M.; Weinstein, Stephanie J.; Virtamo, Jarmo; Haiman, Chris A.; Landi, Maria T.; Caporaso, Neil; Fraumeni, Joseph F.; Vineis, Paolo; Wu, Xifeng; Silverman, Debra T.; Chanock, Stephen; Rothman, Nathaniel


    Candidate gene and genome-wide association studies (GWAS) have identified 11 independent susceptibility loci associated with bladder cancer risk. To discover additional risk variants, we conducted a new GWAS of 2422 bladder cancer cases and 5751 controls, followed by a meta-analysis with two independently published bladder cancer GWAS, resulting in a combined analysis of 6911 cases and 11 814 controls of European descent. TaqMan genotyping of 13 promising single nucleotide polymorphisms with P < 1 × 10−5 was pursued in a follow-up set of 801 cases and 1307 controls. Two new loci achieved genome-wide statistical significance: rs10936599 on 3q26.2 (P = 4.53 × 10−9) and rs907611 on 11p15.5 (P = 4.11 × 10−8). Two notable loci were also identified that approached genome-wide statistical significance: rs6104690 on 20p12.2 (P = 7.13 × 10−7) and rs4510656 on 6p22.3 (P = 6.98 × 10−7); these require further studies for confirmation. In conclusion, our study has identified new susceptibility alleles for bladder cancer risk that require fine-mapping and laboratory investigation, which could further understanding into the biological underpinnings of bladder carcinogenesis. PMID:24163127

  9. Dynamic chromatin: the regulatory domain organization of eukaryotic gene loci.


    Bonifer, C; Hecht, A; Saueressig, H; Winter, D M; Sippel, A E


    It is hypothesized that nuclear DNA is organized in topologically constrained loop domains defining basic units of higher order chromatin structure. Our studies are performed in order to investigate the functional relevance of this structural subdivision of eukaryotic chromatin for the control of gene expression. We used the chicken lysozyme gene locus as a model to examine the relation between chromatin structure and gene function. Several structural features of the lysozyme locus are known: the extension of the region of general DNAasel sensitivity of the active gene, the location of DNA-sequences with high affinity for the nuclear matrix in vitro, and the position of DNAasel hypersensitive chromatin sites (DHSs). The pattern of DHSs changes depending on the transcriptional status of the gene. Functional studies demonstrated that DHSs mark the position of cis-acting regulatory elements. Additionally, we discovered a novel cis-activity of the border regions of the DNAasel sensitive domain (A-elements). By eliminating the position effect on gene expression usually observed when genes are randomly integrated into the genome after transfection, A-elements possibly serve as punctuation marks for a regulatory chromatin domain. Experiments using transgenic mice confirmed that the complete structurally defined lysozyme gene domain behaves as an independent regulatory unit, expressing the gene in a tissue specific and position independent manner. These expression features were lost in transgenic mice carrying a construct, in which the A-elements as well as an upstream enhancer region were deleted, indicating the lack of a locus activation function on this construct. Experiments are designed in order to uncover possible hierarchical relationships between the different cis-acting regulatory elements for stepwise gene activation during cell differentiation. We are aiming at the definition of the basic structural and functional requirements for position independent and high

  10. Dynamic chromatin: the regulatory domain organization of eukaryotic gene loci.


    Bonifer, C; Hecht, A; Saueressig, H; Winter, D M; Sippel, A E


    It is hypothesized that nuclear DNA is organized in topologically constrained loop domains defining basic units of higher order chromatin structure. Our studies are performed in order to investigate the functional relevance of this structural subdivision of eukaryotic chromatin for the control of gene expression. We used the chicken lysozyme gene locus as a model to examine the relation between chromatin structure and gene function. Several structural features of the lysozyme locus are known: the extension of the region of general DNAasel sensitivity of the active gene, the location of DNA-sequences with high affinity for the nuclear matrix in vitro, and the position of DNAasel hypersensitive chromatin sites (DHSs). The pattern of DHSs changes depending on the transcriptional status of the gene. Functional studies demonstrated that DHSs mark the position of cis-acting regulatory elements. Additionally, we discovered a novel cis-activity of the border regions of the DNAasel sensitive domain (A-elements). By eliminating the position effect on gene expression usually observed when genes are randomly integrated into the genome after transfection, A-elements possibly serve as punctuation marks for a regulatory chromatin domain. Experiments using transgenic mice confirmed that the complete structurally defined lysozyme gene domain behaves as an independent regulatory unit, expressing the gene in a tissue specific and position independent manner. These expression features were lost in transgenic mice carrying a construct, in which the A-elements as well as an upstream enhancer region were deleted, indicating the lack of a locus activation function on this construct. Experiments are designed in order to uncover possible hierarchical relationships between the different cis-acting regulatory elements for stepwise gene activation during cell differentiation. We are aiming at the definition of the basic structural and functional requirements for position independent and high

  11. Human leukocyte telomere length is associated with DNA methylation levels in multiple subtelomeric and imprinted loci.


    Buxton, Jessica L; Suderman, Matthew; Pappas, Jane J; Borghol, Nada; McArdle, Wendy; Blakemore, Alexandra I F; Hertzman, Clyde; Power, Christine; Szyf, Moshe; Pembrey, Marcus


    In humans, leukocyte telomere length (LTL) is positively correlated with lifespan, and shorter LTL is associated with increased risk of age-related disease. In this study we tested for association between telomere length and methylated cytosine levels. Measurements of mean telomere length and DNA methylation at >450,000 CpG sites were obtained for both blood (N = 24) and EBV-transformed cell-line (N = 36) DNA samples from men aged 44-45 years. We identified 65 gene promoters enriched for CpG sites at which methylation levels are associated with leukocyte telomere length, and 36 gene promoters enriched for CpG sites at which methylation levels are associated with telomere length in DNA from EBV-transformed cell-lines. We observed significant enrichment of positively associated methylated CpG sites in subtelomeric loci (within 4 Mb of the telomere) (P < 0.01), and also at loci in imprinted regions (P < 0.001). Our results pave the way for further investigations to help elucidate the relationships between telomere length, DNA methylation and gene expression in health and disease.

  12. Unmasking risk loci: DNA methylation illuminates the biology of cancer predisposition: analyzing DNA methylation of transcriptional enhancers reveals missed regulatory links between cancer risk loci and genes.


    Aran, Dvir; Hellman, Asaf


    Paradoxically, DNA sequence polymorphisms in cancer risk loci rarely correlate with the expression of cancer genes. Therefore, the molecular mechanism underlying an individual's susceptibility to cancer has remained largely unknown. However, recent evaluations of the correlations between DNA methylation and gene expression levels across healthy and cancerous genomes have revealed enrichment of disease-related DNA methylation variations within disease-associated risk loci. Moreover, it appears that transcriptional enhancers embedded in cancer risk loci often contain DNA methylation sites that closely define the expression of prominent cancer genes, despite the lack of significant correlations between gene expression levels and the surrounding disease-associated polymorphic sequences. We suggest that DNA methylation variations may obscure the effect of co-residing risk sequence alleles. Analysis of enhancer methylation data may help to reveal the regulatory circuits underlying predisposition to cancers and other common diseases.

  13. An IF-FISH Approach for Covisualization of Gene Loci and Nuclear Architecture in Fission Yeast.


    Kim, K-D; Iwasaki, O; Noma, K


    Recent genomic studies have revealed that chromosomal structures are formed by a hierarchy of organizing processes ranging from gene associations, including interactions among enhancers and promoters, to topologically associating domain formations. Gene associations identified by these studies can be characterized by microscopic analyses. Fission yeast is a model organism, in which gene associations have been broadly mapped across the genome, although many of those associations have not been further examined by cell biological approaches. To address the technically challenging process of the visualization of associating gene loci in the fission yeast nuclei, we provide, in detail, an IF-FISH procedure that allows for covisualizing both gene loci and nuclear structural markers such as the nuclear membrane and nucleolus. PMID:27423862

  14. An IF-FISH Approach for Covisualization of Gene Loci and Nuclear Architecture in Fission Yeast.


    Kim, K-D; Iwasaki, O; Noma, K


    Recent genomic studies have revealed that chromosomal structures are formed by a hierarchy of organizing processes ranging from gene associations, including interactions among enhancers and promoters, to topologically associating domain formations. Gene associations identified by these studies can be characterized by microscopic analyses. Fission yeast is a model organism, in which gene associations have been broadly mapped across the genome, although many of those associations have not been further examined by cell biological approaches. To address the technically challenging process of the visualization of associating gene loci in the fission yeast nuclei, we provide, in detail, an IF-FISH procedure that allows for covisualizing both gene loci and nuclear structural markers such as the nuclear membrane and nucleolus.

  15. Genetics of Hemoglobin in the Deer Mouse, PEROMYSCUS MANICULATUS . I. Multiple α- and β-Globin Structural Loci

    PubMed Central

    Snyder, Lee R. G.


    Genetic data, together with molecular structure studies, have demonstrated that the complex hemoglobin phenotypes in four subspecies of P. maniculatus are generated by at least four, and probably five, globin structural loci. The Hba and Hbc loci apparently arose by duplication of an ancestral α-type locus, while Hbb, Hbd, and Hbe apparently were derived from a β-type locus. The Hba and Hbb structural loci are electrophoretically monomorphic, while Hbc, Hbd, and Hbe are each polymorphic for at least two electrophoretic alleles. Alleles at Hbc and Hbd segregate independently. The globin products of Hbc and Hbd are electrophoretically indistinguishable; therefore, it is impossible to enumerate true gene frequencies in population surveys. Combined evidence from Peromyscus, Mus and Rattus indicates a remarkable similarity in the numbers of duplicated globin structural loci and in their linkage relationships to coat color loci. PMID:669255

  16. Neocentromeres Provide Chromosome Segregation Accuracy and Centromere Clustering to Multiple Loci along a Candida albicans Chromosome

    PubMed Central

    Burrack, Laura S.; Hutton, Hannah F.; Clancey, Shelly Applen; Plemmons, Alexandra E.; Saha, Amrita; Turman, Breanna; Berman, Judith


    Assembly of kinetochore complexes, involving greater than one hundred proteins, is essential for chromosome segregation and genome stability. Neocentromeres, or new centromeres, occur when kinetochores assemble de novo, at DNA loci not previously associated with kinetochore proteins, and they restore chromosome segregation to chromosomes lacking a functional centromere. Neocentromeres have been observed in a number of diseases and may play an evolutionary role in adaptation or speciation. However, the consequences of neocentromere formation on chromosome missegregation rates, gene expression, and three-dimensional (3D) nuclear structure are not well understood. Here, we used Candida albicans, an organism with small, epigenetically-inherited centromeres, as a model system to study the functions of twenty different neocentromere loci along a single chromosome, chromosome 5. Comparison of neocentromere properties relative to native centromere functions revealed that all twenty neocentromeres mediated chromosome segregation, albeit to different degrees. Some neocentromeres also caused reduced levels of transcription from genes found within the neocentromere region. Furthermore, like native centromeres, neocentromeres clustered in 3D with active/functional centromeres, indicating that formation of a new centromere mediates the reorganization of 3D nuclear architecture. This demonstrates that centromere clustering depends on epigenetically defined function and not on the primary DNA sequence, and that neocentromere function is independent of its distance from the native centromere position. Together, the results show that a neocentromere can form at many loci along a chromosome and can support the assembly of a functional kinetochore that exhibits native centromere functions including chromosome segregation accuracy and centromere clustering within the nucleus. PMID:27662467

  17. Extreme geographical fixation of variation in the Plasmodium falciparum gamete surface protein gene Pfs48/45 compared with microsatellite loci.


    Conway, D J; Machado, R L; Singh, B; Dessert, P; Mikes, Z S; Povoa, M M; Oduola, A M; Roper, C


    Comparing patterns of genetic variation at multiple loci in the genome of a species can potentially identify loci which are under selection. The large number of polymorphic microsatellites in the malaria parasite Plasmodium falciparum are available markers to screen for selectively important loci. The Pfs48/45 gene on Chromosome 13 encodes an antigenic protein located on the surface of parasite gametes, which is a candidate for a transmission blocking vaccine. Here, genotypic data from 255 P. falciparum isolates are presented, which show that alleles and haplotypes of five single nucleotide polymorphisms (SNPs) in the Pfs48/45 gene are exceptionally skewed in frequency among different P. falciparum populations, compared with alleles at 11 microsatellite loci sampled widely from the parasite genome. Fixation indices measuring inter-population variance in allele frequencies (F(ST)) were in the order of four to seven times higher for Pfs48/45 than for the microsatellites, whether considered (i) among populations within Africa, or (ii) among different continents. Differing mutational processes at microsatellite and SNP loci could generally affect the population structure at these different types of loci, to an unknown extent which deserves further investigation. The highly contrasting population structure may also suggest divergent selection on the amino acid sequence of Pfs48/45 in different populations, which plausibly indicates a role for the protein in determining gamete recognition and compatibility. PMID:11420101

  18. Integrated analysis of phenome, genome, and transcriptome of hybrid rice uncovered multiple heterosis-related loci for yield increase

    PubMed Central

    Li, Dayong; Huang, Zhiyuan; Song, Shuhui; Xin, Yeyun; Mao, Donghai; Lv, Qiming; Zhou, Ming; Tian, Dongmei; Tang, Mingfeng; Wu, Qi; Liu, Xue; Chen, Tingting; Song, Xianwei; Fu, Xiqin; Zhao, Bingran; Liang, Chengzhi; Li, Aihong; Liu, Guozhen; Li, Shigui; Hu, Songnian; Cao, Xiaofeng; Yu, Jun; Yuan, Longping; Chen, Caiyan; Zhu, Lihuang


    Hybrid rice is the dominant form of rice planted in China, and its use has extended worldwide since the 1970s. It offers great yield advantages and has contributed greatly to the world’s food security. However, the molecular mechanisms underlying heterosis have remained a mystery. In this study we integrated genetics and omics analyses to determine the candidate genes for yield heterosis in a model two-line rice hybrid system, Liang-you-pei 9 (LYP9) and its parents. Phenomics study revealed that the better parent heterosis (BPH) of yield in hybrid is not ascribed to BPH of all the yield components but is specific to the BPH of spikelet number per panicle (SPP) and paternal parent heterosis (PPH) of effective panicle number (EPN). Genetic analyses then identified multiple quantitative trait loci (QTLs) for these two components. Moreover, a number of differentially expressed genes and alleles in the hybrid were mapped by transcriptome profiling to the QTL regions as possible candidate genes. In parallel, a major QTL for yield heterosis, rice heterosis 8 (RH8), was found to be the DTH8/Ghd8/LHD1 gene. Based on the shared allelic heterozygosity of RH8 in many hybrid rice cultivars, a common mechanism for yield heterosis in the present commercial hybrid rice is proposed. PMID:27663737

  19. Investigation of Multiple Susceptibility Loci for Inflammatory Bowel Disease in an Italian Cohort of Patients

    PubMed Central

    Latiano, Anna; Palmieri, Orazio; Latiano, Tiziana; Corritore, Giuseppe; Bossa, Fabrizio; Martino, Giuseppina; Biscaglia, Giuseppe; Scimeca, Daniela; Valvano, Maria Rosa; Pastore, Maria; Marseglia, Antonio; D'Incà, Renata; Andriulli, Angelo; Annese, Vito


    Background Recent GWAs and meta-analyses have outlined about 100 susceptibility genes/loci for inflammatory bowel diseases (IBD). In this study we aimed to investigate the influence of SNPs tagging the genes/loci PTGER4, TNFSF15, NKX2-3, ZNF365, IFNG, PTPN2, PSMG1, and HLA in a large pediatric- and adult-onset IBD Italian cohort. Methods Eight SNPs were assessed in 1,070 Crohn's disease (CD), 1,213 ulcerative colitis (UC), 557 of whom being diagnosed at the age of ≤16 years, and 789 healthy controls. Correlations with sub-phenotypes and major variants of NOD2 gene were investigated. Results The SNPs tagging the TNFSF15, NKX2-3, ZNF365, and PTPN2 genes were associated with CD (P values ranging from 0.037 to 7×10−6). The SNPs tagging the PTGER4, NKX2-3, ZNF365, IFNG, PSMG1, and HLA area were associated with UC (P values 0.047 to 4×10−5). In the pediatric cohort the associations of TNFSF15, NKX2-3 with CD, and PTGER4, NKX2-3, ZNF365, IFNG, PSMG1 with UC, were confirmed. Association with TNFSF15 and pediatric UC was also reported. A correlation with NKX2-3 and need for surgery (P  =  0.038), and with HLA and steroid-responsiveness (P  =  0.024) in UC patients was observed. Moreover, significant association in our CD cohort with TNFSF15 SNP and colonic involvement (P  =  0.021), and with ZNF365 and ileal location (P  =  0.024) was demonstrated. Conclusions We confirmed in a large Italian cohort the associations with CD and UC of newly identified genes, both in adult and pediatric cohort of patients, with some influence on sub-phenotypes. PMID:21818367

  20. Genetic Susceptibility to Vitiligo: GWAS Approaches for Identifying Vitiligo Susceptibility Genes and Loci.


    Shen, Changbing; Gao, Jing; Sheng, Yujun; Dou, Jinfa; Zhou, Fusheng; Zheng, Xiaodong; Ko, Randy; Tang, Xianfa; Zhu, Caihong; Yin, Xianyong; Sun, Liangdan; Cui, Yong; Zhang, Xuejun


    Vitiligo is an autoimmune disease with a strong genetic component, characterized by areas of depigmented skin resulting from loss of epidermal melanocytes. Genetic factors are known to play key roles in vitiligo through discoveries in association studies and family studies. Previously, vitiligo susceptibility genes were mainly revealed through linkage analysis and candidate gene studies. Recently, our understanding of the genetic basis of vitiligo has been rapidly advancing through genome-wide association study (GWAS). More than 40 robust susceptible loci have been identified and confirmed to be associated with vitiligo by using GWAS. Most of these associated genes participate in important pathways involved in the pathogenesis of vitiligo. Many susceptible loci with unknown functions in the pathogenesis of vitiligo have also been identified, indicating that additional molecular mechanisms may contribute to the risk of developing vitiligo. In this review, we summarize the key loci that are of genome-wide significance, which have been shown to influence vitiligo risk. These genetic loci may help build the foundation for genetic diagnosis and personalize treatment for patients with vitiligo in the future. However, substantial additional studies, including gene-targeted and functional studies, are required to confirm the causality of the genetic variants and their biological relevance in the development of vitiligo.

  1. Genetic Susceptibility to Vitiligo: GWAS Approaches for Identifying Vitiligo Susceptibility Genes and Loci

    PubMed Central

    Shen, Changbing; Gao, Jing; Sheng, Yujun; Dou, Jinfa; Zhou, Fusheng; Zheng, Xiaodong; Ko, Randy; Tang, Xianfa; Zhu, Caihong; Yin, Xianyong; Sun, Liangdan; Cui, Yong; Zhang, Xuejun


    Vitiligo is an autoimmune disease with a strong genetic component, characterized by areas of depigmented skin resulting from loss of epidermal melanocytes. Genetic factors are known to play key roles in vitiligo through discoveries in association studies and family studies. Previously, vitiligo susceptibility genes were mainly revealed through linkage analysis and candidate gene studies. Recently, our understanding of the genetic basis of vitiligo has been rapidly advancing through genome-wide association study (GWAS). More than 40 robust susceptible loci have been identified and confirmed to be associated with vitiligo by using GWAS. Most of these associated genes participate in important pathways involved in the pathogenesis of vitiligo. Many susceptible loci with unknown functions in the pathogenesis of vitiligo have also been identified, indicating that additional molecular mechanisms may contribute to the risk of developing vitiligo. In this review, we summarize the key loci that are of genome-wide significance, which have been shown to influence vitiligo risk. These genetic loci may help build the foundation for genetic diagnosis and personalize treatment for patients with vitiligo in the future. However, substantial additional studies, including gene-targeted and functional studies, are required to confirm the causality of the genetic variants and their biological relevance in the development of vitiligo. PMID:26870082

  2. Optimal strategies for mapping complex diseases in the presence of multiple loci.

    PubMed Central

    Goldgar, D E; Easton, D F


    Recent advances in genome technology have led to mapping and subsequent isolation, by positional cloning, of a number of genes for common and/or complex human diseases. It therefore will be possible to utilize information about a known locus in the search for additional, perhaps less penetrant, genes for a particular disease. It is also unclear, under these situations, what the optimal sampling strategy should be. To address these questions, we have calculated the expected LOD score for localizing one locus in a variety of two-locus models of disease, for four different pedigree structures, and under three different scenarios regarding knowledge/testing of one of the two loci. These design considerations are evaluated by use of a cost function that incorporates the costs of ascertaining different family structures, the relative costs of genotyping and mutation testing family members, and the amount of information provided by each family structure and testing scenario. The results indicate that, in most cases, affected sib pairs are a particularly poor strategy, especially when linkage or mutation data are available at the known locus. We also demonstrate that prescreening the sample of families for mutations at known susceptibility loci is, in general, a cost-effective strategy. PMID:9150170

  3. Characterization of the uncertainty of divergence time estimation under relaxed molecular clock models using multiple loci.


    Zhu, Tianqi; Dos Reis, Mario; Yang, Ziheng


    Genetic sequence data provide information about the distances between species or branch lengths in a phylogeny, but not about the absolute divergence times or the evolutionary rates directly. Bayesian methods for dating species divergences estimate times and rates by assigning priors on them. In particular, the prior on times (node ages on the phylogeny) incorporates information in the fossil record to calibrate the molecular tree. Because times and rates are confounded, our posterior time estimates will not approach point values even if an infinite amount of sequence data are used in the analysis. In a previous study we developed a finite-sites theory to characterize the uncertainty in Bayesian divergence time estimation in analysis of large but finite sequence data sets under a strict molecular clock. As most modern clock dating analyses use more than one locus and are conducted under relaxed clock models, here we extend the theory to the case of relaxed clock analysis of data from multiple loci (site partitions). Uncertainty in posterior time estimates is partitioned into three sources: Sampling errors in the estimates of branch lengths in the tree for each locus due to limited sequence length, variation of substitution rates among lineages and among loci, and uncertainty in fossil calibrations. Using a simple but analogous estimation problem involving the multivariate normal distribution, we predict that as the number of loci ([Formula: see text]) goes to infinity, the variance in posterior time estimates decreases and approaches the infinite-data limit at the rate of 1/[Formula: see text], and the limit is independent of the number of sites in the sequence alignment. We then confirmed the predictions by using computer simulation on phylogenies of two or three species, and by analyzing a real genomic data set for six primate species. Our results suggest that with the fossil calibrations fixed, analyzing multiple loci or site partitions is the most effective way

  4. Specific Gene Loci of Clinical Pseudomonas putida Isolates

    PubMed Central

    Molina, Lázaro; Udaondo, Zulema; Duque, Estrella; Fernández, Matilde; Bernal, Patricia; Roca, Amalia; de la Torre, Jesús; Ramos, Juan Luis


    Pseudomonas putida are ubiquitous inhabitants of soils and clinical isolates of this species have been seldom described. Clinical isolates show significant variability in their ability to cause damage to hosts because some of them are able to modulate the host’s immune response. In the current study, comparisons between the genomes of different clinical and environmental strains of P. putida were done to identify genetic clusters shared by clinical isolates that are not present in environmental isolates. We show that in clinical strains specific genes are mostly present on transposons, and that this set of genes exhibit high identity with genes found in pathogens and opportunistic pathogens. The set of genes prevalent in P. putida clinical isolates, and absent in environmental isolates, are related with survival under oxidative stress conditions, resistance against biocides, amino acid metabolism and toxin/antitoxin (TA) systems. This set of functions have influence in colonization and survival within human tissues, since they avoid host immune response or enhance stress resistance. An in depth bioinformatic analysis was also carried out to identify genetic clusters that are exclusive to each of the clinical isolates and that correlate with phenotypical differences between them, a secretion system type III-like was found in one of these clinical strains, a determinant of pathogenicity in Gram-negative bacteria. PMID:26820467

  5. Characterization of candidate genes in inflammatory bowel disease-associated risk loci.


    Peloquin, Joanna M; Goel, Gautam; Kong, Lingjia; Huang, Hailiang; Haritunians, Talin; Sartor, R Balfour; Daly, Mark J; Newberry, Rodney D; McGovern, Dermot P; Yajnik, Vijay; Lira, Sergio A; Xavier, Ramnik J


    GWAS have linked SNPs to risk of inflammatory bowel disease (IBD), but a systematic characterization of disease-associated genes has been lacking. Prior studies utilized microarrays that did not capture many genes encoded within risk loci or defined expression quantitative trait loci (eQTLs) using peripheral blood, which is not the target tissue in IBD. To address these gaps, we sought to characterize the expression of IBD-associated risk genes in disease-relevant tissues and in the setting of active IBD. Terminal ileal (TI) and colonic mucosal tissues were obtained from patients with Crohn's disease or ulcerative colitis and from healthy controls. We developed a NanoString code set to profile 678 genes within IBD risk loci. A subset of patients and controls were genotyped for IBD-associated risk SNPs. Analyses included differential expression and variance analysis, weighted gene coexpression network analysis, and eQTL analysis. We identified 116 genes that discriminate between healthy TI and colon samples and uncovered patterns in variance of gene expression that highlight heterogeneity of disease. We identified 107 coexpressed gene pairs for which transcriptional regulation is either conserved or reversed in an inflammation-independent or -dependent manner. We demonstrate that on average approximately 60% of disease-associated genes are differentially expressed in inflamed tissue. Last, we identified eQTLs with either genotype-only effects on expression or an interaction effect between genotype and inflammation. Our data reinforce tissue specificity of expression in disease-associated candidate genes, highlight genes and gene pairs that are regulated in disease-relevant tissue and inflammation, and provide a foundation to advance the understanding of IBD pathogenesis. PMID:27668286

  6. Characterization of candidate genes in inflammatory bowel disease–associated risk loci

    PubMed Central

    Peloquin, Joanna M.; Sartor, R. Balfour; Newberry, Rodney D.; McGovern, Dermot P.; Yajnik, Vijay; Lira, Sergio A.


    GWAS have linked SNPs to risk of inflammatory bowel disease (IBD), but a systematic characterization of disease-associated genes has been lacking. Prior studies utilized microarrays that did not capture many genes encoded within risk loci or defined expression quantitative trait loci (eQTLs) using peripheral blood, which is not the target tissue in IBD. To address these gaps, we sought to characterize the expression of IBD-associated risk genes in disease-relevant tissues and in the setting of active IBD. Terminal ileal (TI) and colonic mucosal tissues were obtained from patients with Crohn’s disease or ulcerative colitis and from healthy controls. We developed a NanoString code set to profile 678 genes within IBD risk loci. A subset of patients and controls were genotyped for IBD-associated risk SNPs. Analyses included differential expression and variance analysis, weighted gene coexpression network analysis, and eQTL analysis. We identified 116 genes that discriminate between healthy TI and colon samples and uncovered patterns in variance of gene expression that highlight heterogeneity of disease. We identified 107 coexpressed gene pairs for which transcriptional regulation is either conserved or reversed in an inflammation-independent or -dependent manner. We demonstrate that on average approximately 60% of disease-associated genes are differentially expressed in inflamed tissue. Last, we identified eQTLs with either genotype-only effects on expression or an interaction effect between genotype and inflammation. Our data reinforce tissue specificity of expression in disease-associated candidate genes, highlight genes and gene pairs that are regulated in disease-relevant tissue and inflammation, and provide a foundation to advance the understanding of IBD pathogenesis. PMID:27668286

  7. Fast set-based association analysis using summary data from GWAS identifies novel gene loci for human complex traits

    PubMed Central

    Bakshi, Andrew; Zhu, Zhihong; Vinkhuyzen, Anna A. E.; Hill, W. David; McRae, Allan F.; Visscher, Peter M.; Yang, Jian


    We propose a method (fastBAT) that performs a fast set-based association analysis for human complex traits using summary-level data from genome-wide association studies (GWAS) and linkage disequilibrium (LD) data from a reference sample with individual-level genotypes. We demonstrate using simulations and analyses of real datasets that fastBAT is more accurate and orders of magnitude faster than the prevailing methods. Using fastBAT, we analyze summary data from the latest meta-analyses of GWAS on 150,064–339,224 individuals for height, body mass index (BMI), and schizophrenia. We identify 6 novel gene loci for height, 2 for BMI, and 3 for schizophrenia at PfastBAT < 5 × 10−8. The gain of power is due to multiple small independent association signals at these loci (e.g. the THRB and FOXP1 loci for schizophrenia). The method is general and can be applied to GWAS data for all complex traits and diseases in humans and to such data in other species. PMID:27604177

  8. Fast set-based association analysis using summary data from GWAS identifies novel gene loci for human complex traits.


    Bakshi, Andrew; Zhu, Zhihong; Vinkhuyzen, Anna A E; Hill, W David; McRae, Allan F; Visscher, Peter M; Yang, Jian


    We propose a method (fastBAT) that performs a fast set-based association analysis for human complex traits using summary-level data from genome-wide association studies (GWAS) and linkage disequilibrium (LD) data from a reference sample with individual-level genotypes. We demonstrate using simulations and analyses of real datasets that fastBAT is more accurate and orders of magnitude faster than the prevailing methods. Using fastBAT, we analyze summary data from the latest meta-analyses of GWAS on 150,064-339,224 individuals for height, body mass index (BMI), and schizophrenia. We identify 6 novel gene loci for height, 2 for BMI, and 3 for schizophrenia at PfastBAT < 5 × 10(-8). The gain of power is due to multiple small independent association signals at these loci (e.g. the THRB and FOXP1 loci for schizophrenia). The method is general and can be applied to GWAS data for all complex traits and diseases in humans and to such data in other species. PMID:27604177

  9. Locating multiple interacting quantitative trait Loci with the zero-inflated generalized poisson regression.


    Erhardt, Vinzenz; Bogdan, Malgorzata; Czado, Claudia


    We consider the problem of locating multiple interacting quantitative trait loci (QTL) influencing traits measured in counts. In many applications the distribution of the count variable has a spike at zero. Zero-inflated generalized Poisson regression (ZIGPR) allows for an additional probability mass at zero and hence an improvement in the detection of significant loci. Classical model selection criteria often overestimate the QTL number. Therefore, modified versions of the Bayesian Information Criterion (mBIC and EBIC) were successfully used for QTL mapping. We apply these criteria based on ZIGPR as well as simpler models. An extensive simulation study shows their good power detecting QTL while controlling the false discovery rate. We illustrate how the inability of the Poisson distribution to account for over-dispersion leads to an overestimation of the QTL number and hence strongly discourages its application for identifying factors influencing count data. The proposed method is used to analyze the mice gallstone data of Lyons et al. (2003). Our results suggest the existence of a novel QTL on chromosome 4 interacting with another QTL previously identified on chromosome 5. We provide the corresponding code in R.

  10. Amplification of multiple genomic loci from single cells isolated by laser micro-dissection of tissues

    PubMed Central

    Frumkin, Dan; Wasserstrom, Adam; Itzkovitz, Shalev; Harmelin, Alon; Rechavi, Gideon; Shapiro, Ehud


    Background Whole genome amplification (WGA) and laser assisted micro-dissection represent two recently developed technologies that can greatly advance biological and medical research. WGA allows the analysis of multiple genomic loci from a single genome and has been performed on single cells from cell suspensions and from enzymatically-digested tissues. Laser micro-dissection makes it possible to isolate specific single cells from heterogeneous tissues. Results Here we applied for the first time WGA on laser micro-dissected single cells from stained tissue sections, and developed a protocol for sequentially performing the two procedures. The combined procedure allows correlating the cell's genome with its natural morphology and precise anatomical position. From each cell we amplified 122 genomic and mitochondrial loci. In cells obtained from fresh tissue sections, 64.5% of alleles successfully amplified to ~700000 copies each, and mitochondrial DNA was amplified successfully in all cells. Multiplex PCR amplification and analysis of cells from pre-stored sections yielded significantly poorer results. Sequencing and capillary electrophoresis of WGA products allowed detection of slippage mutations in microsatellites (MS), and point mutations in P53. Conclusion Comprehensive genomic analysis of single cells from stained tissue sections opens new research opportunities for cell lineage and depth analyses, genome-wide mutation surveys, and other single cell assays. PMID:18284708

  11. Natural Variation Identifies Multiple Loci Controlling Petal Shape and Size in Arabidopsis thaliana

    PubMed Central

    Abraham, Mary C.; Metheetrairut, Chanatip; Irish, Vivian F.


    Natural variation in organ morphologies can have adaptive significance and contribute to speciation. However, the underlying allelic differences responsible for variation in organ size and shape remain poorly understood. We have utilized natural phenotypic variation in three Arabidopsis thaliana ecotypes to examine the genetic basis for quantitative variation in petal length, width, area, and shape. We identified 23 loci responsible for such variation, many of which appear to correspond to genes not previously implicated in controlling organ morphology. These analyses also demonstrated that allelic differences at distinct loci can independently affect petal length, width, area or shape, suggesting that these traits behave as independent modules. We also showed that ERECTA (ER), encoding a leucine-rich repeat (LRR) receptor-like serine-threonine kinase, is a major effect locus determining petal shape. Allelic variation at the ER locus was associated with differences in petal cell proliferation and concomitant effects on petal shape. ER has been previously shown to be required for regulating cell division and expansion in other contexts; the ER receptor-like kinase functioning to also control organ-specific proliferation patterns suggests that allelic variation in common signaling components may nonetheless have been a key factor in morphological diversification. PMID:23418598

  12. Identification of multiple independent susceptibility loci in the HLA region in Behçet's disease.


    Hughes, Travis; Coit, Patrick; Adler, Adam; Yilmaz, Vuslat; Aksu, Kenan; Düzgün, Nursen; Keser, Gokhan; Cefle, Ayse; Yazici, Ayten; Ergen, Andac; Alpsoy, Erkan; Salvarani, Carlo; Casali, Bruno; Kötter, Ina; Gutierrez-Achury, Javier; Wijmenga, Cisca; Direskeneli, Haner; Saruhan-Direskeneli, Güher; Sawalha, Amr H


    Behçet's disease is an inflammatory disease characterized by recurrent oral and genital ulcers and significant organ involvement. Localizing the genetic association between HLA-B*51 and Behçet's disease and exploring additional susceptibility loci in the human leukocyte antigen (HLA) region are complicated by the strong linkage disequilibrium in this region. We genotyped 8,572 variants in the extended HLA locus and carried out imputation and meta-analysis of 24,834 variants in 2 independent Behçet's disease cohorts from 2 ancestry groups. Genotyped SNPs were used to infer classical HLA alleles in the HLA-A, HLA-B, HLA-C, HLA-DQA1, HLA-DQB1 and HLA-DRB1 loci. Our data suggest that the robust HLA-B*51 association in Behçet's disease is explained by a variant located between the HLA-B and MICA genes (rs116799036: odds ratio (OR) = 3.88, P = 9.42 × 10(-50)). Three additional independent genetic associations within PSORS1C1 (rs12525170: OR = 3.01, P = 3.01 × 10(-26)), upstream of HLA-F-AS1 (rs114854070: OR = 1.95, P = 7.84 × 10(-14)) and with HLA-Cw*1602 (OR = 5.38, P = 6.07 × 10(-18)) were also identified and replicated.

  13. Analysis of immune-related loci identifies 48 new susceptibility variants for multiple sclerosis

    PubMed Central

    Beecham, Ashley H; Patsopoulos, Nikolaos A; Xifara, Dionysia K; Davis, Mary F; Kemppinen, Anu; Cotsapas, Chris; Shahi, Tejas S; Spencer, Chris; Booth, David; Goris, An; Oturai, Annette; Saarela, Janna; Fontaine, Bertrand; Hemmer, Bernhard; Martin, Claes; Zipp, Frauke; D’alfonso, Sandra; Martinelli-Boneschi, Filippo; Taylor, Bruce; Harbo, Hanne F; Kockum, Ingrid; Hillert, Jan; Olsson, Tomas; Ban, Maria; Oksenberg, Jorge R; Hintzen, Rogier; Barcellos, Lisa F; Agliardi, Cristina; Alfredsson, Lars; Alizadeh, Mehdi; Anderson, Carl; Andrews, Robert; Søndergaard, Helle Bach; Baker, Amie; Band, Gavin; Baranzini, Sergio E; Barizzone, Nadia; Barrett, Jeffrey; Bellenguez, Céline; Bergamaschi, Laura; Bernardinelli, Luisa; Berthele, Achim; Biberacher, Viola; Binder, Thomas M C; Blackburn, Hannah; Bomfim, Izaura L; Brambilla, Paola; Broadley, Simon; Brochet, Bruno; Brundin, Lou; Buck, Dorothea; Butzkueven, Helmut; Caillier, Stacy J; Camu, William; Carpentier, Wassila; Cavalla, Paola; Celius, Elisabeth G; Coman, Irène; Comi, Giancarlo; Corrado, Lucia; Cosemans, Leentje; Cournu-Rebeix, Isabelle; Cree, Bruce A C; Cusi, Daniele; Damotte, Vincent; Defer, Gilles; Delgado, Silvia R; Deloukas, Panos; di Sapio, Alessia; Dilthey, Alexander T; Donnelly, Peter; Dubois, Bénédicte; Duddy, Martin; Edkins, Sarah; Elovaara, Irina; Esposito, Federica; Evangelou, Nikos; Fiddes, Barnaby; Field, Judith; Franke, Andre; Freeman, Colin; Frohlich, Irene Y; Galimberti, Daniela; Gieger, Christian; Gourraud, Pierre-Antoine; Graetz, Christiane; Graham, Andrew; Grummel, Verena; Guaschino, Clara; Hadjixenofontos, Athena; Hakonarson, Hakon; Halfpenny, Christopher; Hall, Gillian; Hall, Per; Hamsten, Anders; Harley, James; Harrower, Timothy; Hawkins, Clive; Hellenthal, Garrett; Hillier, Charles; Hobart, Jeremy; Hoshi, Muni; Hunt, Sarah E; Jagodic, Maja; Jelčić, Ilijas; Jochim, Angela; Kendall, Brian; Kermode, Allan; Kilpatrick, Trevor; Koivisto, Keijo; Konidari, Ioanna; Korn, Thomas; Kronsbein, Helena; Langford, Cordelia; Larsson, Malin; Lathrop, Mark; Lebrun-Frenay, Christine; Lechner-Scott, Jeannette; Lee, Michelle H; Leone, Maurizio A; Leppä, Virpi; Liberatore, Giuseppe; Lie, Benedicte A; Lill, Christina M; Lindén, Magdalena; Link, Jenny; Luessi, Felix; Lycke, Jan; Macciardi, Fabio; Männistö, Satu; Manrique, Clara P; Martin, Roland; Martinelli, Vittorio; Mason, Deborah; Mazibrada, Gordon; McCabe, Cristin; Mero, Inger-Lise; Mescheriakova, Julia; Moutsianas, Loukas; Myhr, Kjell-Morten; Nagels, Guy; Nicholas, Richard; Nilsson, Petra; Piehl, Fredrik; Pirinen, Matti; Price, Siân E; Quach, Hong; Reunanen, Mauri; Robberecht, Wim; Robertson, Neil P; Rodegher, Mariaemma; Rog, David; Salvetti, Marco; Schnetz-Boutaud, Nathalie C; Sellebjerg, Finn; Selter, Rebecca C; Schaefer, Catherine; Shaunak, Sandip; Shen, Ling; Shields, Simon; Siffrin, Volker; Slee, Mark; Sorensen, Per Soelberg; Sorosina, Melissa; Sospedra, Mireia; Spurkland, Anne; Strange, Amy; Sundqvist, Emilie; Thijs, Vincent; Thorpe, John; Ticca, Anna; Tienari, Pentti; van Duijn, Cornelia; Visser, Elizabeth M; Vucic, Steve; Westerlind, Helga; Wiley, James S; Wilkins, Alastair; Wilson, James F; Winkelmann, Juliane; Zajicek, John; Zindler, Eva; Haines, Jonathan L; Pericak-Vance, Margaret A; Ivinson, Adrian J; Stewart, Graeme; Hafler, David; Hauser, Stephen L; Compston, Alastair; McVean, Gil; De Jager, Philip; Sawcer, Stephen; McCauley, Jacob L


    Using the ImmunoChip custom genotyping array, we analysed 14,498 multiple sclerosis subjects and 24,091 healthy controls for 161,311 autosomal variants and identified 135 potentially associated regions (p-value < 1.0 × 10-4). In a replication phase, we combined these data with previous genome-wide association study (GWAS) data from an independent 14,802 multiple sclerosis subjects and 26,703 healthy controls. In these 80,094 individuals of European ancestry we identified 48 new susceptibility variants (p-value < 5.0 × 10-8); three found after conditioning on previously identified variants. Thus, there are now 110 established multiple sclerosis risk variants in 103 discrete loci outside of the Major Histocompatibility Complex. With high resolution Bayesian fine-mapping, we identified five regions where one variant accounted for more than 50% of the posterior probability of association. This study enhances the catalogue of multiple sclerosis risk variants and illustrates the value of fine-mapping in the resolution of GWAS signals. PMID:24076602

  14. Age-at-Onset in Late Onset Alzheimer Disease is Modified by Multiple Genetic Loci

    PubMed Central

    Naj, Adam C.; Jun, Gyungah; Reitz, Christiane; Kunkle, Brian W.; Perry, William; Park, YoSon; Beecham, Gary W.; Rajbhandary, Ruchita A.; Hamilton-Nelson, Kara L.; Wang, Li-San; Kauwe, John S.K.; Huentelman, Matthew J.; Myers, Amanda J.; Bird, Thomas D.; Boeve, Bradley F.; Baldwin, Clinton T.; Jarvik, Gail P.; Crane, Paul K.; Rogaeva, Ekaterina; Barmada, Michael M.; Demirci, F. Yesim; Cruchaga, Carlos; Kramer, Patricia; Ertekin-Taner, Nilufer; Hardy, John; Graff-Radford, Neill R.; Green, Robert C.; Larson, Eric B.; St George-Hyslop, Peter; Buxbaum, Joseph D.; Evans, Denis; Schneider, Julie A.; Lunetta, Kathryn L.; Kamboh, M. Ilyas; Saykin, Andrew J.; Reiman, Eric M.; De Jager, Philip L.; Bennett, David A.; Morris, John C.; Montine, Thomas J.; Goate, Alison M.; Blacker, Deborah; Tsuang, Debby W.; Hakonarson, Hakon; Kukull, Walter A.; Foroud, Tatiana M.; Martin, Eden R.; Haines, Jonathan L.; Mayeux, Richard; Farrer, Lindsay A.; Schellenberg, Gerard D.; Pericak-Vance, Margaret A.


    Importance As APOE locus variants contribute to both risk of late-onset Alzheimer disease and differences in age-at-onset, it is important to know if other established late-onset Alzheimer disease risk loci also affect age-at-onset in cases. Objectives To investigate the effects of known Alzheimer disease risk loci in modifying age-at-onset, and to estimate their cumulative effect on age-at-onset variation, using data from genome-wide association studies in the Alzheimer’s Disease Genetics Consortium (ADGC). Design, Setting and Participants The ADGC comprises 14 case-control, prospective, and family-based datasets with data on 9,162 Caucasian participants with Alzheimer’s occurring after age 60 who also had complete age-at-onset information, gathered between 1989 and 2011 at multiple sites by participating studies. Data on genotyped or imputed single nucleotide polymorphisms (SNPs) most significantly associated with risk at ten confirmed LOAD loci were examined in linear modeling of AAO, and individual dataset results were combined using a random effects, inverse variance-weighted meta-analysis approach to determine if they contribute to variation in age-at-onset. Aggregate effects of all risk loci on AAO were examined in a burden analysis using genotype scores weighted by risk effect sizes. Main Outcomes and Measures Age at disease onset abstracted from medical records among participants with late-onset Alzheimer disease diagnosed per standard criteria. Results Analysis confirmed association of APOE with age-at-onset (rs6857, P=3.30×10−96), with associations in CR1 (rs6701713, P=7.17×10−4), BIN1 (rs7561528, P=4.78×10−4), and PICALM (rs561655, P=2.23×10−3) reaching statistical significance (P<0.005). Risk alleles individually reduced age-at-onset by 3-6 months. Burden analyses demonstrated that APOE contributes to 3.9% of variation in age-at-onset (R2=0.220) over baseline (R2=0.189) whereas the other nine loci together contribute to 1.1% of

  15. Multiple-interval mapping for quantitative trait loci with a spike in the trait distribution.


    Li, Wenyun; Chen, Zehua


    For phenotypic distributions where many individuals share a common value-such as survival time following a pathogenic infection-a spike occurs at that common value. This spike affects quantitative trait loci (QTL) mapping methodologies and causes standard approaches to perform suboptimally. In this article, we develop a multiple-interval mapping (MIM) procedure based on mixture generalized linear models (GLIMs). An extended Bayesian information criterion (EBIC) is used for model selection. To demonstrate its utility, this new approach is compared to single-QTL models that appropriately handle the phenotypic distribution. The method is applied to data from Listeria infection as well as data from simulation studies. Compared to the single-QTL model, the findings demonstrate that the MIM procedure greatly improves the efficiency in terms of positive selection rate and false discovery rate. The method developed has been implemented using functions in R and is freely available to download and use.

  16. Genetic relationship between soxRS and mar loci in promoting multiple antibiotic resistance in Escherichia coli.

    PubMed Central

    Miller, P F; Gambino, L F; Sulavik, M C; Gracheck, S J


    Multiple antibiotic resistance in Escherichia coli has typically been associated with mutations at the mar locus, located at 34 min on the E. coli chromosome. A new mutant, marC, isolated on the basis of a Mar phenotype but which maps to the soxRS (encoding the regulators of the superoxide stress response) locus located at 92 min, is described here. This mutant shares several features with a known constitutive allele of the soxRS gene, prompting the conclusion that it is a highly active allele of this gene. The marC mutation has thus been given the designation soxR201. This new mutant was used to examine the relationship between the mar and sox loci in promoting antibiotic resistance. The results of these studies indicate that full antibiotic resistance resulting from the soxR201 mutation is partially dependent on an intact mar locus and is associated with an increase in the steady-state level of mar-specific mRNA. In addition, paraquat treatment of wild-type cells is shown to increase the level of antibiotic resistance in a dose-dependent manner that requires an intact soxRS locus. Conversely, overexpression of MarA from a multicopy plasmid results in weak activation of a superoxide stress response target gene. These findings are consistent with a model in which the regulatory factors encoded by the marA and soxS genes control the expression of overlapping sets of target genes, with MarA preferentially acting on targets involved with antibiotic resistance and SoxS directed primarily towards components of the superoxide stress response. Furthermore, compounds frequently used to induce the superoxide stress response, including paraquat, menadione, and phenazine methosulfate, differ with respect to the amount of protection provided against them by the antibiotic resistance response. Images PMID:7986007

  17. Identification of pKM101-encoded loci specifying potentially lethal gene products.

    PubMed Central

    Winans, S C; Walker, G C


    Two pKM101-encoded loci (designated kilA and kilB) have been identified which elaborate products that are potentially lethal to the bacterial cell. The lethal effects of each of these products is inhibited by two other plasmid-encoded loci, designated korA and korB (for kil override). Both korA and korB are required to control the lethality of either kil gene. In the presence of korA and korB both kil genes have other phenotypes: kilB is necessary for conjugal transfer, whereas kilA is responsible for the small-colony morphology on defined media that is characteristic of pKM101-containing strains (the Slo phenotype). PMID:3881396

  18. Cardiometabolic risk loci share downstream cis- and trans-gene regulation across tissues and diseases.


    Franzén, Oscar; Ermel, Raili; Cohain, Ariella; Akers, Nicholas K; Di Narzo, Antonio; Talukdar, Husain A; Foroughi-Asl, Hassan; Giambartolomei, Claudia; Fullard, John F; Sukhavasi, Katyayani; Köks, Sulev; Gan, Li-Ming; Giannarelli, Chiara; Kovacic, Jason C; Betsholtz, Christer; Losic, Bojan; Michoel, Tom; Hao, Ke; Roussos, Panos; Skogsberg, Josefin; Ruusalepp, Arno; Schadt, Eric E; Björkegren, Johan L M


    Genome-wide association studies (GWAS) have identified hundreds of cardiometabolic disease (CMD) risk loci. However, they contribute little to genetic variance, and most downstream gene-regulatory mechanisms are unknown. We genotyped and RNA-sequenced vascular and metabolic tissues from 600 coronary artery disease patients in the Stockholm-Tartu Atherosclerosis Reverse Networks Engineering Task study (STARNET). Gene expression traits associated with CMD risk single-nucleotide polymorphism (SNPs) identified by GWAS were more extensively found in STARNET than in tissue- and disease-unspecific gene-tissue expression studies, indicating sharing of downstream cis-/trans-gene regulation across tissues and CMDs. In contrast, the regulatory effects of other GWAS risk SNPs were tissue-specific; abdominal fat emerged as an important gene-regulatory site for blood lipids, such as for the low-density lipoprotein cholesterol and coronary artery disease risk gene PCSK9 STARNET provides insights into gene-regulatory mechanisms for CMD risk loci, facilitating their translation into opportunities for diagnosis, therapy, and prevention. PMID:27540175

  19. Cardiometabolic risk loci share downstream cis- and trans-gene regulation across tissues and diseases.


    Franzén, Oscar; Ermel, Raili; Cohain, Ariella; Akers, Nicholas K; Di Narzo, Antonio; Talukdar, Husain A; Foroughi-Asl, Hassan; Giambartolomei, Claudia; Fullard, John F; Sukhavasi, Katyayani; Köks, Sulev; Gan, Li-Ming; Giannarelli, Chiara; Kovacic, Jason C; Betsholtz, Christer; Losic, Bojan; Michoel, Tom; Hao, Ke; Roussos, Panos; Skogsberg, Josefin; Ruusalepp, Arno; Schadt, Eric E; Björkegren, Johan L M


    Genome-wide association studies (GWAS) have identified hundreds of cardiometabolic disease (CMD) risk loci. However, they contribute little to genetic variance, and most downstream gene-regulatory mechanisms are unknown. We genotyped and RNA-sequenced vascular and metabolic tissues from 600 coronary artery disease patients in the Stockholm-Tartu Atherosclerosis Reverse Networks Engineering Task study (STARNET). Gene expression traits associated with CMD risk single-nucleotide polymorphism (SNPs) identified by GWAS were more extensively found in STARNET than in tissue- and disease-unspecific gene-tissue expression studies, indicating sharing of downstream cis-/trans-gene regulation across tissues and CMDs. In contrast, the regulatory effects of other GWAS risk SNPs were tissue-specific; abdominal fat emerged as an important gene-regulatory site for blood lipids, such as for the low-density lipoprotein cholesterol and coronary artery disease risk gene PCSK9 STARNET provides insights into gene-regulatory mechanisms for CMD risk loci, facilitating their translation into opportunities for diagnosis, therapy, and prevention.

  20. Loci of Mycobacterium avium ser2 gene cluster and their functions.

    PubMed Central

    Mills, J A; McNeil, M R; Belisle, J T; Jacobs, W R; Brennan, P J


    The highly antigenic glycopeptidolipids present on the surface of members of the Mycobacterium avium complex serve to distinguish these bacteria from all others and to define the various serovars that compose this complex. Previously, the genes responsible for the biosynthesis of the disaccharide hapten [2,3-di-O-methyl-alpha-L-fucopyranosyl-(1-->3)-alpha-L-rhamnopyranose] of serovar 2 of the M. avium complex were isolated, localized to a contiguous 22- to 27-kb fragment of the M. avium genome, and designated the ser2 gene cluster (J. T. Belisle, L. Pascopella, J. M. Inamine, P. J. Brennan, and W. R. Jacobs, Jr., J. Bacteriol. 173:6991-6997, 1991). In the present study, transposon saturation mutagenesis was used to map the specific genetic loci within the ser2 gene cluster required for expression of this disaccharide. Four essential loci, termed ser2A, -B, -C, and -D, constituting a total of 5.7 kb within the ser2 gene cluster, were defined. The ser2B and ser2D loci encode the methyltransferases required to methylate the fucose at the 3 and 2 positions, respectively. The rhamnosyltransferase was encoded by ser2A, whereas either ser2C or ser2D encoded the fucosyltransferase. The ser2C and ser2D loci are also apparently involved in the de novo synthesis of fucose. Isolation of the truncated versions of the hapten induced by the transposon insertions provides genetic evidence that the glycopeptidolipids of M. avium serovar 2 are synthesized by an initial transfer of the rhamnose unit to the peptide core followed by fucose and finally O methylation of the fucosyl unit. PMID:8050992

  1. Loci of Mycobacterium avium ser2 gene cluster and their functions.


    Mills, J A; McNeil, M R; Belisle, J T; Jacobs, W R; Brennan, P J


    The highly antigenic glycopeptidolipids present on the surface of members of the Mycobacterium avium complex serve to distinguish these bacteria from all others and to define the various serovars that compose this complex. Previously, the genes responsible for the biosynthesis of the disaccharide hapten [2,3-di-O-methyl-alpha-L-fucopyranosyl-(1-->3)-alpha-L-rhamnopyranose] of serovar 2 of the M. avium complex were isolated, localized to a contiguous 22- to 27-kb fragment of the M. avium genome, and designated the ser2 gene cluster (J. T. Belisle, L. Pascopella, J. M. Inamine, P. J. Brennan, and W. R. Jacobs, Jr., J. Bacteriol. 173:6991-6997, 1991). In the present study, transposon saturation mutagenesis was used to map the specific genetic loci within the ser2 gene cluster required for expression of this disaccharide. Four essential loci, termed ser2A, -B, -C, and -D, constituting a total of 5.7 kb within the ser2 gene cluster, were defined. The ser2B and ser2D loci encode the methyltransferases required to methylate the fucose at the 3 and 2 positions, respectively. The rhamnosyltransferase was encoded by ser2A, whereas either ser2C or ser2D encoded the fucosyltransferase. The ser2C and ser2D loci are also apparently involved in the de novo synthesis of fucose. Isolation of the truncated versions of the hapten induced by the transposon insertions provides genetic evidence that the glycopeptidolipids of M. avium serovar 2 are synthesized by an initial transfer of the rhamnose unit to the peptide core followed by fucose and finally O methylation of the fucosyl unit. PMID:8050992

  2. Sum statistics for the joint detection of multiple disease loci in case-control association studies with SNP markers.


    Wille, Anja; Hoh, Josephine; Ott, Jurg


    In complex traits, multiple disease loci presumably interact to produce the disease. For this reason, even with high-resolution single nucleotide polymorphism (SNP) marker maps, it has been difficult to map susceptibility loci by conventional locus-by-locus methods. Fine mapping strategies are needed that allow for the simultaneous detection of interacting disease loci while handling large numbers of densely spaced markers. For this purpose, sum statistics were recently proposed as a first-stage analysis method for case-control association studies with SNPs. Via sums of single-marker statistics, information over multiple disease-associated markers is combined and, with a global significance value alpha, a small set of "interesting" markers is selected for further analysis. Here, the statistical properties of such approaches are examined by computer simulation. It is shown that sum statistics can often be successfully applied when marker-by-marker approaches fail to detect association. Compared with Bonferroni or False Discovery Rate (FDR) procedures, sum statistics have greater power, and more disease loci can be detected. However, in studies with tightly linked markers, simple sum statistics can be suboptimal, since the intermarker correlation is ignored. A method is presented that takes the correlation structure among marker loci into account when marker statistics are combined.

  3. DNA-damaging agents stimulate gene expression at specific loci in Escherichia coli

    SciTech Connect

    Kenyon, C.J.; Walker, G.C.


    Operon fusions in Escherichia coli were obtained that showed increased beta-galactosidase expression in response to treatment with the DNA-damaging agent mitomycin C. These fusions were generated by using the Mud(ApR, lac) vector to insert the lactose structural genes randomly into the bacterial chromosome. Induction of beta-galactosidase in these strains, which carried fusions of lac to these din (damage-inducible) loci, was (i) triggered by UV light as well as by mitomycin C and (ii) abolished by either a recA- or a lexA- mutation. Similar characteristics of induction were observed when the lactose genes were fused to a prophage lambda promoter by using Mud(ApR, lac). These results indicate that E. coli contains a set of genes that, like prophage lambda genes, are expressed in response to DNA-damaging agents and regulated by the recA and lexA gene products. These din genes map at five bacterial loci. One din::Mud(ApR, lac) insertion results in a UV-sensitive phenotype and may be within the uvrA transcriptional unit.

  4. Microplitis demolitor Bracovirus Proviral Loci and Clustered Replication Genes Exhibit Distinct DNA Amplification Patterns during Replication

    PubMed Central

    Simmonds, Tyler J.; Thomas, Sarah A.; Strand, Michael R.


    ABSTRACT Polydnaviruses are large, double-stranded DNA viruses that are beneficial symbionts of parasitoid wasps. Polydnaviruses in the genus Bracovirus (BVs) persist in wasps as proviruses, and their genomes consist of two functional components referred to as proviral segments and nudivirus-like genes. Prior studies established that the DNA domains where proviral segments reside are amplified during replication and that segments within amplified loci are circularized before packaging into nucleocapsids. One DNA domain where nudivirus-like genes are located is also amplified but never packaged into virions. We recently sequenced the genome of the braconid Microplitis demolitor, which carries M. demolitor bracovirus (MdBV). Here, we took advantage of this resource to characterize the DNAs that are amplified during MdBV replication using a combination of Illumina and Pacific Biosciences sequencing approaches. The results showed that specific nucleotide sites identify the boundaries of amplification for proviral loci. Surprisingly, however, amplification of loci 3, 4, 6, and 8 produced head-to-tail concatemeric intermediates; loci 1, 2, and 5 produced head-to-head/tail-to-tail concatemers; and locus 7 yielded no identified concatemers. Sequence differences at amplification junctions correlated with the types of amplification intermediates the loci produced, while concatemer processing gave rise to the circularized DNAs that are packaged into nucleocapsids. The MdBV nudivirus-like gene cluster was also amplified, albeit more weakly than most proviral loci and with nondiscrete boundaries. Overall, the MdBV genome exhibited three patterns of DNA amplification during replication. Our data also suggest that PacBio sequencing could be useful in studying the replication intermediates produced by other DNA viruses. IMPORTANCE Polydnaviruses are of fundamental interest because they provide a novel example of viruses evolving into beneficial symbionts. All polydnaviruses are

  5. Genome-wide association study reveals novel quantitative trait Loci associated with resistance to multiple leaf spot diseases of spring wheat.


    Gurung, Suraj; Mamidi, Sujan; Bonman, J Michael; Xiong, Mai; Brown-Guedira, Gina; Adhikari, Tika B


    Accelerated wheat development and deployment of high-yielding, climate resilient, and disease resistant cultivars can contribute to enhanced food security and sustainable intensification. To facilitate gene discovery, we assembled an association mapping panel of 528 spring wheat landraces of diverse geographic origin for a genome-wide association study (GWAS). All accessions were genotyped using an Illumina Infinium 9K wheat single nucleotide polymorphism (SNP) chip and 4781 polymorphic SNPs were used for analysis. To identify loci underlying resistance to the major leaf spot diseases and to better understand the genomic patterns, we quantified population structure, allelic diversity, and linkage disequilibrium. Our results showed 32 loci were significantly associated with resistance to the major leaf spot diseases. Further analysis identified QTL effective against major leaf spot diseases of wheat which appeared to be novel and others that were previously identified by association analysis using Diversity Arrays Technology (DArT) and bi-parental mapping. In addition, several identified SNPs co-localized with genes that have been implicated in plant disease resistance. Future work could aim to select the putative novel loci and pyramid them in locally adapted wheat cultivars to develop broad-spectrum resistance to multiple leaf spot diseases of wheat via marker-assisted selection (MAS). PMID:25268502

  6. Genome-Wide Association Study Reveals Novel Quantitative Trait Loci Associated with Resistance to Multiple Leaf Spot Diseases of Spring Wheat

    PubMed Central

    Bonman, J. Michael; Xiong, Mai; Brown-Guedira, Gina; Adhikari, Tika B.


    Accelerated wheat development and deployment of high-yielding, climate resilient, and disease resistant cultivars can contribute to enhanced food security and sustainable intensification. To facilitate gene discovery, we assembled an association mapping panel of 528 spring wheat landraces of diverse geographic origin for a genome-wide association study (GWAS). All accessions were genotyped using an Illumina Infinium 9K wheat single nucleotide polymorphism (SNP) chip and 4781 polymorphic SNPs were used for analysis. To identify loci underlying resistance to the major leaf spot diseases and to better understand the genomic patterns, we quantified population structure, allelic diversity, and linkage disequilibrium. Our results showed 32 loci were significantly associated with resistance to the major leaf spot diseases. Further analysis identified QTL effective against major leaf spot diseases of wheat which appeared to be novel and others that were previously identified by association analysis using Diversity Arrays Technology (DArT) and bi-parental mapping. In addition, several identified SNPs co-localized with genes that have been implicated in plant disease resistance. Future work could aim to select the putative novel loci and pyramid them in locally adapted wheat cultivars to develop broad-spectrum resistance to multiple leaf spot diseases of wheat via marker-assisted selection (MAS). PMID:25268502

  7. Using early flowering transgenic apple to accelerate the breeding of donor parents with multiple loci for disease resistance (Malus x domestica)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    One of the goals of the USDA-NIFA-SCRI RosBREED project is to develop donor parents with multiple loci for disease resistance. Due to the long generation time of tree fruit crops, the accumulation of pyramided resistance loci for multiple diseases by conventional breeding methods could require deca...

  8. Association between polymorphism of the norepinephrine transporter gene rs2242446 and rs5669 loci and depression disorders

    PubMed Central

    Pan, Yu; Cheng, Qi; Shan, Mo-Shui; Yan, Jin


    Objective: To explore the association between polymorphism of the norepinephrine transporter (NET) gene rs2242446 and rs5669 loci and depression in Chinese Han population. Methods: A case-control study was carried out, the gene types and allele distributions of NFT gene rs2242446 and rs5569 loci in 302 depression patients and 302 healthy controls were detected by Taqman SNP genotyping technology. Results: The gene types and allele frequency distributions of NFT gene rs2242446 and rs5569 loci had significant differences between case group and control group (rs2242446, x2=26.045, P<0.05, x2=8.827, P<0.05, rs5569, x2=42.47, P<0.05, x2=20.9, P<0.05). The CC genotype of NET gene rs2242446 locus and rs5569 loci was a protective factor of depression compared with the CT and TT genotypes. Conclusion: The NET genepoly morphism of rs2242446 and rs5569 loci was a ssociated with depression in Chinese Han population, in which the CC genotype of rs2242446 and rs5569 loci was a protective factor of depression. PMID:26770504

  9. Nonimmunoglobulin target loci of activation-induced cytidine deaminase (AID) share unique features with immunoglobulin genes

    PubMed Central

    Kato, Lucia; Begum, Nasim A.; Burroughs, A. Maxwell; Doi, Tomomitsu; Kawai, Jun; Daub, Carsten O.; Kawaguchi, Takahisa; Matsuda, Fumihiko; Hayashizaki, Yoshihide; Honjo, Tasuku


    Activation-induced cytidine deaminase (AID) is required for both somatic hypermutation and class-switch recombination in activated B cells. AID is also known to target nonimmunoglobulin genes and introduce mutations or chromosomal translocations, eventually causing tumors. To identify as-yet-unknown AID targets, we screened early AID-induced DNA breaks by using two independent genome-wide approaches. Along with known AID targets, this screen identified a set of unique genes (SNHG3, MALAT1, BCL7A, and CUX1) and confirmed that these loci accumulated mutations as frequently as Ig locus after AID activation. Moreover, these genes share three important characteristics with the Ig gene: translocations in tumors, repetitive sequences, and the epigenetic modification of chromatin by H3K4 trimethylation in the vicinity of cleavage sites. PMID:22308462

  10. Nonimmunoglobulin target loci of activation-induced cytidine deaminase (AID) share unique features with immunoglobulin genes.


    Kato, Lucia; Begum, Nasim A; Burroughs, A Maxwell; Doi, Tomomitsu; Kawai, Jun; Daub, Carsten O; Kawaguchi, Takahisa; Matsuda, Fumihiko; Hayashizaki, Yoshihide; Honjo, Tasuku


    Activation-induced cytidine deaminase (AID) is required for both somatic hypermutation and class-switch recombination in activated B cells. AID is also known to target nonimmunoglobulin genes and introduce mutations or chromosomal translocations, eventually causing tumors. To identify as-yet-unknown AID targets, we screened early AID-induced DNA breaks by using two independent genome-wide approaches. Along with known AID targets, this screen identified a set of unique genes (SNHG3, MALAT1, BCL7A, and CUX1) and confirmed that these loci accumulated mutations as frequently as Ig locus after AID activation. Moreover, these genes share three important characteristics with the Ig gene: translocations in tumors, repetitive sequences, and the epigenetic modification of chromatin by H3K4 trimethylation in the vicinity of cleavage sites.

  11. Genome-wide association study identifies multiple susceptibility loci for pancreatic cancer.


    Wolpin, Brian M; Rizzato, Cosmeri; Kraft, Peter; Kooperberg, Charles; Petersen, Gloria M; Wang, Zhaoming; Arslan, Alan A; Beane-Freeman, Laura; Bracci, Paige M; Buring, Julie; Canzian, Federico; Duell, Eric J; Gallinger, Steven; Giles, Graham G; Goodman, Gary E; Goodman, Phyllis J; Jacobs, Eric J; Kamineni, Aruna; Klein, Alison P; Kolonel, Laurence N; Kulke, Matthew H; Li, Donghui; Malats, Núria; Olson, Sara H; Risch, Harvey A; Sesso, Howard D; Visvanathan, Kala; White, Emily; Zheng, Wei; Abnet, Christian C; Albanes, Demetrius; Andreotti, Gabriella; Austin, Melissa A; Barfield, Richard; Basso, Daniela; Berndt, Sonja I; Boutron-Ruault, Marie-Christine; Brotzman, Michelle; Büchler, Markus W; Bueno-de-Mesquita, H Bas; Bugert, Peter; Burdette, Laurie; Campa, Daniele; Caporaso, Neil E; Capurso, Gabriele; Chung, Charles; Cotterchio, Michelle; Costello, Eithne; Elena, Joanne; Funel, Niccola; Gaziano, J Michael; Giese, Nathalia A; Giovannucci, Edward L; Goggins, Michael; Gorman, Megan J; Gross, Myron; Haiman, Christopher A; Hassan, Manal; Helzlsouer, Kathy J; Henderson, Brian E; Holly, Elizabeth A; Hu, Nan; Hunter, David J; Innocenti, Federico; Jenab, Mazda; Kaaks, Rudolf; Key, Timothy J; Khaw, Kay-Tee; Klein, Eric A; Kogevinas, Manolis; Krogh, Vittorio; Kupcinskas, Juozas; Kurtz, Robert C; LaCroix, Andrea; Landi, Maria T; Landi, Stefano; Le Marchand, Loic; Mambrini, Andrea; Mannisto, Satu; Milne, Roger L; Nakamura, Yusuke; Oberg, Ann L; Owzar, Kouros; Patel, Alpa V; Peeters, Petra H M; Peters, Ulrike; Pezzilli, Raffaele; Piepoli, Ada; Porta, Miquel; Real, Francisco X; Riboli, Elio; Rothman, Nathaniel; Scarpa, Aldo; Shu, Xiao-Ou; Silverman, Debra T; Soucek, Pavel; Sund, Malin; Talar-Wojnarowska, Renata; Taylor, Philip R; Theodoropoulos, George E; Thornquist, Mark; Tjønneland, Anne; Tobias, Geoffrey S; Trichopoulos, Dimitrios; Vodicka, Pavel; Wactawski-Wende, Jean; Wentzensen, Nicolas; Wu, Chen; Yu, Herbert; Yu, Kai; Zeleniuch-Jacquotte, Anne; Hoover, Robert; Hartge, Patricia; Fuchs, Charles; Chanock, Stephen J; Stolzenberg-Solomon, Rachael S; Amundadottir, Laufey T


    We performed a multistage genome-wide association study including 7,683 individuals with pancreatic cancer and 14,397 controls of European descent. Four new loci reached genome-wide significance: rs6971499 at 7q32.3 (LINC-PINT, per-allele odds ratio (OR) = 0.79, 95% confidence interval (CI) 0.74-0.84, P = 3.0 × 10(-12)), rs7190458 at 16q23.1 (BCAR1/CTRB1/CTRB2, OR = 1.46, 95% CI 1.30-1.65, P = 1.1 × 10(-10)), rs9581943 at 13q12.2 (PDX1, OR = 1.15, 95% CI 1.10-1.20, P = 2.4 × 10(-9)) and rs16986825 at 22q12.1 (ZNRF3, OR = 1.18, 95% CI 1.12-1.25, P = 1.2 × 10(-8)). We identified an independent signal in exon 2 of TERT at the established region 5p15.33 (rs2736098, OR = 0.80, 95% CI 0.76-0.85, P = 9.8 × 10(-14)). We also identified a locus at 8q24.21 (rs1561927, P = 1.3 × 10(-7)) that approached genome-wide significance located 455 kb telomeric of PVT1. Our study identified multiple new susceptibility alleles for pancreatic cancer that are worthy of follow-up studies. PMID:25086665

  12. Genetics of Hemoglobin in the Deer Mouse, PEROMYSCUS MANICULATUS . II. Multiple Alleles at Regulatory Loci

    PubMed Central

    Snyder, Lee R. G.


    Deer mice are polymorphic for electrophoretic hemoglobin phenotypes showing one, two, or three bands. Within the multibanded phenotypes, there is considerable variation in the hemoglobin partitioning, defined as the fraction of total hemoglobin made up by the secondary and tertiary bands. In subspecies sonoriensis, for example, hemoglobin partitionings range from 0.03 to 0.38. The inheritance of partitioning values is under remarkably strict genetic control. The genetic variation is additive and the narrow heritability is close to 1.0. The inheritance data can be modeled in precise detail by postulating multiple-allele polymorphisms at globin regulatory loci. Comparison of simulated versus actual inheritance data demonstrates that the so-called null structural alleles actually produce functional globins.—The genetic controls in Peromyscus may be analogous to those in primates. Unfortunately, the molecular mechanisms effecting the regulation are unknown. Different subspecies of P. maniculatus show strikingly different arrays of partitioning values, but the role of natural selection in maintaining the quantitative polymorphisms remains obscure. PMID:669256

  13. Gene-based meta-analysis of genome-wide association studies implicates new loci involved in obesity.


    Hägg, Sara; Ganna, Andrea; Van Der Laan, Sander W; Esko, Tonu; Pers, Tune H; Locke, Adam E; Berndt, Sonja I; Justice, Anne E; Kahali, Bratati; Siemelink, Marten A; Pasterkamp, Gerard; Strachan, David P; Speliotes, Elizabeth K; North, Kari E; Loos, Ruth J F; Hirschhorn, Joel N; Pawitan, Yudi; Ingelsson, Erik


    To date, genome-wide association studies (GWASs) have identified >100 loci with single variants associated with body mass index (BMI). This approach may miss loci with high allelic heterogeneity; therefore, the aim of the present study was to use gene-based meta-analysis to identify regions with high allelic heterogeneity to discover additional obesity susceptibility loci. We included GWAS data from 123 865 individuals of European descent from 46 cohorts in Stage 1 and Metabochip data from additional 103 046 individuals from 43 cohorts in Stage 2, all within the Genetic Investigation of ANthropometric Traits (GIANT) consortium. Each cohort was tested for association between ∼2.4 million (Stage 1) or ∼200 000 (Stage 2) imputed or genotyped single variants and BMI, and summary statistics were subsequently meta-analyzed in 17 941 genes. We used the 'VErsatile Gene-based Association Study' (VEGAS) approach to assign variants to genes and to calculate gene-based P-values based on simulations. The VEGAS method was applied to each cohort separately before a gene-based meta-analysis was performed. In Stage 1, two known (FTO and TMEM18) and six novel (PEX2, MTFR2, SSFA2, IARS2, CEP295 and TXNDC12) loci were associated with BMI (P < 2.8 × 10(-6) for 17 941 gene tests). We confirmed all loci, and six of them were gene-wide significant in Stage 2 alone. We provide biological support for the loci by pathway, expression and methylation analyses. Our results indicate that gene-based meta-analysis of GWAS provides a useful strategy to find loci of interest that were not identified in standard single-marker analyses due to high allelic heterogeneity. PMID:26376864

  14. Multiple Linkage Disequilibrium Mapping Methods to Validate Additive Quantitative Trait Loci in Korean Native Cattle (Hanwoo).


    Li, Yi; Kim, Jong-Joo


    The efficiency of genome-wide association analysis (GWAS) depends on power of detection for quantitative trait loci (QTL) and precision for QTL mapping. In this study, three different strategies for GWAS were applied to detect QTL for carcass quality traits in the Korean cattle, Hanwoo; a linkage disequilibrium single locus regression method (LDRM), a combined linkage and linkage disequilibrium analysis (LDLA) and a BayesCπ approach. The phenotypes of 486 steers were collected for weaning weight (WWT), yearling weight (YWT), carcass weight (CWT), backfat thickness (BFT), longissimus dorsi muscle area, and marbling score (Marb). Also the genotype data for the steers and their sires were scored with the Illumina bovine 50K single nucleotide polymorphism (SNP) chips. For the two former GWAS methods, threshold values were set at false discovery rate <0.01 on a chromosome-wide level, while a cut-off threshold value was set in the latter model, such that the top five windows, each of which comprised 10 adjacent SNPs, were chosen with significant variation for the phenotype. Four major additive QTL from these three methods had high concordance found in 64.1 to 64.9Mb for Bos taurus autosome (BTA) 7 for WWT, 24.3 to 25.4Mb for BTA14 for CWT, 0.5 to 1.5Mb for BTA6 for BFT and 26.3 to 33.4Mb for BTA29 for BFT. Several candidate genes (i.e. glutamate receptor, ionotropic, ampa 1 [GRIA1], family with sequence similarity 110, member B [FAM110B], and thymocyte selection-associated high mobility group box [TOX]) may be identified close to these QTL. Our result suggests that the use of different linkage disequilibrium mapping approaches can provide more reliable chromosome regions to further pinpoint DNA makers or causative genes in these regions.

  15. Multiple Linkage Disequilibrium Mapping Methods to Validate Additive Quantitative Trait Loci in Korean Native Cattle (Hanwoo).


    Li, Yi; Kim, Jong-Joo


    The efficiency of genome-wide association analysis (GWAS) depends on power of detection for quantitative trait loci (QTL) and precision for QTL mapping. In this study, three different strategies for GWAS were applied to detect QTL for carcass quality traits in the Korean cattle, Hanwoo; a linkage disequilibrium single locus regression method (LDRM), a combined linkage and linkage disequilibrium analysis (LDLA) and a BayesCπ approach. The phenotypes of 486 steers were collected for weaning weight (WWT), yearling weight (YWT), carcass weight (CWT), backfat thickness (BFT), longissimus dorsi muscle area, and marbling score (Marb). Also the genotype data for the steers and their sires were scored with the Illumina bovine 50K single nucleotide polymorphism (SNP) chips. For the two former GWAS methods, threshold values were set at false discovery rate <0.01 on a chromosome-wide level, while a cut-off threshold value was set in the latter model, such that the top five windows, each of which comprised 10 adjacent SNPs, were chosen with significant variation for the phenotype. Four major additive QTL from these three methods had high concordance found in 64.1 to 64.9Mb for Bos taurus autosome (BTA) 7 for WWT, 24.3 to 25.4Mb for BTA14 for CWT, 0.5 to 1.5Mb for BTA6 for BFT and 26.3 to 33.4Mb for BTA29 for BFT. Several candidate genes (i.e. glutamate receptor, ionotropic, ampa 1 [GRIA1], family with sequence similarity 110, member B [FAM110B], and thymocyte selection-associated high mobility group box [TOX]) may be identified close to these QTL. Our result suggests that the use of different linkage disequilibrium mapping approaches can provide more reliable chromosome regions to further pinpoint DNA makers or causative genes in these regions. PMID:26104396

  16. Revisiting the Thrifty Gene Hypothesis via 65 Loci Associated with Susceptibility to Type 2 Diabetes

    PubMed Central

    Ayub, Qasim; Moutsianas, Loukas; Chen, Yuan; Panoutsopoulou, Kalliope; Colonna, Vincenza; Pagani, Luca; Prokopenko, Inga; Ritchie, Graham R.S.; Tyler-Smith, Chris; McCarthy, Mark I.; Zeggini, Eleftheria; Xue, Yali


    We have investigated the evidence for positive selection in samples of African, European, and East Asian ancestry at 65 loci associated with susceptibility to type 2 diabetes (T2D) previously identified through genome-wide association studies. Selection early in human evolutionary history is predicted to lead to ancestral risk alleles shared between populations, whereas late selection would result in population-specific signals at derived risk alleles. By using a wide variety of tests based on the site frequency spectrum, haplotype structure, and population differentiation, we found no global signal of enrichment for positive selection when we considered all T2D risk loci collectively. However, in a locus-by-locus analysis, we found nominal evidence for positive selection at 14 of the loci. Selection favored the protective and risk alleles in similar proportions, rather than the risk alleles specifically as predicted by the thrifty gene hypothesis, and may not be related to influence on diabetes. Overall, we conclude that past positive selection has not been a powerful influence driving the prevalence of T2D risk alleles. PMID:24412096

  17. The consequences of dominance and gene flow for local adaptation and differentiation at two linked loci

    PubMed Central

    Akerman, Ada; Bürger, Reinhard


    For a subdivided population the consequences of dominance and gene flow for the maintenance of multilocus polymorphism, local adaptation, and differentiation are investigated. The dispersing population inhabits two demes in which selection acts in opposite direction. Fitness is determined additively by two linked diallelic loci with arbitrary intermediate dominance (no over- or underdominance). For weak as well as strong migration, the equilibrium structure is derived. As a special case, a continuous-time continent–island model (CI model) is analyzed, with one-way migration from the continent to the island. For this CI model, the equilibrium and stability configuration is obtained explicitly for weak migration, for strong migration, for independent loci, and for complete linkage. For independent loci, the possible bifurcation patterns are derived as functions of the migration rate. These patterns depend strongly on the degree of dominance. The effects of dominance, linkage, and migration on the amount of linkage disequilibrium (LD) and the degree of local adaptation are explored. Explicit formulas are obtained for D   (=x1x4−x2x3) and r2 (the squared correlation in allelic state). They demonstrate that dominant island alleles increase D and decrease r2. Local adaptation is elevated by dominance of the locally adaptive alleles. The effective migration rate at a linked neutral locus is calculated. If advantageous alleles are dominant, it is decreased only slightly below the actual migration rate. For a quantitative trait that is determined by two additive loci, the influence of dominance on measures of differentiation is studied. Explicit expressions for QST and two types of FST at equilibrium are deduced and their relation is discussed. PMID:24793653

  18. Identification of genes for controlling swine adipose deposition by integrating transcriptome, whole-genome resequencing, and quantitative trait loci data.


    Xing, Kai; Zhu, Feng; Zhai, LiWei; Chen, ShaoKang; Tan, Zhen; Sun, YangYang; Hou, ZhuoCheng; Wang, ChuDuan


    Backfat thickness is strongly associated with meat quality, fattening efficiency, reproductive performance, and immunity in pigs. Fat storage and fatty acid synthesis mainly occur in adipose tissue. Therefore, we used a high-throughput massively parallel sequencing approach to identify transcriptomes in adipose tissue, and whole-genome differences from three full-sibling pairs of pigs with opposite (high and low) backfat thickness phenotypes. We obtained an average of 38.69 million reads for six samples, 78.68% of which were annotated in the reference genome. Eighty-nine overlapping differentially expressed genes were identified among the three pair comparisons. Whole-genome resequencing also detected multiple genetic variations between the pools of DNA from the two groups. Compared with the animal quantitative trait loci (QTL) database, 20 differentially expressed genes were matched to the QTLs associated with fatness in pigs. Our technique of integrating transcriptome, whole-genome resequencing, and QTL database information provided a rich source of important differentially expressed genes and variations. Associate analysis between selected SNPs and backfat thickness revealed that two SNPs and one haplotype of ME1 significantly affected fat deposition in pigs. Moreover, genetic analysis confirmed that variations in the differentially expressed genes may affect fat deposition. PMID:26996612

  19. Identification of genes for controlling swine adipose deposition by integrating transcriptome, whole-genome resequencing, and quantitative trait loci data

    PubMed Central

    Xing, Kai; Zhu, Feng; Zhai, LiWei; Chen, ShaoKang; Tan, Zhen; Sun, YangYang; Hou, ZhuoCheng; Wang, ChuDuan


    Backfat thickness is strongly associated with meat quality, fattening efficiency, reproductive performance, and immunity in pigs. Fat storage and fatty acid synthesis mainly occur in adipose tissue. Therefore, we used a high-throughput massively parallel sequencing approach to identify transcriptomes in adipose tissue, and whole-genome differences from three full-sibling pairs of pigs with opposite (high and low) backfat thickness phenotypes. We obtained an average of 38.69 million reads for six samples, 78.68% of which were annotated in the reference genome. Eighty-nine overlapping differentially expressed genes were identified among the three pair comparisons. Whole-genome resequencing also detected multiple genetic variations between the pools of DNA from the two groups. Compared with the animal quantitative trait loci (QTL) database, 20 differentially expressed genes were matched to the QTLs associated with fatness in pigs. Our technique of integrating transcriptome, whole-genome resequencing, and QTL database information provided a rich source of important differentially expressed genes and variations. Associate analysis between selected SNPs and backfat thickness revealed that two SNPs and one haplotype of ME1 significantly affected fat deposition in pigs. Moreover, genetic analysis confirmed that variations in the differentially expressed genes may affect fat deposition. PMID:26996612

  20. Difference in number of loci of swine leukocyte antigen classical class I genes among haplotypes.


    Tanaka-Matsuda, Maiko; Ando, Asako; Rogel-Gaillard, Claire; Chardon, Patrick; Uenishi, Hirohide


    The structure of the entire genomic region of swine leukocyte antigen (SLA)-the porcine major histocompatibility complex--was recently elucidated in a particular haplotype named Hp-1.0 (H01). However, it has been suggested that there are differences in the number of loci of SLA genes, particularly classical class I genes, among haplotypes. To clarify the between-haplotype copy number variance in genes of the SLA region, we sequenced the genomic region carrying SLA classical class I genes on two different haplotypes, revealing increments of up to six in the number of classical class I genes in a single haplotype. All of the SLA-1(-like) (SLA-1 and newly designated SLA-12) and SLA-3 genes detected in the haplotypes thus analyzed were transcribed in the individual. The process by which duplication of SLA classical class I genes was likely to have occurred was interpreted from an analysis of repetitive sequences adjacent to the duplicated class I genes.

  1. MANBA, CXCR5, SOX8, RPS6KB1 and ZBTB46 are genetic risk loci for multiple sclerosis

    PubMed Central

    Lill, Christina M.; Schjeide, Brit-Maren M.; Graetz, Christiane; Ban, Maria; Alcina, Antonio; Ortiz, Miguel A.; Pérez, Jennifer; Damotte, Vincent; Booth, David; Lopez de Lapuente, Aitzkoa; Broer, Linda; Schilling, Marcel; Akkad, Denis A.; Aktas, Orhan; Alloza, Iraide; Antigüedad, Alfredo; Arroyo, Rafa; Blaschke, Paul; Buttmann, Mathias; Chan, Andrew; Compston, Alastair; Cournu-Rebeix, Isabelle; Dörner, Thomas; Epplen, Joerg T.; Fernández, Óscar; Gerdes, Lisa-Ann; Guillot-Noël, Léna; Hartung, Hans-Peter; Hoffjan, Sabine; Izquierdo, Guillermo; Kemppinen, Anu; Kroner, Antje; Kubisch, Christian; Kümpfel, Tania; Li, Shu-Chen; Lindenberger, Ulman; Lohse, Peter; Lubetzki, Catherine; Luessi, Felix; Malhotra, Sunny; Mescheriakova, Julia; Montalban, Xavier; Papeix, Caroline; Paredes, Lidia F.; Rieckmann, Peter; Steinhagen-Thiessen, Elisabeth; Winkelmann, Alexander; Zettl, Uwe K.; Hintzen, Rogier; Vandenbroeck, Koen; Stewart, Graeme; Fontaine, Bertrand; Comabella, Manuel; Urcelay, Elena; Matesanz, Fuencisla; Sawcer, Stephen; Bertram, Lars; Zipp, Frauke


    A recent genome-wide association study reported five loci for which there was strong, but sub-genome-wide significant evidence for association with multiple sclerosis risk. The aim of this study was to evaluate the role of these potential risk loci in a large and independent data set of ∼20 000 subjects. We tested five single nucleotide polymorphisms rs228614 (MANBA), rs630923 (CXCR5), rs2744148 (SOX8), rs180515 (RPS6KB1), and rs6062314 (ZBTB46) for association with multiple sclerosis risk in a total of 8499 cases with multiple sclerosis, 8765 unrelated control subjects and 958 trios of European descent. In addition, we assessed the overall evidence for association by combining these newly generated data with the results from the original genome-wide association study by meta-analysis. All five tested single nucleotide polymorphisms showed consistent and statistically significant evidence for association with multiple sclerosis in our validation data sets (rs228614: odds ratio = 0.91, P = 2.4 × 10−6; rs630923: odds ratio = 0.89, P = 1.2 × 10−4; rs2744148: odds ratio = 1.14, P = 1.8 × 10−6; rs180515: odds ratio = 1.12, P = 5.2 × 10−7; rs6062314: odds ratio = 0.90, P = 4.3 × 10−3). Combining our data with results from the previous genome-wide association study by meta-analysis, the evidence for association was strengthened further, surpassing the threshold for genome-wide significance (P < 5 × 10−8) in each case. Our study provides compelling evidence that these five loci are genuine multiple sclerosis susceptibility loci. These results may eventually lead to a better understanding of the underlying disease pathophysiology. PMID:23739915

  2. Expression Quantitative Trait Loci Analysis Identifies Associations Between Genotype and Gene Expression in Human Intestine

    PubMed Central



    BACKGROUND & AIMS Genome-wide association studies have greatly increased our understanding of intestinal disease. However, little is known about how genetic variations result in phenotypic changes. Some polymorphisms have been shown to modulate quantifiable phenotypic traits; these are called quantitative trait loci. Quantitative trait loci that affect levels of gene expression are called expression quantitative trait loci (eQTL), which can provide insight into the biological relevance of data from genome-wide association studies. We performed a comprehensive eQTL scan of intestinal tissue. METHODS Total RNA was extracted from ileal biopsy specimens and genomic DNA was obtained from whole-blood samples from the same cohort of individuals. Cis- and trans-eQTL analyses were performed using a custom software pipeline for samples from 173 subjects. The analyses determined the expression levels of 19,047 unique autosomal genes listed in the US National Center for Biotechnology Information database and more than 580,000 variants from the Single Nucleotide Polymorphism database. RESULTS The presence of more than 15,000 cis- and trans-eQTL was detected with statistical significance. eQTL associated with the same expression trait were in high linkage disequilibrium. Comparative analysis with previous eQTL studies showed that 30% to 40% of genes identified as eQTL in monocytes, liver tissue, lymphoblastoid cell lines, T cells, and fibroblasts are also eQTL in ileal tissue. Conversely, most of the significant eQTL have not been previously identified and could be tissue specific. These are involved in many cell functions, including division and antigen processing and presentation. Our analysis confirmed that previously published cis-eQTL are single nucleotide polymorphisms associated with inflammatory bowel disease: rs2298428/UBE2L3, rs1050152/SLC22A4, and SLC22A5. We identified many new associations between inflammatory bowel disease susceptibility loci and gene expression

  3. Migration-selection balance at multiple Loci and selection on dominance and recombination.


    Yanchukov, Alexey; Proulx, Stephen R


    A steady influx of a single deleterious multilocus genotype will impose genetic load on the resident population and leave multiple descendants carrying various numbers of the foreign alleles. Provided that the foreign types are rare at equilibrium, and all immigrant genes are eventually eliminated by selection, the population structure can be inferred explicitly from the branching process taking place within a single immigrant lineage. Unless the migration and recombination rates were high, this novel method gives a close approximation to the simulation with all possible multilocus genotypes considered. Once the load and the foreign genotypes frequencies are known, it becomes possible to estimate selection acting on the invading modifiers of (i) dominance and (ii) recombination rate on the foreign gene block. We found that the modifiers of the (i) type are able to invade faster than the type (ii) modifier, however, this result only applies in the strong selection/low migration/low recombination scenario. Varying the number of genes in the immigrant genotype can have a non-monotonic effect on the migration load and the modifier's invasion rate: although blocks carrying more genes can give rise to longer lineages, they also experience stronger selection pressure. The heaviest load is therefore imposed by the genotypes carrying moderate numbers of genes. PMID:24551127

  4. Migration-selection balance at multiple Loci and selection on dominance and recombination.


    Yanchukov, Alexey; Proulx, Stephen R


    A steady influx of a single deleterious multilocus genotype will impose genetic load on the resident population and leave multiple descendants carrying various numbers of the foreign alleles. Provided that the foreign types are rare at equilibrium, and all immigrant genes are eventually eliminated by selection, the population structure can be inferred explicitly from the branching process taking place within a single immigrant lineage. Unless the migration and recombination rates were high, this novel method gives a close approximation to the simulation with all possible multilocus genotypes considered. Once the load and the foreign genotypes frequencies are known, it becomes possible to estimate selection acting on the invading modifiers of (i) dominance and (ii) recombination rate on the foreign gene block. We found that the modifiers of the (i) type are able to invade faster than the type (ii) modifier, however, this result only applies in the strong selection/low migration/low recombination scenario. Varying the number of genes in the immigrant genotype can have a non-monotonic effect on the migration load and the modifier's invasion rate: although blocks carrying more genes can give rise to longer lineages, they also experience stronger selection pressure. The heaviest load is therefore imposed by the genotypes carrying moderate numbers of genes.

  5. Genome-wide association study identifies multiple susceptibility loci for pancreatic cancer

    PubMed Central

    Wolpin, Brian M.; Rizzato, Cosmeri; Kraft, Peter; Kooperberg, Charles; Petersen, Gloria M.; Wang, Zhaoming; Arslan, Alan A.; Beane-Freeman, Laura; Bracci, Paige M.; Buring, Julie; Canzian, Federico; Duell, Eric J.; Gallinger, Steven; Giles, Graham G.; Goodman, Gary E.; Goodman, Phyllis J.; Jacobs, Eric J.; Kamineni, Aruna; Klein, Alison P.; Kolonel, Laurence N.; Kulke, Matthew H.; Li, Donghui; Malats, Núria; Olson, Sara H.; Risch, Harvey A.; Sesso, Howard D.; Visvanathan, Kala; White, Emily; Zheng, Wei; Abnet, Christian C.; Albanes, Demetrius; Andreotti, Gabriella; Austin, Melissa A.; Barfield, Richard; Basso, Daniela; Berndt, Sonja I.; Boutron-Ruault, Marie-Christine; Brotzman, Michelle; Büchler, Markus W.; Bueno-de-Mesquita, H. Bas; Bugert, Peter; Burdette, Laurie; Campa, Daniele; Caporaso, Neil E.; Capurso, Gabriele; Chung, Charles; Cotterchio, Michelle; Costello, Eithne; Elena, Joanne; Funel, Niccola; Gaziano, J. Michael; Giese, Nathalia A.; Giovannucci, Edward L.; Goggins, Michael; Gorman, Megan J.; Gross, Myron; Haiman, Christopher A.; Hassan, Manal; Helzlsouer, Kathy J.; Henderson, Brian E.; Holly, Elizabeth A.; Hu, Nan; Hunter, David J.; Innocenti, Federico; Jenab, Mazda; Kaaks, Rudolf; Key, Timothy J.; Khaw, Kay-Tee; Klein, Eric A.; Kogevinas, Manolis; Krogh, Vittorio; Kupcinskas, Juozas; Kurtz, Robert C.; LaCroix, Andrea; Landi, Maria T.; Landi, Stefano; Le Marchand, Loic; Mambrini, Andrea; Mannisto, Satu; Milne, Roger L.; Nakamura, Yusuke; Oberg, Ann L.; Owzar, Kouros; Patel, Alpa V.; Peeters, Petra H. M.; Peters, Ulrike; Pezzilli, Raffaele; Piepoli, Ada; Porta, Miquel; Real, Francisco X.; Riboli, Elio; Rothman, Nathaniel; Scarpa, Aldo; Shu, Xiao-Ou; Silverman, Debra T.; Soucek, Pavel; Sund, Malin; Talar-Wojnarowska, Renata; Taylor, Philip R.; Theodoropoulos, George E.; Thornquist, Mark; Tjønneland, Anne; Tobias, Geoffrey S.; Trichopoulos, Dimitrios; Vodicka, Pavel; Wactawski-Wende, Jean; Wentzensen, Nicolas; Wu, Chen; Yu, Herbert; Yu, Kai; Zeleniuch-Jacquotte, Anne; Hoover, Robert; Hartge, Patricia; Fuchs, Charles; Chanock, Stephen J.


    We performed a multistage genome-wide association study (GWAS) including 7,683 individuals with pancreatic cancer and 14,397 controls of European descent. Four new loci reached genome-wide significance: rs6971499 at 7q32.3 (LINC-PINT; per-allele odds ratio [OR] = 0.79; 95% confidence interval [CI] = 0.74–0.84; P = 3.0×10−12), rs7190458 at 16q23.1 (BCAR1/CTRB1/CTRB2; OR = 1.46; 95% CI = 1.30–1.65; P = 1.1×10−10), rs9581943 at 13q12.2 (PDX1; OR = 1.15; 95% CI = 1.10–1.20; P = 2.4×10−9), and rs16986825 at 22q12.1 (ZNRF3; OR = 1.18; 95% CI = 1.12–1.25; P = 1.2×10−8). An independent signal was identified in exon 2 of TERT at the established region 5p15.33 (rs2736098; OR = 0.80; 95% CI = 0.76–0.85; P = 9.8×10−14). We also identified a locus at 8q24.21 (rs1561927; P = 1.3×10−7) that approached genome-wide significance located 455 kb telomeric of PVT1. Our study has identified multiple new susceptibility alleles for pancreatic cancer worthy of follow-up studies. PMID:25086665

  6. Significant Association of Multiple Human Cytomegalovirus Genomic Loci with Glioblastoma Multiforme Samples

    PubMed Central

    Ranganathan, Padhma; Clark, Paul A.; Kuo, John S.; Salamat, M. Shahriar


    Viruses are appreciated as etiological agents of certain human tumors, but the number of different cancer types induced or exacerbated by viral infections is unknown. Glioblastoma multiforme (GBM)/astrocytoma grade IV is a malignant and lethal brain cancer of unknown origin. Over the past decade, several studies have searched for the presence of a prominent herpesvirus, human cytomegalovirus (HCMV), in GBM samples. While some have detected HCMV DNA, RNA, and proteins in GBM tissues, others have not. Therefore, any purported association of HCMV with GBM remains controversial. In most of the previous studies, only one or a select few viral targets were analyzed. Thus, it remains unclear the extent to which the entire viral genome was present when detected. Here we report the results of a survey of GBM specimens for as many as 20 different regions of the HCMV genome. Our findings indicate that multiple HCMV loci are statistically more likely to be found in GBM samples than in other brain tumors or epileptic brain specimens and that the viral genome was more often detected in frozen samples than in paraffin-embedded archival tissue samples. Finally, our experimental results indicate that cellular genomes substantially outnumber viral genomes in HCMV-positive GBM specimens, likely indicating that only a minority of the cells found in such samples harbor viral DNA. These data argue for the association of HCMV with GBM, defining the virus as oncoaccessory. Furthermore, they imply that, were HCMV to enhance the growth or survival of a tumor (i.e., if it is oncomodulatory), it would likely do so through mechanisms distinct from classic tumor viruses that express transforming viral oncoproteins in the overwhelming majority of tumor cells. PMID:22090104

  7. Genome-wide meta-analyses identify multiple loci associated with smoking behavior

    PubMed Central


    Consistent but indirect evidence has implicated genetic factors in smoking behavior1,2. We report meta-analyses of several smoking phenotypes within cohorts of the Tobacco and Genetics Consortium (n = 74,053). We also partnered with the European Network of Genetic and Genomic Epidemiology (ENGAGE) and Oxford-GlaxoSmithKline (Ox-GSK) consortia to follow up the 15 most significant regions (n > 140,000). We identified three loci associated with number of cigarettes smoked per day. The strongest association was a synonymous 15q25 SNP in the nicotinic receptor gene CHRNA3 (rs1051730[A], β = 1.03, standard error (s.e.) = 0.053, P = 2.8 × 10−73). Two 10q25 SNPs (rs1329650[G], β = 0.367, s.e. = 0.059, P = 5.7 × 10−10; and rs1028936[A], β = 0.446, s.e. = 0.074, P = 1.3 × 10−9) and one 9q13 SNP in EGLN2 (rs3733829[G], β = 0.333, s.e. = 0.058, P = 1.0 × 10−8) also exceeded genome-wide significance for cigarettes per day. For smoking initiation, eight SNPs exceeded genome-wide significance, with the strongest association at a nonsynonymous SNP in BDNF on chromosome 11 (rs6265[C], odds ratio (OR) = 1.06, 95% confidence interval (Cl) 1.04–1.08, P = 1.8 × 10−8). One SNP located near DBH on chromosome 9 (rs3025343[G], OR = 1.12, 95% Cl 1.08–1.18, P = 3.6 × 10−8) was significantly associated with smoking cessation. PMID:20418890

  8. Genome-wide meta-analyses identify multiple loci associated with smoking behavior.



    Consistent but indirect evidence has implicated genetic factors in smoking behavior. We report meta-analyses of several smoking phenotypes within cohorts of the Tobacco and Genetics Consortium (n = 74,053). We also partnered with the European Network of Genetic and Genomic Epidemiology (ENGAGE) and Oxford-GlaxoSmithKline (Ox-GSK) consortia to follow up the 15 most significant regions (n > 140,000). We identified three loci associated with number of cigarettes smoked per day. The strongest association was a synonymous 15q25 SNP in the nicotinic receptor gene CHRNA3 (rs1051730[A], beta = 1.03, standard error (s.e.) = 0.053, P = 2.8 x 10(-73)). Two 10q25 SNPs (rs1329650[G], beta = 0.367, s.e. = 0.059, P = 5.7 x 10(-10); and rs1028936[A], beta = 0.446, s.e. = 0.074, P = 1.3 x 10(-9)) and one 9q13 SNP in EGLN2 (rs3733829[G], beta = 0.333, s.e. = 0.058, P = 1.0 x 10(-8)) also exceeded genome-wide significance for cigarettes per day. For smoking initiation, eight SNPs exceeded genome-wide significance, with the strongest association at a nonsynonymous SNP in BDNF on chromosome 11 (rs6265[C], odds ratio (OR) = 1.06, 95% confidence interval (Cl) 1.04-1.08, P = 1.8 x 10(-8)). One SNP located near DBH on chromosome 9 (rs3025343[G], OR = 1.12, 95% Cl 1.08-1.18, P = 3.6 x 10(-8)) was significantly associated with smoking cessation.

  9. Association analysis of GWAS and candidate gene loci in a Pakistani population with psoriasis.


    Munir, Saeeda; ber Rahman, Simeen; Rehman, Sadia; Saba, Nusrat; Ahmad, Wasim; Nilsson, Staffan; Mazhar, Kehkashan; Naluai, Åsa Torinsson


    Psoriasis is a common inflammatory and hyper proliferative condition of the skin and a serious chronic systemic autoimmune disease. We undertook an association study to investigate the genetic etiology of psoriasis in a Pakistani population by genotyping single-nucleotide polymorphisms (SNPs) previously reported to be associated in genome-wide association (GWAS) or in candidate gene studies of psoriasis. Fifty seven single-nucleotide polymorphisms (SNPs) from 42 loci were genotyped in 533 psoriasis patients and 373 controls. Our results showed genome wide significant association of the MHC region (rs1265181 being the most significant from five SNPs used with overall OR=3.38; p=2.97E-18), as well as nominally significant associations at ten other loci (p<0.05) in the Pakistani population (LCE3B, REL, IL13/IL4, TNIP1, IL12B, TRAF3IP2, ZC3H12C, NOS2 and RNF114 from GWAS and PRR9 from a previous candidate gene study). Overall, only nine SNPs out of the 42 GWAS loci, displayed an odds ratio in the opposite allelic direction and only three did not reach similar odds ratio within 95% confidence interval as previously reported (SLC45A1/TNFRSF9, ELMO1 and IL28RA). This indicates similar genetic risk factors and molecular mechanisms behind disease in Pakistani psoriasis patients as in other populations. In addition, we show that the MHC and TNIP1 regions are significantly different in patients with psoriasis onset before the age of 40 (type I) compared to after 40 years of age (type II). MHC being associated mainly with type I while TNIP1 with type II patients.

  10. Identification of New Genetic Susceptibility Loci for Breast Cancer Through Consideration of Gene-Environment Interactions

    PubMed Central

    Schoeps, Anja; Rudolph, Anja; Seibold, Petra; Dunning, Alison M.; Milne, Roger L.; Bojesen, Stig E.; Swerdlow, Anthony; Andrulis, Irene; Brenner, Hermann; Behrens, Sabine; Orr, Nicholas; Jones, Michael; Ashworth, Alan; Li, Jingmei; Cramp, Helen; Connley, Dan; Czene, Kamila; Darabi, Hatef; Chanock, Stephen J.; Lissowska, Jolanta; Figueroa, Jonine D.; Knight, Julia; Glendon, Gord; Mulligan, Anna M.; Dumont, Martine; Severi, Gianluca; Baglietto, Laura; Olson, Janet; Vachon, Celine; Purrington, Kristen; Moisse, Matthieu; Neven, Patrick; Wildiers, Hans; Spurdle, Amanda; Kosma, Veli-Matti; Kataja, Vesa; Hartikainen, Jaana M.; Hamann, Ute; Ko, Yon-Dschun; Dieffenbach, Aida K.; Arndt, Volker; Stegmaier, Christa; Malats, Núria; Arias Perez, JoséI.; Benítez, Javier; Flyger, Henrik; Nordestgaard, Børge G.; Truong, Théresè; Cordina-Duverger, Emilie; Menegaux, Florence; Silva, Isabel dos Santos; Fletcher, Olivia; Johnson, Nichola; Häberle, Lothar; Beckmann, Matthias W.; Ekici, Arif B.; Braaf, Linde; Atsma, Femke; van den Broek, Alexandra J.; Makalic, Enes; Schmidt, Daniel F.; Southey, Melissa C.; Cox, Angela; Simard, Jacques; Giles, Graham G.; Lambrechts, Diether; Mannermaa, Arto; Brauch, Hiltrud; Guénel, Pascal; Peto, Julian; Fasching, Peter A.; Hopper, John; Flesch-Janys, Dieter; Couch, Fergus; Chenevix-Trench, Georgia; Pharoah, Paul D. P.; Garcia-Closas, Montserrat; Schmidt, Marjanka K.; Hall, Per; Easton, Douglas F.; Chang-Claude, Jenny


    Genes that alter disease risk only in combination with certain environmental exposures may not be detected in genetic association analysis. By using methods accounting for gene-environment (G × E) interaction, we aimed to identify novel genetic loci associated with breast cancer risk. Up to 34,475 cases and 34,786 controls of European ancestry from up to 23 studies in the Breast Cancer Association Consortium were included. Overall, 71,527 single nucleotide polymorphisms (SNPs), enriched for association with breast cancer, were tested for interaction with 10 environmental risk factors using three recently proposed hybrid methods and a joint test of association and interaction. Analyses were adjusted for age, study, population stratification, and confounding factors as applicable. Three SNPs in two independent loci showed statistically significant association: SNPs rs10483028 and rs2242714 in perfect linkage disequilibrium on chromosome 21 and rs12197388 in ARID1B on chromosome 6. While rs12197388 was identified using the joint test with parity and with age at menarche (P-values = 3 × 10−07), the variants on chromosome 21 q22.12, which showed interaction with adult body mass index (BMI) in 8,891 postmenopausal women, were identified by all methods applied. SNP rs10483028 was associated with breast cancer in women with a BMI below 25 kg/m2 (OR = 1.26, 95% CI 1.15–1.38) but not in women with a BMI of 30 kg/m2 or higher (OR = 0.89, 95% CI 0.72–1.11, P for interaction = 3.2 × 10−05). Our findings confirm comparable power of the recent methods for detecting G × E interaction and the utility of using G × E interaction analyses to identify new susceptibility loci. PMID:24248812

  11. Identification of quantitative trait loci and candidate genes for cadmium tolerance in Populus

    SciTech Connect

    Induri, Brahma R; Ellis, Danielle R; Slavov, Goncho T.; Yin, Tongming; Zhang, Xinye; Tuskan, Gerald A; DiFazio, Steven P


    Understanding genetic variation for the response of Populus to heavy metals like cadmium (Cd) is an important step in elucidating the underlying mechanisms of tolerance. In this study, a pseudo-backcross pedigree of Populus trichocarpa Torr. & Gray and Populus deltoides Bart. was characterized for growth and performance traits after Cd exposure. A total of 16 quantitative trait loci (QTL) at logarithm of odds (LOD) ratio 2.5 were detected for total dry weight, its components and root volume. Major QTL for Cd responses were mapped to two different linkage groups and the relative allelic effects were in opposing directions on the two chromosomes, suggesting differential mechanisms at these two loci. The phenotypic variance explained by Cd QTL ranged from 5.9 to 11.6% and averaged 8.2% across all QTL. A whole-genome microarray study led to the identification of nine Cd-responsive genes from these QTL. Promising candidates for Cd tolerance include an NHL repeat membrane-spanning protein, a metal transporter and a putative transcription factor. Additional candidates in the QTL intervals include a putative homolog of a glutamate cysteine ligase, and a glutathione-S-transferase. Functional characterization of these candidate genes should enhance our understanding of Cd metabolism and transport and phytoremediation capabilities of Populus.

  12. Ethanol elevates physiological all-trans-retinoic acid levels in select loci through altering retinoid metabolism in multiple loci: a potential mechanism of ethanol toxicity

    PubMed Central

    Kane, Maureen A.; Folias, Alexandra E.; Wang, Chao; Napoli, Joseph L.


    All-trans-retinoic acid (atRA) supports embryonic development, central nervous system function, and the immune response. atRA initiates neurogenesis and dendritic growth in the hippocampus and is required for spatial memory; superphysiological atRA inhibits neurogenesis, causes teratology and/or embryo toxicity, and alters cognitive function and behavior. Because abnormal atRA shares pathological conditions with alcoholism, inhibition of retinol (vitamin A) activation into atRA has been credited widely as a mechanism of ethanol toxicity. Here, we analyze the effects of ethanol on retinoid concentrations in vivo during normal vitamin A nutriture, using sensitive and analytically robust assays. Ethanol either increased or had no effect on atRA, regardless of changes in retinol and retinyl esters. Acute ethanol (3.5 g/kg) increased atRA in adult hippocampus (1.6-fold), liver (2.4-fold), and testis (1.5-fold). Feeding dams a liquid diet with 6.5% ethanol from embryonic day 13 (e13) to e19 increased atRA in fetal hippocampus (up to 20-fold) and cortex (up to 50-fold), depending on blood alcohol content. One-month feeding of the 6.5% ethanol diet increased atRA in adult hippocampus (20-fold), cortex (2-fold), testis (2-fold), and serum (10-fold). Tissue-specific increases in retinoid dehydrogenase mRNAs and activities, extrahepatic retinol concentrations, and atRA catabolism combined to produce site-specific effects. Because a sustained increase in atRA has deleterious effects on the central nervous system and embryo development, these data suggest that superphysiological atRA contributes to ethanol pathological conditions, including cognitive dysfunction and fetal alcohol syndrome.—Kane, M. A., Folias, A. E., Wang, C., Napoli, J. L. Ethanol elevates physiological all-trans-retinoic acid levels in select loci through altering retinoid metabolism in multiple loci: a potential mechanism of ethanol toxicity. PMID:19890016

  13. Multiple New Loci Associated with Kidney Function and Chronic Kidney Disease: The CKDGen consortium

    PubMed Central

    Köttgen, Anna; Pattaro, Cristian; Böger, Carsten A.; Fuchsberger, Christian; Olden, Matthias; Glazer, Nicole L.; Parsa, Afshin; Gao, Xiaoyi; Yang, Qiong; Smith, Albert V.; O’Connell, Jeffrey R.; Li, Man; Schmidt, Helena; Tanaka, Toshiko; Isaacs, Aaron; Ketkar, Shamika; Hwang, Shih-Jen; Johnson, Andrew D.; Dehghan, Abbas; Teumer, Alexander; Paré, Guillaume; Atkinson, Elizabeth J.; Zeller, Tanja; Lohman, Kurt; Cornelis, Marilyn C.; Probst-Hensch, Nicole M.; Kronenberg, Florian; Tönjes, Anke; Hayward, Caroline; Aspelund, Thor; Eiriksdottir, Gudny; Launer, Lenore; Harris, Tamara B.; Rapmersaud, Evadnie; Mitchell, Braxton D.; Boerwinkle, Eric; Struchalin, Maksim; Cavalieri, Margherita; Singleton, Andrew; Giallauria, Francesco; Metter, Jeffery; de Boer, Ian; Haritunians, Talin; Lumley, Thomas; Siscovick, David; Psaty, Bruce M.; Zillikens, M. Carola; Oostra, Ben A.; Feitosa, Mary; Province, Michael; Levy, Daniel; de Andrade, Mariza; Turner, Stephen T.; Schillert, Arne; Ziegler, Andreas; Wild, Philipp S.; Schnabel, Renate B.; Wilde, Sandra; Muenzel, Thomas F.; Leak, Tennille S; Illig, Thomas; Klopp, Norman; Meisinger, Christa; Wichmann, H.-Erich; Koenig, Wolfgang; Zgaga, Lina; Zemunik, Tatijana; Kolcic, Ivana; Minelli, Cosetta; Hu, Frank B.; Johansson, Åsa; Igl, Wilmar; Zaboli, Ghazal; Wild, Sarah H; Wright, Alan F; Campbell, Harry; Ellinghaus, David; Schreiber, Stefan; Aulchenko, Yurii S; Rivadeneira, Fernando; Uitterlinden, Andre G; Hofman, Albert; Imboden, Medea; Nitsch, Dorothea; Brandstätter, Anita; Kollerits, Barbara; Kedenko, Lyudmyla; Mägi, Reedik; Stumvoll, Michael; Kovacs, Peter; Boban, Mladen; Campbell, Susan; Endlich, Karlhans; Völzke, Henry; Kroemer, Heyo K.; Nauck, Matthias; Völker, Uwe; Polasek, Ozren; Vitart, Veronique; Badola, Sunita; Parker, Alexander N.; Ridker, Paul M.; Kardia, Sharon L. R.; Blankenberg, Stefan; Liu, Yongmei; Curhan, Gary C.; Franke, Andre; Rochat, Thierry; Paulweber, Bernhard; Prokopenko, Inga; Wang, Wei; Gudnason, Vilmundur; Shuldiner, Alan R.; Coresh, Josef; Schmidt, Reinhold; Ferrucci, Luigi; Shlipak, Michael G.; van Duijn, Cornelia M.; Borecki, Ingrid; Krämer, Bernhard K.; Rudan, Igor; Gyllensten, Ulf; Wilson, James F.; Witteman, Jacqueline C.; Pramstaller, Peter P.; Rettig, Rainer; Hastie, Nick; Chasman, Daniel I.; Kao, W. H.; Heid, Iris M.; Fox, Caroline S.


    Chronic kidney disease (CKD) is a significant public health problem, and recent genetic studies have identified common CKD susceptibility variants. The CKDGen consortium performed a meta-analysis of genome-wide association data in 67,093 Caucasian individuals from 20 population-based studies to identify new susceptibility loci for reduced renal function, estimated by serum creatinine (eGFRcrea), cystatin C (eGFRcys), and CKD (eGFRcrea <60 ml/min/1.73m2; n = 5,807 CKD cases). Follow-up of the 23 genome-wide significant loci (p<5×10−8) in 22,982 replication samples identified 13 novel loci for renal function and CKD (in or near LASS2, GCKR, ALMS1, TFDP2, DAB2, SLC34A1, VEGFA, PRKAG2, PIP5K1B, ATXN2, DACH1, UBE2Q2, and SLC7A9) and 7 creatinine production and secretion loci (CPS1, SLC22A2, TMEM60, WDR37, SLC6A13, WDR72, BCAS3). These results further our understanding of biologic mechanisms of kidney function by identifying loci potentially influencing nephrogenesis, podocyte function, angiogenesis, solute transport, and metabolic functions of the kidney. PMID:20383146

  14. Genetic diversity of MHC class I loci in six non-model frogs is shaped by positive selection and gene duplication

    PubMed Central

    Kiemnec-Tyburczy, K M; Richmond, J Q; Savage, A E; Lips, K R; Zamudio, K R


    Comparative studies of major histocompatibility complex (MHC) genes across vertebrate species can reveal the evolutionary processes that shape the structure and function of immune regulatory proteins. In this study, we characterized MHC class I sequences from six frog species representing three anuran families (Hylidae, Centrolenidae and Ranidae). Using cDNA from our focal species, we amplified a total of 79 unique sequences spanning exons 2–4 that encode the extracellular domains of the functional alpha chain protein. We compared intra- and interspecific nucleotide and amino-acid divergence, tested for recombination, and identified codon sites under selection by estimating the rate of non-synonymous to synonymous substitutions with multiple codon-based maximum likelihood methods. We determined that positive (diversifying) selection was acting on specific amino-acid sites located within the domains that bind pathogen-derived peptides. We also found significant signals of recombination across the physical distance of the genes. Finally, we determined that all the six species expressed two or three putative classical class I loci, in contrast to the single locus condition of Xenopus laevis. Our results suggest that MHC evolution in anurans is a dynamic process and that variation in numbers of loci and genetic diversity can exist among taxa. Thus, the accumulation of genetic data for more species will be useful in further characterizing the relative importance of processes such as selection, recombination and gene duplication in shaping MHC loci among amphibian lineages. PMID:22549517

  15. Genealogical analyses of multiple loci of litostomatean ciliates (Protista, Ciliophora, Litostomatea)

    PubMed Central

    Vd’ačný, Peter; Bourland, William A.; Orsi, William; Epstein, Slava S.; Foissner, Wilhelm


    The class Litostomatea is a highly diverse ciliate taxon comprising hundreds of free-living and endocommensal species. However, their traditional morphology-based classification conflicts with 18S rRNA gene phylogenies indicating (1) a deep bifurcation of the Litostomatea into Rhynchostomatia and Haptoria + Trichostomatia, and (2) body polarization and simplification of the oral apparatus as main evolutionary trends in the Litostomatea. To test whether 18S rRNA molecules provide a suitable proxy for litostomatean evolutionary history, we used eighteen new ITS1-5.8S rRNA-ITS2 region sequences from various free-living litostomatean orders. These single- and multiple-locus analyses are in agreement with previous 18S rRNA gene phylogenies, supporting that both 18S rRNA gene and ITS region sequences are effective tools for resolving phylogenetic relationships among the litostomateans. Despite insertions, deletions and mutational saturations in the ITS region, the present study shows that ITS1 and ITS2 molecules can be used to infer phylogenetic relationships not only at species level but also at higher taxonomic ranks when their secondary structure information is utilized to aid alignment. PMID:22789763

  16. Epigenetic Modifications Unlock the Milk Protein Gene Loci during Mouse Mammary Gland Development and Differentiation

    PubMed Central

    Rijnkels, Monique; Freeman-Zadrowski, Courtneay; Hernandez, Joseph; Potluri, Vani; Wang, Liguo; Li, Wei; Lemay, Danielle G.


    Background Unlike other tissues, development and differentiation of the mammary gland occur mostly after birth. The roles of systemic hormones and local growth factors important for this development and functional differentiation are well-studied. In other tissues, it has been shown that chromatin organization plays a key role in transcriptional regulation and underlies epigenetic regulation during development and differentiation. However, the role of chromatin organization in mammary gland development and differentiation is less well-defined. Here, we have studied the changes in chromatin organization at the milk protein gene loci (casein, whey acidic protein, and others) in the mouse mammary gland before and after functional differentiation. Methodology/Principal Findings Distal regulatory elements within the casein gene cluster and whey acidic protein gene region have an open chromatin organization after pubertal development, while proximal promoters only gain open-chromatin marks during pregnancy in conjunction with the major induction of their expression. In contrast, other milk protein genes, such as alpha-lactalbumin, already have an open chromatin organization in the mature virgin gland. Changes in chromatin organization in the casein gene cluster region that are present after puberty persisted after lactation has ceased, while the changes which occurred during pregnancy at the gene promoters were not maintained. In general, mammary gland expressed genes and their regulatory elements exhibit developmental stage- and tissue-specific chromatin organization. Conclusions/Significance A progressive gain of epigenetic marks indicative of open/active chromatin on genes marking functional differentiation accompanies the development of the mammary gland. These results support a model in which a chromatin organization is established during pubertal development that is then poised to respond to the systemic hormonal signals of pregnancy and lactation to achieve the

  17. Analyses of genetic variations at microsatellite loci present in-and-around the Pfcrt gene in Indian Plasmodium falciparum.


    Chauhan, Kshipra; Pande, Veena; Das, Aparup


    Evolution and spread of chloroquine resistant (CQR) malaria parasite Plasmodium falciparum have posed great threat in malaria intervention across the globe. The occurrence of K76T mutation in the P. falciparum chloroquine resistance transporter (pfcrt) gene has been widely attributed to CQR with four neighboring mutations providing compensatory fitness benefit to the parasite survival. Understanding evolutionary patterns of the pfcrt gene is of great relevance not only for devising new malaria control measures but also could serve as a model to understand evolution and spread of other human drug-resistant pathogens. Several studies, mainly based on differential patterns of diversities of the microsatellite loci placed in-and-around the pfcrt gene have indicated the role of positive natural selection under the 'hitchhiking' model of molecular evolution. However, the studies were restricted to limited number of microsatellite loci present inside the pfcrt gene. Moreover, comparatively higher level of diversities in microsatellite loci present inside the pfcrt gene than the loci flanking the pfcrt gene are hallmarks of Indian P. falciparum, presenting contrasting evolutionary models to global isolates. With a view to infer evolutionary patterns of the pfcrt gene in Indian P. falciparum, we have adopted a unique sampling scheme of two types of populations (cultured and field collected) and utilized 20 polymorphic microsatellite loci (16 located inside the pfcrt gene and four in the two flanking regions) to disentangle between genetic drift (inbred cultured isolates) and natural selection (field isolates). Data analyses employing different population genetic tests could not straightforwardly explain either the model invoking 'genetic hitchhiking' or 'genetic drift'. However, complex evolutionary models influenced by both demography and natural selection or an alternative model of natural selection (e.g. diversifying/balancing selection) might better explain the observed

  18. Meta-analysis of genome-wide association studies discovers multiple loci for chronic lymphocytic leukemia

    PubMed Central

    Berndt, Sonja I.; Camp, Nicola J.; Skibola, Christine F.; Vijai, Joseph; Wang, Zhaoming; Gu, Jian; Nieters, Alexandra; Kelly, Rachel S.; Smedby, Karin E.; Monnereau, Alain; Cozen, Wendy; Cox, Angela; Wang, Sophia S.; Lan, Qing; Teras, Lauren R.; Machado, Moara; Yeager, Meredith; Brooks-Wilson, Angela R.; Hartge, Patricia; Purdue, Mark P.; Birmann, Brenda M.; Vajdic, Claire M.; Cocco, Pierluigi; Zhang, Yawei; Giles, Graham G.; Zeleniuch-Jacquotte, Anne; Lawrence, Charles; Montalvan, Rebecca; Burdett, Laurie; Hutchinson, Amy; Ye, Yuanqing; Call, Timothy G.; Shanafelt, Tait D.; Novak, Anne J.; Kay, Neil E.; Liebow, Mark; Cunningham, Julie M.; Allmer, Cristine; Hjalgrim, Henrik; Adami, Hans-Olov; Melbye, Mads; Glimelius, Bengt; Chang, Ellen T.; Glenn, Martha; Curtin, Karen; Cannon-Albright, Lisa A.; Diver, W Ryan; Link, Brian K.; Weiner, George J.; Conde, Lucia; Bracci, Paige M.; Riby, Jacques; Arnett, Donna K.; Zhi, Degui; Leach, Justin M.; Holly, Elizabeth A.; Jackson, Rebecca D.; Tinker, Lesley F.; Benavente, Yolanda; Sala, Núria; Casabonne, Delphine; Becker, Nikolaus; Boffetta, Paolo; Brennan, Paul; Foretova, Lenka; Maynadie, Marc; McKay, James; Staines, Anthony; Chaffee, Kari G.; Achenbach, Sara J.; Vachon, Celine M.; Goldin, Lynn R.; Strom, Sara S.; Leis, Jose F.; Weinberg, J. Brice; Caporaso, Neil E.; Norman, Aaron D.; De Roos, Anneclaire J.; Morton, Lindsay M.; Severson, Richard K.; Riboli, Elio; Vineis, Paolo; Kaaks, Rudolph; Masala, Giovanna; Weiderpass, Elisabete; Chirlaque, María- Dolores; Vermeulen, Roel C. H.; Travis, Ruth C.; Southey, Melissa C.; Milne, Roger L.; Albanes, Demetrius; Virtamo, Jarmo; Weinstein, Stephanie; Clavel, Jacqueline; Zheng, Tongzhang; Holford, Theodore R.; Villano, Danylo J.; Maria, Ann; Spinelli, John J.; Gascoyne, Randy D.; Connors, Joseph M.; Bertrand, Kimberly A.; Giovannucci, Edward; Kraft, Peter; Kricker, Anne; Turner, Jenny; Ennas, Maria Grazia; Ferri, Giovanni M.; Miligi, Lucia; Liang, Liming; Ma, Baoshan; Huang, Jinyan; Crouch, Simon; Park, Ju-Hyun; Chatterjee, Nilanjan; North, Kari E.; Snowden, John A.; Wright, Josh; Fraumeni, Joseph F.; Offit, Kenneth; Wu, Xifeng; de Sanjose, Silvia; Cerhan, James R.; Chanock, Stephen J.; Rothman, Nathaniel; Slager, Susan L.


    Chronic lymphocytic leukemia (CLL) is a common lymphoid malignancy with strong heritability. To further understand the genetic susceptibility for CLL and identify common loci associated with risk, we conducted a meta-analysis of four genome-wide association studies (GWAS) composed of 3,100 cases and 7,667 controls with follow-up replication in 1,958 cases and 5,530 controls. Here we report three new loci at 3p24.1 (rs9880772, EOMES, P=2.55 × 10−11), 6p25.2 (rs73718779, SERPINB6, P=1.97 × 10−8) and 3q28 (rs9815073, LPP, P=3.62 × 10−8), as well as a new independent SNP at the known 2q13 locus (rs9308731, BCL2L11, P=1.00 × 10−11) in the combined analysis. We find suggestive evidence (P<5 × 10−7) for two additional new loci at 4q24 (rs10028805, BANK1, P=7.19 × 10−8) and 3p22.2 (rs1274963, CSRNP1, P=2.12 × 10−7). Pathway analyses of new and known CLL loci consistently show a strong role for apoptosis, providing further evidence for the importance of this biological pathway in CLL susceptibility. PMID:26956414

  19. Meta-analysis of genome-wide association studies discovers multiple loci for chronic lymphocytic leukemia.


    Berndt, Sonja I; Camp, Nicola J; Skibola, Christine F; Vijai, Joseph; Wang, Zhaoming; Gu, Jian; Nieters, Alexandra; Kelly, Rachel S; Smedby, Karin E; Monnereau, Alain; Cozen, Wendy; Cox, Angela; Wang, Sophia S; Lan, Qing; Teras, Lauren R; Machado, Moara; Yeager, Meredith; Brooks-Wilson, Angela R; Hartge, Patricia; Purdue, Mark P; Birmann, Brenda M; Vajdic, Claire M; Cocco, Pierluigi; Zhang, Yawei; Giles, Graham G; Zeleniuch-Jacquotte, Anne; Lawrence, Charles; Montalvan, Rebecca; Burdett, Laurie; Hutchinson, Amy; Ye, Yuanqing; Call, Timothy G; Shanafelt, Tait D; Novak, Anne J; Kay, Neil E; Liebow, Mark; Cunningham, Julie M; Allmer, Cristine; Hjalgrim, Henrik; Adami, Hans-Olov; Melbye, Mads; Glimelius, Bengt; Chang, Ellen T; Glenn, Martha; Curtin, Karen; Cannon-Albright, Lisa A; Diver, W Ryan; Link, Brian K; Weiner, George J; Conde, Lucia; Bracci, Paige M; Riby, Jacques; Arnett, Donna K; Zhi, Degui; Leach, Justin M; Holly, Elizabeth A; Jackson, Rebecca D; Tinker, Lesley F; Benavente, Yolanda; Sala, Núria; Casabonne, Delphine; Becker, Nikolaus; Boffetta, Paolo; Brennan, Paul; Foretova, Lenka; Maynadie, Marc; McKay, James; Staines, Anthony; Chaffee, Kari G; Achenbach, Sara J; Vachon, Celine M; Goldin, Lynn R; Strom, Sara S; Leis, Jose F; Weinberg, J Brice; Caporaso, Neil E; Norman, Aaron D; De Roos, Anneclaire J; Morton, Lindsay M; Severson, Richard K; Riboli, Elio; Vineis, Paolo; Kaaks, Rudolph; Masala, Giovanna; Weiderpass, Elisabete; Chirlaque, María-Dolores; Vermeulen, Roel C H; Travis, Ruth C; Southey, Melissa C; Milne, Roger L; Albanes, Demetrius; Virtamo, Jarmo; Weinstein, Stephanie; Clavel, Jacqueline; Zheng, Tongzhang; Holford, Theodore R; Villano, Danylo J; Maria, Ann; Spinelli, John J; Gascoyne, Randy D; Connors, Joseph M; Bertrand, Kimberly A; Giovannucci, Edward; Kraft, Peter; Kricker, Anne; Turner, Jenny; Ennas, Maria Grazia; Ferri, Giovanni M; Miligi, Lucia; Liang, Liming; Ma, Baoshan; Huang, Jinyan; Crouch, Simon; Park, Ju-Hyun; Chatterjee, Nilanjan; North, Kari E; Snowden, John A; Wright, Josh; Fraumeni, Joseph F; Offit, Kenneth; Wu, Xifeng; de Sanjose, Silvia; Cerhan, James R; Chanock, Stephen J; Rothman, Nathaniel; Slager, Susan L


    Chronic lymphocytic leukemia (CLL) is a common lymphoid malignancy with strong heritability. To further understand the genetic susceptibility for CLL and identify common loci associated with risk, we conducted a meta-analysis of four genome-wide association studies (GWAS) composed of 3,100 cases and 7,667 controls with follow-up replication in 1,958 cases and 5,530 controls. Here we report three new loci at 3p24.1 (rs9880772, EOMES, P=2.55 × 10(-11)), 6p25.2 (rs73718779, SERPINB6, P=1.97 × 10(-8)) and 3q28 (rs9815073, LPP, P=3.62 × 10(-8)), as well as a new independent SNP at the known 2q13 locus (rs9308731, BCL2L11, P=1.00 × 10(-11)) in the combined analysis. We find suggestive evidence (P<5 × 10(-7)) for two additional new loci at 4q24 (rs10028805, BANK1, P=7.19 × 10(-8)) and 3p22.2 (rs1274963, CSRNP1, P=2.12 × 10(-7)). Pathway analyses of new and known CLL loci consistently show a strong role for apoptosis, providing further evidence for the importance of this biological pathway in CLL susceptibility. PMID:26956414

  20. Identification of multiple genetic loci in the mouse controlling immobility time in the tail suspension and forced swimming tests.


    Abou-Elnaga, Ahmed F; Torigoe, Daisuke; Fouda, Mohamed M; Darwish, Ragab A; Abou-Ismail, Usama A; Morimatsu, Masami; Agui, Takashi


    Depression is one of the most famous psychiatric disorders in humans in all over the countries and considered a complex neurobehavioral trait and difficult to identify causal genes. Tail suspension test (TST) and forced swimming test (FST) are widely used for assessing depression-like behavior and antidepressant activity in mice. A variety of antidepressant agents are known to reduce immobility time in both TST and FST. To identify genetic determinants of immobility duration in both tests, we analyzed 101 F2 mice from an intercross between C57BL/6 and DBA/2 strains. Quantitative trait locus (QTL) mapping using 106 microsatellite markers revealed three loci (two significant and one suggestive) and five suggestive loci controlling immobility time in the TST and FST, respectively. Results of QTL analysis suggest a broad description of the genetic architecture underlying depression, providing underpinnings for identifying novel molecular targets for antidepressants to clear the complex genetic mechanisms of depressive disorders.

  1. Genetic structure and gene flow among Komodo dragon populations inferred by microsatellite loci analysis.


    Ciofi, C; Bruford, M W


    A general concern for the conservation of endangered species is the maintenance of genetic variation within populations, particularly when they become isolated and reduced in size. Estimates of gene flow and effective population size are therefore important for any conservation initiative directed to the long-term persistence of a species in its natural habitat. In the present study, 10 microsatellite loci were used to assess the level of genetic variability among populations of the Komodo dragon Varanus komodoensis. Effective population size was calculated and gene flow estimates were compared with palaeogeographic data in order to assess the degree of vulnerability of four island populations. Rinca and Flores, currently separated by an isthmus of about 200 m, retained a high level of genetic diversity and showed a high degree of genetic similarity, with gene flow values close to one migrant per generation. The island of Komodo showed by far the highest levels of genetic divergence, and its allelic distinctiveness was considered of great importance in the maintenance of genetic variability within the species. A lack of distinct alleles and low levels of gene flow and genetic variability were found for the small population of Gili Motang island, which was identified as vulnerable to stochastic threats. Our results are potentially important for both the short- and long-term management of the Komodo dragon, and are critical in view of future re-introduction or augmentation in areas where the species is now extinct or depleted.

  2. Genetic structure and gene flow among Komodo dragon populations inferred by microsatellite loci analysis.


    Ciofi, C; Bruford, M W


    A general concern for the conservation of endangered species is the maintenance of genetic variation within populations, particularly when they become isolated and reduced in size. Estimates of gene flow and effective population size are therefore important for any conservation initiative directed to the long-term persistence of a species in its natural habitat. In the present study, 10 microsatellite loci were used to assess the level of genetic variability among populations of the Komodo dragon Varanus komodoensis. Effective population size was calculated and gene flow estimates were compared with palaeogeographic data in order to assess the degree of vulnerability of four island populations. Rinca and Flores, currently separated by an isthmus of about 200 m, retained a high level of genetic diversity and showed a high degree of genetic similarity, with gene flow values close to one migrant per generation. The island of Komodo showed by far the highest levels of genetic divergence, and its allelic distinctiveness was considered of great importance in the maintenance of genetic variability within the species. A lack of distinct alleles and low levels of gene flow and genetic variability were found for the small population of Gili Motang island, which was identified as vulnerable to stochastic threats. Our results are potentially important for both the short- and long-term management of the Komodo dragon, and are critical in view of future re-introduction or augmentation in areas where the species is now extinct or depleted. PMID:10703549

  3. Alzheimer’s Disease Risk Polymorphisms Regulate Gene Expression in the ZCWPW1 and the CELF1 Loci

    PubMed Central

    Karch, Celeste M.; Ezerskiy, Lubov A.; Bertelsen, Sarah; Goate, Alison M.


    Late onset Alzheimer’s disease (LOAD) is a genetically complex and clinically heterogeneous disease. Recent large-scale genome wide association studies (GWAS) have identified more than twenty loci that modify risk for AD. Despite the identification of these loci, little progress has been made in identifying the functional variants that explain the association with AD risk. Thus, we sought to determine whether the novel LOAD GWAS single nucleotide polymorphisms (SNPs) alter expression of LOAD GWAS genes and whether expression of these genes is altered in AD brains. The majority of LOAD GWAS SNPs occur in gene dense regions under large linkage disequilibrium (LD) blocks, making it unclear which gene(s) are modified by the SNP. Thus, we tested for brain expression quantitative trait loci (eQTLs) between LOAD GWAS SNPs and SNPs in high LD with the LOAD GWAS SNPs in all of the genes within the GWAS loci. We found a significant eQTL between rs1476679 and PILRB and GATS, which occurs within the ZCWPW1 locus. PILRB and GATS expression levels, within the ZCWPW1 locus, were also associated with AD status. Rs7120548 was associated with MTCH2 expression, which occurs within the CELF1 locus. Additionally, expression of several genes within the CELF1 locus, including MTCH2, were highly correlated with one another and were associated with AD status. We further demonstrate that PILRB, as well as other genes within the GWAS loci, are most highly expressed in microglia. These findings together with the function of PILRB as a DAP12 receptor supports the critical role of microglia and neuroinflammation in AD risk. PMID:26919393

  4. Genome-wide meta-analyses of multiancestry cohorts identify multiple new susceptibility loci for refractive error and myopia.


    Verhoeven, Virginie J M; Hysi, Pirro G; Wojciechowski, Robert; Fan, Qiao; Guggenheim, Jeremy A; Höhn, René; MacGregor, Stuart; Hewitt, Alex W; Nag, Abhishek; Cheng, Ching-Yu; Yonova-Doing, Ekaterina; Zhou, Xin; Ikram, M Kamran; Buitendijk, Gabriëlle H S; McMahon, George; Kemp, John P; Pourcain, Beate St; Simpson, Claire L; Mäkelä, Kari-Matti; Lehtimäki, Terho; Kähönen, Mika; Paterson, Andrew D; Hosseini, S Mohsen; Wong, Hoi Suen; Xu, Liang; Jonas, Jost B; Pärssinen, Olavi; Wedenoja, Juho; Yip, Shea Ping; Ho, Daniel W H; Pang, Chi Pui; Chen, Li Jia; Burdon, Kathryn P; Craig, Jamie E; Klein, Barbara E K; Klein, Ronald; Haller, Toomas; Metspalu, Andres; Khor, Chiea-Chuen; Tai, E-Shyong; Aung, Tin; Vithana, Eranga; Tay, Wan-Ting; Barathi, Veluchamy A; Chen, Peng; Li, Ruoying; Liao, Jiemin; Zheng, Yingfeng; Ong, Rick T; Döring, Angela; Evans, David M; Timpson, Nicholas J; Verkerk, Annemieke J M H; Meitinger, Thomas; Raitakari, Olli; Hawthorne, Felicia; Spector, Tim D; Karssen, Lennart C; Pirastu, Mario; Murgia, Federico; Ang, Wei; Mishra, Aniket; Montgomery, Grant W; Pennell, Craig E; Cumberland, Phillippa M; Cotlarciuc, Ioana; Mitchell, Paul; Wang, Jie Jin; Schache, Maria; Janmahasatian, Sarayut; Janmahasathian, Sarayut; Igo, Robert P; Lass, Jonathan H; Chew, Emily; Iyengar, Sudha K; Gorgels, Theo G M F; Rudan, Igor; Hayward, Caroline; Wright, Alan F; Polasek, Ozren; Vatavuk, Zoran; Wilson, James F; Fleck, Brian; Zeller, Tanja; Mirshahi, Alireza; Müller, Christian; Uitterlinden, André G; Rivadeneira, Fernando; Vingerling, Johannes R; Hofman, Albert; Oostra, Ben A; Amin, Najaf; Bergen, Arthur A B; Teo, Yik-Ying; Rahi, Jugnoo S; Vitart, Veronique; Williams, Cathy; Baird, Paul N; Wong, Tien-Yin; Oexle, Konrad; Pfeiffer, Norbert; Mackey, David A; Young, Terri L; van Duijn, Cornelia M; Saw, Seang-Mei; Bailey-Wilson, Joan E; Stambolian, Dwight; Klaver, Caroline C; Hammond, Christopher J


    Refractive error is the most common eye disorder worldwide and is a prominent cause of blindness. Myopia affects over 30% of Western populations and up to 80% of Asians. The CREAM consortium conducted genome-wide meta-analyses, including 37,382 individuals from 27 studies of European ancestry and 8,376 from 5 Asian cohorts. We identified 16 new loci for refractive error in individuals of European ancestry, of which 8 were shared with Asians. Combined analysis identified 8 additional associated loci. The new loci include candidate genes with functions in neurotransmission (GRIA4), ion transport (KCNQ5), retinoic acid metabolism (RDH5), extracellular matrix remodeling (LAMA2 and BMP2) and eye development (SIX6 and PRSS56). We also confirmed previously reported associations with GJD2 and RASGRF1. Risk score analysis using associated SNPs showed a tenfold increased risk of myopia for individuals carrying the highest genetic load. Our results, based on a large meta-analysis across independent multiancestry studies, considerably advance understanding of the mechanisms involved in refractive error and myopia.

  5. Somatic Copy Number Alterations at Oncogenic Loci Show Diverse Correlations with Gene Expression

    NASA Astrophysics Data System (ADS)

    Roszik, Jason; Wu, Chang-Jiun; Siroy, Alan E.; Lazar, Alexander J.; Davies, Michael A.; Woodman, Scott E.; Kwong, Lawrence N.


    Somatic copy number alterations (SCNAs) affecting oncogenic drivers have a firmly established role in promoting cancer. However, no agreed-upon standard exists for calling locus-specific amplifications and deletions in each patient sample. Here, we report the correlative analysis of copy number amplitude and length with gene expression across 6,109 samples from The Cancer Genome Atlas (TCGA) dataset across 16 cancer types. Using specificity, sensitivity, and precision-based scores, we assigned optimized amplitude and length cutoffs for nine recurrent SCNAs affecting known oncogenic drivers, using mRNA expression as a functional readout. These cutoffs captured the majority of SCNA-driven, highly-expression-altered samples. The majority of oncogenes required only amplitude cutoffs, as high amplitude samples were almost invariably focal; however, CDKN2A and PTEN uniquely required both amplitude and length cutoffs as primary predictors. For PTEN, these extended to downstream AKT activation. In contrast, SCNA genes located peri-telomerically or in fragile sites showed poor expression-copy number correlations. Overall, our analyses identify optimized amplitude and length cutoffs as efficient predictors of gene expression changes for specific oncogenic SCNAs, yet warn against one-size-fits-all interpretations across all loci. Our results have implications for cancer data analyses and the clinic, where copy number and mutation data are increasingly used to personalize cancer therapy.

  6. Somatic Copy Number Alterations at Oncogenic Loci Show Diverse Correlations with Gene Expression

    PubMed Central

    Roszik, Jason; Wu, Chang-Jiun; Siroy, Alan E.; Lazar, Alexander J.; Davies, Michael A; Woodman, Scott E; Kwong, Lawrence N


    Somatic copy number alterations (SCNAs) affecting oncogenic drivers have a firmly established role in promoting cancer. However, no agreed-upon standard exists for calling locus-specific amplifications and deletions in each patient sample. Here, we report the correlative analysis of copy number amplitude and length with gene expression across 6,109 samples from The Cancer Genome Atlas (TCGA) dataset across 16 cancer types. Using specificity, sensitivity, and precision-based scores, we assigned optimized amplitude and length cutoffs for nine recurrent SCNAs affecting known oncogenic drivers, using mRNA expression as a functional readout. These cutoffs captured the majority of SCNA-driven, highly-expression-altered samples. The majority of oncogenes required only amplitude cutoffs, as high amplitude samples were almost invariably focal; however, CDKN2A and PTEN uniquely required both amplitude and length cutoffs as primary predictors. For PTEN, these extended to downstream AKT activation. In contrast, SCNA genes located peri-telomerically or in fragile sites showed poor expression-copy number correlations. Overall, our analyses identify optimized amplitude and length cutoffs as efficient predictors of gene expression changes for specific oncogenic SCNAs, yet warn against one-size-fits-all interpretations across all loci. Our results have implications for cancer data analyses and the clinic, where copy number and mutation data are increasingly used to personalize cancer therapy. PMID:26787600

  7. De Novo and Rare Variants at Multiple Loci Support the Oligogenic Origins of Atrioventricular Septal Heart Defects

    PubMed Central

    Priest, James R.; Osoegawa, Kazutoyo; Mohammed, Nebil; Nanda, Vivek; Kundu, Ramendra; Schultz, Kathleen; Girirajan, Santhosh; Scheetz, Todd; Waggott, Daryl; Haddad, Francois; Reddy, Sushma; Bernstein, Daniel; Burns, Trudy; Steimle, Jeffrey D.; Yang, Xinan H.; Moskowitz, Ivan P.; Hurles, Matthew; Lifton, Richard P.; Nickerson, Debbie; Bamshad, Michael; Eichler, Evan E.; Mital, Seema; Sheffield, Val; Quertermous, Thomas; Gelb, Bruce D.; Portman, Michael; Ashley, Euan A.


    Congenital heart disease (CHD) has a complex genetic etiology, and recent studies suggest that high penetrance de novo mutations may account for only a small fraction of disease. In a multi-institutional cohort surveyed by exome sequencing, combining analysis of 987 individuals (discovery cohort of 59 affected trios and 59 control trios, and a replication cohort of 100 affected singletons and 533 unaffected singletons) we observe variation at novel and known loci related to a specific cardiac malformation the atrioventricular septal defect (AVSD). In a primary analysis, by combining developmental coexpression networks with inheritance modeling, we identify a de novo mutation in the DNA binding domain of NR1D2 (p.R175W). We show that p.R175W changes the transcriptional activity of Nr1d2 using an in vitro transactivation model in HUVEC cells. Finally, we demonstrate previously unrecognized cardiovascular malformations in the Nr1d2tm1-Dgen knockout mouse. In secondary analyses we map genetic variation to protein-interaction networks suggesting a role for two collagen genes in AVSD, which we corroborate by burden testing in a second replication cohort of 100 AVSDs and 533 controls (p = 8.37e-08). Finally, we apply a rare-disease inheritance model to identify variation in genes previously associated with CHD (ZFPM2, NSD1, NOTCH1, VCAN, and MYH6), cardiac malformations in mouse models (ADAM17, CHRD, IFT140, PTPRJ, RYR1 and ATE1), and hypomorphic alleles of genes causing syndromic CHD (EHMT1, SRCAP, BBS2, NOTCH2, and KMT2D) in 14 of 59 trios, greatly exceeding variation in control trios without CHD (p = 9.60e-06). In total, 32% of trios carried at least one putatively disease-associated variant across 19 loci,suggesting that inherited and de novo variation across a heterogeneous group of loci may contribute to disease risk. PMID:27058611

  8. De Novo and Rare Variants at Multiple Loci Support the Oligogenic Origins of Atrioventricular Septal Heart Defects.


    Priest, James R; Osoegawa, Kazutoyo; Mohammed, Nebil; Nanda, Vivek; Kundu, Ramendra; Schultz, Kathleen; Lammer, Edward J; Girirajan, Santhosh; Scheetz, Todd; Waggott, Daryl; Haddad, Francois; Reddy, Sushma; Bernstein, Daniel; Burns, Trudy; Steimle, Jeffrey D; Yang, Xinan H; Moskowitz, Ivan P; Hurles, Matthew; Lifton, Richard P; Nickerson, Debbie; Bamshad, Michael; Eichler, Evan E; Mital, Seema; Sheffield, Val; Quertermous, Thomas; Gelb, Bruce D; Portman, Michael; Ashley, Euan A


    Congenital heart disease (CHD) has a complex genetic etiology, and recent studies suggest that high penetrance de novo mutations may account for only a small fraction of disease. In a multi-institutional cohort surveyed by exome sequencing, combining analysis of 987 individuals (discovery cohort of 59 affected trios and 59 control trios, and a replication cohort of 100 affected singletons and 533 unaffected singletons) we observe variation at novel and known loci related to a specific cardiac malformation the atrioventricular septal defect (AVSD). In a primary analysis, by combining developmental coexpression networks with inheritance modeling, we identify a de novo mutation in the DNA binding domain of NR1D2 (p.R175W). We show that p.R175W changes the transcriptional activity of Nr1d2 using an in vitro transactivation model in HUVEC cells. Finally, we demonstrate previously unrecognized cardiovascular malformations in the Nr1d2tm1-Dgen knockout mouse. In secondary analyses we map genetic variation to protein-interaction networks suggesting a role for two collagen genes in AVSD, which we corroborate by burden testing in a second replication cohort of 100 AVSDs and 533 controls (p = 8.37e-08). Finally, we apply a rare-disease inheritance model to identify variation in genes previously associated with CHD (ZFPM2, NSD1, NOTCH1, VCAN, and MYH6), cardiac malformations in mouse models (ADAM17, CHRD, IFT140, PTPRJ, RYR1 and ATE1), and hypomorphic alleles of genes causing syndromic CHD (EHMT1, SRCAP, BBS2, NOTCH2, and KMT2D) in 14 of 59 trios, greatly exceeding variation in control trios without CHD (p = 9.60e-06). In total, 32% of trios carried at least one putatively disease-associated variant across 19 loci,suggesting that inherited and de novo variation across a heterogeneous group of loci may contribute to disease risk.

  9. Sequencing of Pax6 loci from the elephant shark reveals a family of Pax6 genes in vertebrate genomes, forged by ancient duplications and divergences.


    Ravi, Vydianathan; Bhatia, Shipra; Gautier, Philippe; Loosli, Felix; Tay, Boon-Hui; Tay, Alice; Murdoch, Emma; Coutinho, Pedro; van Heyningen, Veronica; Brenner, Sydney; Venkatesh, Byrappa; Kleinjan, Dirk A


    Pax6 is a developmental control gene essential for eye development throughout the animal kingdom. In addition, Pax6 plays key roles in other parts of the CNS, olfactory system, and pancreas. In mammals a single Pax6 gene encoding multiple isoforms delivers these pleiotropic functions. Here we provide evidence that the genomes of many other vertebrate species contain multiple Pax6 loci. We sequenced Pax6-containing BACs from the cartilaginous elephant shark (Callorhinchus milii) and found two distinct Pax6 loci. Pax6.1 is highly similar to mammalian Pax6, while Pax6.2 encodes a paired-less Pax6. Using synteny relationships, we identify homologs of this novel paired-less Pax6.2 gene in lizard and in frog, as well as in zebrafish and in other teleosts. In zebrafish two full-length Pax6 duplicates were known previously, originating from the fish-specific genome duplication (FSGD) and expressed in divergent patterns due to paralog-specific loss of cis-elements. We show that teleosts other than zebrafish also maintain duplicate full-length Pax6 loci, but differences in gene and regulatory domain structure suggest that these Pax6 paralogs originate from a more ancient duplication event and are hence renamed as Pax6.3. Sequence comparisons between mammalian and elephant shark Pax6.1 loci highlight the presence of short- and long-range conserved noncoding elements (CNEs). Functional analysis demonstrates the ancient role of long-range enhancers for Pax6 transcription. We show that the paired-less Pax6.2 ortholog in zebrafish is expressed specifically in the developing retina. Transgenic analysis of elephant shark and zebrafish Pax6.2 CNEs with homology to the mouse NRE/Pα internal promoter revealed highly specific retinal expression. Finally, morpholino depletion of zebrafish Pax6.2 resulted in a "small eye" phenotype, supporting a role in retinal development. In summary, our study reveals that the pleiotropic functions of Pax6 in vertebrates are served by a divergent

  10. Phylogeny and historical biogeography of the cocosoid palms (Arecaceae, Arecoideae, Cocoseae) inferred from sequences of six WRKY gene family loci

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Arecaceae tribe Cocoseae is the most economically important tribe of palms, including both coconut and African oil palm. It is mostly represented in the Neotropics, with one and two genera endemic to South Africa and Madagascar, respectively. Using primers for six single copy WRKY gene family loci...

  11. Pinpointing genes underlying the quantitative trait loci for root-knot nematode resistance in palaeopolyploid soybean by whole genome resequencing

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The objective of this study was to utilize next-generation sequencing (NGS) technologies to dissect quantitative trait loci (QTL) for southern root-knot nematode (RKN) resistance into individual genes in soybean. Two-hundred forty-six recombinant inbred lines (RIL) derived from a cross between Mage...

  12. Genetic linkage analysis of 14 candidate gene loci in a family with autosomal dominant osteoarthritis without dysplasia.

    PubMed Central

    Meulenbelt, I; Bijkerk, C; Breedveld, F C; Slagboom, P E


    The role of various gene loci was investigated in a family in which familial osteoarthritis (FOA), with onset at an early age, is transmitted as an autosomal dominant mendelian trait. The absence of clinical and radiographic signs of dysplasia and calcium pyrophosphate deposition disease (CPDD) indicates that the basic disease process in this family is osteoarthritis (OA). Genetic linkage analysis of 14 candidate genes resulted in the exclusion of 10 important genes (COL2A1, COL9A1, COL9A2, COL11A1, COL11A2, COMP, the CPDD region, CRTL-1, CRTM, and MMP3). Other relevant genes were not informative in this family. The candidate loci previously identified in FOA and heritable skeletal disorders associated with OA are clearly not involved in the development of the primary FOA phenotype in the family investigated, indicating genetic heterogeneity. Images PMID:9429149

  13. Quantitative trait loci linked to PRNP gene controlling health and production traits in INRA 401 sheep

    PubMed Central

    Vitezica, Zulma G; Moreno, Carole R; Lantier, Frederic; Lantier, Isabelle; Schibler, Laurent; Roig, Anne; François, Dominique; Bouix, Jacques; Allain, Daniel; Brunel, Jean-Claude; Barillet, Francis; Elsen, Jean-Michel


    In this study, the potential association of PrP genotypes with health and productive traits was investigated. Data were recorded on animals of the INRA 401 breed from the Bourges-La Sapinière INRA experimental farm. The population consisted of 30 rams and 852 ewes, which produced 1310 lambs. The animals were categorized into three PrP genotype classes: ARR homozygous, ARR heterozygous, and animals without any ARR allele. Two analyses differing in the approach considered were carried out. Firstly, the potential association of the PrP genotype with disease (Salmonella resistance) and production (wool and carcass) traits was studied. The data used included 1042, 1043 and 1013 genotyped animals for the Salmonella resistance, wool and carcass traits, respectively. The different traits were analyzed using an animal model, where the PrP genotype effect was included as a fixed effect. Association analyses do not indicate any evidence of an effect of PrP genotypes on traits studied in this breed. Secondly, a quantitative trait loci (QTL) detection approach using the PRNP gene as a marker was applied on ovine chromosome 13. Interval mapping was used. Evidence for one QTL affecting mean fiber diameter was found at 25 cM from the PRNP gene. However, a linkage between PRNP and this QTL does not imply unfavorable linkage disequilibrium for PRNP selection purposes. PMID:17612481

  14. Incipient speciation by sexual isolation in Drosophila: concurrent evolution at multiple loci.


    Ting, C T; Takahashi, A; Wu, C I


    Drosophila melanogaster from Zimbabwe and nearby regions shows strong but asymmetric sexual isolation from its cosmopolitan counterparts. By creating stable chromosome-substitution lines, earlier studies were able to show that the two major autosomes have very large effects on both male mating success and female mating preference. In this study, we genetically dissect this sexual isolation by recombination analysis between a whole-chromosome substitution line (which carries a Zimbabwe-derived third chromosome) and a strain with seven visible markers on that chromosome. Four loci are responsible for male mating success and three others are found to control female mating preference. Because male and female traits are not closely linked, their strong association among isofemale lines is most likely a reflection of sexual selection in nature. The results suggest that a large number of behavioral loci may evolve concurrently in the incipient stage of speciation before other aspects of reproductive isolation (such as hybrid sterility) have become evident. The results shed light on the population genetic processes underlying the formation of nascent species, as well as modes of speciation.

  15. Genome-wide association study identifies multiple susceptibility loci for glioma

    PubMed Central

    Kinnersley, Ben; Labussière, Marianne; Holroyd, Amy; Di Stefano, Anna-Luisa; Broderick, Peter; Vijayakrishnan, Jayaram; Mokhtari, Karima; Delattre, Jean-Yves; Gousias, Konstantinos; Schramm, Johannes; Schoemaker, Minouk J.; Fleming, Sarah J.; Herms, Stefan; Heilmann, Stefanie; Schreiber, Stefan; Wichmann, Heinz-Erich; Nöthen, Markus M.; Swerdlow, Anthony; Lathrop, Mark; Simon, Matthias; Bondy, Melissa; Sanson, Marc; Houlston, Richard S.


    Previous genome-wide association studies (GWASs) have shown that common genetic variation contributes to the heritable risk of glioma. To identify new glioma susceptibility loci, we conducted a meta-analysis of four GWAS (totalling 4,147 cases and 7,435 controls), with imputation using 1000 Genomes and UK10K Project data as reference. After genotyping an additional 1,490 cases and 1,723 controls we identify new risk loci for glioblastoma (GBM) at 12q23.33 (rs3851634, near POLR3B, P=3.02 × 10−9) and non-GBM at 10q25.2 (rs11196067, near VTI1A, P=4.32 × 10−8), 11q23.2 (rs648044, near ZBTB16, P=6.26 × 10−11), 12q21.2 (rs12230172, P=7.53 × 10−11) and 15q24.2 (rs1801591, near ETFA, P=5.71 × 10−9). Our findings provide further insights into the genetic basis of the different glioma subtypes. PMID:26424050

  16. Evolutionary relationships within the lamioid tribe Synandreae (Lamiaceae) based on multiple low-copy nuclear loci

    PubMed Central

    Roy, Tilottama; Catlin, Nathan S.; Garner, Drake M.G.; Cantino, Philip D.; Scheen, Anne-Cathrine


    The subfamily Lamioideae (Lamiaceae) comprises ten tribes, of which only Stachydeae and Synandreae include New World members. Previous studies have investigated the phylogenetic relationships among the members of Synandreae based on plastid and nuclear ribosomal DNA loci. In an effort to re-examine the phylogenetic relationships within Synandreae, the current study incorporates data from four low-copy nuclear loci, PHOT1, PHOT2, COR, and PPR. Our results confirm previous studies based on chloroplast and nuclear ribosomal markers in supporting the monophyly of tribe Synandreae, as well as sister relationships between Brazoria and Warnockia, and between that pair of genera and a monophyletic Physostegia. However, we observe incongruence in the relationships of Macbridea and Synandra. The placement of Synandreae within Lamioideae is poorly resolved and incongruent among different analyses, and the sister group of Synandreae remains enigmatic. Comparison of the colonization and migration patterns corroborates a single colonization of the New World by Synandreae during the Late Miocene/Tortonian age. This is in contrast to the only other lamioid tribe that includes New World members, Stachydeae, which colonized the New World at least twice—during the mid-Miocene and Pliocene. Edaphic conditions and intolerance of soil acidity may be factors that restricted the distribution of most genera of Synandreae to southeastern and south–central North America, whereas polyploidy could have increased the colonizing capability of the more wide-ranging genus, Physostegia. PMID:27547537

  17. Evolutionary relationships within the lamioid tribe Synandreae (Lamiaceae) based on multiple low-copy nuclear loci.


    Roy, Tilottama; Catlin, Nathan S; Garner, Drake M G; Cantino, Philip D; Scheen, Anne-Cathrine; Lindqvist, Charlotte


    The subfamily Lamioideae (Lamiaceae) comprises ten tribes, of which only Stachydeae and Synandreae include New World members. Previous studies have investigated the phylogenetic relationships among the members of Synandreae based on plastid and nuclear ribosomal DNA loci. In an effort to re-examine the phylogenetic relationships within Synandreae, the current study incorporates data from four low-copy nuclear loci, PHOT1, PHOT2, COR, and PPR. Our results confirm previous studies based on chloroplast and nuclear ribosomal markers in supporting the monophyly of tribe Synandreae, as well as sister relationships between Brazoria and Warnockia, and between that pair of genera and a monophyletic Physostegia. However, we observe incongruence in the relationships of Macbridea and Synandra. The placement of Synandreae within Lamioideae is poorly resolved and incongruent among different analyses, and the sister group of Synandreae remains enigmatic. Comparison of the colonization and migration patterns corroborates a single colonization of the New World by Synandreae during the Late Miocene/Tortonian age. This is in contrast to the only other lamioid tribe that includes New World members, Stachydeae, which colonized the New World at least twice-during the mid-Miocene and Pliocene. Edaphic conditions and intolerance of soil acidity may be factors that restricted the distribution of most genera of Synandreae to southeastern and south-central North America, whereas polyploidy could have increased the colonizing capability of the more wide-ranging genus, Physostegia. PMID:27547537

  18. Multiple Stochastic Point Processes in Gene Expression

    NASA Astrophysics Data System (ADS)

    Murugan, Rajamanickam


    We generalize the idea of multiple-stochasticity in chemical reaction systems to gene expression. Using Chemical Langevin Equation approach we investigate how this multiple-stochasticity can influence the overall molecular number fluctuations. We show that the main sources of this multiple-stochasticity in gene expression could be the randomness in transcription and translation initiation times which in turn originates from the underlying bio-macromolecular recognition processes such as the site-specific DNA-protein interactions and therefore can be internally regulated by the supra-molecular structural factors such as the condensation/super-coiling of DNA. Our theory predicts that (1) in case of gene expression system, the variances ( φ) introduced by the randomness in transcription and translation initiation-times approximately scales with the degree of condensation ( s) of DNA or mRNA as φ ∝ s -6. From the theoretical analysis of the Fano factor as well as coefficient of variation associated with the protein number fluctuations we predict that (2) unlike the singly-stochastic case where the Fano factor has been shown to be a monotonous function of translation rate, in case of multiple-stochastic gene expression the Fano factor is a turn over function with a definite minimum. This in turn suggests that the multiple-stochastic processes can also be well tuned to behave like a singly-stochastic point processes by adjusting the rate parameters.

  19. Quantitative trait loci and candidate genes associated with starch pasting viscosity characteristics in cassava (Manihot esculenta Crantz).


    Thanyasiriwat, T; Sraphet, S; Whankaew, S; Boonseng, O; Bao, J; Lightfoot, D A; Tangphatsornruang, S; Triwitayakorn, K


    Starch pasting viscosity is an important quality trait in cassava (Manihot esculenta Crantz) cultivars. The aim here was to identify loci and candidate genes associated with the starch pasting viscosity. Quantitative trait loci (QTL) mapping for seven pasting viscosity parameters was carried out using 100 lines of an F1 mapping population from a cross between two cassava cultivars Huay Bong 60 and Hanatee. Starch samples were obtained from roots of cassava grown in 2008 and 2009 at Rayong, and in 2009 at Lop Buri province, Thailand. The traits showed continuous distribution among the F1 progeny with transgressive variation. Fifteen QTL were identified from mean trait data, with Logarithm of Odds (LOD) values from 2.77-13.01 and phenotype variations explained (PVE) from10.0-48.4%. In addition, 48 QTL were identified in separate environments. The LOD values ranged from 2.55-8.68 and explained 6.6-43.7% of phenotype variation. The loci were located on 19 linkage groups. The most important QTL for pasting temperature (PT) (qPT.1LG1) from mean trait values showed largest effect with highest LOD value (13.01) and PVE (48.4%). The QTL co-localised with PT and pasting time (PTi) loci that were identified in separate environments. Candidate genes were identified within the QTL peak regions. However, the major genes of interest, encoding the family of glycosyl or glucosyl transferases and hydrolases, were located at the periphery of QTL peaks. The loci identified could be effectively applied in breeding programmes to improve cassava starch quality. Alleles of candidate genes should be further studied in order to better understand their effects on starch quality traits.

  20. Stochastic multiple-valued gene networks.


    Zhu, Peican; Han, Jie


    Among various approaches to modeling gene regulatory networks (GRNs), Boolean networks (BNs) and its probabilistic extension, probabilistic Boolean networks (PBNs), have been studied to gain insights into the dynamics of GRNs. To further exploit the simplicity of logical models, a multiple-valued network employs gene states that are not limited to binary values, thus providing a finer granularity in the modeling of GRNs. In this paper, stochastic multiple-valued networks (SMNs) are proposed for modeling the effects of noise and gene perturbation in a GRN. An SMN enables an accurate and efficient simulation of a probabilistic multiple-valued network (as an extension of a PBN). In a k-level SMN of n genes, it requires a complexity of O(nLk(n)) to compute the state transition matrix, where L is a factor related to the minimum sequence length in the SMN for achieving a desired accuracy. The use of randomly permuted stochastic sequences further increases computational efficiency and allows for a tunable tradeoff between accuracy and efficiency. The analysis of a p53-Mdm2 network and a WNT5A network shows that the proposed SMN approach is efficient in evaluating the network dynamics and steady state distribution of gene networks under random gene perturbation.

  1. Admixture as a tool for finding linked genes and detecting that difference from allelic association between loci.


    Chakraborty, R; Weiss, K M


    Admixture between genetically different populations may produce gametic association between gene loci as a function of the genetic difference between parental populations and the admixture rate. This association decays as a function of time since admixture and the recombination rate between the loci. Admixture between genetically long-separated human populations has been frequent in the centuries since the age of exploration and colonization, resulting in numerous hybrid descendant populations today, as in the Americas. This represents a natural experiment for genetic epidemiology and anthropology, in which to use polymorphic marker loci (e.g., restriction fragment length polymorphisms) and disequilibrium to infer a genetic basis for traits of interest. In this paper we show that substantial disequilibrium remains today under widely applicable situations, which can be detected without requiring inordinately close linkage between trait and marker loci. Very disparate parental allele frequencies produce large disequilibrium, but the sample size needed to detect such levels of disequilibrium can be large due to the skewed haplotype frequency distribution in the admixed population. Such situations, however, provide power to differentiate between disequilibrium due just to population mixing from that due to physical linkage of loci--i.e., to help map the genetic locus of the trait. A gradient of admixture levels between the same parental populations may be used to test genetic models by relating admixture to disequilibrium levels.

  2. Performance of Markov Chain–Monte Carlo Approaches for Mapping Genes in Oligogenic Models with an Unknown Number of Loci

    PubMed Central

    Lee, Jae K.; Thomas, Duncan C.


    Markov chain–Monte Carlo (MCMC) techniques for multipoint mapping of quantitative trait loci have been developed on nuclear-family and extended-pedigree data. These methods are based on repeated sampling—peeling and gene dropping of genotype vectors and random sampling of each of the model parameters from their full conditional distributions, given phenotypes, markers, and other model parameters. We further refine such approaches by improving the efficiency of the marker haplotype-updating algorithm and by adopting a new proposal for adding loci. Incorporating these refinements, we have performed an extensive simulation study on simulated nuclear-family data, varying the number of trait loci, family size, displacement, and other segregation parameters. Our simulation studies show that our MCMC algorithm identifies the locations of the true trait loci and estimates their segregation parameters well—provided that the total number of sibship pairs in the pedigree data is reasonably large, heritability of each individual trait locus is not too low, and the loci are not too close together. Our MCMC algorithm was shown to be significantly more efficient than LOKI (Heath 1997) in our simulation study using nuclear-family data. PMID:11032787

  3. Evolution of Vertebrate Adam Genes; Duplication of Testicular Adams from Ancient Adam9/9-like Loci.


    Bahudhanapati, Harinath; Bhattacharya, Shashwati; Wei, Shuo


    Members of the disintegrin metalloproteinase (ADAM) family have important functions in regulating cell-cell and cell-matrix interactions as well as cell signaling. There are two major types of ADAMs: the somatic ADAMs (sADAMs) that have a significant presence in somatic tissues, and the testicular ADAMs (tADAMs) that are expressed predominantly in the testis. Genes encoding tADAMs can be further divided into two groups: group I (intronless) and group II (intron-containing). To date, tAdams have only been reported in placental mammals, and their evolutionary origin and relationship to sAdams remain largely unknown. Using phylogenetic and syntenic tools, we analyzed the Adam genes in various vertebrates ranging from fishes to placental mammals. Our analyses reveal duplication and loss of some sAdams in certain vertebrate species. In particular, there exists an Adam9-like gene in non-mammalian vertebrates but not mammals. We also identified putative group I and group II tAdams in all amniote species that have been examined. These tAdam homologues are more closely related to Adams 9 and 9-like than to other sAdams. In all amniote species examined, group II tAdams lie in close vicinity to Adam9 and hence likely arose from tandem duplication, whereas group I tAdams likely originated through retroposition because of their lack of introns. Clusters of multiple group I tAdams are also common, suggesting tandem duplication after retroposition. Therefore, Adam9/9-like and some of the derived tAdam loci are likely preferred targets for tandem duplication and/or retroposition. Consistent with this hypothesis, we identified a young retroposed gene that duplicated recently from Adam9 in the opossum. As a result of gene duplication, some tAdams were pseudogenized in certain species, whereas others acquired new expression patterns and functions. The rapid duplication of Adam genes has a major contribution to the diversity of ADAMs in various vertebrate species. PMID:26308360

  4. Evolution of Vertebrate Adam Genes; Duplication of Testicular Adams from Ancient Adam9/9-like Loci

    PubMed Central

    Wei, Shuo


    Members of the disintegrin metalloproteinase (ADAM) family have important functions in regulating cell-cell and cell-matrix interactions as well as cell signaling. There are two major types of ADAMs: the somatic ADAMs (sADAMs) that have a significant presence in somatic tissues, and the testicular ADAMs (tADAMs) that are expressed predominantly in the testis. Genes encoding tADAMs can be further divided into two groups: group I (intronless) and group II (intron-containing). To date, tAdams have only been reported in placental mammals, and their evolutionary origin and relationship to sAdams remain largely unknown. Using phylogenetic and syntenic tools, we analyzed the Adam genes in various vertebrates ranging from fishes to placental mammals. Our analyses reveal duplication and loss of some sAdams in certain vertebrate species. In particular, there exists an Adam9-like gene in non-mammalian vertebrates but not mammals. We also identified putative group I and group II tAdams in all amniote species that have been examined. These tAdam homologues are more closely related to Adams 9 and 9-like than to other sAdams. In all amniote species examined, group II tAdams lie in close vicinity to Adam9 and hence likely arose from tandem duplication, whereas group I tAdams likely originated through retroposition because of their lack of introns. Clusters of multiple group I tAdams are also common, suggesting tandem duplication after retroposition. Therefore, Adam9/9-like and some of the derived tAdam loci are likely preferred targets for tandem duplication and/or retroposition. Consistent with this hypothesis, we identified a young retroposed gene that duplicated recently from Adam9 in the opossum. As a result of gene duplication, some tAdams were pseudogenized in certain species, whereas others acquired new expression patterns and functions. The rapid duplication of Adam genes has a major contribution to the diversity of ADAMs in various vertebrate species. PMID:26308360

  5. Diversity of CRISPR loci and virulence genes in pathogenic Escherichia coli isolates from various sources.


    Jiang, Yun; Yin, Shuang; Dudley, Edward G; Cutter, Catherine N


    Shiga toxin-producing Escherichia coli (STEC) strains, including those of O157:H7 and the "big six" serogroups (i.e., O26, O45, O103, O111, O121, and O145) are food-borne pathogens that pose a serious health threat to humans. Ruminants, especially cattle, are a major reservoir for O157 and non-O157 STEC. In the present study, 115 E. coli strains isolated from small and very small beef processing plants were screened for virulence genes (stx1, stx2, eae) using a multiplex polymerase chain reaction (PCR). Thirteen (11.3%) of the 115 isolates tested positive for stx1, stx2, or eae genes, but only 4 (3.5%) tested positive for either stx1 or stx2. A multiplex PCR reaction targeting eight O-serogroups (O26, O45, O103, O111, O113, O121, O145, O157) identified 12 isolates as O26, O103, O111, or O145, with E. coli O26 being the most predominant serogroup (61.5%). The thirteen isolates were further analyzed using Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) subtyping. Consistent with previous studies, CRISPR alleles from strains of the same serogroup were similar in their spacer content and order, regardless of the isolation source. A completely different CRISPR allele was observed in one isolate ("7-J") which exhibited a different O-serogroup (O78). Our results confirmed previous findings that CRISPR loci are conserved among phylogenetically-related strains. In addition, 8 E. coli O26 isolates and a collection of 42 E. coli O26 isolates were screened for 12 enterohemorrhagic E. coli-specific genes. Seven genes (ECs848-Hypothetical Protein, ECs2226-Hypothetical Protein, ECs3857-nleB, ECs3858-Hypothetical Protein, ECs4552-escF, ECs4553-Hypothetical Protein, and ECs4557-sepL) were found in all 50 isolates. An additional 5 genes (ECs1322-ureA urease subunit γ, ECs1323-ureB urease subunit β, ECs1326-ureF, ECs1561-Hypothetical Protein, and ECs1568-Hypothetical Protein) were found to be highly prevalent in isolates from human sources, while lower in

  6. The genetic variance for multiple linked quantitative trait loci conditional on marker information in a crossed population.


    Matsuda, H; Iwaisaki, H


    In the prediction of genetic values and quantitative trait loci (QTLs) mapping via the mixed model method incorporating marker information in animal populations, it is important to model the genetic variance for individuals with an arbitrary pedigree structure. In this study, for a crossed population originated from different genetic groups such as breeds or outbred strains, the variance of additive genetic values for multiple linked QTLs that are contained in a chromosome segment, especially the segregation variance, is investigated assuming the use of marker data. The variance for a finite number of QTLs in one chromosomal segment is first examined for the crossed population with the general pedigree. Then, applying the concept of the expectation of identity-by-descent proportion, an approximation to the mean of the conditional probabilities for the linked QTLs over all loci is obtained, and using it an expression for the variance in the case of an infinite number of linked QTLs marked by flanking markers is derived. It appears that the approach presented can be useful in the segment mapping using, and in the genetic evaluation of, crosses with general pedigrees in the population of concern. The calculation of the segregation variance through the current approach is illustrated numerically, using a small data-set.

  7. Transferability and fine mapping of type 2 diabetes loci in African Americans: the Candidate Gene Association Resource Plus Study.


    Ng, Maggie C Y; Saxena, Richa; Li, Jiang; Palmer, Nicholette D; Dimitrov, Latchezar; Xu, Jianzhao; Rasmussen-Torvik, Laura J; Zmuda, Joseph M; Siscovick, David S; Patel, Sanjay R; Crook, Errol D; Sims, Mario; Chen, Yii-Der I; Bertoni, Alain G; Li, Mingyao; Grant, Struan F A; Dupuis, Josée; Meigs, James B; Psaty, Bruce M; Pankow, James S; Langefeld, Carl D; Freedman, Barry I; Rotter, Jerome I; Wilson, James G; Bowden, Donald W


    Type 2 diabetes (T2D) disproportionally affects African Americans (AfA) but, to date, genetic variants identified from genome-wide association studies (GWAS) are primarily from European and Asian populations. We examined the single nucleotide polymorphism (SNP) and locus transferability of 40 reported T2D loci in six AfA GWAS consisting of 2,806 T2D case subjects with or without end-stage renal disease and 4,265 control subjects from the Candidate Gene Association Resource Plus Study. Our results revealed that seven index SNPs at the TCF7L2, KLF14, KCNQ1, ADCY5, CDKAL1, JAZF1, and GCKR loci were significantly associated with T2D (P < 0.05). The strongest association was observed at TCF7L2 rs7903146 (odds ratio [OR] 1.30; P = 6.86 × 10⁻⁸). Locus-wide analysis demonstrated significant associations (P(emp) < 0.05) at regional best SNPs in the TCF7L2, KLF14, and HMGA2 loci as well as suggestive signals in KCNQ1 after correction for the effective number of SNPs at each locus. Of these loci, the regional best SNPs were in differential linkage disequilibrium (LD) with the index and adjacent SNPs. Our findings suggest that some loci discovered in prior reports affect T2D susceptibility in AfA with similar effect sizes. The reduced and differential LD pattern in AfA compared with European and Asian populations may facilitate fine mapping of causal variants at loci shared across populations. PMID:23193183

  8. Molecular phylogeny of Salmo of the western Balkans, based upon multiple nuclear loci

    PubMed Central


    Background Classification of species within the genus Salmo is still a matter of discussion due to their high level of diversity and to the low power of resolution of mitochondrial (mt)DNA-based phylogeny analyses that have been traditionally used in evolutionary studies of the genus. We apply a new marker system based on nuclear (n)DNA loci to present a novel view of the phylogeny of Salmo representatives and we compare it with the mtDNA-based phylogeny. Methods Twenty-two nDNA loci were sequenced for 76 individuals of the brown trout complex: Salmo trutta (Danubian, Atlantic, Adriatic, Mediterranean and Duero mtDNA lineages), Salmo marmoratus (marble trout), Salmo obtusirostris (softmouth trout), and Salmo ohridanus (Ohrid belvica or belushka). Sequences were phylogenetically analyzed using maximum-likelihood and Bayesian Inference methods. The divergence time of the major clades was estimated using the program BEAST. Results The existence of five genetic units i.e. S. salar, S. ohridanus, S. obtusirostris, S. marmoratus and the S. trutta complex, including its major phylogenetic lineages was confirmed. Contrary to previous observations, S. obtusirostris was found to be sister to the S. trutta complex and the S. marmoratus clade rather than to the S. ohridanus clade. Reticulate evolution of S. obtusirostris was confirmed and a time for its pre-glacial origin suggested. S. marmoratus was found to be a separate species as S. trutta and S. obtusirostris. Relationships among lineages within the S. trutta complex were weakly supported and remain largely unresolved. Conclusions Nuclear DNA-based results showed a fairly good match with the phylogeny of Salmo inferred from mtDNA analyses. The comparison of nDNA and mtDNA data revealed at least four cases of mitochondrial–nuclear DNA discordance observed that were all confined to the Adriatic basin of the Western Balkans. Together with the well-known extensive morphological and genetic variability of Balkan trouts, this

  9. The historical biogeography of two Caribbean butterflies (Lepidoptera: Heliconiidae) as inferred from genetic variation at multiple loci.


    Davies, Neil; Bermingham, Eldredge


    Mitochondrial DNA and allozyme variation was examined in populations of two Neotropical butterflies, Heliconius charithonia and Dryas iulia. On the mainland, both species showed evidence of considerable gene flow over huge distances. The island populations, however, revealed significant genetic divergence across some, but not all, ocean passages. Despite the phylogenetic relatedness and broadly similar ecologies of these two butterflies, their intraspecific biogeography clearly differed. Phylogenetic analyses of mitochondrial DNA sequences revealed that populations of D. iulia north of St. Vincent are monophyletic and were probably derived from South America. By contrast, the Jamaican subspecies of H. charithonia rendered West Indian H. charithonia polyphyletic with respect to the mainland populations; thus, H. charithonia seems to have colonized the Greater Antilles on at least two separate occasions from Central America. Colonization velocity does not correlate with subsequent levels of gene flow in either species. Even where range expansion seems to have been instantaneous on a geological timescale, significant allele frequency differences at allozyme loci demonstrate that gene flow is severely curtailed across narrow ocean passages. Stochastic extinction, rapid (re)colonization, but low gene flow probably explain why, in the same species, some islands support genetically distinct and nonexpanding populations, while nearby a single lineage is distributed across several islands. Despite the differences, some common biogeographic patterns were evident between these butterflies and other West Indian taxa; such congruence suggests that intraspecific evolution in the West Indies has been somewhat constrained by earth history events, such as changes in sea level.

  10. Bioinvasions of the medfly Ceratitis capitata: source estimation using DNA sequences at multiple intron loci.

    PubMed Central

    Davies, N; Villablanca, F X; Roderick, G K


    The Mediterranean fruit fly, Ceratitis capitata, is a devastating agricultural pest that threatens to become established in vulnerable areas such as California and Florida. Considerable controversy surrounds the status of Californian medfly infestations: Do they represent repeated introductions or the persistence of a resident population? Attempts to resolve this question using traditional population genetic markers and statistical methods are problematic because the most likely source populations in Latin America were themselves only recently colonized and are genetically very similar. Here, significant population structure among several New World medfly populations is demonstrated through the analysis of DNA sequence variation at four intron loci. Surprisingly, in these newly founded populations, estimates of population structure increase when measures of subdivision take into account the relatedness of alleles as well as their frequency. A nonequilibrium, likelihood-based statistical test that utilizes multilocus genotypes suggests that the sole medfly captured in California during 1996 was introduced from Latin America and was less likely to be a remnant of an ancestral Californian population. Many bioinvasions are hierarchical in nature, consisting of several sequential or overlapping invasion events, the totality of which can be termed a metainvasion. Phylogenetic data from multilocus DNA sequences will be vital to understanding the evolutionary and ecological processes that underlie metainvasions and to resolving their constituent levels. PMID:10471718

  11. Allele Distributions at Hybrid Incompatibility Loci Facilitate the Potential for Gene Flow between Cultivated and Weedy Rice in the US

    PubMed Central

    Craig, Stephanie M.; Reagon, Michael; Resnick, Lauren E.; Caicedo, Ana L.


    The accumulation of independent mutations over time in two populations often leads to reproductive isolation. Reproductive isolation between diverging populations may be reinforced by barriers that occur either pre- or postzygotically. Hybrid sterility is the most common form of postzygotic isolation in plants. Four postzygotic sterility loci, comprising three hybrid sterility systems (Sa, s5, DPL), have been recently identified in Oryza sativa. These loci explain, in part, the limited hybridization that occurs between the domesticated cultivated rice varieties, O. sativa spp. japonica and O. sativa spp. indica. In the United States, cultivated fields of japonica rice are often invaded by conspecific weeds that have been shown to be of indica origin. Crop-weed hybrids have been identified in crop fields, but at low frequencies. Here we examined the possible role of these hybrid incompatibility loci in the interaction between cultivated and weedy rice. We identified a novel allele at Sa that seemingly prevents loss of fertility in hybrids. Additionally, we found wide-compatibility type alleles at strikingly high frequencies at the Sa and s5 loci in weed groups, and a general lack of incompatible alleles between crops and weeds at the DPL loci. Our results suggest that weedy individuals, particularly those of the SH and BRH groups, should be able to freely hybridize with the local japonica crop, and that prezygotic factors, such as differences in flowering time, have been more important in limiting weed-crop gene flow in the past. As the selective landscape for weedy rice changes due to increased use of herbicide resistant strains of cultivated rice, the genetic barriers that hinder indica-japonica hybridization cannot be counted on to limit the flow of favorable crop genes into weeds. PMID:24489758

  12. Multiple novel prostate cancer susceptibility signals identified by fine-mapping of known risk loci among Europeans.


    Amin Al Olama, Ali; Dadaev, Tokhir; Hazelett, Dennis J; Li, Qiuyan; Leongamornlert, Daniel; Saunders, Edward J; Stephens, Sarah; Cieza-Borrella, Clara; Whitmore, Ian; Benlloch Garcia, Sara; Giles, Graham G; Southey, Melissa C; Fitzgerald, Liesel; Gronberg, Henrik; Wiklund, Fredrik; Aly, Markus; Henderson, Brian E; Schumacher, Fredrick; Haiman, Christopher A; Schleutker, Johanna; Wahlfors, Tiina; Tammela, Teuvo L; Nordestgaard, Børge G; Key, Tim J; Travis, Ruth C; Neal, David E; Donovan, Jenny L; Hamdy, Freddie C; Pharoah, Paul; Pashayan, Nora; Khaw, Kay-Tee; Stanford, Janet L; Thibodeau, Stephen N; Mcdonnell, Shannon K; Schaid, Daniel J; Maier, Christiane; Vogel, Walther; Luedeke, Manuel; Herkommer, Kathleen; Kibel, Adam S; Cybulski, Cezary; Wokołorczyk, Dominika; Kluzniak, Wojciech; Cannon-Albright, Lisa; Brenner, Hermann; Butterbach, Katja; Arndt, Volker; Park, Jong Y; Sellers, Thomas; Lin, Hui-Yi; Slavov, Chavdar; Kaneva, Radka; Mitev, Vanio; Batra, Jyotsna; Clements, Judith A; Spurdle, Amanda; Teixeira, Manuel R; Paulo, Paula; Maia, Sofia; Pandha, Hardev; Michael, Agnieszka; Kierzek, Andrzej; Govindasami, Koveela; Guy, Michelle; Lophatonanon, Artitaya; Muir, Kenneth; Viñuela, Ana; Brown, Andrew A; Freedman, Mathew; Conti, David V; Easton, Douglas; Coetzee, Gerhard A; Eeles, Rosalind A; Kote-Jarai, Zsofia


    Genome-wide association studies (GWAS) have identified numerous common prostate cancer (PrCa) susceptibility loci. We have fine-mapped 64 GWAS regions known at the conclusion of the iCOGS study using large-scale genotyping and imputation in 25 723 PrCa cases and 26 274 controls of European ancestry. We detected evidence for multiple independent signals at 16 regions, 12 of which contained additional newly identified significant associations. A single signal comprising a spectrum of correlated variation was observed at 39 regions; 35 of which are now described by a novel more significantly associated lead SNP, while the originally reported variant remained as the lead SNP only in 4 regions. We also confirmed two association signals in Europeans that had been previously reported only in East-Asian GWAS. Based on statistical evidence and linkage disequilibrium (LD) structure, we have curated and narrowed down the list of the most likely candidate causal variants for each region. Functional annotation using data from ENCODE filtered for PrCa cell lines and eQTL analysis demonstrated significant enrichment for overlap with bio-features within this set. By incorporating the novel risk variants identified here alongside the refined data for existing association signals, we estimate that these loci now explain ∼38.9% of the familial relative risk of PrCa, an 8.9% improvement over the previously reported GWAS tag SNPs. This suggests that a significant fraction of the heritability of PrCa may have been hidden during the discovery phase of GWAS, in particular due to the presence of multiple independent signals within the same region. PMID:26025378

  13. Multiple novel prostate cancer susceptibility signals identified by fine-mapping of known risk loci among Europeans.


    Amin Al Olama, Ali; Dadaev, Tokhir; Hazelett, Dennis J; Li, Qiuyan; Leongamornlert, Daniel; Saunders, Edward J; Stephens, Sarah; Cieza-Borrella, Clara; Whitmore, Ian; Benlloch Garcia, Sara; Giles, Graham G; Southey, Melissa C; Fitzgerald, Liesel; Gronberg, Henrik; Wiklund, Fredrik; Aly, Markus; Henderson, Brian E; Schumacher, Fredrick; Haiman, Christopher A; Schleutker, Johanna; Wahlfors, Tiina; Tammela, Teuvo L; Nordestgaard, Børge G; Key, Tim J; Travis, Ruth C; Neal, David E; Donovan, Jenny L; Hamdy, Freddie C; Pharoah, Paul; Pashayan, Nora; Khaw, Kay-Tee; Stanford, Janet L; Thibodeau, Stephen N; Mcdonnell, Shannon K; Schaid, Daniel J; Maier, Christiane; Vogel, Walther; Luedeke, Manuel; Herkommer, Kathleen; Kibel, Adam S; Cybulski, Cezary; Wokołorczyk, Dominika; Kluzniak, Wojciech; Cannon-Albright, Lisa; Brenner, Hermann; Butterbach, Katja; Arndt, Volker; Park, Jong Y; Sellers, Thomas; Lin, Hui-Yi; Slavov, Chavdar; Kaneva, Radka; Mitev, Vanio; Batra, Jyotsna; Clements, Judith A; Spurdle, Amanda; Teixeira, Manuel R; Paulo, Paula; Maia, Sofia; Pandha, Hardev; Michael, Agnieszka; Kierzek, Andrzej; Govindasami, Koveela; Guy, Michelle; Lophatonanon, Artitaya; Muir, Kenneth; Viñuela, Ana; Brown, Andrew A; Freedman, Mathew; Conti, David V; Easton, Douglas; Coetzee, Gerhard A; Eeles, Rosalind A; Kote-Jarai, Zsofia


    Genome-wide association studies (GWAS) have identified numerous common prostate cancer (PrCa) susceptibility loci. We have fine-mapped 64 GWAS regions known at the conclusion of the iCOGS study using large-scale genotyping and imputation in 25 723 PrCa cases and 26 274 controls of European ancestry. We detected evidence for multiple independent signals at 16 regions, 12 of which contained additional newly identified significant associations. A single signal comprising a spectrum of correlated variation was observed at 39 regions; 35 of which are now described by a novel more significantly associated lead SNP, while the originally reported variant remained as the lead SNP only in 4 regions. We also confirmed two association signals in Europeans that had been previously reported only in East-Asian GWAS. Based on statistical evidence and linkage disequilibrium (LD) structure, we have curated and narrowed down the list of the most likely candidate causal variants for each region. Functional annotation using data from ENCODE filtered for PrCa cell lines and eQTL analysis demonstrated significant enrichment for overlap with bio-features within this set. By incorporating the novel risk variants identified here alongside the refined data for existing association signals, we estimate that these loci now explain ∼38.9% of the familial relative risk of PrCa, an 8.9% improvement over the previously reported GWAS tag SNPs. This suggests that a significant fraction of the heritability of PrCa may have been hidden during the discovery phase of GWAS, in particular due to the presence of multiple independent signals within the same region.

  14. Multiple novel prostate cancer susceptibility signals identified by fine-mapping of known risk loci among Europeans

    PubMed Central

    Amin Al Olama, Ali; Dadaev, Tokhir; Hazelett, Dennis J.; Li, Qiuyan; Leongamornlert, Daniel; Saunders, Edward J.; Stephens, Sarah; Cieza-Borrella, Clara; Whitmore, Ian; Benlloch Garcia, Sara; Giles, Graham G.; Southey, Melissa C.; Fitzgerald, Liesel; Gronberg, Henrik; Wiklund, Fredrik; Aly, Markus; Henderson, Brian E.; Schumacher, Fredrick; Haiman, Christopher A.; Schleutker, Johanna; Wahlfors, Tiina; Tammela, Teuvo L.; Nordestgaard, Børge G.; Key, Tim J.; Travis, Ruth C.; Neal, David E.; Donovan, Jenny L.; Hamdy, Freddie C.; Pharoah, Paul; Pashayan, Nora; Khaw, Kay-Tee; Stanford, Janet L.; Thibodeau, Stephen N.; Mcdonnell, Shannon K.; Schaid, Daniel J.; Maier, Christiane; Vogel, Walther; Luedeke, Manuel; Herkommer, Kathleen; Kibel, Adam S.; Cybulski, Cezary; Wokołorczyk, Dominika; Kluzniak, Wojciech; Cannon-Albright, Lisa; Brenner, Hermann; Butterbach, Katja; Arndt, Volker; Park, Jong Y.; Sellers, Thomas; Lin, Hui-Yi; Slavov, Chavdar; Kaneva, Radka; Mitev, Vanio; Batra, Jyotsna; Clements, Judith A.; Spurdle, Amanda; Teixeira, Manuel R.; Paulo, Paula; Maia, Sofia; Pandha, Hardev; Michael, Agnieszka; Kierzek, Andrzej; Govindasami, Koveela; Guy, Michelle; Lophatonanon, Artitaya; Muir, Kenneth; Viñuela, Ana; Brown, Andrew A.; Freedman, Mathew; Conti, David V.; Easton, Douglas; Coetzee, Gerhard A.; Eeles, Rosalind A.; Kote-Jarai, Zsofia


    Genome-wide association studies (GWAS) have identified numerous common prostate cancer (PrCa) susceptibility loci. We have fine-mapped 64 GWAS regions known at the conclusion of the iCOGS study using large-scale genotyping and imputation in 25 723 PrCa cases and 26 274 controls of European ancestry. We detected evidence for multiple independent signals at 16 regions, 12 of which contained additional newly identified significant associations. A single signal comprising a spectrum of correlated variation was observed at 39 regions; 35 of which are now described by a novel more significantly associated lead SNP, while the originally reported variant remained as the lead SNP only in 4 regions. We also confirmed two association signals in Europeans that had been previously reported only in East-Asian GWAS. Based on statistical evidence and linkage disequilibrium (LD) structure, we have curated and narrowed down the list of the most likely candidate causal variants for each region. Functional annotation using data from ENCODE filtered for PrCa cell lines and eQTL analysis demonstrated significant enrichment for overlap with bio-features within this set. By incorporating the novel risk variants identified here alongside the refined data for existing association signals, we estimate that these loci now explain ∼38.9% of the familial relative risk of PrCa, an 8.9% improvement over the previously reported GWAS tag SNPs. This suggests that a significant fraction of the heritability of PrCa may have been hidden during the discovery phase of GWAS, in particular due to the presence of multiple independent signals within the same region. PMID:26025378

  15. Characterization of expressed class II MHC sequences in the banner-tailed kangaroo rat (Dipodomys spectabilis) reveals multiple DRB loci.


    Busch, Joseph D; Waser, Peter M; DeWoody, J Andrew


    Genes of the major histocompatibility complex (MHC) are exceptionally polymorphic due to the combined effects of natural and sexual selection. Most research in wild populations has focused on the second exon of a single class II locus (DRB), but complete gene sequences can provide an illuminating backdrop for studies of intragenic selection, recombination, and organization. To this end, we characterized class II loci in the banner-tailed kangaroo rat (Dipodomys spectabilis). Seven DRB-like sequences (provisionally named MhcDisp-DRB*01 through *07) were isolated from spleen cDNA and most likely comprise > or =5 loci; this multiformity is quite unlike the situation in muroid rodents such as Mus, Rattus, and Peromyscus. In silico translation revealed the presence of important structural residues for glycosylation sites, salt bonds, and CD4+ T-cell recognition. Amino-acid distances varied widely among the seven sequences (2-34%). Nuclear DNA sequences from the Disp-DRB*07 locus (approximately 10 kb) revealed a conventional exon/intron structure as well as a number of microsatellites and short interspersed nuclear elements (B4, Alu, and IDL-Geo subfamilies). Rates of nucleotide substitution at Disp-DRB*07 are similar in both exons and introns (pi = 0.015 and 0.012, respectively), which suggests relaxed selection and may indicate that this locus is an expressed pseudogene. Finally, we performed BLASTn searches against Dipodomys ordii genomic sequences (unassembled reads) and find 90-97% nucleotide similarity between the two kangaroo rat species. Collectively, these data suggest that class II diversity in heteromyid rodents is based on polylocism and departs from the muroid architecture.

  16. Polymorphisms in CRHR1 and the Serotonin Transporter Loci: Gene × Gene × Environment Interactions on Depressive Symptoms

    PubMed Central

    Ressler, Kerry J; Bradley, Bekh; Mercer, Kristina B; Deveau, Todd C; Smith, Alicia K; Gillespie, Charles F; Nemeroff, Charles B; Cubells, Joseph F; Binder, Elisabeth B


    Gene × environment (G × E) interactions mediating depressive symptoms have been separately identified in the stress-sensitive serotonergic (5-HTTLPR) and corticotropin-releasing hormone (CRHR1) systems. Our objective was to examine whether the effects of child abuse are moderated by gene × gene (G × G) interactions between CRHR1 and 5-HTTLPR polymorphisms. We used an association study examining G × G × E interactions of CRHR1 and 5-HTTLPR polymorphisms and measures of child abuse on adult depressive symptomatology. The participant population (N = 1,392) was African-American, of low socioeconomic status (60% with <$1,000/month family income), and with high rates of childhood and lifetime trauma. Depressive symptoms were measured with Beck Depression Inventory (BDI) and history of Major Depression by Structure Clinical Interview based on DSM-IV (SCID). We first replicated an interaction of child abuse and 5-HTTLPR on lifetime SCID diagnosis of major depression in a subsample (N = 236) of the study population—the largest African-American 5-HTTLPR cohort reported to date. We then extended our previously reported interaction with both a CRHR1 SNP (rs110402) and TCA haplotype interacting with child abuse to predict current symptoms (N = 1,059; P = 0.0089). We found that the 5-HTTLPR S allele interacted with CRHR1 haplotypes and child abuse to predict current depressive symptoms (N = 856, P = 0.016). These data suggest that G × E interactions predictive of depressive symptoms may be differentially sensitive to levels of childhood trauma, and the effects of child abuse are moderated by genetic variation at both the CRHR1 and 5-HTTLPR loci and by their G × G interaction. © 2009 Wiley-Liss, Inc. PMID:20029939

  17. The transcriptional repressor ICER binds to multiple loci throughout the genome.


    Muñiz, Luis C; Molina, Carlos A


    The events culminating in ovulation are controlled by the cyclical actions of hormones such as Follical Stimulating Hormone (FSH) and Luteinizing Hormone (LH). The secondary messenger, cyclic AMP (cAMP) conveys the intracellular activity of these hormones. It is well established that a family of transcription factors facilitate cAMP mediated gene expression, yet it remains unknown how these factors directly affect ovulation. One of these factors, Inducible cAMP Early Repressor (ICER) has been implicated in the transcriptional regulation of cAMP inducible genes during folliculogenesis and ovulation. In order to better determine the role of ICER in ovarian function we have identified novel targets using a genome-wide approach. Using a modification of the chromatin immunoprecipitation (ChIP) assay we directly cloned and sequenced the immunoprecipitated ICER-associated DNAs from an immortalized mouse granulose cell line (GRMO2). The analysis of the immunoprecipitated DNA fragments has revealed that ICER's binding to DNA has the following distribution; 16% within the promoter region, 31% within an intron, 14% were not within a gene, 6% were within 20 kb of a promoter and 3% were within the 3' end of genes.

  18. A radiation hybrid map of 15 loci on the distal long arm of chromosome 4, the region containing the gene responsible for facioscapulohumeral muscular dystrophy (FSHD)

    SciTech Connect

    Winokur, S.T.; Wasmuth, J.H. ); Schutte, B. ); Weiffenbach, B. ); Washington, S.S.; Chakravarti, A. ); McElligot, D. ); Altherr, M.R. Los Alamos National Lab., NM )


    A physical map of 4q35 was constructed through radiation hybrid analysis of 134 clones generated from the cell line HHW416, a chromosome 4-only human-hamster somatic cell hybrid. This subtelomeric region contains the as-yet-unidentified gene responsible for facioscapulohumeral muscular dystrophy. The most likely order of 15 loci within 4q35 was determined. The loci ordered on this radiation hybrid map include both genes and polymorphic loci, as well as monomorphic loci which cannot be placed on a genetic linkage map. The physical distance spanning these loci was estimated to be approximately 4.5 Mb, by using a kilobase/centiray conversion factor derived from 4p16.3 marker analysis through the same set of radiation hybrids. The comparison of this physical map to established genetic maps suggests that this region is smaller than initially estimated and that recombination rates are increased near the telomere. 37 refs., 2 figs., 2 tabs.

  19. Comparative population genetic analysis of bocaccio rockfish Sebastes paucispinis using anonymous and gene-associated simple sequence repeat loci.


    Buonaccorsi, Vincent P; Kimbrell, Carol A; Lynn, Eric A; Hyde, John R


    Comparative population genetic analyses of traditional and emergent molecular markers aid in determining appropriate use of new technologies. The bocaccio rockfish Sebastes paucispinis is a high gene-flow marine species off the west coast of North America that experienced strong population decline over the past 3 decades. We used 18 anonymous and 13 gene-associated simple sequence repeat (SSR) loci (expressed sequence tag [EST]-SSRs) to characterize range-wide population structure with temporal replicates. No F(ST)-outliers were detected using the LOSITAN program, suggesting that neither balancing nor divergent selection affected the loci surveyed. Consistent hierarchical structuring of populations by geography or year class was not detected regardless of marker class. The EST-SSRs were less variable than the anonymous SSRs, but no correlation between F(ST) and variation or marker class was observed. General linear model analysis showed that low EST-SSR variation was attributable to low mean repeat number. Comparative genomic analysis with Gasterosteus aculeatus, Takifugu rubripes, and Oryzias latipes showed consistently lower repeat number in EST-SSRs than SSR loci that were not in ESTs. Purifying selection likely imposed functional constraints on EST-SSRs resulting in low repeat numbers that affected diversity estimates but did not affect the observed pattern of population structure.

  20. Multiple Independent Loci at Chromosome 15q25.1 Affect Smoking Quantity: a Meta-Analysis and Comparison with Lung Cancer and COPD

    PubMed Central

    Saccone, Nancy L.; Culverhouse, Robert C.; Schwantes-An, Tae-Hwi; Cannon, Dale S.; Chen, Xiangning; Cichon, Sven; Giegling, Ina; Han, Shizhong; Han, Younghun; Keskitalo-Vuokko, Kaisu; Kong, Xiangyang; Landi, Maria Teresa; Ma, Jennie Z.; Short, Susan E.; Stephens, Sarah H.; Stevens, Victoria L.; Sun, Lingwei; Wang, Yufei; Wenzlaff, Angela S.; Aggen, Steven H.; Breslau, Naomi; Broderick, Peter; Chatterjee, Nilanjan; Chen, Jingchun; Heath, Andrew C.; Heliövaara, Markku; Hoft, Nicole R.; Hunter, David J.; Jensen, Majken K.; Martin, Nicholas G.; Montgomery, Grant W.; Niu, Tianhua; Payne, Thomas J.; Peltonen, Leena; Pergadia, Michele L.; Rice, John P.; Sherva, Richard; Spitz, Margaret R.; Sun, Juzhong; Wang, Jen C.; Weiss, Robert B.; Wheeler, William; Witt, Stephanie H.; Yang, Bao-Zhu; Caporaso, Neil E.; Ehringer, Marissa A.; Eisen, Tim; Gapstur, Susan M.; Gelernter, Joel; Houlston, Richard; Kaprio, Jaakko; Kendler, Kenneth S.; Kraft, Peter; Leppert, Mark F.; Li, Ming D.; Madden, Pamela A. F.; Nöthen, Markus M.; Pillai, Sreekumar; Rietschel, Marcella; Rujescu, Dan; Schwartz, Ann; Amos, Christopher I.; Bierut, Laura J.


    Recently, genetic association findings for nicotine dependence, smoking behavior, and smoking-related diseases converged to implicate the chromosome 15q25.1 region, which includes the CHRNA5-CHRNA3-CHRNB4 cholinergic nicotinic receptor subunit genes. In particular, association with the nonsynonymous CHRNA5 SNP rs16969968 and correlates has been replicated in several independent studies. Extensive genotyping of this region has suggested additional statistically distinct signals for nicotine dependence, tagged by rs578776 and rs588765. One goal of the Consortium for the Genetic Analysis of Smoking Phenotypes (CGASP) is to elucidate the associations among these markers and dichotomous smoking quantity (heavy versus light smoking), lung cancer, and chronic obstructive pulmonary disease (COPD). We performed a meta-analysis across 34 datasets of European-ancestry subjects, including 38,617 smokers who were assessed for cigarettes-per-day, 7,700 lung cancer cases and 5,914 lung-cancer-free controls (all smokers), and 2,614 COPD cases and 3,568 COPD-free controls (all smokers). We demonstrate statistically independent associations of rs16969968 and rs588765 with smoking (mutually adjusted p-values<10−35 and <10−8 respectively). Because the risk alleles at these loci are negatively correlated, their association with smoking is stronger in the joint model than when each SNP is analyzed alone. Rs578776 also demonstrates association with smoking after adjustment for rs16969968 (p<10−6). In models adjusting for cigarettes-per-day, we confirm the association between rs16969968 and lung cancer (p<10−20) and observe a nominally significant association with COPD (p = 0.01); the other loci are not significantly associated with either lung cancer or COPD after adjusting for rs16969968. This study provides strong evidence that multiple statistically distinct loci in this region affect smoking behavior. This study is also the first report of association between rs588765

  1. Contrasting evolutionary histories of MHC class I and class II loci in grouse—Effects of selection and gene conversion

    USGS Publications Warehouse

    Minias, Piotr; Bateson, Zachary W; Whittingham, Linda A; Johnson, Jeff A.; Oyler-McCance, Sara J.; Dunn, Peter O


    Genes of the major histocompatibility complex (MHC) encode receptor molecules that are responsible for recognition of intracellular and extracellular pathogens (class I and class II genes, respectively) in vertebrates. Given the different roles of class I and II MHC genes, one might expect the strength of selection to differ between these two classes. Different selective pressures may also promote different rates of gene conversion at each class. Despite these predictions, surprisingly few studies have looked at differences between class I and II genes in terms of both selection and gene conversion. Here, we investigated the molecular evolution of MHC class I and II genes in five closely related species of prairie grouse (Centrocercus and Tympanuchus) that possess one class I and two class II loci. We found striking differences in the strength of balancing selection acting on MHC class I versus class II genes. More than half of the putative antigen-binding sites (ABS) of class II were under positive or episodic diversifying selection, compared with only 10% at class I. We also found that gene conversion had a stronger role in shaping the evolution of MHC class II than class I. Overall, the combination of strong positive (balancing) selection and frequent gene conversion has maintained higher diversity of MHC class II than class I in prairie grouse. This is one of the first studies clearly demonstrating that macroevolutionary mechanisms can act differently on genes involved in the immune response against intracellular and extracellular pathogens.

  2. Miniature- and Multiple-Eyespot Loci in Chlamydomonas reinhardtii Define New Modulators of Eyespot Photoreception and Assembly.


    Boyd, Joseph S; Lamb, Mary Rose; Dieckmann, Carol L


    The photosensory eyespot of the green alga Chlamydomonas reinhardtii is a model system for the study of organelle biogenesis and placement. Eyespot assembly and positioning are governed by several genetic loci that have been identified in forward genetic screens for phototaxis-defective mutants. These include the previously described miniature-eyespot mutant min1, the multiple-eyespot mutant mlt1, the eyeless mutants eye2 and eye3, and two previously uncharacterized eyespot mutants, min2 and mlt2. In this study, effects of miniature- and multiple-eyespot mutations and their combinations on the localization and expression levels of the rhodopsin photoreceptor channelrhodopsin-1 (ChR1) and the localization of the eyespot-assembly proteins EYE2 and EYE3 were examined. min2 mutants assemble a properly organized, albeit nonfunctional, eyespot that is slightly smaller than wild-type; however, combination of the min2 and mlt1 mutations resulted in drastic reduction of photoreceptor levels. Both stationary-phase mlt1 and mlt2 cells have supernumerary, mislocalized eyespots that exhibit partial or total dissociation of the eyespot layers. In these mutant strains, photoreceptor patches in the plasma membrane were never associated with pigment granule arrays in the chloroplast stroma unless EYE2 was present in the intervening envelope. The data suggest that MIN2 is required for the photoreceptive ability of the eyespot and that MLT2 plays a major role in regulating eyespot number, placement, and integrity. PMID:22384359

  3. Multiple sclerosis risk loci and disease severity in 7,125 individuals from 10 studies

    PubMed Central

    George, Michaela F.; Briggs, Farren B.S.; Shao, Xiaorong; Gianfrancesco, Milena A.; Kockum, Ingrid; Harbo, Hanne F.; Celius, Elisabeth G.; Bos, Steffan D.; Hedström, Anna; Shen, Ling; Bernstein, Allan; Alfredsson, Lars; Hillert, Jan; Olsson, Tomas; Patsopoulos, Nikolaos A.; De Jager, Philip L.; Oturai, Annette B.; Søndergaard, Helle B.; Sellebjerg, Finn; Sorensen, Per S.; Gomez, Refujia; Caillier, Stacy J.; Cree, Bruce A.C.; Oksenberg, Jorge R.; Hauser, Stephen L.; D'Alfonso, Sandra; Leone, Maurizio A.; Boneschi, Filippo Martinelli; Sorosina, Melissa; van der Mei, Ingrid; Taylor, Bruce V.; Zhou, Yuan; Schaefer, Catherine


    Objective: We investigated the association between 52 risk variants identified through genome-wide association studies and disease severity in multiple sclerosis (MS). Methods: Ten unique MS case data sets were analyzed. The Multiple Sclerosis Severity Score (MSSS) was calculated using the Expanded Disability Status Scale at study entry and disease duration. MSSS was considered as a continuous variable and as 2 dichotomous variables (median and extreme ends; MSSS of ≤5 vs >5 and MSSS of <2.5 vs ≥7.5, respectively). Single nucleotide polymorphisms (SNPs) were examined individually and as both combined weighted genetic risk score (wGRS) and unweighted genetic risk score (GRS) for association with disease severity. Random-effects meta-analyses were conducted and adjusted for cohort, sex, age at onset, and HLA-DRB1*15:01. Results: A total of 7,125 MS cases were analyzed. The wGRS and GRS were not strongly associated with disease severity after accounting for cohort, sex, age at onset, and HLA-DRB1*15:01. After restricting analyses to cases with disease duration ≥10 years, associations were null (p value ≥0.05). No SNP was associated with disease severity after adjusting for multiple testing. Conclusions: The largest meta-analysis of established MS genetic risk variants and disease severity, to date, was performed. Results suggest that the investigated MS genetic risk variants are not associated with MSSS, even after controlling for potential confounders. Further research in large cohorts is needed to identify genetic determinants of disease severity using sensitive clinical and MRI measures, which are critical to understanding disease mechanisms and guiding development of effective treatments. PMID:27540591

  4. Genetic variation in the odorant receptors family 13 and the mhc loci influence mate selection in a multiple sclerosis dataset

    PubMed Central


    Background When selecting mates, many vertebrate species seek partners with major histocompatibility complex (MHC) genes different from their own, presumably in response to selective pressure against inbreeding and towards MHC diversity. Attempts at replication of these genetic results in human studies, however, have reached conflicting conclusions. Results Using a multi-analytical strategy, we report validated genome-wide relationships between genetic identity and human mate choice in 930 couples of European ancestry. We found significant similarity between spouses in the MHC at class I region in chromosome 6p21, and at the odorant receptor family 13 locus in chromosome 9. Conversely, there was significant dissimilarity in the MHC class II region, near the HLA-DQA1 and -DQB1 genes. We also found that genomic regions with significant similarity between spouses show excessive homozygosity in the general population (assessed in the HapMap CEU dataset). Conversely, loci that were significantly dissimilar among spouses were more likely to show excessive heterozygosity in the general population. Conclusions This study highlights complex patterns of genomic identity among partners in unrelated couples, consistent with a multi-faceted role for genetic factors in mate choice behavior in human populations. PMID:21067613

  5. Dissecting Quantitative Trait Loci for Boron Efficiency across Multiple Environments in Brassica napus

    PubMed Central

    Zhao, Zunkang; Wu, Likun; Nian, Fuzhao; Ding, Guangda; Shi, Taoxiong; Zhang, Didi; Shi, Lei; Xu, Fangsen; Meng, Jinling


    High yield is the most important goal in crop breeding, and boron (B) is an essential micronutrient for plants. However, B deficiency, leading to yield decreases, is an agricultural problem worldwide. Brassica napus is one of the most sensitive crops to B deficiency, and considerable genotypic variation exists among different cultivars in response to B deficiency. To dissect the genetic basis of tolerance to B deficiency in B. napus, we carried out QTL analysis for seed yield and yield-related traits under low and normal B conditions using the double haploid population (TNDH) by two-year and the BQDH population by three-year field trials. In total, 80 putative QTLs and 42 epistatic interactions for seed yield, plant height, branch number, pod number, seed number, seed weight and B efficiency coefficient (BEC) were identified under low and normal B conditions, singly explaining 4.15–23.16% and 0.53–14.38% of the phenotypic variation. An additive effect of putative QTLs was a more important controlling factor than the additive-additive effect of epistatic interactions. Four QTL-by-environment interactions and 7 interactions between epistatic interactions and the environment contributed to 1.27–4.95% and 1.17–3.68% of the phenotypic variation, respectively. The chromosome region on A2 of SYLB-A2 for seed yield under low B condition and BEC-A2 for BEC in the two populations was equivalent to the region of a reported major QTL, BE1. The B. napus homologous genes of Bra020592 and Bra020595 mapped to the A2 region and were speculated to be candidate genes for B efficiency. These findings reveal the complex genetic basis of B efficiency in B. napus. They provide a basis for the fine mapping and cloning of the B efficiency genes and for breeding B-efficient cultivars by marker-assisted selection (MAS). PMID:23028855

  6. Genome-Wide Association Study Reveals Multiple Loci Influencing Normal Human Facial Morphology

    PubMed Central

    Raffensperger, Zachary D.; Heike, Carrie L.; Cunningham, Michael L.; Hecht, Jacqueline T.; Kau, Chung How; Moreno, Lina M.; Wehby, George L.; Murray, Jeffrey C.; Laurie, Cecelia A.; Laurie, Cathy C.; Santorico, Stephanie; Klein, Ophir; Feingold, Eleanor; Hallgrimsson, Benedikt; Spritz, Richard A.; Marazita, Mary L.; Weinberg, Seth M.


    Numerous lines of evidence point to a genetic basis for facial morphology in humans, yet little is known about how specific genetic variants relate to the phenotypic expression of many common facial features. We conducted genome-wide association meta-analyses of 20 quantitative facial measurements derived from the 3D surface images of 3118 healthy individuals of European ancestry belonging to two US cohorts. Analyses were performed on just under one million genotyped SNPs (Illumina OmniExpress+Exome v1.2 array) imputed to the 1000 Genomes reference panel (Phase 3). We observed genome-wide significant associations (p < 5 x 10−8) for cranial base width at 14q21.1 and 20q12, intercanthal width at 1p13.3 and Xq13.2, nasal width at 20p11.22, nasal ala length at 14q11.2, and upper facial depth at 11q22.1. Several genes in the associated regions are known to play roles in craniofacial development or in syndromes affecting the face: MAFB, PAX9, MIPOL1, ALX3, HDAC8, and PAX1. We also tested genotype-phenotype associations reported in two previous genome-wide studies and found evidence of replication for nasal ala length and SNPs in CACNA2D3 and PRDM16. These results provide further evidence that common variants in regions harboring genes of known craniofacial function contribute to normal variation in human facial features. Improved understanding of the genes associated with facial morphology in healthy individuals can provide insights into the pathways and mechanisms controlling normal and abnormal facial morphogenesis. PMID:27560520

  7. Genome-Wide Association Study Reveals Multiple Loci Influencing Normal Human Facial Morphology.


    Shaffer, John R; Orlova, Ekaterina; Lee, Myoung Keun; Leslie, Elizabeth J; Raffensperger, Zachary D; Heike, Carrie L; Cunningham, Michael L; Hecht, Jacqueline T; Kau, Chung How; Nidey, Nichole L; Moreno, Lina M; Wehby, George L; Murray, Jeffrey C; Laurie, Cecelia A; Laurie, Cathy C; Cole, Joanne; Ferrara, Tracey; Santorico, Stephanie; Klein, Ophir; Mio, Washington; Feingold, Eleanor; Hallgrimsson, Benedikt; Spritz, Richard A; Marazita, Mary L; Weinberg, Seth M


    Numerous lines of evidence point to a genetic basis for facial morphology in humans, yet little is known about how specific genetic variants relate to the phenotypic expression of many common facial features. We conducted genome-wide association meta-analyses of 20 quantitative facial measurements derived from the 3D surface images of 3118 healthy individuals of European ancestry belonging to two US cohorts. Analyses were performed on just under one million genotyped SNPs (Illumina OmniExpress+Exome v1.2 array) imputed to the 1000 Genomes reference panel (Phase 3). We observed genome-wide significant associations (p < 5 x 10-8) for cranial base width at 14q21.1 and 20q12, intercanthal width at 1p13.3 and Xq13.2, nasal width at 20p11.22, nasal ala length at 14q11.2, and upper facial depth at 11q22.1. Several genes in the associated regions are known to play roles in craniofacial development or in syndromes affecting the face: MAFB, PAX9, MIPOL1, ALX3, HDAC8, and PAX1. We also tested genotype-phenotype associations reported in two previous genome-wide studies and found evidence of replication for nasal ala length and SNPs in CACNA2D3 and PRDM16. These results provide further evidence that common variants in regions harboring genes of known craniofacial function contribute to normal variation in human facial features. Improved understanding of the genes associated with facial morphology in healthy individuals can provide insights into the pathways and mechanisms controlling normal and abnormal facial morphogenesis.

  8. Genome-Wide Association Study Reveals Multiple Loci Influencing Normal Human Facial Morphology.


    Shaffer, John R; Orlova, Ekaterina; Lee, Myoung Keun; Leslie, Elizabeth J; Raffensperger, Zachary D; Heike, Carrie L; Cunningham, Michael L; Hecht, Jacqueline T; Kau, Chung How; Nidey, Nichole L; Moreno, Lina M; Wehby, George L; Murray, Jeffrey C; Laurie, Cecelia A; Laurie, Cathy C; Cole, Joanne; Ferrara, Tracey; Santorico, Stephanie; Klein, Ophir; Mio, Washington; Feingold, Eleanor; Hallgrimsson, Benedikt; Spritz, Richard A; Marazita, Mary L; Weinberg, Seth M


    Numerous lines of evidence point to a genetic basis for facial morphology in humans, yet little is known about how specific genetic variants relate to the phenotypic expression of many common facial features. We conducted genome-wide association meta-analyses of 20 quantitative facial measurements derived from the 3D surface images of 3118 healthy individuals of European ancestry belonging to two US cohorts. Analyses were performed on just under one million genotyped SNPs (Illumina OmniExpress+Exome v1.2 array) imputed to the 1000 Genomes reference panel (Phase 3). We observed genome-wide significant associations (p < 5 x 10-8) for cranial base width at 14q21.1 and 20q12, intercanthal width at 1p13.3 and Xq13.2, nasal width at 20p11.22, nasal ala length at 14q11.2, and upper facial depth at 11q22.1. Several genes in the associated regions are known to play roles in craniofacial development or in syndromes affecting the face: MAFB, PAX9, MIPOL1, ALX3, HDAC8, and PAX1. We also tested genotype-phenotype associations reported in two previous genome-wide studies and found evidence of replication for nasal ala length and SNPs in CACNA2D3 and PRDM16. These results provide further evidence that common variants in regions harboring genes of known craniofacial function contribute to normal variation in human facial features. Improved understanding of the genes associated with facial morphology in healthy individuals can provide insights into the pathways and mechanisms controlling normal and abnormal facial morphogenesis. PMID:27560520

  9. A genome-wide association study identifies multiple loci for variation in human ear morphology.


    Adhikari, Kaustubh; Reales, Guillermo; Smith, Andrew J P; Konka, Esra; Palmen, Jutta; Quinto-Sanchez, Mirsha; Acuña-Alonzo, Victor; Jaramillo, Claudia; Arias, William; Fuentes, Macarena; Pizarro, María; Barquera Lozano, Rodrigo; Macín Pérez, Gastón; Gómez-Valdés, Jorge; Villamil-Ramírez, Hugo; Hunemeier, Tábita; Ramallo, Virginia; Silva de Cerqueira, Caio C; Hurtado, Malena; Villegas, Valeria; Granja, Vanessa; Gallo, Carla; Poletti, Giovanni; Schuler-Faccini, Lavinia; Salzano, Francisco M; Bortolini, Maria-Cátira; Canizales-Quinteros, Samuel; Rothhammer, Francisco; Bedoya, Gabriel; Calderón, Rosario; Rosique, Javier; Cheeseman, Michael; Bhutta, Mahmood F; Humphries, Steve E; Gonzalez-José, Rolando; Headon, Denis; Balding, David; Ruiz-Linares, Andrés


    Here we report a genome-wide association study for non-pathological pinna morphology in over 5,000 Latin Americans. We find genome-wide significant association at seven genomic regions affecting: lobe size and attachment, folding of antihelix, helix rolling, ear protrusion and antitragus size (linear regression P values 2 × 10(-8) to 3 × 10(-14)). Four traits are associated with a functional variant in the Ectodysplasin A receptor (EDAR) gene, a key regulator of embryonic skin appendage development. We confirm expression of Edar in the developing mouse ear and that Edar-deficient mice have an abnormally shaped pinna. Two traits are associated with SNPs in a region overlapping the T-Box Protein 15 (TBX15) gene, a major determinant of mouse skeletal development. Strongest association in this region is observed for SNP rs17023457 located in an evolutionarily conserved binding site for the transcription factor Cartilage paired-class homeoprotein 1 (CART1), and we confirm that rs17023457 alters in vitro binding of CART1. PMID:26105758

  10. A genome-wide association study identifies multiple loci for variation in human ear morphology.


    Adhikari, Kaustubh; Reales, Guillermo; Smith, Andrew J P; Konka, Esra; Palmen, Jutta; Quinto-Sanchez, Mirsha; Acuña-Alonzo, Victor; Jaramillo, Claudia; Arias, William; Fuentes, Macarena; Pizarro, María; Barquera Lozano, Rodrigo; Macín Pérez, Gastón; Gómez-Valdés, Jorge; Villamil-Ramírez, Hugo; Hunemeier, Tábita; Ramallo, Virginia; Silva de Cerqueira, Caio C; Hurtado, Malena; Villegas, Valeria; Granja, Vanessa; Gallo, Carla; Poletti, Giovanni; Schuler-Faccini, Lavinia; Salzano, Francisco M; Bortolini, Maria-Cátira; Canizales-Quinteros, Samuel; Rothhammer, Francisco; Bedoya, Gabriel; Calderón, Rosario; Rosique, Javier; Cheeseman, Michael; Bhutta, Mahmood F; Humphries, Steve E; Gonzalez-José, Rolando; Headon, Denis; Balding, David; Ruiz-Linares, Andrés


    Here we report a genome-wide association study for non-pathological pinna morphology in over 5,000 Latin Americans. We find genome-wide significant association at seven genomic regions affecting: lobe size and attachment, folding of antihelix, helix rolling, ear protrusion and antitragus size (linear regression P values 2 × 10(-8) to 3 × 10(-14)). Four traits are associated with a functional variant in the Ectodysplasin A receptor (EDAR) gene, a key regulator of embryonic skin appendage development. We confirm expression of Edar in the developing mouse ear and that Edar-deficient mice have an abnormally shaped pinna. Two traits are associated with SNPs in a region overlapping the T-Box Protein 15 (TBX15) gene, a major determinant of mouse skeletal development. Strongest association in this region is observed for SNP rs17023457 located in an evolutionarily conserved binding site for the transcription factor Cartilage paired-class homeoprotein 1 (CART1), and we confirm that rs17023457 alters in vitro binding of CART1.

  11. A genome-wide association study identifies multiple loci for variation in human ear morphology

    PubMed Central

    Adhikari, Kaustubh; Reales, Guillermo; Smith, Andrew J. P.; Konka, Esra; Palmen, Jutta; Quinto-Sanchez, Mirsha; Acuña-Alonzo, Victor; Jaramillo, Claudia; Arias, William; Fuentes, Macarena; Pizarro, María; Barquera Lozano, Rodrigo; Macín Pérez, Gastón; Gómez-Valdés, Jorge; Villamil-Ramírez, Hugo; Hunemeier, Tábita; Ramallo, Virginia; Silva de Cerqueira, Caio C.; Hurtado, Malena; Villegas, Valeria; Granja, Vanessa; Gallo, Carla; Poletti, Giovanni; Schuler-Faccini, Lavinia; Salzano, Francisco M.; Bortolini, Maria- Cátira; Canizales-Quinteros, Samuel; Rothhammer, Francisco; Bedoya, Gabriel; Calderón, Rosario; Rosique, Javier; Cheeseman, Michael; Bhutta, Mahmood F.; Humphries, Steve E.; Gonzalez-José, Rolando; Headon, Denis; Balding, David; Ruiz-Linares, Andrés


    Here we report a genome-wide association study for non-pathological pinna morphology in over 5,000 Latin Americans. We find genome-wide significant association at seven genomic regions affecting: lobe size and attachment, folding of antihelix, helix rolling, ear protrusion and antitragus size (linear regression P values 2 × 10−8 to 3 × 10−14). Four traits are associated with a functional variant in the Ectodysplasin A receptor (EDAR) gene, a key regulator of embryonic skin appendage development. We confirm expression of Edar in the developing mouse ear and that Edar-deficient mice have an abnormally shaped pinna. Two traits are associated with SNPs in a region overlapping the T-Box Protein 15 (TBX15) gene, a major determinant of mouse skeletal development. Strongest association in this region is observed for SNP rs17023457 located in an evolutionarily conserved binding site for the transcription factor Cartilage paired-class homeoprotein 1 (CART1), and we confirm that rs17023457 alters in vitro binding of CART1. PMID:26105758

  12. Phylogenetic analysis of Pasteuria penetrans by use of multiple genetic loci.


    Charles, Lauren; Carbone, Ignazio; Davies, Keith G; Bird, David; Burke, Mark; Kerry, Brian R; Opperman, Charles H


    Pasteuria penetrans is a gram-positive, endospore-forming eubacterium that apparently is a member of the Bacillus-Clostridium clade. It is an obligate parasite of root knot nematodes (Meloidogyne spp.) and preferentially grows on the developing ovaries, inhibiting reproduction. Root knot nematodes are devastating root pests of economically important crop plants and are difficult to control. Consequently, P. penetrans has long been recognized as a potential biocontrol agent for root knot nematodes, but the fastidious life cycle and the obligate nature of parasitism have inhibited progress on mass culture and deployment. We are currently sequencing the genome of the Pasteuria bacterium and have performed amino acid level analyses of 33 bacterial species (including P. penetrans) using concatenation of 40 housekeeping genes, with and without insertions/deletions (indels) removed, and using each gene individually. By application of maximum-likelihood, maximum-parsimony, and Bayesian methods to the resulting data sets, P. penetrans was found to cluster tightly, with a high level of confidence, in the Bacillus class of the gram-positive, low-G+C-content eubacteria. Strikingly, our analyses identified P. penetrans as ancestral to Bacillus spp. Additionally, all analyses revealed that P. penetrans is surprisingly more closely related to the saprophytic extremophile Bacillus haladurans and Bacillus subtilis than to the pathogenic species Bacillus anthracis and Bacillus cereus. Collectively, these findings strongly imply that P. penetrans is an ancient member of the Bacillus group. We suggest that P. penetrans may have evolved from an ancient symbiotic bacterial associate of nematodes, possibly as the root knot nematode evolved to be a highly specialized parasite of plants. PMID:16077116

  13. Identification of novel candidate gene loci and increased sex chromosome aneuploidy among infants with conotruncal heart defects.


    Osoegawa, Kazutoyo; Iovannisci, David M; Lin, Bin; Parodi, Christina; Schultz, Kathleen; Shaw, Gary M; Lammer, Edward J


    Congenital heart defects (CHDs) are common malformations, affecting four to eight per 1,000 total births. Conotruncal defects are an important pathogenetic subset of CHDs, comprising nearly 20% of the total. Although both environmental and genetic factors are known to contribute to the occurrence of conotruncal defects, the causes remain unknown for most. To identify novel candidate genes/loci, we used array comparative genomic hybridization to detect chromosomal microdeletions/duplications. From a population base of 974,579 total births born during 1999-2004, we screened 389 California infants born with tetralogy of Fallot or d-transposition of the great arteries. We found that 1.7% (5/288) of males with a conotruncal defect had sex chromosome aneuploidy, a sevenfold increased frequency (relative risk = 7.0; 95% confidence interval 2.9-16.9). We identified eight chromosomal microdeletions/duplications for conotruncal defects. From these duplications and deletions, we found five high priority candidate genes (GATA4, CRKL, BMPR1A, SNAI2, and ZFHX4). This is the initial report that sex chromosome aneuploidy is associated with conotruncal defects among boys. These chromosomal microduplications/deletions provide evidence that GATA4, SNAI2, and CRKL are highly dosage sensitive genes involved in outflow tract development. Genome wide screening for copy number variation can be productive for identifying novel genes/loci contributing to non-syndromic common malformations.

  14. [Susceptibility gene in multiple system atrophy (MSA)].


    Tsuji, Shoji


    To elucidate molecular bases of multiple system atrophy (MSA), we first focused on recently identified MSA multiplex families. Though linkage analyses followed by whole genome resequencing, we have identified a causative gene, COQ2, for MSA. We then conducted comprehensive nucleotide sequence analysis of COQ2 of sporadic MSA cases and controls, and found that functionally deleterious COQ2 variants confer a strong risk for developing MSA. COQ2 encodes an enzyme in the biosynthetic pathway of coenzyme Q10. Decreased synthesis of coenzyme Q10 is considered to be involved in the pathogenesis of MSA through decreased electron transport in mitochondria and increased vulnerability to oxidative stress. PMID:25672683

  15. [Information behavior of 7 STR loci on chromosome 9p in gene scanning].


    Zeng, Zhao-Yang; Xiong, Wei; Xiong, Fang; Shen, Shou-Rong; Li, Xiao-Ling; Li, Wei-Fang; Wang, Rong; Xiao, Bing-Yi; Fan, Song-Qing; Huang, He; Zhou, Ming; Li, Gui-Yuan


    To get genotype and allele frequency distributions of seven short tandem repeat (STR) loci of chromosome 9p,D9S288,D9S157,D9S1748,D9S171,D9S161,D9S1817 and D9S1805 in Chinese Han population in Hunan area,blood samples were collected from the random Han individual in Hunan and the whole genomic DNA was extracted.STR loci were amplified by multiplex-PCR technique and genotyped by ABI 377 sequencer.Seventy-five alleles were detected,with frequencies ranging from 0.002 to 0.800,and constituted 243 genotypes. All the seven loci met Hardy-Weinberg equilibrium. The statistical analysis of seven STR loci showed H(heterozygosity) ranging from 0.347 to 0.844,DP(discrimination power) ranging from 0.346 to 0.841,PPE(probabilities of paternity exclusion) ranging from 0.308 to 0.738 and PIC(polymorphic information content) ranging from 0.328 to 0.822. The result indicated that there was a significant difference between Han ethnic group and the white and the black.

  16. Gene-centric meta-analyses for central adiposity traits in up to 57 412 individuals of European descent confirm known loci and reveal several novel associations

    PubMed Central

    Yoneyama, Sachiko; Guo, Yiran; Lanktree, Matthew B.; Barnes, Michael R.; Elbers, Clara C.; Karczewski, Konrad J; Padmanabhan, Sandosh; Bauer, Florianne; Baumert, Jens; Beitelshees, Amber; Berenson, Gerald S.; Boer, Jolanda M.A.; Burke, Gregory; Cade, Brian; Chen, Wei; Cooper-Dehoff, Rhonda M.; Gaunt, Tom R.; Gieger, Christian; Gong, Yan; Gorski, Mathias; Heard-Costa, Nancy; Johnson, Toby; Lamonte, Michael J.; Mcdonough, Caitrin; Monda, Keri L.; Onland-Moret, N. Charlotte; Nelson, Christopher P.; O'Connell, Jeffrey R.; Ordovas, Jose; Peter, Inga; Peters, Annette; Shaffer, Jonathan; Shen, Haiqinq; Smith, Erin; Speilotes, Liz; Thomas, Fridtjof; Thorand, Barbara; Monique Verschuren, W. M.; Anand, Sonia S.; Dominiczak, Anna; Davidson, Karina W.; Hegele, Robert A.; Heid, Iris; Hofker, Marten H.; Huggins, Gordon S.; Illig, Thomas; Johnson, Julie A.; Kirkland, Susan; König, Wolfgang; Langaee, Taimour Y.; Mccaffery, Jeanne; Melander, Olle; Mitchell, Braxton D.; Munroe, Patricia; Murray, Sarah S.; Papanicolaou, George; Redline, Susan; Reilly, Muredach; Samani, Nilesh J.; Schork, Nicholas J.; Van Der Schouw, Yvonne T.; Shimbo, Daichi; Shuldiner, Alan R.; Tobin, Martin D.; Wijmenga, Cisca; Yusuf, Salim; Hakonarson, Hakon; Lange, Leslie A.; Demerath, Ellen W; Fox, Caroline S.; North, Kari E; Reiner, Alex P.; Keating, Brendan; Taylor, Kira C.


    Waist circumference (WC) and waist-to-hip ratio (WHR) are surrogate measures of central adiposity that are associated with adverse cardiovascular events, type 2 diabetes and cancer independent of body mass index (BMI). WC and WHR are highly heritable with multiple susceptibility loci identified to date. We assessed the association between SNPs and BMI-adjusted WC and WHR and unadjusted WC in up to 57 412 individuals of European descent from 22 cohorts collaborating with the NHLBI's Candidate Gene Association Resource (CARe) project. The study population consisted of women and men aged 20–80 years. Study participants were genotyped using the ITMAT/Broad/CARE array, which includes ∼50 000 cosmopolitan tagged SNPs across ∼2100 cardiovascular-related genes. Each trait was modeled as a function of age, study site and principal components to control for population stratification, and we conducted a fixed-effects meta-analysis. No new loci for WC were observed. For WHR analyses, three novel loci were significantly associated (P < 2.4 × 10−6). Previously unreported rs2811337-G near TMCC1 was associated with increased WHR (β ± SE, 0.048 ± 0.008, P = 7.7 × 10−9) as was rs7302703-G in HOXC10 (β = 0.044 ± 0.008, P = 2.9 × 10−7) and rs936108-C in PEMT (β = 0.035 ± 0.007, P = 1.9 × 10−6). Sex-stratified analyses revealed two additional novel signals among females only, rs12076073-A in SHC1 (β = 0.10 ± 0.02, P = 1.9 × 10−6) and rs1037575-A in ATBDB4 (β = 0.046 ± 0.01, P = 2.2 × 10−6), supporting an already established sexual dimorphism of central adiposity-related genetic variants. Functional analysis using ENCODE and eQTL databases revealed that several of these loci are in regulatory regions or regions with differential expression in adipose tissue. PMID:24345515

  17. Meta-analysis of gene-environment-wide association scans accounting for education level identifies additional loci for refractive error.


    Fan, Qiao; Verhoeven, Virginie J M; Wojciechowski, Robert; Barathi, Veluchamy A; Hysi, Pirro G; Guggenheim, Jeremy A; Höhn, René; Vitart, Veronique; Khawaja, Anthony P; Yamashiro, Kenji; Hosseini, S Mohsen; Lehtimäki, Terho; Lu, Yi; Haller, Toomas; Xie, Jing; Delcourt, Cécile; Pirastu, Mario; Wedenoja, Juho; Gharahkhani, Puya; Venturini, Cristina; Miyake, Masahiro; Hewitt, Alex W; Guo, Xiaobo; Mazur, Johanna; Huffman, Jenifer E; Williams, Katie M; Polasek, Ozren; Campbell, Harry; Rudan, Igor; Vatavuk, Zoran; Wilson, James F; Joshi, Peter K; McMahon, George; St Pourcain, Beate; Evans, David M; Simpson, Claire L; Schwantes-An, Tae-Hwi; Igo, Robert P; Mirshahi, Alireza; Cougnard-Gregoire, Audrey; Bellenguez, Céline; Blettner, Maria; Raitakari, Olli; Kähönen, Mika; Seppala, Ilkka; Zeller, Tanja; Meitinger, Thomas; Ried, Janina S; Gieger, Christian; Portas, Laura; van Leeuwen, Elisabeth M; Amin, Najaf; Uitterlinden, André G; Rivadeneira, Fernando; Hofman, Albert; Vingerling, Johannes R; Wang, Ya Xing; Wang, Xu; Tai-Hui Boh, Eileen; Ikram, M Kamran; Sabanayagam, Charumathi; Gupta, Preeti; Tan, Vincent; Zhou, Lei; Ho, Candice E H; Lim, Wan'e; Beuerman, Roger W; Siantar, Rosalynn; Tai, E-Shyong; Vithana, Eranga; Mihailov, Evelin; Khor, Chiea-Chuen; Hayward, Caroline; Luben, Robert N; Foster, Paul J; Klein, Barbara E K; Klein, Ronald; Wong, Hoi-Suen; Mitchell, Paul; Metspalu, Andres; Aung, Tin; Young, Terri L; He, Mingguang; Pärssinen, Olavi; van Duijn, Cornelia M; Jin Wang, Jie; Williams, Cathy; Jonas, Jost B; Teo, Yik-Ying; Mackey, David A; Oexle, Konrad; Yoshimura, Nagahisa; Paterson, Andrew D; Pfeiffer, Norbert; Wong, Tien-Yin; Baird, Paul N; Stambolian, Dwight; Wilson, Joan E Bailey; Cheng, Ching-Yu; Hammond, Christopher J; Klaver, Caroline C W; Saw, Seang-Mei; Rahi, Jugnoo S; Korobelnik, Jean-François; Kemp, John P; Timpson, Nicholas J; Smith, George Davey; Craig, Jamie E; Burdon, Kathryn P; Fogarty, Rhys D; Iyengar, Sudha K; Chew, Emily; Janmahasatian, Sarayut; Martin, Nicholas G; MacGregor, Stuart; Xu, Liang; Schache, Maria; Nangia, Vinay; Panda-Jonas, Songhomitra; Wright, Alan F; Fondran, Jeremy R; Lass, Jonathan H; Feng, Sheng; Zhao, Jing Hua; Khaw, Kay-Tee; Wareham, Nick J; Rantanen, Taina; Kaprio, Jaakko; Pang, Chi Pui; Chen, Li Jia; Tam, Pancy O; Jhanji, Vishal; Young, Alvin L; Döring, Angela; Raffel, Leslie J; Cotch, Mary-Frances; Li, Xiaohui; Yip, Shea Ping; Yap, Maurice K H; Biino, Ginevra; Vaccargiu, Simona; Fossarello, Maurizio; Fleck, Brian; Yazar, Seyhan; Tideman, Jan Willem L; Tedja, Milly; Deangelis, Margaret M; Morrison, Margaux; Farrer, Lindsay; Zhou, Xiangtian; Chen, Wei; Mizuki, Nobuhisa; Meguro, Akira; Mäkelä, Kari Matti


    Myopia is the most common human eye disorder and it results from complex genetic and environmental causes. The rapidly increasing prevalence of myopia poses a major public health challenge. Here, the CREAM consortium performs a joint meta-analysis to test single-nucleotide polymorphism (SNP) main effects and SNP × education interaction effects on refractive error in 40,036 adults from 25 studies of European ancestry and 10,315 adults from 9 studies of Asian ancestry. In European ancestry individuals, we identify six novel loci (FAM150B-ACP1, LINC00340, FBN1, DIS3L-MAP2K1, ARID2-SNAT1 and SLC14A2) associated with refractive error. In Asian populations, three genome-wide significant loci AREG, GABRR1 and PDE10A also exhibit strong interactions with education (P<8.5 × 10(-5)), whereas the interactions are less evident in Europeans. The discovery of these loci represents an important advance in understanding how gene and environment interactions contribute to the heterogeneity of myopia.

  18. Identification of multiple risk variants for ankylosing spondylitis through high-density genotyping of immune-related loci.


    Cortes, Adrian; Hadler, Johanna; Pointon, Jenny P; Robinson, Philip C; Karaderi, Tugce; Leo, Paul; Cremin, Katie; Pryce, Karena; Harris, Jessica; Lee, Seunghun; Joo, Kyung Bin; Shim, Seung-Cheol; Weisman, Michael; Ward, Michael; Zhou, Xiaodong; Garchon, Henri-Jean; Chiocchia, Gilles; Nossent, Johannes; Lie, Benedicte A; Førre, Øystein; Tuomilehto, Jaakko; Laiho, Kari; Jiang, Lei; Liu, Yu; Wu, Xin; Bradbury, Linda A; Elewaut, Dirk; Burgos-Vargas, Ruben; Stebbings, Simon; Appleton, Louise; Farrah, Claire; Lau, Jonathan; Kenna, Tony J; Haroon, Nigil; Ferreira, Manuel A; Yang, Jian; Mulero, Juan; Fernandez-Sueiro, Jose Luis; Gonzalez-Gay, Miguel A; Lopez-Larrea, Carlos; Deloukas, Panos; Donnelly, Peter; Bowness, Paul; Gafney, Karl; Gaston, Hill; Gladman, Dafna D; Rahman, Proton; Maksymowych, Walter P; Xu, Huji; Crusius, J Bart A; van der Horst-Bruinsma, Irene E; Chou, Chung-Tei; Valle-Oñate, Raphael; Romero-Sánchez, Consuelo; Hansen, Inger Myrnes; Pimentel-Santos, Fernando M; Inman, Robert D; Videm, Vibeke; Martin, Javier; Breban, Maxime; Reveille, John D; Evans, David M; Kim, Tae-Hwan; Wordsworth, Bryan Paul; Brown, Matthew A


    Ankylosing spondylitis is a common, highly heritable inflammatory arthritis affecting primarily the spine and pelvis. In addition to HLA-B*27 alleles, 12 loci have previously been identified that are associated with ankylosing spondylitis in populations of European ancestry, and 2 associated loci have been identified in Asians. In this study, we used the Illumina Immunochip microarray to perform a case-control association study involving 10,619 individuals with ankylosing spondylitis (cases) and 15,145 controls. We identified 13 new risk loci and 12 additional ankylosing spondylitis-associated haplotypes at 11 loci. Two ankylosing spondylitis-associated regions have now been identified encoding four aminopeptidases that are involved in peptide processing before major histocompatibility complex (MHC) class I presentation. Protective variants at two of these loci are associated both with reduced aminopeptidase function and with MHC class I cell surface expression.

  19. Identification of multiple risk variants for ankylosing spondylitis through high-density genotyping of immune-related loci

    PubMed Central

    Cortes, Adrian; Hadler, Johanna; Pointon, Jenny P; Robinson, Philip C; Karaderi, Tugce; Leo, Paul; Cremin, Katie; Pryce, Karena; Harris, Jessica; lee, Seunghun; Joo, Kyung Bin; Shim, Seung-Cheol; Weisman, Michael; Ward, Michael; Zhou, Xiaodong; Garchon, Henri-Jean; Chiocchia, Gilles; Nossent, Johannes; Lie, Benedicte A; Førre, Øystein; Tuomilehto, Jaakko; Laiho, Kari; Jiang, Lei; Liu, Yu; Wu, Xin; Bradbury, Linda A; Elewaut, Dirk; Burgos-Vargas, Ruben; Stebbings, Simon; Appleton, Louise; Farrah, Claire; Lau, Jonathan; Kenna, Tony J; Haroon, Nigil; Ferreira, Manuel A; Yang, Jian; Mulero, Juan; Fernandez-Sueiro, Jose Luis; Gonzalez-Gay, Miguel A; lopez-Larrea, Carlos; Deloukas, Panos; Donnelly, Peter; Bowness, Paul; Gafney, Karl; Gaston, Hill; Gladman, Dafna D; Rahman, Proton; Maksymowych, Walter P; Xu, Huji; Crusius, J Bart A; van der Horst-Bruinsma, Irene E; Chou, Chung-Tei; Valle-Oñate, Raphael; Romero-Sánchez, Consuelo; Hansen, Inger Myrnes; Pimentel-Santos, Fernando M; Inman, Robert D; Videm, Vibeke; Martin, Javier; Breban, Maxime; Reveille, John D; Evans, David M; Kim, Tae-Hwan; Wordsworth, Bryan Paul; Brown, Matthew A


    Ankylosing spondylitis is a common, highly heritable inflammatory arthritis affecting primarily the spine and pelvis. In addition to HLA-B*27 alleles, 12 loci have previously been identified that are associated with ankylosing spondylitis in populations of European ancestry, and 2 associated loci have been identified in Asians. In this study, we used the Illumina Immunochip microarray to perform a case-control association study involving 10,619 individuals with ankylosing spondylitis (cases) and 15,145 controls. We identified 13 new risk loci and 12 additional ankylosing spondylitis–associated haplotypes at 11 loci. Two ankylosing spondylitis–associated regions have now been identified encoding four aminopeptidases that are involved in peptide processing before major histocompatibility complex (MHC) class I presentation. Protective variants at two of these loci are associated both with reduced aminopeptidase function and with MHC class I cell surface expression. PMID:23749187

  20. Multiple marker mapping of quantitative trait loci in a cross between outbred wild boar and large white pigs.

    PubMed Central

    Knott, S A; Marklund, L; Haley, C S; Andersson, K; Davies, W; Ellegren, H; Fredholm, M; Hansson, I; Hoyheim, B; Lundström, K; Moller, M; Andersson, L


    A quantitative trait locus (QTL) analysis of growth and fatness data from a three generation pig experiment is presented. The population of 199 F2 animals was derived from a cross between wild boar and Large White pigs. Animals were typed for 240 markers spanning 23 Morgans of 18 autosomes and the X chromosome. A series of analyses are presented within a least squares framework. First, these identify chromosomes containing loci controlling trait variation and subsequently attempt to map QTLs to locations within chromosomes. This population gives evidence for a large QTL affecting back fat and another for abdominal fat segregating on chromosome 4. The best locations for these QTLs are within 4 cM of each other and, hence, this is likely to be a single QTL affecting both traits. The allele inherited from the wild boar causes an increase in fat deposition. A QTL for intestinal length was also located in the same region on chromosome 4 and could be the same QTL with pleiotropic effects. Significant effects, owing to multiple QTLs, for intestinal length were identified on chromosomes 3 and 5. A single QTL affecting growth rate to 30 kg was located on chromosome 13 such that the Large White allele increased early growth rate, another QTL on chromosome 10 affected growth rate from 30 to 70 kg and another on chromosome 4 affected growth rate to 70 kg. PMID:9611214

  1. Susceptibility loci for lung cancer are associated with mRNA levels of nearby genes in the lung.


    Nguyen, Justin Dang Uy; Lamontagne, Maxime; Couture, Christian; Conti, Massimo; Paré, Peter D; Sin, Don D; Hogg, James C; Nickle, David; Postma, Dirkje S; Timens, Wim; Laviolette, Michel; Bossé, Yohan


    Recent studies identified three genetic loci reproducibly associated with lung cancer in populations of European ancestry, namely 15q25, 5p15 and 6p21. The goals of this study are first to confirm whether these loci are associated with lung cancer in a French Canadian population and second to identify disease-associated single nucleotide polymorphisms (SNPs) influencing messenger RNA (mRNA) expression levels of genes in the lung, that is expression quantitative trait loci (eQTLs). SNPs were genotyped in 420 patients undergoing lung cancer surgery and compared with 3151 controls of European ancestry. Genome-wide gene expression levels in non-tumor lung tissues of the same 420 patients were also measured to identify eQTLs. Significant eQTLs were then followed-up in two replication sets (n = 339 and 363). SNPs found in the three susceptibility loci were associated with lung cancer in the French Canadian population. Strong eQTLs were found on chromosome 15q25 with the expression levels of CHRNA5 (P = 2.23 × 10(-) (22) with rs12907966). The CHRNA5-rs12907966 eQTL was convincingly validated in the two replication sets (P = 3.46 × 10(-) (16) and 2.01 × 10(-) (15)). On 6p21, a trend was observed for rs3131379 to be associated with the expression of APOM (P = 3.58 × 10(-) (4)) and validated in the replication sets (P = 1.11 × 10(-) (8) and 6.84 × 10(-) (4)). On 5p15, no significant eQTLs were found. This study confirmed that chromosomes 15q25, 5p15 and 6p21 harbored susceptibility loci for lung cancer in French Canadians. Most importantly, this study suggests that the risk alleles at 15q25 and 6p21 may mediate their effect by regulating the mRNA expression levels of CHRNA5 and APOM in the lung.

  2. Susceptibility loci for lung cancer are associated with mRNA levels of nearby genes in the lung

    PubMed Central

    Nguyen, Justin Dang Uy; Lamontagne, Maxime; Couture, Christian; Conti, Massimo; Paré, Peter D.; Sin, Don D.; Hogg, James C.; Nickle, David; Postma, Dirkje S.; Timens, Wim; Laviolette, Michel; Bossé, Yohan


    Recent studies identified three genetic loci reproducibly associated with lung cancer in populations of European ancestry, namely 15q25, 5p15 and 6p21. The goals of this study are first to confirm whether these loci are associated with lung cancer in a French Canadian population and second to identify disease-associated single nucleotide polymorphisms (SNPs) influencing messenger RNA (mRNA) expression levels of genes in the lung, that is expression quantitative trait loci (eQTLs). SNPs were genotyped in 420 patients undergoing lung cancer surgery and compared with 3151 controls of European ancestry. Genome-wide gene expression levels in non-tumor lung tissues of the same 420 patients were also measured to identify eQTLs. Significant eQTLs were then followed-up in two replication sets (n = 339 and 363). SNPs found in the three susceptibility loci were associated with lung cancer in the French Canadian population. Strong eQTLs were found on chromosome 15q25 with the expression levels of CHRNA5 (P = 2.23 × 10− 22 with rs12907966). The CHRNA5-rs12907966 eQTL was convincingly validated in the two replication sets (P = 3.46 × 10− 16 and 2.01 × 10− 15). On 6p21, a trend was observed for rs3131379 to be associated with the expression of APOM (P = 3.58 × 10− 4) and validated in the replication sets (P = 1.11 × 10− 8 and 6.84 × 10− 4). On 5p15, no significant eQTLs were found. This study confirmed that chromosomes 15q25, 5p15 and 6p21 harbored susceptibility loci for lung cancer in French Canadians. Most importantly, this study suggests that the risk alleles at 15q25 and 6p21 may mediate their effect by regulating the mRNA expression levels of CHRNA5 and APOM in the lung. PMID:25187487

  3. Chromosomal localization of 5S rRNA gene loci and the implications for relationships within the Allium complex.


    Lee, S H; Do, G S; Seo, B B


    Chromosomal localizations and distribution patterns of the 5S rRNA genes by means of fluorescence in-situ hybridization in diploid Allium species could help to classify species into chromosome types and aid in determining relationships among genomes. All eleven diploid species were classified into five types, A to E. Species of type A showed a pair of 5S rRNA signals on the short arm of chromosome 5 and two pairs of signals on both arms of chromosome 7. Species of types B and C showed one pair and two pairs of signals on the short arm of chromosome 7, respectively. Type D species showed two pairs of signals on the satellite region of the short arm and a pair of signals on the long arm of chromosome 7. Type E species showed three distinct 5S rRNA gene loci signals on the short arm of chromosome 7. Information on chromosomal localization of 5S rRNA gene loci and distribution patterns within chromosomes in diploid Allium species could help to infer the pathway of origin of the three kinds of alloploid species. Data indicate that A. wakegi is an allopolyploid with genomes of types B and C, and A. deltoide-fistulosum is an allotetraploid derived from a natural hybridization between different species within chromosome type A. Results indicate that A. senescens is an allopolyploid with type B chromosomes and an unidentified chromosomal type. PMID:10328620

  4. Species-Level Phylogeny and Polyploid Relationships in Hordeum (Poaceae) Inferred by Next-Generation Sequencing and In Silico Cloning of Multiple Nuclear Loci

    PubMed Central

    Brassac, Jonathan; Blattner, Frank R.


    Polyploidization is an important speciation mechanism in the barley genus Hordeum. To analyze evolutionary changes after allopolyploidization, knowledge of parental relationships is essential. One chloroplast and 12 nuclear single-copy loci were amplified by polymerase chain reaction (PCR) in all Hordeum plus six out-group species. Amplicons from each of 96 individuals were pooled, sheared, labeled with individual-specific barcodes and sequenced in a single run on a 454 platform. Reference sequences were obtained by cloning and Sanger sequencing of all loci for nine supplementary individuals. The 454 reads were assembled into contigs representing the 13 loci and, for polyploids, also homoeologues. Phylogenetic analyses were conducted for all loci separately and for a concatenated data matrix of all loci. For diploid taxa, a Bayesian concordance analysis and a coalescent-based dated species tree was inferred from all gene trees. Chloroplast matK was used to determine the maternal parent in allopolyploid taxa. The relative performance of different multilocus analyses in the presence of incomplete lineage sorting and hybridization was also assessed. The resulting multilocus phylogeny reveals for the first time species phylogeny and progenitor-derivative relationships of all di- and polyploid Hordeum taxa within a single analysis. Our study proves that it is possible to obtain a multilocus species-level phylogeny for di- and polyploid taxa by combining PCR with next-generation sequencing, without cloning and without creating a heavy load of sequence data. PMID:26048340

  5. Genome-wide association study identifies multiple novel loci associated with disease progression in subjects with mild cognitive impairment.


    Hu, X; Pickering, E H; Hall, S K; Naik, S; Liu, Y C; Soares, H; Katz, E; Paciga, S A; Liu, W; Aisen, P S; Bales, K R; Samad, T A; John, S L


    Alzheimer's disease (AD) is the leading cause of dementia among the elderly population; however, knowledge about genetic risk factors involved in disease progression is limited. We conducted a genome-wide association study (GWAS) using clinical decline as measured by changes in the Clinical Dementia Rating-sum of boxes as a quantitative trait to test for single-nucleotide polymorphisms (SNPs) that were associated with the rate of progression in 822 Caucasian subjects of amnestic mild cognitive impairment (MCI). There was no significant association with disease progress for any of the recently identified disease susceptibility variants in CLU, CR1, PICALM, BIN1, EPHA1, MS4A6A, MS4A4E or CD33 following multiple testing correction. We did, however, identify multiple novel loci that reached genome-wide significance at the 0.01 level. These top variants (rs7840202 at chr8 in UBR5: P=4.27 × 10(-14); rs11637611 with a cluster of SNPs at chr15q23 close to the Tay-Sachs disease locus: P=1.07 × 10(-15); and rs12752888 at chr1: P=3.08 × 10(-11)) were also associated with a significant decline in cognition as well as the conversion of subjects with MCI to a diagnosis of AD. Taken together, these variants define approximately 16.6% of the MCI sub-population with a faster rate of decline independent of the other known disease risk factors. In addition to providing new insights into protein pathways that may be involved with the progress to AD in MCI subjects, these variants if further validated may enable the identification of a more homogeneous population of subjects at an earlier stage of disease for testing novel hypotheses and/or therapies in the clinical setting. PMID:22833209

  6. Multiple Quantitative Trait Loci Influence the Shape of a Male-Specific Genital Structure in Drosophila melanogaster

    PubMed Central

    McNeil, Casey L.; Bain, Clint L.; Macdonald, Stuart J.


    The observation that male genitalia diverge more rapidly than other morphological traits during evolution is taxonomically widespread and likely due to some form of sexual selection. One way to elucidate the evolutionary forces acting on these traits is to detail the genetic architecture of variation both within and between species, a program of research that is considerably more tractable in a model system. Drosophila melanogaster and its sibling species, D. simulans, D. mauritiana, and D. sechellia, are morphologically distinguishable only by the shape of the posterior lobe, a male-specific elaboration of the genital arch. We extend earlier studies identifying quantitative trait loci (QTL) responsible for lobe divergence across species and report the first genetic dissection of lobe shape variation within a species. Using an advanced intercross mapping design, we identify three autosomal QTL contributing to the difference in lobe shape between a pair of D. melanogaster inbred lines. The QTL each contribute 4.6–10.7% to shape variation, and two show a significant epistatic interaction. Interestingly, these intraspecific QTL map to the same locations as interspecific lobe QTL, implying some shared genetic control of the trait within and between species. As a first step toward a mechanistic understanding of natural lobe shape variation, we find an association between our QTL data and a set of genes that show sex-biased expression in the developing genital imaginal disc (the precursor of the adult genitalia). These genes are good candidates to harbor naturally segregating polymorphisms contributing to posterior lobe shape. PMID:22384345

  7. Identifying Candidate Genes for Type 2 Diabetes Mellitus and Obesity through Gene Expression Profiling in Multiple Tissues or Cells

    PubMed Central

    Meng, Yuhuan; Zhou, Jinghui; Zhuo, Min; Ling, Fei; Zhang, Yu; Du, Hongli; Wang, Xiaoning


    Type 2 Diabetes Mellitus (T2DM) and obesity have become increasingly prevalent in recent years. Recent studies have focused on identifying causal variations or candidate genes for obesity and T2DM via analysis of expression quantitative trait loci (eQTL) within a single tissue. T2DM and obesity are affected by comprehensive sets of genes in multiple tissues. In the current study, gene expression levels in multiple human tissues from GEO datasets were analyzed, and 21 candidate genes displaying high percentages of differential expression were filtered out. Specifically, DENND1B, LYN, MRPL30, POC1B, PRKCB, RP4-655J12.3, HIBADH, and TMBIM4 were identified from the T2DM-control study, and BCAT1, BMP2K, CSRNP2, MYNN, NCKAP5L, SAP30BP, SLC35B4, SP1, BAP1, GRB14, HSP90AB1, ITGA5, and TOMM5 were identified from the obesity-control study. The majority of these genes are known to be involved in T2DM and obesity. Therefore, analysis of gene expression in various tissues using GEO datasets may be an effective and feasible method to determine novel or causal genes associated with T2DM and obesity. PMID:24455749

  8. Identifying candidate genes for Type 2 Diabetes Mellitus and obesity through gene expression profiling in multiple tissues or cells.


    Chen, Junhui; Meng, Yuhuan; Zhou, Jinghui; Zhuo, Min; Ling, Fei; Zhang, Yu; Du, Hongli; Wang, Xiaoning


    Type 2 Diabetes Mellitus (T2DM) and obesity have become increasingly prevalent in recent years. Recent studies have focused on identifying causal variations or candidate genes for obesity and T2DM via analysis of expression quantitative trait loci (eQTL) within a single tissue. T2DM and obesity are affected by comprehensive sets of genes in multiple tissues. In the current study, gene expression levels in multiple human tissues from GEO datasets were analyzed, and 21 candidate genes displaying high percentages of differential expression were filtered out. Specifically, DENND1B, LYN, MRPL30, POC1B, PRKCB, RP4-655J12.3, HIBADH, and TMBIM4 were identified from the T2DM-control study, and BCAT1, BMP2K, CSRNP2, MYNN, NCKAP5L, SAP30BP, SLC35B4, SP1, BAP1, GRB14, HSP90AB1, ITGA5, and TOMM5 were identified from the obesity-control study. The majority of these genes are known to be involved in T2DM and obesity. Therefore, analysis of gene expression in various tissues using GEO datasets may be an effective and feasible method to determine novel or causal genes associated with T2DM and obesity.

  9. Multiple common variants for celiac disease influencing immune gene expression

    PubMed Central

    Dubois, Patrick CA; Trynka, Gosia; Franke, Lude; Hunt, Karen A; Romanos, Jihane; Curtotti, Alessandra; Zhernakova, Alexandra; Heap, Graham AR; Ádány, Róza; Aromaa, Arpo; Bardella, Maria Teresa; van den Berg, Leonard H; Bockett, Nicholas A; de la Concha, Emilio G.; Dema, Bárbara; Fehrmann, Rudolf SN; Fernández-Arquero, Miguel; Fiatal, Szilvia; Grandone, Elvira; Green, Peter M; Groen, Harry JM; Gwilliam, Rhian; Houwen, Roderick HJ; Hunt, Sarah E; Kaukinen, Katri; Kelleher, Dermot; Korponay-Szabo, Ilma; Kurppa, Kalle; MacMathuna, Padraic; Mäki, Markku; Mazzilli, Maria Cristina; McCann, Owen T; Mearin, M Luisa; Mein, Charles A; Mirza, Muddassar M; Mistry, Vanisha; Mora, Barbara; Morley, Katherine I; Mulder, Chris J; Murray, Joseph A; Núñez, Concepción; Oosterom, Elvira; Ophoff, Roel A; Polanco, Isabel; Peltonen, Leena; Platteel, Mathieu; Rybak, Anna; Salomaa, Veikko; Schweizer, Joachim J; Sperandeo, Maria Pia; Tack, Greetje J; Turner, Graham; Veldink, Jan H; Verbeek, Wieke HM; Weersma, Rinse K; Wolters, Victorien M; Urcelay, Elena; Cukrowska, Bozena; Greco, Luigi; Neuhausen, Susan L.; McManus, Ross; Barisani, Donatella; Deloukas, Panos; Barrett, Jeffrey C; Saavalainen, Paivi; Wijmenga, Cisca; van Heel, David A


    We performed a second-generation genome wide association study of 4,533 celiac disease cases and 10,750 controls. We genotyped 113 selected SNPs with PGWAS<10−4, and 18 SNPs from 14 known loci, in a further 4,918 cases and 5,684 controls. Variants from 13 new regions reached genome wide significance (Pcombined<5×10−8), most contain immune function genes (BACH2, CCR4, CD80, CIITA/SOCS1/CLEC16A, ICOSLG, ZMIZ1) with ETS1, RUNX3, THEMIS and TNFRSF14 playing key roles in thymic T cell selection. A further 13 regions had suggestive association evidence. In an expression quantitative trait meta-analysis of 1,469 whole blood samples, 20 of 38 (52.6%) tested loci had celiac risk variants correlated (P<0.0028, FDR 5%) with cis gene expression. PMID:20190752

  10. Integrative Transcriptome, Genome and Quantitative Trait Loci Resources Identify Single Nucleotide Polymorphisms in Candidate Genes for Growth Traits in Turbot.


    Robledo, Diego; Fernández, Carlos; Hermida, Miguel; Sciara, Andrés; Álvarez-Dios, José Antonio; Cabaleiro, Santiago; Caamaño, Rubén; Martínez, Paulino; Bouza, Carmen


    Growth traits represent a main goal in aquaculture breeding programs and may be related to adaptive variation in wild fisheries. Integrating quantitative trait loci (QTL) mapping and next generation sequencing can greatly help to identify variation in candidate genes, which can result in marker-assisted selection and better genetic structure information. Turbot is a commercially important flatfish in Europe and China, with available genomic information on QTLs and genome mapping. Muscle and liver RNA-seq from 18 individuals was carried out to obtain gene sequences and markers functionally related to growth, resulting in a total of 20,447 genes and 85,344 single nucleotide polymorphisms (SNPs). Many growth-related genes and SNPs were identified and placed in the turbot genome and genetic map to explore their co-localization with growth-QTL markers. Forty-five SNPs on growth-related genes were selected based on QTL co-localization and relevant function for growth traits. Forty-three SNPs were technically feasible and validated in a wild Atlantic population, where 91% were polymorphic. The integration of functional and structural genomic resources in turbot provides a practical approach for QTL mining in this species. Validated SNPs represent a useful set of growth-related gene markers for future association, functional and population studies in this flatfish species. PMID:26901189

  11. Integrative Transcriptome, Genome and Quantitative Trait Loci Resources Identify Single Nucleotide Polymorphisms in Candidate Genes for Growth Traits in Turbot

    PubMed Central

    Robledo, Diego; Fernández, Carlos; Hermida, Miguel; Sciara, Andrés; Álvarez-Dios, José Antonio; Cabaleiro, Santiago; Caamaño, Rubén; Martínez, Paulino; Bouza, Carmen


    Growth traits represent a main goal in aquaculture breeding programs and may be related to adaptive variation in wild fisheries. Integrating quantitative trait loci (QTL) mapping and next generation sequencing can greatly help to identify variation in candidate genes, which can result in marker-assisted selection and better genetic structure information. Turbot is a commercially important flatfish in Europe and China, with available genomic information on QTLs and genome mapping. Muscle and liver RNA-seq from 18 individuals was carried out to obtain gene sequences and markers functionally related to growth, resulting in a total of 20,447 genes and 85,344 single nucleotide polymorphisms (SNPs). Many growth-related genes and SNPs were identified and placed in the turbot genome and genetic map to explore their co-localization with growth-QTL markers. Forty-five SNPs on growth-related genes were selected based on QTL co-localization and relevant function for growth traits. Forty-three SNPs were technically feasible and validated in a wild Atlantic population, where 91% were polymorphic. The integration of functional and structural genomic resources in turbot provides a practical approach for QTL mining in this species. Validated SNPs represent a useful set of growth-related gene markers for future association, functional and population studies in this flatfish species. PMID:26901189

  12. Segmentation of genomic and transcriptomic microarrays data reveals major correlation between DNA copy number aberrations and gene-loci expression.


    Ortiz-Estevez, M; De Las Rivas, J; Fontanillo, C; Rubio, A


    DNA copy number aberrations (CNAs) are genetic alterations common in cancer cells. Their transcriptional consequences are still poorly understood. Based on the fact that DNA copy number (CN) is highly correlated with the genomic position, we have applied a segmentation algorithm to gene expression (GE) to explore its relation with CN. We have found a strong correlation between segmented CN (sCN) and segmented GE (sGE), corroborating that CNAs have clear effects on genome-wide expression. We have found out that most of the recurrent regions of sGE are common to those obtained from sCN analysis. Results for two cancer datasets confirm the known targets of aberrations and provide new candidates to study. The suggested methodology allows to find recurrent aberrations specific to sGE, revealing loci where the expression of the genes is independent from their CNs. R code and additional files are available as supplementary material. PMID:21044881

  13. Perspectives on the Use of Multiple Sclerosis Risk Genes for Prediction

    PubMed Central

    van Duijn, Cornelia M.; Janssens, A. Cecile J. W.; Hintzen, Rogier Q.


    Objective A recent collaborative genome-wide association study replicated a large number of susceptibility loci and identified novel loci. This increase in known multiple sclerosis (MS) risk genes raises questions about clinical applicability of genotyping. In an empirical set we assessed the predictive power of typing multiple genes. Next, in a modelling study we explored current and potential predictive performance of genetic MS risk models. Materials and Methods Genotype data on 6 MS risk genes in 591 MS patients and 600 controls were used to investigate the predictive value of combining risk alleles. Next, the replicated and novel MS risk loci from the recent and largest international genome-wide association study were used to construct genetic risk models simulating a population of 100,000 individuals. Finally, we assessed the required numbers, frequencies, and ORs of risk SNPs for higher discriminative accuracy in the future. Results Individuals with 10 to 12 risk alleles had a significantly increased risk compared to individuals with the average population risk for developing MS (OR 2.76 (95% CI 2.02–3.77)). In the simulation study we showed that the area under the receiver operating characteristic curve (AUC) for a risk score based on the 6 SNPs was 0.64. The AUC increases to 0.66 using the well replicated 24 SNPs and to 0.69 when including all replicated and novel SNPs (n = 53) in the risk model. An additional 20 SNPs with allele frequency 0.30 and ORs 1.1 would be needed to increase the AUC to a slightly higher level of 0.70, and at least 50 novel variants with allele frequency 0.30 and ORs 1.4 would be needed to obtain an AUC of 0.85. Conclusion Although new MS risk SNPs emerge rapidly, the discriminatory ability in a clinical setting will be limited. PMID:22164203

  14. On the organization of human T-cell receptor loci: log-periodic distribution of T-cell receptor gene segments

    PubMed Central

    Toor, Amir A.; Toor, Abdullah A.; Rahmani, Mohamed; Manjili, Masoud H.


    The human T-cell repertoire is complex and is generated by the rearrangement of variable (V), diversity (D) and joining (J) segments on the T-cell receptor (TCR) loci. The T-cell repertoire demonstrates self-similarity in terms clonal frequencies when defined by V, D and J gene segment usage; therefore to determine whether the structural ordering of these gene segments on the TCR loci contributes to the observed clonal frequencies, the TCR loci were examined for self-similarity and periodicity in terms of gene segment organization. Logarithmic transformation of numeric sequence order demonstrated that the V and J gene segments for both T-cell receptor α (TRA) and β (TRB) loci are arranged in a self-similar manner when the spacing between the adjacent segments was considered as a function of the size of the neighbouring gene segment, with an average fractal dimension of approximately 1.5. Accounting for the gene segments occurring on helical DNA molecules with a logarithmic distribution, sine and cosine functions of the log-transformed angular coordinates of the start and stop nucleotides of successive TCR gene segments showed an ordered progression from the 5′ to the 3′ end of the locus, supporting a log-periodic organization. T-cell clonal frequency estimates, based on V and J segment usage, from normal stem cell donors were plotted against the V and J segment on TRB locus and demonstrated a periodic distribution. We hypothesize that this quasi-periodic variation in gene-segment representation in the T-cell clonal repertoire may be influenced by the location of the gene segments on the periodic-logarithmically scaled TCR loci. Interactions between the two strands of DNA in the double helix may influence the probability of gene segment usage by means of either constructive or destructive interference resulting from the superposition of the two helices. PMID:26763333

  15. Highly efficient CRISPR/Cas9-mediated TAR cloning of genes and chromosomal loci from complex genomes in yeast.


    Lee, Nicholas C O; Larionov, Vladimir; Kouprina, Natalay


    Transformation-associated recombination (TAR) protocol allowing the selective isolation of full-length genes complete with their distal enhancer regions and entire genomic loci with sizes up to 250 kb from complex genomes in yeast S. cerevisiae has been developed more than a decade ago. However, its wide spread usage has been impeded by a low efficiency (0.5-2%) of chromosomal region capture during yeast transformants which in turn requires a time-consuming screen of hundreds of colonies. Here, we demonstrate that pre-treatment of genomic DNA with CRISPR-Cas9 nucleases to generate double-strand breaks near the targeted genomic region results in a dramatic increase in the fraction of gene-positive colonies (up to 32%). As only a dozen or less yeast transformants need to be screened to obtain a clone with the desired chromosomal region, extensive experience with yeast is no longer required. A TAR-CRISPR protocol may help to create a bank of human genes, each represented by a genomic copy containing its native regulatory elements, that would lead to a significant advance in functional, structural and comparative genomics, in diagnostics, gene replacement, generation of animal models for human diseases and has a potential for gene therapy.

  16. Isolation and manipulation of quantitative trait loci for disease resistance in rice using a candidate gene approach.


    Hu, Ke-Ming; Qiu, De-Yun; Shen, Xiang-Ling; Li, Xiang-Hua; Wang, Shi-Ping


    Bacterial blight caused by Xanthomonas oryzae pv. oryzae and fungal blast caused by Magnaporthe grisea result in heavy production losses in rice, a main staple food for approximately 50% of the world's population. Application of host resistance to these pathogens is the most economical and environment-friendly approach to solve this problem. Quantitative trait loci (QTLs) controlling quantitative resistance are valuable sources for broad-spectrum and durable disease resistance. Although large numbers of QTLs for bacterial blight and blast resistance have been identified, these sources have not been used effectively in rice improvement because of the complex genetic control of quantitative resistance and because the genes underlying resistance QTLs are unknown. To isolate disease resistance QTLs, we established a candidate gene strategy that integrates linkage map, expression profile, and functional complementation analyses. This strategy has proven to be applicable for identifying the genes underlying minor resistance QTLs in rice-Xoo and rice-M. grisea systems and it may also help to shed light on disease resistance QTLs of other cereals. Our results also suggest that a single minor QTL can be used in rice improvement by modulating the expression of the gene underlying the QTL. Pyramiding two or three minor QTL genes, whose expression can be managed and that function in different defense signal transduction pathways, may allow the breeding of rice cultivars that are highly resistant to bacterial blight and blast.

  17. Phenotypes Associated with Knockouts of Eight Dense Granule Gene Loci (GRA2-9) in Virulent Toxoplasma gondii.


    Rommereim, Leah M; Bellini, Valeria; Fox, Barbara A; Pètre, Graciane; Rak, Camille; Touquet, Bastien; Aldebert, Delphine; Dubremetz, Jean-François; Cesbron-Delauw, Marie-France; Mercier, Corinne; Bzik, David J


    Toxoplasma gondii actively invades host cells and establishes a parasitophorous vacuole (PV) that accumulates many proteins secreted by the dense granules (GRA proteins). To date, at least 23 GRA proteins have been reported, though the function(s) of most of these proteins still remains unknown. We targeted gene knockouts at ten GRA gene loci (GRA1-10) to investigate the cellular roles and essentiality of these classical GRA proteins during acute infection in the virulent type I RH strain. While eight of these genes (GRA2-9) were successfully knocked out, targeted knockouts at the GRA1 and GRA10 loci were not obtained, suggesting these GRA proteins may be essential. As expected, the Δgra2 and Δgra6 knockouts failed to form an intravacuolar network (IVN). Surprisingly, Δgra7 exhibited hyper-formation of the IVN in both normal and lipid-free growth conditions. No morphological alterations were identified in parasite or PV structures in the Δgra3, Δgra4, Δgra5, Δgra8, or Δgra9 knockouts. With the exception of the Δgra3 and Δgra8 knockouts, all of the GRA knockouts exhibited defects in their infection rate in vitro. While the single GRA knockouts did not exhibit reduced replication rates in vitro, replication rate defects were observed in three double GRA knockout strains (Δgra4Δgra6, Δgra3Δgra5 and Δgra3Δgra7). However, the virulence of single or double GRA knockout strains in CD1 mice was not affected. Collectively, our results suggest that while the eight individual GRA proteins investigated in this study (GRA2-9) are not essential, several GRA proteins may provide redundant and potentially important functions during acute infection. PMID:27458822

  18. Phenotypes Associated with Knockouts of Eight Dense Granule Gene Loci (GRA2-9) in Virulent Toxoplasma gondii

    PubMed Central

    Fox, Barbara A.; Pètre, Graciane; Rak, Camille; Touquet, Bastien; Aldebert, Delphine; Dubremetz, Jean-François; Cesbron-Delauw, Marie-France; Mercier, Corinne; Bzik, David J.


    Toxoplasma gondii actively invades host cells and establishes a parasitophorous vacuole (PV) that accumulates many proteins secreted by the dense granules (GRA proteins). To date, at least 23 GRA proteins have been reported, though the function(s) of most of these proteins still remains unknown. We targeted gene knockouts at ten GRA gene loci (GRA1-10) to investigate the cellular roles and essentiality of these classical GRA proteins during acute infection in the virulent type I RH strain. While eight of these genes (GRA2-9) were successfully knocked out, targeted knockouts at the GRA1 and GRA10 loci were not obtained, suggesting these GRA proteins may be essential. As expected, the Δgra2 and Δgra6 knockouts failed to form an intravacuolar network (IVN). Surprisingly, Δgra7 exhibited hyper-formation of the IVN in both normal and lipid-free growth conditions. No morphological alterations were identified in parasite or PV structures in the Δgra3, Δgra4, Δgra5, Δgra8, or Δgra9 knockouts. With the exception of the Δgra3 and Δgra8 knockouts, all of the GRA knockouts exhibited defects in their infection rate in vitro. While the single GRA knockouts did not exhibit reduced replication rates in vitro, replication rate defects were observed in three double GRA knockout strains (Δgra4Δgra6, Δgra3Δgra5 and Δgra3Δgra7). However, the virulence of single or double GRA knockout strains in CD1 mice was not affected. Collectively, our results suggest that while the eight individual GRA proteins investigated in this study (GRA2-9) are not essential, several GRA proteins may provide redundant and potentially important functions during acute infection. PMID:27458822

  19. Fine mapping of type 1 diabetes susceptibility loci and evidence for colocalization of causal variants with lymphoid gene enhancers.


    Onengut-Gumuscu, Suna; Chen, Wei-Min; Burren, Oliver; Cooper, Nick J; Quinlan, Aaron R; Mychaleckyj, Josyf C; Farber, Emily; Bonnie, Jessica K; Szpak, Michal; Schofield, Ellen; Achuthan, Premanand; Guo, Hui; Fortune, Mary D; Stevens, Helen; Walker, Neil M; Ward, Lucas D; Kundaje, Anshul; Kellis, Manolis; Daly, Mark J; Barrett, Jeffrey C; Cooper, Jason D; Deloukas, Panos; Todd, John A; Wallace, Chris; Concannon, Patrick; Rich, Stephen S


    Genetic studies of type 1 diabetes (T1D) have identified 50 susceptibility regions, finding major pathways contributing to risk, with some loci shared across immune disorders. To make genetic comparisons across autoimmune disorders as informative as possible, a dense genotyping array, the Immunochip, was developed, from which we identified four new T1D-associated regions (P < 5 × 10(-8)). A comparative analysis with 15 immune diseases showed that T1D is more similar genetically to other autoantibody-positive diseases, significantly most similar to juvenile idiopathic arthritis and significantly least similar to ulcerative colitis, and provided support for three additional new T1D risk loci. Using a Bayesian approach, we defined credible sets for the T1D-associated SNPs. The associated SNPs localized to enhancer sequences active in thymus, T and B cells, and CD34(+) stem cells. Enhancer-promoter interactions can now be analyzed in these cell types to identify which particular genes and regulatory sequences are causal. PMID:25751624

  20. Fine-mapping identifies multiple prostate cancer risk loci at 5p15, one of which associates with TERT expression

    PubMed Central

    Kote-Jarai, Zsofia; Saunders, Edward J.; Leongamornlert, Daniel A.; Tymrakiewicz, Malgorzata; Dadaev, Tokhir; Jugurnauth-Little, Sarah; Ross-Adams, Helen; Al Olama, Ali Amin; Benlloch, Sara; Halim, Silvia; Russel, Roslin; Dunning, Alison M.; Luccarini, Craig; Dennis, Joe; Neal, David E.; Hamdy, Freddie C.; Donovan, Jenny L.; Muir, Ken; Giles, Graham G.; Severi, Gianluca; Wiklund, Fredrik; Gronberg, Henrik; Haiman, Christopher A.; Schumacher, Fredrick; Henderson, Brian E.; Le Marchand, Loic; Lindstrom, Sara; Kraft, Peter; Hunter, David J.; Gapstur, Susan; Chanock, Stephen; Berndt, Sonja I.; Albanes, Demetrius; Andriole, Gerald; Schleutker, Johanna; Weischer, Maren; Canzian, Federico; Riboli, Elio; Key, Tim J.; Travis, Ruth C.; Campa, Daniele; Ingles, Sue A.; John, Esther M.; Hayes, Richard B.; Pharoah, Paul; Khaw, Kay-Tee; Stanford, Janet L.; Ostrander, Elaine A.; Signorello, Lisa B.; Thibodeau, Stephen N.; Schaid, Dan; Maier, Christiane; Vogel, Walther; Kibel, Adam S.; Cybulski, Cezary; Lubinski, Jan; Cannon-Albright, Lisa; Brenner, Hermann; Park, Jong Y.; Kaneva, Radka; Batra, Jyotsna; Spurdle, Amanda; Clements, Judith A.; Teixeira, Manuel R.; Govindasami, Koveela; Guy, Michelle; Wilkinson, Rosemary A.; Sawyer, Emma J.; Morgan, Angela; Dicks, Ed; Baynes, Caroline; Conroy, Don; Bojesen, Stig E.; Kaaks, Rudolf; Vincent, Daniel; Bacot, François; Tessier, Daniel C.; Easton, Douglas F.; Eeles, Rosalind A.


    Associations between single nucleotide polymorphisms (SNPs) at 5p15 and multiple cancer types have been reported. We have previously shown evidence for a strong association between prostate cancer (PrCa) risk and rs2242652 at 5p15, intronic in the telomerase reverse transcriptase (TERT) gene that encodes TERT. To comprehensively evaluate the association between genetic variation across this region and PrCa, we performed a fine-mapping analysis by genotyping 134 SNPs using a custom Illumina iSelect array or Sequenom MassArray iPlex, followed by imputation of 1094 SNPs in 22 301 PrCa cases and 22 320 controls in The PRACTICAL consortium. Multiple stepwise logistic regression analysis identified four signals in the promoter or intronic regions of TERT that independently associated with PrCa risk. Gene expression analysis of normal prostate tissue showed evidence that SNPs within one of these regions also associated with TERT expression, providing a potential mechanism for predisposition to disease. PMID:23535824

  1. Identification of 11 pseudogenes in the DNA methyltransferase gene family in rodents and humans and implications for the functional loci.


    Lees-Murdock, Diane J; McLoughlin, Gerard A; McDaid, Jennifer R; Quinn, Lisa M; O'Doherty, Alan; Hiripi, László; Hack, Catherine J; Walsh, Colum P


    DNA (cytosine-5-)-methyltransferase genes are important for normal development in mice and humans. We describe here 11 pseudogenes spread among human, mouse, and rat belonging to this gene family, ranging from 1 pseudogene in humans to 7 in rat, all belonging to the Dnmt3 subfamily. All except 1 rat Dnmt3b pseudogene appear to be transcriptionally silent. Dnmt3a2, a transcript variant of Dnmt3a starting at an alternative promoter, had the highest number of processed pseudogenes, while none were found for the canonical Dnmt3a, suggesting the former transcript is more highly expressed in germ cells. Comparison of human, mouse, and rat Dnmt3a2 sequences also suggests that human exon 8 is a recent acquisition. Alignment of the 3'UTR of Dnmt3a2 among the functional genes and the processed pseudogenes suggested that a second polyadenylation site downstream of the RefSeq poly(A) was being used in mice, resulting in a longer 3'UTR, a finding confirmed by RT-PCR in mouse tissues. We also found conserved cytoplasmic polyadenylation elements, usually implicated in regulating translation in oocytes, in Dnmt3b and Dnmt1. Expression of DNMT3B in the mouse oocyte was confirmed by immunocytochemistry. These results clarify the structure of a number of loci in the three species examined and provide some useful insights into the structure and evolution of this gene family.

  2. Environmental and seasonal influences on red raspberry flavour volatiles and identification of quantitative trait loci (QTL) and candidate genes.


    Paterson, Alistair; Kassim, Angzzas; McCallum, Susan; Woodhead, Mary; Smith, Kay; Zait, Dzeti; Graham, Julie


    Raspberry volatiles are important for perceptions of sensory quality, mould resistance and some have nutraceutical activities. Twelve raspberry character volatiles were quantified, 11 of them in fruit from two seasons, from plants from the Glen Moy × Latham mapping population growing in both open field and under cover (polytunnels). Effects of season and environment were examined for their impact on the content of α-ionone, α-ionol, β-ionone, β-damascenone, linalool, geraniol, benzyl alcohol, (Z)-3-hexenol, acetoin, acetic and hexanoic acids, whilst raspberry ketone was measured in one season. A significant variation was observed in fruit volatiles in all progeny between seasons and method of cultivation. Quantitative trait loci were determined and mapped to six of the seven linkage groups, as were candidate genes in the volatiles pathways.

  3. Linkage disequilibrium between the juvenile neuronal ceroid lipofuscinosis gene and marker loci on chromosome 16p12. 1

    SciTech Connect

    Lerner, T.J.; MacCormack, K.; Gleitsman, J.; Schlumpf, K.; Breakefield, X.O.; Gusella, J.F.; Haines, J.L. )


    The neuronal ceroid lipofuscinoses (NCL; Batten disease) are a collection of autosomal recessive disorders characterized by the accumulation of autofluorescent lipopigments in the neurons and other cell types. Clinically, these disorders are characterized by progressive encephalopathy, loss of vision, and seizures. CLN3, the gene responsible for juvenile NCL, has been mapped to a 15-cM region flanked by the marker loci D16S148 and D16S150 on human chromosome 16. CLN2, the gene causing the late-infantile form of NCL (LNCL), is not yet mapped. The authors have used highly informative dinucleoide repeat markers mapping between D16S148 and D16S150 to refine the localization of CLN3 and to test for linkage to CLN2. The authors find significant linkage disequilibrium between CLN3 and the dinucleotide repeat marker loci D16S288 (X[sup 2](7) = 46.5, P < .005), D16S298 (X[sup 2](6) = 36.6, P < .005), and D16S299 (X[sup 2](7) = 73.8, P < .005), and also a novel RFLP marker at the D16S272 locus (X[sup 2](1) = 5.7, P = .02). These markers all map to 16p12.1. The D16S298/D16S299 haplotype [open quotes]5/4[close quotes] is highly overrepresented, accounting for 54% of CLN3 chromosomes as compared with 8% of control chromosomes (X[sup 2] = 117, df = 1, P < .001). Examination of the haplotypes suggests that the CLN3 locus can be narrowed to the region immediately surrounding these markers in 16p12.1. Analysis of D16S299 in LNCL pedigrees supports the previous finding that CLN3 and CLN2 are different genetic loci. This study also indicates that dinucleotide repeat markers play a valuable role in disequilibrium studies. 23 refs., 1 fig., 4 tabs.

  4. Clock genes localize to quantitative trait loci for stage-specific growth in juvenile coho salmon, Oncorhynchus kisutch.


    O'Malley, Kathleen G; McClelland, Erin K; Naish, Kerry A


    In most organisms, an internal circadian clock coordinates the expression of biological rhythms and enables individuals to anticipate and respond to the seasonally changing environment. There is remarkable conservation of function in the molecular machinery underlying this circadian clock across taxa with 4 canonical proteins interacting to form an autoregulatory feedback loop: CLOCK, CRYPTOCHROME, PERIOD, and BMAL. We mapped duplicated copies of Clock and Cryptochrome in coho salmon (Oncorhynchus kisutch) to determine if these genes localize to quantitative trait loci (QTL) for hatch timing, weight, length, and growth rate measured throughout the juvenile life-history stage. We found that Cryptochrome2b mapped to a QTL region for growth (measured at 304 days post-hatching) on linkage group OKI06. The percentage of variation (PEV) explained by this QTL was 15.2%. Cryptochrome2b was also associated with a marginally nonsignificant QTL for length (measured at 395 days post-hatching). OtsClock1b mapped to a QTL region for growth rate (PEV 10.1%) and length (PEV 10.5%) on linkage group OKI24 (measured at 479 days posthatching). Neither gene localized to QTL for hatch timing or weight. Our findings indicate that the growth rate and length QTL associated with OtsClock1b and Cryptochrome2b are development stage-specific and may result from temporally differentiated gene expression patterns.

  5. First insights into the giant panda (Ailuropoda melanoleuca) blood transcriptome: a resource for novel gene loci and immunogenetics.


    Du, Lianming; Li, Wujiao; Fan, Zhenxin; Shen, Fujun; Yang, Mingyu; Wang, Zili; Jian, Zuoyi; Hou, Rong; Yue, Bisong; Zhang, Xiuyue


    The giant panda (Ailuropoda melanoleuca) is one of the most famous flagship species for conservation, and its draft genome has recently been assembled. However, the transcriptome is not yet available. In this study, the blood transcriptomes of three pandas were characterized and about 160 million sequencing reads were generated using Illumina HiSeq 2000 paired-end sequencing technology. The assembly yielded 92 598 transcripts with an average length of 1626 bp and N50 length of 2842 bp. Based on a sequence similarity search against nonredundant (nr) protein database, a total of 38 522 (41.6%) transcripts were annotated. Of these annotated transcripts, 25 142 and 8272 transcripts were assigned to gene ontology terms and clusters of orthologous group, respectively. A search against the Kyoto Encyclopedia of Genes and Genomes Pathway database (KEGG) indicated that 9098 (9.83%) transcripts mapped to 324 KEGG pathways, and the best represented functional categories of pathways were signal transduction and immune system. We have also identified 23 460 microsatellites, 43 560 SNPs as well as 21 456 alternative splicing events in the assembly. Additionally, a total of 24 341 complete open reading frames (ORFs) were detected from the assembly where 1492 ORFs were found to be novel gene loci as these have not been annotated so far in any public database.

  6. First insights into the giant panda (Ailuropoda melanoleuca) blood transcriptome: a resource for novel gene loci and immunogenetics.


    Du, Lianming; Li, Wujiao; Fan, Zhenxin; Shen, Fujun; Yang, Mingyu; Wang, Zili; Jian, Zuoyi; Hou, Rong; Yue, Bisong; Zhang, Xiuyue


    The giant panda (Ailuropoda melanoleuca) is one of the most famous flagship species for conservation, and its draft genome has recently been assembled. However, the transcriptome is not yet available. In this study, the blood transcriptomes of three pandas were characterized and about 160 million sequencing reads were generated using Illumina HiSeq 2000 paired-end sequencing technology. The assembly yielded 92 598 transcripts with an average length of 1626 bp and N50 length of 2842 bp. Based on a sequence similarity search against nonredundant (nr) protein database, a total of 38 522 (41.6%) transcripts were annotated. Of these annotated transcripts, 25 142 and 8272 transcripts were assigned to gene ontology terms and clusters of orthologous group, respectively. A search against the Kyoto Encyclopedia of Genes and Genomes Pathway database (KEGG) indicated that 9098 (9.83%) transcripts mapped to 324 KEGG pathways, and the best represented functional categories of pathways were signal transduction and immune system. We have also identified 23 460 microsatellites, 43 560 SNPs as well as 21 456 alternative splicing events in the assembly. Additionally, a total of 24 341 complete open reading frames (ORFs) were detected from the assembly where 1492 ORFs were found to be novel gene loci as these have not been annotated so far in any public database. PMID:25556892

  7. Copy number variation and microdeletions of the Y chromosome linked genes and loci across different categories of Indian infertile males

    PubMed Central

    Kumari, Anju; Yadav, Sandeep Kumar; Misro, Man Mohan; Ahmad, Jamal; Ali, Sher


    We analyzed 34 azoospermic (AZ), 43 oligospermic (OS), and 40 infertile males with normal spermiogram (INS) together with 55 normal fertile males (NFM) from the Indian population. AZ showed more microdeletions in the AZFa and AZFb regions whereas oligospermic ones showed more microdeletions in the AZFc region. Frequency of the AZF partial deletions was higher in males with spermatogenic impairments than in INS. Significantly, SRY, DAZ and BPY2 genes showed copy number variation across different categories of the patients and much reduced copies of the DYZ1 repeat arrays compared to that in normal fertile males. Likewise, INS showed microdeletions, sequence and copy number variation of several Y linked genes and loci. In the context of infertility, STS deletions and copy number variations both were statistically significant (p = 0.001). Thus, semen samples used during in vitro fertilization (IVF) and assisted reproductive technology (ART) must be assessed for the microdeletions of AZFa, b and c regions in addition to the affected genes reported herein. Present study is envisaged to be useful for DNA based diagnosis of different categories of the infertile males lending support to genetic counseling to the couples aspiring to avail assisted reproductive technologies. PMID:26638807

  8. Gene-centric meta-analyses for central adiposity traits in up to 57 412 individuals of European descent confirm known loci and reveal several novel associations

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Waist circumference (WC) and waist-to-hip ratio (WHR) are surrogate measures of central adiposity that are associated with adverse cardiovascular events, type 2 diabetes and cancer independent of body mass index (BMI). WC and WHR are highly heritable with multiple susceptibility loci identified to d...

  9. Identification of differently expressed genes with specific SNP Loci for breast cancer by the integration of SNP and gene expression profiling analyses.


    Yuan, Pengfei; Liu, Dechun; Deng, Miao; Liu, Jiangbo; Wang, Jianguang; Zhang, Like; Liu, Qipeng; Zhang, Ting; Chen, Yanbin; Jin, Gaoyuan


    This study aims to explore the relationship between gene polymorphism and breast cancer, and to screen DEGs (differentially expressed genes) with SNPs (single nucleotide polymorphisms) related to breast cancer. The SNPs of 17 patients and the preprocessed SNP profiling GSE 32258 (38 cases of normal breast cells) were combined to identify their correlation with breast cancer using chi-square test. The gene expression profiling batch8_9 (38 cases of patients and 8 cases of normal tissue) was preprocessed with limma package, and the DEGs were filtered out. Then fisher's method was applied to integrate DEGs and SNPs associated with breast cancer. With NetBox software, TRED (Transcriptional Regulatory Element Database) and UCSC (University of California Santa Cruz) database, genes-associated network and transcriptional regulatory network were constructed using cytoscape software. Further, GO (Gene Ontology) and KEGG analyses were performed for genes in the networks by using siggenes. In total, 332 DEGs were identified. There were 160 breast cancer-related SNPs related to 106 genes of gene expression profiling (19 were significant DEGs). Finally, 11co-correlated DEGs were selected. In genes-associated network, 9 significant DEGs were correlated to 23 LINKER genes while, in transcriptional regulatory network, E2F1 had regulatory relationships with 7 DEGs including MTUS1, CD44, CCNB1 and CCND2. KRAS with SNP locus of rs1137282 was involved in 35 KEGG pathways. The genes of MTUS1, CD44, CCNB1, CCND2 and KRAS with specific SNP loci may be used as biomarkers for diagnosis of breast cancer. Besides, E2F1 was recognized as the transcription factor of 7 DEGs including MTUS1, CD44, CCNB1 and CCND2.

  10. Global population genetic structure and male-mediated gene flow in the green sea turtle (Chelonia mydas): analysis of microsatellite loci.

    PubMed Central

    Roberts, Mark A; Schwartz, Tonia S; Karl, Stephen A


    We assessed the degree of population subdivision among global populations of green sea turtles, Chelonia mydas, using four microsatellite loci. Previously, a single-copy nuclear DNA study indicated significant male-mediated gene flow among populations alternately fixed for different mitochondrial DNA haplotypes and that genetic divergence between populations in the Atlantic and Pacific Oceans was more common than subdivisions among populations within ocean basins. Even so, overall levels of variation at single-copy loci were low and inferences were limited. Here, the markedly more variable microsatellite loci confirm the presence of male-mediated gene flow among populations within ocean basins. This analysis generally confirms the genetic divergence between the Atlantic and Pacific. As with the previous study, phylogenetic analyses of genetic distances based on the microsatellite loci indicate a close genetic relationship among eastern Atlantic and Indian Ocean populations. Unlike the single-copy study, however, the results here cannot be attributed to an artifact of general low variability and likely represent recent or ongoing migration between ocean basins. Sequence analyses of regions flanking the microsatellite repeat reveal considerable amounts of cryptic variation and homoplasy and significantly aid in our understanding of population connectivity. Assessment of the allele frequency distributions indicates that at least some of the loci may not be evolving by the stepwise mutation model. PMID:15126404

  11. Utility of Multi-Gene Loci for Forensic Species Diagnosis of Blowflies

    PubMed Central

    Zaidi, Farrah; Wei, Shu-jun; Shi, Min; Chen, Xue-xin


    Contemporary studies in forensic entomology exhaustively evaluate gene sequences because these constitute the fastest and most accurate method of species identification. For this purpose single gene segments, cytochrome oxidase subunit I (COI) in particular, are commonly used. However, the limitation of such sequences in identification, especially of closely related species and populations, demand a multi-gene approach. But this raises the question of which group of genes can best fulfill the identification task? In this context the utility of five gene segments was explored among blowfly species from two distinct geographic regions, China and Pakistan. COI, cytochrome b (CYTB), NADH dehydrogenase 5 (ND5), nuclear internal transcribed spacers (ITS1 and ITS2), were sequenced for eight blowfly species including Chrysomya megacephala F. (Diptera: Calliphoidae), Ch. pinguis Walker, Lucilia sericata Meigen L. porphyrina Walker, L. illustris Meigen Hemipyrellia ligurriens Wiedemann, Aldrichina grahami Aldrich, and the housefly, Musca domestica L. (Muscidae), from Hangzhou, China; while COI, CYTB, and ITS2 were sequenced for four species, i.e. Ch. megacephala, Ch. rufifacies, L. cuprina, and the flesh fly, Sarcophaga albiceps Meigen (Sarcophagidae), from Dera Ismail Khan Pakistan. The results demonstrate a universal utility of these gene segments in the molecular identification of flies of forensic importance. PMID:21864153

  12. Utility of multi-gene loci for forensic species diagnosis of blowflies.


    Zaidi, Farrah; Wei, Shu-jun; Shi, Min; Chen, Xue-xin


    Contemporary studies in forensic entomology exhaustively evaluate gene sequences because these constitute the fastest and most accurate method of species identification. For this purpose single gene segments, cytochrome oxidase subunit I (COI) in particular, are commonly used. However, the limitation of such sequences in identification, especially of closely related species and populations, demand a multi-gene approach. But this raises the question of which group of genes can best fulfill the identification task? In this context the utility of five gene segments was explored among blowfly species from two distinct geographic regions, China and Pakistan. COI, cytochrome b (CYTB), NADH dehydrogenase 5 (ND5), nuclear internal transcribed spacers (ITS1 and ITS2), were sequenced for eight blowfly species including Chrysomya megacephala F. (Diptera: Calliphoidae), Ch. pinguis Walker, Lucilia sericata Meigen L. porphyrina Walker, L. illustris Meigen Hemipyrellia ligurriens Wiedemann, Aldrichina grahami Aldrich, and the housefly, Musca domestica L. (Muscidae), from Hangzhou, China; while COI, CYTB, and ITS2 were sequenced for four species, i.e. Ch. megacephala, Ch. rufifacies, L. cuprina, and the flesh fly, Sarcophaga albiceps Meigen (Sarcophagidae), from Dera Ismail Khan Pakistan. The results demonstrate a universal utility of these gene segments in the molecular identification of flies of forensic importance.

  13. Genome-wide meta-analysis of maize heterosis reveals the potential role of additive gene expression at pericentromeric loci

    PubMed Central


    Background The identification of QTL involved in heterosis formation is one approach to unravel the not yet fully understood genetic basis of heterosis - the improved agronomic performance of hybrid F1 plants compared to their inbred parents. The identification of candidate genes underlying a QTL is important both for developing markers and determining the molecular genetic basis of a trait, but remains difficult owing to the large number of genes often contained within individual QTL. To address this problem in heterosis analysis, we applied a meta-analysis strategy for grain yield (GY) of Zea mays L. as example, incorporating QTL-, hybrid field-, and parental gene expression data. Results For the identification of genes underlying known heterotic QTL, we made use of tight associations between gene expression pattern and the trait of interest, identified by correlation analyses. Using this approach genes strongly associated with heterosis for GY were discovered to be clustered in pericentromeric regions of the complex maize genome. This suggests that expression differences of sequences in recombination-suppressed regions are important in the establishment of heterosis for GY in F1 hybrids and also in the conservation of heterosis for GY across genotypes. Importantly functional analysis of heterosis-associated genes from these genomic regions revealed over-representation of a number of functional classes, identifying key processes contributing to heterosis for GY. Based on the finding that the majority of the analyzed heterosis-associated genes were addtitively expressed, we propose a model referring to the influence of cis-regulatory variation on heterosis for GY by the compensation of fixed detrimental expression levels in parents. Conclusions The study highlights the utility of a meta-analysis approach that integrates phenotypic and multi-level molecular data to unravel complex traits in plants. It provides prospects for the identification of genes relevant for

  14. Genomic deletions correlate with underexpression of novel candidate genes at six loci in pediatric pilocytic astrocytoma.


    Potter, Nicola; Karakoula, Aikaterini; Phipps, Kim P; Harkness, William; Hayward, Richard; Thompson, Dominic N P; Jacques, Thomas S; Harding, Brian; Thomas, David G T; Palmer, Rodger W; Rees, Jeremy; Darling, John; Warr, Tracy J


    The molecular pathogenesis of pediatric pilocytic astrocytoma (PA) is not well defined. Previous cytogenetic and molecular studies have not identified nonrandom genetic aberrations. To correlate differential gene expression and genomic copy number aberrations (CNAs) in PA, we have used Affymetrix GeneChip HG_U133A to generate gene expression profiles of 19 pediatric patients and the SpectralChip 2600 to investigate CNAs in 11 of these tumors. Hierarchical clustering according to expression profile similarity grouped tumors and controls separately. We identified 1844 genes that showed significant differential expression between tumor and normal controls, with a large number clearly influencing phosphatidylinositol and mitogen-activated protein kinase signaling in PA. Most CNAs identified in this study were single-clone alterations. However, a small region of loss involving up to seven adjacent clones at 7q11.23 was observed in seven tumors and correlated with the underexpression of BCL7B. Loss of four individual clones was also associated with reduced gene expression including SH3GL2 at 9p21.2-p23, BCL7A (which shares 90% sequence homology with BCL7B) at 12q24.33, DRD1IP at 10q26.3, and TUBG2 and CNTNAP1 at 17q21.31. Moreover, the down-regulation of FOXG1B at 14q12 correlated with loss within the gene promoter region in most tumors. This is the first study to correlate differential gene expression with CNAs in PA. PMID:18670637

  15. Methods for monitoring multiple gene expression

    SciTech Connect

    Berka, Randy; Bachkirova, Elena; Rey, Michael


    The present invention relates to methods for monitoring differential expression of a plurality of genes in a first filamentous fungal cell relative to expression of the same genes in one or more second filamentous fungal cells using microarrays containing Trichoderma reesei ESTs or SSH clones, or a combination thereof. The present invention also relates to computer readable media and substrates containing such array features for monitoring expression of a plurality of genes in filamentous fungal cells.

  16. Methods for monitoring multiple gene expression

    SciTech Connect

    Berka, Randy; Bachkirova, Elena; Rey, Michael


    The present invention relates to methods for monitoring differential expression of a plurality of genes in a first filamentous fungal cell relative to expression of the same genes in one or more second filamentous fungal cells using microarrays containing Trichoderma reesei ESTs or SSH clones, or a combination thereof. The present invention also relates to computer readable media and substrates containing such array features for monitoring expression of a plurality of genes in filamentous fungal cells.

  17. Methods for monitoring multiple gene expression

    SciTech Connect

    Berka, Randy; Bachkirova, Elena; Rey, Michael


    The present invention relates to methods for monitoring differential expression of a plurality of genes in a first filamentous fungal cell relative to expression of the same genes in one or more second filamentous fungal cells using microarrays containing Trichoderma reesei ESTs or SSH clones, or a combination thereof. The present invention also relates to computer readable media and substrates containing such array features for monitoring expression of a plurality of genes in filamentous fungal cells.

  18. Quantitative trait loci and underlying candidate genes controlling agronomical and fruit quality traits in octoploid strawberry (Fragaria × ananassa).


    Zorrilla-Fontanesi, Yasmín; Cabeza, Amalia; Domínguez, Pedro; Medina, Juan Jesús; Valpuesta, Victoriano; Denoyes-Rothan, Beatrice; Sánchez-Sevilla, José F; Amaya, Iraida


    Breeding for fruit quality traits in strawberry (Fragaria × ananassa, 2n = 8x = 56) is complex due to the polygenic nature of these traits and the octoploid constitution of this species. In order to improve the efficiency of genotype selection, the identification of quantitative trait loci (QTL) and associated molecular markers will constitute a valuable tool for breeding programs. However, the implementation of these markers in breeding programs depends upon the complexity and stability of QTLs across different environments. In this work, the genetic control of 17 agronomical and fruit quality traits was investigated in strawberry using a F(1) population derived from an intraspecific cross between two contrasting selection lines, '232' and '1392'. QTL analyses were performed over three successive years based on the separate parental linkage maps and a pseudo-testcross strategy. The integrated strawberry genetic map consists of 338 molecular markers covering 37 linkage groups, thus exceeding the 28 chromosomes. 33 QTLs were identified for 14 of the 17 studied traits and approximately 37% of them were stable over time. For each trait, 1-5 QTLs were identified with individual effects ranging between 9.2 and 30.5% of the phenotypic variation, indicating that all analysed traits are complex and quantitatively inherited. Many QTLs controlling correlated traits were co-located in homoeology group V, indicating linkage or pleiotropic effects of loci. Candidate genes for several QTLs controlling yield, anthocyanins, firmness and L-ascorbic acid are proposed based on both their co-localization and predicted function. We also report conserved QTLs among strawberry and other Rosaceae based on their syntenic location.

  19. Genome-wide association study identifies multiple loci associated with both mammographic density and breast cancer risk

    PubMed Central

    Lindström, Sara; Thompson, Deborah J.; Paterson, Andrew D.; Li, Jingmei; Gierach, Gretchen L.; Scott, Christopher; Stone, Jennifer; Douglas, Julie A.; dos-Santos-Silva, Isabel; Fernandez-Navarro, Pablo; Verghase, Jajini; Smith, Paula; Brown, Judith; Luben, Robert; Wareham, Nicholas J.; Loos, Ruth J.F.; Heit, John A.; Pankratz, V. Shane; Norman, Aaron; Goode, Ellen L.; Cunningham, Julie M.; deAndrade, Mariza; Vierkant, Robert A.; Czene, Kamila; Fasching, Peter A.; Baglietto, Laura; Southey, Melissa C.; Giles, Graham G.; Shah, Kaanan P.; Chan, Heang-Ping; Helvie, Mark A.; Beck, Andrew H.; Knoblauch, Nicholas W.; Hazra, Aditi; Hunter, David J.; Kraft, Peter; Pollan, Marina; Figueroa, Jonine D.; Couch, Fergus J.; Hopper, John L.; Hall, Per; Easton, Douglas F.; Boyd, Norman F.; Vachon, Celine M.; Tamimi, Rulla M.


    Mammographic density reflects the amount of stromal and epithelial tissues in relation to adipose tissue in the breast and is a strong risk factor for breast cancer. Here we report the results from meta-analysis of genome-wide association studies (GWAS) of three mammographic density phenotypes: dense area, non-dense area and percent density in up to 7,916 women in stage 1 and an additional 10,379 women in stage 2. We identify genome-wide significant (P<5×10−8) loci for dense area (AREG, ESR1, ZNF365, LSP1/TNNT3, IGF1, TMEM184B, SGSM3/MKL1), non-dense area (8p11.23) and percent density (PRDM6, 8p11.23, TMEM184B). Four of these regions are known breast cancer susceptibility loci, and four additional regions were found to be associated with breast cancer (P<0.05) in a large meta-analysis. These results provide further evidence of a shared genetic basis between mammographic density and breast cancer and illustrate the power of studying intermediate quantitative phenotypes to identify putative disease susceptibility loci. PMID:25342443

  20. Meta-analysis identifies multiple loci associated with kidney function-related traits in east Asian populations.


    Okada, Yukinori; Sim, Xueling; Go, Min Jin; Wu, Jer-Yuarn; Gu, Dongfeng; Takeuchi, Fumihiko; Takahashi, Atsushi; Maeda, Shiro; Tsunoda, Tatsuhiko; Chen, Peng; Lim, Su-Chi; Wong, Tien-Yin; Liu, Jianjun; Young, Terri L; Aung, Tin; Seielstad, Mark; Teo, Yik-Ying; Kim, Young Jin; Lee, Jong-Young; Han, Bok-Ghee; Kang, Daehee; Chen, Chien-Hsiun; Tsai, Fuu-Jen; Chang, Li-Ching; Fann, S-J Cathy; Mei, Hao; Rao, Dabeeru C; Hixson, James E; Chen, Shufeng; Katsuya, Tomohiro; Isono, Masato; Ogihara, Toshio; Chambers, John C; Zhang, Weihua; Kooner, Jaspal S; Albrecht, Eva; Yamamoto, Kazuhiko; Kubo, Michiaki; Nakamura, Yusuke; Kamatani, Naoyuki; Kato, Norihiro; He, Jiang; Chen, Yuan-Tsong; Cho, Yoon Shin; Tai, E-Shyong; Tanaka, Toshihiro


    Chronic kidney disease (CKD), impairment of kidney function, is a serious public health problem, and the assessment of genetic factors influencing kidney function has substantial clinical relevance. Here, we report a meta-analysis of genome-wide association studies for kidney function-related traits, including 71,149 east Asian individuals from 18 studies in 11 population-, hospital- or family-based cohorts, conducted as part of the Asian Genetic Epidemiology Network (AGEN). Our meta-analysis identified 17 loci newly associated with kidney function-related traits, including the concentrations of blood urea nitrogen, uric acid and serum creatinine and estimated glomerular filtration rate based on serum creatinine levels (eGFRcrea) (P < 5.0 × 10(-8)). We further examined these loci with in silico replication in individuals of European ancestry from the KidneyGen, CKDGen and GUGC consortia, including a combined total of ∼110,347 individuals. We identify pleiotropic associations among these loci with kidney function-related traits and risk of CKD. These findings provide new insights into the genetics of kidney function. PMID:22797727

  1. Genome-wide association study identifies multiple loci associated with both mammographic density and breast cancer risk.


    Lindström, Sara; Thompson, Deborah J; Paterson, Andrew D; Li, Jingmei; Gierach, Gretchen L; Scott, Christopher; Stone, Jennifer; Douglas, Julie A; dos-Santos-Silva, Isabel; Fernandez-Navarro, Pablo; Verghase, Jajini; Smith, Paula; Brown, Judith; Luben, Robert; Wareham, Nicholas J; Loos, Ruth J F; Heit, John A; Pankratz, V Shane; Norman, Aaron; Goode, Ellen L; Cunningham, Julie M; deAndrade, Mariza; Vierkant, Robert A; Czene, Kamila; Fasching, Peter A; Baglietto, Laura; Southey, Melissa C; Giles, Graham G; Shah, Kaanan P; Chan, Heang-Ping; Helvie, Mark A; Beck, Andrew H; Knoblauch, Nicholas W; Hazra, Aditi; Hunter, David J; Kraft, Peter; Pollan, Marina; Figueroa, Jonine D; Couch, Fergus J; Hopper, John L; Hall, Per; Easton, Douglas F; Boyd, Norman F; Vachon, Celine M; Tamimi, Rulla M


    Mammographic density reflects the amount of stromal and epithelial tissues in relation to adipose tissue in the breast and is a strong risk factor for breast cancer. Here we report the results from meta-analysis of genome-wide association studies (GWAS) of three mammographic density phenotypes: dense area, non-dense area and percent density in up to 7,916 women in stage 1 and an additional 10,379 women in stage 2. We identify genome-wide significant (P<5 × 10(-8)) loci for dense area (AREG, ESR1, ZNF365, LSP1/TNNT3, IGF1, TMEM184B and SGSM3/MKL1), non-dense area (8p11.23) and percent density (PRDM6, 8p11.23 and TMEM184B). Four of these regions are known breast cancer susceptibility loci, and four additional regions were found to be associated with breast cancer (P<0.05) in a large meta-analysis. These results provide further evidence of a shared genetic basis between mammographic density and breast cancer and illustrate the power of studying intermediate quantitative phenotypes to identify putative disease-susceptibility loci. PMID:25342443

  2. Suppressor Mutants of Neurospora Crassa That Tolerate Allelic Differences at Single or at Multiple Heterokaryon Incompatibility Loci

    PubMed Central

    Arganoza, M. T.; Ohrnberger, J.; Min, J.; Akins, R. A.


    Allelic differences at any one of at least 11 heterokaryon incompatibility (het) loci in Neurospora crassa trigger an incompatibility response: localized cell death at sites of hyphal anastomosis. We have isolated spontaneous and insertional suppressor mutants that are heterokaryon-compatible in spite of allelic differences at one or at several het loci. Some intra- and extragenic mutants tolerated allelic differences only at single het loci. Multi-tolerant spontaneous mutants were isolated by selecting simultaneously for tolerance of differences at het-c, -d and -e, or at each of these plus mating-type. Some suppressor mutants were specific for only one allele at the affected het locus; others suppressed both alleles. Insertional mutations were isolated from banks of transformants, each having a plasmid integrated into a random position in the chromosome. One mutant tolerated allelic differences at het-d. A homologous cosmid from a Neurospora genomic bank complemented the mutant phenotype. A second insertional inactivation mutant was tolerant of het-c differences. Inactivation of the wild-type locus corresponding to the integration site was accomplished by repeat-induced point mutation (RIP). The RIP progeny, like the original mutant, were tolerant of differences at het-c. It may be possible to use such suppressor mutants as universal donors of hypovirulence in pathogenic fungi. PMID:8088519

  3. Genome-wide meta-analyses of multi-ethnic cohorts identify multiple new susceptibility loci for refractive error and myopia

    PubMed Central

    Verhoeven, Virginie J.M.; Hysi, Pirro G.; Wojciechowski, Robert; Fan, Qiao; Guggenheim, Jeremy A.; Höhn, René; MacGregor, Stuart; Hewitt, Alex W.; Nag, Abhishek; Cheng, Ching-Yu; Yonova-Doing, Ekaterina; Zhou, Xin; Ikram, M. Kamran; Buitendijk, Gabriëlle H.S.; McMahon, George; Kemp, John P.; St. Pourcain, Beate; Simpson, Claire L.; Mäkelä, Kari-Matti; Lehtimäki, Terho; Kähönen, Mika; Paterson, Andrew D.; Hosseini, S. Mohsen; Wong, Hoi Suen; Xu, Liang; Jonas, Jost B.; Pärssinen, Olavi; Wedenoja, Juho; Yip, Shea Ping; Ho, Daniel W. H.; Pang, Chi Pui; Chen, Li Jia; Burdon, Kathryn P.; Craig, Jamie E.; Klein, Barbara E. K.; Klein, Ronald; Haller, Toomas; Metspalu, Andres; Khor, Chiea-Chuen; Tai, E-Shyong; Aung, Tin; Vithana, Eranga; Tay, Wan-Ting; Barathi, Veluchamy A.; Chen, Peng; Li, Ruoying; Liao, Jiemin; Zheng, Yingfeng; Ong, Rick T.; Döring, Angela; Evans, David M.; Timpson, Nicholas J.; Verkerk, Annemieke J.M.H.; Meitinger, Thomas; Raitakari, Olli; Hawthorne, Felicia; Spector, Tim D.; Karssen, Lennart C.; Pirastu, Mario; Murgia, Federico; Ang, Wei; Mishra, Aniket; Montgomery, Grant W.; Pennell, Craig E.; Cumberland, Phillippa M.; Cotlarciuc, Ioana; Mitchell, Paul; Wang, Jie Jin; Schache, Maria; Janmahasathian, Sarayut; Igo, Robert P.; Lass, Jonathan H.; Chew, Emily; Iyengar, Sudha K.; Gorgels, Theo G.M.F.; Rudan, Igor; Hayward, Caroline; Wright, Alan F.; Polasek, Ozren; Vatavuk, Zoran; Wilson, James F.; Fleck, Brian; Zeller, Tanja; Mirshahi, Alireza; Müller, Christian; Uitterlinden, Andre’ G.; Rivadeneira, Fernando; Vingerling, Johannes R.; Hofman, Albert; Oostra, Ben A.; Amin, Najaf; Bergen, Arthur A.B.; Teo, Yik-Ying; Rahi, Jugnoo S.; Vitart, Veronique; Williams, Cathy; Baird, Paul N.; Wong, Tien-Yin; Oexle, Konrad; Pfeiffer, Norbert; Mackey, David A.; Young, Terri L.; van Duijn, Cornelia M.; Saw, Seang-Mei; Wilson, Joan E. Bailey; Stambolian, Dwight; Klaver, Caroline C.; Hammond, Christopher J.


    Refractive error is the most common eye disorder worldwide, and a prominent cause of blindness. Myopia affects over 30% of Western populations, and up to 80% of Asians. The CREAM consortium conducted genome-wide meta-analyses including 37,382 individuals from 27 studies of European ancestry, and 8,376 from 5 Asian cohorts. We identified 16 new loci for refractive error in subjects of European ancestry, of which 8 were shared with Asians. Combined analysis revealed 8 additional loci. The new loci include genes with functions in neurotransmission (GRIA4), ion channels (KCNQ5), retinoic acid metabolism (RDH5), extracellular matrix remodeling (LAMA2, BMP2), and eye development (SIX6, PRSS56). We also confirmed previously reported associations with GJD2 and RASGRF1. Risk score analysis using associated SNPs showed a tenfold increased risk of myopia for subjects with the highest genetic load. Our results, accumulated across independent multi-ethnic studies, considerably advance understanding of mechanisms involved in refractive error and myopia. PMID:23396134

  4. Analysis of thirteen trinucleotide repeat loci as candidate genes for Schizophrenia and bipolar affective disorder

    SciTech Connect

    Jain, S.; Leggo, J.; Ferguson-Smith, M.A.; Rubinsztein, D.C.


    A group of diseases are due to abnormal expansions of trinucleotide repeats. These diseases all affect the nervous system. In addition, they manifest the phenomenon of anticipation, in which the disease tends to present at an earlier age or with greater severity in successive generations. Many additional genes with trinucleotide repeats are believed to be expressed in the human brain. As anticipation has been reported in schizophrenia and bipolar affective disorder, we have examined allele distributions of 13 trinucleotide repeat-containing genes, many novel and all expressed in the brain, in genomic DNA from schizophrenic (n = 20-97) and bipolar affective disorder patients (23-30) and controls (n = 43-146). No evidence was obtained to implicate expanded alleles in these 13 genes as causal factors in these diseases. 26 refs., 1 fig., 2 tabs.

  5. Mutations in Rik1, Clr2, Clr3 and Clr4 Genes Asymmetrically Derepress the Silent Mating-Type Loci in Fission Yeast

    PubMed Central

    Ekwall, K.; Ruusala, T.


    In Schizosaccharomyces pombe the mating-type information is stored at two transcriptionally silent loci (mat2 and mat3). The region between these sites (K region) is inert for meiotic crossing over. The mating-type genes (M or P) are expressed only when present at a third, active locus (mat1). We have earlier shown that the positional regulation of P genes is based on repression at the silent site, caused by elements in the flanking DNA sequences. In this study we have mutagenized a sterile mat1 deleted strain and selected for cells that are able to conjugate. Recessive mutations of this type should define genes encoding trans-acting factors involved in repression of the silent mating-type loci. Before this work mutations in two genes, clr1 and swi6, had been shown to allow both expression of the silent loci and recombination in the K region. The sensitivity of the present selection is demonstrated by the isolation of new mutations that derepress one or both of the silent loci (M-mating or bi-mating). The frequency of M-mating mutants was almost two orders of magnitude higher than that of bi-mating mutants and in all mutants analyzed mat3-M expression was significantly higher than mat2-P expression. The mutations define three new genes, clr2, clr3 and clr4. In addition we show that the rik1 mutant previously known to allow recombination in the K region also derepresses the silent loci. PMID:8138176

  6. Hardy-Weinberg analysis of a large set of published association studies reveals genotyping error and a deficit of heterozygotes across multiple loci

    PubMed Central


    In genetic association studies, deviation from Hardy-Weinberg equilibrium (HWD) can be due to recent admixture or selection at a locus, but is most commonly due to genotyping errors. In addition to its utility for identifying potential genotyping errors in individual studies, here we report that HWD can be useful in detecting the presence, magnitude and direction of genotyping error across multiple studies. If there is a consistent genotyping error at a given locus, larger studies, in general, will show more evidence for HWD than small studies. As a result, for loci prone to genotyping errors, there will be a correlation between HWD and the study sample size. By contrast, in the absence of consistent genotyping errors, there will be a chance distribution of p-values among studies without correlation with sample size. We calculated the evidence for HWD at 17 separate polymorphic loci investigated in 325 published genetic association studies. In the full set of studies, there was a significant correlation between HWD and locus-standardised sample size (p = 0.001). For 14/17 of the individual loci, there was a positive correlation between extent of HWD and sample size, with the evidence for two loci (5-HTTLPR and CTSD) rising to the level of statistical significance. Among single nucleotide polymorphisms (SNPs), 15/23 studies that deviated significantly from Hardy-Weinberg equilibrium (HWE) did so because of a deficit of hetero-zygotes. The inbreeding coefficient (F(is)) is a measure of the degree and direction of deviation from HWE. Among studies investigating SNPs, there was a significant correlation between F(is) and HWD (R = 0.191; p = 0.002), indicating that the greater the deviation from HWE, the greater the deficit of heterozygotes. By contrast, for repeat variants, only one in five studies that deviated significantly from HWE showed a deficit of heterozygotes and there was no significant correlation between F(is) and HWD. These results indicate the presence of

  7. Fine mapping of quantitative trait loci using advanced intercross lines of mice and positional cloning of the corresponding genes.


    Iraqi, F


    High-resolution mapping of quantitative trait loci (QTLs) is an essential step towards positional cloning and identification of the corresponding genes. Most QTL detection and mapping studies in mice have been carried out using F2 intercross and backcross populations. As a consequence of the limited number of recombination events in small chromosomal regions, this has generally permitted mapping to only relatively large confidence intervals of 20 to 40 cM. A number of population designs have been proposed to increase recombination level in crosses. This includes advanced intercross lines (AIL) described by Darvasi and Soller [Genomics. 1995; 141: 1199-1207]. In this report demonstration of the utility of the AIL approach for fine mapping of QTL, which previously had been mapped with 95% confidence interval to 20 to 40 cM in a F2 intercross, will be presented. The methodological approaches to go from the fine-mapped QTL to the identification of the actual genes and mutations are discussed.

  8. Transcriptional Regulation of the Stem Cell Leukemia Gene (SCL) — Comparative Analysis of Five Vertebrate SCL Loci

    PubMed Central

    Göttgens, Berthold; Barton, Linda M.; Chapman, Michael A.; Sinclair, Angus M.; Knudsen, Bjarne; Grafham, Darren; Gilbert, James G.R.; Rogers, Jane; Bentley, David R.; Green, Anthony R.


    The stem cell leukemia (SCL) gene encodes a bHLH transcription factor with a pivotal role in hematopoiesis and vasculogenesis and a pattern of expression that is highly conserved between mammals and zebrafish. Here we report the isolation and characterization of the zebrafish SCL locus together with the identification of three neighboring genes, IER5, MAP17, and MUPP1. This region spans 68 kb and comprises the longest zebrafish genomic sequence currently available for comparison with mammalian, chicken, and pufferfish sequences. Our data show conserved synteny between zebrafish and mammalian SCL and MAP17 loci, thus suggesting the likely genomic domain necessary for the conserved pattern of SCL expression. Long-range comparative sequence analysis/phylogenetic footprinting was used to identify noncoding conserved sequences representing candidate transcriptional regulatory elements. The SCL promoter/enhancer, exon 1, and the poly(A) region were highly conserved, but no homology to other known mouse SCL enhancers was detected in the zebrafish sequence. A combined homology/structure analysis of the poly(A) region predicted consistent structural features, suggesting a conserved functional role in mRNA regulation. Analysis of the SCL promoter/enhancer revealed five motifs, which were conserved from zebrafish to mammals, and each of which is essential for the appropriate pattern or level of SCL transcription. [The following individuals kindly provided reagents, samples, or unpublished information as indicated in the paper: N. Tanese.] PMID:11997341

  9. Intragenic homogenization and multiple copies of prey-wrapping silk genes in Argiope garden spiders

    PubMed Central


    Background Spider silks are spectacular examples of phenotypic diversity arising from adaptive molecular evolution. An individual spider can produce an array of specialized silks, with the majority of constituent silk proteins encoded by members of the spidroin gene family. Spidroins are dominated by tandem repeats flanked by short, non-repetitive N- and C-terminal coding regions. The remarkable mechanical properties of spider silks have been largely attributed to the repeat sequences. However, the molecular evolutionary processes acting on spidroin terminal and repetitive regions remain unclear due to a paucity of complete gene sequences and sampling of genetic variation among individuals. To better understand spider silk evolution, we characterize a complete aciniform spidroin gene from an Argiope orb-weaving spider and survey aciniform gene fragments from congeneric individuals. Results We present the complete aciniform spidroin (AcSp1) gene from the silver garden spider Argiope argentata (Aar_AcSp1), and document multiple AcSp1 loci in individual genomes of A. argentata and the congeneric A. trifasciata and A. aurantia. We find that Aar_AcSp1 repeats have >98% pairwise nucleotide identity. By comparing AcSp1 repeat amino acid sequences between Argiope species and with other genera, we identify regions of conservation over vast amounts of evolutionary time. Through a PCR survey of individual A. argentata, A. trifasciata, and A. aurantia genomes, we ascertain that AcSp1 repeats show limited variation between species whereas terminal regions are more divergent. We also find that average dN/dS across codons in the N-terminal, repetitive, and C-terminal encoding regions indicate purifying selection that is strongest in the N-terminal region. Conclusions Using the complete A. argentata AcSp1 gene and spidroin genetic variation between individuals, this study clarifies some of the molecular evolutionary processes underlying the spectacular mechanical attributes of

  10. Loci controlling lymphocyte production of interferon c after alloantigen stimulation in vitro and their co-localization with genes controlling lymphocyte infiltration of tumors and tumor susceptibility.


    Lipoldová, Marie; Havelková, Helena; Badalova, Jana; Vojtísková, Jarmila; Quan, Lei; Krulova, Magdaléna; Sohrabi, Yahya; Stassen, Alphons P; Demant, Peter


    Low infiltration of lymphocytes into cancers is associated with poor prognosis, but the reasons why some patients exhibit a low and others a high infiltration of tumors are unknown. Previously we mapped four loci (Lynf1–Lynf4) controlling lymphocyte infiltration of mouse lung tumors. These loci do not encode any of the molecules that are involved in traffic of lymphocytes. Here we report a genetic relationship between these loci and the control of production of IFNγ in allogeneic mixed lymphocyte cultures (MLC). We found that IFNγ production by lymphocytes of O20/A mice is lower than by lymphocytes of OcB-9/Dem mice (both H2pz) stimulated in MLC by irradiated splenocytes of C57BL/10SnPh (H2b) or BALB/ cHeA (H2d) mice, or by ConA. IFNγ production in MLCs of individual (O20 9 OcB-9)F2mice stimulated by irradiated C57BL/10 splenocytes and genotyped for microsatellite markers revealed four IFNγ-controlling loci (Cypr4-Cypr7), each of which is closely linked with one of the four Lynf loci and with a cluster of susceptibility genes for different tumors. This suggests that inherited differences in certain lymphocyte responses may modify their propensity to infiltrate tumors and their capacity to affect tumor growth.

  11. Resistance of Mice of the 129 Background to Yersinia pestis Maps to Multiple Loci on Chromosome 1.


    Tencati, Michael; Tapping, Richard I


    Yersinia pestis is a Gram-negative bacterium that is the causative agent of bubonic and pneumonic plague. It is commonly acquired by mammals such as rodents and humans via the bite of an infected flea. We previously reported that multiple substrains of the 129 mouse background are resistant to pigmentation locus-negative (pgm(-)) Yersinia pestis and that this phenotype maps to a 30-centimorgan (cM) region located on chromosome 1. In this study, we have further delineated this plague resistance locus to a region of less than 20 cM through the creation and phenotyping of recombinant offspring arising from novel crossovers in this region. Furthermore, our experiments have revealed that there are at least two alleles in this initial locus, both of which are required for resistance on a susceptible C57BL/6 background. These two alleles work in trans since resistance is restored in offspring possessing one allele contributed by each parent. Our studies also indicated that the Slc11a1 gene (formerly known as Nramp1) located within the chromosome1 locus is not responsible for conferring resistance to 129 mice. PMID:27481241

  12. A non-inheritable maternal Cas9-based multiple-gene editing system in mice

    PubMed Central

    Sakurai, Takayuki; Kamiyoshi, Akiko; Kawate, Hisaka; Mori, Chie; Watanabe, Satoshi; Tanaka, Megumu; Uetake, Ryuichi; Sato, Masahiro; Shindo, Takayuki


    The CRISPR/Cas9 system is capable of editing multiple genes through one-step zygote injection. The preexisting method is largely based on the co-injection of Cas9 DNA (or mRNA) and guide RNAs (gRNAs); however, it is unclear how many genes can be simultaneously edited by this method, and a reliable means to generate transgenic (Tg) animals with multiple gene editing has yet to be developed. Here, we employed non-inheritable maternal Cas9 (maCas9) protein derived from Tg mice with systemic Cas9 overexpression (Cas9 mice). The maCas9 protein in zygotes derived from mating or in vitro fertilization of Tg/+ oocytes and +/+ sperm could successfully edit the target genome. The efficiency of such maCas9-based genome editing was comparable to that of zygote microinjection–based genome editing widely used at present. Furthermore, we demonstrated a novel approach to create “Cas9 transgene-free” gene-modified mice using non-Tg (+/+) zygotes carrying maCas9. The maCas9 protein in mouse zygotes edited nine target loci simultaneously after injection with nine different gRNAs alone. Cas9 mouse-derived zygotes have the potential to facilitate the creation of genetically modified animals carrying the Cas9 transgene, enabling repeatable genome engineering and the production of Cas9 transgene-free mice. PMID:26817415

  13. Promising Loci and Genes for Yolk and Ovary Weight in Chickens Revealed by a Genome-Wide Association Study

    PubMed Central

    Yi, Guoqiang; Yuan, Jingwei; Duan, Zhongyi; Qu, Lujiang; Xu, Guiyun; Wang, Kehua; Yang, Ning


    Because it serves as the cytoplasm of the oocyte and provides a large amount of reserves, the egg yolk has biological significance for developing embryos. The ovary and its hierarchy of follicles are the main reproductive organs responsible for yolk deposition in chickens. However, the genetic architecture underlying the yolk and ovarian follicle weights remains elusive. Here, we measured the yolk weight (YW) at 11 age points from onset of egg laying to 72 weeks of age and measured the follicle weight (FW) and ovary weight (OW) at 73 weeks as part of a comprehensive genome-wide association study (GWAS) in 1,534 F2 hens derived from reciprocal crosses between White Leghorn (WL) and Dongxiang chickens (DX). For all ages, YWs exhibited moderate single nucleotide polymorphism (SNP)-based heritability estimates (0.25–0.38), while the estimates for FW (0.16) and OW (0.20) were relatively low. Independent univariate genome-wide screens for each trait identified 12, 3, and 31 novel significant associations with YW, FW, and OW, respectively. A list of candidate genes such as ZAR1, STARD13, ACER1b, ACSBG2, and DHRS12 were identified for having a plausible function in yolk and follicle development. These genes are important to the initiation of embryogenesis, lipid transport, lipoprotein synthesis, lipid droplet promotion, and steroid hormone metabolism, respectively. Our study provides for the first time a genome-wide association (GWA) analysis for follicle and ovary weight. Identification of the promising loci as well as potential candidate genes will greatly advance our understanding of the genetic basis underlying dynamic yolk weight and ovarian follicle development and has practical significance in breeding programs for the alteration of yolk weight at different age points. PMID:26332579

  14. Two distinct genetic loci regulating class II gene expression are defective in human mutant and patient cell lines.

    PubMed Central

    Yang, Z; Accolla, R S; Pious, D; Zegers, B J; Strominger, J L


    Heterokaryons were prepared and analyzed shortly after cell fusion using two mutant class-II-negative human B cell lines (RJ 2.2.5 and 6.1.6) and a cell line (TF) from a patient with a class-II-negative Bare Lymphocyte Syndrome. The resulting transient heterokaryons were analyzed by using an anti-HLA-DR monoclonal antibody to assess the cell surface expression of HLA-DR (the major subtype of class II antigens) by immunofluorescence microscopy and by using uniformly 32P-labeled SP6 RNA probes in Northern blots and RNase protection assays to assess mRNA synthesis. We find that class II gene expression in a B cell line from a Bare Lymphocyte Syndrome patient (TF) is rescued by a B cell line which expresses class II antigens indicating that this disease, at least in part, is caused by a defect(s) in a genetic locus encoding a factor(s) necessary for class II gene expression. Secondly, reciprocal genetic complementation was demonstrated in the heterokaryons 6.1.6 x RJ 2.2.5 and TF x RJ 2.2.5 (but not in TF x 6.1.6) by detection of cell surface DR by immunofluorescence microscopy and by a novel class II mRNA typing technique which allows characterization of distinct class II alleles. Thus, the two mutants generated in vitro have defects at two different genetic loci encoding specific regulatory factors necessary for human class II gene expression. One of these mutant cell lines, but not the other, complements the defect in the patient cell line, TF. Images PMID:2458252

  15. Molecular characterization of Verocytotoxigenic Escherichia coli O157:H7 isolates from Argentina by Multiple-Loci VNTR Analysis (MLVA)

    PubMed Central

    Bustamante, Ana V.; Lucchesi, Paula M.A.; Parma, Alberto E.


    The aim of this work was to adapt described MLVA protocols to the molecular typing and characterization of VTEC O157:H7 isolates from Argentina. Nine VNTR loci were amplified by PCR showing diversity values from 0.49 to 0.73. Nine MLVA profiles were observed and the cluster analysis indicated both unrelated and closely related VTEC O157:H7 strains. In spite of the limited number of isolates studied, the panel of VNTR used made it possible to perform a first approach of the high genetic diversity of native strains of O157:H7 by MLVA. PMID:24031443

  16. Identification of Quantitative Trait Loci (QTL) and Candidate Genes for Cadmium Tolerance in Populus

    SciTech Connect

    Induri, Brahma R; Ellis, Danielle R; Slavov, Gancho; Yin, Tongming; Muchero, Wellington; Tuskan, Gerald A; DiFazio, Stephen P


    Knowledge of genetic variation in response of Populus to heavy metals like cadmium (Cd) is an important step in understanding the underlying mechanisms of tolerance. In this study, a pseudo-backcross pedigree of Populus trichocarpa and Populus deltoides was characterized for Cd exposure. The pedigree showed significant variation for Cd tolerance thus enabling the identification of relatively tolerant and susceptible genotypes for intensive characterization. A total of 16 QTLs at logarithm of odds (LOD) ratio > 2.5, were found to be associated with total dry weight, its components, and root volume. Four major QTLs for total dry weight were mapped to different linkage groups in control (LG III) and Cd conditions (LG XVI) and had opposite allelic effects on Cd tolerance, suggesting that these genomic regions were differentially controlled. The phenotypic variation explained by Cd QTL for all traits under study varied from 5.9% to 11.6% and averaged 8.2% across all QTL. Leaf Cd contents also showed significant variation suggesting the phytoextraction potential of Populus genotypes, though heritability of this trait was low (0.22). A whole-genome microarray study was conducted by using two genotypes with extreme responses for Cd tolerance in the above study and differentially expressed genes were identified. Candidate genes including CAD2 (CADMIUM SENSITIVE 2), HMA5 (HEAVY METAL ATPase5), ATGTST1 (Arabidopsis thaliana Glutathione S-Transferase1), ATGPX6 (Glutathione peroxidase 6), and ATMRP 14 (Arabidopsis thaliana Multidrug Resistance associated Protein 14) were identified from QTL intervals and microarray study. Functional characterization of these candidate genes could enhance phytoremediation capabilities of Populus.

  17. Candidate genes in quantitative trait loci associated with absolute and relative kidney weight in rats with Inherited Stress Induced Arterial Hypertension

    PubMed Central


    Background The kidney mass is significantly increased in hypertensive ISIAH rats with Inherited Stress Induced Arterial Hypertension as compared with normotensive WAG rats. The QTL/microarray approach was carried out to determine the positional candidate genes in the QTL for absolute and relative kidney weight. Results Several known and predicted genes differentially expressed in ISIAH and WAG kidney were mapped to genetic loci associated with the absolute and relative kidney weight in 6-month old F2 hybrid (ISIAHxWAG) males. The knowledge-driven filtering of the list of candidates helped to suggest several positional candidate genes, which may be related to the structural and mass changes in hypertensive ISIAH kidney. In the current study, we showed that all loci found for absolute and relative kidney weight didn't overlap with significant or suggestive loci for arterial blood pressure level. So, the genes differentially expressed in ISIAH and WAG kidneys and located in these QTL regions associated with absolute and relative kidney weight shouldn't substantially influence the BP level in the 6 month-old ISIAH rats. However, in some cases, small effects may be suggested. Conclusions The further experimental validation of causative genes and detection of polymorphisms will provide opportunities to advance our understanding of the underlying nature of structural and mass changes in hypertensive ISIAH kidney. PMID:25707311

  18. Epigenomic analysis of the HOX gene loci reveals mechanisms that may control canonical expression patterns in AML and normal hematopoietic cells.


    Spencer, D H; Young, M A; Lamprecht, T L; Helton, N M; Fulton, R; O'Laughlin, M; Fronick, C; Magrini, V; Demeter, R T; Miller, C A; Klco, J M; Wilson, R K; Ley, T J


    HOX genes are highly expressed in many acute myeloid leukemia (AML) samples, but the patterns of expression and associated regulatory mechanisms are not clearly understood. We analyzed RNA sequencing data from 179 primary AML samples and normal hematopoietic cells to understand the range of expression patterns in normal versus leukemic cells. HOX expression in AML was restricted to specific genes in the HOXA or HOXB loci, and was highly correlated with recurrent cytogenetic abnormalities. However, the majority of samples expressed a canonical set of HOXA and HOXB genes that was nearly identical to the expression signature of normal hematopoietic stem/progenitor cells. Transcriptional profiles at the HOX loci were similar between normal cells and AML samples, and involved bidirectional transcription at the center of each gene cluster. Epigenetic analysis of a subset of AML samples also identified common regions of chromatin accessibility in AML samples and normal CD34(+) cells that displayed differences in methylation depending on HOX expression patterns. These data provide an integrated epigenetic view of the HOX gene loci in primary AML samples, and suggest that HOX expression in most AML samples represents a normal stem cell program that is controlled by epigenetic mechanisms at specific regulatory elements.

  19. Epigenomic analysis of the HOX gene loci reveals mechanisms that may control canonical expression patterns in AML and normal hematopoietic cells

    PubMed Central

    Spencer, David H.; Young, Margaret A.; Lamprecht, Tamara L.; Helton, Nichole M.; Fulton, Robert; O’Laughlin, Michelle; Fronick, Catrina; Magrini, Vincent; Demeter, Ryan T.; Miller, Christopher A.; Klco, Jeffery M.; Wilson, Richard K.; Ley, Timothy J.


    HOX genes are highly expressed in many acute myeloid leukemia (AML) samples, but the patterns of expression and associated regulatory mechanisms are not clearly understood. We analyzed RNA sequencing data from 179 primary AML samples and normal hematopoietic cells to understand the range of expression patterns in normal versus leukemic cells. HOX expression in AML was restricted to specific genes in the HOXA or HOXB loci, and was highly correlated with recurrent cytogenetic abnormalities. However, the majority of samples expressed a canonical set of HOXA and HOXB genes that was nearly identical to the expression signature of normal hematopoietic stem/progenitor cells (HSPCs). Transcriptional profiles at the HOX loci were similar between normal cells and AML samples, and involved bidirectional transcription at the center of each gene cluster. Epigenetic analysis of a subset of AML samples also identified common regions of chromatin accessibility in AML samples and normal CD34+ cells that displayed differences in methylation depending on HOX expression patterns. These data provide an integrated epigenetic view of the HOX gene loci in primary AML samples, and suggest that HOX expression in most AML samples represents a normal stem cell program that is controlled by epigenetic mechanisms at specific regulatory elements. PMID:25600023

  20. Exclusion of the neuronal nitric oxide synthase gene and the human achaete-scute homologue 1 gene as candidate loci for spinal cerebellar ataxia 2 (SCA2)

    SciTech Connect

    Twells, R.; Xu, W. |; Ball, D.


    The autosomal dominant ataxias are a heterogeneous group of disorders, characterized by progressive degeneration of the cerebellum, pons and inferior olives, as well as the spinal cord. We previously mapped the spinal cerebellar ataxia 2 locus (SCA2) to chromosome 12q23-24.1 in a large Cuban founder population, flanked by the markers D12S58 and PLA2. Anticipation is a common feature of this disorder and therefore we have examined genes in this region which contain trinucleotide repeat motifs as candidate loci for SCA2. The neuronal nitric oxide synthase gene (NOS) has recently been assigned to chromosome 12q24.2-24.3 by fluorescent in situ hybridization. Neuronal NOS is responsible for the production of nitric oxide, a neurotransmitter expressed in high levels in the cerebellum as well as other regions of the nervous system. We report here the identification and analysis of an (AAT){sub n} repeat motif in an intronic region of the neuronal NOS gene, genetic mapping data and its exclusion from being involved in SCA2. We also report the exclusion of the human achaete-scute homologue 1 gene (HASH1), instrumental in neurosensory development in mouse, from being involved in SCA2 by the analysis of a proximal (CAG){sub n} repeat motif in the Cuban pedigrees, and its genetic location on chromosome 12q.

  1. Restriction fragment length polymorphism within the class I gene loci of the equine major histocompatibility complex

    SciTech Connect

    Alexander, A.J.; Bailey, E.; Woodward, J.G.


    Fourteen standard bred horses were serotyped as homozygous for 1 of 6 Equine Leukocyte Antigen (ELA) specificities. DNA was purified from peripheral leukocytes and digested with Hind III or Pvu II. Southern blot hybridization analysis was carried out using a /sup 32/P-labeled mouse cDNA probe (PH2IIa) specific for class I MHC genes. Both enzymes generated blots that contained a large number of bands (23 to 30) per horse. Significant polymorphism existed among most fragment sizes, while a dozen highly conserved band sizes suggested the presence of Qa/tla - like genes. Only 2 animals (both W6's) showed identical band patterns. Polymorphism was greatest between horses of different serotypes and was significantly decreased within serotypes. Unique bands were present on both blots for both W1's and W6's and may account for the serologic specificity seen in ELA W1 and W6 horses. This study is consistent with the findings in other higher vertebrates and implies that the MHC of the horse includes a highly polymorphic class I multigene family.

  2. Coding Gene Single Nucleotide Polymorphism Mapping and Quantitative Trait Loci Detection for Physiological Reproductive Traits in Brook Charr, Salvelinus fontinalis

    PubMed Central

    Sauvage, Christopher; Vagner, Marie; Derôme, Nicolas; Audet, Céline; Bernatchez, Louis


    A linkage map of 40 linkage groups (LGs) was developed for brook charr, Salvelinus fontinalis, using an F2 interstrain hybrid progeny (n = 171) and 256 coding gene SNP developed specifically for brook charr and validated from a large (>1000) subset of putative SNP, as well as 81 microsatellite markers. To identify quantitative trait loci (QTL) related to reproduction functions, these fish were also phenotyped at six physiological traits, including spermatozoid head diameter, sperm concentration, plasma testosterone, plasma 11-keto-testosterone, egg diameter, and plasma 17β-estradiol. Five significant QTL were detected over four LGs for egg diameter and plasma 17β-estradiol concentration in females, and sperm concentration as well as spermatozoid head diameter in males. In females, two different QTLs located on LG 11 and LG 34 were associated with the egg number, whereas one QTL was associated with plasma 17β-estradiol concentration (LG 8). Their total percent variance explained (PVE) was 26.7% and 27.6%, respectively. In males, two QTL were also detected for the sperm concentration, and their PVE were estimated at 18.58% and 14.95%, respectively. The low QTL number, associated with the high PVE, suggests that the variance in these reproductive physiological traits was either under the control of one major gene or a small number of genes. The QTL associated with sperm concentration, plasma 17β-estradiol, and egg diameter appeared to be under a dominance effect, whereas the two others were under a negative additive effect. These results show that genes underlying the phenotypic variance of these traits are under different modes of action (additive vs. dominance) and may be used to predict an increase or a decrease in their phenotypic values in subsequent generations of selective breeding. Moreover, this newly developed panel of mapped SNP located in coding gene regions will be useful for screening wild populations, especially in the context of investigating the

  3. Anonymous marker loci within 400 kb of HLA-A generate haplotypes in linkage disequilibrium with the hemochromatosis gene (HFE)

    SciTech Connect

    Yaouanq, J.; Perichon, M.; Treut, A.L.; Kahloun, A.E.; Mauvieux, V.; Blayau, M.; Jouanolle, A.M.; Chauvel, B.; Le Gall, J.Y.; David, V. )


    The hemochromatosis gene (HFE) maps to 6p21.3 and is less than 1 cM from the HLA class I gene; however, the precise physical location of the gene has remained elusive and controversial. The unambiguous identification of a crossover event within hemochromatosis families is very difficult; it is particularly hampered by the variability of the phenotypic expression as well as by the sex- and age-related penetrance of the disease. For these considerations, traditional linkage analysis could prove of limited value in further refining the extrapolated physical position of HFE. The authors therefore embarked upon a linkage-disequilibrium analysis of HFE and normal chromosomes for the Brittany population. In this report, 66 hemochromatosis families yielding 151 hemochromatosis chromosomes and 182 normal chromosomes were RFLP-typed with a battery of probes, including two newly derived polymorphic markers from the 6.7 and HLA-F loci located 150 and 250 kb telomeric to HLA-A, respectively. The results suggest a strong peak of existing linkage disequilibrium focused within the i82-to-6.7 interval (approximately 250 kb). The zone of linkage disequilibrium is flanked by the i97 locus, positioned 30 kb proximal to i82, and the HLA-F gene, found 250 kb distal to HLA-A, markers of which display no significant association with HFE. These data support the possibility that HFE resides within the 400-kb expanse of DNA between i97 and HLA-F. Alternatively, the very tight association of HLA-A3 and allele 1 of the 6.7 locus, both of which are comprised by the major ancestral or founder HFE haplotype in Brittany, supports the possibility that the disease gene may reside immediately telomeric to the 6.7 locus within the linkage-disequilibrium zone. Additionally, hemochromatosis haplotypes possessing HLA-A11 and the low-frequency HLA-F polymorphism (allele 2) are supportive of a separate founder chromosome containing a second, independently arising mutant allele. 69 refs., 1 fig., 5 tabs.

  4. Association between Gene Polymorphisms of Seven Newly Identified Loci and Type 2 Diabetes and the Correlate Quantitative Traits in Chinese Dong Populations

    PubMed Central

    LIU, Liya; CHEN, Lizhang; LI, Zhanzhan; LI, Liang; QU, Jian; XUE, Jing


    Abstract Background There are much heterogeneity in the genetic variation of type 2 diabetes (T2D). The purpose of this study was to investigate the association of seven novel genetic loci identified in a recent genome-wide association studies (GWAS) with T2D in Chinese Dong populations. Methods A case-controlled study was performed in individuals of Chinese Dong nationality. The genotypes of PARD3B (rs849230), LOC729993 (rs149228), EPHA4 (rs16862811), HNT (rs3099797), PTPRD (rs17584499 and rs649891), TOMM7 (rs2240727) genes were determined using Multiplex PCR-SNaPshot. The independent association between each polymorphism and T2D was assessed using unconditional binary logistic regression analysis (BLR). Results A total of 136 cases of T2D and 136 control subjects were enrolled in the study. The polymorphism of rs2240727 in TOMM7 gene was associated with T2D (odds ratio (OR) = 1.65, per copy of the risk T allele, P = 0.004). In addition, CT and TT were risk genotypes for T2D (OR (95% CIs):2.64 (1.28-5.45) and 3.42 (1.58-7.41) respectively). After correcting for multiple testing, the above results remained significant (all P < 0.05). After adjusting for the confounders of age, gender, and BMI, the association between T2D and rs2240727 remained significant (P < 0.01). There were significantly statistical difference in levels of fasting plasm glucose(FPG) among genotypes of rs2240727 in controls and patients, the levels of FPG were significantly higher in CT and TT genotypes than in CC genotype in both groups (all P < 0.05). Conclusions The rs2240727 genetic variant in TOMM7 was associated with T2D of Chinese Dong individuals, and might enhance the risk of T2D by affecting the level of FPG. PMID:26060696

  5. Histone Gene Multiplicity and Position Effect Variegation in DROSOPHILA MELANOGASTER

    PubMed Central

    Moore, Gerald D.; Sinclair, Donald A.; Grigliatti, Thomas A.


    The histone genes of wild-type Drosophila melanogaster are reiterated 100–150 times per haploid genome and are located in the segment of chromosome 2 that corresponds to polytene bands 39D2-3 to E1-2. The influence of altered histone gene multiplicity on chromatin structure has been assayed by measuring modification of the gene inactivation associated with position effect variegation in genotypes bearing deletions of the 39D-E segment. The proportion of cells in which a variegating gene is active is increased in genotypes that are heterozygous for a deficiency that removes the histone gene complex. Deletions that remove segments adjacent to the histone gene complex have no effect on the expression of variegating genes. Suppression of position effect variegation associated with reduction of histone gene multiplicity applies to both X-linked and autosomal variegating genes. Position effects exerted by both autosomal and sex-chromosome heterochromatin were suppressible by deletions of the histone gene complex. The suppression was independent of the presence of the Y chromosome. A deficiency that deletes only the distal portion of the histone gene complex also has the ability to suppress position effect variegation. Duplication of the histone gene complex did not enhance position effect variegation. Deletion or duplication of the histone gene complex in the maternal genome had no effect on the extent of variegation in progeny whose histone gene multiplicity was normal. These results are discussed with respect to current knowledge of the organization of the histone gene complex and control of its expression. PMID:17246163

  6. Multiple Avirulence Loci and Allele-Specific Effector Recognition Control the Pm3 Race-Specific Resistance of Wheat to Powdery Mildew[OPEN

    PubMed Central

    Roffler, Stefan; Stirnweis, Daniel; Treier, Georges; Herren, Gerhard; Korol, Abraham B.; Wicker, Thomas


    In cereals, several mildew resistance genes occur as large allelic series; for example, in wheat (Triticum aestivum and Triticum turgidum), 17 functional Pm3 alleles confer agronomically important race-specific resistance to powdery mildew (Blumeria graminis). The molecular basis of race specificity has been characterized in wheat, but little is known about the corresponding avirulence genes in powdery mildew. Here, we dissected the genetics of avirulence for six Pm3 alleles and found that three major Avr loci affect avirulence, with a common locus_1 involved in all AvrPm3-Pm3 interactions. We cloned the effector gene AvrPm3a2/f2 from locus_2, which is recognized by the Pm3a and Pm3f alleles. Induction of a Pm3 allele-dependent hypersensitive response in transient assays in Nicotiana benthamiana and in wheat demonstrated specificity. Gene expression analysis of Bcg1 (encoded by locus_1) and AvrPm3 a2/f2 revealed significant differences between isolates, indicating that in addition to protein polymorphisms, expression levels play a role in avirulence. We propose a model for race specificity involving three components: an allele-specific avirulence effector, a resistance gene allele, and a pathogen-encoded suppressor of avirulence. Thus, whereas a genetically simple allelic series controls specificity in the plant host, recognition on the pathogen side is more complex, allowing flexible evolutionary responses and adaptation to resistance genes. PMID:26452600

  7. Nucleotide variation and balancing selection at the Ckma gene in Atlantic cod: analysis with multiple merger coalescent models

    PubMed Central

    Halldórsdóttir, Katrín


    High-fecundity organisms, such as Atlantic cod, can withstand substantial natural selection and the entailing genetic load of replacing alleles at a number of loci due to their excess reproductive capacity. High-fecundity organisms may reproduce by sweepstakes leading to highly skewed heavy-tailed offspring distribution. Under such reproduction the Kingman coalescent of binary mergers breaks down and models of multiple merger coalescent are more appropriate. Here we study nucleotide variation at the Ckma (Creatine Kinase Muscle type A) gene in Atlantic cod. The gene shows extreme differentiation between the North (Canada, Greenland, Iceland, Norway, Barents Sea) and the South (Faroe Islands, North-, Baltic-, Celtic-, and Irish Seas) with FST > 0.8 between regions whereas neutral loci show no differentiation. This is evidence of natural selection. The protein sequence is conserved by purifying selection whereas silent and non-coding sites show extreme differentiation. The unfolded site-frequency spectrum has three modes, a mode at singleton sites and two high frequency modes at opposite frequencies representing divergent branches of the gene genealogy that is evidence for balancing selection. Analysis with multiple-merger coalescent models can account for the high frequency of singleton sites and indicate reproductive sweepstakes. Coalescent time scales vary with population size and with the inverse of variance in offspring number. Parameter estimates using multiple-merger coalescent models show that times scales are faster than under the Kingman coalescent. PMID:25755922

  8. Nucleotide variation and balancing selection at the Ckma gene in Atlantic cod: analysis with multiple merger coalescent models.


    Árnason, Einar; Halldórsdóttir, Katrín


    High-fecundity organisms, such as Atlantic cod, can withstand substantial natural selection and the entailing genetic load of replacing alleles at a number of loci due to their excess reproductive capacity. High-fecundity organisms may reproduce by sweepstakes leading to highly skewed heavy-tailed offspring distribution. Under such reproduction the Kingman coalescent of binary mergers breaks down and models of multiple merger coalescent are more appropriate. Here we study nucleotide variation at the Ckma (Creatine Kinase Muscle type A) gene in Atlantic cod. The gene shows extreme differentiation between the North (Canada, Greenland, Iceland, Norway, Barents Sea) and the South (Faroe Islands, North-, Baltic-, Celtic-, and Irish Seas) with FST > 0.8 between regions whereas neutral loci show no differentiation. This is evidence of natural selection. The protein sequence is conserved by purifying selection whereas silent and non-coding sites show extreme differentiation. The unfolded site-frequency spectrum has three modes, a mode at singleton sites and two high frequency modes at opposite frequencies representing divergent branches of the gene genealogy that is evidence for balancing selection. Analysis with multiple-merger coalescent models can account for the high frequency of singleton sites and indicate reproductive sweepstakes. Coalescent time scales vary with population size and with the inverse of variance in offspring number. Parameter estimates using multiple-merger coalescent models show that times scales are faster than under the Kingman coalescent. PMID:25755922

  9. Migration and Gene Flow Among Domestic Populations of the Chagas Insect Vector Triatoma dimidiata (Hemiptera: Reduviidae) Detected by Microsatellite Loci

    PubMed Central

    Stevens, Lori; Monroy, M. Carlota; Rodas, Antonieta Guadalupe; Hicks, Robin M.; Lucero, David E.; Lyons, Leslie A.; Dorn, Patricia L.


    Triatoma dimidiata (Latreille, 1811) is the most abundant and significant insect vector of the parasite Trypanosoma cruzi in Central America, and particularly in Guatemala. Tr. cruzi is the causative agent of Chagas disease, and successful disease control requires understanding the geographic distribution and degree of migration of vectors such as T. dimidiata that frequently re-infest houses within months following insecticide application. The population genetic structure of T. dimidiata collected from six villages in southern Guatemala was studied to gain insight into the migration patterns of the insects in this region where populations are largely domestic. This study provided insight into the likelihood of eliminating T. dimidiata by pesticide application as has been observed in some areas for other domestic triatomines such as Triatoma infestans. Genotypes of microsatellite loci for 178 insects from six villages were found to represent five genetic clusters using a Bayesian Markov Chain Monte Carlo method. Individual clusters were found in multiple villages, with multiple clusters in the same house. Although migration occurred, there was statistically significant genetic differentiation among villages (FRT = 0.05) and high genetic differentiation among houses within villages (FSR = 0.11). Relatedness of insects within houses varied from 0 to 0.25, i.e., from unrelated to half-sibs. The results suggest that T. dimidiata in southern Guatemala moves between houses and villages often enough that recolonization is likely, implying the use of insecticides alone is not sufficient for effective control of Chagas disease in this region and more sustainable solutions are required. PMID:26334816

  10. Expression of DNA methylation genes in secondary progressive multiple sclerosis.


    Fagone, Paolo; Mangano, Katia; Di Marco, Roberto; Touil-Boukoffa, Chafia; Chikovan, Tinatin; Signorelli, Santo; Lombardo, Giuseppe A G; Patti, Francesco; Mammana, Santa; Nicoletti, Ferdinando


    Multiple sclerosis (MS) is an immunoinflammatory disease of the central nervous system that seems to be influenced by DNA methylation. We sought to explore the expression pattern of genes involved in the control of DNA methylation in Secondary Progressive (SP) MS patients' PBMCs. We have found that SP MS is characterized by a significant upregulation of two genes belonging to the MBD family genes, MBD2 and MBD4, and by a downregulation of TDG and TET3. PMID:26711572

  11. Multiple type 2 diabetes susceptibility genes following genome-wide association scan in UK samples

    PubMed Central

    Zeggini, Eleftheria; Weedon, Michael N.; Lindgren, Cecilia M.; Frayling, Timothy M.; Elliott, Katherine S.; Lango, Hana; Timpson, Nicholas J.; Perry, John R.B.; Rayner, Nigel W.; Freathy, Rachel M.; Barrett, Jeffrey C.; Shields, Beverley; Morris, Andrew P.; Ellard, Sian; Groves, Christopher J.; Harries, Lorna W.; Marchini, Jonathan L.; Owen, Katharine R.; Knight, Beatrice; Cardon, Lon R.; Walker, Mark; Hitman, Graham A.; Morris, Andrew D.; Doney, Alex S.F.; McCarthy, Mark I.; Hattersley, Andrew T.


    The molecular mechanisms involved in the development of type 2 diabetes are poorly understood. Starting from genome-wide genotype data for 1,924 diabetic cases and 2,938 population controls generated by the Wellcome Trust Case Control Consortium, we set out to detect replicated diabetes association signals through analysis of 3,757 additional cases and 5,346 controls, and by integration of our findings with equivalent data from other international consortia. We detected diabetes susceptibility loci in and around the genes CDKAL1, CDKN2A/CDKN2B and IGF2BP2 and confirmed the recently described associations at HHEX/IDE and SLC30A8. Our findings provide insights into the genetic architecture of type 2 diabetes, emphasizing the contribution of multiple variants of modest effect. The regions identified underscore the importance of pathways influencing pancreatic beta cell development and function in the etiology of type 2 diabetes. PMID:17463249

  12. Integration of gene-based markers in a pearl millet genetic map for identification of candidate genes underlying drought tolerance quantitative trait loci

    PubMed Central


    Background Identification of genes underlying drought tolerance (DT) quantitative trait loci (QTLs) will facilitate understanding of molecular mechanisms of drought tolerance, and also will accelerate genetic improvement of pearl millet through marker-assisted selection. We report a map based on genes with assigned functional roles in plant adaptation to drought and other abiotic stresses and demonstrate its use in identifying candidate genes underlying a major DT-QTL. Results Seventy five single nucleotide polymorphism (SNP) and conserved intron spanning primer (CISP) markers were developed from available expressed sequence tags (ESTs) using four genotypes, H 77/833-2, PRLT 2/89-33, ICMR 01029 and ICMR 01004, representing parents of two mapping populations. A total of 228 SNPs were obtained from 30.5 kb sequenced region resulting in a SNP frequency of 1/134 bp. The positions of major pearl millet linkage group (LG) 2 DT-QTLs (reported from crosses H 77/833-2 × PRLT 2/89-33 and 841B × 863B) were added to the present consensus function map which identified 18 genes, coding for PSI reaction center subunit III, PHYC, actin, alanine glyoxylate aminotransferase, uridylate kinase, acyl-CoA oxidase, dipeptidyl peptidase IV, MADS-box, serine/threonine protein kinase, ubiquitin conjugating enzyme, zinc finger C- × 8-C × 5-C × 3-H type, Hd3, acetyl CoA carboxylase, chlorophyll a/b binding protein, photolyase, protein phosphatase1 regulatory subunit SDS22 and two hypothetical proteins, co-mapping in this DT-QTL interval. Many of these candidate genes were found to have significant association with QTLs of grain yield, flowering time and leaf rolling under drought stress conditions. Conclusions We have exploited available pearl millet EST sequences to generate a mapped resource of seventy five new gene-based markers for pearl millet and demonstrated its use in identifying candidate genes underlying a major DT-QTL in this species. The reported gene-based markers represent

  13. Comparison of CDC and sequence-based molecular typing of syphilis treponemes: tpr and arp loci are variable in multiple samples from the same patient

    PubMed Central


    Background Molecular typing of syphilis-causing strains provides important epidemiologic data. We tested whether identified molecular subtypes were identical in PCR-positive parallel samples taken from the same patient at a same time. We also tested whether subtype prevalence differs in skin and blood samples. Results Eighteen syphilis positive patients (showing both positive serology and PCR), with two PCR-typeable parallel samples taken at the same time, were tested with both CDC (Centers for Disease Control and Prevention) and sequence-based typing. Samples taken from 9 of 18 patients were completely typed for TP0136, TP0548, 23S rDNA, arp, and tpr loci. The CDC typing revealed 11 distinct genotypes while the sequence-based typing identified 6 genotypes. When results from molecular typing of TP0136, TP0548, and 23S rDNA were analyzed in samples taken from the same patient, no discrepancies in the identified genotypes were found; however, there were discrepancies in 11 of 18 patients (61.1%) samples relative to the arp and tpr loci. In addition to the above described typing, 127 PCR-positive swabs and whole blood samples were tested for individual genotype frequencies. The repetition number for the arp gene was lower in whole blood (WB) samples compared to swab samples. Similarly, the most common tpr RFLP type “d” was found to have lower occurrence rates in WB samples while type “e” had an increased occurrence in these samples. Conclusions Differences in the CDC subtypes identified in parallel samples indicated genetic instability of the arp and tpr loci and suggested limited applicability of the CDC typing system in epidemiological studies. Differences in treponemal genotypes detected in whole blood and swab samples suggested important differences between both compartments and/or differences in adherence of treponeme variants to human cells. PMID:23898829

  14. The Role of Multiple Transcription Factors In Archaeal Gene Expression

    SciTech Connect

    Charles J. Daniels


    Since the inception of this research program, the project has focused on two central questions: What is the relationship between the 'eukaryal-like' transcription machinery of archaeal cells and its counterparts in eukaryal cells? And, how does the archaeal cell control gene expression using its mosaic of eukaryal core transcription machinery and its bacterial-like transcription regulatory proteins? During the grant period we have addressed these questions using a variety of in vivo approaches and have sought to specifically define the roles of the multiple TATA binding protein (TBP) and TFIIB-like (TFB) proteins in controlling gene expression in Haloferax volcanii. H. volcanii was initially chosen as a model for the Archaea based on the availability of suitable genetic tools; however, later studies showed that all haloarchaea possessed multiple tbp and tfb genes, which led to the proposal that multiple TBP and TFB proteins may function in a manner similar to alternative sigma factors in bacterial cells. In vivo transcription and promoter analysis established a clear relationship between the promoter requirements of haloarchaeal genes and those of the eukaryal RNA polymerase II promoter. Studies on heat shock gene promoters, and the demonstration that specific tfb genes were induced by heat shock, provided the first indication that TFB proteins may direct expression of specific gene families. The construction of strains lacking tbp or tfb genes, coupled with the finding that many of these genes are differentially expressed under varying growth conditions, provided further support for this model. Genetic tools were also developed that led to the construction of insertion and deletion mutants, and a novel gene expression scheme was designed that allowed the controlled expression of these genes in vivo. More recent studies have used a whole genome array to examine the expression of these genes and we have established a linkage between the expression of specific tfb

  15. Regulation of gene expression in autoimmune disease loci and the genetic basis of proliferation in CD4+ effector memory T cells.


    Hu, Xinli; Kim, Hyun; Raj, Towfique; Brennan, Patrick J; Trynka, Gosia; Teslovich, Nikola; Slowikowski, Kamil; Chen, Wei-Min; Onengut, Suna; Baecher-Allan, Clare; De Jager, Philip L; Rich, Stephen S; Stranger, Barbara E; Brenner, Michael B; Raychaudhuri, Soumya


    Genome-wide association studies (GWAS) and subsequent dense-genotyping of associated loci identified over a hundred single-nucleotide polymorphism (SNP) variants associated with the risk of rheumatoid arthritis (RA), type 1 diabetes (T1D), and celiac disease (CeD). Immunological and genetic studies suggest a role for CD4-positive effector memory T (CD+ TEM) cells in the pathogenesis of these diseases. To elucidate mechanisms of autoimmune disease alleles, we investigated molecular phenotypes in CD4+ effector memory T cells potentially affected by these variants. In a cohort of genotyped healthy individuals, we isolated high purity CD4+ TEM cells from peripheral blood, then assayed relative abundance, proliferation upon T cell receptor (TCR) stimulation, and the transcription of 215 genes within disease loci before and after stimulation. We identified 46 genes regulated by cis-acting expression quantitative trait loci (eQTL), the majority of which we detected in stimulated cells. Eleven of the 46 genes with eQTLs were previously undetected in peripheral blood mononuclear cells. Of 96 risk alleles of RA, T1D, and/or CeD in densely genotyped loci, eleven overlapped cis-eQTLs, of which five alleles completely explained the respective signals. A non-coding variant, rs389862A, increased proliferative response (p=4.75 × 10-8). In addition, baseline expression of seventeen genes in resting cells reliably predicted proliferative response after TCR stimulation. Strikingly, however, there was no evidence that risk alleles modulated CD4+ TEM abundance or proliferation. Our study underscores the power of examining molecular phenotypes in relevant cells and conditions for understanding pathogenic mechanisms of disease variants. PMID:24968232

  16. Population genetic structure of the African elephant in Uganda based on variation at mitochondrial and nuclear loci: evidence for male-biased gene flow.


    Nyakaana, S; Arctander, P


    A drastic decline has occurred in the size of the Uganda elephant population in the last 40 years, exacerbated by two main factors; an increase in the size of the human population and poaching for ivory. One of the attendant consequences of such a decline is a reduction in the amount of genetic diversity in the surviving populations due to increased effects of random genetic drift. Information about the amount of genetic variation within and between the remaining populations is vital for their future conservation and management. The genetic structure of the African elephant in Uganda was examined using nucleotide variation of mitochondrial control region sequences and four nuclear microsatellite loci in 72 individuals from three localities. Eleven mitochondrial DNA (mtDNA) haplotypes were observed, nine of which were geographically localized. We found significant genetic differentiation between the three populations at the mitochondrial locus while three out of the four microsatellite loci differentiated KV and QE, one locus differentiated KV and MF and no loci differentiated MF and QE. Expected heterozygosity at the four loci varied between 0.51 and 0.84 while nucleotide diversity at the mitochondrial locus was 1.4%. Incongruent patterns of genetic variation within and between populations were revealed by the two genetic systems, and we have explained these in terms of the differences in the effective population sizes of the two genomes and male-biased gene flow between populations.

  17. Population genetic structure of the African elephant in Uganda based on variation at mitochondrial and nuclear loci: evidence for male-biased gene flow.


    Nyakaana, S; Arctander, P


    A drastic decline has occurred in the size of the Uganda elephant population in the last 40 years, exacerbated by two main factors; an increase in the size of the human population and poaching for ivory. One of the attendant consequences of such a decline is a reduction in the amount of genetic diversity in the surviving populations due to increased effects of random genetic drift. Information about the amount of genetic variation within and between the remaining populations is vital for their future conservation and management. The genetic structure of the African elephant in Uganda was examined using nucleotide variation of mitochondrial control region sequences and four nuclear microsatellite loci in 72 individuals from three localities. Eleven mitochondrial DNA (mtDNA) haplotypes were observed, nine of which were geographically localized. We found significant genetic differentiation between the three populations at the mitochondrial locus while three out of the four microsatellite loci differentiated KV and QE, one locus differentiated KV and MF and no loci differentiated MF and QE. Expected heterozygosity at the four loci varied between 0.51 and 0.84 while nucleotide diversity at the mitochondrial locus was 1.4%. Incongruent patterns of genetic variation within and between populations were revealed by the two genetic systems, and we have explained these in terms of the differences in the effective population sizes of the two genomes and male-biased gene flow between populations. PMID:10447852

  18. Molecular phylogeny of the nettle family (Urticaceae) inferred from multiple loci of three genomes and extensive generic sampling.


    Wu, Zeng-Yuan; Monro, Alex K; Milne, Richard I; Wang, Hong; Yi, Ting-Shuang; Liu, Jie; Li, De-Zhu


    Urticaceae is one of the larger Angiosperm families, but relationships within it remain poorly known. This study presents the first densely sampled molecular phylogeny of Urticaceae, using maximum likelihood (ML), maximum parsimony (MP) and Bayesian inference (BI) to analyze the DNA sequence data from two nuclear (ITS and 18S), four chloroplast (matK, rbcL, rpll4-rps8-infA-rpl36, trnL-trnF) and one mitochondrial (matR) loci. We sampled 169 accessions representing 122 species, representing 47 of the 54 recognized genera within Urticaceae, including four of the six sometimes separated as Cecropiaceae. Major results included: (1) Urticaceae including Cecropiaceae was monophyletic; (2) Cecropiaceae was biphyletic, with both lineages nested within Urticaceae; (3) Urticaceae can be divided into four well-supported clades; (4) previously erected tribes or subfamilies were broadly supported, with some additions and alterations; (5) the monophyly of many genera was supported, whereas Boehmeria, Pellionia, Pouzolzia and Urera were clearly polyphyletic, while Urtica and Pilea each had a small genus nested within them; (6) relationships between genera were clarified, mostly with substantial support. These results clarify that some morphological characters have been overstated and others understated in previous classifications of the family, and provide a strong foundation for future studies on biogeography, character evolution, and circumscription of difficult genera.

  19. Antipsychotic Induced Gene Regulation in Multiple Brain Regions

    PubMed Central

    Girgenti, Matthew James; Nisenbaum, Laura K.; Bymaster, Franklin; Terwilliger, Rosemarie; Duman, Ronald S; Newton, Samuel Sathyanesan


    The molecular mechanism of action of antipsychotic drugs is not well understood. Their complex receptor affinity profiles indicate that their action could extend beyond dopamine receptor blockade. Single gene expression studies and high-throughput gene profiling have shown the induction of genes from several molecular classes and functional categories. Using a focused microarray approach we investigated gene regulation in rat striatum, frontal cortex and hippocampus after chronic administration of haloperidol or olanzapine. Regulated genes were validated by in-situ hybridization, realtime PCR and immunohistochemistry. Only limited overlap was observed in genes regulated by haloperidol and olanzapine. Both drugs elicited maximal gene regulation in the striatum and least in the hippocampus. Striatal gene induction by haloperidol was predominantly in neurotransmitter signaling, G-protein coupled receptors and transcription factors. Olanzapine prominently induced retinoic acid and trophic factor signaling genes in the frontal cortex. The data also revealed the induction of several genes that could be targeted in future drug development efforts. The study uncovered the induction of several novel genes, including somatostatin receptors and metabotropic glutamate receptors. The results demonstrating the regulation of multiple receptors and transcription factors suggests that both typical and atypical antipsychotics could possess a complex molecular mechanism of action. PMID:20070867

  20. Neuropeptide Y receptor gene y6: multiple deaths or resurrections?


    Starbäck, P; Wraith, A; Eriksson, H; Larhammar, D


    The neuropeptide Y family of G-protein-coupled receptors consists of five cloned members in mammals. Four genes give rise to functional receptors in all mammals investigated. The y6 gene is a pseudogene in human and pig and is absent in rat, but generates a functional receptor in rabbit and mouse and probably in the collared peccary (Pecari tajacu), a distant relative of the pig family. We report here that the guinea pig y6 gene has a highly distorted nucleotide sequence with multiple frame-shift mutations. One evolutionary scenario may suggest that y6 was inactivated before the divergence of the mammalian orders and subsequently resurrected in some lineages. However, the pseudogene mutations seem to be distinct in human, pig, and guinea pig, arguing for separate inactivation events. In either case, the y6 gene has a quite unusual evolutionary history with multiple independent deaths or resurrections.

  1. Reticulate evolution: frequent introgressive hybridization among chinese hares (genus lepus) revealed by analyses of multiple mitochondrial and nuclear DNA loci

    PubMed Central


    Background Interspecific hybridization may lead to the introgression of genes and genomes across species barriers and contribute to a reticulate evolutionary pattern and thus taxonomic uncertainties. Since several previous studies have demonstrated that introgressive hybridization has occurred among some species within Lepus, therefore it is possible that introgressive hybridization events also occur among Chinese Lepus species and contribute to the current taxonomic confusion. Results Data from four mtDNA genes, from 116 individuals, and one nuclear gene, from 119 individuals, provides the first evidence of frequent introgression events via historical and recent interspecific hybridizations among six Chinese Lepus species. Remarkably, the mtDNA of L. mandshuricus was completely replaced by mtDNA from L. timidus and L. sinensis. Analysis of the nuclear DNA sequence revealed a high proportion of heterozygous genotypes containing alleles from two divergent clades and that several haplotypes were shared among species, suggesting repeated and recent introgression. Furthermore, results from the present analyses suggest that Chinese hares belong to eight species. Conclusion This study provides a framework for understanding the patterns of speciation and the taxonomy of this clade. The existence of morphological intermediates and atypical mitochondrial gene genealogies resulting from frequent hybridization events likely contribute to the current taxonomic confusion of Chinese hares. The present study also demonstrated that nuclear gene sequence could offer a powerful complementary data set with mtDNA in tracing a complete evolutionary history of recently diverged species. PMID:21794180

  2. Multiplex SSR-PCR approaches for semi-automated genotyping and characterization of loci linked to blast disease resistance genes in rice.


    Ashkani, Sadegh; Rafii, Mohd Yusop; Shabanimofrad, Mahmoodreza; Foroughi, Majid; Azizia, Parisa; Akhtar, Mohd Sayeed; Sahebi, Mahbod; Harun, Abd Rahim; Nasehi, Abbas


    In the present study, 63 polymorphic microsatellite markers related to rice blast resistance genes were fluorescently labelled at the 5'-end with either 6-FAM or HEX using the G5 dye set and incorporated into a multiplex SSR-PCR for the detection of fragments using an automated system. For rice F3 families obtained from crosses between Pongsu Seribu 2 (Malaysian blast resistant cultivar) and Mahsuri (a susceptible rice cultivar), the genotypes for 13 designated multiplex SSR panels were determined. The genotyping assays were performed using a capillary-based ABIPRISM 3100 genetic analyser. The sizes of the SSRs alleles observed in the range from 79 to 324 bp. The observed marker segregation data were analysed using the Chi(2) test. A genetic linkage map covering ten chromosomes and comprising 63 polymorphic SSR markers was constructed, and the distorted loci were localised to linkage groups. The results indicated that distorted loci are presented on eight chromosomes. PMID:26318048

  3. Multiplex SSR-PCR approaches for semi-automated genotyping and characterization of loci linked to blast disease resistance genes in rice.


    Ashkani, Sadegh; Rafii, Mohd Yusop; Shabanimofrad, Mahmoodreza; Foroughi, Majid; Azizia, Parisa; Akhtar, Mohd Sayeed; Sahebi, Mahbod; Harun, Abd Rahim; Nasehi, Abbas


    In the present study, 63 polymorphic microsatellite markers related to rice blast resistance genes were fluorescently labelled at the 5'-end with either 6-FAM or HEX using the G5 dye set and incorporated into a multiplex SSR-PCR for the detection of fragments using an automated system. For rice F3 families obtained from crosses between Pongsu Seribu 2 (Malaysian blast resistant cultivar) and Mahsuri (a susceptible rice cultivar), the genotypes for 13 designated multiplex SSR panels were determined. The genotyping assays were performed using a capillary-based ABIPRISM 3100 genetic analyser. The sizes of the SSRs alleles observed in the range from 79 to 324 bp. The observed marker segregation data were analysed using the Chi(2) test. A genetic linkage map covering ten chromosomes and comprising 63 polymorphic SSR markers was constructed, and the distorted loci were localised to linkage groups. The results indicated that distorted loci are presented on eight chromosomes.

  4. Integrating genetic association, genetics of gene expression, and single nucleotide polymorphism set analysis to identify susceptibility Loci for type 2 diabetes mellitus.


    Greenawalt, Danielle M; Sieberts, Solveig K; Cornelis, Marilyn C; Girman, Cynthia J; Zhong, Hua; Yang, Xia; Guinney, Justin; Qi, Lu; Hu, Frank B


    Large-scale genome-wide association studies (GWAS) have identified over 40 genomic regions significantly associated with type 2 diabetes mellitus. However, GWAS results are not always straightforward to interpret, and linking these loci to meaningful disease etiology is often difficult without extensive follow-up studies. The authors expanded on previously reported type 2 diabetes mellitus GWAS from the nested case-control studies of 2 prospective US cohorts by incorporating expression single nucleotide polymorphism (SNP) information and applying SNP set enrichment analysis to identify sets of SNPs associated with genes that could provide further biologic insight to traditional genome-wide analysis. Using data collected between 1989 and 1994 in these previous studies to form a nested case-control study, the authors found that 3 of the most significantly associated SNPs to type 2 diabetes mellitus in their study are expression SNPs to the lymphocyte antigen 75 gene (LY75), the ubiquitin-specific peptidase 36 gene (USP36), and the phosphatidylinositol transfer protein, cytoplasmic 1 gene (PITPNC1). SNP set enrichment analysis of the GWAS results identified enrichment for expression SNPs to the macrophage-enriched module and the Gene Ontology (GO) biologic process fat cell differentiation human, which includes the transcription factor 7-like 2 gene (TCF7L2), as well as other type 2 diabetes mellitus-associated genes. Integrating genome-wide association, gene expression, and gene set analysis may provide valuable biologic support for potential type 2 diabetes mellitus susceptibility loci and may be useful in identifying new targets or pathways of interest for the treatment and prevention of type 2 diabetes mellitus.

  5. An investigation of gene-environment interactions between 47 newly identified breast cancer susceptibility loci and environmental risk factors

    PubMed Central

    Rudolph, Anja; Milne, Roger L.; Truong, Thérèse; Knight, Julia A.; Seibold, Petra; Flesch-Janys, Dieter; Behrens, Sabine; Eilber, Ursula; Bolla, Manjeet K.; Wang, Qin; Dennis, Joe; Dunning, Alison M.; Shah, Mitul; Munday, Hannah R.; Darabi, Hatef; Eriksson, Mikael; Brand, Judith S.; Olson, Janet; Vachon, Celine M.; Hallberg, Emily; Castelao, J. Esteban; Carracedo, Angel; Torres, Maria; Li, Jingmei; Humphreys, Keith; Cordina-Duverger, Emilie; Menegaux, Florence; Flyger, Henrik; Nordestgaard, Børge G.; Nielsen, Sune F.; Yesilyurt, Betul T.; Floris, Giuseppe; Leunen, Karin; Engelhardt, Ellen G.; Broeks, Annegien; Rutgers, Emiel J.; Glendon, Gord; Mulligan, Anna Marie; Cross, Simon; Reed, Malcolm; Gonzalez-Neira, Anna; Perez, José Ignacio Arias; Provenzano, Elena; Apicella, Carmel; Southey, Melissa C.; Spurdle, Amanda; Investigators, kConFab; Group, AOCS; Häberle, Lothar; Beckmann, Matthias W.; Ekici, Arif B.; Dieffenbach, Aida Karina; Arndt, Volker; Stegmaier, Christa; McLean, Catriona; Baglietto, Laura; Chanock, Stephen J.; Lissowska, Jolanta; Sherman, Mark E.; Brüning, Thomas; Hamann, Ute; Ko, Yon-Dschun; Orr, Nick; Schoemaker, Minouk; Ashworth, Alan; Kosma, Veli-Matti; Kataja, Vesa; Hartikainen, Jaana M.; Mannermaa, Arto; Swerdlow, Anthony; Giles, Graham G.; Brenner, Hermann; Fasching, Peter A.; Chenevix-Trench, Georgia; Hopper, John; Benítez, Javier; Cox, Angela; Andrulis, Irene L.; Lambrechts, Diether; Gago-Dominguez, Manuela; Couch, Fergus; Czene, Kamila; Bojesen, Stig E.; Easton, Doug F.; Schmidt, Marjanka K.; Guénel, Pascal; Hall, Per; Pharoah, Paul D. P.; Garcia-Closas, Montserrat; Chang-Claude, Jenny


    A large genotyping project within the Breast Cancer Association Consortium (BCAC) recently identified 41 associations between single nucleotide polymorphisms (SNPs) and overall breast cancer (BC) risk. We investigated whether the effects of these 41 SNPs, as well as six SNPs associated with estrogen receptor (ER) negative BC risk are modified by 13 environmental risk factors for BC. Data from 22 studies participating in BCAC were pooled, comprising up to 26,633 cases and 30,119 controls. Interactions between SNPs and environmental factors were evaluated using an empirical Bayes-type shrinkage estimator. Six SNPs showed interactions with associated p-values (pint) <1.1×10−3. None of the observed interactions was significant after accounting for multiple testing. The Bayesian False Discovery Probability was used to rank the findings, which indicated three interactions as being noteworthy at 1% prior probability of interaction. SNP rs6828523 was associated with increased ER-negative BC risk in women ≥170cm (OR=1.22, p=0.017), but inversely associated with ER-negative BC risk in women <160cm (OR=0.83, p=0.039, pint=1.9×10−4). The inverse association between rs4808801 and overall BC risk was stronger for women who had had four or more pregnancies (OR=0.85, p=2.0×10−4), and absent in women who had had just one (OR=0.96, p=0.19, pint = 6.1×10−4). SNP rs11242675 was inversely associated with overall BC risk in never/former smokers (OR=0.93, p=2.8×10−5), but no association was observed in current smokers (OR=1.07, p=0.14, pint = 3.4×10−4). In conclusion, recently identified breast cancer susceptibility loci are not strongly modified by established risk factors and the observed potential interactions require confirmation in independent studies. PMID:25227710

  6. Investigation of gene-environment interactions between 47 newly identified breast cancer susceptibility loci and environmental risk factors.


    Rudolph, Anja; Milne, Roger L; Truong, Thérèse; Knight, Julia A; Seibold, Petra; Flesch-Janys, Dieter; Behrens, Sabine; Eilber, Ursula; Bolla, Manjeet K; Wang, Qin; Dennis, Joe; Dunning, Alison M; Shah, Mitul; Munday, Hannah R; Darabi, Hatef; Eriksson, Mikael; Brand, Judith S; Olson, Janet; Vachon, Celine M; Hallberg, Emily; Castelao, J Esteban; Carracedo, Angel; Torres, Maria; Li, Jingmei; Humphreys, Keith; Cordina-Duverger, Emilie; Menegaux, Florence; Flyger, Henrik; Nordestgaard, Børge G; Nielsen, Sune F; Yesilyurt, Betul T; Floris, Giuseppe; Leunen, Karin; Engelhardt, Ellen G; Broeks, Annegien; Rutgers, Emiel J; Glendon, Gord; Mulligan, Anna Marie; Cross, Simon; Reed, Malcolm; Gonzalez-Neira, Anna; Arias Perez, José Ignacio; Provenzano, Elena; Apicella, Carmel; Southey, Melissa C; Spurdle, Amanda; Häberle, Lothar; Beckmann, Matthias W; Ekici, Arif B; Dieffenbach, Aida Karina; Arndt, Volker; Stegmaier, Christa; McLean, Catriona; Baglietto, Laura; Chanock, Stephen J; Lissowska, Jolanta; Sherman, Mark E; Brüning, Thomas; Hamann, Ute; Ko, Yon-Dschun; Orr, Nick; Schoemaker, Minouk; Ashworth, Alan; Kosma, Veli-Matti; Kataja, Vesa; Hartikainen, Jaana M; Mannermaa, Arto; Swerdlow, Anthony; Giles, Graham G; Brenner, Hermann; Fasching, Peter A; Chenevix-Trench, Georgia; Hopper, John; Benítez, Javier; Cox, Angela; Andrulis, Irene L; Lambrechts, Diether; Gago-Dominguez, Manuela; Couch, Fergus; Czene, Kamila; Bojesen, Stig E; Easton, Doug F; Schmidt, Marjanka K; Guénel, Pascal; Hall, Per; Pharoah, Paul D P; Garcia-Closas, Montserrat; Chang-Claude, Jenny


    A large genotyping project within the Breast Cancer Association Consortium (BCAC) recently identified 41 associations between single nucleotide polymorphisms (SNPs) and overall breast cancer (BC) risk. We investigated whether the effects of these 41 SNPs, as well as six SNPs associated with estrogen receptor (ER) negative BC risk are modified by 13 environmental risk factors for BC. Data from 22 studies participating in BCAC were pooled, comprising up to 26,633 cases and 30,119 controls. Interactions between SNPs and environmental factors were evaluated using an empirical Bayes-type shrinkage estimator. Six SNPs showed interactions with associated p-values (pint ) <1.1 × 10(-3) . None of the observed interactions was significant after accounting for multiple testing. The Bayesian False Discovery Probability was used to rank the findings, which indicated three interactions as being noteworthy at 1% prior probability of interaction. SNP rs6828523 was associated with increased ER-negative BC risk in women ≥170 cm (OR = 1.22, p = 0.017), but inversely associated with ER-negative BC risk in women <160 cm (OR = 0.83, p = 0.039, pint = 1.9 × 10(-4) ). The inverse association between rs4808801 and overall BC risk was stronger for women who had had four or more pregnancies (OR = 0.85, p = 2.0 × 10(-4) ), and absent in women who had had just one (OR = 0.96, p = 0.19, pint = 6.1 × 10(-4) ). SNP rs11242675 was inversely associated with overall BC risk in never/former smokers (OR = 0.93, p = 2.8 × 10(-5) ), but no association was observed in current smokers (OR = 1.07, p = 0.14, pint = 3.4 × 10(-4) ). In conclusion, recently identified BC susceptibility loci are not strongly modified by established risk factors and the observed potential interactions require confirmation in independent studies.

  7. Identification and Characterization of Sex-Associated Loci in Sockeye Salmon Using Genotyping-by-Sequencing and Comparison with a Sex-Determining Assay Based on the sdY Gene.


    Larson, Wesley A; McKinney, Garrett J; Seeb, James E; Seeb, Lisa W


    Loci that can be used to screen for sex in salmon can provide important information for study of both wild and cultured populations. Here, we tested for associations between sex and genotypes at thousands of loci available from a genotyping-by-sequencing (GBS) dataset to discover sex-associated loci in sockeye salmon (Oncorhynchus nerka). We discovered 7 sex-associated loci, developed high-throughput assays for 2 loci, and tested the utility of these 2 assays in 8 collections of sockeye salmon sampled throughout North America. We also screened an existing assay based on the master sex-determining gene in salmon (sdY) in these collections. The ability of GBS-derived loci to assign fish to their phenotypic sex varied substantially among collections suggesting that recombination between the loci that we discovered and the sex-determining gene has occurred. Assignment accuracy to phenotypic sex was much higher with the sdY assay but was still less than 100%. Alignment of sequences from GBS-derived loci to draft genomes for 2 salmonids provided strong evidence that many of these loci are found on chromosomes orthologous to the known sex chromosome in sockeye salmon. Our study is the first to describe the approximate location of the sex-determining region in sockeye salmon and indicates that sdY is also the master sex-determining gene in this species. However, discordances between sdY genotypes and phenotypic sex and the variable performance of GBS-derived loci warrant more research. PMID:27417855

  8. Identification and Characterization of Sex-Associated Loci in Sockeye Salmon Using Genotyping-by-Sequencing and Comparison with a Sex-Determining Assay Based on the sdY Gene.


    Larson, Wesley A; McKinney, Garrett J; Seeb, James E; Seeb, Lisa W


    Loci that can be used to screen for sex in salmon can provide important information for study of both wild and cultured populations. Here, we tested for associations between sex and genotypes at thousands of loci available from a genotyping-by-sequencing (GBS) dataset to discover sex-associated loci in sockeye salmon (Oncorhynchus nerka). We discovered 7 sex-associated loci, developed high-throughput assays for 2 loci, and tested the utility of these 2 assays in 8 collections of sockeye salmon sampled throughout North America. We also screened an existing assay based on the master sex-determining gene in salmon (sdY) in these collections. The ability of GBS-derived loci to assign fish to their phenotypic sex varied substantially among collections suggesting that recombination between the loci that we discovered and the sex-determining gene has occurred. Assignment accuracy to phenotypic sex was much higher with the sdY assay but was still less than 100%. Alignment of sequences from GBS-derived loci to draft genomes for 2 salmonids provided strong evidence that many of these loci are found on chromosomes orthologous to the known sex chromosome in sockeye salmon. Our study is the first to describe the approximate location of the sex-determining region in sockeye salmon and indicates that sdY is also the master sex-determining gene in this species. However, discordances between sdY genotypes and phenotypic sex and the variable performance of GBS-derived loci warrant more research.

  9. Genome-wide quantitative trait locus mapping identifies multiple major loci for brittle rachis and threshability in Tibetan semi-wild wheat (Triticum aestivum ssp. tibetanum Shao).


    Jiang, Yun-Feng; Lan, Xiu-Jin; Luo, Wei; Kong, Xing-Chen; Qi, Peng-Fei; Wang, Ji-Rui; Wei, Yu-Ming; Jiang, Qian-Tao; Liu, Ya-Xi; Peng, Yuan-Ying; Chen, Guo-Yue; Dai, Shou-Fen; Zheng, You-Liang


    Tibetan semi-wild wheat (Triticum aestivum ssp. tibetanum Shao) is a semi-wild hexaploid wheat resource that is only naturally distributed in the Qinghai-Tibet Plateau. Brittle rachis and hard threshing are two important characters of Tibetan semi-wild wheat. A whole-genome linkage map of T. aestivum ssp. tibetanum was constructed using a recombinant inbred line population (Q1028×ZM9023) with 186 lines, 564 diversity array technology markers, and 117 simple sequence repeat markers. Phenotypic data on brittle rachis and threshability, as two quantitative traits, were evaluated on the basis of the number of average spike rachis fragments per spike and percent threshability in 2012 and 2013, respectively. Quantitative trait locus (QTL) mapping performed using inclusive composite interval mapping analysis clearly identified four QTLs for brittle rachis and three QTLs for threshability. However, three loci on 2DS, 2DL, and 5AL showed pleiotropism for brittle rachis and threshability; they respectively explained 5.3%, 18.6%, and 18.6% of phenotypic variation for brittle rachis and 17.4%, 13.2%, and 35.2% of phenotypic variation for threshability. A locus on 3DS showed an independent effect on brittle rachis, which explained 38.7% of the phenotypic variation. The loci on 2DS and 3DS probably represented the effect of Tg and Br1, respectively. The locus on 5AL was in very close proximity to the Q gene, but was different from the predicted q in Tibetan semi-wild wheat. To our knowledge, the locus on 2DL has never been reported in common wheat but was prominent in T. aestivum ssp. tibetanum accession Q1028. It remarkably interacted with the locus on 5AL to affect brittle rachis. Several major loci for brittle rachis and threshability were identified in Tibetan semi-wild wheat, improving the understanding of these two characters and suggesting the occurrence of special evolution in Tibetan semi-wild wheat.

  10. Comparison of KIR gene content profiles revealed a difference between northern and southern Persians in the distribution of KIR2DS5 and its linked loci.


    Solgi, Ghasem; Ghafari, Hamidreza; Ashouri, Elham; Alimoghdam, Kamran; Rajalingam, Raja; Amirzargar, Aliakbar


    Killer cell immunoglobulin-like receptors (KIR) are the key receptors of human natural killer (NK) cells that mount an early immune response against infection and tumors. The number and type of KIR genes are substantially variable between individuals and populations. Recently we reported KIR gene content diversity in a Persian population living in the southern province of Fars, which is comparable to that of European Caucasians. These results are consistent with the ethnic ancestry and affinity between Persians and Caucasians. Herein we analyzed another Persian population living in the northern province of Tehran and discovered an unexpected increase in the distribution of KIR2DS5 and its linked loci KIR3DS1, -2DS1, and -2DL5 in northern Persians compared with that reported in the southern Persian population. Although the geographic barriers may have limited the gene flow, the impact of the local environment on the natural selection of KIR2DS5 and its linked loci in the northern Persians cannot be completely ruled out. The difference in northern and southern populations in activating KIR gene content creates an appealing hypothesis that KIR2DS5-enriched northern Persians are more resistant to developing clinical conditions demonstrated to be associated with KIR2DS5, such as psoriasis vulgaris, endometriosis, ankylosing spondylitis, and acute rejection of kidney grafts, compared with those living in the southern part of the country. PMID:21867738

  11. Genome-wide search of the genes tagged with the consensus of 33.6 repeat loci in buffalo Bubalus bubalis employing minisatellite-associated sequence amplification.


    Pathak, Deepali; Srivastava, Jyoti; Samad, Rana; Parwez, Iqbal; Kumar, Sudhir; Ali, Sher


    Minisatellites have been implicated with chromatin organization and gene regulation, but mRNA transcripts tagged with these elements have not been systematically characterized. The aim of the present study was to gain an insight into the transcribing genes associated with consensus of 33.6 repeat loci across the tissues in water buffalo, Bubalus bubalis. Using cDNA from spermatozoa and eight different somatic tissues and an oligo primer based on two units of consensus of 33.6 repeat loci (5' CCTCCAGCCCTCCTCCAGCCCT 3'), we conducted minisatellite-associated sequence amplification (MASA) and identified 29 mRNA transcripts. These transcripts were cloned and sequenced. Blast search of the individual mRNA transcript revealed sequence homologies with various transcribing genes and contigs in the database. Using real-time PCR, we detected the highest expression of nine mRNA transcripts in spermatozoa and one each in liver and lung. Further, 21 transcripts were found to be conserved across the species; seven were specific to bovid whereas one was exclusive to the buffalo genome. The present work demonstrates innate potentials of MASA in accessing several functional genes simultaneously without screening the cDNA library. This approach may be exploited for the development of tissue-specific mRNA fingerprints in the context of genome analysis and functional and comparative genomics.

  12. A powerful latent variable method for detecting and characterizing gene-based gene-gene interaction on multiple quantitative traits

    PubMed Central


    Background On thinking quantitatively of complex diseases, there are at least three statistical strategies for analyzing the gene-gene interaction: SNP by SNP interaction on single trait, gene-gene (each can involve multiple SNPs) interaction on single trait and gene-gene interaction on multiple traits. The third one is the most general in dissecting the genetic mechanism underlying complex diseases underpinning multiple quantitative traits. In this paper, we developed a novel statistic for this strategy through modifying the Partial Least Squares Path Modeling (PLSPM), called mPLSPM statistic. Results Simulation studies indicated that mPLSPM statistic was powerful and outperformed the principal component analysis (PCA) based linear regression method. Application to real data in the EPIC-Norfolk GWAS sub-cohort showed suggestive interaction (γ) between TMEM18 gene and BDNF gene on two composite body shape scores (γ = 0.047 and γ = 0.058, with P = 0.021, P = 0.005), and BMI (γ = 0.043, P = 0.034). This suggested these scores (synthetically latent traits) were more suitable to capture the obesity related genetic interaction effect between genes compared to single trait. Conclusions The proposed novel mPLSPM statistic is a valid and powerful gene-based method for detecting gene-gene interaction on multiple quantitative phenotypes. PMID:24059907

  13. Global Population Genetic Structure and Male-Mediated Gene Flow in the Green Turtle (Chelonia Mydas): RFLP Analyses of Anonymous Nuclear Loci

    PubMed Central

    Karl, S. A.; Bowen, B. W.; Avise, J. C.


    We introduce an approach for the analysis of Mendelian polymorphisms in nuclear DNA (nDNA), using restriction fragment patterns from anonymous single-copy regions amplified by the polymerase chain reaction, and apply this method to the elucidation of population structure and gene flow in the endangered green turtle, Chelonia mydas. Seven anonymous clones isolated from a total cell DNA library were sequenced to generate primers for the amplification of nDNA fragments. Nine individuals were screened for restriction site polymorphisms at these seven loci, using 40 endonucleases. Two loci were monomorphic, while the remainder exhibited a total of nine polymorphic restriction sites and three size variants (reflecting 600-base pair (bp) and 20-bp deletions and a 20-bp insertion). A total of 256 turtle specimens from 15 nesting populations worldwide were then scored for these polymorphisms. Genotypic proportions within populations were in accord with Hardy-Weinberg expectations. Strong linkage disequilibrium observed among polymorphic sites within loci enabled multisite haplotype assignments. Estimates of the standardized variance in haplotype frequency among global collections (F(ST) = 0.17), within the Atlantic-Mediterranean (F(ST) = 0.13), and within the Indian-Pacific (F(ST) = 0.13), revealed a moderate degree of population substructure. Although a previous study concluded that nesting populations appear to be highly structured with respect to female (mitochondrial DNA) lineages, estimates of Nm based on nDNA data from this study indicate moderate rates of male-mediated gene flow. A positive relationship between genetic similarity and geographic proximity suggests historical connections and/or contemporary gene flow between particular rookery populations, likely via matings on overlapping feeding grounds, migration corridors or nonnatal rookeries. PMID:1350555

  14. Three subfamilies of pheromone and receptor genes generate multiple B mating specificities in the mushroom Coprinus cinereus.

    PubMed Central

    Halsall, J R; Milner, M J; Casselton, L A


    The B mating type locus of the basidiomycete Coprinus cinereus encodes a large family of lipopeptide pheromones and their seven transmembrane domain receptors. Here we show that the B42 locus, like the previously described B6 locus, derives its unique specificity from nine multiallelic genes that are organized into three subgroups each comprising a receptor and two pheromone genes. We show that the three genes within each group are kept together as a functional unit by being embedded in an allele-specific DNA sequence. Using a combination of sequence analysis, Southern blotting, and DNA-mediated transformation with cloned genes, we demonstrate that different B loci may share alleles of one or two groups of genes. This is consistent with the prediction that the three subgroups of genes are functionally redundant and that it is the different combinations of their alleles that generate the multiple B mating specificities found in nature. The B42 locus was found to contain an additional gene, mfs1, that encodes a putative multidrug transporter belonging to the major facilitator family. In strains with other B mating specificities, this gene, whose functional significance was not established, lies in a region of shared homology flanking the B locus. PMID:10757757

  15. Genome-wide association study identifies loci and candidate genes for meat quality traits in Simmental beef cattle.


    Xia, Jiangwei; Qi, Xin; Wu, Yang; Zhu, Bo; Xu, Lingyang; Zhang, Lupei; Gao, Xue; Chen, Yan; Li, Junya; Gao, Huijiang


    Improving meat quality is the best way to enhance profitability and strengthen competitiveness in beef industry. Identification of genetic variants that control beef quality traits can help breeders design optimal breeding programs to achieve this goal. We carried out a genome-wide association study for meat quality traits in 1141 Simmental cattle using the Illumina Bovine HD 770K SNP array to identify the candidate genes and genomic regions associated with meat quality traits for beef cattle, including fat color, meat color, marbling score, longissimus muscle area, and shear force. In our study, we identified twenty significant single-nucleotide polymorphisms (SNPs) (p < 1.47 × 10(-6)) associated with these five meat quality traits. Notably, we observed several SNPs were in or near eleven genes which have been reported previously, including TMEM236, SORL1, TRDN, S100A10, AP2S1, KCTD16, LOC506594, DHX15, LAMA4, PREX1, and BRINP3. We identified a haplotype block on BTA13 containing five significant SNPs associated with fat color trait. We also found one of 19 SNPs was associated with multiple traits (shear force and longissimus muscle area) on BTA7. Our results offer valuable insights to further explore the potential mechanism of meat quality traits in Simmental beef cattle.

  16. Quantitative trait loci from the host genetic background modulate the durability of a resistance gene: a rational basis for sustainable resistance breeding in plants

    PubMed Central

    Quenouille, J; Paulhiac, E; Moury, B; Palloix, A


    The combination of major resistance genes with quantitative resistance factors is hypothesized as a promising breeding strategy to preserve the durability of resistant cultivar, as recently observed in different pathosystems. Using the pepper (Capsicum annuum)/Potato virus Y (PVY, genus Potyvirus) pathosystem, we aimed at identifying plant genetic factors directly affecting the frequency of virus adaptation to the major resistance gene pvr23 and at comparing them with genetic factors affecting quantitative resistance. The resistance breakdown frequency was a highly heritable trait (h2=0.87). Four loci including additive quantitative trait loci (QTLs) and epistatic interactions explained together 70% of the variance of pvr23 breakdown frequency. Three of the four QTLs controlling pvr23 breakdown frequency were also involved in quantitative resistance, strongly suggesting that QTLs controlling quantitative resistance have a pleiotropic effect on the durability of the major resistance gene. With the first mapping of QTLs directly affecting resistance durability, this study provides a rationale for sustainable resistance breeding. Surprisingly, a genetic trade-off was observed between the durability of PVY resistance controlled by pvr23 and the spectrum of the resistance against different potyviruses. This trade-off seemed to have been resolved by the combination of minor-effect durability QTLs under long-term farmer selection. PMID:24569635

  17. Superantigen-induced CD4+ T cell tolerance is associated with DNA methylation and histone hypo-acetylation at cytokine gene loci.


    Thomas, R M; Saouaf, S J; Wells, A D


    Anergy is an important mechanism of peripheral tolerance in which T cells lose the capacity to produce proinflammatory cytokines such as interleukin-2 (IL-2) and interferon-gamma (IFNgamma). To determine whether the induction of T-cell anergy in vivo is associated with epigenetic changes that oppose cytokine gene expression, we measured DNA methylation and histone acetylation at the IL2 and IFNgamma loci in CD4+ T cells from mice tolerant to a viral superantigen. Tolerant T cells exhibited more DNA methylation and less histone acetylation at the regulatory regions of the IL2 and IFNgamma genes than effector T cells, which are able to produce IL-2 and IFNgamma. These data show that T-cell anergy in this model is associated with epigenetic modifications that oppose gene expression, and suggest that these mechanisms may be important in the maintenance of tolerance. PMID:17671507

  18. Genome-wide analysis identifies changes in histone retention and epigenetic modifications at developmental and imprinted gene loci in the sperm of infertile men

    PubMed Central

    Hammoud, Saher Sue; Nix, David A.; Hammoud, Ahmad O.; Gibson, Mark; Cairns, Bradley R.; Carrell, Douglas T.


    BACKGROUND The sperm chromatin of fertile men retains a small number of nucleosomes that are enriched at developmental gene promoters and imprinted gene loci. This unique chromatin packaging at certain gene promoters provides these genomic loci the ability to convey instructive epigenetic information to the zygote, potentially expanding the role and significance of the sperm epigenome in embryogenesis. We hypothesize that changes in chromatin packaging may be associated with poor reproductive outcome. METHODS Seven patients with reproductive dysfunction were recruited: three had unexplained poor embryogenesis during IVF and four were diagnosed with male infertility and previously shown to have altered protamination. Genome-wide analysis of the location of histones and histone modifications was analyzed by isolation and purification of DNA bound to histones and protamines. The histone-bound fraction of DNA was analyzed using high-throughput sequencing, both initially and following chromatin immunoprecipitation. The protamine-bound fraction was hybridized to agilent arrays. DNA methylation was examined using bisulfite sequencing. RESULTS Unlike fertile men, five of seven infertile men had non-programmatic (randomly distributed) histone retention genome-wide. Interestingly, in contrast to the total histone pool, the localization of H3 Lysine 4 methylation (H3K4me) or H3 Lysine 27 methylation (H3K27me) was highly similar in the gametes of infertile men compared with fertile men. However, there was a reduction in the amount of H3K4me or H3K27me retained at developmental transcription factors and certain imprinted genes. Finally, the methylation status of candidate developmental promoters and imprinted loci were altered in a subset of the infertile men. CONCLUSIONS This initial genome-wide analysis of epigenetic markings in the sperm of infertile men demonstrates differences in composition and epigenetic markings compared with fertile men, especially at certain imprinted

  19. Parallel bacterial evolution within multiple patients identifies candidate pathogenicity genes

    PubMed Central

    Lieberman, Tami D.; Michel, Jean-Baptiste; Aingaran, Mythili; Potter-Bynoe, Gail; Roux, Damien; Davis, Michael R.; Skurnik, David; Leiby, Nicholas; LiPuma, John J.; Goldberg, Joanna B.; McAdam, Alexander J.; Priebe, Gregory P.; Kishony, Roy


    Bacterial pathogens evolve during the infection of their human hosts1-8, but separating adaptive and neutral mutations remains challenging9-11. Here, we identify bacterial genes under adaptive evolution by tracking recurrent patterns of mutations in the same pathogenic strain during the infection of multiple patients. We conducted a retrospective study of a Burkholderia dolosa outbreak among people with cystic fibrosis, sequencing the genomes of 112 isolates collected from 14 individuals over 16 years. We find that 17 bacterial genes acquired non-synonymous mutations in multiple individuals, which indicates parallel adaptive evolution. Mutations in these genes illuminate the genetic basis of important pathogenic phenotypes, including antibiotic resistance and bacterial membrane composition, and implicate oxygen-dependent gene regulation as paramount in lung infections. Several genes have not been previously implicated in pathogenesis, suggesting new therapeutic targets. The identification of parallel molecular evolution suggests key selection forces acting on pathogens within humans and can help predict and prepare for their future evolutionary course. PMID:22081229

  20. Comparison of Multiple Gene Assembly Methods for Metabolic Engineering

    NASA Astrophysics Data System (ADS)

    Lu, Chenfeng; Mansoorabadi, Karen; Jeffries, Thomas

    A universal, rapid DNA assembly method for efficient multigene plasmid construction is important for biological research and for optimizing gene expression in industrial microbes. Three different approaches to achieve this goal were evaluated. These included creating long complementary extensions using a uracil-DNA glycosylase technique, overlap extension polymerase chain reaction, and a SfiI-based ligation method. SfiI ligation was the only successful approach for assembling large DNA fragments that contained repeated homologous regions. In addition, the SfiI method has been improved over a similar, previous published technique so that it is more flexible and does not require polymerase chain reaction to incorporate adaptors. In the present study, Saccharomyces cerevisiae genes TAL1, TKL1, and PYK1 under control of the 6-phosphogluconate dehydrogenase promoter were successfully ligated together using multiple unique SfiI restriction sites. The desired construct was obtained 65% of the time during vector construction using four-piece ligations. The SfiI method consists of three steps: first a SfiI linker vector is constructed, whose multiple cloning site is flanked by two three-base linkers matching the neighboring SfiI linkers on SfiI digestion; second, the linkers are attached to the desired genes by cloning them into SfiI linker vectors; third, the genes flanked by the three-base linkers, are released by SfiI digestion. In the final step, genes of interest are joined together in a simple one-step ligation.

  1. Multiple Routes to Subfunctionalization and Gene Duplicate Specialization

    PubMed Central

    Proulx, Stephen R.


    Gene duplication is arguably the most significant source of new functional genetic material. A better understanding of the processes that lead to the stable incorporation of gene duplications into the genome is important both because it relates to interspecific differences in genome composition and because it can shed light on why some classes of gene are more prone to duplication than others. Typically, models of gene duplication consider the periods before duplication, during the spread and fixation of a new duplicate, and following duplication as distinct phases without a common underlying selective environment. I consider a scenario where a gene that is initially expressed in multiple contexts can undergo mutations that alter its expression profile or its functional coding sequence. The selective regime that acts on the functional output of the allele copies carried by an individual is constant. If there is a potential selective benefit to having different coding sequences expressed in each context, then, regardless of the constraints on functional variation at the single-locus gene, the waiting time until a gene duplication is incorporated goes down as population size increases. PMID:22143920

  2. Loci under selection during multiple range expansions of an invasive plant are mostly population specific, but patterns are associated with climate.


    Zenni, Rafael D; Hoban, Sean M


    Identifying the genes underlying rapid evolutionary changes, describing their function and ascertaining the environmental pressures that determine fitness are the central elements needed for understanding of evolutionary processes and phenotypic changes that improve the fitness of populations. It has been hypothesized that rapid adaptive changes in new environments may contribute to the rapid spread and success of invasive plants and animals. As yet, studies of adaptation during invasion are scarce, as is knowledge of the genes underlying adaptation, especially in multiple replicated invasions. Here, we quantified how genotype frequencies change during invasions, resulting in rapid evolution of naturalized populations. We used six fully replicated common garden experiments in Brazil where Pinus taeda (loblolly pine) was introduced at the same time, in the same numbers, from the same seed sources, and has formed naturalized populations expanding outward from the plantations. We used a combination of nonparametric, population genetics and multivariate statistics to detect changes in genotype frequencies along each of the six naturalization gradients and their association with climate as well as shifts in allele frequencies compared to the source populations. Results show 25 genes with significant shifts in genotype frequencies. Six genes had shifts in more than one population. Climate explained 25% of the variation in the groups of genes under selection across all locations, but specific genes under strong selection during invasions did not show climate-related convergence. In conclusion, we detected rapid evolutionary changes during invasive range expansions, but the particular gene-level patterns of evolution may be population specific.

  3. Demographic histories of adaptively diverged riparian and non-riparian species of Ainsliaea (Asteraceae) inferred from coalescent analyses using multiple nuclear loci

    PubMed Central


    Background Understanding demographic histories, such as divergence time, patterns of gene flow, and population size changes, in ecologically diverging lineages provide implications for the process and maintenance of population differentiation by ecological adaptation. This study addressed the demographic histories in two independently derived lineages of flood-resistant riparian plants and their non-riparian relatives [Ainsliaea linearis (riparian) and A. apiculata (non-riparian); A. oblonga (riparian) and A. macroclinidioides (non-riparian); Asteraceae] using an isolation-with-migration (IM) model based on variation at 10 nuclear DNA loci. Results The highest posterior probabilities of the divergence time parameters were estimated to be ca. 25,000 years ago for A. linearis and A. apiculata and ca. 9000 years ago for A. oblonga and A. macroclinidioides, although the confidence intervals of the parameters had broad ranges. The likelihood ratio tests detected evidence of historical gene flow between both riparian/non-riparian species pairs. The riparian populations showed lower levels of genetic diversity and a significant reduction in effective population sizes compared to the non-riparian populations and their ancestral populations. Conclusions This study showed the recent origins of flood-resistant riparian plants, which are remarkable examples of plant ecological adaptation. The recent divergence and genetic signatures of historical gene flow among riparian/non-riparian species implied that they underwent morphological and ecological differentiation within short evolutionary timescales and have maintained their species boundaries in the face of gene flow. Comparative analyses of adaptive divergence in two sets of riparian/non-riparian lineages suggested that strong natural selection by flooding had frequently reduced the genetic diversity and size of riparian populations through genetic drift, possibly leading to fixation of adaptive traits in riparian

  4. Direct evidence for redundant segmental replacement between multiple 18S rRNA genes in a single Prototheca strain.


    Ueno, Ryohei; Huss, Volker A R; Urano, Naoto; Watabe, Shugo


    Informational genes such as those encoding rRNAs are related to transcription and translation, and are thus considered to be rarely subject to lateral gene transfer (LGT) between different organisms, compared to operational genes having metabolic functions. However, several lines of evidence have suggested or confirmed the occurrence of LGT of DNA segments encoding evolutionarily variable regions of rRNA genes between different organisms. In the present paper, we show, for the first time to our knowledge, that variable regions of the 18S rRNA gene are segmentally replaced by multiple copies of different sequences in a single strain of the green microalga Prototheca wickerhamii, resulting in at least 17 genotypes, nine of which were actually transcribed. Recombination between different 18S rRNA genes occurred in seven out of eight variable regions (V1-V5 and V7-V9) of eukaryotic small subunit (SSU) rRNAs. While no recombination was observed in V1, one to three different recombination loci were demonstrated for the other regions. Such segmental replacement was also implicated for helix H37, which is defined as V6 of prokaryotic SSU rRNAs. Our observations provide direct evidence for redundant recombination of an informational gene, which encodes a component of mature ribosomes, in a single strain of one organism.

  5. Identification of quantitative trait loci influencing skeletal architecture in mice: emergence of Cdh11 as a primary candidate gene regulating femoral morphology

    PubMed Central

    Farber, Charles R.; Kelly, Scott A.; Baruch, Ethan; Yu, Daniel; Hua, Kunjie; Nehrenberg, Derrick L.; Pardo-Manuel de Villena, Fernando; Buus, Ryan J.; Garland, Theodore; Pomp, Daniel


    Bone strength is influenced by many properties intrinsic to bone, including its mass, geometry, and mineralization. To further advance our understanding of the genetic basis of bone strength-related traits, we utilized a large (N=815), moderately (G4) advanced intercross line (AIL) of mice derived from a high-runner selection line (HR) and the C57BL/6J inbred strain. In total, 16 quantitative trait loci (QTL) were identified that affected areal bone mineral density (aBMD) and femoral length and width. Four significant (P<0.05) and one suggestive (P<0.10) QTL were identified for three aBMD measurements: total body, vertebral and femoral. A QTL on Chromosome (Chr.) 3 influenced all three aBMD measures, while the other four QTL were unique to a single measure. A total of 10 significant and one suggestive QTL were identified for femoral length (FL) and two measures of femoral width, anterior-posterior (AP) and medial-lateral (ML). FL QTL were distinct from loci affecting AP and ML width, and of the seven AP QTL, only three affected ML. A QTL on Chr. 8 that explained 7.1% and 4.0% of the variance in AP and ML, respectively, was mapped to a six megabase (Mb) region harboring 12 protein-coding genes. The pattern of haplotype diversity across the QTL region and expression profiles of QTL genes, suggested that of the 12, cadherin 11 (Cdh11) was most likely the causal gene. These findings, when combined with existing data from gene knockouts, identify Cdh11 as a strong candidate gene within which genetic variation may affect bone morphology. PMID:21638317

  6. Genome-wide association analysis identifies genetic loci associated with resistance to multiple antimalarials in Plasmodium falciparum from China-Myanmar border

    PubMed Central

    Wang, Zenglei; Cabrera, Mynthia; Yang, Jingyun; Yuan, Lili; Gupta, Bhavna; Liang, Xiaoying; Kemirembe, Karen; Shrestha, Sony; Brashear, Awtum; Li, Xiaolian; Porcella, Stephen F.; Miao, Jun; Yang, Zhaoqing; Su, Xin-zhuan; Cui, Liwang


    Drug resistance has emerged as one of the greatest challenges facing malaria control. The recent emergence of resistance to artemisinin (ART) and its partner drugs in ART-based combination therapies (ACT) is threatening the efficacy of this front-line regimen for treating Plasmodium falciparum parasites. Thus, an understanding of the molecular mechanisms that underlie the resistance to ART and the partner drugs has become a high priority for resistance containment and malaria management. Using genome-wide association studies, we investigated the associations of genome-wide single nucleotide polymorphisms with in vitro sensitivities to 10 commonly used antimalarial drugs in 94 P. falciparum isolates from the China-Myanmar border area, a region with the longest history of ART usage. We identified several loci associated with various drugs, including those containing pfcrt and pfdhfr. Of particular interest is a locus on chromosome 10 containing the autophagy-related protein 18 (ATG18) associated with decreased sensitivities to dihydroartemisinin, artemether and piperaquine – an ACT partner drug in this area. ATG18 is a phosphatidylinositol-3-phosphate binding protein essential for autophagy and recently identified as a potential ART target. Further investigations on the ATG18 and genes at the chromosome 10 locus may provide an important lead for a connection between ART resistance and autophagy. PMID:27694982

  7. Convergence in pigmentation at multiple levels: mutations, genes and function

    PubMed Central

    Manceau, Marie; Domingues, Vera S.; Linnen, Catherine R.; Rosenblum, Erica Bree; Hoekstra, Hopi E.


    Convergence—the independent evolution of the same trait by two or more taxa—has long been of interest to evolutionary biologists, but only recently has the molecular basis of phenotypic convergence been identified. Here, we highlight studies of rapid evolution of cryptic coloration in vertebrates to demonstrate that phenotypic convergence can occur at multiple levels: mutations, genes and gene function. We first show that different genes can be responsible for convergent phenotypes even among closely related populations, for example, in the pale beach mice inhabiting Florida's Gulf and Atlantic coasts. By contrast, the exact same mutation can create similar phenotypes in distantly related species such as mice and mammoths. Next, we show that different mutations in the same gene need not be functionally equivalent to produce similar phenotypes. For example, separate mutations produce divergent protein function but convergent pale coloration in two lizard species. Similarly, mutations that alter the expression of a gene in different ways can, nevertheless, result in similar phenotypes, as demonstrated by sister species of deer mice. Together these studies underscore the importance of identifying not only the genes, but also the precise mutations and their effects on protein function, that contribute to adaptation and highlight how convergence can occur at different genetic levels. PMID:20643733

  8. Convergence in pigmentation at multiple levels: mutations, genes and function.


    Manceau, Marie; Domingues, Vera S; Linnen, Catherine R; Rosenblum, Erica Bree; Hoekstra, Hopi E


    Convergence--the independent evolution of the same trait by two or more taxa--has long been of interest to evolutionary biologists, but only recently has the molecular basis of phenotypic convergence been identified. Here, we highlight studies of rapid evolution of cryptic coloration in vertebrates to demonstrate that phenotypic convergence can occur at multiple levels: mutations, genes and gene function. We first show that different genes can be responsible for convergent phenotypes even among closely related populations, for example, in the pale beach mice inhabiting Florida's Gulf and Atlantic coasts. By contrast, the exact same mutation can create similar phenotypes in distantly related species such as mice and mammoths. Next, we show that different mutations in the same gene need not be functionally equivalent to produce similar phenotypes. For example, separate mutations produce divergent protein function but convergent pale coloration in two lizard species. Similarly, mutations that alter the expression of a gene in different ways can, nevertheless, result in similar phenotypes, as demonstrated by sister species of deer mice. Together these studies underscore the importance of identifying not only the genes, but also the precise mutations and their effects on protein function, that contribute to adaptation and highlight how convergence can occur at different genetic levels. PMID:20643733

  9. Parallel Recruitment of Multiple Genes into C4 Photosynthesis

    PubMed Central

    Christin, Pascal-Antoine; Boxall, Susanna F.; Gregory, Richard; Edwards, Erika J.; Hartwell, James; Osborne, Colin P.


    During the diversification of living organisms, novel adaptive traits usually evolve through the co-option of preexisting genes. However, most enzymes are encoded by gene families, whose members vary in their expression and catalytic properties. Each may therefore differ in its suitability for recruitment into a novel function. In this work, we test for the presence of such a gene recruitment bias using the example of C4 photosynthesis, a complex trait that evolved recurrently in flowering plants as a response to atmospheric CO2 depletion. We combined the analysis of complete nuclear genomes and high-throughput transcriptome data for three grass species that evolved the C4 trait independently. For five of the seven enzymes analyzed, the same gene lineage was recruited across the independent C4 origins, despite the existence of multiple copies. The analysis of a closely related C3 grass confirmed that C4 expression patterns were not present in the C3 ancestors but were acquired during the evolutionary transition to C4 photosynthesis. The significant bias in gene recruitment indicates that some genes are more suitable for a novel function, probably because the mutations they accumulated brought them closer to the characteristics required for the new function. PMID:24179135

  10. Optimizing multiple sclerosis diagnosis: gene expression and genomic association

    PubMed Central

    Gurevich, Michael; Miron, Gadi; Achiron, Anat


    Objective The diagnosis of multiple sclerosis (MS) at disease onset is sometimes masqueraded by other diagnostic options resembling MS clinically or radiologically (NonMS). In the present study we utilized findings of large-scale Genome-Wide Association Studies (GWAS) to develop a blood gene expression-based classification tool to assist in diagnosis during the first demyelinating event. Methods We have merged knowledge of 110 MS susceptibility genes gained from MS GWAS studies together with our experimental results of differential blood gene expression profiling between 80 MS and 31 NonMS patients. Multiple classification algorithms were applied to this cohort to construct a diagnostic classifier that correctly distinguished between MS and NonMS patients. Accuracy of the classifier was tested on an additional independent group of 146 patients including 121 MS and 25 NonMS patients. Results We have constructed a 42 gene-transcript expression-based MS diagnostic classifier. The overall accuracy of the classifier, as tested on an independent patient population consisting of diagnostically challenging cases including NonMS patients with positive MRI findings, achieved a correct classification rate of 76.0 ± 3.5%. Interpretation The presented diagnostic classification tool complements the existing diagnostic McDonald criteria by assisting in the accurate exclusion of other neurological diseases at presentation of the first demyelinating event suggestive of MS. PMID:25815353

  11. Multiple Loci and Complete Taxonomic Sampling Resolve the Phylogeny and Biogeographic History of Tenrecs (Mammalia: Tenrecidae) and Reveal Higher Speciation Rates in Madagascar's Humid Forests.


    Everson, Kathryn M; Soarimalala, Voahangy; Goodman, Steven M; Olson, Link E


    The family Tenrecidae (tenrecs) is one of only four extant terrestrial mammal lineages to have colonized and diversified on Madagascar. Over the last 15 years, several studies have disagreed on relationships among major tenrec lineages, resulting in multiple reinterpretations of the number and timing of historical transoceanic dispersal events between Africa and Madagascar. We reconstructed the phylogeny of Tenrecidae using multiple loci from all recognized extant species and estimated divergence timing using six fossil calibrations within Afrotheria. All phylogenetic analyses strongly support monophyly of the Malagasy tenrecs, and our divergence timing analysis places their colonization of the island at 30-56 Ma. Our comprehensive phylogeny supports three important taxonomic revisions that reflect the evolutionary history of tenrecs: (1) we formally elevate the African otter shrews to their own family Potamogalidae, thereby rendering extant Tenrecidae entirely endemic to Madagascar; (2) we subsume the semiaquatic genus Limnogale within the shrew tenrec genus Microgale; and (3) we re-elevate the two largest-bodied shrew tenrecs, Microgale dobsoni and Microgale talazaci, to the genus Nesogale Thomas (1918) Finally, we use recently summarized habitat data to test the hypothesis that diversification rates differ between humid and arid habitats on Madagascar, and we compare three common methods for ancestral biogeographic reconstruction. These analyses suggest higher speciation rates in humid habitats and reveal a minimum of three and more likely five independent transitions to arid habitats. Our results resolve the relationships among previously recalcitrant taxa, illuminate the timing and mechanisms of major biogeographic patterns in an extraordinary example of an island radiation, and permit the first comprehensive, phylogenetically consistent taxonomy of Madagascar's tenrecs.

  12. Genes and Environment in Multiple Sclerosis project: A platform to investigate multiple sclerosis risk.


    Xia, Zongqi; White, Charles C; Owen, Emily K; Von Korff, Alina; Clarkson, Sarah R; McCabe, Cristin A; Cimpean, Maria; Winn, Phoebe A; Hoesing, Ashley; Steele, Sonya U; Cortese, Irene C M; Chitnis, Tanuja; Weiner, Howard L; Reich, Daniel S; Chibnik, Lori B; De Jager, Philip L


    The Genes and Environment in Multiple Sclerosis project establishes a platform to investigate the events leading to multiple sclerosis (MS) in at-risk individuals. It has recruited 2,632 first-degree relatives from across the USA. Using an integrated genetic and environmental risk score, we identified subjects with twice the MS risk when compared to the average family member, and we report an initial incidence rate in these subjects that is 30 times greater than that of sporadic MS. We discuss the feasibility of large-scale studies of asymptomatic at-risk subjects that leverage modern tools of subject recruitment to execute collaborative projects.

  13. Multiple blood pressure loci with opposing blood pressure effects on rat chromosome 1 in a homologous region linked to hypertension on human chromosome 15.


    Mell, Blair; Abdul-Majeed, Shakila; Kumarasamy, Sivarajan; Waghulde, Harshal; Pillai, Resmi; Nie, Ying; Joe, Bina


    Genetic dissection of blood pressure (BP) quantitative trait loci (QTLs) in rats has facilitated the fine-mapping of regions linked to the inheritance of hypertension. The goal of the current study was to further fine-map one such genomic region on rat chromosome 1 (BPQTL1b1), the homologous region of which on human chromosome 15 harbors BP QTLs, as reported by four independent studies. Of the six substrains constructed and studied, the systolic BP of two of the congenic strains were significantly lower by 36 and 27 mm Hg than that of the salt-sensitive (S) rat (P < 0.0001, P = 0.0003, respectively). The congenic segments of these two strains overlapped between 135.12 and 138.78 Mb and contained eight genes and two predicted miRNAs. None of the annotations had variants within expressed sequences. These data taken together with the previous localization resolved QTL1b1 with a 70% improvement from the original 7.39 Mb to the current 2.247 Mb interval. Furthermore, the systolic BP of one of the congenic substrains was significantly higher by 20 mm Hg (P < 0.0001) than the BP of the S rat. The limits of this newly identified QTL with a BP increasing effect (QTL1b1a) were between 134.12 and 135.76 Mb, spanning 1.64 Mb, containing two protein-coding genes, Mctp2 and Rgma, and a predicted miRNA. There were four synonymous variants within Mctp2. These data provide evidence for two independent BP QTLs with opposing BP effects within the previously identified BP QTL1b1 region. Additionally, these findings illustrate the complexity underlying the genetic mechanisms of BP regulation, wherein inherited elements beyond protein-coding sequences or known regulatory regions could be operational. PMID:25231251

  14. Inference of gene interaction networks using conserved subsequential patterns from multiple time course gene expression datasets

    PubMed Central


    Motivation Deciphering gene interaction networks (GINs) from time-course gene expression (TCGx) data is highly valuable to understand gene behaviors (e.g., activation, inhibition, time-lagged causality) at the system level. Existing methods usually use a global or local proximity measure to infer GINs from a single dataset. As the noise contained in a single data set is hardly self-resolved, the results are sometimes not reliable. Also, these proximity measurements cannot handle the co-existence of the various in vivo positive, negative and time-lagged gene interactions. Methods and results We propose to infer reliable GINs from multiple TCGx datasets using a novel conserved subsequential pattern of gene expression. A subsequential pattern is a maximal subset of genes sharing positive, negative or time-lagged correlations of one expression template on their own subsets of time points. Based on these patterns, a GIN can be built from each of the datasets. It is assumed that reliable gene interactions would be detected repeatedly. We thus use conserved gene pairs from the individual GINs of the multiple TCGx datasets to construct a reliable GIN for a species. We apply our method on six TCGx datasets related to yeast cell cycle, and validate the reliable GINs using protein interaction networks, biopathways and transcription factor-gene regulations. We also compare the reliable GINs with those GINs reconstructed by a global proximity measure Pearson correlation coefficient method from single datasets. It has been demonstrated that our reliable GINs achieve much better prediction performance especially with much higher precision. The functional enrichment analysis also suggests that gene sets in a reliable GIN are more functionally significant. Our method is especially useful to decipher GINs from multiple TCGx datasets related to less studied organisms where little knowledge is available except gene expression data. PMID:26681650

  15. Targeted insertions of two exogenous collagen genes into both alleles of their endogenous loci in cultured human cells: the insertions are directed by relatively short fragments containing the promoters and the 5' ends of the genes.

    PubMed Central

    Ganguly, A; Smelt, S; Mewar, R; Fertala, A; Sieron, A L; Overhauser, J; Prockop, D J


    Previous studies demonstrated that type II procollagen is synthesized by HT-1080 cells that are stably transfected with constructs of the human COL2A1 gene that contain the promoter and 5' end of either the COL2A1 gene or the human COL1A1 gene. Since the host HT-1080 cells were from a human tumor line that synthesizes type IV collagen but not type II or type I procollagen, the results suggested that the constructs were integrated near active enhancers or promoters. Here, however, we demonstrate that a 33-kb construct of the COL2A1 gene containing a 5' fragment from the same gene was inserted into both alleles of the endogenous COL2A1 gene on chromosome 12, apparently by homologous recombination by a nonconservative pathway. In contrast, a similar construct of the COL2A1 gene in which the 5' end was replaced with a 1.9-kb fragment from the 5' end of the COL1A1 gene was inserted into both alleles of the locus for the COL1A1 gene on chromosome 17. Therefore, targeted insertion of the gene construct was not directed by the degree of sequence homology. Instead, it was directed by the relatively short 5' fragment from the COL1A1 gene that contained the promoter and the initially transcribed sequences of the gene. After insertion, both gene constructs were expressed from previously inactive loci. Images PMID:8041796

  16. Uncoupling the Roles of HLA-DRB1 and HLA-DRB5 Genes in Multiple Sclerosis1

    PubMed Central

    Caillier, Stacy J.; Briggs, Farren; Cree, Bruce A. C.; Baranzini, Sergio E.; Fernandez-Viña, Marcelo; Ramsay, Patricia P.; Khan, Omar; Royal, Walter; Hauser, Stephen L.; Barcellos, Lisa F.; Oksenberg, Jorge R.


    Genetic susceptibility to multiple sclerosis (MS) is associated with the MHC located on chromosome 6p21. This signal maps primarily to a 1-Mb region encompassing the HLA class II loci, and it segregates often with the HLA-DQB1*0602, -DQA1*0102, -DRB1*1501, -DRB5*0101 haplotype. However, the identification of the true predisposing gene or genes within the susceptibility haplotype has been handicapped by the strong linkage disequilibrium across the locus. African Americans have greater MHC haplotypic diversity and distinct patterns of linkage disequilibrium, which make this population particularly informative for fine mapping efforts. The purpose of this study was to establish the telomeric boundary of the HLA class II region affecting susceptibility to MS by assessing genetic association with the neighboring HLA-DRB5 gene as well as seven telomeric single nucleotide polymorphisms in a large, well-characterized African American dataset. Rare DRB5*null individuals were previously described in African populations. Although significant associations with both HLA-DRB1 and HLA-DRB5 loci were present, HLA-DRB1*1503 was associated with MS in the absence of HLA-DRB5, providing evidence for HLA-DRB1 as the primary susceptibility gene. Interestingly, the HLA-DRB5*null subjects appear to be at increased risk for developing secondary progressive MS. Thus, HLA-DRB5 attenuates MS severity, a finding consistent with HLA-DRB5’s proposed role as a modifier in experimental autoimmune encephalomyelitis. Additionally, conditional haplotype analysis revealed a susceptibility signal at the class III AGER locus independent of DRB1. The data underscore the power of the African American MS dataset to identify disease genes by association in a region of high linkage disequilibrium. PMID:18832704

  17. Adaptive Horizontal Gene Transfers between Multiple Cheese-Associated Fungi.


    Ropars, Jeanne; Rodríguez de la Vega, Ricardo C; López-Villavicencio, Manuela; Gouzy, Jérôme; Sallet, Erika; Dumas, Émilie; Lacoste, Sandrine; Debuchy, Robert; Dupont, Joëlle; Branca, Antoine; Giraud, Tatiana


    Domestication is an excellent model for studies of adaptation because it involves recent and strong selection on a few, identified traits [1-5]. Few studies have focused on the domestication of fungi, with notable exceptions [6-11], despite their importance to bioindustry [12] and to a general understanding of adaptation in eukaryotes [5]. Penicillium fungi are ubiquitous molds among which two distantly related species have been independently selected for cheese making-P. roqueforti for blue cheeses like Roquefort and P. camemberti for soft cheeses like Camembert. The selected traits include morphology, aromatic profile, lipolytic and proteolytic activities, and ability to grow at low temperatures, in a matrix containing bacterial and fungal competitors [13-15]. By comparing the genomes of ten Penicillium species, we show that adaptation to cheese was associated with multiple recent horizontal transfers of large genomic regions carrying crucial metabolic genes. We identified seven horizontally transferred regions (HTRs) spanning more than 10 kb each, flanked by specific transposable elements, and displaying nearly 100% identity between distant Penicillium species. Two HTRs carried genes with functions involved in the utilization of cheese nutrients or competition and were found nearly identical in multiple strains and species of cheese-associated Penicillium fungi, indicating recent selective sweeps; they were experimentally associated with faster growth and greater competitiveness on cheese and contained genes highly expressed in the early stage of cheese maturation. These findings have industrial and food safety implications and improve our understanding of the processes of adaptation to rapid environmental changes.

  18. Molecular analysis of immunoglobulin genes in multiple myeloma.


    Kosmas, C; Stamatopoulos, K; Stavroyianni, N; Belessi, C; Viniou, N; Yataganas, X


    The study of immunoglobulin genes in multiple myeloma over the last five years has provided important information regarding biology, ontogenetic location, disease evolution, pathogenic consequences and tumor-specific therapeutic intervention with idiotypic vaccination. Detailed analysis of V(H) genes has revealed clonal relationship between switch variants expressed by the bone marrow plasma cell and myeloma progenitors in the marrow and peripheral blood. V(H) gene usage is biased against V4-34 (encoding antibodies with cold agglutinin specificity; anti-l/i) explaining the absence of autoimmune phenomena in myeloma compared to other B-cell lymphoproliferative disorders. V(H) genes accumulate somatic hypermutations following a distribution compatible with antigen selection, but with no intraclonal heterogeneity. V(L) genes indicate a bias in usage of VkappaI family members and somatic hypermutation, in line with antigen selection, of the expressed Vkappa genes is higher than any other B-cell lymphoid disorder. A complementary imprint of antigen selection as evidenced by somatic hypermutation of either the V(H) or V(L) clonogenic genes has been observed. The absence of ongoing somatic mutations in either V(H) or V(L) genes gives rise to the notion that the cell of origin in myeloma is a post-germinal center memory B-cell. Clinical application of sensitive PCR methods in order to detect clonal immunoglobulin gene rearrangements has made relevant the monitoring and follow-up of minimal residual disease in stem cell autografts and after myeloablative therapy. The fact that surface immunoglobulin V(H) and V(L) sequences constitute unique tumor-specific antigenic determinants has stimulated investigators to devise strategies aiming to generate active specific immunity against the idiotype of malignant B-cells in myeloma by constructing vaccines based on expressed single-chain Fv fragments, DNA plasmids carrying V(H)+V(L) clonogenic genes for naked DNA vaccination, or

  19. Screening of candidate genes and fine mapping of drought tolerance quantitative trait loci on chromosome 4 in rice (Oryza sativa L.) under drought stress.


    Nie, Yuan-Yuan; Zhang, Lin; Wu, Yun-Hua; Liu, Hao-Jie; Mao, Wei-Wei; Du, Juan; Xiu, Hai-Lin; Wu, Xiao-Yu; Li, Xia; Yan, Yu-Wei; Liu, Guo-Lan; Liu, Hong-Yan; Hu, Song-Ping


    Due to severe water resource shortage, genetics of and breeding for DT (drought tolerance) in rice (Oryza sativa L.) have become one of the hot research topics. Identification of grain yield QTLs (quantitative trait loci) directly related to the DT trait of rice can provide useful information for breeding new drought-resistant and water-saving rice varieties via marker-assisted selection. A population of 105 advanced BILs (backcross introgression lines) derived from a cross between Zhenshan97B and IRAT109 in Zhenshan97B background were grown under drought stress in a field experiment and phenotypic traits were investigated. The results showed that in the target interval of RM273-RM255 on chromosome 4, three main-effect QTLs related to panicle length, panicle number, and spikelet number per panicle were identified (LOD [logarithm of the odds] > 2.0). The panicle length-related QTL had two loci located in the neighboring intervals of RM17308-RM17305 and RM17349-RM17190, which explained 18.80% and 20.42%, respectively, of the phenotypic variation, while the panicle number-related QTL was identified in the interval of RM1354-RM17308, explaining 11.47% of the phenotypic variation. As far as the spikelet number per panicle-related QTL was concerned, it was found to be located in the interval of RM17308-RM17305, which explained 28.08% of the phenotypic variation. Using the online Plant-GE query system, a total of 13 matched ESTs (expressed sequence tags) were found in the target region, and of the 13 ESTs, 12 had corresponding predicted genes. For instance, the two ESTs CB096766 and CA765747 were corresponded to the same predicted gene LOC_Os04g46370, while the other four ESTs, CA754286, CB000011, CX056247, and CX056240, were corresponded to the same predicted gene LOC_Os04g46390. PMID:26640678

  20. Bacterial evolution through the selective loss of beneficial Genes. Trade-offs in expression involving two loci.

    PubMed Central

    Zinser, Erik R; Schneider, Dominique; Blot, Michel; Kolter, Roberto


    The loss of preexisting genes or gene activities during evolution is a major mechanism of ecological specialization. Evolutionary processes that can account for gene loss or inactivation have so far been restricted to one of two mechanisms: direct selection for the loss of gene activities that are disadvantageous under the conditions of selection (i.e., antagonistic pleiotropy) and selection-independent genetic drift of neutral (or nearly neutral) mutations (i.e., mutation accumulation). In this study we demonstrate with an evolved strain of Escherichia coli that a third, distinct mechanism exists by which gene activities can be lost. This selection-dependent mechanism involves the expropriation of one gene's upstream regulatory element by a second gene via a homologous recombination event. Resulting from this genetic exchange is the activation of the second gene and a concomitant inactivation of the first gene. This gene-for-gene expression tradeoff provides a net fitness gain, even if the forfeited activity of the first gene can play a positive role in fitness under the conditions of selection. PMID:12930738

  1. Evidence that a secondary metabolic biosynthetic gene cluster has grown by gene relocation during evolution of the filamentous fungus Fusarium.


    Proctor, Robert H; McCormick, Susan P; Alexander, Nancy J; Desjardins, Anne E


    Trichothecenes are terpene-derived secondary metabolites produced by multiple genera of filamentous fungi, including many plant pathogenic species of Fusarium. These metabolites are of interest because they are toxic to animals and plants and can contribute to pathogenesis of Fusarium on some crop species. Fusarium graminearum and F. sporotrichioides have trichothecene biosynthetic genes (TRI) at three loci: a 12-gene TRI cluster and two smaller TRI loci that consist of one or two genes. Here, comparisons of additional Fusarium species have provided evidence that TRI loci have a complex evolutionary history that has included loss, non-functionalization and rearrangement of genes as well as trans-species polymorphism. The results also indicate that the TRI cluster has expanded in some species by relocation of two genes into it from the smaller loci. Thus, evolutionary forces have driven consolidation of TRI genes into fewer loci in some fusaria but have maintained three distinct TRI loci in others. PMID:19843228

  2. Evolution of duplicated IgH loci in Atlantic salmon, Salmo salar

    PubMed Central


    Background The Atlantic salmon (Salmo salar) immunoglobulin heavy chain (IgH) locus possesses two parallel IgH isoloci (IGH-A and IGH-B), that are related to the genomic duplication event in the family Salmonidae. These duplicated IgH loci in Atlantic salmon provide a unique opportunity to examine the mechanisms of genome diversity and genome evolution of the IgH loci in vertebrates. In this study, we defined the structure of these loci in Atlantic salmon, and sequenced 24 bacterial artificial chromosome (BAC) clones that were assembled into the IGH-A (1.1 Mb) and IGH-B (0.9 Mb) loci. In addition, over 7,000 cDNA clones from the IgH variable (VH) region have been sequenced and analyzed. Results The present study shows that the genomic organization of the duplicated IgH loci in Atlantic salmon differs from that in other teleosts and other vertebrates. The loci possess multiplegenes upstream of the Cμ region, with three of the Cτ genes being functional. Moreover, the duplicated loci possess over 300 VH segments which could be classified into 18 families. This is the largest number of VH families currently defined in any vertebrate. There were significant structural differences between the two loci, indicating that both IGH-A and -B loci have evolved independently in the short time after the recent genome duplication approximately 60 mya. Conclusions Our results indicate that the duplication of the IgH loci in Atlantic salmon significantly contributes to the increased diversity of the antibody repertoire, as compared with the single IgH locus in other vertebrates. PMID:20813058

  3. Estrogen Signaling Multiple Pathways to Impact Gene Transcription

    PubMed Central

    Marino, Maria; Galluzzo, Paola; Ascenzi, Paolo


    Steroid hormones exert profound effects on cell growth, development, differentiation, and homeostasis. Their effects are mediated through specific intracellular steroid receptors that act via multiple mechanisms. Among others, the action mechanism starting upon 17β-estradiol (E2) binds to its receptors (ER) is considered a paradigmatic example of how steroid hormones function. Ligand-activated ER dimerizes and translocates in the nucleus where it recognizes specific hormone response elements located in or near promoter DNA regions of target genes. Behind the classical genomic mechanism shared with other steroid hormones, E2 also modulates gene expression by a second indirect mechanism that involves the interaction of ER with other transcription factors which, in turn, bind their cognate DNA elements. In this case, ER modulates the activities of transcription factors such as the activator protein (AP)-1, nuclear factor-κB (NF-κB) and stimulating protein-1 (Sp-1), by stabilizing DNA-protein complexes and/or recruiting co-activators. In addition, E2 binding to ER may also exert rapid actions that start with the activation of a variety of signal transduction pathways (e.g. ERK/MAPK, p38/MAPK, PI3K/AKT, PLC/PKC). The debate about the contribution of different ER-mediated signaling pathways to coordinate the expression of specific sets of genes is still open. This review will focus on the recent knowledge about the mechanism by which ERs regulate the expression of target genes and the emerging field of integration of membrane and nuclear receptor signaling, giving examples of the ways by which the genomic and non-genomic actions of ERs on target genes converge. PMID:18369406

  4. Plasmodium genetic loci linked to host cytokine and chemokine responses

    PubMed Central

    Pattaradilokrat, Sittiporn; Li, Jian; Wu, Jian; Qi, Yanwei; Eastman, Richard T.; Zilversmit, Martine; Nair, Sethu C.; Huaman, Maria Cecilia; Quinones, Mariam; Jiang, Hongying; Li, Na; Zhu, Jun; Zhao, Keji; Kaneko, Osamu; Long, Carole A.; Su, Xin-zhuan


    Both host and parasite factors contribute to disease severity of malaria infection; however, the molecular mechanisms responsible for the disease and the host-parasite interactions involved remain largely unresolved. To investigate effects of parasite factors on host immune responses and pathogenesis, we measured levels of plasma cytokines/chemokines (CC) and growth rates in mice infected with two Plasmodium yoelii strains having different virulence phenotypes and in progeny from a genetic cross of the two parasites. Quantitative trait loci (QTL) analysis linked levels of many CCs, particularly IL-1β, IP-10, IFN-γ, MCP-1, and MIG, and early parasite growth rate to loci on multiple parasite chromosomes, including chromosomes 7, 9, 10, 12, and 13. Comparison of the genome sequences spanning the mapped loci revealed various candidate genes. The loci on chromosome 7 and 13 had significant (p < 0.005) additive effects on IL-1β, IL-5, and IP-10 responses, and the chromosome 9 and 12 loci had significant (p = 0.017) interaction. Infection of knockout mice showed critical roles of MCP-1 and IL-10 in parasitemia control and host mortality. These results provide important information for better understanding of malaria pathogenesis and can be used to examine the role of these factors in human malaria infection. PMID:24452266

  5. Migration and horizontal gene transfer divide microbial genomes into multiple niches.


    Niehus, Rene; Mitri, Sara; Fletcher, Alexander G; Foster, Kevin R


    Horizontal gene transfer is central to microbial evolution, because it enables genetic regions to spread horizontally through diverse communities. However, how gene transfer exerts such a strong effect is not understood. Here we develop an eco-evolutionary model and show how genetic transfer, even when rare, can transform the evolution and ecology of microbes. We recapitulate existing models, which suggest that asexual reproduction will overpower horizontal transfer and greatly limit its effects. We then show that allowing immigration completely changes these predictions. With migration, the rates and impacts of horizontal transfer are greatly increased, and transfer is most frequent for loci under positive natural selection. Our analysis explains how ecologically important loci can sweep through competing strains and species. In this way, microbial genomes can evolve to become ecologically diverse where different genomic regions encode for partially overlapping, but distinct, ecologies. Under these conditions ecological species do not exist, because genes, not species, inhabit niches. PMID:26592443

  6. Migration and horizontal gene transfer divide microbial genomes into multiple niches

    PubMed Central

    Niehus, Rene; Mitri, Sara; Fletcher, Alexander G.; Foster, Kevin R.


    Horizontal gene transfer is central to microbial evolution, because it enables genetic regions to spread horizontally through diverse communities. However, how gene transfer exerts such a strong effect is not understood. Here we develop an eco-evolutionary model and show how genetic transfer, even when rare, can transform the evolution and ecology of microbes. We recapitulate existing models, which suggest that asexual reproduction will overpower horizontal transfer and greatly limit its effects. We then show that allowing immigration completely changes these predictions. With migration, the rates and impacts of horizontal transfer are greatly increased, and transfer is most frequent for loci under positive natural selection. Our analysis explains how ecologically important loci can sweep through competing strains and species. In this way, microbial genomes can evolve to become ecologically diverse where different genomic regions encode for partially overlapping, but distinct, ecologies. Under these conditions ecological species do not exist, because genes, not species, inhabit niches. PMID:26592443

  7. Adaptive Horizontal Gene Transfers between Multiple Cheese-Associated Fungi

    PubMed Central

    Ropars, Jeanne; Rodríguez de la Vega, Ricardo C.; López-Villavicencio, Manuela; Gouzy, Jérôme; Sallet, Erika; Dumas, Émilie; Lacoste, Sandrine; Debuchy, Robert; Dupont, Joëlle; Branca, Antoine; Giraud, Tatiana


    Summary Domestication is an excellent model for studies of adaptation because it involves recent and strong selection on a few, identified traits [1–5]. Few studies have focused on the domestication of fungi, with notable exceptions [6–11], despite their importance to bioindustry [12] and to a general understanding of adaptation in eukaryotes [5]. Penicillium fungi are ubiquitous molds among which two distantly related species have been independently selected for cheese making—P. roqueforti for blue cheeses like Roquefort and P. camemberti for soft cheeses like Camembert. The selected traits include morphology, aromatic profile, lipolytic and proteolytic activities, and ability to grow at low temperatures, in a matrix containing bacterial and fungal competitors [13–15]. By comparing the genomes of ten Penicillium species, we show that adaptation to cheese was associated with multiple recent horizontal transfers of large genomic regions carrying crucial metabolic genes. We identified seven horizontally transferred regions (HTRs) spanning more than 10 kb each, flanked by specific transposable elements, and displaying nearly 100% identity between distant Penicillium species. Two HTRs carried genes with functions involved in the utilization of cheese nutrients or competition and were found nearly identical in multiple strains and species of cheese-associated Penicillium fungi, indicating recent selective sweeps; they were experimentally associated with faster growth and greater competitiveness on cheese and contained genes highly expressed in the early stage of cheese maturation. These findings have industrial and food safety implications and improve our understanding of the processes of adaptation to rapid environmental changes. PMID:26412136

  8. Turnip mosaic virus (TuMV) is able to use alleles of both eIF4E and eIF(iso)4E from multiple loci of the diploid Brassica rapa.


    Jenner, Carol E; Nellist, Charlotte F; Barker, Guy C; Walsh, John A


    Three copies of eIF4E and three copies of eIF(iso)4E have been identified and sequenced from a Turnip mosaic virus (TuMV)-susceptible, inbred, diploid Brassica rapa line, R-o-18. One of the copies of eIF4E lacked exons 2 and 3 and appeared to be a pseudogene. The two other copies of eIF4E and two of the three copies of eIF(iso)4E were isolated from a bacterial artificial chromosome library of R-o-18. Using an Arabidopsis line (Col-0::dSpm) with a transposon knock-out of the eIF(iso)4E gene which resulted in a change from complete susceptibility to complete resistance to TuMV, complementation experiments were carried out with the two versions of eIF4E and the two versions of eIF(iso)4E. When transformed into Col-0::dSpm, all four Brassica transgenes complemented the Arabidopsis eIF(iso)4E knock-out, conferring susceptibility to both mechanical and aphid challenge with TuMV. One of the copies of eIF4E did not appear to support viral replication as successfully as the other copy of eIF4E or the two copies of eIF(iso)4E. The results show that TuMV can use both eIF4E and eIF(iso)4E from B. rapa for replication and, for the first time, that a virus can use eIF4E and eIF(iso)4E from multiple loci of a single host plant.

  9. Turnip mosaic virus (TuMV) is able to use alleles of both eIF4E and eIF(iso)4E from multiple loci of the diploid Brassica rapa.


    Jenner, Carol E; Nellist, Charlotte F; Barker, Guy C; Walsh, John A


    Three copies of eIF4E and three copies of eIF(iso)4E have been identified and sequenced from a Turnip mosaic virus (TuMV)-susceptible, inbred, diploid Brassica rapa line, R-o-18. One of the copies of eIF4E lacked exons 2 and 3 and appeared to be a pseudogene. The two other copies of eIF4E and two of the three copies of eIF(iso)4E were isolated from a bacterial artificial chromosome library of R-o-18. Using an Arabidopsis line (Col-0::dSpm) with a transposon knock-out of the eIF(iso)4E gene which resulted in a change from complete susceptibility to complete resistance to TuMV, complementation experiments were carried out with the two versions of eIF4E and the two versions of eIF(iso)4E. When transformed into Col-0::dSpm, all four Brassica transgenes complemented the Arabidopsis eIF(iso)4E knock-out, conferring susceptibility to both mechanical and aphid challenge with TuMV. One of the copies of eIF4E did not appear to support viral replication as successfully as the other copy of eIF4E or the two copies of eIF(iso)4E. The results show that TuMV can use both eIF4E and eIF(iso)4E from B. rapa for replication and, for the first time, that a virus can use eIF4E and eIF(iso)4E from multiple loci of a single host plant. PMID:20672877

  10. Restriction fragment length polymorphism of ovine casein genes: close linkage between the alpha s1-, alpha s2-, beta- and kappa-casein loci.


    Leveziel, H; Metenier, L; Guerin, G; Cullen, P; Provot, C; Bertaud, M; Mercier, J C


    Restriction fragment length polymorphism (RFLP) of ovine casein genes was investigated. Genomic DNA from 56 rams was digested with 10 restriction endonucleases and Southern blots probed with the four ovine casein cDNAs (alpha s1-, beta-, alpha s2- and kappa-Cn). Five enzymes, namely, BglI, PvuII, RsaI, TaqI and HindIII revealed nine different RFLPs. The inheritance of six of these polymorphisms was studied by segregation analysis of gametes in nine rams' families, and each of them could be related to the existence of alleles at the relevant casein locus. A close linkage between the four ovine casein genes was demonstrated since no recombination within the four pairs of loci examined, alpha s1-beta-Cn, alpha s1-kappa-Cn, beta-kappa-Cn and alpha s2-kappa-Cn, was observed in the progeny of double heterozygous rams. The casein genes are thus clustered in the ovine species as in the case of other mammals.

  11. Human antibody expression in transgenic rats: comparison of chimeric IgH loci with human VH, D and JH but bearing different rat C-gene regions.


    Ma, Biao; Osborn, Michael J; Avis, Suzanne; Ouisse, Laure-Hélène; Ménoret, Séverine; Anegon, Ignacio; Buelow, Roland; Brüggemann, Marianne


    Expression of human antibody repertoires in transgenic animals has been accomplished by introducing large human Ig loci into mice and, more recently, a chimeric IgH locus into rats. With human VH, D and JH genes linked to the rat C-region antibody expression was significantly increased, similar to wild-type levels not found with fully human constructs. Here we compare four rat-lines containing the same human VH-region (comprising 22 VHs, all Ds and all JHs in natural configuration) but linked to different rat CH-genes and regulatory sequences. The endogenous IgH locus was silenced by zinc-finger nucleases. After breeding, all lines produced exclusively chimeric human H-chain with near normal IgM levels. However, in two lines poor IgG expression and inefficient immune responses were observed, implying that high expression, class-switching and hypermutation are linked to optimal enhancer function provided by the large regulatory region at the 3' end of the IgH locus. Furthermore, exclusion of Cδ and its downstream interval region may assist recombination. Highly diverse IgG and immune responses similar to normal rats were identified in two strains carrying diverse and differently spaced C-genes.

  12. Identification of loci and functional characterization of trichothecene biosynthesis genes in filamentous fungi of the genus Trichoderma.


    Cardoza, R E; Malmierca, M G; Hermosa, M R; Alexander, N J; McCormick, S P; Proctor, R H; Tijerino, A M; Rumbero, A; Monte, E; Gutiérrez, S


    Trichothecenes are mycotoxins produced by Trichoderma, Fusarium, and at least four other genera in the fungal order Hypocreales. Fusarium has a trichothecene biosynthetic gene (TRI) cluster that encodes transport and regulatory proteins as well as most enzymes required for the formation of the mycotoxins. However, little is known about trichothecene biosynthesis in the other genera. Here, we identify and characterize TRI gene orthologues (tri) in Trichoderma arundinaceum and Trichoderma brevicompactum. Our results indicate that both Trichoderma species have a tri cluster that consists of orthologues of seven genes present in the Fusarium TRI cluster. Organization of genes in the cluster is the same in the two Trichoderma species but differs from the organization in Fusarium. Sequence and functional analysis revealed that the gene (tri5) responsible for the first committed step in trichothecene biosynthesis is located outside the cluster in both Trichoderma species rather than inside the cluster as it is in Fusarium. Heterologous expression analysis revealed that two T. arundinaceum cluster genes (tri4 and tri11) differ in function from their Fusarium orthologues. The Tatri4-encoded enzyme catalyzes only three of the four oxygenation reactions catalyzed by the orthologous enzyme in Fusarium. The Tatri11-encoded enzyme catalyzes a completely different reaction (trichothecene C-4 hydroxylation) than the Fusarium orthologue (trichothecene C-15 hydroxylation). The results of this study indicate that although some characteristics of the tri/TRI cluster have been conserved during evolution of Trichoderma and Fusarium, the cluster has undergone marked changes, including gene loss and/or gain, gene rearrangement, and divergence of gene function.

  13. Detecting selection in the blue crab, Callinectes sapidus, using DNA sequence data from multiple nuclear protein-coding genes.


    Yednock, Bree K; Neigel, Joseph E


    The identification of genes involved in the adaptive evolution of non-model organisms with uncharacterized genomes constitutes a major challenge. This study employed a rigorous and targeted candidate gene approach to test for positive selection on protein-coding genes of the blue crab, Callinectes sapidus. Four genes with putative roles in physiological adaptation to environmental stress were chosen as candidates. A fifth gene not expected to play a role in environmental adaptation was used as a control. Large samples (n>800) of DNA sequences from C. sapidus were used in tests of selective neutrality based on sequence polymorphisms. In combination with these, sequences from the congener C. similis were used in neutrality tests based on interspecific divergence. In multiple tests, significant departures from neutral expectations and indicative of positive selection were found for the candidate gene trehalose 6-phosphate synthase (tps). These departures could not be explained by any of the historical population expansion or bottleneck scenarios that were evaluated in coalescent simulations. Evidence was also found for balancing selection at ATP-synthase subunit 9 (atps) using a maximum likelihood version of the Hudson, Kreitmen, and Aguadé test, and positive selection favoring amino acid replacements within ATP/ADP translocase (ant) was detected using the McDonald-Kreitman test. In contrast, test statistics for the control gene, ribosomal protein L12 (rpl), which presumably has experienced the same demographic effects as the candidate loci, were not significantly different from neutral expectations and could readily be explained by demographic effects. Together, these findings demonstrate the utility of the candidate gene approach for investigating adaptation at the molecular level in a marine invertebrate for which extensive genomic resources are not available.

  14. All-or-(N)One - an epistemological characterization of the human tumorigenic neuronal paralogous FAM72 gene loci.


    Kutzner, Arne; Pramanik, Subrata; Kim, Pok-Son; Heese, Klaus


    FAM72 is a novel neuronal progenitor cell (NPC) self-renewal supporting protein expressed under physiological conditions at low levels in other tissues. Accumulating data indicate the potential pivotal tumourigenic effects of FAM72. Our in silico human genome-wide analysis (GWA) revealed that the FAM72 gene family consists of four human-specific paralogous members, all of which are located on chromosome (chr) 1. Unique asymmetric FAM72 segmental gene duplications are most likely to have occurred in conjunction with the paired genomic neighbour SRGAP2 (SLIT-ROBO Rho GTPase activating protein), as both genes have four paralogues in humans but only one vertebra-emerging orthologue in all other species. No species with two or three FAM72/SRGAP2 gene pairs could be identified, and the four exclusively human-defining ohnologues, with different mutation patterns in Homo neanderthalensis and Denisova hominin, may remain under epigenetic control through long non-coding (lnc) RNAs. PMID:26206078

  15. Gene expression profiles of autophagy-related genes in multiple sclerosis.


    Igci, Mehri; Baysan, Mehmet; Yigiter, Remzi; Ulasli, Mustafa; Geyik, Sirma; Bayraktar, Recep; Bozgeyik, İbrahim; Bozgeyik, Esra; Bayram, Ali; Cakmak, Ecir Ali


    Multiple sclerosis (MS) is an imflammatory disease of central nervous system caused by genetic and environmental factors that remain largely unknown. Autophagy is the process of degradation and recycling of damaged cytoplasmic organelles, macromolecular aggregates, and long-lived proteins. Malfunction of autophagy contributes to the pathogenesis of neurological diseases, and autophagy genes may modulate the T cell survival. We aimed to examine the expression levels of autophagy-related genes. The blood samples of 95 unrelated patients (aged 17-65years, 37 male, 58 female) diagnosed as MS and 95 healthy controls were used to extract the RNA samples. After conversion to single stranded cDNA using polyT priming: the targeted genes were pre-amplified, and 96×78 (samples×primers) qRT-PCR reactions were performed for each primer pair on each sample on a 96.96 array of Fluidigm BioMark™. Compared to age- and sex-matched controls, gene expression levels of ATG16L2, ATG9A, BCL2, FAS, GAA, HGS, PIK3R1, RAB24, RGS19, ULK1, FOXO1, HTT were significantly altered (false discovery rate<0.05). Thus, altered expression levels of several autophagy related genes may affect protein levels, which in turn would influence the activity of autophagy, or most probably, those genes might be acting independent of autophagy and contributing to MS pathogenesis as risk factors. The indeterminate genetic causes leading to alterations in gene expressions require further analysis. PMID:27125224

  16. Gene expression profiles of autophagy-related genes in multiple sclerosis.


    Igci, Mehri; Baysan, Mehmet; Yigiter, Remzi; Ulasli, Mustafa; Geyik, Sirma; Bayraktar, Recep; Bozgeyik, İbrahim; Bozgeyik, Esra; Bayram, Ali; Cakmak, Ecir Ali


    Multiple sclerosis (MS) is an imflammatory disease of central nervous system caused by genetic and environmental factors that remain largely unknown. Autophagy is the process of degradation and recycling of damaged cytoplasmic organelles, macromolecular aggregates, and long-lived proteins. Malfunction of autophagy contributes to the pathogenesis of neurological diseases, and autophagy genes may modulate the T cell survival. We aimed to examine the expression levels of autophagy-related genes. The blood samples of 95 unrelated patients (aged 17-65years, 37 male, 58 female) diagnosed as MS and 95 healthy controls were used to extract the RNA samples. After conversion to single stranded cDNA using polyT priming: the targeted genes were pre-amplified, and 96×78 (samples×primers) qRT-PCR reactions were performed for each primer pair on each sample on a 96.96 array of Fluidigm BioMark™. Compared to age- and sex-matched controls, gene expression levels of ATG16L2, ATG9A, BCL2, FAS, GAA, HGS, PIK3R1, RAB24, RGS19, ULK1, FOXO1, HTT were significantly altered (false discovery rate<0.05). Thus, altered expression levels of several autophagy related genes may affect protein levels, which in turn would influence the activity of autophagy, or most probably, those genes might be acting independent of autophagy and contributing to MS pathogenesis as risk factors. The indeterminate genetic causes leading to alterations in gene expressions require further analysis.

  17. Platypus globin genes and flanking loci suggest a new insertional model for beta-globin evolution in birds and mammals

    PubMed Central

    Patel, Vidushi S; Cooper, Steven JB; Deakin, Janine E; Fulton, Bob; Graves, Tina; Warren, Wesley C; Wilson, Richard K; Graves, Jennifer AM


    Background Vertebrate alpha (α)- and beta (β)-globin gene families exemplify the way in which genomes evolve to produce functional complexity. From tandem duplication of a single globin locus, the α- and β-globin clusters expanded, and then were separated onto different chromosomes. The previous finding of a fossil β-globin gene (ω) in the marsupial α-cluster, however, suggested that duplication of the α-β cluster onto two chromosomes, followed by lineage-specific gene loss and duplication, produced paralogous α- and β-globin clusters in birds and mammals. Here we analyse genomic data from an egg-laying monotreme mammal, the platypus (Ornithorhynchus anatinus), to explore haemoglobin evolution at the stem of the mammalian radiation. Results The platypus α-globin cluster (chromosome 21) contains embryonic and adult α- globin genes, a β-like ω-globin gene, and the GBY globin gene with homology to cytoglobin, arranged as 5'-ζ-ζ'-αD-α3-α2-α1-ω-GBY-3'. The platypus β-globin cluster (chromosome 2) contains single embryonic and adult globin genes arranged as 5'-ε-β-3'. Surprisingly, all of these globin genes were expressed in some adult tissues. Comparison of flanking sequences revealed that all jawed vertebrate α-globin clusters are flanked by MPG-C16orf35 and LUC7L, whereas all bird and mammal β-globin clusters are embedded in olfactory genes. Thus, the mammalian α- and β-globin clusters are orthologous to the bird α- and β-globin clusters respectively. Conclusion We propose that α- and β-globin clusters evolved from an ancient MPG-C16orf35-α-β-GBY-LUC7L arrangement 410 million years ago. A copy of the original β (represented by ω in marsupials and monotremes) was inserted into an array of olfactory genes before the amniote radiation (>315 million years ago), then duplicated and diverged to form orthologous clusters of β-globin genes with different expression profiles in different lineages. PMID:18657265

  18. Reference genes for quantitative gene expression studies in multiple avian species.


    Olias, Philipp; Adam, Iris; Meyer, Anne; Scharff, Constance; Gruber, Achim D


    Quantitative real-time PCR (qPCR) rapidly and reliably quantifies gene expression levels across different experimental conditions. Selection of suitable reference genes is essential for meaningful normalization and thus correct interpretation of data. In recent years, an increasing number of avian species other than the chicken has been investigated molecularly, highlighting the need for an experimentally validated pan-avian primer set for reference genes. Here we report testing a set for 14 candidate reference genes (18S, ABL, GAPDH, GUSB, HMBS, HPRT, PGK1, RPL13, RPL19, RPS7, SDHA, TFRC, VIM, YWHAZ) on different tissues of the mallard (Anas platyrhynchos), domestic chicken (Gallus gallus domesticus), common crane (Grus grus), white-tailed eagle (Haliaeetus albicilla), domestic turkey (Meleagris gallopavo f. domestica), cockatiel (Nymphicus hollandicus), Humboldt penguin (Sphenicus humboldti), ostrich (Struthio camelus) and zebra finch (Taeniopygia guttata), spanning a broad range of the phylogenetic tree of birds. Primer pairs for six to 11 genes were successfully established for each of the nine species. As a proof of principle, we analyzed expression levels of 10 candidate reference genes as well as FOXP2 and the immediate early genes, EGR1 and CFOS, known to be rapidly induced by singing in the avian basal ganglia. We extracted RNA from microbiopsies of the striatal song nucleus Area X of adult male zebra finches after they had sang or remained silent. Using three different statistical algorithms, we identified five genes (18S, PGK1, RPS7, TFRC, YWHAZ) that were stably expressed within each group and also between the singing and silent conditions, establishing them as suitable reference genes. In conclusion, the newly developed pan-avian primer set allows accurate normalization and quantification of gene expression levels in multiple avian species. PMID:24926893

  19. Transcriptomic characterization of two major Fusarium resistance quantitative trait loci (QTLs), Fhb1 and Qfhs.ifa-5A, identifies novel candidate genes

    PubMed Central

    Schweiger, Wolfgang; Steiner, Barbara; Ametz, Christian; Siegwart, Gerald; Wiesenberger, Gerlinde; Berthiller, Franz; Lemmens, Marc; Jia, Haiyan; Adam, Gerhard; Muehlbauer, Gary J; Kreil, David P; Buerstmayr, Hermann


    Fusarium head blight, caused by Fusarium graminearum, is a devastating disease of wheat. We developed near-isogenic lines (NILs) differing in the two strongest known F. graminearum resistance quantitative trait loci (QTLs), Qfhs.ndsu-3BS (also known as resistance gene Fhb1) and Qfhs.ifa-5A, which are located on the short arm of chromosome 3B and on chromosome 5A, respectively. These NILs showing different levels of resistance were used to identify transcripts that are changed significantly in a QTL-specific manner in response to the pathogen and between mock-inoculated samples. After inoculation with F. graminearum spores, 16 transcripts showed a significantly different response for Fhb1 and 352 for Qfhs.ifa-5A. Notably, we identified a lipid transfer protein which is constitutively at least 50-fold more abundant in plants carrying the resistant allele of Qfhs.ifa-5A. In addition to this candidate gene associated with Qfhs.ifa-5A, we identified a uridine diphosphate (UDP)-glycosyltransferase gene, designated TaUGT12887, exhibiting a positive difference in response to the pathogen in lines harbouring both QTLs relative to lines carrying only the Qfhs.ifa-5A resistance allele, suggesting Fhb1 dependence of this transcript. Yet, this dependence was observed only in the NIL with already higher basal resistance. The complete cDNA of TaUGT12887 was reconstituted from available wheat genomic sequences, and a synthetic recoded gene was expressed in a toxin-sensitive strain of Saccharomyces cerevisiae. This gene conferred deoxynivalenol resistance, albeit much weaker than that observed with the previously characterized barley HvUGT13248. PMID:23738863

  20. Combined Analyses of the ITS Loci and the Corresponding 16S rRNA Genes Reveal High Micro- and Macrodiversity of SAR11 Populations in the Red Sea

    PubMed Central

    Ngugi, David Kamanda; Stingl, Ulrich


    Bacteria belonging to the SAR11 clade are among the most abundant prokaryotes in the pelagic zone of the ocean. 16S rRNA gene-based analyses indicate that they constitute up to 60% of the bacterioplankton community in the surface waters of the Red Sea. This extremely oligotrophic water body is further characterized by an epipelagic zone, which has a temperature above 24°C throughout the year, and a remarkable uniform temperature (∼22°C) and salinity (∼41 psu) from the mixed layer (∼200 m) to the bottom at over 2000 m depth. Despite these conditions that set it apart from other marine environments, the microbiology of this ecosystem is still vastly understudied. Prompted by the limited phylogenetic resolution of the 16S rRNA gene, we extended our previous study by sequencing the internal transcribed spacer (ITS) region of SAR11 in different depths of the Red Sea’s water column together with the respective 16S fragment. The overall diversity captured by the ITS loci was ten times higher than that of the corresponding 16S rRNA genes. Moreover, species estimates based on the ITS showed a highly diverse population of SAR11 in the mixed layer that became diminished in deep isothermal waters, which was in contrast to results of the related 16S rRNA genes. While the 16S rRNA gene-based sequences clustered into three phylogenetic subgroups, the related ITS fragments fell into several phylotypes that showed clear depth-dependent shifts in relative abundances. Blast-based analyses not only documented the observed vertical partitioning and universal co-occurrence of specific phylotypes in five other distinct oceanic provinces, but also highlighted the influence of ecosystem-specific traits (e.g., temperature, nutrient availability, and concentration of dissolved oxygen) on the population dynamics of this ubiquitous marine bacterium. PMID:23185592

  1. Identification of Two Aflatrem Biosynthesis Gene Loci in Aspergillus flavus and Metabolic Engineering of Penicillium paxilli To Elucidate Their Function ▿

    PubMed Central

    Nicholson, Matthew J.; Koulman, Albert; Monahan, Brendon J.; Pritchard, Beth L.; Payne, Gary A.; Scott, Barry


    Aflatrem is a potent tremorgenic toxin produced by the soil fungus Aspergillus flavus, and a member of a structurally diverse group of fungal secondary metabolites known as indole-diterpenes. Gene clusters for indole-diterpene biosynthesis have recently been described in several species of filamentous fungi. A search of Aspergillus complete genome sequence data identified putative aflatrem gene clusters in the genomes of A. flavus and Aspergillus oryzae. In both species the genes for aflatrem biosynthesis cluster at two discrete loci; the first, ATM1, is telomere proximal on chromosome 5 and contains a cluster of three genes, atmG, atmC, and atmM, and the second, ATM2, is telomere distal on chromosome 7 and contains five genes, atmD, atmQ, atmB, atmA, and atmP. Reverse transcriptase PCR in A. flavus demonstrated that aflatrem biosynthesis transcript levels increased with the onset of aflatrem production. Transfer of atmP and atmQ into Penicillium paxilli paxP and paxQ deletion mutants, known to accumulate paxilline intermediates paspaline and 13-desoxypaxilline, respectively, showed that AtmP is a functional homolog of PaxP and that AtmQ utilizes 13-desoxypaxilline as a substrate to synthesize aflatrem pathway-specific intermediates, paspalicine and paspalinine. We propose a scheme for aflatrem biosynthesis in A. flavus based on these reconstitution experiments in P. paxilli and identification of putative intermediates in wild-type cultures of A. flavus. PMID:19801473

  2. Discovery of new variable number tandem repeat loci in multiple Cryptosporidium parvum genomes for the surveillance and investigation of outbreaks of cryptosporidiosis.


    Pérez-Cordón, Gregorio; Robinson, Guy; Nader, Johanna; Chalmers, Rachel M


    Cryptosporidium parvum is a protozoan parasite causing gastro-intestinal disease (cryptosporidiosis) in humans and animals. The ability to investigate sources of contamination and routes of transmission by characterization and comparison of isolates in a cost- and time-efficient manner will help surveillance and epidemiological investigations, but as yet there is no standardised multi-locus typing scheme. To systematically identify variable number tandem repeat (VNTR) loci, which have been shown to provide differentiation in moderately conserved species, we interrogated the reference C. parvum Iowa II genome and seven other C. parvum genomes using a tandem repeat finder software. We identified 28 loci that met criteria defined previously for robust typing schemes for inter-laboratory surveillance, that had potential for generating PCR amplicons analysable on most fragment sizing platforms: repeats ≥6 bp, occurring in tandem in a single repeat region, and providing a total amplicon size of <300 bp including 50 bp for the location of the forward and reverse primers. The qualifying loci will be further investigated in vitro for consideration as preferred loci in the development of a robust VNTR scheme. PMID:27523797

  3. Development of a Multiple Loci Variable Number of Tandem Repeats Analysis (MLVA) to Unravel the Intra-Pathovar Structure of Pseudomonas syringae pv. actinidiae Populations Worldwide.


    Ciarroni, Serena; Gallipoli, Lorenzo; Taratufolo, Maria C; Butler, Margi I; Poulter, Russell T M; Pourcel, Christine; Vergnaud, Gilles; Balestra, Giorgio M; Mazzaglia, Angelo


    The bacterial canker of kiwifruit by Pseudomonas syringae pv. actinidiae is an emblematic example of a catastrophic disease of fruit crops. In 2008 a new, extremely virulent form of the pathogen emerged and rapidly devastated many Actinidia spp. orchards all over the world. In order to understand differences in populations within this pathovar and to elucidate their diffusion and movements on world scale, it is necessary to be able to quickly and on a routine basis compare new isolates with previous records. In this report a worldwide collection of 142 strains was analyzed by MLVA, chosen as investigative technique for its efficacy, reproducibility, simplicity and low cost. A panel of 13 Variable Number of Tandem Repeats (VNTR) loci was identified and used to describe the pathogen population. The MLVA clustering is highly congruent with the population structure as previously established by other molecular approaches including whole genome sequencing and correlates with geographic origin, time of isolation and virulence. For convenience, we divided the VNTR loci in two panels. Panel 1 assay, using six loci, recognizes 23 different haplotypes, clustered into ten complexes with highest congruence with previous classifications. Panel 2, with seven VNTR loci, provides discriminatory power. Using the total set of 13 VNTR loci, 58 haplotypes can be distinguished. The recent hypervirulent type shows very limited diversity and includes, beside the strains from Europe, New Zealand and Chile, a few strains from Shaanxi, China. A broad genetic variability is observed in China, but different types are also retrievable in Japan and Korea. The low virulent strains cluster together and are very different from the other MLVA genotypes. Data were used to generate a public database in MLVAbank. MLVA represents a very promising first-line assay for large-scale routine genotyping, prior to whole genome sequencing of only the most relevant samples.

  4. Development of a Multiple Loci Variable Number of Tandem Repeats Analysis (MLVA) to Unravel the Intra-Pathovar Structure of Pseudomonas syringae pv. actinidiae Populations Worldwide

    PubMed Central

    Ciarroni, Serena; Gallipoli, Lorenzo; Taratufolo, Maria C.; Butler, Margi I.; Poulter, Russell T. M.; Pourcel, Christine; Vergnaud, Gilles; Balestra, Giorgio M.; Mazzaglia, Angelo


    The bacterial canker of kiwifruit by Pseudomonas syringae pv. actinidiae is an emblematic example of a catastrophic disease of fruit crops. In 2008 a new, extremely virulent form of the pathogen emerged and rapidly devastated many Actinidia spp. orchards all over the world. In order to understand differences in populations within this pathovar and to elucidate their diffusion and movements on world scale, it is necessary to be able to quickly and on a routine basis compare new isolates with previous records. In this report a worldwide collection of 142 strains was analyzed by MLVA, chosen as investigative technique for its efficacy, reproducibility, simplicity and low cost. A panel of 13 Variable Number of Tandem Repeats (VNTR) loci was identified and used to describe the pathogen population. The MLVA clustering is highly congruent with the population structure as previously established by other molecular approaches including whole genome sequencing and correlates with geographic origin, time of isolation and virulence. For convenience, we divided the VNTR loci in two panels. Panel 1 assay, using six loci, recognizes 23 different haplotypes, clustered into ten complexes with highest congruence with previous classifications. Panel 2, with seven VNTR loci, provides discriminatory power. Using the total set of 13 VNTR loci, 58 haplotypes can be distinguished. The recent hypervirulent type shows very limited diversity and includes, beside the strains from Europe, New Zealand and Chile, a few strains from Shaanxi, China. A broad genetic variability is observed in China, but different types are also retrievable in Japan and Korea. The low virulent strains cluster together and are very different from the other MLVA genotypes. Data were used to generate a public database in MLVAbank. MLVA represents a very promising first-line assay for large-scale routine genotyping, prior to whole genome sequencing of only the most relevant samples. PMID:26262683

  5. Development of a Multiple Loci Variable Number of Tandem Repeats Analysis (MLVA) to Unravel the Intra-Pathovar Structure of Pseudomonas syringae pv. actinidiae Populations Worldwide.


    Ciarroni, Serena; Gallipoli, Lorenzo; Taratufolo, Maria C; Butler, Margi I; Poulter, Russell T M; Pourcel, Christine; Vergnaud, Gilles; Balestra, Giorgio M; Mazzaglia, Angelo


    The bacterial canker of kiwifruit by Pseudomonas syringae pv. actinidiae is an emblematic example of a catastrophic disease of fruit crops. In 2008 a new, extremely virulent form of the pathogen emerged and rapidly devastated many Actinidia spp. orchards all over the world. In order to understand differences in populations within this pathovar and to elucidate their diffusion and movements on world scale, it is necessary to be able to quickly and on a routine basis compare new isolates with previous records. In this report a worldwide collection of 142 strains was analyzed by MLVA, chosen as investigative technique for its efficacy, reproducibility, simplicity and low cost. A panel of 13 Variable Number of Tandem Repeats (VNTR) loci was identified and used to describe the pathogen population. The MLVA clustering is highly congruent with the population structure as previously established by other molecular approaches including whole genome sequencing and correlates with geographic origin, time of isolation and virulence. For convenience, we divided the VNTR loci in two panels. Panel 1 assay, using six loci, recognizes 23 different haplotypes, clustered into ten complexes with highest congruence with previous classifications. Panel 2, with seven VNTR loci, provides discriminatory power. Using the total set of 13 VNTR loci, 58 haplotypes can be distinguished. The recent hypervirulent type shows very limited diversity and includes, beside the strains from Europe, New Zealand and Chile, a few strains from Shaanxi, China. A broad genetic variability is observed in China, but different types are also retrievable in Japan and Korea. The low virulent strains cluster together and are very different from the other MLVA genotypes. Data were used to generate a public database in MLVAbank. MLVA represents a very promising first-line assay for large-scale routine genotyping, prior to whole genome sequencing of only the most relevant samples. PMID:26262683

  6. Meta-Analysis of Genome-Wide Association Studies and Network Analysis-Based Integration with Gene Expression Data Identify New Suggestive Loci and Unravel a Wnt-Centric Network Associated with Dupuytren’s Disease

    PubMed Central

    Becker, Kerstin; Siegert, Sabine; Toliat, Mohammad Reza; Du, Juanjiangmeng; Casper, Ramona; Dolmans, Guido H.; Werker, Paul M.; Tinschert, Sigrid; Franke, Andre; Gieger, Christian; Strauch, Konstantin; Nothnagel, Michael; Nürnberg, Peter; Hennies, Hans Christian


    Dupuytren´s disease, a fibromatosis of the connective tissue in the palm, is a common complex disease with a strong genetic component. Up to date nine genetic loci have been found to be associated with the disease. Six of these loci contain genes that code for Wnt signalling proteins. In spite of this striking first insight into the genetic factors in Dupuytren´s disease, much of the inherited risk in Dupuytren´s disease still needs to be discovered. The already identified loci jointly explain ~1% of the heritability in this disease. To further elucidate the genetic basis of Dupuytren´s disease, we performed a genome-wide meta-analysis combining three genome-wide association study (GWAS) data sets, comprising 1,580 cases and 4,480 controls. We corroborated all nine previously identified loci, six of these with genome-wide significance (p-value < 5x10-8). In addition, we identified 14 new suggestive loci (p-value < 10−5). Intriguingly, several of these new loci contain genes associated with Wnt signalling and therefore represent excellent candidates for replication. Next, we compared whole-transcriptome data between patient- and control-derived tissue samples and found the Wnt/β-catenin pathway to be the top deregulated pathway in patient samples. We then conducted network and pathway analyses in order to identify protein networks that are enriched for genes highlighted in the GWAS meta-analysis and expression data sets. We found further evidence that the Wnt signalling pathways in conjunction with other pathways may play a critical role in Dupuytren´s disease. PMID:27467239

  7. Imputation and subset-based association analysis across different cancer types identifies multiple independent risk loci in the TERT-CLPTM1L region on chromosome 5p15.33.


    Wang, Zhaoming; Zhu, Bin; Zhang, Mingfeng; Parikh, Hemang; Jia, Jinping; Chung, Charles C; Sampson, Joshua N; Hoskins, Jason W; Hutchinson, Amy; Burdette, Laurie; Ibrahim, Abdisamad; Hautman, Christopher; Raj, Preethi S; Abnet, Christian C; Adjei, Andrew A; Ahlbom, Anders; Albanes, Demetrius; Allen, Naomi E; Ambrosone, Christine B; Aldrich, Melinda; Amiano, Pilar; Amos, Christopher; Andersson, Ulrika; Andriole, Gerald; Andrulis, Irene L; Arici, Cecilia; Arslan, Alan A; Austin, Melissa A; Baris, Dalsu; Barkauskas, Donald A; Bassig, Bryan A; Beane Freeman, Laura E; Berg, Christine D; Berndt, Sonja I; Bertazzi, Pier Alberto; Biritwum, Richard B; Black, Amanda; Blot, William; Boeing, Heiner; Boffetta, Paolo; Bolton, Kelly; Boutron-Ruault, Marie-Christine; Bracci, Paige M; Brennan, Paul; Brinton, Louise A; Brotzman, Michelle; Bueno-de-Mesquita, H Bas; Buring, Julie E; Butler, Mary Ann; Cai, Qiuyin; Cancel-Tassin, Geraldine; Canzian, Federico; Cao, Guangwen; Caporaso, Neil E; Carrato, Alfredo; Carreon, Tania; Carta, Angela; Chang, Gee-Chen; Chang, I-Shou; Chang-Claude, Jenny; Che, Xu; Chen, Chien-Jen; Chen, Chih-Yi; Chen, Chung-Hsing; Chen, Constance; Chen, Kuan-Yu; Chen, Yuh-Min; Chokkalingam, Anand P; Chu, Lisa W; Clavel-Chapelon, Francoise; Colditz, Graham A; Colt, Joanne S; Conti, David; Cook, Michael B; Cortessis, Victoria K; Crawford, E David; Cussenot, Olivier; Davis, Faith G; De Vivo, Immaculata; Deng, Xiang; Ding, Ti; Dinney, Colin P; Di Stefano, Anna Luisa; Diver, W Ryan; Duell, Eric J; Elena, Joanne W; Fan, Jin-Hu; Feigelson, Heather Spencer; Feychting, Maria; Figueroa, Jonine D; Flanagan, Adrienne M; Fraumeni, Joseph F; Freedman, Neal D; Fridley, Brooke L; Fuchs, Charles S; Gago-Dominguez, Manuela; Gallinger, Steven; Gao, Yu-Tang; Gapstur, Susan M; Garcia-Closas, Montserrat; Garcia-Closas, Reina; Gastier-Foster, Julie M; Gaziano, J Michael; Gerhard, Daniela S; Giffen, Carol A; Giles, Graham G; Gillanders, Elizabeth M; Giovannucci, Edward L; Goggins, Michael; Gokgoz, Nalan; Goldstein, Alisa M; Gonzalez, Carlos; Gorlick, Richard; Greene, Mark H; Gross, Myron; Grossman, H Barton; Grubb, Robert; Gu, Jian; Guan, Peng; Haiman, Christopher A; Hallmans, Goran; Hankinson, Susan E; Harris, Curtis C; Hartge, Patricia; Hattinger, Claudia; Hayes, Richard B; He, Qincheng; Helman, Lee; Henderson, Brian E; Henriksson, Roger; Hoffman-Bolton, Judith; Hohensee, Chancellor; Holly, Elizabeth A; Hong, Yun-Chul; Hoover, Robert N; Hosgood, H Dean; Hsiao, Chin-Fu; Hsing, Ann W; Hsiung, Chao Agnes; Hu, Nan; Hu, Wei; Hu, Zhibin; Huang, Ming-Shyan; Hunter, David J; Inskip, Peter D; Ito, Hidemi; Jacobs, Eric J; Jacobs, Kevin B; Jenab, Mazda; Ji, Bu-Tian; Johansen, Christoffer; Johansson, Mattias; Johnson, Alison; Kaaks, Rudolf; Kamat, Ashish M; Kamineni, Aruna; Karagas, Margaret; Khanna, Chand; Khaw, Kay-Tee; Kim, Christopher; Kim, In-Sam; Kim, Jin Hee; Kim, Yeul Hong; Kim, Young-Chul; Kim, Young Tae; Kang, Chang Hyun; Jung, Yoo Jin; Kitahara, Cari M; Klein, Alison P; Klein, Robert; Kogevinas, Manolis; Koh, Woon-Puay; Kohno, Takashi; Kolonel, Laurence N; Kooperberg, Charles; Kratz, Christian P; Krogh, Vittorio; Kunitoh, Hideo; Kurtz, Robert C; Kurucu, Nilgun; Lan, Qing; Lathrop, Mark; Lau, Ching C; Lecanda, Fernando; Lee, Kyoung-Mu; Lee, Maxwell P; Le Marchand, Loic; Lerner, Seth P; Li, Donghui; Liao, Linda M; Lim, Wei-Yen; Lin, Dongxin; Lin, Jie; Lindstrom, Sara; Linet, Martha S; Lissowska, Jolanta; Liu, Jianjun; Ljungberg, Börje; Lloreta, Josep; Lu, Daru; Ma, Jing; Malats, Nuria; Mannisto, Satu; Marina, Neyssa; Mastrangelo, Giuseppe; Matsuo, Keitaro; McGlynn, Katherine A; McKean-Cowdin, Roberta; McNeill, Lorna H; McWilliams, Robert R; Melin, Beatrice S; Meltzer, Paul S; Mensah, James E; Miao, Xiaoping; Michaud, Dominique S; Mondul, Alison M; Moore, Lee E; Muir, Kenneth; Niwa, Shelley; Olson, Sara H; Orr, Nick; Panico, Salvatore; Park, Jae Yong; Patel, Alpa V; Patino-Garcia, Ana; Pavanello, Sofia; Peeters, Petra H M; Peplonska, Beata; Peters, Ulrike; Petersen, Gloria M; Picci, Piero; Pike, Malcolm C; Porru, Stefano; Prescott, Jennifer; Pu, Xia; Purdue, Mark P; Qiao, You-Lin; Rajaraman, Preetha; Riboli, Elio; Risch, Harvey A; Rodabough, Rebecca J; Rothman, Nathaniel; Ruder, Avima M; Ryu, Jeong-Seon; Sanson, Marc; Schned, Alan; Schumacher, Fredrick R; Schwartz, Ann G; Schwartz, Kendra L; Schwenn, Molly; Scotlandi, Katia; Seow, Adeline; Serra, Consol; Serra, Massimo; Sesso, Howard D; Severi, Gianluca; Shen, Hongbing; Shen, Min; Shete, Sanjay; Shiraishi, Kouya; Shu, Xiao-Ou; Siddiq, Afshan; Sierrasesumaga, Luis; Sierri, Sabina; Loon Sihoe, Alan Dart; Silverman, Debra T; Simon, Matthias; Southey, Melissa C; Spector, Logan; Spitz, Margaret; Stampfer, Meir; Stattin, Par; Stern, Mariana C; Stevens, Victoria L; Stolzenberg-Solomon, Rachael Z; Stram, Daniel O; Strom, Sara S; Su, Wu-Chou; Sund, Malin; Sung, Sook Whan; Swerdlow, Anthony; Tan, Wen; Tanaka, Hideo; Tang, Wei; Tang, Ze-Zhang; Tardon, Adonina; Tay, Evelyn; Taylor, Philip R; Tettey, Yao; Thomas, David M; Tirabosco, Roberto; Tjonneland, Anne; Tobias, Geoffrey S; Toro, Jorge R; Travis, Ruth C; Trichopoulos, Dimitrios; Troisi, Rebecca; Truelove, Ann; Tsai, Ying-Huang; Tucker, Margaret A; Tumino, Rosario; Van Den Berg, David; Van Den Eeden, Stephen K; Vermeulen, Roel; Vineis, Paolo; Visvanathan, Kala; Vogel, Ulla; Wang, Chaoyu; Wang, Chengfeng; Wang, Junwen; Wang, Sophia S; Weiderpass, Elisabete; Weinstein, Stephanie J; Wentzensen, Nicolas; Wheeler, William; White, Emily; Wiencke, John K; Wolk, Alicja; Wolpin, Brian M; Wong, Maria Pik; Wrensch, Margaret; Wu, Chen; Wu, Tangchun; Wu, Xifeng; Wu, Yi-Long; Wunder, Jay S; Xiang, Yong-Bing; Xu, Jun; Yang, Hannah P; Yang, Pan-Chyr; Yatabe, Yasushi; Ye, Yuanqing; Yeboah, Edward D; Yin, Zhihua; Ying, Chen; Yu, Chong-Jen; Yu, Kai; Yuan, Jian-Min; Zanetti, Krista A; Zeleniuch-Jacquotte, Anne; Zheng, Wei; Zhou, Baosen; Mirabello, Lisa; Savage, Sharon A; Kraft, Peter; Chanock, Stephen J; Yeager, Meredith; Landi, Maria Terese; Shi, Jianxin; Chatterjee, Nilanjan; Amundadottir, Laufey T


    Genome-wide association studies (GWAS) have mapped risk alleles for at least 10 distinct cancers to a small region of 63 000 bp on chromosome 5p15.33. This region harbors the TERT and CLPTM1L genes; the former encodes the catalytic subunit of telomerase reverse transcriptase and the latter may play a role in apoptosis. To investigate further the genetic architecture of common susceptibility alleles in this region, we conducted an agnostic subset-based meta-analysis (association analysis based on subsets) across six distinct cancers in 34 248 cases and 45 036 controls. Based on sequential conditional analysis, we identified as many as six independent risk loci marked by common single-nucleotide polymorphisms: five in the TERT gene (Region 1: rs7726159, P = 2.10 × 10(-39); Region 3: rs2853677, P = 3.30 × 10(-36) and PConditional = 2.36 × 10(-8); Region 4: rs2736098, P = 3.87 × 10(-12) and PConditional = 5.19 × 10(-6), Region 5: rs13172201, P = 0.041 and PConditional = 2.04 × 10(-6); and Region 6: rs10069690, P = 7.49 × 10(-15) and PConditional = 5.35 × 10(-7)) and one in the neighboring CLPTM1L gene (Region 2: rs451360; P = 1.90 × 10(-18) and PConditional = 7.06 × 10(-16)). Between three and five cancers mapped to each independent locus with both risk-enhancing and protective effects. Allele-specific effects on DNA methylation were seen for a subset of risk loci, indicating that methylation and subsequent effects on gene expression may contribute to the biology of risk variants on 5p15.33. Our results provide strong support for extensive pleiotropy across this region of 5p15.33, to an extent not previously observed in other cancer susceptibility loci.

  8. Transcription Profiling-Based Identification of Staphylococcus aureus Genes Regulated by the agr and/or sarA Loci

    PubMed Central

    Dunman, P. M.; Murphy, E.; Haney, S.; Palacios, D.; Tucker-Kellogg, G.; Wu, S.; Brown, E. L.; Zagursky, R. J.; Shlaes, D.; Projan, S. J.


    The advent of transcription profiling technologies has provided researchers with an unprecedented ability to study biological processes. Accordingly, a custom-made Affymetrix GeneChip, constituting >86% of the Staphylococcus aureus genome, was used to identify open reading frames that are regulated by agr and/or SarA, the two best-studied regulators of the organism's virulence response. RNA extracted from wild-type cells and agr, sarA, and agr sarA mutant cells in the early-, mid-, and late-log and stationary phases of growth was analyzed. Open reading frames with transcription patterns expected of genes either up- or downregulated in an agr- and/or SarA-dependent manner were identified. Oligonucleotide microarray and Northern blot analyses confirmed that the transcription of several known virulence genes, including hla (alpha-toxin) and spa (protein A), is regulated by each effector and provided insights about the regulatory cascades involved in both alpha-hemolysin and protein A expression. Several putative virulence factors were also identified as regulated by agr and/or SarA. In addition, genes that are involved in several biological processes but which are difficult to reconcile as playing a direct role in the organism's pathogenesis also appeared to be regulated by each effector, suggesting that products of both the agr and the sarA locus are more-global transcription regulators than previously realized. PMID:11717293

  9. Identification of genes/loci and functional markers for seed oil quality improvement by exploring soybean genetic diversity

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The difference in seed oil composition and content among soybean genotypes can be attributed mostly to variations in transcript sequences and/or transcript accumulation of oil-related genes expressed in seeds. We applied the Illumina HiSeq 2000 system to sequence RNA populations in soybean seeds fro...

  10. Construction of a gene-gene interaction network with a combined score across multiple approaches.


    Zhang, A M; Song, H; Shen, Y H; Liu, Y


    Recent progress in computational methods for inves-tigating physical and functional gene interactions has provided new insights into the complexity of biological processes. An essential part of these methods is presented visually in the form of gene interaction networks that can be valuable in exploring the mechanisms of disease. Here, a combined network based on gene pairs with an extra layer of re-liability was constructed after converting and combining the gene pair scores using a novel algorithm across multiple approaches. Four groups of kidney cancer data sets from ArrayExpress were downloaded and analyzed to identify differentially expressed genes using a rank prod-ucts analysis tool. Gene co-expression network, protein-protein interac-tion, co-occurrence network and a combined network were constructed using empirical Bayesian meta-analysis approach, Search Tool for the Retrieval of Interacting Genes/Proteins (STRING) database, an odds ratio formula of the cBioPortal for Cancer Genomics and a novel rank algorithm with combined score, respectively. The topological features of these networks were then compared to evaluate their performances. The results indicated that the gene pairs and their relationship rank-ings were not uniform. The values of topological parameters, such as clustering coefficient and the fitting coefficient R(2) of interaction net-work constructed using our ranked based combination score, were much greater than the other networks. The combined network had a classic small world property which transferred information quickly and displayed great resilience to the dysfunction of low-degree hubs with high-clustering and short average path length. It also followed distinct-ly a scale-free network with a higher reliability. PMID:26125911

  11. Identification of TSG101 functional domains and p21 loci required for TSG101-mediated p21 gene regulation.


    Lin, Yu-Shiuan; Chen, Yin-Ju; Cohen, Stanley N; Cheng, Tzu-Hao


    TSG101 (tumor susceptibility gene 101) is a multi-domain protein known to act in the cell nucleus, cytoplasm, and periplasmic membrane. Remarkably, TSG101, whose location within cells varies with the stage of the cell cycle, affects biological events as diverse as cell growth and proliferation, gene expression, cytokinesis, and endosomal trafficking. The functions of TSG101 additionally are recruited for viral and microvesicle budding and for intracellular survival of invading bacteria. Here we report that the TSG101 protein also interacts with and down-regulates the promoter of the p21 (CIP1/WAF1) tumor suppressor gene, and identify a p21 locus and TSG101 domains that mediate this interaction. TSG101 deficiency in Saos-2 human osteosarcoma cells was accompanied by an increased abundance of p21 mRNA and protein and the retardation of cell proliferation. A cis-acting element in the p21 promoter that interacts with TSG101 and is required for promoter repression was located using chromatin immunoprecipitation (ChIP) analysis and p21-driven luciferase reporter gene expression, respectively. Additional analysis of TSG101 deletion mutants lacking specific domains established the role of the central TSG101 domains in binding to the p21 promoter and demonstrated the additional essentiality of the TSG101 C-terminal steadiness box (SB) in the repression of p21 promoter activity. Neither binding of TSG101 to the p21 promoter nor repression of this promoter required the TSG101 N-terminal UEV domain, which mediates the ubiquitin-recognition functions of TSG101 and its actions as a member of ESCRT endocytic trafficking complexes, indicating that regulation of the p21 promoter by TSG101 is independent of its role in such trafficking.

  12. Capture Hi-C reveals novel candidate genes and complex long-range interactions with related autoimmune risk loci

    PubMed Central

    Martin, Paul; McGovern, Amanda; Orozco, Gisela; Duffus, Kate; Yarwood, Annie; Schoenfelder, Stefan; Cooper, Nicholas J.; Barton, Anne; Wallace, Chris; Fraser, Peter; Worthington, Jane; Eyre, Steve


    Genome-wide association studies have been tremendously successful in identifying genetic variants associated with complex diseases. The majority of association signals are intergenic and evidence is accumulating that a high proportion of signals lie in enhancer regions. We use Capture Hi-C to investigate, for the first time, the interactions between associated variants for four autoimmune diseases and their functional targets in B- and T-cell lines. Here we report numerous looping interactions and provide evidence that only a minority of interactions are common to both B- and T-cell lines, suggesting interactions may be highly cell-type specific; some disease-associated SNPs do not interact with the nearest gene but with more compelling candidate genes (for example, FOXO1, AZI2) often situated several megabases away; and finally, regions associated with different autoimmune diseases interact with each other and the same promoter suggesting common autoimmune gene targets (for example, PTPRC, DEXI and ZFP36L1). PMID:26616563

  13. Meta-analysis of genome-wide association studies identifies multiple lung cancer susceptibility loci in never-smoking Asian women.


    Wang, Zhaoming; Seow, Wei Jie; Shiraishi, Kouya; Hsiung, Chao A; Matsuo, Keitaro; Liu, Jie; Chen, Kexin; Yamji, Taiki; Yang, Yang; Chang, I-Shou; Wu, Chen; Hong, Yun-Chul; Burdett, Laurie; Wyatt, Kathleen; Chung, Charles C; Li, Shengchao A; Yeager, Meredith; Hutchinson, Amy; Hu, Wei; Caporaso, Neil; Landi, Maria T; Chatterjee, Nilanjan; Song, Minsun; Fraumeni, Joseph F; Kohno, Takashi; Yokota, Jun; Kunitoh, Hideo; Ashikawa, Kyota; Momozawa, Yukihide; Daigo, Yataro; Mitsudomi, Tetsuya; Yatabe, Yasushi; Hida, Toyoaki; Hu, Zhibin; Dai, Juncheng; Ma, Hongxia; Jin, Guangfu; Song, Bao; Wang, Zhehai; Cheng, Sensen; Yin, Zhihua; Li, Xuelian; Ren, Yangwu; Guan, Peng; Chang, Jiang; Tan, Wen; Chen, Chien-Jen; Chang, Gee-Chen; Tsai, Ying-Huang; Su, Wu-Chou; Chen, Kuan-Yu; Huang, Ming-Shyan; Chen, Yuh-Min; Zheng, Hong; Li, Haixin; Cui, Ping; Guo, Huan; Xu, Ping; Liu, Li; Iwasaki, Motoki; Shimazu, Taichi; Tsugane, Shoichiro; Zhu, Junjie; Jiang, Gening; Fei, Ke; Park, Jae Yong; Kim, Yeul Hong; Sung, Jae Sook; Park, Kyong Hwa; Kim, Young Tae; Jung, Yoo Jin; Kang, Chang Hyun; Park, In Kyu; Kim, Hee Nam; Jeon, Hyo-Sung; Choi, Jin Eun; Choi, Yi Young; Kim, Jin Hee; Oh, In-Jae; Kim, Young-Chul; Sung, Sook Whan; Kim, Jun Suk; Yoon, Ho-Il; Kweon, Sun-Seog; Shin, Min-Ho; Seow, Adeline; Chen, Ying; Lim, Wei-Yen; Liu, Jianjun; Wong, Maria Pik; Lee, Victor Ho Fun; Bassig, Bryan A; Tucker, Margaret; Berndt, Sonja I; Chow, Wong-Ho; Ji, Bu-Tian; Wang, Junwen; Xu, Jun; Sihoe, Alan Dart Loon; Ho, James C M; Chan, John K C; Wang, Jiu-Cun; Lu, Daru; Zhao, Xueying; Zhao, Zhenhong; Wu, Junjie; Chen, Hongyan; Jin, Li; Wei, Fusheng; Wu, Guoping; An, She-Juan; Zhang, Xu-Chao; Su, Jian; Wu, Yi-Long; Gao, Yu-Tang; Xiang, Yong-Bing; He, Xingzhou; Li, Jihua; Zheng, Wei; Shu, Xiao-Ou; Cai, Qiuyin; Klein, Robert; Pao, William; Lawrence, Charles; Hosgood, H Dean; Hsiao, Chin-Fu; Chien, Li-Hsin; Chen, Ying-Hsiang; Chen, Chung-Hsing; Wang, Wen-Chang; Chen, Chih-Yi; Wang, Chih-Liang; Yu, Chong-Jen; Chen, Hui-Ling; Su, Yu-Chun; Tsai, Fang-Yu; Chen, Yi-Song; Li, Yao-Jen; Yang, Tsung-Ying; Lin, Chien-Chung; Yang, Pan-Chyr; Wu, Tangchun; Lin, Dongxin; Zhou, Baosen; Yu, Jinming; Shen, Hongbing; Kubo, Michiaki; Chanock, Stephen J; Rothman, Nathaniel; Lan, Qing


    Genome-wide association studies (GWAS) of lung cancer in Asian never-smoking women have previously identified six susceptibility loci associated with lung cancer risk. To further discover new susceptibility loci, we imputed data from four GWAS of Asian non-smoking female lung cancer (6877 cases and 6277 controls) using the 1000 Genomes Project (Phase 1 Release 3) data as the reference and genotyped additional samples (5878 cases and 7046 controls) for possible replication. In our meta-analysis, three new loci achieved genome-wide significance, marked by single nucleotide polymorphism (SNP) rs7741164 at 6p21.1 (per-allele odds ratio (OR) = 1.17; P = 5.8 × 10(-13)), rs72658409 at 9p21.3 (per-allele OR = 0.77; P = 1.41 × 10(-10)) and rs11610143 at 12q13.13 (per-allele OR = 0.89; P = 4.96 × 10(-9)). These findings identified new genetic susceptibility alleles for lung cancer in never-smoking women in Asia and merit follow-up to understand their biological underpinnings.

  14. Meta-analysis of genome-wide association studies identifies multiple lung cancer susceptibility loci in never-smoking Asian women.


    Wang, Zhaoming; Seow, Wei Jie; Shiraishi, Kouya; Hsiung, Chao A; Matsuo, Keitaro; Liu, Jie; Chen, Kexin; Yamji, Taiki; Yang, Yang; Chang, I-Shou; Wu, Chen; Hong, Yun-Chul; Burdett, Laurie; Wyatt, Kathleen; Chung, Charles C; Li, Shengchao A; Yeager, Meredith; Hutchinson, Amy; Hu, Wei; Caporaso, Neil; Landi, Maria T; Chatterjee, Nilanjan; Song, Minsun; Fraumeni, Joseph F; Kohno, Takashi; Yokota, Jun; Kunitoh, Hideo; Ashikawa, Kyota; Momozawa, Yukihide; Daigo, Yataro; Mitsudomi, Tetsuya; Yatabe, Yasushi; Hida, Toyoaki; Hu, Zhibin; Dai, Juncheng; Ma, Hongxia; Jin, Guangfu; Song, Bao; Wang, Zhehai; Cheng, Sensen; Yin, Zhihua; Li, Xuelian; Ren, Yangwu; Guan, Peng; Chang, Jiang; Tan, Wen; Chen, Chien-Jen; Chang, Gee-Chen; Tsai, Ying-Huang; Su, Wu-Chou; Chen, Kuan-Yu; Huang, Ming-Shyan; Chen, Yuh-Min; Zheng, Hong; Li, Haixin; Cui, Ping; Guo, Huan; Xu, Ping; Liu, Li; Iwasaki, Motoki; Shimazu, Taichi; Tsugane, Shoichiro; Zhu, Junjie; Jiang, Gening; Fei, Ke; Park, Jae Yong; Kim, Yeul Hong; Sung, Jae Sook; Park, Kyong Hwa; Kim, Young Tae; Jung, Yoo Jin; Kang, Chang Hyun; Park, In Kyu; Kim, Hee Nam; Jeon, Hyo-Sung; Choi, Jin Eun; Choi, Yi Young; Kim, Jin Hee; Oh, In-Jae; Kim, Young-Chul; Sung, Sook Whan; Kim, Jun Suk; Yoon, Ho-Il; Kweon, Sun-Seog; Shin, Min-Ho; Seow, Adeline; Chen, Ying; Lim, Wei-Yen; Liu, Jianjun; Wong, Maria Pik; Lee, Victor Ho Fun; Bassig, Bryan A; Tucker, Margaret; Berndt, Sonja I; Chow, Wong-Ho; Ji, Bu-Tian; Wang, Junwen; Xu, Jun; Sihoe, Alan Dart Loon; Ho, James C M; Chan, John K C; Wang, Jiu-Cun; Lu, Daru; Zhao, Xueying; Zhao, Zhenhong; Wu, Junjie; Chen, Hongyan; Jin, Li; Wei, Fusheng; Wu, Guoping; An, She-Juan; Zhang, Xu-Chao; Su, Jian; Wu, Yi-Long; Gao, Yu-Tang; Xiang, Yong-Bing; He, Xingzhou; Li, Jihua; Zheng, Wei; Shu, Xiao-Ou; Cai, Qiuyin; Klein, Robert; Pao, William; Lawrence, Charles; Hosgood, H Dean; Hsiao, Chin-Fu; Chien, Li-Hsin; Chen, Ying-Hsiang; Chen, Chung-Hsing; Wang, Wen-Chang; Chen, Chih-Yi; Wang, Chih-Liang; Yu, Chong-Jen; Chen, Hui-Ling; Su, Yu-Chun; Tsai, Fang-Yu; Chen, Yi-Song; Li, Yao-Jen; Yang, Tsung-Ying; Lin, Chien-Chung; Yang, Pan-Chyr; Wu, Tangchun; Lin, Dongxin; Zhou, Baosen; Yu, Jinming; Shen, Hongbing; Kubo, Michiaki; Chanock, Stephen J; Rothman, Nathaniel; Lan, Qing


    Genome-wide association studies (GWAS) of lung cancer in Asian never-smoking women have previously identified six susceptibility loci associated with lung cancer risk. To further discover new susceptibility loci, we imputed data from four GWAS of Asian non-smoking female lung cancer (6877 cases and 6277 controls) using the 1000 Genomes Project (Phase 1 Release 3) data as the reference and genotyped additional samples (5878 cases and 7046 controls) for possible replication. In our meta-analysis, three new loci achieved genome-wide significance, marked by single nucleotide polymorphism (SNP) rs7741164 at 6p21.1 (per-allele odds ratio (OR) = 1.17; P = 5.8 × 10(-13)), rs72658409 at 9p21.3 (per-allele OR = 0.77; P = 1.41 × 10(-10)) and rs11610143 at 12q13.13 (per-allele OR = 0.89; P = 4.96 × 10(-9)). These findings identified new genetic susceptibility alleles for lung cancer in never-smoking women in Asia and merit follow-up to understand their biological underpinnings. PMID:26732429

  15. Mapping adipose and muscle tissue expression quantitative trait loci in African Americans to identify genes for type 2 diabetes and obesity.


    Sajuthi, Satria P; Sharma, Neeraj K; Chou, Jeff W; Palmer, Nicholette D; McWilliams, David R; Beal, John; Comeau, Mary E; Ma, Lijun; Calles-Escandon, Jorge; Demons, Jamehl; Rogers, Samantha; Cherry, Kristina; Menon, Lata; Kouba, Ethel; Davis, Donna; Burris, Marcie; Byerly, Sara J; Ng, Maggie C Y; Maruthur, Nisa M; Patel, Sanjay R; Bielak, Lawrence F; Lange, Leslie A; Guo, Xiuqing; Sale, Michèle M; Chan, Kei Hang K; Monda, Keri L; Chen, Gary K; Taylor, Kira; Palmer, Cameron; Edwards, Todd L; North, Kari E; Haiman, Christopher A; Bowden, Donald W; Freedman, Barry I; Langefeld, Carl D; Das, Swapan K


    Relative to European Americans, type 2 diabetes (T2D) is more prevalent in African Americans (AAs). Genetic variation may modulate transcript abundance in insulin-responsive tissues and contribute to risk; yet, published studies identifying expression quantitative trait loci (eQTLs) in African ancestry populations are restricted to blood cells. This study aims to develop a map of genetically regulated transcripts expressed in tissues important for glucose homeostasis in AAs, critical for identifying the genetic etiology of T2D and related traits. Quantitative measures of adipose and muscle gene expression, and genotypic data were integrated in 260 non-diabetic AAs to identify expression regulatory variants. Their roles in genetic susceptibility to T2D, and related metabolic phenotypes, were evaluated by mining GWAS datasets. eQTL analysis identified 1971 and 2078 cis-eGenes in adipose and muscle, respectively. Cis-eQTLs for 885 transcripts including top cis-eGenes CHURC1, USMG5, and ERAP2 were identified in both tissues. 62.1 % of top cis-eSNPs were within ±50 kb of transcription start sites and cis-eGenes were enriched for mitochondrial transcripts. Mining GWAS databases revealed association of cis-eSNPs for more than 50 genes with T2D (e.g. PIK3C2A, RBMS1, UFSP1), gluco-metabolic phenotypes (e.g. INPP5E, SNX17, ERAP2, FN3KRP), and obesity (e.g. POMC, CPEB4). Integration of GWAS meta-analysis data from AA cohorts revealed the most significant association for cis-eSNPs of ATP5SL and MCCC1 genes, with T2D and BMI, respectively. This study developed the first comprehensive map of adipose and muscle tissue eQTLs in AAs (publically accessible at ) and identified genetically regulated transcripts for delineating genetic causes of T2D, and related metabolic phenotypes.

  16. Mapping adipose and muscle tissue expression quantitative trait loci in African Americans to identify genes for type 2 diabetes and obesity.


    Sajuthi, Satria P; Sharma, Neeraj K; Chou, Jeff W; Palmer, Nicholette D; McWilliams, David R; Beal, John; Comeau, Mary E; Ma, Lijun; Calles-Escandon, Jorge; Demons, Jamehl; Rogers, Samantha; Cherry, Kristina; Menon, Lata; Kouba, Ethel; Davis, Donna; Burris, Marcie; Byerly, Sara J; Ng, Maggie C Y; Maruthur, Nisa M; Patel, Sanjay R; Bielak, Lawrence F; Lange, Leslie A; Guo, Xiuqing; Sale, Michèle M; Chan, Kei Hang K; Monda, Keri L; Chen, Gary K; Taylor, Kira; Palmer, Cameron; Edwards, Todd L; North, Kari E; Haiman, Christopher A; Bowden, Donald W; Freedman, Barry I; Langefeld, Carl D; Das, Swapan K


    Relative to European Americans, type 2 diabetes (T2D) is more prevalent in African Americans (AAs). Genetic variation may modulate transcript abundance in insulin-responsive tissues and contribute to risk; yet, published studies identifying expression quantitative trait loci (eQTLs) in African ancestry populations are restricted to blood cells. This study aims to develop a map of genetically regulated transcripts expressed in tissues important for glucose homeostasis in AAs, critical for identifying the genetic etiology of T2D and related traits. Quantitative measures of adipose and muscle gene expression, and genotypic data were integrated in 260 non-diabetic AAs to identify expression regulatory variants. Their roles in genetic susceptibility to T2D, and related metabolic phenotypes, were evaluated by mining GWAS datasets. eQTL analysis identified 1971 and 2078 cis-eGenes in adipose and muscle, respectively. Cis-eQTLs for 885 transcripts including top cis-eGenes CHURC1, USMG5, and ERAP2 were identified in both tissues. 62.1 % of top cis-eSNPs were within ±50 kb of transcription start sites and cis-eGenes were enriched for mitochondrial transcripts. Mining GWAS databases revealed association of cis-eSNPs for more than 50 genes with T2D (e.g. PIK3C2A, RBMS1, UFSP1), gluco-metabolic phenotypes (e.g. INPP5E, SNX17, ERAP2, FN3KRP), and obesity (e.g. POMC, CPEB4). Integration of GWAS meta-analysis data from AA cohorts revealed the most significant association for cis-eSNPs of ATP5SL and MCCC1 genes, with T2D and BMI, respectively. This study developed the first comprehensive map of adipose and muscle tissue eQTLs in AAs (publically accessible at ) and identified genetically regulated transcripts for delineating genetic causes of T2D, and related metabolic phenotypes. PMID:27193597

  17. Diversity and Distribution of Marine Synechococcus: Multiple Gene Phylogenies for Consensus Classification and Development of qPCR Assays for Sensitive Measurement of Clades in the Ocean

    PubMed Central

    Ahlgren, Nathan A.; Rocap, Gabrielle


    Marine Synechococcus is a globally significant genus of cyanobacteria that is comprised of multiple genetic lineages or clades. These clades are thought to represent ecologically distinct units, or ecotypes. Because multiple clades often co-occur together in the oceans, Synechococcus are ideal microbes to explore how closely related bacterial taxa within the same functional guild of organisms co-exist and partition marine habitats. Here we sequenced multiple gene loci from cultured strains to confirm the congruency of clade classifications between the 16S–23S rDNA internally transcribed spacer (ITS), 16S rDNA, narB, ntcA, and rpoC1 loci commonly used in Synechococcus diversity studies. We designed quantitative PCR (qPCR) assays that target the ITS for 10 Synechococcus clades, including four clades, XV, XVI, CRD1, and CRD2, not covered by previous assays employing other loci. Our new qPCR assays are very sensitive and specific, detecting down to tens of cells per ml. Application of these qPCR assays to field samples from the northwest Atlantic showed clear shifts in Synechococcus community composition across a coastal to open-ocean transect. Consistent with previous studies, clades I and IV dominated cold, coastal Synechococcus communities. Clades II and X were abundant at the two warmer, off-shore stations, and at all stations multiple Synechococcus clades co-occurred. qPCR assays developed here provide valuable tools to further explore the dynamics of microbial community structure and the mechanisms of co-existence. PMID:22723796

  18. Distinct loci in the CHRNA5/CHRNA3/CHRNB4 gene cluster are associated with onset of regular smoking.


    Stephens, Sarah H; Hartz, Sarah M; Hoft, Nicole R; Saccone, Nancy L; Corley, Robin C; Hewitt, John K; Hopfer, Christian J; Breslau, Naomi; Coon, Hilary; Chen, Xiangning; Ducci, Francesca; Dueker, Nicole; Franceschini, Nora; Frank, Josef; Han, Younghun; Hansel, Nadia N; Jiang, Chenhui; Korhonen, Tellervo; Lind, Penelope A; Liu, Jason; Lyytikäinen, Leo-Pekka; Michel, Martha; Shaffer, John R; Short, Susan E; Sun, Juzhong; Teumer, Alexander; Thompson, John R; Vogelzangs, Nicole; Vink, Jacqueline M; Wenzlaff, Angela; Wheeler, William; Yang, Bao-Zhu; Aggen, Steven H; Balmforth, Anthony J; Baumeister, Sebastian E; Beaty, Terri H; Benjamin, Daniel J; Bergen, Andrew W; Broms, Ulla; Cesarini, David; Chatterjee, Nilanjan; Chen, Jingchun; Cheng, Yu-Ching; Cichon, Sven; Couper, David; Cucca, Francesco; Dick, Danielle; Foroud, Tatiana; Furberg, Helena; Giegling, Ina; Gillespie, Nathan A; Gu, Fangyi; Hall, Alistair S; Hällfors, Jenni; Han, Shizhong; Hartmann, Annette M; Heikkilä, Kauko; Hickie, Ian B; Hottenga, Jouke Jan; Jousilahti, Pekka; Kaakinen, Marika; Kähönen, Mika; Koellinger, Philipp D; Kittner, Stephen; Konte, Bettina; Landi, Maria-Teresa; Laatikainen, Tiina; Leppert, Mark; Levy, Steven M; Mathias, Rasika A; McNeil, Daniel W; Medland, Sarah E; Montgomery, Grant W; Murray, Tanda; Nauck, Matthias; North, Kari E; Paré, Peter D; Pergadia, Michele; Ruczinski, Ingo; Salomaa, Veikko; Viikari, Jorma; Willemsen, Gonneke; Barnes, Kathleen C; Boerwinkle, Eric; Boomsma, Dorret I; Caporaso, Neil; Edenberg, Howard J; Francks, Clyde; Gelernter, Joel; Grabe, Hans Jörgen; Hops, Hyman; Jarvelin, Marjo-Riitta; Johannesson, Magnus; Kendler, Kenneth S; Lehtimäki, Terho; Magnusson, Patrik K E; Marazita, Mary L; Marchini, Jonathan; Mitchell, Braxton D; Nöthen, Markus M; Penninx, Brenda W; Raitakari, Olli; Rietschel, Marcella; Rujescu, Dan; Samani, Nilesh J; Schwartz, Ann G; Shete, Sanjay; Spitz, Margaret; Swan, Gary E; Völzke, Henry; Veijola, Juha; Wei, Qingyi; Amos, Chris; Cannon, Dale S; Grucza, Richard; Hatsukami, Dorothy; Heath, Andrew; Johnson, Eric O; Kaprio, Jaakko; Madden, Pamela; Martin, Nicholas G; Stevens, Victoria L; Weiss, Robert B; Kraft, Peter; Bierut, Laura J; Ehringer, Marissa A


    Neuronal nicotinic acetylcholine receptor (nAChR) genes (CHRNA5/CHRNA3/CHRNB4) have been reproducibly associated with nicotine dependence, smoking behaviors, and lung cancer risk. Of the few reports that have focused on early smoking behaviors, association results have been mixed. This meta-analysis examines early smoking phenotypes and SNPs in the gene cluster to determine: (1) whether the most robust association signal in this region (rs16969968) for other smoking behaviors is also associated with early behaviors, and/or (2) if additional statistically independent signals are important in early smoking. We focused on two phenotypes: age of tobacco initiation (AOI) and age of first regular tobacco use (AOS). This study included 56,034 subjects (41 groups) spanning nine countries and evaluated five SNPs including rs1948, rs16969968, rs578776, rs588765, and rs684513. Each dataset was analyzed using a centrally generated script. Meta-analyses were conducted from summary statistics. AOS yielded significant associations with SNPs rs578776 (beta = 0.02, P = 0.004), rs1948 (beta = 0.023, P = 0.018), and rs684513 (beta = 0.032, P = 0.017), indicating protective effects. There were no significant associations for the AOI phenotype. Importantly, rs16969968, the most replicated signal in this region for nicotine dependence, cigarettes per day, and cotinine levels, was not associated with AOI (P = 0.59) or AOS (P = 0.92). These results provide important insight into the complexity of smoking behavior phenotypes, and suggest that association signals in the CHRNA5/A3/B4 gene cluster affecting early smoking behaviors may be different from those affecting the mature nicotine dependence phenotype. PMID:24186853

  19. Distinct Loci in the CHRNA5/CHRNA3/CHRNB4 Gene Cluster Are Associated With Onset of Regular Smoking

    PubMed Central

    Stephens, Sarah H.; Hartz, Sarah M.; Hoft, Nicole R.; Saccone, Nancy L.; Corley, Robin C.; Hewitt, John K.; Hopfer, Christian J.; Breslau, Naomi; Coon, Hilary; Chen, Xiangning; Ducci, Francesca; Dueker, Nicole; Franceschini, Nora; Frank, Josef; Han, Younghun; Hansel, Nadia N.; Jiang, Chenhui; Korhonen, Tellervo; Lind, Penelope A.; Liu, Jason; Lyytikäinen, Leo-Pekka; Michel, Martha; Shaffer, John R.; Short, Susan E.; Sun, Juzhong; Teumer, Alexander; Thompson, John R.; Vogelzangs, Nicole; Vink, Jacqueline M.; Wenzlaff, Angela; Wheeler, William; Yang, Bao-Zhu; Aggen, Steven H.; Balmforth, Anthony J.; Baumeister, Sebastian E.; Beaty, Terri H.; Benjamin, Daniel J.; Bergen, Andrew W.; Broms, Ulla; Cesarini, David; Chatterjee, Nilanjan; Chen, Jingchun; Cheng, Yu-Ching; Cichon, Sven; Couper, David; Cucca, Francesco; Dick, Danielle; Foroud, Tatiana; Furberg, Helena; Giegling, Ina; Gillespie, Nathan A.; Gu, Fangyi; Hall, Alistair S.; Hällfors, Jenni; Han, Shizhong; Hartmann, Annette M.; Heikkilä, Kauko; Hickie, Ian B.; Hottenga, Jouke Jan; Jousilahti, Pekka; Kaakinen, Marika; Kähönen, Mika; Koellinger, Philipp D.; Kittner, Stephen; Konte, Bettina; Landi, Maria-Teresa; Laatikainen, Tiina; Leppert, Mark; Levy, Steven M.; Mathias, Rasika A.; McNeil, Daniel W.; Medland, Sarah E.; Montgomery, Grant W.; Murray, Tanda; Nauck, Matthias; North, Kari E.; Paré, Peter D.; Pergadia, Michele; Ruczinski, Ingo; Salomaa, Veikko; Viikari, Jorma; Willemsen, Gonneke; Barnes, Kathleen C.; Boerwinkle, Eric; Boomsma, Dorret I.; Caporaso, Neil; Edenberg, Howard J.; Francks, Clyde; Gelernter, Joel; Grabe, Hans Jörgen; Hops, Hyman; Jarvelin, Marjo-Riitta; Johannesson, Magnus; Kendler, Kenneth S.; Lehtimäki, Terho; Magnusson, Patrik K.E.; Marazita, Mary L.; Marchini, Jonathan; Mitchell, Braxton D.; Nöthen, Markus M.; Penninx, Brenda W.; Raitakari, Olli; Rietschel, Marcella; Rujescu, Dan; Samani, Nilesh J.; Schwartz, Ann G.; Shete, Sanjay; Spitz, Margaret; Swan, Gary E.; Völzke, Henry; Veijola, Juha; Wei, Qingyi; Amos, Chris; Cannon, Dale S.; Grucza, Richard; Hatsukami, Dorothy; Heath, Andrew; Johnson, Eric O.; Kaprio, Jaakko; Madden, Pamela; Martin, Nicholas G.; Stevens, Victoria L.; Weiss, Robert B.; Kraft, Peter; Bierut, Laura J.; Ehringer, Marissa A.


    Neuronal nicotinic acetylcholine receptor (nAChR) genes (CHRNA5/CHRNA3/CHRNB4) have been reproducibly associated with nicotine dependence, smoking behaviors, and lung cancer risk. Of the few reports that have focused on early smoking behaviors, association results have been mixed. This meta-analysis examines early smoking phenotypes and SNPs in the gene cluster to determine: (1) whether the most robust association signal in this region (rs16969968) for other smoking behaviors is also associated with early behaviors, and/or (2) if additional statistically independent signals are important in early smoking. We focused on two phenotypes: age of tobacco initiation (AOI) and age of first regular tobacco use (AOS). This study included 56,034 subjects (41 groups) spanning nine countries and evaluated five SNPs including rs1948, rs16969968, rs578776, rs588765, and rs684513. Each dataset was analyzed using a centrally generated script. Meta-analyses were conducted from summary statistics. AOS yielded significant associations with SNPs rs578776 (beta = 0.02, P = 0.004), rs1948 (beta = 0.023, P = 0.018), and rs684513 (beta = 0.032, P = 0.017), indicating protective effects. There were no significant associations for the AOI phenotype. Importantly, rs16969968, the most replicated signal in this region for nicotine dependence, cigarettes per day, and cotinine levels, was not associated with AOI (P = 0.59) or AOS (P = 0.92). These results provide important insight into the complexity of smoking behavior phenotypes, and suggest that association signals in the CHRNA5/A3/B4 gene cluster affecting early smoking behaviors may be different from those affecting the mature nicotine dependence phenotype. PMID:24186853

  20. PDCD10 Gene Mutations in Multiple Cerebral Cavernous Malformations

    PubMed Central

    Cigoli, Maria Sole; Avemaria, Francesca; De Benedetti, Stefano; Gesu, Giovanni P.; Accorsi, Lucio Giordano; Parmigiani, Stefano; Corona, Maria Franca; Capra, Valeria; Mosca, Andrea; Giovannini, Simona; Notturno, Francesca; Ciccocioppo, Fausta; Volpi, Lilia; Estienne, Margherita; De Michele, Giuseppe; Antenora, Antonella; Bilo, Leda; Tavoni, Antonietta; Zamponi, Nelia; Alfei, Enrico; Baranello, Giovanni; Riva, Daria; Penco, Silvana


    Cerebral cavernous malformations (CCMs) are vascular abnormalities that may cause seizures, intracerebral haemorrhages, and focal neurological deficits. Familial form shows an autosomal dominant pattern of inheritance with incomplete penetrance and variable clinical expression. Three genes have been identified causing familial CCM: KRIT1/CCM1, MGC4607/CCM2, and PDCD10/CCM3. Aim of this study is to report additional PDCD10/CCM3 families poorly described so far which account for 10-15% of hereditary cerebral cavernous malformations. Our group investigated 87 consecutive Italian affected individuals (i.e. positive Magnetic Resonance Imaging) with multiple/familial CCM through direct sequencing and Multiplex Ligation-Dependent Probe Amplification (MLPA) analysis. We identified mutations in over 97.7% of cases, and PDCD10/CCM3 accounts for 13.1%. PDCD10/CCM3 molecular screening revealed four already known mutations and four novel ones. The mutated patients show an earlier onset of clinical manifestations as compared to CCM1/CCM2 mutated patients. The study of further families carrying mutations in PDCD10/CCM3 may help define a possible correlation between genotype and phenotype; an accurate clinical follow up of the subjects would help define more precisely whether mutations in PDCD10/CCM3 lead to a characteristic phenotype. PMID:25354366

  1. Evaluation of effects of multiple candidate genes (LEP, LEPR, MC4R, PIK3C3, and VRTN) on production traits in Duroc pigs.


    Hirose, Kensuke; Ito, Tetsuya; Fukawa, Kazuo; Arakawa, Aisaku; Mikawa, Satoshi; Hayashi, Yoichi; Tanaka, Kazuaki


    We evaluated multiple effects of genetic variations of five candidate loci (LEP, LEPR, MC4R, PIK3C3 and VRTN) on four production traits (average daily weight gain (ADG); backfat thickness (BFT); loin eye muscle area (EMA); and intramuscular fat content (IMF)) in a closed nucleus herd of pure Duroc pigs. Polymorphisms in LEPR, MC4R and PIK3C3 had significant single gene effects on ADG and BFT. The additive genetic variance in ADG and BFT (16.99% and 22.51%, respectively) was explained by genetic effects of these three loci. No correlations were observed between the LEP genotype and production traits in this study. Although we detected marginally epistatic interactions between LEPR and PIK3C3 on the eye muscle area, there were no significant epistatic effects on any traits among all loci pairs. These results suggest that LEPR, MC4R, PIK3C3 and VRTN may independently influence growth rate and fat deposition. Furthermore, the statistical models for predicting the breeding values of each trait had the lowest Akaike's information criterion values when considering the effect of the MC4R, LEPR, PIK3C3 and VRTN genotype simultaneously. These results suggest that LEPR, MC4R, PIK3C3 and VRTN are useful markers for accurately predicting breeding values in Duroc pigs.

  2. Sequence variation and gene duplication at MHC DQB loci of baiji (Lipotes vexillifer), a Chinese river dolphin.


    Yang, G; Yan, J; Zhou, K; Wei, F


    The major histocompatibility complex (MHC) is a fundamental part of the vertebrate immune system, and the high variability in many MHC genes is thought to play an important role in the recognition of parasites. Baiji (Lipotes vexillifer) is one of the most endangered species in the world. Its wild population has declined to fewer than 100 individuals and has a very high risk of becoming extinct in the near future. In this study we present a first step in the molecular characterization of a DQB-like locus of baiji by nucleotide sequence analysis of the polymorphic exon 2 segments. In the examined 172 bp sequences from a group of 18 incidentally captured or stranded individuals, 48 variable sites were determined and 43 alleles were identified, many of which were represented by only one clone. Three to seven alleles were found in each individual, suggesting gene duplications. No deletion, insertion, or exceptional stop codon was detected, suggesting these alleles function in vivo. Phylogenetic reconstruction using neighbor joining grouped the 43 alleles into two distinct lineages, differing by seven nucleotides and four amino acids. Substitutions of amino acids tend to be clustered around sites postulated to be responsible for selective peptide recognition. In the peptide-binding region (PBR) of the DQB locus, the average number of nonsynonymous substitutions per site is greater than that of synonymous substitutions per site (0.1962 versus 0.0256, respectively). Nucleotide and amino acid sequences both showed a relatively high level of similarity (nucleotides 90.6%; amino acids 80.6%) to those of beluga whale (Delphinapterus leucas) and narwhal (Monodon monoceros). The high level of baiji MHC polymorphism revealed in the present study has not been reported in other cetaceans and could be a consequence of the small baiji population adapting to freshwater with a relatively high level of pathogens. PMID:15843636

  3. Layered genetic control of DNA methylation and gene expression: a locus of multiple sclerosis in healthy individuals.


    Shin, Jean; Bourdon, Celine; Bernard, Manon; Wilson, Michael D; Reischl, Eva; Waldenberger, Melanie; Ruggeri, Barbara; Schumann, Gunter; Desrivieres, Sylvane; Leemans, Alexander; Abrahamowicz, Michal; Leonard, Gabriel; Richer, Louis; Bouchard, Luigi; Gaudet, Daniel; Paus, Tomas; Pausova, Zdenka


    DNA methylation may contribute to the etiology of complex genetic disorders through its impact on genome integrity and gene expression; it is modulated by DNA-sequence variants, named methylation quantitative trait loci (meQTLs). Most meQTLs influence methylation of a few CpG dinucleotides within short genomic regions (<3 kb). Here, we identified a layered genetic control of DNA methylation at numerous CpGs across a long 300 kb genomic region. This control involved a single long-range meQTL and multiple local meQTLs. The long-range meQTL explained up to 75% of variance in methylation of CpGs located over extended areas of the 300 kb region. The meQTL was identified in four samples (P = 2.8 × 10(-17), 3.1 × 10(-31), 4.0 × 10(-71) and 5.2 × 10(-199)), comprising a total of 2796 individuals. The long-range meQTL was strongly associated not only with DNA methylation but also with mRNA expression of several genes within the 300 kb region (P = 7.1 × 10(-18)-1.0 × 10(-123)). The associations of the meQTL with gene expression became attenuated when adjusted for DNA methylation (causal inference test: P = 2.4 × 10(-13)-7.1 × 10(-20)), indicating coordinated regulation of DNA methylation and gene expression. Further, the long-range meQTL was found to be in linkage disequilibrium with the most replicated locus of multiple sclerosis, a disease affecting primarily the brain white matter. In middle-aged adults free of the disease, we observed that the risk allele was associated with subtle structural properties of the brain white matter found in multiple sclerosis (P = 0.02). In summary, we identified a long-range meQTL that controls methylation and expression of several genes and may be involved in increasing brain vulnerability to multiple sclerosis.

  4. Layered genetic control of DNA methylation and gene expression: a locus of multiple sclerosis in healthy individuals

    PubMed Central

    Shin, Jean; Bourdon, Celine; Bernard, Manon; Wilson, Michael D.; Reischl, Eva; Waldenberger, Melanie; Ruggeri, Barbara; Schumann, Gunter; Desrivieres, Sylvane; Leemans, Alexander; Abrahamowicz, Michal; Leonard, Gabriel; Richer, Louis; Bouchard, Luigi; Gaudet, Daniel; Paus, Tomas; Pausova, Zdenka


    DNA methylation may contribute to the etiology of complex genetic disorders through its impact on genome integrity and gene expression; it is modulated by DNA-sequence variants, named methylation quantitative trait loci (meQTLs). Most meQTLs influence methylation of a few CpG dinucleotides within short genomic regions (<3 kb). Here, we identified a layered genetic control of DNA methylation at numerous CpGs across a long 300 kb genomic region. This control involved a single long-range meQTL and multiple local meQTLs. The long-range meQTL explained up to 75% of variance in methylation of CpGs located over extended areas of the 300 kb region. The meQTL was identified in four samples (P = 2.8 × 10−17, 3.1 × 10−31, 4.0 × 10−71 and 5.2 × 10−199), comprising a total of 2796 individuals. The long-range meQTL was strongly associated not only with DNA methylation but also with mRNA expression of several genes within the 300 kb region (P = 7.1 × 10−18–1.0 × 10−123). The associations of the meQTL with gene expression became attenuated when adjusted for DNA methylation (causal inference test: P = 2.4 × 10−13–7.1 × 10−20), indicating coordinated regulation of DNA methylation and gene expression. Further, the long-range meQTL was found to be in linkage disequilibrium with the most replicated locus of multiple sclerosis, a disease affecting primarily the brain white matter. In middle-aged adults free of the disease, we observed that the risk allele was associated with subtle structural properties of the brain white matter found in multiple sclerosis (P = 0.02). In summary, we identified a long-range meQTL that controls methylation and expression of several genes and may be involved in increasing brain vulnerability to multiple sclerosis. PMID:26220975

  5. Multiple Novel Loci, Including Those Related to Crohn’s Disease, Psoriasis and Inflammation, Identified in a Genome-Wide Association Study of Fibrinogen in 17,686 Women: the Women’s Genome Health Study

    PubMed Central

    Danik, Jacqueline S.; Pare, Guillaume; Chasman, Daniel I.; Zee, Robert Y.L.; Kwiatkowski, David J.; Parker, Alex; Miletich, Joseph P.; Ridker, Paul M


    Background Fibrinogen is a multifunctional circulating glycoprotein involved in wound-healing, thrombosis, platelet aggregation and inflammation, and elevated levels predict vascular disease. Despite evidence of such crucial biological functions and moderate heritability, comprehensive analysis of the influence of genetic variation on fibrinogen is not available. Methods and Results To address this issue, we undertook a genome-wide association study evaluating the potential relationships between 337,343 single nucleotide polymorphisms (SNPs) and plasma fibrinogen levels among 17,686 apparently healthy women participating in the Women’s Genome Health Study (WGHS). As C-reactive protein is also an inflammatory marker known to predict cardiovascular diseases, we compared the determinants of fibrinogen levels with those of C-reactive protein. Four novel loci were identified, in addition to the fibrinogen gene cluster, which were associated with fibrinogen levels at genome-wide levels of significance (range of P-values from 8.82×10-09 to 8.04×10-39). Two of the loci related to common chronic inflammatory diseases: the first, at locus 5q31.1 (SLC22A5, SLC22A4, IRF1) lies immediately adjacent to a locus linked to Crohn’s disease (P-value for lead SNP 1.24 × 10-12) and the second, at locus 17q25.1 (CD300LF, SLC9A3R1, NAT9) has been associated with psoriasis (P-value for lead SNP 7.72×10-11). A third locus at 1q21.3 (IL6R) lies within the interleukin 6 receptor gene, a critical component of the inflammatory cascade (P-value for lead SNP 1.80×10-11). A novel locus at 2q34 (CPS1) participates in the urea cycle (P-value 8.82×10-09). The majority of implicated SNPs showed little evidence of dual association with C-reactive protein levels. Conclusions An agnostic survey of the human genome identifies novel loci related to common chronic inflammatory diseases as genetic determinants of fibrinogen levels, in addition to loci that relate to the inflammatory cascade, the

  6. X-linked gene expression in the Virginia opossum: differences between the paternally derived Gpd and Pgk-A loci

    SciTech Connect

    Samollow, P.B.; Ford, A.L.; VandeBerg, J.L.


    Expression of X-linked glucose-6-phosphate dehydrogenase (G6PD) and phosphoglycerate kinase-A (PGK-A) in the Virginia opossum (Didelphis virginiana) was studied electrophoretically in animals from natural populations and those produced through controlled laboratory crosses. Blood from most of the wild animals exhibited a common single-banded phenotype for both enzymes. Rare variant animals, regardless of sex, exhibited single-banded phenotypes different in mobility from the common mobility class of the respective enzyme. The laboratory crosses confirmed the allelic basis for the common and rare phenotypes. Transmission of PGK-A phenotypes followed the pattern of determinate (nonrandom) inactivation of the paternally derived Pgk-A allele, and transmission of G6PD also was consistent with this pattern. A survey of tissue-specific expression of G6PD phenotypes of heterozygous females revealed, in almost all tissues, three-banded patterns skewed in favor of the allele that was expressed in blood cells. Three-banded patterns were never observed in males or in putatively homozygous females. These patterns suggest simultaneous, but unequal, expression of the maternally and paternally derived Gpd alleles within individual cells. The absence of such partial expression was noted in a parallel survey of females heterozygous at the Pgd-A locus. Thus, it appears that Gpd and Pgk-A are X-linked in D. virginiana and subject to preferential paternal allele inactivation, but that dosage compensation may not be complete for all paternally derived X-linked genes.

  7. Improved radiation hybrid map of rat chromosome 2: colocalization of the genes encoding corticotropin-releasing hormone and IL6-receptor with quantitative trait loci regulating the inflammatory response.


    Laes, J F; Ravoet, M; Quan, X; Van Vooren, P; Szpirer, J; Szpirer, C


    We established a radiation hybrid (RH) map of several genes and anonymous markers in the lower half of rat chromosome 2, a chromosome region that contains quantitative trait loci (QTLs) for blood pressure, diabetes and inflammatory response. Two of the newly localized genes (Crh and Il6r) encode proteins involved in the regulation of inflammatory and immune events. Our data show that they reside within regions that were genetically defined as QTLs controlling the inflammatory response. These genes are thus both functional and positional candidates.

  8. High prevalence of immunoglobulin light chain gene aberrations as revealed by FISH in multiple myeloma and MGUS.


    Türkmen, Seval; Binder, Anastasia; Gerlach, Antje; Niehage, Sylke; Theodora Melissari, Maria; Inandiklioglu, Nihal; Dörken, Bernd; Burmeister, Thomas


    Multiple myeloma (MM) is a malignant B-cell neoplasm characterized by an uncontrolled proliferation of aberrant plasma cells in the bone marrow. Chromosome aberrations in MM are complex and represent a hallmark of the disease, involving many chromosomes that are altered both numerically and structurally. Nearly half of the cases are nonhyperdiploid and show IGH translocations with the following partner genes: CCND1, FGFR3 and MMSET, MAF, MAFB, and CCND3. The remaining 50% are grouped into a hyperdiploid group that is characterized by multiple trisomies involving chromosomes 3, 5, 7, 9, 11, 15, 19, and 21. In this study, we analyzed the immunoglobulin light chain kappa (IGK, 2p12) and lambda (IGL, 22q11) loci in 150 cases, mostly with MM but in a few cases monoclonal gammopathy of undetermined significance (MGUS), without IGH translocations. We identified aberrations in 27% (= 40 patients) including rearrangements (12%), gains (12%), and deletions (4.6%). In 6 of 18 patients with IGK or/and IGL rearrangements, we detected a MYC rearrangement which suggests that MYC is the translocation partner in the majority of these cases. PMID:24729354

  9. Epigenome-wide association study (EWAS) of BMI, BMI change and waist circumference in African American adults identifies multiple replicated loci

    PubMed Central

    Demerath, Ellen W.; Guan, Weihua; Grove, Megan L.; Aslibekyan, Stella; Mendelson, Michael; Zhou, Yi-Hui; Hedman, Åsa K.; Sandling, Johanna K.; Li, Li-An; Irvin, Marguerite R.; Zhi, Degui; Deloukas, Panos; Liang, Liming; Liu, Chunyu; Bressler, Jan; Spector, Tim D.; North, Kari; Li, Yun; Absher, Devin M.; Levy, Daniel; Arnett, Donna K.; Fornage, Myriam; Pankow, James S.; Boerwinkle, Eric


    Obesity is an important component of the pathophysiology of chronic diseases. Identifying epigenetic modifications associated with elevated adiposity, including DNA methylation variation, may point to genomic pathways that are dysregulated in numerous conditions. The Illumina 450K Bead Chip array was used to assay DNA methylation in leukocyte DNA obtained from 2097 African American adults in the Atherosclerosis Risk in Communities (ARIC) study. Mixed-effects regression models were used to test the association of methylation beta value with concurrent body mass index (BMI) and waist circumference (WC), and BMI change, adjusting for batch effects and potential confounders. Replication using whole-blood DNA from 2377 White adults in the Framingham Heart Study and CD4+ T cell DNA from 991 Whites in the Genetics of Lipid Lowering Drugs and Diet Network Study was followed by testing using adipose tissue DNA from 648 women in the Multiple Tissue Human Expression Resource cohort. Seventy-six BMI-related probes, 164 WC-related probes and 8 BMI change-related probes passed the threshold for significance in ARIC (P < 1 × 10−7; Bonferroni), including probes in the recently reported HIF3A, CPT1A and ABCG1 regions. Replication using blood DNA was achieved for 37 BMI probes and 1 additional WC probe. Sixteen of these also replicated in adipose tissue, including 15 novel methylation findings near genes involved in lipid metabolism, immune response/cytokine signaling and other diverse pathways, including LGALS3BP, KDM2B, PBX1 and BBS2, among others. Adiposity traits are associated with DNA methylation at numerous CpG sites that replicate across studies despite variation in tissue type, ethnicity and analytic approaches. PMID:25935004

  10. Selecting causal genes from genome-wide association studies via functionally-coherent subnetworks

    PubMed Central

    Taşan, Murat; Musso, Gabriel; Hao, Tong; Vidal, Marc; MacRae, Calum A.; Roth, Frederick P.


    While genome-wide association (GWA) studies have linked thousands of loci to human diseases, the causal genes and variants at these loci generally remain unknown. Although investigators typically focus on genes closest to the associated polymorphisms, the causal gene is often more distal. Relying on the literature to help prioritize additional candidate genes at associated loci can draw attention away from less-characterized causal genes. Here we describe a strategy that uses genome-scale ‘co-function’ networks to identify sets of mutually functionally related genes spanning multiple GWA loci. Using associations from ~100 GWA studies covering ten cancer types, this approach outperforms the common alternative strategy in ranking known cancer genes. The strategy’s power grows with more GWA loci, offering an increasing opportunity to elucidate causes of complex human disease. PMID:25532137

  11. Imputation and subset-based association analysis across different cancer types identifies multiple independent risk loci in the TERT-CLPTM1L region on chromosome 5p15.33.


    Wang, Zhaoming; Zhu, Bin; Zhang, Mingfeng; Parikh, Hemang; Jia, Jinping; Chung, Charles C; Sampson, Joshua N; Hoskins, Jason W; Hutchinson, Amy; Burdette, Laurie; Ibrahim, Abdisamad; Hautman, Christopher; Raj, Preethi S; Abnet, Christian C; Adjei, Andrew A; Ahlbom, Anders; Albanes, Demetrius; Allen, Naomi E; Ambrosone, Christine B; Aldrich, Melinda; Amiano, Pilar; Amos, Christopher; Andersson, Ulrika; Andriole, Gerald; Andrulis, Irene L; Arici, Cecilia; Arslan, Alan A; Austin, Melissa A; Baris, Dalsu; Barkauskas, Donald A; Bassig, Bryan A; Beane Freeman, Laura E; Berg, Christine D; Berndt, Sonja I; Bertazzi, Pier Alberto; Biritwum, Richard B; Black, Amanda; Blot, William; Boeing, Heiner; Boffetta, Paolo; Bolton, Kelly; Boutron-Ruault, Marie-Christine; Bracci, Paige M; Brennan, Paul; Brinton, Louise A; Brotzman, Michelle; Bueno-de-Mesquita, H Bas; Buring, Julie E; Butler, Mary Ann; Cai, Qiuyin; Cancel-Tassin, Geraldine; Canzian, Federico; Cao, Guangwen; Caporaso, Neil E; Carrato, Alfredo; Carreon, Tania; Carta, Angela; Chang, Gee-Chen; Chang, I-Shou; Chang-Claude, Jenny; Che, Xu; Chen, Chien-Jen; Chen, Chih-Yi; Chen, Chung-Hsing; Chen, Constance; Chen, Kuan-Yu; Chen, Yuh-Min; Chokkalingam, Anand P; Chu, Lisa W; Clavel-Chapelon, Francoise; Colditz, Graham A; Colt, Joanne S; Conti, David; Cook, Michael B; Cortessis, Victoria K; Crawford, E David; Cussenot, Olivier; Davis, Faith G; De Vivo, Immaculata; Deng, Xiang; Ding, Ti; Dinney, Colin P; Di Stefano, Anna Luisa; Diver, W Ryan; Duell, Eric J; Elena, Joanne W; Fan, Jin-Hu; Feigelson, Heather Spencer; Feychting, Maria; Figueroa, Jonine D; Flanagan, Adrienne M; Fraumeni, Joseph F; Freedman, Neal D; Fridley, Brooke L; Fuchs, Charles S; Gago-Dominguez, Manuela; Gallinger, Steven; Gao, Yu-Tang; Gapstur, Susan M; Garcia-Closas, Montserrat; Garcia-Closas, Reina; Gastier-Foster, Julie M; Gaziano, J Michael; Gerhard, Daniela S; Giffen, Carol A; Giles, Graham G; Gillanders, Elizabeth M; Giovannucci, Edward L; Goggins, Michael; Gokgoz, Nalan; Goldstein, Alisa M; Gonzalez, Carlos; Gorlick, Richard; Greene, Mark H; Gross, Myron; Grossman, H Barton; Grubb, Robert; Gu, Jian; Guan, Peng; Haiman, Christopher A; Hallmans, Goran; Hankinson, Susan E; Harris, Curtis C; Hartge, Patricia; Hattinger, Claudia; Hayes, Richard B; He, Qincheng; Helman, Lee; Henderson, Brian E; Henriksson, Roger; Hoffman-Bolton, Judith; Hohensee, Chancellor; Holly, Elizabeth A; Hong, Yun-Chul; Hoover, Robert N; Hosgood, H Dean; Hsiao, Chin-Fu; Hsing, Ann W; Hsiung, Chao Agnes; Hu, Nan; Hu, Wei; Hu, Zhibin; Huang, Ming-Shyan; Hunter, David J; Inskip, Peter D; Ito, Hidemi; Jacobs, Eric J; Jacobs, Kevin B; Jenab, Mazda; Ji, Bu-Tian; Johansen, Christoffer; Johansson, Mattias; Johnson, Alison; Kaaks, Rudolf; Kamat, Ashish M; Kamineni, Aruna; Karagas, Margaret; Khanna, Chand; Khaw, Kay-Tee; Kim, Christopher; Kim, In-Sam; Kim, Jin Hee; Kim, Yeul Hong; Kim, Young-Chul; Kim, Young Tae; Kang, Chang Hyun; Jung, Yoo Jin; Kitahara, Cari M; Klein, Alison P; Klein, Robert; Kogevinas, Manolis; Koh, Woon-Puay; Kohno, Takashi; Kolonel, Laurence N; Kooperberg, Charles; Kratz, Christian P; Krogh, Vittorio; Kunitoh, Hideo; Kurtz, Robert C; Kurucu, Nilgun; Lan, Qing; Lathrop, Mark; Lau, Ching C; Lecanda, Fernando; Lee, Kyoung-Mu; Lee, Maxwell P; Le Marchand, Loic; Lerner, Seth P; Li, Donghui; Liao, Linda M; Lim, Wei-Yen; Lin, Dongxin; Lin, Jie; Lindstrom, Sara; Linet, Martha S; Lissowska, Jolanta; Liu, Jianjun; Ljungberg, Börje; Lloreta, Josep; Lu, Daru; Ma, Jing; Malats, Nuria; Mannisto, Satu; Marina, Neyssa; Mastrangelo, Giuseppe; Matsuo, Keitaro; McGlynn, Katherine A; McKean-Cowdin, Roberta; McNeill, Lorna H; McWilliams, Robert R; Melin, Beatrice S; Meltzer, Paul S; Mensah, James E; Miao, Xiaoping; Michaud, Dominique S; Mondul, Alison M; Moore, Lee E; Muir, Kenneth; Niwa, Shelley; Olson, Sara H; Orr, Nick; Panico, Salvatore; Park, Jae Yong; Patel, Alpa V; Patino-Garcia, Ana; Pavanello, Sofia; Peeters, Petra H M; Peplonska, Beata; Peters, Ulrike; Petersen, Gloria M; Picci, Piero; Pike, Malcolm C; Porru, Stefano; Prescott, Jennifer; Pu, Xia; Purdue, Mark P; Qiao, You-Lin; Rajaraman, Preetha; Riboli, Elio; Risch, Harvey A; Rodabough, Rebecca J; Rothman, Nathaniel; Ruder, Avima M; Ryu, Jeong-Seon; Sanson, Marc; Schned, Alan; Schumacher, Fredrick R; Schwartz, Ann G; Schwartz, Kendra L; Schwenn, Molly; Scotlandi, Katia; Seow, Adeline; Serra, Consol; Serra, Massimo; Sesso, Howard D; Severi, Gianluca; Shen, Hongbing; Shen, Min; Shete, Sanjay; Shiraishi, Kouya; Shu, Xiao-Ou; Siddiq, Afshan; Sierrasesumaga, Luis; Sierri, Sabina; Loon Sihoe, Alan Dart; Silverman, Debra T; Simon, Matthias; Southey, Melissa C; Spector, Logan; Spitz, Margaret; Stampfer, Meir; Stattin, Par; Stern, Mariana C; Stevens, Victoria L; Stolzenberg-Solomon, Rachael Z; Stram, Daniel O; Strom, Sara S; Su, Wu-Chou; Sund, Malin; Sung, Sook Whan; Swerdlow, Anthony; Tan, Wen; Tanaka, Hideo; Tang, Wei; Tang, Ze-Zhang; Tardon, Adonina; Tay, Evelyn; Taylor, Philip R; Tettey, Yao; Thomas, David M; Tirabosco, Roberto; Tjonneland, Anne; Tobias, Geoffrey S; Toro, Jorge R; Travis, Ruth C; Trichopoulos, Dimitrios; Troisi, Rebecca; Truelove, Ann; Tsai, Ying-Huang; Tucker, Margaret A; Tumino, Rosario; Van Den Berg, David; Van Den Eeden, Stephen K; Vermeulen, Roel; Vineis, Paolo; Visvanathan, Kala; Vogel, Ulla; Wang, Chaoyu; Wang, Chengfeng; Wang, Junwen; Wang, Sophia S; Weiderpass, Elisabete; Weinstein, Stephanie J; Wentzensen, Nicolas; Wheeler, William; White, Emily; Wiencke, John K; Wolk, Alicja; Wolpin, Brian M; Wong, Maria Pik; Wrensch, Margaret; Wu, Chen; Wu, Tangchun; Wu, Xifeng; Wu, Yi-Long; Wunder, Jay S; Xiang, Yong-Bing; Xu, Jun; Yang, Hannah P; Yang, Pan-Chyr; Yatabe, Yasushi; Ye, Yuanqing; Yeboah, Edward D; Yin, Zhihua; Ying, Chen; Yu, Chong-Jen; Yu, Kai; Yuan, Jian-Min; Zanetti, Krista A; Zeleniuch-Jacquotte, Anne; Zheng, Wei; Zhou, Baosen; Mirabello, Lisa; Savage, Sharon A; Kraft, Peter; Chanock, Stephen J; Yeager, Meredith; Landi, Maria Terese; Shi, Jianxin; Chatterjee, Nilanjan; Amundadottir, Laufey T


    Genome-wide association studies (GWAS) have mapped risk alleles for at least 10 distinct cancers to a small region of 63 000 bp on chromosome 5p15.33. This region harbors the TERT and CLPTM1L genes; the former encodes the catalytic subunit of telomerase reverse transcriptase and the latter may play a role in apoptosis. To investigate further the genetic architecture of common susceptibility alleles in this region, we conducted an agnostic subset-based meta-analysis (association analysis based on subsets) across six distinct cancers in 34 248 cases and 45 036 controls. Based on sequential conditional analysis, we identified as many as six independent risk loci marked by common single-nucleotide polymorphisms: five in the TERT gene (Region 1: rs7726159, P = 2.10 × 10(-39); Region 3: rs2853677, P = 3.30 × 10(-36) and PConditional = 2.36 × 10(-8); Region 4: rs2736098, P = 3.87 × 10(-12) and PConditional = 5.19 × 10(-6), Region 5: rs13172201, P = 0.041 and PConditional = 2.04 × 10(-6); and Region 6: rs10069690, P = 7.49 × 10(-15) and PConditional = 5.35 × 10(-7)) and one in the neighboring CLPTM1L gene (Region 2: rs451360; P = 1.90 × 10(-18) and PConditional = 7.06 × 10(-16)). Between three and five cancers mapped to each independent locus with both risk-enhancing and protective effects. Allele-specific effects on DNA methylation were seen for a subset of risk loci, indicating that methylation and subsequent effects on gene expression may contribute to the biology of risk variants on 5p15.33. Our results provide strong support for extensive pleiotropy across this region of 5p15.33, to an extent not previously observed in other cancer susceptibility loci. PMID:25027329

  12. Imputation and subset-based association analysis across different cancer types identifies multiple independent risk loci in the TERT-CLPTM1L region on chromosome 5p15.33

    PubMed Central

    Wang, Zhaoming; Zhu, Bin; Zhang, Mingfeng; Parikh, Hemang; Jia, Jinping; Chung, Charles C.; Sampson, Joshua N.; Hoskins, Jason W.; Hutchinson, Amy; Burdette, Laurie; Ibrahim, Abdisamad; Hautman, Christopher; Raj, Preethi S.; Abnet, Christian C.; Adjei, Andrew A.; Ahlbom, Anders; Albanes, Demetrius; Allen, Naomi E.; Ambrosone, Christine B.; Aldrich, Melinda; Amiano, Pilar; Amos, Christopher; Andersson, Ulrika; Andriole, Gerald; Andrulis, Irene L.; Arici, Cecilia; Arslan, Alan A.; Austin, Melissa A.; Baris, Dalsu; Barkauskas, Donald A.; Bassig, Bryan A.; Beane Freeman, Laura E.; Berg, Christine D.; Berndt, Sonja I.; Bertazzi, Pier Alberto; Biritwum, Richard B.; Black, Amanda; Blot, William; Boeing, Heiner; Boffetta, Paolo; Bolton, Kelly; Boutron-Ruault, Marie-Christine; Bracci, Paige M.; Brennan, Paul; Brinton, Louise A.; Brotzman, Michelle; Bueno-de-Mesquita, H. Bas; Buring, Julie E.; Butler, Mary Ann; Cai, Qiuyin; Cancel-Tassin, Geraldine; Canzian, Federico; Cao, Guangwen; Caporaso, Neil E.; Carrato, Alfredo; Carreon, Tania; Carta, Angela; Chang, Gee-Chen; Chang, I-Shou; Chang-Claude, Jenny; Che, Xu; Chen, Chien-Jen; Chen, Chih-Yi; Chen, Chung-Hsing; Chen, Constance; Chen, Kuan-Yu; Chen, Yuh-Min; Chokkalingam, Anand P.; Chu, Lisa W.; Clavel-Chapelon, Francoise; Colditz, Graham A.; Colt, Joanne S.; Conti, David; Cook, Michael B.; Cortessis, Victoria K.; Crawford, E. David; Cussenot, Olivier; Davis, Faith G.; De Vivo, Immaculata; Deng, Xiang; Ding, Ti; Dinney, Colin P.; Di Stefano, Anna Luisa; Diver, W. Ryan; Duell, Eric J.; Elena, Joanne W.; Fan, Jin-Hu; Feigelson, Heather Spencer; Feychting, Maria; Figueroa, Jonine D.; Flanagan, Adrienne M.; Fraumeni, Joseph F.; Freedman, Neal D.; Fridley, Brooke L.; Fuchs, Charles S.; Gago-Dominguez, Manuela; Gallinger, Steven; Gao, Yu-Tang; Gapstur, Susan M.; Garcia-Closas, Montserrat; Garcia-Closas, Reina; Gastier-Foster, Julie M.; Gaziano, J. Michael; Gerhard, Daniela S.; Giffen, Carol A.; Giles, Graham G.; Gillanders, Elizabeth M.; Giovannucci, Edward L.; Goggins, Michael; Gokgoz, Nalan; Goldstein, Alisa M.; Gonzalez, Carlos; Gorlick, Richard; Greene, Mark H.; Gross, Myron; Grossman, H. Barton; Grubb, Robert; Gu, Jian; Guan, Peng; Haiman, Christopher A.; Hallmans, Goran; Hankinson, Susan E.; Harris, Curtis C.; Hartge, Patricia; Hattinger, Claudia; Hayes, Richard B.; He, Qincheng; Helman, Lee; Henderson, Brian E.; Henriksson, Roger; Hoffman-Bolton, Judith; Hohensee, Chancellor; Holly, Elizabeth A.; Hong, Yun-Chul; Hoover, Robert N.; Hosgood, H. Dean; Hsiao, Chin-Fu; Hsing, Ann W.; Hsiung, Chao Agnes; Hu, Nan; Hu, Wei; Hu, Zhibin; Huang, Ming-Shyan; Hunter, David J.; Inskip, Peter D.; Ito, Hidemi; Jacobs, Eric J.; Jacobs, Kevin B.; Jenab, Mazda; Ji, Bu-Tian; Johansen, Christoffer; Johansson, Mattias; Johnson, Alison; Kaaks, Rudolf; Kamat, Ashish M.; Kamineni, Aruna; Karagas, Margaret; Khanna, Chand; Khaw, Kay-Tee; Kim, Christopher; Kim, In-Sam; Kim, Jin Hee; Kim, Yeul Hong; Kim, Young-Chul; Kim, Young Tae; Kang, Chang Hyun; Jung, Yoo Jin; Kitahara, Cari M.; Klein, Alison P.; Klein, Robert; Kogevinas, Manolis; Koh, Woon-Puay; Kohno, Takashi; Kolonel, Laurence N.; Kooperberg, Charles; Kratz, Christian P.; Krogh, Vittorio; Kunitoh, Hideo; Kurtz, Robert C.; Kurucu, Nilgun; Lan, Qing; Lathrop, Mark; Lau, Ching C.; Lecanda, Fernando; Lee, Kyoung-Mu; Lee, Maxwell P.; Le Marchand, Loic; Lerner, Seth P.; Li, Donghui; Liao, Linda M.; Lim, Wei-Yen; Lin, Dongxin; Lin, Jie; Lindstrom, Sara; Linet, Martha S.; Lissowska, Jolanta; Liu, Jianjun; Ljungberg, Börje; Lloreta, Josep; Lu, Daru; Ma, Jing; Malats, Nuria; Mannisto, Satu; Marina, Neyssa; Mastrangelo, Giuseppe; Matsuo, Keitaro; McGlynn, Katherine A.; McKean-Cowdin, Roberta; McNeill, Lorna H.; McWilliams, Robert R.; Melin, Beatrice S.; Meltzer, Paul S.; Mensah, James E.; Miao, Xiaoping; Michaud, Dominique S.; Mondul, Alison M.; Moore, Lee E.; Muir, Kenneth; Niwa, Shelley; Olson, Sara H.; Orr, Nick; Panico, Salvatore; Park, Jae Yong; Patel, Alpa V.; Patino-Garcia, Ana; Pavanello, Sofia; Peeters, Petra H. M.; Peplonska, Beata; Peters, Ulrike; Petersen, Gloria M.; Picci, Piero; Pike, Malcolm C.; Porru, Stefano; Prescott, Jennifer; Pu, Xia; Purdue, Mark P.; Qiao, You-Lin; Rajaraman, Preetha; Riboli, Elio; Risch, Harvey A.; Rodabough, Rebecca J.; Rothman, Nathaniel; Ruder, Avima M.; Ryu, Jeong-Seon; Sanson, Marc; Schned, Alan; Schumacher, Fredrick R.; Schwartz, Ann G.; Schwartz, Kendra L.; Schwenn, Molly; Scotlandi, Katia; Seow, Adeline; Serra, Consol; Serra, Massimo; Sesso, Howard D.; Severi, Gianluca; Shen, Hongbing; Shen, Min; Shete, Sanjay; Shiraishi, Kouya; Shu, Xiao-Ou; Siddiq, Afshan; Sierrasesumaga, Luis; Sierri, Sabina; Loon Sihoe, Alan Dart; Silverman, Debra T.; Simon, Matthias; Southey, Melissa C.; Spector, Logan; Spitz, Margaret; Stampfer, Meir; Stattin, Par; Stern, Mariana C.; Stevens, Victoria L.; Stolzenberg-Solomon, Rachael Z.; Stram, Daniel O.; Strom, Sara S.; Su, Wu-Chou; Sund, Malin; Sung, Sook Whan; Swerdlow, Anthony; Tan, Wen; Tanaka, Hideo; Tang, Wei; Tang, Ze-Zhang; Tardon, Adonina; Tay, Evelyn; Taylor, Philip R.; Tettey, Yao; Thomas, David M.; Tirabosco, Roberto; Tjonneland, Anne; Tobias, Geoffrey S.; Toro, Jorge R.; Travis, Ruth C.; Trichopoulos, Dimitrios; Troisi, Rebecca; Truelove, Ann; Tsai, Ying-Huang; Tucker, Margaret A.; Tumino, Rosario; Van Den Berg, David; Van Den Eeden, Stephen K.; Vermeulen, Roel; Vineis, Paolo; Visvanathan, Kala; Vogel, Ulla; Wang, Chaoyu; Wang, Chengfeng; Wang, Junwen; Wang, Sophia S.; Weiderpass, Elisabete; Weinstein, Stephanie J.; Wentzensen, Nicolas; Wheeler, William; White, Emily; Wiencke, John K.; Wolk, Alicja; Wolpin, Brian M.; Wong, Maria Pik; Wrensch, Margaret; Wu, Chen; Wu, Tangchun; Wu, Xifeng; Wu, Yi-Long; Wunder, Jay S.; Xiang, Yong-Bing; Xu, Jun; Yang, Hannah P.; Yang, Pan-Chyr; Yatabe, Yasushi; Ye, Yuanqing; Yeboah, Edward D.; Yin, Zhihua; Ying, Chen; Yu, Chong-Jen; Yu, Kai; Yuan, Jian-Min; Zanetti, Krista A.; Zeleniuch-Jacquotte, Anne; Zheng, Wei; Zhou, Baosen; Mirabello, Lisa; Savage, Sharon A.; Kraft, Peter; Chanock, Stephen J.; Yeager, Meredith; Landi, Maria Terese; Shi, Jianxin; Chatterjee, Nilanjan; Amundadottir, Laufey T.


    Genome-wide association studies (GWAS) have mapped risk alleles for at least 10 distinct cancers to a small region of 63 000 bp on chromosome 5p15.33. This region harbors the TERT and CLPTM1L genes; the former encodes the catalytic subunit of telomerase reverse transcriptase and the latter may play a role in apoptosis. To investigate further the genetic architecture of common susceptibility alleles in this region, we conducted an agnostic subset-based meta-analysis (association analysis based on subsets) across six distinct cancers in 34 248 cases and 45 036 controls. Based on sequential conditional analysis, we identified as many as six independent risk loci marked by common single-nucleotide polymorphisms: five in the TERT gene (Region 1: rs7726159, P = 2.10 × 10−39; Region 3: rs2853677, P = 3.30 × 10−36 and PConditional = 2.36 × 10−8; Region 4: rs2736098, P = 3.87 × 10−12 and PConditional = 5.19 × 10−6, Region 5: rs13172201, P = 0.041 and PConditional = 2.04 × 10−6; and Region 6: rs10069690, P = 7.49 × 10−15 and PConditional = 5.35 × 10−7) and one in the neighboring CLPTM1L gene (Region 2: rs451360; P = 1.90 × 10−18 and PConditional = 7.06 × 10−16). Between three and five cancers mapped to each independent locus with both risk-enhancing and protective effects. Allele-specific effects on DNA methylation were seen for a subset of risk loci, indicating that methylation and subsequent effects on gene expression may contribute to the biology of risk variants on 5p15.33. Our results provide strong support for extensive pleiotropy across this region of 5p15.33, to an extent not previously observed in other cancer susceptibility loci. PMID:25027329

  13. Multiple Suboptimal Solutions for Prediction Rules in Gene Expression Data

    PubMed Central

    Komori, Osamu; Pritchard, Mari; Eguchi, Shinto


    This paper discusses mathematical and statistical aspects in analysis methods applied to microarray gene expressions. We focus on pattern recognition to extract informative features embedded in the data for prediction of phenotypes. It has been pointed out that there are severely difficult problems due to the unbalance in the number of observed genes compared with the number of observed subjects. We make a reanalysis of microarray gene expression published data to detect many other gene sets with almost the same performance. We conclude in the current stage that it is not possible to extract only informative genes with high performance in the all observed genes. We investigate the reason why this difficulty still exists even though there are actively proposed analysis methods and learning algorithms in statistical machine learning approaches. We focus on the mutual coherence or the absolute value of the Pearson correlations between two genes and describe the distributions of the correlation for the selected set of genes and the total set. We show that the problem of finding informative genes in high dimensional data is ill-posed and that the difficulty is closely related with the mutual coherence. PMID:23662163

  14. Identification and characterization of multiple Spidroin 1 genes encoding major ampullate silk proteins in Nephila clavipes.


    Gaines, W A; Marcotte, W R


    Spider dragline silk is primarily composed of proteins called major ampullate spidroins (MaSps) that consist of a large repeat array flanked by nonrepetitive N- and C-terminal domains. Until recently, there has been little evidence for more than one gene encoding each of the two major spidroin silk proteins, MaSp1 and MaSp2. Here, we report the deduced N-terminal domain sequences for two distinct MaSp1 genes from Nephila clavipes (MaSp1A and MaSp1B) and for MaSp2. All three MaSp genes are co-expressed in the major ampullate gland. A search of the GenBank database also revealed two distinct MaSp1 C-terminal domain sequences. Sequencing confirmed that both MaSp1 genes are present in all seven Nephila clavipes spiders examined. The presence of nucleotide polymorphisms in these genes confirmed that MaSp1A and MaSp1B are distinct genetic loci and not merely alleles of the same gene. We experimentally determined the transcription start sites for all three MaSp genes and established preliminary pairing between the two MaSp1 N- and C-terminal domains. Phylogenetic analysis of these new sequences and other published MaSp N- and C-terminal domain sequences illustrated that duplications of MaSp genes may be widespread among spider species.

  15. Identification and Characterization of Multiple Spidroin 1 Genes Encoding Major Ampullate Silk Proteins in Nephila clavipes

    PubMed Central

    Gaines, William A.; Marcotte, William R.


    Spider dragline silk is primarily composed of proteins called major ampullate spidroins (MaSp) that consist of a large repeat array flanked by non-repetitive N- and C-terminal domains. Until recently, there has been little evidence for more than one gene encoding each of the two major spidroin silk proteins, MaSp1 and MaSp2. Here, we report the deduced N-terminal domain sequences for two distinct MaSp1 genes from Nephila clavipes (MaSp1A and MaSp1B) and for MaSp2. All three MaSp genes are co-expressed in the major ampullate gland. A search of the GenBank database also revealed two distinct MaSp1 C-terminal domain sequences. Sequencing confirmed that both MaSp1 genes are present in all seven Nephila clavipes spiders examined. The presence of nucleotide polymorphisms in these genes confirmed that MaSp1A and MaSp1B are distinct genetic loci and not merely alleles of the same gene. We have experimentally determined the transcription start sites for all three MaSp genes and established preliminary pairing between the two MaSp1 N- and C-terminal domains. Phylogenetic analysis of these new sequences and other published MaSp N- and C-terminal domain sequences illustrated that duplications of MaSp genes may be widespread among spider species. PMID:18828837

  16. Development of a Lac Operon Concept Inventory (LOCI)

    PubMed Central

    Stefanski, Katherine M.; Gardner, Grant E.; Seipelt-Thiemann, Rebecca L.


    Concept inventories (CIs) are valuable tools for educators that assess student achievement and identify misconceptions held by students. Results of student responses can be used to adjust or develop new instructional methods for a given topic. The regulation of gene expression in both prokaryotes and eukaryotes is an important concept in genetics and one that is particularly challenging for undergraduate students. As part of a larger study examining instructional methods related to gene regulation, the authors developed a 12-item CI assessing student knowledge of the lac operon. Using an established protocol, the authors wrote open-ended questions and conducted in-class testing with undergraduate microbiology and genetics students to discover common errors made by students about the lac operon and to determine aspects of item validity. Using these results, we constructed a 12-item multiple-choice lac operon CI called the Lac Operon Concept Inventory (LOCI), The LOCI was reviewed by two experts in the field for content validity. The LOCI underwent item analysis and was assessed for reliability with a sample of undergraduate genetics students (n = 115). The data obtained were found to be valid and reliable (coefficient alpha = 0.994) with adequate discriminatory power and item difficulty. PMID:27252300

  17. Development of a Lac Operon Concept Inventory (LOCI).


    Stefanski, Katherine M; Gardner, Grant E; Seipelt-Thiemann, Rebecca L


    Concept inventories (CIs) are valuable tools for educators that assess student achievement and identify misconceptions held by students. Results of student responses can be used to adjust or develop new instructional methods for a given topic. The regulation of gene expression in both prokaryotes and eukaryotes is an important concept in genetics and one that is particularly challenging for undergraduate students. As part of a larger study examining instructional methods related to gene regulation, the authors developed a 12-item CI assessing student knowledge of the lac operon. Using an established protocol, the authors wrote open-ended questions and conducted in-class testing with undergraduate microbiology and genetics students to discover common errors made by students about the lac operon and to determine aspects of item validity. Using these results, we constructed a 12-item multiple-choice lac operon CI called the Lac Operon Concept Inventory (LOCI), The LOCI was reviewed by two experts in the field for content validity. The LOCI underwent item analysis and was assessed for reliability with a sample of undergraduate genetics students (n = 115). The data obtained were found to be valid and reliable (coefficient alpha = 0.994) with adequate discriminatory power and item difficulty. PMID:27252300

  18. Genome-wide mapping in a house mouse hybrid zone reveals hybrid sterility loci and Dobzhansky-Muller interactions.


    Turner, Leslie M; Harr, Bettina


    Mapping hybrid defects in contact zones between incipient species can identify genomic regions contributing to reproductive isolation and reveal genetic mechanisms of speciation. The house mouse features a rare combination of sophisticated genetic tools and natural hybrid zones between subspecies. Male hybrids often show reduced fertility, a common reproductive barrier between incipient species. Laboratory crosses have identified sterility loci, but each encompasses hundreds of genes. We map genetic determinants of testis weight and testis gene expression using offspring of mice captured in a hybrid zone between M. musculus musculus and M. m. domesticus. Many generations of admixture enables high-resolution mapping of loci contributing to these sterility-related phenotypes. We identify complex interactions among sterility loci, suggesting multiple, non-independent genetic incompatibilities contribute to barriers to gene flow in the hybrid zone.

  19. Genome-wide mapping in a house mouse hybrid zone reveals hybrid sterility loci and Dobzhansky-Muller interactions

    PubMed Central

    Turner, Leslie M; Harr, Bettina


    Mapping hybrid defects in contact zones between incipient species can identify genomic regions contributing to reproductive isolation and reveal genetic mechanisms of speciation. The house mouse features a rare combination of sophisticated genetic tools and natural hybrid zones between subspecies. Male hybrids often show reduced fertility, a common reproductive barrier between incipient species. Laboratory crosses have identified sterility loci, but each encompasses hundreds of genes. We map genetic determinants of testis weight and testis gene expression using offspring of mice captured in a hybrid zone between M. musculus musculus and M. m. domesticus. Many generations of admixture enables high-resolution mapping of loci contributing to these sterility-related phenotypes. We identify complex interactions among sterility loci, suggesting multiple, non-independent genetic incompatibilities contribute to barriers to gene flow in the hybrid zone. DOI: PMID:25487987

  20. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.


    Beauparlant, Marc A; Drouin, Guy


    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  1. Sesterterpene ophiobolin biosynthesis involving multiple gene clusters in Aspergillus ustus

    PubMed Central

    Chai, Hangzhen; Yin, Ru; Liu, Yongfeng; Meng, Huiying; Zhou, Xianqiang; Zhou, Guolin; Bi, Xupeng; Yang, Xue; Zhu, Tonghan; Zhu, Weiming; Deng, Zixin; Hong, Kui


    Terpenoids are the most diverse and abundant natural products among which sesterterpenes account for less than 2%, with very few reports on their biosynthesis. Ophiobolins are tricyclic 5–8–5 ring sesterterpenes with potential pharmaceutical application. Aspergillus ustus 094102 from mangrove rizhosphere produces ophiobolin and other terpenes. We obtained five gene cluster knockout mutants, with altered ophiobolin yield using genome sequencing and in silico analysis, combined with in vivo genetic manipulation. Involvement of the five gene clusters in ophiobolin synthesis was confirmed by investigation of the five key terpene synthesis relevant enzymes in each gene cluster, either by gene deletion and complementation or in vitro verification of protein function. The results demonstrate that ophiobolin skeleton biosynthesis involves five gene clusters, which are responsible for C15, C20, C25, and C30 terpenoid biosynthesis. PMID:27273151

  2. Multiple Yeast Genes, Including Paf1 Complex Genes, Affect Telomere Length via Telomerase RNA Abundance▿ †

    PubMed Central

    Mozdy, Amy D.; Podell, Elaine R.; Cech, Thomas R.


    Twofold reductions in telomerase RNA levels cause telomere shortening in both humans and the yeast Saccharomyces cerevisiae. To test whether multiple genes that affect telomere length act by modulating telomerase RNA abundance, we used real-time reverse transcription-PCR to screen S. cerevisiae deletion strains reported to maintain shorter or longer telomeres to determine the levels of their telomerase RNA (TLC1) abundance. Of 290 strains screened, 5 had increased TLC1 levels; 4 of these maintained longer telomeres. Twenty strains had decreased TLC1 levels; 18 of these are known to maintain shorter telomeres. Four strains with decreased TLC1 RNA levels contained deletions of subunits of Paf1C (polymerase II-associated factor complex). While Paf1C had been implicated in the transcription of both polyadenylated and nonpolyadenylated RNAs, Paf1C had not been associated previously with the noncoding telomerase RNA. In Paf1C mutant strains, TLC1 overexpression partially rescues telomere length and cell growth defects, suggesting that telomerase RNA is a critical direct or indirect Paf1C target. Other factors newly identified as affecting TLC1 RNA levels include cyclin-dependent kinase, the mediator complex, protein phosphatase 2A, and ribosomal proteins L13B and S16A. This report establishes that a subset of telomere length genes act by modulating telomerase RNA abundance. PMID:18411302

  3. An atlas of gene regulatory networks reveals multiple three-gene mechanisms for interpreting morphogen gradients

    PubMed Central

    Cotterell, James; Sharpe, James


    The interpretation of morphogen gradients is a pivotal concept in developmental biology, and several mechanisms have been proposed to explain how gene regulatory networks (GRNs) achieve concentration-dependent responses. However, the number of different mechanisms that may exist for cells to interpret morphogens, and the importance of design features such as feedback or local cell–cell communication, is unclear. A complete understanding of such systems will require going beyond a case-by-case analysis of real morphogen interpretation mechanisms and mapping out a complete GRN ‘design space.' Here, we generate a first atlas of design space for GRNs capable of patterning a homogeneous field of cells into discrete gene expression domains by interpreting a fixed morphogen gradient. We uncover multiple very distinct mechanisms distributed discretely across the atlas, thereby expanding the repertoire of morphogen interpretation network motifs. Analyzing this diverse collection of mechanisms also allows us to predict that local cell–cell communication will rarely be responsible for the basic dose-dependent response of morphogen interpretation networks. PMID:21045819

  4. The RAD7 and RAD16 genes, which are essential for pyrimidine dimer removal from the silent mating type loci, are also required for repair of the nontranscribed strand of an active gene in Saccharomyces cerevisiae.

    PubMed Central

    Verhage, R; Zeeman, A M; de Groot, N; Gleig, F; Bang, D D; van de Putte, P; Brouwer, J


    The rad16 mutant of Saccharomyces cerevisiae was previously shown to be impaired in removal of UV-induced pyrimidine dimers from the silent mating-type loci (D. D. Bang, R. A. Verhage, N. Goosen, J. Brouwer, and P. van de Putte, Nucleic Acids Res. 20:3925-3931, 1992). Here we show that rad7 as well as rad7 rad16 double mutants have the same repair phenotype, indicating that the RAD7 and RAD16 gene products might operate in the same nucleotide excision repair subpathway. Dimer removal from the genome overall is essentially incomplete in these mutants, leaving about 20 to 30% of the DNA unrepaired. Repair analysis of the transcribed RPB2 gene shows that the nontranscribed strand is not repaired at all in rad7 and rad16 mutants, whereas the transcribed strand is repaired in these mutants at a fast rate similar to that in RAD+ cells. When the results obtained with the RPB2 gene can be generalized, the RAD7 and RAD16 proteins not only are essential for repair of silenced regions but also function in repair of nontranscribed strands of active genes in S. cerevisiae. The phenotype of rad7 and rad16 mutants closely resembles that of human xeroderma pigmentosum complementation group C (XP-C) cells, suggesting that RAD7 and RAD16 in S. cerevisiae function in the same pathway as the XPC gene in human cells. RAD4, which on the basis of sequence homology has been proposed to be the yeast XPC counterpart, seems to be involved in repair of both inactive and active yeast DNA, challenging the hypothesis that RAD4 and XPC are functional homologs. Images PMID:8065346

  5. Predicting Gene Structures from Multiple RT-PCR Tests

    NASA Astrophysics Data System (ADS)

    Kováč, Jakub; Vinař, Tomáš; Brejová, Broňa

    It has been demonstrated that the use of additional information such as ESTs and protein homology can significantly improve accuracy of gene prediction. However, many sources of external information are still being omitted from consideration. Here, we investigate the use of product lengths from RT-PCR experiments in gene finding. We present hardness results and practical algorithms for several variants of the problem and apply our methods to a real RT-PCR data set in the Drosophila genome. We conclude that the use of RT-PCR data can improve the sensitivity of gene prediction and locate novel splicing variants.

  6. A Large-Scale Functional Analysis of Putative Target Genes of Mating-Type Loci Provides Insight into the Regulation of Sexual Development of the Cereal Pathogen Fusarium graminearum.


    Kim, Hee-Kyoung; Jo, Seong-Mi; Kim, Gi-Yong; Kim, Da-Woon; Kim, Yeon-Ki; Yun, Sung-Hwan


    Fusarium graminearum, the causal agent of Fusarium head blight in cereal crops, produces sexual progeny (ascospore) as an important overwintering and dissemination strategy for completing the disease cycle. This homothallic ascomycetous species does not require a partner for sexual mating; instead, it carries two opposite mating-type (MAT) loci in a single nucleus to control sexual development. To gain a comprehensive understanding of the regulation of sexual development in F. graminearum, we used in-depth and high-throughput analyses to examine the target genes controlled transcriptionally by two-linked MAT loci (MAT1-1, MAT1-2). We hybridized a genome-wide microarray with total RNAs from F. graminearum mutants that lacked each MAT locus individually or together, and overexpressed MAT1-2-1, as well as their wild-type progenitor, at an early stage of sexual development. A comparison of the gene expression levels revealed a total of 1,245 differentially expressed genes (DEGs) among all of the mutants examined. Among these, genes involved in metabolism, cell wall organization, cellular response to stimuli, cell adhesion, fertilization, development, chromatin silencing, and signal transduction, were significantly enriched. Protein binding microarray analysis revealed the presence of putative core DNA binding sequences (ATTAAT or ATTGTT) for the HMG (high mobility group)-box motif in the MAT1-2-1 protein. Targeted deletion of 106 DEGs revealed 25 genes that were specifically required for sexual development, most of which were regulated transcriptionally by both the MAT1-1 and MAT1-2 loci. Taken together with the expression patterns of key target genes, we propose a regulatory pathway for MAT-mediated sexual development, in which both MAT loci may be activated by several environmental cues via chromatin remodeling and/or signaling pathways, and then control the expression of at least 1,245 target genes during sexual development via regulatory cascades and/or networks

  7. Single Cell Visualization of Yeast Gene Expression Shows Correlation of Epigenetic Switching between Multiple Heterochromatic Regions through Multiple Generations

    PubMed Central

    Mano, Yasunobu; Kobayashi, Tetsuya J.; Nakayama, Jun-ichi; Uchida, Hiroyuki; Oki, Masaya


    Differences in gene expression between individual cells can be mediated by epigenetic regulation; thus, methods that enable detailed analyses of single cells are crucial to understanding this phenomenon. In this study, genomic silencing regions of Saccharomyces cerevisiae that are subject to epigenetic regulation, including the HMR, HML, and telomere regions, were investigated using a newly developed single cell analysis method. This method uses fluorescently labeled proteins to track changes in gene expression over multiple generations of a single cell. Epigenetic control of gene expression differed depending on the specific silencing region at which the reporter gene was inserted. Correlations between gene expression at the HMR-left and HMR-right regions, as well as the HMR-right and HML-right regions, were observed in the single-cell level; however, no such correlations involving the telomere region were observed. Deletion of the histone acetyltransferase GCN5 gene from a yeast strain carrying a fluorescent reporter gene at the HMR-left region reduced the frequency of changes in gene expression over a generation. The results presented here suggest that epigenetic control within an individual cell is reversible and can be achieved via regulation of histone acetyltransferase activity. PMID:23843746

  8. Diplotype Trend Regression Analysis of the ADH Gene Cluster and the ALDH2 Gene: Multiple Significant Associations with Alcohol Dependence

    PubMed Central

    Luo, Xingguang; Kranzler, Henry R.; Zuo, Lingjun; Wang, Shuang; Schork, Nicholas J.; Gelernter, Joel


    The set of alcohol-metabolizing enzymes has considerable genetic and functional complexity. The relationships between some alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH) genes and alcohol dependence (AD) have long been studied in many populations, but not comprehensively. In the present study, we genotyped 16 markers within the ADH gene cluster (including the ADH1A, ADH1B, ADH1C, ADH5, ADH6, and ADH7 genes), 4 markers within the ALDH2 gene, and 38 unlinked ancestry-informative markers in a case-control sample of 801 individuals. Associations between markers and disease were analyzed by a Hardy-Weinberg equilibrium (HWE) test, a conventional case-control comparison, a structured association analysis, and a novel diplotype trend regression (DTR) analysis. Finally, the disease alleles were fine mapped by a Hardy-Weinberg disequilibrium (HWD) measure (J). All markers were found to be in HWE in controls, but some markers showed HWD in cases. Genotypes of many markers were associated with AD. DTR analysis showed that ADH5 genotypes and diplotypes of ADH1A, ADH1B, ADH7, and ALDH2 were associated with AD in European Americans and/or African Americans. The risk-influencing alleles were fine mapped from among the markers studied and were found to coincide with some well-known functional variants. We demonstrated that DTR was more powerful than many other conventional association methods. We also found that several ADH genes and the ALDH2 gene were susceptibility loci for AD, and the associations were best explained by several independent risk genes. PMID:16685648

  9. Phylogeny of the caniform carnivora: evidence from multiple genes.


    Yu, Li; Zhang, Ya-ping


    The monophyletic group Caniformia in the order Carnivora currently comprises seven families whose relationships remain contentious. The phylogenetic positions of the two panda species within the Caniformia have also been evolutionary puzzles over the past decades, especially for Ailurus fulgens (the red panda). Here, new nuclear sequences from two introns of the beta-fibrinogen gene (beta-fibrinogen introns 4 and 7) and a complete mitochondrial (mt) gene (ND2) from 17 caniform representatives were explored for their utilities in resolving higher-level relationships in the Caniformia. In addition, two previously available nuclear (IRBP exon 1 and TTR intron 1) data sets were also combined and analyzed simultaneously with the newly obtained sequence data in this study. Combined analyses of four nuclear and one mt genes (4417 bp) recover a branching order in which almost all nodes were strongly supported. The present analyses provide evidence in favor of Ailurus fulgens as the closest taxon to the procyonid-mustelid (i.e., Musteloidea sensu stricto) clade, followed by pinnipeds (i.e., Otariidae and Phocidae), Ursidae (including Ailuropoda melanoleuca), and Canidae, the most basal lineage in the Caniformia. The potential utilities of different genes in the context of caniform phylogeny were also evaluated, with special attention to the previously unexplored beta-fibrinogen intron 4 and 7 genes.

  10. Multiple quantitative trait loci for cortical and trabecular bone regulation map to mid-distal mouse chromosome 4 that shares linkage homology to human chromosome 1p36.


    Beamer, Wesley G; Shultz, Kathryn L; Coombs, Harold F; Horton, Lindsay G; Donahue, Leah Rae; Rosen, Clifford J


    The mid-distal region of mouse chromosome 4 (Chr 4) is homologous with human Chr 1p36. Previously, we reported that mouse Chr 4 carries a quantitative trait locus (QTL) with strong regulatory effect on volumetric bone mineral density (vBMD). The intent of this study is to utilize nested congenic strains to decompose the genetic complexity of this gene-rich region. Adult females and males from 18 nested congenic strains carrying discrete C3H sequences were phenotyped for femoral mineral and volume by pQCT and for trabecular bone volume (BV), tissue volume (TV), trabecular number (, and trabecular thickness (Trab.thk) by MicroCT 40. Our data show that the mouse Chr 4 region consists of at least 10 regulatory QTL regions that affected either or both pQCT and MicroCT 40 phenotypes. The pQCT phenotypes were typically similar between sexes, whereas the MicroCT 40 phenotypes were divergent. Individual congenic strains contained one to seven QTL regions. These regions conferred large positive or negative effects in some congenic strains, depending on the particular bone phenotype. The QTL regions II to X are syntenic with human 1p36, containing from 1 to 102 known genes. We identified 13 candidate genes that can be linked to bone within these regions. Six of these genes were linked to osteoblasts, three linked to osteoclasts, and two linked to skeletal development. Three of these genes have been identified in Genome Wide Association Studies (GWAS) linked to 1p36. In region III, there is only one gene, Lck, which conferred negative pQCT and MicroCT 40 phenotypes in both sexes. This gene is important to development and functioning of T cells, has been associated with osteoclast activity, and represents a novel bone regulatory gene that merits further experimental evaluation. In summary, congenic strains are powerful tools for identifying regulatory regions that influence bone biology and offer models for testing hypotheses about gene-gene and gene

  11. Multiple quantitative trait loci for cortical and trabecular bone regulation map to mid-distal mouse chromosome 4 that shares linkage homology to human chromosome 1p36.


    Beamer, Wesley G; Shultz, Kathryn L; Coombs, Harold F; Horton, Lindsay G; Donahue, Leah Rae; Rosen, Clifford J


    The mid-distal region of mouse chromosome 4 (Chr 4) is homologous with human Chr 1p36. Previously, we reported that mouse Chr 4 carries a quantitative trait locus (QTL) with strong regulatory effect on volumetric bone mineral density (vBMD). The intent of this study is to utilize nested congenic strains to decompose the genetic complexity of this gene-rich region. Adult females and males from 18 nested congenic strains carrying discrete C3H sequences were phenotyped for femoral mineral and volume by pQCT and for trabecular bone volume (BV), tissue volume (TV), trabecular number (, and trabecular thickness (Trab.thk) by MicroCT 40. Our data show that the mouse Chr 4 region consists of at least 10 regulatory QTL regions that affected either or both pQCT and MicroCT 40 phenotypes. The pQCT phenotypes were typically similar between sexes, whereas the MicroCT 40 phenotypes were divergent. Individual congenic strains contained one to seven QTL regions. These regions conferred large positive or negative effects in some congenic strains, depending on the particular bone phenotype. The QTL regions II to X are syntenic with human 1p36, containing from 1 to 102 known genes. We identified 13 candidate genes that can be linked to bone within these regions. Six of these genes were linked to osteoblasts, three linked to osteoclasts, and two linked to skeletal development. Three of these genes have been identified in Genome Wide Association Studies (GWAS) linked to 1p36. In region III, there is only one gene, Lck, which conferred negative pQCT and MicroCT 40 phenotypes in both sexes. This gene is important to development and functioning of T cells, has been associated with osteoclast activity, and represents a novel bone regulatory gene that merits further experimental evaluation. In summary, congenic strains are powerful tools for identifying regulatory regions that influence bone biology and offer models for testing hypotheses about gene-gene and gene

  12. Genes and quantitative trait loci (QTL) controlling trace element concentrations in perennial grasses grown on phytotoxic soil contaminated with heavy metals

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Perennial grasses cover diverse soils throughout the world, including sites contaminated with heavy metals, producing forages that must be safe for livestock and wildlife. Chromosome regions known as quantitative trait loci (QTLs) controlling forage mineral concentrations were mapped in a populatio...

  13. Developing Pedagogical Tools to Improve Teaching Multiple Models of the Gene in High School

    ERIC Educational Resources Information Center

    Auckaraaree, Nantaya


    Multiple models of the gene are used to explore genetic phenomena in scientific practices and in the classroom. In genetics curricula, the classical and molecular models are presented in disconnected domains. Research demonstrates that, without explicit connections, students have difficulty developing an understanding of the gene that spans…

  14. In vivo imaging of clock gene expression in multiple tissues of freely moving mice.


    Hamada, Toshiyuki; Sutherland, Kenneth; Ishikawa, Masayori; Miyamoto, Naoki; Honma, Sato; Shirato, Hiroki; Honma, Ken-Ichi


    Clock genes are expressed throughout the body, although how they oscillate in unrestrained animals is not known. Here, we show an in vivo imaging technique that enables long-term simultaneous imaging of multiple tissues. We use dual-focal 3D tracking and signal-intensity calibration to follow gene expression in a target area. We measure circadian rhythms of clock genes in the olfactory bulb, right and left ears and cortices, and the skin. In addition, the kinetic relationship between gene expression and physiological responses to experimental cues is monitored. Under stable conditions gene expression is in phase in all tissues. In response to a long-duration light pulse, the olfactory bulb shifts faster than other tissues. In Cry1(-/-) Cry2(-/-) arrhythmic mice circadian oscillation is absent in all tissues. Thus, our system successfully tracks circadian rhythms in clock genes in multiple tissues in unrestrained mice. PMID:27285820

  15. Multiple Neuropeptide-Coding Genes Involved in Planarian Pharynx Extension.


    Shimoyama, Seira; Inoue, Takeshi; Kashima, Makoto; Agata, Kiyokazu


    Planarian feeding behavior involves three steps: moving toward food, extending the pharynx from their planarian's ventral side after arriving at the food, and ingesting the food through the pharynx. Although pharynx extension is a remarkable behavior, it remains unknown what neuronal cell types are involved in its regulation. To identify neurons involved in regulating pharynx extension, we quantitatively analyzed pharynx extension and sought to identify these neurons by RNA interference (RNAi) and in situ hybridization. This assay, when performed using planarians with amputation of various body parts, clearly showed that the head portion is indispensable for inducing pharynx extension. We thus tested the effects of knockdown of brain neurons such as serotonergic, GABAergic, and dopaminergic neurons by RNAi, but did not observe any effects on pharynx extension behavior. However, animals with RNAi of the Prohormone Convertase 2 (PC2, a neuropeptide processing enzyme) gene did not perform the pharynx extension behavior, suggesting the possible involvement of neuropeptide(s in the regulation of pharynx extension. We screened 24 neuropeptide-coding genes, analyzed their functions by RNAi using the pharynx extension assay system, and identified at least five neuropeptide genes involved in pharynx extension. These was expressed in different cells or neurons, and some of them were expressed in the brain, suggesting complex regulation of planarian feeding behavior by the nervous system.

  16. Richer color experience in observers with multiple photopigment opsin genes.


    Jameson, K A; Highnote, S M; Wasserman, L M


    Traditional color vision theory posits that three types of retinal photopigments transduce light into a trivariate neural color code, thereby explaining color-matching behaviors. This principle of trichromacy is in need of reexamination in view of molecular genetics results suggesting that a substantial percentage of women possess more than three classes of retinal photopigments. At issue is the question of whether four-photopigment retinas necessarily yield trichromatic color perception. In the present paper, we review results and theory underlying the accepted photoreceptor-based model of trichromacy. A review of the psychological literature shows that gender-linked differences in color perception warrant further investigation of retinal photopigment classes and color perception relations. We use genetic analyses to examine an important position in the gene sequence, and we empirically assess and compare the color perception of individuals possessing more than three retinal photopigment genes with those possessing fewer retinal photopigment genes. Women with four-photopigment genotypes are found to perceive significantly more chromatic appearances in comparison with either male or female trichromat controls. We provide a rationale for this previously undetected finding and discuss implications for theories of color perception and gender differences in color behavior.

  17. Multiple Neuropeptide-Coding Genes Involved in Planarian Pharynx Extension.


    Shimoyama, Seira; Inoue, Takeshi; Kashima, Makoto; Agata, Kiyokazu


    Planarian feeding behavior involves three steps: moving toward food, extending the pharynx from their planarian's ventral side after arriving at the food, and ingesting the food through the pharynx. Although pharynx extension is a remarkable behavior, it remains unknown what neuronal cell types are involved in its regulation. To identify neurons involved in regulating pharynx extension, we quantitatively analyzed pharynx extension and sought to identify these neurons by RNA interference (RNAi) and in situ hybridization. This assay, when performed using planarians with amputation of various body parts, clearly showed that the head portion is indispensable for inducing pharynx extension. We thus tested the effects of knockdown of brain neurons such as serotonergic, GABAergic, and dopaminergic neurons by RNAi, but did not observe any effects on pharynx extension behavior. However, animals with RNAi of the Prohormone Convertase 2 (PC2, a neuropeptide processing enzyme) gene did not perform the pharynx extension behavior, suggesting the possible involvement of neuropeptide(s in the regulation of pharynx extension. We screened 24 neuropeptide-coding genes, analyzed their functions by RNAi using the pharynx extension assay system, and identified at least five neuropeptide genes involved in pharynx extension. These was expressed in different cells or neurons, and some of them were expressed in the brain, suggesting complex regulation of planarian feeding behavior by the nervous system. PMID:27268986

  18. An efficient strategy for gene mapping using multipoint linkage analysis: exclusion of the multiple endocrine neoplasia 2A (MEN2A) locus from chromosome 13.


    Farrer, L A; Goodfellow, P J; Lamarche, C M; Franjkovic, I; Myers, S; White, B N; Holden, J J; Kidd, J R; Simpson, N E; Kidd, K K


    Members of four families in which multiple endocrine neoplasia type 2A (MEN-2A) is segregating were typed for seven DNA markers and one red cell enzyme marker on chromosome 13. Close linkage was excluded between the MEN2A locus and each marker locus tested. By means of multipoint analysis and the genetic map of chromosome 13 developed by Leppert et al., MEN2A was excluded from any position between the most proximal marker locus (D13S6) and the most distal marker locus (D13S3) and from within 12 cMorgans outside these two loci, respectively. However, the support of exclusion within an interval was diminished under the assumption of a substantially larger genetic map in females. The strategy of multipoint analysis, which excluded between 1.5 and 2.0 times more chromosome 13 than did two-point analysis, demonstrates the utility of linkage maps in mapping disease genes. PMID:2883889

  19. Recognizable cerebellar dysplasia associated with mutations in multiple tubulin genes

    PubMed Central

    Oegema, Renske; Cushion, Thomas D.; Phelps, Ian G.; Chung, Seo-Kyung; Dempsey, Jennifer C.; Collins, Sarah; Mullins, Jonathan G.L.; Dudding, Tracy; Gill, Harinder; Green, Andrew J.; Dobyns, William B.; Ishak, Gisele E.; Rees, Mark I.; Doherty, Dan


    Mutations in alpha- and beta-tubulins are increasingly recognized as a major cause of malformations of cortical development (MCD), typically lissencephaly, pachygyria and polymicrogyria; however, sequencing tubulin genes in large cohorts of MCD patients has detected tubulin mutations in only 1–13%. We identified patients with a highly characteristic cerebellar dysplasia but without lissencephaly, pachygyria and polymicrogyria typically associated with tubulin mutations. Remarkably, in seven of nine patients (78%), targeted sequencing revealed mutations in three different tubulin genes (TUBA1A, TUBB2B and TUBB3), occurring de novo or inherited from a mosaic parent. Careful re-review of the cortical phenotype on brain imaging revealed only an irregular pattern of gyri and sulci, for which we propose the term tubulinopathy-related dysgyria. Basal ganglia (100%) and brainstem dysplasia (80%) were common features. On the basis of in silico structural predictions, the mutations affect amino acids in diverse regions of the alpha-/beta-tubulin heterodimer, including the nucleotide binding pocket. Cell-based assays of tubulin dynamics reveal various effects of the mutations on incorporation into microtubules: TUBB3 p.Glu288Lys and p.Pro357Leu do not incorporate into microtubules at all, whereas TUBB2B p.Gly13Ala shows reduced incorporation and TUBA1A p.Arg214His incorporates fully, but at a slower rate than wild-type. The broad range of effects on microtubule incorporation is at odds with the highly stereotypical clinical phenotype, supporting differential roles for the three tubulin genes involved. Identifying this highly characteristic phenotype is important due to the low recurrence risk compared with the other (recessive) cerebellar dysplasias and the apparent lack of non-neurological medical issues. PMID:26130693

  20. Recognizable cerebellar dysplasia associated with mutations in multiple tubulin genes.


    Oegema, Renske; Cushion, Thomas D; Phelps, Ian G; Chung, Seo-Kyung; Dempsey, Jennifer C; Collins, Sarah; Mullins, Jonathan G L; Dudding, Tracy; Gill, Harinder; Green, Andrew J; Dobyns, William B; Ishak, Gisele E; Rees, Mark I; Doherty, Dan


    Mutations in alpha- and beta-tubulins are increasingly recognized as a major cause of malformations of cortical development (MCD), typically lissencephaly, pachygyria and polymicrogyria; however, sequencing tubulin genes in large cohorts of MCD patients has detected tubulin mutations in only 1-13%. We identified patients with a highly characteristic cerebellar dysplasia but without lissencephaly, pachygyria and polymicrogyria typically associated with tubulin mutations. Remarkably, in seven of nine patients (78%), targeted sequencing revealed mutations in three different tubulin genes (TUBA1A, TUBB2B and TUBB3), occurring de novo or inherited from a mosaic parent. Careful re-review of the cortical phenotype on brain imaging revealed only an irregular pattern of gyri and sulci, for which we propose the term tubulinopathy-related dysgyria. Basal ganglia (100%) and brainstem dysplasia (80%) were common features. On the basis of in silico structural predictions, the mutations affect amino acids in diverse regions of the alpha-/beta-tubulin heterodimer, including the nucleotide binding pocket. Cell-based assays of tubulin dynamics reveal various effects of the mutations on incorporation into microtubules: TUBB3 p.Glu288Lys and p.Pro357Leu do not incorporate into microtubules at all, whereas TUBB2B p.Gly13Ala shows reduced incorporation and TUBA1A p.Arg214His incorporates fully, but at a slower rate than wild-type. The broad range of effects on microtubule incorporation is at odds with the highly stereotypical clinical phenotype, supporting differential roles for the three tubulin genes involved. Identifying this highly characteristic phenotype is important due to the low recurrence risk compared with the other (recessive) cerebellar dysplasias and the apparent lack of non-neurological medical issues.

  1. Remodelling of a homeobox gene cluster by multiple independent gene reunions in Drosophila.


    Chan, Carolus; Jayasekera, Suvini; Kao, Bryant; Páramo, Moisés; von Grotthuss, Marcin; Ranz, José M


    Genome clustering of homeobox genes is often thought to reflect arrangements of tandem gene duplicates maintained by advantageous coordinated gene regulation. Here we analyse the chromosomal organization of the NK homeobox genes, presumed to be part of a single cluster in the Bilaterian ancestor, across 20 arthropods. We find that the ProtoNK cluster was extensively fragmented in some lineages, showing that NK clustering in Drosophila species does not reflect selectively maintained gene arrangements. More importantly, the arrangement of NK and neighbouring genes across the phylogeny supports that, in two instances within the Drosophila genus, some cluster remnants became reunited via large-scale chromosomal rearrangements. Simulated scenarios of chromosome evolution indicate that these reunion events are unlikely unless the genome neighbourhoods harbouring the participating genes tend to colocalize in the nucleus. Our results underscore how mechanisms other than tandem gene duplication can result in paralogous gene clustering during genome evolution. PMID:25739651

  2. Visualization of multiple alignments, phylogenies and gene family evolution.


    Procter, James B; Thompson, Julie; Letunic, Ivica; Creevey, Chris; Jossinet, Fabrice; Barton, Geoffrey J


    Software for visualizing sequence alignments and trees are essential tools for life scientists. In this review, we describe the major features and capabilities of a selection of stand-alone and web-based applications useful when investigating the function and evolution of a gene family. These range from simple viewers, to systems that provide sophisticated editing and analysis functions. We conclude with a discussion of the challenges that these tools now face due to the flood of next generation sequence data and the increasingly complex network of bioinformatics information sources.

  3. miR2Gene: pattern discovery of single gene, multiple genes, and pathways by enrichment analysis of their microRNA regulators

    PubMed Central


    Background In recent years, a number of tools have been developed to explore microRNAs (miRNAs) by analyzing their target genes. However, a reverse problem, that is, inferring patterns of protein-coding genes through their miRNA regulators, has not been explored. As various miRNA annotation data become available, exploring gene patterns by analyzing the prior knowledge of their miRNA regulators is becoming more feasible. Results In this study, we developed a tool, miR2Gene, for this purpose. Various sets of miRNAs, according to prior rules such as function, associated disease, tissue specificity, family, and cluster, were integrated with miR2Gene. For given genes, miR2Gene evaluates the enrichment of the predicted miRNAs that regulate them in each miRNA set. This tool can be used for single genes, multiple genes, and KEGG pathways. For the KEGG pathway, genes with enriched miRNA sets are highlighted according to various rules. We confirmed the usefulness of miR2Gene through case studies. Conclusions miR2Gene represents a novel and useful tool that integrates miRNA knowledge for protein-coding gene analysis. miR2Gene is freely available at PMID:22784580

  4. Multiple pathways of selected gene amplification during adaptive mutation.


    Kugelberg, Elisabeth; Kofoid, Eric; Reams, Andrew B; Andersson, Dan I; Roth, John R


    In a phenomenon referred to as "adaptive mutation," a population of bacterial cells with a mutation in the lac operon (lac-) accumulates Lac+ revertants during prolonged exposure to selective growth conditions (lactose). Evidence was provided that selective conditions do not increase the mutation rate but instead favor the growth of rare cells with a duplication of the leaky lac allele. A further increase in copy number (amplification) improves growth and increases the likelihood of a sequence change by adding more mutational targets to the clone (cells and lac copies per cell). These duplications and amplifications are described here. Before selection, cells with large (134-kb) lac duplications and long junction sequences (>1 kb) were common (0.2%). The same large repeats were found after selection in cells with a low-copy-number lac amplification. Surprisingly, smaller repeats (average, 34 kb) were found in high-copy-number amplifications. The small-repeat duplications form when deletions modify a preexisting large-repeat duplication. The shorter repeat size allowed higher lac amplification and better growth on lactose. Thus, selection favors a succession of gene-amplification types that make sequence changes more probable by adding targets. These findings are relevant to genetic adaptation in any biological systems in which fitness can be increased by adding gene copies (e.g., cancer and bacterial drug resistance). PMID:17082307

  5. Protein Interaction Networks Link Schizophrenia Risk Loci to Synaptic Function

    PubMed Central

    Schwarz, Emanuel; Izmailov, Rauf; Liò, Pietro; Meyer-Lindenberg, Andreas


    Schizophrenia is a severe and highly heritable psychiatric disorder affecting approximately 1% of the population. Genome-wide association studies have identified 108 independent genetic loci with genome-wide significance but their functional importance has yet to be elucidated. Here, we develop a novel strategy based on network analysis of protein–protein interactions (PPI) to infer biological function associated with variants most strongly linked to illness risk. We show that the schizophrenia loci are strongly linked to synaptic transmission (P FWE < .001) and ion transmembrane transport (P FWE = .03), but not to ontological categories previously found to be shared across psychiatric illnesses. We demonstrate that brain expression of risk-linked genes within the identified processes is strongly modulated during birth and identify a set of synaptic genes consistently changed across multiple brain regions of adult schizophrenia patients. These results suggest synaptic function as a developmentally determined schizophrenia process supported by the illness’s most associated genetic variants and their PPI networks. The implicated genes may be valuable targets for mechanistic experiments and future drug development approaches. PMID:27056717

  6. A Hox Gene, Antennapedia, Regulates Expression of Multiple Major Silk Protein Genes in the Silkworm Bombyx mori.


    Tsubota, Takuya; Tomita, Shuichiro; Uchino, Keiro; Kimoto, Mai; Takiya, Shigeharu; Kajiwara, Hideyuki; Yamazaki, Toshimasa; Sezutsu, Hideki


    Hoxgenes play a pivotal role in the determination of anteroposterior axis specificity during bilaterian animal development. They do so by acting as a master control and regulating the expression of genes important for development. Recently, however, we showed that Hoxgenes can also function in terminally differentiated tissue of the lepidopteranBombyx mori In this species,Antennapedia(Antp) regulates expression of sericin-1, a major silk protein gene, in the silk gland. Here, we investigated whether Antpcan regulate expression of multiple genes in this tissue. By means of proteomic, RT-PCR, and in situ hybridization analyses, we demonstrate that misexpression of Antpin the posterior silk gland induced ectopic expression of major silk protein genes such assericin-3,fhxh4, and fhxh5 These genes are normally expressed specifically in the middle silk gland as is Antp Therefore, the evidence strongly suggests that Antpactivates these silk protein genes in the middle silk gland. The putativesericin-1 activator complex (middle silk gland-intermolt-specific complex) can bind to the upstream regions of these genes, suggesting that Antpdirectly activates their expression. We also found that the pattern of gene expression was well conserved between B. moriand the wild species Bombyx mandarina, indicating that the gene regulation mechanism identified here is an evolutionarily conserved mechanism and not an artifact of the domestication of B. mori We suggest that Hoxgenes have a role as a master control in terminally differentiated tissues, possibly acting as a primary regulator for a range of physiological processes.

  7. Involvement of multiple loci in quorum quenching of autoinducer I molecules in the nitrogen-fixing symbiont Rhizobium (Sinorhizobium) sp. strain NGR234.


    Krysciak, D; Schmeisser, C; Preuss, S; Riethausen, J; Quitschau, M; Grond, S; Streit, W R


    Rhizobium sp. strain NGR234 is a unique alphaproteobacterium (order Rhizobiales) that forms nitrogen-fixing nodules with more legumes than any other microsymbiont. Since we have previously described the complete genome sequence of NGR234, we now report on a genome-wide functional analysis of the genes and enzymes involved in autoinducer I hydrolysis in this microbe. Altogether we identified five cosmid clones that repeatedly gave a positive result in our function-based approach for the detection of autoinducer I hydrolase genes. Of these five cosmid clones, two were located on pNGR234b and three were on cNGR234. Subcloning and in vitro mutagenesis in combination with BLAST analyses identified the corresponding open reading frames (ORFs) of all cosmid clones: dlhR, qsdR1, qsdR2, aldR, and hitR-hydR. Analyses of recombinant DlhR and QsdR1 proteins by using high-performance liquid chromatography-mass spectrometry (HPLC-MS) demonstrate that these enzymes function as acyl homoserine lactone (AHL) lactonases. Furthermore, we showed that these enzymes inhibited biofilm formation and other quorum-sensing-dependent processes in Pseudomonas aeruginosa, Chromobacterium violaceum, and Agrobacterium tumefaciens. Finally, our e