Sample records for multiple genes including

  1. Methods for simultaneous control of lignin content and composition, and cellulose content in plants

    DOEpatents

    Chiang, Vincent Lee C.; Li, Laigeng

    2005-02-15

    The present invention relates to a method of concurrently introducing multiple genes into plants and trees is provided. The method includes simultaneous transformation of plants with multiple genes from the phenylpropanoid pathways including 4CL, CAld5H, AldOMT, SAD and CAD genes and combinations thereof to produce various lines of transgenic plants displaying altered agronomic traits. The agronomic traits of the plants are regulated by the orientation of the specific genes and the selected gene combinations, which are incorporated into the plant genome.

  2. Uptake, Results, and Outcomes of Germline Multiple-Gene Sequencing After Diagnosis of Breast Cancer.

    PubMed

    Kurian, Allison W; Ward, Kevin C; Hamilton, Ann S; Deapen, Dennis M; Abrahamse, Paul; Bondarenko, Irina; Li, Yun; Hawley, Sarah T; Morrow, Monica; Jagsi, Reshma; Katz, Steven J

    2018-05-10

    Low-cost sequencing of multiple genes is increasingly available for cancer risk assessment. Little is known about uptake or outcomes of multiple-gene sequencing after breast cancer diagnosis in community practice. To examine the effect of multiple-gene sequencing on the experience and treatment outcomes for patients with breast cancer. For this population-based retrospective cohort study, patients with breast cancer diagnosed from January 2013 to December 2015 and accrued from SEER registries across Georgia and in Los Angeles, California, were surveyed (n = 5080, response rate = 70%). Responses were merged with SEER data and results of clinical genetic tests, either BRCA1 and BRCA2 (BRCA1/2) sequencing only or including additional other genes (multiple-gene sequencing), provided by 4 laboratories. Type of testing (multiple-gene sequencing vs BRCA1/2-only sequencing), test results (negative, variant of unknown significance, or pathogenic variant), patient experiences with testing (timing of testing, who discussed results), and treatment (strength of patient consideration of, and surgeon recommendation for, prophylactic mastectomy), and prophylactic mastectomy receipt. We defined a patient subgroup with higher pretest risk of carrying a pathogenic variant according to practice guidelines. Among 5026 patients (mean [SD] age, 59.9 [10.7]), 1316 (26.2%) were linked to genetic results from any laboratory. Multiple-gene sequencing increasingly replaced BRCA1/2-only testing over time: in 2013, the rate of multiple-gene sequencing was 25.6% and BRCA1/2-only testing, 74.4%;in 2015 the rate of multiple-gene sequencing was 66.5% and BRCA1/2-only testing, 33.5%. Multiple-gene sequencing was more often ordered by genetic counselors (multiple-gene sequencing, 25.5% and BRCA1/2-only testing, 15.3%) and delayed until after surgery (multiple-gene sequencing, 32.5% and BRCA1/2-only testing, 19.9%). Multiple-gene sequencing substantially increased rate of detection of any pathogenic variant (multiple-gene sequencing: higher-risk patients, 12%; average-risk patients, 4.2% and BRCA1/2-only testing: higher-risk patients, 7.8%; average-risk patients, 2.2%) and variants of uncertain significance, especially in minorities (multiple-gene sequencing: white patients, 23.7%; black patients, 44.5%; and Asian patients, 50.9% and BRCA1/2-only testing: white patients, 2.2%; black patients, 5.6%; and Asian patients, 0%). Multiple-gene sequencing was not associated with an increase in the rate of prophylactic mastectomy use, which was highest with pathogenic variants in BRCA1/2 (BRCA1/2, 79.0%; other pathogenic variant, 37.6%; variant of uncertain significance, 30.2%; negative, 35.3%). Multiple-gene sequencing rapidly replaced BRCA1/2-only testing for patients with breast cancer in the community and enabled 2-fold higher detection of clinically relevant pathogenic variants without an associated increase in prophylactic mastectomy. However, important targets for improvement in the clinical utility of multiple-gene sequencing include postsurgical delay and racial/ethnic disparity in variants of uncertain significance.

  3. Gene-gene-environment interactions between drugs, transporters, receptors, and metabolizing enzymes: Statins, SLCO1B1, and CYP3A4 as an example.

    PubMed

    Sadee, Wolfgang

    2013-09-01

    Pharmacogenetic biomarker tests include mostly specific single gene-drug pairs, capable of accounting for a portion of interindividual variability in drug response and toxicity. However, multiple genes are likely to contribute, either acting independently or epistatically, with the CYP2C9-VKORC1-warfarin test panel, an example of a clinically used gene-gene-dug interaction. I discuss here further instances of gene-gene-drug interactions, including a proposed dynamic effect on statin therapy by genetic variants in both a transporter (SLCO1B1) and a metabolizing enzyme (CYP3A4) in liver cells, the main target site where statins block cholesterol synthesis. These examples set a conceptual framework for developing diagnostic panels involving multiple gene-drug combinations. Copyright © 2013 Wiley Periodicals, Inc.

  4. DNA methylome signature in rheumatoid arthritis.

    PubMed

    Nakano, Kazuhisa; Whitaker, John W; Boyle, David L; Wang, Wei; Firestein, Gary S

    2013-01-01

    Epigenetics can influence disease susceptibility and severity. While DNA methylation of individual genes has been explored in autoimmunity, no unbiased systematic analyses have been reported. Therefore, a genome-wide evaluation of DNA methylation loci in fibroblast-like synoviocytes (FLS) isolated from the site of disease in rheumatoid arthritis (RA) was performed. Genomic DNA was isolated from six RA and five osteoarthritis (OA) FLS lines and evaluated using the Illumina HumanMethylation450 chip. Cluster analysis of data was performed and corrected using Benjamini-Hochberg adjustment for multiple comparisons. Methylation was confirmed by pyrosequencing and gene expression was determined by qPCR. Pathway analysis was performed using the Kyoto Encyclopedia of Genes and Genomes. RA and control FLS segregated based on DNA methylation, with 1859 differentially methylated loci. Hypomethylated loci were identified in key genes relevant to RA, such as CHI3L1, CASP1, STAT3, MAP3K5, MEFV and WISP3. Hypermethylation was also observed, including TGFBR2 and FOXO1. Hypomethylation of individual genes was associated with increased gene expression. Grouped analysis identified 207 hypermethylated or hypomethylated genes with multiple differentially methylated loci, including COL1A1, MEFV and TNF. Hypomethylation was increased in multiple pathways related to cell migration, including focal adhesion, cell adhesion, transendothelial migration and extracellular matrix interactions. Confirmatory studies with OA and normal FLS also demonstrated segregation of RA from control FLS based on methylation pattern. Differentially methylated genes could alter FLS gene expression and contribute to the pathogenesis of RA. DNA methylation of critical genes suggests that RA FLS are imprinted and implicate epigenetic contributions to inflammatory arthritis.

  5. Multiconstrained gene clustering based on generalized projections

    PubMed Central

    2010-01-01

    Background Gene clustering for annotating gene functions is one of the fundamental issues in bioinformatics. The best clustering solution is often regularized by multiple constraints such as gene expressions, Gene Ontology (GO) annotations and gene network structures. How to integrate multiple pieces of constraints for an optimal clustering solution still remains an unsolved problem. Results We propose a novel multiconstrained gene clustering (MGC) method within the generalized projection onto convex sets (POCS) framework used widely in image reconstruction. Each constraint is formulated as a corresponding set. The generalized projector iteratively projects the clustering solution onto these sets in order to find a consistent solution included in the intersection set that satisfies all constraints. Compared with previous MGC methods, POCS can integrate multiple constraints from different nature without distorting the original constraints. To evaluate the clustering solution, we also propose a new performance measure referred to as Gene Log Likelihood (GLL) that considers genes having more than one function and hence in more than one cluster. Comparative experimental results show that our POCS-based gene clustering method outperforms current state-of-the-art MGC methods. Conclusions The POCS-based MGC method can successfully combine multiple constraints from different nature for gene clustering. Also, the proposed GLL is an effective performance measure for the soft clustering solutions. PMID:20356386

  6. Orthogonal Cas9 proteins for RNA-guided gene regulation and editing

    DOEpatents

    Church, George M.; Esvelt, Kevin; Mali, Prashant

    2017-03-07

    Methods of modulating expression of a target nucleic acid in a cell are provided including use of multiple orthogonal Cas9 proteins to simultaneously and independently regulate corresponding genes or simultaneously and independently edit corresponding genes.

  7. Gene Delivery in Neuro-Oncology.

    PubMed

    Dixit, Karan; Kumthekar, Priya

    2017-09-02

    Glioblastoma multiforme (GBM) is the most common primary malignant brain tumor in adults with a dismal prognosis despite aggressive multimodal management thus novel treatments are urgently needed. Gene therapy is a versatile treatment strategy being investigated in multiple cancers including GBM. In gene therapy, a variety of vectors or "carriers" are used to deliver genes designed for different anti-tumoral effects. Gene delivery vehicles and approaches to treatment will be addressed in this review. The most commonly studied vectors are viral based, however, driven by advances in biomedical engineering, mesenchymal and neural stem cells, as well as multiple different types of nanoparticles have been developed to improve tumor tropism and also increase gene transfer into tumor cells. Different genes have been studied including suicide genes, which convert non-toxic prodrug into cytotoxic drug; immunomodulatory genes, which stimulate the immune system; and tumor suppressor genes which repair the defect that allow cells to divide unchecked. Gene therapy may be a promising treatment strategy in neuro-oncology as it is versatile and flexible due to the ability to tailor vectors and genes for specific therapeutic activity. Pre-clinical studies and clinical trials have demonstrated feasibility and safety of gene therapy; however, further studies are required to determine efficacy.

  8. Differential diagnosis of Mendelian and mitochondrial disorders in patients with suspected multiple sclerosis

    PubMed Central

    Katz Sand, Ilana B.; Honce, Justin M.; Lublin, Fred D.

    2015-01-01

    Several single gene disorders share clinical and radiologic characteristics with multiple sclerosis and have the potential to be overlooked in the differential diagnostic evaluation of both adult and paediatric patients with multiple sclerosis. This group includes lysosomal storage disorders, various mitochondrial diseases, other neurometabolic disorders, and several other miscellaneous disorders. Recognition of a single-gene disorder as causal for a patient’s ‘multiple sclerosis-like’ phenotype is critically important for accurate direction of patient management, and evokes broader genetic counselling implications for affected families. Here we review single gene disorders that have the potential to mimic multiple sclerosis, provide an overview of clinical and investigational characteristics of each disorder, and present guidelines for when clinicians should suspect an underlying heritable disorder that requires diagnostic confirmation in a patient with a definite or probable diagnosis of multiple sclerosis. PMID:25636970

  9. Screening of differentially expressed genes between multiple trauma patients with and without sepsis.

    PubMed

    Ji, S C; Pan, Y T; Lu, Q Y; Sun, Z Y; Liu, Y Z

    2014-03-17

    The purpose of this study was to identify critical genes associated with septic multiple trauma by comparing peripheral whole blood samples from multiple trauma patients with and without sepsis. A microarray data set was downloaded from the Gene Expression Omnibus (GEO) database. This data set included 70 samples, 36 from multiple trauma patients with sepsis and 34 from multiple trauma patients without sepsis (as a control set). The data were preprocessed, and differentially expressed genes (DEGs) were then screened for using packages of the R language. Functional analysis of DEGs was performed with DAVID. Interaction networks were then established for the most up- and down-regulated genes using HitPredict. Pathway-enrichment analysis was conducted for genes in the networks using WebGestalt. Fifty-eight DEGs were identified. The expression levels of PLAU (down-regulated) and MMP8 (up-regulated) presented the largest fold-changes, and interaction networks were established for these genes. Further analysis revealed that PLAT (plasminogen activator, tissue) and SERPINF2 (serpin peptidase inhibitor, clade F, member 2), which interact with PLAU, play important roles in the pathway of the component and coagulation cascade. We hypothesize that PLAU is a major regulator of the component and coagulation cascade, and down-regulation of PLAU results in dysfunction of the pathway, causing sepsis.

  10. Stable carbon isotope fractionation of chlorinated ethenes by a microbial consortium containing multiple dechlorinating genes.

    PubMed

    Liu, Na; Ding, Longzhen; Li, Haijun; Zhang, Pengpeng; Zheng, Jixing; Weng, Chih-Huang

    2018-08-01

    The study aimed to determine the possible contribution of specific growth conditions and community structures to variable carbon enrichment factors (Ɛ- carbon ) values for the degradation of chlorinated ethenes (CEs) by a bacterial consortium with multiple dechlorinating genes. Ɛ- carbon values for trichloroethylene, cis-1,2-dichloroethylene, and vinyl chloride were -7.24% ± 0.59%, -14.6% ± 1.71%, and -21.1% ± 1.14%, respectively, during their degradation by a microbial consortium containing multiple dechlorinating genes including tceA and vcrA. The Ɛ- carbon values of all CEs were not greatly affected by changes in growth conditions and community structures, which directly or indirectly affected reductive dechlorination of CEs by this consortium. Stability analysis provided evidence that the presence of multiple dechlorinating genes within a microbial consortium had little effect on carbon isotope fractionation, as long as the genes have definite, non-overlapping functions. Copyright © 2018 Elsevier Ltd. All rights reserved.

  11. Analysis of Gene Expression Profiles of Soft Tissue Sarcoma Using a Combination of Knowledge-Based Filtering with Integration of Multiple Statistics

    PubMed Central

    Doi, Ayano; Ichinohe, Risa; Ikuyo, Yoriko; Takahashi, Teruyoshi; Marui, Shigetaka; Yasuhara, Koji; Nakamura, Tetsuro; Sugita, Shintaro; Sakamoto, Hiromi; Yoshida, Teruhiko; Hasegawa, Tadashi

    2014-01-01

    The diagnosis and treatment of soft tissue sarcomas (STS) have been difficult. Of the diverse histological subtypes, undifferentiated pleomorphic sarcoma (UPS) is particularly difficult to diagnose accurately, and its classification per se is still controversial. Recent advances in genomic technologies provide an excellent way to address such problems. However, it is often difficult, if not impossible, to identify definitive disease-associated genes using genome-wide analysis alone, primarily because of multiple testing problems. In the present study, we analyzed microarray data from 88 STS patients using a combination method that used knowledge-based filtering and a simulation based on the integration of multiple statistics to reduce multiple testing problems. We identified 25 genes, including hypoxia-related genes (e.g., MIF, SCD1, P4HA1, ENO1, and STAT1) and cell cycle- and DNA repair-related genes (e.g., TACC3, PRDX1, PRKDC, and H2AFY). These genes showed significant differential expression among histological subtypes, including UPS, and showed associations with overall survival. STAT1 showed a strong association with overall survival in UPS patients (logrank p = 1.84×10−6 and adjusted p value 2.99×10−3 after the permutation test). According to the literature, the 25 genes selected are useful not only as markers of differential diagnosis but also as prognostic/predictive markers and/or therapeutic targets for STS. Our combination method can identify genes that are potential prognostic/predictive factors and/or therapeutic targets in STS and possibly in other cancers. These disease-associated genes deserve further preclinical and clinical validation. PMID:25188299

  12. Network-Assisted Investigation of Combined Causal Signals from Genome-Wide Association Studies in Schizophrenia

    PubMed Central

    Jia, Peilin; Wang, Lily; Fanous, Ayman H.; Pato, Carlos N.; Edwards, Todd L.; Zhao, Zhongming

    2012-01-01

    With the recent success of genome-wide association studies (GWAS), a wealth of association data has been accomplished for more than 200 complex diseases/traits, proposing a strong demand for data integration and interpretation. A combinatory analysis of multiple GWAS datasets, or an integrative analysis of GWAS data and other high-throughput data, has been particularly promising. In this study, we proposed an integrative analysis framework of multiple GWAS datasets by overlaying association signals onto the protein-protein interaction network, and demonstrated it using schizophrenia datasets. Building on a dense module search algorithm, we first searched for significantly enriched subnetworks for schizophrenia in each single GWAS dataset and then implemented a discovery-evaluation strategy to identify module genes with consistent association signals. We validated the module genes in an independent dataset, and also examined them through meta-analysis of the related SNPs using multiple GWAS datasets. As a result, we identified 205 module genes with a joint effect significantly associated with schizophrenia; these module genes included a number of well-studied candidate genes such as DISC1, GNA12, GNA13, GNAI1, GPR17, and GRIN2B. Further functional analysis suggested these genes are involved in neuronal related processes. Additionally, meta-analysis found that 18 SNPs in 9 module genes had P meta<1×10−4, including the gene HLA-DQA1 located in the MHC region on chromosome 6, which was reported in previous studies using the largest cohort of schizophrenia patients to date. These results demonstrated our bi-directional network-based strategy is efficient for identifying disease-associated genes with modest signals in GWAS datasets. This approach can be applied to any other complex diseases/traits where multiple GWAS datasets are available. PMID:22792057

  13. Genome-wide association study for Crohn's disease in the Quebec Founder Population identifies multiple validated disease loci.

    PubMed

    Raelson, John V; Little, Randall D; Ruether, Andreas; Fournier, Hélène; Paquin, Bruno; Van Eerdewegh, Paul; Bradley, W E C; Croteau, Pascal; Nguyen-Huu, Quynh; Segal, Jonathan; Debrus, Sophie; Allard, René; Rosenstiel, Philip; Franke, Andre; Jacobs, Gunnar; Nikolaus, Susanna; Vidal, Jean-Michel; Szego, Peter; Laplante, Nathalie; Clark, Hilary F; Paulussen, René J; Hooper, John W; Keith, Tim P; Belouchi, Abdelmajid; Schreiber, Stefan

    2007-09-11

    Genome-wide association (GWA) studies offer a powerful unbiased method for the identification of multiple susceptibility genes for complex diseases. Here we report the results of a GWA study for Crohn's disease (CD) using family trios from the Quebec Founder Population (QFP). Haplotype-based association analyses identified multiple regions associated with the disease that met the criteria for genome-wide significance, with many containing a gene whose function appears relevant to CD. A proportion of these were replicated in two independent German Caucasian samples, including the established CD loci NOD2 and IBD5. The recently described IL23R locus was also identified and replicated. For this region, multiple individuals with all major haplotypes in the QFP were sequenced and extensive fine mapping performed to identify risk and protective alleles. Several additional loci, including a region on 3p21 containing several plausible candidate genes, a region near JAKMIP1 on 4p16.1, and two larger regions on chromosome 17 were replicated. Together with previously published loci, the spectrum of CD genes identified to date involves biochemical networks that affect epithelial defense mechanisms, innate and adaptive immune response, and the repair or remodeling of tissue.

  14. EBF factors drive expression of multiple classes of target genes governing neuronal development.

    PubMed

    Green, Yangsook S; Vetter, Monica L

    2011-04-30

    Early B cell factor (EBF) family members are transcription factors known to have important roles in several aspects of vertebrate neurogenesis, including commitment, migration and differentiation. Knowledge of how EBF family members contribute to neurogenesis is limited by a lack of detailed understanding of genes that are transcriptionally regulated by these factors. We performed a microarray screen in Xenopus animal caps to search for targets of EBF transcriptional activity, and identified candidate targets with multiple roles, including transcription factors of several classes. We determined that, among the most upregulated candidate genes with expected neuronal functions, most require EBF activity for some or all of their expression, and most have overlapping expression with ebf genes. We also found that the candidate target genes that had the most strongly overlapping expression patterns with ebf genes were predicted to be direct transcriptional targets of EBF transcriptional activity. The identification of candidate targets that are transcription factor genes, including nscl-1, emx1 and aml1, improves our understanding of how EBF proteins participate in the hierarchy of transcription control during neuronal development, and suggests novel mechanisms by which EBF activity promotes migration and differentiation. Other candidate targets, including pcdh8 and kcnk5, expand our knowledge of the types of terminal differentiated neuronal functions that EBF proteins regulate.

  15. Germline mutations in candidate predisposition genes in individuals with cutaneous melanoma and at least two independent additional primary cancers.

    PubMed

    Pritchard, Antonia L; Johansson, Peter A; Nathan, Vaishnavi; Howlie, Madeleine; Symmons, Judith; Palmer, Jane M; Hayward, Nicholas K

    2018-01-01

    While a number of autosomal dominant and autosomal recessive cancer syndromes have an associated spectrum of cancers, the prevalence and variety of cancer predisposition mutations in patients with multiple primary cancers have not been extensively investigated. An understanding of the variants predisposing to more than one cancer type could improve patient care, including screening and genetic counselling, as well as advancing the understanding of tumour development. A cohort of 57 patients ascertained due to their cutaneous melanoma (CM) diagnosis and with a history of two or more additional non-cutaneous independent primary cancer types were recruited for this study. Patient blood samples were assessed by whole exome or whole genome sequencing. We focussed on variants in 525 pre-selected genes, including 65 autosomal dominant and 31 autosomal recessive cancer predisposition genes, 116 genes involved in the DNA repair pathway, and 313 commonly somatically mutated in cancer. The same genes were analysed in exome sequence data from 1358 control individuals collected as part of non-cancer studies (UK10K). The identified variants were classified for pathogenicity using online databases, literature and in silico prediction tools. No known pathogenic autosomal dominant or previously described compound heterozygous mutations in autosomal recessive genes were observed in the multiple cancer cohort. Variants typically found somatically in haematological malignancies (in JAK1, JAK2, SF3B1, SRSF2, TET2 and TYK2) were present in lymphocyte DNA of patients with multiple primary cancers, all of whom had a history of haematological malignancy and cutaneous melanoma, as well as colorectal cancer and/or prostate cancer. Other potentially pathogenic variants were discovered in BUB1B, POLE2, ROS1 and DNMT3A. Compared to controls, multiple cancer cases had significantly more likely damaging mutations (nonsense, frameshift ins/del) in tumour suppressor and tyrosine kinase genes and higher overall burden of mutations in all cancer genes. We identified several pathogenic variants that likely predispose to at least one of the tumours in patients with multiple cancers. We additionally present evidence that there may be a higher burden of variants of unknown significance in 'cancer genes' in patients with multiple cancer types. Further screens of this nature need to be carried out to build evidence to show if the cancers observed in these patients form part of a cancer spectrum associated with single germline variants in these genes, whether multiple layers of susceptibility exist (oligogenic or polygenic), or if the occurrence of multiple different cancers is due to random chance.

  16. Hormonal response to bidirectional selection on social behavior

    USDA-ARS?s Scientific Manuscript database

    Behavior is a quantitative trait determined through the actions of multiple genes. These genes form pleiotropic networks that are sensitive to environmental variation and genetic background. One aspect of behavioral gene networks that is of special interest includes effects during early development....

  17. Multiple Roles of Integrin-Linked Kinase in Epidermal Development, Maturation and Pigmentation Revealed by Molecular Profiling

    PubMed Central

    Judah, David; Rudkouskaya, Alena; Wilson, Ryan; Carter, David E.; Dagnino, Lina

    2012-01-01

    Integrin-linked kinase (ILK) is an important scaffold protein that mediates a variety of cellular responses to integrin stimulation by extracellular matrix proteins. Mice with epidermis-restricted inactivation of the Ilk gene exhibit pleiotropic phenotypic defects, including impaired hair follicle morphogenesis, reduced epidermal adhesion to the basement membrane, compromised epidermal integrity, as well as wasting and failure to thrive leading to perinatal death. To better understand the underlying molecular mechanisms that cause such a broad range of alterations, we investigated the impact of Ilk gene inactivation on the epidermis transcriptome. Microarray analysis showed over 700 differentially regulated mRNAs encoding proteins involved in multiple aspects of epidermal function, including keratinocyte differentiation and barrier formation, inflammation, regeneration after injury, and fundamental epidermal developmental pathways. These studies also revealed potential effects on genes not previously implicated in ILK functions, including those important for melanocyte and melanoblast development and function, regulation of cytoskeletal dynamics, and homeobox genes. This study shows that ILK is a critical regulator of multiple aspects of epidermal function and homeostasis, and reveals the previously unreported involvement of ILK not only in epidermal differentiation and barrier formation, but also in melanocyte genesis and function. PMID:22574216

  18. Multiple roles of integrin-linked kinase in epidermal development, maturation and pigmentation revealed by molecular profiling.

    PubMed

    Judah, David; Rudkouskaya, Alena; Wilson, Ryan; Carter, David E; Dagnino, Lina

    2012-01-01

    Integrin-linked kinase (ILK) is an important scaffold protein that mediates a variety of cellular responses to integrin stimulation by extracellular matrix proteins. Mice with epidermis-restricted inactivation of the Ilk gene exhibit pleiotropic phenotypic defects, including impaired hair follicle morphogenesis, reduced epidermal adhesion to the basement membrane, compromised epidermal integrity, as well as wasting and failure to thrive leading to perinatal death. To better understand the underlying molecular mechanisms that cause such a broad range of alterations, we investigated the impact of Ilk gene inactivation on the epidermis transcriptome. Microarray analysis showed over 700 differentially regulated mRNAs encoding proteins involved in multiple aspects of epidermal function, including keratinocyte differentiation and barrier formation, inflammation, regeneration after injury, and fundamental epidermal developmental pathways. These studies also revealed potential effects on genes not previously implicated in ILK functions, including those important for melanocyte and melanoblast development and function, regulation of cytoskeletal dynamics, and homeobox genes. This study shows that ILK is a critical regulator of multiple aspects of epidermal function and homeostasis, and reveals the previously unreported involvement of ILK not only in epidermal differentiation and barrier formation, but also in melanocyte genesis and function.

  19. Systematic genomic identification of colorectal cancer genes delineating advanced from early clinical stage and metastasis

    PubMed Central

    2013-01-01

    Background Colorectal cancer is the third leading cause of cancer deaths in the United States. The initial assessment of colorectal cancer involves clinical staging that takes into account the extent of primary tumor invasion, determining the number of lymph nodes with metastatic cancer and the identification of metastatic sites in other organs. Advanced clinical stage indicates metastatic cancer, either in regional lymph nodes or in distant organs. While the genomic and genetic basis of colorectal cancer has been elucidated to some degree, less is known about the identity of specific cancer genes that are associated with advanced clinical stage and metastasis. Methods We compiled multiple genomic data types (mutations, copy number alterations, gene expression and methylation status) as well as clinical meta-data from The Cancer Genome Atlas (TCGA). We used an elastic-net regularized regression method on the combined genomic data to identify genetic aberrations and their associated cancer genes that are indicators of clinical stage. We ranked candidate genes by their regression coefficient and level of support from multiple assay modalities. Results A fit of the elastic-net regularized regression to 197 samples and integrated analysis of four genomic platforms identified the set of top gene predictors of advanced clinical stage, including: WRN, SYK, DDX5 and ADRA2C. These genetic features were identified robustly in bootstrap resampling analysis. Conclusions We conducted an analysis integrating multiple genomic features including mutations, copy number alterations, gene expression and methylation. This integrated approach in which one considers all of these genomic features performs better than any individual genomic assay. We identified multiple genes that robustly delineate advanced clinical stage, suggesting their possible role in colorectal cancer metastatic progression. PMID:24308539

  20. dbCPG: A web resource for cancer predisposition genes.

    PubMed

    Wei, Ran; Yao, Yao; Yang, Wu; Zheng, Chun-Hou; Zhao, Min; Xia, Junfeng

    2016-06-21

    Cancer predisposition genes (CPGs) are genes in which inherited mutations confer highly or moderately increased risks of developing cancer. Identification of these genes and understanding the biological mechanisms that underlie them is crucial for the prevention, early diagnosis, and optimized management of cancer. Over the past decades, great efforts have been made to identify CPGs through multiple strategies. However, information on these CPGs and their molecular functions is scattered. To address this issue and provide a comprehensive resource for researchers, we developed the Cancer Predisposition Gene Database (dbCPG, Database URL: http://bioinfo.ahu.edu.cn:8080/dbCPG/index.jsp), the first literature-based gene resource for exploring human CPGs. It contains 827 human (724 protein-coding, 23 non-coding, and 80 unknown type genes), 637 rats, and 658 mouse CPGs. Furthermore, data mining was performed to gain insights into the understanding of the CPGs data, including functional annotation, gene prioritization, network analysis of prioritized genes and overlap analysis across multiple cancer types. A user-friendly web interface with multiple browse, search, and upload functions was also developed to facilitate access to the latest information on CPGs. Taken together, the dbCPG database provides a comprehensive data resource for further studies of cancer predisposition genes.

  1. Systems Biophysics of Gene Expression

    PubMed Central

    Vilar, Jose M.G.; Saiz, Leonor

    2013-01-01

    Gene expression is a process central to any form of life. It involves multiple temporal and functional scales that extend from specific protein-DNA interactions to the coordinated regulation of multiple genes in response to intracellular and extracellular changes. This diversity in scales poses fundamental challenges to the use of traditional approaches to fully understand even the simplest gene expression systems. Recent advances in computational systems biophysics have provided promising avenues to reliably integrate the molecular detail of biophysical process into the system behavior. Here, we review recent advances in the description of gene regulation as a system of biophysical processes that extend from specific protein-DNA interactions to the combinatorial assembly of nucleoprotein complexes. There is now basic mechanistic understanding on how promoters controlled by multiple, local and distal, DNA binding sites for transcription factors can actively control transcriptional noise, cell-to-cell variability, and other properties of gene regulation, including precision and flexibility of the transcriptional responses. PMID:23790365

  2. Origin and functional diversification of an amphibian defense peptide arsenal.

    PubMed

    Roelants, Kim; Fry, Bryan G; Ye, Lumeng; Stijlemans, Benoit; Brys, Lea; Kok, Philippe; Clynen, Elke; Schoofs, Liliane; Cornelis, Pierre; Bossuyt, Franky

    2013-01-01

    The skin secretion of many amphibians contains an arsenal of bioactive molecules, including hormone-like peptides (HLPs) acting as defense toxins against predators, and antimicrobial peptides (AMPs) providing protection against infectious microorganisms. Several amphibian taxa seem to have independently acquired the genes to produce skin-secreted peptide arsenals, but it remains unknown how these originated from a non-defensive ancestral gene and evolved diverse defense functions against predators and pathogens. We conducted transcriptome, genome, peptidome and phylogenetic analyses to chart the full gene repertoire underlying the defense peptide arsenal of the frog Silurana tropicalis and reconstruct its evolutionary history. Our study uncovers a cluster of 13 transcriptionally active genes, together encoding up to 19 peptides, including diverse HLP homologues and AMPs. This gene cluster arose from a duplicated gastrointestinal hormone gene that attained a HLP-like defense function after major remodeling of its promoter region. Instead, new defense functions, including antimicrobial activity, arose by mutation of the precursor proteins, resulting in the proteolytic processing of secondary peptides alongside the original ones. Although gene duplication did not trigger functional innovation, it may have subsequently facilitated the convergent loss of the original function in multiple gene lineages (subfunctionalization), completing their transformation from HLP gene to AMP gene. The processing of multiple peptides from a single precursor entails a mechanism through which peptide-encoding genes may establish new functions without the need for gene duplication to avoid adaptive conflicts with older ones.

  3. Origin and Functional Diversification of an Amphibian Defense Peptide Arsenal

    PubMed Central

    Roelants, Kim; Fry, Bryan G.; Ye, Lumeng; Stijlemans, Benoit; Brys, Lea; Kok, Philippe; Clynen, Elke; Schoofs, Liliane; Cornelis, Pierre; Bossuyt, Franky

    2013-01-01

    The skin secretion of many amphibians contains an arsenal of bioactive molecules, including hormone-like peptides (HLPs) acting as defense toxins against predators, and antimicrobial peptides (AMPs) providing protection against infectious microorganisms. Several amphibian taxa seem to have independently acquired the genes to produce skin-secreted peptide arsenals, but it remains unknown how these originated from a non-defensive ancestral gene and evolved diverse defense functions against predators and pathogens. We conducted transcriptome, genome, peptidome and phylogenetic analyses to chart the full gene repertoire underlying the defense peptide arsenal of the frog Silurana tropicalis and reconstruct its evolutionary history. Our study uncovers a cluster of 13 transcriptionally active genes, together encoding up to 19 peptides, including diverse HLP homologues and AMPs. This gene cluster arose from a duplicated gastrointestinal hormone gene that attained a HLP-like defense function after major remodeling of its promoter region. Instead, new defense functions, including antimicrobial activity, arose by mutation of the precursor proteins, resulting in the proteolytic processing of secondary peptides alongside the original ones. Although gene duplication did not trigger functional innovation, it may have subsequently facilitated the convergent loss of the original function in multiple gene lineages (subfunctionalization), completing their transformation from HLP gene to AMP gene. The processing of multiple peptides from a single precursor entails a mechanism through which peptide-encoding genes may establish new functions without the need for gene duplication to avoid adaptive conflicts with older ones. PMID:23935531

  4. Egg Case Silk Gene Sequences from Argiope Spiders: Evidence for Multiple Loci and a Loss of Function Between Paralogs

    PubMed Central

    Chaw, R. Crystal; Collin, Matthew; Wimmer, Marjorie; Helmrick, Kara-Leigh; Hayashi, Cheryl Y.

    2017-01-01

    Spiders swath their eggs with silk to protect developing embryos and hatchlings. Egg case silks, like other fibrous spider silks, are primarily composed of proteins called spidroins (spidroin = spider-fibroin). Silks, and thus spidroins, are important throughout the lives of spiders, yet the evolution of spidroin genes has been relatively understudied. Spidroin genes are notoriously difficult to sequence because they are typically very long (≥ 10 kb of coding sequence) and highly repetitive. Here, we investigate the evolution of spider silk genes through long-read sequencing of Bacterial Artificial Chromosome (BAC) clones. We demonstrate that the silver garden spider Argiope argentata has multiple egg case spidroin loci with a loss of function at one locus. We also use degenerate PCR primers to search the genomic DNA of congeneric species and find evidence for multiple egg case spidroin loci in other Argiope spiders. Comparative analyses show that these multiple loci are more similar at the nucleotide level within a species than between species. This pattern is consistent with concerted evolution homogenizing gene copies within a genome. More complicated explanations include convergent evolution or recent independent gene duplications within each species. PMID:29127108

  5. Chemotaxis and flagellar genes of Chromobacterium violaceum.

    PubMed

    Pereira, Maristela; Parente, Juliana Alves; Bataus, Luiz Artur Mendes; Cardoso, Divina das Dores de Paula; Soares, Renata Bastos Ascenço; Soares, Célia Maria de Almeida

    2004-03-31

    The availability of the complete genome of the Gram-negative beta-proteobacterium Chromobacterium violaceum has increasingly impacted our understanding of this microorganism. This review focuses on the genomic organization and structural analysis of the deduced proteins of the chemosensory adaptation system of C. violaceum. C. violaceum has multiple homologues of most chemotaxis genes, organized mostly in clusters in the bacterial genome. We found at least 67 genes, distributed in 10 gene clusters, involved in the chemotaxis of C. violaceum. A close examination of the chemoreceptors methyl-accepting chemotaxis proteins (MCPs), and the deduced sequences of the members of the two-component signaling system revealed canonical motifs, described as essential for the function of the deduced proteins. The chemoreceptors found in C. violaceum include the complete repertoire of such genes described in bacteria, designated as tsr, tar, trg, and tap; 41 MCP loci were found in the C. violaceum genome. Also, the C. violaceum genome includes a large repertoire of the proteins of the chemosensory transducer system. Multiple homologues of bacterial chemotaxis genes, including CheA, CheB, CheD, CheR, CheV, CheY, CheZ, and CheW, were found in the C. violaceum genome.

  6. SysBioCube: A Data Warehouse and Integrative Data Analysis Platform Facilitating Systems Biology Studies of Disorders of Military Relevance

    DTIC Science & Technology

    2013-12-18

    include interactive gene and methylation profiles, interactive heatmaps, cytoscape network views, integrative genomics viewer ( IGV ), and protein-protein...single chart. The website also provides an option to include multiple genes. Integrative Genomics Viewer ( IGV )1, is a high-performance desktop tool for

  7. Multiple genes contribute to anhydrobiosis (tolerance to extreme desiccation) in the nematode Panagrolaimus superbus

    PubMed Central

    Evangelista, Cláudia Carolina Silva; Guidelli, Giovanna Vieira; Borges, Gustavo; Araujo, Thais Fenz; de Souza, Tiago Alves Jorge; Neves, Ubiraci Pereira da Costa; Tunnacliffe, Alan; Pereira, Tiago Campos

    2017-01-01

    Abstract The molecular basis of anhydrobiosis, the state of suspended animation entered by some species during extreme desiccation, is still poorly understood despite a number of transcriptome and proteome studies. We therefore conducted functional screening by RNA interference (RNAi) for genes involved in anhydrobiosis in the holo-anhydrobiotic nematode Panagrolaimus superbus. A new method of survival analysis, based on staining, and proof-of-principle RNAi experiments confirmed a role for genes involved in oxidative stress tolerance, while a novel medium-scale RNAi workflow identified a further 40 anhydrobiosis-associated genes, including several involved in proteostasis, DNA repair and signal transduction pathways. This suggests that multiple genes contribute to anhydrobiosis in P. superbus. PMID:29111563

  8. Pediatric Multiple Sclerosis: Genes, Environment, and a Comprehensive Therapeutic Approach.

    PubMed

    Cappa, Ryan; Theroux, Liana; Brenton, J Nicholas

    2017-10-01

    Pediatric multiple sclerosis is an increasingly recognized and studied disorder that accounts for 3% to 10% of all patients with multiple sclerosis. The risk for pediatric multiple sclerosis is thought to reflect a complex interplay between environmental and genetic risk factors. Environmental exposures, including sunlight (ultraviolet radiation, vitamin D levels), infections (Epstein-Barr virus), passive smoking, and obesity, have been identified as potential risk factors in youth. Genetic predisposition contributes to the risk of multiple sclerosis, and the major histocompatibility complex on chromosome 6 makes the single largest contribution to susceptibility to multiple sclerosis. With the use of large-scale genome-wide association studies, other non-major histocompatibility complex alleles have been identified as independent risk factors for the disease. The bridge between environment and genes likely lies in the study of epigenetic processes, which are environmentally-influenced mechanisms through which gene expression may be modified. This article will review these topics to provide a framework for discussion of a comprehensive approach to counseling and ultimately treating the pediatric patient with multiple sclerosis. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. A multicolor panel of novel lentiviral "gene ontology" (LeGO) vectors for functional gene analysis.

    PubMed

    Weber, Kristoffer; Bartsch, Udo; Stocking, Carol; Fehse, Boris

    2008-04-01

    Functional gene analysis requires the possibility of overexpression, as well as downregulation of one, or ideally several, potentially interacting genes. Lentiviral vectors are well suited for this purpose as they ensure stable expression of complementary DNAs (cDNAs), as well as short-hairpin RNAs (shRNAs), and can efficiently transduce a wide spectrum of cell targets when packaged within the coat proteins of other viruses. Here we introduce a multicolor panel of novel lentiviral "gene ontology" (LeGO) vectors designed according to the "building blocks" principle. Using a wide spectrum of different fluorescent markers, including drug-selectable enhanced green fluorescent protein (eGFP)- and dTomato-blasticidin-S resistance fusion proteins, LeGO vectors allow simultaneous analysis of multiple genes and shRNAs of interest within single, easily identifiable cells. Furthermore, each functional module is flanked by unique cloning sites, ensuring flexibility and individual optimization. The efficacy of these vectors for analyzing multiple genes in a single cell was demonstrated in several different cell types, including hematopoietic, endothelial, and neural stem and progenitor cells, as well as hepatocytes. LeGO vectors thus represent a valuable tool for investigating gene networks using conditional ectopic expression and knock-down approaches simultaneously.

  10. Planar Cell Polarity Pathway Genes and Risk for Spina Bifida

    PubMed Central

    Wen, Shu; Zhu, Huiping; Lu, Wei; Mitchell, Laura E.; Shaw, Gary M.; Lammer, Edward J.; Finnell, Richard H.

    2009-01-01

    Spina bifida, a neural tube closure defect (NTD) involving the posterior portion of what will ultimately give rise to the spinal cord, is one of the most common and serious birth defects. The etiology of spina bifida is thought to be multi-factorial and involve multiple interacting genes and environmental factors. The causes of this congenital malformation remain largely unknown. However, several candidate genes for spina bifida have been identified in lower vertebrates, including the planar cell polarity (PCP) genes. We used data from a case-control study conducted in California to evaluate the association between variation within several key PCP genes and the risk of spina bifida. The PCP genes included in this study were the human homologues of the Xenopus genes Flamingo, Strabismus, Prickle, Dishevelled and Scrib, two of the homologues of Xenopus Wnt genes, WNT5A and WNT11, and two of the homologues of Xenopus Frizzled, FZD3 and FZD6. None of the 172 SNPs that were evaluated were significantly associated with spina bifida in any racial/ethnic group after correction for multiple testing. However, several SNPs in the PRICKLE2 gene had unadjusted p value<0.01. In conclusion our results, though largely negative, suggest that the PRICKLE2 gene may potentially modify the risk of spina bifida and deserves further investigation. PMID:20101694

  11. dbCPG: A web resource for cancer predisposition genes

    PubMed Central

    Wei, Ran; Yao, Yao; Yang, Wu; Zheng, Chun-Hou; Zhao, Min; Xia, Junfeng

    2016-01-01

    Cancer predisposition genes (CPGs) are genes in which inherited mutations confer highly or moderately increased risks of developing cancer. Identification of these genes and understanding the biological mechanisms that underlie them is crucial for the prevention, early diagnosis, and optimized management of cancer. Over the past decades, great efforts have been made to identify CPGs through multiple strategies. However, information on these CPGs and their molecular functions is scattered. To address this issue and provide a comprehensive resource for researchers, we developed the Cancer Predisposition Gene Database (dbCPG, Database URL: http://bioinfo.ahu.edu.cn:8080/dbCPG/index.jsp), the first literature-based gene resource for exploring human CPGs. It contains 827 human (724 protein-coding, 23 non-coding, and 80 unknown type genes), 637 rats, and 658 mouse CPGs. Furthermore, data mining was performed to gain insights into the understanding of the CPGs data, including functional annotation, gene prioritization, network analysis of prioritized genes and overlap analysis across multiple cancer types. A user-friendly web interface with multiple browse, search, and upload functions was also developed to facilitate access to the latest information on CPGs. Taken together, the dbCPG database provides a comprehensive data resource for further studies of cancer predisposition genes. PMID:27192119

  12. Mobilization of Neural Precursors in the Circulating Blood of Patients with Multiple Sclerosis

    DTIC Science & Technology

    2013-09-01

    Bongarzone ER. Expression of sonic hedgehog targeted genes in peripheral blood mononuclear cells of patients with multiple sclerosis. Society for...Print Program#/Poster#: 322.13 Presentation Title: Expression of sonic  hedgehog  targeted genes in peripheral blood mononuclear cells of patients with...analyses. Gene array hybridization showed up­ regulation of various components of the Sonic  hedgehog  (Shh) pathway including, Olig1 and Olig2. Taken

  13. Comparative genomics of duplicate γ-glutamyl transferase genes in teleosts: medaka (Oryzias latipes), stickleback (Gasterosteus aculeatus), green spotted pufferfish (Tetraodon nigroviridis), fugu (Takifugu rubripes), and zebrafish (Danio rerio).

    PubMed

    Law, Sheran Hiu Wan; Redelings, Benjamin David; Kullman, Seth William

    2012-01-15

    The availability of multiple teleost (bony fish) genomes is providing unprecedented opportunities to understand the diversity and function of gene duplication events using comparative genomics. Here we examine multiple paralogous genes of γ-glutamyl transferase (GGT) in several distantly related teleost species including medaka, stickleback, green spotted pufferfish, fugu, and zebrafish. Through mining genome databases, we have identified multiple GGT orthologs. Duplicate (paralogous) GGT sequences for GGT1 (GGT1 a and b), GGTL1 (GGTL1 a and b), and GGTL3 (GGTL3 a and b) were identified for each species. Phylogenetic analysis suggests that GGTs are ancient proteins conserved across most metazoan phyla and those paralogous GGTs in teleosts likely arose from the serial 3R genome duplication events. A third GGTL1 gene (GGTL1c) was found in green spotted pufferfish; however, this gene is not present in medaka, stickleback, or fugu. Similarly, one or both paralogs of GGTL3 appear to have been lost in green spotted pufferfish, fugu, and zebrafish. Syntenic relationships were highly maintained between duplicated teleost chromosomes, among teleosts and across ray-finned (Actinopterygii) and lobe-finned (Sarcopterygii) species. To assess subfunction partitioning, six medaka GGT genes were cloned and assessed for developmental and tissue-specific expression. On the basis of these data, we propose a modification of the "duplication-degeneration-complementation" model of subfunction partitioning where quantitative differences rather than absolute differences in gene expression are observed between gene paralogs. Our results demonstrate that multiple GGT genes have been retained within teleost genomes. Questions remain, however, regarding the functional roles of multiple GGTs in these species. Copyright © 2011 Wiley Periodicals, Inc., A Wiley Company.

  14. The Interaction Network Ontology-supported modeling and mining of complex interactions represented with multiple keywords in biomedical literature.

    PubMed

    Özgür, Arzucan; Hur, Junguk; He, Yongqun

    2016-01-01

    The Interaction Network Ontology (INO) logically represents biological interactions, pathways, and networks. INO has been demonstrated to be valuable in providing a set of structured ontological terms and associated keywords to support literature mining of gene-gene interactions from biomedical literature. However, previous work using INO focused on single keyword matching, while many interactions are represented with two or more interaction keywords used in combination. This paper reports our extension of INO to include combinatory patterns of two or more literature mining keywords co-existing in one sentence to represent specific INO interaction classes. Such keyword combinations and related INO interaction type information could be automatically obtained via SPARQL queries, formatted in Excel format, and used in an INO-supported SciMiner, an in-house literature mining program. We studied the gene interaction sentences from the commonly used benchmark Learning Logic in Language (LLL) dataset and one internally generated vaccine-related dataset to identify and analyze interaction types containing multiple keywords. Patterns obtained from the dependency parse trees of the sentences were used to identify the interaction keywords that are related to each other and collectively represent an interaction type. The INO ontology currently has 575 terms including 202 terms under the interaction branch. The relations between the INO interaction types and associated keywords are represented using the INO annotation relations: 'has literature mining keywords' and 'has keyword dependency pattern'. The keyword dependency patterns were generated via running the Stanford Parser to obtain dependency relation types. Out of the 107 interactions in the LLL dataset represented with two-keyword interaction types, 86 were identified by using the direct dependency relations. The LLL dataset contained 34 gene regulation interaction types, each of which associated with multiple keywords. A hierarchical display of these 34 interaction types and their ancestor terms in INO resulted in the identification of specific gene-gene interaction patterns from the LLL dataset. The phenomenon of having multi-keyword interaction types was also frequently observed in the vaccine dataset. By modeling and representing multiple textual keywords for interaction types, the extended INO enabled the identification of complex biological gene-gene interactions represented with multiple keywords.

  15. Construct and Compare Gene Coexpression Networks with DAPfinder and DAPview.

    PubMed

    Skinner, Jeff; Kotliarov, Yuri; Varma, Sudhir; Mine, Karina L; Yambartsev, Anatoly; Simon, Richard; Huyen, Yentram; Morgun, Andrey

    2011-07-14

    DAPfinder and DAPview are novel BRB-ArrayTools plug-ins to construct gene coexpression networks and identify significant differences in pairwise gene-gene coexpression between two phenotypes. Each significant difference in gene-gene association represents a Differentially Associated Pair (DAP). Our tools include several choices of filtering methods, gene-gene association metrics, statistical testing methods and multiple comparison adjustments. Network results are easily displayed in Cytoscape. Analyses of glioma experiments and microarray simulations demonstrate the utility of these tools. DAPfinder is a new friendly-user tool for reconstruction and comparison of biological networks.

  16. Systematic reconstruction of autism biology from massive genetic mutation profiles

    PubMed Central

    Zhang, Chaolin; Jiang, Yong-hui

    2018-01-01

    Autism spectrum disorder (ASD) affects 1% of world population and has become a pressing medical and social problem worldwide. As a paradigmatic complex genetic disease, ASD has been intensively studied and thousands of gene mutations have been reported. Because these mutations rarely recur, it is difficult to (i) pinpoint the fewer disease-causing versus majority random events and (ii) replicate or verify independent studies. A coherent and systematic understanding of autism biology has not been achieved. We analyzed 3392 and 4792 autism-related mutations from two large-scale whole-exome studies across multiple resolution levels, that is, variants (single-nucleotide), genes (protein-coding unit), and pathways (molecular module). These mutations do not recur or replicate at the variant level, but significantly and increasingly do so at gene and pathway levels. Genetic association reveals a novel gene + pathway dual-hit model, where the mutation burden becomes less relevant. In multiple independent analyses, hundreds of variants or genes repeatedly converge to several canonical pathways, either novel or literature-supported. These pathways define recurrent and systematic ASD biology, distinct from previously reported gene groups or networks. They also present a catalog of novel ASD risk factors including 118 variants and 72 genes. At a subpathway level, most variants disrupt the pathway-related gene functions, and in the same gene, they tend to hit residues extremely close to each other and in the same domain. Multiple interacting variants spotlight key modules, including the cAMP (adenosine 3′,5′-monophosphate) second-messenger system and mGluR (metabotropic glutamate receptor) signaling regulation by GRKs (G protein–coupled receptor kinases). At a superpathway level, distinct pathways further interconnect and converge to three biology themes: synaptic function, morphology, and plasticity. PMID:29651456

  17. Systematic reconstruction of autism biology from massive genetic mutation profiles.

    PubMed

    Luo, Weijun; Zhang, Chaolin; Jiang, Yong-Hui; Brouwer, Cory R

    2018-04-01

    Autism spectrum disorder (ASD) affects 1% of world population and has become a pressing medical and social problem worldwide. As a paradigmatic complex genetic disease, ASD has been intensively studied and thousands of gene mutations have been reported. Because these mutations rarely recur, it is difficult to (i) pinpoint the fewer disease-causing versus majority random events and (ii) replicate or verify independent studies. A coherent and systematic understanding of autism biology has not been achieved. We analyzed 3392 and 4792 autism-related mutations from two large-scale whole-exome studies across multiple resolution levels, that is, variants (single-nucleotide), genes (protein-coding unit), and pathways (molecular module). These mutations do not recur or replicate at the variant level, but significantly and increasingly do so at gene and pathway levels. Genetic association reveals a novel gene + pathway dual-hit model, where the mutation burden becomes less relevant. In multiple independent analyses, hundreds of variants or genes repeatedly converge to several canonical pathways, either novel or literature-supported. These pathways define recurrent and systematic ASD biology, distinct from previously reported gene groups or networks. They also present a catalog of novel ASD risk factors including 118 variants and 72 genes. At a subpathway level, most variants disrupt the pathway-related gene functions, and in the same gene, they tend to hit residues extremely close to each other and in the same domain. Multiple interacting variants spotlight key modules, including the cAMP (adenosine 3',5'-monophosphate) second-messenger system and mGluR (metabotropic glutamate receptor) signaling regulation by GRKs (G protein-coupled receptor kinases). At a superpathway level, distinct pathways further interconnect and converge to three biology themes: synaptic function, morphology, and plasticity.

  18. Nanoparticles for cancer gene therapy: Recent advances, challenges, and strategies.

    PubMed

    Wang, Kui; Kievit, Forrest M; Zhang, Miqin

    2016-12-01

    Compared to conventional treatments, gene therapy offers a variety of advantages for cancer treatment including high potency and specificity, low off-target toxicity, and delivery of multiple genes that concurrently target cancer tumorigenesis, recurrence, and drug resistance. In the past decades, gene therapy has undergone remarkable progress, and is now poised to become a first line therapy for cancer. Among various gene delivery systems, nanoparticles have attracted much attention because of their desirable characteristics including low toxicity profiles, well-controlled and high gene delivery efficiency, and multi-functionalities. This review provides an overview on gene therapeutics and gene delivery technologies, and highlight recent advances, challenges and insights into the design and the utility of nanoparticles in gene therapy for cancer treatment. Copyright © 2016. Published by Elsevier Ltd.

  19. RPG: the Ribosomal Protein Gene database.

    PubMed

    Nakao, Akihiro; Yoshihama, Maki; Kenmochi, Naoya

    2004-01-01

    RPG (http://ribosome.miyazaki-med.ac.jp/) is a new database that provides detailed information about ribosomal protein (RP) genes. It contains data from humans and other organisms, including Drosophila melanogaster, Caenorhabditis elegans, Saccharo myces cerevisiae, Methanococcus jannaschii and Escherichia coli. Users can search the database by gene name and organism. Each record includes sequences (genomic, cDNA and amino acid sequences), intron/exon structures, genomic locations and information about orthologs. In addition, users can view and compare the gene structures of the above organisms and make multiple amino acid sequence alignments. RPG also provides information on small nucleolar RNAs (snoRNAs) that are encoded in the introns of RP genes.

  20. RPG: the Ribosomal Protein Gene database

    PubMed Central

    Nakao, Akihiro; Yoshihama, Maki; Kenmochi, Naoya

    2004-01-01

    RPG (http://ribosome.miyazaki-med.ac.jp/) is a new database that provides detailed information about ribosomal protein (RP) genes. It contains data from humans and other organisms, including Drosophila melanogaster, Caenorhabditis elegans, Saccharo myces cerevisiae, Methanococcus jannaschii and Escherichia coli. Users can search the database by gene name and organism. Each record includes sequences (genomic, cDNA and amino acid sequences), intron/exon structures, genomic locations and information about orthologs. In addition, users can view and compare the gene structures of the above organisms and make multiple amino acid sequence alignments. RPG also provides information on small nucleolar RNAs (snoRNAs) that are encoded in the introns of RP genes. PMID:14681386

  1. Planar cell polarity pathway genes and risk for spina bifida.

    PubMed

    Wen, Shu; Zhu, Huiping; Lu, Wei; Mitchell, Laura E; Shaw, Gary M; Lammer, Edward J; Finnell, Richard H

    2010-02-01

    Spina bifida, a neural tube closure defect (NTD) involving the posterior portion of what will ultimately give rise to the spinal cord, is one of the most common and serious birth defects. The etiology of spina bifida is thought to be multi-factorial and involve multiple interacting genes and environmental factors. The causes of this congenital malformation remain largely unknown. However, several candidate genes for spina bifida have been identified in lower vertebrates, including the planar cell polarity (PCP) genes. We used data from a case-control study conducted in California to evaluate the association between variation within several key PCP genes and the risk of spina bifida. The PCP genes included in this study were the human homologs of the Xenopus genes Flamingo, Strabismus, Prickle, Dishevelled, and Scrib, two of the homologs of Xenopus Wnt genes, WNT5A and WNT11, and two of the homologs of Xenopus Frizzled, FZD3 and FZD6. None of the 172 SNPs that were evaluated were significantly associated with spina bifida in any racial/ethnic group after correction for multiple testing. However, several SNPs in the PRICKLE2 gene had unadjusted P-value <0.01. In conclusion, our results, though largely negative, suggest that the PRICKLE2 gene may potentially modify the risk of spina bifida and deserves further investigation. Copyright 2010 Wiley-Liss, Inc.

  2. Localized epigenetic silencing of a damage-activated WNT enhancer limits regeneration in mature Drosophila imaginal discs

    PubMed Central

    Harris, Robin E; Setiawan, Linda; Saul, Josh; Hariharan, Iswar K

    2016-01-01

    Many organisms lose the capacity to regenerate damaged tissues as they mature. Damaged Drosophila imaginal discs regenerate efficiently early in the third larval instar (L3) but progressively lose this ability. This correlates with reduced damage-responsive expression of multiple genes, including the WNT genes wingless (wg) and Wnt6. We demonstrate that damage-responsive expression of both genes requires a bipartite enhancer whose activity declines during L3. Within this enhancer, a damage-responsive module stays active throughout L3, while an adjacent silencing element nucleates increasing levels of epigenetic silencing restricted to this enhancer. Cas9-mediated deletion of the silencing element alleviates WNT repression, but is, in itself, insufficient to promote regeneration. However, directing Myc expression to the blastema overcomes repression of multiple genes, including wg, and restores cellular responses necessary for regeneration. Localized epigenetic silencing of damage-responsive enhancers can therefore restrict regenerative capacity in maturing organisms without compromising gene functions regulated by developmental signals. DOI: http://dx.doi.org/10.7554/eLife.11588.001 PMID:26840050

  3. Trainable Gene Regulation Networks with Applications to Drosophila Pattern Formation

    NASA Technical Reports Server (NTRS)

    Mjolsness, Eric

    2000-01-01

    This chapter will very briefly introduce and review some computational experiments in using trainable gene regulation network models to simulate and understand selected episodes in the development of the fruit fly, Drosophila melanogaster. For details the reader is referred to the papers introduced below. It will then introduce a new gene regulation network model which can describe promoter-level substructure in gene regulation. As described in chapter 2, gene regulation may be thought of as a combination of cis-acting regulation by the extended promoter of a gene (including all regulatory sequences) by way of the transcription complex, and of trans-acting regulation by the transcription factor products of other genes. If we simplify the cis-action by using a phenomenological model which can be tuned to data, such as a unit or other small portion of an artificial neural network, then the full transacting interaction between multiple genes during development can be modelled as a larger network which can again be tuned or trained to data. The larger network will in general need to have recurrent (feedback) connections since at least some real gene regulation networks do. This is the basic modeling approach taken, which describes how a set of recurrent neural networks can be used as a modeling language for multiple developmental processes including gene regulation within a single cell, cell-cell communication, and cell division. Such network models have been called "gene circuits", "gene regulation networks", or "genetic regulatory networks", sometimes without distinguishing the models from the actual modeled systems.

  4. Identifying metabolic enzymes with multiple types of association evidence

    PubMed Central

    Kharchenko, Peter; Chen, Lifeng; Freund, Yoav; Vitkup, Dennis; Church, George M

    2006-01-01

    Background Existing large-scale metabolic models of sequenced organisms commonly include enzymatic functions which can not be attributed to any gene in that organism. Existing computational strategies for identifying such missing genes rely primarily on sequence homology to known enzyme-encoding genes. Results We present a novel method for identifying genes encoding for a specific metabolic function based on a local structure of metabolic network and multiple types of functional association evidence, including clustering of genes on the chromosome, similarity of phylogenetic profiles, gene expression, protein fusion events and others. Using E. coli and S. cerevisiae metabolic networks, we illustrate predictive ability of each individual type of association evidence and show that significantly better predictions can be obtained based on the combination of all data. In this way our method is able to predict 60% of enzyme-encoding genes of E. coli metabolism within the top 10 (out of 3551) candidates for their enzymatic function, and as a top candidate within 43% of the cases. Conclusion We illustrate that a combination of genome context and other functional association evidence is effective in predicting genes encoding metabolic enzymes. Our approach does not rely on direct sequence homology to known enzyme-encoding genes, and can be used in conjunction with traditional homology-based metabolic reconstruction methods. The method can also be used to target orphan metabolic activities. PMID:16571130

  5. Allen Brain Atlas-Driven Visualizations: a web-based gene expression energy visualization tool.

    PubMed

    Zaldivar, Andrew; Krichmar, Jeffrey L

    2014-01-01

    The Allen Brain Atlas-Driven Visualizations (ABADV) is a publicly accessible web-based tool created to retrieve and visualize expression energy data from the Allen Brain Atlas (ABA) across multiple genes and brain structures. Though the ABA offers their own search engine and software for researchers to view their growing collection of online public data sets, including extensive gene expression and neuroanatomical data from human and mouse brain, many of their tools limit the amount of genes and brain structures researchers can view at once. To complement their work, ABADV generates multiple pie charts, bar charts and heat maps of expression energy values for any given set of genes and brain structures. Such a suite of free and easy-to-understand visualizations allows for easy comparison of gene expression across multiple brain areas. In addition, each visualization links back to the ABA so researchers may view a summary of the experimental detail. ABADV is currently supported on modern web browsers and is compatible with expression energy data from the Allen Mouse Brain Atlas in situ hybridization data. By creating this web application, researchers can immediately obtain and survey numerous amounts of expression energy data from the ABA, which they can then use to supplement their work or perform meta-analysis. In the future, we hope to enable ABADV across multiple data resources.

  6. Integrative analysis of GWAS, eQTLs and meQTLs data suggests that multiple gene sets are associated with bone mineral density.

    PubMed

    Wang, W; Huang, S; Hou, W; Liu, Y; Fan, Q; He, A; Wen, Y; Hao, J; Guo, X; Zhang, F

    2017-10-01

    Several genome-wide association studies (GWAS) of bone mineral density (BMD) have successfully identified multiple susceptibility genes, yet isolated susceptibility genes are often difficult to interpret biologically. The aim of this study was to unravel the genetic background of BMD at pathway level, by integrating BMD GWAS data with genome-wide expression quantitative trait loci (eQTLs) and methylation quantitative trait loci (meQTLs) data METHOD: We employed the GWAS datasets of BMD from the Genetic Factors for Osteoporosis Consortium (GEFOS), analysing patients' BMD. The areas studied included 32 735 femoral necks, 28 498 lumbar spines, and 8143 forearms. Genome-wide eQTLs (containing 923 021 eQTLs) and meQTLs (containing 683 152 unique methylation sites with local meQTLs) data sets were collected from recently published studies. Gene scores were first calculated by summary data-based Mendelian randomisation (SMR) software and meQTL-aligned GWAS results. Gene set enrichment analysis (GSEA) was then applied to identify BMD-associated gene sets with a predefined significance level of 0.05. We identified multiple gene sets associated with BMD in one or more regions, including relevant known biological gene sets such as the Reactome Circadian Clock (GSEA p-value = 1.0 × 10 -4 for LS and 2.7 × 10 -2 for femoral necks BMD in eQTLs-based GSEA) and insulin-like growth factor receptor binding (GSEA p-value = 5.0 × 10 -4 for femoral necks and 2.6 × 10 -2 for lumbar spines BMD in meQTLs-based GSEA). Our results provided novel clues for subsequent functional analysis of bone metabolism, and illustrated the benefit of integrating eQTLs and meQTLs data into pathway association analysis for genetic studies of complex human diseases. Cite this article : W. Wang, S. Huang, W. Hou, Y. Liu, Q. Fan, A. He, Y. Wen, J. Hao, X. Guo, F. Zhang. Integrative analysis of GWAS, eQTLs and meQTLs data suggests that multiple gene sets are associated with bone mineral density. Bone Joint Res 2017;6:572-576. © 2017 Wang et al.

  7. Small RNA biology is systems biology.

    PubMed

    Jost, Daniel; Nowojewski, Andrzej; Levine, Erel

    2011-01-01

    During the last decade small regulatory RNA (srRNA) emerged as central players in the regulation of gene expression in all kingdoms of life. Multiple pathways for srRNA biogenesis and diverse mechanisms of gene regulation may indicate that srRNA regulation evolved independently multiple times. However, small RNA pathways share numerous properties, including the ability of a single srRNA to regulate multiple targets. Some of the mechanisms of gene regulation by srRNAs have significant effect on the abundance of free srRNAs that are ready to interact with new targets. This results in indirect interactions among seemingly unrelated genes, as well as in a crosstalk between different srRNA pathways. Here we briefly review and compare the major srRNA pathways, and argue that the impact of srRNA is always at the system level. We demonstrate how a simple mathematical model can ease the discussion of governing principles. To demonstrate these points we review a few examples from bacteria and animals.

  8. Meta-Analysis of Multiple Sclerosis Microarray Data Reveals Dysregulation in RNA Splicing Regulatory Genes.

    PubMed

    Paraboschi, Elvezia Maria; Cardamone, Giulia; Rimoldi, Valeria; Gemmati, Donato; Spreafico, Marta; Duga, Stefano; Soldà, Giulia; Asselta, Rosanna

    2015-09-30

    Abnormalities in RNA metabolism and alternative splicing (AS) are emerging as important players in complex disease phenotypes. In particular, accumulating evidence suggests the existence of pathogenic links between multiple sclerosis (MS) and altered AS, including functional studies showing that an imbalance in alternatively-spliced isoforms may contribute to disease etiology. Here, we tested whether the altered expression of AS-related genes represents a MS-specific signature. A comprehensive comparative analysis of gene expression profiles of publicly-available microarray datasets (190 MS cases, 182 controls), followed by gene-ontology enrichment analysis, highlighted a significant enrichment for differentially-expressed genes involved in RNA metabolism/AS. In detail, a total of 17 genes were found to be differentially expressed in MS in multiple datasets, with CELF1 being dysregulated in five out of seven studies. We confirmed CELF1 downregulation in MS (p=0.0015) by real-time RT-PCRs on RNA extracted from blood cells of 30 cases and 30 controls. As a proof of concept, we experimentally verified the unbalance in alternatively-spliced isoforms in MS of the NFAT5 gene, a putative CELF1 target. In conclusion, for the first time we provide evidence of a consistent dysregulation of splicing-related genes in MS and we discuss its possible implications in modulating specific AS events in MS susceptibility genes.

  9. Precise Sequential DNA Ligation on A Solid Substrate: Solid-Based Rapid Sequential Ligation of Multiple DNA Molecules

    PubMed Central

    Takita, Eiji; Kohda, Katsunori; Tomatsu, Hajime; Hanano, Shigeru; Moriya, Kanami; Hosouchi, Tsutomu; Sakurai, Nozomu; Suzuki, Hideyuki; Shinmyo, Atsuhiko; Shibata, Daisuke

    2013-01-01

    Ligation, the joining of DNA fragments, is a fundamental procedure in molecular cloning and is indispensable to the production of genetically modified organisms that can be used for basic research, the applied biosciences, or both. Given that many genes cooperate in various pathways, incorporating multiple gene cassettes in tandem in a transgenic DNA construct for the purpose of genetic modification is often necessary when generating organisms that produce multiple foreign gene products. Here, we describe a novel method, designated PRESSO (precise sequential DNA ligation on a solid substrate), for the tandem ligation of multiple DNA fragments. We amplified donor DNA fragments with non-palindromic ends, and ligated the fragment to acceptor DNA fragments on solid beads. After the final donor DNA fragments, which included vector sequences, were joined to the construct that contained the array of fragments, the ligation product (the construct) was thereby released from the beads via digestion with a rare-cut meganuclease; the freed linear construct was circularized via an intra-molecular ligation. PRESSO allowed us to rapidly and efficiently join multiple genes in an optimized order and orientation. This method can overcome many technical challenges in functional genomics during the post-sequencing generation. PMID:23897972

  10. Origins of extrinsic variability in eukaryotic gene expression

    NASA Astrophysics Data System (ADS)

    Volfson, Dmitri; Marciniak, Jennifer; Blake, William J.; Ostroff, Natalie; Tsimring, Lev S.; Hasty, Jeff

    2006-02-01

    Variable gene expression within a clonal population of cells has been implicated in a number of important processes including mutation and evolution, determination of cell fates and the development of genetic disease. Recent studies have demonstrated that a significant component of expression variability arises from extrinsic factors thought to influence multiple genes simultaneously, yet the biological origins of this extrinsic variability have received little attention. Here we combine computational modelling with fluorescence data generated from multiple promoter-gene inserts in Saccharomyces cerevisiae to identify two major sources of extrinsic variability. One unavoidable source arising from the coupling of gene expression with population dynamics leads to a ubiquitous lower limit for expression variability. A second source, which is modelled as originating from a common upstream transcription factor, exemplifies how regulatory networks can convert noise in upstream regulator expression into extrinsic noise at the output of a target gene. Our results highlight the importance of the interplay of gene regulatory networks with population heterogeneity for understanding the origins of cellular diversity.

  11. Origins of extrinsic variability in eukaryotic gene expression

    NASA Astrophysics Data System (ADS)

    Volfson, Dmitri; Marciniak, Jennifer; Blake, William J.; Ostroff, Natalie; Tsimring, Lev S.; Hasty, Jeff

    2006-03-01

    Variable gene expression within a clonal population of cells has been implicated in a number of important processes including mutation and evolution, determination of cell fates and the development of genetic disease. Recent studies have demonstrated that a significant component of expression variability arises from extrinsic factors thought to influence multiple genes in concert, yet the biological origins of this extrinsic variability have received little attention. Here we combine computational modeling with fluorescence data generated from multiple promoter-gene inserts in Saccharomyces cerevisiae to identify two major sources of extrinsic variability. One unavoidable source arising from the coupling of gene expression with population dynamics leads to a ubiquitous noise floor in expression variability. A second source which is modeled as originating from a common upstream transcription factor exemplifies how regulatory networks can convert noise in upstream regulator expression into extrinsic noise at the output of a target gene. Our results highlight the importance of the interplay of gene regulatory networks with population heterogeneity for understanding the origins of cellular diversity.

  12. miR-137 inhibits the invasion of melanoma cells through downregulation of multiple oncogenic target genes.

    PubMed

    Luo, Chonglin; Tetteh, Paul W; Merz, Patrick R; Dickes, Elke; Abukiwan, Alia; Hotz-Wagenblatt, Agnes; Holland-Cunz, Stefan; Sinnberg, Tobias; Schittek, Birgit; Schadendorf, Dirk; Diederichs, Sven; Eichmüller, Stefan B

    2013-03-01

    MicroRNAs are small noncoding RNAs that regulate gene expression and have important roles in various types of cancer. Previously, miR-137 was reported to act as a tumor suppressor in different cancers, including malignant melanoma. In this study, we show that low miR-137 expression is correlated with poor survival in stage IV melanoma patients. We identified and validated two genes (c-Met and YB1) as direct targets of miR-137 and confirmed two previously known targets, namely enhancer of zeste homolog 2 (EZH2) and microphthalmia-associated transcription factor (MITF). Functional studies showed that miR-137 suppressed melanoma cell invasion through the downregulation of multiple target genes. The decreased invasion caused by miR-137 overexpression could be phenocopied by small interfering RNA knockdown of EZH2, c-Met, or Y box-binding protein 1 (YB1). Furthermore, miR-137 inhibited melanoma cell migration and proliferation. Finally, miR-137 induced apoptosis in melanoma cell lines and decreased BCL2 levels. In summary, our study confirms that miR-137 acts as a tumor suppressor in malignant melanoma and reveals that miR-137 regulates multiple targets including c-Met, YB1, EZH2, and MITF.

  13. A rapid NGS strategy for comprehensive molecular diagnosis of Birt-Hogg-Dubé syndrome in patients with primary spontaneous pneumothorax.

    PubMed

    Zhang, Xinxin; Ma, Dehua; Zou, Wei; Ding, Yibing; Zhu, Chengchu; Min, Haiyan; Zhang, Bin; Wang, Wei; Chen, Baofu; Ye, Minhua; Cai, Minghui; Pan, Yanqing; Cao, Lei; Wan, Yueming; Jin, Yu; Gao, Qian; Yi, Long

    2016-05-27

    Primary spontaneous pneumothorax (PSP) or pulmonary cysts is one of the manifestations of Birt-Hogg-Dube syndrome (BHDS) that is caused by heterozygous mutations in FLCN gene. Most of the mutations are SNVs and small indels, and there are also approximately 10 % large intragenic deletions and duplications of the mutations. These molecular findings are generally obtained by disparate methods including Sanger sequencing and Multiple Ligation-dependent Probe Amplification in the clinical laboratory. In addition, as a genetically heterogeneous disorder, PSP may be caused by mutations in multiple genes include FBN1, COL3A1, CBS, SERPINA1 and TSC1/TSC2 genes. For differential diagnosis, these genes should also be screened which makes the diagnostic procedure more time-consuming and labor-intensive. Forty PSP patients were divided into 2 groups. Nineteen patients with different pathogenic mutations of FLCN previously identified by conventional Sanger sequencing and MLPA were included in test group, 21 random PSP patients without any genetic screening were included in blinded sample group. 7 PSP genes including FLCN, FBN1, COL3A1, CBS, SERPINA1 and TSC1/TSC2 were designed and enriched by Haloplex system, sequenced on a Miseq platform and analyzed in the 40 patients to evaluate the performance of the targeted-NGS method. We demonstrated that the full spectrum of genes associated with pneumothorax including FLCN gene mutations can be identified simultaneously in multiplexed sequence data. Noteworthy, by our in-house copy number analysis of the sequence data, we could not only detect intragenic deletions, but also determine approximate deletion junctions simultaneously. NGS based Haloplex target enrichment technology is proved to be a rapid and cost-effective screening strategy for the comprehensive molecular diagnosis of BHDS in PSP patients, as it can replace Sanger sequencing and MLPA by simultaneously detecting exonic and intronic SNVs, small indels, large intragenic deletions and determining deletion junctions in PSP-related genes.

  14. CARHTA GENE: multipopulation integrated genetic and radiation hybrid mapping.

    PubMed

    de Givry, Simon; Bouchez, Martin; Chabrier, Patrick; Milan, Denis; Schiex, Thomas

    2005-04-15

    CAR(H)(T)A GENE: is an integrated genetic and radiation hybrid (RH) mapping tool which can deal with multiple populations, including mixtures of genetic and RH data. CAR(H)(T)A GENE: performs multipoint maximum likelihood estimations with accelerated expectation-maximization algorithms for some pedigrees and has sophisticated algorithms for marker ordering. Dedicated heuristics for framework mapping are also included. CAR(H)(T)A GENE: can be used as a C++ library, through a shell command and a graphical interface. The XML output for companion tools is integrated. The program is available free of charge from www.inra.fr/bia/T/CarthaGene for Linux, Windows and Solaris machines (with Open Source). tschiex@toulouse.inra.fr.

  15. GESearch: An Interactive GUI Tool for Identifying Gene Expression Signature.

    PubMed

    Ye, Ning; Yin, Hengfu; Liu, Jingjing; Dai, Xiaogang; Yin, Tongming

    2015-01-01

    The huge amount of gene expression data generated by microarray and next-generation sequencing technologies present challenges to exploit their biological meanings. When searching for the coexpression genes, the data mining process is largely affected by selection of algorithms. Thus, it is highly desirable to provide multiple options of algorithms in the user-friendly analytical toolkit to explore the gene expression signatures. For this purpose, we developed GESearch, an interactive graphical user interface (GUI) toolkit, which is written in MATLAB and supports a variety of gene expression data files. This analytical toolkit provides four models, including the mean, the regression, the delegate, and the ensemble models, to identify the coexpression genes, and enables the users to filter data and to select gene expression patterns by browsing the display window or by importing knowledge-based genes. Subsequently, the utility of this analytical toolkit is demonstrated by analyzing two sets of real-life microarray datasets from cell-cycle experiments. Overall, we have developed an interactive GUI toolkit that allows for choosing multiple algorithms for analyzing the gene expression signatures.

  16. Developmental regulation of diacylglycerol acyltransferase family gene expression in tung tree tissues

    USDA-ARS?s Scientific Manuscript database

    Diacylglycerol acyltransferases (DGAT) are responsible for the final and rate-limiting step of triacylglycerol (TAG) biosynthesis in eukaryotic organisms. DGAT genes have been identified in numerous organisms. Multiple isoforms of DGAT are present in eukaryotes, including DGAT1 and DGAT2 of tung tre...

  17. Comparison of multiple gene assembly methods for metabolic engineering

    Treesearch

    Chenfeng Lu; Karen Mansoorabadi; Thomas Jeffries

    2007-01-01

    A universal, rapid DNA assembly method for efficient multigene plasmid construction is important for biological research and for optimizing gene expression in industrial microbes. Three different approaches to achieve this goal were evaluated. These included creating long complementary extensions using a uracil-DNA glycosylase technique, overlap extension polymerase...

  18. Shared regulatory sites are abundant in the human genome and shed light on genome evolution and disease pleiotropy.

    PubMed

    Tong, Pin; Monahan, Jack; Prendergast, James G D

    2017-03-01

    Large-scale gene expression datasets are providing an increasing understanding of the location of cis-eQTLs in the human genome and their role in disease. However, little is currently known regarding the extent of regulatory site-sharing between genes. This is despite it having potentially wide-ranging implications, from the determination of the way in which genetic variants may shape multiple phenotypes to the understanding of the evolution of human gene order. By first identifying the location of non-redundant cis-eQTLs, we show that regulatory site-sharing is a relatively common phenomenon in the human genome, with over 10% of non-redundant regulatory variants linked to the expression of multiple nearby genes. We show that these shared, local regulatory sites are linked to high levels of chromatin looping between the regulatory sites and their associated genes. In addition, these co-regulated gene modules are found to be strongly conserved across mammalian species, suggesting that shared regulatory sites have played an important role in shaping human gene order. The association of these shared cis-eQTLs with multiple genes means they also appear to be unusually important in understanding the genetics of human phenotypes and pleiotropy, with shared regulatory sites more often linked to multiple human phenotypes than other regulatory variants. This study shows that regulatory site-sharing is likely an underappreciated aspect of gene regulation and has important implications for the understanding of various biological phenomena, including how the two and three dimensional structures of the genome have been shaped and the potential causes of disease pleiotropy outside coding regions.

  19. Hybrid coexpression link similarity graph clustering for mining biological modules from multiple gene expression datasets.

    PubMed

    Salem, Saeed; Ozcaglar, Cagri

    2014-01-01

    Advances in genomic technologies have enabled the accumulation of vast amount of genomic data, including gene expression data for multiple species under various biological and environmental conditions. Integration of these gene expression datasets is a promising strategy to alleviate the challenges of protein functional annotation and biological module discovery based on a single gene expression data, which suffers from spurious coexpression. We propose a joint mining algorithm that constructs a weighted hybrid similarity graph whose nodes are the coexpression links. The weight of an edge between two coexpression links in this hybrid graph is a linear combination of the topological similarities and co-appearance similarities of the corresponding two coexpression links. Clustering the weighted hybrid similarity graph yields recurrent coexpression link clusters (modules). Experimental results on Human gene expression datasets show that the reported modules are functionally homogeneous as evident by their enrichment with biological process GO terms and KEGG pathways.

  20. C-State: an interactive web app for simultaneous multi-gene visualization and comparative epigenetic pattern search.

    PubMed

    Sowpati, Divya Tej; Srivastava, Surabhi; Dhawan, Jyotsna; Mishra, Rakesh K

    2017-09-13

    Comparative epigenomic analysis across multiple genes presents a bottleneck for bench biologists working with NGS data. Despite the development of standardized peak analysis algorithms, the identification of novel epigenetic patterns and their visualization across gene subsets remains a challenge. We developed a fast and interactive web app, C-State (Chromatin-State), to query and plot chromatin landscapes across multiple loci and cell types. C-State has an interactive, JavaScript-based graphical user interface and runs locally in modern web browsers that are pre-installed on all computers, thus eliminating the need for cumbersome data transfer, pre-processing and prior programming knowledge. C-State is unique in its ability to extract and analyze multi-gene epigenetic information. It allows for powerful GUI-based pattern searching and visualization. We include a case study to demonstrate its potential for identifying user-defined epigenetic trends in context of gene expression profiles.

  1. Repeated cis-regulatory tuning of a metabolic bottleneck gene during evolution.

    PubMed

    Kuang, Meihua Christina; Kominek, Jacek; Alexander, William G; Cheng, Jan-Fang; Wrobel, Russell L; Hittinger, Chris Todd

    2018-05-21

    Repeated evolutionary events imply underlying genetic constraints that can make evolutionary mechanisms predictable. Morphological traits are thought to evolve frequently through cis-regulatory changes because these mechanisms bypass constraints in pleiotropic genes that are reused during development. In contrast, the constraints acting on metabolic traits during evolution are less well studied. Here we show how a metabolic bottleneck gene has repeatedly adopted similar cis-regulatory solutions during evolution, likely due to its pleiotropic role integrating flux from multiple metabolic pathways. Specifically, the genes encoding phosphoglucomutase activity (PGM1/PGM2), which connect GALactose catabolism to glycolysis, have gained and lost direct regulation by the transcription factor Gal4 several times during yeast evolution. Through targeted mutations of predicted Gal4-binding sites in yeast genomes, we show this galactose-mediated regulation of PGM1/2 supports vigorous growth on galactose in multiple yeast species, including Saccharomyces uvarum and Lachancea kluyveri. Furthermore, the addition of galactose-inducible PGM1 alone is sufficient to improve the growth on galactose of multiple species that lack this regulation, including Saccharomyces cerevisiae. The strong association between regulation of PGM1/2 by Gal4 even enables remarkably accurate predictions of galactose growth phenotypes between closely related species. This repeated mode of evolution suggests that this specific cis-regulatory connection is a common way that diverse yeasts can govern flux through the pathway, likely due to the constraints imposed by this pleiotropic bottleneck gene. Since metabolic pathways are highly interconnected, we argue that cis-regulatory evolution might be widespread at pleiotropic genes that control metabolic bottlenecks and intersections.

  2. Changing the Game: Using Integrative Genomics to Probe Virulence Mechanisms of the Stem Rust Pathogen Puccinia graminis f. sp. tritici.

    PubMed

    Figueroa, Melania; Upadhyaya, Narayana M; Sperschneider, Jana; Park, Robert F; Szabo, Les J; Steffenson, Brian; Ellis, Jeff G; Dodds, Peter N

    2016-01-01

    The recent resurgence of wheat stem rust caused by new virulent races of Puccinia graminis f. sp. tritici (Pgt) poses a threat to food security. These concerns have catalyzed an extensive global effort toward controlling this disease. Substantial research and breeding programs target the identification and introduction of new stem rust resistance (Sr) genes in cultivars for genetic protection against the disease. Such resistance genes typically encode immune receptor proteins that recognize specific components of the pathogen, known as avirulence (Avr) proteins. A significant drawback to deploying cultivars with single Sr genes is that they are often overcome by evolution of the pathogen to escape recognition through alterations in Avr genes. Thus, a key element in achieving durable rust control is the deployment of multiple effective Sr genes in combination, either through conventional breeding or transgenic approaches, to minimize the risk of resistance breakdown. In this situation, evolution of pathogen virulence would require changes in multiple Avr genes in order to bypass recognition. However, choosing the optimal Sr gene combinations to deploy is a challenge that requires detailed knowledge of the pathogen Avr genes with which they interact and the virulence phenotypes of Pgt existing in nature. Identifying specific Avr genes from Pgt will provide screening tools to enhance pathogen virulence monitoring, assess heterozygosity and propensity for mutation in pathogen populations, and confirm individual Sr gene functions in crop varieties carrying multiple effective resistance genes. Toward this goal, much progress has been made in assembling a high quality reference genome sequence for Pgt, as well as a Pan-genome encompassing variation between multiple field isolates with diverse virulence spectra. In turn this has allowed prediction of Pgt effector gene candidates based on known features of Avr genes in other plant pathogens, including the related flax rust fungus. Upregulation of gene expression in haustoria and evidence for diversifying selection are two useful parameters to identify candidate Avr genes. Recently, we have also applied machine learning approaches to agnostically predict candidate effectors. Here, we review progress in stem rust pathogenomics and approaches currently underway to identify Avr genes recognized by wheat Sr genes.

  3. Initial genome sequencing and analysis of multiple myeloma

    PubMed Central

    Chapman, Michael A.; Lawrence, Michael S.; Keats, Jonathan J.; Cibulskis, Kristian; Sougnez, Carrie; Schinzel, Anna C.; Harview, Christina L.; Brunet, Jean-Philippe; Ahmann, Gregory J.; Adli, Mazhar; Anderson, Kenneth C.; Ardlie, Kristin G.; Auclair, Daniel; Baker, Angela; Bergsagel, P. Leif; Bernstein, Bradley E.; Drier, Yotam; Fonseca, Rafael; Gabriel, Stacey B.; Hofmeister, Craig C.; Jagannath, Sundar; Jakubowiak, Andrzej J.; Krishnan, Amrita; Levy, Joan; Liefeld, Ted; Lonial, Sagar; Mahan, Scott; Mfuko, Bunmi; Monti, Stefano; Perkins, Louise M.; Onofrio, Robb; Pugh, Trevor J.; Vincent Rajkumar, S.; Ramos, Alex H.; Siegel, David S.; Sivachenko, Andrey; Trudel, Suzanne; Vij, Ravi; Voet, Douglas; Winckler, Wendy; Zimmerman, Todd; Carpten, John; Trent, Jeff; Hahn, William C.; Garraway, Levi A.; Meyerson, Matthew; Lander, Eric S.; Getz, Gad; Golub, Todd R.

    2013-01-01

    Multiple myeloma is an incurable malignancy of plasma cells, and its pathogenesis is poorly understood. Here we report the massively parallel sequencing of 38 tumor genomes and their comparison to matched normal DNAs. Several new and unexpected oncogenic mechanisms were suggested by the pattern of somatic mutation across the dataset. These include the mutation of genes involved in protein translation (seen in nearly half of the patients), genes involved in histone methylation, and genes involved in blood coagulation. In addition, a broader than anticipated role of NF-κB signaling was suggested by mutations in 11 members of the NF-κB pathway. Of potential immediate clinical relevance, activating mutations of the kinase BRAF were observed in 4% of patients, suggesting the evaluation of BRAF inhibitors in multiple myeloma clinical trials. These results indicate that cancer genome sequencing of large collections of samples will yield new insights into cancer not anticipated by existing knowledge. PMID:21430775

  4. Improved Statistical Methods Enable Greater Sensitivity in Rhythm Detection for Genome-Wide Data

    PubMed Central

    Hutchison, Alan L.; Maienschein-Cline, Mark; Chiang, Andrew H.; Tabei, S. M. Ali; Gudjonson, Herman; Bahroos, Neil; Allada, Ravi; Dinner, Aaron R.

    2015-01-01

    Robust methods for identifying patterns of expression in genome-wide data are important for generating hypotheses regarding gene function. To this end, several analytic methods have been developed for detecting periodic patterns. We improve one such method, JTK_CYCLE, by explicitly calculating the null distribution such that it accounts for multiple hypothesis testing and by including non-sinusoidal reference waveforms. We term this method empirical JTK_CYCLE with asymmetry search, and we compare its performance to JTK_CYCLE with Bonferroni and Benjamini-Hochberg multiple hypothesis testing correction, as well as to five other methods: cyclohedron test, address reduction, stable persistence, ANOVA, and F24. We find that ANOVA, F24, and JTK_CYCLE consistently outperform the other three methods when data are limited and noisy; empirical JTK_CYCLE with asymmetry search gives the greatest sensitivity while controlling for the false discovery rate. Our analysis also provides insight into experimental design and we find that, for a fixed number of samples, better sensitivity and specificity are achieved with higher numbers of replicates than with higher sampling density. Application of the methods to detecting circadian rhythms in a metadataset of microarrays that quantify time-dependent gene expression in whole heads of Drosophila melanogaster reveals annotations that are enriched among genes with highly asymmetric waveforms. These include a wide range of oxidation reduction and metabolic genes, as well as genes with transcripts that have multiple splice forms. PMID:25793520

  5. integIRTy: a method to identify genes altered in cancer by accounting for multiple mechanisms of regulation using item response theory.

    PubMed

    Tong, Pan; Coombes, Kevin R

    2012-11-15

    Identifying genes altered in cancer plays a crucial role in both understanding the mechanism of carcinogenesis and developing novel therapeutics. It is known that there are various mechanisms of regulation that can lead to gene dysfunction, including copy number change, methylation, abnormal expression, mutation and so on. Nowadays, all these types of alterations can be simultaneously interrogated by different types of assays. Although many methods have been proposed to identify altered genes from a single assay, there is no method that can deal with multiple assays accounting for different alteration types systematically. In this article, we propose a novel method, integration using item response theory (integIRTy), to identify altered genes by using item response theory that allows integrated analysis of multiple high-throughput assays. When applied to a single assay, the proposed method is more robust and reliable than conventional methods such as Student's t-test or the Wilcoxon rank-sum test. When used to integrate multiple assays, integIRTy can identify novel-altered genes that cannot be found by looking at individual assay separately. We applied integIRTy to three public cancer datasets (ovarian carcinoma, breast cancer, glioblastoma) for cross-assay type integration which all show encouraging results. The R package integIRTy is available at the web site http://bioinformatics.mdanderson.org/main/OOMPA:Overview. kcoombes@mdanderson.org. Supplementary data are available at Bioinformatics online.

  6. Dynamic evolution of Geranium mitochondrial genomes through multiple horizontal and intracellular gene transfers.

    PubMed

    Park, Seongjun; Grewe, Felix; Zhu, Andan; Ruhlman, Tracey A; Sabir, Jamal; Mower, Jeffrey P; Jansen, Robert K

    2015-10-01

    The exchange of genetic material between cellular organelles through intracellular gene transfer (IGT) or between species by horizontal gene transfer (HGT) has played an important role in plant mitochondrial genome evolution. The mitochondrial genomes of Geraniaceae display a number of unusual phenomena including highly accelerated rates of synonymous substitutions, extensive gene loss and reduction in RNA editing. Mitochondrial DNA sequences assembled for 17 species of Geranium revealed substantial reduction in gene and intron content relative to the ancestor of the Geranium lineage. Comparative analyses of nuclear transcriptome data suggest that a number of these sequences have been functionally relocated to the nucleus via IGT. Evidence for rampant HGT was detected in several Geranium species containing foreign organellar DNA from diverse eudicots, including many transfers from parasitic plants. One lineage has experienced multiple, independent HGT episodes, many of which occurred within the past 5.5 Myr. Both duplicative and recapture HGT were documented in Geranium lineages. The mitochondrial genome of Geranium brycei contains at least four independent HGT tracts that are absent in its nearest relative. Furthermore, G. brycei mitochondria carry two copies of the cox1 gene that differ in intron content, providing insight into contrasting hypotheses on cox1 intron evolution. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  7. Novel Mutations in PSENEN Gene in Two Chinese Acne Inversa Families Manifested as Familial Multiple Comedones and Dowling-Degos Disease

    PubMed Central

    Zhou, Cheng; Wen, Guang-Dong; Soe, Lwin Myint; Xu, Hong-Jun; Du, Juan; Zhang, Jian-Zhong

    2016-01-01

    Background: Acne inversa (AI), also called hidradenitis suppurativa, is a chronic, inflammatory, recurrent skin disease of the hair follicle. Familial AI shows autosomal-dominant inheritance caused by mutations in the γ-secretase genes. This study was aimed to identify the specific mutations in the γ-secretase genes in two Chinese families with AI. Methods: In this study, two Chinese families with AI were investigated. All the affected individuals in the two families mainly manifested with multiple comedones, pitted scars, and a few inflammatory nodules on their face, neck, trunk, axilla, buttocks, upper arms, and thighs. Reticulate pigmentation in the flexures areas resembled Dowling-Degos disease clinically and pathologically. In addition, one of the affected individuals developed anal canal squamous cell carcinoma. Molecular mutation analysis of γ-secretase genes including PSENEN, PSEN1, and NCSTN was performed by polymerase chain reaction and direct DNA sequencing. Results: Two novel mutations of PSENEN gene were identified, including a heterozygous missense mutation c.194T>G (p.L65R) and a splice site mutation c.167-2A>G. Conclusions: The identification of the two mutations could expand the spectrum of mutations in the γ-secretase genes underlying AI and provide valuable information for further study of genotype-phenotype correlations. PMID:27900998

  8. Nuclear hormone receptors in parasitic helminths

    PubMed Central

    Wu, Wenjie; LoVerde, Philip T

    2010-01-01

    Nuclear receptors (NRs) belong to a large protein superfamily that are important transcriptional modulators in metazoans. Parasitic helminths include parasitic worms from the Lophotrochozoa (Platyhelminths) and Ecdysozoa (Nematoda). NRs in parasitic helminths diverged into two different evolutionary lineages. NRs in parasitic Platyhelminths have orthologues in Deuterostomes, in arthropods or both with a feature of extensive gene loss and gene duplication within different gene groups. NRs in parasitic Nematoda follow the nematode evolutionary lineage with a feature of multiple duplication of SupNRs and gene loss. PMID:20600585

  9. Large-scale analysis of antisense transcription in wheat using the Affymetrix GeneChip Wheat Genome Array

    USDA-ARS?s Scientific Manuscript database

    Natural antisense transcripts (NATs) are transcripts of the opposite DNA strand to the sense-strand either at the same locus (cis-encoded) or a different locus (trans-encoded). They can affect gene expression at multiple stages including transcription, RNA processing and transport, and translation....

  10. Allelic association of sequence variants in the herpes virus entry mediator-B gene (PVRL2) with the severity of multiple sclerosis.

    PubMed

    Schmidt, S; Pericak-Vance, M A; Sawcer, S; Barcellos, L F; Hart, J; Sims, J; Prokop, A M; van der Walt, J; DeLoa, C; Lincoln, R R; Oksenberg, J R; Compston, A; Hauser, S L; Haines, J L; Gregory, S G

    2006-07-01

    Discrepant findings have been reported regarding an association of the apolipoprotein E (APOE) gene with the clinical course of multiple sclerosis (MS). To resolve these discrepancies, we examined common sequence variation in six candidate genes residing in a 380-kb genomic region surrounding and including the APOE locus for an association with MS severity. We genotyped at least three polymorphisms in each of six candidate genes in 1,540 Caucasian MS families (729 single-case and multiple-case families from the United States, 811 single-case families from the UK). By applying the quantitative transmission/disequilibrium test to a recently proposed MS severity score, the only statistically significant (P=0.003) association with MS severity was found for an intronic variant in the Herpes Virus Entry Mediator-B Gene PVRL2. Additional genotyping extended the association to a 16.6 kb block spanning intron 1 to intron 2 of the gene. Sequencing of PVRL2 failed to identify variants with an obvious functional role. In conclusion, the analysis of a very large data set suggests that genetic polymorphisms in PVRL2 may influence MS severity and supports the possibility that viral factors may contribute to the clinical course of MS, consistent with previous reports.

  11. A Novel System for Simultaneous or Sequential Integration of Multiple Gene-Loading Vectors into a Defined Site of a Human Artificial Chromosome

    PubMed Central

    Suzuki, Teruhiko; Kazuki, Yasuhiro; Oshimura, Mitsuo; Hara, Takahiko

    2014-01-01

    Human artificial chromosomes (HACs) are gene-delivery vectors suitable for introducing large DNA fragments into mammalian cells. Although a HAC theoretically incorporates multiple gene expression cassettes of unlimited DNA size, its application has been limited because the conventional gene-loading system accepts only one gene-loading vector (GLV) into a HAC. We report a novel method for the simultaneous or sequential integration of multiple GLVs into a HAC vector (designated as the SIM system) via combined usage of Cre, FLP, Bxb1, and φC31 recombinase/integrase. As a proof of principle, we first attempted simultaneous integration of three GLVs encoding EGFP, Venus, and TdTomato into a gene-loading site of a HAC in CHO cells. These cells successfully expressed all three fluorescent proteins. Furthermore, microcell-mediated transfer of HACs enabled the expression of those fluorescent proteins in recipient cells. We next demonstrated that GLVs could be introduced into a HAC one-by-one via reciprocal usage of recombinase/integrase. Lastly, we introduced a fourth GLV into a HAC after simultaneous integration of three GLVs by FLP-mediated DNA recombination. The SIM system expands the applicability of HAC vectors and is useful for various biomedical studies, including cell reprogramming. PMID:25303219

  12. A novel system for simultaneous or sequential integration of multiple gene-loading vectors into a defined site of a human artificial chromosome.

    PubMed

    Suzuki, Teruhiko; Kazuki, Yasuhiro; Oshimura, Mitsuo; Hara, Takahiko

    2014-01-01

    Human artificial chromosomes (HACs) are gene-delivery vectors suitable for introducing large DNA fragments into mammalian cells. Although a HAC theoretically incorporates multiple gene expression cassettes of unlimited DNA size, its application has been limited because the conventional gene-loading system accepts only one gene-loading vector (GLV) into a HAC. We report a novel method for the simultaneous or sequential integration of multiple GLVs into a HAC vector (designated as the SIM system) via combined usage of Cre, FLP, Bxb1, and φC31 recombinase/integrase. As a proof of principle, we first attempted simultaneous integration of three GLVs encoding EGFP, Venus, and TdTomato into a gene-loading site of a HAC in CHO cells. These cells successfully expressed all three fluorescent proteins. Furthermore, microcell-mediated transfer of HACs enabled the expression of those fluorescent proteins in recipient cells. We next demonstrated that GLVs could be introduced into a HAC one-by-one via reciprocal usage of recombinase/integrase. Lastly, we introduced a fourth GLV into a HAC after simultaneous integration of three GLVs by FLP-mediated DNA recombination. The SIM system expands the applicability of HAC vectors and is useful for various biomedical studies, including cell reprogramming.

  13. Insights into natural products biosynthesis from analysis of 490 polyketide synthases from Fusarium.

    PubMed

    Brown, Daren W; Proctor, Robert H

    2016-04-01

    Species of the fungus Fusarium collectively cause disease on almost all crop plants and produce numerous natural products (NPs), including some of the mycotoxins of greatest concern to agriculture. Many Fusarium NPs are derived from polyketide synthases (PKSs), large multi-domain enzymes that catalyze sequential condensation of simple carboxylic acids to form polyketides. To gain insight into the biosynthesis of polyketide-derived NPs in Fusarium, we retrieved 488 PKS gene sequences from genome sequences of 31 species of the fungus. In addition to these apparently functional PKS genes, the genomes collectively included 81 pseudogenized PKS genes. Phylogenetic analysis resolved the PKS genes into 67 clades, and based on multiple lines of evidence, we propose that homologs in each clade are responsible for synthesis of a polyketide that is distinct from those synthesized by PKSs in other clades. The presence and absence of PKS genes among the species examined indicated marked differences in distribution of PKS homologs. Comparisons of Fusarium PKS genes and genes flanking them to those from other Ascomycetes provided evidence that Fusarium has the genetic potential to synthesize multiple NPs that are the same or similar to those reported in other fungi, but that have not yet been reported in Fusarium. The results also highlight ways in which such analyses can help guide identification of novel Fusarium NPs and differences in NP biosynthetic capabilities that exist among fungi. Published by Elsevier Inc.

  14. Simultaneous Identification of Multiple Driver Pathways in Cancer

    PubMed Central

    Leiserson, Mark D. M.; Blokh, Dima

    2013-01-01

    Distinguishing the somatic mutations responsible for cancer (driver mutations) from random, passenger mutations is a key challenge in cancer genomics. Driver mutations generally target cellular signaling and regulatory pathways consisting of multiple genes. This heterogeneity complicates the identification of driver mutations by their recurrence across samples, as different combinations of mutations in driver pathways are observed in different samples. We introduce the Multi-Dendrix algorithm for the simultaneous identification of multiple driver pathways de novo in somatic mutation data from a cohort of cancer samples. The algorithm relies on two combinatorial properties of mutations in a driver pathway: high coverage and mutual exclusivity. We derive an integer linear program that finds set of mutations exhibiting these properties. We apply Multi-Dendrix to somatic mutations from glioblastoma, breast cancer, and lung cancer samples. Multi-Dendrix identifies sets of mutations in genes that overlap with known pathways – including Rb, p53, PI(3)K, and cell cycle pathways – and also novel sets of mutually exclusive mutations, including mutations in several transcription factors or other genes involved in transcriptional regulation. These sets are discovered directly from mutation data with no prior knowledge of pathways or gene interactions. We show that Multi-Dendrix outperforms other algorithms for identifying combinations of mutations and is also orders of magnitude faster on genome-scale data. Software available at: http://compbio.cs.brown.edu/software. PMID:23717195

  15. Identification of diverse nerve growth factor-regulated genes by serial analysis of gene expression (SAGE) profiling

    PubMed Central

    Angelastro, James M.; Klimaschewski, Lars; Tang, Song; Vitolo, Ottavio V.; Weissman, Tamily A.; Donlin, Laura T.; Shelanski, Michael L.; Greene, Lloyd A.

    2000-01-01

    Neurotrophic factors such as nerve growth factor (NGF) promote a wide variety of responses in neurons, including differentiation, survival, plasticity, and repair. Such actions often require changes in gene expression. To identify the regulated genes and thereby to more fully understand the NGF mechanism, we carried out serial analysis of gene expression (SAGE) profiling of transcripts derived from rat PC12 cells before and after NGF-promoted neuronal differentiation. Multiple criteria supported the reliability of the profile. Approximately 157,000 SAGE tags were analyzed, representing at least 21,000 unique transcripts. Of these, nearly 800 were regulated by 6-fold or more in response to NGF. Approximately 150 of the regulated transcripts have been matched to named genes, the majority of which were not previously known to be NGF-responsive. Functional categorization of the regulated genes provides insight into the complex, integrated mechanism by which NGF promotes its multiple actions. It is anticipated that as genomic sequence information accrues the data derived here will continue to provide information about neurotrophic factor mechanisms. PMID:10984536

  16. Horizontal acquisition of multiple mitochondrial genes from a parasitic plant followed by gene conversion with host mitochondrial genes

    PubMed Central

    2010-01-01

    Background Horizontal gene transfer (HGT) is relatively common in plant mitochondrial genomes but the mechanisms, extent and consequences of transfer remain largely unknown. Previous results indicate that parasitic plants are often involved as either transfer donors or recipients, suggesting that direct contact between parasite and host facilitates genetic transfer among plants. Results In order to uncover the mechanistic details of plant-to-plant HGT, the extent and evolutionary fate of transfer was investigated between two groups: the parasitic genus Cuscuta and a small clade of Plantago species. A broad polymerase chain reaction (PCR) survey of mitochondrial genes revealed that at least three genes (atp1, atp6 and matR) were recently transferred from Cuscuta to Plantago. Quantitative PCR assays show that these three genes have a mitochondrial location in the one species line of Plantago examined. Patterns of sequence evolution suggest that these foreign genes degraded into pseudogenes shortly after transfer and reverse transcription (RT)-PCR analyses demonstrate that none are detectably transcribed. Three cases of gene conversion were detected between native and foreign copies of the atp1 gene. The identical phylogenetic distribution of the three foreign genes within Plantago and the retention of cytidines at ancestral positions of RNA editing indicate that these genes were probably acquired via a single, DNA-mediated transfer event. However, samplings of multiple individuals from two of the three species in the recipient Plantago clade revealed complex and perplexing phylogenetic discrepancies and patterns of sequence divergence for all three of the foreign genes. Conclusions This study reports the best evidence to date that multiple mitochondrial genes can be transferred via a single HGT event and that transfer occurred via a strictly DNA-level intermediate. The discovery of gene conversion between co-resident foreign and native mitochondrial copies suggests that transferred genes may be evolutionarily important in generating mitochondrial genetic diversity. Finally, the complex relationships within each lineage of transferred genes imply a surprisingly complicated history of these genes in Plantago subsequent to their acquisition via HGT and this history probably involves some combination of additional transfers (including intracellular transfer), gene duplication, differential loss and mutation-rate variation. Unravelling this history will probably require sequencing multiple mitochondrial and nuclear genomes from Plantago. See Commentary: http://www.biomedcentral.com/1741-7007/8/147. PMID:21176201

  17. Isolation and characterization of multiple F-box genes linked to the S9- and S10-RNase in apple (Malus × domestica Borkh.).

    PubMed

    Okada, Kazuma; Moriya, Shigeki; Haji, Takashi; Abe, Kazuyuki

    2013-06-01

    Using 11 consensus primer pairs designed from S-linked F-box genes of apple and Japanese pear, 10 new F-box genes (MdFBX21 to 30) were isolated from the apple cultivar 'Spartan' (S(9)S(10)). MdFBX21 to 23 and MdFBX24 to 30 were completely linked to the S(9) -RNase and S(10-)RNase, respectively, and showed pollen-specific expression and S-haplotype-specific polymorphisms. Therefore, these 10 F-box genes are good candidates for the pollen determinant of self-incompatibility in apple. Phylogenetic analysis and comparison of deduced amino acid sequences of MdFBX21 to 30 with those of 25 S-linked F-box genes previously isolated from apple showed that a deduced amino acid identity of greater than 88.0 % can be used as the tentative criterion to classify F-box genes into one type. Using this criterion, 31 of 35 F-box genes of apple were classified into 11 types (SFBB1-11). All types included F-box genes derived from S(3-) and S(9-)haplotypes, and seven types included F-box genes derived from S(3-), S(9-), and S(10-)haplotypes. Moreover, comparison of nucleotide sequences of S-RNases and multiple F-box genes among S(3-), S(9-), and S(10-)haplotypes suggested that F-box genes within each type showed high nucleotide identity regardless of the identity of the S-RNase. The large number of F-box genes as candidates for the pollen determinant and the high degree of conservation within each type are consistent with the collaborative non-self-recognition model reported for Petunia. These findings support that the collaborative non-self-recognition system also exists in apple.

  18. Microarray profiling analysis uncovers common molecular mechanisms of rubella virus, human cytomegalovirus, and herpes simplex virus type 2 infections in ECV304 cells.

    PubMed

    Mo, X; Xu, L; Yang, Q; Feng, H; Peng, J; Zhang, Y; Yuan, W; Wang, Y; Li, Y; Deng, Y; Wan, Y; Chen, Z; Li, F; Wu, X

    2011-08-01

    To study the common molecular mechanisms of various viruses infections that might result in congential cardiovascular diseases in perinatal period, changes in mRNA expression levels of ECV304 cells infected by rubella virus (RUBV), human cytomegalovirus (HCMV), and herpes simplex virus type 2 (HSV-2) were analyzed using a microarray system representing 18,716 human genes. 99 genes were found to exhibit differential expression (80 up-regulated and 19 down-regulated). Biological process analysis showed that 33 signaling pathways including 22 genes were relevant significantly to RV, HCMV and HSV-II infections. Of these 33 biological processes, 28 belong to one-gene biological processes and 5 belong to multiple-gene biological processes. Gene annotation indicated that the 5 multiple-gene biological processes including regulation of cell growth, collagen fibril organization, mRNA transport, cell adhesion and regulation of cell shape, and seven down- or up-regulated genes [CRIM1 (cysteine rich transmembrane BMP regulator 1), WISP2 (WNT1 inducible signaling pathway protein 2), COL12A1 (collagen, type XII, alpha 1), COL11A2 (collagen, type XI, alpha 2), CNTN5 (contactin 5), DDR1 (discoidin domain receptor tyrosine kinase 1), VEGF (vascular endothelial growth factor precursor)], are significantly correlated to RUBV, HCMV and HSV-2 infections in ECV304 cells. The results obtained in this study suggested the common molecular mechanisms of viruses infections that might result in congential cardiovascular diseases.

  19. Genome Wide Analysis of the Apple MYB Transcription Factor Family Allows the Identification of MdoMYB121 Gene Confering Abiotic Stress Tolerance in Plants

    PubMed Central

    Wang, Rong-Kai; Zhang, Rui-Fen; Hao, Yu-Jin

    2013-01-01

    The MYB proteins comprise one of the largest families of transcription factors (TFs) in plants. Although several MYB genes have been characterized to play roles in secondary metabolism, the MYB family has not yet been identified in apple. In this study, 229 apple MYB genes were identified through a genome-wide analysis and divided into 45 subgroups. A computational analysis was conducted using the apple genomic database to yield a complete overview of the MYB family, including the intron-exon organizations, the sequence features of the MYB DNA-binding domains, the carboxy-terminal motifs, and the chromosomal locations. Subsequently, the expression of 18 MYB genes, including 12 were chosen from stress-related subgroups, while another 6 ones from other subgroups, in response to various abiotic stresses was examined. It was found that several of these MYB genes, particularly MdoMYB121, were induced by multiple stresses. The MdoMYB121 was then further functionally characterized. Its predicted protein was found to be localized in the nucleus. A transgenic analysis indicated that the overexpression of the MdoMYB121 gene remarkably enhanced the tolerance to high salinity, drought, and cold stresses in transgenic tomato and apple plants. Our results indicate that the MYB genes are highly conserved in plant species and that MdoMYB121 can be used as a target gene in genetic engineering approaches to improve the tolerance of plants to multiple abiotic stresses. PMID:23950843

  20. Identification of Single- and Multiple-Class Specific Signature Genes from Gene Expression Profiles by Group Marker Index

    PubMed Central

    Tsai, Yu-Shuen; Aguan, Kripamoy; Pal, Nikhil R.; Chung, I-Fang

    2011-01-01

    Informative genes from microarray data can be used to construct prediction model and investigate biological mechanisms. Differentially expressed genes, the main targets of most gene selection methods, can be classified as single- and multiple-class specific signature genes. Here, we present a novel gene selection algorithm based on a Group Marker Index (GMI), which is intuitive, of low-computational complexity, and efficient in identification of both types of genes. Most gene selection methods identify only single-class specific signature genes and cannot identify multiple-class specific signature genes easily. Our algorithm can detect de novo certain conditions of multiple-class specificity of a gene and makes use of a novel non-parametric indicator to assess the discrimination ability between classes. Our method is effective even when the sample size is small as well as when the class sizes are significantly different. To compare the effectiveness and robustness we formulate an intuitive template-based method and use four well-known datasets. We demonstrate that our algorithm outperforms the template-based method in difficult cases with unbalanced distribution. Moreover, the multiple-class specific genes are good biomarkers and play important roles in biological pathways. Our literature survey supports that the proposed method identifies unique multiple-class specific marker genes (not reported earlier to be related to cancer) in the Central Nervous System data. It also discovers unique biomarkers indicating the intrinsic difference between subtypes of lung cancer. We also associate the pathway information with the multiple-class specific signature genes and cross-reference to published studies. We find that the identified genes participate in the pathways directly involved in cancer development in leukemia data. Our method gives a promising way to find genes that can involve in pathways of multiple diseases and hence opens up the possibility of using an existing drug on other diseases as well as designing a single drug for multiple diseases. PMID:21909426

  1. Novel genomic rearrangements mediated by multiple genetic elements in Streptococcus pyogenes M23ND confer potential for evolutionary persistence

    PubMed Central

    Bao, Yun-Juan; Liang, Zhong; Mayfield, Jeffrey A.; McShan, William M.; Lee, Shaun W.; Ploplis, Victoria A.; Castellino, Francis J.

    2016-01-01

    Symmetric genomic rearrangements around replication axes in genomes are commonly observed in prokaryotic genomes, including Group A Streptococcus (GAS). However, asymmetric rearrangements are rare. Our previous studies showed that the hypervirulent invasive GAS strain, M23ND, containing an inactivated transcriptional regulator system, covRS, exhibits unique extensive asymmetric rearrangements, which reconstructed a genomic structure distinct from other GAS genomes. In the current investigation, we identified the rearrangement events and examined the genetic consequences and evolutionary implications underlying the rearrangements. By comparison with a close phylogenetic relative, M18-MGAS8232, we propose a molecular model wherein a series of asymmetric rearrangements have occurred in M23ND, involving translocations, inversions and integrations mediated by multiple factors, viz., rRNA-comX (factor for late competence), transposons and phage-encoded gene segments. Assessments of the cumulative gene orientations and GC skews reveal that the asymmetric genomic rearrangements did not affect the general genomic integrity of the organism. However, functional distributions reveal re-clustering of a broad set of CovRS-regulated actively transcribed genes, including virulence factors and metabolic genes, to the same leading strand, with high confidence (p-value ~10−10). The re-clustering of the genes suggests a potential selection advantage for the spatial proximity to the transcription complexes, which may contain the global transcriptional regulator, CovRS, and other RNA polymerases. Their proximities allow for efficient transcription of the genes required for growth, virulence and persistence. A new paradigm of survival strategies of GAS strains is provided through multiple genomic rearrangements, while, at the same time, maintaining genomic integrity. PMID:27329479

  2. Transcriptional Changes in Canine Distemper Virus-Induced Demyelinating Leukoencephalitis Favor a Biphasic Mode of Demyelination

    PubMed Central

    Ulrich, Reiner; Puff, Christina; Wewetzer, Konstantin; Kalkuhl, Arno; Deschl, Ulrich; Baumgärtner, Wolfgang

    2014-01-01

    Canine distemper virus (CDV)-induced demyelinating leukoencephalitis in dogs (Canis familiaris) is suggested to represent a naturally occurring translational model for subacute sclerosing panencephalitis and multiple sclerosis in humans. The aim of this study was a hypothesis-free microarray analysis of the transcriptional changes within cerebellar specimens of five cases of acute, six cases of subacute demyelinating, and three cases of chronic demyelinating and inflammatory CDV leukoencephalitis as compared to twelve non-infected control dogs. Frozen cerebellar specimens were used for analysis of histopathological changes including demyelination, transcriptional changes employing microarrays, and presence of CDV nucleoprotein RNA and protein using microarrays, RT-qPCR and immunohistochemistry. Microarray analysis revealed 780 differentially expressed probe sets. The dominating change was an up-regulation of genes related to the innate and the humoral immune response, and less distinct the cytotoxic T-cell-mediated immune response in all subtypes of CDV leukoencephalitis as compared to controls. Multiple myelin genes including myelin basic protein and proteolipid protein displayed a selective down-regulation in subacute CDV leukoencephalitis, suggestive of an oligodendrocyte dystrophy. In contrast, a marked up-regulation of multiple immunoglobulin-like expressed sequence tags and the delta polypeptide of the CD3 antigen was observed in chronic CDV leukoencephalitis, in agreement with the hypothesis of an immune-mediated demyelination in the late inflammatory phase of the disease. Analysis of pathways intimately linked to demyelination as determined by morphometry employing correlation-based Gene Set Enrichment Analysis highlighted the pathomechanistic importance of up-regulated genes comprised by the gene ontology terms “viral replication” and “humoral immune response” as well as down-regulated genes functionally related to “metabolite and energy generation”. PMID:24755553

  3. Transcriptional changes in canine distemper virus-induced demyelinating leukoencephalitis favor a biphasic mode of demyelination.

    PubMed

    Ulrich, Reiner; Puff, Christina; Wewetzer, Konstantin; Kalkuhl, Arno; Deschl, Ulrich; Baumgärtner, Wolfgang

    2014-01-01

    Canine distemper virus (CDV)-induced demyelinating leukoencephalitis in dogs (Canis familiaris) is suggested to represent a naturally occurring translational model for subacute sclerosing panencephalitis and multiple sclerosis in humans. The aim of this study was a hypothesis-free microarray analysis of the transcriptional changes within cerebellar specimens of five cases of acute, six cases of subacute demyelinating, and three cases of chronic demyelinating and inflammatory CDV leukoencephalitis as compared to twelve non-infected control dogs. Frozen cerebellar specimens were used for analysis of histopathological changes including demyelination, transcriptional changes employing microarrays, and presence of CDV nucleoprotein RNA and protein using microarrays, RT-qPCR and immunohistochemistry. Microarray analysis revealed 780 differentially expressed probe sets. The dominating change was an up-regulation of genes related to the innate and the humoral immune response, and less distinct the cytotoxic T-cell-mediated immune response in all subtypes of CDV leukoencephalitis as compared to controls. Multiple myelin genes including myelin basic protein and proteolipid protein displayed a selective down-regulation in subacute CDV leukoencephalitis, suggestive of an oligodendrocyte dystrophy. In contrast, a marked up-regulation of multiple immunoglobulin-like expressed sequence tags and the delta polypeptide of the CD3 antigen was observed in chronic CDV leukoencephalitis, in agreement with the hypothesis of an immune-mediated demyelination in the late inflammatory phase of the disease. Analysis of pathways intimately linked to demyelination as determined by morphometry employing correlation-based Gene Set Enrichment Analysis highlighted the pathomechanistic importance of up-regulated genes comprised by the gene ontology terms "viral replication" and "humoral immune response" as well as down-regulated genes functionally related to "metabolite and energy generation".

  4. Alteration of Multiple Leukocyte Gene Expression Networks is Linked with Magnetic Resonance Markers of Prognosis After Acute ST-Elevation Myocardial Infarction.

    PubMed

    Teren, A; Kirsten, H; Beutner, F; Scholz, M; Holdt, L M; Teupser, D; Gutberlet, M; Thiery, J; Schuler, G; Eitel, I

    2017-02-03

    Prognostic relevant pathways of leukocyte involvement in human myocardial ischemic-reperfusion injury are largely unknown. We enrolled 136 patients with ST-elevation myocardial infarction (STEMI) after primary angioplasty within 12 h after onset of symptoms. Following reperfusion, whole blood was collected within a median time interval of 20 h (interquartile range: 15-25 h) for genome-wide gene expression analysis. Subsequent CMR scans were performed using a standard protocol to determine infarct size (IS), area at risk (AAR), myocardial salvage index (MSI) and the extent of late microvascular obstruction (lateMO). We found 398 genes associated with lateMO and two genes with IS. Neither AAR, nor MSI showed significant correlations with gene expression. Genes correlating with lateMO were strongly related to several canonical pathways, including positive regulation of T-cell activation (p = 3.44 × 10 -5 ), and regulation of inflammatory response (p = 1.86 × 10 -3 ). Network analysis of multiple gene expression alterations associated with larger lateMO identified the following functional consequences: facilitated utilisation and decreased concentration of free fatty acid, repressed cell differentiation, enhanced phagocyte movement, increased cell death, vascular disease and compensatory vasculogenesis. In conclusion, the extent of lateMO after acute, reperfused STEMI correlated with altered activation of multiple genes related to fatty acid utilisation, lymphocyte differentiation, phagocyte mobilisation, cell survival, and vascular dysfunction.

  5. Status of Therapeutic Gene Transfer to Treat Cardiovascular Disease in Dogs and Cats.

    PubMed

    Sleeper, Meg M

    2017-09-01

    Gene therapy is a procedure resulting in the transfer of a gene into an individual's cells to treat a disease. One goal of gene transfer is to express a functional gene when the endogenous gene is inactive. However, because heart failure is a complex disease characterized by multiple abnormalities at the cellular level, an alternate gene delivery approach is to alter myocardial protein levels to improve function. This article discusses background information on gene delivery, including packaging, administration, and a brief discussion of some of the candidate transgenes likely to alter the progression of naturally occurring heart disease in dogs and cats. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Developing tools for investigating the multiple roles of ethylene: Identification and mapping genes for ethylene biosynthesis and reception in barley

    USDA-ARS?s Scientific Manuscript database

    The plant hormone ethylene is important to many plant processes from germination through senescence, including responses to in vitro growth and plant regeneration. Knowledge of the number of genes, and of their function, that are involved in ethylene biosynthesis and reception is necessary to determ...

  7. Genome Sequence of Klebsiella pneumoniae KpQ3, a DHA-1 β-Lactamase-Producing Nosocomial Isolate

    PubMed Central

    Tobes, Raquel; Codoñer, Francisco M.; López-Camacho, Elena; Salanueva, Iñigo J.; Manrique, Marina; Brozynska, Marta; Gómez-Gil, Rosa; Martínez-Blanch, Juan F.; Álvarez-Tejado, Miguel; Pareja, Eduardo

    2013-01-01

    Klebsiella pneumoniae KpQ3 is a multidrug-resistant isolate obtained from a blood culture of a patient in a burn unit in the Hospital Universitario La Paz (Madrid, Spain) in 2008. The genome contains multiple antibiotic resistance genes, including a plasmid-mediated DHA-1 cephalosporinase gene. PMID:23469341

  8. Computational Analysis of Candidate Disease Genes and Variants for Salt-Sensitive Hypertension in Indigenous Southern Africans

    PubMed Central

    Tiffin, Nicki; Meintjes, Ayton; Ramesar, Rajkumar; Bajic, Vladimir B.; Rayner, Brian

    2010-01-01

    Multiple factors underlie susceptibility to essential hypertension, including a significant genetic and ethnic component, and environmental effects. Blood pressure response of hypertensive individuals to salt is heterogeneous, but salt sensitivity appears more prevalent in people of indigenous African origin. The underlying genetics of salt-sensitive hypertension, however, are poorly understood. In this study, computational methods including text- and data-mining have been used to select and prioritize candidate aetiological genes for salt-sensitive hypertension. Additionally, we have compared allele frequencies and copy number variation for single nucleotide polymorphisms in candidate genes between indigenous Southern African and Caucasian populations, with the aim of identifying candidate genes with significant variability between the population groups: identifying genetic variability between population groups can exploit ethnic differences in disease prevalence to aid with prioritisation of good candidate genes. Our top-ranking candidate genes include parathyroid hormone precursor (PTH) and type-1angiotensin II receptor (AGTR1). We propose that the candidate genes identified in this study warrant further investigation as potential aetiological genes for salt-sensitive hypertension. PMID:20886000

  9. Association of a novel point mutation in MSH2 gene with familial multiple primary cancers.

    PubMed

    Hu, Hai; Li, Hong; Jiao, Feng; Han, Ting; Zhuo, Meng; Cui, Jiujie; Li, Yixue; Wang, Liwei

    2017-10-03

    Multiple primary cancers (MPC) have been identified as two or more cancers without any subordinate relationship that occur either simultaneously or metachronously in the same or different organs of an individual. Lynch syndrome is an autosomal dominant genetic disorder that increases the risk of many types of cancers. Lynch syndrome patients who suffer more than two cancers can also be considered as MPC; patients of this kind provide unique resources to learn how genetic mutation causes MPC in different tissues. We performed a whole genome sequencing on blood cells and two tumor samples of a Lynch syndrome patient who was diagnosed with five primary cancers. The mutational landscape of the tumors, including somatic point mutations and copy number alternations, was characterized. We also compared Lynch syndrome with sporadic cancers and proposed a model to illustrate the mutational process by which Lynch syndrome progresses to MPC. We revealed a novel pathologic mutation on the MSH2 gene (G504 splicing) that associates with Lynch syndrome. Systematical comparison of the mutation landscape revealed that multiple cancers in the proband were evolutionarily independent. Integrative analysis showed that truncating mutations of DNA mismatch repair (MMR) genes were significantly enriched in the patient. A mutation progress model that included germline mutations of MMR genes, double hits of MMR system, mutations in tissue-specific driver genes, and rapid accumulation of additional passenger mutations was proposed to illustrate how MPC occurs in Lynch syndrome patients. Our findings demonstrate that both germline and somatic alterations are driving forces of carcinogenesis, which may resolve the carcinogenic theory of Lynch syndrome.

  10. Frequent mutation of histone-modifying genes in non-Hodgkin lymphoma | Office of Cancer Genomics

    Cancer.gov

    In a recent Nature article, Morin et al. uncovered a novel role for chromatin modification in driving the progression of two non-Hodgkin lymphomas (NHLs), follicular lymphoma and diffuse large B-cell lymphoma. Through DNA and RNA sequencing of 117 tumor samples and 10 assorted cell lines, the authors identified and validated 109 genes with multiple mutations in these B-cell NHLs. Of the 109 genes, several genes not previously linked to lymphoma demonstrated positive selection for mutation including two genes involved in histone modification, MLL2 and MEF2B.

  11. Mutations of the Birt–Hogg–Dubé gene in patients with multiple lung cysts and recurrent pneumothorax

    PubMed Central

    Gunji, Yoko; Akiyoshi, Taeko; Sato, Teruhiko; Kurihara, Masatoshi; Tominaga, Shigeru; Takahashi, Kazuhisa; Seyama, Kuniaki

    2007-01-01

    Rationale Birt–Hogg–Dubé (BHD) syndrome, a rare inherited autosomal genodermatosis first recognised in 1977, is characterised by fibrofolliculomas of the skin, an increased risk of renal tumours and multiple lung cysts with spontaneous pneumothorax. The BHD gene, a tumour suppressor gene located at chromosome 17p11.2, has recently been shown to be defective. Recent genetic studies revealed that clinical pictures of the disease may be variable and may not always present the full expression of the phenotypes. Objectives We hypothesised that mutations of the BHD gene are responsible for patients who have multiple lung cysts of which the underlying causes have not yet been elucidated. Methods We studied eight patients with lung cysts, without skin and renal disease; seven of these patients have a history of spontaneous pneumothorax and five have a family history of pneumothorax. The BHD gene was examined using PCR, denaturing high‐performance liquid chromatography and direct sequencing. Main results We found that five of the eight patients had a BHD germline mutation. All mutations were unique and four of them were novel, including three different deletions or insertions detected in exons 6, 12 and 13, respectively and one splice acceptor site mutation in intron 5 resulting in an in‐frame deletion of exon 6. Conclusions We found that germline mutations of the BHD gene are involved in some patients with multiple lung cysts and pneumothorax. Pulmonologists should be aware that BHD syndrome can occur as an isolated phenotype with pulmonary involvement. PMID:17496196

  12. Hybrid coexpression link similarity graph clustering for mining biological modules from multiple gene expression datasets

    PubMed Central

    2014-01-01

    Background Advances in genomic technologies have enabled the accumulation of vast amount of genomic data, including gene expression data for multiple species under various biological and environmental conditions. Integration of these gene expression datasets is a promising strategy to alleviate the challenges of protein functional annotation and biological module discovery based on a single gene expression data, which suffers from spurious coexpression. Results We propose a joint mining algorithm that constructs a weighted hybrid similarity graph whose nodes are the coexpression links. The weight of an edge between two coexpression links in this hybrid graph is a linear combination of the topological similarities and co-appearance similarities of the corresponding two coexpression links. Clustering the weighted hybrid similarity graph yields recurrent coexpression link clusters (modules). Experimental results on Human gene expression datasets show that the reported modules are functionally homogeneous as evident by their enrichment with biological process GO terms and KEGG pathways. PMID:25221624

  13. Combinatorial Screening for Transgenic Yeasts with High Cellulase Activities in Combination with a Tunable Expression System

    PubMed Central

    Ito, Yoichiro; Yamanishi, Mamoru; Ikeuchi, Akinori; Imamura, Chie; Matsuyama, Takashi

    2015-01-01

    Combinatorial screening used together with a broad library of gene expression cassettes is expected to produce a powerful tool for the optimization of the simultaneous expression of multiple enzymes. Recently, we proposed a highly tunable protein expression system that utilized multiple genome-integrated target genes to fine-tune enzyme expression in yeast cells. This tunable system included a library of expression cassettes each composed of three gene-expression control elements that in different combinations produced a wide range of protein expression levels. In this study, four gene expression cassettes with graded protein expression levels were applied to the expression of three cellulases: cellobiohydrolase 1, cellobiohydrolase 2, and endoglucanase 2. After combinatorial screening for transgenic yeasts simultaneously secreting these three cellulases, we obtained strains with higher cellulase expressions than a strain harboring three cellulase-expression constructs within one high-performance gene expression cassette. These results show that our method will be of broad use throughout the field of metabolic engineering. PMID:26692026

  14. Divergence of RNA polymerase α subunits in angiosperm plastid genomes is mediated by genomic rearrangement.

    PubMed

    Blazier, J Chris; Ruhlman, Tracey A; Weng, Mao-Lun; Rehman, Sumaiyah K; Sabir, Jamal S M; Jansen, Robert K

    2016-04-18

    Genes for the plastid-encoded RNA polymerase (PEP) persist in the plastid genomes of all photosynthetic angiosperms. However, three unrelated lineages (Annonaceae, Passifloraceae and Geraniaceae) have been identified with unusually divergent open reading frames (ORFs) in the conserved region of rpoA, the gene encoding the PEP α subunit. We used sequence-based approaches to evaluate whether these genes retain function. Both gene sequences and complete plastid genome sequences were assembled and analyzed from each of the three angiosperm families. Multiple lines of evidence indicated that the rpoA sequences are likely functional despite retaining as low as 30% nucleotide sequence identity with rpoA genes from outgroups in the same angiosperm order. The ratio of non-synonymous to synonymous substitutions indicated that these genes are under purifying selection, and bioinformatic prediction of conserved domains indicated that functional domains are preserved. One of the lineages (Pelargonium, Geraniaceae) contains species with multiple rpoA-like ORFs that show evidence of ongoing inter-paralog gene conversion. The plastid genomes containing these divergent rpoA genes have experienced extensive structural rearrangement, including large expansions of the inverted repeat. We propose that illegitimate recombination, not positive selection, has driven the divergence of rpoA.

  15. Genome sequence of an enhancin gene-rich nucleopolyhedrovirus (NPV) from Agrotis segetum: collinearity with Spodoptera exigua multiple NPV.

    PubMed

    Jakubowska, Agata K; Peters, Sander A; Ziemnicka, Jadwiga; Vlak, Just M; van Oers, Monique M

    2006-03-01

    The genome sequence of a Polish isolate of Agrotis segetum nucleopolyhedrovirus (AgseNPV-A) was determined and analysed. The circular genome is composed of 147,544 bp and has a G+C content of 45.7 mol%. It contains 153 putative, non-overlapping open reading frames (ORFs) encoding predicted proteins of more than 50 aa, together making up 89.8 % of the genome. The remaining 10.2 % of the DNA constitutes non-coding regions and homologous-repeat regions. One hundred and forty-three AgseNPV-A ORFs are homologues of previously reported baculovirus gene sequences. There are ten unique ORFs and they account for 3 % of the genome in total. All 62 lepidopteran baculovirus genes, including the 29 core baculovirus genes, were found in the AgseNPV-A genome. The gene content and gene order of AgseNPV-A are most similar to those of Spodoptera exigua (Se) multiple NPV and their shared homologous genes are 100 % collinear. Three putative enhancin genes were identified in the AgseNPV-A genome. In phylogenetic analysis, the AgseNPV-A enhancins form a cluster separated from enhancins of the Mamestra species NPVs.

  16. Use of whole-exome sequencing to determine the genetic basis of multiple mitochondrial respiratory chain complex deficiencies.

    PubMed

    Taylor, Robert W; Pyle, Angela; Griffin, Helen; Blakely, Emma L; Duff, Jennifer; He, Langping; Smertenko, Tania; Alston, Charlotte L; Neeve, Vivienne C; Best, Andrew; Yarham, John W; Kirschner, Janbernd; Schara, Ulrike; Talim, Beril; Topaloglu, Haluk; Baric, Ivo; Holinski-Feder, Elke; Abicht, Angela; Czermin, Birgit; Kleinle, Stephanie; Morris, Andrew A M; Vassallo, Grace; Gorman, Grainne S; Ramesh, Venkateswaran; Turnbull, Douglass M; Santibanez-Koref, Mauro; McFarland, Robert; Horvath, Rita; Chinnery, Patrick F

    2014-07-02

    Mitochondrial disorders have emerged as a common cause of inherited disease, but their diagnosis remains challenging. Multiple respiratory chain complex defects are particularly difficult to diagnose at the molecular level because of the massive number of nuclear genes potentially involved in intramitochondrial protein synthesis, with many not yet linked to human disease. To determine the molecular basis of multiple respiratory chain complex deficiencies. We studied 53 patients referred to 2 national centers in the United Kingdom and Germany between 2005 and 2012. All had biochemical evidence of multiple respiratory chain complex defects but no primary pathogenic mitochondrial DNA mutation. Whole-exome sequencing was performed using 62-Mb exome enrichment, followed by variant prioritization using bioinformatic prediction tools, variant validation by Sanger sequencing, and segregation of the variant with the disease phenotype in the family. Presumptive causal variants were identified in 28 patients (53%; 95% CI, 39%-67%) and possible causal variants were identified in 4 (8%; 95% CI, 2%-18%). Together these accounted for 32 patients (60% 95% CI, 46%-74%) and involved 18 different genes. These included recurrent mutations in RMND1, AARS2, and MTO1, each on a haplotype background consistent with a shared founder allele, and potential novel mutations in 4 possible mitochondrial disease genes (VARS2, GARS, FLAD1, and PTCD1). Distinguishing clinical features included deafness and renal involvement associated with RMND1 and cardiomyopathy with AARS2 and MTO1. However, atypical clinical features were present in some patients, including normal liver function and Leigh syndrome (subacute necrotizing encephalomyelopathy) seen in association with TRMU mutations and no cardiomyopathy with founder SCO2 mutations. It was not possible to confidently identify the underlying genetic basis in 21 patients (40%; 95% CI, 26%-54%). Exome sequencing enhances the ability to identify potential nuclear gene mutations in patients with biochemically defined defects affecting multiple mitochondrial respiratory chain complexes. Additional study is required in independent patient populations to determine the utility of this approach in comparison with traditional diagnostic methods.

  17. SEA: a super-enhancer archive.

    PubMed

    Wei, Yanjun; Zhang, Shumei; Shang, Shipeng; Zhang, Bin; Li, Song; Wang, Xinyu; Wang, Fang; Su, Jianzhong; Wu, Qiong; Liu, Hongbo; Zhang, Yan

    2016-01-04

    Super-enhancers are large clusters of transcriptional enhancers regarded as having essential roles in driving the expression of genes that control cell identity during development and tumorigenesis. The construction of a genome-wide super-enhancer database is urgently needed to better understand super-enhancer-directed gene expression regulation for a given biology process. Here, we present a specifically designed web-accessible database, Super-Enhancer Archive (SEA, http://sea.edbc.org). SEA focuses on integrating super-enhancers in multiple species and annotating their potential roles in the regulation of cell identity gene expression. The current release of SEA incorporates 83 996 super-enhancers computationally or experimentally identified in 134 cell types/tissues/diseases, including human (75 439, three of which were experimentally identified), mouse (5879, five of which were experimentally identified), Drosophila melanogaster (1774) and Caenorhabditis elegans (904). To facilitate data extraction, SEA supports multiple search options, including species, genome location, gene name, cell type/tissue and super-enhancer name. The response provides detailed (epi)genetic information, incorporating cell type specificity, nearby genes, transcriptional factor binding sites, CRISPR/Cas9 target sites, evolutionary conservation, SNPs, H3K27ac, DNA methylation, gene expression and TF ChIP-seq data. Moreover, analytical tools and a genome browser were developed for users to explore super-enhancers and their roles in defining cell identity and disease processes in depth. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. The Diagnostic Performance of Stool DNA Testing for Colorectal Cancer: A Systematic Review and Meta-Analysis.

    PubMed

    Zhai, Rong-Lin; Xu, Fei; Zhang, Pei; Zhang, Wan-Li; Wang, Hui; Wang, Ji-Liang; Cai, Kai-Lin; Long, Yue-Ping; Lu, Xiao-Ming; Tao, Kai-Xiong; Wang, Guo-Bin

    2016-02-01

    This meta-analysis was designed to evaluate the diagnostic performance of stool DNA testing for colorectal cancer (CRC) and compare the performance between single-gene and multiple-gene tests.MEDLINE, Cochrane, EMBASE databases were searched using keywords colorectal cancers, stool/fecal, sensitivity, specificity, DNA, and screening. Sensitivity analysis, quality assessments, and performance bias were performed for the included studies.Fifty-three studies were included in the analysis with a total sample size of 7524 patients. The studies were heterogeneous with regard to the genes being analyzed for fecal genetic biomarkers of CRC, as well as the laboratory methods being used for each assay. The sensitivity of the different assays ranged from 2% to 100% and the specificity ranged from 81% to 100%. The meta-analysis found that the pooled sensitivities for single- and multigene assays were 48.0% and 77.8%, respectively, while the pooled specificities were 97.0% and 92.7%. Receiver operator curves and diagnostic odds ratios showed no significant difference between both tests with regard to sensitivity or specificity.This meta-analysis revealed that using assays that evaluated multiple genes compared with single-gene assays did not increase the sensitivity or specificity of stool DNA testing in detecting CRC.

  19. Genomic and Coexpression Analyses Predict Multiple Genes Involved in Triterpene Saponin Biosynthesis in Medicago truncatula[C][W

    PubMed Central

    Naoumkina, Marina A.; Modolo, Luzia V.; Huhman, David V.; Urbanczyk-Wochniak, Ewa; Tang, Yuhong; Sumner, Lloyd W.; Dixon, Richard A.

    2010-01-01

    Saponins, an important group of bioactive plant natural products, are glycosides of triterpenoid or steroidal aglycones (sapogenins). Saponins possess many biological activities, including conferring potential health benefits for humans. However, most of the steps specific for the biosynthesis of triterpene saponins remain uncharacterized at the molecular level. Here, we use comprehensive gene expression clustering analysis to identify candidate genes involved in the elaboration, hydroxylation, and glycosylation of the triterpene skeleton in the model legume Medicago truncatula. Four candidate uridine diphosphate glycosyltransferases were expressed in Escherichia coli, one of which (UGT73F3) showed specificity for multiple sapogenins and was confirmed to glucosylate hederagenin at the C28 position. Genetic loss-of-function studies in M. truncatula confirmed the in vivo function of UGT73F3 in saponin biosynthesis. This report provides a basis for future studies to define genetically the roles of multiple cytochromes P450 and glycosyltransferases in triterpene saponin biosynthesis in Medicago. PMID:20348429

  20. Assembly and multiple gene expression of thermophilic enzymes in Escherichia coli for in vitro metabolic engineering.

    PubMed

    Ninh, Pham Huynh; Honda, Kohsuke; Sakai, Takaaki; Okano, Kenji; Ohtake, Hisao

    2015-01-01

    In vitro reconstitution of an artificial metabolic pathway is an emerging approach for the biocatalytic production of industrial chemicals. However, several enzymes have to be separately prepared (and purified) for the construction of an in vitro metabolic pathway, thereby limiting the practical applicability of this approach. In this study, genes encoding the nine thermophilic enzymes involved in a non-ATP-forming chimeric glycolytic pathway were assembled in an artificial operon and co-expressed in a single recombinant Escherichia coli strain. Gene expression levels of the thermophilic enzymes were controlled by their sequential order in the artificial operon. The specific activities of the recombinant enzymes in the cell-free extract of the multiple-gene-expression E. coli were 5.0-1,370 times higher than those in an enzyme cocktail prepared from a mixture of single-gene-expression strains, in each of which a single one of the nine thermophilic enzymes was overproduced. Heat treatment of a crude extract of the multiple-gene-expression cells led to the denaturation of indigenous proteins and one-step preparation of an in vitro synthetic pathway comprising only a limited number of thermotolerant enzymes. Coupling this in vitro pathway with other thermophilic enzymes including the H2 O-forming NADH oxidase or the malate/lactate dehydrogenase facilitated one-pot conversion of glucose to pyruvate or lactate, respectively. © 2014 Wiley Periodicals, Inc.

  1. Smoking cessation pharmacogenetics: analysis of varenicline and bupropion in placebo-controlled clinical trials.

    PubMed

    King, David P; Paciga, Sara; Pickering, Eve; Benowitz, Neal L; Bierut, Laura J; Conti, David V; Kaprio, Jaakko; Lerman, Caryn; Park, Peter W

    2012-02-01

    Despite effective therapies for smoking cessation, most smokers find quitting difficult and most successful quitters relapse. Considerable evidence supports a genetic risk for nicotine dependence; however, less is known about the pharmacogenetics of smoking cessation. In the first pharmacogenetic investigation of the efficacy of varenicline and bupropion, we examined whether genes important in the pharmacodynamics and pharmacokinetics of these drugs and nicotine predict medication efficacy and adverse events. Subjects participated in randomized, double-blind, placebo-controlled smoking cessation clinical trials, comparing varenicline, a nicotinic acetylcholine receptor (nAChR) partial agonist, with bupropion, a norepinephrine/dopamine reuptake inhibitor, and placebo. Primary analysis included 1175 smokers of European ancestry, and 785 single nucleotide polymorphisms from 24 genes, representing 254 linkage disequilibrium (LD) bins (genes included nAChR subunits, additional varenicline-specific genes, and genes involved in nicotine or bupropion metabolism). For varenicline, continuous abstinence (weeks 9-12) was associated with multiple nAChR subunit genes (including CHRNB2, CHRNA5, and CHRNA4) (OR=1.76; 95% CI: 1.23-2.52) (p<0.005); for bupropion, abstinence was associated with CYP2B6 (OR=1.78; 95% CI: 1.27-2.50) (p<0.001). Incidence of nausea was associated with several nAChR subunit genes (OR=0.50; 95% CI: 0.36-0.70) (p<0.0001) and time to relapse after quitting was associated with HTR3B (HR=1.97; 95% CI: 1.45-2.68) (p<0.0001). These data provide evidence for multiple genetic loci contributing to smoking cessation and therapeutic response. Different loci are associated with varenicline vs bupropion response, suggesting that additional research may identify clinically useful markers to guide treatment decisions.

  2. Exploring advantages/disadvantages and improvements in overcoming gene delivery barriers of amino acid modified trimethylated chitosan.

    PubMed

    Zheng, Hao; Tang, Cui; Yin, Chunhua

    2015-06-01

    Present study aimed at exploring advantages/disadvantages of amino acid modified trimethylated chitosan in conquering multiple gene delivery obstacles and thus providing comprehensive understandings for improved transfection efficiency. Arginine, cysteine, and histidine modified trimethyl chitosan were synthesized and employed to self-assemble with plasmid DNA (pDNA) to form nanocomplexes, namely TRNC, TCNC, and THNC, respectively. They were assessed by structural stability, cellular uptake, endosomal escape, release behavior, nuclear localization, and in vitro and in vivo transfection efficiencies. Besides, sodium tripolyphosphate (TPP) was added into TRNC to compromise certain disadvantageous attributes for pDNA delivery. Optimal endosomal escape ability failed to bring in satisfactory transfection efficiency of THNC due to drawbacks in structural stability, cellular uptake, pDNA liberation, and nuclear distribution. TCNC evoked the most potent gene expression owing to multiple advantages including sufficient stability, preferable uptake, efficient pDNA release, and high nucleic accumulation. Undesirable stability and insufficient pDNA release adversely affected TRNC-mediated gene transfer. However, incorporation of TPP could improve such disadvantages and consequently resulted in enhanced transfection efficiencies. Coordination of multiple contributing effects to conquer all delivery obstacles was necessitated for improved transfection efficiency, which would provide insights into rational design of gene delivery vehicles.

  3. Multifaceted Targeting of the Chromatin Mediates Gonadotropin-Releasing Hormone Effects on Gene Expression in the Gonadotrope.

    PubMed

    Melamed, Philippa; Haj, Majd; Yosefzon, Yahav; Rudnizky, Sergei; Wijeweera, Andrea; Pnueli, Lilach; Kaplan, Ariel

    2018-01-01

    Gonadotropin-releasing hormone (GnRH) stimulates the expression of multiple genes in the pituitary gonadotropes, most notably to induce synthesis of the gonadotropins, luteinizing hormone (LH), and follicle-stimulating hormone (FSH), but also to ensure the appropriate functioning of these cells at the center of the mammalian reproductive endocrine axis. Aside from the activation of gene-specific transcription factors, GnRH stimulates through its membrane-bound receptor, alterations in the chromatin that facilitate transcription of its target genes. These include changes in the histone and DNA modifications, nucleosome positioning, and chromatin packaging at the regulatory regions of each gene. The requirements for each of these events vary according to the DNA sequence which determines the basal chromatin packaging at the regulatory regions. Despite considerable progress in this field in recent years, we are only beginning to understand some of the complexities involved in the role and regulation of this chromatin structure, including new modifications, extensive cross talk, histone variants, and the actions of distal enhancers and non-coding RNAs. This short review aims to integrate the latest findings on GnRH-induced alterations in the chromatin of its target genes, which indicate multiple and diverse actions. Understanding these processes is illuminating not only in the context of the activation of these hormones during the reproductive life span but may also reveal how aberrant epigenetic regulation of these genes leads to sub-fertility.

  4. Multifaceted Targeting of the Chromatin Mediates Gonadotropin-Releasing Hormone Effects on Gene Expression in the Gonadotrope

    PubMed Central

    Melamed, Philippa; Haj, Majd; Yosefzon, Yahav; Rudnizky, Sergei; Wijeweera, Andrea; Pnueli, Lilach; Kaplan, Ariel

    2018-01-01

    Gonadotropin-releasing hormone (GnRH) stimulates the expression of multiple genes in the pituitary gonadotropes, most notably to induce synthesis of the gonadotropins, luteinizing hormone (LH), and follicle-stimulating hormone (FSH), but also to ensure the appropriate functioning of these cells at the center of the mammalian reproductive endocrine axis. Aside from the activation of gene-specific transcription factors, GnRH stimulates through its membrane-bound receptor, alterations in the chromatin that facilitate transcription of its target genes. These include changes in the histone and DNA modifications, nucleosome positioning, and chromatin packaging at the regulatory regions of each gene. The requirements for each of these events vary according to the DNA sequence which determines the basal chromatin packaging at the regulatory regions. Despite considerable progress in this field in recent years, we are only beginning to understand some of the complexities involved in the role and regulation of this chromatin structure, including new modifications, extensive cross talk, histone variants, and the actions of distal enhancers and non-coding RNAs. This short review aims to integrate the latest findings on GnRH-induced alterations in the chromatin of its target genes, which indicate multiple and diverse actions. Understanding these processes is illuminating not only in the context of the activation of these hormones during the reproductive life span but may also reveal how aberrant epigenetic regulation of these genes leads to sub-fertility. PMID:29535683

  5. Identification of aberrant gene expression associated with aberrant promoter methylation in primordial germ cells between E13 and E16 rat F3 generation vinclozolin lineage.

    PubMed

    Taguchi, Y-h

    2015-01-01

    Transgenerational epigenetics (TGE) are currently considered important in disease, but the mechanisms involved are not yet fully understood. TGE abnormalities expected to cause disease are likely to be initiated during development and to be mediated by aberrant gene expression associated with aberrant promoter methylation that is heritable between generations. However, because methylation is removed and then re-established during development, it is not easy to identify promoter methylation abnormalities by comparing normal lineages with those expected to exhibit TGE abnormalities. This study applied the recently proposed principal component analysis (PCA)-based unsupervised feature extraction to previously reported and publically available gene expression/promoter methylation profiles of rat primordial germ cells, between E13 and E16 of the F3 generation vinclozolin lineage that are expected to exhibit TGE abnormalities, to identify multiple genes that exhibited aberrant gene expression/promoter methylation during development. The biological feasibility of the identified genes were tested via enrichment analyses of various biological concepts including pathway analysis, gene ontology terms and protein-protein interactions. All validations suggested superiority of the proposed method over three conventional and popular supervised methods that employed t test, limma and significance analysis of microarrays, respectively. The identified genes were globally related to tumors, the prostate, kidney, testis and the immune system and were previously reported to be related to various diseases caused by TGE. Among the genes reported by PCA-based unsupervised feature extraction, we propose that chemokine signaling pathways and leucine rich repeat proteins are key factors that initiate transgenerational epigenetic-mediated diseases, because multiple genes included in these two categories were identified in this study.

  6. Identification of aberrant gene expression associated with aberrant promoter methylation in primordial germ cells between E13 and E16 rat F3 generation vinclozolin lineage

    PubMed Central

    2015-01-01

    Background Transgenerational epigenetics (TGE) are currently considered important in disease, but the mechanisms involved are not yet fully understood. TGE abnormalities expected to cause disease are likely to be initiated during development and to be mediated by aberrant gene expression associated with aberrant promoter methylation that is heritable between generations. However, because methylation is removed and then re-established during development, it is not easy to identify promoter methylation abnormalities by comparing normal lineages with those expected to exhibit TGE abnormalities. Methods This study applied the recently proposed principal component analysis (PCA)-based unsupervised feature extraction to previously reported and publically available gene expression/promoter methylation profiles of rat primordial germ cells, between E13 and E16 of the F3 generation vinclozolin lineage that are expected to exhibit TGE abnormalities, to identify multiple genes that exhibited aberrant gene expression/promoter methylation during development. Results The biological feasibility of the identified genes were tested via enrichment analyses of various biological concepts including pathway analysis, gene ontology terms and protein-protein interactions. All validations suggested superiority of the proposed method over three conventional and popular supervised methods that employed t test, limma and significance analysis of microarrays, respectively. The identified genes were globally related to tumors, the prostate, kidney, testis and the immune system and were previously reported to be related to various diseases caused by TGE. Conclusions Among the genes reported by PCA-based unsupervised feature extraction, we propose that chemokine signaling pathways and leucine rich repeat proteins are key factors that initiate transgenerational epigenetic-mediated diseases, because multiple genes included in these two categories were identified in this study. PMID:26677731

  7. Genetic association of impulsivity in young adults: a multivariate study

    PubMed Central

    Khadka, S; Narayanan, B; Meda, S A; Gelernter, J; Han, S; Sawyer, B; Aslanzadeh, F; Stevens, M C; Hawkins, K A; Anticevic, A; Potenza, M N; Pearlson, G D

    2014-01-01

    Impulsivity is a heritable, multifaceted construct with clinically relevant links to multiple psychopathologies. We assessed impulsivity in young adult (N~2100) participants in a longitudinal study, using self-report questionnaires and computer-based behavioral tasks. Analysis was restricted to the subset (N=426) who underwent genotyping. Multivariate association between impulsivity measures and single-nucleotide polymorphism data was implemented using parallel independent component analysis (Para-ICA). Pathways associated with multiple genes in components that correlated significantly with impulsivity phenotypes were then identified using a pathway enrichment analysis. Para-ICA revealed two significantly correlated genotype–phenotype component pairs. One impulsivity component included the reward responsiveness subscale and behavioral inhibition scale of the Behavioral-Inhibition System/Behavioral-Activation System scale, and the second impulsivity component included the non-planning subscale of the Barratt Impulsiveness Scale and the Experiential Discounting Task. Pathway analysis identified processes related to neurogenesis, nervous system signal generation/amplification, neurotransmission and immune response. We identified various genes and gene regulatory pathways associated with empirically derived impulsivity components. Our study suggests that gene networks implicated previously in brain development, neurotransmission and immune response are related to impulsive tendencies and behaviors. PMID:25268255

  8. Chondrodysplasia with multiple dislocations: comprehensive study of a series of 30 cases.

    PubMed

    Ranza, E; Huber, C; Levin, N; Baujat, G; Bole-Feysot, C; Nitschke, P; Masson, C; Alanay, Y; Al-Gazali, L; Bitoun, P; Boute, O; Campeau, P; Coubes, C; McEntagart, M; Elcioglu, N; Faivre, L; Gezdirici, A; Johnson, D; Mihci, E; Nur, B G; Perrin, L; Quelin, C; Terhal, P; Tuysuz, B; Cormier-Daire, V

    2017-06-01

    The group of chondrodysplasia with multiple dislocations includes several entities, characterized by short stature, dislocation of large joints, hand and/or vertebral anomalies. Other features, such as epiphyseal or metaphyseal changes, cleft palate, intellectual disability are also often part of the phenotype. In addition, several conditions with overlapping features are related to this group and broaden the spectrum. The majority of these disorders have been linked to pathogenic variants in genes encoding proteins implicated in the synthesis or sulfation of proteoglycans (PG). In a series of 30 patients with multiple dislocations, we have performed exome sequencing and subsequent targeted analysis of 15 genes, implicated in chondrodysplasia with multiple dislocations, and related conditions. We have identified causative pathogenic variants in 60% of patients (18/30); when a clinical diagnosis was suspected, this was molecularly confirmed in 53% of cases. Forty percent of patients remain without molecular etiology. Pathogenic variants in genes implicated in PG synthesis are of major importance in chondrodysplasia with multiple dislocations and related conditions. The combination of hand features, growth failure severity, radiological aspects of long bones and of vertebrae allowed discrimination among the different conditions. We propose key diagnostic clues to the clinician. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. Joint association of nicotinic acetylcholine receptor variants with abdominal obesity in American Indians: the Strong Heart Family Study.

    PubMed

    Zhu, Yun; Yang, Jingyun; Yeh, Fawn; Cole, Shelley A; Haack, Karin; Lee, Elisa T; Howard, Barbara V; Zhao, Jinying

    2014-01-01

    Cigarette smoke is a strong risk factor for obesity and cardiovascular disease. The effect of genetic variants involved in nicotine metabolism on obesity or body composition has not been well studied. Though many genetic variants have previously been associated with adiposity or body fat distribution, a single variant usually confers a minimal individual risk. The goal of this study is to evaluate the joint association of multiple variants involved in cigarette smoke or nicotine dependence with obesity-related phenotypes in American Indians. To achieve this goal, we genotyped 61 tagSNPs in seven genes encoding nicotine acetylcholine receptors (nAChRs) in 3,665 American Indians participating in the Strong Heart Family Study. Single SNP association with obesity-related traits was tested using family-based association, adjusting for traditional risk factors including smoking. Joint association of all SNPs in the seven nAChRs genes were examined by gene-family analysis based on weighted truncated product method (TPM). Multiple testing was controlled by false discovery rate (FDR). Results demonstrate that multiple SNPs showed weak individual association with one or more measures of obesity, but none survived correction for multiple testing. However, gene-family analysis revealed significant associations with waist circumference (p = 0.0001) and waist-to-hip ratio (p = 0.0001), but not body mass index (p = 0.20) and percent body fat (p = 0.29), indicating that genetic variants are jointly associated with abdominal, but not general, obesity among American Indians. The observed combined genetic effect is independent of cigarette smoking per se. In conclusion, multiple variants in the nAChR gene family are jointly associated with abdominal obesity in American Indians, independent of general obesity and cigarette smoking per se.

  10. Identification of novel mutational drivers reveals oncogene dependencies in multiple myeloma.

    PubMed

    Walker, Brian A; Mavrommatis, Konstantinos; Wardell, Christopher P; Ashby, T Cody; Bauer, Michael; Davies, Faith E; Rosenthal, Adam; Wang, Hongwei; Qu, Pingping; Hoering, Antje; Samur, Mehmet; Towfic, Fadi; Ortiz, Maria; Flynt, Erin; Yu, Zhinuan; Yang, Zhihong; Rozelle, Dan; Obenauer, John; Trotter, Matthew; Auclair, Daniel; Keats, Jonathan; Bolli, Niccolo; Fulciniti, Mariateresa; Szalat, Raphael; Moreau, Philippe; Durie, Brian; Stewart, A Keith; Goldschmidt, Hartmut; Raab, Marc S; Einsele, Hermann; Sonneveld, Pieter; San Miguel, Jesus; Lonial, Sagar; Jackson, Graham H; Anderson, Kenneth C; Avet-Loiseau, Herve; Munshi, Nikhil; Thakurta, Anjan; Morgan, Gareth J

    2018-06-08

    Understanding the profile of oncogene and tumor suppressor gene mutations with their interactions and impact on the prognosis of multiple myeloma (MM) can improve the definition of disease subsets and identify pathways important in disease pathobiology. Using integrated genomics of 1,273 newly diagnosed patients with multiple myeloma we identify 63 driver genes, some of which are novel including IDH1 , IDH2 , HUWE1 , KLHL6 , and PTPN11 Oncogene mutations are significantly more clonal than tumor suppressor mutations, indicating they may exert a bigger selective pressure. Patients with more mutations in driver genes are associated with a worse outcome, as are those with identified mechanisms of genomic instability. Oncogenic dependencies were identified between mutations in driver genes, common regions of copy number change, and primary translocation and hyperdiploidy events. These dependencies included associations with t(4;14) and mutations in FGFR3 , DIS3 and PRKD2 ; t(11;14) with mutations in CCND1 and IRF4 ; t(14;16) with mutations in MAF , BRAF , DIS3 and ATM ; and hyperdiploidy with gain 11q, mutations in FAM46C and MYC rearrangements. These associations indicate that the genomic landscape of myeloma is pre-determined by the primary events upon which further dependencies are built, giving rise to a non-random accumulation of genetic hits. Understanding these dependencies may elucidate potential evolutionary patterns and lead to better treatment regimens. Copyright © 2018 American Society of Hematology.

  11. Multiple advanced logic gates made of DNA-Ag nanocluster and the application for intelligent detection of pathogenic bacterial genes.

    PubMed

    Lin, Xiaodong; Liu, Yaqing; Deng, Jiankang; Lyu, Yanlong; Qian, Pengcheng; Li, Yunfei; Wang, Shuo

    2018-02-21

    The integration of multiple DNA logic gates on a universal platform to implement advance logic functions is a critical challenge for DNA computing. Herein, a straightforward and powerful strategy in which a guanine-rich DNA sequence lighting up a silver nanocluster and fluorophore was developed to construct a library of logic gates on a simple DNA-templated silver nanoclusters (DNA-AgNCs) platform. This library included basic logic gates, YES, AND, OR, INHIBIT, and XOR, which were further integrated into complex logic circuits to implement diverse advanced arithmetic/non-arithmetic functions including half-adder, half-subtractor, multiplexer, and demultiplexer. Under UV irradiation, all the logic functions could be instantly visualized, confirming an excellent repeatability. The logic operations were entirely based on DNA hybridization in an enzyme-free and label-free condition, avoiding waste accumulation and reducing cost consumption. Interestingly, a DNA-AgNCs-based multiplexer was, for the first time, used as an intelligent biosensor to identify pathogenic genes, E. coli and S. aureus genes, with a high sensitivity. The investigation provides a prototype for the wireless integration of multiple devices on even the simplest single-strand DNA platform to perform diverse complex functions in a straightforward and cost-effective way.

  12. Novel genomic findings in multiple myeloma identified through routine diagnostic sequencing.

    PubMed

    Ryland, Georgina L; Jones, Kate; Chin, Melody; Markham, John; Aydogan, Elle; Kankanige, Yamuna; Caruso, Marisa; Guinto, Jerick; Dickinson, Michael; Prince, H Miles; Yong, Kwee; Blombery, Piers

    2018-05-14

    Multiple myeloma is a genomically complex haematological malignancy with many genomic alterations recognised as important in diagnosis, prognosis and therapeutic decision making. Here, we provide a summary of genomic findings identified through routine diagnostic next-generation sequencing at our centre. A cohort of 86 patients with multiple myeloma underwent diagnostic sequencing using a custom hybridisation-based panel targeting 104 genes. Sequence variants, genome-wide copy number changes and structural rearrangements were detected using an inhouse-developed bioinformatics pipeline. At least one mutation was found in 69 (80%) patients. Frequently mutated genes included TP53 (36%), KRAS (22.1%), NRAS (15.1%), FAM46C/DIS3 (8.1%) and TET2/FGFR3 (5.8%), including multiple mutations not previously described in myeloma. Importantly we observed TP53 mutations in the absence of a 17 p deletion in 8% of the cohort, highlighting the need for sequencing-based assessment in addition to cytogenetics to identify these high-risk patients. Multiple novel copy number changes and immunoglobulin heavy chain translocations are also discussed. Our results demonstrate that many clinically relevant genomic findings remain in multiple myeloma which have not yet been identified through large-scale sequencing efforts, and provide important mechanistic insights into plasma cell pathobiology. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  13. GeneNetFinder2: Improved Inference of Dynamic Gene Regulatory Relations with Multiple Regulators.

    PubMed

    Han, Kyungsook; Lee, Jeonghoon

    2016-01-01

    A gene involved in complex regulatory interactions may have multiple regulators since gene expression in such interactions is often controlled by more than one gene. Another thing that makes gene regulatory interactions complicated is that regulatory interactions are not static, but change over time during the cell cycle. Most research so far has focused on identifying gene regulatory relations between individual genes in a particular stage of the cell cycle. In this study we developed a method for identifying dynamic gene regulations of several types from the time-series gene expression data. The method can find gene regulations with multiple regulators that work in combination or individually as well as those with single regulators. The method has been implemented as the second version of GeneNetFinder (hereafter called GeneNetFinder2) and tested on several gene expression datasets. Experimental results with gene expression data revealed the existence of genes that are not regulated by individual genes but rather by a combination of several genes. Such gene regulatory relations cannot be found by conventional methods. Our method finds such regulatory relations as well as those with multiple, independent regulators or single regulators, and represents gene regulatory relations as a dynamic network in which different gene regulatory relations are shown in different stages of the cell cycle. GeneNetFinder2 is available at http://bclab.inha.ac.kr/GeneNetFinder and will be useful for modeling dynamic gene regulations with multiple regulators.

  14. Hypothesis: neoplasms in myotonic dystrophy

    PubMed Central

    Hilbert, James E.; Martens, William; Thornton, Charles A.; Moxley, Richard T.; Greene, Mark H.

    2011-01-01

    Tumorigenesis is a multi-step process due to an accumulation of genetic mutations in multiple genes in diverse pathways which ultimately lead to loss of control over cell growth. It is well known that inheritance of rare germline mutations in genes involved in tumorigenesis pathways confer high lifetime risk of neoplasia in affected individuals. Furthermore, a substantial number of multiple malformation syndromes include cancer susceptibility in their phenotype. Studies of the mechanisms underlying these inherited syndromes have added to the understanding of both normal development and the pathophysiology of carcinogenesis. Myotonic dystrophy (DM) represents a group of autosomal dominant, multisystemic diseases that share the clinical features of myotonia, muscle weakness, and early-onset cataracts. Myotonic dystrophy type 1 (DM1) and myotonic dystrophy type 2 (DM2) result from unstable nucleotide repeat expansions in their respective genes. There have been multiple reports of tumors in individuals with DM, most commonly benign calcifying cutaneous tumors known as pilomatricomas. We provide a summary of the tumors reported in DM and a hypothesis for a possible mechanism of tumorigenesis. We hope to stimulate further study into the potential role of DM genes in tumorigenesis, and help define DM pathogenesis, and facilitate developing novel treatment modalities. PMID:19642006

  15. Study of three interesting Amanita species from Thailand: Morphology, multiple-gene phylogeny and toxin analysis

    PubMed Central

    Thongbai, Benjarong; Miller, Steven L.; Stadler, Marc; Wittstein, Kathrin; Hyde, Kevin D.; Lumyong, Saisamorn

    2017-01-01

    Amanita ballerina and A. brunneitoxicaria spp. nov. are introduced from Thailand. Amanita fuligineoides is also reported for the first time from Thailand, increasing the known distribution of this taxon. Together, those findings support our view that many taxa are yet to be discovered in the region. While both morphological characters and a multiple-gene phylogeny clearly place A. brunneitoxicaria and A. fuligineoides in sect. Phalloideae (Fr.) Quél., the placement of A. ballerina is problematic. On the one hand, the morphology of A. ballerina shows clear affinities with stirps Limbatula of sect. Lepidella. On the other hand, in a multiple-gene phylogeny including taxa of all sections in subg. Lepidella, A. ballerina and two other species, including A. zangii, form a well-supported clade sister to the Phalloideae sensu Bas 1969, which include the lethal “death caps” and “destroying angels”. Together, the A. ballerina-A. zangii clade and the Phalloideae sensu Bas 1969 also form a well-supported clade. We therefore screened for two of the most notorious toxins by HPLC-MS analysis of methanolic extracts from the basidiomata. Interestingly, neither α-amanitin nor phalloidin was found in A. ballerina, whereas Amanita fuligineoides was confirmed to contain both α-amanitin and phalloidin, and A. brunneitoxicaria contained only α-amanitin. Together with unique morphological characteristics, the position in the phylogeny indicates that A. ballerina is either an important link in the evolution of the deadly Amanita sect. Phalloideae species, or a member of a new section also including A. zangii. PMID:28767681

  16. Using complementary approaches to identify trans-domain nuclear gene transfers in the extremophile Galdieria sulphuraria (Rhodophyta).

    PubMed

    Pandey, Ravi S; Saxena, Garima; Bhattacharya, Debashish; Qiu, Huan; Azad, Rajeev K

    2017-02-01

    Identification of horizontal gene transfers (HGTs) has primarily relied on phylogenetic tree based methods, which require a rich sampling of sequenced genomes to ensure a reliable inference. Because the success of phylogenetic approaches depends on the breadth and depth of the database, researchers usually apply stringent filters to detect only the most likely gene transfers in the genomes of interest. One such study focused on a highly conservative estimate of trans-domain gene transfers in the extremophile eukaryote, Galdieria sulphuraria (Galdieri) Merola (Rhodophyta), by applying multiple filters in their phylogenetic pipeline. This led to the identification of 75 inter-domain acquisitions from Bacteria or Archaea. Because of the evolutionary, ecological, and potential biotechnological significance of foreign genes in algae, alternative approaches and pipelines complementing phylogenetics are needed for a more comprehensive assessment of HGT. We present here a novel pipeline that uncovered 17 novel foreign genes of prokaryotic origin in G. sulphuraria, results that are supported by multiple lines of evidence including composition-based, comparative data, and phylogenetics. These genes encode a variety of potentially adaptive functions, from metabolite transport to DNA repair. © 2016 Phycological Society of America.

  17. Imaging Effects of Neurotrophic Factor Genes on Brain Plasticity and Repair in Multiple Sclerosis

    DTIC Science & Technology

    2011-07-01

    focal and diffuse effects in brain (including cortical thickness and subcortical volume measures, lesion volumetry , and voxel-based morphometry and...to both focal and diffuse effects in gray and white matter, including cortical thickness and subcortical volume measures, lesion volumetry , and

  18. The Child with Recurrent Mycobacterial Disease.

    PubMed

    Reed, Brian; Dolen, William K

    2018-06-23

    Many genetic conditions predispose affected individuals to opportunistic infections. A number of immunodeficiency diseases, including genetic defects termed Mendelian susceptibility to mycobacterial disease (MSMD), permit infection from many different strains of mycobacteria that would otherwise not cause disease. These include tuberculous and nontuberculous mycobacteria, and bacille Calmette-Guérin vaccine (BCG). Patients may present with infections from other organisms that depend on macrophage function for containment. Defects in multiple genes in the IL-12 and NFKB signaling pathways can cause the MSMD phenotype, some of which include IL12RB1, IL12B, IKBKG, ISG15, IFNGR1, IFNGR2, CYBB, TYK2, IRF8, and STAT1. Multiple autosomal recessive and dominant, and 2 X-linked recessive gene defects resulting in the MSMD phenotype have been reported, and others await discovery. This review presents the known gene defects and describes clinical findings that result from the mutations. If MSMD is suspected, a careful clinical history and examination and basic immunodeficiency screening tests will narrow the differential diagnosis. A specific diagnosis requires more sophisticated laboratory investigation. Genetic testing permits a definitive diagnosis, permitting genetic counseling. Mild cases respond well to appropriate antibiotic therapy, whereas severe disease may require hematopoietic stem cell transplantation.

  19. Multiple markers and multiple individuals refine true seal phylogeny and bring molecules and morphology back in line.

    PubMed

    Fulton, Tara Lynn; Strobeck, Curtis

    2010-04-07

    Despite decades of study, some aspects of Phocidae (Pinnipedia, Carnivora) phylogeny still remain unresolved. Using the largest novel dataset to date, including all extant phocids and comprising 15 nuclear and 13 mitochondrial genes, we illustrate the utility of including multiple individuals per species in resolving rapid radiations, and provide new insight into phocid phylogeny. In line with longstanding morphological views, Pusa is recovered as monophyletic for the first time with genetic data. The data are also used to explore the relationship between genetic distance and taxonomic rank. Intraspecific sampling also highlights the discrepancy between molecular and morphological rates of evolution within Phocidae.

  20. Dynamic regulation of genetic pathways and targets during aging in Caenorhabditis elegans.

    PubMed

    He, Kan; Zhou, Tao; Shao, Jiaofang; Ren, Xiaoliang; Zhao, Zhongying; Liu, Dahai

    2014-03-01

    Numerous genetic targets and some individual pathways associated with aging have been identified using the worm model. However, less is known about the genetic mechanisms of aging in genome wide, particularly at the level of multiple pathways as well as the regulatory networks during aging. Here, we employed the gene expression datasets of three time points during aging in Caenorhabditis elegans (C. elegans) and performed the approach of gene set enrichment analysis (GSEA) on each dataset between adjacent stages. As a result, multiple genetic pathways and targets were identified as significantly down- or up-regulated. Among them, 5 truly aging-dependent signaling pathways including MAPK signaling pathway, mTOR signaling pathway, Wnt signaling pathway, TGF-beta signaling pathway and ErbB signaling pathway as well as 12 significantly associated genes were identified with dynamic expression pattern during aging. On the other hand, the continued declines in the regulation of several metabolic pathways have been demonstrated to display age-related changes. Furthermore, the reconstructed regulatory networks based on three of aging related Chromatin immunoprecipitation experiments followed by sequencing (ChIP-seq) datasets and the expression matrices of 154 involved genes in above signaling pathways provide new insights into aging at the multiple pathways level. The combination of multiple genetic pathways and targets needs to be taken into consideration in future studies of aging, in which the dynamic regulation would be uncovered.

  1. Comparative genomics in the Asteraceae reveals little evidence for parallel evolutionary change in invasive taxa.

    PubMed

    Hodgins, Kathryn A; Bock, Dan G; Hahn, Min A; Heredia, Sylvia M; Turner, Kathryn G; Rieseberg, Loren H

    2015-05-01

    Asteraceae, the largest family of flowering plants, has given rise to many notorious invasive species. Using publicly available transcriptome assemblies from 35 Asteraceae, including six major invasive species, we examined evidence for micro- and macro-evolutionary genomic changes associated with invasion. To detect episodes of positive selection repeated across multiple introductions, we conducted comparisons between native and introduced genotypes from six focal species and identified genes with elevated rates of amino acid change (dN/dS). We then looked for evidence of positive selection at a broader phylogenetic scale across all taxa. As invasive species may experience founder events during colonization and spread, we also looked for evidence of increased genetic load in introduced genotypes. We rarely found evidence for parallel changes in orthologous genes in the intraspecific comparisons, but in some cases we identified changes in members of the same gene family. Using among-species comparisons, we detected positive selection in 0.003-0.69% and 2.4-7.8% of the genes using site and stochastic branch-site models, respectively. These genes had diverse putative functions, including defence response, stress response and herbicide resistance, although there was no clear pattern in the GO terms. There was no indication that introduced genotypes have a higher proportion of deleterious alleles than native genotypes in the six focal species, suggesting multiple introductions and admixture mitigated the impact of drift. Our findings provide little evidence for common genomic responses in invasive taxa of the Asteraceae and hence suggest that multiple evolutionary pathways may lead to adaptation during introduction and spread in these species. © 2014 John Wiley & Sons Ltd.

  2. Expression of Multiple Stress Response Genes by Escherichia Coli Under Modeled Reduced Gravity

    NASA Astrophysics Data System (ADS)

    Vukanti, Raja; Leff, Laura G.

    2012-09-01

    Bacteria, in response to changes in their environment, quickly regulate gene expression; hence, transcriptional profiling has been widely used to characterize bacterial responses to various environmental conditions. In this study, we used clinorotation to grow bacteria under low-sedimentation, -shear, and -turbulence conditions (referred to as modeled reduced gravity, MRG, below) which profoundly impacts bacteria including causing elevated resistance to multiple environmental stresses. To explore potential mechanisms behind the multiple stress resistance response to MRG, we assessed expression levels of E. coli genes, using reverse transcription followed by real-time-PCR, involved in specific stress and general stress responses under MRG and normal gravity (NG) in nutritionally rich and minimal media, and during exponential and stationary phases of growth. In addition, growth rates as well as physico-chemical parameters of culture media were examined. Over-expression of stress response genes (csiD, cstA, katE, otsA, treA) occurred under MRG compared to NG controls, but only during the later stages of growth in rich medium demonstrating that bacterial response to MRG varies with growth-medium and -phase. At stationary phase in rich medium under MRG and NG, E. coli had similar growth rates (based on rRNA-leader abundance) and yields (cell mass and numbers); this coupled, with observations of simultaneous induction of starvation response genes (csiD and cstA) suggests the multiple stress resistance phenotype under MRG could be attributable to microzones of nutrient unavailability around cells. Overall, in rich medium, the response resembled the general stress response (GSR) that E. coli develops during stationary phase of growth. Along these same lines, induction of genes coding for GSR was reversed by improving nutritional conditions under MRG. The reversal of GSR under MRG suggests that the multiple stress response exhibited is not specific to MRG but may result from nutrient limitation experienced by bacteria after incubation in nutrient-rich media under these conditions.

  3. Action of multiple intra-QTL genes concerted around a co-localized transcription factor underpins a large effect QTL

    PubMed Central

    Dixit, Shalabh; Kumar Biswal, Akshaya; Min, Aye; Henry, Amelia; Oane, Rowena H.; Raorane, Manish L.; Longkumer, Toshisangba; Pabuayon, Isaiah M.; Mutte, Sumanth K.; Vardarajan, Adithi R.; Miro, Berta; Govindan, Ganesan; Albano-Enriquez, Blesilda; Pueffeld, Mandy; Sreenivasulu, Nese; Slamet-Loedin, Inez; Sundarvelpandian, Kalaipandian; Tsai, Yuan-Ching; Raghuvanshi, Saurabh; Hsing, Yue-Ie C.; Kumar, Arvind; Kohli, Ajay

    2015-01-01

    Sub-QTLs and multiple intra-QTL genes are hypothesized to underpin large-effect QTLs. Known QTLs over gene families, biosynthetic pathways or certain traits represent functional gene-clusters of genes of the same gene ontology (GO). Gene-clusters containing genes of different GO have not been elaborated, except in silico as coexpressed genes within QTLs. Here we demonstrate the requirement of multiple intra-QTL genes for the full impact of QTL qDTY12.1 on rice yield under drought. Multiple evidences are presented for the need of the transcription factor ‘no apical meristem’ (OsNAM12.1) and its co-localized target genes of separate GO categories for qDTY12.1 function, raising a regulon-like model of genetic architecture. The molecular underpinnings of qDTY12.1 support its effectiveness in further improving a drought tolerant genotype and for its validity in multiple genotypes/ecosystems/environments. Resolving the combinatorial value of OsNAM12.1 with individual intra-QTL genes notwithstanding, identification and analyses of qDTY12.1has fast-tracked rice improvement towards food security. PMID:26507552

  4. Multiple Genes Repress Motility in Uropathogenic Escherichia coli Constitutively Expressing Type 1 Fimbriae▿ †

    PubMed Central

    Simms, Amy N.; Mobley, Harry L. T.

    2008-01-01

    Two surface organelles of uropathogenic Escherichia coli (UPEC), flagella and type 1 fimbriae, are critical for colonization of the urinary tract but mediate opposite actions. Flagella propel bacteria through urine and along mucus layers, while type 1 fimbriae allow bacteria to adhere to specific receptors present on uroepithelial cells. Constitutive expression of type 1 fimbriae leads to repression of motility and chemotaxis in UPEC strain CFT073, suggesting that UPEC may coordinately regulate motility and adherence. To identify genes involved in this regulation of motility by type 1 fimbriae, transposon mutagenesis was performed on a phase-locked type 1 fimbrial ON variant of strain CFT073 (CFT073 fim L-ON), followed by a screen for restoration of motility in soft agar. Functions of the genes identified included attachment, metabolism, transport, DNA mismatch repair, and transcriptional regulation, and a number of genes had hypothetical function. Isogenic deletion mutants of these genes were also constructed in CFT073 fim L-ON. Motility was partially restored in six of these mutants, including complementable mutations in four genes encoding known transcriptional regulators, lrhA, lrp, slyA, and papX; a mismatch repair gene, mutS; and one hypothetical gene, ydiV. Type 1 fimbrial expression in these mutants was unaltered, and the majority of these mutants expressed larger amounts of flagellin than the fim L-ON parental strain. Our results indicate that repression of motility in CFT073 fim L-ON is not solely due to the constitutive expression of type 1 fimbriae on the surfaces of the bacteria and that multiple genes may contribute to this repression. PMID:18359812

  5. Multiple homologous genes knockout (KO) by CRISPR/Cas9 system in rabbit.

    PubMed

    Liu, Huan; Sui, Tingting; Liu, Di; Liu, Tingjun; Chen, Mao; Deng, Jichao; Xu, Yuanyuan; Li, Zhanjun

    2018-03-20

    The CRISPR/Cas9 system is a highly efficient and convenient genome editing tool, which has been widely used for single or multiple gene mutation in a variety of organisms. Disruption of multiple homologous genes, which have similar DNA sequences and gene function, is required for the study of the desired phenotype. In this study, to test whether the CRISPR/Cas9 system works on the mutation of multiple homologous genes, a single guide RNA (sgRNA) targeting three fucosyltransferases encoding genes (FUT1, FUT2 and SEC1) was designed. As expected, triple gene mutation of FUT1, FUT2 and SEC1 could be achieved simultaneously via a sgRNA mediated CRISPR/Cas9 system. Besides, significantly reduced serum fucosyltransferases enzymes activity was also determined in those triple gene mutation rabbits. Thus, we provide the first evidence that multiple homologous genes knockout (KO) could be achieved efficiently by a sgRNA mediated CRISPR/Cas9 system in mammals, which could facilitate the genotype to phenotype studies of homologous genes in future. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. Somatic mutations affect key pathways in lung adenocarcinoma

    PubMed Central

    Ding, Li; Getz, Gad; Wheeler, David A.; Mardis, Elaine R.; McLellan, Michael D.; Cibulskis, Kristian; Sougnez, Carrie; Greulich, Heidi; Muzny, Donna M.; Morgan, Margaret B.; Fulton, Lucinda; Fulton, Robert S.; Zhang, Qunyuan; Wendl, Michael C.; Lawrence, Michael S.; Larson, David E.; Chen, Ken; Dooling, David J.; Sabo, Aniko; Hawes, Alicia C.; Shen, Hua; Jhangiani, Shalini N.; Lewis, Lora R.; Hall, Otis; Zhu, Yiming; Mathew, Tittu; Ren, Yanru; Yao, Jiqiang; Scherer, Steven E.; Clerc, Kerstin; Metcalf, Ginger A.; Ng, Brian; Milosavljevic, Aleksandar; Gonzalez-Garay, Manuel L.; Osborne, John R.; Meyer, Rick; Shi, Xiaoqi; Tang, Yuzhu; Koboldt, Daniel C.; Lin, Ling; Abbott, Rachel; Miner, Tracie L.; Pohl, Craig; Fewell, Ginger; Haipek, Carrie; Schmidt, Heather; Dunford-Shore, Brian H.; Kraja, Aldi; Crosby, Seth D.; Sawyer, Christopher S.; Vickery, Tammi; Sander, Sacha; Robinson, Jody; Winckler, Wendy; Baldwin, Jennifer; Chirieac, Lucian R.; Dutt, Amit; Fennell, Tim; Hanna, Megan; Johnson, Bruce E.; Onofrio, Robert C.; Thomas, Roman K.; Tonon, Giovanni; Weir, Barbara A.; Zhao, Xiaojun; Ziaugra, Liuda; Zody, Michael C.; Giordano, Thomas; Orringer, Mark B.; Roth, Jack A.; Spitz, Margaret R.; Wistuba, Ignacio I.; Ozenberger, Bradley; Good, Peter J.; Chang, Andrew C.; Beer, David G.; Watson, Mark A.; Ladanyi, Marc; Broderick, Stephen; Yoshizawa, Akihiko; Travis, William D.; Pao, William; Province, Michael A.; Weinstock, George M.; Varmus, Harold E.; Gabriel, Stacey B.; Lander, Eric S.; Gibbs, Richard A.; Meyerson, Matthew; Wilson, Richard K.

    2009-01-01

    Determining the genetic basis of cancer requires comprehensive analyses of large collections of histopathologically well-classified primary tumours. Here we report the results of a collaborative study to discover somatic mutations in 188 human lung adenocarcinomas. DNA sequencing of 623 genes with known or potential relationships to cancer revealed more than 1,000 somatic mutations across the samples. Our analysis identified 26 genes that are mutated at significantly high frequencies and thus are probably involved in carcinogenesis. The frequently mutated genes include tyrosine kinases, among them the EGFR homologue ERBB4; multiple ephrin receptor genes, notably EPHA3; vascular endothelial growth factor receptor KDR; and NTRK genes. These data provide evidence of somatic mutations in primary lung adenocarcinoma for several tumour suppressor genes involved in other cancers—including NF1, APC, RB1 and ATM—and for sequence changes in PTPRD as well as the frequently deleted gene LRP1B. The observed mutational profiles correlate with clinical features, smoking status and DNA repair defects. These results are reinforced by data integration including single nucleotide polymorphism array and gene expression array. Our findings shed further light on several important signalling pathways involved in lung adenocarcinoma, and suggest new molecular targets for treatment. PMID:18948947

  7. The Homeodomain of PDX-1 Mediates Multiple Protein-Protein Interactions in the Formation of a Transcriptional Activation Complex on the Insulin Promoter

    PubMed Central

    Ohneda, Kinuko; Mirmira, Raghavendra G.; Wang, Juehu; Johnson, Jeffrey D.; German, Michael S.

    2000-01-01

    Activation of insulin gene transcription specifically in the pancreatic β cells depends on multiple nuclear proteins that interact with each other and with sequences on the insulin gene promoter to build a transcriptional activation complex. The homeodomain protein PDX-1 exemplifies such interactions by binding to the A3/4 region of the rat insulin I promoter and activating insulin gene transcription by cooperating with the basic-helix-loop-helix (bHLH) protein E47/Pan1, which binds to the adjacent E2 site. The present study provides evidence that the homeodomain of PDX-1 acts as a protein-protein interaction domain to recruit multiple proteins, including E47/Pan1, BETA2/NeuroD1, and high-mobility group protein I(Y), to an activation complex on the E2A3/4 minienhancer. The transcriptional activity of this complex results from the clustering of multiple activation domains capable of interacting with coactivators and the basal transcriptional machinery. These interactions are not common to all homeodomain proteins: the LIM homeodomain protein Lmx1.1 can also activate the E2A3/4 minienhancer in cooperation with E47/Pan1 but does so through different interactions. Cooperation between Lmx1.1 and E47/Pan1 results not only in the aggregation of multiple activation domains but also in the unmasking of a potent activation domain on E47/Pan1 that is normally silent in non-β cells. While more than one activation complex may be capable of activating insulin gene transcription through the E2A3/4 minienhancer, each is dependent on multiple specific interactions among a unique set of nuclear proteins. PMID:10629047

  8. A genetic network that suppresses genome rearrangements in Saccharomyces cerevisiae and contains defects in cancers

    PubMed Central

    Putnam, Christopher D.; Srivatsan, Anjana; Nene, Rahul V.; Martinez, Sandra L.; Clotfelter, Sarah P.; Bell, Sara N.; Somach, Steven B.; E.S. de Souza, Jorge; Fonseca, André F.; de Souza, Sandro J.; Kolodner, Richard D.

    2016-01-01

    Gross chromosomal rearrangements (GCRs) play an important role in human diseases, including cancer. The identity of all Genome Instability Suppressing (GIS) genes is not currently known. Here multiple Saccharomyces cerevisiae GCR assays and query mutations were crossed into arrays of mutants to identify progeny with increased GCR rates. One hundred eighty two GIS genes were identified that suppressed GCR formation. Another 438 cooperatively acting GIS genes were identified that were not GIS genes, but suppressed the increased genome instability caused by individual query mutations. Analysis of TCGA data using the human genes predicted to act in GIS pathways revealed that a minimum of 93% of ovarian and 66% of colorectal cancer cases had defects affecting one or more predicted GIS gene. These defects included loss-of-function mutations, copy-number changes associated with reduced expression, and silencing. In contrast, acute myeloid leukaemia cases did not appear to have defects affecting the predicted GIS genes. PMID:27071721

  9. Imaging Effects of Neurotrophic Factor Genes on Brain Plasticity and Repair in Multiple Sclerosis

    DTIC Science & Technology

    2012-07-01

    sensitive to focal and diffuse changes in brain tissue (including cortical thickness and subcortical volume measures, lesion volumetry , and voxel-based...sensitive to both focal and diffuse effects in gray and white matter, including cortical thickness and subcortical volume measures, lesion volumetry , and

  10. A Hybrid One-Way ANOVA Approach for the Robust and Efficient Estimation of Differential Gene Expression with Multiple Patterns

    PubMed Central

    Mollah, Mohammad Manir Hossain; Jamal, Rahman; Mokhtar, Norfilza Mohd; Harun, Roslan; Mollah, Md. Nurul Haque

    2015-01-01

    Background Identifying genes that are differentially expressed (DE) between two or more conditions with multiple patterns of expression is one of the primary objectives of gene expression data analysis. Several statistical approaches, including one-way analysis of variance (ANOVA), are used to identify DE genes. However, most of these methods provide misleading results for two or more conditions with multiple patterns of expression in the presence of outlying genes. In this paper, an attempt is made to develop a hybrid one-way ANOVA approach that unifies the robustness and efficiency of estimation using the minimum β-divergence method to overcome some problems that arise in the existing robust methods for both small- and large-sample cases with multiple patterns of expression. Results The proposed method relies on a β-weight function, which produces values between 0 and 1. The β-weight function with β = 0.2 is used as a measure of outlier detection. It assigns smaller weights (≥ 0) to outlying expressions and larger weights (≤ 1) to typical expressions. The distribution of the β-weights is used to calculate the cut-off point, which is compared to the observed β-weight of an expression to determine whether that gene expression is an outlier. This weight function plays a key role in unifying the robustness and efficiency of estimation in one-way ANOVA. Conclusion Analyses of simulated gene expression profiles revealed that all eight methods (ANOVA, SAM, LIMMA, EBarrays, eLNN, KW, robust BetaEB and proposed) perform almost identically for m = 2 conditions in the absence of outliers. However, the robust BetaEB method and the proposed method exhibited considerably better performance than the other six methods in the presence of outliers. In this case, the BetaEB method exhibited slightly better performance than the proposed method for the small-sample cases, but the the proposed method exhibited much better performance than the BetaEB method for both the small- and large-sample cases in the presence of more than 50% outlying genes. The proposed method also exhibited better performance than the other methods for m > 2 conditions with multiple patterns of expression, where the BetaEB was not extended for this condition. Therefore, the proposed approach would be more suitable and reliable on average for the identification of DE genes between two or more conditions with multiple patterns of expression. PMID:26413858

  11. Mutation profiling of 19 candidate genes in acute myeloid leukemia suggests significance of DNMT3A mutations.

    PubMed

    Shin, Sang-Yong; Lee, Seung-Tae; Kim, Hee-Jin; Cho, Eun Hae; Kim, Jong-Won; Park, Silvia; Jung, Chul Won; Kim, Sun-Hee

    2016-08-23

    We selected 19 significantly-mutated genes in AMLs, including FLT3, DNMT3A, NPM1, TET2, RUNX1, CEBPA, WT1, IDH1, IDH2, NRAS, ASXL1, SETD2, PTPN11, TP53, KIT, JAK2, KRAS, BRAF and CBL, and performed massively parallel sequencing for 114 patients with acute myeloid leukemias, mainly including those with normal karyotypes (CN-AML). More than 80% of patients had at least one mutation in the genes tested. DNMT3A mutation was significantly associated with adverse outcome in addition to conventional risk stratification such as the European LeukemiaNet (ELN) classification. We observed clinical usefulness of mutation testing on multiple target genes and the association with disease subgroups, clinical features and prognosis in AMLs.

  12. Divergence of RNA polymerase α subunits in angiosperm plastid genomes is mediated by genomic rearrangement

    PubMed Central

    Blazier, J. Chris; Ruhlman, Tracey A.; Weng, Mao-Lun; Rehman, Sumaiyah K.; Sabir, Jamal S. M.; Jansen, Robert K.

    2016-01-01

    Genes for the plastid-encoded RNA polymerase (PEP) persist in the plastid genomes of all photosynthetic angiosperms. However, three unrelated lineages (Annonaceae, Passifloraceae and Geraniaceae) have been identified with unusually divergent open reading frames (ORFs) in the conserved region of rpoA, the gene encoding the PEP α subunit. We used sequence-based approaches to evaluate whether these genes retain function. Both gene sequences and complete plastid genome sequences were assembled and analyzed from each of the three angiosperm families. Multiple lines of evidence indicated that the rpoA sequences are likely functional despite retaining as low as 30% nucleotide sequence identity with rpoA genes from outgroups in the same angiosperm order. The ratio of non-synonymous to synonymous substitutions indicated that these genes are under purifying selection, and bioinformatic prediction of conserved domains indicated that functional domains are preserved. One of the lineages (Pelargonium, Geraniaceae) contains species with multiple rpoA-like ORFs that show evidence of ongoing inter-paralog gene conversion. The plastid genomes containing these divergent rpoA genes have experienced extensive structural rearrangement, including large expansions of the inverted repeat. We propose that illegitimate recombination, not positive selection, has driven the divergence of rpoA. PMID:27087667

  13. Inference of Evolutionary Forces Acting on Human Biological Pathways

    PubMed Central

    Daub, Josephine T.; Dupanloup, Isabelle; Robinson-Rechavi, Marc; Excoffier, Laurent

    2015-01-01

    Because natural selection is likely to act on multiple genes underlying a given phenotypic trait, we study here the potential effect of ongoing and past selection on the genetic diversity of human biological pathways. We first show that genes included in gene sets are generally under stronger selective constraints than other genes and that their evolutionary response is correlated. We then introduce a new procedure to detect selection at the pathway level based on a decomposition of the classical McDonald–Kreitman test extended to multiple genes. This new test, called 2DNS, detects outlier gene sets and takes into account past demographic effects and evolutionary constraints specific to gene sets. Selective forces acting on gene sets can be easily identified by a mere visual inspection of the position of the gene sets relative to their two-dimensional null distribution. We thus find several outlier gene sets that show signals of positive, balancing, or purifying selection but also others showing an ancient relaxation of selective constraints. The principle of the 2DNS test can also be applied to other genomic contrasts. For instance, the comparison of patterns of polymorphisms private to African and non-African populations reveals that most pathways show a higher proportion of nonsynonymous mutations in non-Africans than in Africans, potentially due to different demographic histories and selective pressures. PMID:25971280

  14. Core Promoter Functions in the Regulation of Gene Expression of Drosophila Dorsal Target Genes*

    PubMed Central

    Zehavi, Yonathan; Kuznetsov, Olga; Ovadia-Shochat, Avital; Juven-Gershon, Tamar

    2014-01-01

    Developmental processes are highly dependent on transcriptional regulation by RNA polymerase II. The RNA polymerase II core promoter is the ultimate target of a multitude of transcription factors that control transcription initiation. Core promoters consist of core promoter motifs, e.g. the initiator, TATA box, and the downstream core promoter element (DPE), which confer specific properties to the core promoter. Here, we explored the importance of core promoter functions in the dorsal-ventral developmental gene regulatory network. This network includes multiple genes that are activated by different nuclear concentrations of Dorsal, an NFκB homolog transcription factor, along the dorsal-ventral axis. We show that over two-thirds of Dorsal target genes contain DPE sequence motifs, which is significantly higher than the proportion of DPE-containing promoters in Drosophila genes. We demonstrate that multiple Dorsal target genes are evolutionarily conserved and functionally dependent on the DPE. Furthermore, we have analyzed the activation of key Dorsal target genes by Dorsal, as well as by another Rel family transcription factor, Relish, and the dependence of their activation on the DPE motif. Using hybrid enhancer-promoter constructs in Drosophila cells and embryo extracts, we have demonstrated that the core promoter composition is an important determinant of transcriptional activity of Dorsal target genes. Taken together, our results provide evidence for the importance of core promoter composition in the regulation of Dorsal target genes. PMID:24634215

  15. Endeavour update: a web resource for gene prioritization in multiple species

    PubMed Central

    Tranchevent, Léon-Charles; Barriot, Roland; Yu, Shi; Van Vooren, Steven; Van Loo, Peter; Coessens, Bert; De Moor, Bart; Aerts, Stein; Moreau, Yves

    2008-01-01

    Endeavour (http://www.esat.kuleuven.be/endeavourweb; this web site is free and open to all users and there is no login requirement) is a web resource for the prioritization of candidate genes. Using a training set of genes known to be involved in a biological process of interest, our approach consists of (i) inferring several models (based on various genomic data sources), (ii) applying each model to the candidate genes to rank those candidates against the profile of the known genes and (iii) merging the several rankings into a global ranking of the candidate genes. In the present article, we describe the latest developments of Endeavour. First, we provide a web-based user interface, besides our Java client, to make Endeavour more universally accessible. Second, we support multiple species: in addition to Homo sapiens, we now provide gene prioritization for three major model organisms: Mus musculus, Rattus norvegicus and Caenorhabditis elegans. Third, Endeavour makes use of additional data sources and is now including numerous databases: ontologies and annotations, protein–protein interactions, cis-regulatory information, gene expression data sets, sequence information and text-mining data. We tested the novel version of Endeavour on 32 recent disease gene associations from the literature. Additionally, we describe a number of recent independent studies that made use of Endeavour to prioritize candidate genes for obesity and Type II diabetes, cleft lip and cleft palate, and pulmonary fibrosis. PMID:18508807

  16. The Genome of the Anaerobic Fungus Orpinomyces sp. Strain C1A Reveals the Unique Evolutionary History of a Remarkable Plant Biomass Degrader

    PubMed Central

    Youssef, Noha H.; Couger, M. B.; Struchtemeyer, Christopher G.; Liggenstoffer, Audra S.; Prade, Rolf A.; Najar, Fares Z.; Atiyeh, Hasan K.; Wilkins, Mark R.

    2013-01-01

    Anaerobic gut fungi represent a distinct early-branching fungal phylum (Neocallimastigomycota) and reside in the rumen, hindgut, and feces of ruminant and nonruminant herbivores. The genome of an anaerobic fungal isolate, Orpinomyces sp. strain C1A, was sequenced using a combination of Illumina and PacBio single-molecule real-time (SMRT) technologies. The large genome (100.95 Mb, 16,347 genes) displayed extremely low G+C content (17.0%), large noncoding intergenic regions (73.1%), proliferation of microsatellite repeats (4.9%), and multiple gene duplications. Comparative genomic analysis identified multiple genes and pathways that are absent in Dikarya genomes but present in early-branching fungal lineages and/or nonfungal Opisthokonta. These included genes for posttranslational fucosylation, the production of specific intramembrane proteases and extracellular protease inhibitors, the formation of a complete axoneme and intraflagellar trafficking machinery, and a near-complete focal adhesion machinery. Analysis of the lignocellulolytic machinery in the C1A genome revealed an extremely rich repertoire, with evidence of horizontal gene acquisition from multiple bacterial lineages. Experimental analysis indicated that strain C1A is a remarkable biomass degrader, capable of simultaneous saccharification and fermentation of the cellulosic and hemicellulosic fractions in multiple untreated grasses and crop residues examined, with the process significantly enhanced by mild pretreatments. This capability, acquired during its separate evolutionary trajectory in the rumen, along with its resilience and invasiveness compared to prokaryotic anaerobes, renders anaerobic fungi promising agents for consolidated bioprocessing schemes in biofuels production. PMID:23709508

  17. The genome of the anaerobic fungus Orpinomyces sp. strain C1A reveals the unique evolutionary history of a remarkable plant biomass degrader.

    PubMed

    Youssef, Noha H; Couger, M B; Struchtemeyer, Christopher G; Liggenstoffer, Audra S; Prade, Rolf A; Najar, Fares Z; Atiyeh, Hasan K; Wilkins, Mark R; Elshahed, Mostafa S

    2013-08-01

    Anaerobic gut fungi represent a distinct early-branching fungal phylum (Neocallimastigomycota) and reside in the rumen, hindgut, and feces of ruminant and nonruminant herbivores. The genome of an anaerobic fungal isolate, Orpinomyces sp. strain C1A, was sequenced using a combination of Illumina and PacBio single-molecule real-time (SMRT) technologies. The large genome (100.95 Mb, 16,347 genes) displayed extremely low G+C content (17.0%), large noncoding intergenic regions (73.1%), proliferation of microsatellite repeats (4.9%), and multiple gene duplications. Comparative genomic analysis identified multiple genes and pathways that are absent in Dikarya genomes but present in early-branching fungal lineages and/or nonfungal Opisthokonta. These included genes for posttranslational fucosylation, the production of specific intramembrane proteases and extracellular protease inhibitors, the formation of a complete axoneme and intraflagellar trafficking machinery, and a near-complete focal adhesion machinery. Analysis of the lignocellulolytic machinery in the C1A genome revealed an extremely rich repertoire, with evidence of horizontal gene acquisition from multiple bacterial lineages. Experimental analysis indicated that strain C1A is a remarkable biomass degrader, capable of simultaneous saccharification and fermentation of the cellulosic and hemicellulosic fractions in multiple untreated grasses and crop residues examined, with the process significantly enhanced by mild pretreatments. This capability, acquired during its separate evolutionary trajectory in the rumen, along with its resilience and invasiveness compared to prokaryotic anaerobes, renders anaerobic fungi promising agents for consolidated bioprocessing schemes in biofuels production.

  18. Roles of the Sodium-Translocating NADH:Quinone Oxidoreductase (Na+-NQR) on Vibrio cholerae Metabolism, Motility and Osmotic Stress Resistance

    PubMed Central

    Minato, Yusuke; Halang, Petra; Quinn, Matthew J.; Faulkner, Wyatt J.; Aagesen, Alisha M.; Steuber, Julia; Stevens, Jan F.; Häse, Claudia C.

    2014-01-01

    The Na+ translocating NADH:quinone oxidoreductase (Na+-NQR) is a unique respiratory enzyme catalyzing the electron transfer from NADH to quinone coupled with the translocation of sodium ions across the membrane. Typically, Vibrio spp., including Vibrio cholerae, have this enzyme but lack the proton-pumping NADH:ubiquinone oxidoreductase (Complex I). Thus, Na+-NQR should significantly contribute to multiple aspects of V. cholerae physiology; however, no detailed characterization of this aspect has been reported so far. In this study, we broadly investigated the effects of loss of Na+-NQR on V. cholerae physiology by using Phenotype Microarray (Biolog), transcriptome and metabolomics analyses. We found that the V. cholerae ΔnqrA-F mutant showed multiple defects in metabolism detected by Phenotype Microarray. Transcriptome analysis revealed that the V. cholerae ΔnqrA-F mutant up-regulates 31 genes and down-regulates 55 genes in both early and mid-growth phases. The most up-regulated genes included the cadA and cadB genes, encoding a lysine decarboxylase and a lysine/cadaverine antiporter, respectively. Increased CadAB activity was further suggested by the metabolomics analysis. The down-regulated genes include sialic acid catabolism genes. Metabolomic analysis also suggested increased reductive pathway of TCA cycle and decreased purine metabolism in the V. cholerae ΔnqrA-F mutant. Lack of Na+-NQR did not affect any of the Na+ pumping-related phenotypes of V. cholerae suggesting that other secondary Na+ pump(s) can compensate for Na+ pumping activity of Na+-NQR. Overall, our study provides important insights into the contribution of Na+-NQR to V. cholerae physiology. PMID:24811312

  19. Genetic and epigenetic mutations of tumor suppressive genes in sporadic pituitary adenoma

    PubMed Central

    Zhou, Yunli; Zhang, Xun; Klibanski, Anne

    2013-01-01

    Human pituitary adenomas are the most common intracranial neoplasms. Approximately 5% of them are familial adenomas. Patients with familial tumors carry germline mutations in predisposition genes, including AIP, MEN1 and PRKAR1A. These mutations are extremely rare in sporadic pituitary adenomas, which therefore are caused by different mechanisms. Multiple tumor suppressive genes linked to sporadic tumors have been identified. Their inactivation is caused by epigenetic mechanisms, mainly promoter hypermethylation, and can be placed into two groups based on their functional interaction with tumor suppressors RB or p53. The RB group includes CDKN2A, CDKN2B, CDKN2C, RB1, BMP4, CDH1, CDH13, GADD45B and GADD45G; AIP and MEN1 genes also belong to this group. The p53 group includes MEG3, MGMT, PLAGL1, RASSF1, RASSF3 and SOCS1. We propose that the tumor suppression function of these genes is mainly mediated by the RB and p53 pathways. We also discuss possible tumor suppression mechanisms for individual genes. PMID:24035864

  20. Candidate gene analysis for Alzheimer's disease in adults with Down syndrome.

    PubMed

    Lee, Joseph H; Lee, Annie J; Dang, Lam-Ha; Pang, Deborah; Kisselev, Sergey; Krinsky-McHale, Sharon J; Zigman, Warren B; Luchsinger, José A; Silverman, Wayne; Tycko, Benjamin; Clark, Lorraine N; Schupf, Nicole

    2017-08-01

    Individuals with Down syndrome (DS) overexpress many genes on chromosome 21 due to trisomy and have high risk of dementia due to the Alzheimer's disease (AD) neuropathology. However, there is a wide range of phenotypic differences (e.g., age at onset of AD, amyloid β levels) among adults with DS, suggesting the importance of factors that modify risk within this particularly vulnerable population, including genotypic variability. Previous genetic studies in the general population have identified multiple genes that are associated with AD. This study examined the contribution of polymorphisms in these genes to the risk of AD in adults with DS ranging from 30 to 78 years of age at study entry (N = 320). We used multiple logistic regressions to estimate the likelihood of AD using single-nucleotide polymorphisms (SNPs) in candidate genes, adjusting for age, sex, race/ethnicity, level of intellectual disability and APOE genotype. This study identified multiple SNPs in APP and CST3 that were associated with AD at a gene-wise level empirical p-value of 0.05, with odds ratios in the range of 1.5-2. SNPs in MARK4 were marginally associated with AD. CST3 and MARK4 may contribute to our understanding of potential mechanisms where CST3 may contribute to the amyloid pathway by inhibiting plaque formation, and MARK4 may contribute to the regulation of the transition between stable and dynamic microtubules. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Heterogeneous data fusion for brain tumor classification.

    PubMed

    Metsis, Vangelis; Huang, Heng; Andronesi, Ovidiu C; Makedon, Fillia; Tzika, Aria

    2012-10-01

    Current research in biomedical informatics involves analysis of multiple heterogeneous data sets. This includes patient demographics, clinical and pathology data, treatment history, patient outcomes as well as gene expression, DNA sequences and other information sources such as gene ontology. Analysis of these data sets could lead to better disease diagnosis, prognosis, treatment and drug discovery. In this report, we present a novel machine learning framework for brain tumor classification based on heterogeneous data fusion of metabolic and molecular datasets, including state-of-the-art high-resolution magic angle spinning (HRMAS) proton (1H) magnetic resonance spectroscopy and gene transcriptome profiling, obtained from intact brain tumor biopsies. Our experimental results show that our novel framework outperforms any analysis using individual dataset.

  2. ''The control of lignin synthesis''

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Carlson, John E.

    2005-04-07

    In this project we tested the hypothesis that regulation of the synthesis of lignin in secondary xylem cells in conifer trees involves the transport of glucosylated lignin monomers to the wall of xylem cells, followed by de-glucosylation in the cell wall by monolignol-specific glucosidase enzymes, which activates the monomers for lignin polymerization. The information we gathered is relevant to the fundamental understanding of how trees make wood, and to the applied goal of more environmentally friendly pulp and paper production. We characterized the complete genomic structure of the Coniferin-specific Beta-glucosidase (CBG) gene family in the conifers loblolly pine (Pinus taeda)more » and lodgepole pine (Pinus contorta), and partial genomic sequences were obtained in several other tree species. Both pine species contain multiple CBG genes which raises the possibility of differential regulation, perhaps related to the multiple roles of lignin in development and defense. Subsequent projects will need to include detailed gene expression studies of each gene family member during tree growth and development, and testing the role of each monolignol-specific glucosidase gene in controlling lignin content.« less

  3. Genotet: An Interactive Web-based Visual Exploration Framework to Support Validation of Gene Regulatory Networks.

    PubMed

    Yu, Bowen; Doraiswamy, Harish; Chen, Xi; Miraldi, Emily; Arrieta-Ortiz, Mario Luis; Hafemeister, Christoph; Madar, Aviv; Bonneau, Richard; Silva, Cláudio T

    2014-12-01

    Elucidation of transcriptional regulatory networks (TRNs) is a fundamental goal in biology, and one of the most important components of TRNs are transcription factors (TFs), proteins that specifically bind to gene promoter and enhancer regions to alter target gene expression patterns. Advances in genomic technologies as well as advances in computational biology have led to multiple large regulatory network models (directed networks) each with a large corpus of supporting data and gene-annotation. There are multiple possible biological motivations for exploring large regulatory network models, including: validating TF-target gene relationships, figuring out co-regulation patterns, and exploring the coordination of cell processes in response to changes in cell state or environment. Here we focus on queries aimed at validating regulatory network models, and on coordinating visualization of primary data and directed weighted gene regulatory networks. The large size of both the network models and the primary data can make such coordinated queries cumbersome with existing tools and, in particular, inhibits the sharing of results between collaborators. In this work, we develop and demonstrate a web-based framework for coordinating visualization and exploration of expression data (RNA-seq, microarray), network models and gene-binding data (ChIP-seq). Using specialized data structures and multiple coordinated views, we design an efficient querying model to support interactive analysis of the data. Finally, we show the effectiveness of our framework through case studies for the mouse immune system (a dataset focused on a subset of key cellular functions) and a model bacteria (a small genome with high data-completeness).

  4. A distinct regulatory region of the Bmp5 locus activates gene expression following adult bone fracture or soft tissue injury.

    PubMed

    Guenther, Catherine A; Wang, Zhen; Li, Emma; Tran, Misha C; Logan, Catriona Y; Nusse, Roel; Pantalena-Filho, Luiz; Yang, George P; Kingsley, David M

    2015-08-01

    Bone morphogenetic proteins (BMPs) are key signaling molecules required for normal development of bones and other tissues. Previous studies have shown that null mutations in the mouse Bmp5 gene alter the size, shape and number of multiple bone and cartilage structures during development. Bmp5 mutations also delay healing of rib fractures in adult mutants, suggesting that the same signals used to pattern embryonic bone and cartilage are also reused during skeletal regeneration and repair. Despite intense interest in BMPs as agents for stimulating bone formation in clinical applications, little is known about the regulatory elements that control developmental or injury-induced BMP expression. To compare the DNA sequences that activate gene expression during embryonic bone formation and following acute injuries in adult animals, we assayed regions surrounding the Bmp5 gene for their ability to stimulate lacZ reporter gene expression in transgenic mice. Multiple genomic fragments, distributed across the Bmp5 locus, collectively coordinate expression in discrete anatomic domains during normal development, including in embryonic ribs. In contrast, a distinct regulatory region activated expression following rib fracture in adult animals. The same injury control region triggered gene expression in mesenchymal cells following tibia fracture, in migrating keratinocytes following dorsal skin wounding, and in regenerating epithelial cells following lung injury. The Bmp5 gene thus contains an "injury response" control region that is distinct from embryonic enhancers, and that is activated by multiple types of injury in adult animals. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Methylation and microRNA-mediated epigenetic regulation of SOCS3

    PubMed Central

    Boosani, Chandra S.; Agrawal, Devendra K.

    2017-01-01

    Epigenetic gene silencing of several genes causes different pathological conditions in humans, and DNA methylation has been identified as one of the key mechanisms that underlie this evolutionarily conserved phenomenon associated with developmental and pathological gene regulation. Recent advances in the miRNA technology with high throughput analysis of gene regulation further increased our understanding on the role of miRNAs regulating multiple gene expression. There is increasing evidence supporting that the miRNAs not only regulate gene expression but they also are involved in the hypermethylation of promoter sequences, which cumulatively contributes to the epigenetic gene silencing. Here, we critically evaluated the recent progress on the transcriptional regulation of an important suppressor protein that inhibits cytokine-mediated signaling, SOCS3, whose expression is directly regulated both by promoter methylation and also by microRNAs, affecting its vital cell regulating functions. SOCS3 was identified as a potent inhibitor of Jak/STAT signaling pathway which is frequently upregulated in several pathologies, including cardiovascular disease, cancer, diabetes, viral infections, and the expression of SOCS3 was inhibited or greatly reduced due to hypermethylation of the CpG islands in its promoter region or suppression of its expression by different microRNAs. Additionally, we discuss key intracellular signaling pathways regulated by SOCS3 involving cellular events, including cell proliferation, cell growth, cell migration and apoptosis. Identification of the pathway intermediates as specific targets would not only aid in the development of novel therapeutic drugs, but, would also assist in developing new treatment strategies that could successfully be employed in combination therapy to target multiple signaling pathways. PMID:25682267

  6. FunGene: the functional gene pipeline and repository.

    PubMed

    Fish, Jordan A; Chai, Benli; Wang, Qiong; Sun, Yanni; Brown, C Titus; Tiedje, James M; Cole, James R

    2013-01-01

    Ribosomal RNA genes have become the standard molecular markers for microbial community analysis for good reasons, including universal occurrence in cellular organisms, availability of large databases, and ease of rRNA gene region amplification and analysis. As markers, however, rRNA genes have some significant limitations. The rRNA genes are often present in multiple copies, unlike most protein-coding genes. The slow rate of change in rRNA genes means that multiple species sometimes share identical 16S rRNA gene sequences, while many more species share identical sequences in the short 16S rRNA regions commonly analyzed. In addition, the genes involved in many important processes are not distributed in a phylogenetically coherent manner, potentially due to gene loss or horizontal gene transfer. While rRNA genes remain the most commonly used markers, key genes in ecologically important pathways, e.g., those involved in carbon and nitrogen cycling, can provide important insights into community composition and function not obtainable through rRNA analysis. However, working with ecofunctional gene data requires some tools beyond those required for rRNA analysis. To address this, our Functional Gene Pipeline and Repository (FunGene; http://fungene.cme.msu.edu/) offers databases of many common ecofunctional genes and proteins, as well as integrated tools that allow researchers to browse these collections and choose subsets for further analysis, build phylogenetic trees, test primers and probes for coverage, and download aligned sequences. Additional FunGene tools are specialized to process coding gene amplicon data. For example, FrameBot produces frameshift-corrected protein and DNA sequences from raw reads while finding the most closely related protein reference sequence. These tools can help provide better insight into microbial communities by directly studying key genes involved in important ecological processes.

  7. NON-MENDELIAN ETIOLOGIC FACTORS IN NEUROPSYCHIATRIC ILLNESS: PLEIOTROPY, EPIGENETICS, AND CONVERGENCE

    PubMed Central

    Deutsch, Curtis K; McIlvane, William J

    2013-01-01

    The target article by Charney on behavior genetics/genomics discusses how numerous molecular factors can inform heritability estimations and genetic association studies. These factors find application in the search for genes for behavioral phenotypes, including neuropsychiatric disorders. We elaborate upon how single causal factors can generate multiple phenotypes, and discuss how multiple causal factors may converge on common neurodevelopmental mechanisms. PMID:23095384

  8. Genome Sequence of the Pea Aphid Acyrthosiphon pisum

    PubMed Central

    2010-01-01

    Aphids are important agricultural pests and also biological models for studies of insect-plant interactions, symbiosis, virus vectoring, and the developmental causes of extreme phenotypic plasticity. Here we present the 464 Mb draft genome assembly of the pea aphid Acyrthosiphon pisum. This first published whole genome sequence of a basal hemimetabolous insect provides an outgroup to the multiple published genomes of holometabolous insects. Pea aphids are host-plant specialists, they can reproduce both sexually and asexually, and they have coevolved with an obligate bacterial symbiont. Here we highlight findings from whole genome analysis that may be related to these unusual biological features. These findings include discovery of extensive gene duplication in more than 2000 gene families as well as loss of evolutionarily conserved genes. Gene family expansions relative to other published genomes include genes involved in chromatin modification, miRNA synthesis, and sugar transport. Gene losses include genes central to the IMD immune pathway, selenoprotein utilization, purine salvage, and the entire urea cycle. The pea aphid genome reveals that only a limited number of genes have been acquired from bacteria; thus the reduced gene count of Buchnera does not reflect gene transfer to the host genome. The inventory of metabolic genes in the pea aphid genome suggests that there is extensive metabolite exchange between the aphid and Buchnera, including sharing of amino acid biosynthesis between the aphid and Buchnera. The pea aphid genome provides a foundation for post-genomic studies of fundamental biological questions and applied agricultural problems. PMID:20186266

  9. Two FGFRL-Wnt circuits organize the planarian anteroposterior axis.

    PubMed

    Scimone, M Lucila; Cote, Lauren E; Rogers, Travis; Reddien, Peter W

    2016-04-11

    How positional information instructs adult tissue maintenance is poorly understood. Planarians undergo whole-body regeneration and tissue turnover, providing a model for adult positional information studies. Genes encoding secreted and transmembrane components of multiple developmental pathways are predominantly expressed in planarian muscle cells. Several of these genes regulate regional identity, consistent with muscle harboring positional information. Here, single-cell RNA-sequencing of 115 muscle cells from distinct anterior-posterior regions identified 44 regionally expressed genes, including multiple Wnt and ndk/FGF receptor-like (ndl/FGFRL) genes. Two distinct FGFRL-Wnt circuits, involving juxtaposed anterior FGFRL and posterior Wnt expression domains, controlled planarian head and trunk patterning. ndl-3 and wntP-2 inhibition expanded the trunk, forming ectopic mouths and secondary pharynges, which independently extended and ingested food. fz5/8-4 inhibition, like that of ndk and wntA, caused posterior brain expansion and ectopic eye formation. Our results suggest that FGFRL-Wnt circuits operate within a body-wide coordinate system to control adult axial positioning.

  10. Chum salmon egg extracts induce upregulation of collagen type I and exert antioxidative effects on human dermal fibroblast cultures.

    PubMed

    Yoshino, Atsushi; Polouliakh, Natalia; Meguro, Akira; Takeuchi, Masaki; Kawagoe, Tatsukata; Mizuki, Nobuhisa

    2016-01-01

    Components of fish roe possess antioxidant and antiaging activities, making them potentially very beneficial natural resources. Here, we investigated chum salmon eggs (CSEs) as a source of active ingredients, including vitamins, unsaturated fatty acids, and proteins. We incubated human dermal fibroblast cultures for 48 hours with high and low concentrations of CSE extracts and analyzed changes in gene expression. Cells treated with CSE extract showed concentration-dependent upregulation of collagen type I genes and of multiple antioxidative genes, including OXR1, TXNRD1, and PRDX family genes. We further conducted in silico phylogenetic footprinting analysis of promoter regions. These results suggested that transcription factors such as acute myeloid leukemia-1a and cyclic adenosine monophosphate response element-binding protein may be involved in the observed upregulation of antioxidative genes. Our results support the idea that CSEs are strong candidate sources of antioxidant materials and cosmeceutically effective ingredients.

  11. Genomic and Epigenomic Alterations in Cancer.

    PubMed

    Chakravarthi, Balabhadrapatruni V S K; Nepal, Saroj; Varambally, Sooryanarayana

    2016-07-01

    Multiple genetic and epigenetic events characterize tumor progression and define the identity of the tumors. Advances in high-throughput technologies, like gene expression profiling, next-generation sequencing, proteomics, and metabolomics, have enabled detailed molecular characterization of various tumors. The integration and analyses of these high-throughput data have unraveled many novel molecular aberrations and network alterations in tumors. These molecular alterations include multiple cancer-driving mutations, gene fusions, amplification, deletion, and post-translational modifications, among others. Many of these genomic events are being used in cancer diagnosis, whereas others are therapeutically targeted with small-molecule inhibitors. Multiple genes/enzymes that play a role in DNA and histone modifications are also altered in various cancers, changing the epigenomic landscape during cancer initiation and progression. Apart from protein-coding genes, studies are uncovering the critical regulatory roles played by noncoding RNAs and noncoding regions of the genome during cancer progression. Many of these genomic and epigenetic events function in tandem to drive tumor development and metastasis. Concurrent advances in genome-modulating technologies, like gene silencing and genome editing, are providing ability to understand in detail the process of cancer initiation, progression, and signaling as well as opening up avenues for therapeutic targeting. In this review, we discuss some of the recent advances in cancer genomic and epigenomic research. Copyright © 2016 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  12. Enhanced Tolerance of Transgenic Potato Plants Over-Expressing Non-specific Lipid Transfer Protein-1 (StnsLTP1) against Multiple Abiotic Stresses

    PubMed Central

    Gangadhar, Baniekal H.; Sajeesh, Kappachery; Venkatesh, Jelli; Baskar, Venkidasamy; Abhinandan, Kumar; Yu, Jae W.; Prasad, Ram; Mishra, Raghvendra K.

    2016-01-01

    Abiotic stresses such as heat, drought, and salinity are major environmental constraints that limit potato (Solanum tuberosum L.) production worldwide. Previously, we found a potential thermo-tolerance gene, named StnsLTP1 from potato using yeast functional screening. Here, we report the functional characterization of StnsLTP1 and its role in multiple abiotic stresses in potato plants. Computational analysis of StnsLTP1 with other plant LTPs showed eight conserved cysteine residues, and four α-helices stabilized by four disulfide bridges. Expression analysis of StnsLTP1 gene showed differential expression under heat, water-deficit and salt stresses. Transgenic potato lines over-expressing StnsLTP1 gene displayed enhanced cell membrane integrity under stress conditions, as indicated by reduced membrane lipid per-oxidation, and hydrogen peroxide content relative to untransformed (UT) control plants. In addition, transgenic lines over-expressing StLTP1 also exhibited increased antioxidant enzyme activity with enhanced accumulation of ascorbates, and up-regulation of stress-related genes including StAPX, StCAT, StSOD, StHsfA3, StHSP70, and StsHSP20 compared with the UT plants. These results suggests that StnsLTP1 transgenic plants acquired improved tolerance to multiple abiotic stresses through enhanced activation of antioxidative defense mechanisms via cyclic scavenging of reactive oxygen species and regulated expression of stress-related genes. PMID:27597854

  13. Ectopic Integration of Transforming DNA Is Rare among Neurospora Transformants Selected for Gene Replacement

    PubMed Central

    Miao, VPW.; Rountree, M. R.; Selker, E. U.

    1995-01-01

    In a variety of organisms, DNA-mediated transformation experiments commonly produce transformants with multiple copies of the transforming DNA, including both selected and unselected molecules. Such ``cotransformants'' are much more common than expected from the individual transformation frequencies, suggesting that subpopulations of cells, or nuclei, are particularly competent for transformation. We found that Neurospora crassa transformants selected for gene replacement at the am gene had not efficiently incorporated additional DNA, suggesting that nuclei that undergo transformation by homologous recombination are not highly competent at integration of DNA by illegitimate recombination. Spheroplasts were treated with DNA fragments homologous to am and with an Escherichia coli hph plasmid. Transformants were initially selected for hph (hygromycin(R)), allowed to conidiate to generate homokaryons and then selected for either Am(-) (gene replacements) or hph. Surprisingly, most am replacement strains were hygromycin(S) (124/140) and carried no extraneous DNA (116/140). Most transformants selected for hph also had ectopic copies of am DNA and/or multiple copies of hph sequences (32/35), generally at multiple sites, confirming that efficient cotransformation could occur. To test the implication that cotransformation involving gene replacement and ectopic integration is rare, we compared the yields of am replacement strains with or without prior selection for hph. The initial selection did not appreciably help (or hinder) recovery of strains with replacements. PMID:7789758

  14. Multiple Cross Displacement Amplification Coupled With Nanoparticles-Based Lateral Flow Biosensor for Detection of Staphylococcus aureus and Identification of Methicillin-Resistant S. aureus.

    PubMed

    Wang, Yi; Yan, Weiqiang; Fu, Shanshan; Hu, Shoukui; Wang, Yan; Xu, Jianguo; Ye, Changyun

    2018-01-01

    Staphylococcus aureus ( S. aureus ), including methicillin-resistant S. aureus (MRSA), is one of the most important human pathogens, which is responsible for bacteremia, soft-tissue infections, and food poisoning. Hence, multiple cross displacement amplification (MCDA) is employed to detect all S. aureus strains, and differentiates MRSA from methicillin-sensitive S. aureus . Multiplex MCDA (m-MCDA), which targets the nuc gene ( S. aureus -specific gene) and mecA gene (encoding penicillin-binding protein-2'), could detect S. aureus strains and identify MRSA within 85 min. Detection of the m-MCDA products is achieved using disposable lateral flow biosensors. A total of 58 strains, including various species of Gram-positive and Gram-negative strains, are used for evaluating and optimizing m-MCDA assays. The optimal amplification condition is found to be 63°C for 40 min, with detection limits at 100 fg DNA/reaction for nuc and mecA genes in the pure cultures, and 10 CFU/tube for nuc and mecA genes in the blood samples. The analytical specificity of m-MCDA assay is of 100%, and no cross-reactions to non- S. aureus strains are produced according to the specificity testing. Particularly, two additional components, including AUDG enzyme and dUTP, are added into the m-MCDA amplification mixtures, which are used for eliminating the unwanted results arising from carryover contamination. Thus, the m-MCDA technique appears to be a simple, rapid, sensitive, and reliable assay to detect all S. aureus strains, and identify MRSA infection for appropriate antibiotic therapy.

  15. Unraveling Haplotype Diversity of the Apical Membrane Antigen-1 Gene in Plasmodium falciparum Populations in Thailand

    PubMed Central

    Lumkul, Lalita; Sawaswong, Vorthon; Simpalipan, Phumin; Kaewthamasorn, Morakot; Harnyuttanakorn, Pongchai; Pattaradilokrat, Sittiporn

    2018-01-01

    Development of an effective vaccine is critically needed for the prevention of malaria. One of the key antigens for malaria vaccines is the apical membrane antigen 1 (AMA-1) of the human malaria parasite Plasmodium falciparum, the surface protein for erythrocyte invasion of the parasite. The gene encoding AMA-1 has been sequenced from populations of P. falciparum worldwide, but the haplotype diversity of the gene in P. falciparum populations in the Greater Mekong Subregion (GMS), including Thailand, remains to be characterized. In the present study, the AMA-1 gene was PCR amplified and sequenced from the genomic DNA of 65 P. falciparum isolates from 5 endemic areas in Thailand. The nearly full-length 1,848 nucleotide sequence of AMA-1 was subjected to molecular analyses, including nucleotide sequence diversity, haplotype diversity and deduced amino acid sequence diversity and neutrality tests. Phylogenetic analysis and pairwise population differentiation (Fst indices) were performed to infer the population structure. The analyses identified 60 single nucleotide polymorphic loci, predominately located in domain I of AMA-1. A total of 31 unique AMA-1 haplotypes were identified, which included 11 novel ones. The phylogenetic tree of the AMA-1 haplotypes revealed multiple clades of AMA-1, each of which contained parasites of multiple geographical origins, consistent with the Fst indices indicating genetic homogeneity or gene flow among geographically distinct populations of P. falciparum in Thailand’s borders with Myanmar, Laos and Cambodia. In summary, the study revealed novel haplotypes and population structure needed for the further advancement of AMA-1-based malaria vaccines in the GMS. PMID:29742870

  16. Late Multiple Organ Surge in Interferon-Regulated Target Genes Characterizes Staphylococcal Enterotoxin B Lethality

    PubMed Central

    Ferreyra, Gabriela A.; Elinoff, Jason M.; Demirkale, Cumhur Y.; Starost, Matthew F.; Buckley, Marilyn; Munson, Peter J.; Krakauer, Teresa; Danner, Robert L.

    2014-01-01

    Background Bacterial superantigens are virulence factors that cause toxic shock syndrome. Here, the genome-wide, temporal response of mice to lethal intranasal staphylococcal enterotoxin B (SEB) challenge was investigated in six tissues. Results The earliest responses and largest number of affected genes occurred in peripheral blood mononuclear cells (PBMC), spleen, and lung tissues with the highest content of both T-cells and monocyte/macrophages, the direct cellular targets of SEB. In contrast, the response of liver, kidney, and heart was delayed and involved fewer genes, but revealed a dominant genetic program that was seen in all 6 tissues. Many of the 85 uniquely annotated transcripts participating in this shared genomic response have not been previously linked to SEB. Nine of the 85 genes were subsequently confirmed by RT-PCR in every tissue/organ at 24 h. These 85 transcripts, up-regulated in all tissues, annotated to the interferon (IFN)/antiviral-response and included genes belonging to the DNA/RNA sensing system, DNA damage repair, the immunoproteasome, and the ER/metabolic stress-response and apoptosis pathways. Overall, this shared program was identified as a type I and II interferon (IFN)-response and the promoters of these genes were highly enriched for IFN regulatory matrices. Several genes whose secreted products induce the IFN pathway were up-regulated at early time points in PBMCs, spleen, and/or lung. Furthermore, IFN regulatory factors including Irf1, Irf7 and Irf8, and Zbp1, a DNA sensor/transcription factor that can directly elicit an IFN innate immune response, participated in this host-wide SEB signature. Conclusion Global gene-expression changes across multiple organs implicated a host-wide IFN-response in SEB-induced death. Therapies aimed at IFN-associated innate immunity may improve outcome in toxic shock syndromes. PMID:24551153

  17. Integrated analysis of miRNA and mRNA expression data identifies multiple miRNAs regulatory networks for the tumorigenesis of colorectal cancer.

    PubMed

    Xu, Peng; Wang, Junhua; Sun, Bo; Xiao, Zhongdang

    2018-06-15

    Investigating the potential biological function of differential changed genes through integrating multiple omics data including miRNA and mRNA expression profiles, is always hot topic. However, how to evaluate the repression effect on target genes integrating miRNA and mRNA expression profiles are not fully solved. In this study, we provide an analyzing method by integrating both miRNAs and mRNAs expression data simultaneously. Difference analysis was adopted based on the repression score, then significantly repressed mRNAs were screened out by DEGseq. Pathway analysis for the significantly repressed mRNAs shows that multiple pathways such as MAPK signaling pathway, TGF-beta signaling pathway and so on, may correlated to the colorectal cancer(CRC). Focusing on the MAPK signaling pathway, a miRNA-mRNA network that centering the cell fate genes was constructed. Finally, the miRNA-mRNAs that potentially important in the CRC carcinogenesis were screened out and scored by impact index. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. Integrative prescreening in analysis of multiple cancer genomic studies

    PubMed Central

    2012-01-01

    Background In high throughput cancer genomic studies, results from the analysis of single datasets often suffer from a lack of reproducibility because of small sample sizes. Integrative analysis can effectively pool and analyze multiple datasets and provides a cost effective way to improve reproducibility. In integrative analysis, simultaneously analyzing all genes profiled may incur high computational cost. A computationally affordable remedy is prescreening, which fits marginal models, can be conducted in a parallel manner, and has low computational cost. Results An integrative prescreening approach is developed for the analysis of multiple cancer genomic datasets. Simulation shows that the proposed integrative prescreening has better performance than alternatives, particularly including prescreening with individual datasets, an intensity approach and meta-analysis. We also analyze multiple microarray gene profiling studies on liver and pancreatic cancers using the proposed approach. Conclusions The proposed integrative prescreening provides an effective way to reduce the dimensionality in cancer genomic studies. It can be coupled with existing analysis methods to identify cancer markers. PMID:22799431

  19. The simultaneous occurrence of multiple myeloma and JAK2 positive myeloproliferative neoplasms - Report on two cases

    PubMed Central

    Badelita, S; Dobrea, C; Colita, A; Dogaru, M; Dragomir, M; Jardan, C; Coriu, D

    2015-01-01

    Multiple myeloma and JAK2 positive chronic myeloproliferative neoplasms are hematologic malignancies with a completely different cellular origin. Two cases of simultaneous occurrence of multiple myeloma, one with primary myelofibrosis and another one with essential thrombocythemia are reported in this article. In such cases, an accurate diagnosis requires a molecular testing, including gene sequencing and differential diagnosis of pancytosis associated with splenic amyloidosis. In general, in such cases, of two coexisting malignant hematologic diseases, the treatment of the most aggressive one is recommended. For our two cases, it was decided to start a Velcade based therapy. The main concern was the medullar toxicity, especially when a multiple myeloma was associated with a primary myelofibrosis. Abbreviations:JAK2 = Janus kinase 2 gene, PMF = primary myelofibrosis, MPNs = myeloproliferative neoplasms, ET = essential thrombocythemia, PV = polycythemia vera, MM = multiple myeloma, WBC = white blood cells, Hb = haemoglobin, Ht = haematocrit, Plt = platelets, BMB = bone marrow biopsy, CBC = blood cell count, CT = computerized tomography, LAP = leukocyte alkaline phosphatase, MGUS = monoclonal gammopathy of undetermined significance. PMID:25914740

  20. Association of interleukin-1 gene variations with moderate to severe chronic periodontitis in multiple ethnicities

    PubMed Central

    Wu, X; Offenbacher, S; Lόpez, N J; Chen, D; Wang, H-Y; Rogus, J; Zhou, J; Beck, J; Jiang, S; Bao, X; Wilkins, L; Doucette-Stamm, L; Kornman, K

    2015-01-01

    Background and Objective Genetic markers associated with disease are often non-functional and generally tag one or more functional “causative” variants in linkage disequilibrium. Markers may not show tight linkage to the causative variants across multiple ethnicities due to evolutionary divergence, and therefore may not be informative across different population groups. Validated markers of disease suggest causative variants exist in the gene and, if the causative variants can be identified, it is reasonable to hypothesize that such variants will be informative across diverse populations. The aim of this study was to test that hypothesis using functional Interleukin-1 (IL-1) gene variations across multiple ethnic populations to replace the non-functional markers originally associated with chronic adult periodontitis in Caucasians. Material and Methods Adult chronic periodontitis cases and controls from four ethnic groups (Caucasians, African Americans, Hispanics and Asians) were recruited in the USA, Chile and China. Genotypes of IL1B gene single nucleotide polymorphisms (SNPs), including three functional SNPs (rs16944, rs1143623, rs4848306) in the promoter and one intronic SNP (rs1143633), were determined using a single base extension method or TaqMan 5′ nuclease assay. Logistic regression and other statistical analyses were used to examine the association between moderate to severe periodontitis and IL1B gene variations, including SNPs, haplotypes and composite genotypes. Genotype patterns associated with disease in the discovery study were then evaluated in independent validation studies. Results Significant associations were identified in the discovery study, consisting of Caucasians and African Americans, between moderate to severe adult chronic periodontitis and functional variations in the IL1B gene, including a pattern of four IL1B SNPs (OR = 1.87, p < 0.0001). The association between the disease and this IL1B composite genotype pattern was validated in two additional studies consisting of Hispanics (OR = 1.95, p = 0.04) or Asians (OR = 3.27, p = 0.01). A meta-analysis of the three populations supported the association between the IL-1 genotype pattern and moderate to severe periodontitis (OR 1.95; p < 0.001). Our analysis also demonstrated that IL1B gene variations had added value to conventional risk factors in predicting chronic periodontitis. Conclusion This study validated the influence of IL-1 genetic factors on the severity of chronic periodontitis in four different ethnicities. PMID:24690098

  1. Molecular Profiling of Glatiramer Acetate Early Treatment Effects in Multiple Sclerosis

    PubMed Central

    Achiron, Anat; Feldman, Anna; Gurevich, Michael

    2009-01-01

    Background: Glatiramer acetate (GA, Copaxone®) has beneficial effects on the clinical course of relapsing-remitting multiple sclerosis (RRMS). However, the exact molecular mechanisms of GA effects are only partially understood. Objective: To characterized GA molecular effects in RRMS patients within 3 months of treatment by microarray profiling of peripheral blood mononuclear cells (PBMC). Methods: Gene-expression profiles were determined in RRMS patients before and at 3 months after initiation of GA treatment using Affimetrix (U133A-2) microarrays containing 14,500 well-characterized human genes. Most informative genes (MIGs) of GA-induced biological convergent pathways operating in RRMS were constructed using gene functional annotation, enrichment analysis and pathway reconstruction bioinformatic softwares. Verification at the mRNA and protein level was performed by qRT-PCR and FACS. Results: GA induced a specific gene expression molecular signature that included altered expression of 480 genes within 3 months of treatment; 262 genes were up-regulated, and 218 genes were down-regulated. The main convergent mechanisms of GA effects were related to antigen-activated apoptosis, inflammation, adhesion, and MHC class-I antigen presentation. Conclusions: Our findings demonstrate that GA treatment induces alternations of immunomodulatory gene expression patterns that are important for suppression of disease activity already at three months of treatment and can be used as molecular markers of GA activity. PMID:19893201

  2. The first Korean patient with Potocki-Shaffer syndrome: a rare cause of multiple exostoses.

    PubMed

    Sohn, Young Bae; Yim, Shin-Young; Cho, Eun-Hae; Kim, Ok-Hwa

    2015-02-01

    Potocki-Shaffer syndrome (PSS, OMIM #601224) is a rare contiguous gene deletion syndrome caused by haploinsufficiency of genes located on the 11p11.2p12. Affected individuals have a number of characteristic features including multiple exostoses, biparietal foramina, abnormalities of genitourinary system, hypotonia, developmental delay, and intellectual disability. We report here on the first Korean case of an 8-yr-old boy with PSS diagnosed by high resolution microarray. Initial evaluation was done at age 6 months because of a history of developmental delay, hypotonia, and dysmorphic face. Coronal craniosynostosis and enlarged parietal foramina were found on skull radiographs. At age 6 yr, he had severe global developmental delay. Multiple exostoses of long bones were detected during a radiological check-up. Based on the clinical and radiological features, PSS was highly suspected. Subsequently, chromosomal microarray analysis identified an 8.6 Mb deletion at 11p11.2 [arr 11p12p11.2 (Chr11:39,204,770-47,791,278)×1]. The patient continued rehabilitation therapy for profound developmental delay. The progression of multiple exostosis has being monitored. This case confirms and extends data on the genetic basis of PSS. In clinical and radiologic aspect, a patient with multiple exostoses accompanying with syndromic features, including craniofacial abnormalities and mental retardation, the diagnosis of PSS should be considered.

  3. Variation of types of alcoholism: review and subtypes identified in Han Chinese.

    PubMed

    Lee, Sheng-Yu; Chen, Shiou-Lan; Chang, Yun-Hsuan; Lu, Ru-Band

    2014-01-03

    Alcoholism, as it has been hypothesized, is caused by a highly heterogeneous genetic load. Since 1960, many reports have used the bio-psycho-social approach to subtype alcoholism; however, no subtypes have been genetically validated. We reviewed and compared the major single-gene, multiple-gene, and gene-to-gene interaction studies on alcoholism published during the past quarter-century, including many recent studies that have made contributions to the subtyping of alcoholism. Four subtypes of alcoholism have been reported: [1] pure alcoholism, [2] anxiety/depression alcoholism, [3] antisocial alcoholism, and [4] mixed alcoholism. Most of the important studies focused on three genes: DRD2, MAOA, and ALDH2. Therefore, our review focuses on these three genes. © 2013.

  4. The metazoan Mediator co-activator complex as an integrative hub for transcriptional regulation.

    PubMed

    Malik, Sohail; Roeder, Robert G

    2010-11-01

    The Mediator is an evolutionarily conserved, multiprotein complex that is a key regulator of protein-coding genes. In metazoan cells, multiple pathways that are responsible for homeostasis, cell growth and differentiation converge on the Mediator through transcriptional activators and repressors that target one or more of the almost 30 subunits of this complex. Besides interacting directly with RNA polymerase II, Mediator has multiple functions and can interact with and coordinate the action of numerous other co-activators and co-repressors, including those acting at the level of chromatin. These interactions ultimately allow the Mediator to deliver outputs that range from maximal activation of genes to modulation of basal transcription to long-term epigenetic silencing.

  5. The extraction of simple relationships in growth factor-specific multiple-input and multiple-output systems in cell-fate decisions by backward elimination PLS regression.

    PubMed

    Akimoto, Yuki; Yugi, Katsuyuki; Uda, Shinsuke; Kudo, Takamasa; Komori, Yasunori; Kubota, Hiroyuki; Kuroda, Shinya

    2013-01-01

    Cells use common signaling molecules for the selective control of downstream gene expression and cell-fate decisions. The relationship between signaling molecules and downstream gene expression and cellular phenotypes is a multiple-input and multiple-output (MIMO) system and is difficult to understand due to its complexity. For example, it has been reported that, in PC12 cells, different types of growth factors activate MAP kinases (MAPKs) including ERK, JNK, and p38, and CREB, for selective protein expression of immediate early genes (IEGs) such as c-FOS, c-JUN, EGR1, JUNB, and FOSB, leading to cell differentiation, proliferation and cell death; however, how multiple-inputs such as MAPKs and CREB regulate multiple-outputs such as expression of the IEGs and cellular phenotypes remains unclear. To address this issue, we employed a statistical method called partial least squares (PLS) regression, which involves a reduction of the dimensionality of the inputs and outputs into latent variables and a linear regression between these latent variables. We measured 1,200 data points for MAPKs and CREB as the inputs and 1,900 data points for IEGs and cellular phenotypes as the outputs, and we constructed the PLS model from these data. The PLS model highlighted the complexity of the MIMO system and growth factor-specific input-output relationships of cell-fate decisions in PC12 cells. Furthermore, to reduce the complexity, we applied a backward elimination method to the PLS regression, in which 60 input variables were reduced to 5 variables, including the phosphorylation of ERK at 10 min, CREB at 5 min and 60 min, AKT at 5 min and JNK at 30 min. The simple PLS model with only 5 input variables demonstrated a predictive ability comparable to that of the full PLS model. The 5 input variables effectively extracted the growth factor-specific simple relationships within the MIMO system in cell-fate decisions in PC12 cells.

  6. Cisplatin Resistance: A Cellular Self-Defense Mechanism Resulting from Multiple Epigenetic and Genetic Changes

    PubMed Central

    Shen, Ding-Wu; Pouliot, Lynn M.; Hall, Matthew D.

    2012-01-01

    Cisplatin is one of the most effective broad-spectrum anticancer drugs. Its effectiveness seems to be due to the unique properties of cisplatin, which enters cells via multiple pathways and forms multiple different DNA-platinum adducts while initiating a cellular self-defense system by activating or silencing a variety of different genes, resulting in dramatic epigenetic and/or genetic alternations. As a result, the development of cisplatin resistance in human cancer cells in vivo and in vitro by necessity stems from bewilderingly complex genetic and epigenetic changes in gene expression and alterations in protein localization. Extensive published evidence has demonstrated that pleiotropic alterations are frequently detected during development of resistance to this toxic metal compound. Changes occur in almost every mechanism supporting cell survival, including cell growth-promoting pathways, apoptosis, developmental pathways, DNA damage repair, and endocytosis. In general, dozens of genes are affected in cisplatin-resistant cells, including pathways involved in copper metabolism as well as transcription pathways that alter the cytoskeleton, change cell surface presentation of proteins, and regulate epithelial-to-mesenchymal transition. Decreased accumulation is one of the most common features resulting in cisplatin resistance. This seems to be a consequence of numerous epigenetic and genetic changes leading to the loss of cell-surface binding sites and/or transporters for cisplatin, and decreased fluid phase endocytosis. PMID:22659329

  7. Cisplatin resistance: a cellular self-defense mechanism resulting from multiple epigenetic and genetic changes.

    PubMed

    Shen, Ding-Wu; Pouliot, Lynn M; Hall, Matthew D; Gottesman, Michael M

    2012-07-01

    Cisplatin is one of the most effective broad-spectrum anticancer drugs. Its effectiveness seems to be due to the unique properties of cisplatin, which enters cells via multiple pathways and forms multiple different DNA-platinum adducts while initiating a cellular self-defense system by activating or silencing a variety of different genes, resulting in dramatic epigenetic and/or genetic alternations. As a result, the development of cisplatin resistance in human cancer cells in vivo and in vitro by necessity stems from bewilderingly complex genetic and epigenetic changes in gene expression and alterations in protein localization. Extensive published evidence has demonstrated that pleiotropic alterations are frequently detected during development of resistance to this toxic metal compound. Changes occur in almost every mechanism supporting cell survival, including cell growth-promoting pathways, apoptosis, developmental pathways, DNA damage repair, and endocytosis. In general, dozens of genes are affected in cisplatin-resistant cells, including pathways involved in copper metabolism as well as transcription pathways that alter the cytoskeleton, change cell surface presentation of proteins, and regulate epithelial-to-mesenchymal transition. Decreased accumulation is one of the most common features resulting in cisplatin resistance. This seems to be a consequence of numerous epigenetic and genetic changes leading to the loss of cell-surface binding sites and/or transporters for cisplatin, and decreased fluid phase endocytosis.

  8. PANTHER: a browsable database of gene products organized by biological function, using curated protein family and subfamily classification.

    PubMed

    Thomas, Paul D; Kejariwal, Anish; Campbell, Michael J; Mi, Huaiyu; Diemer, Karen; Guo, Nan; Ladunga, Istvan; Ulitsky-Lazareva, Betty; Muruganujan, Anushya; Rabkin, Steven; Vandergriff, Jody A; Doremieux, Olivier

    2003-01-01

    The PANTHER database was designed for high-throughput analysis of protein sequences. One of the key features is a simplified ontology of protein function, which allows browsing of the database by biological functions. Biologist curators have associated the ontology terms with groups of protein sequences rather than individual sequences. Statistical models (Hidden Markov Models, or HMMs) are built from each of these groups. The advantage of this approach is that new sequences can be automatically classified as they become available. To ensure accurate functional classification, HMMs are constructed not only for families, but also for functionally distinct subfamilies. Multiple sequence alignments and phylogenetic trees, including curator-assigned information, are available for each family. The current version of the PANTHER database includes training sequences from all organisms in the GenBank non-redundant protein database, and the HMMs have been used to classify gene products across the entire genomes of human, and Drosophila melanogaster. The ontology terms and protein families and subfamilies, as well as Drosophila gene c;assifications, can be browsed and searched for free. Due to outstanding contractual obligations, access to human gene classifications and to protein family trees and multiple sequence alignments will temporarily require a nominal registration fee. PANTHER is publicly available on the web at http://panther.celera.com.

  9. Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

    PubMed

    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

    2015-10-01

    The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

  10. Surface enhanced Raman gene probe and methods thereof

    DOEpatents

    Vo-Dinh, T.

    1998-09-29

    The subject invention disclosed herein is a new gene probe biosensor and methods based on surface enhanced Raman scattering (SERS) label detection. The SER gene probe biosensor comprises a support means, a SER gene probe having at least one oligonucleotide strand labeled with at least one SERS label, and a SERS active substrate disposed on the support means and having at least one of the SER gene probes adsorbed thereon. Biotargets such as bacterial and viral DNA, RNA and PNA are detected using a SER gene probe via hybridization to oligonucleotide strands complementary to the SER gene probe. The support means supporting the SERS active substrate includes a fiberoptic probe, an array of fiberoptic probes for performance of multiple assays and a waveguide microsensor array with charge-coupled devices or photodiode arrays. 18 figs.

  11. Surface enhanced Raman gene probe and methods thereof

    DOEpatents

    Vo-Dinh, Tuan

    1998-01-01

    The subject invention disclosed herein is a new gene probe biosensor and methods thereof based on surface enhanced Raman scattering (SERS) label detection. The SER gene probe biosensor comprises a support means, a SER gene probe having at least one oligonucleotide strand labeled with at least one SERS label, and a SERS active substrate disposed on the support means and having at least one of the SER gene probes adsorbed thereon. Biotargets such as bacterial and viral DNA, RNA and PNA are detected using a SER gene probe via hybridization to oligonucleotide strands complementary to the SER gene probe. The support means supporting the SERS active substrate includes a fiberoptic probe, an array of fiberoptic probes for performance of multiple assays and a waveguide microsensor array with charge-coupled devices or photodiode arrays.

  12. Surface enhanced Raman gene probe and methods thereof

    DOEpatents

    Vo-Dinh, T.

    1998-02-24

    The subject invention disclosed is a new gene probe biosensor and methods based on surface enhanced Raman scattering (SERS) label detection. The SER gene probe biosensor comprises a support means, a SER gene probe having at least one oligonucleotide strand labeled with at least one SERS label, and a SERS active substrate disposed on the support means and having at least one of the SER gene probes adsorbed thereon. Biotargets such as bacterial and viral DNA, RNA and PNA are detected using a SER gene probe via hybridization to oligonucleotide strands complementary to the SER gene probe. The support means includes a fiberoptic probe, an array of fiberoptic probes for performance of multiple assays and a waveguide microsensor array with charge-coupled devices or photodiode arrays. 18 figs.

  13. Surface enhanced Raman gene probe and methods thereof

    DOEpatents

    Vo-Dinh, T.

    1998-07-21

    The subject invention disclosed is a new gene probe biosensor and methods based on surface enhanced Raman scattering (SERS) label detection. The SER gene probe biosensor comprises a support means, a SER gene probe having at least one oligonucleotide strand labeled with at least one SERS label, and a SERS active substrate disposed on the support means and having at least one of the SER gene probes adsorbed. Biotargets such as bacterial and viral DNA, RNA and PNA are detected using a SER gene probe via hybridization to oligonucleotide strands complementary to the SER gene probe. The support means supporting the SERS active substrate includes a fiberoptic probe, an array of fiberoptic probes for performance of multiple assays and a waveguide microsensor array with charge-coupled devices or photodiode arrays. 18 figs.

  14. Reduced Abd-B Hox function during kidney development results in lineage infidelity.

    PubMed

    Magella, Bliss; Mahoney, Robert; Adam, Mike; Potter, S Steven

    2018-06-15

    Hox genes can function as key drivers of segment identity, with Hox mutations in Drosophila often resulting in dramatic homeotic transformations. In addition, however, they can serve other essential functions. In mammals, the study of Hox gene roles in development is complicated by the presence of four Hox clusters with a total of 39 genes showing extensive functional overlap. In this study, in order to better understand shared core Hox functions, we examined kidney development in mice with frameshift mutations of multiple Abd-B type Hox genes. The resulting phenotypes included dramatically reduced branching morphogenesis of the ureteric bud, premature depletion of nephron progenitors and abnormal development of the stromal compartment. Most unexpected, however, we also observed a cellular level lineage infidelity in nephron segments. Scattered cells within the proximal tubules, for example, expressed genes normally expressed only in collecting ducts. Multiple combinations of inappropriate nephron segment specific marker expression were found. In some cases, cells within a tubule showed incorrect identity, while in other cases cells showed ambiguous character, with simultaneous expression of genes associated with more than one nephron segment. These results give evidence that Hox genes have an overlapping core function at the cellular level in driving and/or maintaining correct differentiation decisions. Copyright © 2018 Elsevier Inc. All rights reserved.

  15. Identification of evolutionarily conserved DNA damage response genes that alter sensitivity to cisplatin

    PubMed Central

    Gaponova, Anna V.; Deneka, Alexander Y.; Beck, Tim N.; Liu, Hanqing; Andrianov, Gregory; Nikonova, Anna S.; Nicolas, Emmanuelle; Einarson, Margret B.; Golemis, Erica A.; Serebriiskii, Ilya G.

    2017-01-01

    Ovarian, head and neck, and other cancers are commonly treated with cisplatin and other DNA damaging cytotoxic agents. Altered DNA damage response (DDR) contributes to resistance of these tumors to chemotherapies, some targeted therapies, and radiation. DDR involves multiple protein complexes and signaling pathways, some of which are evolutionarily ancient and involve protein orthologs conserved from yeast to humans. To identify new regulators of cisplatin-resistance in human tumors, we integrated high throughput and curated datasets describing yeast genes that regulate sensitivity to cisplatin and/or ionizing radiation. Next, we clustered highly validated genes based on chemogenomic profiling, and then mapped orthologs of these genes in expanded genomic networks for multiple metazoans, including humans. This approach identified an enriched candidate set of genes involved in the regulation of resistance to radiation and/or cisplatin in humans. Direct functional assessment of selected candidate genes using RNA interference confirmed their activity in influencing cisplatin resistance, degree of γH2AX focus formation and ATR phosphorylation, in ovarian and head and neck cancer cell lines, suggesting impaired DDR signaling as the driving mechanism. This work enlarges the set of genes that may contribute to chemotherapy resistance and provides a new contextual resource for interpreting next generation sequencing (NGS) genomic profiling of tumors. PMID:27863405

  16. TRAM (Transcriptome Mapper): database-driven creation and analysis of transcriptome maps from multiple sources

    PubMed Central

    2011-01-01

    Background Several tools have been developed to perform global gene expression profile data analysis, to search for specific chromosomal regions whose features meet defined criteria as well as to study neighbouring gene expression. However, most of these tools are tailored for a specific use in a particular context (e.g. they are species-specific, or limited to a particular data format) and they typically accept only gene lists as input. Results TRAM (Transcriptome Mapper) is a new general tool that allows the simple generation and analysis of quantitative transcriptome maps, starting from any source listing gene expression values for a given gene set (e.g. expression microarrays), implemented as a relational database. It includes a parser able to assign univocal and updated gene symbols to gene identifiers from different data sources. Moreover, TRAM is able to perform intra-sample and inter-sample data normalization, including an original variant of quantile normalization (scaled quantile), useful to normalize data from platforms with highly different numbers of investigated genes. When in 'Map' mode, the software generates a quantitative representation of the transcriptome of a sample (or of a pool of samples) and identifies if segments of defined lengths are over/under-expressed compared to the desired threshold. When in 'Cluster' mode, the software searches for a set of over/under-expressed consecutive genes. Statistical significance for all results is calculated with respect to genes localized on the same chromosome or to all genome genes. Transcriptome maps, showing differential expression between two sample groups, relative to two different biological conditions, may be easily generated. We present the results of a biological model test, based on a meta-analysis comparison between a sample pool of human CD34+ hematopoietic progenitor cells and a sample pool of megakaryocytic cells. Biologically relevant chromosomal segments and gene clusters with differential expression during the differentiation toward megakaryocyte were identified. Conclusions TRAM is designed to create, and statistically analyze, quantitative transcriptome maps, based on gene expression data from multiple sources. The release includes FileMaker Pro database management runtime application and it is freely available at http://apollo11.isto.unibo.it/software/, along with preconfigured implementations for mapping of human, mouse and zebrafish transcriptomes. PMID:21333005

  17. Fast Construction of Near Parsimonious Hybridization Networks for Multiple Phylogenetic Trees.

    PubMed

    Mirzaei, Sajad; Wu, Yufeng

    2016-01-01

    Hybridization networks represent plausible evolutionary histories of species that are affected by reticulate evolutionary processes. An established computational problem on hybridization networks is constructing the most parsimonious hybridization network such that each of the given phylogenetic trees (called gene trees) is "displayed" in the network. There have been several previous approaches, including an exact method and several heuristics, for this NP-hard problem. However, the exact method is only applicable to a limited range of data, and heuristic methods can be less accurate and also slow sometimes. In this paper, we develop a new algorithm for constructing near parsimonious networks for multiple binary gene trees. This method is more efficient for large numbers of gene trees than previous heuristics. This new method also produces more parsimonious results on many simulated datasets as well as a real biological dataset than a previous method. We also show that our method produces topologically more accurate networks for many datasets.

  18. Small RNAs Reflect Grandparental Environments in Apomictic Dandelion

    PubMed Central

    Morgado, Lionel; Preite, Veronica; Oplaat, Carla; Anava, Sarit; Ferreira de Carvalho, Julie; Rechavi, Oded; Johannes, Frank; Verhoeven, Koen J.F.

    2017-01-01

    Abstract Plants can show long-term effects of environmental stresses and in some cases a stress “memory” has been reported to persist across generations, potentially mediated by epigenetic mechanisms. However, few documented cases exist of transgenerational effects that persist for multiple generations and it remains unclear if or how epigenetic mechanisms are involved. Here, we show that the composition of small regulatory RNAs in apomictic dandelion lineages reveals a footprint of drought stress and salicylic acid treatment experienced two generations ago. Overall proportions of 21 and 24 nt RNA pools were shifted due to grandparental treatments. While individual genes did not show strong up- or downregulation of associated sRNAs, the subset of genes that showed the strongest shifts in sRNA abundance was significantly enriched for several GO terms including stress-specific functions. This suggests that a stress-induced signal was transmitted across multiple unexposed generations leading to persistent changes in epigenetic gene regulation. PMID:28472380

  19. Recent progress in the genetics of spontaneously hypertensive rats.

    PubMed

    Pravenec, M; Křen, V; Landa, V; Mlejnek, P; Musilová, A; Šilhavý, J; Šimáková, M; Zídek, V

    2014-01-01

    The spontaneously hypertensive rat (SHR) is the most widely used animal model of essential hypertension and accompanying metabolic disturbances. Recent advances in sequencing of genomes of BN-Lx and SHR progenitors of the BXH/HXB recombinant inbred (RI) strains as well as accumulation of multiple data sets of intermediary phenotypes in the RI strains, including mRNA and microRNA abundance, quantitative metabolomics, proteomics, methylomics or histone modifications, will make it possible to systematically search for genetic variants involved in regulation of gene expression and in the etiology of complex pathophysiological traits. New advances in manipulation of the rat genome, including efficient transgenesis and gene targeting, will enable in vivo functional analyses of selected candidate genes to identify QTL at the molecular level or to provide insight into mechanisms whereby targeted genes affect pathophysiological traits in the SHR.

  20. PSAT: A web tool to compare genomic neighborhoods of multiple prokaryotic genomes

    PubMed Central

    Fong, Christine; Rohmer, Laurence; Radey, Matthew; Wasnick, Michael; Brittnacher, Mitchell J

    2008-01-01

    Background The conservation of gene order among prokaryotic genomes can provide valuable insight into gene function, protein interactions, or events by which genomes have evolved. Although some tools are available for visualizing and comparing the order of genes between genomes of study, few support an efficient and organized analysis between large numbers of genomes. The Prokaryotic Sequence homology Analysis Tool (PSAT) is a web tool for comparing gene neighborhoods among multiple prokaryotic genomes. Results PSAT utilizes a database that is preloaded with gene annotation, BLAST hit results, and gene-clustering scores designed to help identify regions of conserved gene order. Researchers use the PSAT web interface to find a gene of interest in a reference genome and efficiently retrieve the sequence homologs found in other bacterial genomes. The tool generates a graphic of the genomic neighborhood surrounding the selected gene and the corresponding regions for its homologs in each comparison genome. Homologs in each region are color coded to assist users with analyzing gene order among various genomes. In contrast to common comparative analysis methods that filter sequence homolog data based on alignment score cutoffs, PSAT leverages gene context information for homologs, including those with weak alignment scores, enabling a more sensitive analysis. Features for constraining or ordering results are designed to help researchers browse results from large numbers of comparison genomes in an organized manner. PSAT has been demonstrated to be useful for helping to identify gene orthologs and potential functional gene clusters, and detecting genome modifications that may result in loss of function. Conclusion PSAT allows researchers to investigate the order of genes within local genomic neighborhoods of multiple genomes. A PSAT web server for public use is available for performing analyses on a growing set of reference genomes through any web browser with no client side software setup or installation required. Source code is freely available to researchers interested in setting up a local version of PSAT for analysis of genomes not available through the public server. Access to the public web server and instructions for obtaining source code can be found at . PMID:18366802

  1. Computational Identification of Tissue-Specific Splicing Regulatory Elements in Human Genes from RNA-Seq Data.

    PubMed

    Badr, Eman; ElHefnawi, Mahmoud; Heath, Lenwood S

    2016-01-01

    Alternative splicing is a vital process for regulating gene expression and promoting proteomic diversity. It plays a key role in tissue-specific expressed genes. This specificity is mainly regulated by splicing factors that bind to specific sequences called splicing regulatory elements (SREs). Here, we report a genome-wide analysis to study alternative splicing on multiple tissues, including brain, heart, liver, and muscle. We propose a pipeline to identify differential exons across tissues and hence tissue-specific SREs. In our pipeline, we utilize the DEXSeq package along with our previously reported algorithms. Utilizing the publicly available RNA-Seq data set from the Human BodyMap project, we identified 28,100 differentially used exons across the four tissues. We identified tissue-specific exonic splicing enhancers that overlap with various previously published experimental and computational databases. A complicated exonic enhancer regulatory network was revealed, where multiple exonic enhancers were found across multiple tissues while some were found only in specific tissues. Putative combinatorial exonic enhancers and silencers were discovered as well, which may be responsible for exon inclusion or exclusion across tissues. Some of the exonic enhancers are found to be co-occurring with multiple exonic silencers and vice versa, which demonstrates a complicated relationship between tissue-specific exonic enhancers and silencers.

  2. Information Commons for Rice (IC4R)

    PubMed Central

    2016-01-01

    Rice is the most important staple food for a large part of the world's human population and also a key model organism for plant research. Here, we present Information Commons for Rice (IC4R; http://ic4r.org), a rice knowledgebase featuring adoption of an extensible and sustainable architecture that integrates multiple omics data through community-contributed modules. Each module is developed and maintained by different committed groups, deals with data collection, processing and visualization, and delivers data on-demand via web services. In the current version, IC4R incorporates a variety of rice data through multiple committed modules, including genome-wide expression profiles derived entirely from RNA-Seq data, resequencing-based genomic variations obtained from re-sequencing data of thousands of rice varieties, plant homologous genes covering multiple diverse plant species, post-translational modifications, rice-related literatures and gene annotations contributed by the rice research community. Unlike extant related databases, IC4R is designed for scalability and sustainability and thus also features collaborative integration of rice data and low costs for database update and maintenance. Future directions of IC4R include incorporation of other omics data and association of multiple omics data with agronomically important traits, dedicating to build IC4R into a valuable knowledgebase for both basic and translational researches in rice. PMID:26519466

  3. Pyrethroid Resistance in Malaysian Populations of Dengue Vector Aedes aegypti Is Mediated by CYP9 Family of Cytochrome P450 Genes.

    PubMed

    Ishak, Intan H; Kamgang, Basile; Ibrahim, Sulaiman S; Riveron, Jacob M; Irving, Helen; Wondji, Charles S

    2017-01-01

    Dengue control and prevention rely heavily on insecticide-based interventions. However, insecticide resistance in the dengue vector Aedes aegypti, threatens the continued effectiveness of these tools. The molecular basis of the resistance remains uncharacterised in many endemic countries including Malaysia, preventing the design of evidence-based resistance management. Here, we investigated the underlying molecular basis of multiple insecticide resistance in Ae. aegypti populations across Malaysia detecting the major genes driving the metabolic resistance. Genome-wide microarray-based transcription analysis was carried out to detect the genes associated with metabolic resistance in these populations. Comparisons of the susceptible New Orleans strain to three non-exposed multiple insecticide resistant field strains; Penang, Kuala Lumpur and Kota Bharu detected 2605, 1480 and 425 differentially expressed transcripts respectively (fold-change>2 and p-value ≤ 0.05). 204 genes were commonly over-expressed with monooxygenase P450 genes (CYP9J27, CYP6CB1, CYP9J26 and CYP9M4) consistently the most up-regulated detoxification genes in all populations, indicating that they possibly play an important role in the resistance. In addition, glutathione S-transferases, carboxylesterases and other gene families commonly associated with insecticide resistance were also over-expressed. Gene Ontology (GO) enrichment analysis indicated an over-representation of GO terms linked to resistance such as monooxygenases, carboxylesterases, glutathione S-transferases and heme-binding. Polymorphism analysis of CYP9J27 sequences revealed a high level of polymorphism (except in Joho Bharu), suggesting a limited directional selection on this gene. In silico analysis of CYP9J27 activity through modelling and docking simulations suggested that this gene is involved in the multiple resistance in Malaysian populations as it is predicted to metabolise pyrethroids, DDT and bendiocarb. The predominant over-expression of cytochrome P450s suggests that synergist-based (PBO) control tools could be utilised to improve control of this major dengue vector across Malaysia.

  4. Development and applications of transgenesis in the yellow fever mosquito, Aedes aegypti.

    PubMed

    Adelman, Zachary N; Jasinskiene, Nijole; James, Anthony A

    2002-04-30

    Transgenesis technology has been developed for the yellow fever mosquito, Aedes aegypti. Successful integration of exogenous DNA into the germline of this mosquito has been achieved with the class II transposable elements, Hermes, mariner and piggyBac. A number of marker genes, including the cinnabar(+) gene of Drosophila melanogaster, and fluorescent protein genes, can be used to monitor the insertion of these elements. The availability of multiple elements and marker genes provides a powerful set of tools to investigate basic biological properties of this vector insect, as well as the materials for developing novel, genetics-based, control strategies for the transmission of disease.

  5. Gene Therapy for Infectious Diseases

    PubMed Central

    Bunnell, Bruce A.; Morgan, Richard A.

    1998-01-01

    Gene therapy is being investigated as an alternative treatment for a wide range of infectious diseases that are not amenable to standard clinical management. Approaches to gene therapy for infectious diseases can be divided into three broad categories: (i) gene therapies based on nucleic acid moieties, including antisense DNA or RNA, RNA decoys, and catalytic RNA moieties (ribozymes); (ii) protein approaches such as transdominant negative proteins and single-chain antibodies; and (iii) immunotherapeutic approaches involving genetic vaccines or pathogen-specific lymphocytes. It is further possible that combinations of the aforementioned approaches will be used simultaneously to inhibit multiple stages of the life cycle of the infectious agent. PMID:9457428

  6. [Analysis of genetic models and gene effects on main agronomy characters in rapeseed].

    PubMed

    Li, J; Qiu, J; Tang, Z; Shen, L

    1992-01-01

    According to four different genetic models, the genetic patterns of 8 agronomy traits were analysed by using the data of 24 generations which included positive and negative cross of 81008 x Tower, both of the varieties are of good quality. The results showed that none of 8 characters could fit in with additive-dominance models. Epistasis was found in all of these characters, and it has significant effect on generation means. Seed weight/plant and some other main yield characters are controlled by duplicate interaction genes. The interaction between triple genes or multiple genes needs to be utilized in yield heterosis.

  7. Genetics Home Reference: familial pityriasis rubra pilaris

    MedlinePlus

    ... interacting proteins known as nuclear factor-kappa-B (NF-κB). NF-κB regulates the activity of multiple genes, including ... but it is particularly abundant in the skin. NF-κB signaling appears to play an important role ...

  8. Multiple signals at the extended 8p23 locus are associated with susceptibility to systemic lupus erythematosus.

    PubMed

    Demirci, F Yesim; Wang, Xingbin; Morris, David L; Feingold, Eleanor; Bernatsky, Sasha; Pineau, Christian; Clarke, Ann; Ramsey-Goldman, Rosalind; Manzi, Susan; Vyse, Timothy J; Kamboh, M I

    2017-06-01

    A major systemic lupus erythematosus (SLE) susceptibility locus lies within a common inversion polymorphism region (encompassing 3.8 - 4.5  Mb) located at 8p23. Initially implicated genes included FAM167A-BLK and XKR6 , of which BLK received major attention due to its known role in B-cell biology. Recently, additional SLE risk carried in non-inverted background was also reported. In this case -control study, we further investigated the 'extended' 8p23 locus (~ 4  Mb) where we observed multiple SLE signals and assessed these signals for their relation to the inversion affecting this region. The study involved a North American discovery data set ( ~ 1200  subjects) and a replication data set (> 10 000  subjects) comprising European-descent individuals. Meta-analysis of 8p23 SNPs, with p < 0.05 in both data sets, identified 51 genome-wide significant SNPs (p < 5.0 × 10 -8 ). While most of these SNPs were related to previously implicated signals ( XKR6-FAM167A-BLK subregion), our results also revealed two 'new' SLE signals, including SGK223-CLDN23-MFHAS1 (6.06 × 10 -9 ≤ meta p ≤ 4.88 × 10 -8 ) and CTSB (meta p = 4.87 × 10 -8 ) subregions that are located > 2 Mb upstream and ~ 0.3  Mb downstream from previously reported signals. Functional assessment of relevant SNPs indicated putative cis -effects on the expression of various genes at 8p23. Additional analyses in discovery sample, where the inversion genotypes were inferred, replicated the association of non-inverted status with SLE risk and suggested that a number of SLE risk alleles are predominantly carried in non-inverted background. Our results implicate multiple (known+novel) SLE signals/genes at the extended 8p23 locus, beyond previously reported signals/genes, and suggest that this broad locus contributes to SLE risk through the effects of multiple genes/pathways. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  9. Calcisponges have a ParaHox gene and dynamic expression of dispersed NK homeobox genes.

    PubMed

    Fortunato, Sofia A V; Adamski, Marcin; Ramos, Olivia Mendivil; Leininger, Sven; Liu, Jing; Ferrier, David E K; Adamska, Maja

    2014-10-30

    Sponges are simple animals with few cell types, but their genomes paradoxically contain a wide variety of developmental transcription factors, including homeobox genes belonging to the Antennapedia (ANTP) class, which in bilaterians encompass Hox, ParaHox and NK genes. In the genome of the demosponge Amphimedon queenslandica, no Hox or ParaHox genes are present, but NK genes are linked in a tight cluster similar to the NK clusters of bilaterians. It has been proposed that Hox and ParaHox genes originated from NK cluster genes after divergence of sponges from the lineage leading to cnidarians and bilaterians. On the other hand, synteny analysis lends support to the notion that the absence of Hox and ParaHox genes in Amphimedon is a result of secondary loss (the ghost locus hypothesis). Here we analysed complete suites of ANTP-class homeoboxes in two calcareous sponges, Sycon ciliatum and Leucosolenia complicata. Our phylogenetic analyses demonstrate that these calcisponges possess orthologues of bilaterian NK genes (Hex, Hmx and Msx), a varying number of additional NK genes and one ParaHox gene, Cdx. Despite the generation of scaffolds spanning multiple genes, we find no evidence of clustering of Sycon NK genes. All Sycon ANTP-class genes are developmentally expressed, with patterns suggesting their involvement in cell type specification in embryos and adults, metamorphosis and body plan patterning. These results demonstrate that ParaHox genes predate the origin of sponges, thus confirming the ghost locus hypothesis, and highlight the need to analyse the genomes of multiple sponge lineages to obtain a complete picture of the ancestral composition of the first animal genome.

  10. Dinucleotide controlled null models for comparative RNA gene prediction.

    PubMed

    Gesell, Tanja; Washietl, Stefan

    2008-05-27

    Comparative prediction of RNA structures can be used to identify functional noncoding RNAs in genomic screens. It was shown recently by Babak et al. [BMC Bioinformatics. 8:33] that RNA gene prediction programs can be biased by the genomic dinucleotide content, in particular those programs using a thermodynamic folding model including stacking energies. As a consequence, there is need for dinucleotide-preserving control strategies to assess the significance of such predictions. While there have been randomization algorithms for single sequences for many years, the problem has remained challenging for multiple alignments and there is currently no algorithm available. We present a program called SISSIz that simulates multiple alignments of a given average dinucleotide content. Meeting additional requirements of an accurate null model, the randomized alignments are on average of the same sequence diversity and preserve local conservation and gap patterns. We make use of a phylogenetic substitution model that includes overlapping dependencies and site-specific rates. Using fast heuristics and a distance based approach, a tree is estimated under this model which is used to guide the simulations. The new algorithm is tested on vertebrate genomic alignments and the effect on RNA structure predictions is studied. In addition, we directly combined the new null model with the RNAalifold consensus folding algorithm giving a new variant of a thermodynamic structure based RNA gene finding program that is not biased by the dinucleotide content. SISSIz implements an efficient algorithm to randomize multiple alignments preserving dinucleotide content. It can be used to get more accurate estimates of false positive rates of existing programs, to produce negative controls for the training of machine learning based programs, or as standalone RNA gene finding program. Other applications in comparative genomics that require randomization of multiple alignments can be considered. SISSIz is available as open source C code that can be compiled for every major platform and downloaded here: http://sourceforge.net/projects/sissiz.

  11. A knowledge-driven interaction analysis reveals potential neurodegenerative mechanism of multiple sclerosis susceptibility.

    PubMed

    Bush, W S; McCauley, J L; DeJager, P L; Dudek, S M; Hafler, D A; Gibson, R A; Matthews, P M; Kappos, L; Naegelin, Y; Polman, C H; Hauser, S L; Oksenberg, J; Haines, J L; Ritchie, M D

    2011-07-01

    Gene-gene interactions are proposed as an important component of the genetic architecture of complex diseases, and are just beginning to be evaluated in the context of genome-wide association studies (GWAS). In addition to detecting epistasis, a benefit to interaction analysis is that it also increases power to detect weak main effects. We conducted a knowledge-driven interaction analysis of a GWAS of 931 multiple sclerosis (MS) trios to discover gene-gene interactions within established biological contexts. We identify heterogeneous signals, including a gene-gene interaction between CHRM3 (muscarinic cholinergic receptor 3) and MYLK (myosin light-chain kinase) (joint P=0.0002), an interaction between two phospholipase C-β isoforms, PLCβ1 and PLCβ4 (joint P=0.0098), and a modest interaction between ACTN1 (actinin alpha 1) and MYH9 (myosin heavy chain 9) (joint P=0.0326), all localized to calcium-signaled cytoskeletal regulation. Furthermore, we discover a main effect (joint P=5.2E-5) previously unidentified by single-locus analysis within another related gene, SCIN (scinderin), a calcium-binding cytoskeleton regulatory protein. This work illustrates that knowledge-driven interaction analysis of GWAS data is a feasible approach to identify new genetic effects. The results of this study are among the first gene-gene interactions and non-immune susceptibility loci for MS. Further, the implicated genes cluster within inter-related biological mechanisms that suggest a neurodegenerative component to MS.

  12. JRmGRN: Joint reconstruction of multiple gene regulatory networks with common hub genes using data from multiple tissues or conditions.

    PubMed

    Deng, Wenping; Zhang, Kui; Liu, Sanzhen; Zhao, Patrick; Xu, Shizhong; Wei, Hairong

    2018-04-30

    Joint reconstruction of multiple gene regulatory networks (GRNs) using gene expression data from multiple tissues/conditions is very important for understanding common and tissue/condition-specific regulation. However, there are currently no computational models and methods available for directly constructing such multiple GRNs that not only share some common hub genes but also possess tissue/condition-specific regulatory edges. In this paper, we proposed a new graphic Gaussian model for joint reconstruction of multiple gene regulatory networks (JRmGRN), which highlighted hub genes, using gene expression data from several tissues/conditions. Under the framework of Gaussian graphical model, JRmGRN method constructs the GRNs through maximizing a penalized log likelihood function. We formulated it as a convex optimization problem, and then solved it with an alternating direction method of multipliers (ADMM) algorithm. The performance of JRmGRN was first evaluated with synthetic data and the results showed that JRmGRN outperformed several other methods for reconstruction of GRNs. We also applied our method to real Arabidopsis thaliana RNA-seq data from two light regime conditions in comparison with other methods, and both common hub genes and some conditions-specific hub genes were identified with higher accuracy and precision. JRmGRN is available as a R program from: https://github.com/wenpingd. hairong@mtu.edu. Proof of theorem, derivation of algorithm and supplementary data are available at Bioinformatics online.

  13. 3-Hydroxy-3-methylglutaryl CoA lyase (HL): Mouse and human HL gene (HMGCL) cloning and detection of large gene deletions in two unrelated HL-deficient patients

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, S.P.; Robert, M.F.; Mitchell, G.A.

    1996-04-01

    3-hydroxy-3-methylglutaryl CoA lyase (HL, EC 4.1.3.4) catalyzes the cleavage of 3-hydroxy-3-methylglutaryl CoA to acetoacetic acid and acetyl CoA, the final reaction of both ketogenesis and leucine catabolism. Autosomal-recessive HL deficiency in humans results in episodes of hypoketotic hypoglycemia and coma. Using a mouse HL cDNA as a probe, we isolated a clone containing the full-length mouse HL gene that spans about 15 kb of mouse chromosome 4 and contains nine exons. The promoter region of the mouse HL gene contains elements characteristic of a housekeeping gene: a CpG island containing multiple Sp1 binding sites surrounds exon 1, and neither amore » TATA nor a CAAT box are present. We identified multiple transcription start sites in the mouse HL gene, 35 to 9 bases upstream of the translation start codon. We also isolated two human HL genomic clones that include HL exons 2 to 9 within 18 kb. The mouse and human HL genes (HGMW-approved symbol HMGCL) are highly homologous, with identical locations of intron-exon junctions. By genomic Southern blot analysis and exonic PCR, was found 2 of 33 HL-deficient probands to be homozygous for large deletions in the HL gene. 26 refs., 4 figs., 2 tabs.« less

  14. Microbial genotype-phenotype mapping by class association rule mining.

    PubMed

    Tamura, Makio; D'haeseleer, Patrik

    2008-07-01

    Microbial phenotypes are typically due to the concerted action of multiple gene functions, yet the presence of each gene may have only a weak correlation with the observed phenotype. Hence, it may be more appropriate to examine co-occurrence between sets of genes and a phenotype (multiple-to-one) instead of pairwise relations between a single gene and the phenotype. Here, we propose an efficient class association rule mining algorithm, netCAR, in order to extract sets of COGs (clusters of orthologous groups of proteins) associated with a phenotype from COG phylogenetic profiles and a phenotype profile. netCAR takes into account the phylogenetic co-occurrence graph between COGs to restrict hypothesis space, and uses mutual information to evaluate the biconditional relation. We examined the mining capability of pairwise and multiple-to-one association by using netCAR to extract COGs relevant to six microbial phenotypes (aerobic, anaerobic, facultative, endospore, motility and Gram negative) from 11,969 unique COG profiles across 155 prokaryotic organisms. With the same level of false discovery rate, multiple-to-one association can extract about 10 times more relevant COGs than one-to-one association. We also reveal various topologies of association networks among COGs (modules) from extracted multiple-to-one correlation rules relevant with the six phenotypes; including a well-connected network for motility, a star-shaped network for aerobic and intermediate topologies for the other phenotypes. netCAR outperforms a standard CAR mining algorithm, CARapriori, while requiring several orders of magnitude less computational time for extracting 3-COG sets. Source code of the Java implementation is available as Supplementary Material at the Bioinformatics online website, or upon request to the author. Supplementary data are available at Bioinformatics online.

  15. The origin of parasitism gene in nematodes: evolutionary analysis through the construction of domain trees.

    PubMed

    Yang, Yizi; Luo, Damin

    2013-01-01

    Inferring evolutionary history of parasitism genes is important to understand how evolutionary mechanisms affect the occurrences of parasitism genes. In this study, we constructed multiple domain trees for parasitism genes and genes under free-living conditions. Further analyses of horizontal gene transfer (HGT)-like phylogenetic incongruences, duplications, and speciations were performed based on these trees. By comparing these analyses, the contributions of pre-adaptations were found to be more important to the evolution of parasitism genes than those of duplications, and pre-adaptations are as crucial as previously reported HGTs to parasitism. Furthermore, speciation may also affect the evolution of parasitism genes. In addition, Pristionchus pacificus was suggested to be a common model organism for studies of parasitic nematodes, including root-knot species. These analyses provided information regarding mechanisms that may have contributed to the evolution of parasitism genes.

  16. Multiple schwannomatosis caused by the recently described INI1 gene--molecular pathology, and implications for prognosis.

    PubMed

    Brennan, Paul M; Barlow, Antonio; Geraghty, Alistair; Summers, David; Fitzpatrick, Michael M

    2011-06-01

    The most common genetic predisposition to multiple schwannoma growth is mutation of the neurofibromatosis type 2 gene. We describe a patient with multiple schwannomas and mutation in the recently described INI1 gene, which also predisposes to the disease. We explore the implications for prognosis and outcome.

  17. C/EBPβ Mediates Growth Hormone-Regulated Expression of Multiple Target Genes

    PubMed Central

    Cui, Tracy X.; Lin, Grace; LaPensee, Christopher R.; Calinescu, Anda-Alexandra; Rathore, Maanjot; Streeter, Cale; Piwien-Pilipuk, Graciela; Lanning, Nathan; Jin, Hui; Carter-Su, Christin; Qin, Zhaohui S.

    2011-01-01

    Regulation of c-Fos transcription by GH is mediated by CCAAT/enhancer binding protein β (C/EBPβ). This study examines the role of C/EBPβ in mediating GH activation of other early response genes, including Cyr61, Btg2, Socs3, Zfp36, and Socs1. C/EBPβ depletion using short hairpin RNA impaired responsiveness of these genes to GH, as seen for c-Fos. Rescue with wild-type C/EBPβ led to GH-dependent recruitment of the coactivator p300 to the c-Fos promoter. In contrast, rescue with C/EBPβ mutated at the ERK phosphorylation site at T188 failed to induce GH-dependent recruitment of p300, indicating that ERK-mediated phosphorylation of C/EBPβ at T188 is required for GH-induced recruitment of p300 to c-Fos. GH also induced the occupancy of phosphorylated C/EBPβ and p300 on Cyr61, Btg2, and Socs3 at predicted C/EBP-cAMP response element-binding protein motifs in their promoters. Consistent with a role for ERKs in GH-induced expression of these genes, treatment with U0126 to block ERK phosphorylation inhibited their GH-induced expression. In contrast, GH-dependent expression of Zfp36 and Socs1 was not inhibited by U0126. Thus, induction of multiple early response genes by GH in 3T3-F442A cells is mediated by C/EBPβ. A subset of these genes is regulated similarly to c-Fos, through a mechanism involving GH-stimulated ERK 1/2 activation, phosphorylation of C/EBPβ, and recruitment of p300. Overall, these studies suggest that C/EBPβ, like the signal transducer and activator of transcription proteins, regulates multiple genes in response to GH. PMID:21292824

  18. In Vivo Imaging of Transgenic Gene Expression in Individual Retinal Progenitors in Chimeric Zebrafish Embryos to Study Cell Nonautonomous Influences.

    PubMed

    Dudczig, Stefanie; Currie, Peter D; Poggi, Lucia; Jusuf, Patricia R

    2017-03-22

    The genetic and technical strengths have made the zebrafish vertebrate a key model organism in which the consequences of gene manipulations can be traced in vivo throughout the rapid developmental period. Multiple processes can be studied including cell proliferation, gene expression, cell migration and morphogenesis. Importantly, the generation of chimeras through transplantations can be easily performed, allowing mosaic labeling and tracking of individual cells under the influence of the host environment. For example, by combining functional gene manipulations of the host embryo (e.g., through morpholino microinjection) and live imaging, the effects of extrinsic, cell nonautonomous signals (provided by the genetically modified environment) on individual transplanted donor cells can be assessed. Here we demonstrate how this approach is used to compare the onset of fluorescent transgene expression as a proxy for the timing of cell fate determination in different genetic host environments. In this article, we provide the protocol for microinjecting zebrafish embryos to mark donor cells and to cause gene knockdown in host embryos, a description of the transplantation technique used to generate chimeric embryos, and the protocol for preparing and running in vivo time-lapse confocal imaging of multiple embryos. In particular, performing multiposition imaging is crucial when comparing timing of events such as the onset of gene expression. This requires data collection from multiple control and experimental embryos processed simultaneously. Such an approach can easily be extended for studies of extrinsic influences in any organ or tissue of choice accessible to live imaging, provided that transplantations can be targeted easily according to established embryonic fate maps.

  19. DOPA Decarboxylase Modulates Tau Toxicity.

    PubMed

    Kow, Rebecca L; Sikkema, Carl; Wheeler, Jeanna M; Wilkinson, Charles W; Kraemer, Brian C

    2018-03-01

    The microtubule-associated protein tau accumulates into toxic aggregates in multiple neurodegenerative diseases. We found previously that loss of D 2 -family dopamine receptors ameliorated tauopathy in multiple models including a Caenorhabditis elegans model of tauopathy. To better understand how loss of D 2 -family dopamine receptors can ameliorate tau toxicity, we screened a collection of C. elegans mutations in dopamine-related genes (n = 45) for changes in tau transgene-induced behavioral defects. These included many genes responsible for dopamine synthesis, metabolism, and signaling downstream of the D 2 receptors. We identified one dopamine synthesis gene, DOPA decarboxylase (DDC), as a suppressor of tau toxicity in tau transgenic worms. Loss of the C. elegans DDC gene, bas-1, ameliorated the behavioral deficits of tau transgenic worms, reduced phosphorylated and detergent-insoluble tau accumulation, and reduced tau-mediated neuron loss. Loss of function in other genes in the dopamine and serotonin synthesis pathways did not alter tau-induced toxicity; however, their function is required for the suppression of tau toxicity by bas-1. Additional loss of D 2 -family dopamine receptors did not synergize with bas-1 suppression of tauopathy phenotypes. Loss of the DDC bas-1 reduced tau-induced toxicity in a C. elegans model of tauopathy, while loss of no other dopamine or serotonin synthesis genes tested had this effect. Because loss of activity upstream of DDC could reduce suppression of tau by DDC, this suggests the possibility that loss of DDC suppresses tau via the combined accumulation of dopamine precursor levodopa and serotonin precursor 5-hydroxytryptophan. Published by Elsevier Inc.

  20. Insights into TREM2 biology by network analysis of human brain gene expression data

    PubMed Central

    Forabosco, Paola; Ramasamy, Adaikalavan; Trabzuni, Daniah; Walker, Robert; Smith, Colin; Bras, Jose; Levine, Adam P.; Hardy, John; Pocock, Jennifer M.; Guerreiro, Rita; Weale, Michael E.; Ryten, Mina

    2013-01-01

    Rare variants in TREM2 cause susceptibility to late-onset Alzheimer's disease. Here we use microarray-based expression data generated from 101 neuropathologically normal individuals and covering 10 brain regions, including the hippocampus, to understand TREM2 biology in human brain. Using network analysis, we detect a highly preserved TREM2-containing module in human brain, show that it relates to microglia, and demonstrate that TREM2 is a hub gene in 5 brain regions, including the hippocampus, suggesting that it can drive module function. Using enrichment analysis we show significant overrepresentation of genes implicated in the adaptive and innate immune system. Inspection of genes with the highest connectivity to TREM2 suggests that it plays a key role in mediating changes in the microglial cytoskeleton necessary not only for phagocytosis, but also migration. Most importantly, we show that the TREM2-containing module is significantly enriched for genes genetically implicated in Alzheimer's disease, multiple sclerosis, and motor neuron disease, implying that these diseases share common pathways centered on microglia and that among the genes identified are possible new disease-relevant genes. PMID:23855984

  1. A high resolution atlas of gene expression in the domestic sheep (Ovis aries)

    PubMed Central

    Farquhar, Iseabail L.; Young, Rachel; Lefevre, Lucas; Pridans, Clare; Tsang, Hiu G.; Afrasiabi, Cyrus; Watson, Mick; Whitelaw, C. Bruce; Freeman, Tom C.; Archibald, Alan L.; Hume, David A.

    2017-01-01

    Sheep are a key source of meat, milk and fibre for the global livestock sector, and an important biomedical model. Global analysis of gene expression across multiple tissues has aided genome annotation and supported functional annotation of mammalian genes. We present a large-scale RNA-Seq dataset representing all the major organ systems from adult sheep and from several juvenile, neonatal and prenatal developmental time points. The Ovis aries reference genome (Oar v3.1) includes 27,504 genes (20,921 protein coding), of which 25,350 (19,921 protein coding) had detectable expression in at least one tissue in the sheep gene expression atlas dataset. Network-based cluster analysis of this dataset grouped genes according to their expression pattern. The principle of ‘guilt by association’ was used to infer the function of uncharacterised genes from their co-expression with genes of known function. We describe the overall transcriptional signatures present in the sheep gene expression atlas and assign those signatures, where possible, to specific cell populations or pathways. The findings are related to innate immunity by focusing on clusters with an immune signature, and to the advantages of cross-breeding by examining the patterns of genes exhibiting the greatest expression differences between purebred and crossbred animals. This high-resolution gene expression atlas for sheep is, to our knowledge, the largest transcriptomic dataset from any livestock species to date. It provides a resource to improve the annotation of the current reference genome for sheep, presenting a model transcriptome for ruminants and insight into gene, cell and tissue function at multiple developmental stages. PMID:28915238

  2. A high resolution atlas of gene expression in the domestic sheep (Ovis aries).

    PubMed

    Clark, Emily L; Bush, Stephen J; McCulloch, Mary E B; Farquhar, Iseabail L; Young, Rachel; Lefevre, Lucas; Pridans, Clare; Tsang, Hiu G; Wu, Chunlei; Afrasiabi, Cyrus; Watson, Mick; Whitelaw, C Bruce; Freeman, Tom C; Summers, Kim M; Archibald, Alan L; Hume, David A

    2017-09-01

    Sheep are a key source of meat, milk and fibre for the global livestock sector, and an important biomedical model. Global analysis of gene expression across multiple tissues has aided genome annotation and supported functional annotation of mammalian genes. We present a large-scale RNA-Seq dataset representing all the major organ systems from adult sheep and from several juvenile, neonatal and prenatal developmental time points. The Ovis aries reference genome (Oar v3.1) includes 27,504 genes (20,921 protein coding), of which 25,350 (19,921 protein coding) had detectable expression in at least one tissue in the sheep gene expression atlas dataset. Network-based cluster analysis of this dataset grouped genes according to their expression pattern. The principle of 'guilt by association' was used to infer the function of uncharacterised genes from their co-expression with genes of known function. We describe the overall transcriptional signatures present in the sheep gene expression atlas and assign those signatures, where possible, to specific cell populations or pathways. The findings are related to innate immunity by focusing on clusters with an immune signature, and to the advantages of cross-breeding by examining the patterns of genes exhibiting the greatest expression differences between purebred and crossbred animals. This high-resolution gene expression atlas for sheep is, to our knowledge, the largest transcriptomic dataset from any livestock species to date. It provides a resource to improve the annotation of the current reference genome for sheep, presenting a model transcriptome for ruminants and insight into gene, cell and tissue function at multiple developmental stages.

  3. Molecular study on some antibiotic resistant genes in Salmonella spp. isolates

    NASA Astrophysics Data System (ADS)

    Nabi, Ari Q.

    2017-09-01

    Studying the genes related with antimicrobial resistance in Salmonella spp. is a crucial step toward a correct and faster treatment of infections caused by the pathogen. In this work Integron mediated antibiotic resistant gene IntI1 (Class I Integrase IntI1) and some plasmid mediated antibiotic resistance genes (Qnr) were scanned among the isolated non-Typhoid Salmonellae strains with known resistance to some important antimicrobial drugs using Sybr Green real time PCR. The aim of the study was to correlate the multiple antibiotics and antimicrobial resistance of Salmonella spp. with the presence of integrase (IntI1) gene and plasmid mediated quinolone resistant genes. Results revealed the presence of Class I Integrase gene in 76% of the isolates with confirmed multiple antibiotic resistances. Moreover, about 32% of the multiple antibiotic resistant serotypes showed a positive R-PCR for plasmid mediated qnrA gene encoding for nalidixic acid and ciprofloxacin resistance. No positive results could be revealed form R-PCRs targeting qnrB or qnrS. In light of these results we can conclude that the presence of at least one of the qnr genes and/or the presence of Integrase Class I gene were responsible for the multiple antibiotic resistance to for nalidixic acid and ciprofloxacin from the studied Salmonella spp. and further studies required to identify the genes related with multiple antibiotic resistance of the pathogen.

  4. RNA-Seq Meta-analysis identifies genes in skeletal muscle associated with gain and intake across a multi-season study of crossbred beef steers.

    PubMed

    Keel, Brittney N; Zarek, Christina M; Keele, John W; Kuehn, Larry A; Snelling, Warren M; Oliver, William T; Freetly, Harvey C; Lindholm-Perry, Amanda K

    2018-06-04

    Feed intake and body weight gain are economically important inputs and outputs of beef production systems. The purpose of this study was to discover differentially expressed genes that will be robust for feed intake and gain across a large segment of the cattle industry. Transcriptomic studies often suffer from issues with reproducibility and cross-validation. One way to improve reproducibility is by integrating multiple datasets via meta-analysis. RNA sequencing (RNA-Seq) was performed on longissimus dorsi muscle from 80 steers (5 cohorts, each with 16 animals) selected from the outside fringe of a bivariate gain and feed intake distribution to understand the genes and pathways involved in feed efficiency. In each cohort, 16 steers were selected from one of four gain and feed intake phenotypes (n = 4 per phenotype) in a 2 × 2 factorial arrangement with gain and feed intake as main effect variables. Each cohort was analyzed as a single experiment using a generalized linear model and results from the 5 cohort analyses were combined in a meta-analysis to identify differentially expressed genes (DEG) across the cohorts. A total of 51 genes were differentially expressed for the main effect of gain, 109 genes for the intake main effect, and 11 genes for the gain x intake interaction (P corrected  < 0.05). A jackknife sensitivity analysis showed that, in general, the meta-analysis produced robust DEGs for the two main effects and their interaction. Pathways identified from over-represented genes included mitochondrial energy production and oxidative stress pathways for the main effect of gain due to DEG including GPD1, NDUFA6, UQCRQ, ACTC1, and MGST3. For intake, metabolic pathways including amino acid biosynthesis and degradation were identified, and for the interaction analysis the pathways identified included GADD45, pyridoxal 5'phosphate salvage, and caveolar mediated endocytosis signaling. Variation among DEG identified by cohort suggests that environment and breed may play large roles in the expression of genes associated with feed efficiency in the muscle of beef cattle. Meta-analyses of transcriptome data from groups of animals over multiple cohorts may be necessary to elucidate the genetics contributing these types of biological phenotypes.

  5. Recurrent R-spondin fusions in colon cancer.

    PubMed

    Seshagiri, Somasekar; Stawiski, Eric W; Durinck, Steffen; Modrusan, Zora; Storm, Elaine E; Conboy, Caitlin B; Chaudhuri, Subhra; Guan, Yinghui; Janakiraman, Vasantharajan; Jaiswal, Bijay S; Guillory, Joseph; Ha, Connie; Dijkgraaf, Gerrit J P; Stinson, Jeremy; Gnad, Florian; Huntley, Melanie A; Degenhardt, Jeremiah D; Haverty, Peter M; Bourgon, Richard; Wang, Weiru; Koeppen, Hartmut; Gentleman, Robert; Starr, Timothy K; Zhang, Zemin; Largaespada, David A; Wu, Thomas D; de Sauvage, Frederic J

    2012-08-30

    Identifying and understanding changes in cancer genomes is essential for the development of targeted therapeutics. Here we analyse systematically more than 70 pairs of primary human colon tumours by applying next-generation sequencing to characterize their exomes, transcriptomes and copy-number alterations. We have identified 36,303 protein-altering somatic changes that include several new recurrent mutations in the Wnt pathway gene TCF7L2, chromatin-remodelling genes such as TET2 and TET3 and receptor tyrosine kinases including ERBB3. Our analysis for significantly mutated cancer genes identified 23 candidates, including the cell cycle checkpoint kinase ATM. Copy-number and RNA-seq data analysis identified amplifications and corresponding overexpression of IGF2 in a subset of colon tumours. Furthermore, using RNA-seq data we identified multiple fusion transcripts including recurrent gene fusions involving R-spondin family members RSPO2 and RSPO3 that together occur in 10% of colon tumours. The RSPO fusions were mutually exclusive with APC mutations, indicating that they probably have a role in the activation of Wnt signalling and tumorigenesis. Consistent with this we show that the RSPO fusion proteins were capable of potentiating Wnt signalling. The R-spondin gene fusions and several other gene mutations identified in this study provide new potential opportunities for therapeutic intervention in colon cancer.

  6. Recurrent R-spondin fusions in colon cancer

    PubMed Central

    Seshagiri, Somasekar; Stawiski, Eric W.; Durinck, Steffen; Modrusan, Zora; Storm, Elaine E.; Conboy, Caitlin B.; Chaudhuri, Subhra; Guan, Yinghui; Janakiraman, Vasantharajan; Jaiswal, Bijay S.; Guillory, Joseph; Ha, Connie; Dijkgraaf, Gerrit J. P.; Stinson, Jeremy; Gnad, Florian; Huntley, Melanie A.; Degenhardt, Jeremiah D.; Haverty, Peter M.; Bourgon, Richard; Wang, Weiru; Koeppen, Hartmut; Gentleman, Robert; Starr, Timothy K.; Zhang, Zemin; Largaespada, David A.; Wu, Thomas D.; de Sauvage, Frederic J

    2013-01-01

    Identifying and understanding changes in cancer genomes is essential for the development of targeted therapeutics1. Here we analyse systematically more than 70 pairs of primary human colon tumours by applying next-generation sequencing to characterize their exomes, transcriptomes and copy-number alterations. We have identified 36,303 protein-altering somatic changes that include several new recurrent mutations in the Wnt pathway gene TCF7L2, chromatin-remodelling genes such as TET2 and TET3 and receptor tyrosine kinases including ERBB3. Our analysis for significantly mutated cancer genes identified 23 candidates, including the cell cycle checkpoint kinase ATM. Copy-number and RNA-seq data analysis identified amplifications and corresponding overexpression of IGF2 in a subset of colon tumours. Furthermore, using RNA-seq data we identified multiple fusion transcripts including recurrent gene fusions involving R-spondin family members RSPO2 and RSPO3 that together occur in 10% of colon tumours. The RSPO fusions were mutually exclusive with APC mutations, indicating that they probably have a role in the activation of Wnt signalling and tumorigenesis. Consistent with this we show that the RSPO fusion proteins were capable of potentiating Wnt signalling. The R-spondin gene fusions and several other gene mutations identified in this study provide new potential opportunities for therapeutic intervention in colon cancer. PMID:22895193

  7. DPYD, TYMS, TYMP, TK1, and TK2 Genetic Expressions as Response Markers in Locally Advanced Rectal Cancer Patients Treated with Fluoropyrimidine-Based Chemoradiotherapy

    PubMed Central

    Wu, Chan-Han; Huang, Chun-Ming; Chung, Fu-Yen; Huang, Ching-Wen; Tsai, Hsiang-Lin; Chen, Chin-Fan; Wang, Jaw-Yuan

    2013-01-01

    This study is to investigate multiple chemotherapeutic agent- and radiation-related genetic biomarkers in locally advanced rectal cancer (LARC) patients following fluoropyrimidine-based concurrent chemoradiotherapy (CCRT) for response prediction. We initially selected 6 fluoropyrimidine metabolism-related genes (DPYD, ORPT, TYMS, TYMP, TK1, and TK2) and 3 radiotherapy response-related genes (GLUT1, HIF-1 α, and HIF-2 α) as targets for gene expression identification in 60 LARC cancer specimens. Subsequently, a high-sensitivity weighted enzymatic chip array was designed and constructed to predict responses following CCRT. After CCRT, 39 of 60 (65%) LARC patients were classified as responders (pathological tumor regression grade 2 ~ 4). Using a panel of multiple genetic biomarkers (chip), including DPYD, TYMS, TYMP, TK1, and TK2, at a cutoff value for 3 positive genes, a sensitivity of 89.7% and a specificity of 81% were obtained (AUC: 0.915; 95% CI: 0.840–0.991). Negative chip results were significantly correlated to poor CCRT responses (TRG 0-1) (P = 0.014, hazard ratio: 22.704, 95% CI: 3.055–235.448 in multivariate analysis). Disease-free survival analysis showed significantly better survival rate in patients with positive chip results (P = 0.0001). We suggest that a chip including DPYD, TYMS, TYMP, TK1, and TK2 genes is a potential tool to predict response in LARC following fluoropyrimidine-based CCRT. PMID:24455740

  8. PYRETHROID INDUCED ALTERATIONS IN TRANSCRIPTION OF CALCIUM RESPONSIVE AND IMMEDIATE EARLY GENES IN VIVO.

    EPA Science Inventory

    Multiple molecular targets for pyrethroid insecticides have been evaluated in in vitro preparations, including but not limited to voltage-sensitive sodium channels (VSSCs), voltage-sensitive calcium channels (VSCCs), GABAergic receptors, ATPases and mitochondrial respiratory chai...

  9. The Trophic Life Cycle Stage of the Opportunistic Fungal Pathogen Pneumocystis murina Hinders the Ability of Dendritic Cells To Stimulate CD4+ T Cell Responses

    PubMed Central

    Evans, Heather M.; Simpson, Andrew; Shen, Shu; Stromberg, Arnold J.; Pickett, Carol L.

    2017-01-01

    ABSTRACT The life cycle of the opportunistic fungal pathogen Pneumocystis murina consists of a trophic stage and an ascus-like cystic stage. Infection with the cyst stage induces proinflammatory immune responses, while trophic forms suppress the cytokine response to multiple pathogen-associated molecular patterns (PAMPs), including β-glucan. A targeted gene expression assay was used to evaluate the dendritic cell response following stimulation with trophic forms alone, with a normal mixture of trophic forms and cysts, or with β-glucan. We demonstrate that stimulation with trophic forms downregulated the expression of multiple genes normally associated with the response to infection, including genes encoding transcription factors. Trophic forms also suppressed the expression of genes related to antigen processing and presentation, including the gene encoding the major histocompatibility complex (MHC) class II transactivator, CIITA. Stimulation of dendritic cells with trophic forms, but not a mixture of trophic forms and cysts, reduced the expression of MHC class II and the costimulatory molecule CD40 on the surface of the cells. These defects in the expression of MHC class II and costimulatory molecules corresponded with a reduced capacity for trophic form-loaded dendritic cells to stimulate CD4+ T cell proliferation and polarization. These data are consistent with the delayed innate and adaptive responses previously observed in immunocompetent mice inoculated with trophic forms compared to responses in mice inoculated with a mixture of trophic forms and cysts. We propose that trophic forms broadly inhibit the ability of dendritic cells to fulfill their role as antigen-presenting cells. PMID:28694293

  10. Nur77 coordinately regulates expression of genes linked to glucose metabolism in skeletal muscle.

    PubMed

    Chao, Lily C; Zhang, Zidong; Pei, Liming; Saito, Tsugumichi; Tontonoz, Peter; Pilch, Paul F

    2007-09-01

    Innervation is important for normal metabolism in skeletal muscle, including insulin-sensitive glucose uptake. However, the transcription factors that transduce signals from the neuromuscular junction to the nucleus and affect changes in metabolic gene expression are not well defined. We demonstrate here that the orphan nuclear receptor Nur77 is a regulator of gene expression linked to glucose utilization in muscle. In vivo, Nur77 is preferentially expressed in glycolytic compared with oxidative muscle and is responsive to beta-adrenergic stimulation. Denervation of rat muscle compromises expression of Nur77 in parallel with that of numerous genes linked to glucose metabolism, including glucose transporter 4 and genes involved in glycolysis, glycogenolysis, and the glycerophosphate shuttle. Ectopic expression of Nur77, either in rat muscle or in C2C12 muscle cells, induces expression of a highly overlapping set of genes, including glucose transporter 4, muscle phosphofructokinase, and glycogen phosphorylase. Furthermore, selective knockdown of Nur77 in rat muscle by small hairpin RNA or genetic deletion of Nur77 in mice reduces the expression of a battery of genes involved in skeletal muscle glucose utilization in vivo. Finally, we show that Nur77 binds the promoter regions of multiple genes involved in glucose metabolism in muscle. These results identify Nur77 as a potential mediator of neuromuscular signaling in the control of metabolic gene expression.

  11. Nur77 coordinately regulates expression of genes linked to glucose metabolism in skeletal muscle

    PubMed Central

    Chao, Lily C.; Zhang, Zidong; Pei, Liming; Saito, Tsugumichi; Tontonoz, Peter; Pilch, Paul F.

    2008-01-01

    Innervation is important for normal metabolism in skeletal muscle, including insulin-sensitive glucose uptake. However, the transcription factors that transduce signals from the neuromuscular junction to the nucleus and affect changes in metabolic gene expression are not well defined. We demonstrate here that the orphan nuclear receptor Nur77 is a regulator of gene expression linked to glucose utilization in muscle. In vivo, Nur77 is preferentially expressed in glycolytic compared to oxidative muscle and is responsive to β-adrenergic stimulation. Denervation of rat muscle compromises expression of Nur77 in parallel with that of numerous genes linked to glucose metabolism, including GLUT4 and genes involved in glycolysis, glycogenolysis, and the glycerophosphate shuttle. Ectopic expression of Nur77, either in rat muscle or in C2C12 muscle cells, induces expression of a highly overlapping set of genes, including GLUT4, muscle phosphofructokinase, and glycogen phosphorylase. Furthermore, selective knockdown of Nur77 in rat muscle by shRNA or genetic deletion of Nur77 in mice reduces the expression of a battery of genes involved in skeletal muscle glucose utilization in vivo. Finally, we show that Nur77 binds the promoter regions of multiple innervation-dependent genes in muscle. These results identify Nur77 as a potential mediator of neuromuscular signaling in the control of metabolic gene expression. PMID:17550977

  12. Association of Protein Translation and Extracellular Matrix Gene Sets with Breast Cancer Metastasis: Findings Uncovered on Analysis of Multiple Publicly Available Datasets Using Individual Patient Data Approach.

    PubMed

    Chowdhury, Nilotpal; Sapru, Shantanu

    2015-01-01

    Microarray analysis has revolutionized the role of genomic prognostication in breast cancer. However, most studies are single series studies, and suffer from methodological problems. We sought to use a meta-analytic approach in combining multiple publicly available datasets, while correcting for batch effects, to reach a more robust oncogenomic analysis. The aim of the present study was to find gene sets associated with distant metastasis free survival (DMFS) in systemically untreated, node-negative breast cancer patients, from publicly available genomic microarray datasets. Four microarray series (having 742 patients) were selected after a systematic search and combined. Cox regression for each gene was done for the combined dataset (univariate, as well as multivariate - adjusted for expression of Cell cycle related genes) and for the 4 major molecular subtypes. The centre and microarray batch effects were adjusted by including them as random effects variables. The Cox regression coefficients for each analysis were then ranked and subjected to a Gene Set Enrichment Analysis (GSEA). Gene sets representing protein translation were independently negatively associated with metastasis in the Luminal A and Luminal B subtypes, but positively associated with metastasis in Basal tumors. Proteinaceous extracellular matrix (ECM) gene set expression was positively associated with metastasis, after adjustment for expression of cell cycle related genes on the combined dataset. Finally, the positive association of the proliferation-related genes with metastases was confirmed. To the best of our knowledge, the results depicting mixed prognostic significance of protein translation in breast cancer subtypes are being reported for the first time. We attribute this to our study combining multiple series and performing a more robust meta-analytic Cox regression modeling on the combined dataset, thus discovering 'hidden' associations. This methodology seems to yield new and interesting results and may be used as a tool to guide new research.

  13. Association of Protein Translation and Extracellular Matrix Gene Sets with Breast Cancer Metastasis: Findings Uncovered on Analysis of Multiple Publicly Available Datasets Using Individual Patient Data Approach

    PubMed Central

    Chowdhury, Nilotpal; Sapru, Shantanu

    2015-01-01

    Introduction Microarray analysis has revolutionized the role of genomic prognostication in breast cancer. However, most studies are single series studies, and suffer from methodological problems. We sought to use a meta-analytic approach in combining multiple publicly available datasets, while correcting for batch effects, to reach a more robust oncogenomic analysis. Aim The aim of the present study was to find gene sets associated with distant metastasis free survival (DMFS) in systemically untreated, node-negative breast cancer patients, from publicly available genomic microarray datasets. Methods Four microarray series (having 742 patients) were selected after a systematic search and combined. Cox regression for each gene was done for the combined dataset (univariate, as well as multivariate – adjusted for expression of Cell cycle related genes) and for the 4 major molecular subtypes. The centre and microarray batch effects were adjusted by including them as random effects variables. The Cox regression coefficients for each analysis were then ranked and subjected to a Gene Set Enrichment Analysis (GSEA). Results Gene sets representing protein translation were independently negatively associated with metastasis in the Luminal A and Luminal B subtypes, but positively associated with metastasis in Basal tumors. Proteinaceous extracellular matrix (ECM) gene set expression was positively associated with metastasis, after adjustment for expression of cell cycle related genes on the combined dataset. Finally, the positive association of the proliferation-related genes with metastases was confirmed. Conclusion To the best of our knowledge, the results depicting mixed prognostic significance of protein translation in breast cancer subtypes are being reported for the first time. We attribute this to our study combining multiple series and performing a more robust meta-analytic Cox regression modeling on the combined dataset, thus discovering 'hidden' associations. This methodology seems to yield new and interesting results and may be used as a tool to guide new research. PMID:26080057

  14. Multiple fuzzy neural network system for outcome prediction and classification of 220 lymphoma patients on the basis of molecular profiling.

    PubMed

    Ando, Tatsuya; Suguro, Miyuki; Kobayashi, Takeshi; Seto, Masao; Honda, Hiroyuki

    2003-10-01

    A fuzzy neural network (FNN) using gene expression profile data can select combinations of genes from thousands of genes, and is applicable to predict outcome for cancer patients after chemotherapy. However, wide clinical heterogeneity reduces the accuracy of prediction. To overcome this problem, we have proposed an FNN system based on majoritarian decision using multiple noninferior models. We used transcriptional profiling data, which were obtained from "Lymphochip" DNA microarrays (http://llmpp.nih.gov/DLBCL), reported by Rosenwald (N Engl J Med 2002; 346: 1937-47). When the data were analyzed by our FNN system, accuracy (73.4%) of outcome prediction using only 1 FNN model with 4 genes was higher than that (68.5%) of the Cox model using 17 genes. Higher accuracy (91%) was obtained when an FNN system with 9 noninferior models, consisting of 35 independent genes, was used. The genes selected by the system included genes that are informative in the prognosis of Diffuse large B-cell lymphoma (DLBCL), such as genes showing an expression pattern similar to that of CD10 and BCL-6 or similar to that of IRF-4 and BCL-4. We classified 220 DLBCL patients into 5 groups using the prediction results of 9 FNN models. These groups may correspond to DLBCL subtypes. In group A containing half of the 220 patients, patients with poor outcome were found to satisfy 2 rules, i.e., high expression of MAX dimerization with high expression of unknown A (LC_26146), or high expression of MAX dimerization with low expression of unknown B (LC_33144). The present paper is the first to describe the multiple noninferior FNN modeling system. This system is a powerful tool for predicting outcome and classifying patients, and is applicable to other heterogeneous diseases.

  15. miRNA-Mediated Relationships between Cis-SNP Genotypes and Transcript Intensities in Lymphocyte Cell Lines

    PubMed Central

    Zhang, Wensheng; Edwards, Andrea; Zhu, Dongxiao; Flemington, Erik K.; Deininger, Prescott; Zhang, Kun

    2012-01-01

    In metazoans, miRNAs regulate gene expression primarily through binding to target sites in the 3′ UTRs (untranslated regions) of messenger RNAs (mRNAs). Cis-acting variants within, or close to, a gene are crucial in explaining the variability of gene expression measures. Single nucleotide polymorphisms (SNPs) in the 3′ UTRs of genes can affect the base-pairing between miRNAs and mRNAs, and hence disrupt existing target sites (in the reference sequence) or create novel target sites, suggesting a possible mechanism for cis regulation of gene expression. Moreover, because the alleles of different SNPs within a DNA sequence of limited length tend to be in strong linkage disequilibrium (LD), we hypothesize the variants of miRNA target sites caused by SNPs potentially function as bridges linking the documented cis-SNP markers to the expression of the associated genes. A large-scale analysis was herein performed to test this hypothesis. By systematically integrating multiple latest information sources, we found 21 significant gene-level SNP-involved miRNA-mediated post-transcriptional regulation modules (SNP-MPRMs) in the form of SNP-miRNA-mRNA triplets in lymphocyte cell lines for the CEU and YRI populations. Among the cognate genes, six including ALG8, DGKE, GNA12, KLF11, LRPAP1, and MMAB are related to multiple genetic diseases such as depressive disorder and Type-II diabetes. Furthermore, we found that ∼35% of the documented transcript intensity-related cis-SNPs (∼950) in a recent publication are identical to, or in significant linkage disequilibrium (LD) (p<0.01) with, one or multiple SNPs located in miRNA target sites. Based on these associations (or identities), 69 significant exon-level SNP-MPRMs and 12 disease genes were further determined for two populations. These results provide concrete in silico evidence for the proposed hypothesis. The discovered modules warrant additional follow-up in independent laboratory studies. PMID:22348086

  16. Practical applications of the bioinformatics toolbox for narrowing quantitative trait loci.

    PubMed

    Burgess-Herbert, Sarah L; Cox, Allison; Tsaih, Shirng-Wern; Paigen, Beverly

    2008-12-01

    Dissecting the genes involved in complex traits can be confounded by multiple factors, including extensive epistatic interactions among genes, the involvement of epigenetic regulators, and the variable expressivity of traits. Although quantitative trait locus (QTL) analysis has been a powerful tool for localizing the chromosomal regions underlying complex traits, systematically identifying the causal genes remains challenging. Here, through its application to plasma levels of high-density lipoprotein cholesterol (HDL) in mice, we demonstrate a strategy for narrowing QTL that utilizes comparative genomics and bioinformatics techniques. We show how QTL detected in multiple crosses are subjected to both combined cross analysis and haplotype block analysis; how QTL from one species are mapped to the concordant regions in another species; and how genomewide scans associating haplotype groups with their phenotypes can be used to prioritize the narrowed regions. Then we illustrate how these individual methods for narrowing QTL can be systematically integrated for mouse chromosomes 12 and 15, resulting in a significantly reduced number of candidate genes, often from hundreds to <10. Finally, we give an example of how additional bioinformatics resources can be combined with experiments to determine the most likely quantitative trait genes.

  17. Culture adaptation of malaria parasites selects for convergent loss-of-function mutants.

    PubMed

    Claessens, Antoine; Affara, Muna; Assefa, Samuel A; Kwiatkowski, Dominic P; Conway, David J

    2017-01-24

    Cultured human pathogens may differ significantly from source populations. To investigate the genetic basis of laboratory adaptation in malaria parasites, clinical Plasmodium falciparum isolates were sampled from patients and cultured in vitro for up to three months. Genome sequence analysis was performed on multiple culture time point samples from six monoclonal isolates, and single nucleotide polymorphism (SNP) variants emerging over time were detected. Out of a total of five positively selected SNPs, four represented nonsense mutations resulting in stop codons, three of these in a single ApiAP2 transcription factor gene, and one in SRPK1. To survey further for nonsense mutants associated with culture, genome sequences of eleven long-term laboratory-adapted parasite strains were examined, revealing four independently acquired nonsense mutations in two other ApiAP2 genes, and five in Epac. No mutants of these genes exist in a large database of parasite sequences from uncultured clinical samples. This implicates putative master regulator genes in which multiple independent stop codon mutations have convergently led to culture adaptation, affecting most laboratory lines of P. falciparum. Understanding the adaptive processes should guide development of experimental models, which could include targeted gene disruption to adapt fastidious malaria parasite species to culture.

  18. Gene discovery by chemical mutagenesis and whole-genome sequencing in Dictyostelium.

    PubMed

    Li, Cheng-Lin Frank; Santhanam, Balaji; Webb, Amanda Nicole; Zupan, Blaž; Shaulsky, Gad

    2016-09-01

    Whole-genome sequencing is a useful approach for identification of chemical-induced lesions, but previous applications involved tedious genetic mapping to pinpoint the causative mutations. We propose that saturation mutagenesis under low mutagenic loads, followed by whole-genome sequencing, should allow direct implication of genes by identifying multiple independent alleles of each relevant gene. We tested the hypothesis by performing three genetic screens with chemical mutagenesis in the social soil amoeba Dictyostelium discoideum Through genome sequencing, we successfully identified mutant genes with multiple alleles in near-saturation screens, including resistance to intense illumination and strong suppressors of defects in an allorecognition pathway. We tested the causality of the mutations by comparison to published data and by direct complementation tests, finding both dominant and recessive causative mutations. Therefore, our strategy provides a cost- and time-efficient approach to gene discovery by integrating chemical mutagenesis and whole-genome sequencing. The method should be applicable to many microbial systems, and it is expected to revolutionize the field of functional genomics in Dictyostelium by greatly expanding the mutation spectrum relative to other common mutagenesis methods. © 2016 Li et al.; Published by Cold Spring Harbor Laboratory Press.

  19. The Changing Landscape of Genetic Testing for Inherited Breast Cancer Predisposition.

    PubMed

    Afghahi, Anosheh; Kurian, Allison W

    2017-05-01

    The advent of multiple-gene germline panel testing has led to significant advances in hereditary breast and ovarian cancer risk assessment. These include guideline-specific cancer risk management recommendations for patients and their families, such as screening with breast magnetic resonance imaging and risk-reducing surgeries, which have the potential to reduce substantially the morbidity and mortality associated with a hereditary cancer predisposition. However, controversy remains about the clinical validity and actionability of genetic testing in a broader patient population. We discuss events leading to the wider availability of commercialized multiple-gene germline panel testing, the recent data that support using this powerful tool to improve cancer risk assessment and reduction strategies, and remaining challenges to clinical optimization of this new genetic technology.

  20. A Novel Mitochondrial DNA Deletion in Patient with Pearson Syndrome.

    PubMed

    Khasawneh, Rame; Alsokhni, Hala; Alzghoul, Bayan; Momani, Asim; Abualsheikh, Nazih; Kamal, Nazmi; Qatawneh, Mousa

    2018-04-01

    Arteriovenous Pearson syndrome is a very rare multisystemic mitochondrial disease characterized by sideroblastic anemia and exocrine pancreatic insufficiency. It is usually fatal in infancy. We reported a four-month-old infant presented with fever and pancytopenia. Bone marrow examination showed hypoplastic changes and sideroblastic features. Molecular Study showed a novel hetroplasmic mitochondrial deletions (m. 10760 -m. 15889+) in multiple genes (ND4,ND5,ND6, CYTB). In our patient the pathogenic mutation was 5.1 kb heteroplasmic deletions in multiple genes that are important and crucial for intact oxidative phosphorylation pathway and ATP production in the mitochondrial DNA. This mutation was not reported in literature including the mitomap.org website (which was last edited on Nov 30, 2017 and accessed on Jan 13, 2018).

  1. Variants of CEP68 Gene Are Associated with Acute Urticaria/Angioedema Induced by Multiple Non-Steroidal Anti-Inflammatory Drugs

    PubMed Central

    Cornejo-García, José Antonio; Flores, Carlos; Plaza-Serón, María C.; Acosta-Herrera, Marialbert; Blanca-López, Natalia; Doña, Inmaculada; Torres, María J.; Mayorga, Cristobalina; Guéant-Rodríguez, Rosa M.; Ayuso, Pedro; Fernández, Javier; Laguna, José J.; Agúndez, José A. G.; García-Martín, Elena; Guéant, Jean-Louis; Canto, Gabriela; Blanca, Miguel

    2014-01-01

    Non-steroidal anti-inflammatory drugs (NSAIDs) are the most consumed drugs worldwide because of their efficacy and utility in the treatment of pain and inflammatory diseases. However, they are also responsible for an important number of adverse effects including hypersensitivity reactions. The most important group of these reactions is triggered by non-immunological, pharmacological mechanisms catalogued under the denomination of cross-intolerance (CRI), with acute urticaria/angioedema induced by multiple NSAIDs (MNSAID-UA) the most frequently associated clinical entity. A recent genome-wide association study identified the gene encoding the centrosomal protein of 68 KDa (CEP68) as the major locus associated with aspirin intolerance susceptibility in asthmatics. In this study, we aimed to assess the role of this locus in susceptibility to CRI to NSAIDs by examining 53 common gene variants in a total of 635 patients that were classified as MNSAID-UA (n = 399), airway exacerbations (n = 110) or blended pattern (n = 126), and 425 controls. We found in the MNSAID-UA group a number of variants (17) associated (lowest p-value = 1.13×10−6), including the non-synonymous Gly74Ser variant (rs7572857) previously associated with aspirin intolerance susceptibility in asthmatics. Although not being significant in the context of multiple testing, eight of these variants were also associated with exacerbated respiratory disease or blended reactions. Our results suggest that CEP68 gene variants may play an important role in MNSAID-UA susceptibility and, despite the different regulatory mechanisms involved depending on the specific affected organ, in the development of hypersensitivity reactions to NSAIDs. PMID:24618698

  2. Cloning and analysis of the positively acting regulatory gene amdR from Aspergillus nidulans.

    PubMed Central

    Andrianopoulos, A; Hynes, M J

    1988-01-01

    The positively acting regulatory gene amdR of Aspergillus nidulans coordinately regulates the expression of four unlinked structural genes involved in acetamide (amdS), omega amino acid (gatA and gabA), and lactam (lamA) catabolism. By the use of DNA-mediated transformation of A. nidulans, the amdR regulatory gene was cloned from a genomic cosmid library. Southern blot analysis of DNA from various loss-of-function amdR mutants revealed the presence of four detectable DNA rearrangements, including a deletion, an insertion, and a translocation. No detectable DNA rearrangements were found in several constitutive amdRc mutants. Analysis of the fate of amdR-bearing plasmids in transformants showed that 10 to 20% of the transformation events were homologous integrations or gene conversions, and this phenomenon was exploited in developing a strategy by which amdRc and amdR- alleles can be readily cloned and analyzed. Examination of the transcription of amdR by Northern blot (RNA blot) analysis revealed the presence of two mRNAs (2.7 and 1.8 kilobases) which were constitutively synthesized at a very low level. In addition, amdR transcription did not appear to depend on the presence of a functional amdR product nor was it altered in amdRc mutants. The dosage effects of multiple copies of amdR in transformants were examined, and it was shown that such transformants exhibited stronger growth than did the wild type on acetamide and pyrrolidinone media, indicating increased expression of the amdS and lamA genes, respectively. These results were used to formulate a model for amdR-mediated regulation of gene expression in which the low constitutive level of amdR product sets the upper limits of basal and induced transcription of the structural genes. Multiple copies of 5' sequences from the amdS gene can result in reduced growth on substrates whose utilization is dependent on amdR-controlled genes. This has been attributed to titration of limiting amdR gene product. Strong support for this proposal was obtained by showing that multiple copies of the amdR gene can reverse this phenomenon (antititration). Images PMID:3062382

  3. Genetics of human neural tube defects

    PubMed Central

    Greene, Nicholas D.E.; Stanier, Philip; Copp, Andrew J.

    2009-01-01

    Neural tube defects (NTDs) are common, severe congenital malformations whose causation involves multiple genes and environmental factors. Although more than 200 genes are known to cause NTDs in mice, there has been rather limited progress in delineating the molecular basis underlying most human NTDs. Numerous genetic studies have been carried out to investigate candidate genes in cohorts of patients, with particular reference to those that participate in folate one-carbon metabolism. Although the homocysteine remethylation gene MTHFR has emerged as a risk factor in some human populations, few other consistent findings have resulted from this approach. Similarly, attention focused on the human homologues of mouse NTD genes has contributed only limited positive findings to date, although an emerging association between genes of the non-canonical Wnt (planar cell polarity) pathway and NTDs provides candidates for future studies. Priorities for the next phase of this research include: (i) larger studies that are sufficiently powered to detect significant associations with relatively minor risk factors; (ii) analysis of multiple candidate genes in groups of well-genotyped individuals to detect possible gene–gene interactions; (iii) use of high throughput genomic technology to evaluate the role of copy number variants and to detect ‘private’ and regulatory mutations, neither of which have been studied to date; (iv) detailed analysis of patient samples stratified by phenotype to enable, for example, hypothesis-driven testing of candidates genes in groups of NTDs with specific defects of folate metabolism, or in groups of fetuses with well-defined phenotypes such as craniorachischisis. PMID:19808787

  4. Gene order in rosid phylogeny, inferred from pairwise syntenies among extant genomes

    PubMed Central

    2012-01-01

    Background Ancestral gene order reconstruction for flowering plants has lagged behind developments in yeasts, insects and higher animals, because of the recency of widespread plant genome sequencing, sequencers' embargoes on public data use, paralogies due to whole genome duplication (WGD) and fractionation of undeleted duplicates, extensive paralogy from other sources, and the computational cost of existing methods. Results We address these problems, using the gene order of four core eudicot genomes (cacao, castor bean, papaya and grapevine) that have escaped any recent WGD events, and two others (poplar and cucumber) that descend from independent WGDs, in inferring the ancestral gene order of the rosid clade and those of its main subgroups, the fabids and malvids. We improve and adapt techniques including the OMG method for extracting large, paralogy-free, multiple orthologies from conflated pairwise synteny data among the six genomes and the PATHGROUPS approach for ancestral gene order reconstruction in a given phylogeny, where some genomes may be descendants of WGD events. We use the gene order evidence to evaluate the hypothesis that the order Malpighiales belongs to the malvids rather than as traditionally assigned to the fabids. Conclusions Gene orders of ancestral eudicot species, involving 10,000 or more genes can be reconstructed in an efficient, parsimonious and consistent way, despite paralogies due to WGD and other processes. Pairwise genomic syntenies provide appropriate input to a parameter-free procedure of multiple ortholog identification followed by gene-order reconstruction in solving instances of the "small phylogeny" problem. PMID:22759433

  5. Insights into the innate immunome of actiniarians using a comparative genomic approach.

    PubMed

    van der Burg, Chloé A; Prentis, Peter J; Surm, Joachim M; Pavasovic, Ana

    2016-11-02

    Innate immune genes tend to be highly conserved in metazoans, even in early divergent lineages such as Cnidaria (jellyfish, corals, hydroids and sea anemones) and Porifera (sponges). However, constant and diverse selection pressures on the immune system have driven the expansion and diversification of different immune gene families in a lineage-specific manner. To investigate how the innate immune system has evolved in a subset of sea anemone species (Order: Actiniaria), we performed a comprehensive and comparative study using 10 newly sequenced transcriptomes, as well as three publically available transcriptomes, to identify the origins, expansions and contractions of candidate and novel immune gene families. We characterised five conserved genes and gene families, as well as multiple novel innate immune genes, including the newly recognised putative pattern recognition receptor CniFL. Single copies of TLR, MyD88 and NF-κB were found in most species, and several copies of IL-1R-like, NLR and CniFL were found in almost all species. Multiple novel immune genes were identified with domain architectures including the Toll/interleukin-1 receptor (TIR) homology domain, which is well documented as functioning in protein-protein interactions and signal transduction in immune pathways. We hypothesise that these genes may interact as novel proteins in immune pathways of cnidarian species. Novelty in the actiniarian immunome is not restricted to only TIR-domain-containing proteins, as we identify a subset of NLRs which have undergone neofunctionalisation and contain 3-5 N-terminal transmembrane domains, which have so far only been identified in two anthozoan species. This research has significance in understanding the evolution and origin of the core eumetazoan gene set, including how novel innate immune genes evolve. For example, the evolution of transmembrane domain containing NLRs indicates that these NLRs may be membrane-bound, while all other metazoan and plant NLRs are exclusively cytosolic receptors. This is one example of how species without an adaptive immune system may evolve innovative solutions to detect pathogens or interact with native microbiota. Overall, these results provide an insight into the evolution of the innate immune system, and show that early divergent lineages, such as actiniarians, have a diverse repertoire of conserved and novel innate immune genes.

  6. Genome Structures and Transcriptomes Signify Niche Adaptation for the Multiple-Ion-Tolerant Extremophyte Schrenkiella parvula1[C][W][OPEN

    PubMed Central

    Oh, Dong-Ha; Hong, Hyewon; Lee, Sang Yeol; Yun, Dae-Jin; Bohnert, Hans J.; Dassanayake, Maheshi

    2014-01-01

    Schrenkiella parvula (formerly Thellungiella parvula), a close relative of Arabidopsis (Arabidopsis thaliana) and Brassica crop species, thrives on the shores of Lake Tuz, Turkey, where soils accumulate high concentrations of multiple-ion salts. Despite the stark differences in adaptations to extreme salt stresses, the genomes of S. parvula and Arabidopsis show extensive synteny. S. parvula completes its life cycle in the presence of Na+, K+, Mg2+, Li+, and borate at soil concentrations lethal to Arabidopsis. Genome structural variations, including tandem duplications and translocations of genes, interrupt the colinearity observed throughout the S. parvula and Arabidopsis genomes. Structural variations distinguish homologous gene pairs characterized by divergent promoter sequences and basal-level expression strengths. Comparative RNA sequencing reveals the enrichment of ion-transport functions among genes with higher expression in S. parvula, while pathogen defense-related genes show higher expression in Arabidopsis. Key stress-related ion transporter genes in S. parvula showed increased copy number, higher transcript dosage, and evidence for subfunctionalization. This extremophyte offers a framework to identify the requisite adjustments of genomic architecture and expression control for a set of genes found in most plants in a way to support distinct niche adaptation and lifestyles. PMID:24563282

  7. Functional analysis of aromatic biosynthetic pathways in Pseudomonas putida KT2440

    PubMed Central

    Molina‐Henares, M. Antonia; García‐Salamanca, Adela; Molina‐Henares, A. Jesús; De La Torre, Jesús; Herrera, M. Carmen; Ramos, Juan L.; Duque, Estrella

    2009-01-01

    Summary Pseudomonas putida KT2440 is a non‐pathogenic prototrophic bacterium with high potential for biotechnological applications. Despite all that is known about this strain, the biosynthesis of essential chemicals has not been fully analysed and auxotroph mutants are scarce. We carried out massive mini‐Tn5 random mutagenesis and screened for auxotrophs that require aromatic amino acids. The biosynthesis of aromatic amino acids was analysed in detail including physical and transcriptional organization of genes, complementation assays and feeding experiments to establish pathway intermediates. There is a single pathway from chorismate leading to the biosynthesis of tryptophan, whereas the biosynthesis of phenylalanine and tyrosine is achieved through multiple convergent pathways. Genes for tryptophan biosynthesis are grouped in unlinked regions with the trpBA and trpGDE genes organized as operons and the trpI, trpE and trpF genes organized as single transcriptional units. The pheA and tyrA gene‐encoding multifunctional enzymes for phenylalanine and tyrosine biosynthesis are linked in the chromosome and form an operon with the serC gene involved in serine biosynthesis. The last step in the biosynthesis of these two amino acids requires an amino transferase activity for which multiple tyrB‐like genes are present in the host chromosome. PMID:21261884

  8. Systematic correlation of environmental exposure and physiological and self-reported behaviour factors with leukocyte telomere length.

    PubMed

    Patel, Chirag J; Manrai, Arjun K; Corona, Erik; Kohane, Isaac S

    2017-02-01

    It is hypothesized that environmental exposures and behaviour influence telomere length, an indicator of cellular ageing. We systematically associated 461 indicators of environmental exposures, physiology and self-reported behaviour with telomere length in data from the US National Health and Nutrition Examination Survey (NHANES) in 1999-2002. Further, we tested whether factors identified in the NHANES participants are also correlated with gene expression of telomere length modifying genes. We correlated 461 environmental exposures, behaviours and clinical variables with telomere length, using survey-weighted linear regression, adjusting for sex, age, age squared, race/ethnicity, poverty level, education and born outside the USA, and estimated the false discovery rate to adjust for multiple hypotheses. We conducted a secondary analysis to investigate the correlation between identified environmental variables and gene expression levels of telomere-associated genes in publicly available gene expression samples. After correlating 461 variables with telomere length, we found 22 variables significantly associated with telomere length after adjustment for multiple hypotheses. Of these varaibales, 14 were associated with longer telomeres, including biomarkers of polychlorinated biphenyls([PCBs; 0.1 to 0.2 standard deviation (SD) increase for 1 SD increase in PCB level, P  < 0.002] and a form of vitamin A, retinyl stearate. Eight variables associated with shorter telomeres, including biomarkers of cadmium, C-reactive protein and lack of physical activity. We could not conclude that PCBs are correlated with gene expression of telomere-associated genes. Both environmental exposures and chronic disease-related risk factors may play a role in telomere length. Our secondary analysis found no evidence of association between PCBs/smoking and gene expression of telomere-associated genes. All correlations between exposures, behaviours and clinical factors and changes in telomere length will require further investigation regarding biological influence of exposure. © The Author 2016. Published by Oxford University Press on behalf of the International Epidemiological Association

  9. Genetic modification of stem cells for transplantation.

    PubMed

    Phillips, M Ian; Tang, Yao Liang

    2008-01-14

    Gene modification of cells prior to their transplantation, especially stem cells, enhances their survival and increases their function in cell therapy. Like the Trojan horse, the gene-modified cell has to gain entrance inside the host's walls and survive and deliver its transgene products. Using cellular, molecular and gene manipulation techniques the transplanted cell can be protected in a hostile environment from immune rejection, inflammation, hypoxia and apoptosis. Genetic engineering to modify cells involves constructing modules of functional gene sequences. They can be simple reporter genes or complex cassettes with gene switches, cell specific promoters and multiple transgenes. We discuss methods to deliver and construct gene cassettes with viral and non-viral delivery, siRNA, and conditional Cre/Lox P. We review the current uses of gene-modified stem cells in cardiovascular disease, diabetes, neurological diseases, (including Parkinson's, Alzheimer's and spinal cord injury repair), bone defects, hemophilia, and cancer.

  10. Gene Therapy with the Sleeping Beauty Transposon System.

    PubMed

    Kebriaei, Partow; Izsvák, Zsuzsanna; Narayanavari, Suneel A; Singh, Harjeet; Ivics, Zoltán

    2017-11-01

    The widespread clinical implementation of gene therapy requires the ability to stably integrate genetic information through gene transfer vectors in a safe, effective, and economical manner. The latest generation of Sleeping Beauty (SB) transposon vectors fulfills these requirements, and may overcome limitations associated with viral gene transfer vectors and transient nonviral gene delivery approaches that are prevalent in ongoing clinical trials. The SB system enables high-level stable gene transfer and sustained transgene expression in multiple primary human somatic cell types, thereby representing a highly attractive gene transfer strategy for clinical use. Here, we review the most important aspects of using SB for gene therapy, including vectorization as well as genomic integration features. We also illustrate the path to successful clinical implementation by highlighting the application of chimeric antigen receptor (CAR)-modified T cells in cancer immunotherapy. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Genetic Modification of Stem Cells for Transplantation

    PubMed Central

    Phillips, M. Ian; Tang, Yao Liang

    2009-01-01

    Gene modification of cells for prior to their transplantation, especially stem cells, enhances their survival and increases their function in cell therapy. Like the Trojan horse, the gene modified cell has to gain entrance inside the host’s walls and survive and deliver its transgene products Using cellular, molecular and gene manipulation techniques the transplanted cell can be protected in a hostile environment from immune rejection, inflammation, hypoxia and apoptosis. Genetic engineering to modify cells involves constructing modules of functional gene sequences. They can be simple reporter genes or complex cassettes with gene switches, cell specific promoters and multiple transgenes. We discuss methods to deliver and construct gene cassettes with viral and non viral delivery, siRNA, and conditional Cre/Lox P. We review the current uses of gene modified stem cells in cardiovascular disease, diabetes, neurological diseases,( including Parkinson’s, Alzheimer’s and spinal cord injury repair), bone defects, hemophilia, and cancer. PMID:18031863

  12. Expression Atlas: gene and protein expression across multiple studies and organisms

    PubMed Central

    Tang, Y Amy; Bazant, Wojciech; Burke, Melissa; Fuentes, Alfonso Muñoz-Pomer; George, Nancy; Koskinen, Satu; Mohammed, Suhaib; Geniza, Matthew; Preece, Justin; Jarnuczak, Andrew F; Huber, Wolfgang; Stegle, Oliver; Brazma, Alvis; Petryszak, Robert

    2018-01-01

    Abstract Expression Atlas (http://www.ebi.ac.uk/gxa) is an added value database that provides information about gene and protein expression in different species and contexts, such as tissue, developmental stage, disease or cell type. The available public and controlled access data sets from different sources are curated and re-analysed using standardized, open source pipelines and made available for queries, download and visualization. As of August 2017, Expression Atlas holds data from 3,126 studies across 33 different species, including 731 from plants. Data from large-scale RNA sequencing studies including Blueprint, PCAWG, ENCODE, GTEx and HipSci can be visualized next to each other. In Expression Atlas, users can query genes or gene-sets of interest and explore their expression across or within species, tissues, developmental stages in a constitutive or differential context, representing the effects of diseases, conditions or experimental interventions. All processed data matrices are available for direct download in tab-delimited format or as R-data. In addition to the web interface, data sets can now be searched and downloaded through the Expression Atlas R package. Novel features and visualizations include the on-the-fly analysis of gene set overlaps and the option to view gene co-expression in experiments investigating constitutive gene expression across tissues or other conditions. PMID:29165655

  13. Two FGFRL-Wnt circuits organize the planarian anteroposterior axis

    PubMed Central

    Scimone, M Lucila; Cote, Lauren E; Rogers, Travis; Reddien, Peter W

    2016-01-01

    How positional information instructs adult tissue maintenance is poorly understood. Planarians undergo whole-body regeneration and tissue turnover, providing a model for adult positional information studies. Genes encoding secreted and transmembrane components of multiple developmental pathways are predominantly expressed in planarian muscle cells. Several of these genes regulate regional identity, consistent with muscle harboring positional information. Here, single-cell RNA-sequencing of 115 muscle cells from distinct anterior-posterior regions identified 44 regionally expressed genes, including multiple Wnt and ndk/FGF receptor-like (ndl/FGFRL) genes. Two distinct FGFRL-Wnt circuits, involving juxtaposed anterior FGFRL and posterior Wnt expression domains, controlled planarian head and trunk patterning. ndl-3 and wntP-2 inhibition expanded the trunk, forming ectopic mouths and secondary pharynges, which independently extended and ingested food. fz5/8-4 inhibition, like that of ndk and wntA, caused posterior brain expansion and ectopic eye formation. Our results suggest that FGFRL-Wnt circuits operate within a body-wide coordinate system to control adult axial positioning. DOI: http://dx.doi.org/10.7554/eLife.12845.001 PMID:27063937

  14. Co-existence of Blau syndrome and NAID? Diagnostic challenges associated with presence of multiple pathogenic variants in NOD2 gene: a case report.

    PubMed

    Dziedzic, Magdalena; Marjańska, Agata; Bąbol-Pokora, Katarzyna; Urbańczyk, Anna; Grześk, Elżbieta; Młynarski, Wojciech; Kołtan, Sylwia

    2017-07-27

    Pediatric autoinflammatory diseases are rare and still poorly understood conditions resulting from defective genetic control of innate immune system, inter alia from anomalies of NOD2 gene. The product of this gene is Nod2 protein, taking part in maintenance of immune homeostasis. Clinical form of resultant autoinflammatory condition depends on NOD2 genotype; usually patients with NOD2 defects present with Blau syndrome, NOD2-associated autoinflammatory disease (NAID) or Crohn's disease. We present the case of a 7-year-old girl with co-existing symptoms of two rare diseases, Blau syndrome and NAID. Overlapping manifestations of two syndromes raised a significant diagnostic challenge, until next-generation molecular test (NGS) identified presence of three pathogenic variants of NOD2 gene: P268S, IVS8 +158 , 1007 fs, and established the ultimate diagnosis. Presence of multiple genetical abnormalities resulted in an ambiguous clinical presentation with overlapping symptoms of Blau syndrome and NAID. Final diagnosis of autoinflammatory disease opened new therapeutic possibilities, including the use of biological treatments.

  15. Male germline transmits fetal alcohol epigenetic marks for multiple generations: a review.

    PubMed

    Sarkar, Dipak K

    2016-01-01

    Alcohol exposure during fetal and early postnatal development can lead to an increased incidence of later life adult-onset diseases. Examples include central nervous system dysfunction, depression, anxiety, hyperactivity, and an inability to deal with stressful situations, increased infection and cancer. Direct effects of alcohol leading to developmental abnormalities often involve epigenetic modifications of genes that regulate cellular functions. Epigenetic marks carried over from the parents are known to undergo molecular programming events that happen early in embryonic development by a wave of DNA demethylation, which leaves the embryo with a fresh genomic composition. The proopiomelanocortin (Pomc) gene controls neuroendocrine-immune functions and is imprinted by fetal alcohol exposure. Recently, this gene has been shown to be hypermethylated through three generations. Additionally, the alcohol epigenetic marks on the Pomc gene are maintained in the male but not in the female germline during this transgenerational transmission. These data suggest that the male-specific chromosome might be involved in transmitting alcohol epigenetic marks through multiple generations. © 2015 Society for the Study of Addiction.

  16. Sequence variants in the autophagy gene IRGM and multiple other replicating loci contribute to Crohn disease susceptibility

    PubMed Central

    Parkes, Miles; Barrett, Jeffrey C; Prescott, Natalie; Tremelling, Mark; Anderson, Carl A; Fisher, Sheila A; Roberts, Roland G; Nimmo, Elaine R; Cummings, Fraser R; Soars, Dianne; Drummond, Hazel; Lees, Charlie W; Khawaja, Saud A; Bagnall, Richard; Burke, Denis A; Todhunter, Catherine E; Ahmad, Tariq; Onnie, Clive M; McArdle, Wendy; Strachan, David; Bethel, Graeme; Bryan, Claire; Deloukas, Panos; Forbes, Alastair; Sanderson, Jeremy; Jewell, Derek P; Satsangi, Jack; Mansfield, John C; Cardon, Lon; Mathew, Christopher G

    2008-01-01

    A genome-wide association scan in Crohn disease by the Wellcome Trust Case Control Consortium1 detected strong association at 6 novel loci. We tested 37 SNPs from these and other loci for association in an independent case control sample. Replication was obtained for the IRGM gene on chromosome 5q33.1 which induces autophagy (replication P = 6.6 × 10−4, combined P = 2.1 × 10−10), and for 9 other loci including NKX2-3 and gene deserts on chromosomes 1q and 5p13. PMID:17554261

  17. High Resolution Melt (HRM) analysis is an efficient tool to genotype EMS mutants in complex crop genomes.

    PubMed

    Lochlainn, Seosamh Ó; Amoah, Stephen; Graham, Neil S; Alamer, Khalid; Rios, Juan J; Kurup, Smita; Stoute, Andrew; Hammond, John P; Østergaard, Lars; King, Graham J; White, Phillip J; Broadley, Martin R

    2011-12-08

    Targeted Induced Loci Lesions IN Genomes (TILLING) is increasingly being used to generate and identify mutations in target genes of crop genomes. TILLING populations of several thousand lines have been generated in a number of crop species including Brassica rapa. Genetic analysis of mutants identified by TILLING requires an efficient, high-throughput and cost effective genotyping method to track the mutations through numerous generations. High resolution melt (HRM) analysis has been used in a number of systems to identify single nucleotide polymorphisms (SNPs) and insertion/deletions (IN/DELs) enabling the genotyping of different types of samples. HRM is ideally suited to high-throughput genotyping of multiple TILLING mutants in complex crop genomes. To date it has been used to identify mutants and genotype single mutations. The aim of this study was to determine if HRM can facilitate downstream analysis of multiple mutant lines identified by TILLING in order to characterise allelic series of EMS induced mutations in target genes across a number of generations in complex crop genomes. We demonstrate that HRM can be used to genotype allelic series of mutations in two genes, BraA.CAX1a and BraA.MET1.a in Brassica rapa. We analysed 12 mutations in BraA.CAX1.a and five in BraA.MET1.a over two generations including a back-cross to the wild-type. Using a commercially available HRM kit and the Lightscanner™ system we were able to detect mutations in heterozygous and homozygous states for both genes. Using HRM genotyping on TILLING derived mutants, it is possible to generate an allelic series of mutations within multiple target genes rapidly. Lines suitable for phenotypic analysis can be isolated approximately 8-9 months (3 generations) from receiving M3 seed of Brassica rapa from the RevGenUK TILLING service.

  18. High Resolution Melt (HRM) analysis is an efficient tool to genotype EMS mutants in complex crop genomes

    PubMed Central

    2011-01-01

    Background Targeted Induced Loci Lesions IN Genomes (TILLING) is increasingly being used to generate and identify mutations in target genes of crop genomes. TILLING populations of several thousand lines have been generated in a number of crop species including Brassica rapa. Genetic analysis of mutants identified by TILLING requires an efficient, high-throughput and cost effective genotyping method to track the mutations through numerous generations. High resolution melt (HRM) analysis has been used in a number of systems to identify single nucleotide polymorphisms (SNPs) and insertion/deletions (IN/DELs) enabling the genotyping of different types of samples. HRM is ideally suited to high-throughput genotyping of multiple TILLING mutants in complex crop genomes. To date it has been used to identify mutants and genotype single mutations. The aim of this study was to determine if HRM can facilitate downstream analysis of multiple mutant lines identified by TILLING in order to characterise allelic series of EMS induced mutations in target genes across a number of generations in complex crop genomes. Results We demonstrate that HRM can be used to genotype allelic series of mutations in two genes, BraA.CAX1a and BraA.MET1.a in Brassica rapa. We analysed 12 mutations in BraA.CAX1.a and five in BraA.MET1.a over two generations including a back-cross to the wild-type. Using a commercially available HRM kit and the Lightscanner™ system we were able to detect mutations in heterozygous and homozygous states for both genes. Conclusions Using HRM genotyping on TILLING derived mutants, it is possible to generate an allelic series of mutations within multiple target genes rapidly. Lines suitable for phenotypic analysis can be isolated approximately 8-9 months (3 generations) from receiving M3 seed of Brassica rapa from the RevGenUK TILLING service. PMID:22152063

  19. OncoSimulR: genetic simulation with arbitrary epistasis and mutator genes in asexual populations.

    PubMed

    Diaz-Uriarte, Ramon

    2017-06-15

    OncoSimulR implements forward-time genetic simulations of biallelic loci in asexual populations with special focus on cancer progression. Fitness can be defined as an arbitrary function of genetic interactions between multiple genes or modules of genes, including epistasis, restrictions in the order of accumulation of mutations, and order effects. Mutation rates can differ among genes, and can be affected by (anti)mutator genes. Also available are sampling from simulations (including single-cell sampling), plotting the genealogical relationships of clones and generating and plotting fitness landscapes. Implemented in R and C ++, freely available from BioConductor for Linux, Mac and Windows under the GNU GPL license. Version 2.5.9 or higher available from: http://www.bioconductor.org/packages/devel/bioc/html/OncoSimulR.html . GitHub repository at: https://github.com/rdiaz02/OncoSimul. ramon.diaz@iib.uam.es. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press.

  20. Chum salmon egg extracts induce upregulation of collagen type I and exert antioxidative effects on human dermal fibroblast cultures

    PubMed Central

    Yoshino, Atsushi; Polouliakh, Natalia; Meguro, Akira; Takeuchi, Masaki; Kawagoe, Tatsukata; Mizuki, Nobuhisa

    2016-01-01

    Components of fish roe possess antioxidant and antiaging activities, making them potentially very beneficial natural resources. Here, we investigated chum salmon eggs (CSEs) as a source of active ingredients, including vitamins, unsaturated fatty acids, and proteins. We incubated human dermal fibroblast cultures for 48 hours with high and low concentrations of CSE extracts and analyzed changes in gene expression. Cells treated with CSE extract showed concentration-dependent upregulation of collagen type I genes and of multiple antioxidative genes, including OXR1, TXNRD1, and PRDX family genes. We further conducted in silico phylogenetic footprinting analysis of promoter regions. These results suggested that transcription factors such as acute myeloid leukemia-1a and cyclic adenosine monophosphate response element-binding protein may be involved in the observed upregulation of antioxidative genes. Our results support the idea that CSEs are strong candidate sources of antioxidant materials and cosmeceutically effective ingredients. PMID:27621603

  1. Dual control of pcdh8l/PCNS expression and function in Xenopus laevis neural crest cells by adam13/33 via the transcription factors tfap2α and arid3a.

    PubMed

    Khedgikar, Vikram; Abbruzzese, Genevieve; Mathavan, Ketan; Szydlo, Hannah; Cousin, Helene; Alfandari, Dominique

    2017-08-22

    Adam13/33 is a cell surface metalloprotease critical for cranial neural crest (CNC) cell migration. It can cleave multiple substrates including itself, fibronectin, ephrinB, cadherin-11, pcdh8 and pcdh8l (this work). Cleavage of cadherin-11 produces an extracellular fragment that promotes CNC migration. In addition, the adam13 cytoplasmic domain is cleaved by gamma secretase, translocates into the nucleus and regulates multiple genes. Here, we show that adam13 interacts with the arid3a/dril1/Bright transcription factor. This interaction promotes a proteolytic cleavage of arid3a and its translocation to the nucleus where it regulates another transcription factor: tfap2α. Tfap2α in turn activates multiple genes including the protocadherin pcdh8l (PCNS). The proteolytic activity of adam13 is critical for the release of arid3a from the plasma membrane while the cytoplasmic domain appears critical for the cleavage of arid3a. In addition to this transcriptional control of pcdh8l, adam13 cleaves pcdh8l generating an extracellular fragment that also regulates cell migration.

  2. Dual control of pcdh8l/PCNS expression and function in Xenopus laevis neural crest cells by adam13/33 via the transcription factors tfap2α and arid3a

    PubMed Central

    Khedgikar, Vikram; Abbruzzese, Genevieve; Mathavan, Ketan; Szydlo, Hannah; Cousin, Helene

    2017-01-01

    Adam13/33 is a cell surface metalloprotease critical for cranial neural crest (CNC) cell migration. It can cleave multiple substrates including itself, fibronectin, ephrinB, cadherin-11, pcdh8 and pcdh8l (this work). Cleavage of cadherin-11 produces an extracellular fragment that promotes CNC migration. In addition, the adam13 cytoplasmic domain is cleaved by gamma secretase, translocates into the nucleus and regulates multiple genes. Here, we show that adam13 interacts with the arid3a/dril1/Bright transcription factor. This interaction promotes a proteolytic cleavage of arid3a and its translocation to the nucleus where it regulates another transcription factor: tfap2α. Tfap2α in turn activates multiple genes including the protocadherin pcdh8l (PCNS). The proteolytic activity of adam13 is critical for the release of arid3a from the plasma membrane while the cytoplasmic domain appears critical for the cleavage of arid3a. In addition to this transcriptional control of pcdh8l, adam13 cleaves pcdh8l generating an extracellular fragment that also regulates cell migration. PMID:28829038

  3. Epigenomics of Hypertension

    PubMed Central

    Liang, Mingyu; Cowley, Allen W.; Mattson, David L.; Kotchen, Theodore A.; Liu, Yong

    2013-01-01

    Multiple genes and pathways are involved in the pathogenesis of hypertension. Epigenomic studies of hypertension are beginning to emerge and hold great promise of providing novel insights into the mechanisms underlying hypertension. Epigenetic marks or mediators including DNA methylation, histone modifications, and non-coding RNA can be studied at a genome or near-genome scale using epigenomic approaches. At the single gene level, several studies have identified changes in epigenetic modifications in genes expressed in the kidney that correlate with the development of hypertension. Systematic analysis and integration of epigenetic marks at the genome scale, demonstration of cellular and physiological roles of specific epigenetic modifications, and investigation of inheritance are among the major challenges and opportunities for future epigenomic and epigenetic studies of hypertension. Essential hypertension is a multifactorial disease involving multiple genetic and environmental factors and mediated by alterations in multiple biological pathways. Because the non-genetic mechanisms may involve epigenetic modifications, epigenomics is one of the latest concepts and approaches brought to bear on hypertension research. In this article, we summarize briefly the concepts and techniques for epigenomics, discuss the rationale for applying epigenomic approaches to study hypertension, and review the current state of this research area. PMID:24011581

  4. Root-synthesised cytokinins induce salinity tolerance in tomato (Solanum lycopersicum L.)

    USDA-ARS?s Scientific Manuscript database

    Soil salinity decreases crop yield via multiple mechanisms, including decreasing concentrations of the growth-promoting, senescence-delaying and insect resistance-enhancing plant hormones cytokinins. Two approaches evaluated whether root-localised ipt (a key enzyme for cytokinin biosynthesis) gene e...

  5. Ancient genomic architecture for mammalian olfactory receptor clusters

    PubMed Central

    Aloni, Ronny; Olender, Tsviya; Lancet, Doron

    2006-01-01

    Background Mammalian olfactory receptor (OR) genes reside in numerous genomic clusters of up to several dozen genes. Whole-genome sequence alignment nets of five mammals allow their comprehensive comparison, aimed at reconstructing the ancestral olfactory subgenome. Results We developed a new and general tool for genome-wide definition of genomic gene clusters conserved in multiple species. Syntenic orthologs, defined as gene pairs showing conservation of both genomic location and coding sequence, were subjected to a graph theory algorithm for discovering CLICs (clusters in conservation). When applied to ORs in five mammals, including the marsupial opossum, more than 90% of the OR genes were found within a framework of 48 multi-species CLICs, invoking a general conservation of gene order and composition. A detailed analysis of individual CLICs revealed multiple differences among species, interpretable through species-specific genomic rearrangements and reflecting complex mammalian evolutionary dynamics. One significant instance involves CLIC #1, which lacks a human member, implying the human-specific deletion of an OR cluster, whose mouse counterpart has been tentatively associated with isovaleric acid odorant detection. Conclusion The identified multi-species CLICs demonstrate that most of the mammalian OR clusters have a common ancestry, preceding the split between marsupials and placental mammals. However, only two of these CLICs were capable of incorporating chicken OR genes, parsimoniously implying that all other CLICs emerged subsequent to the avian-mammalian divergence. PMID:17010214

  6. The utility of multiple molecular methods including whole genome sequencing as tools to differentiate Escherichia coli O157:H7 outbreaks.

    PubMed

    Berenger, Byron M; Berry, Chrystal; Peterson, Trevor; Fach, Patrick; Delannoy, Sabine; Li, Vincent; Tschetter, Lorelee; Nadon, Celine; Honish, Lance; Louie, Marie; Chui, Linda

    2015-01-01

    A standardised method for determining Escherichia coli O157:H7 strain relatedness using whole genome sequencing or virulence gene profiling is not yet established. We sought to assess the capacity of either high-throughput polymerase chain reaction (PCR) of 49 virulence genes, core-genome single nt variants (SNVs) or k-mer clustering to discriminate between outbreak-associated and sporadic E. coli O157:H7 isolates. Three outbreaks and multiple sporadic isolates from the province of Alberta, Canada were included in the study. Two of the outbreaks occurred concurrently in 2014 and one occurred in 2012. Pulsed-field gel electrophoresis (PFGE) and multilocus variable-number tandem repeat analysis (MLVA) were employed as comparator typing methods. The virulence gene profiles of isolates from the 2012 and 2014 Alberta outbreak events and contemporary sporadic isolates were mostly identical; therefore the set of virulence genes chosen in this study were not discriminatory enough to distinguish between outbreak clusters. Concordant with PFGE and MLVA results, core genome SNV and k-mer phylogenies clustered isolates from the 2012 and 2014 outbreaks as distinct events. k-mer phylogenies demonstrated increased discriminatory power compared with core SNV phylogenies. Prior to the widespread implementation of whole genome sequencing for routine public health use, issues surrounding cost, technical expertise, software standardisation, and data sharing/comparisons must be addressed.

  7. High-resolution melting (HRM) re-analysis of a polyposis patients cohort reveals previously undetected heterozygous and mosaic APC gene mutations.

    PubMed

    Out, Astrid A; van Minderhout, Ivonne J H M; van der Stoep, Nienke; van Bommel, Lysette S R; Kluijt, Irma; Aalfs, Cora; Voorendt, Marsha; Vossen, Rolf H A M; Nielsen, Maartje; Vasen, Hans F A; Morreau, Hans; Devilee, Peter; Tops, Carli M J; Hes, Frederik J

    2015-06-01

    Familial adenomatous polyposis is most frequently caused by pathogenic variants in either the APC gene or the MUTYH gene. The detection rate of pathogenic variants depends on the severity of the phenotype and sensitivity of the screening method, including sensitivity for mosaic variants. For 171 patients with multiple colorectal polyps without previously detectable pathogenic variant, APC was reanalyzed in leukocyte DNA by one uniform technique: high-resolution melting (HRM) analysis. Serial dilution of heterozygous DNA resulted in a lowest detectable allelic fraction of 6% for the majority of variants. HRM analysis and subsequent sequencing detected pathogenic fully heterozygous APC variants in 10 (6%) of the patients and pathogenic mosaic variants in 2 (1%). All these variants were previously missed by various conventional scanning methods. In parallel, HRM APC scanning was applied to DNA isolated from polyp tissue of two additional patients with apparently sporadic polyposis and without detectable pathogenic APC variant in leukocyte DNA. In both patients a pathogenic mosaic APC variant was present in multiple polyps. The detection of pathogenic APC variants in 7% of the patients, including mosaics, illustrates the usefulness of a complete APC gene reanalysis of previously tested patients, by a supplementary scanning method. HRM is a sensitive and fast pre-screening method for reliable detection of heterozygous and mosaic variants, which can be applied to leukocyte and polyp derived DNA.

  8. Postoperative Pain and Analgesia: Is There a Genetic Basis to the Opioid Crisis?

    PubMed

    Elmallah, Randa K; Ramkumar, Prem N; Khlopas, Anton; Ramkumar, Rathika R; Chughtai, Morad; Sodhi, Nipun; Sultan, Assem A; Mont, Michael A

    2018-06-01

    Multiple factors have been implicated in determining why certain patients have increased postoperative pain, with the potential to develop chronic pain. The purpose of this study was to: 1) identify and describe genes that affect postoperative pain perception and control; 2) address modifiable risk factors that result in epigenetic altered responses to pain; and 3) characterize differences in pain sensitivity and thresholds between opioid-naïve and opioid-dependent patients. Three electronic databases were used to conduct the literature search: Pubmed, EBSCO host, and SCOPUS. A total of 372 abstracts were reviewed, of which 46 studies were deemed relevant and are included in this review. Specific gene alterations that were shown to affect postoperative pain control included single nucleotide polymorphisms in the mu, kappa, and delta opioid receptors, ion channel genes, cytotoxic T-cells, glutamate receptors and cytokine genes, among others. Alcoholism, obesity, and smoking were all linked with genetic polymorphisms that altered pain sensitivity. Opioid abuse was found to be associated with a poorer response to analgesics postoperatively, as well as a risk for prescription overdose. Although pain perception has multiple complex influences, the greatest variability seen in response to opioids among postoperative patients known to date can be traced to genetic differences in opioid metabolism. Further study is needed to determine the clinical significance of these genetic associations.

  9. Genetics of autism spectrum disorders.

    PubMed

    Kumar, Ravinesh A; Christian, Susan L

    2009-05-01

    Autism spectrum disorders (ASDs) are a clinically complex group of childhood disorders that have firm evidence of an underlying genetic etiology. Many techniques have been used to characterize the genetic bases of ASDs. Linkage studies have identified several replicated susceptibility loci, including 2q24-2q31, 7q, and 17q11-17q21. Association studies and mutation analysis of candidate genes have implicated the synaptic genes NRXN1, NLGN3, NLGN4, SHANK3, and CNTNAP2 in ASDs. Traditional cytogenetic approaches highlight the high frequency of large chromosomal abnormalities (3%-7% of patients), including the most frequently observed maternal 15q11-13 duplications (1%-3% of patients). Newly developed techniques include high-resolution DNA microarray technologies, which have discovered formerly undetectable submicroscopic copy number variants, and genomewide association studies, which allow simultaneous detection of multiple genes associated with ASDs. Although great progress has been made in autism genetics, the molecular bases of most ASDs remains enigmatic.

  10. Multiple Site-Directed and Saturation Mutagenesis by the Patch Cloning Method.

    PubMed

    Taniguchi, Naohiro; Murakami, Hiroshi

    2017-01-01

    Constructing protein-coding genes with desired mutations is a basic step for protein engineering. Herein, we describe a multiple site-directed and saturation mutagenesis method, termed MUPAC. This method has been used to introduce multiple site-directed mutations in the green fluorescent protein gene and in the moloney murine leukemia virus reverse transcriptase gene. Moreover, this method was also successfully used to introduce randomized codons at five desired positions in the green fluorescent protein gene, and for simple DNA assembly for cloning.

  11. Female pseudohermaphroditism with multiple caudal anomalies: Absence of Y-specific DNA sequences as pathogenetic factors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Seaver, L.H.; Grimes, J.; Erickson, R.P.

    1994-05-15

    46,XX female pseudohermaphrodites have been previously described with nearly complete masculinization of the external genitalia and no apparent source of testosterone. Multiple malformations of internal genital, urinary, and gastrointestinal tracts are associated. We have evaluated four such infants with female pseudohermaphroditism and multiple caudal anomalies. Three cases had apparently normal chromosome (46,XX); one had a 46,XX,del(10)(q25.3{yields}qter) chromosome constitution. The chromosome breakpoint is in the region of PAX2, a developmentally important paired box gene which is expressed in urogenital tissue. Using the polymerase chain reaction, we screened for the presence of multiple Y specific sequences, including SRY (sex determining region, Ymore » chromosome), that could explain masculinization of the external genitalia. All were negative for Y centromeric sequences, ZFY (Zinc finger Y), and SRY. Furthermore, there was no evidence for adrenal or other sources of testosterone. We suggest that the masculinization in these cases is the result of abnormal expression of genes which would normally be regulated by testosterone. 32 refs., 1 fig., 2 tabs.« less

  12. Overexpression of the Arabidopsis CBF3 Transcriptional Activator Mimics Multiple Biochemical Changes Associated with Cold Acclimation1

    PubMed Central

    Gilmour, Sarah J.; Sebolt, Audrey M.; Salazar, Maite P.; Everard, John D.; Thomashow, Michael F.

    2000-01-01

    We further investigated the role of the Arabidopsis CBF regulatory genes in cold acclimation, the process whereby certain plants increase in freezing tolerance upon exposure to low temperature. The CBF genes, which are rapidly induced in response to low temperature, encode transcriptional activators that control the expression of genes containing the C-repeat/dehydration responsive element DNA regulatory element in their promoters. Constitutive expression of either CBF1 or CBF3 (also known as DREB1b and DREB1a, respectively) in transgenic Arabidopsis plants has been shown to induce the expression of target COR (cold-regulated) genes and to enhance freezing tolerance in nonacclimated plants. Here we demonstrate that overexpression of CBF3 in Arabidopsis also increases the freezing tolerance of cold-acclimated plants. Moreover, we show that it results in multiple biochemical changes associated with cold acclimation: CBF3-expressing plants had elevated levels of proline (Pro) and total soluble sugars, including sucrose, raffinose, glucose, and fructose. Plants overexpressing CBF3 also had elevated P5CS transcript levels suggesting that the increase in Pro levels resulted, at least in part, from increased expression of the key Pro biosynthetic enzyme Δ1-pyrroline-5-carboxylate synthase. These results lead us to propose that CBF3 integrates the activation of multiple components of the cold acclimation response. PMID:11115899

  13. A greedy, graph-based algorithm for the alignment of multiple homologous gene lists.

    PubMed

    Fostier, Jan; Proost, Sebastian; Dhoedt, Bart; Saeys, Yvan; Demeester, Piet; Van de Peer, Yves; Vandepoele, Klaas

    2011-03-15

    Many comparative genomics studies rely on the correct identification of homologous genomic regions using accurate alignment tools. In such case, the alphabet of the input sequences consists of complete genes, rather than nucleotides or amino acids. As optimal multiple sequence alignment is computationally impractical, a progressive alignment strategy is often employed. However, such an approach is susceptible to the propagation of alignment errors in early pairwise alignment steps, especially when dealing with strongly diverged genomic regions. In this article, we present a novel accurate and efficient greedy, graph-based algorithm for the alignment of multiple homologous genomic segments, represented as ordered gene lists. Based on provable properties of the graph structure, several heuristics are developed to resolve local alignment conflicts that occur due to gene duplication and/or rearrangement events on the different genomic segments. The performance of the algorithm is assessed by comparing the alignment results of homologous genomic segments in Arabidopsis thaliana to those obtained by using both a progressive alignment method and an earlier graph-based implementation. Especially for datasets that contain strongly diverged segments, the proposed method achieves a substantially higher alignment accuracy, and proves to be sufficiently fast for large datasets including a few dozens of eukaryotic genomes. http://bioinformatics.psb.ugent.be/software. The algorithm is implemented as a part of the i-ADHoRe 3.0 package.

  14. Integrated computational biology analysis to evaluate target genes for chronic myelogenous leukemia.

    PubMed

    Zheng, Yu; Wang, Yu-Ping; Cao, Hongbao; Chen, Qiusheng; Zhang, Xi

    2018-06-05

    Although hundreds of genes have been linked to chronic myelogenous leukemia (CML), many of the results lack reproducibility. In the present study, data across multiple modalities were integrated to evaluate 579 CML candidate genes, including literature‑based CML‑gene relation data, Gene Expression Omnibus RNA expression data and pathway‑based gene‑gene interaction data. The expression data included samples from 76 patients with CML and 73 healthy controls. For each target gene, four metrics were proposed and tested with case/control classification. The effectiveness of the four metrics presented was demonstrated by the high classification accuracy (94.63%; P<2x10‑4). Cross metric analysis suggested nine top candidate genes for CML: Epidermal growth factor receptor, tumor protein p53, catenin β 1, janus kinase 2, tumor necrosis factor, abelson murine leukemia viral oncogene homolog 1, vascular endothelial growth factor A, B‑cell lymphoma 2 and proto‑oncogene tyrosine‑protein kinase. In addition, 145 CML candidate pathways enriched with 485 out of 579 genes were identified (P<8.2x10‑11; q=0.005). In conclusion, weighted genetic networks generated using computational biology may be complementary to biological experiments for the evaluation of known or novel CML target genes.

  15. nfi-1 affects behavior and life-span in C. elegans but is not essential for DNA replication or survival

    PubMed Central

    Lazakovitch, Elena; Kalb, John M; Matsumoto, Reiko; Hirono, Keiko; Kohara, Yuji; Gronostajski, Richard M

    2005-01-01

    Background The Nuclear Factor I (one) (NFI) family of transcription/replication factors plays essential roles in mammalian gene expression and development and in adenovirus DNA replication. Because of its role in viral DNA replication NFI has long been suspected to function in host DNA synthesis. Determining the requirement for NFI proteins in mammalian DNA replication is complicated by the presence of 4 NFI genes in mice and humans. Loss of individual NFI genes in mice cause defects in brain, lung and tooth development, but the presence of 4 homologous NFI genes raises the issue of redundant roles for NFI genes in DNA replication. No NFI genes are present in bacteria, fungi or plants. However single NFI genes are present in several simple animals including Drosophila and C. elegans, making it possible to test for a requirement for NFI in multicellular eukaryotic DNA replication and development. Here we assess the functions of the single nfi-1 gene in C. elegans. Results C. elegans NFI protein (CeNFI) binds specifically to the same NFI-binding site recognized by vertebrate NFIs. nfi-1 encodes alternatively-spliced, maternally-inherited transcripts that are expressed at the single cell stage, during embryogenesis, and in adult muscles, neurons and gut cells. Worms lacking nfi-1 survive but have defects in movement, pharyngeal pumping and egg-laying and have a reduced life-span. Expression of the muscle gene Ce titin is decreased in nfi-1 mutant worms. Conclusion NFI gene function is not needed for survival in C. elegans and thus NFI is likely not essential for DNA replication in multi-cellular eukaryotes. The multiple defects in motility, egg-laying, pharyngeal pumping, and reduced lifespan indicate that NFI is important for these processes. Reduction in Ce titin expression could affect muscle function in multiple tissues. The phenotype of nfi-1 null worms indicates that NFI functions in multiple developmental and behavioral systems in C. elegans, likely regulating genes that function in motility, egg-laying, pharyngeal pumping and lifespan maintenance. PMID:16242019

  16. Bayesian approach to transforming public gene expression repositories into disease diagnosis databases.

    PubMed

    Huang, Haiyan; Liu, Chun-Chi; Zhou, Xianghong Jasmine

    2010-04-13

    The rapid accumulation of gene expression data has offered unprecedented opportunities to study human diseases. The National Center for Biotechnology Information Gene Expression Omnibus is currently the largest database that systematically documents the genome-wide molecular basis of diseases. However, thus far, this resource has been far from fully utilized. This paper describes the first study to transform public gene expression repositories into an automated disease diagnosis database. Particularly, we have developed a systematic framework, including a two-stage Bayesian learning approach, to achieve the diagnosis of one or multiple diseases for a query expression profile along a hierarchical disease taxonomy. Our approach, including standardizing cross-platform gene expression data and heterogeneous disease annotations, allows analyzing both sources of information in a unified probabilistic system. A high level of overall diagnostic accuracy was shown by cross validation. It was also demonstrated that the power of our method can increase significantly with the continued growth of public gene expression repositories. Finally, we showed how our disease diagnosis system can be used to characterize complex phenotypes and to construct a disease-drug connectivity map.

  17. Three gene expression vector sets for concurrently expressing multiple genes in Saccharomyces cerevisiae.

    PubMed

    Ishii, Jun; Kondo, Takashi; Makino, Harumi; Ogura, Akira; Matsuda, Fumio; Kondo, Akihiko

    2014-05-01

    Yeast has the potential to be used in bulk-scale fermentative production of fuels and chemicals due to its tolerance for low pH and robustness for autolysis. However, expression of multiple external genes in one host yeast strain is considerably labor-intensive due to the lack of polycistronic transcription. To promote the metabolic engineering of yeast, we generated systematic and convenient genetic engineering tools to express multiple genes in Saccharomyces cerevisiae. We constructed a series of multi-copy and integration vector sets for concurrently expressing two or three genes in S. cerevisiae by embedding three classical promoters. The comparative expression capabilities of the constructed vectors were monitored with green fluorescent protein, and the concurrent expression of genes was monitored with three different fluorescent proteins. Our multiple gene expression tool will be helpful to the advanced construction of genetically engineered yeast strains in a variety of research fields other than metabolic engineering. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  18. Positive Selection of Plasmodium falciparum Parasites With Multiple var2csa-Type PfEMP1 Genes During the Course of Infection in Pregnant Women

    PubMed Central

    Salanti, Ali; Lavstsen, Thomas; Nielsen, Morten A.; Theander, Thor G.; Leke, Rose G. F.; Lo, Yeung Y.; Bobbili, Naveen; Arnot, David E.; Taylor, Diane W.

    2011-01-01

    Placental malaria infections are caused by Plasmodium falciparum–infected red blood cells sequestering in the placenta by binding to chondroitin sulfate A, mediated by VAR2CSA, a variant of the PfEMP1 family of adhesion antigens. Recent studies have shown that many P. falciparum genomes have multiple genes coding for different VAR2CSA proteins, and parasites with >1 var2csa gene appear to be more common in pregnant women with placental malaria than in nonpregnant individuals. We present evidence that, in pregnant women, parasites containing multiple var2csa-type genes possess a selective advantage over parasites with a single var2csa gene. Accumulation of parasites with multiple copies of the var2csa gene during the course of pregnancy was also correlated with the development of antibodies involved in blocking VAR2CSA adhesion. The data suggest that multiplicity of var2csa-type genes enables P. falciparum parasites to persist for a longer period of time during placental infections, probably because of their greater capacity for antigenic variation and evasion of variant-specific immune responses. PMID:21592998

  19. Mxra8 is a receptor for multiple arthritogenic alphaviruses.

    PubMed

    Zhang, Rong; Kim, Arthur S; Fox, Julie M; Nair, Sharmila; Basore, Katherine; Klimstra, William B; Rimkunas, Rebecca; Fong, Rachel H; Lin, Hueylie; Poddar, Subhajit; Crowe, James E; Doranz, Benjamin J; Fremont, Daved H; Diamond, Michael S

    2018-05-01

    Arthritogenic alphaviruses comprise a group of enveloped RNA viruses that are transmitted to humans by mosquitoes and cause debilitating acute and chronic musculoskeletal disease 1 . The host factors required for alphavirus entry remain poorly characterized 2 . Here we use a genome-wide CRISPR-Cas9-based screen to identify the cell adhesion molecule Mxra8 as an entry mediator for multiple emerging arthritogenic alphaviruses, including chikungunya, Ross River, Mayaro and O'nyong nyong viruses. Gene editing of mouse Mxra8 or human MXRA8 resulted in reduced levels of viral infection of cells and, reciprocally, ectopic expression of these genes resulted in increased infection. Mxra8 bound directly to chikungunya virus particles and enhanced virus attachment and internalization into cells. Consistent with these findings, Mxra8-Fc fusion protein or anti-Mxra8 monoclonal antibodies blocked chikungunya virus infection in multiple cell types, including primary human synovial fibroblasts, osteoblasts, chondrocytes and skeletal muscle cells. Mutagenesis experiments suggest that Mxra8 binds to a surface-exposed region across the A and B domains of chikungunya virus E2 protein, which are a speculated site of attachment. Finally, administration of the Mxra8-Fc protein or anti-Mxra8 blocking antibodies to mice reduced chikungunya and O'nyong nyong virus infection as well as associated foot swelling. Pharmacological targeting of Mxra8 could form a strategy for mitigating infection and disease by multiple arthritogenic alphaviruses.

  20. High-density array-CGH with targeted NGS unmask multiple noncontiguous minute deletions on chromosome 3p21 in mesothelioma.

    PubMed

    Yoshikawa, Yoshie; Emi, Mitsuru; Hashimoto-Tamaoki, Tomoko; Ohmuraya, Masaki; Sato, Ayuko; Tsujimura, Tohru; Hasegawa, Seiki; Nakano, Takashi; Nasu, Masaki; Pastorino, Sandra; Szymiczek, Agata; Bononi, Angela; Tanji, Mika; Pagano, Ian; Gaudino, Giovanni; Napolitano, Andrea; Goparaju, Chandra; Pass, Harvey I; Yang, Haining; Carbone, Michele

    2016-11-22

    We used a custom-made comparative genomic hybridization array (aCGH; average probe interval 254 bp) to screen 33 malignant mesothelioma (MM) biopsies for somatic copy number loss throughout the 3p21 region (10.7 Mb) that harbors 251 genes, including BRCA1 (breast cancer 1)-associated protein 1 (BAP1), the most commonly mutated gene in MM. We identified frequent minute biallelic deletions (<3 kb) in 46 of 251 genes: four were cancer-associated genes: SETD2 (SET domain-containing protein 2) (7 of 33), BAP1 (8 of 33), PBRM1 (polybromo 1) (3 of 33), and SMARCC1 (switch/sucrose nonfermentable- SWI/SNF-related, matrix-associated, actin-dependent regulator of chromatin, subfamily c, member 1) (2 of 33). These four genes were further investigated by targeted next-generation sequencing (tNGS), which revealed sequence-level mutations causing biallelic inactivation. Combined high-density aCGH and tNGS revealed biallelic gene inactivation in SETD2 (9 of 33, 27%), BAP1 (16 of 33, 48%), PBRM1 (5 of 33, 15%), and SMARCC1 (2 of 33, 6%). The incidence of genetic alterations detected is much higher than reported in the literature because minute deletions are not detected by NGS or commercial aCGH. Many of these minute deletions were not contiguous, but rather alternated with segments showing oscillating copy number changes along the 3p21 region. In summary, we found that in MM: (i) multiple minute simultaneous biallelic deletions are frequent in chromosome 3p21, where they occur as distinct events involving multiple genes; (ii) in addition to BAP1, mutations of SETD2, PBRM1, and SMARCC1 are frequent in MM; and (iii) our results suggest that high-density aCGH combined with tNGS provides a more precise estimate of the frequency and types of genes inactivated in human cancer than approaches based exclusively on NGS strategy.

  1. Alternative splicing for members of human mosaic domain superfamilies. I. The CH and LIM domains containing group of proteins.

    PubMed

    Friedberg, Felix

    2009-05-01

    In this paper we examine (restricted to homo sapiens) the products resulting from gene duplication and the subsequent alternative splicing for the members of a multidomain group of proteins which possess the evolutionary conserved calponin homology CH domain, i.e. an "actin binding domain", as a singlet and which, in addition, contain the conserved cysteine rich double Zn finger possessing Lim domain, also as a singlet. Seven genes, resulting from gene duplications, were identified that code for seven group members for which pre-mRNAs appear to have undergone multiple alternative splicing: Mical 1, 2 and 3 are located on chromosomes 6q21, 11p15 and 22q11, respectively. The LMO7 gene is present on chromosome 13q22 and the LIMCH1 gene on chromosome 4p13. Micall1 is mapped to chromosome 22q13 and Micall2 to chromosome 7p22. Translated Gen/Bank ESTs suggest the existence of multiple products alternatively spliced from the pre-mRNAs encoded by these genes. Characteristic indicators of such splicing among the proteins derived from one gene must include containment of some common extensive 100% identical regions. In some instances only one exon might be partly or completely eliminated. Sometimes alternative splicing is also associated with an increased frequency of creation of an exon or part of an exon from an intron. Not only coding regions for the body of the protein but also for its N- or -C ends could be affected by the splicing. If created forms are merely beginning at different starting points but remain identical in sequence thereafter, their existence as products of alternate splicing must be questioned. In the splicings, described in this paper, multiple isoforms rather than a single isoform appear as products during the gene expression.

  2. Genetic variation in cell death genes and risk of non-Hodgkin lymphoma.

    PubMed

    Schuetz, Johanna M; Daley, Denise; Graham, Jinko; Berry, Brian R; Gallagher, Richard P; Connors, Joseph M; Gascoyne, Randy D; Spinelli, John J; Brooks-Wilson, Angela R

    2012-01-01

    Non-Hodgkin lymphomas are a heterogeneous group of solid tumours that constitute the 5(th) highest cause of cancer mortality in the United States and Canada. Poor control of cell death in lymphocytes can lead to autoimmune disease or cancer, making genes involved in programmed cell death of lymphocytes logical candidate genes for lymphoma susceptibility. We tested for genetic association with NHL and NHL subtypes, of SNPs in lymphocyte cell death genes using an established population-based study. 17 candidate genes were chosen based on biological function, with 123 SNPs tested. These included tagSNPs from HapMap and novel SNPs discovered by re-sequencing 47 cases in genes for which SNP representation was judged to be low. The main analysis, which estimated odds ratios by fitting data to an additive logistic regression model, used European ancestry samples that passed quality control measures (569 cases and 547 controls). A two-tiered approach for multiple testing correction was used: correction for number of tests within each gene by permutation-based methodology, followed by correction for the number of genes tested using the false discovery rate. Variant rs928883, near miR-155, showed an association (OR per A-allele: 2.80 [95% CI: 1.63-4.82]; p(F) = 0.027) with marginal zone lymphoma that is significant after correction for multiple testing. This is the first reported association between a germline polymorphism at a miRNA locus and lymphoma.

  3. Altering the selection capabilities of common cloning vectors via restriction enzyme mediated gene disruption

    PubMed Central

    2013-01-01

    Background The cloning of gene sequences forms the basis for many molecular biological studies. One important step in the cloning process is the isolation of bacterial transformants carrying vector DNA. This involves a vector-encoded selectable marker gene, which in most cases, confers resistance to an antibiotic. However, there are a number of circumstances in which a different selectable marker is required or may be preferable. Such situations can include restrictions to host strain choice, two phase cloning experiments and mutagenesis experiments, issues that result in additional unnecessary cloning steps, in which the DNA needs to be subcloned into a vector with a suitable selectable marker. Results We have used restriction enzyme mediated gene disruption to modify the selectable marker gene of a given vector by cloning a different selectable marker gene into the original marker present in that vector. Cloning a new selectable marker into a pre-existing marker was found to change the selection phenotype conferred by that vector, which we were able to demonstrate using multiple commonly used vectors and multiple resistance markers. This methodology was also successfully applied not only to cloning vectors, but also to expression vectors while keeping the expression characteristics of the vector unaltered. Conclusions Changing the selectable marker of a given vector has a number of advantages and applications. This rapid and efficient method could be used for co-expression of recombinant proteins, optimisation of two phase cloning procedures, as well as multiple genetic manipulations within the same host strain without the need to remove a pre-existing selectable marker in a previously genetically modified strain. PMID:23497512

  4. Genetics and Genomics of Single-Gene Cardiovascular Diseases: Common Hereditary Cardiomyopathies as Prototypes of Single-Gene Disorders

    PubMed Central

    Marian, Ali J.; van Rooij, Eva; Roberts, Robert

    2016-01-01

    This is the first of 2 review papers on genetics and genomics appearing as part of the series on “omics.” Genomics pertains to all components of an organism’s genes, whereas genetics involves analysis of a specific gene(s) in the context of heredity. The paper provides introductory comments, describes the basis of human genetic diversity, and addresses the phenotypic consequences of genetic variants. Rare variants with large effect sizes are responsible for single-gene disorders, whereas complex polygenic diseases are typically due to multiple genetic variants, each exerting a modest effect size. To illustrate the clinical implications of genetic variants with large effect sizes, 3 common forms of hereditary cardiomyopathies are discussed as prototypic examples of single-gene disorders, including their genetics, clinical manifestations, pathogenesis, and treatment. The genetic basis of complex traits is discussed in a separate paper. PMID:28007145

  5. Mitochondria, oligodendrocytes and inflammation in bipolar disorder: evidence from transcriptome studies points to intriguing parallels with multiple sclerosis

    PubMed Central

    Konradi, Christine; Sillivan, Stephanie E.; Clay, Hayley B.

    2011-01-01

    Gene expression studies of bipolar disorder (BPD) have shown changes in transcriptome profiles in multiple brain regions. Here we summarize the most consistent findings in the scientific literature, and compare them to data from schizophrenia (SZ) and major depressive disorder (MDD). The transcriptome profiles of all three disorders overlap, making the existence of a BPD-specific profile unlikely. Three groups of functionally related genes are consistently expressed at altered levels in BPD, SZ and MDD. Genes involved in energy metabolism and mitochondrial function are downregulated, genes involved in immune response and inflammation are upregulated, and genes expressed in oligodendrocytes are downregulated. Experimental paradigms for multiple sclerosis demonstrate a tight link between energy metabolism, inflammation and demyelination. These studies also show variabilities in the extent of oligodendrocyte stress, which can vary from a downregulation of oligodendrocyte genes, such as observed in psychiatric disorders, to cell death and brain lesions seen in multiple sclerosis. We conclude that experimental models of multiple sclerosis could be of interest for the research of BPD, SZ and MDD. PMID:21310238

  6. Patterns of evolution at the gametophytic self-incompatibility Sorbus aucuparia (Pyrinae) S pollen genes support the non-self recognition by multiple factors model.

    PubMed

    Aguiar, Bruno; Vieira, Jorge; Cunha, Ana E; Fonseca, Nuno A; Reboiro-Jato, David; Reboiro-Jato, Miguel; Fdez-Riverola, Florentino; Raspé, Olivier; Vieira, Cristina P

    2013-05-01

    S-RNase-based gametophytic self-incompatibility evolved once before the split of the Asteridae and Rosidae. In Prunus (tribe Amygdaloideae of Rosaceae), the self-incompatibility S-pollen is a single F-box gene that presents the expected evolutionary signatures. In Malus and Pyrus (subtribe Pyrinae of Rosaceae), however, clusters of F-box genes (called SFBBs) have been described that are expressed in pollen only and are linked to the S-RNase gene. Although polymorphic, SFBB genes present levels of diversity lower than those of the S-RNase gene. They have been suggested as putative S-pollen genes, in a system of non-self recognition by multiple factors. Subsets of allelic products of the different SFBB genes interact with non-self S-RNases, marking them for degradation, and allowing compatible pollinations. This study performed a detailed characterization of SFBB genes in Sorbus aucuparia (Pyrinae) to address three predictions of the non-self recognition by multiple factors model. As predicted, the number of SFBB genes was large to account for the many S-RNase specificities. Secondly, like the S-RNase gene, the SFBB genes were old. Thirdly, amino acids under positive selection-those that could be involved in specificity determination-were identified when intra-haplotype SFBB genes were analysed using codon models. Overall, the findings reported here support the non-self recognition by multiple factors model.

  7. Rapid microRNA changes in airways of human volunteers after controlled exposure to air pollutants

    EPA Science Inventory

    Introduction/Rationale: Exposure to air pollutants, including ozone and diesel exhaust (DE) are known to cause acute cardiopulmonary dysfunction; however, the molecular mechanisms underlying these changes remain elusive. One mechanism for rapid regulation of multiple genes is a...

  8. Colloquium paper: uniquely human evolution of sialic acid genetics and biology.

    PubMed

    Varki, Ajit

    2010-05-11

    Darwinian evolution of humans from our common ancestors with nonhuman primates involved many gene-environment interactions at the population level, and the resulting human-specific genetic changes must contribute to the "Human Condition." Recent data indicate that the biology of sialic acids (which directly involves less than 60 genes) shows more than 10 uniquely human genetic changes in comparison with our closest evolutionary relatives. Known outcomes are tissue-specific changes in abundant cell-surface glycans, changes in specificity and/or expression of multiple proteins that recognize these glycans, and novel pathogen regimes. Specific events include Alu-mediated inactivation of the CMAH gene, resulting in loss of synthesis of the Sia N-glycolylneuraminic acid (Neu5Gc) and increase in expression of the precursor N-acetylneuraminic acid (Neu5Ac); increased expression of alpha2-6-linked Sias (likely because of changed expression of ST6GALI); and multiple changes in SIGLEC genes encoding Sia-recognizing Ig-like lectins (Siglecs). The last includes binding specificity changes (in Siglecs -5, -7, -9, -11, and -12); expression pattern changes (in Siglecs -1, -5, -6, and -11); gene conversion (SIGLEC11); and deletion or pseudogenization (SIGLEC13, SIGLEC14, and SIGLEC16). A nongenetic outcome of the CMAH mutation is human metabolic incorporation of foreign dietary Neu5Gc, in the face of circulating anti-Neu5Gc antibodies, generating a novel "xeno-auto-antigen" situation. Taken together, these data suggest that both the genes associated with Sia biology and the related impacts of the environment comprise a relative "hot spot" of genetic and physiological changes in human evolution, with implications for uniquely human features both in health and disease.

  9. Integration of multiple stimuli-sensing systems to regulate HrpS and type III secretion system in Erwinia amylovora.

    PubMed

    Lee, Jae Hoon; Zhao, Youfu

    2018-02-01

    The bacterial enhancer binding protein (bEBP) HrpS is essential for Erwinia amylovora virulence by activating the type III secretion system (T3SS). However, how the hrpS gene is regulated remains poorly understood in E. amylovora. In this study, 5' rapid amplification of cDNA ends and promoter deletion analyses showed that the hrpS gene contains two promoters driven by HrpX/HrpY and the Rcs phosphorelay system, respectively. Electrophoretic mobility shift and gene expression assays demonstrated that integration host factor IHF positively regulates hrpS expression through directly binding the hrpX promoter and positively regulating hrpX/hrpY expression. Moreover, hrpX expression was down-regulated in the relA/spoT ((p)ppGpp-deficient) mutant and the dksA mutant, but up-regulated when the wild-type strain was treated with serine hydroxamate, which induced (p)ppGpp-mediated stringent response. Furthermore, the csrA mutant showed significantly reduced transcripts of major hrpS activators, including the hrpX/hrpY, rcsA and rcsB genes, indicating that CsrA is required for full hrpS expression. On the other hand, the csrB mutant exhibited up-regulation of the rcsA and rcsB genes, and hrpS expression was largely diminished in the csrB/rcsB mutant, indicating that the Rcs system is mainly responsible for the increased hrpS expression in the csrB mutant. These findings suggest that E. amylovora recruits multiple stimuli-sensing systems, including HrpX/HrpY, the Rcs phosphorelay system and the Gac-Csr system, to regulate hrpS and T3SS gene expression.

  10. Pseudoscorpion mitochondria show rearranged genes and genome-wide reductions of RNA gene sizes and inferred structures, yet typical nucleotide composition bias

    PubMed Central

    2012-01-01

    Background Pseudoscorpions are chelicerates and have historically been viewed as being most closely related to solifuges, harvestmen, and scorpions. No mitochondrial genomes of pseudoscorpions have been published, but the mitochondrial genomes of some lineages of Chelicerata possess unusual features, including short rRNA genes and tRNA genes that lack sequence to encode arms of the canonical cloverleaf-shaped tRNA. Additionally, some chelicerates possess an atypical guanine-thymine nucleotide bias on the major coding strand of their mitochondrial genomes. Results We sequenced the mitochondrial genomes of two divergent taxa from the chelicerate order Pseudoscorpiones. We find that these genomes possess unusually short tRNA genes that do not encode cloverleaf-shaped tRNA structures. Indeed, in one genome, all 22 tRNA genes lack sequence to encode canonical cloverleaf structures. We also find that the large ribosomal RNA genes are substantially shorter than those of most arthropods. We inferred secondary structures of the LSU rRNAs from both pseudoscorpions, and find that they have lost multiple helices. Based on comparisons with the crystal structure of the bacterial ribosome, two of these helices were likely contact points with tRNA T-arms or D-arms as they pass through the ribosome during protein synthesis. The mitochondrial gene arrangements of both pseudoscorpions differ from the ancestral chelicerate gene arrangement. One genome is rearranged with respect to the location of protein-coding genes, the small rRNA gene, and at least 8 tRNA genes. The other genome contains 6 tRNA genes in novel locations. Most chelicerates with rearranged mitochondrial genes show a genome-wide reversal of the CA nucleotide bias typical for arthropods on their major coding strand, and instead possess a GT bias. Yet despite their extensive rearrangement, these pseudoscorpion mitochondrial genomes possess a CA bias on the major coding strand. Phylogenetic analyses of all 13 mitochondrial protein-coding gene sequences consistently yield trees that place pseudoscorpions as sister to acariform mites. Conclusion The well-supported phylogenetic placement of pseudoscorpions as sister to Acariformes differs from some previous analyses based on morphology. However, these two lineages share multiple molecular evolutionary traits, including substantial mitochondrial genome rearrangements, extensive nucleotide substitution, and loss of helices in their inferred tRNA and rRNA structures. PMID:22409411

  11. Amplification of a Gene Related to Mammalian mdr Genes in Drug-Resistant Plasmodium falciparum

    NASA Astrophysics Data System (ADS)

    Wilson, Craig M.; Serrano, Adelfa E.; Wasley, Annemarie; Bogenschutz, Michael P.; Shankar, Anuraj H.; Wirth, Dyann F.

    1989-06-01

    The malaria parasite Plasmodium falciparum contains at least two genes related to the mammalian multiple drug resistance genes, and at least one of the P. falciparum genes is expressed at a higher level and is present in higher copy number in a strain that is resistant to multiple drugs than in a strain that is sensitive to the drugs.

  12. Increased Resistance to Multiple Antimicrobials and Altered Resistance Gene Expression in CMY-2-Positive Salmonella enterica following a Simulated Patient Treatment with Ceftriaxone

    PubMed Central

    Hamilton, Russell D.; Hulsebus, Holly J.; Akbar, Samina

    2012-01-01

    Salmonellosis is one of the most common causes of food-borne disease in the United States. Increasing antimicrobial resistance and corresponding increases in virulence present serious challenges. Currently, empirical therapy for invasive Salmonella enterica infection includes either ceftriaxone or ciprofloxacin (E. L. Hohmann, Clin. Infect. Dis. 32:263–269, 2001). The blaCMY-2 gene confers resistance to ceftriaxone, the antimicrobial of choice for pediatric patients with invasive Salmonella enterica infections, making these infections especially dangerous (J. M. Whichard et al., Emerg. Infect. Dis. 11:1464–1466, 2005). We hypothesized that blaCMY-2-positive Salmonella enterica would exhibit increased MICs to multiple antimicrobial agents and increased resistance gene expression following exposure to ceftriaxone using a protocol that simulated a patient treatment in vitro. Seven Salmonella enterica strains survived a simulated patient treatment in vitro and, following treatment, exhibited a significantly increased ceftriaxone MIC. Not only would these isolates be less responsive to further ceftriaxone treatment, but because the blaCMY-2 genes are commonly located on large, multidrug-resistant plasmids, increased expression of the blaCMY-2 gene may be associated with increased expression of other drug resistance genes located on the plasmid (N. D. Hanson and C. C. Sanders, Curr. Pharm. Des. 5:881–894, 1999). The results of this study demonstrate that a simulated patient treatment with ceftriaxone can alter the expression of antimicrobial resistance genes, including blaCMY-2 and floR in S. enterica serovar Typhimurium and S. enterica serovar Newport. Additionally, we have shown increased MICs following a simulated patient treatment with ceftriaxone for tetracycline, amikacin, ceftriaxone, and cefepime, all of which have resistance genes commonly located on CMY-2 plasmids. The increases in resistance observed are significant and may have a negative impact on both public health and antimicrobial resistance of Salmonella enterica. PMID:22961898

  13. Recent molecular genetic studies and methodological issues in suicide research.

    PubMed

    Tsai, Shih-Jen; Hong, Chen-Jee; Liou, Ying-Jay

    2011-06-01

    Suicide behavior (SB) spans a spectrum ranging from suicidal ideation to suicide attempts and completed suicide. Strong evidence suggests a genetic susceptibility to SB, including familial heritability and common occurrence in twins. This review addresses recent molecular genetic studies in SB that include case-control association, genome gene-expression microarray, and genome-wide association (GWA). This work also reviews epigenetics in SB and pharmacogenetic studies of antidepressant-induced suicide. SB fulfills criteria for a complex genetic phenotype in which environmental factors interact with multiple genes to influence susceptibility. So far, case-control association approaches are still the mainstream in SB genetic studies, although whole genome gene-expression microarray and GWA studies have begun to emerge in recent years. Genetic association studies have suggested several genes (e.g., serotonin transporter, tryptophan hydroxylase 2, and brain-derived neurotrophic factor) related to SB, but not all reports support these findings. The case-control approach while useful is limited by present knowledge of disease pathophysiology. Genome-wide studies of gene expression and genetic variation are not constrained by our limited knowledge. However, the explanatory power and path to clinical translation of risk estimates for common variants reported in genome-wide association studies remain unclear because of the presence of rare and structural genetic variation. As whole genome sequencing becomes increasingly widespread, available genomic information will no longer be the limiting factor in applying genetics to clinical medicine. These approaches provide exciting new avenues to identify new candidate genes for SB genetic studies. The other limitation of genetic association is the lack of a consistent definition of the SB phenotype among studies, an inconsistency that hampers the comparability of the studies and data pooling. In summary, SB involves multiple genes interacting with non-genetic factors. A better understanding of the SB genes by combining whole genome approaches with case-control association studies, may potentially lead to developing effective screening, prevention, and management of SB. Copyright © 2010 Elsevier Inc. All rights reserved.

  14. A Convenient Cas9-based Conditional Knockout Strategy for Simultaneously Targeting Multiple Genes in Mouse.

    PubMed

    Chen, Jiang; Du, Yinan; He, Xueyan; Huang, Xingxu; Shi, Yun S

    2017-03-31

    The most powerful way to probe protein function is to characterize the consequence of its deletion. Compared to conventional gene knockout (KO), conditional knockout (cKO) provides an advanced gene targeting strategy with which gene deletion can be performed in a spatially and temporally restricted manner. However, for most species that are amphiploid, the widely used Cre-flox conditional KO (cKO) system would need targeting loci in both alleles to be loxP flanked, which in practice, requires time and labor consuming breeding. This is considerably significant when one is dealing with multiple genes. CRISPR/Cas9 genome modulation system is advantaged in its capability in targeting multiple sites simultaneously. Here we propose a strategy that could achieve conditional KO of multiple genes in mouse with Cre recombinase dependent Cas9 expression. By transgenic construction of loxP-stop-loxP (LSL) controlled Cas9 (LSL-Cas9) together with sgRNAs targeting EGFP, we showed that the fluorescence molecule could be eliminated in a Cre-dependent manner. We further verified the efficacy of this novel strategy to target multiple sites by deleting c-Maf and MafB simultaneously in macrophages specifically. Compared to the traditional Cre-flox cKO strategy, this sgRNAs-LSL-Cas9 cKO system is simpler and faster, and would make conditional manipulation of multiple genes feasible.

  15. Identification of Genes Affecting the Toxicity of Anti-Cancer Drug Bortezomib by Genome-Wide Screening in S. pombe

    PubMed Central

    Takeda, Kojiro; Mori, Ayaka; Yanagida, Mitsuhiro

    2011-01-01

    Bortezomib/PS-341/Velcade, a proteasome inhibitor, is widely used to treat multiple myeloma. While several mechanisms of the cytotoxicity of the drug were proposed, the actual mechanism remains elusive. We aimed to identify genes affecting the cytotoxicity of Bortezomib in the fission yeast S.pombe as the drug inhibits this organism's cell division cycle like proteasome mutants. Among the 2815 genes screened (covering 56% of total ORFs), 19 genes, whose deletions induce strong synthetic lethality with Bortezomib, were identified. The products of the 19 genes included four ubiquitin enzymes and one nuclear proteasome factor, and 13 of them are conserved in humans. Our results will provide useful information for understanding the actions of Bortezomib within cells. PMID:21760946

  16. Genome-based insights into the resistome and mobilome of multidrug-resistant Aeromonas sp. ARM81 isolated from wastewater.

    PubMed

    Adamczuk, Marcin; Dziewit, Lukasz

    2017-01-01

    The draft genome of multidrug-resistant Aeromonas sp. ARM81 isolated from a wastewater treatment plant in Warsaw (Poland) was obtained. Sequence analysis revealed multiple genes conferring resistance to aminoglycosides, β-lactams or tetracycline. Three different β-lactamase genes were identified, including an extended-spectrum β-lactamase gene bla PER-1 . The antibiotic susceptibility was experimentally tested. Genome sequencing also allowed us to investigate the plasmidome and transposable mobilome of ARM81. Four plasmids, of which two carry phenotypic modules (i.e., genes encoding a zinc transporter ZitB and a putative glucosyltransferase), and 28 putative transposase genes were identified. The mobility of three insertion sequences (isoforms of previously identified elements ISAs12, ISKpn9 and ISAs26) was confirmed using trap plasmids.

  17. Carbon-dependent control of electron transfer and central carbon pathway genes for methane biosynthesis in the Archaean, Methanosarcina acetivorans strain C2A

    PubMed Central

    2010-01-01

    Background The archaeon, Methanosarcina acetivorans strain C2A forms methane, a potent greenhouse gas, from a variety of one-carbon substrates and acetate. Whereas the biochemical pathways leading to methane formation are well understood, little is known about the expression of the many of the genes that encode proteins needed for carbon flow, electron transfer and/or energy conservation. Quantitative transcript analysis was performed on twenty gene clusters encompassing over one hundred genes in M. acetivorans that encode enzymes/proteins with known or potential roles in substrate conversion to methane. Results The expression of many seemingly "redundant" genes/gene clusters establish substrate dependent control of approximately seventy genes for methane production by the pathways for methanol and acetate utilization. These include genes for soluble-type and membrane-type heterodisulfide reductases (hdr), hydrogenases including genes for a vht-type F420 non-reducing hydrogenase, molybdenum-type (fmd) as well as tungsten-type (fwd) formylmethanofuran dehydrogenases, genes for rnf and mrp-type electron transfer complexes, for acetate uptake, plus multiple genes for aha- and atp-type ATP synthesis complexes. Analysis of promoters for seven gene clusters reveal UTR leaders of 51-137 nucleotides in length, raising the possibility of both transcriptional and translational levels of control. Conclusions The above findings establish the differential and coordinated expression of two major gene families in M. acetivorans in response to carbon/energy supply. Furthermore, the quantitative mRNA measurements demonstrate the dynamic range for modulating transcript abundance. Since many of these gene clusters in M. acetivorans are also present in other Methanosarcina species including M. mazei, and in M. barkeri, these findings provide a basis for predicting related control in these environmentally significant methanogens. PMID:20178638

  18. Sensory ataxic neuropathy with ophthalmoparesis caused by POLG mutations.

    PubMed

    Milone, Margherita; Brunetti-Pierri, Nicola; Tang, Lin-Ya; Kumar, Neeraj; Mezei, Michelle M; Josephs, Keith; Powell, Suzanne; Simpson, Ericka; Wong, Lee-Jun C

    2008-08-01

    Mutations in POLG gene are responsible for a wide spectrum of clinical disorders with altered mitochondrial DNA (mtDNA) integrity, including mtDNA multiple deletions and depletion. Sensory ataxic neuropathy with ophthalmoparesis (SANDO) caused by mutations in POLG gene, fulfilling the clinical triad of sensory ataxic neuropathy, dysarthria and/or dysphagia and ophthalmoparesis, has described in a few reports. Here we described five cases of adult onset autosomal recessive sensory ataxic neuropathy with ophthalmoplegia. All patients had ataxia, neuropathy, myopathy, and progressive external ophthalmoplegia (PEO). The muscle pathology revealed ragged-red and cytochrome c oxidase (COX) negative fibers in three patients. However, deficiencies in the activities of mitochondrial respiratory chain enzyme complexes were not detected in any of the patients' muscle samples. Multiple deletions of mtDNA were detected in blood and muscle specimens but mtDNA depletion was not found. Due to these diagnostic difficulties, POLG-related syndromes are definitively diagnosed based on the presence of deleterious mutations in the POLG gene.

  19. Natural allelic variation of the AZI1 gene controls root growth under zinc-limiting condition

    PubMed Central

    Bouain, Nadia; Saenchai, Chorpet

    2018-01-01

    Zinc is an essential micronutrient for all living organisms and is involved in a plethora of processes including growth and development, and immunity. However, it is unknown if there is a common genetic and molecular basis underlying multiple facets of zinc function. Here we used natural variation in Arabidopsis thaliana to study the role of zinc in regulating growth. We identify allelic variation of the systemic immunity gene AZI1 as a key for determining root growth responses to low zinc conditions. We further demonstrate that this gene is important for modulating primary root length depending on the zinc and defence status. Finally, we show that the interaction of the immunity signal azelaic acid and zinc level to regulate root growth is conserved in rice. This work demonstrates that there is a common genetic and molecular basis for multiple zinc dependent processes and that nutrient cues can determine the balance of growth and immune responses in plants. PMID:29608565

  20. Multiplicity of experimental approaches to therapy for genetic muscle diseases and necessity for population screening.

    PubMed

    Laing, Nigel G

    2008-01-01

    Currently a multiplicity of experimental approaches to therapy for genetic muscle diseases is being investigated. These include replacement of the missing gene, manipulation of the gene message, repair of the mutation, upregulation of an alternative gene and pharmacological interventions targeting a number of systems. A number of these approaches are in current clinical trials. There is considerable anticipation that perhaps more than one of the approaches will finally prove of clinical benefit, but there are many voices of caution. No matter which approaches might ultimately prove effective, there is a consensus that for most benefit to the patients it will be necessary to start treatment as early as possible. A consensus is also developing that the only way to do this is to implement population-based newborn screening to identify affected children shortly after birth. Population-based newborn screening is currently practised in very few places in the world and it brings with it implications for prevention rather than cure of genetic muscle diseases.

  1. Gene cluster conservation provides insight into cercosporin biosynthesis and extends production to the genus Colletotrichum.

    PubMed

    de Jonge, Ronnie; Ebert, Malaika K; Huitt-Roehl, Callie R; Pal, Paramita; Suttle, Jeffrey C; Spanner, Rebecca E; Neubauer, Jonathan D; Jurick, Wayne M; Stott, Karina A; Secor, Gary A; Thomma, Bart P H J; Van de Peer, Yves; Townsend, Craig A; Bolton, Melvin D

    2018-06-12

    Species in the genus Cercospora cause economically devastating diseases in sugar beet, maize, rice, soy bean, and other major food crops. Here, we sequenced the genome of the sugar beet pathogen Cercospora beticola and found it encodes 63 putative secondary metabolite gene clusters, including the cercosporin toxin biosynthesis ( CTB ) cluster. We show that the CTB gene cluster has experienced multiple duplications and horizontal transfers across a spectrum of plant pathogenic fungi, including the wide-host range Colletotrichum genus as well as the rice pathogen Magnaporthe oryzae Although cercosporin biosynthesis has been thought to rely on an eight-gene CTB cluster, our phylogenomic analysis revealed gene collinearity adjacent to the established cluster in all CTB cluster-harboring species. We demonstrate that the CTB cluster is larger than previously recognized and includes cercosporin facilitator protein, previously shown to be involved with cercosporin autoresistance, and four additional genes required for cercosporin biosynthesis, including the final pathway enzymes that install the unusual cercosporin methylenedioxy bridge. Lastly, we demonstrate production of cercosporin by Colletotrichum fioriniae , the first known cercosporin producer within this agriculturally important genus. Thus, our results provide insight into the intricate evolution and biology of a toxin critical to agriculture and broaden the production of cercosporin to another fungal genus containing many plant pathogens of important crops worldwide. Copyright © 2018 the Author(s). Published by PNAS.

  2. Molecular Signatures in Skin Associated with Clinical Improvement During Mycophenolate Treatment in Systemic Sclerosis

    PubMed Central

    Hinchcliff, Monique; Huang, Chiang-Ching; Wood, Tammara A.; Mahoney, J. Matthew; Martyanov, Viktor; Bhattacharyya, Swati; Tamaki, Zenshiro; Lee, Jungwha; Carns, Mary; Podlusky, Sofia; Sirajuddin, Arlene; Shah, Sanjiv J; Chang, Rowland W.; Lafyatis, Robert; Varga, John; Whitfield, Michael L.

    2013-01-01

    Heterogeneity in systemic sclerosis/SSc confounds clinical trials. We previously identified ‘intrinsic’ gene expression subsets by analysis of SSc skin. Here we test the hypotheses that skin gene expression signatures including intrinsic subset are associated with skin score/MRSS improvement during mycophenolate mofetil (MMF) treatment. Gene expression and intrinsic subset assignment were measured in 12 SSc patients’ biopsies and ten controls at baseline, and from serial biopsies of one cyclophosphamide-treated patient, and nine MMF-treated patients. Gene expression changes during treatment were determined using paired t-tests corrected for multiple hypothesis testing. MRSS improved in four of seven MMF-treated patients classified as the inflammatory intrinsic subset. Three patients without MRSS improvement were classified as normal-like or fibroproliferative intrinsic subsets. 321 genes (FDR <5%) were differentially expressed at baseline between patients with and without MRSS improvement during treatment. Expression of 571 genes (FDR <10%) changed between pre- and post-MMF treatment biopsies for patients demonstrating MRSS improvement. Gene expression changes in skin are only seen in patients with MRSS improvement. Baseline gene expression in skin, including intrinsic subset assignment, may identify SSc patients whose MRSS will improve during MMF treatment, suggesting that gene expression in skin may allow targeted treatment in SSc. PMID:23677167

  3. Transcriptomic Profiling Analysis of Arabidopsis thaliana Treated with Exogenous Myo-Inositol

    PubMed Central

    Ye, Wenxing; Ren, Weibo; Kong, Lingqi; Zhang, Wanjun; Wang, Tao

    2016-01-01

    Myo-insositol (MI) is a crucial substance in the growth and developmental processes in plants. It is commonly added to the culture medium to promote adventitious shoot development. In our previous work, MI was found in influencing Agrobacterium-mediated transformation. In this report, a high-throughput RNA sequencing technique (RNA-Seq) was used to investigate differently expressed genes in one-month-old Arabidopsis seedling grown on MI free or MI supplemented culture medium. The results showed that 21,288 and 21,299 genes were detected with and without MI treatment, respectively. The detected genes included 184 new genes that were not annotated in the Arabidopsis thaliana reference genome. Additionally, 183 differentially expressed genes were identified (DEGs, FDR ≤0.05, log2 FC≥1), including 93 up-regulated genes and 90 down-regulated genes. The DEGs were involved in multiple pathways, such as cell wall biosynthesis, biotic and abiotic stress response, chromosome modification, and substrate transportation. Some significantly differently expressed genes provided us with valuable information for exploring the functions of exogenous MI. RNA-Seq results showed that exogenous MI could alter gene expression and signaling transduction in plant cells. These results provided a systematic understanding of the functions of exogenous MI in detail and provided a foundation for future studies. PMID:27603208

  4. SZGR 2.0: a one-stop shop of schizophrenia candidate genes

    PubMed Central

    Jia, Peilin; Han, Guangchun; Zhao, Junfei; Lu, Pinyi; Zhao, Zhongming

    2017-01-01

    SZGR 2.0 is a comprehensive resource of candidate variants and genes for schizophrenia, covering genetic, epigenetic, transcriptomic, translational and many other types of evidence. By systematic review and curation of multiple lines of evidence, we included almost all variants and genes that have ever been reported to be associated with schizophrenia. In particular, we collected ∼4200 common variants reported in genome-wide association studies, ∼1000 de novo mutations discovered by large-scale sequencing of family samples, 215 genes spanning rare and replication copy number variations, 99 genes overlapping with linkage regions, 240 differentially expressed genes, 4651 differentially methylated genes and 49 genes as antipsychotic drug targets. To facilitate interpretation, we included various functional annotation data, especially brain eQTL, methylation QTL, brain expression featured in deep categorization of brain areas and developmental stages and brain-specific promoter and enhancer annotations. Furthermore, we conducted cross-study, cross-data type and integrative analyses of the multidimensional data deposited in SZGR 2.0, and made the data and results available through a user-friendly interface. In summary, SZGR 2.0 provides a one-stop shop of schizophrenia variants and genes and their function and regulation, providing an important resource in the schizophrenia and other mental disease community. SZGR 2.0 is available at https://bioinfo.uth.edu/SZGR/. PMID:27733502

  5. A Host Transcriptional Signature for Presymptomatic Detection of Infection in Humans Exposed to Influenza H1N1 or H3N2

    DTIC Science & Technology

    2013-01-09

    specificity. The majority of the top 50 predictive genes contained in each factor are known to characterize host response to viral infection, and include...RSAD2, the OAS family, multiple interferon response elements, the myxovirus- resistance gene MX1, cytokine response pathways and others [16,17,18]. Many...antiviral pathways (Fig. s4). Furthermore, the high degree of similarity and cross- applicability of the two signatures permit the mathematical

  6. Expression profiling of chickpea genes differentially regulated during a resistance response to Ascochyta rabiei.

    PubMed

    Coram, Tristan E; Pang, Edwin C K

    2006-11-01

    Using microarray technology and a set of chickpea (Cicer arietinum L.) unigenes, grasspea (Lathyrus sativus L.) expressed sequence tags (ESTs) and lentil (Lens culinaris Med.) resistance gene analogues, the ascochyta blight (Ascochyta rabiei (Pass.) L.) resistance response was studied in four chickpea genotypes, including resistant, moderately resistant, susceptible and wild relative (Cicer echinospermum L.) genotypes. The experimental system minimized environmental effects and was conducted in reference design, in which samples from mock-inoculated controls acted as reference against post-inoculation samples. Robust data quality was achieved through the use of three biological replicates (including a dye swap), the inclusion of negative controls and strict selection criteria for differentially expressed genes, including a fold change cut-off determined by self-self hybridizations, Student's t-test and multiple testing correction (P < 0.05). Microarray observations were also validated by quantitative reverse transcriptase-polymerase chain reaction (RT-PCR). The time course expression patterns of 756 microarray features resulted in the differential expression of 97 genes in at least one genotype at one time point. k-means clustering grouped the genes into clusters of similar observations for each genotype, and comparisons between A. rabiei-resistant and A. rabiei-susceptible genotypes revealed potential gene 'signatures' predictive of effective A. rabiei resistance. These genes included several pathogenesis-related proteins, SNAKIN2 antimicrobial peptide, proline-rich protein, disease resistance response protein DRRG49-C, environmental stress-inducible protein, leucine-zipper protein, polymorphic antigen membrane protein, Ca-binding protein and several unknown proteins. The potential involvement of these genes and their pathways of induction are discussed. This study represents the first large-scale gene expression profiling in chickpea, and future work will focus on the functional validation of the genes of interest.

  7. Comprehensive Molecular Characterization of Urothelial Bladder Carcinoma

    PubMed Central

    2014-01-01

    Urothelial carcinoma of the bladder is a common malignancy that causes approximately 150,000 deaths per year worldwide. To date, no molecularly targeted agents have been approved for the disease. As part of The Cancer Genome Atlas project, we report here an integrated analysis of 131 urothelial carcinomas to provide a comprehensive landscape of molecular alterations. There were statistically significant recurrent mutations in 32 genes, including multiple genes involved in cell cycle regulation, chromatin regulation, and kinase signaling pathways, as well as 9 genes not previously reported as significantly mutated in any cancer. RNA sequencing revealed four expression subtypes, two of which (papillary-like and basal/squamous-like) were also evident in miRNA sequencing and protein data. Whole-genome and RNA sequencing identified recurrent in-frame activating FGFR3-TACC3 fusions and expression or integration of several viruses (including HPV16) that are associated with gene inactivation. Our analyses identified potential therapeutic targets in 69% of the tumours, including 42% with targets in the PI3K/AKT/mTOR pathway and 45% with targets (including ERBB2) in the RTK/MAPK pathway. Chromatin regulatory genes were more frequently mutated in urothelial carcinoma than in any common cancer studied to date, suggesting the future possibility of targeted therapy for chromatin abnormalities. PMID:24476821

  8. Systems genetics: a paradigm to improve discovery of candidate genes and mechanisms underlying complex traits.

    PubMed

    Feltus, F Alex

    2014-06-01

    Understanding the control of any trait optimally requires the detection of causal genes, gene interaction, and mechanism of action to discover and model the biochemical pathways underlying the expressed phenotype. Functional genomics techniques, including RNA expression profiling via microarray and high-throughput DNA sequencing, allow for the precise genome localization of biological information. Powerful genetic approaches, including quantitative trait locus (QTL) and genome-wide association study mapping, link phenotype with genome positions, yet genetics is less precise in localizing the relevant mechanistic information encoded in DNA. The coupling of salient functional genomic signals with genetically mapped positions is an appealing approach to discover meaningful gene-phenotype relationships. Techniques used to define this genetic-genomic convergence comprise the field of systems genetics. This short review will address an application of systems genetics where RNA profiles are associated with genetically mapped genome positions of individual genes (eQTL mapping) or as gene sets (co-expression network modules). Both approaches can be applied for knowledge independent selection of candidate genes (and possible control mechanisms) underlying complex traits where multiple, likely unlinked, genomic regions might control specific complex traits. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  9. Pyrethroid Resistance in Malaysian Populations of Dengue Vector Aedes aegypti Is Mediated by CYP9 Family of Cytochrome P450 Genes

    PubMed Central

    Ishak, Intan H.; Kamgang, Basile; Ibrahim, Sulaiman S.; Riveron, Jacob M.; Irving, Helen

    2017-01-01

    Background Dengue control and prevention rely heavily on insecticide-based interventions. However, insecticide resistance in the dengue vector Aedes aegypti, threatens the continued effectiveness of these tools. The molecular basis of the resistance remains uncharacterised in many endemic countries including Malaysia, preventing the design of evidence-based resistance management. Here, we investigated the underlying molecular basis of multiple insecticide resistance in Ae. aegypti populations across Malaysia detecting the major genes driving the metabolic resistance. Methodology/Principal Findings Genome-wide microarray-based transcription analysis was carried out to detect the genes associated with metabolic resistance in these populations. Comparisons of the susceptible New Orleans strain to three non-exposed multiple insecticide resistant field strains; Penang, Kuala Lumpur and Kota Bharu detected 2605, 1480 and 425 differentially expressed transcripts respectively (fold-change>2 and p-value ≤ 0.05). 204 genes were commonly over-expressed with monooxygenase P450 genes (CYP9J27, CYP6CB1, CYP9J26 and CYP9M4) consistently the most up-regulated detoxification genes in all populations, indicating that they possibly play an important role in the resistance. In addition, glutathione S-transferases, carboxylesterases and other gene families commonly associated with insecticide resistance were also over-expressed. Gene Ontology (GO) enrichment analysis indicated an over-representation of GO terms linked to resistance such as monooxygenases, carboxylesterases, glutathione S-transferases and heme-binding. Polymorphism analysis of CYP9J27 sequences revealed a high level of polymorphism (except in Joho Bharu), suggesting a limited directional selection on this gene. In silico analysis of CYP9J27 activity through modelling and docking simulations suggested that this gene is involved in the multiple resistance in Malaysian populations as it is predicted to metabolise pyrethroids, DDT and bendiocarb. Conclusion/significance The predominant over-expression of cytochrome P450s suggests that synergist-based (PBO) control tools could be utilised to improve control of this major dengue vector across Malaysia. PMID:28114328

  10. A Gene-Oriented Haplotype Comparison Reveals Recently Selected Genomic Regions in Temperate and Tropical Maize Germplasm

    PubMed Central

    Zhang, Jie; Li, Yongxiang; Zheng, Jun; Zhang, Hongwei; Yang, Xiaohong; Wang, Jianhua; Wang, Guoying

    2017-01-01

    The extensive genetic variation present in maize (Zea mays) germplasm makes it possible to detect signatures of positive artificial selection that occurred during temperate and tropical maize improvement. Here we report an analysis of 532,815 polymorphisms from a maize association panel consisting of 368 diverse temperate and tropical inbred lines. We developed a gene-oriented approach adapting exonic polymorphisms to identify recently selected alleles by comparing haplotypes across the maize genome. This analysis revealed evidence of selection for more than 1100 genomic regions during recent improvement, and included regulatory genes and key genes with visible mutant phenotypes. We find that selected candidate target genes in temperate maize are enriched in biosynthetic processes, and further examination of these candidates highlights two cases, sucrose flux and oil storage, in which multiple genes in a common pathway can be cooperatively selected. Finally, based on available parallel gene expression data, we hypothesize that some genes were selected for regulatory variations, resulting in altered gene expression. PMID:28099470

  11. Human genetics of infectious diseases: a unified theory

    PubMed Central

    Casanova, Jean-Laurent; Abel, Laurent

    2007-01-01

    Since the early 1950s, the dominant paradigm in the human genetics of infectious diseases postulates that rare monogenic immunodeficiencies confer vulnerability to multiple infectious diseases (one gene, multiple infections), whereas common infections are associated with the polygenic inheritance of multiple susceptibility genes (one infection, multiple genes). Recent studies, since 1996 in particular, have challenged this view. A newly recognised group of primary immunodeficiencies predisposing the individual to a principal or single type of infection is emerging. In parallel, several common infections have been shown to reflect the inheritance of one major susceptibility gene, at least in some populations. This novel causal relationship (one gene, one infection) blurs the distinction between patient-based Mendelian genetics and population-based complex genetics, and provides a unified conceptual frame for exploring the molecular genetic basis of infectious diseases in humans. PMID:17255931

  12. Global gene expression associated with hepatocarcinogenesis in adult male mice induced by in utero arsenic exposure.

    PubMed

    Liu, Jie; Xie, Yaxiong; Ducharme, Danica M K; Shen, Jun; Diwan, Bhalchandra A; Merrick, B Alex; Grissom, Sherry F; Tucker, Charles J; Paules, Richard S; Tennant, Raymond; Waalkes, Michael P

    2006-03-01

    Our previous work has shown that exposure to inorganic arsenic in utero produces hepatocellular carcinoma (HCC) in adult male mice. To explore further the molecular mechanisms of transplacental arsenic hepatocarcinogenesis, we conducted a second arsenic transplacental carcinogenesis study and used a genomewide microarray to profile arsenic-induced aberrant gene expression more extensively. Briefly, pregnant C3H mice were given drinking water containing 85 ppm arsenic as sodium arsenite or unaltered water from days 8 to 18 of gestation. The incidence of HCC in adult male offspring was increased 4-fold and tumor multiplicity 3-fold after transplacental arsenic exposure. Samples of normal liver and liver tumors were taken at autopsy for genomic analysis. Arsenic exposure in utero resulted in significant alterations (p < 0.001) in the expression of 2,010 genes in arsenic-exposed liver samples and in the expression of 2,540 genes in arsenic-induced HCC. Ingenuity Pathway Analysis revealed that significant alterations in gene expression occurred in a number of biological networks, and Myc plays a critical role in one of the primary networks. Real-time reverse transcriptase-polymerase chain reaction and Western blot analysis of selected genes/proteins showed > 90% concordance. Arsenic-altered gene expression included activation of oncogenes and HCC biomarkers, and increased expression of cell proliferation-related genes, stress proteins, and insulin-like growth factors and genes involved in cell-cell communications. Liver feminization was evidenced by increased expression of estrogen-linked genes and altered expression of genes that encode gender-related metabolic enzymes. These novel findings are in agreement with the biology and histology of arsenic-induced HCC, thereby indicating that multiple genetic events are associated with transplacental arsenic hepatocarcinogenesis.

  13. Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

    PubMed

    Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

    2016-06-28

    In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

  14. Gene expression profiling in liver and testis of rats to characterize the toxicity of triazole fungicides.

    PubMed

    Tully, Douglas B; Bao, Wenjun; Goetz, Amber K; Blystone, Chad R; Ren, Hongzu; Schmid, Judith E; Strader, Lillian F; Wood, Carmen R; Best, Deborah S; Narotsky, Michael G; Wolf, Douglas C; Rockett, John C; Dix, David J

    2006-09-15

    Four triazole fungicides were studied using toxicogenomic techniques to identify potential mechanisms of action. Adult male Sprague-Dawley rats were dosed for 14 days by gavage with fluconazole, myclobutanil, propiconazole, or triadimefon. Following exposure, serum was collected for hormone measurements, and liver and testes were collected for histology, enzyme biochemistry, or gene expression profiling. Body and testis weights were unaffected, but liver weights were significantly increased by all four triazoles, and hepatocytes exhibited centrilobular hypertrophy. Myclobutanil exposure increased serum testosterone and decreased sperm motility, but no treatment-related testis histopathology was observed. We hypothesized that gene expression profiles would identify potential mechanisms of toxicity and used DNA microarrays and quantitative real-time PCR (qPCR) to generate profiles. Triazole fungicides are designed to inhibit fungal cytochrome P450 (CYP) 51 enzyme but can also modulate the expression and function of mammalian CYP genes and enzymes. Triazoles affected the expression of numerous CYP genes in rat liver and testis, including multiple Cyp2c and Cyp3a isoforms as well as other xenobiotic metabolizing enzyme (XME) and transporter genes. For some genes, such as Ces2 and Udpgtr2, all four triazoles had similar effects on expression, suggesting possible common mechanisms of action. Many of these CYP, XME and transporter genes are regulated by xeno-sensing nuclear receptors, and hierarchical clustering of CAR/PXR-regulated genes demonstrated the similarities of toxicogenomic responses in liver between all four triazoles and in testis between myclobutanil and triadimefon. Triazoles also affected expression of multiple genes involved in steroid hormone metabolism in the two tissues. Thus, gene expression profiles helped identify possible toxicological mechanisms of the triazole fungicides.

  15. Genomics of Natural Populations: How Differentially Expressed Genes Shape the Evolution of Chromosomal Inversions in Drosophila pseudoobscura

    PubMed Central

    Fuller, Zachary L.; Haynes, Gwilym D.; Richards, Stephen; Schaeffer, Stephen W.

    2016-01-01

    Chromosomal rearrangements can shape the structure of genetic variation in the genome directly through alteration of genes at breakpoints or indirectly by holding combinations of genetic variants together due to reduced recombination. The third chromosome of Drosophila pseudoobscura is a model system to test hypotheses about how rearrangements are established in populations because its third chromosome is polymorphic for >30 gene arrangements that were generated by a series of overlapping inversion mutations. Circumstantial evidence has suggested that these gene arrangements are selected. Despite the expected homogenizing effects of extensive gene flow, the frequencies of arrangements form gradients or clines in nature, which have been stable since the system was first described >80 years ago. Furthermore, multiple arrangements exist at appreciable frequencies across several ecological niches providing the opportunity for heterokaryotypes to form. In this study, we tested whether genes are differentially expressed among chromosome arrangements in first instar larvae, adult females and males. In addition, we asked whether transcriptional patterns in heterokaryotypes are dominant, semidominant, overdominant, or underdominant. We find evidence for a significant abundance of differentially expressed genes across the inverted regions of the third chromosome, including an enrichment of genes involved in sensory perception for males. We find the majority of loci show additivity in heterokaryotypes. Our results suggest that multiple genes have expression differences among arrangements that were either captured by the original inversion mutation or accumulated after it reached polymorphic frequencies, providing a potential source of genetic variation for selection to act upon. These data suggest that the inversions are favored because of their indirect effect of recombination suppression that has held different combinations of differentially expressed genes together in the various gene arrangement backgrounds. PMID:27401754

  16. Cap 'n' collar C regulates genes responsible for imidacloprid resistance in the Colorado potato beetle, Leptinotarsa decemlineata.

    PubMed

    Gaddelapati, Sharath Chandra; Kalsi, Megha; Roy, Amit; Palli, Subba Reddy

    2018-08-01

    The Colorado potato beetle (CPB), Leptinotarsa decemlineata developed resistance to imidacloprid after exposure to this insecticide for multiple generations. Our previous studies showed that xenobiotic transcription factor, cap 'n' collar isoform C (CncC) regulates the expression of multiple cytochrome P450 genes, which play essential roles in resistance to plant allelochemicals and insecticides. In this study, we sought to obtain a comprehensive picture of the genes regulated by CncC in imidacloprid-resistant CPB. We performed sequencing of RNA isolated from imidacloprid-resistant CPB treated with dsRNA targeting CncC or gene coding for green fluorescent protein (control). Comparative transcriptome analysis showed that CncC regulated the expression of 1798 genes, out of which 1499 genes were downregulated in CncC knockdown beetles. Interestingly, expression of 79% of imidacloprid induced P450 genes requires CncC. We performed quantitative real-time PCR to verify the reduction in the expression of 20 genes including those coding for detoxification enzymes (P450s, glutathione S-transferases, and esterases) and ABC transporters. The genes coding for ABC transporters are induced in insecticide resistant CPB and require CncC for their expression. Knockdown of genes coding for ABC transporters simultaneously or individually caused an increase in imidacloprid-induced mortality in resistant beetles confirming their contribution to insecticide resistance. These studies identified CncC as a transcription factor involved in regulation of genes responsible for imidacloprid resistance. Small molecule inhibitors of CncC or suppression of CncC by RNAi could provide effective synergists for pest control or management of insecticide resistance. Copyright © 2018 Elsevier Ltd. All rights reserved.

  17. Noninvasive optical monitoring multiple physiological parameters response to cytokine storm

    NASA Astrophysics Data System (ADS)

    Li, Zebin; Li, Ting

    2018-02-01

    Cancer and other disease originated by immune or genetic problems have become a main cause of death. Gene/cell therapy is a highlighted potential method for the treatment of these diseases. However, during the treatment, it always causes cytokine storm, which probably trigger acute respiratory distress syndrome and multiple organ failure. Here we developed a point-of-care device for noninvasive monitoring cytokine storm induced multiple physiological parameters simultaneously. Oxy-hemoglobin, deoxy-hemoglobin, water concentration and deep-tissue/tumor temperature variations were simultaneously measured by extended near infrared spectroscopy. Detection algorithms of symptoms such as shock, edema, deep-tissue fever and tissue fibrosis were developed and included. Based on these measurements, modeling of patient tolerance and cytokine storm intensity were carried out. This custom device was tested on patients experiencing cytokine storm in intensive care unit. The preliminary data indicated the potential of our device in popular and milestone gene/cell therapy, especially, chimeric antigen receptor T-cell immunotherapy (CAR-T).

  18. The Zymomonas mobilis regulator hfq contributes to tolerance against multiple lignocellulosic pretreatment inhibitors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yang, Shihui; Pelletier, Dale A; Lu, Tse-Yuan

    Zymomonas mobilis produces near theoretical yields of ethanol and recombinant strains are candidate industrial microorganisms. To date, few studies have examined its responses to various stresses at the gene level. Hfq is a conserved bacterial member of the Sm-like family of RNA-binding proteins, coordinating a broad array of responses including multiple stress responses. In a previous study, we observed Z. mobilis ZM4 gene ZMO0347 showed higher expression under anaerobic, stationary phase compared to that of aerobic, stationary conditions. We have shown the utility of the pKNOCK suicide plasmid for mutant construction in Z. mobilis, and constructed a Gateway compatible expressionmore » plasmid for use in Z. mobilis for the first time. We have also used genetics to show Z. mobilis Hfq and S. cerevisiae Lsm proteins play important roles in resisting multiple, important industrially relevant inhibitors. The conserved nature of this global regulator offers the potential to apply insights from these fundamental studies for further industrial strain development.« less

  19. Plasmacytomagenesis in Eμ-v-abl transgenic mice is accelerated when apoptosis is restrained

    PubMed Central

    Vandenberg, Cassandra J.; Waring, Paul; Strasser, Andreas

    2014-01-01

    Mice susceptible to plasma cell tumors provide a useful model for human multiple myeloma. We previously showed that mice expressing an Eµ-v-abl oncogene solely develop plasmacytomas. Here we show that loss of the proapoptotic BH3-only protein Bim or, to a lesser extent, overexpression of antiapoptotic Bcl-2 or Mcl-1, significantly accelerated the development of plasmacytomas and increased their incidence. Disease was preceded by an increased abundance of plasma cells, presumably reflecting their enhanced survival capacity in vivo. Plasmacytomas of each genotype expressed high levels of v-abl and frequently harbored a rearranged c-myc gene, probably as a result of chromosome translocation. As in human multiple myelomas, elevated expression of cyclin D genes was common, and p53 deregulation was rare. Our results for plasmacytomas highlight the significance of antiapoptotic changes in multiple myeloma, which include elevated expression of Mcl-1 and, less frequently, Bcl-2, and suggest that closer attention to defects in Bim expression is warranted. PMID:24986687

  20. Comparative description of ten transcriptomes of newly sequenced invertebrates and efficiency estimation of genomic sampling in non-model taxa

    PubMed Central

    2012-01-01

    Introduction Traditionally, genomic or transcriptomic data have been restricted to a few model or emerging model organisms, and to a handful of species of medical and/or environmental importance. Next-generation sequencing techniques have the capability of yielding massive amounts of gene sequence data for virtually any species at a modest cost. Here we provide a comparative analysis of de novo assembled transcriptomic data for ten non-model species of previously understudied animal taxa. Results cDNA libraries of ten species belonging to five animal phyla (2 Annelida [including Sipuncula], 2 Arthropoda, 2 Mollusca, 2 Nemertea, and 2 Porifera) were sequenced in different batches with an Illumina Genome Analyzer II (read length 100 or 150 bp), rendering between ca. 25 and 52 million reads per species. Read thinning, trimming, and de novo assembly were performed under different parameters to optimize output. Between 67,423 and 207,559 contigs were obtained across the ten species, post-optimization. Of those, 9,069 to 25,681 contigs retrieved blast hits against the NCBI non-redundant database, and approximately 50% of these were assigned with Gene Ontology terms, covering all major categories, and with similar percentages in all species. Local blasts against our datasets, using selected genes from major signaling pathways and housekeeping genes, revealed high efficiency in gene recovery compared to available genomes of closely related species. Intriguingly, our transcriptomic datasets detected multiple paralogues in all phyla and in nearly all gene pathways, including housekeeping genes that are traditionally used in phylogenetic applications for their purported single-copy nature. Conclusions We generated the first study of comparative transcriptomics across multiple animal phyla (comparing two species per phylum in most cases), established the first Illumina-based transcriptomic datasets for sponge, nemertean, and sipunculan species, and generated a tractable catalogue of annotated genes (or gene fragments) and protein families for ten newly sequenced non-model organisms, some of commercial importance (i.e., Octopus vulgaris). These comprehensive sets of genes can be readily used for phylogenetic analysis, gene expression profiling, developmental analysis, and can also be a powerful resource for gene discovery. The characterization of the transcriptomes of such a diverse array of animal species permitted the comparison of sequencing depth, functional annotation, and efficiency of genomic sampling using the same pipelines, which proved to be similar for all considered species. In addition, the datasets revealed their potential as a resource for paralogue detection, a recurrent concern in various aspects of biological inquiry, including phylogenetics, molecular evolution, development, and cellular biochemistry. PMID:23190771

  1. The Pathogen-Host Interactions database (PHI-base): additions and future developments

    PubMed Central

    Urban, Martin; Pant, Rashmi; Raghunath, Arathi; Irvine, Alistair G.; Pedro, Helder; Hammond-Kosack, Kim E.

    2015-01-01

    Rapidly evolving pathogens cause a diverse array of diseases and epidemics that threaten crop yield, food security as well as human, animal and ecosystem health. To combat infection greater comparative knowledge is required on the pathogenic process in multiple species. The Pathogen-Host Interactions database (PHI-base) catalogues experimentally verified pathogenicity, virulence and effector genes from bacterial, fungal and protist pathogens. Mutant phenotypes are associated with gene information. The included pathogens infect a wide range of hosts including humans, animals, plants, insects, fish and other fungi. The current version, PHI-base 3.6, available at http://www.phi-base.org, stores information on 2875 genes, 4102 interactions, 110 host species, 160 pathogenic species (103 plant, 3 fungal and 54 animal infecting species) and 181 diseases drawn from 1243 references. Phenotypic and gene function information has been obtained by manual curation of the peer-reviewed literature. A controlled vocabulary consisting of nine high-level phenotype terms permits comparisons and data analysis across the taxonomic space. PHI-base phenotypes were mapped via their associated gene information to reference genomes available in Ensembl Genomes. Virulence genes and hotspots can be visualized directly in genome browsers. Future plans for PHI-base include development of tools facilitating community-led curation and inclusion of the corresponding host target(s). PMID:25414340

  2. Genome-Wide Variation Patterns Uncover the Origin and Selection in Cultivated Ginseng (Panax ginseng Meyer)

    PubMed Central

    Li, Ming-Rui; Shi, Feng-Xue; Li, Ya-Ling; Jiang, Peng; Jiao, Lili

    2017-01-01

    Abstract Chinese ginseng (Panax ginseng Meyer) is a medicinally important herb and plays crucial roles in traditional Chinese medicine. Pharmacological analyses identified diverse bioactive components from Chinese ginseng. However, basic biological attributes including domestication and selection of the ginseng plant remain under-investigated. Here, we presented a genome-wide view of the domestication and selection of cultivated ginseng based on the whole genome data. A total of 8,660 protein-coding genes were selected for genome-wide scanning of the 30 wild and cultivated ginseng accessions. In complement, the 45s rDNA, chloroplast and mitochondrial genomes were included to perform phylogenetic and population genetic analyses. The observed spatial genetic structure between northern cultivated ginseng (NCG) and southern cultivated ginseng (SCG) accessions suggested multiple independent origins of cultivated ginseng. Genome-wide scanning further demonstrated that NCG and SCG have undergone distinct selection pressures during the domestication process, with more genes identified in the NCG (97 genes) than in the SCG group (5 genes). Functional analyses revealed that these genes are involved in diverse pathways, including DNA methylation, lignin biosynthesis, and cell differentiation. These findings suggested that the SCG and NCG groups have distinct demographic histories. Candidate genes identified are useful for future molecular breeding of cultivated ginseng. PMID:28922794

  3. Anti-inflammatory genes associated with multiple sclerosis: a gene expression study.

    PubMed

    Perga, S; Montarolo, F; Martire, S; Berchialla, P; Malucchi, S; Bertolotto, A

    2015-02-15

    Multiple sclerosis (MS) is an autoimmune inflammatory disease of the central nervous system caused by a complex interaction between multiple genes and environmental factors. HLA region is the strongest susceptibility locus, but recent huge genome-wide association studies identified new susceptibility genes. Among these, BACH2, PTGER4, RGS1 and ZFP36L1 were highlighted. Here, a gene expression analysis revealed that three of them, namely BACH2, PTGER4 and ZFP36L1, are down-regulated in MS patients' blood cells compared to healthy subjects. Interestingly, all these genes are involved in the immune system regulation with predominant anti-inflammatory role and their reduction could predispose to MS development. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Genome-wide characterization of the WRKY gene family in radish (Raphanus sativus L.) reveals its critical functions under different abiotic stresses.

    PubMed

    Karanja, Bernard Kinuthia; Fan, Lianxue; Xu, Liang; Wang, Yan; Zhu, Xianwen; Tang, Mingjia; Wang, Ronghua; Zhang, Fei; Muleke, Everlyne M'mbone; Liu, Liwang

    2017-11-01

    The radish WRKY gene family was genome-widely identified and played critical roles in response to multiple abiotic stresses. The WRKY is among the largest transcription factors (TFs) associated with multiple biological activities for plant survival, including control response mechanisms against abiotic stresses such as heat, salinity, and heavy metals. Radish is an important root vegetable crop and therefore characterization and expression pattern investigation of WRKY transcription factors in radish is imperative. In the present study, 126 putative WRKY genes were retrieved from radish genome database. Protein sequence and annotation scrutiny confirmed that RsWRKY proteins possessed highly conserved domains and zinc finger motif. Based on phylogenetic analysis results, RsWRKYs candidate genes were divided into three groups (Group I, II and III) with the number 31, 74, and 20, respectively. Additionally, gene structure analysis revealed that intron-exon patterns of the WRKY genes are highly conserved in radish. Linkage map analysis indicated that RsWRKY genes were distributed with varying densities over nine linkage groups. Further, RT-qPCR analysis illustrated the significant variation of 36 RsWRKY genes under one or more abiotic stress treatments, implicating that they might be stress-responsive genes. In total, 126 WRKY TFs were identified from the R. sativus genome wherein, 35 of them showed abiotic stress-induced expression patterns. These results provide a genome-wide characterization of RsWRKY TFs and baseline for further functional dissection and molecular evolution investigation, specifically for improving abiotic stress resistances with an ultimate goal of increasing yield and quality of radish.

  5. One-step generation of complete gene knockout mice and monkeys by CRISPR/Cas9-mediated gene editing with multiple sgRNAs.

    PubMed

    Zuo, Erwei; Cai, Yi-Jun; Li, Kui; Wei, Yu; Wang, Bang-An; Sun, Yidi; Liu, Zhen; Liu, Jiwei; Hu, Xinde; Wei, Wei; Huo, Xiaona; Shi, Linyu; Tang, Cheng; Liang, Dan; Wang, Yan; Nie, Yan-Hong; Zhang, Chen-Chen; Yao, Xuan; Wang, Xing; Zhou, Changyang; Ying, Wenqin; Wang, Qifang; Chen, Ren-Chao; Shen, Qi; Xu, Guo-Liang; Li, Jinsong; Sun, Qiang; Xiong, Zhi-Qi; Yang, Hui

    2017-07-01

    The CRISPR/Cas9 system is an efficient gene-editing method, but the majority of gene-edited animals showed mosaicism, with editing occurring only in a portion of cells. Here we show that single gene or multiple genes can be completely knocked out in mouse and monkey embryos by zygotic injection of Cas9 mRNA and multiple adjacent single-guide RNAs (spaced 10-200 bp apart) that target only a single key exon of each gene. Phenotypic analysis of F0 mice following targeted deletion of eight genes on the Y chromosome individually demonstrated the robustness of this approach in generating knockout mice. Importantly, this approach delivers complete gene knockout at high efficiencies (100% on Arntl and 91% on Prrt2) in monkey embryos. Finally, we could generate a complete Prrt2 knockout monkey in a single step, demonstrating the usefulness of this approach in rapidly establishing gene-edited monkey models.

  6. Ear leaf photosynthesis and related parameters of transgenic and non-GMO maize hybrids

    USDA-ARS?s Scientific Manuscript database

    Hybrid maize (Zea mays L.) has undergone transformation by using transgenic technology to include d-endotoxins for insect control and tolerance for the herbicides glyphosate and glufosinate . Maize hybrids are being grown with multiple transgenic traits into their genotype (stacked-gene). Limited...

  7. Inherited genetic variants associated with occurrence of multiple primary melanoma.

    PubMed

    Gibbs, David C; Orlow, Irene; Kanetsky, Peter A; Luo, Li; Kricker, Anne; Armstrong, Bruce K; Anton-Culver, Hoda; Gruber, Stephen B; Marrett, Loraine D; Gallagher, Richard P; Zanetti, Roberto; Rosso, Stefano; Dwyer, Terence; Sharma, Ajay; La Pilla, Emily; From, Lynn; Busam, Klaus J; Cust, Anne E; Ollila, David W; Begg, Colin B; Berwick, Marianne; Thomas, Nancy E

    2015-06-01

    Recent studies, including genome-wide association studies, have identified several putative low-penetrance susceptibility loci for melanoma. We sought to determine their generalizability to genetic predisposition for multiple primary melanoma in the international population-based Genes, Environment, and Melanoma (GEM) Study. GEM is a case-control study of 1,206 incident cases of multiple primary melanoma and 2,469 incident first primary melanoma participants as the control group. We investigated the odds of developing multiple primary melanoma for 47 SNPs from 21 distinct genetic regions previously reported to be associated with melanoma. ORs and 95% confidence intervals were determined using logistic regression models adjusted for baseline features (age, sex, age by sex interaction, and study center). We investigated univariable models and built multivariable models to assess independent effects of SNPs. Eleven SNPs in 6 gene neighborhoods (TERT/CLPTM1L, TYRP1, MTAP, TYR, NCOA6, and MX2) and a PARP1 haplotype were associated with multiple primary melanoma. In a multivariable model that included only the most statistically significant findings from univariable modeling and adjusted for pigmentary phenotype, back nevi, and baseline features, we found TERT/CLPTM1L rs401681 (P = 0.004), TYRP1 rs2733832 (P = 0.006), MTAP rs1335510 (P = 0.0005), TYR rs10830253 (P = 0.003), and MX2 rs45430 (P = 0.008) to be significantly associated with multiple primary melanoma, while NCOA6 rs4911442 approached significance (P = 0.06). The GEM Study provides additional evidence for the relevance of these genetic regions to melanoma risk and estimates the magnitude of the observed genetic effect on development of subsequent primary melanoma. ©2015 American Association for Cancer Research.

  8. Inherited genetic variants associated with occurrence of multiple primary melanoma

    PubMed Central

    Gibbs, David C.; Orlow, Irene; Kanetsky, Peter A.; Luo, Li; Kricker, Anne; Armstrong, Bruce K.; Anton-Culver, Hoda; Gruber, Stephen B.; Marrett, Loraine D.; Gallagher, Richard P.; Zanetti, Roberto; Rosso, Stefano; Dwyer, Terence; Sharma, Ajay; La Pilla, Emily; From, Lynn; Busam, Klaus J.; Cust, Anne E.; Ollila, David W.; Begg, Colin B.; Berwick, Marianne; Thomas, Nancy E.

    2015-01-01

    Recent studies including genome-wide association studies have identified several putative low-penetrance susceptibility loci for melanoma. We sought to determine their generalizability to genetic predisposition for multiple primary melanoma in the international population-based Genes, Environment, and Melanoma (GEM) Study. GEM is a case-control study of 1,206 incident cases of multiple primary melanoma and 2,469 incident first primary melanoma participants as the control group. We investigated the odds of developing multiple primary melanoma for 47 single nucleotide polymorphisms (SNP) from 21 distinct genetic regions previously reported to be associated with melanoma. ORs and 95% CIs were determined using logistic regression models adjusted for baseline features (age, sex, age by sex interaction, and study center). We investigated univariable models and built multivariable models to assess independent effects of SNPs. Eleven SNPs in 6 gene neighborhoods (TERT/CLPTM1L, TYRP1, MTAP, TYR, NCOA6, and MX2) and a PARP1 haplotype were associated with multiple primary melanoma. In a multivariable model that included only the most statistically significant findings from univariable modeling and adjusted for pigmentary phenotype, back nevi, and baseline features, we found TERT/CLPTM1L rs401681 (P = 0.004), TYRP1 rs2733832 (P = 0.006), MTAP rs1335510 (P = 0.0005), TYR rs10830253 (P = 0.003), and MX2 rs45430 (P = 0.008) to be significantly associated with multiple primary melanoma while NCOA6 rs4911442 approached significance (P = 0.06). The GEM study provides additional evidence for the relevance of these genetic regions to melanoma risk and estimates the magnitude of the observed genetic effect on development of subsequent primary melanoma. PMID:25837821

  9. A resource for characterizing genome-wide binding and putative target genes of transcription factors expressed during secondary growth and wood formation in Populus.

    PubMed

    Liu, Lijun; Ramsay, Trevor; Zinkgraf, Matthew; Sundell, David; Street, Nathaniel Robert; Filkov, Vladimir; Groover, Andrew

    2015-06-01

    Identifying transcription factor target genes is essential for modeling the transcriptional networks underlying developmental processes. Here we report a chromatin immunoprecipitation sequencing (ChIP-seq) resource consisting of genome-wide binding regions and associated putative target genes for four Populus homeodomain transcription factors expressed during secondary growth and wood formation. Software code (programs and scripts) for processing the Populus ChIP-seq data are provided within a publically available iPlant image, including tools for ChIP-seq data quality control and evaluation adapted from the human Encyclopedia of DNA Elements (ENCODE) project. Basic information for each transcription factor (including members of Class I KNOX, Class III HD ZIP, BEL1-like families) binding are summarized, including the number and location of binding regions, distribution of binding regions relative to gene features, associated putative target genes, and enriched functional categories of putative target genes. These ChIP-seq data have been integrated within the Populus Genome Integrative Explorer (PopGenIE) where they can be analyzed using a variety of web-based tools. We present an example analysis that shows preferential binding of transcription factor ARBORKNOX1 to the nearest neighbor genes in a pre-calculated co-expression network module, and enrichment for meristem-related genes within this module including multiple orthologs of Arabidopsis KNOTTED-like Arabidopsis 2/6. © 2015 Society for Experimental Biology and John Wiley & Sons Ltd This article has been contributed to by US Government employees and their work is in the public domain in the USA.

  10. Neurofibromatosis.

    PubMed

    Korf, Bruce R

    2013-01-01

    The "neurofibromatoses" are a set of distinct genetic disorders that have in common the occurrence of tumors of the nerve sheath. They include NF1, NF2, and schwannomatosis. All are dominantly inherited with a high rate of new mutation and variable expression. NF1 includes effects on multiple systems of the body. The major NF1-associated tumor is the neurofibroma. In addition, clinical manifestations include bone dysplasia, learning disabilities, and an increased risk of malignancy. NF2 includes schwannomas of multiple cranial and spinal nerves, especially the vestibular nerve, as well as other tumors such as meningiomas and ependymomas. The schwannomatosis phenotype is limited to multiple schwannomas, and usually presents with pain. The genes that underlie each of the disorders are known: NF1 for neurofibromatosis type 1, NF2 for neurofibromatosis type 2, and INI1/SMARCB1 for schwannomatosis. Genetic testing is possible to identify mutations. Insights into pathogenesis are beginning to suggest new treatment strategies, and therapeutic trials with several new forms of treatment are underway. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. Wilms' tumour 1 (WT1) in development, homeostasis and disease.

    PubMed

    Hastie, Nicholas D

    2017-08-15

    The study of genes mutated in human disease often leads to new insights into biology as well as disease mechanisms. One such gene is Wilms' tumour 1 ( WT1 ), which plays multiple roles in development, tissue homeostasis and disease. In this Primer, I summarise how this multifaceted gene functions in various mammalian tissues and organs, including the kidney, gonads, heart and nervous system. This is followed by a discussion of our current understanding of the molecular mechanisms by which WT1 and its two major isoforms regulate these processes at the transcriptional and post-transcriptional levels. © 2017. Published by The Company of Biologists Ltd.

  12. Current Progress in Therapeutic Gene Editing for Monogenic Diseases

    PubMed Central

    Prakash, Versha; Moore, Marc; Yáñez-Muñoz, Rafael J

    2016-01-01

    Programmable nucleases allow defined alterations in the genome with ease-of-use, efficiency, and specificity. Their availability has led to accurate and widespread genome engineering, with multiple applications in basic research, biotechnology, and therapy. With regard to human gene therapy, nuclease-based gene editing has facilitated development of a broad range of therapeutic strategies based on both nonhomologous end joining and homology-dependent repair. This review discusses current progress in nuclease-based therapeutic applications for a subset of inherited monogenic diseases including cystic fibrosis, Duchenne muscular dystrophy, diseases of the bone marrow, and hemophilia and highlights associated challenges and future prospects. PMID:26765770

  13. Arabidopsis thaliana gonidialess A/Zuotin related factors (GlsA/ZRF) are essential for maintenance of meristem integrity.

    PubMed

    Guzmán-López, José Alfredo; Abraham-Juárez, María Jazmín; Lozano-Sotomayor, Paulina; de Folter, Stefan; Simpson, June

    2016-05-01

    Observation of a differential expression pattern, including strong expression in meristematic tissue of an Agave tequilana GlsA/ZRF ortholog suggested an important role for this gene during bulbil formation and developmental changes in this species. In order to better understand this role, the two GlsA/ZFR orthologs present in the genome of Arabidopsis thaliana were functionally characterized by analyzing expression patterns, double mutant phenotypes, promoter-GUS fusions and expression of hormone related or meristem marker genes. Patterns of expression for A. thaliana show that GlsA/ZFR genes are strongly expressed in SAMs and RAMs in mature plants and developing embryos and double mutants showed multiple changes in morphology related to both SAM and RAM tissues. Typical double mutants showed stunted growth of aerial and root tissue, formation of multiple ectopic meristems and effects on cotyledons, leaves and flowers. The KNOX genes STM and BP were overexpressed in double mutants whereas CLV3, WUSCHEL and AS1 were repressed and lack of AtGlsA expression was also associated with changes in localization of auxin and cytokinin. These results suggest that GlsA/ZFR is an essential component of the machinery that maintains the integrity of SAM and RAM tissue and underline the potential to identify new genes or gene functions based on observations in non-model plants.

  14. Genes Upregulated in Winter Wheat (Triticum aestivum L.) during Mild Freezing and Subsequent Thawing Suggest Sequential Activation of Multiple Response Mechanisms.

    PubMed

    Skinner, Daniel Z

    2015-01-01

    Exposing fully cold-acclimated wheat plants to a mild freeze-thaw cycle of -3 °C for 24h followed by +3 °C for 24 or 48 h results in dramatically improved tolerance of subsequent exposure to sub-freezing temperatures. Gene enrichment analysis of crown tissue from plants collected before or after the -3 °C freeze or after thawing at +3 °C for 24 or 48 h revealed that many biological processes and molecular functions were activated during the freeze-thaw cycle in an increasing cascade of responses such that over 150 processes or functions were significantly enhanced by the end of the 48 h, post-freeze thaw. Nearly 2,000 individual genes were upregulated more than 2-fold over the 72 h course of freezing and thawing, but more than 70% of these genes were upregulated during only one of the time periods examined, suggesting a series of genes and gene functions were involved in activation of the processes that led to enhanced freezing tolerance. This series of functions appeared to include extensive cell signaling, activation of stress response mechanisms and the phenylpropanoid biosynthetic pathway, extensive modification of secondary metabolites, and physical restructuring of cell membranes. By identifying plant lines that are especially able to activate these multiple mechanisms it may be possible to develop lines with enhanced winterhardiness.

  15. The Human CHRNA7 and CHRFAM7A Genes: A Review of the Genetics, Regulation, and Function

    PubMed Central

    Sinkus, Melissa L.; Graw, Sharon; Freedman, Robert; Ross, Randal G.; Lester, Henry A.; Leonard, Sherry

    2015-01-01

    The human α7 neuronal nicotinic acetylcholine receptor gene (CHRNA7) is ubiquitously expressed in both the central nervous system and in the periphery. CHRNA7 is genetically linked to multiple disorders with cognitive deficits, including schizophrenia, bipolar disorder, ADHD, epilepsy, Alzheimer’s disease, and Rett syndrome. The regulation of CHRNA7 is complex; more than a dozen mechanisms are known, one of which is a partial duplication of the parent gene. Exons 5-10 of CHRNA7 on chromosome 15 were duplicated and inserted 1.6 Mb upstream of CHRNA7, interrupting an earlier partial duplication of two other genes. The chimeric CHRFAM7A gene product, dupα7, assembles with α7 subunits, resulting in a dominant negative regulation of function. The duplication is human specific, occurring neither in primates nor in rodents. The duplicated α7 sequence in exons 5-10 of CHRFAM7A is almost identical to CHRNA7, and thus is not completely queried in high throughput genetic studies (GWAS). Further, pre-clinical animal models of the α7nAChR utilized in drug development research do not have CHRFAM7A (dupα7) and cannot fully model human drug responses. The wide expression of CHRNA7, its multiple functions and modes of regulation present challenges for study of this gene in disease. PMID:25701707

  16. Dissecting the mechanisms responsible for the multiple insecticide resistance phenotype in Anopheles gambiae s.s., M form, from Vallée du Kou, Burkina Faso

    PubMed Central

    Kwiatkowska, Rachel M.; Platt, Naomi; Poupardin, Rodolphe; Irving, Helen; Dabire, Roch K.; Mitchell, Sara; Jones, Christopher M.; Diabaté, Abdoulaye; Ranson, Hilary; Wondji, Charles S.

    2013-01-01

    With the exception of target site mutations, insecticide resistance mechanisms in the principle malaria vector Anopheles gambiae, remains largely uncharacterized in Burkina Faso. Here we detected high prevalence of resistance in Vallée du Kou (VK) to pyrethroids, DDT and dieldrin, moderate level for carbamates and full susceptibility to organophosphates. High frequencies of L1014F kdr (75%) and Rdl (87%) mutations were observed showing strong correlation with pyrethroids/DDT and dieldrin resistance. The frequency of ace1R mutation was low even in carbamate resistant mosquitoes. Microarray analysis identified genes significantly over-transcribed in VK. These include the cytochrome P450 genes, CYP6P3 and CYP6Z2, previously associated with pyrethroid resistance. Gene Ontology (GO) enrichment analysis suggested that elevated neurotransmitter activity is associated with resistance, with the over-transcription of target site resistance genes such as acetylcholinesterase and the GABA receptor. A rhodopsin receptor gene previously associated with pyrethroid resistance in Culex pipiens pallens was also over-transcribed in VK. This study highlights the complex network of mechanisms conferring multiple resistance in malaria vectors and such information should be taken into account when designing and implementing resistance control strategies. PMID:23380570

  17. Molecular Typing of Lung Adenocarcinoma on Cytological Samples Using a Multigene Next Generation Sequencing Panel

    PubMed Central

    Fassan, Matteo; Rachiglio, Anna Maria; Cappellesso, Rocco; Antonello, Davide; Amato, Eliana; Mafficini, Andrea; Lambiase, Matilde; Esposito, Claudia; Bria, Emilio; Simonato, Francesca; Scardoni, Maria; Turri, Giona; Chilosi, Marco; Tortora, Giampaolo; Fassina, Ambrogio; Normanno, Nicola

    2013-01-01

    Identification of driver mutations in lung adenocarcinoma has led to development of targeted agents that are already approved for clinical use or are in clinical trials. Therefore, the number of biomarkers that will be needed to assess is expected to rapidly increase. This calls for the implementation of methods probing the mutational status of multiple genes for inoperable cases, for which limited cytological or bioptic material is available. Cytology specimens from 38 lung adenocarcinomas were subjected to the simultaneous assessment of 504 mutational hotspots of 22 lung cancer-associated genes using 10 nanograms of DNA and Ion Torrent PGM next-generation sequencing. Thirty-six cases were successfully sequenced (95%). In 24/36 cases (67%) at least one mutated gene was observed, including EGFR, KRAS, PIK3CA, BRAF, TP53, PTEN, MET, SMAD4, FGFR3, STK11, MAP2K1. EGFR and KRAS mutations, respectively found in 6/36 (16%) and 10/36 (28%) cases, were mutually exclusive. Nine samples (25%) showed concurrent alterations in different genes. The next-generation sequencing test used is superior to current standard methodologies, as it interrogates multiple genes and requires limited amounts of DNA. Its applicability to routine cytology samples might allow a significant increase in the fraction of lung cancer patients eligible for personalized therapy. PMID:24236184

  18. The Complex Transcriptional Response of Acaryochloris marina to Different Oxygen Levels.

    PubMed

    Hernández-Prieto, Miguel A; Lin, Yuankui; Chen, Min

    2017-02-09

    Ancient oxygenic photosynthetic prokaryotes produced oxygen as a waste product, but existed for a long time under an oxygen-free (anoxic) atmosphere, before an oxic atmosphere emerged. The change in oxygen levels in the atmosphere influenced the chemistry and structure of many enzymes that contained prosthetic groups that were inactivated by oxygen. In the genome of Acaryochloris marina , multiple gene copies exist for proteins that are normally encoded by a single gene copy in other cyanobacteria. Using high throughput RNA sequencing to profile transcriptome responses from cells grown under microoxic and hyperoxic conditions, we detected 8446 transcripts out of the 8462 annotated genes in the Cyanobase database. Two-thirds of the 50 most abundant transcripts are key proteins in photosynthesis. Microoxic conditions negatively affected the levels of expression of genes encoding photosynthetic complexes, with the exception of some subunits. In addition to the known regulation of the multiple copies of psbA , we detected a similar transcriptional pattern for psbJ and psbU , which might play a key role in the altered components of photosystem II. Furthermore, regulation of genes encoding proteins important for reactive oxygen species-scavenging is discussed at genome level, including, for the first time, specific small RNAs having possible regulatory roles under varying oxygen levels. Copyright © 2017 Hernandez-Prieto et al.

  19. Engineered human skin substitutes undergo large-scale genomic reprogramming and normal skin-like maturation after transplantation to athymic mice.

    PubMed

    Klingenberg, Jennifer M; McFarland, Kevin L; Friedman, Aaron J; Boyce, Steven T; Aronow, Bruce J; Supp, Dorothy M

    2010-02-01

    Bioengineered skin substitutes can facilitate wound closure in severely burned patients, but deficiencies limit their outcomes compared with native skin autografts. To identify gene programs associated with their in vivo capabilities and limitations, we extended previous gene expression profile analyses to now compare engineered skin after in vivo grafting with both in vitro maturation and normal human skin. Cultured skin substitutes were grafted on full-thickness wounds in athymic mice, and biopsy samples for microarray analyses were collected at multiple in vitro and in vivo time points. Over 10,000 transcripts exhibited large-scale expression pattern differences during in vitro and in vivo maturation. Using hierarchical clustering, 11 different expression profile clusters were partitioned on the basis of differential sample type and temporal stage-specific activation or repression. Analyses show that the wound environment exerts a massive influence on gene expression in skin substitutes. For example, in vivo-healed skin substitutes gained the expression of many native skin-expressed genes, including those associated with epidermal barrier and multiple categories of cell-cell and cell-basement membrane adhesion. In contrast, immunological, trichogenic, and endothelial gene programs were largely lacking. These analyses suggest important areas for guiding further improvement of engineered skin for both increased homology with native skin and enhanced wound healing.

  20. The Complex Transcriptional Response of Acaryochloris marina to Different Oxygen Levels

    PubMed Central

    Hernández-Prieto, Miguel A.; Lin, Yuankui; Chen, Min

    2016-01-01

    Ancient oxygenic photosynthetic prokaryotes produced oxygen as a waste product, but existed for a long time under an oxygen-free (anoxic) atmosphere, before an oxic atmosphere emerged. The change in oxygen levels in the atmosphere influenced the chemistry and structure of many enzymes that contained prosthetic groups that were inactivated by oxygen. In the genome of Acaryochloris marina, multiple gene copies exist for proteins that are normally encoded by a single gene copy in other cyanobacteria. Using high throughput RNA sequencing to profile transcriptome responses from cells grown under microoxic and hyperoxic conditions, we detected 8446 transcripts out of the 8462 annotated genes in the Cyanobase database. Two-thirds of the 50 most abundant transcripts are key proteins in photosynthesis. Microoxic conditions negatively affected the levels of expression of genes encoding photosynthetic complexes, with the exception of some subunits. In addition to the known regulation of the multiple copies of psbA, we detected a similar transcriptional pattern for psbJ and psbU, which might play a key role in the altered components of photosystem II. Furthermore, regulation of genes encoding proteins important for reactive oxygen species-scavenging is discussed at genome level, including, for the first time, specific small RNAs having possible regulatory roles under varying oxygen levels. PMID:27974439

  1. Candidate-gene association study of mothers with pre-eclampsia, and their infants, analyzing 775 SNPs in 190 genes.

    PubMed

    Goddard, Katrina A B; Tromp, Gerard; Romero, Roberto; Olson, Jane M; Lu, Qing; Xu, Zhiying; Parimi, Neeta; Nien, Jyh Kae; Gomez, Ricardo; Behnke, Ernesto; Solari, Margarita; Espinoza, Jimmy; Santolaya, Joaquin; Chaiworapongsa, Tinnakorn; Lenk, Guy M; Volkenant, Kimberly; Anant, Madan Kumar; Salisbury, Benjamin A; Carr, Janet; Lee, Min Soeb; Vovis, Gerald F; Kuivaniemi, Helena

    2007-01-01

    Pre-eclampsia (PE) affects 5-7% of pregnancies in the US, and is a leading cause of maternal death and perinatal morbidity and mortality worldwide. To identify genes with a role in PE, we conducted a large-scale association study evaluating 775 SNPs in 190 candidate genes selected for a potential role in obstetrical complications. SNP discovery was performed by DNA sequencing, and genotyping was carried out in a high-throughput facility using the MassARRAY(TM) System. Women with PE (n = 394) and their offspring (n = 324) were compared with control women (n = 602) and their offspring (n = 631) from the same hospital-based population. Haplotypes were estimated for each gene using the EM algorithm, and empirical p values were obtained for a logistic regression-based score test, adjusted for significant covariates. An interaction model between maternal and offspring genotypes was also evaluated. The most significant findings for association with PE were COL1A1 (p = 0.0011) and IL1A (p = 0.0014) for the maternal genotype, and PLAUR (p = 0.0008) for the offspring genotype. Common candidate genes for PE, including MTHFR and NOS3, were not significantly associated with PE. For the interaction model, SNPs within IGF1 (p = 0.0035) and IL4R (p = 0.0036) gave the most significant results. This study is one of the most comprehensive genetic association studies of PE to date, including an evaluation of offspring genotypes that have rarely been considered in previous studies. Although we did not identify statistically significant evidence of association for any of the candidate loci evaluated here after adjusting for multiple testing using the false discovery rate, additional compelling evidence exists, including multiple SNPs with nominally significant p values in COL1A1 and the IL1A region, and previous reports of association for IL1A, to support continued interest in these genes as candidates for PE. Identification of the genetic regulators of PE may have broader implications, since women with PE are at increased risk of death from cardiovascular diseases later in life.

  2. The action of a dietary retinoid on gene expression and cancer induction in electron-irradiated rat skin

    NASA Technical Reports Server (NTRS)

    Burns, Fredric J.; Chen, Shuaili; Xu, Guijuan; Wu, Feng; Tang, Moon-Shong

    2002-01-01

    Current models of radiation carcinogenesis generally assume that the DNA is damaged in a variety of ways by the radiation and that subsequent cell divisions contribute to the conversion of the damage to heritable mutations. Cancer may seem complex and intractable, but its complexity provides multiple opportunities for preventive interventions. Mitotic inhibitors are among the strongest cancer preventive agents, not only slowing the growth rate of preneoplasias but also increasing the fidelity of DNA repair processes. Ionizing radiation, including electrons, is a strong inducer of cancer in rat skin, and dietary retinoids have shown potent cancer preventive activity in the same system. A non-toxic dietary dose of retinyl acetate altered gene expression levels 24 hours after electron irradiation of rat skin. Of the 8740 genes on an Affymetrix rat expression array, the radiation significantly (5 fold or higher) altered 188, while the retinoid altered 231, including 16 radiation-altered genes that were reversely altered. While radiation strongly affected the expression of stress response, immune/inflammation and nucleic acid metabolism genes, the retinoid most strongly affected proliferation-related genes, including some significant reversals, such as, keratin 14, retinol binding protein, and calcium binding proteins. These results point to reversal of proliferation-relevant genes as a likely basis for the anti-radiogenic effects of dietary retinyl acetate.

  3. Patterns of evolution at the gametophytic self-incompatibility Sorbus aucuparia (Pyrinae) S pollen genes support the non-self recognition by multiple factors model

    PubMed Central

    Aguiar, Bruno; Vieira, Jorge; Cunha, Ana E.; Fonseca, Nuno A.; Reboiro-Jato, David; Reboiro-Jato, Miguel; Fdez-Riverola, Florentino; Raspé, Olivier; Vieira, Cristina P.

    2013-01-01

    S-RNase-based gametophytic self-incompatibility evolved once before the split of the Asteridae and Rosidae. In Prunus (tribe Amygdaloideae of Rosaceae), the self-incompatibility S-pollen is a single F-box gene that presents the expected evolutionary signatures. In Malus and Pyrus (subtribe Pyrinae of Rosaceae), however, clusters of F-box genes (called SFBBs) have been described that are expressed in pollen only and are linked to the S-RNase gene. Although polymorphic, SFBB genes present levels of diversity lower than those of the S-RNase gene. They have been suggested as putative S-pollen genes, in a system of non-self recognition by multiple factors. Subsets of allelic products of the different SFBB genes interact with non-self S-RNases, marking them for degradation, and allowing compatible pollinations. This study performed a detailed characterization of SFBB genes in Sorbus aucuparia (Pyrinae) to address three predictions of the non-self recognition by multiple factors model. As predicted, the number of SFBB genes was large to account for the many S-RNase specificities. Secondly, like the S-RNase gene, the SFBB genes were old. Thirdly, amino acids under positive selection—those that could be involved in specificity determination—were identified when intra-haplotype SFBB genes were analysed using codon models. Overall, the findings reported here support the non-self recognition by multiple factors model. PMID:23606363

  4. Addictive genes and the relationship to obesity and inflammation.

    PubMed

    Heber, David; Carpenter, Catherine L

    2011-10-01

    There is increasing evidence that the same brain reward circuits involved in perpetuating drug abuse are involved in the hedonic urges and food cravings observed clinically in overweight and obese subjects. A polymorphism of the D2 dopamine receptor which renders it less sensitive to dopamine stimulation has been proposed to promote self-stimulatory behavior such as consuming alcohol, abusing drugs, or binging on foods. It is important to determine how this polymorphism may interact with other well-known candidate genes for obesity including polymorphisms of the leptin receptor gene and the opiomelanocortin gene. Leptin is a proinflammatory cytokine as well as a long-term signal maintaining body fat. Upper-body obesity stimulates systemic inflammation through the action of multiple cytokines including leptin throughout many organs including the brain. The association of numerous diseases including diabetes mellitus, heart disease, as well as depression with chronic low-grade inflammation due to abdominal obesity has raised the possibility that obesity-associated inflammation affecting the brain may promote addictive behaviors leading to a self-perpetuating cycle that may affect not only foods but addictions to drugs, alcohol, and gambling. This new area of interdisciplinary research holds the promise of developing new approaches to treating drug abuse and obesity.

  5. A multicolor panel of TALE-KRAB based transcriptional repressor vectors enabling knockdown of multiple gene targets

    PubMed Central

    Zhang, Zhonghui; Wu, Elise; Qian, Zhijian; Wu, Wen-Shu

    2014-01-01

    Stable and efficient knockdown of multiple gene targets is highly desirable for dissection of molecular pathways. Because it allows sequence-specific DNA binding, transcription activator-like effector (TALE) offers a new genetic perturbation technique that allows for gene-specific repression. Here, we constructed a multicolor lentiviral TALE-Kruppel-associated box (KRAB) expression vector platform that enables knockdown of multiple gene targets. This platform is fully compatible with the Golden Gate TALEN and TAL Effector Kit 2.0, a widely used and efficient method for TALE assembly. We showed that this multicolor TALE-KRAB vector system when combined together with bone marrow transplantation could quickly knock down c-kit and PU.1 genes in hematopoietic stem and progenitor cells of recipient mice. Furthermore, our data demonstrated that this platform simultaneously knocked down both c-Kit and PU.1 genes in the same primary cell populations. Together, our results suggest that this multicolor TALE-KRAB vector platform is a promising and versatile tool for knockdown of multiple gene targets and could greatly facilitate dissection of molecular pathways. PMID:25475013

  6. A multicolor panel of TALE-KRAB based transcriptional repressor vectors enabling knockdown of multiple gene targets.

    PubMed

    Zhang, Zhonghui; Wu, Elise; Qian, Zhijian; Wu, Wen-Shu

    2014-12-05

    Stable and efficient knockdown of multiple gene targets is highly desirable for dissection of molecular pathways. Because it allows sequence-specific DNA binding, transcription activator-like effector (TALE) offers a new genetic perturbation technique that allows for gene-specific repression. Here, we constructed a multicolor lentiviral TALE-Kruppel-associated box (KRAB) expression vector platform that enables knockdown of multiple gene targets. This platform is fully compatible with the Golden Gate TALEN and TAL Effector Kit 2.0, a widely used and efficient method for TALE assembly. We showed that this multicolor TALE-KRAB vector system when combined together with bone marrow transplantation could quickly knock down c-kit and PU.1 genes in hematopoietic stem and progenitor cells of recipient mice. Furthermore, our data demonstrated that this platform simultaneously knocked down both c-Kit and PU.1 genes in the same primary cell populations. Together, our results suggest that this multicolor TALE-KRAB vector platform is a promising and versatile tool for knockdown of multiple gene targets and could greatly facilitate dissection of molecular pathways.

  7. The FLIGHT Drosophila RNAi database

    PubMed Central

    Bursteinas, Borisas; Jain, Ekta; Gao, Qiong; Baum, Buzz; Zvelebil, Marketa

    2010-01-01

    FLIGHT (http://flight.icr.ac.uk/) is an online resource compiling data from high-throughput Drosophila in vivo and in vitro RNAi screens. FLIGHT includes details of RNAi reagents and their predicted off-target effects, alongside RNAi screen hits, scores and phenotypes, including images from high-content screens. The latest release of FLIGHT is designed to enable users to upload, analyze, integrate and share their own RNAi screens. Users can perform multiple normalizations, view quality control plots, detect and assign screen hits and compare hits from multiple screens using a variety of methods including hierarchical clustering. FLIGHT integrates RNAi screen data with microarray gene expression as well as genomic annotations and genetic/physical interaction datasets to provide a single interface for RNAi screen analysis and datamining in Drosophila. PMID:20855970

  8. PubMed Central

    Praticò, A.D.; Serra, A.; Maiolino, L.; Cocuzza, S.; Di Mauro, P.; Licciardello, L.; Milone, P.; Privitera, G.; Belfiore, G.; Di Pietro, M.; Di Raimondo, F.; Romano, A.; Chiarenza, A.; Muglia, M.; Polizzi, A.; Evans, D.G.

    2016-01-01

    SUMMARY Neurofibromatosis type 2 [NF2; MIM # 101000] is an autosomal dominant disorder characterised by the occurrence of vestibular schwannomas (VSs), schwannomas of other cranial, spinal and cutaneous nerves, cranial and spinal meningiomas and/or other central nervous system (CNS) tumours (e.g., ependymomas, astrocytomas). Additional features include early onset cataracts, optic nerve sheath meningiomas, retinal hamartomas, dermal schwannomas (i.e., NF2-plaques), and (few) café-au-lait spots. Clinically, NF2 children fall into two main groups: (1) congenital NF2 - with bilateral VSs detected as early as the first days to months of life, which can be stable/asymptomatic for one-two decades and suddenly progress; and (2) severe pre-pubertal (Wishart type) NF2- with multiple (and rapidly progressive) CNS tumours other-than-VS, which usually present first, years before VSs [vs. the classical adult (Gardner type) NF2, with bilateral VSs presenting in young adulthood, sometimes as the only disease feature]. Some individuals can develop unilateral VS associated with ipsilateral meningiomas or multiple schwannomas localised to one part of the peripheral nervous system [i.e., mosaic NF2] or multiple non-VS, non-intradermal cranial, spinal and peripheral schwannomas (histologically proven) [schwannomatosis]. NF2 is caused by mutations in the NF2 gene at chromosome 22q12.1, which encodes for a protein called merlin or schwannomin, most similar to the exrin-readixin-moesin (ERM) proteins; mosaicNF2 is due to mosaic phenomena for the NF2 gene, whilst schwannomatosis is caused by coupled germ-line and mosaic mutations either in the SMARCB1 gene [SWNTS1; MIM # 162091] or the LZTR1 gene [SWNTS2; MIM # 615670] both falling within the 22q region and the NF2 gene. Data driven from in vitro and animal studies on the merlin pathway [e.g., post-translational and upstream/downstream regulation] allowed biologically targeted treatment strategies [e.g., Lapatinib, Erlotinib, Bevacizumab] aimed to multiple tumour shrinkage and/or regression and tumour arrest of progression with functional improvement. PMID:27958595

  9. A Network Approach of Gene Co-expression in the Zea mays/Aspergillus flavus Pathosystem to Map Host/Pathogen Interaction Pathways.

    PubMed

    Musungu, Bryan M; Bhatnagar, Deepak; Brown, Robert L; Payne, Gary A; OBrian, Greg; Fakhoury, Ahmad M; Geisler, Matt

    2016-01-01

    A gene co-expression network (GEN) was generated using a dual RNA-seq study with the fungal pathogen Aspergillus flavus and its plant host Zea mays during the initial 3 days of infection. The analysis deciphered novel pathways and mapped genes of interest in both organisms during the infection. This network revealed a high degree of connectivity in many of the previously recognized pathways in Z. mays such as jasmonic acid, ethylene, and reactive oxygen species (ROS). For the pathogen A. flavus , a link between aflatoxin production and vesicular transport was identified within the network. There was significant interspecies correlation of expression between Z. mays and A. flavus for a subset of 104 Z. mays , and 1942 A. flavus genes. This resulted in an interspecies subnetwork enriched in multiple Z. mays genes involved in the production of ROS. In addition to the ROS from Z. mays , there was enrichment in the vesicular transport pathways and the aflatoxin pathway for A. flavus . Included in these genes, a key aflatoxin cluster regulator, AflS, was found to be co-regulated with multiple Z. mays ROS producing genes within the network, suggesting AflS may be monitoring host ROS levels. The entire GEN for both host and pathogen, and the subset of interspecies correlations, is presented as a tool for hypothesis generation and discovery for events in the early stages of fungal infection of Z. mays by A. flavus .

  10. MVisAGe Identifies Concordant and Discordant Genomic Alterations of Driver Genes in Squamous Tumors.

    PubMed

    Walter, Vonn; Du, Ying; Danilova, Ludmila; Hayward, Michele C; Hayes, D Neil

    2018-06-15

    Integrated analyses of multiple genomic datatypes are now common in cancer profiling studies. Such data present opportunities for numerous computational experiments, yet analytic pipelines are limited. Tools such as the cBioPortal and Regulome Explorer, although useful, are not easy to access programmatically or to implement locally. Here, we introduce the MVisAGe R package, which allows users to quantify gene-level associations between two genomic datatypes to investigate the effect of genomic alterations (e.g., DNA copy number changes on gene expression). Visualizing Pearson/Spearman correlation coefficients according to the genomic positions of the underlying genes provides a powerful yet novel tool for conducting exploratory analyses. We demonstrate its utility by analyzing three publicly available cancer datasets. Our approach highlights canonical oncogenes in chr11q13 that displayed the strongest associations between expression and copy number, including CCND1 and CTTN , genes not identified by copy number analysis in the primary reports. We demonstrate highly concordant usage of shared oncogenes on chr3q, yet strikingly diverse oncogene usage on chr11q as a function of HPV infection status. Regions of chr19 that display remarkable associations between methylation and gene expression were identified, as were previously unreported miRNA-gene expression associations that may contribute to the epithelial-to-mesenchymal transition. Significance: This study presents an important bioinformatics tool that will enable integrated analyses of multiple genomic datatypes. Cancer Res; 78(12); 3375-85. ©2018 AACR . ©2018 American Association for Cancer Research.

  11. A Network Approach of Gene Co-expression in the Zea mays/Aspergillus flavus Pathosystem to Map Host/Pathogen Interaction Pathways

    PubMed Central

    Musungu, Bryan M.; Bhatnagar, Deepak; Brown, Robert L.; Payne, Gary A.; OBrian, Greg; Fakhoury, Ahmad M.; Geisler, Matt

    2016-01-01

    A gene co-expression network (GEN) was generated using a dual RNA-seq study with the fungal pathogen Aspergillus flavus and its plant host Zea mays during the initial 3 days of infection. The analysis deciphered novel pathways and mapped genes of interest in both organisms during the infection. This network revealed a high degree of connectivity in many of the previously recognized pathways in Z. mays such as jasmonic acid, ethylene, and reactive oxygen species (ROS). For the pathogen A. flavus, a link between aflatoxin production and vesicular transport was identified within the network. There was significant interspecies correlation of expression between Z. mays and A. flavus for a subset of 104 Z. mays, and 1942 A. flavus genes. This resulted in an interspecies subnetwork enriched in multiple Z. mays genes involved in the production of ROS. In addition to the ROS from Z. mays, there was enrichment in the vesicular transport pathways and the aflatoxin pathway for A. flavus. Included in these genes, a key aflatoxin cluster regulator, AflS, was found to be co-regulated with multiple Z. mays ROS producing genes within the network, suggesting AflS may be monitoring host ROS levels. The entire GEN for both host and pathogen, and the subset of interspecies correlations, is presented as a tool for hypothesis generation and discovery for events in the early stages of fungal infection of Z. mays by A. flavus. PMID:27917194

  12. Multiple Vibrio fischeri genes are involved in biofilm formation and host colonization

    PubMed Central

    Chavez-Dozal, Alba; Hogan, David; Gorman, Clayton; Quintanal-Villalonga, Alvaro; Nishiguchi, Michele K.

    2012-01-01

    Biofilms are increasingly recognized as the predominant form for survival in the environment for most bacteria. The successful colonization of Vibrio fischeri in its squid host Euprymna tasmanica, involves complex microbe-host interactions mediated by specific genes that are essential for biofilm formation and colonization. In the present investigation, structural and regulatory genes were selected to study their role in biofilm formation and host colonization. We have mutated several genes (pilT, pilU, flgF, motY, ibpA and mifB) by an insertional inactivation strategy. Results demonstrate that structural genes responsible for synthesis of type IV pili and flagella are crucial for biofilm formation and host infection. Moreover, regulatory genes affect colony aggregation by various mechanisms including alteration of synthesis of transcriptional factors and regulation of extracellular polysaccharide production. These results reflect the significance of how genetic alterations influence communal behavior, which is important in understanding symbiotic relationships. PMID:22486781

  13. In vivo simultaneous transcriptional activation of multiple genes in the brain using CRISPR-dCas9-activator transgenic mice.

    PubMed

    Zhou, Haibo; Liu, Junlai; Zhou, Changyang; Gao, Ni; Rao, Zhiping; Li, He; Hu, Xinde; Li, Changlin; Yao, Xuan; Shen, Xiaowen; Sun, Yidi; Wei, Yu; Liu, Fei; Ying, Wenqin; Zhang, Junming; Tang, Cheng; Zhang, Xu; Xu, Huatai; Shi, Linyu; Cheng, Leping; Huang, Pengyu; Yang, Hui

    2018-03-01

    Despite rapid progresses in the genome-editing field, in vivo simultaneous overexpression of multiple genes remains challenging. We generated a transgenic mouse using an improved dCas9 system that enables simultaneous and precise in vivo transcriptional activation of multiple genes and long noncoding RNAs in the nervous system. As proof of concept, we were able to use targeted activation of endogenous neurogenic genes in these transgenic mice to directly and efficiently convert astrocytes into functional neurons in vivo. This system provides a flexible and rapid screening platform for studying complex gene networks and gain-of-function phenotypes in the mammalian brain.

  14. Brooke-Spiegler syndrome: report of 10 patients from 8 families with novel germline mutations: evidence of diverse somatic mutations in the same patient regardless of tumor type.

    PubMed

    Sima, Radek; Vanecek, Tomas; Kacerovska, Denisa; Trubac, Pavel; Cribier, Bernard; Rutten, Arno; Vazmitel, Marina; Spagnolo, Dominic V; Litvik, Radek; Vantuchova, Yvetta; Weyers, Wolfgang; Pearce, Robert L; Pearn, John; Michal, Michal; Kazakov, Dmitry V

    2010-06-01

    Brooke-Spiegler syndrome (BSS) is an inherited autosomal dominant disease characterized by the development of multiple adnexal cutaneous neoplasms including spiradenoma, cylindroma, spiradenocylindroma, and trichoepithelioma (cribriform trichoblastoma). BSS patients have various mutations in the CYLD gene, a tumor suppressor gene located on chromosome 16q. Our search of the literature revealed 51 germline CYLD mutations reported to date. Somatic CYLD mutations have rarely been investigated. We studied 10 patients from 8 families with BSS. Analysis of germline mutations of the CYLD gene was performed using either peripheral blood or nontumorous tissue. In addition, 19 formalin-fixed paraffin-embedded tumor samples were analyzed for somatic mutations, including loss of heterozygosity studies. A total of 38 tumors were available for histopathologic review. We have identified 8 novel germline mutations, all of which consisted of substitutions, deletions, and insertions/duplications and all except one led to premature stop codons. The substitution mutation in a single case was also predicted to disrupt protein function and seems causally implicated in tumor formation. We demonstrate for the first time that somatic events, loss of heterozygosity, or sequence mutations may differ among multiple neoplasms even of the same histologic type, occurring in the same patient.

  15. Pharmacogenetics of the β2-Adrenergic Receptor Gene

    PubMed Central

    Ortega, Victor E.; Hawkins, Gregory A.; Peters, Stephen P.; Bleecker, Eugene R.

    2009-01-01

    Asthma is a complex genetic disease with multiple genetic and environmental determinants contributing to the observed variability in response to common anti-asthma therapies. Asthma pharmacogenetic research has focused on multiple candidate genes including the β2-adrenergic receptor gene (ADRβ2) and its effect on individual responses to beta agonist therapy. At present, knowledge about the effects of ADRβ2 variation on therapeutic responses is evolving and should not alter current Asthma Guideline approaches consisting of the use of short acting beta agonists for as-needed symptom based therapy and the use of a regular long-acting beta agonist in combination with inhaled corticosteroid therapy for optimal control of asthma symptoms in those asthmatics who are not controlled on inhaled corticosteroid alone. This approach is based upon studies showing a consistent pharmacogenetic response to regular use of short acting beta agonists (SABA) and less consistent findings in studies evaluating long acting beta agonist (LABA). While emerging pharmacogenetic studies are provocative and should lead to functional approaches, conflicting data with responses to LABA therapy may be caused by factors that include small sample sizes of study populations and differences in experimental design that may limit the conclusions that may be drawn from these clinical trials at the present time. PMID:17996583

  16. Deciphering amyotrophic lateral sclerosis: what phenotype, neuropathology and genetics are telling us about pathogenesis.

    PubMed

    Ravits, John; Appel, Stanley; Baloh, Robert H; Barohn, Richard; Brooks, Benjamin Rix; Elman, Lauren; Floeter, Mary Kay; Henderson, Christopher; Lomen-Hoerth, Catherine; Macklis, Jeffrey D; McCluskey, Leo; Mitsumoto, Hiroshi; Przedborski, Serge; Rothstein, Jeffrey; Trojanowski, John Q; van den Berg, Leonard H; Ringel, Steven

    2013-05-01

    Amyotrophic lateral sclerosis (ALS) is characterized phenotypically by progressive weakness and neuropathologically by loss of motor neurons. Phenotypically, there is marked heterogeneity. Typical ALS has mixed upper motor neuron (UMN) and lower motor neuron (LMN) involvement. Primary lateral sclerosis has predominant UMN involvement. Progressive muscular atrophy has predominant LMN involvement. Bulbar and limb ALS have predominant regional involvement. Frontotemporal dementia has significant cognitive and behavioral involvement. These phenotypes can be so distinctive that they would seem to have differing biology. However, they cannot be distinguished, at least neuropathologically or genetically. In sporadic ALS (SALS), they are mostly characterized by ubiquitinated cytoplasmic inclusions of TDP-43. In familial ALS (FALS), where phenotypes are indistinguishable from SALS and similarly heterogeneous, each mutated gene has its own genetic and molecular signature. Overall, since the same phenotypes can have multiple causes including different gene mutations, there must be multiple molecular mechanisms causing ALS - and ALS is a syndrome. Since, however, multiple phenotypes can be caused by one single gene mutation, a single molecular mechanism can cause heterogeneity. What the mechanisms are remain unknown, but active propagation of the pathology neuroanatomically seems to be a principal component. Leading candidate mechanisms include RNA processing, cell-cell interactions between neurons and non-neuronal neighbors, focal seeding from a misfolded protein that has prion-like propagation, and fatal errors introduced during neurodevelopment of the motor system. If fundamental mechanisms could be identified and understood, ALS therapy could rationally target progression and stop the disease - a goal that seems increasingly achievable.

  17. A group LASSO-based method for robustly inferring gene regulatory networks from multiple time-course datasets.

    PubMed

    Liu, Li-Zhi; Wu, Fang-Xiang; Zhang, Wen-Jun

    2014-01-01

    As an abstract mapping of the gene regulations in the cell, gene regulatory network is important to both biological research study and practical applications. The reverse engineering of gene regulatory networks from microarray gene expression data is a challenging research problem in systems biology. With the development of biological technologies, multiple time-course gene expression datasets might be collected for a specific gene network under different circumstances. The inference of a gene regulatory network can be improved by integrating these multiple datasets. It is also known that gene expression data may be contaminated with large errors or outliers, which may affect the inference results. A novel method, Huber group LASSO, is proposed to infer the same underlying network topology from multiple time-course gene expression datasets as well as to take the robustness to large error or outliers into account. To solve the optimization problem involved in the proposed method, an efficient algorithm which combines the ideas of auxiliary function minimization and block descent is developed. A stability selection method is adapted to our method to find a network topology consisting of edges with scores. The proposed method is applied to both simulation datasets and real experimental datasets. It shows that Huber group LASSO outperforms the group LASSO in terms of both areas under receiver operating characteristic curves and areas under the precision-recall curves. The convergence analysis of the algorithm theoretically shows that the sequence generated from the algorithm converges to the optimal solution of the problem. The simulation and real data examples demonstrate the effectiveness of the Huber group LASSO in integrating multiple time-course gene expression datasets and improving the resistance to large errors or outliers.

  18. Genes with a spike expression are clustered in chromosome (sub)bands and spike (sub)bands have a powerful prognostic value in patients with multiple myeloma

    PubMed Central

    Kassambara, Alboukadel; Hose, Dirk; Moreaux, Jérôme; Walker, Brian A.; Protopopov, Alexei; Reme, Thierry; Pellestor, Franck; Pantesco, Véronique; Jauch, Anna; Morgan, Gareth; Goldschmidt, Hartmut; Klein, Bernard

    2012-01-01

    Background Genetic abnormalities are common in patients with multiple myeloma, and may deregulate gene products involved in tumor survival, proliferation, metabolism and drug resistance. In particular, translocations may result in a high expression of targeted genes (termed spike expression) in tumor cells. We identified spike genes in multiple myeloma cells of patients with newly-diagnosed myeloma and investigated their prognostic value. Design and Methods Genes with a spike expression in multiple myeloma cells were picked up using box plot probe set signal distribution and two selection filters. Results In a cohort of 206 newly diagnosed patients with multiple myeloma, 2587 genes/expressed sequence tags with a spike expression were identified. Some spike genes were associated with some transcription factors such as MAF or MMSET and with known recurrent translocations as expected. Spike genes were not associated with increased DNA copy number and for a majority of them, involved unknown mechanisms. Of spiked genes, 36.7% clustered significantly in 149 out of 862 documented chromosome (sub)bands, of which 53 had prognostic value (35 bad, 18 good). Their prognostic value was summarized with a spike band score that delineated 23.8% of patients with a poor median overall survival (27.4 months versus not reached, P<0.001) using the training cohort of 206 patients. The spike band score was independent of other gene expression profiling-based risk scores, t(4;14), or del17p in an independent validation cohort of 345 patients. Conclusions We present a new approach to identify spike genes and their relationship to patients’ survival. PMID:22102711

  19. A Guide to Approaching Regulatory Considerations for Lentiviral-Mediated Gene Therapies.

    PubMed

    White, Michael; Whittaker, Roger; Gándara, Carolina; Stoll, Elizabeth A

    2017-08-01

    Lentiviral vectors are increasingly the gene transfer tool of choice for gene or cell therapies, with multiple clinical investigations showing promise for this viral vector in terms of both safety and efficacy. The third-generation vector system is well characterized, effectively delivers genetic material and maintains long-term stable expression in target cells, delivers larger amounts of genetic material than other methods, is nonpathogenic, and does not cause an inflammatory response in the recipient. This report aims to help academic scientists and regulatory managers negotiate the governance framework to achieve successful translation of a lentiviral vector-based gene therapy. The focus is on European regulations and how they are administered in the United Kingdom, although many of the principles will be similar for other regions, including the United States. The report justifies the rationale for using third-generation lentiviral vectors to achieve gene delivery for in vivo and ex vivo applications; briefly summarizes the extant regulatory guidance for gene therapies, categorized as advanced therapeutic medicinal products (ATMPs); provides guidance on specific regulatory issues regarding gene therapies; presents an overview of the key stakeholders to be approached when pursuing clinical trials authorization for an ATMP; and includes a brief catalogue of the documentation required to submit an application for regulatory approval of a new gene therapy.

  20. A Guide to Approaching Regulatory Considerations for Lentiviral-Mediated Gene Therapies

    PubMed Central

    White, Michael; Whittaker, Roger; Gándara, Carolina; Stoll, Elizabeth A.

    2017-01-01

    Lentiviral vectors are increasingly the gene transfer tool of choice for gene or cell therapies, with multiple clinical investigations showing promise for this viral vector in terms of both safety and efficacy. The third-generation vector system is well characterized, effectively delivers genetic material and maintains long-term stable expression in target cells, delivers larger amounts of genetic material than other methods, is nonpathogenic, and does not cause an inflammatory response in the recipient. This report aims to help academic scientists and regulatory managers negotiate the governance framework to achieve successful translation of a lentiviral vector-based gene therapy. The focus is on European regulations and how they are administered in the United Kingdom, although many of the principles will be similar for other regions, including the United States. The report justifies the rationale for using third-generation lentiviral vectors to achieve gene delivery for in vivo and ex vivo applications; briefly summarizes the extant regulatory guidance for gene therapies, categorized as advanced therapeutic medicinal products (ATMPs); provides guidance on specific regulatory issues regarding gene therapies; presents an overview of the key stakeholders to be approached when pursuing clinical trials authorization for an ATMP; and includes a brief catalogue of the documentation required to submit an application for regulatory approval of a new gene therapy. PMID:28817344

  1. Intracellular gene transfer in action: Dual transcription and multiple silencings of nuclear and mitochondrial cox2 genes in legumes

    PubMed Central

    Adams, Keith L.; Song, Keming; Roessler, Philip G.; Nugent, Jacqueline M.; Doyle, Jane L.; Doyle, Jeff J.; Palmer, Jeffrey D.

    1999-01-01

    The respiratory gene cox2, normally present in the mitochondrion, was previously shown to have been functionally transferred to the nucleus during flowering plant evolution, possibly during the diversification of legumes. To search for novel intermediate stages in the process of intracellular gene transfer and to assess the evolutionary timing and frequency of cox2 transfer, activation, and inactivation, we examined nuclear and mitochondrial (mt) cox2 presence and expression in over 25 legume genera and mt cox2 presence in 392 genera. Transfer and activation of cox2 appear to have occurred during recent legume evolution, more recently than previously inferred. Many intermediate stages of the gene transfer process are represented by cox2 genes in the studied legumes. Nine legumes contain intact copies of both nuclear and mt cox2, although transcripts could not be detected for some of these genes. Both cox2 genes are transcribed in seven legumes that are phylogenetically interspersed with species displaying only nuclear or mt cox2 expression. Inactivation of cox2 in each genome has taken place multiple times and in a variety of ways, including loss of detectable transcripts or transcript editing and partial to complete gene loss. Phylogenetic evidence shows about the same number (3–5) of separate inactivations of nuclear and mt cox2, suggesting that there is no selective advantage for a mt vs. nuclear location of cox2 in plants. The current distribution of cox2 presence and expression between the nucleus and mitochondrion in the studied legumes is probably the result of chance mutations silencing either cox2 gene. PMID:10570164

  2. Virulence gene regulation by CvfA, a putative RNase: the CvfA-enolase complex in Streptococcus pyogenes links nutritional stress, growth-phase control, and virulence gene expression.

    PubMed

    Kang, Song Ok; Caparon, Michael G; Cho, Kyu Hong

    2010-06-01

    Streptococcus pyogenes, a multiple-auxotrophic human pathogen, regulates virulence gene expression according to nutritional availability during various stages in the infection process or in different infection sites. We discovered that CvfA influenced the expression of virulence genes according to growth phase and nutritional status. The influence of CvfA in C medium, rich in peptides and poor in carbohydrates, was most pronounced at the stationary phase. Under these conditions, up to 30% of the transcriptome exhibited altered expression; the levels of expression of multiple virulence genes were altered, including the genes encoding streptokinase, CAMP factor, streptolysin O, M protein (more abundant in the CvfA(-) mutant), SpeB, mitogenic factor, and streptolysin S (less abundant). The increase of carbohydrates or peptides in media restored the levels of expression of the virulence genes in the CvfA(-) mutant to wild-type levels (emm, ska, and cfa by carbohydrates; speB by peptides). Even though the regulation of gene expression dependent on nutritional stress is commonly linked to the stringent response, the levels of ppGpp were not altered by deletion of cvfA. Instead, CvfA interacted with enolase, implying that CvfA, a putative RNase, controls the transcript decay rates of virulence factors or their regulators according to nutritional status. The virulence of CvfA(-) mutants was highly attenuated in murine models, indicating that CvfA-mediated gene regulation is necessary for the pathogenesis of S. pyogenes. Taken together, the CvfA-enolase complex in S. pyogenes is involved in the regulation of virulence gene expression by controlling RNA degradation according to nutritional stress.

  3. Phylogenetic analysis of pectin-related gene families in Physcomitrella patens and nine other plant species yields evolutionary insights into cell walls

    PubMed Central

    2014-01-01

    Background Pectins are acidic sugar-containing polysaccharides that are universally conserved components of the primary cell walls of plants and modulate both tip and diffuse cell growth. However, many of their specific functions and the evolution of the genes responsible for producing and modifying them are incompletely understood. The moss Physcomitrella patens is emerging as a powerful model system for the study of plant cell walls. To identify deeply conserved pectin-related genes in Physcomitrella, we generated phylogenetic trees for 16 pectin-related gene families using sequences from ten plant genomes and analyzed the evolutionary relationships within these families. Results Contrary to our initial hypothesis that a single ancestral gene was present for each pectin-related gene family in the common ancestor of land plants, five of the 16 gene families, including homogalacturonan galacturonosyltransferases, polygalacturonases, pectin methylesterases, homogalacturonan methyltransferases, and pectate lyase-like proteins, show evidence of multiple members in the early land plant that gave rise to the mosses and vascular plants. Seven of the gene families, the UDP-rhamnose synthases, UDP-glucuronic acid epimerases, homogalacturonan galacturonosyltransferase-like proteins, β-1,4-galactan β-1,4-galactosyltransferases, rhamnogalacturonan II xylosyltransferases, and pectin acetylesterases appear to have had a single member in the common ancestor of land plants. We detected no Physcomitrella members in the xylogalacturonan xylosyltransferase, rhamnogalacturonan I arabinosyltransferase, pectin methylesterase inhibitor, or polygalacturonase inhibitor protein families. Conclusions Several gene families related to the production and modification of pectins in plants appear to have multiple members that are conserved as far back as the common ancestor of mosses and vascular plants. The presence of multiple members of these families even before the divergence of other important cell wall-related genes, such as cellulose synthases, suggests a more complex role than previously suspected for pectins in the evolution of land plants. The presence of relatively small pectin-related gene families in Physcomitrella as compared to Arabidopsis makes it an attractive target for analysis of the functions of pectins in cell walls. In contrast, the absence of genes in Physcomitrella for some families suggests that certain pectin modifications, such as homogalacturonan xylosylation, arose later during land plant evolution. PMID:24666997

  4. The Molecular Signatures Database (MSigDB) hallmark gene set collection.

    PubMed

    Liberzon, Arthur; Birger, Chet; Thorvaldsdóttir, Helga; Ghandi, Mahmoud; Mesirov, Jill P; Tamayo, Pablo

    2015-12-23

    The Molecular Signatures Database (MSigDB) is one of the most widely used and comprehensive databases of gene sets for performing gene set enrichment analysis. Since its creation, MSigDB has grown beyond its roots in metabolic disease and cancer to include >10,000 gene sets. These better represent a wider range of biological processes and diseases, but the utility of the database is reduced by increased redundancy across, and heterogeneity within, gene sets. To address this challenge, here we use a combination of automated approaches and expert curation to develop a collection of "hallmark" gene sets as part of MSigDB. Each hallmark in this collection consists of a "refined" gene set, derived from multiple "founder" sets, that conveys a specific biological state or process and displays coherent expression. The hallmarks effectively summarize most of the relevant information of the original founder sets and, by reducing both variation and redundancy, provide more refined and concise inputs for gene set enrichment analysis.

  5. Clinical features, endoscopic polypectomy and STK11 gene mutation in a nine-month-old Peutz-Jeghers syndrome Chinese infant

    PubMed Central

    Huang, Zhi-Heng; Song, Zai; Zhang, Ping; Wu, Jie; Huang, Ying

    2016-01-01

    AIM: To investigate multiple polyps in a Chinese Peutz-Jeghers syndrome (PJS) infant. METHODS: A nine-month-old PJS infant was admitted to our hospital for recurrent prolapsed rectal polyps for one month. The clinical characteristics, a colonoscopic image, the pathological characteristics of the polyps and X-ray images of the intestinal perforation were obtained. Serine threonine-protein kinase 11 (STK11) gene analysis was also performed using a DNA sample from this infant. RESULTS: Here we describe the youngest known Chinese infant with PJS. Five polyps, including a giant polyp of approximately 4 cm × 2 cm in size, were removed from the infant’s intestine. Laparotomy was performed to repair a perforation caused by pneumoperitoneum. The pathological results showed that this child had PJS. Molecular analysis of the STK11 gene further revealed a novel frameshift mutation (c.64_65het_delAT) in exon 1 in this PJS infant. CONCLUSION: The appropriate treatment method for multiple polyps in an infant must be carefully considered. Our results also show that the STK11 gene mutation is the primary cause of PJS. PMID:27004004

  6. Kcne2 Deletion Creates a Multisystem Syndrome Predisposing to Sudden Cardiac Death

    PubMed Central

    Hu, Zhaoyang; Kant, Ritu; Anand, Marie; King, Elizabeth C.; Krogh-Madsen, Trine; Christini, David J.; Abbott, Geoffrey W.

    2014-01-01

    Background Sudden cardiac death (SCD) is the leading global cause of mortality, exhibiting increased incidence in diabetics. Ion channel gene perturbations provide a well-established ventricular arrhythmogenic substrate for SCD. However, most arrhythmia susceptibility genes - including the KCNE2 K+ channel β subunit - are expressed in multiple tissues, suggesting potential multiplex SCD substrates. Methods and Results Using “whole transcript” transcriptomics, we uncovered cardiac angiotensinogen upregulation and remodeling of cardiac angiotensinogen interaction networks in P21 Kcne2−/− mouse pups, and adrenal remodeling consistent with metabolic syndrome in adult Kcne2−/− mice. This led to the discovery that Kcne2 disruption causes multiple acknowledged SCD substrates of extracardiac origin: diabetes, hypercholesterolemia, hyperkalemia, anemia and elevated angiotensin II. Kcne2 deletion was also prerequisite for aging-dependent QT prolongation, ventricular fibrillation and SCD immediately following transient ischemia, and fasting-dependent hypoglycemia, myocardial ischemia and atrioventricular block. Conclusions Disruption of a single, widely expressed arrhythmia susceptibility gene can generate a multisystem syndrome comprising manifold electrical and systemic substrates and triggers of SCD. This paradigm is expected to apply to other arrhythmia susceptibility genes, the majority of which encode ubiquitously expressed ion channel subunits or regulatory proteins. PMID:24403551

  7. Association of the 5′-upstream regulatory region of the α7 nicotinic acetylcholine receptor subunit gene (CHRNA7) with schizophrenia

    PubMed Central

    Stephens, Sarah H.; Logel, Judith; Barton, Amanda; Franks, Alexis; Schultz, Jessica; Short, Margaret; Dickenson, Jane; James, Benjamin; Fingerlin, Tasha E.; Wagner, Brandie; Hodgkinson, Colin; Graw, Sharon; Ross, Randal G.; Freedman, Robert; Leonard, Sherry

    2009-01-01

    Background The α7 neuronal nicotinic acetylcholine receptor subunit gene (CHRNA7) is localized in a chromosomal region (15q14) linked to schizophrenia in multiple independent studies. CHRNA7 was selected as the best candidate gene in the region for a well-documented endophenotype of schizophrenia, the P50 sensory processing deficit, by genetic linkage and biochemical studies. Methods Subjects included Caucasian-Non Hispanic and African-American case-control subjects collected in Denver, and schizophrenic subjects from families in the NIMH Genetics Initiative on Schizophrenia. Thirty-five single nucleotide polymorphisms (SNPs) in the 5′-upstream regulatory region of CHRNA7 were genotyped for association with schizophrenia, and for smoking in schizophrenia. Results The rs3087454 SNP, located at position −1831 bp in the upstream regulatory region of CHRNA7, was significantly associated with schizophrenia in the case-control samples after multiple-testing correction (P = 0.0009, African American; P = 0.013, Caucasian-Non Hispanic); the association was supported in family members. There was nominal association of this SNP with smoking in schizophrenia. Conclusions The data support association of regulatory region polymorphisms in the CHRNA7 gene with schizophrenia. PMID:19181484

  8. DNA mismatch repair gene MSH6 implicated in determining age at natural menopause

    PubMed Central

    Perry, John R.B.; Hsu, Yi-Hsiang; Chasman, Daniel I.; Johnson, Andrew D.; Elks, Cathy; Albrecht, Eva; Andrulis, Irene L.; Beesley, Jonathan; Berenson, Gerald S.; Bergmann, Sven; Bojesen, Stig E.; Bolla, Manjeet K.; Brown, Judith; Buring, Julie E.; Campbell, Harry; Chang-Claude, Jenny; Chenevix-Trench, Georgia; Corre, Tanguy; Couch, Fergus J.; Cox, Angela; Czene, Kamila; D'adamo, Adamo Pio; Davies, Gail; Deary, Ian J.; Dennis, Joe; Easton, Douglas F.; Engelhardt, Ellen G.; Eriksson, Johan G.; Esko, Tõnu; Fasching, Peter A.; Figueroa, Jonine D.; Flyger, Henrik; Fraser, Abigail; Garcia-Closas, Montse; Gasparini, Paolo; Gieger, Christian; Giles, Graham; Guenel, Pascal; Hägg, Sara; Hall, Per; Hayward, Caroline; Hopper, John; Ingelsson, Erik; Kardia, Sharon L.R.; Kasiman, Katherine; Knight, Julia A.; Lahti, Jari; Lawlor, Debbie A.; Magnusson, Patrik K.E.; Margolin, Sara; Marsh, Julie A.; Metspalu, Andres; Olson, Janet E.; Pennell, Craig E.; Polasek, Ozren; Rahman, Iffat; Ridker, Paul M.; Robino, Antonietta; Rudan, Igor; Rudolph, Anja; Salumets, Andres; Schmidt, Marjanka K.; Schoemaker, Minouk J.; Smith, Erin N.; Smith, Jennifer A.; Southey, Melissa; Stöckl, Doris; Swerdlow, Anthony J.; Thompson, Deborah J.; Truong, Therese; Ulivi, Sheila; Waldenberger, Melanie; Wang, Qin; Wild, Sarah; Wilson, James F; Wright, Alan F.; Zgaga, Lina; Ong, Ken K.; Murabito, Joanne M.; Karasik, David; Murray, Anna

    2014-01-01

    The length of female reproductive lifespan is associated with multiple adverse outcomes, including breast cancer, cardiovascular disease and infertility. The biological processes that govern the timing of the beginning and end of reproductive life are not well understood. Genetic variants are known to contribute to ∼50% of the variation in both age at menarche and menopause, but to date the known genes explain <15% of the genetic component. We have used genome-wide association in a bivariate meta-analysis of both traits to identify genes involved in determining reproductive lifespan. We observed significant genetic correlation between the two traits using genome-wide complex trait analysis. However, we found no robust statistical evidence for individual variants with an effect on both traits. A novel association with age at menopause was detected for a variant rs1800932 in the mismatch repair gene MSH6 (P = 1.9 × 10−9), which was also associated with altered expression levels of MSH6 mRNA in multiple tissues. This study contributes to the growing evidence that DNA repair processes play a key role in ovarian ageing and could be an important therapeutic target for infertility. PMID:24357391

  9. The Natural History of Class I Primate Alcohol Dehydrogenases Includes Gene Duplication, Gene Loss, and Gene Conversion

    PubMed Central

    Carrigan, Matthew A.; Uryasev, Oleg; Davis, Ross P.; Zhai, LanMin; Hurley, Thomas D.; Benner, Steven A.

    2012-01-01

    Background Gene duplication is a source of molecular innovation throughout evolution. However, even with massive amounts of genome sequence data, correlating gene duplication with speciation and other events in natural history can be difficult. This is especially true in its most interesting cases, where rapid and multiple duplications are likely to reflect adaptation to rapidly changing environments and life styles. This may be so for Class I of alcohol dehydrogenases (ADH1s), where multiple duplications occurred in primate lineages in Old and New World monkeys (OWMs and NWMs) and hominoids. Methodology/Principal Findings To build a preferred model for the natural history of ADH1s, we determined the sequences of nine new ADH1 genes, finding for the first time multiple paralogs in various prosimians (lemurs, strepsirhines). Database mining then identified novel ADH1 paralogs in both macaque (an OWM) and marmoset (a NWM). These were used with the previously identified human paralogs to resolve controversies relating to dates of duplication and gene conversion in the ADH1 family. Central to these controversies are differences in the topologies of trees generated from exonic (coding) sequences and intronic sequences. Conclusions/Significance We provide evidence that gene conversions are the primary source of difference, using molecular clock dating of duplications and analyses of microinsertions and deletions (micro-indels). The tree topology inferred from intron sequences appear to more correctly represent the natural history of ADH1s, with the ADH1 paralogs in platyrrhines (NWMs) and catarrhines (OWMs and hominoids) having arisen by duplications shortly predating the divergence of OWMs and NWMs. We also conclude that paralogs in lemurs arose independently. Finally, we identify errors in database interpretation as the source of controversies concerning gene conversion. These analyses provide a model for the natural history of ADH1s that posits four ADH1 paralogs in the ancestor of Catarrhine and Platyrrhine primates, followed by the loss of an ADH1 paralog in the human lineage. PMID:22859968

  10. Identification of two novel critical mutations in PCNT gene resulting in microcephalic osteodysplastic primordial dwarfism type II associated with multiple intracranial aneurysms.

    PubMed

    Li, Fei-Feng; Wang, Xu-Dong; Zhu, Min-Wei; Lou, Zhi-Hong; Zhang, Qiong; Zhu, Chun-Yu; Feng, Hong-Lin; Lin, Zhi-Guo; Liu, Shu-Lin

    2015-12-01

    Microcephalic osteodysplastic primordial dwarfism type II (MOPD II) is a highly detrimental human autosomal inherited recessive disorder. The hallmark characteristics of this disease are intrauterine and postnatal growth restrictions, with some patients also having cerebrovascular problems such as cerebral aneurysms. The genomic basis behind most clinical features of MOPD II remains largely unclear. The aim of this work was to identify the genetic defects in a Chinese family with MOPD II associated with multiple intracranial aneurysms. The patient had typical MOPD II syndrome, with subarachnoid hemorrhage and multiple intracranial aneurysms. We identified three novel mutations in the PCNT gene, including one single base alteration (9842A>C in exon 45) and two deletions (Del-C in exon 30 and Del-16 in exon 41). The deletions were co-segregated with the affected individual in the family and were not present in the control population. Computer modeling demonstrated that the deletions may cause drastic changes on the secondary and tertiary structures, affecting the hydrophilicity and hydrophobicity of the mutant proteins. In conclusion, we identified two novel mutations in the PCNT gene associated with MOPD II and intracranial aneurysms, and the mutations were expected to alter the stability and functioning of the protein by computer modeling.

  11. Transposon mutagenesis identifies genes that cooperate with mutant Pten in breast cancer progression

    PubMed Central

    Rangel, Roberto; Lee, Song-Choon; Hon-Kim Ban, Kenneth; Guzman-Rojas, Liliana; Mann, Michael B.; Newberg, Justin Y.; McNoe, Leslie A.; Selvanesan, Luxmanan; Ward, Jerrold M.; Rust, Alistair G.; Chin, Kuan-Yew; Black, Michael A.; Jenkins, Nancy A.; Copeland, Neal G.

    2016-01-01

    Triple-negative breast cancer (TNBC) has the worst prognosis of any breast cancer subtype. To better understand the genetic forces driving TNBC, we performed a transposon mutagenesis screen in a phosphatase and tensin homolog (Pten) mutant mice and identified 12 candidate trunk drivers and a much larger number of progression genes. Validation studies identified eight TNBC tumor suppressor genes, including the GATA-like transcriptional repressor TRPS1. Down-regulation of TRPS1 in TNBC cells promoted epithelial-to-mesenchymal transition (EMT) by deregulating multiple EMT pathway genes, in addition to increasing the expression of SERPINE1 and SERPINB2 and the subsequent migration, invasion, and metastasis of tumor cells. Transposon mutagenesis has thus provided a better understanding of the genetic forces driving TNBC and discovered genes with potential clinical importance in TNBC. PMID:27849608

  12. Transcriptional response of Musca domestica larvae to bacterial infection.

    PubMed

    Tang, Ting; Li, Xiang; Yang, Xue; Yu, Xue; Wang, Jianhui; Liu, Fengsong; Huang, Dawei

    2014-01-01

    The house fly Musca domestica, a cosmopolitan dipteran insect, is a significant vector for human and animal bacterial pathogens, but little is known about its immune response to these pathogens. To address this issue, we inoculated the larvae with a mixture of Escherichia coli and Staphylococcus aureus and profiled the transcriptome 6, 24, and 48 h thereafter. Many genes known to controlling innate immunity in insects were induced following infection, including genes encoding pattern recognition proteins (PGRPs), various components of the Toll and IMD signaling pathways and of the proPO-activating and redox systems, and multiple antimicrobial peptides. Interestingly, we also uncovered a large set of novel immune response genes including two broad-spectrum antimicrobial peptides (muscin and domesticin), which might have evolved to adapt to house-fly's unique ecological environments. Finally, genes mediating oxidative phosphorylation were repressed at 48 h post-infection, suggesting disruption of energy homeostasis and mitochondrial function at the late stages of infection. Collectively, our data reveal dynamic changes in gene expression following bacterial infection in the house fly, paving the way for future in-depth analysis of M. domestica's immune system.

  13. Transcriptome Profiling of Shewanella oneidensis Gene Expression following Exposure to Acidic and Alkaline pH†

    PubMed Central

    Leaphart, Adam B.; Thompson, Dorothea K.; Huang, Katherine; Alm, Eric; Wan, Xiu-Feng; Arkin, Adam; Brown, Steven D.; Wu, Liyou; Yan, Tingfen; Liu, Xueduan; Wickham, Gene S.; Zhou, Jizhong

    2006-01-01

    The molecular response of Shewanella oneidensis MR-1 to variations in extracellular pH was investigated based on genomewide gene expression profiling. Microarray analysis revealed that cells elicited both general and specific transcriptome responses when challenged with environmental acid (pH 4) or base (pH 10) conditions over a 60-min period. Global responses included the differential expression of genes functionally linked to amino acid metabolism, transcriptional regulation and signal transduction, transport, cell membrane structure, and oxidative stress protection. Response to acid stress included the elevated expression of genes encoding glycogen biosynthetic enzymes, phosphate transporters, and the RNA polymerase sigma-38 factor (rpoS), whereas the molecular response to alkaline pH was characterized by upregulation of nhaA and nhaR, which are predicted to encode an Na+/H+ antiporter and transcriptional activator, respectively, as well as sulfate transport and sulfur metabolism genes. Collectively, these results suggest that S. oneidensis modulates multiple transporters, cell envelope components, and pathways of amino acid consumption and central intermediary metabolism as part of its transcriptome response to changing external pH conditions. PMID:16452448

  14. Genetics of alcoholism.

    PubMed

    Edenberg, Howard J; Foroud, Tatiana

    2014-01-01

    Multiple lines of evidence strongly indicate that genetic factors contribute to the risk for alcohol use disorders (AUD). There is substantial heterogeneity in AUD, which complicates studies seeking to identify specific genetic factors. To identify these genetic effects, several different alcohol-related phenotypes have been analyzed, including diagnosis and quantitative measures related to AUDs. Study designs have used candidate gene analyses, genetic linkage studies, genomewide association studies (GWAS), and analyses of rare variants. Two genes that encode enzymes of alcohol metabolism have the strongest effect on AUD: aldehyde dehydrogenase 2 and alcohol dehydrogenase 1B each has strongly protective variants that reduce risk, with odds ratios approximately 0.2-0.4. A number of other genes important in AUD have been identified and replicated, including GABRA2 and alcohol dehydrogenases 1B and 4. GWAS have identified additional candidates. Rare variants are likely also to play a role; studies of these are just beginning. A multifaceted approach to gene identification, targeting both rare and common variations and assembling much larger datasets for meta-analyses, is critical for identifying the key genes and pathways important in AUD. © 2014 Elsevier B.V. All rights reserved.

  15. Genome-wide analysis of gene expression of EMS-induced short fiber mutant Ligon lintless-y (liy) in cotton (Gossypium hirsutum L.).

    PubMed

    Naoumkina, Marina; Bechere, Efrem; Fang, David D; Thyssen, Gregory N; Florane, Christopher B

    2017-07-01

    In this work we describe a chemically-induced short fiber mutant cotton line, Ligon-lintless-y (li y ), which is controlled by a single recessive locus and affects multiple traits, including height of the plant, and length and maturity of fiber. An RNAseq analysis was used to evaluate global transcriptional changes during cotton fiber development at 3, 8 and 16days post anthesis. We found that 613, 2629 and 3397 genes were significantly down-regulated, while 2700, 477 and 3260 were significantly up-regulated in li y at 3, 8 and 16 DPA. Gene set enrichment analysis revealed that many metabolic pathways, including carbohydrate, cell wall, hormone metabolism and transport were substantially altered in li y developing fibers. We discuss perturbed expression of genes involved in signal transduction and biosynthesis of phytohormones, such as auxin, abscisic acid, gibberellin and ethylene. The results of this study provide new insights into transcriptional regulation of cotton fiber development. Published by Elsevier Inc.

  16. Selective Inhibition of Tumor Oncogenes by Disruption of Super-Enhancers

    PubMed Central

    Lovén, Jakob; Hoke, Heather A.; Lin, Charles Y.; Lau, Ashley; Orlando, David A.; Vakoc, Christopher R.; Bradner, James E.; Lee, Tong Ihn; Young, Richard A.

    2013-01-01

    Summary Chromatin regulators have become attractive targets for cancer therapy, but it is unclear why inhibition of these ubiquitous regulators should have gene-specific effects in tumor cells. Here, we investigate how inhibition of the widely expressed transcriptional coactivator BRD4 leads to selective inhibition of the MYC oncogene in multiple myeloma (MM). BRD4 and Mediator were found to co-occupy thousands of enhancers associated with active genes. They also co-occupied a small set of exceptionally large super-enhancers associated with genes that feature prominently in MM biology, including the MYC oncogene. Treatment of MM tumor cells with the BET-bromodomain inhibitor JQ1 led to preferential loss of BRD4 at super-enhancers and consequent transcription elongation defects that preferentially impacted genes with super-enhancers, including MYC. Super-enhancers were found at key oncogenic drivers in many other tumor cells. These observations have implications for the discovery of cancer therapeutics directed at components of super-enhancers in diverse tumor types. PMID:23582323

  17. Epigenetics of reproductive infertility.

    PubMed

    Das, Laxmidhar; Parbin, Sabnam; Pradhan, Nibedita; Kausar, Chahat; Patra, Samir K

    2017-06-01

    Infertility is a complex pathophysiological condition. It may caused by specific or multiple physical and physiological factors, including abnormalities in homeostasis, hormonal imbalances and genetic alterations. In recent times various studies implicated that, aberrant epigenetic mechanisms are associated with reproductive infertility. There might be transgenerational effects associated with epigenetic modifications of gametes and studies suggest the importance of alterations in epigenetic modification at early and late stages of gametogenesis. To determine the causes of infertility it is necessary to understand the altered epigenetic modifications of associated gene and mechanisms involved therein. This review is devoted to elucidate the recent mechanistic advances in regulation of genes by epigenetic modification and emphasizes their possible role related to reproductive infertility. It includes environmental, nutritional, hormonal and physiological factors and influence of internal structural architecture of chromatin nucleosomes affecting DNA and histone modifications in both male and female gametes, early embryogenesis and offspring. Finally, we would like to emphasize that research on human infertility by gene knock out of epigenetic modifiers genes must be relied upon animal models.

  18. oPOSSUM: integrated tools for analysis of regulatory motif over-representation

    PubMed Central

    Ho Sui, Shannan J.; Fulton, Debra L.; Arenillas, David J.; Kwon, Andrew T.; Wasserman, Wyeth W.

    2007-01-01

    The identification of over-represented transcription factor binding sites from sets of co-expressed genes provides insights into the mechanisms of regulation for diverse biological contexts. oPOSSUM, an internet-based system for such studies of regulation, has been improved and expanded in this new release. New features include a worm-specific version for investigating binding sites conserved between Caenorhabditis elegans and C. briggsae, as well as a yeast-specific version for the analysis of co-expressed sets of Saccharomyces cerevisiae genes. The human and mouse applications feature improvements in ortholog mapping, sequence alignments and the delineation of multiple alternative promoters. oPOSSUM2, introduced for the analysis of over-represented combinations of motifs in human and mouse genes, has been integrated with the original oPOSSUM system. Analysis using user-defined background gene sets is now supported. The transcription factor binding site models have been updated to include new profiles from the JASPAR database. oPOSSUM is available at http://www.cisreg.ca/oPOSSUM/ PMID:17576675

  19. SigmaS controls multiple pathways associated with intracellular multiplication of Legionella pneumophila.

    PubMed

    Hovel-Miner, Galadriel; Pampou, Sergey; Faucher, Sebastien P; Clarke, Margaret; Morozova, Irina; Morozov, Pavel; Russo, James J; Shuman, Howard A; Kalachikov, Sergey

    2009-04-01

    Legionella pneumophila is the causative agent of the severe and potentially fatal pneumonia Legionnaires' disease. L. pneumophila is able to replicate within macrophages and protozoa by establishing a replicative compartment in a process that requires the Icm/Dot type IVB secretion system. The signals and regulatory pathways required for Legionella infection and intracellular replication are poorly understood. Mutation of the rpoS gene, which encodes sigma(S), does not affect growth in rich medium but severely decreases L. pneumophila intracellular multiplication within protozoan hosts. To gain insight into the intracellular multiplication defect of an rpoS mutant, we examined its pattern of gene expression during exponential and postexponential growth. We found that sigma(S) affects distinct groups of genes that contribute to Legionella intracellular multiplication. We demonstrate that rpoS mutants have a functional Icm/Dot system yet are defective for the expression of many genes encoding Icm/Dot-translocated substrates. We also show that sigma(S) affects the transcription of the cpxR and pmrA genes, which encode two-component response regulators that directly affect the transcription of Icm/Dot substrates. Our characterization of the L. pneumophila small RNA csrB homologs, rsmY and rsmZ, introduces a link between sigma(S) and the posttranscriptional regulator CsrA. We analyzed the network of sigma(S)-controlled genes by mutational analysis of transcriptional regulators affected by sigma(S). One of these, encoding the L. pneumophila arginine repressor homolog gene, argR, is required for maximal intracellular growth in amoebae. These data show that sigma(S) is a key regulator of multiple pathways required for L. pneumophila intracellular multiplication.

  20. Vitamin D receptor gene Alw I, Fok I, Apa I, and Taq I polymorphisms in patients with urinary stone.

    PubMed

    Seo, Ill Young; Kang, In-Hong; Chae, Soo-Cheon; Park, Seung Chol; Lee, Young-Jin; Yang, Yun Sik; Ryu, Soo Bang; Rim, Joung Sik

    2010-04-01

    To evaluate vitamin D receptor (VDR) gene polymorphisms in Korean patients so as to identify the candidate genes associated with urinary stones. Urinary stones are a multifactorial disease that includes various genetic factors. A normal control group of 535 healthy subjects and 278 patients with urinary stones was evaluated. Of 125 patients who presented stone samples, 102 had calcium stones on chemical analysis. The VDR gene Alw I, Fok I, Apa I, and Taq I polymorphisms were evaluated using the polymerase chain reaction-restriction fragment length polymorphism analysis. Allelic and genotypic frequencies were calculated to identify associations in both groups. The haplotype frequencies of the VDR gene polymorphisms for multiple loci were also determined. For the VDR gene Alw I, Fok I, Apa I, and Taq I polymorphisms, there was no statistically significant difference between the patients with urinary stones and the healthy controls. There was also no statistically significant difference between the patients with calcium stones and the healthy controls. A novel haplotype (Ht 4; CTTT) was identified in 13.5% of the patients with urinary stones and in 8.3% of the controls (P = .001). The haplotype frequencies were significantly different between the patients with calcium stones and the controls (P = .004). The VDR gene Alw I, Fok I, Apa I, and Taq I polymorphisms does not seem to be candidate genetic markers for urinary stones in Korean patients. However, 1 novel haplotype of the VDR gene polymorphisms for multiple loci might be a candidate genetic marker. Copyright 2010 Elsevier Inc. All rights reserved.

  1. Excessive burden of lysosomal storage disorder gene variants in Parkinson's disease.

    PubMed

    Robak, Laurie A; Jansen, Iris E; van Rooij, Jeroen; Uitterlinden, André G; Kraaij, Robert; Jankovic, Joseph; Heutink, Peter; Shulman, Joshua M

    2017-12-01

    Mutations in the glucocerebrosidase gene (GBA), which cause Gaucher disease, are also potent risk factors for Parkinson's disease. We examined whether a genetic burden of variants in other lysosomal storage disorder genes is more broadly associated with Parkinson's disease susceptibility. The sequence kernel association test was used to interrogate variant burden among 54 lysosomal storage disorder genes, leveraging whole exome sequencing data from 1156 Parkinson's disease cases and 1679 control subjects. We discovered a significant burden of rare, likely damaging lysosomal storage disorder gene variants in association with Parkinson's disease risk. The association signal was robust to the exclusion of GBA, and consistent results were obtained in two independent replication cohorts, including 436 cases and 169 controls with whole exome sequencing and an additional 6713 cases and 5964 controls with exome-wide genotyping. In secondary analyses designed to highlight the specific genes driving the aggregate signal, we confirmed associations at the GBA and SMPD1 loci and newly implicate CTSD, SLC17A5, and ASAH1 as candidate Parkinson's disease susceptibility genes. In our discovery cohort, the majority of Parkinson's disease cases (56%) have at least one putative damaging variant in a lysosomal storage disorder gene, and 21% carry multiple alleles. Our results highlight several promising new susceptibility loci and reinforce the importance of lysosomal mechanisms in Parkinson's disease pathogenesis. We suggest that multiple genetic hits may act in combination to degrade lysosomal function, enhancing Parkinson's disease susceptibility. © The Author (2017). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  2. Identification and characterisation of the angiotensin converting enzyme-3 (ACE3) gene: a novel mammalian homologue of ACE

    PubMed Central

    Rella, Monika; Elliot, Joann L; Revett, Timothy J; Lanfear, Jerry; Phelan, Anne; Jackson, Richard M; Turner, Anthony J; Hooper, Nigel M

    2007-01-01

    Background Mammalian angiotensin converting enzyme (ACE) plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple sequence alignment and molecular modelling have been employed to characterise the predicted ACE3 protein. In mouse, rat, cow and dog, the predicted protein has mutations in some of the critical residues involved in catalysis, including the catalytic Glu in the HEXXH zinc binding motif which is Gln, and ESTs or reverse-transcription PCR indicate that the gene is expressed. In humans, the predicted ACE3 protein has an intact HEXXH motif, but there are other deletions and insertions in the gene and no ESTs have been identified. Conclusion In the genomes of several mammalian species there is a gene that encodes a novel, single domain ACE-like protein, ACE3. In mouse, rat, cow and dog ACE3, the catalytic Glu is replaced by Gln in the putative zinc binding motif, indicating that in these species ACE3 would lack catalytic activity as a zinc metalloprotease. In humans, no evidence was found that the ACE3 gene is expressed and the presence of deletions and insertions in the sequence indicate that ACE3 is a pseudogene. PMID:17597519

  3. Identification and verification of differentially expressed genes in the caprine hypothalamic-pituitary-gonadal axis that are associated with litter size.

    PubMed

    Feng, Tao; Cao, Gui-Ling; Chu, Ming-Xing; Di, Ran; Huang, Dong-Wei; Liu, Qiu-Yue; Pan, Zhang-Yuan; Jin, Mei; Zhang, Ying-Jie; Li, Ning

    2015-02-01

    Litter size is a favorable economic trait for the goat industry, but remains a complex trait controlled by multiple genes in multiple organs. Several genes have been identified that may affect embryo survival, follicular development, and the health of fetuses during pregnancy. Jining Grey goats demonstrate the largest litter size among goat breeds indigenous to China. In order to better understand the genetic basis of this trait, six suppression subtractive hybridization (SSH) cDNA libraries were constructed using pooled mRNAs from hypothalamuses, pituitaries, and ovaries of sexually mature and adult polytocous Jining Grey goats, as testers, versus the pooled corresponding mRNAs of monotocous Liaoning Cashmere goats, as drivers. A total of 1,458 true-positive clones--including 955 known genes and 481 known and 22 unknown expressed sequence tags--were obtained from the SSH libraries by sequencing and alignment. The known genes were categorized into cellular processes and signaling information storage and processing, and metabolism. Three genes (FTH1, GH, and SAA) were selected to validate the SSH results by quantitative real-time PCR; all three were up-regulated in the corresponding tissues in the tester group indicating that these are candidate genes associated with the large litter size of Jining Grey goats. Several other identified genes may affect embryo survival, follicular development, and health during pregnancy. This study provides insights into the mechanistic basis by which the caprine hypothalamic-pituitary-gonadal axis affects reproductive traits and provides a theoretical basis for goat production and breeding. © 2015 Wiley Periodicals, Inc.

  4. Alternate approaches to repress endogenous microRNA activity in Arabidopsis thaliana

    PubMed Central

    Wang, Ming-Bo

    2011-01-01

    MicroRnAs (miRnAs) are an endogenous class of regulatory small RnA (sRnA). in plants, miRnAs are processed from short non-protein-coding messenger RnAs (mRnAs) transcribed from small miRnA genes (MIR genes). Traditionally in the model plant Arabidopsis thaliana (Arabidopsis), the functional analysis of a gene product has relied on the identification of a corresponding T-DnA insertion knockout mutant from a large, randomly-mutagenized population. However, because of the small size of MIR genes and presence of multiple, highly conserved members in most plant miRnA families, it has been extremely laborious and time consuming to obtain a corresponding single or multiple, null mutant plant line. Our recent study published in Molecular Plant1 outlines an alternate method for the functional characterization of miRnA action in Arabidopsis, termed anti-miRnA technology. Using this approach we demonstrated that the expression of individual miRnAs or entire miRnA families, can be readily and efficiently knocked-down. Our approach is in addition to two previously reported methodologies that also allow for the targeted suppression of either individual miRnAs, or all members of a MIR gene family; these include miRnA target mimicry2,3 and transcriptional gene silencing (TGS) of MIR gene promoters.4 All three methodologies rely on endogenous gene regulatory machinery and in this article we provide an overview of these technologies and discuss their strengths and weaknesses in inhibiting the activity of their targeted miRnA(s). PMID:21358288

  5. Global Control of GacA in Secondary Metabolism, Primary Metabolism, Secretion Systems, and Motility in the Rhizobacterium Pseudomonas aeruginosa M18

    PubMed Central

    Wei, Xue; Tang, Lulu; Wu, Daqiang

    2013-01-01

    The rhizobacterium Pseudomonas aeruginosa M18 can produce a broad spectrum of secondary metabolites, including the antibiotics pyoluteorin (Plt) and phenazine-1-carboxylic acid (PCA), hydrogen cyanide, and the siderophores pyoverdine and pyochelin. The antibiotic biosynthesis of M18 is coordinately controlled by multiple distinct regulatory pathways, of which the GacS/GacA system activates Plt biosynthesis but strongly downregulates PCA biosynthesis. Here, we investigated the global influence of a gacA mutation on the M18 transcriptome and related metabolic and physiological processes. Transcriptome profiling revealed that the transcript levels of 839 genes, which account for approximately 15% of the annotated genes in the M18 genome, were significantly influenced by the gacA mutation during the early stationary growth phase of M18. Most secondary metabolic gene clusters, such as pvd, pch, plt, amb, and hcn, were activated by GacA. The GacA regulon also included genes encoding extracellular enzymes and cytochrome oxidases. Interestingly, the primary metabolism involved in the assimilation and metabolism of phosphorus, sulfur, and nitrogen sources was also notably regulated by GacA. Another important category of the GacA regulon was secretion systems, including H1, H2, and H3 (type VI secretion systems [T6SSs]), Hxc (T2SS), and Has and Apr (T1SSs), and CupE and Tad pili. More remarkably, GacA inhibited swimming, swarming, and twitching motilities. Taken together, the Gac-initiated global regulation, which was mostly mediated through multiple regulatory systems or factors, was mainly involved in secondary and primary metabolism, secretion systems, motility, etc., contributing to ecological or nutritional competence, ion homeostasis, and biocontrol in M18. PMID:23708134

  6. Genomic Characterization of Nonclonal mcr-1-Positive Multidrug-Resistant Klebsiella pneumoniae from Clinical Samples in Thailand

    PubMed Central

    Srijan, Apichai; Ruekit, Sirigade; Snesrud, Erik; Maybank, Rosslyn; Serichantalergs, Oralak; Kormanee, Rosarin; Sukhchat, Prawet; Sriyabhaya, Jossin; Hinkle, Mary; Crawford, John M.; McGann, Patrick; Swierczewski, Brett E.

    2018-01-01

    Multidrug-resistant Klebsiella pneumoniae strains are one of the most prevalent causes of nosocomial infections and pose an increasingly dangerous public health threat. The lack of remaining treatment options has resulted in the utilization of older drug classes, including colistin. As a drug of last resort, the discovery of plasmid-mediated colistin resistance by mcr-1 denotes the potential development of pandrug-resistant bacterial pathogens. To address the emergence of the mcr-1 gene, 118 gram-negative Enterobacteriaceae isolated from clinical samples collected at Queen Sirikit Naval Hospital in Chonburi, Thailand were screened for colistin resistance using automated antimicrobial susceptibility testing and conventional PCR screening. Two K. pneumoniae strains, QS17-0029 and QS17-0161, were positive for mcr-1, and both isolates were sequenced to closure using short- and long-read whole-genome sequencing. QS17-0029 carried 16 antibiotic resistance genes in addition to mcr-1, including 2 carbapenemases, blaNDM-1 and blaOXA-232. QS17-0161 carried 13 antibiotic resistance genes in addition to mcr-1, including the extended-spectrum β-lactamase blaCTX-M-55. Both isolates carried multiple plasmids, but mcr-1 was located alone on highly similar 33.9 Kb IncX4 plasmids in both isolates. The IncX4 plasmid shared considerable homology to other mcr-1-containing IncX4 plasmids. This is the first report of a clinical K. pneumoniae strain from Thailand carrying mcr-1 as well as the first strain to simultaneously carry mcr-1 and multiple carbapenemase genes (QS17-0029). The identification and characterization of these isolates serves to highlight the urgent need for continued surveillance and intervention in Southeast Asia, where extensively drug-resistant pathogens are being increasingly identified in hospital-associated infections. PMID:29688801

  7. Genomic Characterization of Nonclonal mcr-1-Positive Multidrug-Resistant Klebsiella pneumoniae from Clinical Samples in Thailand.

    PubMed

    Srijan, Apichai; Margulieux, Katie R; Ruekit, Sirigade; Snesrud, Erik; Maybank, Rosslyn; Serichantalergs, Oralak; Kormanee, Rosarin; Sukhchat, Prawet; Sriyabhaya, Jossin; Hinkle, Mary; Crawford, John M; McGann, Patrick; Swierczewski, Brett E

    2018-05-01

    Multidrug-resistant Klebsiella pneumoniae strains are one of the most prevalent causes of nosocomial infections and pose an increasingly dangerous public health threat. The lack of remaining treatment options has resulted in the utilization of older drug classes, including colistin. As a drug of last resort, the discovery of plasmid-mediated colistin resistance by mcr-1 denotes the potential development of pandrug-resistant bacterial pathogens. To address the emergence of the mcr-1 gene, 118 gram-negative Enterobacteriaceae isolated from clinical samples collected at Queen Sirikit Naval Hospital in Chonburi, Thailand were screened for colistin resistance using automated antimicrobial susceptibility testing and conventional PCR screening. Two K. pneumoniae strains, QS17-0029 and QS17-0161, were positive for mcr-1, and both isolates were sequenced to closure using short- and long-read whole-genome sequencing. QS17-0029 carried 16 antibiotic resistance genes in addition to mcr-1, including 2 carbapenemases, bla NDM-1 and bla OXA-232 . QS17-0161 carried 13 antibiotic resistance genes in addition to mcr-1, including the extended-spectrum β-lactamase bla CTX-M-55 . Both isolates carried multiple plasmids, but mcr-1 was located alone on highly similar 33.9 Kb IncX4 plasmids in both isolates. The IncX4 plasmid shared considerable homology to other mcr-1-containing IncX4 plasmids. This is the first report of a clinical K. pneumoniae strain from Thailand carrying mcr-1 as well as the first strain to simultaneously carry mcr-1 and multiple carbapenemase genes (QS17-0029). The identification and characterization of these isolates serves to highlight the urgent need for continued surveillance and intervention in Southeast Asia, where extensively drug-resistant pathogens are being increasingly identified in hospital-associated infections.

  8. Uncoupling of oxidative stress resistance and lifespan in long-lived isp-1 mitochondrial mutants in Caenorhabditis elegans.

    PubMed

    Dues, Dylan J; Schaar, Claire E; Johnson, Benjamin K; Bowman, Megan J; Winn, Mary E; Senchuk, Megan M; Van Raamsdonk, Jeremy M

    2017-07-01

    Mutations affecting components of the mitochondrial electron transport chain have been shown to increase lifespan in multiple species including the worm Caenorhabditis elegans. While it was originally proposed that decreased generation of reactive oxygen species (ROS) resulting from lower rates of electron transport could account for the observed increase in lifespan, recent evidence indicates that ROS levels are increased in at least some of these long-lived mitochondrial mutants. Here, we show that the long-lived mitochondrial mutant isp-1 worms have increased resistance to oxidative stress. Our results suggest that elevated ROS levels in isp-1 worms cause the activation of multiple stress-response pathways including the mitochondrial unfolded protein response, the SKN-1-mediated stress response, and the hypoxia response. In addition, these worms have increased expression of specific antioxidant enzymes, including a marked upregulation of the inducible superoxide dismutase genes sod-3 and sod-5. Examining the contribution of sod-3 and sod-5 to the oxidative stress resistance in isp-1 worms revealed that loss of either of these genes increased resistance to oxidative stress, but not other forms of stress. Deletion of sod-3 or sod-5 decreased the lifespan of isp-1 worms and further exacerbated their slow physiologic rates. Thus, while deletion of sod-3 and sod-5 genes has little impact on stress resistance, physiologic rates or lifespan in wild-type worms, these genes are required for the longevity of isp-1 worms. Overall, this work shows that the increased resistance to oxidative stress in isp-1 worms does not account for their longevity, and that resistance to oxidative stress can be experimentally dissociated from lifespan. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Spontaneous mutations in CYC8 and MIG1 suppress the short chronological lifespan of budding yeast lacking SNF1/AMPK

    PubMed Central

    Maqani, Nazif; Fine, Ryan D.; Shahid, Mehreen; Li, Mingguang; Enriquez-Hesles, Elisa; Smith, Jeffrey S.

    2018-01-01

    Chronologically aging yeast cells are prone to adaptive regrowth, whereby mutants with a survival advantage spontaneously appear and re-enter the cell cycle in stationary phase cultures. Adaptive regrowth is especially noticeable with short-lived strains, including those defective for SNF1, the homolog of mammalian AMP-activated protein kinase (AMPK). SNF1 becomes active in response to multiple environmental stresses that occur in chronologically aging cells, including glucose depletion and oxidative stress. SNF1 is also required for the extension of chronological lifespan (CLS) by caloric restriction (CR) as defined as limiting glucose at the time of culture inoculation. To identify specific downstream SNF1 targets responsible for CLS extension during CR, we screened for adaptive regrowth mutants that restore chronological longevity to a short-lived snf1∆ parental strain. Whole genome sequencing of the adapted mutants revealed missense mutations in TPR motifs 9 and 10 of the transcriptional co-repressor Cyc8 that specifically mediate repression through the transcriptional repressor Mig1. Another mutation occurred in MIG1 itself, thus implicating the activation of Mig1-repressed genes as a key function of SNF1 in maintaining CLS. Consistent with this conclusion, the cyc8 TPR mutations partially restored growth on alternative carbon sources and significantly extended CLS compared to the snf1∆ parent. Furthermore, cyc8 TPR mutations reactivated multiple Mig1-repressed genes, including the transcription factor gene CAT8, which is responsible for activating genes of the glyoxylate and gluconeogenesis pathways. Deleting CAT8 completely blocked CLS extension by the cyc8 TPR mutations on CLS, identifying these pathways as key Snf1-regulated CLS determinants.

  10. Cryptosporidium hominis gene catalog: a resource for the selection of novel Cryptosporidium vaccine candidates

    PubMed Central

    Ifeonu, Olukemi O.; Simon, Raphael; Tennant, Sharon M.; Sheoran, Abhineet S.; Daly, Maria C.; Felix, Victor; Kissinger, Jessica C.; Widmer, Giovanni; Levine, Myron M.; Tzipori, Saul; Silva, Joana C.

    2016-01-01

    Human cryptosporidiosis, caused primarily by Cryptosporidium hominis and a subset of Cryptosporidium parvum, is a major cause of moderate-to-severe diarrhea in children under 5 years of age in developing countries and can lead to nutritional stunting and death. Cryptosporidiosis is particularly severe and potentially lethal in immunocompromised hosts. Biological and technical challenges have impeded traditional vaccinology approaches to identify novel targets for the development of vaccines against C. hominis, the predominant species associated with human disease. We deemed that the existence of genomic resources for multiple species in the genus, including a much-improved genome assembly and annotation for C. hominis, makes a reverse vaccinology approach feasible. To this end, we sought to generate a searchable online resource, termed C. hominis gene catalog, which registers all C. hominis genes and their properties relevant for the identification and prioritization of candidate vaccine antigens, including physical attributes, properties related to antigenic potential and expression data. Using bioinformatic approaches, we identified ∼400 C. hominis genes containing properties typical of surface-exposed antigens, such as predicted glycosylphosphatidylinositol (GPI)-anchor motifs, multiple transmembrane motifs and/or signal peptides targeting the encoded protein to the secretory pathway. This set can be narrowed further, e.g. by focusing on potential GPI-anchored proteins lacking homologs in the human genome, but with homologs in the other Cryptosporidium species for which genomic data are available, and with low amino acid polymorphism. Additional selection criteria related to recombinant expression and purification include minimizing predicted post-translation modifications and potential disulfide bonds. Forty proteins satisfying these criteria were selected from 3745 proteins in the updated C. hominis annotation. The immunogenic potential of a few of these is currently being tested. Database URL: http://cryptogc.igs.umaryland.edu PMID:28095366

  11. Targeted and efficient transfer of multiple value-added genes into wheat varieties

    USDA-ARS?s Scientific Manuscript database

    With an objective to optimize an approach to transfer multiple value added genes to a wheat variety while maintaining and improving agronomic performance, two alleles with mutations in the acetolactate synthase (ALS) gene located on wheat chromosomes 6B and 6D providing tolerance to imidazolinone (I...

  12. Should genes with missing data be excluded from phylogenetic analyses?

    PubMed

    Jiang, Wei; Chen, Si-Yun; Wang, Hong; Li, De-Zhu; Wiens, John J

    2014-11-01

    Phylogeneticists often design their studies to maximize the number of genes included but minimize the overall amount of missing data. However, few studies have addressed the costs and benefits of adding characters with missing data, especially for likelihood analyses of multiple loci. In this paper, we address this topic using two empirical data sets (in yeast and plants) with well-resolved phylogenies. We introduce varying amounts of missing data into varying numbers of genes and test whether the benefits of excluding genes with missing data outweigh the costs of excluding the non-missing data that are associated with them. We also test if there is a proportion of missing data in the incomplete genes at which they cease to be beneficial or harmful, and whether missing data consistently bias branch length estimates. Our results indicate that adding incomplete genes generally increases the accuracy of phylogenetic analyses relative to excluding them, especially when there is a high proportion of incomplete genes in the overall dataset (and thus few complete genes). Detailed analyses suggest that adding incomplete genes is especially helpful for resolving poorly supported nodes. Given that we find that excluding genes with missing data often decreases accuracy relative to including these genes (and that decreases are generally of greater magnitude than increases), there is little basis for assuming that excluding these genes is necessarily the safer or more conservative approach. We also find no evidence that missing data consistently bias branch length estimates. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. KAP1 promotes proliferation and metastatic progression of breast cancer cells.

    PubMed

    Addison, Joseph B; Koontz, Colton; Fugett, James H; Creighton, Chad J; Chen, Dongquan; Farrugia, Mark K; Padon, Renata R; Voronkova, Maria A; McLaughlin, Sarah L; Livengood, Ryan H; Lin, Chen-Chung; Ruppert, J Michael; Pugacheva, Elena N; Ivanov, Alexey V

    2015-01-15

    KAP1 (TRIM28) is a transcriptional regulator in embryonic development that controls stem cell self-renewal, chromatin organization, and the DNA damage response, acting as an essential corepressor for KRAB family zinc finger proteins (KRAB-ZNF). To gain insight into the function of this large gene family, we developed an antibody that recognizes the conserved zinc fingers linker region (ZnFL) in multiple KRAB-ZNF. Here, we report that the expression of many KRAB-ZNF along with active SUMOlyated KAP1 is elevated widely in human breast cancers. KAP1 silencing in breast cancer cells reduced proliferation and inhibited the growth and metastasis of tumor xenografts. Conversely, KAP1 overexpression stimulated cell proliferation and tumor growth. In cells where KAP1 was silenced, we identified multiple downregulated genes linked to tumor progression and metastasis, including EREG/epiregulin, PTGS2/COX2, MMP1, MMP2, and CD44, along with downregulation of multiple KRAB-ZNF proteins. KAP1-dependent stabilization of KRAB-ZNF required direct interactions with KAP1. Together, our results show that KAP1-mediated stimulation of multiple KRAB-ZNF contributes to the growth and metastasis of breast cancer. ©2014 American Association for Cancer Research.

  14. Cross-species multiple environmental stress responses: An integrated approach to identify candidate genes for multiple stress tolerance in sorghum (Sorghum bicolor (L.) Moench) and related model species

    PubMed Central

    Modise, David M.; Gemeildien, Junaid; Ndimba, Bongani K.; Christoffels, Alan

    2018-01-01

    Background Crop response to the changing climate and unpredictable effects of global warming with adverse conditions such as drought stress has brought concerns about food security to the fore; crop yield loss is a major cause of concern in this regard. Identification of genes with multiple responses across environmental stresses is the genetic foundation that leads to crop adaptation to environmental perturbations. Methods In this paper, we introduce an integrated approach to assess candidate genes for multiple stress responses across-species. The approach combines ontology based semantic data integration with expression profiling, comparative genomics, phylogenomics, functional gene enrichment and gene enrichment network analysis to identify genes associated with plant stress phenotypes. Five different ontologies, viz., Gene Ontology (GO), Trait Ontology (TO), Plant Ontology (PO), Growth Ontology (GRO) and Environment Ontology (EO) were used to semantically integrate drought related information. Results Target genes linked to Quantitative Trait Loci (QTLs) controlling yield and stress tolerance in sorghum (Sorghum bicolor (L.) Moench) and closely related species were identified. Based on the enriched GO terms of the biological processes, 1116 sorghum genes with potential responses to 5 different stresses, such as drought (18%), salt (32%), cold (20%), heat (8%) and oxidative stress (25%) were identified to be over-expressed. Out of 169 sorghum drought responsive QTLs associated genes that were identified based on expression datasets, 56% were shown to have multiple stress responses. On the other hand, out of 168 additional genes that have been evaluated for orthologous pairs, 90% were conserved across species for drought tolerance. Over 50% of identified maize and rice genes were responsive to drought and salt stresses and were co-located within multifunctional QTLs. Among the total identified multi-stress responsive genes, 272 targets were shown to be co-localized within QTLs associated with different traits that are responsive to multiple stresses. Ontology mapping was used to validate the identified genes, while reconstruction of the phylogenetic tree was instrumental to infer the evolutionary relationship of the sorghum orthologs. The results also show specific genes responsible for various interrelated components of drought response mechanism such as drought tolerance, drought avoidance and drought escape. Conclusions We submit that this approach is novel and to our knowledge, has not been used previously in any other research; it enables us to perform cross-species queries for genes that are likely to be associated with multiple stress tolerance, as a means to identify novel targets for engineering stress resistance in sorghum and possibly, in other crop species. PMID:29590108

  15. Global analysis of genes involved in freshwater adaptation in threespine sticklebacks (Gasterosteus aculeatus).

    PubMed

    DeFaveri, Jacquelin; Shikano, Takahito; Shimada, Yukinori; Goto, Akira; Merilä, Juha

    2011-06-01

    Examples of parallel evolution of phenotypic traits have been repeatedly demonstrated in threespine sticklebacks (Gasterosteus aculeatus) across their global distribution. Using these as a model, we performed a targeted genome scan--focusing on physiologically important genes potentially related to freshwater adaptation--to identify genetic signatures of parallel physiological evolution on a global scale. To this end, 50 microsatellite loci, including 26 loci within or close to (<6 kb) physiologically important genes, were screened in paired marine and freshwater populations from six locations across the Northern Hemisphere. Signatures of directional selection were detected in 24 loci, including 17 physiologically important genes, in at least one location. Although no loci showed consistent signatures of selection in all divergent population pairs, several outliers were common in multiple locations. In particular, seven physiologically important genes, as well as reference ectodysplasin gene (EDA), showed signatures of selection in three or more locations. Hence, although these results give some evidence for consistent parallel molecular evolution in response to freshwater colonization, they suggest that different evolutionary pathways may underlie physiological adaptation to freshwater habitats within the global distribution of the threespine stickleback. © 2011 The Author(s). Evolution© 2011 The Society for the Study of Evolution.

  16. Bladder cancer SNP panel predicts susceptibility and survival

    PubMed Central

    Andrew, Angeline S.; Gui, Jiang; Sanderson, Arthur C.; Mason, Rebecca A.; Morlock, Elaine V.; Schned, Alan R.; Kelsey, Karl T.; Marsit, Carmen J.; Moore, Jason H.; Karagas, Margaret R.

    2009-01-01

    Bladder cancer is the fourth most common malignancy in men and the eighth most common in women in western countries. Single nucleotide polymorphisms (SNPs) in genes that regulate telomere maintenance, mitosis, inflammation, and apoptosis have not been assessed extensively for this disease. Using a population-based study with 832 bladder cancer cases and 1,191 controls, we assessed genetic variation in relation to cancer susceptibility or survival. Findings included an increased risk associated with variants in the methyl-metabolism gene, MTHFD2 (OR 1.7 95% CI 1.3–2.3), the telomerase TEP1 (OR 1.8 95% CI 1.2–2.6) and decreased risk associated with the inflammatory response gene variant IL8RB (OR 0.6 95% CI 0.5–0.9) compared to wild-type. Shorter survival was associated with apoptotic gene variants, including CASP9 (HR 1.8 95% CI 1.1–3.0). Variants in the detoxification gene EPHX1 experienced longer survival (HR 0.4 (95% CI 0.2–0.8). These genes can now be assessed in multiple study populations to identify and validate SNPs appropriate for clinical use. PMID:19252927

  17. Spectrum of mutations in leiomyosarcomas identified by clinical targeted next-generation sequencing.

    PubMed

    Lee, Paul J; Yoo, Naomi S; Hagemann, Ian S; Pfeifer, John D; Cottrell, Catherine E; Abel, Haley J; Duncavage, Eric J

    2017-02-01

    Recurrent genomic mutations in uterine and non-uterine leiomyosarcomas have not been well established. Using a next generation sequencing (NGS) panel of common cancer-associated genes, 25 leiomyosarcomas arising from multiple sites were examined to explore genetic alterations, including single nucleotide variants (SNV), small insertions/deletions (indels), and copy number alterations (CNA). Sequencing showed 86 non-synonymous, coding region somatic variants within 151 gene targets in 21 cases, with a mean of 4.1 variants per case; 4 cases had no putative mutations in the panel of genes assayed. The most frequently altered genes were TP53 (36%), ATM and ATRX (16%), and EGFR and RB1 (12%). CNA were identified in 85% of cases, with the most frequent copy number losses observed in chromosomes 10 and 13 including PTEN and RB1; the most frequent gains were seen in chromosomes 7 and 17. Our data show that deletions in canonical cancer-related genes are common in leiomyosarcomas. Further, the spectrum of gene mutations observed shows that defects in DNA repair and chromosomal maintenance are central to the biology of leiomyosarcomas, and that activating mutations observed in other common cancer types are rare in leiomyosarcomas. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Clinical development of gene therapy: results and lessons from recent successes

    PubMed Central

    Kumar, Sandeep RP; Markusic, David M; Biswas, Moanaro; High, Katherine A; Herzog, Roland W

    2016-01-01

    Therapeutic gene transfer holds the promise of providing lasting therapies and even cures for diseases that were previously untreatable or for which only temporary or suboptimal treatments were available. For some time, clinical gene therapy was characterized by some impressive but rare examples of successes and also several setbacks. However, effective and long-lasting treatments are now being reported from gene therapy trials at an increasing pace. Positive outcomes have been documented for a wide range of genetic diseases (including hematological, immunological, ocular, and neurodegenerative and metabolic disorders) and several types of cancer. Examples include restoration of vision in blind patients, eradication of blood cancers for which all other treatments had failed, correction of hemoglobinopathies and coagulation factor deficiencies, and restoration of the immune system in children born with primary immune deficiency. To date, about 2,000 clinical trials for various diseases have occurred or are in progress, and many more are in the pipeline. Multiple clinical studies reported successful treatments of pediatric patients. Design of gene therapy vectors and their clinical development are advancing rapidly. This article reviews some of the major successes in clinical gene therapy of recent years. PMID:27257611

  19. Androgen-responsive gene database: integrated knowledge on androgen-responsive genes.

    PubMed

    Jiang, Mei; Ma, Yunsheng; Chen, Congcong; Fu, Xuping; Yang, Shu; Li, Xia; Yu, Guohua; Mao, Yumin; Xie, Yi; Li, Yao

    2009-11-01

    Androgen signaling plays an important role in many biological processes. Androgen Responsive Gene Database (ARGDB) is devoted to providing integrated knowledge on androgen-controlled genes. Gene records were collected on the basis of PubMed literature collections. More than 6000 abstracts and 950 original publications were manually screened, leading to 1785 human genes, 993 mouse genes, and 583 rat genes finally included in the database. All the collected genes were experimentally proved to be regulated by androgen at the expression level or to contain androgen-responsive regions. For each gene important details of the androgen regulation experiments were collected from references, such as expression change, androgen-responsive sequence, response time, tissue/cell type, experimental method, ligand identity, and androgen amount, which will facilitate further evaluation by researchers. Furthermore, the database was integrated with multiple annotation resources, including National Center for Biotechnology Information, Gene Ontology, and Kyoto Encyclopedia of Genes and Genomes pathway, to reveal the biological characteristics and significance of androgen-regulated genes. The ARGDB web site is mainly composed of the Browse, Search, Element Scan, and Submission modules. It is user friendly and freely accessible at http://argdb.fudan.edu.cn. Preliminary analysis of the collected data was performed. Many disease pathways, such as prostate carcinogenesis, were found to be enriched in androgen-regulated genes. The discovered androgen-response motifs were similar to those in previous reports. The analysis results are displayed in the web site. In conclusion, ARGDB provides a unified gateway to storage, retrieval, and update of information on androgen-regulated genes.

  20. Genetic variation and gene expression across multiple tissues and developmental stages in a nonhuman primate.

    PubMed

    Jasinska, Anna J; Zelaya, Ivette; Service, Susan K; Peterson, Christine B; Cantor, Rita M; Choi, Oi-Wa; DeYoung, Joseph; Eskin, Eleazar; Fairbanks, Lynn A; Fears, Scott; Furterer, Allison E; Huang, Yu S; Ramensky, Vasily; Schmitt, Christopher A; Svardal, Hannes; Jorgensen, Matthew J; Kaplan, Jay R; Villar, Diego; Aken, Bronwen L; Flicek, Paul; Nag, Rishi; Wong, Emily S; Blangero, John; Dyer, Thomas D; Bogomolov, Marina; Benjamini, Yoav; Weinstock, George M; Dewar, Ken; Sabatti, Chiara; Wilson, Richard K; Jentsch, J David; Warren, Wesley; Coppola, Giovanni; Woods, Roger P; Freimer, Nelson B

    2017-12-01

    By analyzing multitissue gene expression and genome-wide genetic variation data in samples from a vervet monkey pedigree, we generated a transcriptome resource and produced the first catalog of expression quantitative trait loci (eQTLs) in a nonhuman primate model. This catalog contains more genome-wide significant eQTLs per sample than comparable human resources and identifies sex- and age-related expression patterns. Findings include a master regulatory locus that likely has a role in immune function and a locus regulating hippocampal long noncoding RNAs (lncRNAs), whose expression correlates with hippocampal volume. This resource will facilitate genetic investigation of quantitative traits, including brain and behavioral phenotypes relevant to neuropsychiatric disorders.

  1. Carney complex review: Genetic features.

    PubMed

    Bosco Schamun, María Belén; Correa, Ricardo; Graffigna, Patricia; de Miguel, Valeria; Fainstein Day, Patricia

    2018-01-01

    Carney complex is a multiple neoplasia syndrome having endocrine and non-endocrine manifestations. Diagnostic criteria include myxoma, lentigines, and primary pigmented nodular adrenocortical disease, amongst other signs/symptoms. In most cases it is an autosomal dominant disease, and diagnosis therefore requires study and follow-up of the family members. Inactivating mutations of the PRKAR1A gene were identified as the main cause of the disease, although since 2015 other disease-related genes, including PRKACA and PRKACB activating mutations, have also been related with Carney complex. This review will address the genetic aspects related to Carney complex. Copyright © 2017 SEEN y SED. Publicado por Elsevier España, S.L.U. All rights reserved.

  2. Long genes and genes with multiple splice variants are enriched in pathways linked to cancer and other multigenic diseases.

    PubMed

    Sahakyan, Aleksandr B; Balasubramanian, Shankar

    2016-03-12

    The role of random mutations and genetic errors in defining the etiology of cancer and other multigenic diseases has recently received much attention. With the view that complex genes should be particularly vulnerable to such events, here we explore the link between the simple properties of the human genes, such as transcript length, number of splice variants, exon/intron composition, and their involvement in the pathways linked to cancer and other multigenic diseases. We reveal a substantial enrichment of cancer pathways with long genes and genes that have multiple splice variants. Although the latter two factors are interdependent, we show that the overall gene length and splicing complexity increase in cancer pathways in a partially decoupled manner. Our systematic survey for the pathways enriched with top lengthy genes and with genes that have multiple splice variants reveal, along with cancer pathways, the pathways involved in various neuronal processes, cardiomyopathies and type II diabetes. We outline a correlation between the gene length and the number of somatic mutations. Our work is a step forward in the assessment of the role of simple gene characteristics in cancer and a wider range of multigenic diseases. We demonstrate a significant accumulation of long genes and genes with multiple splice variants in pathways of multigenic diseases that have already been associated with de novo mutations. Unlike the cancer pathways, we note that the pathways of neuronal processes, cardiomyopathies and type II diabetes contain genes long enough for topoisomerase-dependent gene expression to also be a potential contributing factor in the emergence of pathologies, should topoisomerases become impaired.

  3. Assessment of the Toxicity of CuO Nanoparticles by Using Saccharomyces cerevisiae Mutants with Multiple Genes Deleted

    PubMed Central

    Bao, Shaopan; Lu, Qicong; Dai, Heping; Zhang, Chao

    2015-01-01

    To develop applicable and susceptible models to evaluate the toxicity of nanoparticles, the antimicrobial effects of CuO nanoparticles (CuO-NPs) on various Saccharomyces cerevisiae (S. cerevisiae) strains (wild type, single-gene-deleted mutants, and multiple-gene-deleted mutants) were determined and compared. Further experiments were also conducted to analyze the mechanisms associated with toxicity using copper salt, bulk CuO (bCuO), carbon-shelled copper nanoparticles (C/Cu-NPs), and carbon nanoparticles (C-NPs) for comparisons. The results indicated that the growth inhibition rates of CuO-NPs for the wild-type and the single-gene-deleted strains were comparable, while for the multiple-gene deletion mutant, significantly higher toxicity was observed (P < 0.05). When the toxicity of the CuO-NPs to yeast cells was compared with the toxicities of copper salt and bCuO, we concluded that the toxicity of CuO-NPs should be attributed to soluble copper rather than to the nanoparticles. The striking difference in adverse effects of C-NPs and C/Cu-NPs with equivalent surface areas also proved this. A toxicity assay revealed that the multiple-gene-deleted mutant was significantly more sensitive to CuO-NPs than the wild type. Specifically, compared with the wild-type strain, copper was readily taken up by mutant strains when cell permeability genes were knocked out, and the mutants with deletions of genes regulated under oxidative stress (OS) were likely producing more reactive oxygen species (ROS). Hence, as mechanism-based gene inactivation could increase the susceptibility of yeast, the multiple-gene-deleted mutants should be improved model organisms to investigate the toxicity of nanoparticles. PMID:26386067

  4. Host genetic determinants of microbiota-dependent nutrition revealed by genome-wide analysis of Drosophila melanogaster

    PubMed Central

    Dobson, Adam J.; Chaston, John M.; Newell, Peter D.; Donahue, Leanne; Hermann, Sara L.; Sannino, David R.; Westmiller, Stephanie; Wong, Adam C.-N.; Clark, Andrew G.; Lazzaro, Brian P.; Douglas, Angela E.

    2015-01-01

    Animals bear communities of gut microorganisms with substantial effects on animal nutrition, but the host genetic basis of these effects is unknown. Here, we use Drosophila to demonstrate substantial among-genotype variation in the effects of eliminating the gut microbiota on five host nutritional indices (weight, and protein, lipid, glucose and glycogen contents); this includes variation in both the magnitude and direction of microbiota-dependent effects. Genome-wide associations to identify the genetic basis of the microbiota-dependent variation reveal polymorphisms in largely non-overlapping sets of genes associated with variation in the nutritional traits, including strong representation of conserved genes functioning in signaling. Key genes identified by the GWA study are validated by loss-of-function mutations that altered microbiota-dependent nutritional effects. We conclude that the microbiota interacts with the animal at multiple points in the signaling and regulatory networks that determine animal nutrition. These interactions with the microbiota are likely conserved across animals, including humans. PMID:25692519

  5. Global prevalence and distribution of genes and microorganisms involved in mercury methylation

    DOE PAGES

    Podar, Mircea; Gilmour, C. C.; Brandt, Craig C.; ...

    2015-10-09

    Mercury methylation produces the neurotoxic, highly bioaccumulative methylmercury (MeHg). Recent identification of the methylation genes (hgcAB) provides the foundation for broadly evaluating microbial Hg-methylation potential in nature without making explicit rate measurements. We first queried hgcAB diversity and distribution in all available microbial metagenomes, encompassing most environments. The genes were found in nearly all anaerobic, but not in aerobic, environments including oxygenated layers of the open ocean. Critically, hgcAB was effectively absent in ~1500 human microbiomes, suggesting a low risk of endogenous MeHg production. New potential methylation habitats were identified, including invertebrate guts, thawing permafrost, coastal dead zones, soils, sediments,more » and extreme environments, suggesting multiple routes for MeHg entry into food webs. Several new taxonomic groups potentially capable of Hg-methylation emerged, including lineages having no cultured representatives. We then begin to address long-standing evolutionary questions about Hg-methylation and ancient carbon fixation mechanisms while generating a new global view of Hg-methylation potential.« less

  6. Pathogenic Germline Variants in 10,389 Adult Cancers.

    PubMed

    Huang, Kuan-Lin; Mashl, R Jay; Wu, Yige; Ritter, Deborah I; Wang, Jiayin; Oh, Clara; Paczkowska, Marta; Reynolds, Sheila; Wyczalkowski, Matthew A; Oak, Ninad; Scott, Adam D; Krassowski, Michal; Cherniack, Andrew D; Houlahan, Kathleen E; Jayasinghe, Reyka; Wang, Liang-Bo; Zhou, Daniel Cui; Liu, Di; Cao, Song; Kim, Young Won; Koire, Amanda; McMichael, Joshua F; Hucthagowder, Vishwanathan; Kim, Tae-Beom; Hahn, Abigail; Wang, Chen; McLellan, Michael D; Al-Mulla, Fahd; Johnson, Kimberly J; Lichtarge, Olivier; Boutros, Paul C; Raphael, Benjamin; Lazar, Alexander J; Zhang, Wei; Wendl, Michael C; Govindan, Ramaswamy; Jain, Sanjay; Wheeler, David; Kulkarni, Shashikant; Dipersio, John F; Reimand, Jüri; Meric-Bernstam, Funda; Chen, Ken; Shmulevich, Ilya; Plon, Sharon E; Chen, Feng; Ding, Li

    2018-04-05

    We conducted the largest investigation of predisposition variants in cancer to date, discovering 853 pathogenic or likely pathogenic variants in 8% of 10,389 cases from 33 cancer types. Twenty-one genes showed single or cross-cancer associations, including novel associations of SDHA in melanoma and PALB2 in stomach adenocarcinoma. The 659 predisposition variants and 18 additional large deletions in tumor suppressors, including ATM, BRCA1, and NF1, showed low gene expression and frequent (43%) loss of heterozygosity or biallelic two-hit events. We also discovered 33 such variants in oncogenes, including missenses in MET, RET, and PTPN11 associated with high gene expression. We nominated 47 additional predisposition variants from prioritized VUSs supported by multiple evidences involving case-control frequency, loss of heterozygosity, expression effect, and co-localization with mutations and modified residues. Our integrative approach links rare predisposition variants to functional consequences, informing future guidelines of variant classification and germline genetic testing in cancer. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  7. Daily rhythms in antennal protein and olfactory sensitivity in the malaria mosquito Anopheles gambiae

    PubMed Central

    Rund, Samuel S. C.; Bonar, Nicolle A.; Champion, Matthew M.; Ghazi, John P.; Houk, Cameron M.; Leming, Matthew T.; Syed, Zainulabeuddin; Duffield, Giles E.

    2013-01-01

    We recently characterized 24-hr daily rhythmic patterns of gene expression in Anopheles gambiae mosquitoes. These include numerous odorant binding proteins (OBPs), soluble odorant carrying proteins enriched in olfactory organs. Here we demonstrate that multiple rhythmically expressed genes including OBPs and takeout proteins, involved in regulating blood feeding behavior, have corresponding rhythmic protein levels as measured by quantitative proteomics. This includes AgamOBP1, previously shown as important to An. gambiae odorant sensing. Further, electrophysiological investigations demonstrate time-of-day specific differences in olfactory sensitivity of antennae to major host-derived odorants. The pre-dusk/dusk peaks in OBPs and takeout gene expression correspond with peak protein abundance at night, and in turn coincide with the time of increased olfactory sensitivity to odorants requiring OBPs and times of increased blood-feeding behavior. This suggests an important role for OBPs in modulating temporal changes in odorant sensitivity, enabling the olfactory system to coordinate with the circadian niche of An. gambiae. PMID:23986098

  8. Adaptation Genomics of a Small-Colony Variant in a Pseudomonas chlororaphis 30-84 Biofilm

    PubMed Central

    Dorosky, Robert J.; Han, Cliff S.; Lo, Chien-chi; Dichosa, Armand E. K.; Chain, Patrick S.; Yu, Jun Myoung; Pierson, Leland S.

    2014-01-01

    The rhizosphere-colonizing bacterium Pseudomonas chlororaphis 30-84 is an effective biological control agent against take-all disease of wheat. In this study, we characterize a small-colony variant (SCV) isolated from a P. chlororaphis 30-84 biofilm. The SCV exhibited pleiotropic phenotypes, including small cell size, slow growth and motility, low levels of phenazine production, and increased biofilm formation and resistance to antimicrobials. To better understand the genetic alterations underlying these phenotypes, RNA and whole-genome sequencing analyses were conducted comparing an SCV to the wild-type strain. Of the genome's 5,971 genes, transcriptomic profiling indicated that 1,098 (18.4%) have undergone substantial reprograming of gene expression in the SCV. Whole-genome sequence analysis revealed multiple alterations in the SCV, including mutations in yfiR (cyclic-di-GMP production), fusA (elongation factor), and cyoE (heme synthesis) and a 70-kb deletion. Genetic analysis revealed that the yfiR locus plays a major role in controlling SCV phenotypes, including colony size, growth, motility, and biofilm formation. Moreover, a point mutation in the fusA gene contributed to kanamycin resistance. Interestingly, the SCV can partially switch back to wild-type morphologies under specific conditions. Our data also support the idea that phenotypic switching in P. chlororaphis is not due to simple genetic reversions but may involve multiple secondary mutations. The emergence of these highly adherent and antibiotic-resistant SCVs within the biofilm might play key roles in P. chlororaphis natural persistence. PMID:25416762

  9. Tensor decomposition-based and principal-component-analysis-based unsupervised feature extraction applied to the gene expression and methylation profiles in the brains of social insects with multiple castes.

    PubMed

    Taguchi, Y-H

    2018-05-08

    Even though coexistence of multiple phenotypes sharing the same genomic background is interesting, it remains incompletely understood. Epigenomic profiles may represent key factors, with unknown contributions to the development of multiple phenotypes, and social-insect castes are a good model for elucidation of the underlying mechanisms. Nonetheless, previous studies have failed to identify genes associated with aberrant gene expression and methylation profiles because of the lack of suitable methodology that can address this problem properly. A recently proposed principal component analysis (PCA)-based and tensor decomposition (TD)-based unsupervised feature extraction (FE) can solve this problem because these two approaches can deal with gene expression and methylation profiles even when a small number of samples is available. PCA-based and TD-based unsupervised FE methods were applied to the analysis of gene expression and methylation profiles in the brains of two social insects, Polistes canadensis and Dinoponera quadriceps. Genes associated with differential expression and methylation between castes were identified, and analysis of enrichment of Gene Ontology terms confirmed reliability of the obtained sets of genes from the biological standpoint. Biologically relevant genes, shown to be associated with significant differential gene expression and methylation between castes, were identified here for the first time. The identification of these genes may help understand the mechanisms underlying epigenetic control of development of multiple phenotypes under the same genomic conditions.

  10. Multiple Translocation of the AVR-Pita Effector Gene among Chromosomes of the Rice Blast Fungus Magnaporthe oryzae and Related Species

    PubMed Central

    Chuma, Izumi; Isobe, Chihiro; Hotta, Yuma; Ibaragi, Kana; Futamata, Natsuru; Kusaba, Motoaki; Yoshida, Kentaro; Terauchi, Ryohei; Fujita, Yoshikatsu; Nakayashiki, Hitoshi; Valent, Barbara; Tosa, Yukio

    2011-01-01

    Magnaporthe oryzae is the causal agent of rice blast disease, a devastating problem worldwide. This fungus has caused breakdown of resistance conferred by newly developed commercial cultivars. To address how the rice blast fungus adapts itself to new resistance genes so quickly, we examined chromosomal locations of AVR-Pita, a subtelomeric gene family corresponding to the Pita resistance gene, in various isolates of M. oryzae (including wheat and millet pathogens) and its related species. We found that AVR-Pita (AVR-Pita1 and AVR-Pita2) is highly variable in its genome location, occurring in chromosomes 1, 3, 4, 5, 6, 7, and supernumerary chromosomes, particularly in rice-infecting isolates. When expressed in M. oryzae, most of the AVR-Pita homologs could elicit Pita-mediated resistance, even those from non-rice isolates. AVR-Pita was flanked by a retrotransposon, which presumably contributed to its multiple translocation across the genome. On the other hand, family member AVR-Pita3, which lacks avirulence activity, was stably located on chromosome 7 in a vast majority of isolates. These results suggest that the diversification in genome location of AVR-Pita in the rice isolates is a consequence of recognition by Pita in rice. We propose a model that the multiple translocation of AVR-Pita may be associated with its frequent loss and recovery mediated by its transfer among individuals in asexual populations. This model implies that the high mobility of AVR-Pita is a key mechanism accounting for the rapid adaptation toward Pita. Dynamic adaptation of some fungal plant pathogens may be achieved by deletion and recovery of avirulence genes using a population as a unit of adaptation. PMID:21829350

  11. Curcumin activates human glutathione S-transferase P1 expression through antioxidant response element.

    PubMed

    Nishinaka, Toru; Ichijo, Yusuke; Ito, Maki; Kimura, Masayoshi; Katsuyama, Masato; Iwata, Kazumi; Miura, Takeshi; Terada, Tomoyuki; Yabe-Nishimura, Chihiro

    2007-05-15

    Curcumin is a plant-derived diferuloylmethane compound extracted from Curcuma longa, possessing antioxidative and anticarcinogenic properties. Antioxidants and oxidative stress are known to induce the expression of certain classes of detoxification enzymes. Since the upregulation of detoxifying enzymes affects the drug metabolism and cell defense system, it is important to understand the gene regulation by such agents. In this study, we demonstrated that curcumin could induce the expression of human glutathione S-transferase P1 (GSTP1). In HepG2 cells treated with 20muM curcumin, the level of GSTP1 mRNA was significantly increased. In luciferase reporter assays, curcumin augmented the promoter activity of a reporter construct carrying 336bp upstream of the 5'-flanking region of the GSTP1 gene. Mutation analyses revealed that the region including antioxidant response element (ARE), which overlaps AP1 in sequence, was essential to the response to curcumin. While the introduction of a wild-type Nrf2 expression construct augmented the promoter activity of the GSTP1 gene, co-expression of a dominant-negative Nrf2 abolished the responsiveness to curcumin. In addition, curcumin activated the expression of the luciferase gene from a reporter construct carrying multiple ARE consensus sequences but not one with multiple AP1 sites. In a gel mobility shift assay with an oligonucleotide with GSTP1 ARE, an increase in the amount of the binding complex was observed in the nuclear extracts of curcumin-treated HepG2 cells. These results suggested that ARE is the primary sequence for the curcumin-induced transactivation of the GSTP1 gene. The induction of GSTP1 may be one of the mechanisms underlying the multiple actions of curcumin.

  12. Co-LncRNA: investigating the lncRNA combinatorial effects in GO annotations and KEGG pathways based on human RNA-Seq data

    PubMed Central

    Zhao, Zheng; Bai, Jing; Wu, Aiwei; Wang, Yuan; Zhang, Jinwen; Wang, Zishan; Li, Yongsheng; Xu, Juan; Li, Xia

    2015-01-01

    Long non-coding RNAs (lncRNAs) are emerging as key regulators of diverse biological processes and diseases. However, the combinatorial effects of these molecules in a specific biological function are poorly understood. Identifying co-expressed protein-coding genes of lncRNAs would provide ample insight into lncRNA functions. To facilitate such an effort, we have developed Co-LncRNA, which is a web-based computational tool that allows users to identify GO annotations and KEGG pathways that may be affected by co-expressed protein-coding genes of a single or multiple lncRNAs. LncRNA co-expressed protein-coding genes were first identified in publicly available human RNA-Seq datasets, including 241 datasets across 6560 total individuals representing 28 tissue types/cell lines. Then, the lncRNA combinatorial effects in a given GO annotations or KEGG pathways are taken into account by the simultaneous analysis of multiple lncRNAs in user-selected individual or multiple datasets, which is realized by enrichment analysis. In addition, this software provides a graphical overview of pathways that are modulated by lncRNAs, as well as a specific tool to display the relevant networks between lncRNAs and their co-expressed protein-coding genes. Co-LncRNA also supports users in uploading their own lncRNA and protein-coding gene expression profiles to investigate the lncRNA combinatorial effects. It will be continuously updated with more human RNA-Seq datasets on an annual basis. Taken together, Co-LncRNA provides a web-based application for investigating lncRNA combinatorial effects, which could shed light on their biological roles and could be a valuable resource for this community. Database URL: http://www.bio-bigdata.com/Co-LncRNA/ PMID:26363020

  13. Evaluating aggregate effects of rare and common variants in the 1000 Genomes Project exon sequencing data using latent variable structural equation modeling.

    PubMed

    Nock, Nl; Zhang, Lx

    2011-11-29

    Methods that can evaluate aggregate effects of rare and common variants are limited. Therefore, we applied a two-stage approach to evaluate aggregate gene effects in the 1000 Genomes Project data, which contain 24,487 single-nucleotide polymorphisms (SNPs) in 697 unrelated individuals from 7 populations. In stage 1, we identified potentially interesting genes (PIGs) as those having at least one SNP meeting Bonferroni correction using univariate, multiple regression models. In stage 2, we evaluate aggregate PIG effects on trait, Q1, by modeling each gene as a latent construct, which is defined by multiple common and rare variants, using the multivariate statistical framework of structural equation modeling (SEM). In stage 1, we found that PIGs varied markedly between a randomly selected replicate (replicate 137) and 100 other replicates, with the exception of FLT1. In stage 1, collapsing rare variants decreased false positives but increased false negatives. In stage 2, we developed a good-fitting SEM model that included all nine genes simulated to affect Q1 (FLT1, KDR, ARNT, ELAV4, FLT4, HIF1A, HIF3A, VEGFA, VEGFC) and found that FLT1 had the largest effect on Q1 (βstd = 0.33 ± 0.05). Using replicate 137 estimates as population values, we found that the mean relative bias in the parameters (loadings, paths, residuals) and their standard errors across 100 replicates was on average, less than 5%. Our latent variable SEM approach provides a viable framework for modeling aggregate effects of rare and common variants in multiple genes, but more elegant methods are needed in stage 1 to minimize type I and type II error.

  14. Systematic profiling of Caenorhabditis elegans locomotive behaviors reveals additional components in G-protein Gαq signaling.

    PubMed

    Yu, Hui; Aleman-Meza, Boanerges; Gharib, Shahla; Labocha, Marta K; Cronin, Christopher J; Sternberg, Paul W; Zhong, Weiwei

    2013-07-16

    Genetic screens have been widely applied to uncover genetic mechanisms of movement disorders. However, most screens rely on human observations of qualitative differences. Here we demonstrate the application of an automatic imaging system to conduct a quantitative screen for genes regulating the locomotive behavior in Caenorhabditis elegans. Two hundred twenty-seven neuronal signaling genes with viable homozygous mutants were selected for this study. We tracked and recorded each animal for 4 min and analyzed over 4,400 animals of 239 genotypes to obtain a quantitative, 10-parameter behavioral profile for each genotype. We discovered 87 genes whose inactivation causes movement defects, including 50 genes that had never been associated with locomotive defects. Computational analysis of the high-content behavioral profiles predicted 370 genetic interactions among these genes. Network partition revealed several functional modules regulating locomotive behaviors, including sensory genes that detect environmental conditions, genes that function in multiple types of excitable cells, and genes in the signaling pathway of the G protein Gαq, a protein that is essential for animal life and behavior. We developed quantitative epistasis analysis methods to analyze the locomotive profiles and validated the prediction of the γ isoform of phospholipase C as a component in the Gαq pathway. These results provided a system-level understanding of how neuronal signaling genes coordinate locomotive behaviors. This study also demonstrated the power of quantitative approaches in genetic studies.

  15. SZGR 2.0: a one-stop shop of schizophrenia candidate genes.

    PubMed

    Jia, Peilin; Han, Guangchun; Zhao, Junfei; Lu, Pinyi; Zhao, Zhongming

    2017-01-04

    SZGR 2.0 is a comprehensive resource of candidate variants and genes for schizophrenia, covering genetic, epigenetic, transcriptomic, translational and many other types of evidence. By systematic review and curation of multiple lines of evidence, we included almost all variants and genes that have ever been reported to be associated with schizophrenia. In particular, we collected ∼4200 common variants reported in genome-wide association studies, ∼1000 de novo mutations discovered by large-scale sequencing of family samples, 215 genes spanning rare and replication copy number variations, 99 genes overlapping with linkage regions, 240 differentially expressed genes, 4651 differentially methylated genes and 49 genes as antipsychotic drug targets. To facilitate interpretation, we included various functional annotation data, especially brain eQTL, methylation QTL, brain expression featured in deep categorization of brain areas and developmental stages and brain-specific promoter and enhancer annotations. Furthermore, we conducted cross-study, cross-data type and integrative analyses of the multidimensional data deposited in SZGR 2.0, and made the data and results available through a user-friendly interface. In summary, SZGR 2.0 provides a one-stop shop of schizophrenia variants and genes and their function and regulation, providing an important resource in the schizophrenia and other mental disease community. SZGR 2.0 is available at https://bioinfo.uth.edu/SZGR/. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Hormone-Related Pathways and Risk of Breast Cancer Subtypes in African American Women

    PubMed Central

    Haddad, Stephen A.; Lunetta, Kathryn L.; Ruiz-Narváez, Edward A.; Bensen, Jeannette T.; Hong, Chi-Chen; Sucheston-Campbell, Lara E.; Yao, Song; Bandera, Elisa V.; Rosenberg, Lynn; Haiman, Christopher A.; Troester, Melissa A.; Ambrosone, Christine B.; Palmer, Julie R.

    2016-01-01

    Purpose We sought to investigate genetic variation in hormone pathways in relation to risk of overall and subtype-specific breast cancer in women of African ancestry (AA). Methods Genotyping and imputation yielded data on 143,934 SNPs in 308 hormone-related genes for 3663 breast cancer cases (1098 ER-, 1983 ER+, 582 ER unknown) and 4687 controls from the African American Breast Cancer Epidemiology and Risk (AMBER) Consortium. AMBER includes data from four large studies of AA women: the Carolina Breast Cancer Study, the Women's Circle of Health Study, the Black Women's Health Study, and the Multiethnic Cohort Study. Pathway- and gene-based analyses were conducted, and single SNP tests were run for the top genes. Results There were no strong associations at the pathway level. The most significantly associated genes were GHRH, CALM2, CETP, and AKR1C1 for overall breast cancer (gene-based nominal p ≤0.01); NR0B1, IGF2R, CALM2, CYP1B1, and GRB2 for ER+ breast cancer (p ≤0.02); and PGR, MAPK3, MAP3K1, and LHCGR for ER- disease (p ≤0.02). Single-SNP tests for SNPs with pairwise linkage disequilibrium r2 <0.8 in the top genes identified 12 common SNPs (in CALM2, CETP, NR0B1, IGF2R, CYP1B1, PGR, MAPK3, and MAP3K1) associated with overall or subtype-specific breast cancer after gene-level correction for multiple testing. Rs11571215 in PGR (progesterone receptor) was the SNP most strongly associated with ER- disease. Conclusion We identified eight genes in hormone pathways that contain common variants associated with breast cancer in AA women after gene-level correction for multiple testing. PMID:26458823

  17. A Network of Genes Antagonistic to the LIN-35 Retinoblastoma Protein of Caenorhabditis elegans

    PubMed Central

    Polley, Stanley R. G.; Fay, David S.

    2012-01-01

    The Caenorhabditis elegans pRb ortholog, LIN-35, functions in a wide range of cellular and developmental processes. This includes a role of LIN-35 in nutrient utilization by the intestine, which it carries out redundantly with SLR-2, a zinc-finger protein. This and other redundant functions of LIN-35 were identified in genetic screens for mutations that display synthetic phenotypes in conjunction with loss of lin-35. To explore the intestinal role of LIN-35, we conducted a genome-wide RNA-interference-feeding screen for suppressors of lin-35; slr-2 early larval arrest. Of the 26 suppressors identified, 17 fall into three functional classes: (1) ribosome biogenesis genes, (2) mitochondrial prohibitins, and (3) chromatin regulators. Further characterization indicates that different categories of suppressors act through distinct molecular mechanisms. We also tested lin-35; slr-2 suppressors, as well as suppressors of the synthetic multivulval phenotype, to determine the spectrum of lin-35-synthetic phenotypes that could be suppressed following inhibition of these genes. We identified 19 genes, most of which are evolutionarily conserved, that can suppress multiple unrelated lin-35-synthetic phenotypes. Our study reveals a network of genes broadly antagonistic to LIN-35 as well as genes specific to the role of LIN-35 in intestinal and vulval development. Suppressors of multiple lin-35 phenotypes may be candidate targets for anticancer therapies. Moreover, screening for suppressors of phenotypically distinct synthetic interactions, which share a common altered gene, may prove to be a novel and effective approach for identifying genes whose activities are most directly relevant to the core functions of the shared gene. PMID:22542970

  18. Improvement of Arabidopsis Biomass and Cold, Drought and Salinity Stress Tolerance by Modified Circadian Clock-Associated PSEUDO-RESPONSE REGULATORs.

    PubMed

    Nakamichi, Norihito; Takao, Saori; Kudo, Toru; Kiba, Takatoshi; Wang, Yin; Kinoshita, Toshinori; Sakakibara, Hitoshi

    2016-05-01

    Plant circadian clocks control the timing of a variety of genetic, metabolic and physiological processes. Recent studies revealed a possible molecular mechanism for circadian clock regulation. Arabidopsis thaliana (Arabidopsis) PSEUDO-RESPONSE REGULATOR (PRR) genes, including TIMING OF CAB EXPRESSION 1 (TOC1), encode clock-associated transcriptional repressors that act redundantly. Disruption of multiple PRR genes results in drastic phenotypes, including increased biomass and abiotic stress tolerance, whereas PRR single mutants show subtle phenotypic differences due to genetic redundancy. In this study, we demonstrate that constitutive expression of engineered PRR5 (PRR5-VP), which functions as a transcriptional activator, can increase biomass and abiotic stress tolerance, similar to prr multiple mutants. Concomitant analyses of relative growth rate, flowering time and photosynthetic activity suggested that increased biomass of PRR5-VP plants is mostly due to late flowering, rather than to alterations in photosynthetic activity or growth rate. In addition, genome-wide gene expression profiling revealed that genes related to cold stress and water deprivation responses were up-regulated in PRR5-VP plants. PRR5-VP plants were more resistant to cold, drought and salinity stress than the wild type, whereas ft tsf and gi, well-known late flowering and increased biomass mutants, were not. These findings suggest that attenuation of PRR function by a single transformation of PRR-VP is a valuable method for increasing biomass as well as abiotic stress tolerance in Arabidopsis. Because the PRR gene family is conserved in vascular plants, PRR-VP may regulate biomass and stress responses in many plants, but especially in long-day annual plants. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  19. Evolution of the acyl-CoA binding protein (ACBP)

    PubMed Central

    Burton, Mark; Rose, Timothy M.; Færgeman, Nils J.; Knudsen, Jens

    2005-01-01

    Acyl-CoA-binding protein (ACBP) is a 10 kDa protein that binds C12–C22 acyl-CoA esters with high affinity. In vitro and in vivo experiments suggest that it is involved in multiple cellular tasks including modulation of fatty acid biosynthesis, enzyme regulation, regulation of the intracellular acyl-CoA pool size, donation of acyl-CoA esters for β-oxidation, vesicular trafficking, complex lipid synthesis and gene regulation. In the present study, we delineate the evolutionary history of ACBP to get a complete picture of its evolution and distribution among species. ACBP homologues were identified in all four eukaryotic kingdoms, Animalia, Plantae, Fungi and Protista, and eleven eubacterial species. ACBP homologues were not detected in any other known bacterial species, or in archaea. Nearly all of the ACBP-containing bacteria are pathogenic to plants or animals, suggesting that an ACBP gene could have been acquired from a eukaryotic host by horizontal gene transfer. Many bacterial, fungal and higher eukaryotic species only harbour a single ACBP homologue. However, a number of species, ranging from protozoa to vertebrates, have evolved two to six lineage-specific paralogues through gene duplication and/or retrotransposition events. The ACBP protein is highly conserved across phylums, and the majority of ACBP genes are subjected to strong purifying selection. Experimental evidence indicates that the function of ACBP has been conserved from yeast to humans and that the multiple lineage-specific paralogues have evolved altered functions. The appearance of ACBP very early on in evolution points towards a fundamental role of ACBP in acyl-CoA metabolism, including ceramide synthesis and in signalling. PMID:16018771

  20. Integrative analysis of DNA methylation and gene expression data identifies EPAS1 as a key regulator of COPD.

    PubMed

    Yoo, Seungyeul; Takikawa, Sachiko; Geraghty, Patrick; Argmann, Carmen; Campbell, Joshua; Lin, Luan; Huang, Tao; Tu, Zhidong; Foronjy, Robert F; Feronjy, Robert; Spira, Avrum; Schadt, Eric E; Powell, Charles A; Zhu, Jun

    2015-01-01

    Chronic Obstructive Pulmonary Disease (COPD) is a complex disease. Genetic, epigenetic, and environmental factors are known to contribute to COPD risk and disease progression. Therefore we developed a systematic approach to identify key regulators of COPD that integrates genome-wide DNA methylation, gene expression, and phenotype data in lung tissue from COPD and control samples. Our integrative analysis identified 126 key regulators of COPD. We identified EPAS1 as the only key regulator whose downstream genes significantly overlapped with multiple genes sets associated with COPD disease severity. EPAS1 is distinct in comparison with other key regulators in terms of methylation profile and downstream target genes. Genes predicted to be regulated by EPAS1 were enriched for biological processes including signaling, cell communications, and system development. We confirmed that EPAS1 protein levels are lower in human COPD lung tissue compared to non-disease controls and that Epas1 gene expression is reduced in mice chronically exposed to cigarette smoke. As EPAS1 downstream genes were significantly enriched for hypoxia responsive genes in endothelial cells, we tested EPAS1 function in human endothelial cells. EPAS1 knockdown by siRNA in endothelial cells impacted genes that significantly overlapped with EPAS1 downstream genes in lung tissue including hypoxia responsive genes, and genes associated with emphysema severity. Our first integrative analysis of genome-wide DNA methylation and gene expression profiles illustrates that not only does DNA methylation play a 'causal' role in the molecular pathophysiology of COPD, but it can be leveraged to directly identify novel key mediators of this pathophysiology.

  1. A pathway-based network analysis of hypertension-related genes

    NASA Astrophysics Data System (ADS)

    Wang, Huan; Hu, Jing-Bo; Xu, Chuan-Yun; Zhang, De-Hai; Yan, Qian; Xu, Ming; Cao, Ke-Fei; Zhang, Xu-Sheng

    2016-02-01

    Complex network approach has become an effective way to describe interrelationships among large amounts of biological data, which is especially useful in finding core functions and global behavior of biological systems. Hypertension is a complex disease caused by many reasons including genetic, physiological, psychological and even social factors. In this paper, based on the information of biological pathways, we construct a network model of hypertension-related genes of the salt-sensitive rat to explore the interrelationship between genes. Statistical and topological characteristics show that the network has the small-world but not scale-free property, and exhibits a modular structure, revealing compact and complex connections among these genes. By the threshold of integrated centrality larger than 0.71, seven key hub genes are found: Jun, Rps6kb1, Cycs, Creb312, Cdk4, Actg1 and RT1-Da. These genes should play an important role in hypertension, suggesting that the treatment of hypertension should focus on the combination of drugs on multiple genes.

  2. Independent and high-level dual-gene expression in adult stem-progenitor cells from a single lentiviral vector.

    PubMed

    Tian, J; Andreadis, S T

    2009-07-01

    Expression of multiple genes from the same target cell is required in several technological and therapeutic applications such as quantitative measurements of promoter activity or in vivo tracking of stem cells. In spite of such need, reaching independent and high-level dual-gene expression cannot be reliably accomplished by current gene transfer vehicles. To address this issue, we designed a lentiviral vector carrying two transcriptional units separated by polyadenylation, terminator and insulator sequences. With this design, the expression level of both genes was as high as that yielded from lentiviral vectors containing only a single transcriptional unit. Similar results were observed with several promoters and cell types including epidermal keratinocytes, bone marrow mesenchymal stem cells and hair follicle stem cells. Notably, we demonstrated quantitative dynamic monitoring of gene expression in primary cells with no need for selection protocols suggesting that this optimized lentivirus may be useful in high-throughput gene expression profiling studies.

  3. Gene profiling-based phenotyping for identification of cellular parameters that contribute to fitness, stress-tolerance and virulence of Listeria monocytogenes variants.

    PubMed

    Koomen, Jeroen; den Besten, Heidy M W; Metselaar, Karin I; Tempelaars, Marcel H; Wijnands, Lucas M; Zwietering, Marcel H; Abee, Tjakko

    2018-06-07

    Microbial population heterogeneity allows for a differential microbial response to environmental stresses and can lead to the selection of stress resistant variants. In this study, we have used two different stress resistant variants of Listeria monocytogenes LO28 with mutations in the rpsU gene encoding ribosomal protein S21, to elucidate features that can contribute to fitness, stress-tolerance and host interaction using a comparative gene profiling and phenotyping approach. Transcriptome analysis showed that 116 genes were upregulated and 114 genes were downregulated in both rpsU variants. Upregulated genes included a major contribution of SigB-controlled genes such as intracellular acid resistance-associated glutamate decarboxylase (GAD) (gad3), genes involved in compatible solute uptake (opuC), glycerol metabolism (glpF, glpK, glpD), and virulence (inlA, inlB). Downregulated genes in the two variants involved mainly genes involved in flagella synthesis and motility. Phenotyping results of the two rpsU variants matched the gene profiling data including enhanced freezing resistance conceivably linked to compatible solute accumulation, higher glycerol utilisation rates, and better adhesion to Caco 2 cells presumably linked to higher expression of internalins. Also, bright field and electron microscopy analysis confirmed reduced flagellation of the variants. The activation of SigB-mediated stress defence offers an explanation for the multiple-stress resistant phenotype in rpsU variants. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  4. Gene delivery strategies for the treatment of mucopolysaccharidoses.

    PubMed

    Baldo, Guilherme; Giugliani, Roberto; Matte, Ursula

    2014-03-01

    Mucopolysaccharidosis (MPS) disorders are genetic diseases caused by deficiencies in the lysosomal enzymes responsible for the degradation of glycosaminoglycans. Current treatments are not able to correct all disease symptoms and are not available for all MPS types, which makes gene therapy especially relevant. Multiple gene therapy approaches have been tested for different types of MPS, and our aim in this study is to critically analyze each of them. In this review, we have included the major studies that describe the use of adeno-associated retroviral and lentiviral vectors, as well as relevant non-viral approaches for MPS disorders. Some protocols such as the use of adeno-associated vectors and lentiviral vectors are approaching the clinic for these disorders and, along with combined approaches, seem to be the future of gene therapy for MPS.

  5. Molecular Approaches to Thyroid Cancer Diagnosis

    PubMed Central

    Hsiao, Susan J.; Nikiforov, Yuri E.

    2014-01-01

    Thyroid nodules are common, and the accurate diagnosis of cancer or benign disease is important for the effective clinical management of these patients. Molecular markers are a helpful diagnostic tool, particularly for cytologically indeterminate thyroid nodules. In the past few years, significant progress has been made in developing molecular markers for clinical use in fine needle aspiration (FNA) specimens, including gene mutation panels and gene expression classifiers. With the availability of next generation sequencing technology, gene mutation panels can be expanded to interrogate multiple genes simultaneously and to provide yet more accurate diagnostic information. In addition, recently several new molecular markers in thyroid cancer have been identified that offer diagnostic, prognostic, and therapeutic information that could potentially be of value in guiding individualized management of patients with thyroid nodules. PMID:24829266

  6. Adenosine Deaminase (ADA)-Deficient Severe Combined Immune Deficiency (SCID): Molecular Pathogenesis and Clinical Manifestations.

    PubMed

    Bradford, Kathryn L; Moretti, Federico A; Carbonaro-Sarracino, Denise A; Gaspar, Hubert B; Kohn, Donald B

    2017-10-01

    Deficiency of adenosine deaminase (ADA, EC3.5.4.4), a housekeeping enzyme of purine metabolism encoded by the Ada gene, is a cause of human severe combined immune deficiency (SCID). Numerous deleterious mutations occurring in the ADA gene have been found in patients with profound lymphopenia (T - B - NK - ), thus underscoring the importance of functional purine metabolism for the development of the immune defense. While untreated ADA SCID is a fatal disorder, there are multiple life-saving therapeutic modalities to restore ADA activity and reconstitute protective immunity, including enzyme replacement therapy (ERT), allogeneic hematopoietic stem cell transplantation (HSCT) and gene therapy (GT) with autologous gene-corrected hematopoietic stem cells (HSC). We review the pathogenic mechanisms and clinical manifestations of ADA SCID.

  7. RANGER-DTL 2.0: Rigorous Reconstruction of Gene-Family Evolution by Duplication, Transfer, and Loss.

    PubMed

    Bansal, Mukul S; Kellis, Manolis; Kordi, Misagh; Kundu, Soumya

    2018-04-24

    RANGER-DTL 2.0 is a software program for inferring gene family evolution using Duplication-Transfer-Loss reconciliation. This new software is highly scalable and easy to use, and offers many new features not currently available in any other reconciliation program. RANGER-DTL 2.0 has a particular focus on reconciliation accuracy and can account for many sources of reconciliation uncertainty including uncertain gene tree rooting, gene tree topological uncertainty, multiple optimal reconciliations, and alternative event cost assignments. RANGER-DTL 2.0 is open-source and written in C ++ and Python. Pre-compiled executables, source code (open-source under GNU GPL), and a detailed manual are freely available from http://compbio.engr.uconn.edu/software/RANGER-DTL/. mukul.bansal@uconn.edu.

  8. Developing Pedagogical Tools to Improve Teaching Multiple Models of the Gene in High School

    ERIC Educational Resources Information Center

    Auckaraaree, Nantaya

    2013-01-01

    Multiple models of the gene are used to explore genetic phenomena in scientific practices and in the classroom. In genetics curricula, the classical and molecular models are presented in disconnected domains. Research demonstrates that, without explicit connections, students have difficulty developing an understanding of the gene that spans…

  9. Array data extractor (ADE): a LabVIEW program to extract and merge gene array data.

    PubMed

    Kurtenbach, Stefan; Kurtenbach, Sarah; Zoidl, Georg

    2013-12-01

    Large data sets from gene expression array studies are publicly available offering information highly valuable for research across many disciplines ranging from fundamental to clinical research. Highly advanced bioinformatics tools have been made available to researchers, but a demand for user-friendly software allowing researchers to quickly extract expression information for multiple genes from multiple studies persists. Here, we present a user-friendly LabVIEW program to automatically extract gene expression data for a list of genes from multiple normalized microarray datasets. Functionality was tested for 288 class A G protein-coupled receptors (GPCRs) and expression data from 12 studies comparing normal and diseased human hearts. Results confirmed known regulation of a beta 1 adrenergic receptor and further indicate novel research targets. Although existing software allows for complex data analyses, the LabVIEW based program presented here, "Array Data Extractor (ADE)", provides users with a tool to retrieve meaningful information from multiple normalized gene expression datasets in a fast and easy way. Further, the graphical programming language used in LabVIEW allows applying changes to the program without the need of advanced programming knowledge.

  10. Multiple Export Mechanisms for mRNAs

    PubMed Central

    Delaleau, Mildred; Borden, Katherine L. B.

    2015-01-01

    Nuclear mRNA export plays an important role in gene expression. We describe the mechanisms of mRNA export including the importance of mRNP assembly, docking with the nuclear basket of the nuclear pore complex (NPC), transit through the central channel of the NPC and cytoplasmic release. We describe multiple mechanisms of mRNA export including NXF1 and CRM1 mediated pathways. Selective groups of mRNAs can be preferentially transported in order to respond to cellular stimuli. RNAs can be selected based on the presence of specific cis-acting RNA elements and binding of specific adaptor proteins. The role that dysregulation of this process plays in human disease is also discussed. PMID:26343730

  11. EGRINs (Environmental Gene Regulatory Influence Networks) in Rice That Function in the Response to Water Deficit, High Temperature, and Agricultural Environments[OPEN

    PubMed Central

    Hafemeister, Christoph; Nicotra, Adrienne B.; Jagadish, S.V. Krishna; Bonneau, Richard; Purugganan, Michael

    2016-01-01

    Environmental gene regulatory influence networks (EGRINs) coordinate the timing and rate of gene expression in response to environmental signals. EGRINs encompass many layers of regulation, which culminate in changes in accumulated transcript levels. Here, we inferred EGRINs for the response of five tropical Asian rice (Oryza sativa) cultivars to high temperatures, water deficit, and agricultural field conditions by systematically integrating time-series transcriptome data, patterns of nucleosome-free chromatin, and the occurrence of known cis-regulatory elements. First, we identified 5447 putative target genes for 445 transcription factors (TFs) by connecting TFs with genes harboring known cis-regulatory motifs in nucleosome-free regions proximal to their transcriptional start sites. We then used network component analysis to estimate the regulatory activity for each TF based on the expression of its putative target genes. Finally, we inferred an EGRIN using the estimated transcription factor activity (TFA) as the regulator. The EGRINs include regulatory interactions between 4052 target genes regulated by 113 TFs. We resolved distinct regulatory roles for members of the heat shock factor family, including a putative regulatory connection between abiotic stress and the circadian clock. TFA estimation using network component analysis is an effective way of incorporating multiple genome-scale measurements into network inference. PMID:27655842

  12. Mitochondrial genomes of praying mantises (Dictyoptera, Mantodea): rearrangement, duplication, and reassignment of tRNA genes.

    PubMed

    Ye, Fei; Lan, Xu-E; Zhu, Wen-Bo; You, Ping

    2016-05-09

    Insect mitochondrial genomes (mitogenomes) contain a conserved set of 37 genes for an extensive diversity of lineages. Previously reported dictyopteran mitogenomes share this conserved mitochondrial gene arrangement, although surprisingly little is known about the mitogenome of Mantodea. We sequenced eight mantodean mitogenomes including the first representatives of two families: Hymenopodidae and Liturgusidae. Only two of these genomes retain the typical insect gene arrangement. In three Liturgusidae species, the trnM genes have translocated. Four species of mantis (Creobroter gemmata, Mantis religiosa, Statilia sp., and Theopompa sp.-HN) have multiple identical tandem duplication of trnR, and Statilia sp. additionally includes five extra duplicate trnW. These extra trnR and trnW in Statilia sp. are erratically arranged and form another novel gene order. Interestingly, the extra trnW is converted from trnR by the process of point mutation at anticodon, which is the first case of tRNA reassignment for an insect. Furthermore, no significant differences were observed amongst mantodean mitogenomes with variable copies of tRNA according to comparative analysis of codon usage. Combined with phylogenetic analysis, the characteristics of tRNA only possess limited phylogenetic information in this research. Nevertheless, these features of gene rearrangement, duplication, and reassignment provide valuable information toward understanding mitogenome evolution in insects.

  13. Mitochondrial genomes of praying mantises (Dictyoptera, Mantodea): rearrangement, duplication, and reassignment of tRNA genes

    PubMed Central

    Ye, Fei; Lan, Xu-e; Zhu, Wen-bo; You, Ping

    2016-01-01

    Insect mitochondrial genomes (mitogenomes) contain a conserved set of 37 genes for an extensive diversity of lineages. Previously reported dictyopteran mitogenomes share this conserved mitochondrial gene arrangement, although surprisingly little is known about the mitogenome of Mantodea. We sequenced eight mantodean mitogenomes including the first representatives of two families: Hymenopodidae and Liturgusidae. Only two of these genomes retain the typical insect gene arrangement. In three Liturgusidae species, the trnM genes have translocated. Four species of mantis (Creobroter gemmata, Mantis religiosa, Statilia sp., and Theopompa sp.-HN) have multiple identical tandem duplication of trnR, and Statilia sp. additionally includes five extra duplicate trnW. These extra trnR and trnW in Statilia sp. are erratically arranged and form another novel gene order. Interestingly, the extra trnW is converted from trnR by the process of point mutation at anticodon, which is the first case of tRNA reassignment for an insect. Furthermore, no significant differences were observed amongst mantodean mitogenomes with variable copies of tRNA according to comparative analysis of codon usage. Combined with phylogenetic analysis, the characteristics of tRNA only possess limited phylogenetic information in this research. Nevertheless, these features of gene rearrangement, duplication, and reassignment provide valuable information toward understanding mitogenome evolution in insects. PMID:27157299

  14. The Pathogen-Host Interactions database (PHI-base): additions and future developments.

    PubMed

    Urban, Martin; Pant, Rashmi; Raghunath, Arathi; Irvine, Alistair G; Pedro, Helder; Hammond-Kosack, Kim E

    2015-01-01

    Rapidly evolving pathogens cause a diverse array of diseases and epidemics that threaten crop yield, food security as well as human, animal and ecosystem health. To combat infection greater comparative knowledge is required on the pathogenic process in multiple species. The Pathogen-Host Interactions database (PHI-base) catalogues experimentally verified pathogenicity, virulence and effector genes from bacterial, fungal and protist pathogens. Mutant phenotypes are associated with gene information. The included pathogens infect a wide range of hosts including humans, animals, plants, insects, fish and other fungi. The current version, PHI-base 3.6, available at http://www.phi-base.org, stores information on 2875 genes, 4102 interactions, 110 host species, 160 pathogenic species (103 plant, 3 fungal and 54 animal infecting species) and 181 diseases drawn from 1243 references. Phenotypic and gene function information has been obtained by manual curation of the peer-reviewed literature. A controlled vocabulary consisting of nine high-level phenotype terms permits comparisons and data analysis across the taxonomic space. PHI-base phenotypes were mapped via their associated gene information to reference genomes available in Ensembl Genomes. Virulence genes and hotspots can be visualized directly in genome browsers. Future plans for PHI-base include development of tools facilitating community-led curation and inclusion of the corresponding host target(s). © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. Genome-Wide Variation Patterns Uncover the Origin and Selection in Cultivated Ginseng (Panax ginseng Meyer).

    PubMed

    Li, Ming-Rui; Shi, Feng-Xue; Li, Ya-Ling; Jiang, Peng; Jiao, Lili; Liu, Bao; Li, Lin-Feng

    2017-09-01

    Chinese ginseng (Panax ginseng Meyer) is a medicinally important herb and plays crucial roles in traditional Chinese medicine. Pharmacological analyses identified diverse bioactive components from Chinese ginseng. However, basic biological attributes including domestication and selection of the ginseng plant remain under-investigated. Here, we presented a genome-wide view of the domestication and selection of cultivated ginseng based on the whole genome data. A total of 8,660 protein-coding genes were selected for genome-wide scanning of the 30 wild and cultivated ginseng accessions. In complement, the 45s rDNA, chloroplast and mitochondrial genomes were included to perform phylogenetic and population genetic analyses. The observed spatial genetic structure between northern cultivated ginseng (NCG) and southern cultivated ginseng (SCG) accessions suggested multiple independent origins of cultivated ginseng. Genome-wide scanning further demonstrated that NCG and SCG have undergone distinct selection pressures during the domestication process, with more genes identified in the NCG (97 genes) than in the SCG group (5 genes). Functional analyses revealed that these genes are involved in diverse pathways, including DNA methylation, lignin biosynthesis, and cell differentiation. These findings suggested that the SCG and NCG groups have distinct demographic histories. Candidate genes identified are useful for future molecular breeding of cultivated ginseng. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  16. Identification of multiple interacting alleles conferring low glycerol and high ethanol yield in Saccharomyces cerevisiae ethanolic fermentation

    PubMed Central

    2013-01-01

    Background Genetic engineering of industrial microorganisms often suffers from undesirable side effects on essential functions. Reverse engineering is an alternative strategy to improve multifactorial traits like low glycerol/high ethanol yield in yeast fermentation. Previous rational engineering of this trait always affected essential functions like growth and stress tolerance. We have screened Saccharomyces cerevisiae biodiversity for specific alleles causing lower glycerol/higher ethanol yield, assuming higher compatibility with normal cellular functionality. Previous work identified ssk1E330N…K356N as causative allele in strain CBS6412, which displayed the lowest glycerol/ethanol ratio. Results We have now identified a unique segregant, 26B, that shows similar low glycerol/high ethanol production as the superior parent, but lacks the ssk1E330N…K356N allele. Using segregants from the backcross of 26B with the inferior parent strain, we applied pooled-segregant whole-genome sequence analysis and identified three minor quantitative trait loci (QTLs) linked to low glycerol/high ethanol production. Within these QTLs, we identified three novel alleles of known regulatory and structural genes of glycerol metabolism, smp1R110Q,P269Q, hot1P107S,H274Y and gpd1L164P as causative genes. All three genes separately caused a significant drop in the glycerol/ethanol production ratio, while gpd1L164P appeared to be epistatically suppressed by other alleles in the superior parent. The order of potency in reducing the glycerol/ethanol ratio of the three alleles was: gpd1L164P > hot1P107S,H274Y ≥ smp1R110Q,P269Q. Conclusions Our results show that natural yeast strains harbor multiple specific alleles of genes controlling essential functions, that are apparently compatible with survival in the natural environment. These newly identified alleles can be used as gene tools for engineering industrial yeast strains with multiple subtle changes, minimizing the risk of negatively affecting other essential functions. The gene tools act at the transcriptional, regulatory or structural gene level, distributing the impact over multiple targets and thus further minimizing possible side-effects. In addition, the results suggest polygenic analysis of complex traits as a promising new avenue to identify novel components involved in cellular functions, including those important in industrial applications. PMID:23759206

  17. A Simple Screening Approach To Prioritize Genes for Functional Analysis Identifies a Role for Interferon Regulatory Factor 7 in the Control of Respiratory Syncytial Virus Disease

    PubMed Central

    McDonald, Jacqueline U.; Kaforou, Myrsini; Clare, Simon; Hale, Christine; Ivanova, Maria; Huntley, Derek; Dorner, Marcus; Wright, Victoria J.; Levin, Michael; Martinon-Torres, Federico; Herberg, Jethro A.

    2016-01-01

    ABSTRACT Greater understanding of the functions of host gene products in response to infection is required. While many of these genes enable pathogen clearance, some enhance pathogen growth or contribute to disease symptoms. Many studies have profiled transcriptomic and proteomic responses to infection, generating large data sets, but selecting targets for further study is challenging. Here we propose a novel data-mining approach combining multiple heterogeneous data sets to prioritize genes for further study by using respiratory syncytial virus (RSV) infection as a model pathogen with a significant health care impact. The assumption was that the more frequently a gene is detected across multiple studies, the more important its role is. A literature search was performed to find data sets of genes and proteins that change after RSV infection. The data sets were standardized, collated into a single database, and then panned to determine which genes occurred in multiple data sets, generating a candidate gene list. This candidate gene list was validated by using both a clinical cohort and in vitro screening. We identified several genes that were frequently expressed following RSV infection with no assigned function in RSV control, including IFI27, IFIT3, IFI44L, GBP1, OAS3, IFI44, and IRF7. Drilling down into the function of these genes, we demonstrate a role in disease for the gene for interferon regulatory factor 7, which was highly ranked on the list, but not for IRF1, which was not. Thus, we have developed and validated an approach for collating published data sets into a manageable list of candidates, identifying novel targets for future analysis. IMPORTANCE Making the most of “big data” is one of the core challenges of current biology. There is a large array of heterogeneous data sets of host gene responses to infection, but these data sets do not inform us about gene function and require specialized skill sets and training for their utilization. Here we describe an approach that combines and simplifies these data sets, distilling this information into a single list of genes commonly upregulated in response to infection with RSV as a model pathogen. Many of the genes on the list have unknown functions in RSV disease. We validated the gene list with new clinical, in vitro, and in vivo data. This approach allows the rapid selection of genes of interest for further, more-detailed studies, thus reducing time and costs. Furthermore, the approach is simple to use and widely applicable to a range of diseases. PMID:27822537

  18. Multiple Testing in the Context of Gene Discovery in Sickle Cell Disease Using Genome-Wide Association Studies.

    PubMed

    Kuo, Kevin H M

    2017-01-01

    The issue of multiple testing, also termed multiplicity, is ubiquitous in studies where multiple hypotheses are tested simultaneously. Genome-wide association study (GWAS), a type of genetic association study that has gained popularity in the past decade, is most susceptible to the issue of multiple testing. Different methodologies have been employed to address the issue of multiple testing in GWAS. The purpose of the review is to examine the methodologies employed in dealing with multiple testing in the context of gene discovery using GWAS in sickle cell disease complications.

  19. Genetic testing for hereditary cancer predisposition: BRCA1/2, Lynch syndrome, and beyond.

    PubMed

    Hall, M J; Obeid, E I; Schwartz, S C; Mantia-Smaldone, G; Forman, A D; Daly, M B

    2016-03-01

    Obstetrician/gynecologists and gynecologic oncologists serve an integral role in the care of women at increased hereditary risk of cancer. Their contribution includes initial identification of high risk patients, screening procedures like bimanual exam, trans-vaginal ultrasound and endometrial biopsy, prophylaxis via TAH and/or BSO, and chemoprevention. Further, gynecologists also serve a central role in the management of the secondary repercussions of efforts to mitigate increased cancer risks, including vasomotor symptoms, sexual function, bone health, cardiovascular disease, and mental health. The past several years has seen multiple new high and moderate penetrance genes introduced into the clinical care of women at increased risk of gynecologic malignancy. Awareness of these new genes and the availability of new multi-gene panel tests is critical for providers on the front-line of women's health. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Innate immune activity conditions the effect of regulatory variants upon monocyte gene expression.

    PubMed

    Fairfax, Benjamin P; Humburg, Peter; Makino, Seiko; Naranbhai, Vivek; Wong, Daniel; Lau, Evelyn; Jostins, Luke; Plant, Katharine; Andrews, Robert; McGee, Chris; Knight, Julian C

    2014-03-07

    To systematically investigate the impact of immune stimulation upon regulatory variant activity, we exposed primary monocytes from 432 healthy Europeans to interferon-γ (IFN-γ) or differing durations of lipopolysaccharide and mapped expression quantitative trait loci (eQTLs). More than half of cis-eQTLs identified, involving hundreds of genes and associated pathways, are detected specifically in stimulated monocytes. Induced innate immune activity reveals multiple master regulatory trans-eQTLs including the major histocompatibility complex (MHC), coding variants altering enzyme and receptor function, an IFN-β cytokine network showing temporal specificity, and an interferon regulatory factor 2 (IRF2) transcription factor-modulated network. Induced eQTL are significantly enriched for genome-wide association study loci, identifying context-specific associations to putative causal genes including CARD9, ATM, and IRF8. Thus, applying pathophysiologically relevant immune stimuli assists resolution of functional genetic variants.

  1. Alternative splicing mechanisms orchestrating post-transcriptional gene expression: intron retention and the intron-rich genome of apicomplexan parasites.

    PubMed

    Lunghi, Matteo; Spano, Furio; Magini, Alessandro; Emiliani, Carla; Carruthers, Vern B; Di Cristina, Manlio

    2016-02-01

    Apicomplexan parasites including Toxoplasma gondii and Plasmodium species have complex life cycles that include multiple hosts and differentiation through several morphologically distinct stages requiring marked changes in gene expression. This review highlights emerging evidence implicating regulation of mRNA splicing as a mechanism to prime these parasites for rapid gene expression upon differentiation. We summarize the most important insights in alternative splicing including its role in regulating gene expression by decreasing mRNA abundance via 'Regulated Unproductive Splicing and Translation'. As a related but less well-understood mechanism, we discuss also our recent work suggesting a role for intron retention for precluding translation of stage specific isoforms of T. gondii glycolytic enzymes. We additionally provide new evidence that intron retention might be a widespread mechanism during parasite differentiation. Supporting this notion, recent genome-wide analysis of Toxoplasma and Plasmodium suggests intron retention is more pervasive than heretofore thought. These findings parallel recent emergence of intron retention being more prevalent in mammals than previously believed, thereby adding to the established roles in plants, fungi and unicellular eukaryotes. Deeper mechanistic studies of intron retention will provide important insight into its role in regulating gene expression in apicomplexan parasites and more general in eukaryotic organisms.

  2. Construction and engineering of large biochemical pathways via DNA assembler

    PubMed Central

    Shao, Zengyi; Zhao, Huimin

    2015-01-01

    Summary DNA assembler enables rapid construction and engineering of biochemical pathways in a one-step fashion by exploitation of the in vivo homologous recombination mechanism in Saccharomyces cerevisiae. It has many applications in pathway engineering, metabolic engineering, combinatorial biology, and synthetic biology. Here we use two examples including the zeaxanthin biosynthetic pathway and the aureothin biosynthetic gene cluster to describe the key steps in the construction of pathways containing multiple genes using the DNA assembler approach. Methods for construct design, pathway assembly, pathway confirmation, and functional analysis are shown. The protocol for fine genetic modifications such as site-directed mutagenesis for engineering the aureothin gene cluster is also illustrated. PMID:23996442

  3. Adeno-associated viral gene therapy for mucopolysaccharidoses exhibiting neurodegeneration.

    PubMed

    Lau, Adeline A; Hemsley, Kim M

    2017-10-01

    The mucopolysaccharidoses (MPS) are a subgroup of lysosomal storage disorders that are caused by mutations in the genes involved in glycosaminoglycan breakdown. Multiple organs and tissues are affected, including the central nervous system. At present, hematopoietic stem cell transplantation and enzyme replacement therapies are approved for some of the (non-neurological) MPS. Treatments that effectively ameliorate the neurological aspects of the disease are being assessed in clinical trials. This review will focus on the recent outcomes and planned viral vector-mediated gene therapy clinical trials, and the pre-clinical data that supported these studies, for MPS-I (Hurler/Scheie syndrome), MPS-II (Hunter syndrome), and MPS-IIIA and -IIIB (Sanfilippo syndrome).

  4. Targeted genetic and viral therapy for advanced head and neck cancers.

    PubMed

    Huang, Pin-I; Chang, Ju-Fang; Kirn, David H; Liu, Ta-Chiang

    2009-06-01

    Head and neck cancers usually present with advanced disease and novel therapies are urgently needed. Genetic therapy aims at restoring malfunctioned tumor suppressor gene(s) or introducing proapoptotic genes. Oncolytic virotherapeutics induce multiple cycles of cancer-specific virus replication, followed by oncolysis, virus spreading and infection of adjacent cancer cells. Oncolytic viruses can also be armed to express therapeutic transgene(s). Recent advances in preclinical and clinical studies are revealing the potential of both therapeutic classes for advanced head and neck cancers, including the approval of two products (Gendicine and H101) by a governmental agency. This review summarizes the available clinical data to date and discusses the challenges and future directions.

  5. Genetic variation in SLC7A2 interacts with calcium and magnesium intakes in modulating the risk of colorectal polyps.

    PubMed

    Sun, Pin; Zhu, Xiangzhu; Shrubsole, Martha J; Ness, Reid M; Hibler, Elizabeth A; Cai, Qiuyin; Long, Jirong; Chen, Zhi; Li, Guoliang; Hou, Lifang; Smalley, Walter E; Edwards, Todd L; Giovannucci, Edward; Zheng, Wei; Dai, Qi

    2017-09-01

    Solute carrier family 7, member 2 (SLC7A2) gene encodes a protein called cationic amino acid transporter 2, which mediates the transport of arginine, lysine and ornithine. l-Arginine is necessary for cancer development and progression, including an important role in colorectal cancer pathogenesis. Furthermore, previous studies found that both calcium and magnesium inhibit the transport of arginine. Thus, calcium, magnesium or calcium:magnesium intake ratio may interact with polymorphisms in the SLC7A2 gene in association with colorectal cancer. We conducted a two-phase case-control study within the Tennessee Colorectal Polyps Study. In the first phase, 23 tagging single-nucleotide polymorphisms in the SLC7A2 gene were included for 725 colorectal adenoma cases and 755 controls. In the second phase conducted in an independent set of 607 cases and 2113 controls, we replicated the significant findings in the first phase. We observed that rs2720574 significantly interacted with calcium:magnesium intake ratio in association with odds of adenoma, particularly multiple/advanced adenoma. In the combined analysis, among those with a calcium:magnesium intake ratio below 2.78, individuals who carried GC/CC genotypes demonstrated higher odds of adenoma [OR (95% CI):1.36 (1.11-1.68)] and multiple/advanced adenoma [OR (95% CI): 1.68 (1.28, 2.20)] than those who carried the GG genotype. The P values for interactions between calcium:magnesium intake ratio and rs2720574 were .002 for all adenomas and <.001 for multiple/advanced adenoma. Among those with the GG genotype, a high calcium:magnesium ratio was associated with increased odds of colorectal adenoma [OR (95% CI): 1.73 (1.27-2.36)] and advanced/multiple adenomas [1.62 (1.05-2.50)], whereas among those with the GC/CC genotypes, high calcium:magnesium ratio was related to reduced odds of colorectal adenoma [0.64 (0.42-0.99)] and advanced/multiple adenomas [0.55 (0.31-1.00)]. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Functional validation of Apoptosis Genes IAP1 and DRONC in midgut tissue of the biting midge Culicoides sonorensis (Diptera: Ceratopogonidae) by RNAi

    USDA-ARS?s Scientific Manuscript database

    Background: Culicoides biting midges transmit multiple ruminant viruses, including bluetongue virus and epizootic hemorrhagic disease virus, causing significant economic burden worldwide due to trade restrictions and production loss. To limit the spread of these viruses, control strategies focus on ...

  7. A limited role for gene duplications in the evolution of platypus venom.

    PubMed

    Wong, Emily S W; Papenfuss, Anthony T; Whittington, Camilla M; Warren, Wesley C; Belov, Katherine

    2012-01-01

    Gene duplication followed by adaptive selection is believed to be the primary driver of venom evolution. However, to date, no studies have evaluated the importance of gene duplications for venom evolution using a genomic approach. The availability of a sequenced genome and a venom gland transcriptome for the enigmatic platypus provides a unique opportunity to explore the role that gene duplication plays in venom evolution. Here, we identify gene duplication events and correlate them with expressed transcripts in an in-season venom gland. Gene duplicates (1,508) were identified. These duplicated pairs (421), including genes that have undergone multiple rounds of gene duplications, were expressed in the venom gland. The majority of these genes are involved in metabolism and protein synthesis not toxin functions. Twelve secretory genes including serine proteases, metalloproteinases, and protease inhibitors likely to produce symptoms of envenomation such as vasodilation and pain were detected. Only 16 of 107 platypus genes with high similarity to known toxins evolved through gene duplication. Platypus venom C-type natriuretic peptides and nerve growth factor do not possess lineage-specific gene duplicates. Extensive duplications, believed to increase the potency of toxic content and promote toxin diversification, were not found. This is the first study to take a genome-wide approach in order to examine the impact of gene duplication on venom evolution. Our findings support the idea that adaptive selection acts on gene duplicates to drive the independent evolution and functional diversification of similar venom genes in venomous species. However, gene duplications alone do not explain the "venome" of the platypus. Other mechanisms, such as alternative splicing and mutation, may be important in venom innovation.

  8. A Limited Role for Gene Duplications in the Evolution of Platypus Venom

    PubMed Central

    Wong, Emily S. W.; Papenfuss, Anthony T.; Whittington, Camilla M.; Warren, Wesley C.; Belov, Katherine

    2012-01-01

    Gene duplication followed by adaptive selection is believed to be the primary driver of venom evolution. However, to date, no studies have evaluated the importance of gene duplications for venom evolution using a genomic approach. The availability of a sequenced genome and a venom gland transcriptome for the enigmatic platypus provides a unique opportunity to explore the role that gene duplication plays in venom evolution. Here, we identify gene duplication events and correlate them with expressed transcripts in an in-season venom gland. Gene duplicates (1,508) were identified. These duplicated pairs (421), including genes that have undergone multiple rounds of gene duplications, were expressed in the venom gland. The majority of these genes are involved in metabolism and protein synthesis not toxin functions. Twelve secretory genes including serine proteases, metalloproteinases, and protease inhibitors likely to produce symptoms of envenomation such as vasodilation and pain were detected. Only 16 of 107 platypus genes with high similarity to known toxins evolved through gene duplication. Platypus venom C-type natriuretic peptides and nerve growth factor do not possess lineage-specific gene duplicates. Extensive duplications, believed to increase the potency of toxic content and promote toxin diversification, were not found. This is the first study to take a genome-wide approach in order to examine the impact of gene duplication on venom evolution. Our findings support the idea that adaptive selection acts on gene duplicates to drive the independent evolution and functional diversification of similar venom genes in venomous species. However, gene duplications alone do not explain the “venome” of the platypus. Other mechanisms, such as alternative splicing and mutation, may be important in venom innovation. PMID:21816864

  9. Structured association analysis leads to insight into Saccharomyces cerevisiae gene regulation by finding multiple contributing eQTL hotspots associated with functional gene modules.

    PubMed

    Curtis, Ross E; Kim, Seyoung; Woolford, John L; Xu, Wenjie; Xing, Eric P

    2013-03-21

    Association analysis using genome-wide expression quantitative trait locus (eQTL) data investigates the effect that genetic variation has on cellular pathways and leads to the discovery of candidate regulators. Traditional analysis of eQTL data via pairwise statistical significance tests or linear regression does not leverage the availability of the structural information of the transcriptome, such as presence of gene networks that reveal correlation and potentially regulatory relationships among the study genes. We employ a new eQTL mapping algorithm, GFlasso, which we have previously developed for sparse structured regression, to reanalyze a genome-wide yeast dataset. GFlasso fully takes into account the dependencies among expression traits to suppress false positives and to enhance the signal/noise ratio. Thus, GFlasso leverages the gene-interaction network to discover the pleiotropic effects of genetic loci that perturb the expression level of multiple (rather than individual) genes, which enables us to gain more power in detecting previously neglected signals that are marginally weak but pleiotropically significant. While eQTL hotspots in yeast have been reported previously as genomic regions controlling multiple genes, our analysis reveals additional novel eQTL hotspots and, more interestingly, uncovers groups of multiple contributing eQTL hotspots that affect the expression level of functional gene modules. To our knowledge, our study is the first to report this type of gene regulation stemming from multiple eQTL hotspots. Additionally, we report the results from in-depth bioinformatics analysis for three groups of these eQTL hotspots: ribosome biogenesis, telomere silencing, and retrotransposon biology. We suggest candidate regulators for the functional gene modules that map to each group of hotspots. Not only do we find that many of these candidate regulators contain mutations in the promoter and coding regions of the genes, in the case of the Ribi group, we provide experimental evidence suggesting that the identified candidates do regulate the target genes predicted by GFlasso. Thus, this structured association analysis of a yeast eQTL dataset via GFlasso, coupled with extensive bioinformatics analysis, discovers a novel regulation pattern between multiple eQTL hotspots and functional gene modules. Furthermore, this analysis demonstrates the potential of GFlasso as a powerful computational tool for eQTL studies that exploit the rich structural information among expression traits due to correlation, regulation, or other forms of biological dependencies.

  10. Analysis of resistance genes of clinical Pannonibacter phragmitetus strain 31801 by complete genome sequencing.

    PubMed

    Ming, De-Song; Chen, Qing-Qing; Chen, Xiao-Tin

    2018-05-14

    To clarify the resistance mechanisms of Pannonibacter phragmitetus 31801, isolated from the blood of a liver abscess patient, at the genomic level, we performed whole genomic sequencing using a PacBio RS II single-molecule real-time long-read sequencer. Bioinformatic analysis of the resulting sequence was then carried out to identify any possible resistance genes. Analyses included Basic Local Alignment Search Tool searches against the Antibiotic Resistance Genes Database, ResFinder analysis of the genome sequence, and Resistance Gene Identifier analysis within the Comprehensive Antibiotic Resistance Database. Prophages, clustered regularly interspaced short palindromic repeats (CRISPR), and other putative virulence factors were also identified using PHAST, CRISPRfinder, and the Virulence Factors Database, respectively. The circular chromosome and single plasmid of P. phragmitetus 31801 contained multiple antibiotic resistance genes, including those coding for three different types of β-lactamase [NPS β-lactamase (EC 3.5.2.6), β-lactamase class C, and a metal-dependent hydrolase of β-lactamase superfamily I]. In addition, genes coding for subunits of several multidrug-resistance efflux pumps were identified, including those targeting macrolides (adeJ, cmeB), tetracycline (acrB, adeAB), fluoroquinolones (acrF, ceoB), and aminoglycosides (acrD, amrB, ceoB, mexY, smeB). However, apart from the tripartite macrolide efflux pump macAB-tolC, the genome did not appear to contain the complete complement of subunit genes required for production of most of the major multidrug-resistance efflux pumps.

  11. Aberrant gene promoter methylation associated with sporadic multiple colorectal cancer.

    PubMed

    Gonzalo, Victoria; Lozano, Juan José; Muñoz, Jenifer; Balaguer, Francesc; Pellisé, Maria; Rodríguez de Miguel, Cristina; Andreu, Montserrat; Jover, Rodrigo; Llor, Xavier; Giráldez, M Dolores; Ocaña, Teresa; Serradesanferm, Anna; Alonso-Espinaco, Virginia; Jimeno, Mireya; Cuatrecasas, Miriam; Sendino, Oriol; Castellví-Bel, Sergi; Castells, Antoni

    2010-01-19

    Colorectal cancer (CRC) multiplicity has been mainly related to polyposis and non-polyposis hereditary syndromes. In sporadic CRC, aberrant gene promoter methylation has been shown to play a key role in carcinogenesis, although little is known about its involvement in multiplicity. To assess the effect of methylation in tumor multiplicity in sporadic CRC, hypermethylation of key tumor suppressor genes was evaluated in patients with both multiple and solitary tumors, as a proof-of-concept of an underlying epigenetic defect. We examined a total of 47 synchronous/metachronous primary CRC from 41 patients, and 41 gender, age (5-year intervals) and tumor location-paired patients with solitary tumors. Exclusion criteria were polyposis syndromes, Lynch syndrome and inflammatory bowel disease. DNA methylation at the promoter region of the MGMT, CDKN2A, SFRP1, TMEFF2, HS3ST2 (3OST2), RASSF1A and GATA4 genes was evaluated by quantitative methylation specific PCR in both tumor and corresponding normal appearing colorectal mucosa samples. Overall, patients with multiple lesions exhibited a higher degree of methylation in tumor samples than those with solitary tumors regarding all evaluated genes. After adjusting for age and gender, binomial logistic regression analysis identified methylation of MGMT2 (OR, 1.48; 95% CI, 1.10 to 1.97; p = 0.008) and RASSF1A (OR, 2.04; 95% CI, 1.01 to 4.13; p = 0.047) as variables independently associated with tumor multiplicity, being the risk related to methylation of any of these two genes 4.57 (95% CI, 1.53 to 13.61; p = 0.006). Moreover, in six patients in whom both tumors were available, we found a correlation in the methylation levels of MGMT2 (r = 0.64, p = 0.17), SFRP1 (r = 0.83, 0.06), HPP1 (r = 0.64, p = 0.17), 3OST2 (r = 0.83, p = 0.06) and GATA4 (r = 0.6, p = 0.24). Methylation in normal appearing colorectal mucosa from patients with multiple and solitary CRC showed no relevant difference in any evaluated gene. These results provide a proof-of-concept that gene promoter methylation is associated with tumor multiplicity. This underlying epigenetic defect may have noteworthy implications in the prevention of patients with sporadic CRC.

  12. Genetic variation in the oxytocin receptor (OXTR) gene is associated with Asperger Syndrome.

    PubMed

    Di Napoli, Agnese; Warrier, Varun; Baron-Cohen, Simon; Chakrabarti, Bhismadev

    2014-01-01

    Autism Spectrum Conditions (ASC) are a group of neurodevelopmental conditions characterized by impairments in communication and social interaction, alongside unusually repetitive behaviors and narrow interests. ASC are highly heritable and have complex patterns of inheritance where multiple genes are involved, alongside environmental and epigenetic factors. Asperger Syndrome (AS) is a subgroup of these conditions, where there is no history of language or cognitive delay. Animal models suggest a role for oxytocin (OXT) and oxytocin receptor (OXTR) genes in social-emotional behaviors, and several studies indicate that the oxytocin/oxytocin receptor system is altered in individuals with ASC. Previous studies have reported associations between genetic variations in the OXTR gene and ASC. The present study tested for an association between nine single nucleotide polymorphisms (SNPs) in the OXTR gene and AS in 530 individuals of Caucasian origin, using SNP association test and haplotype analysis. There was a significant association between rs2268493 in OXTR and AS. Multiple haplotypes that include this SNP (rs2268493-rs2254298, rs2268490-rs2268493-rs2254298, rs2268493-rs2254298-rs53576, rs237885-rs2268490-rs2268493-rs2254298, rs2268490-rs2268493-rs2254298-rs53576) were also associated with AS. rs2268493 has been previously associated with ASC and putatively alters several transcription factor-binding sites and regulates chromatin states, either directly or through other variants in linkage disequilibrium (LD). This study reports a significant association of the sequence variant rs2268493 in the OXTR gene and associated haplotypes with AS.

  13. A phylotranscriptomic backbone of the orb-weaving spider family Araneidae (Arachnida, Araneae) supported by multiple methodological approaches.

    PubMed

    Kallal, Robert J; Fernández, Rosa; Giribet, Gonzalo; Hormiga, Gustavo

    2018-04-07

    The orb-weaving spider family Araneidae is extremely diverse (>3100 spp.) and its members can be charismatic terrestrial arthropods, many of them recognizable by their iconic orbicular snare web, such as the common garden spiders. Despite considerable effort to better understand their backbone relationships based on multiple sources of data (morphological, behavioral and molecular), pervasive low support remains in recent studies. In addition, no overarching phylogeny of araneids is available to date, hampering further comparative work. In this study, we analyze the transcriptomes of 33 taxa, including 19 araneids - 12 of them new to this study - representing most of the core family lineages, to examine the relationships within the family using genomic-scale datasets resulting from various methodological treatments, namely ortholog selection and gene occupancy as a measure of matrix completion. Six matrices were constructed to assess these effects by varying orthology inference method and gene occupancy threshold. Orthology methods used are the benchmarking tool BUSCO and the tree-based method UPhO; three gene occupancy thresholds (45%, 65%, 85%) were used to assess the effect of missing data. Gene tree and species tree-based methods (including multi-species coalescent and concatenation approaches, as well as maximum likelihood and Bayesian inference) were used totalling 17 analytical treatments. The monophyly of Araneidae and the placement of core araneid lineages were supported, together with some previously unsound backbone divergences; these include high support for Zygiellinae as the earliest diverging subfamily (followed by Nephilinae), the placement of Gasteracanthinae as sister group to Cyclosa and close relatives, and close relationships between the Araneus + Neoscona clade and Cyrtophorinae + Argiopinae clade. Incongruences were relegated to short branches in the clade comprising Cyclosa and its close relatives. We found congruence between most of the completed analyses, with minimal topological effects from occupancy/missing data and orthology assessment. The resulting number of genes by certain combinations of orthology and occupancy thresholds being analyzed had the greatest effect on the resulting trees, with anomalous outcomes recovered from analysis of lower numbers of genes. Copyright © 2018 Elsevier Inc. All rights reserved.

  14. Cardiomyocyte-Specific Ablation of Med1 Subunit of the Mediator Complex Causes Lethal Dilated Cardiomyopathy in Mice.

    PubMed

    Jia, Yuzhi; Chang, Hsiang-Chun; Schipma, Matthew J; Liu, Jing; Shete, Varsha; Liu, Ning; Sato, Tatsuya; Thorp, Edward B; Barger, Philip M; Zhu, Yi-Jun; Viswakarma, Navin; Kanwar, Yashpal S; Ardehali, Hossein; Thimmapaya, Bayar; Reddy, Janardan K

    2016-01-01

    Mediator, an evolutionarily conserved multi-protein complex consisting of about 30 subunits, is a key component of the polymerase II mediated gene transcription. Germline deletion of the Mediator subunit 1 (Med1) of the Mediator in mice results in mid-gestational embryonic lethality with developmental impairment of multiple organs including heart. Here we show that cardiomyocyte-specific deletion of Med1 in mice (csMed1-/-) during late gestational and early postnatal development by intercrossing Med1fl/fl mice to α-MyHC-Cre transgenic mice results in lethality within 10 days after weaning due to dilated cardiomyopathy-related ventricular dilation and heart failure. The csMed1-/- mouse heart manifests mitochondrial damage, increased apoptosis and interstitial fibrosis. Global gene expression analysis revealed that loss of Med1 in heart down-regulates more than 200 genes including Acadm, Cacna1s, Atp2a2, Ryr2, Pde1c, Pln, PGC1α, and PGC1β that are critical for calcium signaling, cardiac muscle contraction, arrhythmogenic right ventricular cardiomyopathy, dilated cardiomyopathy and peroxisome proliferator-activated receptor regulated energy metabolism. Many genes essential for oxidative phosphorylation and proper mitochondrial function such as genes coding for the succinate dehydrogenase subunits of the mitochondrial complex II are also down-regulated in csMed1-/- heart contributing to myocardial injury. Data also showed up-regulation of about 180 genes including Tgfb2, Ace, Atf3, Ctgf, Angpt14, Col9a2, Wisp2, Nppa, Nppb, and Actn1 that are linked to cardiac muscle contraction, cardiac hypertrophy, cardiac fibrosis and myocardial injury. Furthermore, we demonstrate that cardiac specific deletion of Med1 in adult mice using tamoxifen-inducible Cre approach (TmcsMed1-/-), results in rapid development of cardiomyopathy and death within 4 weeks. We found that the key findings of the csMed1-/- studies described above are highly reproducible in TmcsMed1-/- mouse heart. Collectively, these observations suggest that Med1 plays a critical role in the maintenance of heart function impacting on multiple metabolic, compensatory and reparative pathways with a likely therapeutic potential in the management of heart failure.

  15. The ‘Pokemon’ (ZBTB7) Gene: No Evidence of Association with Sporadic Breast Cancer

    PubMed Central

    Salas, Antonio; Vega, Ana; Milne, Roger L.; García-Magariños, Manuel; Ruibal, Álvaro; Benítez, Javier; Carracedo, Ángel

    2008-01-01

    It has been proposed that the excess of familiar risk associated with breast cancer could be explained by the cumulative effect of multiple weakly predisposing alleles. The transcriptional repressor FBI1, also known as Pokemon, has recently been identified as a critical factor in oncogenesis. This protein is encoded by the ZBTB7 gene. Here we aimed to determine whether polymorphisms in ZBTB7 are associated with breast cancer risk in a sample of cases and controls collected in hospitals from North and Central Spanish patients. We genotyped 15 SNPs in ZBTB7, including the flanking regions, with an average coverage of 1 SNP/2.4 Kb, in 360 sporadic breast cancer cases and 402 controls. Comparison of allele, genotype and haplotype frequencies between cases and controls did not reveal associations using Pearson’s chi-square test and a permutation procedure to correct for multiple test. In this, the first study of the ZBTB7 gene in relation to, sporadic breast cancer, we found no evidence of an association. PMID:21892298

  16. Genetic Assessment of African Swine Fever Isolates Involved in Outbreaks in the Democratic Republic of Congo between 2005 and 2012 Reveals Co-Circulation of p72 Genotypes I, IX and XIV, Including 19 Variants

    PubMed Central

    Mulumba–Mfumu, Leopold K.; Achenbach, Jenna E.; Mauldin, Matthew R.; Dixon, Linda K.; Tshilenge, Curé Georges; Thiry, Etienne; Moreno, Noelia; Blanco, Esther; Saegerman, Claude; Lamien, Charles E.; Diallo, Adama

    2017-01-01

    African swine fever (ASF) is a devastating disease of domestic pigs. It is a socioeconomically important disease, initially described from Kenya, but subsequently reported in most Sub-Saharan countries. ASF spread to Europe, South America and the Caribbean through multiple introductions which were initially eradicated—except for Sardinia—followed by re‑introduction into Europe in 2007. In this study of ASF within the Democratic Republic of the Congo, 62 domestic pig samples, collected between 2005–2012, were examined for viral DNA and sequencing at multiple loci: C-terminus of the B646L gene (p72 protein), central hypervariable region (CVR) of the B602L gene, and the E183L gene (p54 protein). Phylogenetic analyses identified three circulating genotypes: I (64.5% of samples), IX (32.3%), and XIV (3.2%). This is the first evidence of genotypes IX and XIV within this country. Examination of the CVR revealed high levels of intra-genotypic variation, with 19 identified variants. PMID:28218698

  17. Survival, gene and metabolite responses of Litoria verreauxii alpina frogs to fungal disease chytridiomycosis

    NASA Astrophysics Data System (ADS)

    Grogan, Laura F.; Mulvenna, Jason; Gummer, Joel P. A.; Scheele, Ben C.; Berger, Lee; Cashins, Scott D.; McFadden, Michael S.; Harlow, Peter; Hunter, David A.; Trengove, Robert D.; Skerratt, Lee F.

    2018-03-01

    The fungal skin disease chytridiomycosis has caused the devastating decline and extinction of hundreds of amphibian species globally, yet the potential for evolving resistance, and the underlying pathophysiological mechanisms remain poorly understood. We exposed 406 naïve, captive-raised alpine tree frogs (Litoria verreauxii alpina) from multiple populations (one evolutionarily naïve to chytridiomycosis) to the aetiological agent Batrachochytrium dendrobatidis in two concurrent and controlled infection experiments. We investigated (A) survival outcomes and clinical pathogen burdens between populations and clutches, and (B) individual host tissue responses to chytridiomycosis. Here we present multiple interrelated datasets associated with these exposure experiments, including animal signalment, survival and pathogen burden of 355 animals from Experiment A, and the following datasets related to 61 animals from Experiment B: animal signalment and pathogen burden; raw RNA-Seq reads from skin, liver and spleen tissues; de novo assembled transcriptomes for each tissue type; raw gene expression data; annotation data for each gene; and raw metabolite expression data from skin and liver tissues. These data provide an extensive baseline for future analyses.

  18. Genetic Assessment of African Swine Fever Isolates Involved in Outbreaks in the Democratic Republic of Congo between 2005 and 2012 Reveals Co-Circulation of p72 Genotypes I, IX and XIV, Including 19 Variants.

    PubMed

    Mulumba-Mfumu, Leopold K; Achenbach, Jenna E; Mauldin, Matthew R; Dixon, Linda K; Tshilenge, Curé Georges; Thiry, Etienne; Moreno, Noelia; Blanco, Esther; Saegerman, Claude; Lamien, Charles E; Diallo, Adama

    2017-02-18

    African swine fever (ASF) is a devastating disease of domestic pigs. It is a socioeconomically important disease, initially described from Kenya, but subsequently reported in most Sub-Saharan countries. ASF spread to Europe, South America and the Caribbean through multiple introductions which were initially eradicated-except for Sardinia-followed by re‑introduction into Europe in 2007. In this study of ASF within the Democratic Republic of the Congo, 62 domestic pig samples, collected between 2005-2012, were examined for viral DNA and sequencing at multiple loci: C-terminus of the B646L gene (p72 protein), central hypervariable region (CVR) of the B602L gene, and the E183L gene (p54 protein). Phylogenetic analyses identified three circulating genotypes: I (64.5% of samples), IX (32.3%), and XIV (3.2%). This is the first evidence of genotypes IX and XIV within this country. Examination of the CVR revealed high levels of intra-genotypic variation, with 19 identified variants.

  19. Occurrence and properties of composite transposon Tn2672: evolution of multiple drug resistance transposons.

    PubMed Central

    Hänni, C; Meyer, J; Iida, S; Arber, W

    1982-01-01

    We found Tn2671 (the 23-kb long IS1-flanked r-determinant of NR1-Basel) inserted into the ampicillin resistance gene bla of the Tn3-related transposon Tn902. The resulting 28-kilobase-long composite transposon Tn2672 (= Tn902 bla::Tn2671) is stable, and it translocates as a unit into various loci including IS1 of the resistance transfer factor of R100-1. These results are discussed with respect to the evolution of R plasmids providing multiple drug resistance. Images PMID:6281241

  20. Predicting effects of structural stress in a genome-reduced model bacterial metabolism

    NASA Astrophysics Data System (ADS)

    Güell, Oriol; Sagués, Francesc; Serrano, M. Ángeles

    2012-08-01

    Mycoplasma pneumoniae is a human pathogen recently proposed as a genome-reduced model for bacterial systems biology. Here, we study the response of its metabolic network to different forms of structural stress, including removal of individual and pairs of reactions and knockout of genes and clusters of co-expressed genes. Our results reveal a network architecture as robust as that of other model bacteria regarding multiple failures, although less robust against individual reaction inactivation. Interestingly, metabolite motifs associated to reactions can predict the propagation of inactivation cascades and damage amplification effects arising in double knockouts. We also detect a significant correlation between gene essentiality and damages produced by single gene knockouts, and find that genes controlling high-damage reactions tend to be expressed independently of each other, a functional switch mechanism that, simultaneously, acts as a genetic firewall to protect metabolism. Prediction of failure propagation is crucial for metabolic engineering or disease treatment.

  1. Discrete domains of gene expression in germinal layers distinguish the development of gyrencephaly

    PubMed Central

    de Juan Romero, Camino; Bruder, Carl; Tomasello, Ugo; Sanz-Anquela, José Miguel; Borrell, Víctor

    2015-01-01

    Gyrencephalic species develop folds in the cerebral cortex in a stereotypic manner, but the genetic mechanisms underlying this patterning process are unknown. We present a large-scale transcriptomic analysis of individual germinal layers in the developing cortex of the gyrencephalic ferret, comparing between regions prospective of fold and fissure. We find unique transcriptional signatures in each germinal compartment, where thousands of genes are differentially expressed between regions, including ∼80% of genes mutated in human cortical malformations. These regional differences emerge from the existence of discrete domains of gene expression, which occur at multiple locations across the developing cortex of ferret and human, but not the lissencephalic mouse. Complex expression patterns emerge late during development and map the eventual location of folds or fissures. Protomaps of gene expression within germinal layers may contribute to define cortical folds or functional areas, but our findings demonstrate that they distinguish the development of gyrencephalic cortices. PMID:25916825

  2. Linkage analysis of schizophrenia with five dopamine receptor genes in nine pedigrees

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Coon, H.; Byerley, W.; Holik, J.

    Alterations in dopamine neurotransmission have been strongly implicated in the pathogenesis of schizophrenia for nearly 2 decades. Recently, the genes for five dopamine receptors have been cloned and characterized, and genetic and physical map information has become available. Using these five loci as candidate genes, the authors have tested for genetic linkage to schizophrenia in nine multigenerational families which include multiple affected individuals. In addition to testing conservative disease models, the have used a neurophysiological indicator variable, the P50 auditory evoked response. Deficits in gating of the P50 response have been shown to segregate with schizophrenia in this sample andmore » may identify carriers of gene(s) predisposing for schizophrenia. Linkage results were consistently negative, indicating that a defect at any of the actual receptor sites is unlikely to be a major contributor to schizophrenia in the nine families studied. 47 refs., 1 fig., 4 tabs.« less

  3. Mining microarrays for metabolic meaning: nutritional regulation of hypothalamic gene expression.

    PubMed

    Mobbs, Charles V; Yen, Kelvin; Mastaitis, Jason; Nguyen, Ha; Watson, Elizabeth; Wurmbach, Elisa; Sealfon, Stuart C; Brooks, Andrew; Salton, Stephen R J

    2004-06-01

    DNA microarray analysis has been used to investigate relative changes in the level of gene expression in the CNS, including changes that are associated with disease, injury, psychiatric disorders, drug exposure or withdrawal, and memory formation. We have used oligonucleotide microarrays to identify hypothalamic genes that respond to nutritional manipulation. In addition to commonly used microarray analysis based on criteria such as fold-regulation, we have also found that simply carrying out multiple t tests then sorting by P value constitutes a highly reliable method to detect true regulation, as assessed by real-time polymerase chain reaction (PCR), even for relatively low abundance genes or relatively low magnitude of regulation. Such analyses directly suggested novel mechanisms that mediate effects of nutritional state on neuroendocrine function and are being used to identify regulated gene products that may elucidate the metabolic pathology of obese ob/ob, lean Vgf-/Vgf-, and other models with profound metabolic impairments.

  4. Applications and Limitations of Mouse Models for Understanding Human Atherosclerosis

    PubMed Central

    von Scheidt, Moritz; Zhao, Yuqi; Kurt, Zeyneb; Pan, Calvin; Zeng, Lingyao; Yang, Xia; Schunkert, Heribert; Lusis, Aldons J.

    2017-01-01

    Most of the biological understanding of mechanisms underlying coronary artery disease (CAD) derives from studies of mouse models. The identification of multiple CAD loci and strong candidate genes in large human genome-wide association studies (GWAS) presented an opportunity to examine the relevance of mouse models for the human disease. We comprehensively reviewed the mouse literature, including 827 literature-derived genes, and compared it to human data. First, we observed striking concordance of risk factors for atherosclerosis in mice and humans. Second, there was highly significant overlap of mouse genes with human genes identified by GWAS. In particular, of the 46 genes with strong association signals in CAD-GWAS that were studied in mouse models all but one exhibited consistent effects on atherosclerosis-related phenotypes. Third, we compared 178 CAD-associated pathways derived from human GWAS with 263 from mouse studies and observed that over 50% were consistent between both species. PMID:27916529

  5. Non-invasive imaging using reporter genes altering cellular water permeability

    NASA Astrophysics Data System (ADS)

    Mukherjee, Arnab; Wu, Di; Davis, Hunter C.; Shapiro, Mikhail G.

    2016-12-01

    Non-invasive imaging of gene expression in live, optically opaque animals is important for multiple applications, including monitoring of genetic circuits and tracking of cell-based therapeutics. Magnetic resonance imaging (MRI) could enable such monitoring with high spatiotemporal resolution. However, existing MRI reporter genes based on metalloproteins or chemical exchange probes are limited by their reliance on metals or relatively low sensitivity. Here we introduce a new class of MRI reporters based on the human water channel aquaporin 1. We show that aquaporin overexpression produces contrast in diffusion-weighted MRI by increasing tissue water diffusivity without affecting viability. Low aquaporin levels or mixed populations comprising as few as 10% aquaporin-expressing cells are sufficient to produce MRI contrast. We characterize this new contrast mechanism through experiments and simulations, and demonstrate its utility in vivo by imaging gene expression in tumours. Our results establish an alternative class of sensitive, metal-free reporter genes for non-invasive imaging.

  6. Interleukin 35 and Hepatocyte Growth Factor; as a novel combined immune gene therapy for Multiple Sclerosis disease.

    PubMed

    Moghadam, Samira; Erfanmanesh, Maryam; Esmaeilzadeh, Abdolreza

    2017-11-01

    An autoimmune demyelination disease of the Central Nervous System, Multiple Sclerosis, is a chronic inflammation which mostly involves young adults. Suffering people face functional loss with a severe pain. Most current MS treatments are focused on the immune response suppression. Approved drugs suppress the inflammatory process, but factually, there is no definite cure for Multiple Sclerosis. Recently developed knowledge has demonstrated that gene and cell therapy as a hopeful approach in tissue regeneration. The authors propose a novel combined immune gene therapy for Multiple Sclerosis treatment using anti-inflammatory and remyelination of Interleukine-35 and Hepatocyte Growth Factor properties, respectively. In this hypothesis Interleukine-35 and Hepatocyte Growth Factor introduce to Mesenchymal Stem Cells of EAE mouse model via an adenovirus based vector. It is expected that Interleukine-35 and Hepatocyte Growth Factor genes expressed from MSCs could effectively perform in immunotherapy of Multiple Sclerosis. Copyright © 2017. Published by Elsevier Ltd.

  7. An Unbiased Systems Genetics Approach to Mapping Genetic Loci Modulating Susceptibility to Severe Streptococcal Sepsis

    PubMed Central

    Abdeltawab, Nourtan F.; Aziz, Ramy K.; Kansal, Rita; Rowe, Sarah L.; Su, Yin; Gardner, Lidia; Brannen, Charity; Nooh, Mohammed M.; Attia, Ramy R.; Abdelsamed, Hossam A.; Taylor, William L.; Lu, Lu; Williams, Robert W.; Kotb, Malak

    2008-01-01

    Striking individual differences in severity of group A streptococcal (GAS) sepsis have been noted, even among patients infected with the same bacterial strain. We had provided evidence that HLA class II allelic variation contributes significantly to differences in systemic disease severity by modulating host responses to streptococcal superantigens. Inasmuch as the bacteria produce additional virulence factors that participate in the pathogenesis of this complex disease, we sought to identify additional gene networks modulating GAS sepsis. Accordingly, we applied a systems genetics approach using a panel of advanced recombinant inbred mice. By analyzing disease phenotypes in the context of mice genotypes we identified a highly significant quantitative trait locus (QTL) on Chromosome 2 between 22 and 34 Mb that strongly predicts disease severity, accounting for 25%–30% of variance. This QTL harbors several polymorphic genes known to regulate immune responses to bacterial infections. We evaluated candidate genes within this QTL using multiple parameters that included linkage, gene ontology, variation in gene expression, cocitation networks, and biological relevance, and identified interleukin1 alpha and prostaglandin E synthases pathways as key networks involved in modulating GAS sepsis severity. The association of GAS sepsis with multiple pathways underscores the complexity of traits modulating GAS sepsis and provides a powerful approach for analyzing interactive traits affecting outcomes of other infectious diseases. PMID:18421376

  8. Tracing evolutionary relicts of positive selection on eight malaria-related immune genes in mammals.

    PubMed

    Huang, Bing-Hong; Liao, Pei-Chun

    2015-07-01

    Plasmodium-induced malaria widely infects primates and other mammals. Multiple past studies have revealed that positive selection could be the main evolutionary force triggering the genetic diversity of anti-malaria resistance-associated genes in human or primates. However, researchers focused most of their attention on the infra-generic and intra-specific genome evolution rather than analyzing the complete evolutionary history of mammals. Here we extend previous research by testing the evolutionary link of natural selection on eight candidate genes associated with malaria resistance in mammals. Three of the eight genes were detected to be affected by recombination, including TNF-α, iNOS and DARC. Positive selection was detected in the rest five immunogenes multiple times in different ancestral lineages of extant species throughout the mammalian evolution. Signals of positive selection were exposed in four malaria-related immunogenes in primates: CCL2, IL-10, HO1 and CD36. However, selection signals of G6PD have only been detected in non-primate eutherians. Significantly higher evolutionary rates and more radical amino acid replacement were also detected in primate CD36, suggesting its functional divergence from other eutherians. Prevalent positive selection throughout the evolutionary trajectory of mammalian malaria-related genes supports the arms race evolutionary hypothesis of host genetic response of mammalian immunogenes to infectious pathogens. © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  9. Polymorphisms in genes encoding leptin, ghrelin and their receptors in German multiple sclerosis patients.

    PubMed

    Rey, Linda K; Wieczorek, Stefan; Akkad, Denis A; Linker, Ralf A; Chan, Andrew; Hoffjan, Sabine

    2011-01-01

    Multiple sclerosis (MS) is a neuro-inflammatory, autoimmune disease influenced by environmental and polygenic components. There is growing evidence that the peptide hormone leptin, known to regulate energy homeostasis, as well as its antagonist ghrelin play an important role in inflammatory processes in autoimmune diseases, including MS. Recently, single nucleotide polymorphisms (SNPs) in the genes encoding leptin, ghrelin and their receptors were evaluated, amongst others, in Wegener's granulomatosis and Churg-Strauss syndrome. The Lys656Asn SNP in the LEPR gene showed a significant but contrasting association with these vasculitides. We therefore aimed at investigating these polymorphisms in a German MS case-control cohort. Twelve SNPs in the LEP, LEPR, GHRL and GHSR genes were genotyped in 776 MS patients and 878 control subjects. We found an association of a haplotype in the GHSR gene with MS that could not be replicated in a second cohort. Otherwise, no significant differences in allele or genotype frequencies were observed between patients and controls in this particular cohort. Thus, the present results do not support the hypothesis that genetic variation in the leptin/ghrelin system contributes substantially to the pathogenesis of MS. However, a modest effect of GHSR variation cannot be ruled out and needs to be further evaluated in future studies. Copyright © 2011 Elsevier Ltd. All rights reserved.

  10. Potential hot spot for de novo mutations in PTCH1 gene in Gorlin syndrome patients: a case report of twins from Croatia.

    PubMed

    Musani, Vesna; Ozretić, Petar; Trnski, Diana; Sabol, Maja; Poduje, Sanja; Tošić, Mateja; Šitum, Mirna; Levanat, Sonja

    2018-02-28

    We describe a case of twins with sporadic Gorlin syndrome. Both twins had common Gorlin syndrome features including calcification of the falx cerebri, multiple jaw keratocysts, and multiple basal cell carcinomas, but with different expressivity. One brother also had benign testicular mesothelioma. We propose this tumor type as a possible new feature of Gorlin syndrome. Gorlin syndrome is a rare autosomal dominant disorder characterized by both developmental abnormalities and cancer predisposition, with variable expression of various developmental abnormalities and different types of tumors. The syndrome is primarily caused by mutations in the Patched 1 (PTCH1) gene, although rare mutations of Patched 2 (PTCH2) or Suppressor of Fused (SUFU) genes have also been found. Neither founder mutations nor hot spot locations have been described for PTCH1 in Gorlin syndrome patients. Although de novo mutations of the PTCH1 gene occur in almost 50% of Gorlin syndrome cases, there are a few recurrent mutations. Our twin patients were carriers of a de novo mutation in the PTCH1 gene, c.3364_3365delAT (p.Met1122ValfsX22). This is, to our knowledge, the first Gorlin syndrome-causing mutation that has been reported four independent times in distant geographical locations. Therefore, we propose the location of the described mutation as a potential hot spot for mutations in PTCH1.

  11. A Genomic Score Prognostic of Outcome in Trauma Patients

    PubMed Central

    Warren, H Shaw; Elson, Constance M; Hayden, Douglas L; Schoenfeld, David A; Cobb, J Perren; Maier, Ronald V; Moldawer, Lyle L; Moore, Ernest E; Harbrecht, Brian G; Pelak, Kimberly; Cuschieri, Joseph; Herndon, David N; Jeschke, Marc G; Finnerty, Celeste C; Brownstein, Bernard H; Hennessy, Laura; Mason, Philip H; Tompkins, Ronald G

    2009-01-01

    Traumatic injuries frequently lead to infection, organ failure, and death. Health care providers rely on several injury scoring systems to quantify the extent of injury and to help predict clinical outcome. Physiological, anatomical, and clinical laboratory analytic scoring systems (Acute Physiology and Chronic Health Evaluation [APACHE], Injury Severity Score [ISS]) are utilized, with limited success, to predict outcome following injury. The recent development of techniques for measuring the expression level of all of a person’s genes simultaneously may make it possible to develop an injury scoring system based on the degree of gene activation. We hypothesized that a peripheral blood leukocyte gene expression score could predict outcome, including multiple organ failure, following severe blunt trauma. To test such a scoring system, we measured gene expression of peripheral blood leukocytes from patients within 12 h of traumatic injury. cRNA derived from whole blood leukocytes obtained within 12 h of injury provided gene expression data for the entire genome that were used to create a composite gene expression score for each patient. Total blood leukocytes were chosen because they are active during inflammation, which is reflective of poor outcome. The gene expression score combines the activation levels of all the genes into a single number which compares the patient’s gene expression to the average gene expression in uninjured volunteers. Expression profiles from healthy volunteers were averaged to create a reference gene expression profile which was used to compute a difference from reference (DFR) score for each patient. This score described the overall genomic response of patients within the first 12 h following severe blunt trauma. Regression models were used to compare the association of the DFR, APACHE, and ISS scores with outcome. We hypothesized that patients with a total gene response more different from uninjured volunteers would tend to have poorer outcome than those more similar. Our data show that for measures of poor outcome, such as infections, organ failures, and length of hospital stay, this is correct. DFR scores were associated significantly with adverse outcome, including multiple organ failure, duration of ventilation, length of hospital stay, and infection rate. The association remained significant after adjustment for injury severity as measured by APACHE or ISS. A single score representing changes in gene expression in peripheral blood leukocytes within hours of severe blunt injury is associated with adverse clinical outcomes that develop later in the hospital course. Assessment of genome-wide gene expression provides useful clinical information that is different from that provided by currently utilized anatomic or physiologic scores. PMID:19593405

  12. Lateral Gene Transfer in a Heavy Metal-Contaminated-Groundwater Microbial Community

    PubMed Central

    Hemme, Christopher L.; Green, Stefan J.; Rishishwar, Lavanya; Prakash, Om; Pettenato, Angelica; Chakraborty, Romy; Deutschbauer, Adam M.; Van Nostrand, Joy D.; Wu, Liyou; He, Zhili; Jordan, I. King; Arkin, Adam P.; Kostka, Joel E.

    2016-01-01

    ABSTRACT Unraveling the drivers controlling the response and adaptation of biological communities to environmental change, especially anthropogenic activities, is a central but poorly understood issue in ecology and evolution. Comparative genomics studies suggest that lateral gene transfer (LGT) is a major force driving microbial genome evolution, but its role in the evolution of microbial communities remains elusive. To delineate the importance of LGT in mediating the response of a groundwater microbial community to heavy metal contamination, representative Rhodanobacter reference genomes were sequenced and compared to shotgun metagenome sequences. 16S rRNA gene-based amplicon sequence analysis indicated that Rhodanobacter populations were highly abundant in contaminated wells with low pHs and high levels of nitrate and heavy metals but remained rare in the uncontaminated wells. Sequence comparisons revealed that multiple geochemically important genes, including genes encoding Fe2+/Pb2+ permeases, most denitrification enzymes, and cytochrome c553, were native to Rhodanobacter and not subjected to LGT. In contrast, the Rhodanobacter pangenome contained a recombinational hot spot in which numerous metal resistance genes were subjected to LGT and/or duplication. In particular, Co2+/Zn2+/Cd2+ efflux and mercuric resistance operon genes appeared to be highly mobile within Rhodanobacter populations. Evidence of multiple duplications of a mercuric resistance operon common to most Rhodanobacter strains was also observed. Collectively, our analyses indicated the importance of LGT during the evolution of groundwater microbial communities in response to heavy metal contamination, and a conceptual model was developed to display such adaptive evolutionary processes for explaining the extreme dominance of Rhodanobacter populations in the contaminated groundwater microbiome. PMID:27048805

  13. Epigenetic changes in leukocytes after 8 weeks of resistance exercise training.

    PubMed

    Denham, Joshua; Marques, Francine Z; Bruns, Emma L; O'Brien, Brendan J; Charchar, Fadi J

    2016-06-01

    Regular engagement in resistance exercise training elicits many health benefits including improvement to muscular strength, hypertrophy and insulin sensitivity, though the underpinning molecular mechanisms are poorly understood. The purpose of this study was to determine the influence 8 weeks of resistance exercise training has on leukocyte genome-wide DNA methylation and gene expression in healthy young men. Eight young (21.1 ± 2.2 years) men completed one repetition maximum (1RM) testing before completing 8 weeks of supervised, thrice-weekly resistance exercise training comprising three sets of 8-12 repetitions with a load equivalent to 80 % of 1RM. Blood samples were collected at rest before and after the 8-week training intervention. Genome-wide DNA methylation and gene expression were assessed on isolated leukocyte DNA and RNA using the 450K BeadChip and HumanHT-12 v4 Expression BeadChip (Illumina), respectively. Resistance exercise training significantly improved upper and lower body strength concurrently with diverse genome-wide DNA methylation and gene expression changes (p ≤ 0. 01). DNA methylation changes occurred at multiple regions throughout the genome in context with genes and CpG islands, and in genes relating to axon guidance, diabetes and immune pathways. There were multiple genes with increased expression that were enriched for RNA processing and developmental proteins. Growth factor genes-GHRH and FGF1-showed differential methylation and mRNA expression changes after resistance training. Our findings indicate that resistance exercise training improves muscular strength and is associated with reprogramming of the leukocyte DNA methylome and transcriptome.

  14. Shared molecular pathways and gene networks for cardiovascular disease and type 2 diabetes mellitus in women across diverse ethnicities.

    PubMed

    Chan, Kei Hang K; Huang, Yen-Tsung; Meng, Qingying; Wu, Chunyuan; Reiner, Alexander; Sobel, Eric M; Tinker, Lesley; Lusis, Aldons J; Yang, Xia; Liu, Simin

    2014-12-01

    Although cardiovascular disease (CVD) and type 2 diabetes mellitus (T2D) share many common risk factors, potential molecular mechanisms that may also be shared for these 2 disorders remain unknown. Using an integrative pathway and network analysis, we performed genome-wide association studies in 8155 blacks, 3494 Hispanic American, and 3697 Caucasian American women who participated in the national Women's Health Initiative single-nucleotide polymorphism (SNP) Health Association Resource and the Genomics and Randomized Trials Network. Eight top pathways and gene networks related to cardiomyopathy, calcium signaling, axon guidance, cell adhesion, and extracellular matrix seemed to be commonly shared between CVD and T2D across all 3 ethnic groups. We also identified ethnicity-specific pathways, such as cell cycle (specific for Hispanic American and Caucasian American) and tight junction (CVD and combined CVD and T2D in Hispanic American). In network analysis of gene-gene or protein-protein interactions, we identified key drivers that included COL1A1, COL3A1, and ELN in the shared pathways for both CVD and T2D. These key driver genes were cross-validated in multiple mouse models of diabetes mellitus and atherosclerosis. Our integrative analysis of American women of 3 ethnicities identified multiple shared biological pathways and key regulatory genes for the development of CVD and T2D. These prospective findings also support the notion that ethnicity-specific susceptibility genes and process are involved in the pathogenesis of CVD and T2D. © 2014 American Heart Association, Inc.

  15. shinyGISPA: A web application for characterizing phenotype by gene sets using multiple omics data combinations.

    PubMed

    Dwivedi, Bhakti; Kowalski, Jeanne

    2018-01-01

    While many methods exist for integrating multi-omics data or defining gene sets, there is no one single tool that defines gene sets based on merging of multiple omics data sets. We present shinyGISPA, an open-source application with a user-friendly web-based interface to define genes according to their similarity in several molecular changes that are driving a disease phenotype. This tool was developed to help facilitate the usability of a previously published method, Gene Integrated Set Profile Analysis (GISPA), among researchers with limited computer-programming skills. The GISPA method allows the identification of multiple gene sets that may play a role in the characterization, clinical application, or functional relevance of a disease phenotype. The tool provides an automated workflow that is highly scalable and adaptable to applications that go beyond genomic data merging analysis. It is available at http://shinygispa.winship.emory.edu/shinyGISPA/.

  16. shinyGISPA: A web application for characterizing phenotype by gene sets using multiple omics data combinations

    PubMed Central

    Dwivedi, Bhakti

    2018-01-01

    While many methods exist for integrating multi-omics data or defining gene sets, there is no one single tool that defines gene sets based on merging of multiple omics data sets. We present shinyGISPA, an open-source application with a user-friendly web-based interface to define genes according to their similarity in several molecular changes that are driving a disease phenotype. This tool was developed to help facilitate the usability of a previously published method, Gene Integrated Set Profile Analysis (GISPA), among researchers with limited computer-programming skills. The GISPA method allows the identification of multiple gene sets that may play a role in the characterization, clinical application, or functional relevance of a disease phenotype. The tool provides an automated workflow that is highly scalable and adaptable to applications that go beyond genomic data merging analysis. It is available at http://shinygispa.winship.emory.edu/shinyGISPA/. PMID:29415010

  17. Usefulness of Housekeeping Genes for the Diagnosis of Helicobacter pylori Infection, Strain Discrimination and Detection of Multiple Infection.

    PubMed

    Palau, Montserrat; Kulmann, Marcos; Ramírez-Lázaro, María José; Lario, Sergio; Quilez, María Elisa; Campo, Rafael; Piqué, Núria; Calvet, Xavier; Miñana-Galbis, David

    2016-12-01

    Helicobacter pylori infects human stomachs of over half the world's population, evades the immune response and establishes a chronic infection. Although most people remains asymptomatic, duodenal and gastric ulcers, MALT lymphoma and progression to gastric cancer could be developed. Several virulence factors such as flagella, lipopolysaccharide, adhesins and especially the vacuolating cytotoxin VacA and the oncoprotein CagA have been described for H. pylori. Despite the extensive published data on H. pylori, more research is needed to determine new virulence markers, the exact mode of transmission or the role of multiple infection. Amplification and sequencing of six housekeeping genes (amiA, cgt, cpn60, cpn70, dnaJ, and luxS) related to H. pylori pathogenesis have been performed in order to evaluate their usefulness for the specific detection of H. pylori, the genetic discrimination at strain level and the detection of multiple infection. A total of 52 H. pylori clones, isolated from 14 gastric biopsies from 11 patients, were analyzed for this purpose. All genes were specifically amplified for H. pylori and all clones isolated from different patients were discriminated, with gene distances ranged from 0.9 to 7.8%. Although most clones isolated from the same patient showed identical gene sequences, an event of multiple infection was detected in all the genes and microevolution events were showed for amiA and cpn60 genes. These results suggested that housekeeping genes could be useful for H. pylori detection and to elucidate the mode of transmission and the relevance of the multiple infection. © 2016 John Wiley & Sons Ltd.

  18. Stressing "Escherichia coli" to Educate Students about Research: A CURE to Investigate Multiple Levels of Gene Regulation

    ERIC Educational Resources Information Center

    McDonough, Janet; Goudsouzian, Lara K.; Papaj, Agllai; Maceli, Ashley R.; Klepac-Ceraj, Vanja; Peterson, Celeste N.

    2017-01-01

    Course-based undergraduate research experiences (CUREs) have been shown to increase student retention and learning in the biological sciences. Most CURES cover only one aspect of gene regulation, such as transcriptional control. Here we present a new inquiry-based lab that engages understanding of gene expression from multiple perspectives.…

  19. Highly Conserved Mitochondrial Genomes among Multicellular Red Algae of the Florideophyceae

    PubMed Central

    Yang, Eun Chan; Kim, Kyeong Mi; Kim, Su Yeon; Lee, JunMo; Boo, Ga Hun; Lee, Jung-Hyun; Nelson, Wendy A.; Yi, Gangman; Schmidt, William E.; Fredericq, Suzanne; Boo, Sung Min; Bhattacharya, Debashish; Yoon, Hwan Su

    2015-01-01

    Two red algal classes, the Florideophyceae (approximately 7,100 spp.) and Bangiophyceae (approximately 193 spp.), comprise 98% of red algal diversity in marine and freshwater habitats. These two classes form well-supported monophyletic groups in most phylogenetic analyses. Nonetheless, the interordinal relationships remain largely unresolved, in particular in the largest subclass Rhodymeniophycidae that includes 70% of all species. To elucidate red algal phylogenetic relationships and study organelle evolution, we determined the sequence of 11 mitochondrial genomes (mtDNA) from 5 florideophycean subclasses. These mtDNAs were combined with existing data, resulting in a database of 25 florideophytes and 12 bangiophytes (including cyanidiophycean species). A concatenated alignment of mt proteins was used to resolve ordinal relationships in the Rhodymeniophycidae. Red algal mtDNA genome comparisons showed 47 instances of gene rearrangement including 12 that distinguish Bangiophyceae from Hildenbrandiophycidae, and 5 that distinguish Hildenbrandiophycidae from Nemaliophycidae. These organelle data support a rapid radiation and surprisingly high conservation of mtDNA gene syntheny among the morphologically divergent multicellular lineages of Rhodymeniophycidae. In contrast, we find extensive mitochondrial gene rearrangements when comparing Bangiophyceae and Florideophyceae and multiple examples of gene loss among the different red algal lineages. PMID:26245677

  20. Organization of the Escherichia coli K-12 gene cluster responsible for production of the extracellular polysaccharide colanic acid.

    PubMed Central

    Stevenson, G; Andrianopoulos, K; Hobbs, M; Reeves, P R

    1996-01-01

    Colanic acid (CA) is an extracellular polysaccharide produced by most Escherichia coli strains as well as by other species of the family Enterobacteriaceae. We have determined the sequence of a 23-kb segment of the E. coli K-12 chromosome which includes the cluster of genes necessary for production of CA. The CA cluster comprises 19 genes. Two other sequenced genes (orf1.3 and galF), which are situated between the CA cluster and the O-antigen cluster, were shown to be unnecessary for CA production. The CA cluster includes genes for synthesis of GDP-L-fucose, one of the precursors of CA, and the gene for one of the enzymes in this pathway (GDP-D-mannose 4,6-dehydratase) was identified by biochemical assay. Six of the inferred proteins show sequence similarity to glycosyl transferases, and two others have sequence similarity to acetyl transferases. Another gene (wzx) is predicted to encode a protein with multiple transmembrane segments and may function in export of the CA repeat unit from the cytoplasm into the periplasm in a process analogous to O-unit export. The first three genes of the cluster are predicted to encode an outer membrane lipoprotein, a phosphatase, and an inner membrane protein with an ATP-binding domain. Since homologs of these genes are found in other extracellular polysaccharide gene clusters, they may have a common function, such as export of polysaccharide from the cell. PMID:8759852

  1. Cinnamon polyphenols regulate multiple metabolic pathways involved in insulin signaling and intestinal lipoprotein metabolism of small intestinal enterocytes.

    PubMed

    Qin, Bolin; Dawson, Harry D; Schoene, Norberta W; Polansky, Marilyn M; Anderson, Richard A

    2012-01-01

    Increasing evidence suggests that dietary factors may affect the expression of multiple genes and signaling pathways, which regulate intestinal lipoprotein metabolism. The small intestine is actively involved in the regulation of dietary lipid absorption, intracellular transport, and metabolism and is closely linked to systemic lipid metabolism. Cinnamon polyphenols have been shown to improve glucose, insulin, and lipid metabolism and improve inflammation in cell culture, animal, and human studies. However, little is known of the effects of an aqueous cinnamon extract (CE) on the regulation of genes and signaling pathways related to intestinal metabolism. The aim of the study was to investigate the effects of a CE on the primary enterocytes of chow-fed rats. Freshly isolated intestinal enterocytes were used to investigate apolipoprotein-B48 secretion by immunoprecipitation; gene expressions by quantitative reverse transcriptase-polymerase chain reaction and the protein and phosphorylation levels were evaluated by western blot and flow cytometric analyses. Ex vivo, the CE significantly decreased the amount of apolipoprotein-B48 secretion into the media, inhibited the mRNA expression of genes of the inflammatory cytokines, interleukin-1β, interleukin-6, and tumor necrosis factor-α, and induced the expression of the anti-inflammatory gene, Zfp36. CE also increased the mRNA expression of genes leading to increased insulin sensitivity, including Ir, Irs1, Irs2, Pi3k, and Akt1, and decreased Pten expression. CE also inhibited genes associated with increased cholesterol, triacylglycerols, and apolipoprotein-B48 levels, including Abcg5, Npc1l1, Cd36, Mttp, and Srebp1c, and facilitated Abca1 expression. CE also stimulated the phospho-p38 mitogen-activated protein kinase, c-Jun N-terminal kinase, and extracellular-signal-regulated kinase expressions determined by flow cytometry, with no changes in protein levels. These results demonstrate that the CE regulates genes associated with insulin sensitivity, inflammation, and cholesterol/lipogenesis metabolism and the activity of the mitogen-activated protein kinase signal pathway in intestinal lipoprotein metabolism. Copyright © 2012 Elsevier Inc. All rights reserved.

  2. Distinct organization of the candidate tumor suppressor gene RFP2 in human and mouse: multiple mRNA isoforms in both species- and human-specific antisense transcript RFP2OS.

    PubMed

    Baranova, Ancha; Hammarsund, Marianne; Ivanov, Dmitry; Skoblov, Mikhail; Sangfelt, Olle; Corcoran, Martin; Borodina, Tatiana; Makeeva, Natalia; Pestova, Anna; Tyazhelova, Tatiana; Nazarenko, Svetlana; Gorreta, Francesco; Alsheddi, Tariq; Schlauch, Karen; Nikitin, Eugene; Kapanadze, Bagrat; Shagin, Dmitry; Poltaraus, Andrey; Ivanovich Vorobiev, Andrey; Zabarovsky, Eugene; Lukianov, Sergey; Chandhoke, Vikas; Ibbotson, Rachel; Oscier, David; Einhorn, Stefan; Grander, Dan; Yankovsky, Nick

    2003-12-04

    In the present study, we describe the human and mouse RFP2 gene structure, multiple RFP2 mRNA isoforms in the two species that have different 5' UTRs and a human-specific antisense transcript RFP2OS. Since the human RFP2 5' UTR is not conserved in mouse, these findings might indicate a different regulation of RFP2 in the two species. The predicted human and mouse RFP2 proteins are shown to contain a tripartite RING finger-B-box-coiled-coil domain (RBCC), also known as a TRIM domain, and therefore belong to a subgroup of RING finger proteins that are often involved in developmental and tumorigenic processes. Because homozygous deletions of chromosomal region 13q14.3 are found in a number of malignancies, including chronic lymphocytic leukemia (CLL) and multiple myeloma (MM), we suggest that RFP2 might be involved in tumor development. This study provides necessary information for evaluation of the role of RFP2 in malignant transformation and other biological processes.

  3. Genome-Wide Association Mapping Combined with Reverse Genetics Identifies New Effectors of Low Water Potential-Induced Proline Accumulation in Arabidopsis1[W][OPEN

    PubMed Central

    Verslues, Paul E.; Lasky, Jesse R.; Juenger, Thomas E.; Liu, Tzu-Wen; Kumar, M. Nagaraj

    2014-01-01

    Arabidopsis (Arabidopsis thaliana) exhibits natural genetic variation in drought response, including varying levels of proline (Pro) accumulation under low water potential. As Pro accumulation is potentially important for stress tolerance and cellular redox control, we conducted a genome-wide association (GWAS) study of low water potential-induced Pro accumulation using a panel of natural accessions and publicly available single-nucleotide polymorphism (SNP) data sets. Candidate genomic regions were prioritized for subsequent study using metrics considering both the strength and spatial clustering of the association signal. These analyses found many candidate regions likely containing gene(s) influencing Pro accumulation. Reverse genetic analysis of several candidates identified new Pro effector genes, including thioredoxins and several genes encoding Universal Stress Protein A domain proteins. These new Pro effector genes further link Pro accumulation to cellular redox and energy status. Additional new Pro effector genes found include the mitochondrial protease LON1, ribosomal protein RPL24A, protein phosphatase 2A subunit A3, a MADS box protein, and a nucleoside triphosphate hydrolase. Several of these new Pro effector genes were from regions with multiple SNPs, each having moderate association with Pro accumulation. This pattern supports the use of summary approaches that incorporate clusters of SNP associations in addition to consideration of individual SNP probability values. Further GWAS-guided reverse genetics promises to find additional effectors of Pro accumulation. The combination of GWAS and reverse genetics to efficiently identify new effector genes may be especially applicable for traits difficult to analyze by other genetic screening methods. PMID:24218491

  4. Reliable pre-eclampsia pathways based on multiple independent microarray data sets.

    PubMed

    Kawasaki, Kaoru; Kondoh, Eiji; Chigusa, Yoshitsugu; Ujita, Mari; Murakami, Ryusuke; Mogami, Haruta; Brown, J B; Okuno, Yasushi; Konishi, Ikuo

    2015-02-01

    Pre-eclampsia is a multifactorial disorder characterized by heterogeneous clinical manifestations. Gene expression profiling of preeclamptic placenta have provided different and even opposite results, partly due to data compromised by various experimental artefacts. Here we aimed to identify reliable pre-eclampsia-specific pathways using multiple independent microarray data sets. Gene expression data of control and preeclamptic placentas were obtained from Gene Expression Omnibus. Single-sample gene-set enrichment analysis was performed to generate gene-set activation scores of 9707 pathways obtained from the Molecular Signatures Database. Candidate pathways were identified by t-test-based screening using data sets, GSE10588, GSE14722 and GSE25906. Additionally, recursive feature elimination was applied to arrive at a further reduced set of pathways. To assess the validity of the pre-eclampsia pathways, a statistically-validated protocol was executed using five data sets including two independent other validation data sets, GSE30186, GSE44711. Quantitative real-time PCR was performed for genes in a panel of potential pre-eclampsia pathways using placentas of 20 women with normal or severe preeclamptic singleton pregnancies (n = 10, respectively). A panel of ten pathways were found to discriminate women with pre-eclampsia from controls with high accuracy. Among these were pathways not previously associated with pre-eclampsia, such as the GABA receptor pathway, as well as pathways that have already been linked to pre-eclampsia, such as the glutathione and CDKN1C pathways. mRNA expression of GABRA3 (GABA receptor pathway), GCLC and GCLM (glutathione metabolic pathway), and CDKN1C was significantly reduced in the preeclamptic placentas. In conclusion, ten accurate and reliable pre-eclampsia pathways were identified based on multiple independent microarray data sets. A pathway-based classification may be a worthwhile approach to elucidate the pathogenesis of pre-eclampsia. © The Author 2014. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  5. Gene finding in metatranscriptomic sequences.

    PubMed

    Ismail, Wazim Mohammed; Ye, Yuzhen; Tang, Haixu

    2014-01-01

    Metatranscriptomic sequencing is a highly sensitive bioassay of functional activity in a microbial community, providing complementary information to the metagenomic sequencing of the community. The acquisition of the metatranscriptomic sequences will enable us to refine the annotations of the metagenomes, and to study the gene activities and their regulation in complex microbial communities and their dynamics. In this paper, we present TransGeneScan, a software tool for finding genes in assembled transcripts from metatranscriptomic sequences. By incorporating several features of metatranscriptomic sequencing, including strand-specificity, short intergenic regions, and putative antisense transcripts into a Hidden Markov Model, TranGeneScan can predict a sense transcript containing one or multiple genes (in an operon) or an antisense transcript. We tested TransGeneScan on a mock metatranscriptomic data set containing three known bacterial genomes. The results showed that TranGeneScan performs better than metagenomic gene finders (MetaGeneMark and FragGeneScan) on predicting protein coding genes in assembled transcripts, and achieves comparable or even higher accuracy than gene finders for microbial genomes (Glimmer and GeneMark). These results imply, with the assistance of metatranscriptomic sequencing, we can obtain a broad and precise picture about the genes (and their functions) in a microbial community. TransGeneScan is available as open-source software on SourceForge at https://sourceforge.net/projects/transgenescan/.

  6. Syndrome disintegration: Exome sequencing reveals that Fitzsimmons syndrome is a co-occurrence of multiple events.

    PubMed

    Armour, Christine M; Smith, Amanda; Hartley, Taila; Chardon, Jodi Warman; Sawyer, Sarah; Schwartzentruber, Jeremy; Hennekam, Raoul; Majewski, Jacek; Bulman, Dennis E; Suri, Mohnish; Boycott, Kym M

    2016-07-01

    In 1987 Fitzsimmons and Guilbert described identical male twins with progressive spastic paraplegia, brachydactyly with cone shaped epiphyses, short stature, dysarthria, and "low-normal" intelligence. In subsequent years, four other patients, including one set of female identical twins, a single female child, and a single male individual were described with the same features, and the eponym Fitzsimmons syndrome was adopted (OMIM #270710). We performed exome analysis of the patient described in 2009, and one of the original twins from 1987, the only patients available from the literature. No single genetic etiology exists that explains Fitzsimmons syndrome; however, multiple different genetic causes were identified. Specifically, the twins described by Fitzsimmons had heterozygous mutations in the SACS gene, the gene responsible for autosomal recessive spastic ataxia of Charlevoix Saguenay (ARSACS), as well as a heterozygous mutation in the TRPS1, the gene responsible in Trichorhinophalangeal syndrome type 1 (TRPS1 type 1) which includes brachydactyly as a feature. A TBL1XR1 mutation was identified in the patient described in 2009 as contributing to his cognitive impairment and autistic features with no genetic cause identified for his spasticity or brachydactyly. The findings show that these individuals have multiple different etiologies giving rise to a similar phenotype, and that "Fitzsimmons syndrome" is in fact not one single syndrome. Over time, we anticipate that continued careful phenotyping with concomitant genome-wide analysis will continue to identify the causes of many rare syndromes, but it will also highlight that previously delineated clinical entities are, in fact, not syndromes at all. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  7. Genetic dissection of sorghum grain quality traits using diverse and segregating populations.

    PubMed

    Boyles, Richard E; Pfeiffer, Brian K; Cooper, Elizabeth A; Rauh, Bradley L; Zielinski, Kelsey J; Myers, Matthew T; Brenton, Zachary; Rooney, William L; Kresovich, Stephen

    2017-04-01

    Coordinated association and linkage mapping identified 25 grain quality QTLs in multiple environments, and fine mapping of the Wx locus supports the use of high-density genetic markers in linkage mapping. There is a wide range of end-use products made from cereal grains, and these products often demand different grain characteristics. Fortunately, cereal crop species including sorghum [Sorghum bicolor (L.) Moench] contain high phenotypic variation for traits influencing grain quality. Identifying genetic variants underlying this phenotypic variation allows plant breeders to develop genotypes with grain attributes optimized for their intended usage. Multiple sorghum mapping populations were rigorously phenotyped across two environments (SC Coastal Plain and Central TX) in 2 years for five major grain quality traits: amylose, starch, crude protein, crude fat, and gross energy. Coordinated association and linkage mapping revealed several robust QTLs that make prime targets to improve grain quality for food, feed, and fuel products. Although the amylose QTL interval spanned many megabases, the marker with greatest significance was located just 12 kb from waxy (Wx), the primary gene regulating amylose production in cereal grains. This suggests higher resolution mapping in recombinant inbred line (RIL) populations can be obtained when genotyped at a high marker density. The major QTL for crude fat content, identified in both a RIL population and grain sorghum diversity panel, encompassed the DGAT1 locus, a critical gene involved in maize lipid biosynthesis. Another QTL on chromosome 1 was consistently mapped in both RIL populations for multiple grain quality traits including starch, crude protein, and gross energy. Collectively, these genetic regions offer excellent opportunities to manipulate grain composition and set up future studies for gene validation.

  8. Genetic Determinants Influencing Human Serum Metabolome among African Americans

    PubMed Central

    Yu, Bing; Zheng, Yan; Alexander, Danny; Morrison, Alanna C.; Coresh, Josef; Boerwinkle, Eric

    2014-01-01

    Phenotypes proximal to gene action generally reflect larger genetic effect sizes than those that are distant. The human metabolome, a result of multiple cellular and biological processes, are functional intermediate phenotypes proximal to gene action. Here, we present a genome-wide association study of 308 untargeted metabolite levels among African Americans from the Atherosclerosis Risk in Communities (ARIC) Study. Nineteen significant common variant-metabolite associations were identified, including 13 novel loci (p<1.6×10−10). These loci were associated with 7–50% of the difference in metabolite levels per allele, and the variance explained ranged from 4% to 20%. Fourteen genes were identified within the nineteen loci, and four of them contained non-synonymous substitutions in four enzyme-encoding genes (KLKB1, SIAE, CPS1, and NAT8); the other significant loci consist of eight other enzyme-encoding genes (ACE, GATM, ACY3, ACSM2B, THEM4, ADH4, UGT1A, TREH), a transporter gene (SLC6A13) and a polycystin protein gene (PKD2L1). In addition, four potential disease-associated paths were identified, including two direct longitudinal predictive relationships: NAT8 with N-acetylornithine, N-acetyl-1-methylhistidine and incident chronic kidney disease, and TREH with trehalose and incident diabetes. These results highlight the value of using endophenotypes proximal to gene function to discover new insights into biology and disease pathology. PMID:24625756

  9. Tbx2/3 is an essential mediator within the Brachyury gene network during Ciona notochord development

    PubMed Central

    José-Edwards, Diana S.; Oda-Ishii, Izumi; Nibu, Yutaka; Di Gregorio, Anna

    2013-01-01

    T-box genes are potent regulators of mesoderm development in many metazoans. In chordate embryos, the T-box transcription factor Brachyury (Bra) is required for specification and differentiation of the notochord. In some chordates, including the ascidian Ciona, members of the Tbx2 subfamily of T-box genes are also expressed in this tissue; however, their regulatory relationships with Bra and their contributions to the development of the notochord remain uncharacterized. We determined that the notochord expression of Ciona Tbx2/3 (Ci-Tbx2/3) requires Ci-Bra, and identified a Ci-Tbx2/3 notochord CRM that necessitates multiple Ci-Bra binding sites for its activity. Expression of mutant forms of Ci-Tbx2/3 in the developing notochord revealed a role for this transcription factor primarily in convergent extension. Through microarray screens, we uncovered numerous Ci-Tbx2/3 targets, some of which overlap with known Ci-Bra-downstream notochord genes. Among the Ci-Tbx2/3 notochord targets are evolutionarily conserved genes, including caspases, lineage-specific genes, such as Noto4, and newly identified genes, such as MLKL. This work sheds light on a large section of the notochord regulatory circuitry controlled by T-box factors, and reveals new components of the complement of genes required for the proper formation of this structure. PMID:23674602

  10. Tbx2/3 is an essential mediator within the Brachyury gene network during Ciona notochord development.

    PubMed

    José-Edwards, Diana S; Oda-Ishii, Izumi; Nibu, Yutaka; Di Gregorio, Anna

    2013-06-01

    T-box genes are potent regulators of mesoderm development in many metazoans. In chordate embryos, the T-box transcription factor Brachyury (Bra) is required for specification and differentiation of the notochord. In some chordates, including the ascidian Ciona, members of the Tbx2 subfamily of T-box genes are also expressed in this tissue; however, their regulatory relationships with Bra and their contributions to the development of the notochord remain uncharacterized. We determined that the notochord expression of Ciona Tbx2/3 (Ci-Tbx2/3) requires Ci-Bra, and identified a Ci-Tbx2/3 notochord CRM that necessitates multiple Ci-Bra binding sites for its activity. Expression of mutant forms of Ci-Tbx2/3 in the developing notochord revealed a role for this transcription factor primarily in convergent extension. Through microarray screens, we uncovered numerous Ci-Tbx2/3 targets, some of which overlap with known Ci-Bra-downstream notochord genes. Among the Ci-Tbx2/3 notochord targets are evolutionarily conserved genes, including caspases, lineage-specific genes, such as Noto4, and newly identified genes, such as MLKL. This work sheds light on a large section of the notochord regulatory circuitry controlled by T-box factors, and reveals new components of the complement of genes required for the proper formation of this structure.

  11. Management of familial benign chronic pemphigus

    PubMed Central

    Arora, Harleen; Bray, Fleta N; Cervantes, Jessica; Falto Aizpurua, Leyre A

    2016-01-01

    Benign familial chronic pemphigus or Hailey–Hailey disease is caused by an autosomal dominant mutation in the ATP2C1 gene leading to suprabasilar acantholysis. The disease most commonly affects intertriginous areas symmetrically. The chronic nature of the disease and multiple recurrences make the disease bothersome for patients and a treatment challenge for physicians. Treatments include topical and/or systemic agents and surgery including laser. This review summarizes the available treatment options. PMID:27695354

  12. MiR-191 Regulates Primary Human Fibroblast Proliferation and Directly Targets Multiple Oncogenes

    PubMed Central

    Polioudakis, Damon; Abell, Nathan S.; Iyer, Vishwanath R.

    2015-01-01

    miRNAs play a central role in numerous pathologies including multiple cancer types. miR-191 has predominantly been studied as an oncogene, but the role of miR-191 in the proliferation of primary cells is not well characterized, and the miR-191 targetome has not been experimentally profiled. Here we utilized RNA induced silencing complex immunoprecipitations as well as gene expression profiling to construct a genome wide miR-191 target profile. We show that miR-191 represses proliferation in primary human fibroblasts, identify multiple proto-oncogenes as novel miR-191 targets, including CDK9, NOTCH2, and RPS6KA3, and present evidence that miR-191 extensively mediates target expression through coding sequence (CDS) pairing. Our results provide a comprehensive genome wide miR-191 target profile, and demonstrate miR-191’s regulation of primary human fibroblast proliferation. PMID:25992613

  13. Nutrigenomics, the Microbiome, and Gene-Environment Interactions: New Directions in Cardiovascular Disease Research, Prevention, and Treatment: A Scientific Statement From the American Heart Association.

    PubMed

    Ferguson, Jane F; Allayee, Hooman; Gerszten, Robert E; Ideraabdullah, Folami; Kris-Etherton, Penny M; Ordovás, José M; Rimm, Eric B; Wang, Thomas J; Bennett, Brian J

    2016-06-01

    Cardiometabolic diseases are the leading cause of death worldwide and are strongly linked to both genetic and nutritional factors. The field of nutrigenomics encompasses multiple approaches aimed at understanding the effects of diet on health or disease development, including nutrigenetic studies investigating the relationship between genetic variants and diet in modulating cardiometabolic risk, as well as the effects of dietary components on multiple "omic" measures, including transcriptomics, metabolomics, proteomics, lipidomics, epigenetic modifications, and the microbiome. Here, we describe the current state of the field of nutrigenomics with respect to cardiometabolic disease research and outline a direction for the integration of multiple omics techniques in future nutrigenomic studies aimed at understanding mechanisms and developing new therapeutic options for cardiometabolic disease treatment and prevention. © 2016 American Heart Association, Inc.

  14. An omnibus test for family-based association studies with multiple SNPs and multiple phenotypes.

    PubMed

    Lasky-Su, Jessica; Murphy, Amy; McQueen, Matthew B; Weiss, Scott; Lange, Christoph

    2010-06-01

    We propose an omnibus family-based association test (MFBAT) that can be applied to multiple markers and multiple phenotypes and that has only one degree of freedom. The proposed test statistic extends current FBAT methodology to incorporate multiple markers as well as multiple phenotypes. Using simulation studies, power estimates for the proposed methodology are compared with the standard methodologies. On the basis of these simulations, we find that MFBAT substantially outperforms other methods, including haplotypic approaches and doing multiple tests with single single-nucleotide polymorphisms (SNPs) and single phenotypes. The practical relevance of the approach is illustrated by an application to asthma in which SNP/phenotype combinations are identified and reach overall significance that would not have been identified using other approaches. This methodology is directly applicable to cases in which there are multiple SNPs, such as candidate gene studies, cases in which there are multiple phenotypes, such as expression data, and cases in which there are multiple phenotypes and genotypes, such as genome-wide association studies that incorporate expression profiles as phenotypes. This program is available in the PBAT analysis package.

  15. Next-generation sequencing to solve complex inherited retinal dystrophy: A case series of multiple genes contributing to disease in extended families.

    PubMed

    Jones, Kaylie D; Wheaton, Dianna K; Bowne, Sara J; Sullivan, Lori S; Birch, David G; Chen, Rui; Daiger, Stephen P

    2017-01-01

    With recent availability of next-generation sequencing (NGS), it is becoming more common to pursue disease-targeted panel testing rather than traditional sequential gene-by-gene dideoxy sequencing. In this report, we describe using NGS to identify multiple disease-causing mutations that contribute concurrently or independently to retinal dystrophy in three relatively small families. Family members underwent comprehensive visual function evaluations, and genetic counseling including a detailed family history. A preliminary genetic inheritance pattern was assigned and updated as additional family members were tested. Family 1 (FAM1) and Family 2 (FAM2) were clinically diagnosed with retinitis pigmentosa (RP) and had a suspected autosomal dominant pedigree with non-penetrance (n.p.). Family 3 (FAM3) consisted of a large family with a diagnosis of RP and an overall dominant pedigree, but the proband had phenotypically cone-rod dystrophy. Initial genetic analysis was performed on one family member with traditional Sanger single gene sequencing and/or panel-based testing, and ultimately, retinal gene-targeted NGS was required to identify the underlying cause of disease for individuals within the three families. Results obtained in these families necessitated further genetic and clinical testing of additional family members to determine the complex genetic and phenotypic etiology of each family. Genetic testing of FAM1 (n = 4 affected; 1 n.p.) identified a dominant mutation in RP1 (p.Arg677Ter) that was present for two of the four affected individuals but absent in the proband and the presumed non-penetrant individual. Retinal gene-targeted NGS in the fourth affected family member revealed compound heterozygous mutations in USH2A (p. Cys419Phe, p.Glu767Serfs*21). Genetic testing of FAM2 (n = 3 affected; 1 n.p.) identified three retinal dystrophy genes ( PRPH2 , PRPF8 , and USH2A ) with disease-causing mutations in varying combinations among the affected family members. Genetic testing of FAM3 (n = 7 affected) identified a mutation in PRPH2 (p.Pro216Leu) tracking with disease in six of the seven affected individuals. Additional retinal gene-targeted NGS testing determined that the proband also harbored a multiple exon deletion in the CRX gene likely accounting for her cone-rod phenotype; her son harbored only the mutation in CRX , not the familial mutation in PRPH2 . Multiple genes contributing to the retinal dystrophy genotypes within a family were discovered using retinal gene-targeted NGS. Families with noted examples of phenotypic variation or apparent non-penetrant individuals may offer a clue to suspect complex inheritance. Furthermore, this finding underscores that caution should be taken when attributing a single gene disease-causing mutation (or inheritance pattern) to a family as a whole. Identification of a disease-causing mutation in a proband, even with a clear inheritance pattern in hand, may not be sufficient for targeted, known mutation analysis in other family members.

  16. Two White Spot Syndrome Virus MicroRNAs Target the Dorsal Gene To Promote Virus Infection in Marsupenaeus japonicus Shrimp

    PubMed Central

    Ren, Qian; Huang, Xin; Cui, Yalei; Sun, Jiejie; Wang, Wen

    2017-01-01

    ABSTRACT In eukaryotes, microRNAs (miRNAs) serve as regulators of many biological processes, including virus infection. An miRNA can generally target diverse genes during virus-host interactions. However, the regulation of gene expression by multiple miRNAs has not yet been extensively explored during virus infection. This study found that the Spaztle (Spz)-Toll-Dorsal-antilipopolysaccharide factor (ALF) signaling pathway plays a very important role in antiviral immunity against invasion of white spot syndrome virus (WSSV) in shrimp (Marsupenaeus japonicus). Dorsal, the central gene in the Toll pathway, was targeted by two viral miRNAs (WSSV-miR-N13 and WSSV-miR-N23) during WSSV infection. The regulation of Dorsal expression by viral miRNAs suppressed the Spz-Toll-Dorsal-ALF signaling pathway in shrimp in vivo, leading to virus infection. Our study contributes novel insights into the viral miRNA-mediated Toll signaling pathway during the virus-host interaction. IMPORTANCE An miRNA can target diverse genes during virus-host interactions. However, the regulation of gene expression by multiple miRNAs during virus infection has not yet been extensively explored. The results of this study indicated that the shrimp Dorsal gene, the central gene in the Toll pathway, was targeted by two viral miRNAs during infection with white spot syndrome virus. Regulation of Dorsal expression by viral miRNAs suppressed the Spz-Toll-Dorsal-ALF signaling pathway in shrimp in vivo, leading to virus infection. Our study provides new insight into the viral miRNA-mediated Toll signaling pathway in virus-host interactions. PMID:28179524

  17. Two White Spot Syndrome Virus MicroRNAs Target the Dorsal Gene To Promote Virus Infection in Marsupenaeus japonicus Shrimp.

    PubMed

    Ren, Qian; Huang, Xin; Cui, Yalei; Sun, Jiejie; Wang, Wen; Zhang, Xiaobo

    2017-04-15

    In eukaryotes, microRNAs (miRNAs) serve as regulators of many biological processes, including virus infection. An miRNA can generally target diverse genes during virus-host interactions. However, the regulation of gene expression by multiple miRNAs has not yet been extensively explored during virus infection. This study found that the Spaztle (Spz)-Toll-Dorsal-antilipopolysaccharide factor (ALF) signaling pathway plays a very important role in antiviral immunity against invasion of white spot syndrome virus (WSSV) in shrimp ( Marsupenaeus japonicus ). Dorsal , the central gene in the Toll pathway, was targeted by two viral miRNAs (WSSV-miR-N13 and WSSV-miR-N23) during WSSV infection. The regulation of Dorsal expression by viral miRNAs suppressed the Spz-Toll-Dorsal-ALF signaling pathway in shrimp in vivo , leading to virus infection. Our study contributes novel insights into the viral miRNA-mediated Toll signaling pathway during the virus-host interaction. IMPORTANCE An miRNA can target diverse genes during virus-host interactions. However, the regulation of gene expression by multiple miRNAs during virus infection has not yet been extensively explored. The results of this study indicated that the shrimp Dorsal gene, the central gene in the Toll pathway, was targeted by two viral miRNAs during infection with white spot syndrome virus. Regulation of Dorsal expression by viral miRNAs suppressed the Spz-Toll-Dorsal-ALF signaling pathway in shrimp in vivo , leading to virus infection. Our study provides new insight into the viral miRNA-mediated Toll signaling pathway in virus-host interactions. Copyright © 2017 American Society for Microbiology.

  18. Genetic and epigenetic mechanisms of epilepsy: a review

    PubMed Central

    Chen, Tian; Giri, Mohan; Xia, Zhenyi; Subedi, Yadu Nanda; Li, Yan

    2017-01-01

    Epilepsy is a common episodic neurological disorder or condition characterized by recurrent epileptic seizures, and genetics seems to play a key role in its etiology. Early linkage studies have localized multiple loci that may harbor susceptibility genes to epilepsy, and mutational analyses have detected a number of mutations involved in both ion channel and nonion channel genes in patients with idiopathic epilepsy. Genome-wide studies of epilepsy have found copy number variants at 2q24.2-q24.3, 7q11.22, 15q11.2-q13.3, and 16p13.11-p13.2, some of which disrupt multiple genes, such as NRXN1, AUTS2, NLGN1, CNTNAP2, GRIN2A, PRRT2, NIPA2, and BMP5, implicated for neurodevelopmental disorders, including intellectual disability and autism. Unfortunately, only a few common genetic variants have been associated with epilepsy. Recent exome-sequencing studies have found some genetic mutations, most of which are located in nonion channel genes such as the LGI1, PRRT2, EFHC1, PRICKLE, RBFOX1, and DEPDC5 and in probands with rare forms of familial epilepsy, and some of these genes are involved with the neurodevelopment. Since epigenetics plays a role in neuronal function from embryogenesis and early brain development to tissue-specific gene expression, epigenetic regulation may contribute to the genetic mechanism of neurodevelopment through which a gene and the environment interacting with each other affect the development of epilepsy. This review focused on the analytic tools used to identify epilepsy and then provided a summary of recent linkage and association findings, indicating the existence of novel genes on several chromosomes for further understanding of the biology of epilepsy. PMID:28761347

  19. Nipbl and mediator cooperatively regulate gene expression to control limb development.

    PubMed

    Muto, Akihiko; Ikeda, Shingo; Lopez-Burks, Martha E; Kikuchi, Yutaka; Calof, Anne L; Lander, Arthur D; Schilling, Thomas F

    2014-09-01

    Haploinsufficiency for Nipbl, a cohesin loading protein, causes Cornelia de Lange Syndrome (CdLS), the most common "cohesinopathy". It has been proposed that the effects of Nipbl-haploinsufficiency result from disruption of long-range communication between DNA elements. Here we use zebrafish and mouse models of CdLS to examine how transcriptional changes caused by Nipbl deficiency give rise to limb defects, a common condition in individuals with CdLS. In the zebrafish pectoral fin (forelimb), knockdown of Nipbl expression led to size reductions and patterning defects that were preceded by dysregulated expression of key early limb development genes, including fgfs, shha, hand2 and multiple hox genes. In limb buds of Nipbl-haploinsufficient mice, transcriptome analysis revealed many similar gene expression changes, as well as altered expression of additional classes of genes that play roles in limb development. In both species, the pattern of dysregulation of hox-gene expression depended on genomic location within the Hox clusters. In view of studies suggesting that Nipbl colocalizes with the mediator complex, which facilitates enhancer-promoter communication, we also examined zebrafish deficient for the Med12 Mediator subunit, and found they resembled Nipbl-deficient fish in both morphology and gene expression. Moreover, combined partial reduction of both Nipbl and Med12 had a strongly synergistic effect, consistent with both molecules acting in a common pathway. In addition, three-dimensional fluorescent in situ hybridization revealed that Nipbl and Med12 are required to bring regions containing long-range enhancers into close proximity with the zebrafish hoxda cluster. These data demonstrate a crucial role for Nipbl in limb development, and support the view that its actions on multiple gene pathways result from its influence, together with Mediator, on regulation of long-range chromosomal interactions.

  20. Genes-environment interactions in obesity- and diabetes-associated pancreatic cancer: a GWAS data analysis.

    PubMed

    Tang, Hongwei; Wei, Peng; Duell, Eric J; Risch, Harvey A; Olson, Sara H; Bueno-de-Mesquita, H Bas; Gallinger, Steven; Holly, Elizabeth A; Petersen, Gloria M; Bracci, Paige M; McWilliams, Robert R; Jenab, Mazda; Riboli, Elio; Tjønneland, Anne; Boutron-Ruault, Marie Christine; Kaaks, Rudolf; Trichopoulos, Dimitrios; Panico, Salvatore; Sund, Malin; Peeters, Petra H M; Khaw, Kay-Tee; Amos, Christopher I; Li, Donghui

    2014-01-01

    Obesity and diabetes are potentially alterable risk factors for pancreatic cancer. Genetic factors that modify the associations of obesity and diabetes with pancreatic cancer have previously not been examined at the genome-wide level. Using genome-wide association studies (GWAS) genotype and risk factor data from the Pancreatic Cancer Case Control Consortium, we conducted a discovery study of 2,028 cases and 2,109 controls to examine gene-obesity and gene-diabetes interactions in relation to pancreatic cancer risk by using the likelihood-ratio test nested in logistic regression models and Ingenuity Pathway Analysis (IPA). After adjusting for multiple comparisons, a significant interaction of the chemokine signaling pathway with obesity (P = 3.29 × 10(-6)) and a near significant interaction of calcium signaling pathway with diabetes (P = 1.57 × 10(-4)) in modifying the risk of pancreatic cancer were observed. These findings were supported by results from IPA analysis of the top genes with nominal interactions. The major contributing genes to the two top pathways include GNGT2, RELA, TIAM1, and GNAS. None of the individual genes or single-nucleotide polymorphism (SNP) except one SNP remained significant after adjusting for multiple testing. Notably, SNP rs10818684 of the PTGS1 gene showed an interaction with diabetes (P = 7.91 × 10(-7)) at a false discovery rate of 6%. Genetic variations in inflammatory response and insulin resistance may affect the risk of obesity- and diabetes-related pancreatic cancer. These observations should be replicated in additional large datasets. A gene-environment interaction analysis may provide new insights into the genetic susceptibility and molecular mechanisms of obesity- and diabetes-related pancreatic cancer.

  1. Adaptive Horizontal Gene Transfers between Multiple Cheese-Associated Fungi.

    PubMed

    Ropars, Jeanne; Rodríguez de la Vega, Ricardo C; López-Villavicencio, Manuela; Gouzy, Jérôme; Sallet, Erika; Dumas, Émilie; Lacoste, Sandrine; Debuchy, Robert; Dupont, Joëlle; Branca, Antoine; Giraud, Tatiana

    2015-10-05

    Domestication is an excellent model for studies of adaptation because it involves recent and strong selection on a few, identified traits [1-5]. Few studies have focused on the domestication of fungi, with notable exceptions [6-11], despite their importance to bioindustry [12] and to a general understanding of adaptation in eukaryotes [5]. Penicillium fungi are ubiquitous molds among which two distantly related species have been independently selected for cheese making-P. roqueforti for blue cheeses like Roquefort and P. camemberti for soft cheeses like Camembert. The selected traits include morphology, aromatic profile, lipolytic and proteolytic activities, and ability to grow at low temperatures, in a matrix containing bacterial and fungal competitors [13-15]. By comparing the genomes of ten Penicillium species, we show that adaptation to cheese was associated with multiple recent horizontal transfers of large genomic regions carrying crucial metabolic genes. We identified seven horizontally transferred regions (HTRs) spanning more than 10 kb each, flanked by specific transposable elements, and displaying nearly 100% identity between distant Penicillium species. Two HTRs carried genes with functions involved in the utilization of cheese nutrients or competition and were found nearly identical in multiple strains and species of cheese-associated Penicillium fungi, indicating recent selective sweeps; they were experimentally associated with faster growth and greater competitiveness on cheese and contained genes highly expressed in the early stage of cheese maturation. These findings have industrial and food safety implications and improve our understanding of the processes of adaptation to rapid environmental changes. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  2. Adaptive Horizontal Gene Transfers between Multiple Cheese-Associated Fungi

    PubMed Central

    Ropars, Jeanne; Rodríguez de la Vega, Ricardo C.; López-Villavicencio, Manuela; Gouzy, Jérôme; Sallet, Erika; Dumas, Émilie; Lacoste, Sandrine; Debuchy, Robert; Dupont, Joëlle; Branca, Antoine; Giraud, Tatiana

    2015-01-01

    Summary Domestication is an excellent model for studies of adaptation because it involves recent and strong selection on a few, identified traits [1–5]. Few studies have focused on the domestication of fungi, with notable exceptions [6–11], despite their importance to bioindustry [12] and to a general understanding of adaptation in eukaryotes [5]. Penicillium fungi are ubiquitous molds among which two distantly related species have been independently selected for cheese making—P. roqueforti for blue cheeses like Roquefort and P. camemberti for soft cheeses like Camembert. The selected traits include morphology, aromatic profile, lipolytic and proteolytic activities, and ability to grow at low temperatures, in a matrix containing bacterial and fungal competitors [13–15]. By comparing the genomes of ten Penicillium species, we show that adaptation to cheese was associated with multiple recent horizontal transfers of large genomic regions carrying crucial metabolic genes. We identified seven horizontally transferred regions (HTRs) spanning more than 10 kb each, flanked by specific transposable elements, and displaying nearly 100% identity between distant Penicillium species. Two HTRs carried genes with functions involved in the utilization of cheese nutrients or competition and were found nearly identical in multiple strains and species of cheese-associated Penicillium fungi, indicating recent selective sweeps; they were experimentally associated with faster growth and greater competitiveness on cheese and contained genes highly expressed in the early stage of cheese maturation. These findings have industrial and food safety implications and improve our understanding of the processes of adaptation to rapid environmental changes. PMID:26412136

  3. A functional U-statistic method for association analysis of sequencing data.

    PubMed

    Jadhav, Sneha; Tong, Xiaoran; Lu, Qing

    2017-11-01

    Although sequencing studies hold great promise for uncovering novel variants predisposing to human diseases, the high dimensionality of the sequencing data brings tremendous challenges to data analysis. Moreover, for many complex diseases (e.g., psychiatric disorders) multiple related phenotypes are collected. These phenotypes can be different measurements of an underlying disease, or measurements characterizing multiple related diseases for studying common genetic mechanism. Although jointly analyzing these phenotypes could potentially increase the power of identifying disease-associated genes, the different types of phenotypes pose challenges for association analysis. To address these challenges, we propose a nonparametric method, functional U-statistic method (FU), for multivariate analysis of sequencing data. It first constructs smooth functions from individuals' sequencing data, and then tests the association of these functions with multiple phenotypes by using a U-statistic. The method provides a general framework for analyzing various types of phenotypes (e.g., binary and continuous phenotypes) with unknown distributions. Fitting the genetic variants within a gene using a smoothing function also allows us to capture complexities of gene structure (e.g., linkage disequilibrium, LD), which could potentially increase the power of association analysis. Through simulations, we compared our method to the multivariate outcome score test (MOST), and found that our test attained better performance than MOST. In a real data application, we apply our method to the sequencing data from Minnesota Twin Study (MTS) and found potential associations of several nicotine receptor subunit (CHRN) genes, including CHRNB3, associated with nicotine dependence and/or alcohol dependence. © 2017 WILEY PERIODICALS, INC.

  4. DNA Translator and Aligner: HyperCard utilities to aid phylogenetic analysis of molecules.

    PubMed

    Eernisse, D J

    1992-04-01

    DNA Translator and Aligner are molecular phylogenetics HyperCard stacks for Macintosh computers. They manipulate sequence data to provide graphical gene mapping, conversions, translations and manual multiple-sequence alignment editing. DNA Translator is able to convert documented GenBank or EMBL documented sequences into linearized, rescalable gene maps whose gene sequences are extractable by clicking on the corresponding map button or by selection from a scrolling list. Provided gene maps, complete with extractable sequences, consist of nine metazoan, one yeast, and one ciliate mitochondrial DNAs and three green plant chloroplast DNAs. Single or multiple sequences can be manipulated to aid in phylogenetic analysis. Sequences can be translated between nucleic acids and proteins in either direction with flexible support of alternate genetic codes and ambiguous nucleotide symbols. Multiple aligned sequence output from diverse sources can be converted to Nexus, Hennig86 or PHYLIP format for subsequent phylogenetic analysis. Input or output alignments can be examined with Aligner, a convenient accessory stack included in the DNA Translator package. Aligner is an editor for the manual alignment of up to 100 sequences that toggles between display of matched characters and normal unmatched sequences. DNA Translator also generates graphic displays of amino acid coding and codon usage frequency relative to all other, or only synonymous, codons for approximately 70 select organism-organelle combinations. Codon usage data is compatible with spreadsheet or UWGCG formats for incorporation of additional molecules of interest. The complete package is available via anonymous ftp and is free for non-commercial uses.

  5. A simplified Sanger sequencing method for full genome sequencing of multiple subtypes of human influenza A viruses.

    PubMed

    Deng, Yi-Mo; Spirason, Natalie; Iannello, Pina; Jelley, Lauren; Lau, Hilda; Barr, Ian G

    2015-07-01

    Full genome sequencing of influenza A viruses (IAV), including those that arise from annual influenza epidemics, is undertaken to determine if reassorting has occurred or if other pathogenic traits are present. Traditionally IAV sequencing has been biased toward the major surface glycoproteins haemagglutinin and neuraminidase, while the internal genes are often ignored. Despite the development of next generation sequencing (NGS), many laboratories are still reliant on conventional Sanger sequencing to sequence IAV. To develop a minimal and robust set of primers for Sanger sequencing of the full genome of IAV currently circulating in humans. A set of 13 primer pairs was designed that enabled amplification of the six internal genes of multiple human IAV subtypes including the recent avian influenza A(H7N9) virus from China. Specific primers were designed to amplify the HA and NA genes of each IAV subtype of interest. Each of the primers also incorporated a binding site at its 5'-end for either a forward or reverse M13 primer, such that only two M13 primers were required for all subsequent sequencing reactions. This minimal set of primers was suitable for sequencing the six internal genes of all currently circulating human seasonal influenza A subtypes as well as the avian A(H7N9) viruses that have infected humans in China. This streamlined Sanger sequencing protocol could be used to generate full genome sequence data more rapidly and easily than existing influenza genome sequencing protocols. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  6. Nrf2 and Nrf2-Related Proteins in Development and Developmental Toxicity: Insights from studies in Zebrafish (Danio rerio)

    PubMed Central

    Hahn, Mark E.; Timme-Laragy, Alicia R.; Karchner, Sibel I.; Stegeman, John J.

    2015-01-01

    Oxidative stress is an important mechanism of chemical toxicity, contributing to developmental toxicity and teratogenesis as well as to cardiovascular and neurodegenerative diseases and diabetic embryopathy. Developing animals are especially sensitive to effects of chemicals that disrupt the balance of processes generating reactive species and oxidative stress, and those anti-oxidant defenses that protect against oxidative stress. The expression and inducibility of anti-oxidant defenses through activation of NFE2-related factor 2 (Nrf2) and related proteins is an essential process affecting the susceptibility to oxidants, but the complex interactions of Nrf2 in determining embryonic response to oxidants and oxidative stress are only beginning to be understood. The zebrafish (Danio rerio) is an established model in developmental biology and now also in developmental toxicology and redox signaling. Here we review the regulation of genes involved in protection against oxidative stress in developing vertebrates, with a focus on Nrf2 and related cap’n’collar (CNC)-basic-leucine zipper (bZIP) transcription factors. Vertebrate animals including zebrafish share Nfe2, Nrf1, Nrf2, and Nrf3 as well as a core set of genes that respond to oxidative stress, contributing to the value of zebrafish as a model system with which to investigate the mechanisms involved in regulation of redox signaling and the response to oxidative stress during embryolarval development. Moreover, studies in zebrafish have revealed nrf and keap1 gene duplications that provide an opportunity to dissect multiple functions of vertebrate NRF genes, including multiple sensing mechanisms involved in chemical-specific effects. PMID:26130508

  7. Clustering cancer gene expression data by projective clustering ensemble

    PubMed Central

    Yu, Xianxue; Yu, Guoxian

    2017-01-01

    Gene expression data analysis has paramount implications for gene treatments, cancer diagnosis and other domains. Clustering is an important and promising tool to analyze gene expression data. Gene expression data is often characterized by a large amount of genes but with limited samples, thus various projective clustering techniques and ensemble techniques have been suggested to combat with these challenges. However, it is rather challenging to synergy these two kinds of techniques together to avoid the curse of dimensionality problem and to boost the performance of gene expression data clustering. In this paper, we employ a projective clustering ensemble (PCE) to integrate the advantages of projective clustering and ensemble clustering, and to avoid the dilemma of combining multiple projective clusterings. Our experimental results on publicly available cancer gene expression data show PCE can improve the quality of clustering gene expression data by at least 4.5% (on average) than other related techniques, including dimensionality reduction based single clustering and ensemble approaches. The empirical study demonstrates that, to further boost the performance of clustering cancer gene expression data, it is necessary and promising to synergy projective clustering with ensemble clustering. PCE can serve as an effective alternative technique for clustering gene expression data. PMID:28234920

  8. The WRKY transcription factor family and senescence in switchgrass.

    PubMed

    Rinerson, Charles I; Scully, Erin D; Palmer, Nathan A; Donze-Reiner, Teresa; Rabara, Roel C; Tripathi, Prateek; Shen, Qingxi J; Sattler, Scott E; Rohila, Jai S; Sarath, Gautam; Rushton, Paul J

    2015-11-09

    Early aerial senescence in switchgrass (Panicum virgatum) can significantly limit biomass yields. WRKY transcription factors that can regulate senescence could be used to reprogram senescence and enhance biomass yields. All potential WRKY genes present in the version 1.0 of the switchgrass genome were identified and curated using manual and bioinformatic methods. Expression profiles of WRKY genes in switchgrass flag leaf RNA-Seq datasets were analyzed using clustering and network analyses tools to identify both WRKY and WRKY-associated gene co-expression networks during leaf development and senescence onset. We identified 240 switchgrass WRKY genes including members of the RW5 and RW6 families of resistance proteins. Weighted gene co-expression network analysis of the flag leaf transcriptomes across development readily separated clusters of co-expressed genes into thirteen modules. A visualization highlighted separation of modules associated with the early and senescence-onset phases of flag leaf growth. The senescence-associated module contained 3000 genes including 23 WRKYs. Putative promoter regions of senescence-associated WRKY genes contained several cis-element-like sequences suggestive of responsiveness to both senescence and stress signaling pathways. A phylogenetic comparison of senescence-associated WRKY genes from switchgrass flag leaf with senescence-associated WRKY genes from other plants revealed notable hotspots in Group I, IIb, and IIe of the phylogenetic tree. We have identified and named 240 WRKY genes in the switchgrass genome. Twenty three of these genes show elevated mRNA levels during the onset of flag leaf senescence. Eleven of the WRKY genes were found in hotspots of related senescence-associated genes from multiple species and thus represent promising targets for future switchgrass genetic improvement. Overall, individual WRKY gene expression profiles could be readily linked to developmental stages of flag leaves.

  9. Tissue-Specific Enrichment of Lymphoma Risk Loci in Regulatory Elements

    PubMed Central

    Hayes, James E.; Trynka, Gosia; Vijai, Joseph; Offit, Kenneth; Raychaudhuri, Soumya; Klein, Robert J.

    2015-01-01

    Though numerous polymorphisms have been associated with risk of developing lymphoma, how these variants function to promote tumorigenesis is poorly understood. Here, we report that lymphoma risk SNPs, especially in the non-Hodgkin’s lymphoma subtype chronic lymphocytic leukemia, are significantly enriched for co-localization with epigenetic marks of active gene regulation. These enrichments were seen in a lymphoid-specific manner for numerous ENCODE datasets, including DNase-hypersensitivity as well as multiple segmentation-defined enhancer regions. Furthermore, we identify putatively functional SNPs that are both in regulatory elements in lymphocytes and are associated with gene expression changes in blood. We developed an algorithm, UES, that uses a Monte Carlo simulation approach to calculate the enrichment of previously identified risk SNPs in various functional elements. This multiscale approach integrating multiple datasets helps disentangle the underlying biology of lymphoma, and more broadly, is generally applicable to GWAS results from other diseases as well. PMID:26422229

  10. Gene therapy in pancreatic cancer

    PubMed Central

    Liu, Si-Xue; Xia, Zhong-Sheng; Zhong, Ying-Qiang

    2014-01-01

    Pancreatic cancer (PC) is a highly lethal disease and notoriously difficult to treat. Only a small proportion of PC patients are eligible for surgical resection, whilst conventional chemoradiotherapy only has a modest effect with substantial toxicity. Gene therapy has become a new widely investigated therapeutic approach for PC. This article reviews the basic rationale, gene delivery methods, therapeutic targets and developments of laboratory research and clinical trials in gene therapy of PC by searching the literature published in English using the PubMed database and analyzing clinical trials registered on the Gene Therapy Clinical Trials Worldwide website (http://www. wiley.co.uk/genmed/ clinical). Viral vectors are main gene delivery tools in gene therapy of cancer, and especially, oncolytic virus shows brighter prospect due to its tumor-targeting property. Efficient therapeutic targets for gene therapy include tumor suppressor gene p53, mutant oncogene K-ras, anti-angiogenesis gene VEGFR, suicide gene HSK-TK, cytosine deaminase and cytochrome p450, multiple cytokine genes and so on. Combining different targets or combination strategies with traditional chemoradiotherapy may be a more effective approach to improve the efficacy of cancer gene therapy. Cancer gene therapy is not yet applied in clinical practice, but basic and clinical studies have demonstrated its safety and clinical benefits. Gene therapy will be a new and promising field for the treatment of PC. PMID:25309069

  11. Chromatin remodeling enzyme Brg1 is required for mouse lens fiber cell terminal differentiation and its denucleation

    PubMed Central

    2010-01-01

    Background Brahma-related gene 1 (Brg1, also known as Smarca4 and Snf2β) encodes an adenosine-5'-triphosphate (ATP)-dependent catalytical subunit of the (switch/sucrose nonfermentable) (SWI/SNF) chromatin remodeling complexes. SWI/SNF complexes are recruited to chromatin through multiple mechanisms, including specific DNA-binding factors (for example, heat shock transcription factor 4 (Hsf4) and paired box gene 6 (Pax6)), chromatin structural proteins (for example, high-mobility group A1 (HMGA1)) and/or acetylated core histones. Previous studies have shown that a single amino acid substitution (K798R) in the Brg1 ATPase domain acts via a dominant-negative (dn) mechanism. Genetic studies have demonstrated that Brg1 is an essential gene for early (that is, prior implantation) mouse embryonic development. Brg1 also controls neural stem cell maintenance, terminal differentiation of multiple cell lineages and organs including the T-cells, glial cells and limbs. Results To examine the roles of Brg1 in mouse lens development, a dnBrg1 transgenic construct was expressed using the lens-specific αA-crystallin promoter in postmitotic lens fiber cells. Morphological studies revealed abnormal lens fiber cell differentiation in transgenic lenses resulting in cataract. Electron microscopic studies showed abnormal lens suture formation and incomplete karyolysis (that is, denucleation) of lens fiber cells. To identify genes regulated by Brg1, RNA expression profiling was performed in embryonic day 15.5 (E15.5) wild-type and dnBrg1 transgenic lenses. In addition, comparisons between differentially expressed genes in dnBrg1 transgenic, Pax6 heterozygous and Hsf4 homozygous lenses identified multiple genes coregulated by Brg1, Hsf4 and Pax6. DNase IIβ, a key enzyme required for lens fiber cell denucleation, was found to be downregulated in each of the Pax6, Brg1 and Hsf4 model systems. Lens-specific deletion of Brg1 using conditional gene targeting demonstrated that Brg1 was required for lens fiber cell differentiation, for expression of DNase IIβ, for lens fiber cell denucleation and indirectly for retinal development. Conclusions These studies demonstrate a cell-autonomous role for Brg1 in lens fiber cell terminal differentiation and identified DNase IIβ as a potential direct target of SWI/SNF complexes. Brg1 is directly or indirectly involved in processes that degrade lens fiber cell chromatin. The presence of nuclei and other organelles generates scattered light incompatible with the optical requirements for the lens. PMID:21118511

  12. Identification, Classification and Differential Expression of Oleosin Genes in Tung Tree (Vernicia fordii)

    PubMed Central

    Cao, Heping; Zhang, Lin; Tan, Xiaofeng; Long, Hongxu; Shockey, Jay M.

    2014-01-01

    Triacylglycerols (TAG) are the major molecules of energy storage in eukaryotes. TAG are packed in subcellular structures called oil bodies or lipid droplets. Oleosins (OLE) are the major proteins in plant oil bodies. Multiple isoforms of OLE are present in plants such as tung tree (Vernicia fordii), whose seeds are rich in novel TAG with a wide range of industrial applications. The objectives of this study were to identify OLE genes, classify OLE proteins and analyze OLE gene expression in tung trees. We identified five tung tree OLE genes coding for small hydrophobic proteins. Genome-wide phylogenetic analysis and multiple sequence alignment demonstrated that the five tung OLE genes represented the five OLE subfamilies and all contained the “proline knot” motif (PX5SPX3P) shared among 65 OLE from 19 tree species, including the sequenced genomes of Prunus persica (peach), Populus trichocarpa (poplar), Ricinus communis (castor bean), Theobroma cacao (cacao) and Vitis vinifera (grapevine). Tung OLE1, OLE2 and OLE3 belong to the S type and OLE4 and OLE5 belong to the SM type of Arabidopsis OLE. TaqMan and SYBR Green qPCR methods were used to study the differential expression of OLE genes in tung tree tissues. Expression results demonstrated that 1) All five OLE genes were expressed in developing tung seeds, leaves and flowers; 2) OLE mRNA levels were much higher in seeds than leaves or flowers; 3) OLE1, OLE2 and OLE3 genes were expressed in tung seeds at much higher levels than OLE4 and OLE5 genes; 4) OLE mRNA levels rapidly increased during seed development; and 5) OLE gene expression was well-coordinated with tung oil accumulation in the seeds. These results suggest that tung OLE genes 1–3 probably play major roles in tung oil accumulation and/or oil body development. Therefore, they might be preferred targets for tung oil engineering in transgenic plants. PMID:24516650

  13. Identification, classification and differential expression of oleosin genes in tung tree (Vernicia fordii).

    PubMed

    Cao, Heping; Zhang, Lin; Tan, Xiaofeng; Long, Hongxu; Shockey, Jay M

    2014-01-01

    Triacylglycerols (TAG) are the major molecules of energy storage in eukaryotes. TAG are packed in subcellular structures called oil bodies or lipid droplets. Oleosins (OLE) are the major proteins in plant oil bodies. Multiple isoforms of OLE are present in plants such as tung tree (Vernicia fordii), whose seeds are rich in novel TAG with a wide range of industrial applications. The objectives of this study were to identify OLE genes, classify OLE proteins and analyze OLE gene expression in tung trees. We identified five tung tree OLE genes coding for small hydrophobic proteins. Genome-wide phylogenetic analysis and multiple sequence alignment demonstrated that the five tung OLE genes represented the five OLE subfamilies and all contained the "proline knot" motif (PX5SPX3P) shared among 65 OLE from 19 tree species, including the sequenced genomes of Prunus persica (peach), Populus trichocarpa (poplar), Ricinus communis (castor bean), Theobroma cacao (cacao) and Vitis vinifera (grapevine). Tung OLE1, OLE2 and OLE3 belong to the S type and OLE4 and OLE5 belong to the SM type of Arabidopsis OLE. TaqMan and SYBR Green qPCR methods were used to study the differential expression of OLE genes in tung tree tissues. Expression results demonstrated that 1) All five OLE genes were expressed in developing tung seeds, leaves and flowers; 2) OLE mRNA levels were much higher in seeds than leaves or flowers; 3) OLE1, OLE2 and OLE3 genes were expressed in tung seeds at much higher levels than OLE4 and OLE5 genes; 4) OLE mRNA levels rapidly increased during seed development; and 5) OLE gene expression was well-coordinated with tung oil accumulation in the seeds. These results suggest that tung OLE genes 1-3 probably play major roles in tung oil accumulation and/or oil body development. Therefore, they might be preferred targets for tung oil engineering in transgenic plants.

  14. Capture of microRNA-bound mRNAs identifies the tumor suppressor miR-34a as a regulator of growth factor signaling.

    PubMed

    Lal, Ashish; Thomas, Marshall P; Altschuler, Gabriel; Navarro, Francisco; O'Day, Elizabeth; Li, Xiao Ling; Concepcion, Carla; Han, Yoon-Chi; Thiery, Jerome; Rajani, Danielle K; Deutsch, Aaron; Hofmann, Oliver; Ventura, Andrea; Hide, Winston; Lieberman, Judy

    2011-11-01

    A simple biochemical method to isolate mRNAs pulled down with a transfected, biotinylated microRNA was used to identify direct target genes of miR-34a, a tumor suppressor gene. The method reidentified most of the known miR-34a regulated genes expressed in K562 and HCT116 cancer cell lines. Transcripts for 982 genes were enriched in the pull-down with miR-34a in both cell lines. Despite this large number, validation experiments suggested that ~90% of the genes identified in both cell lines can be directly regulated by miR-34a. Thus miR-34a is capable of regulating hundreds of genes. The transcripts pulled down with miR-34a were highly enriched for their roles in growth factor signaling and cell cycle progression. These genes form a dense network of interacting gene products that regulate multiple signal transduction pathways that orchestrate the proliferative response to external growth stimuli. Multiple candidate miR-34a-regulated genes participate in RAS-RAF-MAPK signaling. Ectopic miR-34a expression reduced basal ERK and AKT phosphorylation and enhanced sensitivity to serum growth factor withdrawal, while cells genetically deficient in miR-34a were less sensitive. Fourteen new direct targets of miR-34a were experimentally validated, including genes that participate in growth factor signaling (ARAF and PIK3R2) as well as genes that regulate cell cycle progression at various phases of the cell cycle (cyclins D3 and G2, MCM2 and MCM5, PLK1 and SMAD4). Thus miR-34a tempers the proliferative and pro-survival effect of growth factor stimulation by interfering with growth factor signal transduction and downstream pathways required for cell division.

  15. The allostatic impact of chronic ethanol on gene expression: A genetic analysis of chronic intermittent ethanol treatment in the BXD cohort

    PubMed Central

    van der Vaart, Andrew D.; Wolstenholme, Jennifer T.; Smith, Maren L.; Harris, Guy M.; Lopez, Marcelo F.; Wolen, Aaron R.; Becker, Howard C.; Williams, Robert W.; Miles, Michael F.

    2016-01-01

    The transition from acute to chronic ethanol exposure leads to lasting behavioral and physiological changes such as increased consumption, dependence, and withdrawal. Changes in brain gene expression are hypothesized to underlie these adaptive responses to ethanol. Previous studies on acute ethanol identified genetic variation in brain gene expression networks and behavioral responses to ethanol across the BXD panel of recombinant inbred mice. In this work, we have performed the first joint genetic and genomic analysis of transcriptome shifts in response to chronic intermittent ethanol (CIE) by vapor chamber exposure in a BXD cohort. CIE treatment is known to produce significant and sustained changes in ethanol consumption with repeated cycles of ethanol vapor. Using Affymetrix microarray analysis of prefrontal cortex (PFC) and nucleus accumbens (NAC) RNA, we compared CIE expression responses to those seen following acute ethanol treatment, and to voluntary ethanol consumption. Gene expression changes in PFC and NAC after CIE overlapped significantly across brain regions and with previously published expression following acute ethanol. Genes highly modulated by CIE were enriched for specific biological processes including synaptic transmission, neuron ensheathment, intracellular signaling, and neuronal projection development. Expression quantitative trait locus (eQTL) analyses identified genomic loci associated with ethanol-induced transcriptional changes with largely distinct loci identified between brain regions. Correlating CIE-regulated genes to ethanol consumption data identified specific genes highly associated with variation in the increase in drinking seen with repeated cycles of CIE. In particular, multiple myelin-related genes were identified. Furthermore, genetic variance in or near dynamin3 (Dnm3) on Chr1 at ~164 Mb may have a major regulatory role in CIE-responsive gene expression. Dnm3 expression correlates significantly with ethanol consumption, is contained in a highly ranked functional group of CIE-regulated genes in the NAC, and has a cis-eQTL within a genomic region linked with multiple CIE-responsive genes. PMID:27838001

  16. Differential transcriptome profiling of chilling stress response between shoots and rhizomes of Oryza longistaminata using RNA sequencing

    PubMed Central

    Wang, Yinxiao; Wang, Wensheng; Zhao, Xiuqin; Zhang, Shilai; Zhang, Jing; Hu, Fengyi; Li, Zhikang

    2017-01-01

    Rice (Oryza sativa) is very sensitive to chilling stress at seedling and reproductive stages, whereas wild rice, O. longistaminata, tolerates non-freezing cold temperatures and has overwintering ability. Elucidating the molecular mechanisms of chilling tolerance (CT) in O. longistaminata should thus provide a basis for rice CT improvement through molecular breeding. In this study, high-throughput RNA sequencing was performed to profile global transcriptome alterations and crucial genes involved in response to long-term low temperature in O. longistaminata shoots and rhizomes subjected to 7 days of chilling stress. A total of 605 and 403 genes were respectively identified as up- and down-regulated in O. longistaminata under 7 days of chilling stress, with 354 and 371 differentially expressed genes (DEGs) found exclusively in shoots and rhizomes, respectively. GO enrichment and KEGG pathway analyses revealed that multiple transcriptional regulatory pathways were enriched in commonly induced genes in both tissues; in contrast, only the photosynthesis pathway was prevalent in genes uniquely induced in shoots, whereas several key metabolic pathways and the programmed cell death process were enriched in genes induced only in rhizomes. Further analysis of these tissue-specific DEGs showed that the CBF/DREB1 regulon and other transcription factors (TFs), including AP2/EREBPs, MYBs, and WRKYs, were synergistically involved in transcriptional regulation of chilling stress response in shoots. Different sets of TFs, such as OsERF922, OsNAC9, OsWRKY25, and WRKY74, and eight genes encoding antioxidant enzymes were exclusively activated in rhizomes under long-term low-temperature treatment. Furthermore, several cis-regulatory elements, including the ICE1-binding site, the GATA element for phytochrome regulation, and the W-box for WRKY binding, were highly abundant in both tissues, confirming the involvement of multiple regulatory genes and complex networks in the transcriptional regulation of CT in O. longistaminata. Finally, most chilling-induced genes with alternative splicing exclusive to shoots were associated with photosynthesis and regulation of gene expression, while those enriched in rhizomes were primarily related to stress signal transduction; this indicates that tissue-specific transcriptional and post-transcriptional regulation mechanisms synergistically contribute to O. longistaminata long-term CT. Our findings provide an overview of the complex regulatory networks of CT in O. longistaminata. PMID:29190752

  17. Gene expression changes consistent with neuroAIDS and impaired working memory in HIV-1 transgenic rats

    PubMed Central

    2014-01-01

    Background A thorough investigation of the neurobiology of HIV-induced neuronal dysfunction and its evolving phenotype in the setting of viral suppression has been limited by the lack of validated small animal models to probe the effects of concomitant low level expression of multiple HIV-1 products in disease-relevant cells in the CNS. Results We report the results of gene expression profiling of the hippocampus of HIV-1 Tg rats, a rodent model of HIV infection in which multiple HIV-1 proteins are expressed under the control of the viral LTR promoter in disease-relevant cells including microglia and astrocytes. The Gene Set Enrichment Analysis (GSEA) algorithm was used for pathway analysis. Gene expression changes observed are consistent with astrogliosis and microgliosis and include evidence of inflammation and cell proliferation. Among the genes with increased expression in HIV-1 Tg rats was the interferon stimulated gene 15 (ISG-15), which was previously shown to be increased in the cerebrospinal fluid (CSF) of HIV patients and to correlate with neuropsychological impairment and neuropathology, and prostaglandin D2 (PGD2) synthase (Ptgds), which has been associated with immune activation and the induction of astrogliosis and microgliosis. GSEA-based pathway analysis highlighted a broad dysregulation of genes involved in neuronal trophism and neurodegenerative disorders. Among the latter are genesets associated with Huntington’s disease, Parkinson’s disease, mitochondrial, peroxisome function, and synaptic trophism and plasticity, such as IGF, ErbB and netrin signaling and the PI3K signal transduction pathway, a mediator of neural plasticity and of a vast array of trophic signals. Additionally, gene expression analyses also show altered lipid metabolism and peroxisomes dysfunction. Supporting the functional significance of these gene expression alterations, HIV-1 Tg rats showed working memory impairments in spontaneous alternation behavior in the T-Maze, a paradigm sensitive to prefrontal cortex and hippocampal function. Conclusions Altogether, differentially regulated genes and pathway analysis identify specific pathways that can be targeted therapeutically to increase trophic support, e.g. IGF, ErbB and netrin signaling, and reduce neuroinflammation, e.g. PGD2 synthesis, which may be beneficial in the treatment of chronic forms of HIV-associated neurocognitive disorders in the setting of viral suppression. PMID:24980976

  18. Differential transcriptome profiling of chilling stress response between shoots and rhizomes of Oryza longistaminata using RNA sequencing.

    PubMed

    Zhang, Ting; Huang, Liyu; Wang, Yinxiao; Wang, Wensheng; Zhao, Xiuqin; Zhang, Shilai; Zhang, Jing; Hu, Fengyi; Fu, Binying; Li, Zhikang

    2017-01-01

    Rice (Oryza sativa) is very sensitive to chilling stress at seedling and reproductive stages, whereas wild rice, O. longistaminata, tolerates non-freezing cold temperatures and has overwintering ability. Elucidating the molecular mechanisms of chilling tolerance (CT) in O. longistaminata should thus provide a basis for rice CT improvement through molecular breeding. In this study, high-throughput RNA sequencing was performed to profile global transcriptome alterations and crucial genes involved in response to long-term low temperature in O. longistaminata shoots and rhizomes subjected to 7 days of chilling stress. A total of 605 and 403 genes were respectively identified as up- and down-regulated in O. longistaminata under 7 days of chilling stress, with 354 and 371 differentially expressed genes (DEGs) found exclusively in shoots and rhizomes, respectively. GO enrichment and KEGG pathway analyses revealed that multiple transcriptional regulatory pathways were enriched in commonly induced genes in both tissues; in contrast, only the photosynthesis pathway was prevalent in genes uniquely induced in shoots, whereas several key metabolic pathways and the programmed cell death process were enriched in genes induced only in rhizomes. Further analysis of these tissue-specific DEGs showed that the CBF/DREB1 regulon and other transcription factors (TFs), including AP2/EREBPs, MYBs, and WRKYs, were synergistically involved in transcriptional regulation of chilling stress response in shoots. Different sets of TFs, such as OsERF922, OsNAC9, OsWRKY25, and WRKY74, and eight genes encoding antioxidant enzymes were exclusively activated in rhizomes under long-term low-temperature treatment. Furthermore, several cis-regulatory elements, including the ICE1-binding site, the GATA element for phytochrome regulation, and the W-box for WRKY binding, were highly abundant in both tissues, confirming the involvement of multiple regulatory genes and complex networks in the transcriptional regulation of CT in O. longistaminata. Finally, most chilling-induced genes with alternative splicing exclusive to shoots were associated with photosynthesis and regulation of gene expression, while those enriched in rhizomes were primarily related to stress signal transduction; this indicates that tissue-specific transcriptional and post-transcriptional regulation mechanisms synergistically contribute to O. longistaminata long-term CT. Our findings provide an overview of the complex regulatory networks of CT in O. longistaminata.

  19. Multiple primary tumors of the upper aerodigestive tract: is there a role for constitutional mutations in the p53 gene?

    PubMed

    Gallo, O; Sardi, I; Pepe, G; Franchi, A; Attanasio, M; Giusti, B; Bocciolini, C; Abbate, R

    1999-07-19

    Head-and-neck cancer (HNC) patients have a high risk of developing second primary tumors of the upper aerodigestive tract, the main cause of death. Although the roles of tobacco and diet in multiple head-and-neck carcinogenesis have been thoroughly investigated, little is known about individual genetic susceptibility factors involved in this process. Genomic instability, reflecting the propensity and the susceptibility of the genome to acquire multiple alterations, could be considered a driving force behind multiple carcinogenesis. Mutation of the p53 tumor-suppressor gene has been proposed to play an important role in this process. Therefore, we evaluated the incidence of inherited p53 germ-line alteration(s) in a population of 24 consecutive HNC patients and their first-degree relatives affected by multiple malignancies as well as the occurrence of p53 somatic acquired mutation(s) in 16 cancers, including first and second primaries from 5 HNCs of the same group. Mutations in exons 4-11 of the p53 gene were investigated using SSCP-PCR analysis and DNA sequencing. Analysis was extended to the peripheral blood and cancer biopsies available from first-degree relatives of cancer-prone families with p53 germ-line mutations. p53 germ-line mutations were identified in the peripheral blood and corresponding cancers of 3 HNC patients who had multiple malignancies. The only missense mutation detected was mapped in exon 6; it is a GTG to GAG substitution with an amino acid change from Val to Glu at codon 197. The remaining 2 p53 germ-line mutations were single-nucleotide substitutions without amino acid change in exon 6 (codon 213, CGA to CGG) and in exon 8 (codon 295, CCT to CCC), respectively. These mutations were found in HNC patients with a family history of cancer. Abnormal expression of wild-type p53 protein in normal and pathological tissues from patients with the same sense single-nucleotide substitutions was detected by immuno-histochemistry.

  20. Gene transcription in sea otters (Enhydra lutris); development of a diagnostic tool for sea otter and ecosystem health

    USGS Publications Warehouse

    Bowen, Lizabeth; Miles, A. Keith; Murray, Michael; Haulena, Martin; Tuttle, Judy; van Bonn, William; Adams, Lance; Bodkin, James L.; Ballachey, Brenda E.; Estes, James A.; Tinker, M. Tim; Keister, Robin; Stott, Jeffrey L.

    2012-01-01

    Gene transcription analysis for diagnosing or monitoring wildlife health requires the ability to distinguish pathophysiological change from natural variation. Herein, we describe methodology for the development of quantitative real-time polymerase chain reaction (qPCR) assays to measure differential transcript levels of multiple immune function genes in the sea otter (Enhydra lutris); sea otter-specific qPCR primer sequences for the genes of interest are defined. We establish a ‘reference’ range of transcripts for each gene in a group of clinically healthy captive and free-ranging sea otters. The 10 genes of interest represent multiple physiological systems that play a role in immuno-modulation, inflammation, cell protection, tumour suppression, cellular stress response, xenobiotic metabolizing enzymes, antioxidant enzymes and cell–cell adhesion. The cycle threshold (CT) measures for most genes were normally distributed; the complement cytolysis inhibitor was the exception. The relative enumeration of multiple gene transcripts in simple peripheral blood samples expands the diagnostic capability currently available to assess the health of sea otters in situ and provides a better understanding of the state of their environment.

Top