Three mouse models of human thalassemia.

PubMed Central

Martinell, J; Whitney, J B; Popp, R A; Russell, L B; Anderson, W F

1981-01-01

Three types of mice with globin gene mutations, called 352HB, 27HB, and Hbath-J, appear to be true animal models of human thalassemia. Expression of the alpha-globin genes in three stocks of mice, each one heterozygous for one of the alpha-globin mutations, was examined at the polypeptide, RNA, and DNA levels. alpha-Globin polypeptide chains, relative to beta-globin chains in heterozygous thalassemic mice, are present at approximately 80% of normal. The ratios of alpha-globin to beta-globin RNA sequences are also 75-80% of normal, exactly reflecting the alpha-globin to beta-globin chain ratios. In the case of mutant 352HB, at least one alpha-globin gene is deleted. Thalassemic mouse erythroid cells appear to compensate partially for the loss of half of their alpha-globin genes. Images PMID:6946454

Photodynamic therapy with decacationic [60]fullerene monoadducts: effect of a light absorbing electron-donor antenna and micellar formulation.

PubMed

Yin, Rui; Wang, Min; Huang, Ying-Ying; Huang, Huang-Chiao; Avci, Pinar; Chiang, Long Y; Hamblin, Michael R

2014-05-01

We report the synthesis and anticancer photodynamic properties of two new decacationic fullerene (LC14) and red light-harvesting antenna-fullerene conjugated monoadduct (LC15) derivatives. The antenna of LC15 was attached covalently to C60>with distance of only <3.0 Ǻ to facilitate ultrafast intramolecular photoinduced-electron-transfer (for type-I photochemistry) and photon absorption at longer wavelengths. Because LC15 was hydrophobic we compared formulation in Cremophor EL micelles with direct dilution from dimethylacetamide. LC14 produced more (1)O2 than LC15, while LC15 produced much more HO·than LC14 as measured by specific fluorescent probes. When delivered by DMA, LC14 killed more HeLa cells than LC15 when excited by UVA light, while LC15 killed more cells when excited by white light consistent with the antenna effect. However LC15 was more effective than LC14 when delivered by micelles regardless of the excitation light. Micellar delivery produced earlier apoptosis and damage to the endoplasmic reticulum as well as to lysosomes and mitochondria. This team of authors report the synthesis and the photodynamic properties of two new derivatives for cancer treatment; one is a decacationic fullerene (LC14) and the other is a red light-harvesting antenna-fullerene conjugated monoadduct (LC15) utilizing a HeLa cell model. Copyright © 2014 Elsevier Inc. All rights reserved.

Platypus globin genes and flanking loci suggest a new insertional model for beta-globin evolution in birds and mammals.

PubMed

Patel, Vidushi S; Cooper, Steven J B; Deakin, Janine E; Fulton, Bob; Graves, Tina; Warren, Wesley C; Wilson, Richard K; Graves, Jennifer A M

2008-07-25

Vertebrate alpha (alpha)- and beta (beta)-globin gene families exemplify the way in which genomes evolve to produce functional complexity. From tandem duplication of a single globin locus, the alpha- and beta-globin clusters expanded, and then were separated onto different chromosomes. The previous finding of a fossil beta-globin gene (omega) in the marsupial alpha-cluster, however, suggested that duplication of the alpha-beta cluster onto two chromosomes, followed by lineage-specific gene loss and duplication, produced paralogous alpha- and beta-globin clusters in birds and mammals. Here we analyse genomic data from an egg-laying monotreme mammal, the platypus (Ornithorhynchus anatinus), to explore haemoglobin evolution at the stem of the mammalian radiation. The platypus alpha-globin cluster (chromosome 21) contains embryonic and adult alpha- globin genes, a beta-like omega-globin gene, and the GBY globin gene with homology to cytoglobin, arranged as 5'-zeta-zeta'-alphaD-alpha3-alpha2-alpha1-omega-GBY-3'. The platypus beta-globin cluster (chromosome 2) contains single embryonic and adult globin genes arranged as 5'-epsilon-beta-3'. Surprisingly, all of these globin genes were expressed in some adult tissues. Comparison of flanking sequences revealed that all jawed vertebrate alpha-globin clusters are flanked by MPG-C16orf35 and LUC7L, whereas all bird and mammal beta-globin clusters are embedded in olfactory genes. Thus, the mammalian alpha- and beta-globin clusters are orthologous to the bird alpha- and beta-globin clusters respectively. We propose that alpha- and beta-globin clusters evolved from an ancient MPG-C16orf35-alpha-beta-GBY-LUC7L arrangement 410 million years ago. A copy of the original beta (represented by omega in marsupials and monotremes) was inserted into an array of olfactory genes before the amniote radiation (>315 million years ago), then duplicated and diverged to form orthologous clusters of beta-globin genes with different expression profiles in different lineages.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martinell, J.; Whitney, J.B.; Popp, R.A.

Three types of mice with globin gene mutations, called 352HB, 27HB, and Hba/sup th-J/, appear to be true animal models of human thalassemia. Expression of the ..cap alpha..-globin genes in three stocks of mice, each one heterozygous for one of the ..cap alpha..-globin mutations, was examined at the polypeptide, RNA, and DNA levels. ..cap alpha..-globin polypeptide chains, relative to ..gamma..-globin chains in heterozygous thalassemic mice, are present at approximately 80% of normal. The ratios of ..cap alpha..-globin to ..gamma..-globin RNA sequences are also 75 to 80% normal, exactly reflecting the ..cap alpha..-globin to ..gamma..-globin chain ratios. In the case ofmore » mutant 352HB, at least one ..cap alpha..-globin gene is deleted. Thalassemic mouse erythroid cells appear to compensate partially for the loss of half of their ..cap alpha..-globin genes.« less

All of the human beta-type globin genes compete for LCR enhancer activity in embryonic erythroid cells of yeast artificial chromosome transgenic mice.

PubMed

Okamura, Eiichi; Matsuzaki, Hitomi; Campbell, Andrew D; Engel, James Douglas; Fukamizu, Akiyoshi; Tanimoto, Keiji

2009-12-01

In primitive erythroid cells of human beta-globin locus transgenic mice (TgM), the locus control region (LCR)-proximal epsilon- and gamma-globin genes are transcribed, whereas the distal delta- and beta-globin genes are silent. It is generally accepted that the beta-globin gene is competitively suppressed by gamma-globin gene expression at this developmental stage. Previously, however, we observed that epsilon-globin gene expression was severely attenuated when its distance from the LCR was extended, implying that beta-globin gene might also be silenced because of its great distance from the LCR. Here, to clarify the beta-globin gene silencing mechanism, we established TgM lines carrying either gamma- or epsilon- plus gamma-globin promoter deletions, without significantly altering the distance between the beta-globin gene and the LCR. Precocious expression of delta- and beta-globin genes was observed in primitive erythroid cells of mutant, but not wild-type TgM, which was most evident when both the epsilon and gamma promoters were deleted. Thus, we clearly demonstrated that the repression of the delta- and beta-globin genes in primitive erythroid cells is dominated by competitive silencing by the epsilon- and gamma-globin gene promoters, and that epsilon- and the other beta-like globin genes might be activated by two distinct mechanisms by the LCR.

Platypus globin genes and flanking loci suggest a new insertional model for beta-globin evolution in birds and mammals

PubMed Central

Patel, Vidushi S; Cooper, Steven JB; Deakin, Janine E; Fulton, Bob; Graves, Tina; Warren, Wesley C; Wilson, Richard K; Graves, Jennifer AM

2008-01-01

Background Vertebrate alpha (α)- and beta (β)-globin gene families exemplify the way in which genomes evolve to produce functional complexity. From tandem duplication of a single globin locus, the α- and β-globin clusters expanded, and then were separated onto different chromosomes. The previous finding of a fossil β-globin gene (ω) in the marsupial α-cluster, however, suggested that duplication of the α-β cluster onto two chromosomes, followed by lineage-specific gene loss and duplication, produced paralogous α- and β-globin clusters in birds and mammals. Here we analyse genomic data from an egg-laying monotreme mammal, the platypus (Ornithorhynchus anatinus), to explore haemoglobin evolution at the stem of the mammalian radiation. Results The platypus α-globin cluster (chromosome 21) contains embryonic and adult α- globin genes, a β-like ω-globin gene, and the GBY globin gene with homology to cytoglobin, arranged as 5'-ζ-ζ'-αD-α3-α2-α1-ω-GBY-3'. The platypus β-globin cluster (chromosome 2) contains single embryonic and adult globin genes arranged as 5'-ε-β-3'. Surprisingly, all of these globin genes were expressed in some adult tissues. Comparison of flanking sequences revealed that all jawed vertebrate α-globin clusters are flanked by MPG-C16orf35 and LUC7L, whereas all bird and mammal β-globin clusters are embedded in olfactory genes. Thus, the mammalian α- and β-globin clusters are orthologous to the bird α- and β-globin clusters respectively. Conclusion We propose that α- and β-globin clusters evolved from an ancient MPG-C16orf35-α-β-GBY-LUC7L arrangement 410 million years ago. A copy of the original β (represented by ω in marsupials and monotremes) was inserted into an array of olfactory genes before the amniote radiation (>315 million years ago), then duplicated and diverged to form orthologous clusters of β-globin genes with different expression profiles in different lineages. PMID:18657265

LCR 5' hypersensitive site specificity for globin gene activation within the active chromatin hub.

PubMed

Peterson, Kenneth R; Fedosyuk, Halyna; Harju-Baker, Susanna

2012-12-01

The DNaseI hypersensitive sites (HSs) of the human β-globin locus control region (LCR) may function as part of an LCR holocomplex within a larger active chromatin hub (ACH). Differential activation of the globin genes during development may be controlled in part by preferential interaction of each gene with specific individual HSs during globin gene switching, a change in conformation of the LCR holocomplex, or both. To distinguish between these possibilities, human β-globin locus yeast artificial chromosome (β-YAC) lines were produced in which the ε-globin gene was replaced with a second marked β-globin gene (β(m)), coupled to an intact LCR, a 5'HS3 complete deletion (5'ΔHS3) or a 5'HS3 core deletion (5'ΔHS3c). The 5'ΔHS3c mice expressed β(m)-globin throughout development; γ-globin was co-expressed in the embryonic yolk sac, but not in the fetal liver; and wild-type β-globin was co-expressed in adult mice. Although the 5'HS3 core was not required for β(m)-globin expression, previous work showed that the 5'HS3 core is necessary for ε-globin expression during embryonic erythropoiesis. A similar phenotype was observed in 5'HS complete deletion mice, except β(m)-globin expression was higher during primitive erythropoiesis and γ-globin expression continued into fetal definitive erythropoiesis. These data support a site specificity model of LCR HS-globin gene interaction.

Interaction of Hb Grey Lynn (Vientiane) [α91(FG3)Leu>Phe (α1)] with Hb E [β26(B8) Glu>Lys] and α(+)-thalassemia: Molecular and Hematological Analysis.

PubMed

Singha, Kritsada; Fucharoen, Goonnapa; Fucharoen, Supan

2015-01-01

Hemoglobin (Hb) Grey Lynn is a Hb variant caused by a mutation at codon 91 of α1-globin gene whereas Hb E is a common β-globin chain variant among Southeast Asian population. We report two hitherto undescribed conditions of Hb Grey Lynn found in Thai individuals. The study was done on two unrelated Thai subjects. Hematological parameters were recorded and Hb analysis was carried out using automated Hb analyzers. Mutations were identified by DNA analysis. Hematological features of the patients were compared with those of various forms of Hb Grey Lynn documented previously. Hb and DNA analyses identified a heterozygous Hb Grey Lynn in one patient and a double heterozygous Hb Grey Lynn and Hb E with α(+)-thalassemia in another. Interaction of α(Grey Lynn) with β(E) chains leads to the formation of a new Hb variant, namely the Hb Grey Lynn E (α(GL)2β(E)2), detectable by liquid chromatography (10.3%) but masked by Hb E on capillary electrophoresis. Interaction of these multiple globin gene defects could lead to complex hemoglobinopathies requiring combined analysis with multiple Hb analyzers followed by DNA testing to provide accurate diagnosis of the cases.

Context-dependent EKLF responsiveness defines the developmental specificity of the human ɛ-globin gene in erythroid cells of YAC transgenic mice

PubMed Central

Tanimoto, Keiji; Liu, Qinghui; Grosveld, Frank; Bungert, Jörg; Engel, James Douglas

2000-01-01

We explored the mechanism of definitive-stage ɛ-globin transcriptional inactivity within a human β-globin YAC expressed in transgenic mice. We focused on the globin CAC and CAAT promoter motifs, as previous laboratory and clinical studies indicated a pivotal role for these elements in globin gene activation. A high-affinity CAC-binding site for the erythroid krüppel-like factor (EKLF) was placed in the ɛ-globin promoter at a position corresponding to that in the adult β-globin promoter, thereby simultaneously ablating a direct repeat (DR) element. This mutation led to EKLF-independent ɛ-globin transcription during definitive erythropoiesis. A second 4-bp substitution in the ɛ-globin CAAT sequence, which simultaneously disrupts a second DR element, further enhanced ectopic definitive erythroid activation of ɛ-globin transcription, which surprisingly became EKLF dependent. We finally examined factors in nuclear extracts prepared from embryonic or adult erythroid cells that bound these elements in vitro, and we identified a novel DR-binding protein (DRED) whose properties are consistent with those expected for a definitive-stage ɛ-globin repressor. We conclude that the suppression of ɛ-globin transcription during definitive erythropoiesis is mediated by the binding of a repressor that prevents EKLF from activating the ɛ-globin gene. PMID:11069894

Silencing of Aγ-Globin Gene Expression during Adult Definitive Erythropoiesis Mediated by GATA-1-FOG-1-Mi2 Complex Binding at the −566 GATA Site▿ †

PubMed Central

Harju-Baker, Susanna; Costa, Flávia C.; Fedosyuk, Halyna; Neades, Renee; Peterson, Kenneth R.

2008-01-01

Autonomous silencing of γ-globin transcription is an important developmental regulatory mechanism controlling globin gene switching. An adult stage-specific silencer of the Aγ-globin gene was identified between −730 and −378 relative to the mRNA start site. A marked copy of the Aγ-globin gene inserted between locus control region 5′ DNase I-hypersensitive site 1 and the ɛ-globin gene was transcriptionally silenced in adult β-globin locus yeast artificial chromosome (β-YAC) transgenic mice, but deletion of the 352-bp region restored expression. This fragment reduced reporter gene expression in K562 cells, and GATA-1 was shown to bind within this sequence at the −566 GATA site. Further, the Mi2 protein, a component of the NuRD complex, was observed in erythroid cells with low γ-globin levels, whereas only a weak signal was detected when γ-globin was expressed. Chromatin immunoprecipitation of fetal liver tissue from β-YAC transgenic mice demonstrated that GATA-1, FOG-1, and Mi2 were recruited to the Aγ-globin −566 or Gγ-globin −567 GATA site when γ-globin expression was low (day 18) but not when γ-globin was expressed (day 12). These data suggest that during definitive erythropoiesis, γ-globin gene expression is silenced, in part, by binding a protein complex containing GATA-1, FOG-1, and Mi2 at the −566/−567 GATA sites of the proximal γ-globin promoters. PMID:18347053

Silencing of Agamma-globin gene expression during adult definitive erythropoiesis mediated by GATA-1-FOG-1-Mi2 complex binding at the -566 GATA site.

PubMed

Harju-Baker, Susanna; Costa, Flávia C; Fedosyuk, Halyna; Neades, Renee; Peterson, Kenneth R

2008-05-01

Autonomous silencing of gamma-globin transcription is an important developmental regulatory mechanism controlling globin gene switching. An adult stage-specific silencer of the (A)gamma-globin gene was identified between -730 and -378 relative to the mRNA start site. A marked copy of the (A)gamma-globin gene inserted between locus control region 5' DNase I-hypersensitive site 1 and the epsilon-globin gene was transcriptionally silenced in adult beta-globin locus yeast artificial chromosome (beta-YAC) transgenic mice, but deletion of the 352-bp region restored expression. This fragment reduced reporter gene expression in K562 cells, and GATA-1 was shown to bind within this sequence at the -566 GATA site. Further, the Mi2 protein, a component of the NuRD complex, was observed in erythroid cells with low gamma-globin levels, whereas only a weak signal was detected when gamma-globin was expressed. Chromatin immunoprecipitation of fetal liver tissue from beta-YAC transgenic mice demonstrated that GATA-1, FOG-1, and Mi2 were recruited to the (A)gamma-globin -566 or (G)gamma-globin -567 GATA site when gamma-globin expression was low (day 18) but not when gamma-globin was expressed (day 12). These data suggest that during definitive erythropoiesis, gamma-globin gene expression is silenced, in part, by binding a protein complex containing GATA-1, FOG-1, and Mi2 at the -566/-567 GATA sites of the proximal gamma-globin promoters.

LCR 5′ hypersensitive site specificity for globin gene activation within the active chromatin hub

PubMed Central

Peterson, Kenneth R.; Fedosyuk, Halyna; Harju-Baker, Susanna

2012-01-01

The DNaseI hypersensitive sites (HSs) of the human β-globin locus control region (LCR) may function as part of an LCR holocomplex within a larger active chromatin hub (ACH). Differential activation of the globin genes during development may be controlled in part by preferential interaction of each gene with specific individual HSs during globin gene switching, a change in conformation of the LCR holocomplex, or both. To distinguish between these possibilities, human β-globin locus yeast artificial chromosome (β-YAC) lines were produced in which the ε-globin gene was replaced with a second marked β-globin gene (βm), coupled to an intact LCR, a 5′HS3 complete deletion (5′ΔHS3) or a 5′HS3 core deletion (5′ΔHS3c). The 5′ΔHS3c mice expressed βm-globin throughout development; γ-globin was co-expressed in the embryonic yolk sac, but not in the fetal liver; and wild-type β-globin was co-expressed in adult mice. Although the 5′HS3 core was not required for βm-globin expression, previous work showed that the 5′HS3 core is necessary for ε-globin expression during embryonic erythropoiesis. A similar phenotype was observed in 5′HS complete deletion mice, except βm-globin expression was higher during primitive erythropoiesis and γ-globin expression continued into fetal definitive erythropoiesis. These data support a site specificity model of LCR HS-globin gene interaction. PMID:23042246

Identification of rare and novel deletions that cause (δβ)0-thalassaemia and hereditary persistence of foetal haemoglobin in Indian population.

PubMed

Mayuranathan, Thiyagaraj; Rayabaram, Janakiram; Das, Reena; Arora, Neeraj; Edison, Eunice S; Chandy, Mammen; Srivastava, Alok; Velayudhan, Shaji R

2014-06-01

Hereditary persistence of foetal haemoglobin (HPFH) and (δβ)(0) -thalassaemia are conditions caused by large deletions that involve δ- and β-globin genes in the β-globin cluster, and they are characterized by increased haemoglobin (HbF) levels in adults. Significant phenotypic diversity is observed between the different mutations that cause these conditions. Molecular characterization of these deletions is important for accurate molecular diagnosis, and they will also provide the information on the cis-acting genetic regulatory elements present in the β-globin cluster. We performed gap-PCR, multiplex ligation-dependent probe amplification (MLPA), quantitative fluorescent multiplex PCR (QF-MPCR) and DNA sequencing to detect and characterize the deletions in the β-globin cluster. We characterized six different deletions resulting in (δβ)(0) -thalassaemia or HPFH in 51 unrelated families. With the help of multiple genetic tools, we performed comprehensive genetic analysis of HPFH and (δβ)(0) -thalassaemia in Indian population and could define the molecular basis of these conditions in this population. We also identified two novel HPFH mutations, 49.98 kb (HPFH-9) and 86.7 kb (HPFH-10) deletions, in this population. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Correction of Murine Sickle Cell Disease Using γ-Globin Lentiviral Vectors to Mediate High-level Expression of Fetal Hemoglobin

PubMed Central

Pestina, Tamara I; Hargrove, Phillip W; Jay, Dennis; Gray, John T; Boyd, Kelli M; Persons, Derek A

2008-01-01

Increased levels of red cell fetal hemogloblin, whether due to hereditary persistence of expression or from induction with hydroxyurea therapy, effectively ameliorate sickle cell disease (SCD). Therefore, we developed erythroid-specific, γ-globin lentiviral vectors for hematopoietic stem cell (HSC)-targeted gene therapy with the goal of permanently increasing fetal hemoglobin (HbF) production in sickle red cells. We evaluated two different γ-globin lentiviral vectors for therapeutic efficacy in the BERK sickle cell mouse model. The first vector, V5, contained the γ-globin gene driven by 3.1 kb of β-globin regulatory sequences and a 130-bp β-globin promoter. The second vector, V5m3, was identical except that the γ-globin 3′-untranslated region (3′-UTR) was replaced with the β-globin 3′-UTR. Adult erythroid cells have β-globin mRNA 3′-UTR-binding proteins that enhance β-globin mRNA stability and we postulated this design might enhance γ-globin expression. Stem cell gene transfer was efficient and nearly all red cells in transplanted mice expressed human γ-globin. Both vectors demonstrated efficacy in disease correction, with the V5m3 vector producing a higher level of γ-globin mRNA which was associated with high-level correction of anemia and secondary organ pathology. These data support the rationale for a gene therapy approach to SCD by permanently enhancing HbF using a γ-globin lentiviral vector. PMID:19050697

THE ANTIGENIC PROPERTIES OF GLOBIN CASEINATE

PubMed Central

Gay, Frederick P.; Robertson, T. Brailsford

1913-01-01

This study of globin and its compound with casein (globin caseinate) shows that globin fails to produce fixation antibodies in rabbits after repeated injections, thus agreeing with our own work and with that of others with similar histon bodies which are primarily toxic. When globin is combined with casein, however, it gives rise to antibodies that react not only with globin caseinate and casein but also with globin. The antibodies in antiglobin casein serum are apparently separate, one for globin and one for casein. In other words, the change in globin undergone on combination with casein has apparently rendered it antigenic. We did not succeed in demonstrating the genesis of this new antigenic property by anaphylaxis experiments. A further investigation of similar and more complex combined proteins is indicated and gives promise of more light on the nature of biological specificity. PMID:19867665

Monomethylfumarate Induces γ-Globin Expression and Fetal Hemoglobin Production in Cultured Human Retinal Pigment Epithelial (RPE) and Erythroid Cells, and in Intact Retina

PubMed Central

Promsote, Wanwisa; Makala, Levi; Li, Biaoru; Smith, Sylvia B.; Singh, Nagendra; Ganapathy, Vadivel; Pace, Betty S.; Martin, Pamela M.

2014-01-01

Purpose. Sickle retinopathy (SR) is a major cause of vision loss in sickle cell disease (SCD). There are no strategies to prevent SR and treatments are extremely limited. The present study evaluated (1) the retinal pigment epithelial (RPE) cell as a hemoglobin producer and novel cellular target for fetal hemoglobin (HbF) induction, and (2) monomethylfumarate (MMF) as an HbF-inducing therapy and abrogator of oxidative stress and inflammation in SCD retina. Methods. Human globin gene expression was evaluated by RT–quantitative (q)PCR in the human RPE cell line ARPE-19 and in primary RPE cells isolated from Townes humanized SCD mice. γ-Globin promoter activity was monitored in KU812 stable dual luciferase reporter expressing cells treated with 0 to 1000 μM dimethylfumarate, MMF, or hydroxyurea (HU; positive control) by dual luciferase assay. Reverse transcriptase–qPCR, fluorescence-activated cell sorting (FACS), immunofluorescence, and Western blot techniques were used to evaluate γ-globin expression and HbF production in primary human erythroid progenitors, ARPE-19, and normal hemoglobin producing (HbAA) and homozygous βs mutation (HbSS) RPE that were treated similarly, and in MMF-injected (1000 μM) HbAA and HbSS retinas. Dihydroethidium labeling and nuclear factor (erythroid-derived 2)-like 2 (Nrf2), IL-1β, and VEGF expression were also analyzed. Results. Retinal pigment epithelial cells express globin genes and synthesize adult and fetal hemoglobin MMF stimulated γ-globin expression and HbF production in cultured RPE and erythroid cells, and in HbSS mouse retina where it also reduced oxidative stress and inflammation. Conclusions. The production of hemoglobin by RPE suggests the potential involvement of this cell type in the etiology of SR. Monomethylfumarate influences multiple parameters consistent with improved retinal health in SCD and may therefore be of therapeutic potential in SR treatment. PMID:24825111

Molecular analysis of globin gene expression in different thalassaemia disorders: individual variation of β(E) pre-mRNA splicing determine disease severity.

PubMed

Tubsuwan, Alisa; Munkongdee, Thongperm; Jearawiriyapaisarn, Natee; Boonchoy, Chanikarn; Winichagoon, Pranee; Fucharoen, Suthat; Svasti, Saovaros

2011-09-01

Thalassaemia is characterized by the reduced or absent production of globins in the haemoglobin molecule leading to imbalanced α-globin/non α-globin chains. HbE, the result of a G to A mutation in codon 26 of the HBB (β-globin) gene, activates a cryptic 5' splice site in codon 25 leading to a reduction of correctly spliced β(E) -globin (HBB:c.79G>A) mRNA and consequently β(+) -thalassaemia. A wide range of clinical severities in bothα- and β-thalassaemia syndromes, from nearly asymptomatic to transfusion-dependent, has been observed. The correlation between clinical heterogeneity in various genotypes of thalassaemia and the levels of globin gene expression and β(E) -globin pre-mRNA splicing were examined using multiplex quantitative real-time reverse transcription polymerase chain reaction (RT-qPCR) and allele-specific RT-qPCR. The α-globin/non α-globin mRNA ratio was demonstrated to be a good indicator for disease severity among different thalassaemia disorders. However, the α-globin/non α-globin mRNA ratio ranged widely in β-thalassaemia/HbE patients, with no significant difference between mild and severe phenotypes. Interestingly, the correctly to aberrantly spliced β(E) -globin mRNA ratio in 30% of mild β-thalassaemia/HbE patients was higher than that of the severe patients. The splicing process of β(E) -globin pre-mRNA differs among β-thalassaemia/HbE patients and serves as one of the modifying factors for disease severity. © 2011 Blackwell Publishing Ltd.

The hematopoietic regulator TAL1 is required for chromatin looping between the β-globin LCR and human γ-globin genes to activate transcription

PubMed Central

Yun, Won Ju; Kim, Yea Woon; Kang, Yujin; Lee, Jungbae; Dean, Ann; Kim, AeRi

2014-01-01

TAL1 is a key hematopoietic transcription factor that binds to regulatory regions of a large cohort of erythroid genes as part of a complex with GATA-1, LMO2 and Ldb1. The complex mediates long-range interaction between the β-globin locus control region (LCR) and active globin genes, and although TAL1 is one of the two DNA-binding complex members, its role is unclear. To explore the role of TAL1 in transcription activation of the human γ-globin genes, we reduced the expression of TAL1 in erythroid K562 cells using lentiviral short hairpin RNA, compromising its association in the β-globin locus. In the TAL1 knockdown cells, the γ-globin transcription was reduced to 35% and chromatin looping of the Gγ-globin gene with the LCR was disrupted with decreased occupancy of the complex member Ldb1 and LMO2 in the locus. However, GATA-1 binding, DNase I hypersensitive site formation and several histone modifications were largely maintained across the β-globin locus. In addition, overexpression of TAL1 increased the γ-globin transcription and increased interaction frequency between the Gγ-globin gene and LCR. These results indicate that TAL1 plays a critical role in chromatin loop formation between the γ-globin genes and LCR, which is a critical step for the transcription of the γ-globin genes. PMID:24470145

The hematopoietic regulator TAL1 is required for chromatin looping between the β-globin LCR and human γ-globin genes to activate transcription.

PubMed

Yun, Won Ju; Kim, Yea Woon; Kang, Yujin; Lee, Jungbae; Dean, Ann; Kim, AeRi

2014-04-01

TAL1 is a key hematopoietic transcription factor that binds to regulatory regions of a large cohort of erythroid genes as part of a complex with GATA-1, LMO2 and Ldb1. The complex mediates long-range interaction between the β-globin locus control region (LCR) and active globin genes, and although TAL1 is one of the two DNA-binding complex members, its role is unclear. To explore the role of TAL1 in transcription activation of the human γ-globin genes, we reduced the expression of TAL1 in erythroid K562 cells using lentiviral short hairpin RNA, compromising its association in the β-globin locus. In the TAL1 knockdown cells, the γ-globin transcription was reduced to 35% and chromatin looping of the (G)γ-globin gene with the LCR was disrupted with decreased occupancy of the complex member Ldb1 and LMO2 in the locus. However, GATA-1 binding, DNase I hypersensitive site formation and several histone modifications were largely maintained across the β-globin locus. In addition, overexpression of TAL1 increased the γ-globin transcription and increased interaction frequency between the (G)γ-globin gene and LCR. These results indicate that TAL1 plays a critical role in chromatin loop formation between the γ-globin genes and LCR, which is a critical step for the transcription of the γ-globin genes.

Conservation of globin genes in the "living fossil" Latimeria chalumnae and reconstruction of the evolution of the vertebrate globin family.

PubMed

Schwarze, Kim; Burmester, Thorsten

2013-09-01

The (hemo-)globins are among the best-investigated proteins in biomedical sciences. These small heme-proteins play an important role in oxygen supply, but may also have other functions. In addition to well known hemoglobin and myoglobin, six other vertebrate globin types have been identified in recent years: neuroglobin, cytoglobin, globin E, globin X, globin Y, and androglobin. Analyses of the genome of the "living fossil" Latimeria chalumnae show that the coelacanth is the only known vertebrate that includes all eight globin types. Thus, Latimeria can also be considered as a "globin fossil". Analyses of gene synteny and phylogenetic reconstructions allow us to trace the evolution and the functional changes of the vertebrate globin family. Neuroglobin and globin X diverged from the other globin types before the separation of Protostomia and Deuterostomia. The cytoglobins, which are unlikely to be involved in O2 supply, form the earliest globin branch within the jawed vertebrates (Gnathostomata), but do not group with the agnathan hemoglobins, as it has been proposed before. There is strong evidence from phylogenetic reconstructions and gene synteny that the eye-specific globin E and muscle-specific myoglobin constitute a common clade, suggesting a similar role in intracellular O2 supply. Latimeria possesses two α- and two β-hemoglobin chains, of which one α-chain emerged prior to the divergence of Actinopterygii and Sarcopterygii, but has been retained only in the coelacanth. Notably, the embryonic hemoglobin α-chains of Gnathostomata derive from a common ancestor, while the embryonic β-chains - with the exception of a more complex pattern in the coelacanth and amphibians - display a clade-specific evolution. Globin Y is associated with the hemoglobin gene cluster, but its phylogenetic position is not resolved. Our data show an early divergence of distinct globin types in the vertebrate evolution before the emergence of tetrapods. The subsequent loss of globins in certain taxa may be associated with changes in the oxygen-dependent metabolism. This article is part of a Special Issue entitled: Oxygen Binding and Sensing Proteins. Copyright © 2013 Elsevier B.V. All rights reserved.

Ancient Duplications and Expression Divergence in the Globin Gene Superfamily of Vertebrates: Insights from the Elephant Shark Genome and Transcriptome

PubMed Central

Opazo, Juan C.; Toloza-Villalobos, Jessica; Burmester, Thorsten; Venkatesh, Byrappa; Storz, Jay F.

2015-01-01

Comparative analyses of vertebrate genomes continue to uncover a surprising diversity of genes in the globin gene superfamily, some of which have very restricted phyletic distributions despite their antiquity. Genomic analysis of the globin gene repertoire of cartilaginous fish (Chondrichthyes) should be especially informative about the duplicative origins and ancestral functions of vertebrate globins, as divergence between Chondrichthyes and bony vertebrates represents the most basal split within the jawed vertebrates. Here, we report a comparative genomic analysis of the vertebrate globin gene family that includes the complete globin gene repertoire of the elephant shark (Callorhinchus milii). Using genomic sequence data from representatives of all major vertebrate classes, integrated analyses of conserved synteny and phylogenetic relationships revealed that the last common ancestor of vertebrates possessed a repertoire of at least seven globin genes: single copies of androglobin and neuroglobin, four paralogous copies of globin X, and the single-copy progenitor of the entire set of vertebrate-specific globins. Combined with expression data, the genomic inventory of elephant shark globins yielded four especially surprising findings: 1) there is no trace of the neuroglobin gene (a highly conserved gene that is present in all other jawed vertebrates that have been examined to date), 2) myoglobin is highly expressed in heart, but not in skeletal muscle (reflecting a possible ancestral condition in vertebrates with single-circuit circulatory systems), 3) elephant shark possesses two highly divergent globin X paralogs, one of which is preferentially expressed in gonads, and 4) elephant shark possesses two structurally distinct α-globin paralogs, one of which is preferentially expressed in the brain. Expression profiles of elephant shark globin genes reveal distinct specializations of function relative to orthologs in bony vertebrates and suggest hypotheses about ancestral functions of vertebrate globins. PMID:25743544

Synthesis and Characterization of Positively Charged Pentacationic [60]Fullerene Monoadducts for Antimicrobial Photodynamic Inactivation

PubMed Central

Thota, Sammaiah; Wang, Min; Jeon, Seaho; Maragani, Satyanarayana; Hamblin, Michael R.; Chiang, Long Y.

2012-01-01

We designed and synthesized two analogous pentacationic [60]fullerenyl monoadducts, C60(>ME1N6+C3) (1) and C60(>ME3N6+C3) (2), with variation of the methoxyethyleneglycol length. Each of these derivatives bears a well-defined number of cationic charges aimed to enhance and control their ability to target pathogenic Gram-positive and Gram-negative bacterial cells for allowing photodynamic inactivation. The synthesis was achieved by the use of a common synthon of pentacationic N,N’,N,N,N,N-hexapropyl-hexa(aminoethyl)amine arm (C3N6+) having six attached propyl groups, instead of methyl or ethyl groups, to provide a well-balanced hydrophobicity–hydrophilicity character of pentacationic precursor intermediates and better compatibility with the highly hydrophobic C60 cage moiety. We demonstrated two plausible synthetic routes for the preparation of 1 and 2 with the product characterization via various spectroscopic methods. PMID:22565476

An intriguing high performance liquid chromatogram of a double heterozygosity for Hb Q-India/Hb D-Punjab.

PubMed

Badyal, Rama Kumari; Chhabra, Sanjeev; Sharma, Prashant; Das, Reena

2014-01-01

Cation exchange high performance liquid chromatography (HPLC) is commonly utilized as the first method of screening for thalassemias and hemoglobinopathies worldwide. This method of diagnosis requires knowledge of the clinical background and complete blood counts as well as skill and experience in interpreting the sometimes complex results produced. An asymptomatic 27-year-old pregnant North Indian woman was found to have a highly unusual chromatographic pattern with multiple unexpected peaks during routine antenatal screening. Most concerning was a C-window peak as Hb C (HBB: c.19G>A) is rare in ethnic Asian Indian populations. Cellulose acetate electrophoresis at alkaline pH (8.6) and parental screening were performed. These revealed the correct diagnosis to be a double heterozygosity for Hb Q-India (HBA1: c.193G>C) (an uncommon asymptomatic α-globin chain variant) plus Hb D-Punjab (HBB: c.364G>C) (a β-globin chain variant that is common in this region and is asymptomatic in the heterozygous state). The unexpected C-window peak was the hybrid of the abnormal α-Q-India and β-D-Punjab globin chains. Another small peak was explained as a variant Hb A2 formed by the combination of α-Q-India and δ-globin chains. Hematopathologists should be cognizant of the complex pattern resulting from coinheritance of both α- and β-globin structural variants. Second-line testing and parental testing are invaluable in resolving unknown peaks, especially if rare or unexpected variants are being considered. Although both Hb Q-India and Hb D-Punjab are relatively common in northwestern India, to the best of our knowledge, only two recent reports describe a total of three cases of such diagnostically puzzling coinheritance.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liebhaber, S.A.; Weiss, I.; Cash, F.E.

Synthesis of normal human hemoglobin A, {alpha}{sub 2}{beta}{sub 2}, is based upon balanced expression of genes in the {alpha}-globin gene cluster on chromosome 15 and the {beta}-globin gene cluster on chromosome 11. Full levels of erythroid-specific activation of the {beta}-globin cluster depend on sequences located at a considerable distance 5{prime} to the {beta}-globin gene, referred to as the locus-activating or dominant control region. The existence of an analogous element(s) upstream of the {alpha}-globin cluster has been suggested from observations on naturally occurring deletions and experimental studies. The authors have identified an individual with {alpha}-thalassemia in whom structurally normal {alpha}-globin genesmore » have been inactivated in cis by a discrete de novo 35-kilobase deletion located {approximately}30 kilobases 5{prime} from the {alpha}-globin gene cluster. They conclude that this deletion inactivates expression of the {alpha}-globin genes by removing one or more of the previously identified upstream regulatory sequences that are critical to expression of the {alpha}-globin genes.« less

β-Globin locus control region HS2 and HS3 interact structurally and functionally

PubMed Central

Jackson, David A.; McDowell, Jennifer C.; Dean, Ann

2003-01-01

The overall structure of the DNase I hypersensitive sites (HSs) that comprise the β-globin locus control region (LCR) is highly conserved among mammals, implying that the HSs have conserved functions. However, it is not well understood how the LCR HSs, either individually or collectively, activate transcription. We analyzed the interactions of HS2, HS3 and HS4 with the human ε- and β-globin genes in chromatinized episomes in fetal/embryonic K562 cells. Only HS2 activates transcription of the ε-globin gene, while all three HSs activate the β-globin gene. HS3 stimulates the β-globin gene constitutively, but HS2 and HS4 transactivation requires expression of the transcription factor EKLF, which is not present in K562 cells but is required for β-globin expression in vivo. To begin addressing how the individual HSs may interact with one another in a complex, we linked the β-globin gene to both the HS2 and HS3. HS2 and HS3 together resulted in synergistic stimulation of β-globin transcription. Unexpectedly, mutated, inactive forms of HS2 impeded the activation of the β-globin gene by HS3. Thus, there appear to be distinct interactions among the HSs and between the HSs and the globin genes. These preferential, non-exclusive interactions may underlie an important structural and functional cooperativity among the regulatory sequences of the β-globin locus in vivo. PMID:12582237

Erythroid Kruppel-like factor (EKLF) is recruited to the γ-globin gene promoter as a co-activator and is required for γ-globin gene induction by short-chain fatty acid derivatives

PubMed Central

Perrine, Susan P.; Mankidy, Rishikesh; Boosalis, Michael S.; Bieker, James J.; Faller, Douglas V.

2011-01-01

Objectives The erythroid Kruppel-like factor (EKLF) is an essential transcription factor for β-type globin gene switching, and specifically activates transcription of the adult β-globin gene promoter. We sought to determine if EKLF is also required for activation of the γ-globin gene by short-chain fatty acid (SCFA) derivatives, which are now entering clinical trials. Methods The functional and physical interaction of EKLF and co-regulatory molecules with the endogenous human globin gene promoters was studied in primary human erythroid progenitors and cell lines, using chromatin immunoprecipitation (ChIP) assays and genetic manipulation of the levels of EKLF and co-regulators. Results and conclusions Knockdown of EKLF prevents SCFA-induced expression of the γ-globin promoter in a stably expressed μLCRβprRlucAγprFluc cassette, and prevents induction of the endogenous γ-globin gene in primary human erythroid progenitors. EKLF is actively recruited to endogenous γ-globin gene promoters after exposure of primary human erythroid progenitors, and murine hematopoietic cell lines, to SCFA derivatives. The core ATPase BRG1 subunit of the human SWI/WNF complex, a ubiquitous multimeric complex that regulates gene expression by remodeling nucleosomal structure, is also required for γ-globin gene induction by SCFA derivatives. BRG1 is actively recruited to the endogenous γ-globin promoter of primary human erythroid progenitors by exposure to SCFA derivatives, and this recruitment is dependent upon the presence of EKLF. These findings demonstrate that EKLF, and the co-activator BRG1, previously demonstrated to be required for definitive or adult erythropoietic patterns of globin gene expression, are co-opted by SCFA derivatives to activate the fetal globin genes. PMID:19220418

Globin gene structure in a reptile supports the transpositional model for amniote α- and β-globin gene evolution.

PubMed

Patel, Vidushi S; Ezaz, Tariq; Deakin, Janine E; Graves, Jennifer A Marshall

2010-12-01

The haemoglobin protein, required for oxygen transportation in the body, is encoded by α- and β-globin genes that are arranged in clusters. The transpositional model for the evolution of distinct α-globin and β-globin clusters in amniotes is much simpler than the previously proposed whole genome duplication model. According to this model, all jawed vertebrates share one ancient region containing α- and β-globin genes and several flanking genes in the order MPG-C16orf35-(α-β)-GBY-LUC7L that has been conserved for more than 410 million years, whereas amniotes evolved a distinct β-globin cluster by insertion of a transposed β-globin gene from this ancient region into a cluster of olfactory receptors flanked by CCKBR and RRM1. It could not be determined whether this organisation is conserved in all amniotes because of the paucity of information from non-avian reptiles. To fill in this gap, we examined globin gene organisation in a squamate reptile, the Australian bearded dragon lizard, Pogona vitticeps (Agamidae). We report here that the α-globin cluster (HBK, HBA) is flanked by C16orf35 and GBY and is located on a pair of microchromosomes, whereas the β-globin cluster is flanked by RRM1 on the 3' end and is located on the long arm of chromosome 3. However, the CCKBR gene that flanks the β-globin cluster on the 5' end in other amniotes is located on the short arm of chromosome 5 in P. vitticeps, indicating that a chromosomal break between the β-globin cluster and CCKBR occurred at least in the agamid lineage. Our data from a reptile species provide further evidence to support the transpositional model for the evolution of β-globin gene cluster in amniotes.

Sequence Divergence in the 3′ Untranslated Regions of Human ζ- and α-Globin mRNAs Mediates a Difference in Their Stabilities and Contributes to Efficient α-to-ζ Gene Developmental Switching

PubMed Central

Russell, J. Eric; Morales, Julia; Makeyev, Aleksandr V.; Liebhaber, Stephen A.

1998-01-01

The developmental stage-specific expression of human globin proteins is characterized by a switch from the coexpression of ζ- and α-globin in the embryonic yolk sac to exclusive expression of α-globin during fetal and adult life. Recent studies with transgenic mice demonstrate that in addition to transcriptional control elements, full developmental silencing of the human ζ-globin gene requires elements encoded within the transcribed region. In the current work, we establish that these latter elements operate posttranscriptionally by reducing the relative stability of ζ-globin mRNA. Using a transgenic mouse model system, we demonstrate that human ζ-globin mRNA is unstable in adult erythroid cells relative to the highly stable human α-globin mRNA. A critical determinant of the difference between α- and ζ-globin mRNA stability is mapped by in vivo expression studies to their respective 3′ untranslated regions (3′UTRs). In vitro messenger ribonucleoprotein (mRNP) assembly assays demonstrate that the α- and ζ-globin 3′UTRs assemble a previously described mRNP stability-determining complex, the α-complex, with distinctly different affinities. The diminished efficiency of α-complex assembly on the ζ 3′UTR results from a single C→G nucleotide substitution in a crucial polypyrimidine tract contained by both the human α- and ζ-globin mRNA 3′UTRs. A potential pathway for accelerated ζ-globin mRNA decay is suggested by the observation that its 3′UTR encodes a shortened poly(A) tail. Based upon these data, we propose a model for ζ-globin gene silencing in fetal and adult erythroid cells in which posttranscriptional controls play a central role by providing for accelerated clearance of ζ-globin transcripts. PMID:9528789

Ancient Duplications and Expression Divergence in the Globin Gene Superfamily of Vertebrates: Insights from the Elephant Shark Genome and Transcriptome.

PubMed

Opazo, Juan C; Lee, Alison P; Hoffmann, Federico G; Toloza-Villalobos, Jessica; Burmester, Thorsten; Venkatesh, Byrappa; Storz, Jay F

2015-07-01

Comparative analyses of vertebrate genomes continue to uncover a surprising diversity of genes in the globin gene superfamily, some of which have very restricted phyletic distributions despite their antiquity. Genomic analysis of the globin gene repertoire of cartilaginous fish (Chondrichthyes) should be especially informative about the duplicative origins and ancestral functions of vertebrate globins, as divergence between Chondrichthyes and bony vertebrates represents the most basal split within the jawed vertebrates. Here, we report a comparative genomic analysis of the vertebrate globin gene family that includes the complete globin gene repertoire of the elephant shark (Callorhinchus milii). Using genomic sequence data from representatives of all major vertebrate classes, integrated analyses of conserved synteny and phylogenetic relationships revealed that the last common ancestor of vertebrates possessed a repertoire of at least seven globin genes: single copies of androglobin and neuroglobin, four paralogous copies of globin X, and the single-copy progenitor of the entire set of vertebrate-specific globins. Combined with expression data, the genomic inventory of elephant shark globins yielded four especially surprising findings: 1) there is no trace of the neuroglobin gene (a highly conserved gene that is present in all other jawed vertebrates that have been examined to date), 2) myoglobin is highly expressed in heart, but not in skeletal muscle (reflecting a possible ancestral condition in vertebrates with single-circuit circulatory systems), 3) elephant shark possesses two highly divergent globin X paralogs, one of which is preferentially expressed in gonads, and 4) elephant shark possesses two structurally distinct α-globin paralogs, one of which is preferentially expressed in the brain. Expression profiles of elephant shark globin genes reveal distinct specializations of function relative to orthologs in bony vertebrates and suggest hypotheses about ancestral functions of vertebrate globins. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

A Phylogenetic Analysis of the Globins in Fungi

PubMed Central

Hoogewijs, David; Dewilde, Sylvia; Vierstraete, Andy; Moens, Luc; Vinogradov, Serge N.

2012-01-01

Background All globins belong to one of three families: the F (flavohemoglobin) and S (sensor) families that exhibit the canonical 3/3 α-helical fold, and the T (truncated 3/3 fold) globins characterized by a shortened 2/2 α-helical fold. All eukaryote 3/3 hemoglobins are related to the bacterial single domain F globins. It is known that Fungi contain flavohemoglobins and single domain S globins. Our aims are to provide a census of fungal globins and to examine their relationships to bacterial globins. Results Examination of 165 genomes revealed that globins are present in >90% of Ascomycota and ∼60% of Basidiomycota genomes. The S globins occur in Blastocladiomycota and Chytridiomycota in addition to the phyla that have FHbs. Unexpectedly, group 1 T globins were found in one Blastocladiomycota and one Chytridiomycota genome. Phylogenetic analyses were carried out on the fungal globins, alone and aligned with representative bacterial globins. The Saccharomycetes and Sordariomycetes with two FHbs form two widely divergent clusters separated by the remaining fungal sequences. One of the Saccharomycete groups represents a new subfamily of FHbs, comprising a previously unknown N-terminal and a FHb missing the C-terminal moiety of its reductase domain. The two Saccharomycete groups also form two clusters in the presence of bacterial FHbs; the surrounding bacterial sequences are dominated by Proteobacteria and Bacilli (Firmicutes). The remaining fungal FHbs cluster with Proteobacteria and Actinobacteria. The Sgbs cluster separately from their bacterial counterparts, except for the intercalation of two Planctomycetes and a Proteobacterium between the Fungi incertae sedis and the Blastocladiomycota and Chytridiomycota. Conclusion Our results are compatible with a model of globin evolution put forward earlier, which proposed that eukaryote F, S and T globins originated via horizontal gene transfer of their bacterial counterparts to the eukaryote ancestor, resulting from the endosymbiotic events responsible for the origin of mitochondria and chloroplasts. PMID:22384087

Chromatin structure of the LCR in the human β-globin locus transcribing the adult δ- and β-globin genes.

PubMed

Kim, Seoyeon; Kim, Yea Woon; Shim, Sung Han; Kim, Chul Geun; Kim, Aeri

2012-03-01

The β-like globin genes are transcribed in a developmental stage specific fashion in erythroid cells. The specific transcription of globin genes is conferred by the locus control region (LCR), but the chromatin structure of the LCR in the human adult β-globin locus transcribing the δ- and β-globin genes is not clear. Here, we employed hybrid MEL cells that contain a human chromosome 11. The δ- and β-globin genes were highly transcribed in hybrid MEL/ch11 cells after transcriptional induction. LCR HS3 and HS2 were strongly occupied by erythroid specific transcriptional activators and co-factors in the induced locus. These HSs, but not HS4 and HS1, were in close proximity with the active globin genes as revealed by high resolution 3C experiments. The active features at HS3 were markedly established after transcriptional induction, while HS2 was in a relatively active conformation before the induction. Unexpectedly, HS1 did not show notable active features except histone hyperacetylation. Taken together, the LCR of the human β-globin locus transcribing the adult δ- and β-globin genes has HS specific chromatin structure. The structure at each HS, which is different from the locus transcribing the fetal globin genes, might relate to its role in transcribing the adult genes. Copyright © 2011 Elsevier Ltd. All rights reserved.

Zebrafish globin switching occurs in two developmental stages and is controlled by the LCR.

PubMed

Ganis, Jared J; Hsia, Nelson; Trompouki, Eirini; de Jong, Jill L O; DiBiase, Anthony; Lambert, Janelle S; Jia, Zhiying; Sabo, Peter J; Weaver, Molly; Sandstrom, Richard; Stamatoyannopoulos, John A; Zhou, Yi; Zon, Leonard I

2012-06-15

Globin gene switching is a complex, highly regulated process allowing expression of distinct globin genes at specific developmental stages. Here, for the first time, we have characterized all of the zebrafish globins based on the completed genomic sequence. Two distinct chromosomal loci, termed major (chromosome 3) and minor (chromosome 12), harbor the globin genes containing α/β pairs in a 5'-3' to 3'-5' orientation. Both these loci share synteny with the mammalian α-globin locus. Zebrafish globin expression was assayed during development and demonstrated two globin switches, similar to human development. A conserved regulatory element, the locus control region (LCR), was revealed by analyzing DNase I hypersensitive sites, H3K4 trimethylation marks and GATA1 binding sites. Surprisingly, the position of these sites with relation to the globin genes is evolutionarily conserved, despite a lack of overall sequence conservation. Motifs within the zebrafish LCR include CACCC, GATA, and NFE2 sites, suggesting functional interactions with known transcription factors but not the same LCR architecture. Functional homology to the mammalian α-LCR MCS-R2 region was confirmed by robust and specific reporter expression in erythrocytes of transgenic zebrafish. Our studies provide a comprehensive characterization of the zebrafish globin loci and clarify the regulation of globin switching. Copyright © 2012 Elsevier Inc. All rights reserved.

Electron paramagnetic resonance of globin proteins - a successful match between spectroscopic development and protein research

NASA Astrophysics Data System (ADS)

Van Doorslaer, Sabine; Cuypers, Bert

2018-02-01

At the start of the twenty-first century, the research into the haem-containing globins got a considerable impetus with the discovery of three new mammalian globins: neuroglobin, cytoglobin and androglobin. Globins are by now found in all kingdoms of life and, in many cases, their functions are still under debate. This revival in globin research increased the demand for adequate physico-chemical research tools to determine the structure-function relationships of these proteins. From early days onwards, electron paramagnetic resonance (EPR) has been used in globin research. In recent decades, the field of EPR has been revolutionised with the introduction of many new pulsed and high-field EPR techniques. In this review, we highlight how EPR has become an essential tool in globin research, and how globins equally provide ideal model systems to push technical developments in EPR.

Rapid and Sensitive Assessment of Globin Chains for Gene and Cell Therapy of Hemoglobinopathies

PubMed Central

Loucari, Constantinos C.; Patsali, Petros; van Dijk, Thamar B.; Stephanou, Coralea; Papasavva, Panayiota; Zanti, Maria; Kurita, Ryo; Nakamura, Yukio; Christou, Soteroulla; Sitarou, Maria; Philipsen, Sjaak; Lederer, Carsten W.; Kleanthous, Marina

2018-01-01

The β-hemoglobinopathies sickle cell anemia and β-thalassemia are the focus of many gene-therapy studies. A key disease parameter is the abundance of globin chains because it indicates the level of anemia, likely toxicity of excess or aberrant globins, and therapeutic potential of induced or exogenous β-like globins. Reversed-phase high-performance liquid chromatography (HPLC) allows versatile and inexpensive globin quantification, but commonly applied protocols suffer from long run times, high sample requirements, or inability to separate murine from human β-globin chains. The latter point is problematic for in vivo studies with gene-addition vectors in murine disease models and mouse/human chimeras. This study demonstrates HPLC-based measurements of globin expression (1) after differentiation of the commonly applied human umbilical cord blood–derived erythroid progenitor-2 cell line, (2) in erythroid progeny of CD34+ cells for the analysis of clustered regularly interspaced short palindromic repeats/Cas9-mediated disruption of the globin regulator BCL11A, and (3) of transgenic mice holding the human β-globin locus. At run times of 8 min for separation of murine and human β-globin chains as well as of human γ-globin chains, and with routine measurement of globin-chain ratios for 12 nL of blood (tested for down to 0.75 nL) or of 300,000 in vitro differentiated cells, the methods presented here and any variant-specific adaptations thereof will greatly facilitate evaluation of novel therapy applications for β-hemoglobinopathies. PMID:29325430

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, S.D.; Cooper, P.; Fung, J.

Genetic factors affecting post-natal g-globin expression - a major modifier of the severity of both b-thalassemia and sickle cell anemia, have been difficult to study. This is especially so in mice, an organism lacking a globin gene with an expression pattern equivalent to that of human g-globin. To model the human b-cluster in mice, with the goal of screening for loci affecting human g-globin expression in vivo, we introduced a human b-globin cluster YAC transgene into the genome of FVB mice . The b-cluster contained a Greek hereditary persistence of fetal hemoglobin (HPFH) g allele resulting in postnatal expression ofmore » human g-globin in transgenic mice. The level of human g-globin for various F1 hybrids derived from crosses between the FVB transgenics and other inbred mouse strains was assessed. The g-globin level of the C3HeB/FVB transgenic mice was noted to be significantly elevated. To map genes affecting postnatal g-globin expression, a 20 centiMorgan (cM) genome scan of a C3HeB/F VB transgenics [prime] FVB backcross was performed, followed by high-resolution marker analysis of promising loci. From this analysis we mapped a locus within a 2.2 cM interval of mouse chromosome 1 at a LOD score of 4.2 that contributes 10.4% of variation in g-globin expression level. Combining transgenic modeling of the human b-globin gene cluster with quantitative trait analysis, we have identified and mapped a murine locus that impacts on human g-globin expression in vivo.« less

Design of retrovirus vectors for transfer and expression of the human. beta. -globin gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miller, A.D.; Bender, M.A.; Harris, E.A.S.

1988-11-01

Regulated expression of the human ..beta..-globin gene has been demonstrated in cultured murine erythroleukemia cells and in mice after retrovirus-mediated gene transfer. However, the low titer of recombinant viruses described to date results in relatively inefficient gene transfer, which limits their usefulness for animal studies and for potential gene therapy in humans for diseases involving defective ..beta..-globin genes. The authors found regions that interfered with virus production within intron 2 of the ..beta..-globin gene and on both sides of the gene. The flanking regions could be removed, but intron 2 was required for ..beta..-globin expression. Inclusion of ..beta..-globin introns necessitatesmore » an antisense orientation of the gene within the retrovirus vector. However, they found no effect of the antisense ..beta..-globin transcription on virus production. A region downstream of the ..beta..-globin gene that stimulates expression of the gene in transgenic mice was included in the viruses without detrimental effects on virus titer. Virus titers of over 10/sup 6/ CFU/ml were obtained with the final vector design, which retained the ability to direct regulated expression of human ..beta..-globin in murine erythroleukemia cells. The vector also allowed transfer and expression of the human ..beta..-globin gene in hematopoietic cells (CFU-S cells) in mice.« less

Deletion of the human beta-globin LCR 5'HS4 or 5'HS1 differentially affects beta-like globin gene expression in beta-YAC transgenic mice.

PubMed

Fedosyuk, Halyna; Peterson, Kenneth R

2007-01-01

A 213 kb human beta-globin locus yeast artificial chromosome (beta-YAC) was modified by homologous recombination to delete 2.9 kb of cross-species conserved sequence similarity encompassing the LCR 5' hypersensitive site (HS) 4 (Delta5'HS4 beta-YAC). In three transgenic mouse lines, completion of the gamma- to beta-globin switch during definitive erythropoiesis was delayed relative to wild-type beta-YAC mice. In addition, quantitative per-copy human beta-like globin mRNA levels were similar to wild-type beta-YAC transgenic lines, although beta-globin gene expression was slightly decreased in the day 12 fetal liver of Delta5'HS4 beta-YAC mice. A 0.8 kb 5'HS1 fragment was similarly deleted in the YAC. Three Delta5'HS1 beta-YAC transgenic lines were established. epsilon-globin gene expression was markedly reduced, approximately 16 fold, during primitive erythropoiesis compared to wild-type beta-YAC mice, but gamma-globin expression levels were unaffected. However, during the fetal stage of definitive erythropoiesis, gamma-globin gene expression was decreased approximately 4 fold at day 12 and approximately 5 fold at day 14. Temporal developmental expression profiles of the beta-like globin genes were unaffected by deletion of 5'HS1. Decreased expression of the epsilon- and gamma-globin genes is the first phenotype ascribed to a 5'HS1 mutation in the human beta-globin locus, suggesting that this HS does indeed have a role in LCR function beyond simply a combined synergism with the other LCR HSs.

The phylogenetic and evolutionary history of a novel alpha-globin-type gene in orangutans (Pongo pygmaeus).

PubMed

Steiper, Michael E; Wolfe, Nathan D; Karesh, William B; Kilbourn, Annelisa M; Bosi, Edwin J; Ruvolo, Maryellen

2006-07-01

The alpha-globin genes are implicated in human resistance to malaria, a disease caused by Plasmodium parasites. This study is the first to analyze DNA sequences from a novel alpha-globin-type gene in orangutans, a species affected by Plasmodium. Phylogenetic methods show that the gene is a duplication of an alpha-globin gene and is located 5' of alpha-2 globin. The alpha-globin-type gene is notable for having four amino acid replacements relative to the orangutan's alpha-1 and alpha-2 globin genes, with no synonymous differences. Pairwise K(a)/K(s) methods and likelihood ratio tests (LRTs) revealed that the evolutionary history of the alpha-globin-type gene has been marked by either neutral or positive evolution, but not purifying selection. A comparative analysis of the amino acid replacements of the alpha-globin-type gene with human hemoglobinopathies and hemoglobin structure showed that two of the four replaced sites are members of the same molecular bond, one that is crucial to the proper functioning of the hemoglobin molecule. This suggested an adaptive evolutionary change. Functionally, this locus may result in a thalassemia-like phenotype in orangutans, possibly as an adaptation to combat Plasmodium.

[Main regulatory element (MRE) of the Danio rerio α/β-globin gene domain exerts enhancer activity toward the promoters of the embryonic-larval and adult globin genes].

PubMed

Kovina, A P; Petrova, N V; Razin, S V; Yarovaia, O V

2016-01-01

In warm-blooded vertebrates, the α- and β-globin genes are organized in domains of different types and are regulated in different fashion. In cold-blooded vertebrates and, in particular, the tropical fish Danio rerio, the α- and β-globin genes form two gene clusters. A major D. rerio globin gene cluster is in chromosome 3 and includes the α- and β-globin genes of embryonic-larval and adult types. The region upstream of the cluster contains c16orf35, harbors the main regulatory element (MRE) of the α-globin gene domain in warm-blooded vertebrates. In this study, transient transfection of erythroid cells with genetic constructs containing a reporter gene under the control of potential regulatory elements of the domain was performed to characterize the promoters of the embryonic-larval and adult α- and β-globin genes of the major cluster. Also, in the 5th intron of c16orf35 in Danio reriowas detected a functional analog of the warm-blooded vertebrate MRE. This enhancer stimulated activity of the promoters of both adult and embryonic-larval α- and β-globin genes.

[Genetic control of mitotic crossing-over in yeasts. III. Induction by 8-methoxypsoralen and long-wave UV irradiation (lambda=365 nm)].

PubMed

Fedorova, I V; Marfin, S V

1982-02-01

The lethal effect of 8-methoxypsoralen (8-MOP) plus 365 nm light has been studied in haploid radiosensitive strains of Saccharomyces cerevisiae. The diploid of wild type and the diploid homozygous for the rad2 mutation (this mutation blocks the excision of UV-induced pyrimidine dimers) were more resistant to the lethal effect of 8-MOP plus 365 nm light than the haploid of wild type and rad2 haploid, respectively. The diploid homozygous for rad54 mutation (the mutation blocks the repair of double-strand breaks in DNA) was more sensitive than haploid rad54. The method of repeated irradiation allowed to study the capacity of radiosensitive diploids to remove monoadducts induced by 8-MOP in DNA. This process was very effective in diploids of wild type and in the rad54 rad54 diploid, while the rad2 rad2 diploid was characterized by nearly complete absence of monoadduct excision. The study of mitotic crossing over and mitotic segregation in yeast diploids, containing a pair of complementing alleles of the ade2 gene (red/pink) has shown a very high recombinogenic effect of 8-MOP plus 365 nm light. The rad2 mutation slightly increased the frequency of mitotic segregation and mitotic crossing over. The rad54 mutation decreased the frequency of mitotic segregation and entirely suppressed mitotic crossing over. The method of repeated irradiation showed that the cross-links, but not monoadducts, are the main cause of high recombinogenic effect of 8-MOP plus 365 nm light. The possible participation of different repair systems in recombinational processes induced by 8-MOP in yeast cells is discussed.

Removing peroxide impurities from ether improves the quality of globin chains for biosynthetic studies.

PubMed

Mirzazadeh, Roghieh; Khatami, Shohreh; Bayat, Parastoo; Zamani, Zahra; Sadeghi, Sedigheh; Roohi, Soghra; Saidi, Parinaz

2005-01-01

The diagnosis of the different forms of thalassemia is one of the important applications of analysis of globin chains. These analyses are done by high performance liquid chromatography (HPLC) using a MONO-S cation exchange column and ether is used for washing the globin powder in the final step. The presence of peroxide impurities in ether could change the structure of the globin chains. In the chromatograms, these modified globins appear as separated peaks next to the unmodified globin peaks. In these cases, the alpha/beta ratio exceed by artifact the correct value. Our study demonstrates that diagnostic centers should ensure that the ether they use is pure.

Butyrate Infusions in the Ovine Fetus Delay the Biologic Clock for Globin Gene Switching

NASA Astrophysics Data System (ADS)

Perrine, Susan P.; Rudolph, Abraham; Faller, Douglas V.; Roman, Christine; Cohen, Ruth A.; Chen, Shao-Jing; Kan, Yuet Wai

1988-11-01

The switch from fetal to adult hemoglobin expression is regulated in many mammalian species by a developmental clock-like mechanism and determined by the gestational age of the fetus. Prolonging fetal globin gene expression is of considerable interest for therapeutic potential in diseases caused by abnormal β -globin genes. Butyric acid, which is found in increased plasma concentrations in infants of diabetic mothers who have delayed globin gene switching, was infused into catheterized fetal lambs in utero during the time of the normal globin gene switch period. The globin gene switch was significantly delayed in three of four butyrate-treated fetuses compared with controls and was entirely prevented in one fetus in whom the infusion was begun before the globin switch was under way. These data provide a model for investigating and arresting the biologic clock of hemoglobin switching.

Editing an α-globin enhancer in primary human hematopoietic stem cells as a treatment for β-thalassemia.

PubMed

Mettananda, Sachith; Fisher, Chris A; Hay, Deborah; Badat, Mohsin; Quek, Lynn; Clark, Kevin; Hublitz, Philip; Downes, Damien; Kerry, Jon; Gosden, Matthew; Telenius, Jelena; Sloane-Stanley, Jackie A; Faustino, Paula; Coelho, Andreia; Doondeea, Jessica; Usukhbayar, Batchimeg; Sopp, Paul; Sharpe, Jacqueline A; Hughes, Jim R; Vyas, Paresh; Gibbons, Richard J; Higgs, Douglas R

2017-09-04

β-Thalassemia is one of the most common inherited anemias, with no effective cure for most patients. The pathophysiology reflects an imbalance between α- and β-globin chains with an excess of free α-globin chains causing ineffective erythropoiesis and hemolysis. When α-thalassemia is co-inherited with β-thalassemia, excess free α-globin chains are reduced significantly ameliorating the clinical severity. Here we demonstrate the use of CRISPR/Cas9 genome editing of primary human hematopoietic stem/progenitor (CD34+) cells to emulate a natural mutation, which deletes the MCS-R2 α-globin enhancer and causes α-thalassemia. When edited CD34+ cells are differentiated into erythroid cells, we observe the expected reduction in α-globin expression and a correction of the pathologic globin chain imbalance in cells from patients with β-thalassemia. Xenograft assays show that a proportion of the edited CD34+ cells are long-term repopulating hematopoietic stem cells, demonstrating the potential of this approach for translation into a therapy for β-thalassemia.β-thalassemia is characterised by the presence of an excess of α-globin chains, which contribute to erythrocyte pathology. Here the authors use CRISP/Cas9 to reduce α-globin expression in hematopoietic precursors, and show effectiveness in xenograft assays in mice.

Efficient synthesis of supercoiled M13 DNA molecule containing a site specifically placed psoralen adduct and its use as a substrate for DNA replication

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kodadek, T.; Gamper, H.

The authors report a simple method for the in vitro synthesis of large quantities of site specifically modified DNA. The protocol involves extension of an oligonucleotide primer annealed to M13 single-stranded DNA using part of the T4 DNA polymerase holoenzyme. The resulting nicked double-stranded circles are ligated and supercoiled in the same tube, producing good yields of form I DNA. When the oligonucleotide primer is chemically modified, the resultant product contains a site-specific lesion. In this study, they report the synthesis of an M13 mp19 form I DNA which contains a psoralen monoadduct or cross-link at the KpnI site. Theymore » demonstrate the utility of these modified substrates by assessing the ability of the bacteriophage T4 DNA replication complex to bypass the damage and show that the psoralen monoadduct poses a severe block to the holoenzyme when attached to the template strand.« less

Molecular analysis of the beta-thalassemia phenotype associated with inheritance of hemoglobin E (alpha 2 beta2(26)Glu leads to Lys).

PubMed Central

Benz, E J; Berman, B W; Tonkonow, B L; Coupal, E; Coates, T; Boxer, L A; Altman, A; Adams, J G

1981-01-01

Inheritance of the gene for betaE-globin is associated with hypochromia and microcytosis, reminiscent of typical heterozygous beta-thalassemia. Patients with hemoglobin (Hb)E-beta-thalassemia exhibit clinical phenotypes of severe beta-thalassemia, a circumstance not encountered in other compound heterozygous states for structural beta-chain mutations and beta-thalassemia. We have analyzed the kinetics of globin synthesis and the levels of globin messenger (m) RNA accumulation in patients with Hb E-beta-thalassemia and Hb E trait. The initial rate of beta-globin synthesis (betaE/alpha=0.20-0.34) was less than expected on the basis of gene dosage, or comparable studies of other compound heterozygous states for beta-thalassemia and structurally abnormal beta-chains. betaE-globin synthesis was not only reduced during short-term incubations (1-5 min), but also remained relatively unchanged during long-term pulse or chase incubations up to 5h. Analysis of globin mRNA by cell-free translation and molecular hybridization confirmed that the unexpectedly low levels of betaE-globin synthesis were associated with comparable reduction in the levels of beta-globin mRNA. In Hb E-beta-thalassemia the betaA + betaE (alpha globin nRNA ratio observed were substantially lower than those obtained from reticulocytes of patients with heterozygous beta-thalassemia, or Hb S-betaO-thalassemia, while in Hb E trait, the betaA + betaE/alpha mRNA ratio was in the ranged observed for beta-thalassemia trait. The betaE-globin gene specifies reduced accumulation of betaE-globin mRNA, a property characteristic of other forms of beta-thalassemia. The beta-thalassemia phenotype associated with inheritance of Hb E is thus determined at the level of beta-globin mRNA metabolism. PMID:6166632

Eos Negatively Regulates Human γ-globin Gene Transcription during Erythroid Differentiation

PubMed Central

Yu, Hai-Chuan; Zhao, Hua-Lu; Wu, Zhi-Kui; Zhang, Jun-Wu

2011-01-01

Background Human globin gene expression is precisely regulated by a complicated network of transcription factors and chromatin modifying activities during development and erythropoiesis. Eos (Ikaros family zinc finger 4, IKZF4), a member of the zinc finger transcription factor Ikaros family, plays a pivotal role as a repressor of gene expression. The aim of this study was to examine the role of Eos in globin gene regulation. Methodology/Principal Findings Western blot and quantitative real-time PCR detected a gradual decrease in Eos expression during erythroid differentiation of hemin-induced K562 cells and Epo-induced CD34+ hematopoietic stem/progenitor cells (HPCs). DNA transfection and lentivirus-mediated gene transfer demonstrated that the enforced expression of Eos significantly represses the expression of γ-globin, but not other globin genes, in K562 cells and CD34+ HPCs. Consistent with a direct role of Eos in globin gene regulation, chromatin immunoprecipitaion and dual-luciferase reporter assays identified three discrete sites located in the DNase I hypersensitivity site 3 (HS3) of the β-globin locus control region (LCR), the promoter regions of the Gγ- and Aγ- globin genes, as functional binding sites of Eos protein. A chromosome conformation capture (3C) assay indicated that Eos may repress the interaction between the LCR and the γ-globin gene promoter. In addition, erythroid differentiation was inhibited by enforced expression of Eos in K562 cells and CD34+ HPCs. Conclusions/Significance Our results demonstrate that Eos plays an important role in the transcriptional regulation of the γ-globin gene during erythroid differentiation. PMID:21829552

[The effect of DNA hydroxymethylase Tet2 on γ globin activation in the treatment of β-thalassemia].

PubMed

Li, W X; Ma, Q W; Zeng, F Y

2018-03-01

Objective: To study the function of ten-eleven translocation 2 (Tet2) in γ globin gene expression in patients with β- thalassemia. Methods: Gamma globin expression was induced by 5-azacytidine and Tet2 gene expression was knocked down by short hairpin RNA (shRNA) in a human immortalized myelogenous leukemia K562 cell line. The global 5-hydroxymethylcytosine (5hmC) level was measured by an ELISA kit. 5hmC level of γ globin gene was quantified by sulfite sequencing. The mRNA level of Tet2, γ globin, and related transcription factors Nfe4 and Klf1 were quantified by real-time PCR. Results: Tet2 knockdown resulted in a decreased global 5hmC level from 0.14% to 0.03% as of the control group in K562 cells. The expression of γ globin was enhanced after 5-azacytidine treatment in vitro. However, γ globin mRNA level in Tet2 knockdown cells was only 55% as that in control group. The CG sites on γ globin gene were unmethylated. As Tet2 was down-regulated, the expression levels of Nfe4 and Klf1 decreased by about 80% and increased to 3.5 folds, respectively. Conclusions: Tet2 appears to maintain 5hmC level and facilitates γ globin gene activation. Moreover, Tet2 more likely regulates γ globin expression via affecting transcription factors rather than the gene itself. Thus, Tet2 could be a potential therapeutic target for β thalassemias.

Generation and Characterization of a Transgenic Mouse Carrying a Functional Human β-Globin Gene with the IVSI-6 Thalassemia Mutation

PubMed Central

Mancini, Irene; Lampronti, Ilaria; Salvatori, Francesca; Fabbri, Enrica; Zuccato, Cristina; Cosenza, Lucia C.; Montagner, Giulia; Borgatti, Monica; Altruda, Fiorella; Fagoonee, Sharmila; Carandina, Gianni; Aiello, Vincenzo; Breda, Laura; Rivella, Stefano; Gambari, Roberto

2015-01-01

Mouse models that carry mutations causing thalassemia represent a suitable tool to test in vivo new mutation-specific therapeutic approaches. Transgenic mice carrying the β-globin IVSI-6 mutation (the most frequent in Middle-Eastern regions and recurrent in Italy and Greece) are, at present, not available. We report the production and characterization of a transgenic mouse line (TG-β-IVSI-6) carrying the IVSI-6 thalassemia point mutation within the human β-globin gene. In the TG-β-IVSI-6 mouse (a) the transgenic integration region is located in mouse chromosome 7; (b) the expression of the transgene is tissue specific; (c) as expected, normally spliced human β-globin mRNA is produced, giving rise to β-globin production and formation of a human-mouse tetrameric chimeric hemoglobin mu α-globin2/hu β-globin2 and, more importantly, (d) the aberrant β-globin-IVSI-6 RNAs are present in blood cells. The TG-β-IVSI-6 mouse reproduces the molecular features of IVSI-6 β-thalassemia and might be used as an in vivo model to characterize the effects of antisense oligodeoxynucleotides targeting the cryptic sites responsible for the generation of aberrantly spliced β-globin RNA sequences, caused by the IVSI-6 mutation. These experiments are expected to be crucial for the development of a personalized therapy for β-thalassemia. PMID:26097845

Structural and Functional Analysis of an mRNP Complex That Mediates the High Stability of Human β-Globin mRNA

PubMed Central

Yu, Jia; Russell, J. Eric

2001-01-01

Human globins are encoded by mRNAs exhibiting high stabilities in transcriptionally silenced erythrocyte progenitors. Unlike α-globin mRNA, whose stability is enhanced by assembly of a specific messenger RNP (mRNP) α complex on its 3′ untranslated region (UTR), neither the structure(s) nor the mechanism(s) that effects the high-level stability of human β-globin mRNA has been identified. The present work describes an mRNP complex assembling on the 3′ UTR of the β-globin mRNA that exhibits many of the properties of the stability-enhancing α complex. The β-globin mRNP complex is shown to contain one or more factors homologous to αCP, a 39-kDa RNA-binding protein that is integral to α-complex assembly. Sequence analysis implicates a specific 14-nucleotide pyrimidine-rich track within its 3′ UTR as the site of β-globin mRNP assembly. The importance of this track to mRNA stability is subsequently verified in vivo using mice expressing human β-globin transgenes that contain informative mutations in this region. In combination, the in vitro and in vivo analyses indicate that the high stabilities of the α- and β-globin mRNAs are maintained through related mRNP complexes that may share a common regulatory pathway. PMID:11486027

Relationship of the Interaction Between Two Quantitative Trait Loci with γ-Globin Expression in β-Thalassemia Intermedia Patients.

PubMed

NickAria, Shiva; Haghpanah, Sezaneh; Ramzi, Mani; Karimi, Mehran

2018-05-10

Globin switching is a significant factor on blood hemoglobin (Hb) level but its molecular mechanisms have not yet been identified, however, several quantitative trait loci (QTL) and polymorphisms involved regions on chromosomes 2p, 6q, 8q and X account for variation in the γ-globin expression level. We studied the effect of interaction between a region on intron six of the TOX gene, chromosome 8q (chr8q) and XmnI locus on the γ-globin promoter, chr11p on γ-globin expression in 150 β-thalassemia intermedia (β-TI) patients, evaluated by statistical interaction analysis. Our results showed a significant interaction between one QTL on intron six of the TOX gene (rs9693712) and XmnI locus that effect γ-globin expression. Interchromosomal interaction mediates through transcriptional machanisms to preserve true genome architectural features, chromosomes localization and DNA bending. This interaction can be a part of the unknown molecular mechanism of globin switching and regulation of gene expression.

Beta-globin locus activation regions: conservation of organization, structure, and function.

PubMed Central

Li, Q L; Zhou, B; Powers, P; Enver, T; Stamatoyannopoulos, G

1990-01-01

The human beta-globin locus activation region (LAR) comprises four erythroid-specific DNase I hypersensitive sites (I-IV) thought to be largely responsible for activating the beta-globin domain and facilitating high-level erythroid-specific globin gene expression. We identified the goat beta-globin LAR, determined 10.2 kilobases of its sequence, and demonstrated its function in transgenic mice. The human and goat LARs share 6.5 kilobases of homologous sequences that are as highly conserved as the epsilon-globin gene promoters. Furthermore, the overall spatial organization of the two LARs has been conserved. These results suggest that the functionally relevant regions of the LAR are large and that in addition to their primary structure, the spatial relationship of the conserved elements is important for LAR function. Images PMID:2236034

Activation of the alpha-globin gene expression correlates with dramatic upregulation of nearby non-globin genes and changes in local and large-scale chromatin spatial structure.

PubMed

Ulianov, Sergey V; Galitsyna, Aleksandra A; Flyamer, Ilya M; Golov, Arkadiy K; Khrameeva, Ekaterina E; Imakaev, Maxim V; Abdennur, Nezar A; Gelfand, Mikhail S; Gavrilov, Alexey A; Razin, Sergey V

2017-07-11

In homeotherms, the alpha-globin gene clusters are located within permanently open genome regions enriched in housekeeping genes. Terminal erythroid differentiation results in dramatic upregulation of alpha-globin genes making their expression comparable to the rRNA transcriptional output. Little is known about the influence of the erythroid-specific alpha-globin gene transcription outburst on adjacent, widely expressed genes and large-scale chromatin organization. Here, we have analyzed the total transcription output, the overall chromatin contact profile, and CTCF binding within the 2.7 Mb segment of chicken chromosome 14 harboring the alpha-globin gene cluster in cultured lymphoid cells and cultured erythroid cells before and after induction of terminal erythroid differentiation. We found that, similarly to mammalian genome, the chicken genomes is organized in TADs and compartments. Full activation of the alpha-globin gene transcription in differentiated erythroid cells is correlated with upregulation of several adjacent housekeeping genes and the emergence of abundant intergenic transcription. An extended chromosome region encompassing the alpha-globin cluster becomes significantly decompacted in differentiated erythroid cells, and depleted in CTCF binding and CTCF-anchored chromatin loops, while the sub-TAD harboring alpha-globin gene cluster and the upstream major regulatory element (MRE) becomes highly enriched with chromatin interactions as compared to lymphoid and proliferating erythroid cells. The alpha-globin gene domain and the neighboring loci reside within the A-like chromatin compartment in both lymphoid and erythroid cells and become further segregated from the upstream gene desert upon terminal erythroid differentiation. Our findings demonstrate that the effects of tissue-specific transcription activation are not restricted to the host genomic locus but affect the overall chromatin structure and transcriptional output of the encompassing topologically associating domain.

Assessment of virally vectored autoimmunity as a biocontrol strategy for cane toads.

PubMed

Pallister, Jackie A; Halliday, Damien C T; Robinson, Anthony J; Venables, Daryl; Voysey, Rhonda D; Boyle, Donna G; Shanmuganathan, Thayalini; Hardy, Christopher M; Siddon, Nicole A; Hyatt, Alex D

2011-01-25

The cane toad, Bufo (Chaunus) marinus, is one of the most notorious vertebrate pests introduced into Australia over the last 200 years and, so far, efforts to identify a naturally occurring B. marinus-specific pathogen for use as a biological control agent have been unsuccessful. We explored an alternative approach that entailed genetically modifying a pathogen with broad host specificity so that it no longer caused disease, but carried a gene to disrupt the cane toad life cycle in a species specific manner. The adult beta globin gene was selected as the model gene for proof of concept of autoimmunity as a biocontrol method for cane toads. A previous report showed injection of bullfrog tadpoles with adult beta globin resulted in an alteration in the form of beta globin expressed in metamorphs as well as reduced survival. In B. marinus we established for the first time that the switch from tadpole to adult globin exists. The effect of injecting B. marinus tadpoles with purified recombinant adult globin protein was then assessed using behavioural (swim speed in tadpoles and jump length in metamorphs), developmental (time to metamorphosis, weight and length at various developmental stages, protein profile of adult globin) and genetic (adult globin mRNA levels) measures. However, we were unable to detect any differences between treated and control animals. Further, globin delivery using Bohle iridovirus, an Australian ranavirus isolate belonging to the Iridovirus family, did not reduce the survival of metamorphs or alter the form of beta globin expressed in metamorphs. While we were able to show for the first time that the switch from tadpole to adult globin does occur in B. marinus, we were not able to induce autoimmunity and disrupt metamorphosis. The short development time of B. marinus tadpoles may preclude this approach.

Association of an α-globin gene cluster duplication and heterozygous β-thalassemia in a patient with a severe thalassemia syndrome.

PubMed

Jiang, Hua; Liu, Sha; Zhang, Yong-Ling; Wan, Jun-Hui; Li, Ru; Li, Dong-Zhi

2015-01-01

We describe a new case of a β-thalassemia (β-thal) heterozygote with the mutation IVS-II-654 (C>T) presenting with a transfusion-dependent phenotype. Multiplex ligation-dependent probe amplification (MLPA) and array comparative genomic hybridization (CGH) analyses of the α-globin gene cluster revealed a full duplication of the α-globin genes including the upstream regulatory element. The duplicated allele and the normal allele in trans resulted in a total of six active α-globin genes. The severe clinical phenotype seemed to be related to the considerable excess of the α- and β-globin deficit caused by the presence of the β-thal. α-Globin cluster duplication should be considered in patients heterozygous for β-thal who show a more severe phenotype than β-thal trait.

Inhibition of G9a methyltransferase stimulates fetal hemoglobin production by facilitating LCR/γ-globin looping.

PubMed

Krivega, Ivan; Byrnes, Colleen; de Vasconcellos, Jaira F; Lee, Y Terry; Kaushal, Megha; Dean, Ann; Miller, Jeffery L

2015-07-30

Induction of fetal hemoglobin (HbF) production in adult erythrocytes can reduce the severity of sickle cell disease and β-thalassemia. Transcription of β-globin genes is regulated by the distant locus control region (LCR), which is brought into direct gene contact by the LDB1/GATA-1/TAL1/LMO2-containing complex. Inhibition of G9a H3K9 methyltransferase by the chemical compound UNC0638 activates fetal and represses adult β-globin gene expression in adult human hematopoietic precursor cells, but the underlying mechanisms are unclear. Here we studied UNC0638 effects on β-globin gene expression using ex vivo differentiation of CD34(+) erythroid progenitor cells from peripheral blood of healthy adult donors. UNC0638 inhibition of G9a caused dosed accumulation of HbF up to 30% of total hemoglobin in differentiated cells. Elevation of HbF was associated with significant activation of fetal γ-globin and repression of adult β-globin transcription. Changes in gene expression were associated with widespread loss of H3K9me2 in the locus and gain of LDB1 complex occupancy at the γ-globin promoters as well as de novo formation of LCR/γ-globin contacts. Our findings demonstrate that G9a establishes epigenetic conditions preventing activation of γ-globin genes during differentiation of adult erythroid progenitor cells. In this view, manipulation of G9a represents a promising epigenetic approach for treatment of β-hemoglobinopathies.

MafK/NF-E2 p18 is required for beta-globin genes activation by mediating the proximity of LCR and active beta-globin genes in MEL cell line.

PubMed

Du, Mei-Jun; Lv, Xiang; Hao, De-Long; Zhao, Guo-Wei; Wu, Xue-Song; Wu, Feng; Liu, De-Pei; Liang, Chih-Chuan

2008-01-01

Evidences indicate that locus control region (LCR) of beta-globin spatially closes to the downstream active gene promoter to mediate the transcriptional activation by looping. DNA binding proteins may play an important role in the looping formation. NF-E2 is one of the key transcription factors in beta-globin gene transcriptional activation. To shed light on whether NF-E2 is involved in this process, DS19MafKsiRNA cell pools were established by specifically knocked down the expression of MafK/NF-E2 p18, one subunit of NF-E2 heterodimer. In the above cell pools, it was observed that the occupancy efficiency of NF-E2 on beta-globin gene locus and the expression level of beta-globin genes were decreased. H3 acetylation, H3-K4 methylation and the deposition of RNA polymerase II, but not the recruitment of GATA-1, were also found reduced at the beta-globin gene cluster. Chromosome Conformation Capture (3C) assay showed that the cross-linking frequency between the main NF-E2 binding site HS2 and downstream structural genes was reduced compared to the normal cell. This result demonstrated that MafK/NF-E2 p18 recruitment was involved in the physical proximity of LCR and active beta-globin genes upon beta-globin gene transcriptional activation.

Open and Lys–His Hexacoordinated Closed Structures of a Globin with Swapped Proximal and Distal Sites

PubMed Central

Teh, Aik-Hong; Saito, Jennifer A.; Najimudin, Nazalan; Alam, Maqsudul

2015-01-01

Globins are haem-binding proteins with a conserved fold made up of α-helices and can possess diverse properties. A putative globin-coupled sensor from Methylacidiphilum infernorum, HGbRL, contains an N-terminal globin domain whose open and closed structures reveal an untypical dimeric architecture. Helices E and F fuse into an elongated helix, resulting in a novel site-swapped globin fold made up of helices A–E, hence the distal site, from one subunit and helices F–H, the proximal site, from another. The open structure possesses a large cavity binding an imidazole molecule, while the closed structure forms a unique Lys–His hexacoordinated species, with the first turn of helix E unravelling to allow Lys52(E10) to bind to the haem. Ligand binding induces reorganization of loop CE, which is stabilized in the closed form, and helix E, triggering a large conformational movement in the open form. These provide a mechanical insight into how a signal may be relayed between the globin domain and the C-terminal domain of HGbRL, a Roadblock/LC7 domain. Comparison with HGbI, a closely related globin, further underlines the high degree of structural versatility that the globin fold is capable of, enabling it to perform a diversity of functions. PMID:26094577

Whole-Genome Duplication and the Functional Diversification of Teleost Fish Hemoglobins

PubMed Central

Opazo, Juan C.; Butts, G. Tyler; Nery, Mariana F.; Storz, Jay F.; Hoffmann, Federico G.

2013-01-01

Subsequent to the two rounds of whole-genome duplication that occurred in the common ancestor of vertebrates, a third genome duplication occurred in the stem lineage of teleost fishes. This teleost-specific genome duplication (TGD) is thought to have provided genetic raw materials for the physiological, morphological, and behavioral diversification of this highly speciose group. The extreme physiological versatility of teleost fish is manifest in their diversity of blood–gas transport traits, which reflects the myriad solutions that have evolved to maintain tissue O2 delivery in the face of changing metabolic demands and environmental O2 availability during different ontogenetic stages. During the course of development, regulatory changes in blood–O2 transport are mediated by the expression of multiple, functionally distinct hemoglobin (Hb) isoforms that meet the particular O2-transport challenges encountered by the developing embryo or fetus (in viviparous or oviparous species) and in free-swimming larvae and adults. The main objective of the present study was to assess the relative contributions of whole-genome duplication, large-scale segmental duplication, and small-scale gene duplication in producing the extraordinary functional diversity of teleost Hbs. To accomplish this, we integrated phylogenetic reconstructions with analyses of conserved synteny to characterize the genomic organization and evolutionary history of the globin gene clusters of teleosts. These results were then integrated with available experimental data on functional properties and developmental patterns of stage-specific gene expression. Our results indicate that multiple α- and β-globin genes were present in the common ancestor of gars (order Lepisoteiformes) and teleosts. The comparative genomic analysis revealed that teleosts possess a dual set of TGD-derived globin gene clusters, each of which has undergone lineage-specific changes in gene content via repeated duplication and deletion events. Phylogenetic reconstructions revealed that paralogous genes convergently evolved similar functional properties in different teleost lineages. Consistent with other recent studies of globin gene family evolution in vertebrates, our results revealed evidence for repeated evolutionary transitions in the developmental regulation of Hb synthesis. PMID:22949522

Towards β-globin gene-targeting with integrase-defective lentiviral vectors.

PubMed

Inanlou, Davoud Nouri; Yakhchali, Bagher; Khanahmad, Hossein; Gardaneh, Mossa; Movassagh, Hesam; Cohan, Reza Ahangari; Ardestani, Mehdi Shafiee; Mahdian, Reza; Zeinali, Sirous

2010-11-01

We have developed an integrase-defective lentiviral (LV) vector in combination with a gene-targeting approach for gene therapy of β-thalassemia. The β-globin gene-targeting construct has two homologous stems including sequence upstream and downstream of the β-globin gene, a β-globin gene positioned between hygromycin and neomycin resistant genes and a herpes simplex virus type 1 thymidine kinase (HSVtk) suicide gene. Utilization of integrase-defective LV as a vector for the β-globin gene increased the number of selected clones relative to non-viral methods. This method represents an important step toward the ultimate goal of a clinical gene therapy for β-thalassemia.

Understanding α-globin gene regulation and implications for the treatment of β-thalassemia.

PubMed

Mettananda, Sachith; Gibbons, Richard J; Higgs, Douglas R

2016-03-01

Over the past three decades, a vast amount of new information has been uncovered describing how the globin genes are regulated. This knowledge has provided significant insights into the general understanding of the regulation of human genes. It is now known that molecular defects within and around the α- and β-globin genes, as well as in the distant regulatory elements, can cause thalassemia. Unbalanced production of globin chains owing to defective synthesis of one, and the continued unopposed synthesis of another, is the central causative factor in the cellular pathology and pathophysiology of thalassemia. A large body of clinical, genetic, and experimental evidence suggests that altering globin chain imbalance by reducing the production of α-globin synthesis ameliorates the disease severity in patients with β-thalassemia. With the development of new genetic-based therapeutic tools that have a potential to decrease the expression of a selected gene in a tissue-specific manner, the possibility of decreasing expression of the α-globin gene to improve the clinical severity of β-thalassemia could become a reality. © 2015 New York Academy of Sciences.

Mutations on the α2-Globin Gene That May Trigger α(+)-Thalassemia.

PubMed

Farashi, Samaneh; Vakili, Shadi; Garous, Negin F; Ashki, Mehri; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein

2015-01-01

In the present study, a total of 11 individuals with hypochromic microcytic anemia who did not reveal the most common α-thalassemia (α-thal) deletions or mutations, were subjected to more investigations by DNA sequencing of the α-globin genes. Seven novel nondeletional α-thal mutations localized on the α2-globin gene in the heterozygous state were identified. These mutations either corrupted regulatory splice sites and consequently affected RNA processing or created unstable hemoglobin (Hb) variants. The mutations described here produced globin gene variants that lead to amino acid changes in critical regions of the globin chain. The clinical presentation of most patients was a persistent mild microcytic anemia similar to an α(+)-thal. In the last decade, numerous α-globin mutations have been observed leading to an α-thal phenotype and these studies have been considered to be important as discussed here.

Repair of Thalassemic Human β -globin mRNA in Mammalian Cells by Antisense Oligonucleotides

NASA Astrophysics Data System (ADS)

Sierakowska, Halina; Sambade, Maria J.; Agrawal, Sudhir; Kole, Ryszard

1996-11-01

In one form of β -thalassemia, a genetic blood disorder, a mutation in intron 2 of the β -globin gene (IVS2-654) causes aberrant splicing of β -globin pre-mRNA and, consequently, β -globin deficiency. Treatment of mammalian cells stably expressing the IVS2-654 human β -globin gene with antisense oligonucleotides targeted at the aberrant splice sites restored correct splicing in a dose-dependent fashion, generating correct human β -globin mRNA and polypeptide. Both products persisted for up to 72 hr posttreatment. The oligonucleotides modified splicing by a true antisense mechanism without overt unspecific effects on cell growth and splicing of other pre-mRNAs. This novel approach in which antisense oligonucleotides are used to restore rather than to down-regulate the activity of the target gene is applicable to other splicing mutants and is of potential clinical interest.

Genetic recombination as a major cause of mutagenesis in the human globin gene clusters.

PubMed

Borg, Joseph; Georgitsi, Marianthi; Aleporou-Marinou, Vassiliki; Kollia, Panagoula; Patrinos, George P

2009-12-01

Homologous recombination is a frequent phenomenon in multigene families and as such it occurs several times in both the alpha- and beta-like globin gene families. In numerous occasions, genetic recombination has been previously implicated as a major mechanism that drives mutagenesis in the human globin gene clusters, either in the form of unequal crossover or gene conversion. Unequal crossover results in the increase or decrease of the human globin gene copies, accompanied in the majority of cases with minor phenotypic consequences, while gene conversion contributes either to maintaining sequence homogeneity or generating sequence diversity. The role of genetic recombination, particularly gene conversion in the evolution of the human globin gene families has been discussed elsewhere. Here, we summarize our current knowledge and review existing experimental evidence outlining the role of genetic recombination in the mutagenic process in the human globin gene families.

Erythroid activator NF-E2, TAL1 and KLF1 play roles in forming the LCR HSs in the human adult β-globin locus.

PubMed

Kim, Yea Woon; Yun, Won Ju; Kim, AeRi

2016-06-01

The β-like globin genes are developmental stage specifically transcribed in erythroid cells. The transcription of the β-like globin genes requires erythroid specific activators such as GATA-1, NF-E2, TAL1 and KLF1. However, the roles of these activators have not fully elucidated in transcription of the human adult β-globin gene. Here we employed hybrid MEL cells (MEL/ch11) where a human chromosome containing the β-globin locus is present and the adult β-globin gene is highly transcribed by induction. The roles of erythroid specific activators were analyzed by inhibiting the expression of NF-E2, TAL1 or KLF1 in MEL/ch11 cells. The loss of each activator decreased the transcription of human β-globin gene, locus wide histone hyperacetylation and the binding of other erythroid specific activators including GATA-1, even though not affecting the expression of other activators. Notably, sensitivity to DNase I was reduced in the locus control region (LCR) hypersensitive sites (HSs) with the depletion of activators. These results indicate that NF-E2, TAL1 and KLF1, all activators play a primary role in HSs formation in the LCR. It might contribute to the transcription of human adult β-globin gene by allowing the access of activators and cofactors. The roles of activators in the adult β-globin locus appear to be different from the roles in the early fetal locus. Copyright © 2016 Elsevier Ltd. All rights reserved.

The globins of cyanobacteria and algae.

PubMed

Johnson, Eric A; Lecomte, Juliette T J

2013-01-01

Approximately, 20 years ago, a haemoglobin gene was identified within the genome of the cyanobacterium Nostoc commune. Haemoglobins have now been confirmed in multiple species of photosynthetic microbes beyond N. commune, and the diversity of these proteins has recently come under increased scrutiny. This chapter summarizes the state of knowledge concerning the phylogeny, physiology and chemistry of globins in cyanobacteria and green algae. Sequence information is by far the best developed and the most rapidly expanding aspect of the field. Structural and ligand-binding properties have been described for just a few proteins. Physiological data are available for even fewer. Although activities such as nitric oxide dioxygenation and oxygen scavenging are strong candidates for cellular function, dedicated studies will be required to complete the story on this intriguing and ancient group of proteins. © 2013 Elsevier Ltd. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Popp, R.A.; Lalley, P.A.; Whitney, J.B.

A genetic polymorphism for a Bgl I endonuclease site near the ..cap alpha..-globin-like pseudogene ..cap alpha..-4 of C57BL/6 and C3H/HeN mice was used to show that ..cap alpha..-4 was not affected by three independent mutations in which the adult globin genes ..cap alpha..-1 and ..cap alpha..-2 were deleted. These results indicated that ..cap alpha..-4 might not be located adjacent to the adult ..cap alpha..-globin genes on chromosome 11. Restriction endonuclease analysis of DNA of a primary clone of a Chinese hamster-mouse somatic cell hybrid that had lost mouse chromosomes 11 and 18 showed that this clone lacked the adult murinemore » globin genes ..cap alpha..-1 and ..cap alpha..-2 but it did contain the ..cap alpha..-globin-like pseudogenes ..cap alpha..-3 and ..cap alpha..-4. These results indicated that the adult ..cap alpha..-globin genes and ..cap alpha..-globin-like pseudogenes are not located on the same chromosome. Similar analyses of several other Chinese hamster-mouse somatic cell hybrids that had segregated other mouse chromosomes indicated that the ..cap alpha..-globin-like pseudogenes ..cap alpha..-3 and ..cap alpha..-4 are located on mouse chromosomes 15 and 17, respectively. These data explain why ..cap alpha..-3 and ..cap alpha..-4 were not affected by the three independently induced deletion-type mutations that cause ..cap alpha..-thalassemia in the mouse.« less

Amelioration of murine beta-thalassemia through drug selection of hematopoietic stem cells transduced with a lentiviral vector encoding both gamma-globin and the MGMT drug-resistance gene.

PubMed

Zhao, Huifen; Pestina, Tamara I; Nasimuzzaman, Md; Mehta, Perdeep; Hargrove, Phillip W; Persons, Derek A

2009-06-04

Correction of murine models of beta-thalassemia has been achieved through high-level globin lentiviral vector gene transfer into mouse hematopoietic stem cells (HSCs). However, transduction of human HSCs is less robust and may be inadequate to achieve therapeutic levels of genetically modified erythroid cells. We therefore developed a double gene lentiviral vector encoding both human gamma-globin under the transcriptional control of erythroid regulatory elements and methylguanine methyltransferase (MGMT), driven by a constitutive cellular promoter. MGMT expression provides cellular resistance to alkylator drugs, which can be administered to kill residual untransduced, diseased HSCs, whereas transduced cells are protected. Mice transplanted with beta-thalassemic HSCs transduced with a gamma-globin/MGMT vector initially had subtherapeutic levels of red cells expressing gamma-globin. To enrich gamma-globin-expressing cells, transplanted mice were treated with the alkylator agent 1,3-bis-chloroethyl-1-nitrosourea. This resulted in significant increases in the number of gamma-globin-expressing red cells and the amount of fetal hemoglobin, leading to resolution of anemia. Selection of transduced HSCs was also obtained when cells were drug-treated before transplantation. Mice that received these cells demonstrated reconstitution with therapeutic levels of gamma-globin-expressing cells. These data suggest that MGMT-based drug selection holds promise as a modality to improve gene therapy for beta-thalassemia.

Mutagenesis of the lac promoter region in M13 mp10 phage DNA by 4'-hydroxymethyl-4,5',8-trimethylpsoralen

DOE Office of Scientific and Technical Information (OSTI.GOV)

Piette, J.; Decuyper-Debergh, D.; Gamper, H.

Double-stranded M13 phage DNA (M13 mp10 replicative form) was photoreacted with 4'-hydroxymethyl-4,5',8-trimethylpsoralen, using light of wavelength greater than 320 nm or greater than 390 nm to generate predominantly crosslinks or monoadducts, respectively. The damaged DNAs were scored for inactivation and mutagenesis after transfection into Escherichia coli. The appearance of light-blue or colorless plaques on indicator medium showed that mutation had occurred in the lac insert of the viral DNA. A comparison of the consequences of the two phototreatments with psoralen supports the idea that crosslinks are both more lethal and more mutagenic than monoadducts. Numerous mutant clones partially or totallymore » deficient in beta-galactosidase were plaque-purified and amplified. The viral DNA of each clone was sequenced by the dideoxy chain-terminating procedure. All of the observed base-pair changes were mapped to the lac promoter region and consisted of 3 transition, 14 transversion, and 6 single base-pair frame-shift mutations. The predominant mutation was a T.A----G.C transversion.« less

Assessment of Virally Vectored Autoimmunity as a Biocontrol Strategy for Cane Toads

PubMed Central

Robinson, Anthony J.; Venables, Daryl; Voysey, Rhonda D.; Boyle, Donna G.; Shanmuganathan, Thayalini; Hardy, Christopher M.; Siddon, Nicole A.; Hyatt, Alex D.

2011-01-01

Background The cane toad, Bufo (Chaunus) marinus, is one of the most notorious vertebrate pests introduced into Australia over the last 200 years and, so far, efforts to identify a naturally occurring B. marinus-specific pathogen for use as a biological control agent have been unsuccessful. We explored an alternative approach that entailed genetically modifying a pathogen with broad host specificity so that it no longer caused disease, but carried a gene to disrupt the cane toad life cycle in a species specific manner. Methodology/Principal Findings The adult beta globin gene was selected as the model gene for proof of concept of autoimmunity as a biocontrol method for cane toads. A previous report showed injection of bullfrog tadpoles with adult beta globin resulted in an alteration in the form of beta globin expressed in metamorphs as well as reduced survival. In B. marinus we established for the first time that the switch from tadpole to adult globin exists. The effect of injecting B. marinus tadpoles with purified recombinant adult globin protein was then assessed using behavioural (swim speed in tadpoles and jump length in metamorphs), developmental (time to metamorphosis, weight and length at various developmental stages, protein profile of adult globin) and genetic (adult globin mRNA levels) measures. However, we were unable to detect any differences between treated and control animals. Further, globin delivery using Bohle iridovirus, an Australian ranavirus isolate belonging to the Iridovirus family, did not reduce the survival of metamorphs or alter the form of beta globin expressed in metamorphs. Conclusions/Significance While we were able to show for the first time that the switch from tadpole to adult globin does occur in B. marinus, we were not able to induce autoimmunity and disrupt metamorphosis. The short development time of B. marinus tadpoles may preclude this approach. PMID:21283623

The effect of globin scaffold on osteoblast adhesion and phenotype expression in vitro.

PubMed

Hamdan, Ahmad A; Loty, Sabine; Isaac, Juliane; Tayot, Jean-Louis; Bouchard, Philippe; Khraisat, Ameen; Bedral, Ariane; Sautier, Jean-Michel

2012-01-01

Different synthetic and natural biomaterials have been used in bone tissue regeneration. However, several limitations are associated with the use of synthetic as well as allogenous or xenogenous natural materials. This study evaluated, in an in vitro model, the behavior of rat osteoblastic cells cultured on a human globin scaffold. Rat osteoblastic cells were isolated from the calvaria of 21-day-old fetal Sprague-Dawley rats. They were then grown in the presence of globin. Real-time polymerase chain reaction (RT-PCR) was performed to study the expression of cyclin D1, integrin Β1, Msx2, Dlx5, Runx2, and osteocalcin on days 1, 5, and 9. Moreover, alkaline phosphatase activity was measured on days 1, 3, 5, and 7. Alizarin red staining was performed on day 9 to observe calcium deposition. Cells were able to adhere, proliferate, and differentiate on globin scaffolds. Moreover, RT-PCR showed that globin may stimulate some key genes of osteoblastic differentiation (Runx2, osteocalcin, Dlx5). Globin had an inhibitory effect on alkaline phosphatase activity. Calcium deposits were seen after 9 days of culture. These results indicate that purified human globin might be a suitable scaffold for bone tissue regeneration.

Characterization of the transcriptome profiles related to globin gene switching during in vitro erythroid maturation

PubMed Central

2012-01-01

Background The fetal and adult globin genes in the human β-globin cluster on chromosome 11 are sequentially expressed to achieve normal hemoglobin switching during human development. The pharmacological induction of fetal γ-globin (HBG) to replace abnormal adult sickle βS-globin is a successful strategy to treat sickle cell disease; however the molecular mechanism of γ-gene silencing after birth is not fully understood. Therefore, we performed global gene expression profiling using primary erythroid progenitors grown from human peripheral blood mononuclear cells to characterize gene expression patterns during the γ-globin to β-globin (γ/β) switch observed throughout in vitro erythroid differentiation. Results We confirmed erythroid maturation in our culture system using cell morphologic features defined by Giemsa staining and the γ/β-globin switch by reverse transcription-quantitative PCR (RT-qPCR) analysis. We observed maximal γ-globin expression at day 7 with a switch to a predominance of β-globin expression by day 28 and the γ/β-globin switch occurred around day 21. Expression patterns for transcription factors including GATA1, GATA2, KLF1 and NFE2 confirmed our system produced the expected pattern of expression based on the known function of these factors in globin gene regulation. Subsequent gene expression profiling was performed with RNA isolated from progenitors harvested at day 7, 14, 21, and 28 in culture. Three major gene profiles were generated by Principal Component Analysis (PCA). For profile-1 genes, where expression decreased from day 7 to day 28, we identified 2,102 genes down-regulated > 1.5-fold. Ingenuity pathway analysis (IPA) for profile-1 genes demonstrated involvement of the Cdc42, phospholipase C, NF-Kβ, Interleukin-4, and p38 mitogen activated protein kinase (MAPK) signaling pathways. Transcription factors known to be involved in γ-and β-globin regulation were identified. The same approach was used to generate profile-2 genes where expression was up-regulated over 28 days in culture. IPA for the 2,437 genes with > 1.5-fold induction identified the mitotic roles of polo-like kinase, aryl hydrocarbon receptor, cell cycle control, and ATM (Ataxia Telangiectasia Mutated Protein) signaling pathways; transcription factors identified included KLF1, GATA1 and NFE2 among others. Finally, profile-3 was generated from 1,579 genes with maximal expression at day 21, around the time of the γ/β-globin switch. IPA identified associations with cell cycle control, ATM, and aryl hydrocarbon receptor signaling pathways. Conclusions The transcriptome analysis completed with erythroid progenitors grown in vitro identified groups of genes with distinct expression profiles, which function in metabolic pathways associated with cell survival, hematopoiesis, blood cells activation, and inflammatory responses. This study represents the first report of a transcriptome analysis in human primary erythroid progenitors to identify transcription factors involved in hemoglobin switching. Our results also demonstrate that the in vitro liquid culture system is an excellent model to define mechanisms of global gene expression and the DNA-binding protein and signaling pathways involved in globin gene regulation. PMID:22537182

A 21 Nucleotide Duplication on the α1- and α2-Globin Genes Involves a Variety of Hypochromic Microcytic Anemias, From Mild to Hb H Disease.

PubMed

Farashi, Samaneh; Faramarzi Garous, Negin; Zeinali, Fatemeh; Vakili, Shadi; Ashki, Mehri; Imanian, Hashem; Najmabadi, Hossein; Azarkeivan, Azita; Tamaddoni, Ahmad

2015-01-01

α-Thalassemia (α-thal) is a common genetic disorder in Iran and many parts of the world. Genetic defects in the α-globin gene cluster can result in α-thal that may develop into a clinical phenotype varying from almost asymptomatic to a lethal hemolytic anemia. Loss of one functional α gene, indicated as heterozygous α(+)-thal, shows minor hematological abnormalities. Homozygosity for α(+)- or heterozygosity for α(0)-thal have more severe hematological abnormalities due to a markedly reduced α chain output. At the molecular level, the absence of three α-globin genes resulting from the compound heterozygous state for α(0)- and α(+)-thal, lead to Hb H disease. Here we present a 21 nucleotide (nt) duplication consisting of six amino acids and 3 bp of intronic sequence at the exon-intron boundary, in both the α-globin genes, detected by direct DNA sequencing. This duplication was identified in three patients originating from two different Iranian ethnic groups and one Arab during more than 12 years. The clinical presentation of these individuals varies widely from a mild asymptomatic anemia (heterozygote in α1-globin gene) to a severely anemic state, diagnosed as an Hb H individual requiring blood transfusion (duplication on the α2-globin gene in combination with the - -(MED) double α-globin gene deletion). The third individual, who was homozygous for this nt duplication on the α1-globin gene, showed severe hypochromic microcytic anemia and splenomegaly. In the last decade, numerous α-globin mutations have demonstrated the necessity of prenatal diagnosis (PND) for α-thal, and this study has contributed another mutation as important enough that needs to be considered.

A Practical Platform for Blood Biomarker Study by Using Global Gene Expression Profiling of Peripheral Whole Blood

PubMed Central

Schmid, Patrick; Yao, Hui; Galdzicki, Michal; Berger, Bonnie; Wu, Erxi; Kohane, Isaac S.

2009-01-01

Background Although microarray technology has become the most common method for studying global gene expression, a plethora of technical factors across the experiment contribute to the variable of genome gene expression profiling using peripheral whole blood. A practical platform needs to be established in order to obtain reliable and reproducible data to meet clinical requirements for biomarker study. Methods and Findings We applied peripheral whole blood samples with globin reduction and performed genome-wide transcriptome analysis using Illumina BeadChips. Real-time PCR was subsequently used to evaluate the quality of array data and elucidate the mode in which hemoglobin interferes in gene expression profiling. We demonstrated that, when applied in the context of standard microarray processing procedures, globin reduction results in a consistent and significant increase in the quality of beadarray data. When compared to their pre-globin reduction counterparts, post-globin reduction samples show improved detection statistics, lowered variance and increased sensitivity. More importantly, gender gene separation is remarkably clearer in post-globin reduction samples than in pre-globin reduction samples. Our study suggests that the poor data obtained from pre-globin reduction samples is the result of the high concentration of hemoglobin derived from red blood cells either interfering with target mRNA binding or giving the pseudo binding background signal. Conclusion We therefore recommend the combination of performing globin mRNA reduction in peripheral whole blood samples and hybridizing on Illumina BeadChips as the practical approach for biomarker study. PMID:19381341

The role of fetal adrenal hormones in the switch from fetal to adult globin synthesis in the sheep.

PubMed

Wintour, E M; Smith, M B; Bell, R J; McDougall, J G; Cauchi, M N

1985-01-01

The switch from gamma (fetal) to beta (adult) globin production was studied by the analysis of globin synthesis in chronically cannulated ovine fetuses and newborn lambs. The gamma/alpha globin synthesis ratio decreased from 0.98 +/- 0.11 (S.D.) (n = 4 samples) at 100-120 days of gestation to 0.15 +/- 0.07 (n = 4) in lambs of 150-156 days post-conception, and the beta/alpha synthesis ratio increased from 0.04 +/- 0.06 (n = 4) to 1.13 +/- 0.21 (n = 4) over the same period. In bilaterally adrenalectomized fetuses, which survived in utero until 151-156 days, the gamma/alpha and beta/alpha synthesis ratios were 0.64 +/- 0.14 (n = 3) and 0.25 +/- 0.07 (n = 3) respectively in the 150- to 156-day period. Bilateral adrenalectomy did not affect the time of onset of beta globin synthesis, but significantly decreased the rate. In one bilaterally adrenalectomized fetus the infusion of increasing concentrations of cortisol restored the rate of beta globin synthesis to normal. Treatment of three intact fetuses with 100 micrograms cortisol/h for 3 weeks, from 100 to 121 days, did not affect the timing or rate of switch from gamma to beta globin synthesis. Thus fetal adrenal secretions, probably cortisol, affected the rate of change of gamma to beta globin synthesis but other factors must have been involved in the initiation of the switch.

A molecular study of a family with Greek hereditary persistence of fetal hemoglobin and beta-thalassemia.

PubMed Central

Giglioni, B; Casini, C; Mantovani, R; Merli, S; Comi, P; Ottolenghi, S; Saglio, G; Camaschella, C; Mazza, U

1984-01-01

A family was studied in which two inherited defects of the non-alpha-globin cluster segregate: Greek hereditary persistence of fetal hemoglobin (HPFH) and beta-thalassemia. Fragments of the non-alpha-globin cluster from two patients were cloned in cosmid and phage lambda vectors, and assigned to either the HPFH or beta-thalassemic chromosome on the basis of the demonstration of a polymorphic BglII site in the HPFH gamma-globin cluster. The thalassemic beta-globin gene carries a mutation at nucleotide 1 of the intervening sequence I, known to cause beta zero-thalassemia; the beta-globin gene from the HPFH chromosome is entirely normal, both in the intron-exon sequence and in 5' flanking regions required for transcription. As the compound HPFH/beta-thalassemia heterozygote synthesizes HbA, these data prove that the HPFH beta-globin gene is functional, although at a decreased rate; its lower activity is likely to be due to a distant mutation. The HPFH A gamma-globin gene shows only two mutations: a T----C substitution in the large intervening sequence (responsible for the BglII polymorphic site) and a C----T substitution 196 nucleotides 5' to the cap site; the 5' flanking sequence is normal up to -1350 nucleotides upstream from the gene. Circumstantial evidence suggests that the mutation at -196 may be responsible for the abnormally high expression of the A gamma-globin gene. Images Fig. 1. Fig. 3. Fig. 4. Fig. 5. PMID:6210198

Alpha-globin gene haplotypes in South American Indians.

PubMed

Zago, M A; Melo Santos, E J; Clegg, J B; Guerreiro, J F; Martinson, J J; Norwich, J; Figueiredo, M S

1995-08-01

The haplotypes of the alpha-globin gene cluster were determined for 99 Indians from the Brazilian Amazon region who belong to 5 tribes: Wayampí, Wayana-Apalaí, Kayapó, Arára, and Yanomámi. Three predominant haplotypes were identified: Ia (present in 38.9% of chromosomes), IIIa (25.8%), and IIe (22.1%). The only alpha-globin gene rearrangement detected was alpha alpha alpha 3.7 I gene triplication associated with haplotype IIIa, found in high frequencies (5.6% and 10.6%) in two tribes and absent in the others. alpha-Globin gene deletions that cause alpha-thalassemia were not seen, supporting the argument that malaria was absent in these populations until recently. The heterogeneous distribution of alpha-globin gene haplotypes and rearrangements among the different tribes differs markedly from the homogeneous distribution of beta-globin gene cluster haplotypes and reflects the action of various genetic mechanisms (genetic drift, founder effect, consanguinity) on small isolated population groups with a complicated history of divergence-fusion events. The alpha-globin gene haplotype distribution has some similarities to distributions observed in Southeast Asian and Pacific Island populations, indicating that these populations have considerable genetic affinities. However, the absence of several features of the alpha-globin gene cluster that are consistently present among the Pacific Islanders suggests that the similarity of haplotypes between Brazilian Indians and people from Polynesia, Micronesia, and Melanesia is more likely to result of ancient common ancestry rather than the consequence of recent direct genetic contribution through immigration.

β-Globin-Expressing Definitive Erythroid Progenitor Cells Generated from Embryonic and Induced Pluripotent Stem Cell-Derived Sacs.

PubMed

Fujita, Atsushi; Uchida, Naoya; Haro-Mora, Juan J; Winkler, Thomas; Tisdale, John

2016-06-01

Human embryonic stem (ES) cells and induced pluripotent stem (iPS) cells represent a potential alternative source for red blood cell transfusion. However, when using traditional methods with embryoid bodies, ES cell-derived erythroid cells predominantly express embryonic type ɛ-globin, with lesser fetal type γ-globin and very little adult type β-globin. Furthermore, no β-globin expression is detected in iPS cell-derived erythroid cells. ES cell-derived sacs (ES sacs) have been recently used to generate functional platelets. Due to its unique structure, we hypothesized that ES sacs serve as hemangioblast-like progenitors capable to generate definitive erythroid cells that express β-globin. With our ES sac-derived erythroid differentiation protocol, we obtained ∼120 erythroid cells per single ES cell. Both primitive (ɛ-globin expressing) and definitive (γ- and β-globin expressing) erythroid cells were generated from not only ES cells but also iPS cells. Primitive erythropoiesis is gradually switched to definitive erythropoiesis during prolonged ES sac maturation, concurrent with the emergence of hematopoietic progenitor cells. Primitive and definitive erythroid progenitor cells were selected on the basis of glycophorin A or CD34 expression from cells within the ES sacs before erythroid differentiation. This selection and differentiation strategy represents an important step toward the development of in vitro erythroid cell production systems from pluripotent stem cells. Further optimization to improve expansion should be required for clinical application. Stem Cells 2016;34:1541-1552. © 2016 AlphaMed Press.

Nucleotide Sequence Analysis of RNA Synthesized from Rabbit Globin Complementary DNA

PubMed Central

Poon, Raymond; Paddock, Gary V.; Heindell, Howard; Whitcome, Philip; Salser, Winston; Kacian, Dan; Bank, Arthur; Gambino, Roberto; Ramirez, Francesco

1974-01-01

Rabbit globin complementary DNA made with RNA-dependent DNA polymerase (reverse transcriptase) was used as template for in vitro synthesis of 32P-labeled RNA. The sequences of the nucleotides in most of the fragments resulting from combined ribonuclease T1 and alkaline phosphatase digestion have been determined. Several fragments were long enough to fit uniquely with the α or β globin amino-acid sequences. These data demonstrate that the cDNA was copied from globin mRNA and contained no detectable contaminants. Images PMID:4139714

[Regulation of the β-globin gene family expression, useful in the search for new therapeutic targets for hemoglobinopathies].

PubMed

Scheps, Karen G; Varela, Viviana

Different hemoglobin isoforms are expressed during the embryonic, fetal and postnatal stages. They are formed by combination of polypeptide chains synthesized from the α- and β-globin gene clusters. Based on the fact that the presence of high hemoglobin F levels is beneficial in both sickle cell disease and severe thalassemic syndromes, a revision of the regulation of the β-globin cluster expression is proposed, especially regarding the genes encoding the y-globin chains (HBG1 and HBG2). In this review we describe the current knowledge about transcription factors and epigenetic regulators involved in the switches of the β-globin cluster. It is expected that the consolidation of knowledge in this field will allow finding new therapeutic targets for the treatment of hemoglobinopathies.

A new gene deletion in the alpha-like globin gene cluster as the molecular basis for the rare alpha-thalassemia-1(--/alpha alpha) in blacks: HbH disease in sickle cell trait.

PubMed

Steinberg, M H; Coleman, M B; Adams, J G; Hartmann, R C; Saba, H; Anagnou, N P

1986-02-01

A novel deletion of at least 26 kilobase of DNA, including both alpha-globin genes, the psi alpha- and psi zeta-globin genes, but sparing the functional zeta-gene was found in a 10-year-old black boy with HbH disease and sickle cell trait. This particular deletion has not previously been described in blacks. Its existence makes it likely that the absence of Hb Barts hydrops fetalis in blacks is due to the rarity of the chromosome lacking two alpha-globin genes rather than a result of early embryonic death due to the failure to synthesize embryonic hemoglobins because of deletion of functional zeta-globin genes.

β-globin gene cluster haplotypes in ethnic minority populations of southwest China

PubMed Central

Sun, Hao; Liu, Hongxian; Huang, Kai; Lin, Keqin; Huang, Xiaoqin; Chu, Jiayou; Ma, Shaohui; Yang, Zhaoqing

2017-01-01

The genetic diversity and relationships among ethnic minority populations of southwest China were investigated using seven polymorphic restriction enzyme sites in the β-globin gene cluster. The haplotypes of 1392 chromosomes from ten ethnic populations living in southwest China were determined. Linkage equilibrium and recombination hotspot were found between the 5′ sites and 3′ sites of the β-globin gene cluster. 5′ haplotypes 2 (+−−−), 6 (−++−+), 9 (−++++) and 3′ haplotype FW3 (−+) were the predominant haplotypes. Notably, haplotype 9 frequency was significantly high in the southwest populations, indicating their difference with other Chinese. The interpopulation differentiation of southwest Chinese minority populations is less than those in populations of northern China and other continents. Phylogenetic analysis shows that populations sharing same ethnic origin or language clustered to each other, indicating current β-globin cluster diversity in the Chinese populations reflects their ethnic origin and linguistic affiliations to a great extent. This study characterizes β-globin gene cluster haplotypes in southwest Chinese minorities for the first time, and reveals the genetic variability and affinity of these populations using β-globin cluster haplotype frequencies. The results suggest that ethnic origin plays an important role in shaping variations of the β-globin gene cluster in the southwestern ethnic populations of China. PMID:28205625

The locus control region is required for association of the murine β-globin locus with engaged transcription factories during erythroid maturation

PubMed Central

Ragoczy, Tobias; Bender, M.A.; Telling, Agnes; Byron, Rachel; Groudine, Mark

2006-01-01

We have examined the relationship between nuclear localization and transcriptional activity of the endogenous murine β-globin locus during erythroid differentiation. Murine fetal liver cells were separated into distinct erythroid maturation stages by fluorescence-activated cell sorting, and the nuclear position of the locus was determined at each stage. We find that the β-globin locus progressively moves away from the nuclear periphery with increasing maturation. Contrary to the prevailing notion that the nuclear periphery is a repressive compartment in mammalian cells, βmajor-globin expression begins at the nuclear periphery prior to relocalization. However, relocation of the locus to the nuclear interior with maturation is accompanied by an increase in βmajor-globin transcription. The distribution of nuclear polymerase II (Pol II) foci also changes with erythroid differentiation: Transcription factories decrease in number and contract toward the nuclear interior. Moreover, both efficient relocalization of the β-globin locus from the periphery and its association with hyperphosphorylated Pol II transcription factories require the locus control region (LCR). These results suggest that the LCR-dependent association of the β-globin locus with transcriptionally engaged Pol II foci provides the driving force for relocalization of the locus toward the nuclear interior during erythroid maturation. PMID:16705039

Production of β-globin and adult hemoglobin following G418 treatment of erythroid precursor cells from homozygous β039 thalassemia patients

PubMed Central

Salvatori, Francesca; Breveglieri, Giulia; Zuccato, Cristina; Finotti, Alessia; Bianchi, Nicoletta; Borgatti, Monica; Feriotto, Giordana; Destro, Federica; Canella, Alessandro; Brognara, Eleonora; Lampronti, Ilaria; Breda, Laura; Rivella, Stefano; Gambari, Roberto

2013-01-01

In several types of thalassemia (including β039-thalassemia), stop codon mutations lead to premature translation termination and to mRNA destabilization through nonsense-mediated decay. Drugs (for instance aminoglycosides) can be designed to suppress premature termination, inducing a ribosomal readthrough. These findings have introduced new hopes for the development of a pharmacologic approach to the cure of this disease. However, the effects of aminoglycosides on globin mRNA carrying β-thalassemia stop mutations have not yet been investigated. In this study, we have used a lentiviral construct containing the β039- thalassemia globin gene under control of the β-globin promoter and a LCR cassette. We demonstrated by fluorescence-activated cell sorting (FACS) analysis the production of β-globin by K562 cell clones expressing the β039-thalassemia globin gene and treated with G418. More importantly, after FACS and high-performance liquid chromatography (HPLC) analyses, erythroid precursor cells from β039-thalassemia patients were demonstrated to be able to produce β-globin and adult hemoglobin after treatment with G418. This study strongly suggests that ribosomal readthrough should be considered a strategy for developing experimental strategies for the treatment of β0-thalassemia caused by stop codon mutations. PMID:19810011

Splice-Site Mutations Cause Rrp6-Mediated Nuclear Retention of the Unspliced RNAs and Transcriptional Down-Regulation of the Splicing-Defective Genes

PubMed Central

Eberle, Andrea B.; Hessle, Viktoria; Helbig, Roger; Dantoft, Widad; Gimber, Niclas; Visa, Neus

2010-01-01

Background Eukaryotic cells have developed surveillance mechanisms to prevent the expression of aberrant transcripts. An early surveillance checkpoint acts at the transcription site and prevents the release of mRNAs that carry processing defects. The exosome subunit Rrp6 is required for this checkpoint in Saccharomyces cerevisiae, but it is not known whether Rrp6 also plays a role in mRNA surveillance in higher eukaryotes. Methodology/Principal Findings We have developed an in vivo system to study nuclear mRNA surveillance in Drosophila melanogaster. We have produced S2 cells that express a human β-globin gene with mutated splice sites in intron 2 (mut β-globin). The transcripts encoded by the mut β-globin gene are normally spliced at intron 1 but retain intron 2. The levels of the mut β-globin transcripts are much lower than those of wild type (wt) ß-globin mRNAs transcribed from the same promoter. We have compared the expression of the mut and wt β-globin genes to investigate the mechanisms that down-regulate the production of defective mRNAs. Both wt and mut β-globin transcripts are processed at the 3′, but the mut β-globin transcripts are less efficiently cleaved than the wt transcripts. Moreover, the mut β-globin transcripts are less efficiently released from the transcription site, as shown by FISH, and this defect is restored by depletion of Rrp6 by RNAi. Furthermore, transcription of the mut β-globin gene is significantly impaired as revealed by ChIP experiments that measure the association of the RNA polymerase II with the transcribed genes. We have also shown that the mut β-globin gene shows reduced levels of H3K4me3. Conclusions/Significance Our results show that there are at least two surveillance responses that operate cotranscriptionally in insect cells and probably in all metazoans. One response requires Rrp6 and results in the inefficient release of defective mRNAs from the transcription site. The other response acts at the transcription level and reduces the synthesis of the defective transcripts through a mechanism that involves histone modifications. PMID:20634951

Complete genome sequencing and analysis of Saprospira grandis str. Lewin, a predatory marine bacterium

PubMed Central

Saw, Jimmy H. W.; Yuryev, Anton; Kanbe, Masaomi; Hou, Shaobin; Young, Aaron G.; Aizawa, Shin-Ichi

2012-01-01

Saprospira grandis is a coastal marine bacterium that can capture and prey upon other marine bacteria using a mechanism known as ‘ixotrophy’. Here, we present the complete genome sequence of Saprospira grandis str. Lewin isolated from La Jolla beach in San Diego, California. The complete genome sequence comprises a chromosome of 4.35 Mbp and a plasmid of 54.9 Kbp. Genome analysis revealed incomplete pathways for the biosynthesis of nine essential amino acids but presence of a large number of peptidases. The genome encodes multiple copies of sensor globin-coupled rsbR genes thought to be essential for stress response and the presence of such sensor globins in Bacteroidetes is unprecedented. A total of 429 spacer sequences within the three CRISPR repeat regions were identified in the genome and this number is the largest among all the Bacteroidetes sequenced to date. PMID:22675601

The 87-kD A gamma-globin enhancer-binding protein is a product of the HOXB2(HOX2H) locus.

PubMed

Sengupta, P K; Lavelle, D E; DeSimone, J

1994-03-01

Developmental regulation of globin gene expression may be controlled by developmental stage-specific nuclear proteins that influence interactions between the locus control region and local regulatory sequences near individual globin genes. We previously isolated an 87-kD nuclear protein from K562 cells that bound to DNA sequences in the beta-globin locus control region, gamma-globin promoter, and A gamma-globin enhancer. The presence of this protein in fetal globin-expressing cells and its absence in adult globin-expressing cells suggested that it may be a developmental stage-specific factor. A lambda gt11 K562 cDNA clone encoding a portion of the HOXB2 (formerly HOX2H) homeobox gene was isolated on the basis of the ability of its beta-galactosidase fusion protein to bind to the same DNA sequences as the 87-kD K562 protein. Because no other relationship had been established between the 87-kD K562 protein and the HOXB2 protein other than their ability to bind ot the same DNA sequences, we have investigated whether the two proteins are related antigenically. Our data show that antisera produced against the HOXB2-beta-gal fusion protein and a synthetic HOXB2 decapeptide react specifically with an 87-kD protein from K562 nuclear extract, showing that the 87-kD K562 nuclear protein is a product of the HOXB2 locus, and is the first demonstration of cellular HOXB2 protein.

Mi2β Is Required for γ-Globin Gene Silencing: Temporal Assembly of a GATA-1-FOG-1-Mi2 Repressor Complex in β-YAC Transgenic Mice

PubMed Central

Costa, Flávia C.; Fedosyuk, Halyna; Chazelle, Allen M.; Neades, Renee Y.; Peterson, Kenneth R.

2012-01-01

Activation of γ-globin gene expression in adults is known to be therapeutic for sickle cell disease. Thus, it follows that the converse, alleviation of repression, would be equally effective, since the net result would be the same: an increase in fetal hemoglobin. A GATA-1-FOG-1-Mi2 repressor complex was recently demonstrated to be recruited to the −566 GATA motif of the Aγ-globin gene. We show that Mi2β is essential for γ-globin gene silencing using Mi2β conditional knockout β-YAC transgenic mice. In addition, increased expression of Aγ-globin was detected in adult blood from β-YAC transgenic mice containing a T>G HPFH point mutation at the −566 GATA silencer site. ChIP experiments demonstrated that GATA-1 is recruited to this silencer at day E16, followed by recruitment of FOG-1 and Mi2 at day E17 in wild-type β-YAC transgenic mice. Recruitment of the GATA-1–mediated repressor complex was disrupted by the −566 HPFH mutation at developmental stages when it normally binds. Our data suggest that a temporal repression mechanism is operative in the silencing of γ-globin gene expression and that either a trans-acting Mi2β knockout deletion mutation or the cis-acting −566 Aγ-globin HPFH point mutation disrupts establishment of repression, resulting in continued γ-globin gene transcription during adult definitive erythropoiesis. PMID:23284307

Mi2β is required for γ-globin gene silencing: temporal assembly of a GATA-1-FOG-1-Mi2 repressor complex in β-YAC transgenic mice.

PubMed

Costa, Flávia C; Fedosyuk, Halyna; Chazelle, Allen M; Neades, Renee Y; Peterson, Kenneth R

2012-01-01

Activation of γ-globin gene expression in adults is known to be therapeutic for sickle cell disease. Thus, it follows that the converse, alleviation of repression, would be equally effective, since the net result would be the same: an increase in fetal hemoglobin. A GATA-1-FOG-1-Mi2 repressor complex was recently demonstrated to be recruited to the -566 GATA motif of the (A)γ-globin gene. We show that Mi2β is essential for γ-globin gene silencing using Mi2β conditional knockout β-YAC transgenic mice. In addition, increased expression of (A)γ-globin was detected in adult blood from β-YAC transgenic mice containing a T>G HPFH point mutation at the -566 GATA silencer site. ChIP experiments demonstrated that GATA-1 is recruited to this silencer at day E16, followed by recruitment of FOG-1 and Mi2 at day E17 in wild-type β-YAC transgenic mice. Recruitment of the GATA-1-mediated repressor complex was disrupted by the -566 HPFH mutation at developmental stages when it normally binds. Our data suggest that a temporal repression mechanism is operative in the silencing of γ-globin gene expression and that either a trans-acting Mi2β knockout deletion mutation or the cis-acting -566 (A)γ-globin HPFH point mutation disrupts establishment of repression, resulting in continued γ-globin gene transcription during adult definitive erythropoiesis.

CD34+ cells from dental pulp stem cells with a ZFN-mediated and homology-driven repair-mediated locus-specific knock-in of an artificial β-globin gene.

PubMed

Chattong, S; Ruangwattanasuk, O; Yindeedej, W; Setpakdee, A; Manotham, K

2017-07-01

In humans, mutations in the β-globin gene (HBB) have two important clinical manifestations: β-thalassemia and sickle cell disease. The progress in genome editing and stem cell research may be relevant to the treatment of β-globin-related diseases. In this work, we employed zinc-finger nuclease (ZFN)-mediated gene integration of synthetic β-globin cDNA into HBB loci, thus correcting almost all β-globin mutations. The integration was achieved in both HEK 293 cells and isolated dental pulp stem cell (DPSCs). We also showed that DPSCs with an artificial gene knock-in were capable of generating stable six-cell clones and were expandable at least 10 8 -fold; therefore, they may serve as a personalized stem cell factory. In addition, transfection with non-integrated pCAG-hOct4 and culturing in a conditioned medium converted the genome-edited DPSCs to CD34 + HSC-like cells. We believe that this approach may be useful for the treatment of β-globin-related diseases, especially the severe form of β-thalassemia.

VNTR alleles associated with the {alpha}-globin locus are haplotype and population related

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martinson, J.J.; Clegg, J.B.; Boyce, A.J.

1994-09-01

The human {alpha}-globin complex contains several polymorphic restriction-enzyme sites (i.e., RFLPs) linked to form haplotypes and is flanked by two hypervariable VNTR loci, the 5{prime} hypervariable region (HVR) and the more highly polymorphic 3{prime}HVR. Using a combination of RFLP analysis and PCR, the authors have characterized the 5{prime}HVR and 3{prime}HVR alleles associated with the {alpha}-globin haplotypes of 133 chromosomes, and they here show that specific {alpha}-globin haplotypes are each associated with discrete subsets of the alleles observed at these two VNTR loci. This statistically highly significant association is observed over a region spanning {approximately} 100 kb. With the exception ofmore » closely related haplotypes, different haplotypes do not share identically sized 3{prime}HVR alleles. Earlier studies have shown that {alpha}-globin haplotype distributions differ between populations; the current findings also reveal extensive population substructure in the repertoire of {alpha}-globin VNTRs. If similar features are characteristic of other VNTR loci, this will have important implications for forensic and anthropological studies. 42 refs., 5 figs., 5 tabs.« less

A Functional Element Necessary for Fetal Hemoglobin Silencing

PubMed Central

Sankaran, Vijay G.; Xu, Jian; Byron, Rachel; Greisman, Harvey A.; Fisher, Chris; Weatherall, David J.; Sabath, Daniel E.; Groudine, Mark; Orkin, Stuart H.; Premawardhena, Anuja; Bender, M.A.

2011-01-01

BACKGROUND An improved understanding of the regulation of the fetal hemoglobin genes holds promise for the development of targeted therapeutic approaches for fetal hemoglobin induction in the β-hemoglobinopathies. Although recent studies have uncovered trans-acting factors necessary for this regulation, limited insight has been gained into the cis-regulatory elements involved. METHODS We identified three families with unusual patterns of hemoglobin expression, suggestive of deletions in the locus of the β-globin gene (β-globin locus). We performed array comparative genomic hybridization to map these deletions and confirmed breakpoints by means of polymerase-chain-reaction assays and DNA sequencing. We compared these deletions, along with previously mapped deletions, and studied the trans-acting factors binding to these sites in the β-globin locus by using chromatin immunoprecipitation. RESULTS We found a new (δβ)0-thalassemia deletion and a rare hereditary persistence of fetal hemoglobin deletion with identical downstream breakpoints. Comparison of the two deletions resulted in the identification of a small intergenic region required for γ-globin (fetal hemoglobin) gene silencing. We mapped a Kurdish β0-thalassemia deletion, which retains the required intergenic region, deletes other surrounding sequences, and maintains fetal hemoglobin silencing. By comparing these deletions and other previously mapped deletions, we elucidated a 3.5-kb intergenic region near the 5′ end of the δ-globin gene that is necessary for γ-globin silencing. We found that a critical fetal hemoglobin silencing factor, BCL11A, and its partners bind within this region in the chromatin of adult erythroid cells. CONCLUSIONS By studying three families with unusual deletions in the β-globin locus, we identified an intergenic region near the δ-globin gene that is necessary for fetal hemoglobin silencing. (Funded by the National Institutes of Health and others.) PMID:21879898

Analyzing 5'HS3 and 5'HS4 LCR core regions and NF-E2 in Iranian thalassemia intermedia patients with normal or carrier status for beta-globin mutations.

PubMed

Neishabury, Maryam; Azarkeivan, Azita; Oberkanins, Christian; Abedini, Seyedeh Sedigheh; Zamani, Shahbaz; Najmabadi, Hossein

2011-03-15

Our data on 114 Iranian individuals with thalassemia intermedia phenotype revealed homozygous or compound heterozygous beta-globin mutations to be the predominant disease factor in 86.2% of cases. However, 8.2% of these individuals were found to be heterozygous or wild type for beta-globin mutations. In search for determinants outside of the beta-globin gene, which could be responsible for the unexpected thalassemia intermedia phenotype in these subjects, we screened the alpha-globin genes, the 5'HS3 and 5'HS4 regions of the beta-globin LCR, and the NF-E2 transcription factor for sequence variations in selected individuals. The -3.7 deletion was the only alpha-globin mutation detected, and no alterations were found in 5'HS3 and NF-E2. Sequence analysis of the 5'HS4 LCR core region identified three known SNPs in a single patient, who required irregular blood transfusions. The A/G polymorphism in the 5'HS4 palindromic region was also observed to be variable. Family studies were carried out on a female G/G homozygous patient, who received irregular blood transfusions. Her father, who had the same heterozygous IVSII-1 beta-globin mutation but the A/G genotype at the 5'HS4 palindromic site, presented with mild anemia and no requirement for blood transfusions. This suggests an impact of SNPs in the 5'HS4 LCR core region on the thalassemia phenotype and offers an interesting subject for further investigations in the Iranian population. Copyright © 2010 Elsevier Inc. All rights reserved.

A simple theory of molecular organization in fullerene-containing liquid crystals

NASA Astrophysics Data System (ADS)

Peroukidis, S. D.; Vanakaras, A. G.; Photinos, D. J.

2005-10-01

Systematic efforts to synthesize fullerene-containing liquid crystals have produced a variety of successful model compounds. We present a simple molecular theory, based on the interconverting shape approach [Vanakaras and Photinos, J. Mater. Chem. 15, 2002 (2005)], that relates the self-organization observed in these systems to their molecular structure. The interactions are modeled by dividing each molecule into a number of submolecular blocks to which specific interactions are assigned. Three types of blocks are introduced, corresponding to fullerene units, mesogenic units, and nonmesogenic linkage units. The blocks are constrained to move on a cubic three-dimensional lattice and molecular flexibility is allowed by retaining a number of representative conformations within the block representation of the molecule. Calculations are presented for a variety of molecular architectures including twin mesogenic branch monoadducts of C60, twin dendromesogenic branch monoadducts, and conical (badminton shuttlecock) multiadducts of C60. The dependence of the phase diagrams on the interaction parameters is explored. In spite of its many simplifications and the minimal molecular modeling used (three types of chemically distinct submolecular blocks with only repulsive interactions), the theory accounts remarkably well for the phase behavior of these systems.

Molecular Basis and Genetic Modifiers of Thalassemia.

PubMed

Mettananda, Sachith; Higgs, Douglas R

2018-04-01

Thalassemia is a disorder of hemoglobin characterized by reduced or absent production of one of the globin chains in human red blood cells with relative excess of the other. Impaired synthesis of β-globin results in β-thalassemia, whereas defective synthesis of α-globin leads to α-thalassemia. Despite being a monogenic disorder, thalassemia exhibits remarkable clinical heterogeneity that is directly related to the intracellular imbalance between α- and β-like globin chains. Novel insights into the genetic modifiers have contributed to the understanding of the correlation between genotype and phenotype and are being explored as therapeutic pathways to cure this life-limiting disease. Copyright © 2017 Elsevier Inc. All rights reserved.

A novel alpha-thalassemia nonsense mutation in HBA2: C.382 A > T globin gene.

PubMed

Hamid, Mohammad; Bokharaei Merci, Hanieh; Galehdari, Hamid; Saberi, Ali Hossein; Kaikhaei, Bijan; Mohammadi-Anaei, Marziye; Ahmadzadeh, Ahmad; Shariati, Gholamreza

2014-07-01

In this study, a new alpha globin gene mutation on the α2-globin gene is reported. This mutation resulted in a Lys > stop codon substitution at position 127 which was detected in four individuals (three males and one female). DNA sequencing revealed this mutation in unrelated persons in Khuzestan province, Southwestern Iran of Lor ethnicity. This mutation caused no severe hematological abnormalities in the carriers. From the nature of substituted residues in α2-globin, it is widely expected that this mutation leads to unstable and truncated protein and should be detected in couples at risk for α-thalassemia.

Disorders of Human Hemoglobin

NASA Astrophysics Data System (ADS)

Bank, Arthur; Mears, J. Gregory; Ramirez, Francesco

1980-02-01

Studies of the human hemoglobin system have provided new insights into the regulation of expression of a group of linked human genes, the γ -δ -β globin gene complex in man. In particular, the thalassemia syndromes and related disorders of man are inherited anemias that provide mutations for the study of the regulation of globin gene expression. New methods, including restriction enzyme analysis and cloning of cellular DNA, have made it feasible to define more precisely the structure and organization of the globin genes in cellular DNA. Deletions of specific globin gene fragments have already been found in certain of these disorders and have been applied in prenatal diagnosis.

Glucocorticoids inhibit coordinated translation of. cap alpha. - and. beta. -globin mRNAs in Friend erythroleukemia cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Papaconstantinou, J.; Stewart, J.A.; Rabek, J.P.

The dimethylsulfoxide (Me/sub 2/SO)-mediated induction of hemoglobin synthesis in Friend erythroleukemia cells is inhibited by the glucocorticoids hydrocortisone, dexamethasone, and fluocinolone acetonide; hydrocortisone, at concentrations of 10/sup -5/ to 10/sup -8/ M inhibits by 90-30% and fluocinolone acetonide at concentrations of 10/sup -8/ to 10/sup -11/ M shows a greater than 90% inhibition. At these concentrations the hormones have no effect on cell growth or viability. In this study it has been shown that there is a group of proteins, including the ..cap alpha..- and ..beta..-globins, whose regulation is associated with the induction of Friend erythroleukemia cell differentiation, and thatmore » the expression of these, in addition to ..cap alpha..- and ..beta..-globin, is affected by glucocorticoids. It is concluded that, although the translation of ..cap alpha..- and ..beta..-globin mRNA is a major site of inhibition by glucocorticoids, there is a detectable amount of ..cap alpha..- and ..beta..-globin mRNA translation which results in unequal amounts of globin synthesis and an overall more potent inhibition of hemoglobin formation.« less

A majority of mice show long-term expression of a human. beta. -globin gene after retrovirus transfer into hematopoietic stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bender, M.A.; Gelinas, R.E.; Miller

1989-04-01

Murine bone marrow was infected with a high-titer retrovirus vector containing the human {beta}-globin and neomycin phosphotransferase genes. Anemic W/W/sup v/ mice were transplanted with infected marrow which in some cases had been exposed to the selective agent G418. Human {beta}-globin expression was monitored in transplanted animals by using a monoclonal antibody specific for human {beta}-globin polypeptide, and hematopoietic reconstitution was monitored by using donor and recipient mice which differed in hemoglobin type. In some experiments all transplanted mice expressed the human {beta}-globin polypeptide for over 4 months, and up to 50% of peripheral erythrocytes contained detectable levels of polypeptide.more » DNA analysis of transplanted animals revealed that virtually every myeloid cell contained a provirus. Integration site analysis and reconstitution of secondary marrow recipients suggested that every mouse was reconstituted with at least one infected stem cell which had extensive repopulation capability. The ability to consistently transfer an active {beta}-globin gene into mouse hematopoietic cells improves the feasibility of using these techniques for somatic cell gene therapy in humans.« less

Assessing the relative stabilities of engineered hemoglobins using electrospray mass spectrometry.

PubMed

Apostol, I

1999-07-15

An ion trap mass spectrometer equipped with an electrospray source was used to examine the relative thermodynamic stabilities of various hemoglobins with respect to both tetramer dissociation and hemin dissociation. The results demonstrated that the stability of hemoglobin molecules can be differentiated by the amount of applied collision-induced dissociation (CID) energy necessary to break up the intact tetramer into its constituent globins. The stability of the intact tetramer was affected by single mutations in the beta-globins. The stabilities of the constituent hologlobins were assessed via trap CID of selected ions. The results demonstrated the importance of the contributions of the hologlobin components to the stability of the intact tetramer. Genetic fusion of two alpha-globins, through the introduction of a single glycine residue between the C-terminus of one alpha-chain and the N-terminus of the second, significantly increased the stability of the hemoglobin pseudo-tetramer. Chemical crosslinking of the beta-globins in addition to genetic fusion of alpha-globins further stabilized the hemoglobin molecule. A dihemoglobin molecule produced by the genetic fusion of two di-alpha-globins with a flexible linker demonstrated a decreased stability relative to the corresponding monohemoglobin. Copyright 1999 Academic Press.

Alternative options for DNA-based experimental therapy of β-thalassemia.

PubMed

Gambari, Roberto

2012-04-01

Beta-thalassemias are caused by more than 200 mutations of the β-globin gene, leading to low or absent production of adult hemoglobin. Achievements have been made with innovative therapeutic strategies for β-thalassemias, based on research conducted at the levels of gene structure, transcription, mRNA processing and protein synthesis. The objective of this review is to describe the development of therapeutic strategies employing viral and non-viral DNA-based approaches for treatment of β-thalassemia. Modification of β-globin gene expression in β-thalassemia cells has been achieved by gene therapy, correction of the mutated β-globin gene and RNA repair. In addition, cellular therapy has been proposed for β-thalassemia, including reprogramming of somatic cells to generate induced pluripotent stem cells to be genetically corrected. Based on the concept that increased production of fetal hemoglobin (HbF) is beneficial in β-thalassemia, DNA-based approaches to increase HbF production have been optimized, including treatment of target cells with lentiviral vectors carrying γ-globin genes. Finally, DNA-based targeting of α-globin gene expression has been applied to reduce the excess of α-globin production by β-thalassemia cells, one of the major causes of the clinical phenotype.

Target-based drug discovery for [Formula: see text]-globin disorders: drug target prediction using quantitative modeling with hybrid functional Petri nets.

PubMed

Mehraei, Mani; Bashirov, Rza; Tüzmen, Şükrü

2016-10-01

Recent molecular studies provide important clues into treatment of [Formula: see text]-thalassemia, sickle-cell anaemia and other [Formula: see text]-globin disorders revealing that increased production of fetal hemoglobin, that is normally suppressed in adulthood, can ameliorate the severity of these diseases. In this paper, we present a novel approach for drug prediction for [Formula: see text]-globin disorders. Our approach is centered upon quantitative modeling of interactions in human fetal-to-adult hemoglobin switch network using hybrid functional Petri nets. In accordance with the reverse pharmacology approach, we pose a hypothesis regarding modulation of specific protein targets that induce [Formula: see text]-globin and consequently fetal hemoglobin. Comparison of simulation results for the proposed strategy with the ones obtained for already existing drugs shows that our strategy is the optimal as it leads to highest level of [Formula: see text]-globin induction and thereby has potential beneficial therapeutic effects on [Formula: see text]-globin disorders. Simulation results enable verification of model coherence demonstrating that it is consistent with qPCR data available for known strategies and/or drugs.

Replication of the Chicken β-Globin Locus: Early-Firing Origins at the 5′ HS4 Insulator and the ρ- and βA-Globin Genes Show Opposite Epigenetic Modifications

PubMed Central

Prioleau, Marie-Noëlle; Gendron, Marie-Claude; Hyrien, Olivier

2003-01-01

Chromatin structure is believed to exert a strong effect on replication origin function. We have studied the replication of the chicken β-globin locus, whose chromatin structure has been extensively characterized. This locus is delimited by hypersensitive sites (HSs) that mark the position of insulator elements. A stretch of condensed chromatin and another HS separate the β-globin domain from an adjacent folate receptor (FR) gene. We demonstrate here that in erythroid cells that express the FR but not the globin genes, replication initiates at four sites within the β-globin domain, one at the 5′ HS4 insulator and the other three near the ρ- and βA-globin genes. Three origins consist of G+C-rich sequences enriched in CpG dinucleotides. The fourth origin is A+T rich. Together with previous work, these data reveal that the insulator origin has unmethylated CpGs, hyperacetylated histones H3 and H4, and lysine 4-methylated histone H3. In contrast, opposite modifications are observed at the other G+C-rich origins. We also show that the whole region, including the stretch of condensed chromatin, replicates early in S phase in these cells. Therefore, different early-firing origins within the same locus may have opposite patterns of epigenetic modifications. The role of insulator elements in DNA replication is discussed. PMID:12724412

Therapeutic fetal-globin inducers reduce transcriptional repression in hemoglobinopathy erythroid progenitors through distinct mechanisms.

PubMed

Dai, Yan; Sangerman, Jose; Luo, Hong Yuan; Fucharoen, Suthat; Chui, David H K; Faller, Douglas V; Perrine, Susan P

2016-01-01

Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ-globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. Copyright © 2015 Elsevier Inc. All rights reserved.

Therapeutic γ-globin inducers reduce transcriptional repression in hemoglobinopathy erythroid progenitors through distinct mechanisms

PubMed Central

Dai, Yan; Sangerman, Jose; Hong, Yuan Luo; Fuchareon, Suthat; Chui, David H.K.; Faller, Douglas V.; Perrine, Susan P.

2015-01-01

Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. PMID:26603726

Diverse hematological phenotypes of β-thalassemia carriers.

PubMed

Luo, Hong-Yuan; Chui, David H K

2016-03-01

Most β-thalassemia carriers have mild anemia, low mean corpuscular volume and mean corpuscular hemoglobin, and elevated hemoglobin α2 (HbA2 ). However, there is considerable variability resulting from coinheritance with α- and/or δ-globin gene mutations, dominant inheritance of β-thalassemia mutations, highly unstable variant globin chains, large deletions removing part or all of the β-globin gene cluster, loss of heterozygosity of the β-globin gene cluster during development, or concomitant erythroid enzyme or membrane protein abnormalities. Recognition of the specific abnormality and correct diagnosis can allay anxiety and unnecessary investigation, help formulate treatment programs, and deliver appropriate genetic and family counseling. © 2016 New York Academy of Sciences.

Increased short circuit current in an azafullerene-based organic solar cell.

PubMed

Cambarau, Werther; Fritze, Urs F; Viterisi, Aurélien; Palomares, Emilio; von Delius, Max

2015-01-21

We report the synthesis of a solution-processable, dodecyloxyphenyl-substituted azafullerene monoadduct (DPC59N) and its application as electron acceptor in bulk heterojunction organic solar cells (BHJ-OSCs). Due to its relatively strong absorption of visible light, DPC59N outperforms PC60BM in respect to short circuit current (JSC) and external quantum efficiency (EQE) in blends with donor P3HT.

The First Report of a 290-bp Deletion in β-Globin Gene in the South of Iran

PubMed Central

Hamid, Mohammad; Nejad, Ladan Dawoody; Shariati, Gholamreza; Galehdari, Hamid; Saberi, Alihossein; Mohammadi-Anaei, Marziye

2017-01-01

Background: β-thalassemia is one of the most widespread diseases in the world, including Iran. In this study, we reported, for the first time, a 290-bp β-globin gene deletion in the south of Iran. Methods: Four individuals from three unrelated families with Arabic ethnic background were studied in Khuzestan Province. Red blood cell indices and hemoglobin analysis were carried out according to the standard methods. Genomic DNA was obtained from peripheral blood cells by salting out procedures. β-globin gene amplification, multiplex ligation-dependent probe amplification (MLPA), and DNA sequencing were performed. Results: The PCR followed by sequencing and MLPA test of the β-globin gene confirmed the presence of a 290-bp deletion in the heterozygous form, along with -88C>A mutation. All the individuals had elevated hemoglobin A2 and normal fetal hemoglobin levels. Conclusions: This mutation causes β0-thalassemia and can be highly useful for prenatal diagnosis in compound heterozygous condition with different β-globin gene mutations. PMID:26948378

Analysis of alpha hemoglobin stabilizing protein overexpression in murine β-thalassemia

PubMed Central

Nasimuzzaman, Md; Khandros, Eugene; Wang, Xiaomei; Kong, Yi; Zhao, Huifen; Weiss, David; Rivella, Stefano; Weiss, Mitchell J.; Persons, Derek A.

2013-01-01

Excess free α-globin is cytotoxic and contributes to the pathophysiology of β-thalassemia. Alpha hemoglobin stabilizing protein (AHSP) is a molecular chaperone that binds free α-globin to promote its folding and inhibit its ability to produce damaging reactive oxygen species. Reduced AHSP levels correlate with increased severity of β-thalassemia in some human cohorts, but causal mechanistic relationships are not established for these associations. We used transgenic and lentiviral gene transfer methods to investigate whether supraphysiologic AHSP levels could mitigate the severity of β-thalassemia intermedia by providing an increased sink for the excess pool of α-globin chains. We tested wild-type AHSP and two mutant versions with amino acid substitutions that confer 3- or 13-fold higher affinity for α-globin. Erythroid overexpression of these AHSP proteins up to 11-fold beyond endogenous levels had no major effects on hematologic parameters in β-thalassemic animals. Our results demonstrate that endogenous AHSP is not limiting for α-globin detoxification in a murine model of β-thalassemia. PMID:20815047

β-Thalassemia.

PubMed

Origa, Raffaella

2017-06-01

β-Thalassemia is caused by reduced (β + ) or absent (β 0 ) synthesis of the β-globin chains of hemoglobin. Three clinical and hematological conditions of increasing severity are recognized: the β-thalassemia carrier state, thalassemia intermedia, and thalassemia major, a severe transfusion-dependent anemia. The severity of disease expression is related mainly to the degree of α-globin chain excess, which precipitates in the red blood cell precursors, causing both mechanic and oxidative damage (ineffective erythropoiesis). Any mechanism that reduces the number of unbound α-globin chains in the red cells may ameliorate the detrimental effects of excess α-globin chains. Factors include the inheritance of mild/silent β-thalassemia mutations, the coinheritance of α-thalassemia alleles, and increased γ-globin chain production. The clinical severity of β-thalassemia syndromes is also influenced by genetic factors unlinked to globin genes as well as environmental conditions and management. Transfusions and oral iron chelation therapy have dramatically improved the quality of life for patients with thalassemia major. Previously a rapidly fatal disease in early childhood, β-thalassemia is now a chronic disease with a greater life expectancy. At present, the only definitive cure is bone marrow transplantation. Therapies undergoing investigation are modulators of erythropoiesis and stem cell gene therapy.Genet Med advance online publication 03 November 2016.

Electron transfer function versus oxygen delivery: a comparative study for several hexacoordinated globins across the animal kingdom.

PubMed

Kiger, Laurent; Tilleman, Lesley; Geuens, Eva; Hoogewijs, David; Lechauve, Christophe; Moens, Luc; Dewilde, Sylvia; Marden, Michael C

2011-01-01

Caenorhabditis elegans globin GLB-26 (expressed from gene T22C1.2) has been studied in comparison with human neuroglobin (Ngb) and cytoglobin (Cygb) for its electron transfer properties. GLB-26 exhibits no reversible binding for O(2) and a relatively low CO affinity compared to myoglobin-like globins. These differences arise from its mechanism of gaseous ligand binding since the heme iron of GLB-26 is strongly hexacoordinated in the absence of external ligands; the replacement of this internal ligand, probably the E7 distal histidine, is required before binding of CO or O(2) as for Ngb and Cygb. Interestingly the ferrous bis-histidyl GLB-26 and Ngb, another strongly hexacoordinated globin, can transfer an electron to cytochrome c (Cyt-c) at a high bimolecular rate, comparable to those of inter-protein electron transfer in mitochondria. In addition, GLB-26 displays an unexpectedly rapid oxidation of the ferrous His-Fe-His complex without O(2) actually binding to the iron atom, since the heme is oxidized by O(2) faster than the time for distal histidine dissociation. These efficient mechanisms for electron transfer could indicate a family of hexacoordinated globin which are functionally different from that of pentacoordinated globins.

High Fractional Occupancy of a Tandem Maf Recognition Element and Its Role in Long-Range β-Globin Gene Regulation

PubMed Central

Stees, Jared R.; Hossain, Mir A.; Sunose, Tomoki; Kudo, Yasushi; Pardo, Carolina E.; Nabilsi, Nancy H.; Darst, Russell P.; Poudyal, Rosha; Igarashi, Kazuhiko; Kladde, Michael P.

2015-01-01

Enhancers and promoters assemble protein complexes that ultimately regulate the recruitment and activity of RNA polymerases. Previous work has shown that at least some enhancers form stable protein complexes, leading to the formation of enhanceosomes. We analyzed protein-DNA interactions in the murine β-globin gene locus using the methyltransferase accessibility protocol for individual templates (MAPit). The data show that a tandem Maf recognition element (MARE) in locus control region (LCR) hypersensitive site 2 (HS2) reveals a remarkably high degree of occupancy during differentiation of mouse erythroleukemia cells. Most of the other transcription factor binding sites in LCR HS2 or in the adult β-globin gene promoter regions exhibit low fractional occupancy, suggesting highly dynamic protein-DNA interactions. Targeting of an artificial zinc finger DNA-binding domain (ZF-DBD) to the HS2 tandem MARE caused a reduction in the association of MARE-binding proteins and transcription complexes at LCR HS2 and the adult βmajor-globin gene promoter but did not affect expression of the βminor-globin gene. The data demonstrate that a stable MARE-associated footprint in LCR HS2 is important for the recruitment of transcription complexes to the adult βmajor-globin gene promoter during erythroid cell differentiation. PMID:26503787

Sickle cell disease caused by heterozygosity for Hb S and novel LCR deletion: Report of two patients.

PubMed

Koenig, Sara C; Becirevic, Esmira; Hellberg, Miriam S C; Li, Michael Y; So, Jason C C; Hankins, Jane S; Ware, Russell E; McMahon, Lillian; Steinberg, Martin H; Luo, Hong-Yuan; Chui, David H K

2009-09-01

The b-globin gene LCR is located approximately 6 kb upstream of the embryonic epsilon-globin gene, and is made up of five DNase I hypersensitive sites (HSs), HS 1-5. LCR plays a pivotal role in regulating the expression of downstream epsilon-, (G)gamma-, (A)gamma-, delta-, and beta-globin genes in cis [1]. Deletions removing the LCR and parts of the downstream beta-globin gene cluster in patients have been described [2]. These individuals present with a (gammadeltabeta)0-thalassemia carrier phenotype. We now report two patients with severe sickle cell disease who were compound heterozygous for Hb S mutation and novel LCR deletion. In one case, HS 1-3 were deleted; in the other, HS 1-5 were deleted. In both cases, the b-like globin genes in cis to the LCR deletions were intact. Genotypically, both patients appeared to have sickle cell trait. Coinherited with either LCR deletion, these individuals presented as sickle cell disease patients. The breakpoints of these LCR deletions were defined. These results affirm that HS 2 and 3 are primarily responsible for conferring erythroid specific high-level expression of cis-linked beta-like globin genes. Furthermore, LCR deletions might cause hemolytic disease of newborns.

Efficient Generation of β-Globin-Expressing Erythroid Cells Using Stromal Cell-Derived Induced Pluripotent Stem Cells from Patients with Sickle Cell Disease.

PubMed

Uchida, Naoya; Haro-Mora, Juan J; Fujita, Atsushi; Lee, Duck-Yeon; Winkler, Thomas; Hsieh, Matthew M; Tisdale, John F

2017-03-01

Human embryonic stem (ES) cells and induced pluripotent stem (iPS) cells represent an ideal source for in vitro modeling of erythropoiesis and a potential alternative source for red blood cell transfusions. However, iPS cell-derived erythroid cells predominantly produce ε- and γ-globin without β-globin production. We recently demonstrated that ES cell-derived sacs (ES sacs), known to express hemangioblast markers, allow for efficient erythroid cell generation with β-globin production. In this study, we generated several iPS cell lines derived from bone marrow stromal cells (MSCs) and peripheral blood erythroid progenitors (EPs) from sickle cell disease patients, and evaluated hematopoietic stem/progenitor cell (HSPC) generation after iPS sac induction as well as subsequent erythroid differentiation. MSC-derived iPS sacs yielded greater amounts of immature hematopoietic progenitors (VEGFR2 + GPA-), definitive HSPCs (CD34 + CD45+), and megakaryoerythroid progenitors (GPA + CD41a+), as compared to EP-derived iPS sacs. Erythroid differentiation from MSC-derived iPS sacs resulted in greater amounts of erythroid cells (GPA+) and higher β-globin (and βS-globin) expression, comparable to ES sac-derived cells. These data demonstrate that human MSC-derived iPS sacs allow for more efficient erythroid cell generation with higher β-globin production, likely due to heightened emergence of immature progenitors. Our findings should be important for iPS cell-derived erythroid cell generation. Stem Cells 2017;35:586-596. © 2016 AlphaMed Press.

Characterisation and confirmation of rare beta-thalassaemia mutations in the Malay, Chinese and Indian ethnic groups in Malaysia.

PubMed

Tan, Jin Ai Mary Anne; Chin, Pui See; Wong, Yean Ching; Tan, Kim Lian; Chan, Lee Lee; George, Elizabeth

2006-10-01

In Malaysia, about 4.5% of the Malay and Chinese populations are heterozygous carriers of beta-thalassaemia. The initial identification of rare beta-globin gene mutations by genomic sequencing will allow the development of simpler and cost-effective PCR-based techniques to complement the existing amplification refractory mutation system (ARMS) and gap-PCR used for the identification of beta-thalassaemia mutations. DNA from 173 beta-thalassaemia carriers and five beta-thalassaemia major patients from the Malay, Chinese and Indian ethnic groups were first analysed by ARMS and gap-PCR. Ninety-five per cent (174/183) of the 183 beta-globin genes studied were characterised using these two techiques. The remaining nine uncharacterised beta-globin genes (4.9%) were analysed using genomic sequencing of a 904 bp amplified PCR product consisting of the promoter region, exon 1, intervening sequence (IVS) 1, exon 2 and the 5' IVS2 regions of the beta-globin gene. The rare beta-globin mutations detected in the Chinese patients were CD27/28 (+C) and CD43 (GAG-TAG), and -88 (C-T) in an Indian patient. Beta-globin mutations at CD16 (-C), IVS1-1 (G-A), IVS2-1 (G-A), -86 (C-G) and Haemoglobin South Florida (CD1, GTG-ATG) were confirmed in the Malay patients. The seven rare beta-globin mutations and a rare haemoglobin variant confirmed in this study have been described in other populations but have not been previously described in Malaysian beta-thalassemia patients.

Genetic disruption of the KLF1 gene to overexpress the γ-globin gene using the CRISPR/Cas9 system.

PubMed

Shariati, Laleh; Khanahmad, Hossein; Salehi, Mansoor; Hejazi, Zahra; Rahimmanesh, Ilnaz; Tabatabaiefar, Mohammad Amin; Modarressi, Mohammad Hossein

2016-10-01

β-thalassemia comprises a major group of human genetic disorders involving a decrease in or an end to the normal synthesis of the β-globin chains of hemoglobin. KLF1 is a key regulatory molecule involved in the γ- to β-globin gene switching process directly inducing the expression of the β-globin gene and indirectly repressing γ-globin. The present study aimed to investigate the ability of an engineered CRISPR/Cas9 system with respect to disrupting the KLF1 gene to inhibit the γ- to β-hemoglobin switching process in K562 cells. We targeted three sites on the KLF1 gene, two of which are upstream of codon 288 in exon 2 and the other site being in exon 3. The average indel percentage in the cells transfected with CRISPR a, b and c was approximately 24%. Relative quantification was performed for the assessment of γ-globin expression. The levels of γ-globin mRNA on day 5 of differentiation were 8.1-, 7.7- and 1.8-fold in the cells treated with CRISPR/Cas9 a, b and c, respectively,compared to untreated cells. The measurement of HbF expression levels confirmed the same results. The findings obtained in the present study support the induction of an indel mutation in the KLF1 gene leading to a null allele. As a result, the effect of KLF1 on the expression of BCL11A is decreased and its inhibitory effect on γ-globin gene expression is removed. Application of CRISPR technology to induce an indel in the KLF1 gene in adult erythroid progenitors may provide a method for activating fetal hemoglobin expression in individuals with β-thalassemia or sickle cell disease. Copyright © 2016 John Wiley & Sons, Ltd.

Interaction of an α-Globin Gene Triplication with β-Globin Gene Mutations in Iranian Patients with β-Thalassemia Intermedia.

PubMed

Farashi, Samaneh; Bayat, Nooshin; Faramarzi Garous, Negin; Ashki, Mehri; Montajabi Niat, Mona; Vakili, Shadi; Imanian, Hashem; Zeinali, Sirous; Najmabadi, Hossein; Azarkeivan, Azita

2015-01-01

The 3.7 kb triplicated α-globin gene (ααα(anti 3.7)) mutation has been found in most populations. It results from an unequal crossover between misaligned homologous segments in the α-globin gene cluster during meiosis. The pathophysiology and clinical severity of β-thalassemia (β-thal) are associated with the degree of α chain imbalance. The excess of α-globin chains plays an important role in the pathophysiology of β-thal. When heterozygous/homozygous β-thal coexists with an α gene numerical alteration, the clinical and hematological phenotype of thalassemia could change to mild anemia in case of an α deletion (-α/αα) or severe anemia in the case of an α triplication (αα/ααα). The coexistence of an ααα(anti 3.7) triplication is considered an important factor in the severity of β-thal, exacerbating the phenotypic severity of β-thal by causing more globin chain imbalance. This study shows that the ααα(anti 3.7) triplication is an important factor in the causation of β-thal intermedia (β-TI) in heterozygous β-thal. This type of phenotype modification has rarely been observed and reported in the Iranian population. Here we report the coinheritance of a triplicated α-globin gene arrangement and heterozygous/homozygous β-thal in 23 cases, presenting with a β-TI or β-thal major (β-TM) phenotype. Some of these patients were considered to have a mild β-TI phenotype as they needed no blood transfusions; some occasionally received blood transfusions in their lifetime (for example on delivery) but some are dependent on regular blood transfusions (every 20 to 40 days). Our study was focused on the importance of detecting the α-globin gene triplication in genotype/phenotype prediction in Iranian thalassemia patients.

Dexamethasone facilitates erythropoiesis in murine embryonic stem cells differentiating into hematopoietic cells in vitro

DOE Office of Scientific and Technical Information (OSTI.GOV)

Srivastava, Anand S.; Kaushal, Sharmeela; Mishra, Rangnath

2006-07-28

Differentiating embryonic stem (ES) cells are increasingly emerging as an important source of hematopoietic progenitors with a potential to be useful for both basic and clinical research applications. It has been suggested that dexamethasone facilitates differentiation of ES cells towards erythrocytes but the mechanism responsible for sequential expression of genes regulating this process are not well-understood. Therefore, we in vitro induced differentiation of murine ES cells towards erythropoiesis and studied the sequential expression of a set of genes during the process. We hypothesized that dexamethasone-activates its cognate nuclear receptors inducing up-regulation of erythropoietic genes such as GATA-1, Flk-1, Epo-R, andmore » direct ES cells towards erythropoietic differentiation. ES cells were cultured in primary hematopoietic differentiation media containing methyl-cellulose, IMDM, IL-3, IL-6, and SCF to promote embryoid body (EB) formation. Total RNA of day 3, 5, and 9-old EBs was isolated for gene expression studies using RT-PCR. Cells from day 9 EBs were subjected to secondary differentiation using three different cytokines and growth factors combinations: (1) SCF, EPO, dexamethasone, and IGF; (2) SCF, IL-3, IL-6, and TPO; and (3) SCF IL-3, IL-6, TPO, and EPO. Total RNA from day 12 of secondary differentiated ES cells was isolated to study the gene expression pattern during this process. Our results demonstrate an up-regulation of GATA-1, Flk-1, HoxB-4, Epo-R, and globin genes ({alpha}-globin, {beta}H-1 globin, {beta}-major globin, {epsilon} -globin, and {zeta}-globin) in the 9-day-old EBs, whereas, RNA from 5-day-old EBs showed expression of HoxB-4, {epsilon}-globin, {gamma}-globin, {beta}H1-globin, and Flk-1. Three-day-old EBs showed only HoxB-4 and Flk-1 gene expression and lacked expression of all globin genes. These findings indicate that erythropoiesis-specific genes are activated later in the course of differentiation. Gene expression studies on the ES cells of secondary EB origin cultured in media containing dexamethasone showed a down-regulation of GATA-3 and an up-regulation of GATA-1, Flk-1, and Epo-R in comparison to the two other cytokines and growth factor combinations containing media. The secondary differentiation also showed an enhanced production of erythrocytic precursors in dexamethasone containing media in comparison to that in the control media. Our results indicate that dexamethasone can prove to be an effective agent which can be employed to enhance differentiation towards erythrocytic progenitors from ES cells.« less

Correction of the sickle cell disease mutation in human hematopoietic stem/progenitor cells.

PubMed

Hoban, Megan D; Cost, Gregory J; Mendel, Matthew C; Romero, Zulema; Kaufman, Michael L; Joglekar, Alok V; Ho, Michelle; Lumaquin, Dianne; Gray, David; Lill, Georgia R; Cooper, Aaron R; Urbinati, Fabrizia; Senadheera, Shantha; Zhu, Allen; Liu, Pei-Qi; Paschon, David E; Zhang, Lei; Rebar, Edward J; Wilber, Andrew; Wang, Xiaoyan; Gregory, Philip D; Holmes, Michael C; Reik, Andreas; Hollis, Roger P; Kohn, Donald B

2015-04-23

Sickle cell disease (SCD) is characterized by a single point mutation in the seventh codon of the β-globin gene. Site-specific correction of the sickle mutation in hematopoietic stem cells would allow for permanent production of normal red blood cells. Using zinc-finger nucleases (ZFNs) designed to flank the sickle mutation, we demonstrate efficient targeted cleavage at the β-globin locus with minimal off-target modification. By co-delivering a homologous donor template (either an integrase-defective lentiviral vector or a DNA oligonucleotide), high levels of gene modification were achieved in CD34(+) hematopoietic stem and progenitor cells. Modified cells maintained their ability to engraft NOD/SCID/IL2rγ(null) mice and to produce cells from multiple lineages, although with a reduction in the modification levels relative to the in vitro samples. Importantly, ZFN-driven gene correction in CD34(+) cells from the bone marrow of patients with SCD resulted in the production of wild-type hemoglobin tetramers. © 2015 by The American Society of Hematology.

Gene Therapy in a Patient with Sickle Cell Disease.

PubMed

Ribeil, Jean-Antoine; Hacein-Bey-Abina, Salima; Payen, Emmanuel; Magnani, Alessandra; Semeraro, Michaela; Magrin, Elisa; Caccavelli, Laure; Neven, Benedicte; Bourget, Philippe; El Nemer, Wassim; Bartolucci, Pablo; Weber, Leslie; Puy, Hervé; Meritet, Jean-François; Grevent, David; Beuzard, Yves; Chrétien, Stany; Lefebvre, Thibaud; Ross, Robert W; Negre, Olivier; Veres, Gabor; Sandler, Laura; Soni, Sandeep; de Montalembert, Mariane; Blanche, Stéphane; Leboulch, Philippe; Cavazzana, Marina

2017-03-02

Sickle cell disease results from a homozygous missense mutation in the β-globin gene that causes polymerization of hemoglobin S. Gene therapy for patients with this disorder is complicated by the complex cellular abnormalities and challenges in achieving effective, persistent inhibition of polymerization of hemoglobin S. We describe our first patient treated with lentiviral vector-mediated addition of an antisickling β-globin gene into autologous hematopoietic stem cells. Adverse events were consistent with busulfan conditioning. Fifteen months after treatment, the level of therapeutic antisickling β-globin remained high (approximately 50% of β-like-globin chains) without recurrence of sickle crises and with correction of the biologic hallmarks of the disease. (Funded by Bluebird Bio and others; HGB-205 ClinicalTrials.gov number, NCT02151526 .).

Gene expression profiling of whole blood: Comparison of target preparation methods for accurate and reproducible microarray analysis

PubMed Central

Vartanian, Kristina; Slottke, Rachel; Johnstone, Timothy; Casale, Amanda; Planck, Stephen R; Choi, Dongseok; Smith, Justine R; Rosenbaum, James T; Harrington, Christina A

2009-01-01

Background Peripheral blood is an accessible and informative source of transcriptomal information for many human disease and pharmacogenomic studies. While there can be significant advantages to analyzing RNA isolated from whole blood, particularly in clinical studies, the preparation of samples for microarray analysis is complicated by the need to minimize artifacts associated with highly abundant globin RNA transcripts. The impact of globin RNA transcripts on expression profiling data can potentially be reduced by using RNA preparation and labeling methods that remove or block globin RNA during the microarray assay. We compared four different methods for preparing microarray hybridization targets from human whole blood collected in PAXGene tubes. Three of the methods utilized the Affymetrix one-cycle cDNA synthesis/in vitro transcription protocol but varied treatment of input RNA as follows: i. no treatment; ii. treatment with GLOBINclear; or iii. treatment with globin PNA oligos. In the fourth method cDNA targets were prepared with the Ovation amplification and labeling system. Results We find that microarray targets generated with labeling methods that reduce globin mRNA levels or minimize the impact of globin transcripts during hybridization detect more transcripts in the microarray assay compared with the standard Affymetrix method. Comparison of microarray results with quantitative PCR analysis of a panel of genes from the NF-kappa B pathway shows good correlation of transcript measurements produced with all four target preparation methods, although method-specific differences in overall correlation were observed. The impact of freezing blood collected in PAXGene tubes on data reproducibility was also examined. Expression profiles show little or no difference when RNA is extracted from either fresh or frozen blood samples. Conclusion RNA preparation and labeling methods designed to reduce the impact of globin mRNA transcripts can significantly improve the sensitivity of the DNA microarray expression profiling assay for whole blood samples. While blockage of globin transcripts during first strand cDNA synthesis with globin PNAs resulted in the best overall performance in this study, we conclude that selection of a protocol for expression profiling studies in blood should depend on several factors, including implementation requirements of the method and study design. RNA isolated from either freshly collected or frozen blood samples stored in PAXGene tubes can be used without altering gene expression profiles. PMID:19123946

Sequence-Dependent Diastereospecific and Diastereodivergent Crosslinking of DNA by Decarbamoylmitomycin C.

PubMed

Aguilar, William; Paz, Manuel M; Vargas, Anayatzinc; Clement, Cristina C; Cheng, Shu-Yuan; Champeil, Elise

2018-04-20

Mitomycin C (MC), a potent antitumor drug, and decarbamoylmitomycin C (DMC), a derivative lacking the carbamoyl group, form highly cytotoxic DNA interstrand crosslinks. The major interstrand crosslink formed by DMC is the C1'' epimer of the major crosslink formed by MC. The molecular basis for the stereochemical configuration exhibited by DMC was investigated using biomimetic synthesis. The formation of DNA-DNA crosslinks by DMC is diastereospecific and diastereodivergent: Only the 1''S-diastereomer of the initially formed monoadduct can form crosslinks at GpC sequences, and only the 1''R-diastereomer of the monoadduct can form crosslinks at CpG sequences. We also show that CpG and GpC sequences react with divergent diastereoselectivity in the first alkylation step: 1"S stereochemistry is favored at GpC sequences and 1''R stereochemistry is favored at CpG sequences. Therefore, the first alkylation step results, at each sequence, in the selective formation of the diastereomer able to generate an interstrand DNA-DNA crosslink after the "second arm" alkylation. Examination of the known DNA adduct pattern obtained after treatment of cancer cell cultures with DMC indicates that the GpC sequence is the major target for the formation of DNA-DNA crosslinks in vivo by this drug. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Nuclear proteins that bind the human gamma-globin gene promoter: alterations in binding produced by point mutations associated with hereditary persistence of fetal hemoglobin.

PubMed Central

Gumucio, D L; Rood, K L; Gray, T A; Riordan, M F; Sartor, C I; Collins, F S

1988-01-01

The molecular mechanisms responsible for the human fetal-to-adult hemoglobin switch have not yet been elucidated. Point mutations identified in the promoter regions of gamma-globin genes from individuals with nondeletion hereditary persistence of fetal hemoglobin (HPFH) may mark cis-acting sequences important for this switch, and the trans-acting factors which interact with these sequences may be integral parts in the puzzle of gamma-globin gene regulation. We have used gel retardation and footprinting strategies to define nuclear proteins which bind to the normal gamma-globin promoter and to determine the effect of HPFH mutations on the binding of a subset of these proteins. We have identified five proteins in human erythroleukemia cells (K562 and HEL) which bind to the proximal promoter region of the normal gamma-globin gene. One factor, gamma CAAT, binds the duplicated CCAAT box sequences; the -117 HPFH mutation increases the affinity of interaction between gamma CAAT and its cognate site. Two proteins, gamma CAC1 and gamma CAC2, bind the CACCC sequence. These proteins require divalent cations for binding. The -175 HPFH mutation interferes with the binding of a fourth protein, gamma OBP, which binds an octamer sequence (ATGCAAAT) in the normal gamma-globin promoter. The HPFH phenotype of the -175 mutation indicates that the octamer-binding protein may play a negative regulatory role in this setting. A fifth protein, EF gamma a, binds to sequences which overlap the octamer-binding site. The erythroid-specific distribution of EF gamma a and its close approximation to an apparent repressor-binding site suggest that it may be important in gamma-globin regulation. Images PMID:2468996

Specific repression of β-globin promoter activity by nuclear ferritin

PubMed Central

Broyles, Robert H.; Belegu, Visar; DeWitt, Christina R.; Shah, Sandeep N.; Stewart, Charles A.; Pye, Quentin N.; Floyd, Robert A.

2001-01-01

Developmental hemoglobin switching involves sequential globin gene activations and repressions that are incompletely understood. Earlier observations, described herein, led us to hypothesize that nuclear ferritin is a repressor of the adult β-globin gene in embryonic erythroid cells. Our data show that a ferritin-family protein in K562 cell nuclear extracts binds specifically to a highly conserved CAGTGC motif in the β-globin promoter at −153 to −148 bp from the cap site, and mutation of the CAGTGC motif reduces binding 20-fold in competition gel-shift assays. Purified human ferritin that is enriched in ferritin-H chains also binds the CAGTGC promoter segment. Expression clones of ferritin-H markedly repress β-globin promoter-driven reporter gene expression in cotransfected CV-1 cells in which the β-promoter has been stimulated with the transcription activator erythroid Krüppel-like factor (EKLF). We have constructed chloramphenicol acetyltransferase reporter plasmids containing either a wild-type or mutant β-globin promoter for the −150 CAGTGC motif and have compared the constructs for susceptibility to repression by ferritin-H in cotransfection assays. We find that stimulation by cotransfected EKLF is retained with the mutant promoter, whereas repression by ferritin-H is lost. Thus, mutation of the −150 CAGTGC motif not only markedly reduces in vitro binding of nuclear ferritin but also abrogates the ability of expressed ferritin-H to repress this promoter in our cell transfection assay, providing a strong link between DNA binding and function, and strong support for our proposal that nuclear ferritin-H is a repressor of the human β-globin gene. Such a repressor could be helpful in treating sickle cell and other genetic diseases. PMID:11481480

A genome-editing strategy to treat β-hemoglobinopathies that recapitulates a mutation associated with a benign genetic condition.

PubMed

Traxler, Elizabeth A; Yao, Yu; Wang, Yong-Dong; Woodard, Kaitly J; Kurita, Ryo; Nakamura, Yukio; Hughes, Jim R; Hardison, Ross C; Blobel, Gerd A; Li, Chunliang; Weiss, Mitchell J

2016-09-01

Disorders resulting from mutations in the hemoglobin subunit beta gene (HBB; which encodes β-globin), mainly sickle cell disease (SCD) and β-thalassemia, become symptomatic postnatally as fetal γ-globin expression from two paralogous genes, hemoglobin subunit gamma 1 (HBG1) and HBG2, decreases and adult β-globin expression increases, thereby shifting red blood cell (RBC) hemoglobin from the fetal (referred to as HbF or α2γ2) to adult (referred to as HbA or α2β2) form. These disorders are alleviated when postnatal expression of fetal γ-globin is maintained. For example, in hereditary persistence of fetal hemoglobin (HPFH), a benign genetic condition, mutations attenuate γ-globin-to-β-globin switching, causing high-level HbF expression throughout life. Co-inheritance of HPFH with β-thalassemia- or SCD-associated gene mutations alleviates their clinical manifestations. Here we performed CRISPR-Cas9-mediated genome editing of human blood progenitors to mutate a 13-nt sequence that is present in the promoters of the HBG1 and HBG2 genes, thereby recapitulating a naturally occurring HPFH-associated mutation. Edited progenitors produced RBCs with increased HbF levels that were sufficient to inhibit the pathological hypoxia-induced RBC morphology found in SCD. Our findings identify a potential DNA target for genome-editing-mediated therapy of β-hemoglobinopathies.

Structural polymorphism at LCR and its role in beta-globin gene regulation.

PubMed

Kukreti, Shrikant; Kaur, Harpreet; Kaushik, Mahima; Bansal, Aparna; Saxena, Sarika; Kaushik, Shikha; Kukreti, Ritushree

2010-09-01

Information on the secondary structures and conformational manifestations of eukaryotic DNA and their biological significance with reference to gene regulation and expression is limited. The human beta-globin gene Locus Control Region (LCR), a dominant regulator of globin gene expression, is a contiguous piece of DNA with five tissue-specific DNase I-hypersensitive sites (HSs). Since these HSs have a high density of transcription factor binding sites, structural interdependencies between HSs and different promoters may directly or indirectly regulate LCR functions. Mutations and SNPs may stabilize or destabilize the local secondary structures, affecting the gene expression by changes in the protein-DNA recognition patterns. Various palindromic or quasi-palindromic segments within LCR, could cause structural polymorphism and geometrical switching of DNA. This emphasizes the importance of understanding of the sequence-dependent variations of the DNA structure. Such structural motifs might act as regulatory elements. The local conformational variability of a DNA segment or action of a DNA specific protein is key to create and maintain active chromatin domains and affect transcription of various tissue specific beta-globin genes. We, summarize here the current status of beta-globin LCR structure and function. Further structural studies at molecular level and functional genomics might solve the regulatory puzzles that control the beta-globin gene locus. Copyright (c) 2010 Elsevier Masson SAS. All rights reserved.

Flanking HS-62.5 and 3' HS1, and regions upstream of the LCR, are not required for beta-globin transcription.

PubMed

Bender, M A; Byron, Rachel; Ragoczy, Tobias; Telling, Agnes; Bulger, Michael; Groudine, Mark

2006-08-15

The locus control region (LCR) was thought to be necessary and sufficient for establishing and maintaining an open beta-globin locus chromatin domain in the repressive environment of the developing erythrocyte. However, deletion of the LCR from the endogenous locus had no significant effect on chromatin structure and did not silence transcription. Thus, the cis-regulatory elements that confer the open domain remain unidentified. The conserved DNaseI hypersensitivity sites (HSs) HS-62.5 and 3'HS1 that flank the locus, and the region upstream of the LCR have been implicated in globin gene regulation. The flanking HSs bind CCCTC binding factor (CTCF) and are thought to interact with the LCR to form a "chromatin hub" involved in beta-globin gene activation. Hispanic thalassemia, a deletion of the LCR and 27 kb upstream, leads to heterochromatinization and silencing of the locus. Thus, the region upstream of the LCR deleted in Hispanic thalassemia (upstream Hispanic region [UHR]) may be required for expression. To determine the importance of the UHR and flanking HSs for beta-globin expression, we generated and analyzed mice with targeted deletions of these elements. We demonstrate deletion of these regions alone, and in combination, do not affect transcription, bringing into question current models for the regulation of the beta-globin locus.

Stimulation of globin synthesis: relative responsiveness of reticulocytes and nucleated erythroid cells

PubMed Central

Waxman, Herbert S.

1970-01-01

The effects of iron, cobalt, hemin, and plasma on hemoglobin synthesis by suspensions of rabbit reticulocytes and nucleated bone marrow cells were studied. L-Leucine-14C and sodium pyruvate-3-14C were employed to measure globin and heme synthesis, respectively. Normal plasma (or serum) was found to stimulate the rate of globin synthesis in both systems. The stimulatory effects of iron and hemin were additive to those of plasma or serum only in the reticulocytes. Cobaltous ion, at concentrations less than 1.0 mmole/liter, was found to stimulate globin synthesis by reticulocytes as effectively as ferrous ion; cobalt was inhibitory only at concentrations greater than 3.0-5.0 mmoles/liter. Heme synthesis by reticulocytes was inhibited at all concentrations employed (0.2-5.0 mmoles/liter). In bone marrow nucleated erythroid cells, globin synthesis was markedly enhanced by exogenous hemin. In contrast to reticulocytes, however, bone marrow cells were unresponsive to either cobalt or transferrin-bound iron. Possible implications of these findings on regulation of the rate and mechanism of iron uptake and hemoglobin synthesis in vivo are discussed. PMID:5443172

Thalassemia

MedlinePlus

... disorder that affects the way the body makes hemoglobin. Hemoglobin is the part of red blood cells that ... alpha globin and beta globin; these proteins make hemoglobin. In thalassemia, a gene that makes these proteins ...

β-thalassemias: paradigmatic diseases for scientific discoveries and development of innovative therapies.

PubMed

Rivella, Stefano

2015-04-01

β-thalassemias are monogenic disorders characterized by defective synthesis of the β-globin chain, one of the major components of adult hemoglobin. A large number of mutations in the β-globin gene or its regulatory elements have been associated with β-thalassemias. Due to the complexity of the regulation of the β-globin gene and the role of red cells in many physiological processes, patients can manifest a large spectrum of phenotypes, and clinical requirements vary from patient to patient. It is important to consider the major differences in the light of potential novel therapeutics. This review summarizes the main discoveries and mechanisms associated with the synthesis of β-globin and abnormal erythropoiesis, as well as current and novel therapies. Copyright© Ferrata Storti Foundation.

Role of Lysosomal Enzyme Release in Circulatory Shock and Critical Illness.

DTIC Science & Technology

1978-06-01

several natural and synthetic substrates, including hemoglobin, globin, serum albumin, thyroglobulin, myosin, oxidized bovine pancreatic ribonuclease A...Multiple isoenzymes of cathepsin D have now been 17Ireported in various tissues, Press et all demonstrated ten different forms of the enzyme from bovine ...spleen which dif- fered in charge at pH 5.5 and 8.4. Woessner18 demonstrated four different isoenzymes from bovine uterus, and Barrett 19 resolved three

Developmental regulation of DNA replication timing at the human beta globin locus.

PubMed

Simon, I; Tenzen, T; Mostoslavsky, R; Fibach, E; Lande, L; Milot, E; Gribnau, J; Grosveld, F; Fraser, P; Cedar, H

2001-11-01

The human beta globin locus replicates late in most cell types, but becomes early replicating in erythroid cells. Using FISH to map DNA replication timing around the endogenous beta globin locus and by applying a genetic approach in transgenic mice, we have demonstrated that both the late and early replication states are controlled by regulatory elements within the locus control region. These results also show that the pattern of replication timing is set up by mechanisms that work independently of gene transcription.

Human beta-globin gene polymorphisms characterized in DNA extracted from ancient bones 12,000 years old.

PubMed

Béraud-Colomb, E; Roubin, R; Martin, J; Maroc, N; Gardeisen, A; Trabuchet, G; Goosséns, M

1995-12-01

Analyzing the nuclear DNA from ancient human bones is an essential step to the understanding of genetic diversity in current populations, provided that such systematic studies are experimentally feasible. This article reports the successful extraction and amplification of nuclear DNA from the beta-globin region from 5 of 10 bone specimens up to 12,000 years old. These have been typed for beta-globin frameworks by sequencing through two variable positions and for a polymorphic (AT) chi (T) gamma microsatellite 500 bp upstream of the beta-globin gene. These specimens of human remains are somewhat older than those analyzed in previous nuclear gene sequencing reports and considerably older than those used to study high-copy-number human mtDNA. These results show that the systematic study of nuclear DNA polymorphisms of ancient populations is feasible.

Plasmodium falciparum malaria skews globin gene expression balance in in-vitro haematopoietic stem cell culture system: Its implications in malaria associated anemia.

PubMed

Pathak, Vrushali; Colah, Roshan; Ghosh, Kanjaksha

2018-02-01

Understanding the pathophysiology and associated host parasite interactions of the malaria infection is the prerequisite for developing effective prevention and treatment strategies. The exact mechanism underlying malaria associated ineffective and dyserythropoiesis is not yet fully understood. Being an important protein, haemoglobin serves as the main amino acid reservoir available to the intra-erythrocytic plasmodium. It is important to check the expression profiling of globin genes which may help us to understand host parasite interactions and its potential contribution to both infection and disease. Here, an in-vitro culture system was used to study the effect of different doses of Plasmodium falciparum on haematopoietic stem cell expansion, differentiation and expression of globin genes. Upon exposure to the different doses of P. falciparum parasites of strains 3D7, Dd2 and RKL9 (intact and lysed form) at different stages of erythroid development, cells demonstrated suppression in growth and differentiation. At almost all stages of erythroid development upon parasite exposure, the γ globin gene was found to be downregulated and the α/β as well as α/non- α globin mRNA ratios in late stage erythroid cells were found to be reduced (p < .01) compared to the untreated controls. The imbalance in globin chain expression might be considered as one of the factors involved in malaria associated inappropriate erythropoietic responses. Copyright © 2018 Elsevier Inc. All rights reserved.

Structural characterization of hemoglobins from Monilifera and Frenulata tubeworms (Siboglinids): first discovery of giant hexagonal-bilayer hemoglobin in the former "Pogonophora" group.

PubMed

Meunier, Cédric; Andersen, Ann C; Bruneaux, Matthieu; Le Guen, Dominique; Terrier, Peran; Leize-Wagner, Emmanuelle; Zal, Franck

2010-01-01

Siboglinids are symbiotic polychete annelids having hemoglobins as essential oxygen- and sulfide-carriers for their endosymbiotic bacteria. We analyzed the structure of the hemoglobins from two species of siboglinids: the monilifera Sclerolinum contortum and the frenulata Oligobrachia webbi (i.e. haakonmosbiensis) from Norwegian cold seeps. Measured by Multi-Angle Laser Light Scattering (MALLS), Sclerolinum shows a 3190+/-50 kDa hexagonal bilayer hemoglobin (HBL-Hb) and a 461+/-46 kDa ring-Hb, just as vestimentifera, whereas Oligobrachia has a 409+/-3.7 kDa ring-Hb only. Electrospray Ionization-Mass Spectrometry (ESI-MS) showed Sclerolinum HBL-Hb composed of seven monomeric globins (15-16 kDa), three disulfide-bonded globin heterodimers and three linkers. The heterodimers always contain globin-b (15814.4+/-1.5 Da). Sclerolinum ring-Hb is composed of globins and dimers with identical masses as its HBL-Hb, but lacks linkers. Oligobrachia ring-Hb has three globin monomers (14-15 kDa) only, with no disulfide-bonded dimers. Comparison of Sclerolinum hemoglobins between Storegga and Haakon Mosby Mud Volcano, using the normalized height of deconvoluted ESI-MS peaks, shows differences in globin monomers abundances that could reflect genetic differences or differential gene expression between distinct seep populations. The discovery of HBL-Hb in Sclerolinum is a new element supporting the hypothesis of monilifera being phylogenetically more closely related to vestimentifera, than to frenulata.

Therapeutic levels of fetal hemoglobin in erythroid progeny of β-thalassemic CD34+ cells after lentiviral vector-mediated gene transfer

PubMed Central

Wilber, Andrew; Hargrove, Phillip W.; Kim, Yoon-Sang; Riberdy, Janice M.; Sankaran, Vijay G.; Papanikolaou, Eleni; Georgomanoli, Maria; Anagnou, Nicholas P.; Orkin, Stuart H.; Nienhuis, Arthur W.

2011-01-01

β-Thalassemia major results from severely reduced or absent expression of the β-chain of adult hemoglobin (α2β2;HbA). Increased levels of fetal hemoglobin (α2γ2;HbF), such as occurs with hereditary persistence of HbF, ameliorate the severity of β-thalassemia, raising the potential for genetic therapy directed at enhancing HbF. We used an in vitro model of human erythropoiesis to assay for enhanced production of HbF after gene delivery into CD34+ cells obtained from mobilized peripheral blood of normal adults or steady-state bone marrow from patients with β-thalassemia major. Lentiviral vectors encoding (1) a human γ-globin gene with or without an insulator, (2) a synthetic zinc-finger transcription factor designed to interact with the γ-globin gene promoters, or (3) a short-hairpin RNA targeting the γ-globin gene repressor, BCL11A, were tested. Erythroid progeny of normal CD34+ cells demonstrated levels of HbF up to 21% per vector copy. For β-thalassemic CD34+ cells, similar gene transfer efficiencies achieved HbF production ranging from 45% to 60%, resulting in up to a 3-fold increase in the total cellular Hb content. These observations suggest that both lentiviral-mediated γ-globin gene addition and genetic reactivation of endogenous γ-globin genes have potential to provide therapeutic HbF levels to patients with β-globin deficiency. PMID:21156846

A randomized Phase I/II Trial of HQK-1001, an oral fetal globin gene inducer, in β–thalassaemia intermedia and HbE/β–thalassaemia

PubMed Central

Fucharoen, Suthat; Inati, Adlette; Siritanaratku, Noppadol; Thein, Swee Lay; Wargin, William C.; Koussa, Suzanne; Taher, Ali; Chaneim, Nattawara; Boosalis, Michael; Berenson, Ronald; Perrine, Susan P.

2014-01-01

β–thalassemia intermedia syndromes (BTI) cause hemolytic anemia, ineffective erythropoiesis, and widespread complications. Higher fetal globin expression within genotypes reduces globin imbalance and ameliorates anemia. Sodium 2,2 dimethylbutyrate (HQK-1001), an orally bioavailable short-chain fatty acid derivative, induces γ-globin expression experimentally and is well-tolerated in normal subjects. Accordingly, a randomized, blinded, placebo-controlled, Phase I/II trial was performed in 21 adult BTI patients (14 with HbE/β0 thalassemia and 7 with β+/β0 thalassemia intermedia, to determine effective doses for fetal globin induction, safety, and tolerability. HQK-1001 or placebo were administered once daily for 8 weeks at four dose levels (10, 20, 30, or 40 mg/kg/day), and subjects were monitored for laboratory and clinical events. Pharmacokinetic profiles demonstrated a t1/2 of 10–12 hours. Adverse events with HQK-1001 treatment were not significantly different from placebo treatment. Median HbF increased with the 20 mg/kg treatment doses above baseline levels by 6.6% and 0.44 g/dL (p <0.01) in 8/9 subjects; total hemoglobin (Hgb) increased by a mean of 1.1 gm/dL in 4/9 subjects. These findings identify a safe oral therapeutic which induces fetal globin in BTI. Further investigation of HQK-1001 with longer dosing to definitively evaluate its hematologic potential appears warranted. PMID:23530969

The beta -globin locus control region (LCR) functions primarily by enhancing the transition from transcription initiation to elongation.

PubMed

Sawado, Tomoyuki; Halow, Jessica; Bender, M A; Groudine, Mark

2003-04-15

To investigate the molecular basis of beta-globin gene activation, we analyzed factor recruitment and histone modification at the adult beta-globin gene in wild-type (WT)/locus control region knockout (DeltaLCR) heterozygous mice and in murine erythroleukemia (MEL) cells. Although histone acetylation and methylation (Lys 4) are high before and after MEL differentiation, recruitment of the erythroid-specific activator NF-E2 to the promoter and preinitiation complex (PIC) assembly occur only after differentiation. We reported previously that targeted deletion of the LCR reduces beta-globin gene expression to 1%-4% of WT without affecting promoter histone acetylation. Here, we report that NF-E2 is recruited equally efficiently to the adult beta-globin promoters of the DeltaLCR and WT alleles. Moreover, the LCR deletion reduces PIC assembly only twofold, but has a dramatic effect on Ser 5 phosphorylation of RNA polymerase II and transcriptional elongation. Our results suggest at least three distinct stages in beta-globin gene activation: (1) an LCR-independent chromatin opening stage prior to NF-E2 recruitment to the promoter and PIC assembly; (2) an intermediate stage in which NF-E2 binding (LCR-independent) and PIC assembly (partially LCR-dependent) occur; and (3) an LCR-dependent fully active stage characterized by efficient pol II elongation. Thus, in its native location the LCR functions primarily downstream of activator recruitment and PIC assembly.

HbVar: A relational database of human hemoglobin variants and thalassemia mutations at the globin gene server.

PubMed

Hardison, Ross C; Chui, David H K; Giardine, Belinda; Riemer, Cathy; Patrinos, George P; Anagnou, Nicholas; Miller, Webb; Wajcman, Henri

2002-03-01

We have constructed a relational database of hemoglobin variants and thalassemia mutations, called HbVar, which can be accessed on the web at http://globin.cse.psu.edu. Extensive information is recorded for each variant and mutation, including a description of the variant and associated pathology, hematology, electrophoretic mobility, methods of isolation, stability information, ethnic occurrence, structure studies, functional studies, and references. The initial information was derived from books by Dr. Titus Huisman and colleagues [Huisman et al., 1996, 1997, 1998]. The current database is updated regularly with the addition of new data and corrections to previous data. Queries can be formulated based on fields in the database. Tables of common categories of variants, such as all those involving the alpha1-globin gene (HBA1) or all those that result in high oxygen affinity, are maintained by automated queries on the database. Users can formulate more precise queries, such as identifying "all beta-globin variants associated with instability and found in Scottish populations." This new database should be useful for clinical diagnosis as well as in fundamental studies of hemoglobin biochemistry, globin gene regulation, and human sequence variation at these loci. Copyright 2002 Wiley-Liss, Inc.

Modulating Vascular Hemodynamics With an Alpha Globin Mimetic Peptide (HbαX).

PubMed

Keller, T C Stevenson; Butcher, Joshua T; Broseghini-Filho, Gilson Brás; Marziano, Corina; DeLalio, Leon J; Rogers, Stephen; Ning, Bo; Martin, Jennifer N; Chechova, Sylvia; Cabot, Maya; Shu, Xiahong; Best, Angela K; Good, Miranda E; Simão Padilha, Alessandra; Purdy, Michael; Yeager, Mark; Peirce, Shayn M; Hu, Song; Doctor, Allan; Barrett, Eugene; Le, Thu H; Columbus, Linda; Isakson, Brant E

2016-12-01

The ability of hemoglobin to scavenge the potent vasodilator nitric oxide (NO) in the blood has been well established as a mechanism of vascular tone homeostasis. In endothelial cells, the alpha chain of hemoglobin (hereafter, alpha globin) and endothelial NO synthase form a macromolecular complex, providing a sink for NO directly adjacent to the production source. We have developed an alpha globin mimetic peptide (named HbαX) that displaces endogenous alpha globin and increases bioavailable NO for vasodilation. Here we show that, in vivo, HbαX administration increases capillary oxygenation and blood flow in arterioles acutely and produces a sustained decrease in systolic blood pressure in normal and angiotensin II-induced hypertensive states. HbαX acts with high specificity and affinity to endothelial NO synthase, without toxicity to liver and kidney and no effect on p50 of O 2 binding in red blood cells. In human vasculature, HbαX blunts vasoconstrictive response to cumulative doses of phenylephrine, a potent constricting agent. By binding to endothelial NO synthase and displacing endogenous alpha globin, HbαX modulates important metrics of vascular function, increasing vasodilation and flow in the resistance vasculature. © 2016 American Heart Association, Inc.

Estimating the age of Hb G-Coushatta [β22(B4)Glu→Ala] mutation by haplotypes of β-globin gene cluster in Denizli, Turkey.

PubMed

Ozturk, Onur; Arikan, Sanem; Atalay, Ayfer; Atalay, Erol O

2018-05-01

Hb G-Coushatta variant was reported from various populations' parts of the world such as Thai, Korea, Algeria, Thailand, China, Japan and Turkey. In our study, we aimed to discuss the possible historical relationships of the Hb G-Coushatta mutation with the possible migration routes of the world. For this purpose, associated haplotypes were determined using polymorphic loci in the beta globin gene cluster of hemoglobin G-Coushatta and normal populations in Denizli, Turkey. We performed statistical analysis such as haplotype analysis, Hardy-Weinberg equilibrium, measurement of genetic diversity and population differentiation parameters, analysis of molecular variance using F-statistics, historical-demographic analyses, mismatch distribution analysis of both populations and applied the test statistics in Arlequin ver. 3.5 software program. The diversity of haplotypes has been shown to indicate different genetic origins for two populations. However, AMOVA results, molecular diversity parameters and population demographic expansion times showed that the Hb G-Coushatta mutation develops on the normal population gene pool. Our estimated τ values showed the average time since the demographic expansion for normal and Hb G-Coushatta populations ranged from approximately 42,000 to 38,000 ybp, respectively. Our data suggest that Hb G-Coushatta population originate in normal population in Denizli, Turkey. These results support the hypothesis that the multiple origin of Hb G-Coushatta and indicate that mutation may have been triggered the formation of new variants on beta globin haplotypes. © 2018 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

Multiple displacement amplification on single cell and possible PGD applications.

PubMed

Hellani, Ali; Coskun, Serdar; Benkhalifa, Moncef; Tbakhi, Abelghani; Sakati, Nadia; Al-Odaib, Ali; Ozand, Pinar

2004-11-01

Multiple displacement amplification (MDA) is a technique used in the amplification of very low amounts of DNA and reported to yield large quantities of high-quality DNA. We used MDA to amplify the whole genome directly from a single cell. The most common techniques used in PGD are PCR and fluorescent in-situ hybridization (FISH). There are many limitations to these techniques including, the number of chromosomes diagnosed for FISH or the quality of DNA issued from a single cell PCR. This report shows, for the first time, use of MDA for single cell whole genome amplification. A total of 16 short tandem repeats (STRs) were amplified successfully with a similar pattern to the genomic DNA. Furthermore, allelic drop out (ADO) derived from MDA was assessed in 40 single cells by analysing (i) heterozygosity for a known beta globin mutation (IVSI-5 C-G) and by studying (ii) the heterozygous loci present in the STRs. ADO turned out to be 10.25% for the beta globin gene sequencing and 5% for the fluorescent PCR analysis of STRs. Moreover, the amplification accuracy of MDA permitted the detection of trisomy 21 on a single cell using comparative genome hybridization-array. Altogether, these data suggest that MDA can be used for single cell molecular karyotyping and the diagnosis of any single gene disorder in PGD.

Hidden Markov models of biological primary sequence information.

PubMed Central

Baldi, P; Chauvin, Y; Hunkapiller, T; McClure, M A

1994-01-01

Hidden Markov model (HMM) techniques are used to model families of biological sequences. A smooth and convergent algorithm is introduced to iteratively adapt the transition and emission parameters of the models from the examples in a given family. The HMM approach is applied to three protein families: globins, immunoglobulins, and kinases. In all cases, the models derived capture the important statistical characteristics of the family and can be used for a number of tasks, including multiple alignments, motif detection, and classification. For K sequences of average length N, this approach yields an effective multiple-alignment algorithm which requires O(KN2) operations, linear in the number of sequences. PMID:8302831

Biomonitoring of carcinogenic substances: enzymatic digestion of globin for detecting alkylated amino acids

NASA Astrophysics Data System (ADS)

Bader, Michael; Rauscher, Dankwart; Geibel, Kurt; Angerer, Juergen

1993-03-01

We report the application of proteases for the total hydrolysis of globin with subsequent determination of amino acids. Optimization of the proteolysis was made with respect to enzyme concentration, time of incubation and type of protease. Ethylene oxide modified globin was used to compare the results of the analysis of the N-terminal amino acid valine after enzymatic cleavage to those obtained from the widely used modified Edman procedure. It is shown that the cleavage is of good reproducibility and yields more alkylated amino acid than the Edman procedure.

AHSP: a novel hemoglobin helper

PubMed Central

Bank, Arthur

2007-01-01

Recently, the small protein α hemoglobin–stabilizing protein (AHSP) was identified and found to specifically bind α-globin, stabilize its structure, and limit the toxic effects of excess α-globin, which are manifest in the inherited blood disorder β thalassemia. In this issue of the JCI, Yu, Weiss, and colleagues show that AHSP is also critical to the formation and stabilization of normal amounts of hemoglobin, even when α-globin is deficient, indicating unique and previously unidentified roles for this molecule (see the related article beginning on page 1856). PMID:17607349

DOE Office of Scientific and Technical Information (OSTI.GOV)

Louie, E.; Dietz, L.; Shafer, F.

A sample on a newborn with hemoglobin FE screen results was obtained to investigate whether E/E or B/{beta}{degrees} thalassemia was present using polymerase chain reaction (PCR) methodology. The newborn appeared homozygous for the hemoglobin E mutation in our initial study, but the parents` genotypes did not support this diagnosis. The father is homozygous for the absence of the hemoglobin E mutation (non E/non E) and the mother is heterozygous (E/non E) for this mutation. The limitation of PCR analysis is an assumption that the amplification of the two {beta}-globin alleles is equivalent. A large deletion on one {beta}-globin gene, whichmore » would produce E/{beta}{degrees} thalassemia, would be missed if it included part or the entire region subjected to amplification. The family results were consistent with either non-paternity, sample mix-up or such a deletion of the {beta}-globin gene in the father and child. To rule out the possibility of non-paternity, two polymorphic loci (HLA on chromosome 6 and a VNTR system of chromosome 17) that are outside of the {beta}-globin gene were analyzed and show that inheritance is consistent and the likelihood of a sample mix-up is then reduced. We therefore believe there is a gene deletion in this family. At the present time, analyses of the RFLPs that are 5{prime} of the {beta}-globin gene cluster show that the polymorphisms most distal from the 5{prime} {beta}-globin gene are not being inherited as expected. These results support our interpretation that a deletion exists in the father and was inherited by the child. The father`s clinical picture of possible HPFH (the father has 12% hemoglobin F) also supports the interpretation of a deletion in this family. Deletions of the {beta}-globin gene within this ethnic group are rare. Currently, Southern blots on the family are being probed to determine the extent of the putative deletion.« less

Genetics Home Reference: sickle cell disease

MedlinePlus

... of beta-globin; this abnormality is called beta thalassemia . In people with sickle cell disease , at least ... globin. If mutations that produce hemoglobin S and beta thalassemia occur together, individuals have hemoglobin S- beta thalassemia (HbSBetaThal) ...

Chromatin looping and eRNA transcription precede the transcriptional activation of gene in the β-globin locus

PubMed Central

Kim, Yea Woon; Lee, Sungkung; Yun, Jangmi; Kim, AeRi

2015-01-01

Enhancers are closely positioned with actively transcribed target genes by chromatin looping. Non-coding RNAs are often transcribed on active enhancers, referred to as eRNAs (enhancer RNAs). To explore the kinetics of enhancer–promoter looping and eRNA transcription during transcriptional activation, we induced the β-globin locus by chemical treatment and analysed cross-linking frequency between the β-globin gene and locus control region (LCR) and the amount of eRNAs transcribed on the LCR in a time course manner. The cross-linking frequency was increased after chemical induction but before the transcriptional activation of gene in the β-globin locus. Transcription of eRNAs was increased in concomitant with the increase in cross-linking frequency. These results show that chromatin looping and eRNA transcription precedes the transcriptional activation of gene. Concomitant occurrence of the two events suggests functional relationship between them. PMID:25588787

Conversion events in gene clusters

PubMed Central

2011-01-01

Background Gene clusters containing multiple similar genomic regions in close proximity are of great interest for biomedical studies because of their associations with inherited diseases. However, such regions are difficult to analyze due to their structural complexity and their complicated evolutionary histories, reflecting a variety of large-scale mutational events. In particular, conversion events can mislead inferences about the relationships among these regions, as traced by traditional methods such as construction of phylogenetic trees or multi-species alignments. Results To correct the distorted information generated by such methods, we have developed an automated pipeline called CHAP (Cluster History Analysis Package) for detecting conversion events. We used this pipeline to analyze the conversion events that affected two well-studied gene clusters (α-globin and β-globin) and three gene clusters for which comparative sequence data were generated from seven primate species: CCL (chemokine ligand), IFN (interferon), and CYP2abf (part of cytochrome P450 family 2). CHAP is freely available at http://www.bx.psu.edu/miller_lab. Conclusions These studies reveal the value of characterizing conversion events in the context of studying gene clusters in complex genomes. PMID:21798034

Gene cooption and convergent evolution of oxygen transport hemoglobins in jawed and jawless vertebrates

PubMed Central

Hoffmann, Federico G.; Opazo, Juan C.; Storz, Jay F.

2010-01-01

Natural selection often promotes evolutionary innovation by coopting preexisting genes for new functions, and this process may be greatly facilitated by gene duplication. Here we report an example of cooptive convergence where paralogous members of the globin gene superfamily independently evolved a specialized O2 transport function in the two deepest branches of the vertebrate family tree. Specifically, phylogenetic evidence demonstrates that erythroid-specific O2 transport hemoglobins evolved independently from different ancestral precursor proteins in jawed vertebrates (gnathostomes) and jawless fish (cyclostomes, represented by lamprey and hagfish). A comprehensive phylogenetic analysis of the vertebrate globin gene superfamily revealed that the erythroid hemoglobins of cyclostomes are orthologous to the cytoglobin protein of gnathostome vertebrates, a hexacoordinate globin that has no O2 transport function and that is predominantly expressed in fibroblasts and related cell types. The phylogeny reconstruction also revealed that vertebrate-specific globins are grouped into four main clades: (i) cyclostome hemoglobin + cytoglobin, (ii) myoglobin + globin E, (iii) globin Y, and (iv) the α- and β-chain hemoglobins of gnathostomes. In the hemoglobins of gnathostomes and cyclostomes, multisubunit quaternary structures provide the basis for cooperative O2 binding and allosteric regulation by coupling the effects of ligand binding at individual subunits with interactions between subunits. However, differences in numerous structural details belie their independent origins. This example of convergent evolution of protein function provides an impressive demonstration of the ability of natural selection to cobble together complex design solutions by tinkering with different variations of the same basic protein scaffold. PMID:20660759

Genetic therapy for beta-thalassemia: from the bench to the bedside.

PubMed

Arumugam, Paritha; Malik, Punam

2010-01-01

Beta-thalassemia is a genetic disorder with mutations in the β-globin gene that reduce or abolish β-globin protein production. Patients with β-thalassemia major (Cooley's anemia) become severely anemic by 6 to 18 months of age, and are transfusion dependent for life, while those with thalassemia intermedia, a less-severe form of thalassemia, are intermittently or rarely transfused. An allogeneically matched bone marrow transplant is curative, although it is restricted to those with matched donors. Gene therapy holds the promise of "fixing" one's own bone marrow cells by transferring the normal β-globin or γ-globin gene into hematopoietic stem cells (HSCs) to permanently produce normal red blood cells. Requirements for effective gene transfer for the treatment of β-thalassemia are regulated, erythroid-specific, consistent, and high-level β-globin or γ-globin expression. Gamma retroviral vectors have had great success with immune-deficiency disorders, but due to vector-associated limitations, they have limited utility in hemoglobinopathies. Lentivirus vectors, on the other hand, have now been shown in several studies to correct mouse and animal models of thalassemia. The immediate challenges of the field as it moves toward clinical trials are to optimize gene transfer and engraftment of a high proportion of genetically modified HSCs and to minimize the adverse consequences that can result from random integration of vectors into the genome by improving current vector design or developing novel vectors. This article discusses the current state of the art in gene therapy for β-thalassemia and some of the challenges it faces in human trials.

Synergistic and additive properties of the beta-globin locus control region (LCR) revealed by 5'HS3 deletion mutations: implication for LCR chromatin architecture.

PubMed

Fang, Xiangdong; Sun, Jin; Xiang, Ping; Yu, Man; Navas, Patrick A; Peterson, Kenneth R; Stamatoyannopoulos, George; Li, Qiliang

2005-08-01

Deletion of the 234-bp core element of the DNase I hypersensitive site 3 (5'HS3) of the locus control region (LCR) in the context of a human beta-globin locus yeast artificial chromosome (beta-YAC) results in profound effects on globin gene expression in transgenic mice. In contrast, deletion of a 2.3-kb 5'HS3 region, which includes the 234-bp core sequence, has a much milder phenotype. Here we report the effects of these deletions on chromatin structure in the beta-globin locus of adult erythroblasts. The 234-bp 5'HS3 deletion abolished histone acetylation throughout the beta-globin locus; recruitment of RNA polymerase II (pol II) to the LCR and beta-globin gene promoter was reduced to a basal level; and formation of all the 5' DNase I hypersensitive sites of the LCR was disrupted. The 2.3-kb 5'HS3 deletion mildly reduced the level of histone acetylation but did not change the profile across the whole locus; the 5' DNase I hypersensitive sites of the LCR were formed, but to a lesser extent; and recruitment of pol II was reduced, but only marginally. These data support the hypothesis that the LCR forms a specific chromatin structure and acts as a single entity. Based on these results we elaborate on a model of LCR chromatin architecture which accommodates the distinct phenotypes of the 5'HS3 and HS3 core deletions.

Hetero Bis-Addition of Spiro-Acetalized or Cyclohexanone Ring to 58π Fullerene Impacts Solubility and Mobility Balance in Polymer Solar Cells.

PubMed

Mikie, Tsubasa; Saeki, Akinori; Ikuma, Naohiko; Kokubo, Ken; Seki, Shu

2015-06-17

Fullerene bis-adducts are increasingly being studied to gain a high open circuit voltage (Voc) in bulk heterojunction organic photovoltaics (OPVs). We designed and synthesized homo and hetero bis-adduct [60]fullerenes by combining fused cyclohexanone or a five-membered spiro-acetalized unit (SAF5) with 1,2-dihydromethano (CH2), indene, or [6,6]-phenyl-C61-butyric acid methyl ester (PCBM). These new eight 56π fullerenes showed a rational rise of the lowest unoccupied molecular orbital (LUMO). We perform a systematic study on the electrochemical property, solubility, morphology, and space-charge-limited current (SCLC) mobility. The best power conversion efficiency (PCE) of 4.43% (average, 4.36%) with the Voc of 0.80 V was obtained for poly(3-hexylthiophene) (P3HT) blended with SAF5/indene hetero bis-adduct, which is a marked advancement in PCE compared to the 0.9% of SAF5 monoadduct. More importantly, we elucidate an important role of mobility balance between hole and electron that correlates with the device PCEs. Besides, an empirical equation to extrapolate the solubilities of hetero bis-adducts is proposed on the basis of those of counter monoadducts. Our work offers a guide to mitigate barriers for exploring a large number of hetero bis-adduct fullerenes for efficient OPVs.

Diagnostic difficulty of beta-thalassemia syndrome in a multi-transfused patient: contribution of myelogram and studying parents.

PubMed

Trawinski, Élisabeth; Fenneteau, Odile; Le Mouel, Lou; Ithier, Ghislaine; Couque, Nathalie

2017-10-01

We report the case of a 5 year old, initially followed for congenital sideroblastic anemia, whose explorations reveal a complex family hemoglobinopathy. Myelogram performed in children, reveals dystrophic mature erythroblasts with hemoglobinization defect and basophil punctuations. These abnormalities point towards an abnormal synthesis of heme or globin chains. Iterative transfusions in child do not allow interpreting a search for abnormal hemoglobin. However, the analysis carried out in his parents, with increased HBA2 rate and microcytosis concluded in beta-thalassemia trait for father and mother. Knowing that beta-thalassemia syndrome is a genetic condition, usually recessive, the presence of beta-thalassemia trait in parents is in favor of a beta-thalassemia syndrome in child. This diagnostic hypothesis is confirmed by molecular study of globin genes that will reveal a complex hemoglobinopathie for all family's members. The parents are carriers for heterozygous mutation of β + thalassemia that the sick child presents in homozygous state supporting the diagnosis of beta-thalassemia syndrome. Moreover, a triple α globin gene is present respectively at heterozygous state for mother and at homozygous state for father and child. The triple α globin gene is a known factor of aggravation of beta-thalassemia and this clinical case with continuum observed, perfectly illustrates the intricacies between α and β globin genes.

Bergamot (Citrus bergamia Risso) fruit extracts as γ-globin gene expression inducers: phytochemical and functional perspectives.

PubMed

Guerrini, Alessandra; Lampronti, Ilaria; Bianchi, Nicoletta; Zuccato, Cristina; Breveglieri, Giulia; Salvatori, Francesca; Mancini, Irene; Rossi, Damiano; Potenza, Rocco; Chiavilli, Francesco; Sacchetti, Gianni; Gambari, Roberto; Borgatti, Monica

2009-05-27

Epicarps of Citrus bergamia fruits from organic farming were extracted with the objective of obtaining derived products differently rich in coumarins and psoralens. The extracts were chemically characterized by (1)H nuclear magnetic resonance (NMR), gas chromatography-flame ionization detection (GC-FID), gas chromatography-mass spectrometry (GC-MS), and high-pressure liquid chromatography (HPLC) for detecting and quantifying the main constituents. Both bergamot extracts and chemical standards corresponding to the main constituents detected were then assayed for their capacity to increase erythroid differentiation of K562 cells and expression of γ-globin genes in human erythroid precursor cells. Three experimental cell systems were employed: (a) the human leukemic K562 cell line, (b) K562 cell clones stably transfected with a pCCL construct carrying green-enhanced green fluorescence protein (EGFP) under the γ-globin gene promoter, and (c) the two-phase liquid culture of human erythroid progenitors isolated from healthy donors. The results suggest that citropten and bergapten are powerful inducers of differentiation and γ-globin gene expression in human erythroid cells. These data could have practical relevance, because pharmacologically mediated regulation of human γ-globin gene expression, with the consequent induction of fetal hemoglobin, is considered to be a potential therapeutic approach in hematological disorders, including β-thalassemia and sickle cell anemia.

Running, swimming and diving modifies neuroprotecting globins in the mammalian brain

PubMed Central

Williams, Terrie M; Zavanelli, Mary; Miller, Melissa A; Goldbeck, Robert A; Morledge, Michael; Casper, Dave; Pabst, D. Ann; McLellan, William; Cantin, Lucas P; Kliger, David S

2007-01-01

The vulnerability of the human brain to injury following just a few minutes of oxygen deprivation with submergence contrasts markedly with diving mammals, such as Weddell seals (Leptonychotes weddellii), which can remain underwater for more than 90 min while exhibiting no neurological or behavioural impairment. This response occurs despite exposure to blood oxygen levels concomitant with human unconsciousness. To determine whether such aquatic lifestyles result in unique adaptations for avoiding ischaemic–hypoxic neural damage, we measured the presence of circulating (haemoglobin) and resident (neuroglobin and cytoglobin) oxygen-carrying globins in the cerebral cortex of 16 mammalian species considered terrestrial, swimming or diving specialists. Here we report a striking difference in globin levels depending on activity lifestyle. A nearly 9.5-fold range in haemoglobin concentration (0.17–1.62 g Hb 100 g brain wet wt−1) occurred between terrestrial and deep-diving mammals; a threefold range in resident globins was evident between terrestrial and swimming specialists. Together, these two globin groups provide complementary mechanisms for facilitating oxygen transfer into neural tissues and the potential for protection against reactive oxygen and nitrogen groups. This enables marine mammals to maintain sensory and locomotor neural functions during prolonged submergence, and suggests new avenues for averting oxygen-mediated neural injury in the mammalian brain. PMID:18089537

Hemoglobin genetics: recent contributions of GWAS and gene editing

PubMed Central

Smith, Elenoe C.; Orkin, Stuart H.

2016-01-01

The β-hemoglobinopathies are inherited disorders resulting from altered coding potential or expression of the adult β-globin gene. Impaired expression of β-globin reduces adult hemoglobin (α2β2) production, the hallmark of β-thalassemia. A single-base mutation at codon 6 leads to formation of HbS (α2βS2) and sickle cell disease. While the basis of these diseases is known, therapy remains largely supportive. Bone marrow transplantation is the only curative therapy. Patients with elevated levels of fetal hemoglobin (HbF, α2γ2) as adults exhibit reduced symptoms and enhanced survival. The β-globin gene locus is a paradigm of cell- and developmental stage-specific regulation. Although the principal erythroid cell transcription factors are known, mechanisms responsible for silencing of the γ-globin gene were obscure until application of genome-wide association studies (GWAS). Here, we review findings in the field. GWAS identified BCL11A as a candidate negative regulator of γ-globin expression. Subsequent studies have established BCL11A as a quantitative repressor. GWAS-related single-nucleotide polymorphisms lie within an essential erythroid enhancer of the BCL11A gene. Disruption of a discrete region within the enhancer reduces BCL11A expression and induces HbF expression, providing the basis for gene therapy using gene editing tools. A recently identified, second silencing factor, leukemia/lymphoma-related factor/Pokemon, shares features with BCL11A, including interaction with the nucleosome remodeling deacetylase repressive complex. These findings suggest involvement of a common pathway for HbF silencing. In addition, we discuss other factors that may be involved in γ-globin gene silencing and their potential manipulation for therapeutic benefit in treating the β-hemoglobinopathies. PMID:27340226

β-Globin chain abnormalities with coexisting α-thalassemia mutations

PubMed Central

Canataroglu, Abdullah; Unsal, Cagatay; Yildiz, Sule Menziletoglu; Turhan, Ferda Tekin; Bozdogan, Sevcan Tug; Dincer, Suleyman; Erkman, Hakan

2012-01-01

Introduction The frequency of hemoglobinopathies is still high in Adana, the biggest city of the Cukurova Region that is located in the southern part of Turkey. Our aim was to identify the concomitant mutations in α- and β-globin genes which lead to complex hemoglobinopathies and to establish an appropriate plan of action for each subject, particularly when prenatal diagnosis is necessary. Material and methods We studied the association between the β-globin gene and α-thalassemia genotypes. The reverse hybridization technique was employed to perform molecular analysis, and the results were confirmed by amplification refractory mutation system (ARMS) or restriction fragment length polymorphism (RFLP) technique. Results We evaluated 36 adult subjects (28 female and 8 male; age range: 18-52 years) with concomitant mutations in their α- and β-globin genes. The –α3.7/αα deletion was the commonest defect in the α-chain as expected, followed by α3.7/–α3.7 deletion. Twenty-five of 36 cases were sickle cell trait with coexisting α-thalassemia, while seven Hb S/S patients had concurrent mutations in their α-genes. The coexistence of αPolyA-2α/αα with Hb A/D and with Hb S/D, which is very uncommon, was also detected. There was a subject with compound heterozygosity for β-globin chain (–α3.7/αα with IVSI.110/S), and also a case who had –α3.7/αα deletion with IVSI.110/A. Conclusions Although limited, our data suggest that it would be valuable to study coexisting α-globin mutations in subjects with sickle cell disease or β-thalassemia trait during the screening programs for premarital couples, especially in populations with a high frequency of hemoglobinopathies. PMID:23056075

Protein adducts as biomarkers of exposure to aromatic diisocyanates in workers manufacturing polyurethane (PUR) foam.

PubMed

Säkkinen, Kirsi; Tornaeus, Jarkko; Hesso, Antti; Hirvonen, Ari; Vainio, Harri; Norppa, Hannu; Rosenberg, Christina

2011-04-01

This work was undertaken to investigate the usefulness of diisocyanate-related protein adducts in blood samples as biomarkers of occupational exposure to toluene diisocyanate (TDI; 2,4- and 2,6-isomers) and 4,4'-methylenediphenyl diisocyanate (MDI). Quantification of adducts as toluene diamines (TDAs) and methylenedianiline (MDA) was performed on perfluoroacylated derivatives by gas chromatography-mass spectrometry (GC-MS/MS) in negative chemical ionisation mode. TDI-derived adducts were found in 77% of plasma and in 59% of globin samples from exposed workers manufacturing flexible polyurethane foam. The plasma levels ranged from 0.003 to 0.58 nmol mL(-1) and those in globin from 0.012 to 0.33 nmol g(-1). The 2,6-isomer amounted to about two-thirds of the sum concentration of TDA isomers. MDI-derived adducts were detected in 3.5% of plasma and in 7% of globin samples from exposed workers manufacturing rigid polyurethane foam. A good correlation was found between the sum of TDA isomers in urine and that in plasma. The relationship between globin adducts and urinary metabolites was ambiguous. Monitoring TDI-derived TDA in plasma thus appears to be an appropriate method for assessing occupational exposure. Contrary to TDI exposure, adducts in plasma or globin were not useful in assessing workers' exposure to MDI. An important outcome of the study was that no amine-related adducts were detected in globin samples from TDI- or MDI-exposed workers, alleviating concerns that TDI or MDI might pose a carcinogenic hazard. Further studies are nevertheless required to judge whether diisocyanates per se could be such a hazard.

Gamma reactivation using the spongy effect of KLF1-binding site sequence: an approach in gene therapy for beta-thalassemia

PubMed Central

Heydari, Nasrin; Shariati, Laleh; Khanahmad, Hossein; Hejazi, Zahra; Shahbazi, Mansoureh; Salehi, Mansoor

2016-01-01

Objective(s): β-thalassemia is one of the most common genetic disorders in the world. As one of the promising treatment strategies, fetal hemoglobin (Hb F) can be induced. The present study was an attempt to reactivate the γ-globin gene by introducing a gene construct containing KLF1 binding sites to the K562 cell line. Materials and Methods: A plasmid containing a 192 bp sequence with two repeats of KLF1 binding sites on β-globin and BCL11A promoters was constructed and used to transfect the K562 cell line. Positive selection was performed under treatment with 150 μg/ml hygromycin B. The remaining cells were expanded and harvested on day 28, and genomic DNA was extracted. The PCR was carried out to verify insertion of DNA fragment to the genome of K562 cells. The cells were differentiated with 15 μg/ml cisplatin. Flowcytometry was performed to identify erythroid differentiation by detection of CD235a+ cells. Real-time RT-PCR was performed to evaluate γ-globin expression in the transfected cells. Results: A 1700 bp fragment was observed on agarose gel as expected and insertion of DNA fragment to the genome of K562 cells was verified. Totally, 84% of cells were differentiated. The transfected cells significantly increased γ-globin expression after differentiation compared to untransfected ones. Conclusion: The findings demonstrate that the spongy effect of KLF1-binding site on BCL11A and β-globin promoters can induce γ-globin expression in K562 cells. This novel strategy can be promising for the treatment of β-thalassemia and sickle cell disease. PMID:27872702

Screening of (-SEA) α-thalassaemia using an immunochromatographic strip assay for the ζ-globin chain in a population with a high prevalence and heterogeneity of haemoglobinopathies.

PubMed

Jomoui, Wittaya; Fucharoen, Goonnapa; Sanchaisuriya, Kanokwan; Fucharoen, Supan

2017-01-01

The presence of the ζ-globin chain is a good marker of (-- SEA ) α 0 -thalassaemia. We evaluated an immunochromatographic (IC) strip assay for ζ-globin in screening for (-- SEA ) α 0 -thalassaemia in a population with a high prevalence and heterogeneity of haemoglobinopathies. The study was carried out on 300 screen positive blood samples of Thai individuals. The IC strip assay for the ζ-globin chain was performed on all samples. The results were interpreted with thalassaemia genotyping using standard haemoglobin and DNA analyses. Several thalassaemia genotypes were noted. Among the 300 subjects investigated, 79 had a positive IC strip assay for ζ-globin and (-- SEA ) α 0 -thalassaemia was identified in 40 of them. No (-- SEA ) α 0 -thalassaemia was detected in the remaining 39 samples with a positive IC strip test result or in the 221 samples with a negative IC strip test result. Further DNA analysis identified α + -thalassaemia in 25 of the 39 (-- SEA ) α 0 -thalassaemia negative samples. Using this IC strip assay in combination with a conventional screening protocol for (-- SEA ) α 0 -thalassaemia could provide sensitivity and specificity of 100% and 90.4%, respectively. IC strip assay for ζ-globin is simple, rapid and does not require sophisticated equipment. Use of this test in addition to the existing screening protocol could detect potential (-- SEA ) α 0 -thalassaemia leading to a significant reduction in the workload of DNA analysis. This could be used in areas where haemoglobinopathies are prevalent and heterogeneous but molecular testing is not available. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

Gene Duplication and the Evolution of Hemoglobin Isoform Differentiation in Birds*

PubMed Central

Grispo, Michael T.; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E.; Storz, Jay F.

2012-01-01

The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the αA-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the αD-globin gene). The αD-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O2 affinity in the presence of allosteric effectors such as organic phosphates and Cl− ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O2 affinity stems primarily from changes in the O2 association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the αD-globin gene that is shared with the embryonic α-like globin gene. PMID:22962007

Gene duplication and the evolution of hemoglobin isoform differentiation in birds.

PubMed

Grispo, Michael T; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E; Storz, Jay F

2012-11-02

The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the α(A)-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the α(D)-globin gene). The α(D)-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O(2) affinity in the presence of allosteric effectors such as organic phosphates and Cl(-) ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O(2) affinity stems primarily from changes in the O(2) association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the α(D)-globin gene that is shared with the embryonic α-like globin gene.

Globin haplotypes of human T-cell lymphotropic virus type I-infected individuals in Salvador, Bahia, Brazil, suggest a post-Columbian African origin of this virus.

PubMed

Alcantara, Luiz Carlos; Van Dooren, Sonia; Gonçalves, Marilda Souza; Kashima, Simone; Costa, Maria Cristina Ramos; Santos, Fred Luciano Neves; Bittencourt, Achilea Lisboa; Dourado, Inês; Filho, Antonio Andrade; Covas, Dimas Tadeu; Vandamme, Anne-Mieke; Galvão-Castro, Bernardo

2003-08-01

The city of Salvador, Bahia, Brazil, has sociodemographic characteristics similar to some African cities. Up to now, it has had the highest prevalence of human T-cell lymphotropic virus type I (HTLV-I) infection (1.74%) in the country. To investigate which strains of HTLV-I are circulating in Salvador, we studied isolates from 82 patients infected with HTLV-I: 19 from the general population, 21 from pregnant women, 16 from intravenous drug users, and 26 from patients and their family attending a neurologic clinic. Phylogenetic analysis from part of the LTR fragments showed that most of these isolates belonged to the Transcontinental subgroup of the Cosmopolitan subtype (HTLV-Ia). Only one sample from a pregnant woman was closely related to the Japanese subgroup, suggesting recent introduction of a Japanese HTLV-I lineage into Salvador. betaA-Globin haplotypes were examined in 34 infected individuals and found to be atypical, confirming the racial heterogeneity of this population. A total of 20 chromosomes were characterized as Central African Republic (CAR) haplotype (29.4%), 31 (45.6%) were characterized as Benin (BEN) haplotype, and 17 (25%) were characterized as Senegal (SEN) haplotype. Five patients' genotypes (14.7%) were CAR/CAR; 10 (29,4%), BEN/BEN; 9 (26.5%), CAR/BEN; 2 (5.9%), BEN/SEN; and 7 (20.6%), SEN/SEN. One patient's genotype (2.9%) was CAR/SEN. The betaA-globin haplotype distribution in Salvador is unusual compared with other Brazilian states. Our data support the hypothesis of multiple post-Columbian introductions of African HTLV-Ia strains in Salvador, Bahia, Brazil.

Novel mutations responsible for α-thalassemia in Iranian families.

PubMed

Bayat, Nooshin; Farashi, Samaneh; Hafezi-Nejad, Nima; Faramarzi, Negin; Ashki, Mehri; Vakili, Shadi; Imanian, Hashem; Khosravi, Mohsen; Azar-Keivan, Azita; Najmabadi, Hossein

2013-01-01

α-Thalassemia (α-thal) is usually caused by deletions on the α-globin gene cluster and the role of point mutations is less well investigated. In the present study, a total of 1048 individuals with hypochromic microcytic anemia, who did not present the most common α-thal deletions, were referred for α-globin gene DNA sequencing. The nucleotide changes were studied and a total of five new mutations was identified, of which three were located on the α2 gene [codon7 (Lys→Stop), codon 34 (Leu→Pro) and codon 83 (Leu→Arg)] and two on the α1 gene [IVS-I-116 (A>G) and codon 44 (+C)]. These novel mutations not only explain new findings by molecular analysis of the α-globin gene but also have clinical importance due to their changes in α-globin production in means of decreased hemoglobin (Hb) related values. Moreover, considerations of its role in combination with other mutations, and the possibility of causing Hb H (β4) are yet to be studied.

The population genetics of the alpha-2 globin locus of orangutans (Pongo pygmaeus).

PubMed

Steiper, Michael E; Wolfe, Nathan D; Karesh, William B; Kilbourn, Annelisa M; Bosi, Edwin J; Ruvolo, Maryellen

2005-03-01

In this study, the molecular population genetics of the orangutan's alpha-2 globin (HBA2) gene were investigated in order to test for the action of natural selection. Haplotypes from 28 orangutan chromosomes were collected from a 1.46-kilobase region of the alpha-2 globin locus. While many aspects of the data were consistent with neutrality, the observed heterogeneous distribution of polymorphisms was inconsistent with neutral expectations. Furthermore, a single amino acid variant, found in both the Bornean and the Sumatran orangutan subspecies, was associated with different alternative synonymous variants in each subspecies, suggesting that the allele may have spread separately through the two subspecies after two distinct origination events. This variant is not in Hardy-Weinberg equilibrium (HWE). These observations are consistent with neutral models that incorporate population structure and models that invoke selection. The orangutan Plasmodium parasite is a plausible selective agent that may underlie the variation at alpha-2 globin in orangutans.

Regiochemically controlled synthesis of a β-4-β' [70]fullerene bis-adduct

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cerón, Maira R.; Castro, Edison; Neti, Venkata S. Pavan K.

2016-12-22

A β-4-β' C 70 bis-adduct regioisomer and an uncommon mono-adduct β-malonate C 70 derivative were synthesized by using a Diels–Alder cycloaddition followed by an addition–elimination of bromo-ethylmalonate and a retro-Diels–Alder cycloaddition reaction. Here, we also report the regioselective synthesis and spectroscopic characterization of C s-symmetric tris- and C 2v-symmetric tetra-adducts of C 70, which are the precursors of the mono- and bis-adduct final products.

HPLC-ESI-MS/MS analysis of hemoglobin peptides in tryptic digests of dried-blood spot extracts detects HbS, HbC, HbD, HbE, HbO-Arab, and HbG-Philadelphia mutations.

PubMed

Haynes, Christopher A; Guerra, Stephanie L; Fontana, Jessalyn C; DeJesús, Víctor R

2013-09-23

Hemoglobinopathies are mutations resulting in abnormal globin chain structure; some have clinically significant outcomes such as anemia or reduced lifespan. Five β-globin mutations are (c.20A>T, p.E6V), (c.19G>A, p. E6K), (c.79G>A, p.E26K), (c.364G>C, p.E121Q), and (c.364G>A, p.E121K), resulting in HbS (sickle-cell hemoglobin), HbC, HbE, HbD-Los Angeles, and HbO-Arab, respectively. One α-globin mutation is (c.[207C>G or 207C>A], p.N68K), resulting in HbG-Philadelphia. HPLC-ESI-MS/MS analysis of dried-blood spot (DBS) punches from newborns extracted with a trypsin-containing solution provides greater than 90% coverage of α-, β-, and γ-globin amino acid sequences. Because the (c.20A>T, p.E6V), (c.19G>A, p. E6K), (c.79G>A, p.E26K), (c.364G>C, p.E121Q), (c.364G>A, p.E121K), and (c.[207C>G or 207C>A], p.N68K) mutations generate globin peptides with novel amino acid sequences, detecting one of these peptides in DBS extracts is indicative of the presence of a hemoglobinopathy in the newborn. The method described here can distinguish normal β-globin peptides from the mutant HbS, HbC, HbE, HbD-Los Angeles and HbO-Arab peptides, as well as normal α-globin peptide from the mutant HbG-Philadelphia peptide, allowing the identification of unaffected heterozygotes such as HbAS, and of compound heterozygotes such as HbASG-Philadelphia. This HPLC-ESI-MS/MS analytical approach provides information that is not available from traditional hemoglobin analyses such as isoelectric focusing and HPLC-UV. It is also capable of determining the amino acid sequence of hemoglobin peptides, potentially allowing the detection of numerous hemoglobinopathies resulting from point mutations. Published by Elsevier B.V.

Role of α-globin H helix in the building of tetrameric human hemoglobin: interaction with α-hemoglobin stabilizing protein (AHSP) and heme molecule.

PubMed

Domingues-Hamdi, Elisa; Vasseur, Corinne; Fournier, Jean-Baptiste; Marden, Michael C; Wajcman, Henri; Baudin-Creuza, Véronique

2014-01-01

Alpha-Hemoglobin Stabilizing Protein (AHSP) binds to α-hemoglobin (α-Hb) or α-globin and maintains it in a soluble state until its association with the β-Hb chain partner to form Hb tetramers. AHSP specifically recognizes the G and H helices of α-Hb. To investigate the degree of interaction of the various regions of the α-globin H helix with AHSP, this interface was studied by stepwise elimination of regions of the α-globin H helix: five truncated α-Hbs α-Hb1-138, α-Hb1-134, α-Hb1-126, α-Hb1-123, α-Hb1-117 were co-expressed with AHSP as two glutathione-S-transferase (GST) fusion proteins. SDS-PAGE and Western Blot analysis revealed that the level of expression of each truncated α-Hb was similar to that of the wild type α-Hb except the shortest protein α-Hb1-117 which displayed a decreased expression. While truncated GST-α-Hb1-138 and GST-α-Hb1-134 were normally soluble; the shorter globins GST-α-Hb1-126 and GST-α-Hb1-117 were obtained in very low quantities, and the truncated GST-α-Hb1-123 provided the least material. Absorbance and fluorescence studies of complexes showed that the truncated α-Hb1-134 and shorter forms led to modified absorption spectra together with an increased fluorescence emission. This attests that shortening the H helix leads to a lower affinity of the α-globin for the heme. Upon addition of β-Hb, the increase in fluorescence indicates the replacement of AHSP by β-Hb. The CO binding kinetics of different truncated AHSPWT/α-Hb complexes showed that these Hbs were not functionally normal in terms of the allosteric transition. The N-terminal part of the H helix is primordial for interaction with AHSP and C-terminal part for interaction with heme, both features being required for stability of α-globin chain.

Characterization of Homozygous Hb Setif (HBA2: c.283G>T) in the Iranian Population.

PubMed

Farashi, Samaneh; Garous, Negin F; Vakili, Shadi; Ashki, Mehri; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein

2016-01-01

Hemoglobin (Hb) variants are abnormalities resulting from point mutations in either of the two α-globin genes (HBA2 or HBA1) or the β-globin gene (HBB). Various reports of Hb variants have been described in Iran and other countries around the world. Hb Setif (or HBA2: c.283G>T) is one of these variants with a mutation at codon 94 of of the α2-globin gene that is characterized in clinically normal heterozygous individuals. We here report clinical and hematological findings in two homozygous cases of Iranian origin for this unstable Hb variant.

Acute chest syndrome is associated with single nucleotide polymorphism-defined beta globin cluster haplotype in children with sickle cell anaemia

PubMed Central

Bean, Christopher J.; Boulet, Sheree L.; Yang, Genyan; Payne, Amanda B.; Ghaji, Nafisa; Pyle, Meredith E.; Hooper, W. Craig; Bhatnagar, Pallav; Keefer, Jeffrey; Barron-Casella, Emily A.; Casella, James F.; DeBaun, Michael R.

2013-01-01

Summary Genetic diversity at the human β-globin locus has been implicated as a modifier of sickle cell anaemia (SCA) severity. However, haplotypes defined by restriction fragment length polymorphism sites across the β-globin locus have not been consistently associated with clinical phenotypes. To define the genetic structure at the β-globin locus more thoroughly, we performed high-density single nucleotide polymorphism (SNP) mapping in 820 children who were homozygous for the sickle cell mutation (HbSS). Genotyping results revealed very high linkage disequilibrium across a large region spanning the locus control region and the HBB (β-globin gene) cluster. We identified three predominant haplotypes accounting for 96% of the βS-carrying chromosomes in this population that could be distinguished using a minimal set of common SNPs. Consistent with previous studies, fetal haemoglobin level was significantly associated with βS-haplotypes. After controlling for covariates, an association was detected between haplotype and rate of hospitalization for acute chest syndrome (ACS) (incidence rate ratio 0.51, 95% confidence interval 0.29–0.89) but not incidence rate of vaso-occlusive pain or presence of silent cerebral infarct (SCI). Our results suggest that these SNP-defined βS-haplotypes may be associated with ACS, but not pain or SCI in a study population of children with SCA. PMID:23952145

EXPERIMENTAL STUDIES IN ACUTE RENAL FAILURE

PubMed Central

Menefee, Max G.; Mueller, C. Barber; Miller, Tracy B.; Myers, Joseph K.; Bell, Allen L.

1964-01-01

When purified human globin is injected intravenously into rats it produces acute renal failure characterized by tubular casts and oliguria. The globin is identifiable within vesicles and channels in the cytoplasm of the proximal tubules, through which it passes from lumen to basal side with no apparent serious effect on the cells. When a very minimal amount of globin is taken up by cells of the distal limb of Henle's loop or distal tubules (lower nephron), a markedly deleterious effect is apparent and the cells die within a short time. The mixture of cell debris and precipitated globin forms plugs within the confines of the basement membranes of the former distal limbs and distal tubules. After a number of lower nephrons are plugged a disruption of proximal tubules is found, which apparently results from the effect of back pressure in the obstructed nephrons. We suggest that any amount in excess of a low threshold of globin, either alone or combined with heme or related material, has a toxic effect on lower nephron cells. Once initiated, the toxic effect is not reversible and the resulting plug of debris and precipitate will occlude the lumen. If a sufficient number of nephrons are made non-functional the animal becomes anuric; otherwise it is oliguric. A high rate of urine flow will protect against the excess absorption of material and thus against acute renal failure. PMID:14238931

MBD2 is a critical component of a methyl cytosine-binding protein complex isolated from primary erythroid cells

PubMed Central

Kransdorf, Evan P.; Wang, Shou Zhen; Zhu, Sheng Zu; Langston, Timothy B.; Rupon, Jeremy W.; Ginder, Gordon D.

2006-01-01

The chicken embryonic β-type globin gene, ρ, is a member of a small group of vertebrate genes whose developmentally regulated expression is mediated by DNA methylation. Previously, we have shown that a methyl cytosine-binding complex binds to the methylated ρ-globin gene in vitro. We have now chromatographically purified and characterized this complex from adult chicken primary erythroid cells. Four components of the MeCP1 transcriptional repression complex were identified: MBD2, RBAP48, HDAC2, and MTA1. These 4 proteins, as well as the zinc-finger protein p66 and the chromatin remodeling factor Mi2, were found to coelute by gel-filtration analysis and pull-down assays. We conclude that these 6 proteins are components of the MeCPC. In adult erythrocytes, significant enrichment for MBD2 is seen at the inactive ρ-globin gene by chromatin immunoprecipitation assay, whereas no enrichment is observed at the active βA-globin gene, demonstrating MBD2 binds to the methylated and transcriptionally silent ρ-globin gene in vivo. Knock-down of MBD2 resulted in up-regulation of a methylated ρ-gene construct in mouse erythroleukemic (MEL)-ρ cells. These results represent the first purification of a MeCP1-like complex from a primary cell source and provide support for a role for MBD2 in developmental gene regulation. PMID:16778143

Cooperativeness of the higher chromatin structure of the beta-globin locus revealed by the deletion mutations of DNase I hypersensitive site 3 of the LCR.

PubMed

Fang, Xiangdong; Xiang, Ping; Yin, Wenxuan; Stamatoyannopoulos, George; Li, Qiliang

2007-01-05

High-level transcription of the globin genes requires the enhancement by a distant element, the locus control region (LCR). Such long-range regulation in vivo involves spatial interaction between transcriptional elements, with intervening chromatin looping out. It has been proposed that the clustering of the HS sites of the LCR, the active globin genes, as well as the remote 5' hypersensitive sites (HSs) (HS-60/-62 in mouse, HS-110 in human) and 3'HS1 forms a specific spatial chromatin structure, termed active chromatin hub (ACH). Here we report the effects of the HS3 deletions of the LCR on the spatial chromatin structure of the beta-globin locus as revealed by the chromatin conformation capture (3C) technology. The small HS3 core deletion (0.23 kb), but not the large HS3 deletion (2.3 kb), disrupted the spatial interactions among all the HS sites of the LCR, the beta-globin gene and 3'HS1. We have previously demonstrated that the large HS3 deletion barely impairs the structure of the LCR holocomplex, while the structure is significantly disrupted by the HS3 core deletion. Taken together, these results suggest that the formation of the ACH is dependent on a largely intact LCR structure. We propose that the ACH indeed is an extension of the LCR holocomplex.

H3 K79 dimethylation marks developmental activation of the beta-globin gene but is reduced upon LCR-mediated high-level transcription.

PubMed

Sawado, Tomoyuki; Halow, Jessica; Im, Hogune; Ragoczy, Tobias; Bresnick, Emery H; Bender, M A; Groudine, Mark

2008-07-15

Genome-wide analyses of the relationship between H3 K79 dimethylation and transcription have revealed contradictory results. To clarify this relationship at a single locus, we analyzed expression and H3 K79 modification levels of wild-type (WT) and transcriptionally impaired beta-globin mutant genes during erythroid differentiation. Analysis of fractionated erythroid cells derived from WT/Delta locus control region (LCR) heterozygous mice reveals no significant H3 K79 dimethylation of the beta-globin gene on either allele prior to activation of transcription. Upon transcriptional activation, H3 K79 di-methylation is observed along both WT and DeltaLCR alleles, and both alleles are located in proximity to H3 K79 dimethylation nuclear foci. However, H3 K79 di-methylation is significantly increased along the DeltaLCR allele compared with the WT allele. In addition, analysis of a partial LCR deletion mutant reveals that H3 K79 dimethylation is inversely correlated with beta-globin gene expression levels. Thus, while our results support a link between H3 K79 dimethylation and gene expression, high levels of this mark are not essential for high level beta-globin gene transcription. We propose that H3 K79 dimethylation is destabilized on a highly transcribed template.

Correlations between oxygen affinity and sequence classifications of plant hemoglobins

USDA-ARS?s Scientific Manuscript database

Plants express three phylogenetic classes of hemoglobins (Hb) based on sequence analyses. Class 1 and 2 Hbs are full length globins with the classical 8 helix Mb-like fold, whereas Class 3 plant Hbs resemble the truncated globins found in bacteria. With the exception of the specialized leghemoglobin...

Reaction mechanism of Ru(II) piano-stool complexes: umbrella sampling QM/MM MD study.

PubMed

Futera, Zdeněk; Burda, Jaroslav V

2014-07-15

Biologically relevant interactions of piano-stool ruthenium(II) complexes with ds-DNA are studied in this article by hybrid quantum mechanics-molecular mechanics (QM/MM) computational technique. The whole reaction mechanism is divided into three phases: (i) hydration of the [Ru(II) (η(6) -benzene)(en)Cl](+) complex, (ii) monoadduct formation between the resulting aqua-Ru(II) complex and N7 position of one of the guanines in the ds-DNA oligomer, and (iii) formation of the intrastrand Ru(II) bridge (cross-link) between two adjacent guanines. Free energy profiles of all the reactions are explored by QM/MM MD umbrella sampling approach where the Ru(II) complex and two guanines represent a quantum core, which is described by density functional theory methods. The combined QM/MM scheme is realized by our own software, which was developed to couple several quantum chemical programs (in this study Gaussian 09) and Amber 11 package. Calculated free energy barriers of the both ruthenium hydration and Ru(II)-N7(G) DNA binding process are in good agreement with experimentally measured rate constants. Then, this method was used to study the possibility of cross-link formation. One feasible pathway leading to Ru(II) guanine-guanine cross-link with synchronous releasing of the benzene ligand is predicted. The cross-linking is an exergonic process with the energy barrier lower than for the monoadduct reaction of Ru(II) complex with ds-DNA. Copyright © 2014 Wiley Periodicals, Inc.

DNA damage in internal organs after cutaneous exposure to sulphur mustard.

PubMed

Batal, Mohamed; Boudry, Isabelle; Mouret, Stéphane; Cléry-Barraud, Cécile; Wartelle, Julien; Bérard, Izabel; Douki, Thierry

2014-07-01

Sulphur mustard (SM) is a chemical warfare agent that attacks mainly skin, eye and lungs. Due to its lipophilic properties, SM is also able to diffuse through the skin and reach internal organs. DNA represents one of the most critical molecular targets of this powerful alkylating agent which modifies DNA structure by forming monoadducts and biadducts. These DNA lesions are involved in the acute toxicity of SM as well as its long-term carcinogenicity. In the present work we studied the formation and persistence of guanine and adenine monoadducts and guanine biadducts in the DNA of brain, lungs, kidneys, spleen, and liver of SKH-1 mice cutaneously exposed to 2, 6 and 60mg/kg of SM. SM-DNA adducts were detected in all studied organs, except in liver at the two lowest doses. Brain and lungs were the organs with the highest level of SM-DNA adducts, followed by kidney, spleen and liver. Monitoring the level of adducts for three weeks after cutaneous exposure showed that the lifetime of adducts were not the same in all organs, lungs being the organ with the longest persistence. Diffusion from skin to internal organs was much more efficient at the highest compared to the lowest dose investigated as the result of the loss of the skin barrier function. These data provide novel information on the distribution of SM in tissues following cutaneous exposures and indicate that brain is an important target. Copyright © 2014 Elsevier Inc. All rights reserved.

A novel mutation of the beta-globin gene promoter (-102 C>A) and pitfalls in family screening.

PubMed

Aguilar-Martinez, Patricia; Jourdan, Eric; Brun, Sophie; Cunat, Séverine; Giansily-Blaizot, Muriel; Pissard, Serge; Schved, Jean-François

2007-12-01

We describe a family with beta-thalassemia in which several pitfalls of genetic diagnoses were present. These include coherent family phenotypes with discrepancies in molecular findings because of nonpaternity, and a false beta-globin gene homozygous genotype due to a large deletion in the second locus. These findings underline the difficulties of family genetic studies and the need for tight relationship between professionals involved in laboratory studies and those in-charge of the clinical follow-up and genetic counselling. In this family, we also report a new silent beta-thalassemia mutation, -102 (C>A), in the distal CACCC box of the beta-globin gene promoter.

Pathophysiology and Clinical Manifestations of the β-Thalassemias

PubMed Central

Nienhuis, Arthur W.; Nathan, David G.

2012-01-01

The β-thalassemia syndromes reflect deficient or absent β-globin synthesis usually owing to a mutation in the β-globin locus. The relative excess of α-globin results in the formation of insoluble aggregates leading to ineffective erythropoiesis and shortened red cell survival. A relatively high capacity for fetal hemoglobin synthesis is a major genetic modifier of disease severity, with polymorphisms in other genes also having a significant role. Iron overload secondary to enhanced absorption and red cell transfusions causes an increase in liver iron and in various other tissues, leading to endocrine and cardiac dysfunction. Modern chelation regimens are effective in removing iron and preserving or restoring organ function. PMID:23209183

Codon 62 (GTG>GCG, Val→Ala) (α1) (HBA1: c.188T>C) causing nondeletional α-thalassemia in a Chinese family.

PubMed

Liao, Can; Tang, Hai-Shen; Li, Ru; Li, Dong-Zhi

2013-01-01

We report a novel α-globin gene point mutation detected during newborn screening for hemoglobinopathies. Sequence analyses identified a GTG>GCG substitution at codon 62 of the α1-globin gene. This mutation causes a silent α-thalassemia (α-thal).

α-Globin as a molecular target in the treatment of β-thalassemia

PubMed Central

Mettananda, Sachith; Gibbons, Richard J.

2015-01-01

The thalassemias, together with sickle cell anemia and its variants, are the world’s most common form of inherited anemia, and in economically undeveloped countries, they still account for tens of thousands of premature deaths every year. In developed countries, treatment of thalassemia is also still far from ideal, requiring lifelong transfusion or allogeneic bone marrow transplantation. Clinical and molecular genetic studies over the course of the last 50 years have demonstrated how coinheritance of modifier genes, which alter the balance of α-like and β-like globin gene expression, may transform severe, transfusion-dependent thalassemia into relatively mild forms of anemia. Most attention has been paid to pathways that increase γ-globin expression, and hence the production of fetal hemoglobin. Here we review the evidence that reduction of α-globin expression may provide an equally plausible approach to ameliorating clinically severe forms of β-thalassemia, and in particular, the very common subgroup of patients with hemoglobin E β-thalassemia that makes up approximately half of all patients born each year with severe β-thalassemia. PMID:25869286

DOE Office of Scientific and Technical Information (OSTI.GOV)

Popp, R.A.; Popp, D.M.; Johnson, F.M.

Mice homozygous for a spontaneous mutation, in which the ..beta..-major globin gene is deleted, have clinical symptoms of ..beta..-thalassemia. These mice have a hypocellular, hypochromic, microcytic anemia that becomes more severe with increasing age. The defective red cell morphology, decreased osmotic fragility of erythrocytes and shortened red cell life span found in ..beta..-thalassemic mice are similar to those observed in human ..beta..-thalassemia. Synthesis of ..beta..-globin is depressed but not as much as might be expected because the expression of the..beta..-minor globin gene is enhanced to encode two to three times more globin than in normal mice. Splenomegaly, an enlarged poolmore » of stem cells for erythropoiesis, and iron overloading occur in older mice. The fact that these mice remain moderately healthy makes them a very suitable animal model in which to develop and test alternative techniques of gene therapy that could be successfully applied to the treatment of human thalassemia. Homozygous ..beta..-thalassemic mice have large deposits of iron in their tissues, which might make these mice also useful for in vivo tests of the effectiveness and possible long-term side effects for newly developed iron chelators.« less

The gammaPE complex contains both SATB1 and HOXB2 and has positive and negative roles in human gamma-globin gene regulation.

PubMed

Case, S S; Huber, P; Lloyd, J A

1999-11-01

A large nuclear protein complex, termed gammaPE (for gamma-globin promoter and enhancer binding factor), binds to five sites located 5' and 3' of the human y-globin gene. Two proteins, SATB1 (special A-T-rich binding protein 1) and HOXB2, can bind to yPE binding sites. SATB1 binds to nuclear matrix-attachment sites, and HOXB2 is a homeodomain protein important in neural development that is also expressed during erythropoiesis. The present work showed that antisera directed against either SATB1 or HOXB2 reacted specifically with the entire gammaPE complex in electrophoretic mobility shift assays (EMSAs), suggesting that the two proteins can bind to the gammaPE binding site simultaneously. When SATB1 or HOXB2 was expressed in vitro, they could bind independently to gammaPE binding sites in EMSA. Interestingly, the proteins expressed in vitro competed effectively with each other for the gammaPE binding site, suggesting that this may occur under certain conditions in vivo. Transient cotransfections of a HOXB2 cDNA and a y-globin-luciferase reporter gene construct into cells expressing SATB1 suggested that SATB1 has a positive and HOXB2 a negative regulatory effect on transcription. Taking into account their potentially opposing effects and binding activities, SATB1 and HOXB2 may modulate the amount of gamma-globin mRNA expressed during development and differentiation.

Versatile Cosmid Vectors for the Isolation, Expression, and Rescue of Gene Sequences: Studies with the Human α -globin Gene Cluster

NASA Astrophysics Data System (ADS)

Lau, Yun-Fai; Kan, Yuet Wai

1983-09-01

We have developed a series of cosmids that can be used as vectors for genomic recombinant DNA library preparations, as expression vectors in mammalian cells for both transient and stable transformations, and as shuttle vectors between bacteria and mammalian cells. These cosmids were constructed by inserting one of the SV2-derived selectable gene markers-SV2-gpt, SV2-DHFR, and SV2-neo-in cosmid pJB8. High efficiency of genomic cloning was obtained with these cosmids and the size of the inserts was 30-42 kilobases. We isolated recombinant cosmids containing the human α -globin gene cluster from these genomic libraries. The simian virus 40 DNA in these selectable gene markers provides the origin of replication and enhancer sequences necessary for replication in permissive cells such as COS 7 cells and thereby allows transient expression of α -globin genes in these cells. These cosmids and their recombinants could also be stably transformed into mammalian cells by using the respective selection systems. Both of the adult α -globin genes were more actively expressed than the embryonic zeta -globin genes in these transformed cell lines. Because of the presence of the cohesive ends of the Charon 4A phage in the cosmids, the transforming DNA sequences could readily be rescued from these stably transformed cells into bacteria by in vitro packaging of total cellular DNA. Thus, these cosmid vectors are potentially useful for direct isolation of structural genes.

Total alpha-globin gene cluster deletion has high frequency in Filipinos

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hunt, J.A.; Haruyama, A.Z.; Chu, B.M.

1994-09-01

Most {alpha}-thalassemias [Thal] are due to large deletions. In Southeast Asians, the (--{sup SEA}) double {alpha}-globin gene deletion is common, 3 (--{sup Tot}) total {alpha}-globin cluster deletions are known: Filipino (--{sup Fil}), Thai (--{sup Thai}), and Chinese (--{sup Chin}). In a Hawaii Thal project, provisional diagnosis of {alpha}-Thal-1 heterozygotes was based on microcytosis, normal isoelectric focusing, and no iron deficiency. One in 10 unselected Filipinos was an {alpha}-Thal-1 heterozygote, 2/3 of these had a (--{sup Tot}) deletion: a {var_sigma}-cDNA probe consistently showed fainter intensity of the constant 5.5 kb {var_sigma}{sub 2} BamHI band, with no heterzygosity for {var_sigma}-globin region polymorphisms;more » {alpha}-cDNA or {var_sigma}-cDNA probes showed no BamHI or BglII bands diagnostic of the (--{sup SEA}) deletion; bands for the (-{alpha}) {alpha}-Thal-2 single {alpha}-globin deletions were only seen in Hb H cases. A reliable monoclonal anti-{var_sigma}-peptide antibody test for the (--{sup SEA}) deletion was always negative in (--{sup Tot}) samples. Southern digests with the Lo probe, a gift from D. Higgs of Oxford Univ., confirmed that 49 of 50 (--{sup Tot}) chromosomes in Filipinos were (--{sup Fil}). Of 20 {alpha}-Thal-1 hydrops born to Filipinos, 11 were (--{sup Fil}/--{sup SEA}) compound heterozygotes; 9 were (--{sup SEA}/--{sup SEA}) homozygotes, but none was a (--{sup Fil}/--{sup Fil}).« less

LDB1-mediated enhancer looping can be established independent of mediator and cohesin.

PubMed

Krivega, Ivan; Dean, Ann

2017-08-21

Mechanistic studies in erythroid cells indicate that LDB1, as part of a GATA1/TAL1/LMO2 complex, brings erythroid-expressed genes into proximity with enhancers for transcription activation. The role of co-activators in establishing this long-range interaction is poorly understood. Here we tested the contributions of the RNA Pol II pre-initiation complex (PIC), mediator and cohesin to establishment of locus control region (LCR)/β-globin proximity. CRISPR/Cas9 editing of the β-globin promoter to eliminate the RNA Pol II PIC by deleting the TATA-box resulted in loss of transcription, but enhancer-promoter interaction was unaffected. Additional deletion of the promoter GATA1 site eliminated LDB1 complex and mediator occupancy and resulted in loss of LCR/β-globin proximity. To separate the roles of LDB1 and mediator in LCR looping, we expressed a looping-competent but transcription-activation deficient form of LDB1 in LDB1 knock down cells: LCR/β-globin proximity was restored without mediator core occupancy. Further, Cas9-directed tethering of mutant LDB1 to the β-globin promoter forced LCR loop formation in the absence of mediator or cohesin occupancy. Moreover, ENCODE data and our chromatin immunoprecipitation results indicate that cohesin is almost completely absent from validated and predicted LDB1-regulated erythroid enhancer-gene pairs. Thus, lineage specific factors largely mediate enhancer-promoter looping in erythroid cells independent of mediator and cohesin. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.

Real-time PCR assays using internal controls for quantitation of HPV-16 and beta-globin DNA in cervicovaginal lavages.

PubMed

Lefevre, Jonas; Hankins, Catherine; Pourreaux, Karina; Voyer, Hélène; Coutlée, François

2003-12-01

High-risk human papillomavirus 16 (HPV-16) DNA viral load has been measured with real-time PCR assays by amplifying HPV-16 and a human gene. However, these assays have not used internal controls (ICs) to screen for the presence of inhibitors contained in samples. To quantitate HPV-16 DNA and cell content with real-time PCR, ICs for HPV-16 DNA and beta-globin were synthesised and used to control for inhibition. The assays were sensitive and linear over 5 logs. Good reproducibility was achieved with inter-run coefficients of variation of 23% (10(2) HPV-16 copies), 12% (10(4) HPV-16 copies), 17% (274 beta-globin DNA copies) and 7% (27,400 beta-globin DNA copies). Samples containing 56,800,000, 306,000, 18,000, and 4,070 HPV-16 copies/microg of cellular DNA were tested blindly and estimated to contain 48,800,000, 479,000, 20,300, and 6,620 HPV-16 copies/microg of DNA (mean ratio of measured to expected viral load of 1.27+/-0.32). Inhibition of amplification of HPV-16 and beta-globin ICs by six samples known to contain PCR inhibitors was variable: four inhibited both ICs while two inhibited only the HPV-16 IC. The use of internal controls with real-time PCR for HPV-16 quantitation allows to screen for the presence of inhibitors that do not affect equally primer-driven genomic amplification.

Molecular evolution of globin genes in Gymnotiform electric fishes: relation to hypoxia tolerance.

PubMed

Tian, Ran; Losilla, Mauricio; Lu, Ying; Yang, Guang; Zakon, Harold

2017-02-13

Nocturnally active gymnotiform weakly electric fish generate electric signals for communication and navigation, which can be energetically taxing. These fish mainly inhabit the Amazon basin, where some species prefer well-oxygenated waters and others live in oxygen-poor, stagnant habitats. The latter species show morphological, physiological, and behavioral adaptations for hypoxia-tolerance. However, there have been no studies of hypoxia tolerance on the molecular level. Globins are classic respiratory proteins. They function principally in oxygen-binding and -delivery in various tissues and organs. Here, we investigate the molecular evolution of alpha and beta hemoglobins, myoglobin, and neuroglobin in 12 gymnotiforms compared with other teleost fish. The present study identified positively selected sites (PSS) on hemoglobin (Hb) and myoglobin (Mb) genes using different maximum likelihood (ML) methods; some PSS fall in structurally important protein regions. This evidence for the positive selection of globin genes suggests that the adaptive evolution of these genes has helped to enhance the capacity for oxygen storage and transport. Interestingly, a substitution of a Cys at a key site in the obligate air-breathing electric eel (Electrophorus electricus) is predicted to enhance oxygen storage of Mb and contribute to NO delivery during hypoxia. A parallel Cys substitution was also noted in an air-breathing African electric fish (Gymnarchus niloticus). Moreover, the expected pattern under normoxic conditions of high expression of myoglobin in heart and neuroglobin in the brain in two hypoxia-tolerant species suggests that the main effect of selection on these globin genes is on their sequence rather than their basal expression patterns. Results indicate a clear signature of positive selection in the globin genes of most hypoxia-tolerant gymnotiform fishes, which are obligate or facultative air breathers. These findings highlight the critical role of globin genes in hypoxia tolerance evolution of Gymnotiform electric fishes.

Coordination and redox state-dependent structural changes of the heme-based oxygen sensor AfGcHK associated with intraprotein signal transduction.

PubMed

Stranava, Martin; Man, Petr; Skálová, Tereza; Kolenko, Petr; Blaha, Jan; Fojtikova, Veronika; Martínek, Václav; Dohnálek, Jan; Lengalova, Alzbeta; Rosůlek, Michal; Shimizu, Toru; Martínková, Markéta

2017-12-22

The heme-based oxygen sensor histidine kinase Af GcHK is part of a two-component signal transduction system in bacteria. O 2 binding to the Fe(II) heme complex of its N-terminal globin domain strongly stimulates autophosphorylation at His 183 in its C-terminal kinase domain. The 6-coordinate heme Fe(III)-OH - and -CN - complexes of Af GcHK are also active, but the 5-coordinate heme Fe(II) complex and the heme-free apo-form are inactive. Here, we determined the crystal structures of the isolated dimeric globin domains of the active Fe(III)-CN - and inactive 5-coordinate Fe(II) forms, revealing striking structural differences on the heme-proximal side of the globin domain. Using hydrogen/deuterium exchange coupled with mass spectrometry to characterize the conformations of the active and inactive forms of full-length Af GcHK in solution, we investigated the intramolecular signal transduction mechanisms. Major differences between the active and inactive forms were observed on the heme-proximal side (helix H5), at the dimerization interface (helices H6 and H7 and loop L7) of the globin domain and in the ATP-binding site (helices H9 and H11) of the kinase domain. Moreover, separation of the sensor and kinase domains, which deactivates catalysis, increased the solvent exposure of the globin domain-dimerization interface (helix H6) as well as the flexibility and solvent exposure of helix H11. Together, these results suggest that structural changes at the heme-proximal side, the globin domain-dimerization interface, and the ATP-binding site are important in the signal transduction mechanism of Af GcHK. We conclude that Af GcHK functions as an ensemble of molecules sampling at least two conformational states. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

A novel tandem mass spectrometry method for first-line screening of mainly beta-thalassemia from dried blood spots.

PubMed

Yu, Chaowen; Huang, Shuodan; Wang, Ming; Zhang, Juan; Liu, Hao; Yuan, Zhaojian; Wang, Xingbin; He, Xiaoyan; Wang, Jie; Zou, Lin

2017-02-10

Traditional methods for thalassemia screening are time-consuming and easily affected by cell hemolysis or hemoglobin degradation in stored blood samples. Tandem mass spectrometry (MS/MS) proved to be an effective technology for sickle cell disorders (SCD) screening. Here, we developed a novel MS/MS method for β-thalassemia screening from dried blood spots (DBS). Stable isotopic-labeled peptides were used as internal standards for quantification and calculation of the α:β-globin ratios. We used the α:β-globin ratio cutoffs to differentiate between normal individuals and patients with thalassemia. About 781 patients and 300 normal individuals were analyzed. The α:β-globin ratios showed significant difference between normal and β-thalassemia patients (P<0.01), particularly when the disease was homozygous or double heterozygous with another α- or β-thalassemia mutation. In the parallel study, all cases screened for suspected thalassemia from six hundred DBS samples by using this MS/MS method were successfully confirmed by genotyping. The intra-assay and inter-assay CVs of the ratios ranged from 2.4% to 3.9% and 4.7% to 7.1%, and there was no significant sample carryover or matrix effect for this MS/MS method. Combined with SCD screening, this MS/MS method could be used as a first-line screening assay for both structural and expression abnormalities of human hemoglobin. Traditional methods for thalassemia screening were depending on the structural integrity of tetramers and could be affected by hemolysis and degradation of whole blood samples, especially when stored. We used proteospecific peptides produced by the tryptic digestion of each globin to evaluate the production ratio between α- and β-globin chains, which turned out to be quite stable even when stored for more than two months. Though most of the peptides were specific to α-globin or β-globin, we only chose four most informative peptides and its stable isotopic-labeled peptides as internal standards for analysis, which could obtain a high accuracy. Currently, we are the first to address the application of MS/MS for thalassemia screening, when combined with SCD screening, this MS/MS method could be used as a first-line screening assay for both structural and expression abnormalities of human hemoglobin. Copyright © 2016. Published by Elsevier B.V.

Investigating alpha-globin structural variants: a retrospective review of 135,000 Brazilian individuals

PubMed Central

Kimura, Elza Miyuki; Oliveira, Denise Madureira; Jorge, Susan Elisabeth; Ribeiro, Daniela Maria; Zaccariotto, Tânia Regina; Santos, Magnun Nueldo Nunes; Almeida, Vanessa; Albuquerque, Dulcinéia Martins; Costa, Fernando Ferreira; Sonati, Maria de Fátima

2015-01-01

Background Brazil has a multiethnic population with a high diversity of hemoglobinopathies. While screenings for beta-globin mutations are far more common, alterations affecting alpha-globin genes are usually more silent and less well known. The aim of this study was to describe the results of a screening program for alpha-globin gene mutations in a representative sample of the Southeastern Brazilian population. Methods A total of 135,000 individuals, including patients with clinical suspicion of hemoglobinopathies and their family members, randomly chosen individuals submitted to blood tests and blood donors who were abnormal hemoglobin carriers were analyzed. The variants were screened by alkaline and acid electrophoreses, isoelectric focusing and cation-exchange high performance liquid chromatography (HPLC) and the abnormal chains were investigated by reverse-phase high performance liquid chromatography (RP-HPLC). Mutations were identified by molecular analyses, and the oxygen affinity, heme–heme cooperativity and Bohr effect of the variants were evaluated by functional tests. Results Four new and 22 rare variants were detected in 98 families. Some of these variants were found in co-inheritance with other hemoglobinopathies. Of the rare hemoglobins, Hasharon, Stanleyville II and J-Rovigo were the most common, the first two being S-like and associated with alpha-thalassemia. Conclusion The variability of alpha-globin alterations reflects the high degree of racial miscegenation and an intense internal migratory flow between different Brazilian regions. This diversity highlights the importance of programs for diagnosing hemoglobinopathies and preventing combinations that may lead to important clinical manifestations in multiethnic populations. PMID:25818820

DOE Office of Scientific and Technical Information (OSTI.GOV)

Popp, R.A.; Marsh, C.L.; Skow, L.C.

Hemoglobins of mouse embryos at 11.5 through 16.5 days of gestation were separated by electrophoresis on cellulose acetate and quantitated by a scanning densitometer to study the effects of two radiation-induced mutations on the expression of embryonic hemoglobin genes in mice. Normal mice produce three kinds of embryonic hemoglobins. In heterozygous ..cap alpha..-thalassemic embryos, expression of EI (x/sub 2/y/sub 2/) and EII (..cap alpha../sub 2/y/sub 2/) is deficient because the x- and ..cap alpha..-globin genes of one of the allelic pairs of Hba on chromosome 11 was deleted or otherwise inactivated by X irradiation. Simultaneous inactivation of the x- andmore » ..cap alpha..-globin genes indicates that these genes must be closely linked. Reduced x- and ..cap alpha..-chain synthesis results in an excess of y chains that associate as homotetramers. This unique y/sub 4/ hemoglobin also appears in ..beta..-duplication embryos where excess y chains are produced by the presence of three rather than two functional alleles of y- and ..beta..-globin genes. In double heterozygotes, which have a single functional allele of x- and ..cap alpha..-globin genes and three functional alleles of y- and ..beta..-globin genes, synthesis of ..cap alpha.. and non-..cap alpha.. chains is severely imbalanced and half of the total hemoglobin is y/sub 4/. Mouse y/sub 4/ has a high affinity for oxygen, P/sub 50/ of less than 10 mm Hg, but it lacks cooperativity so is inefficient for oxygen transport. The death of double heterozygotes in late fetal or neonatal life may be in large part to oxygen deprivation to the tissues.« less

Haemoglobin Fontainebleau (HBA2: c. 64G>C) in Oman: molecular and haematological characteristics and interaction with various haemoglobinopathies.

PubMed

Daar, Shahina; Al Zadjali, Shoaib; Alkindi, Salam; Wali, Yasser; Al-Rawas, Abdulhakeem; Al-Haddabi, Humood; Al-Riyami, Arwa Z

2018-04-01

To describe the laboratory features of haemoglobin Fontainebleau (Hb FB) and its interactions with various α and β globin gene mutations in the Omani population. Over a period of 10 years, a total of 94 blood samples were suspected to have an α variant on HPLC at the Sultan Qaboos University Hospital, Muscat, Oman. Molecular testing was performed using PCR based techniques to define the variant and to analyse other interacting mutations in either α or β globin genes. Of 94 subjects, molecular analysis confirmed the Hb FB variant in 55 samples (38 non-cord and 17 cord blood). A total of 36/38 non-cord samples were heterozygous for the variant, while all 17 cord blood samples were heterozygotes. A total of 43/55 individuals had a concomitant α and/or β globin gene mutation. Hb FB is the the most common α variant in the Omani population. We report the different HPLC profiles of this variant that we observed, with and without other haemoglobinopathies in non-cord and cord blood samples. This is the first report describing the HPLC profiles of this α globin chain variant on 1 year follow-up testing of cord blood samples. With careful analysis by HPLC, it is possible not only to identify Hb FB but also to predict any concomitant α and/or β globin gene mutations. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

PubMed

Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

2015-01-01

Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

Analysis of α1 and α2 globin genes among patients with hemoglobin Adana in Malaysia.

PubMed

Lee, T Y; Lai, M I; Ismail, P; Ramachandran, V; Tan, J A M A; Teh, L K; Othman, R; Hussein, N H; George, E

2016-04-07

Hemoglobin (Hb) Adana [HBA2: c179G>A (or HBA1); p.Gly60Asp] is a non-deletional α-thalassemia variant found in Malaysia. An improvement in the molecular techniques in recent years has made identification of Hb Adana much easier. For this study, a total of 26 Hb Adana α-thalassemia intermedia and 10 Hb Adana trait blood samples were collected from patients. Common deletional and non-deletional α-thalassemia genotypes were determined using multiplex gap polymerase chain reaction (PCR) and multiplex ARMS PCR techniques. Identification of the Hb Adana location on the α-globin gene was carried out using genomic sequencing and the location of the mutation was confirmed via restriction fragment length polymorphism-PCR. Among the 36 samples, 24 (66.7%) had the -α(3.7)/α(Cd59)α mutation, while the -α(3.7)/α(Cd59)α mutation accounted for 2 samples (5.6%) and the remaining 10 (27.8%) samples were α/α(Cd59)α. All 36 samples were found to have the Hb Adana mutation on the α2-globin gene. The position of the α-globin gene mutation found in our cases was similar to that reported in Indonesia (16%) but not to that in Turkey (0.6%). Our results showed that the Hb Adana mutation was preferentially present in the α2-globin genes in Malays compared to the other ethnicities in Malaysia. Thus, the Malays might have similar ancestry based on the similarities in the Hb Adana position.

Translational recognition of the 5'-terminal 7-methylguanosine of globin messenger RNA as a function of ionic strength.

PubMed

Chu, L Y; Rhoads, R E

1978-06-13

The translation of rabbit globin mRNA in cell-free systems derived from either wheat germ or rabbit reticulocyte was studied in the presence of various analogues of the methylated 5' terminus (cap) as a function of ionic strength. Inhibition by these analogues was strongly enhanced by increasing concentrations of KCl, K(OAc), Na(OAc), or NH4(OAc). At appropriate concentrations of K(OAc), both cell-free systems were equally sensitive to inhibition by m7GTP. At 50 mM K(OAc), the reticulocyte system was not sensitive to m7GMP or m7GTP, but at higher concentrations up to 200 mM K(OAc), both nucleotides caused strong inhibition. The compound in m7G5'ppp5'Am was inhibitory at all concentrations of K(OAc) ranging from 50 to 200 mM, although more strongly so at the higher concentrations. Over the same range of nucleotide concentrations, the compounds GMP, GTP, and G5'ppp5'Am were not inhibitors. The mobility on sodium dodecyl sulfate-polyacrylamide electrophoresis of the translation product was that of globin at all K(OAc) concentrations in the presence of m7GTP. Globin mRNA from which the terminal m7GTP group had been removed by chemical treatment (periodate-cyclohexylamine-alkaline phosphatase) or enzymatic treatment (tobacco acid pyrophosphatase-alkaline phosphatase) was translated less efficiently than untreated globin mRNA at higher K(OAc) concentrations, but retained appreciable activity at low K(OAc) concentrations.

Hb L'Aquila [beta106(G8)Leu-->Val, CTG-->GTG]: a novel thalassemic hemoglobin variant.

PubMed

Amato, Antonio; Cappabianca, Maria Pia; Ponzini, Donatella; Rinaldi, Silvana; Biagio, Paola Di; Foglietta, Enrica; Grisanti, Paola; Mastropietro, Fabrizio

2007-01-01

A new beta-globin variant at codon 106 (CTG-->GTG), and which we named Hb L'Aquila [beta106(G8)Leu-->Val], was detected by DNA analysis. The proband and her father presented with the features of a mild beta(+)-thalassemia (thal), confirmed by their alpha/beta-globin chain biosynthesis ratios.

Evaluation of microbial globin promoters for oxygen-limited processes using Escherichia coli.

PubMed

Lara, Alvaro R; Jaén, Karim E; Sigala, Juan-Carlos; Regestein, Lars; Büchs, Jochen

2017-01-01

Oxygen-responsive promoters can be useful for synthetic biology applications, however, information on their characteristics is still limited. Here, we characterized a group of heterologous microaerobic globin promoters in Escherichia coli . Globin promoters from Bacillus subtilis , Campylobacter jejuni , Deinococcus radiodurans , Streptomyces coelicolor , Salmonella typhi and Vitreoscilla stercoraria were used to express the FMN-binding fluorescent protein (FbFP), which is a non-oxygen dependent marker. FbFP fluorescence was monitored online in cultures at maximum oxygen transfer capacities (OTR max ) of 7 and 11 mmol L -1  h -1 . Different FbFP fluorescence intensities were observed and the OTR max affected the induction level and specific fluorescence emission rate (the product of the specific fluorescence intensity multiplied by the specific growth rate) of all promoters. The promoter from S. typhi displayed the highest fluorescence emission yields (the quotient of the fluorescence intensity divided by the scattered light intensity at every time-point) and rate, and together with the promoters from D. radiodurans and S. coelicolor , the highest induction ratios. These results show the potential of diverse heterologous globin promoters for oxygen-limited processes using E. coli .

Prenatal Diagnosis and Molecular Analysis of a Large Novel Deletion (- -JS) Causing α0-Thalassemia.

PubMed

Cao, Jinru; He, Shuzhen; Pu, Yudong; Liu, Jingjing; Liu, Fuping; Feng, Jun

α-Thalassemia (α-thal) is a very common single gene hereditary disease caused by large deletions or point mutations of the α-globin gene cluster in tropical and subtropical regions of the world. Here, we report for the first time, a novel large α-thal deletion in a Chinese family from Jiangsu Province, People's Republic of China (PRC), which removes almost the entire α2 and α1 genes from the α-globin gene cluster. Thus, it was named the Jiangsu deletion (- - JS ) on the α-globin gene cluster causing α 0 -thal. Heterozygotes for this deletion showed an α-thal trait phenotype with reduced mean corpuscular volume (MCV) and mean corpuscular hemoglobin (Hb) (MCH) levels. The sequencing results showed that a 2538 bp deletion (NG_000006.1: g.35801_38338) existed in this novel genotype on the basis of -α 4.2 (leftward), indicating a deletion of about 6.8 kb from the α-globin cluster. In addition, a 29 bp sequence was inserted into the deletion during the recombination events that led to this deletion. Through pedigree analysis, we knew that the proband inherited the novel allele from his mother.

Two new γ chain variants: Hb F-Augusta GA [(G)γ59(E3)Lys → Arg; HBG2: c.179A > G] and Hb F-Port Royal-II [(A)γ125(H3)Glu → Ala; HBG1: c.377A > C].

PubMed

Kutlar, Ferdane; Ameri, Afshin; Patel, Niren H; Zhuang, Lina; Johnson, Lee E; Cheng, Michael L; Kutlar, Abdullah

2014-01-01

The total number of hemoglobin (Hb) variants so far reported to the HbVar database is 1598 (April 9 2014) and 130 of them are fetal Hb variants. Fetal Hb are categorized as two different subunits, (G)γ- and (A)γ-globin chains, and γ chain variants can be observed in both subunits. There are 72 (G)γ- and 58 (A)γ-globin chain variants. Most of them are clinically silent and detected during newborn screening programs in the USA and outside the USA. In this report, we discuss the molecular characteristics and diagnostic difficulties of two new γ-globin chain variants found in an African American baby with no clinical symptoms. One is a new (G)γ-globin chain variant, Hb F-Augusta GA [(G)γ59(E3)Lys → Arg; HBG2: c.179A > G] and the other one is Hb F-Port Royal-II [(A)γ125(H3)Glu → Ala; HBG1: c.377A > C].

The higher structure of chromatin in the LCR of the beta-globin locus changes during development.

PubMed

Fang, Xiangdong; Yin, Wenxuan; Xiang, Ping; Han, Hemei; Stamatoyannopoulos, George; Li, Qiliang

2009-11-27

The beta-globin locus control region (LCR) is able to enhance the expression of all globin genes throughout the course of development. However, the chromatin structure of the LCR at the different developmental stages is not well defined. We report DNase I and micrococcal nuclease hypersensitivity, chromatin immunoprecipitation analyses for histones H2A, H2B, H3, and H4, and 3C (chromatin conformation capture) assays of the normal and mutant beta-globin loci, which demonstrate that nucleosomes at the DNase I hypersensitive sites of the LCR could be either depleted or retained depending on the stages of development. Furthermore, MNase sensitivity and 3C assays suggest that the LCR chromatin is more open in embryonic erythroblasts than in definitive erythroblasts at the primary- and secondary-structure levels; however, the LCR chromatin is packaged more tightly in embryonic erythroblasts than in definitive erythroblasts at the tertiary chromatin level. Our study provides the first evidence that the occupancy of nucleosomes at a DNase I hypersensitive site is a developmental stage-related event and that embryonic and adult cells possess distinct chromatin structures of the LCR.

Sequence change in the HS2-LCR and Ggamma-globin gene promoter region of sickle cell anemia patients.

PubMed

Adorno, E V; Moura-Neto, J P; Lyra, I; Zanette, A; Santos, L F O; Seixas, M O; Reis, M G; Goncalves, M S

2008-02-01

The fetal hemoglobin (HbF) levels and betaS-globin gene haplotypes of 125 sickle cell anemia patients from Brazil were investigated. We sequenced the Ggamma- and Agamma-globin gene promoters and the DNase I-2 hypersensitive sites in the locus control regions (HS2-LCR) of patients with HbF level disparities as compared to their betaS haplotypes. Sixty-four (51.2%) patients had CAR/Ben genotype; 36 (28.8%) Ben/Ben; 18 (14.4%) CAR/CAR; 2 (1.6%) CAR/Atypical; 2 (1.6%) Ben/Cam; 1 (0.8%) CAR/Cam; 1 (0.8%) CAR/Arab-Indian, and 1 (0.8%) Sen/Atypical. The HS2-LCR sequence analyses demonstrated a c.-10.677G>A change in patients with the Ben haplotype and high HbF levels. The Gg gene promoter sequence analyses showed a c.-157T>C substitution shared by all patients, and a c.-222_-225del related to the Cam haplotype. These results identify new polymorphisms in the HS2-LCR and Gg-globin gene promoter. Further studies are required to determine the correlation between HbF synthesis and the clinical profile of sickle cell anemia patients.

Comparison of ligand migration and binding in heme proteins of the globin family

NASA Astrophysics Data System (ADS)

Karin, Nienhaus; Ulrich Nienhaus, G.

2015-12-01

The binding of small diatomic ligands such as carbon monoxide or dioxygen to heme proteins is among the simplest biological processes known. Still, it has taken many decades to understand the mechanistic aspects of this process in full detail. Here, we compare ligand binding in three heme proteins of the globin family, myoglobin, a dimeric hemoglobin, and neuroglobin. The combination of structural, spectroscopic, and kinetic experiments over many years by many laboratories has revealed common properties of globins and a clear mechanistic picture of ligand binding at the molecular level. In addition to the ligand binding site at the heme iron, a primary ligand docking site exists that ensures efficient ligand binding to and release from the heme iron. Additional, secondary docking sites can greatly facilitate ligand escape after its dissociation from the heme. Although there is only indirect evidence at present, a preformed histidine gate appears to exist that allows ligand entry to and exit from the active site. The importance of these features can be assessed by studies involving modified proteins (via site-directed mutagenesis) and comparison with heme proteins not belonging to the globin family.

IVS-II-648/649 (-T) (HBB: c.316-202del) Triggers a Novel β-Thalassemia Phenotype.

PubMed

Azimi, Azam; Alibakhshi, Reza; Hayati, Hasibeh; Tahmasebi, Soosan; Alimoradi, Sasan

2017-01-01

Thalassemia is the most common inherited disorder in Iran. There are approximately 800 different genomic alterations of the β-globin gene described in the HbVar database. In this study, we identified a novel mutation in a 21-year-old woman [IVS-II-648/649 (-T); HBB: c.316-202del)] and describe its clinical implications. Two other members of this family, all with hematological and clinical features associated with β-thalassemia (β-thal), also carried this mutation. The molecular diagnosis of the β-globin gene mutation was performed by direct sequencing. Based on the observed β-thal phenotype and in silico analysis results, we concluded that this novel β-globin gene mutation was associated with the mild phenotype of β-thal.

A Mouse β-Globin Mutant That Is an Exact Model of Hemoglobin Rainier in Man

PubMed Central

Peters, J.; Andrews, S. J.; Loutit, J. F.; Clegg, J. B.

1985-01-01

A mutation induced by ethylnitrosourea in a spermatogonial stem cell of a 101/H mouse has resulted in a structurally altered β-diffuse major globin in one of his offspring. The mutant hemoglobin is associated with polycythemia, rubor, increased oxygen affinity and decreased hem-hem interaction. The mutant haplotype has been designated Hbb d4, polycythemia. Amino acid analysis of the mutant globin has shown that a single substitution β145 Tyr → Cys has occurred, and it is proposed that ethylnitrosourea induced an A → G transition in the tyrosine codon (TAC → TGC). This murine polycythemia is homologous with hemoglobin Rainier in man, in which the amino acid substitution is also β145 Tyr → Cys and which is associated with similar physiological consequences. PMID:3839762

Quantitation of exposure to benzo[a]pyrene with monoclonal antibodies.

PubMed Central

Santella, R M; Hsieh, L L; Lin, C D; Viet, S; Weinstein, I B

1985-01-01

It is now possible to quantitate carcinogen adducts on DNA by highly sensitive immunoassays. These techniques are particularly useful for screening human populations for exposure to potential environmental carcinogens. We have developed a panel of monoclonal antibodies that react with benzo(a)pyrene (BP) modified DNA to be used in an enzyme linked immunoassay (ELISA) to quantitate adduct levels of both human and animal samples. BALBc/Cr mice were immunized with either DNA modified by 7 beta, 8 alpha-dihydroxy-9 alpha, 10 alpha-epoxy-7,8,9, 10-tetrahydrobenzo(a)pyrene (BPDE-I-DNA) complexed electrostatically to methylated bovine serum albumin or with BPDE-I-modified guanosine conjugated with bovine serum albumin (BPDE-I-G-BSA). Four stable clones were produced from the spleen cells of animals immunized with BPDE-I-DNA and one from BPDE-I-G-BSA immunized animals. All antibodies were shown to be highly specific for BPDE-I-DNA and did not crossreact with nonmodified DNA or with N-2-acetylaminofluorene or 1-aminopyrene modified DNA. The antibodies differed in their sensitivity to BPDE-II-DNA, BPDE-I-poly G, BPDE-I-tetraols and BPDE-I-dG. In general, all the antibodies showed the greatest affinity for their original antigen. Those generated against modified DNA showed highest reactivity against modified DNA while the one antibody generated against the monoadduct showed highest reactivity with the monoadduct. These antibodies are currently being used in a highly sensitive competitive ELISA to quantitate levels of BP-DNA adducts in various animal and human tissue samples. PMID:4085452

Spin trapping combined with quantitative mass spectrometry defines free radical redistribution within the oxidized hemoglobin:haptoglobin complex.

PubMed

Vallelian, Florence; Garcia-Rubio, Ines; Puglia, Michele; Kahraman, Abdullah; Deuel, Jeremy W; Engelsberger, Wolfgang R; Mason, Ronald P; Buehler, Paul W; Schaer, Dominik J

2015-08-01

Extracellular or free hemoglobin (Hb) accumulates during hemolysis, tissue damage, and inflammation. Heme-triggered oxidative reactions can lead to diverse structural modifications of lipids and proteins, which contribute to the propagation of tissue damage. One important target of Hb׳s peroxidase reactivity is its own globin structure. Amino acid oxidation and crosslinking events destabilize the protein and ultimately cause accumulation of proinflammatory and cytotoxic Hb degradation products. The Hb scavenger haptoglobin (Hp) attenuates oxidation-induced Hb degradation. In this study we show that in the presence of hydrogen peroxide (H2O2), Hb and the Hb:Hp complex share comparable peroxidative reactivity and free radical generation. While oxidation of both free Hb and Hb:Hp complex generates a common tyrosine-based free radical, the spin-trapping reaction with 5,5-dimethyl-1-pyrroline N-oxide (DMPO) yields dissimilar paramagnetic products in Hb and Hb:Hp, suggesting that radicals are differently redistributed within the complex before reacting with the spin trap. With LC-MS(2) mass spectrometry we assigned multiple known and novel DMPO adduct sites. Quantification of these adducts suggested that the Hb:Hp complex formation causes extensive delocalization of accessible free radicals with drastic reduction of the major tryptophan and cysteine modifications in the β-globin chain of the Hb:Hp complex, including decreased βCys93 DMPO adduction. In contrast, the quantitative changes in DMPO adduct formation on Hb:Hp complex formation were less pronounced in the Hb α-globin chain. In contrast to earlier speculations, we found no evidence that free Hb radicals are delocalized to the Hp chain of the complex. The observation that Hb:Hp complex formation alters free radical distribution in Hb may help to better understand the structural basis for Hp as an antioxidant protein. Copyright © 2015 Elsevier Inc. All rights reserved.

A brief introduction to web-based genome browsers.

PubMed

Wang, Jun; Kong, Lei; Gao, Ge; Luo, Jingchu

2013-03-01

Genome browser provides a graphical interface for users to browse, search, retrieve and analyze genomic sequence and annotation data. Web-based genome browsers can be classified into general genome browsers with multiple species and species-specific genome browsers. In this review, we attempt to give an overview for the main functions and features of web-based genome browsers, covering data visualization, retrieval, analysis and customization. To give a brief introduction to the multiple-species genome browser, we describe the user interface and main functions of the Ensembl and UCSC genome browsers using the human alpha-globin gene cluster as an example. We further use the MSU and the Rice-Map genome browsers to show some special features of species-specific genome browser, taking a rice transcription factor gene OsSPL14 as an example.

Annual Research Progress Report.

DTIC Science & Technology

1979-09-30

will be trained in SLRL test procedures and the methodology will be developed for the incorporation of test materials into the standard rearing diet ...requirements exist for system software maintenance and development of software to report dosing data, to calculate diet preparation data, to manage collected...influence of diet and exercise on myo- globin and metmyoglobin reductase were evaluated in the rat. The activity of inetmyo- globin reductase was

Beyond the Definitions of the Phenotypic Complications of Sickle Cell Disease: An Update on Management

PubMed Central

Ballas, Samir K.; Kesen, Muge R.; Goldberg, Morton F.; Lutty, Gerard A.; Dampier, Carlton; Osunkwo, Ifeyinwa; Wang, Winfred C.; Hoppe, Carolyn; Hagar, Ward; Darbari, Deepika S.; Malik, Punam

2012-01-01

The sickle hemoglobin is an abnormal hemoglobin due to point mutation (GAG → GTG) in exon 1 of the β globin gene resulting in the substitution of glutamic acid by valine at position 6 of the β globin polypeptide chain. Although the molecular lesion is a single-point mutation, the sickle gene is pleiotropic in nature causing multiple phenotypic expressions that constitute the various complications of sickle cell disease in general and sickle cell anemia in particular. The disease itself is chronic in nature but many of its complications are acute such as the recurrent acute painful crises (its hallmark), acute chest syndrome, and priapism. These complications vary considerably among patients, in the same patient with time, among countries and with age and sex. To date, there is no well-established consensus among providers on the management of the complications of sickle cell disease due in part to lack of evidence and in part to differences in the experience of providers. It is the aim of this paper to review available current approaches to manage the major complications of sickle cell disease. We hope that this will establish another preliminary forum among providers that may eventually lead the way to better outcomes. PMID:22924029

Beyond the definitions of the phenotypic complications of sickle cell disease: an update on management.

PubMed

Ballas, Samir K; Kesen, Muge R; Goldberg, Morton F; Lutty, Gerard A; Dampier, Carlton; Osunkwo, Ifeyinwa; Wang, Winfred C; Hoppe, Carolyn; Hagar, Ward; Darbari, Deepika S; Malik, Punam

2012-01-01

The sickle hemoglobin is an abnormal hemoglobin due to point mutation (GAG → GTG) in exon 1 of the β globin gene resulting in the substitution of glutamic acid by valine at position 6 of the β globin polypeptide chain. Although the molecular lesion is a single-point mutation, the sickle gene is pleiotropic in nature causing multiple phenotypic expressions that constitute the various complications of sickle cell disease in general and sickle cell anemia in particular. The disease itself is chronic in nature but many of its complications are acute such as the recurrent acute painful crises (its hallmark), acute chest syndrome, and priapism. These complications vary considerably among patients, in the same patient with time, among countries and with age and sex. To date, there is no well-established consensus among providers on the management of the complications of sickle cell disease due in part to lack of evidence and in part to differences in the experience of providers. It is the aim of this paper to review available current approaches to manage the major complications of sickle cell disease. We hope that this will establish another preliminary forum among providers that may eventually lead the way to better outcomes.

Mutation spectrum of β-globin gene in thalassemia patients at Hasan Sadikin Hospital - West Java Indonesia.

PubMed

Maskoen, Ani Melani; Rahayu, Nurul S; Reniarti, Lelani; Susanah, Susi; Laksono, Bremmy; Fauziah, Prima Nanda; Zada, Almira; Hidayat, Dadang S

2017-12-30

Thalassemia is the most common hereditary haemolytic anemia in Southeast Asia, in which Indonesia is among countries that are at a high risk for thalassemia. It has been reported that mutation in the beta-globin gene is responsible in severe Thalassemia. However, the spectrum of beta-globin gene mutations in Indonesian population varies in different regions . Thus, this study aimed to identify the most prevalent mutation of Thalassemia patients from the Hasan Sadikin Hospital, Bandung, using this as a reference hospital for Thalassemia in West Java. The three most prevalent mutations of beta globin (IVS1nt5, Cd26 (HbE), and IVS1nt1), were conducted in the beginning of this study. Mutations of 291 samples were detected by PCR-RFLP in the Molecular Genetic Laboratory, Faculty of Medicine Universitas Padjadjaran, Bandung. The prevalence of the beta globin gene mutation types were 47.4% IVS1nt5 homozygote, 9.9% compound heterozygote IVS1nt5/HbE, 5.4% compound heterozygote IVS1nt5/IVS1nt1, 1.4% compound heterozygote HbE/IVS1nt1, 1% HbE homozygote, 14.4% Compound heterzygote IVS1nt5/… (no paired mutation), 2.06% compound heterozygote HbE/… (no paired mutation), 1.3% compound heterozygote IVS1nt1/… (no paired mutation), and 7 samples were unidentified. The thalassemia mutation IVS1nt5 homozygote is the most common mutation found in Thalassemia patients at Hasan Sadikin Hospital, Bandung. The samples with unidentified results might carry mutations other than the three that are observed in the present study.

Mathematical modeling of erythrocyte chimerism informs genetic intervention strategies for sickle cell disease.

PubMed

Altrock, Philipp M; Brendel, Christian; Renella, Raffaele; Orkin, Stuart H; Williams, David A; Michor, Franziska

2016-09-01

Recent advances in gene therapy and genome-engineering technologies offer the opportunity to correct sickle cell disease (SCD), a heritable disorder caused by a point mutation in the β-globin gene. The developmental switch from fetal γ-globin to adult β-globin is governed in part by the transcription factor (TF) BCL11A. This TF has been proposed as a therapeutic target for reactivation of γ-globin and concomitant reduction of β-sickle globin. In this and other approaches, genetic alteration of a portion of the hematopoietic stem cell (HSC) compartment leads to a mixture of sickling and corrected red blood cells (RBCs) in periphery. To reverse the sickling phenotype, a certain proportion of corrected RBCs is necessary; the degree of HSC alteration required to achieve a desired fraction of corrected RBCs remains unknown. To address this issue, we developed a mathematical model describing aging and survival of sickle-susceptible and normal RBCs; the former can have a selective survival advantage leading to their overrepresentation. We identified the level of bone marrow chimerism required for successful stem cell-based gene therapies in SCD. Our findings were further informed using an experimental mouse model, where we transplanted mixtures of Berkeley SCD and normal murine bone marrow cells to establish chimeric grafts in murine hosts. Our integrative theoretical and experimental approach identifies the target frequency of HSC alterations required for effective treatment of sickling syndromes in humans. Our work replaces episodic observations of such target frequencies with a mathematical modeling framework that covers a large and continuous spectrum of chimerism conditions. Am. J. Hematol. 91:931-937, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Molecular Basis of β-Thalassemia Intermedia in Erbil Province of Iraqi Kurdistan.

PubMed

Shamoon, Rawand P; Al-Allawi, Nasir A S; Cappellini, Maria D; Di Pierro, Elena; Brancaleoni, Valentina; Granata, Francesca

2015-01-01

β-Thalassemia intermedia (β-TI) is a clinical term describing a range of clinical phenotypes that are intermediate in severity between the carrier state and β-thalassemia major (β-TM). To characterize the molecular basis of β-TI in Erbil Province, Northern Iraq, 83 unrelated patients were investigated. Detection of β-globin gene mutations was carried out by reverse hybridization assay and direct gene sequencing. All patients were screened for the XmnI polymorphism by direct sequencing of HBG2 ((G)γ promoter gene). Detection of α-globin gene deletions and triplication was carried out using the reverse hybridization assay. Four main molecular patterns were identified in association with the β-TI phenotype, namely: β(+)/β(+) (38.5%), β(+)/β(0) (21.6%), β(0)/β(0) (31.3%), and β(0)/wild type (8.4%). IVS-I-6 (T > C) was the most frequently encountered mutation (55 alleles, 34.6%), followed by IVS-II-1 (G > A) and codon 8 (-AA); furthermore, we report for the first time from Iraq two β(+) mutations, -87 (C > G) and 5' untranslated region (5'UTR) +22 (G > A). The XmnI polymorphism was detected in 47.0% of patients, mainly in association with the β(0)/β(0) genotype. The α-globin gene deletions were encountered in four cases, including one case with (- -(FIL)) double gene deletion, a report that is the first from our country. The α-globin gene triplication was detected in five of the seven heterozygous β-thalassemia (β-thal) patients. Similar to other Mediterranean countries, inheritance of mild β-globin mutations was the main molecular pattern underlying β-TI in our patients followed by the ameliorating effect of the XmnI polymorphism.

High Frequency of Hb E-Saskatoon (HBB: c.67G > A) in Brazilians: A New Genetic Origin?

PubMed

Wagner, Sandrine C; Lindenau, Juliana D; Castro, Simone M de; Santin, Ana Paula; Zaleski, Carina F; Azevedo, Laura A; Ribeiro Dos Santos, Ândrea K C; Dos Santos, Sidney E B; Hutz, Mara H

2016-08-01

Hb E-Saskatoon [β22(B4)Glu→Lys, HBB: c.67G > A] is a rare, nonpathological β-globin variant that was first described in a Canadian woman of Scottish and Dutch ancestry and has since then been detected in several populations. The aim of the present study was to identify the origin of Hb E-Saskatoon in Brazil using β-globin haplotypes and genetic ancestry in carriers of this hemoglobin (Hb) variant. Blood samples were investigated by isoelectric focusing (IEF) and high performance liquid chromatography (HPLC) using commercial kits. Hb E-Saskatoon was confirmed by amplification of the HBB gene, followed by sequence analysis. Haplotypes of the β-globin gene were determined by polymerase chain reaction (PCR), followed by digestion with specific restriction enzymes. Individual ancestry was estimated with 48 biallelic insertion/deletions using three 16-plex PCR amplifications. The IEF pattern was similar to Hbs C (HBB: c.19G > A) and Hb E (HBB: c.79G > A) [isoelectric point (pI): 7.59-7.65], and HPLC results showed an elution in the Hb S (HBB: c.20A > T) window [retention time (RT): 4.26-4.38]. DNA sequencing of the amplified β-globin gene showed a mutation at codon 22 (GAA>AAA) corresponding to Hb E-Saskatoon. A total of 11 cases of this variant were identified. In nine unrelated individuals, Hb E-Saskatoon was in linkage disequilibrium with haplotype 2 [+ - - - -]. All subjects showed a high degree of European contribution (mean = 0.85). Hb E-Saskatoon occurred on the β-globin gene of haplotype 2 in all Brazilian carriers. These findings suggest a different genetic origin for this Hb variant from that previously described.

Laboratory investigation of hemoglobinopathies and thalassemias: review and update.

PubMed

Clarke, G M; Higgins, T N

2000-08-01

Structural hemoglobin (Hb) variants typically are based on a point mutation in a globin gene that produce a single amino acid substitution in a globin chain. Although most are of limited clinical significance, a few important subtypes have been identified with some frequency. Homozygous Hb C and Hb S (sickle cell disease) produce significant clinical manifestations, whereas Hb E and Hb D homozygotes may be mildly symptomatic. Although heterozygotes for these variants are typically asymptomatic, diagnosis may be important for genetic counseling. Thalassemia, in contrast, results from quantitative reductions in globin chain synthesis. Those with diminished beta-globin chains are termed beta-thalassemias, whereas those with decreased alpha-chain production are called alpha-thalassemias. Severity of clinical manifestations in these disorders relates to the amount of globin chain produced and the stability of residual chains present in excess. The thalassemia minor syndromes are characterized clinically by mild anemia with persistent microcytosis. Thalassemia intermedia (i.e., Hb H disease) is typified by a moderate, variably compensated hemolytic anemia that may present with clinical symptoms during a period of physiologic stress such as infection, pregnancy, or surgery. The thalassemia major syndromes produce severe, life-threatening anemia. alpha-Thalassemia major usually is incompatible with extrauterine life; beta-thalassemia major presents in infancy and requires life-long transfusion therapy and/or bone marrow transplantation for successful control of the disease. Double heterozygosity for certain structural variants and/or thalassemia syndromes may also lead to severe clinical disease. Several guidelines have been published that outline the required steps for hemoglobinopathy and thalassemia investigation. The availability of HPLC has streamlined many of these requirements, allowing an efficient stepwise diagnostic strategy for these complex disorders.

The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming

2012-11-15

Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catecholmore » enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.« less

Molecular basis of length polymorphism in the human zeta-globin gene complex.

PubMed Central

Goodbourn, S E; Higgs, D R; Clegg, J B; Weatherall, D J

1983-01-01

The length polymorphism between the human zeta-globin gene and its pseudogene is caused by an allele-specific variation in the copy number of a tandemly repeating 36-base-pair sequence. This sequence is related to a tandemly repeated 14-base-pair sequence in the 5' flanking region of the human insulin gene, which is known to cause length polymorphism, and to a repetitive sequence in intervening sequence (IVS) 1 of the pseudo-zeta-globin gene. Evidence is presented that the latter is also of variable length, probably because of differences in the copy number of the tandem repeat. The homology between the three length polymorphisms may be an indication of the presence of a more widespread group of related sequences in the human genome, which might be useful for generalized linkage studies. PMID:6308667

High Risk Behaviors in Marine Mammals: Linking Behavioral Responses to Anthropogenic Disturbance to Biological Consequences

DTIC Science & Technology

2014-09-30

98) Prescribed by ANSI Std Z39-18 2 injury via cardiovascular performance during submergence. Neuro -protection through globin deposition and...relationships for stroking costs, aerobic dive limits, types of neuro -protection (globin deposition, capillarity), and cardiac risk factors that will be mapped...Greenland. A custom built ECG recorder with 3- axis accelerometer recorder and pressure transducer was combined with retrieval transmitters (Argos

DOE Office of Scientific and Technical Information (OSTI.GOV)

Epstein, N.; Than, K.A. Culp, K.M.

Alpha-thalassemia (alpha-thal) is characterized by the absence or reduction in synthesis of the alpha-globin chain due to either deletions or other abnormalities involving the alpha-globin genes located on the short arm of chromosome 16. The diploid cells have four alpha chain genes. The deletion of one, two, three or all four of these genes could result in mild to a complete alpha chain deficiency known as the Hydrops fetalis syndrome or alpha-thal-1, which causes fetal death. It is important to develop a sensitive test to detect carriers of alpha-thal-1 trait for genetic counseling. It has recently been observed that themore » presence of minute amounts of zeta-globin chains (0.01-1%) could serve as a biological marker of alpha-thal carriers. Because high sensitivity is required, we constructed a monoclonal antibody-based immunoassay which can be analyzed either by colorimetric or fluorimetric methods. By testing blood samples from individuals of Southeast Asian ancestry, we were able to show that various forms and combinations of deletions or inactivations of two or three alpha-globin genes results in alpha-thalassemia conditions that have elevated levels of the zeta-chain. Sensitivity achieved in these tests was < 0.1% zeta chain, or as low as 5 ng zeta-chain. Data correlate with results from reversed phase HPLC.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baserga, S.J.; Benz, E.J. Jr.

A number of premature translation termination mutations (nonsense mutations) have been described in the human {alpha}- and {beta}-globin genes. Studies on mRNA isolated from patients with {beta}{sup 0}-thalassemia have shown that for both the {beta}-17 and the {beta}-39 mutations less than normal levels of {beta}-globin mRNA accumulate in peripheral blood cells. (The codon at which the mutation occurs designates the name of the mutation; there are 146 codons in human {beta}-globin mRNA). In vitro studies using the cloned {beta}-39 gene have reproduced this effect in a heterologous transfection system and have suggested that the defect resides in intranuclear metabolism. Themore » authors have asked if this phenomenon of decreased mRNA accumulation is a general property of nonsense mutations and if the effect depends on the location or the type of mutation. Toward this end, they have studied the effect of five nonsense mutations and two missense mutations on the expression of human {beta}-globin mRNA in a heterologous transfection system. In all cases studied, the presence of a translation termination codon correlates with a decrease in the steady-state level of mRNA. The data suggest that the metabolism of a mammalian mRNA is affected by the presence of a mutation that affects translation.« less

Homozygosity for the AATAAA > AATA- - Polyadenylation Site Mutation on the α2-Globin Gene Causing Transfusion-Dependent Hb H Disease in an Iranian Patient: A Case Report.

PubMed

Farashi, Samaneh; Garous, Negin F; Ashki, Mehri; Vakili, Shadi; Zeinali, Fatemeh; Imanian, Hashem; Azarkeivan, Azita; Giordano, Piero C; Najmabadi, Hossein

2015-01-01

We describe a case of Hb H disease associated with homozygosity for a two nucleotide deletion in the polyadenylation signal of the α2-globin gene (HBA2: c.*93_*94delAA). The patient, a 27-year-old son of a consanguineous couple, needs regular blood transfusions every 6 months.

Light-induced protoporphyrin release from erythrocytes in erythropoietic protoporphyria.

PubMed Central

Sandberg, S; Brun, A

1982-01-01

The photohemolysis of normal erythrocytes incubated with protoporphyrin is reduced in the presence of albumin. When globin is added to normal erythrocytes loaded with protoporphyrin, protoporphyrin is bound to globin. During irradiation protoporphyrin moves from globin to the erythrocyte membrane and photohemolysis is initiated. Erythrocytes in patients with erythropoietic protoporphyria contain large amounts of protoporphyrin bound to hemoglobin. Upon irradiation of these cells in the absence of albumin, 40% of protoporphyrin and 80% of hemoglobin is released after 240 kJ/m2. The released protoporphyrin is hemoglobin bound. In contrast, when albumin is present only 8% of hemoglobin is released whereas protoporphyrin is released to 76%. The released protoporphyrin is albumin bound. A hypothesis for the release of erythrocyte protoporphyrin in erythropoietic protoporphyria without simultaneous hemolysis is proposed. Upon irradiation protoporphyrin photodamages its binding sites on hemoglobin, moves through the plasma membrane, and is bound to albumin in plasma. PMID:7107898

Neuroglobin and cytoglobin: two new members of globin family

PubMed Central

Tosqui, Priscilla; Colombo, Marcio Francisco

2011-01-01

The globin family has long been defined by myoglobin and hemoglobin, proteins with the functions of oxygen storage and transportation, respectively. Recently, two new members of this family were discovered: neuroglobin present in neurons and retinal cells and cytoglobin found in various types of tissue. The increased expression of these proteins in hypoxic conditions first suggested a role in oxygen supply. However structural and functional differences, such as the hexacoordinated heme, a high autoxidation rate and different concentrations between different cellular types, have dismissed this hypothesis. The protective role of these globins has already been established. In vitro and in vivo studies have demonstrated increased survival of neurons under stress in the presence of neuroglobin and increased resistance to neurodegenerative diseases. However the mechanism remains unknown. Functions, including detoxification of nitric oxide, free radical scavenging and as an antioxidant and signaling of apoptosis, have also been suggested for neuroglobin and an antifibrotic function for cytoglobin. PMID:23049323

Comparison of different methods for erythroid differentiation in the K562 cell line.

PubMed

Shariati, Laleh; Modaress, Mehran; Khanahmad, Hossein; Hejazi, Zahra; Tabatabaiefar, Mohammad Amin; Salehi, Mansoor; Modarressi, Mohammad Hossein

2016-08-01

To compare methods for erythroid differentiation of K562 cells that will be promising in the treatment of beta-thalassemia by inducing γ-globin synthesis. Cells were treated separately with: RPMI 1640 medium without glutamine, RPMI 1640 medium without glutamine supplemented with 1 mM sodium butyrate, RPMI 1640 medium supplemented with 1 mM sodium butyrate, 25 µg cisplatin/ml, 0.1 µg cytosine arabinoside/ml. The highest differentiation (84 %) with minimum toxicity was obtained with cisplatin at 15 µg /ml. Real-time RT-PCR showed that expression of the γ-globin gene was significantly higher in the cells differentiated with cisplatin compared to undifferentiated cells (P < 0.001). Cisplatin is useful in the experimental therapy of ß-globin gene defects and can be considered for examining the basic mechanism of γ-reactivation.

Erythroid differentiation ability of butyric acid analogues: identification of basal chemical structures of new inducers of foetal haemoglobin.

PubMed

Bianchi, Nicoletta; Chiarabelli, Cristiano; Zuccato, Cristina; Lampronti, Ilaria; Borgatti, Monica; Amari, Gabriele; Delcanale, Maurizio; Chiavilli, Francesco; Prus, Eugenia; Fibach, Eitan; Gambari, Roberto

2015-04-05

Several investigations have demonstrated a mild clinical status in patients with β-globin disorders and congenital high persistence of foetal haemoglobin. This can be mimicked by a pharmacological increase of foetal γ-globin genes expression and foetal haemoglobin production. Our goal was to apply a multistep assay including few screening methods (benzidine staining, RT-PCR and HPLC analyses) and erythroid cellular model systems (the K562 cell line and erythroid precursors collected from peripheral blood) to select erythroid differentiation agents with foetal haemoglobin inducing potential. With this methodology, we have identified a butyric acid derivative, namely the 4174 cyclopropanecarboxylic acid compound, able to induce erythroid differentiation without antiproliferative effect in K562 cells and increase of γ-globin gene expression in erythroid precursor cells. The results are relevant for pharmacological treatments of haemoglobinopathies, including β-thalassaemia and sickle cell anaemia. Copyright © 2015 Elsevier B.V. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Batal, Mohamed; Département de Toxicologie et Risques Chimiques, Unité de Brûlure Chimique, Institut de Recherche Biomédicale des Armées, Antenne de La Tronche, BP87, F-38702 La Tronche Cedex; Boudry, Isabelle

Sulphur mustard (SM) is a chemical warfare agent that attacks mainly skin, eye and lungs. Due to its lipophilic properties, SM is also able to diffuse through the skin and reach internal organs. DNA represents one of the most critical molecular targets of this powerful alkylating agent which modifies DNA structure by forming monoadducts and biadducts. These DNA lesions are involved in the acute toxicity of SM as well as its long-term carcinogenicity. In the present work we studied the formation and persistence of guanine and adenine monoadducts and guanine biadducts in the DNA of brain, lungs, kidneys, spleen, andmore » liver of SKH-1 mice cutaneously exposed to 2, 6 and 60 mg/kg of SM. SM-DNA adducts were detected in all studied organs, except in liver at the two lowest doses. Brain and lungs were the organs with the highest level of SM-DNA adducts, followed by kidney, spleen and liver. Monitoring the level of adducts for three weeks after cutaneous exposure showed that the lifetime of adducts were not the same in all organs, lungs being the organ with the longest persistence. Diffusion from skin to internal organs was much more efficient at the highest compared to the lowest dose investigated as the result of the loss of the skin barrier function. These data provide novel information on the distribution of SM in tissues following cutaneous exposures and indicate that brain is an important target. - Highlights: • Sulphur mustard reaches internal organs after skin exposure • Adducts are detected in the DNA of internal organs • Brain is the organ with the highest level of DNA damage • The barrier function of skin is lost at high dose of sulphur mustard • DNA adducts persist in organs for 2 or 3 weeks.« less

Structural and thermodynamic insight into E. coli UvrABC mediated incision of cluster di-acetylaminofluorene adducts on the NarI sequence

PubMed Central

Jain, Vipin; Hilton, Benjamin; Lin, Bin; Jain, Anshu; MacKerell, Alexander D.; Zou, Yue; Cho, Bongsup P.

2014-01-01

Cluster DNA damage refers to two or more lesions in a single turn of the DNA helix. Such clustering may occur with bulky DNA lesions, which may be responsible for their sequence dependent repair and mutational outcomes. Here we prepared three 16-mer cluster duplexes in which two fluoroacetylaminofluorene adducts (dG-FAAF) are separated by none, one and two nucleotides in the E. coli NarI mutational hot spot (5'-CTCTCG1G2CG3CCATCAC-3'): i.e. 5'-- CG1*G2*CG3CC--3', 5'--CG1G2*CG3*CC--3', and 5'--CG1*G2CG3*CC--3' [G*=dG-FAAF], respectively. We conducted spectroscopic, thermodynamic, and molecular dynamics studies of these di-FAAF duplexes and the results were compared with those of the corresponding mono- FAAF adducts in the same NarI sequence (Nucleic Acids Res. 2012, 3939–3951). Our nucleotide excision repair results showed greater reparability of the di-adducts in comparison to the corresponding mono-adducts. Moreover, we observed dramatic flanking base sequence effects on their repair efficiency in the order of NarI-G2G3 > -G1G3 > -G1G2. The NMR/CD/UV-melting and MD-simulation results revealed that in contrast to the mono-adducts, di-adducts produced synergistic effect on duplex destabilization. In addition, dG-FAAF at G2G3 and G1G3 destack the neighboring bases with greater destabilization occurring with the former. Overall, the results indicate the importance of base stacking and related thermal/thermodynamic destabilization in the repair of bulky cluster arylamine DNA adducts. PMID:23841451

A Novel Frameshift Mutation at Codons 138/139 (HBB: c.417_418insT) on the β-Globin Gene Leads to β-Thalassemia.

PubMed

Jiang, Fan; Huang, Lv-Yin; Chen, Gui-Lan; Zhou, Jian-Ying; Xie, Xing-Mei; Li, Dong-Zhi

2017-01-01

We describe a new β-thalassemic mutation in a Chinese subject. This allele develops by insertion of one nucleotide (+T) between codons 138 and 139 in the third exon of the β-globin gene. The mutation causes a frameshift that leads to a termination codon at codon 139. In the heterozygote, this allele has the phenotype of classical β-thalassemia (β-thal) minor.

Development and characterization of K562 cell clones expressing BCL11A-XL: Decreased hemoglobin production with fetal hemoglobin inducers and its rescue with mithramycin

PubMed Central

Finotti, Alessia; Gasparello, Jessica; Breveglieri, Giulia; Cosenza, Lucia Carmela; Montagner, Giulia; Bresciani, Alberto; Altamura, Sergio; Bianchi, Nicoletta; Martini, Elisa; Gallerani, Eleonora; Borgatti, Monica; Gambari, Roberto

2015-01-01

Induction of fetal hemoglobin (HbF) is considered a promising strategy in the treatment of β-thalassemia, in which production of adult hemoglobin (HbA) is impaired by mutations affecting the β-globin gene. Recent results indicate that B-cell lymphoma/leukemia 11A (BCL11A) is a major repressor of γ-globin gene expression. Therefore, disrupting the binding of the BCL11A transcriptional repressor complex to the γ-globin gene promoter provides a novel approach for inducing expression of the γ-globin genes. To develop a cellular screening system for the identification of BCL11A inhibitors, we produced K562 cell clones with integrated copies of a BCL11A-XL expressing vector. We characterized 12 K562 clones expressing different levels of BCL11A-XL and found that a clear inverse relationship does exist between the levels of BCL11A-XL and the extent of hemoglobinization induced by a panel of HbF inducers. Using mithramycin as an inducer, we found that this molecule was the only HbF inducer efficient in rescuing the ability to differentiate along the erythroid program, even in K562 cell clones expressing high levels of BCL11A-XL, suggesting that BCL11A-XL activity is counteracted by mithramycin. PMID:26342260

PGC-1 Coactivator Activity Is Required for Murine Erythropoiesis

PubMed Central

Cui, Shuaiying; Tanabe, Osamu; Lim, Kim-Chew; Xu, H. Eric; Zhou, X. Edward; Lin, Jiandie D.; Shi, Lihong; Schmidt, Lindsay; Campbell, Andrew; Shimizu, Ritsuko; Yamamoto, Masayuki

2014-01-01

Peroxisome proliferator-activated receptor gamma (PPARγ) coactivator 1α (PGC-1α) and PGC-1β have been shown to be intimately involved in the transcriptional regulation of cellular energy metabolism as well as other biological processes, but both coactivator proteins are expressed in many other tissues and organs in which their function is, in essence, unexplored. Here, we found that both PGC-1 proteins are abundantly expressed in maturing erythroid cells. PGC-1α and PGC-1β compound null mutant (Pgc-1c) animals express less β-like globin mRNAs throughout development; consequently, neonatal Pgc-1c mice exhibit growth retardation and profound anemia. Flow cytometry shows that the number of mature erythrocytes is markedly reduced in neonatal Pgc-1c pups, indicating that erythropoiesis is severely compromised. Furthermore, hematoxylin and eosin staining revealed necrotic cell death and cell loss in Pgc-1c livers and spleen. Chromatin immunoprecipitation studies revealed that both PGC-1α and -1β, as well as two nuclear receptors, TR2 and TR4, coordinately bind to the various globin gene promoters. In addition, PGC-1α and -1β can interact with TR4 to potentiate transcriptional activation. These data provide new insights into our understanding of globin gene regulation and raise the interesting possibility that the PGC-1 coactivators can interact with TR4 to elicit differential stage-specific effects on globin gene transcription. PMID:24662048

Convergent evolution of hemoglobin switching in jawed and jawless vertebrates.

PubMed

Rohlfing, Kim; Stuhlmann, Friederike; Docker, Margaret F; Burmester, Thorsten

2016-02-01

During development, humans and other jawed vertebrates (Gnathostomata) express distinct hemoglobin genes, resulting in different hemoglobin tetramers. Embryonic and fetal hemoglobin have higher oxygen affinities than the adult hemoglobin, sustaining the oxygen demand of the developing organism. Little is known about the expression of hemoglobins during development of jawless vertebrates (Agnatha). We identified three hemoglobin switches in the life cycle of the sea lamprey. Three hemoglobin genes are specifically expressed in the embryo, four genes in the filter feeding larva (ammocoete), and nine genes correspond to the adult hemoglobin chains. During the development from the parasitic to the reproductive adult, the composition of hemoglobin changes again, with a massive increase of chain aHb1. A single hemoglobin chain is expressed constitutively in all stages. We further showed the differential expression of other globin genes: Myoglobin 1 is most highly expressed in the reproductive adult, myoglobin 2 expression peaks in the larva. Globin X1 is restricted to the embryo; globin X2 was only found in the reproductive adult. Cytoglobin is expressed at low levels throughout the life cycle. Because the hemoglobins of jawed and jawless vertebrates evolved independently from a common globin ancestor, hemoglobin switching must also have evolved convergently in these taxa. Notably, the ontogeny of sea lamprey hemoglobins essentially recapitulates their phylogeny, with the embryonic hemoglobins emerging first, followed by the evolution of larval and adult hemoglobins.

Recent trends in the gene therapy of β-thalassemia

PubMed Central

Finotti, Alessia; Breda, Laura; Lederer, Carsten W; Bianchi, Nicoletta; Zuccato, Cristina; Kleanthous, Marina; Rivella, Stefano; Gambari, Roberto

2015-01-01

The β-thalassemias are a group of hereditary hematological diseases caused by over 300 mutations of the adult β-globin gene. Together with sickle cell anemia, thalassemia syndromes are among the most impactful diseases in developing countries, in which the lack of genetic counseling and prenatal diagnosis have contributed to the maintenance of a very high frequency of these genetic diseases in the population. Gene therapy for β-thalassemia has recently seen steadily accelerating progress and has reached a crossroads in its development. Presently, data from past and ongoing clinical trials guide the design of further clinical and preclinical studies based on gene augmentation, while fundamental insights into globin switching and new technology developments have inspired the investigation of novel gene-therapy approaches. Moreover, human erythropoietic stem cells from β-thalassemia patients have been the cellular targets of choice to date whereas future gene-therapy studies might increasingly draw on induced pluripotent stem cells. Herein, we summarize the most significant developments in β-thalassemia gene therapy over the last decade, with a strong emphasis on the most recent findings, for β-thalassemia model systems; for β-, γ-, and anti-sickling β-globin gene addition and combinatorial approaches including the latest results of clinical trials; and for novel approaches, such as transgene-mediated activation of γ-globin and genome editing using designer nucleases. PMID:25737641

Relaxed functional constraints on triplicate α-globin gene in the bank vole suggest a different evolutionary history from other rodents

PubMed Central

Marková, S; Searle, J B; Kotlík, P

2014-01-01

Gene duplication plays an important role in the origin of evolutionary novelties, but the mechanisms responsible for the retention and functional divergence of the duplicated copy are not fully understood. The α-globin genes provide an example of a gene family with different numbers of gene duplicates among rodents. Whereas Rattus and Peromyscus each have three adult α-globin genes (HBA-T1, HBA-T2 and HBA-T3), Mus has only two copies. High rates of amino acid evolution in the independently derived HBA-T3 genes of Peromyscus and Rattus have been attributed to positive selection. Using RACE PCR, reverse transcription-PCR (RT–PCR) and RNA-seq, we show that another rodent, the bank vole Clethrionomys glareolus, possesses three transcriptionally active α-globin genes. The bank vole HBA-T3 gene is distinguished from each HBA-T1 and HBA-T2 by 20 amino acids and is transcribed 23- and 4-fold lower than HBA-T1 and HBA-T2, respectively. Polypeptides corresponding to all three genes are detected by electrophoresis, demonstrating that the translated products of HBA-T3 are present in adult erythrocytes. Patterns of codon substitution and the presence of low-frequency null alleles suggest a postduplication relaxation of purifying selection on bank vole HBA-T3. PMID:24595364

Engineered U7 snRNA mediates sustained splicing correction in erythroid cells from β-thalassemia/HbE patients.

PubMed

Preedagasamzin, Sarinthip; Nualkaew, Tiwaporn; Pongrujikorn, Tanjitti; Jinawath, Natini; Kole, Ryszard; Fucharoen, Suthat; Jearawiriyapaisarn, Natee; Svasti, Saovaros

2018-04-30

Repair of a splicing defect of β-globin pre-mRNA harboring hemoglobin E (HbE) mutation was successfully accomplished in erythroid cells from patients with β-thalassemia/HbE disorder by a synthetic splice-switching oligonucleotide (SSO). However, its application is limited by short-term effectiveness and requirement of lifelong periodic administration of SSO, especially for chronic diseases like thalassemias. Here, we engineered lentiviral vectors that stably express U7 small nuclear RNA (U7 snRNA) carrying the splice-switching sequence of the SSO that restores correct splicing of β E -globin pre-mRNA and achieves a long-term therapeutic effect. Using a two-step tiling approach, we systematically screened U7 snRNAs carrying splice-switching SSO sequences targeted to the cryptic 5' splice site created by HbE mutation. We tested this approach and identified the most responsive element for mediating splicing correction in engineered U7 snRNAs in HeLa-β E cell model cell line. Remarkably, the U7 snRNA lentiviral vector (U7 βE4+1) targeted to this region effectively restored the correctly-spliced β E -globin mRNA for at least 5 months. Moreover, the effects of the U7 βE4+1 snRNA lentiviral vector were also evident as upregulation of the correctly-spliced β E -globin mRNA in erythroid progenitor cells from β-thalassemia/HbE patients treated with the vector, which led to improvements of pathologies in erythroid progenitor cells from thalassemia patients. These results suggest that the splicing correction of β E -globin pre-mRNA by the engineered U7 snRNA lentiviral vector provides a promising, long-term treatment for β-thalassemia/HbE. Copyright © 2018 Elsevier Inc. All rights reserved.

Transfusion independence and HMGA2 activation after gene therapy of human β-thalassaemia.

PubMed

Cavazzana-Calvo, Marina; Payen, Emmanuel; Negre, Olivier; Wang, Gary; Hehir, Kathleen; Fusil, Floriane; Down, Julian; Denaro, Maria; Brady, Troy; Westerman, Karen; Cavallesco, Resy; Gillet-Legrand, Beatrix; Caccavelli, Laure; Sgarra, Riccardo; Maouche-Chrétien, Leila; Bernaudin, Françoise; Girot, Robert; Dorazio, Ronald; Mulder, Geert-Jan; Polack, Axel; Bank, Arthur; Soulier, Jean; Larghero, Jérôme; Kabbara, Nabil; Dalle, Bruno; Gourmel, Bernard; Socie, Gérard; Chrétien, Stany; Cartier, Nathalie; Aubourg, Patrick; Fischer, Alain; Cornetta, Kenneth; Galacteros, Frédéric; Beuzard, Yves; Gluckman, Eliane; Bushman, Frederick; Hacein-Bey-Abina, Salima; Leboulch, Philippe

2010-09-16

The β-haemoglobinopathies are the most prevalent inherited disorders worldwide. Gene therapy of β-thalassaemia is particularly challenging given the requirement for massive haemoglobin production in a lineage-specific manner and the lack of selective advantage for corrected haematopoietic stem cells. Compound β(E)/β(0)-thalassaemia is the most common form of severe thalassaemia in southeast Asian countries and their diasporas. The β(E)-globin allele bears a point mutation that causes alternative splicing. The abnormally spliced form is non-coding, whereas the correctly spliced messenger RNA expresses a mutated β(E)-globin with partial instability. When this is compounded with a non-functional β(0) allele, a profound decrease in β-globin synthesis results, and approximately half of β(E)/β(0)-thalassaemia patients are transfusion-dependent. The only available curative therapy is allogeneic haematopoietic stem cell transplantation, although most patients do not have a human-leukocyte-antigen-matched, geno-identical donor, and those who do still risk rejection or graft-versus-host disease. Here we show that, 33 months after lentiviral β-globin gene transfer, an adult patient with severe β(E)/β(0)-thalassaemia dependent on monthly transfusions since early childhood has become transfusion independent for the past 21 months. Blood haemoglobin is maintained between 9 and 10 g dl(-1), of which one-third contains vector-encoded β-globin. Most of the therapeutic benefit results from a dominant, myeloid-biased cell clone, in which the integrated vector causes transcriptional activation of HMGA2 in erythroid cells with further increased expression of a truncated HMGA2 mRNA insensitive to degradation by let-7 microRNAs. The clonal dominance that accompanies therapeutic efficacy may be coincidental and stochastic or result from a hitherto benign cell expansion caused by dysregulation of the HMGA2 gene in stem/progenitor cells.

mNotch1 signaling and erythropoietin cooperate in erythroid differentiation of multipotent progenitor cells and upregulate beta-globin.

PubMed

Henning, Konstanze; Schroeder, Timm; Schwanbeck, Ralf; Rieber, Nikolaus; Bresnick, Emery H; Just, Ursula

2007-09-01

In many developing tissues, signaling mediated by activation of the transmembrane receptor Notch influences cell-fate decisions, differentiation, proliferation, and cell survival. Notch receptors are expressed on hematopoietic cells and cognate ligands on bone marrow stromal cells. Here, we investigate the role of mNotch1 signaling in the control of erythroid differentiation of multipotent progenitor cells. Multipotent FDCP-mix cell lines engineered to permit the conditional induction of the constitutively active intracellular domain of mNotch1 (mN1(IC)) by the 4-hydroxytamoxifen (OHT)-inducible system were used to analyze the effects of activated mNotch1 on erythroid differentiation and on expression of Gata1, Fog1, Eklf, NF-E2, and beta-globin. Expression was analyzed by Northern blotting and real-time polymerase chain reaction. Enhancer activity of reporter constructs was determined with the dual luciferase system in transient transfection assays. Induction of mN1(IC) by OHT resulted in increased and accelerated differentiation of FDCP-mix cells along the erythroid lineage. Erythroid maturation was induced by activated Notch1 also under conditions that normally promote self-renewal, but required the presence of erythropoietin for differentiation to proceed. While induction of Notch signaling rapidly upregulated Hes1 and Hey1 expression, the expression of Gata1, Fog1, Eklf, and NF-E2 remained unchanged. Concomitantly with erythroid differentiation, activated mNotch1 upregulated beta-globin RNA. Notch signaling transactivated a reporter construct harboring a conserved RBP-J (CBF1) binding site in the hypersensitive site 2 (HS2) of human beta-globin. Transactivation by activated Notch was completely abolished when this RBP-J site was mutated to prevent RBP-J binding. Our results show that activation of mNotch1 induces erythroid differentiation in cooperation with erythropoietin and upregulates beta-globin expression.

The effect of histone deacetylase inhibitors on AHSP expression

PubMed Central

Ziari, Katayoun; Ranjbaran, Reza; Nikouyan, Negin

2018-01-01

Alpha-hemoglobin stabilizing protein (AHSP) is a molecular chaperone that can reduce the damage caused by excess free α-globin to erythroid cells in patients with impaired β-globin chain synthesis. We assessed the effect of sodium phenylbutyrate and sodium valproate, two histone deacetylase inhibitors (HDIs) that are being studied for the treatment of hemoglobinopathies, on the expression of AHSP, BCL11A (all isoforms), γ-globin genes (HBG1/2), and some related transcription factors including GATA1, NFE2, EKLF, KLF4, and STAT3. For this purpose, the K562 cell line was cultured for 2, 4, and 6 days in the presence and absence of sodium phenylbutyrate and sodium valproate. Relative real-time qRT-PCR analysis of mRNA levels was performed to determine the effects of the two compounds on gene expression. Expression of all target mRNAs increased significantly (p < 0.05), except for the expression of BCL11A, which was down-regulated (p < 0.05) in the cells treated with both compounds relative to the levels measured for untreated cells. The findings indicated that sodium valproate had a more considerable effect than sodium phenylbutyrate (p < 0.0005) on BCL11A repression and the up-regulation of other studied genes. γ-Globin and AHSP gene expression continuously increased during the culture period in the treated cells, with the highest gene expression observed for 1 mM sodium valproate after 6 days. Both compounds repressed the expression of BCL11A (-XL, -L, -S) and up-regulated GATA1, NFE2, EKLF, KLF4, STAT3, AHSP, and γ-globin genes expression. Moreover, sodium valproate showed a stronger effect on repressing BCL11A and escalating the expression of other target genes. The findings of this in vitro experiment could be considered in selecting drugs for clinical use in patients with β-hemoglobinopathies. PMID:29389946

Beta-globin LCR and intron elements cooperate and direct spatial reorganization for gene therapy.

PubMed

Buzina, Alla; Lo, Mandy Y M; Moffett, Angela; Hotta, Akitsu; Fussner, Eden; Bharadwaj, Rikki R; Pasceri, Peter; Garcia-Martinez, J Victor; Bazett-Jones, David P; Ellis, James

2008-04-11

The Locus Control Region (LCR) requires intronic elements within beta-globin transgenes to direct high level expression at all ectopic integration sites. However, these essential intronic elements cannot be transmitted through retrovirus vectors and their deletion may compromise the therapeutic potential for gene therapy. Here, we systematically regenerate functional beta-globin intron 2 elements that rescue LCR activity directed by 5'HS3. Evaluation in transgenic mice demonstrates that an Oct-1 binding site and an enhancer in the intron cooperate to increase expression levels from LCR globin transgenes. Replacement of the intronic AT-rich region with the Igmu 3'MAR rescues LCR activity in single copy transgenic mice. Importantly, a combination of the Oct-1 site, Igmu 3'MAR and intronic enhancer in the BGT158 cassette directs more consistent levels of expression in transgenic mice. By introducing intron-modified transgenes into the same genomic integration site in erythroid cells, we show that BGT158 has the greatest transcriptional induction. 3D DNA FISH establishes that induction stimulates this small 5'HS3 containing transgene and the endogenous locus to spatially reorganize towards more central locations in erythroid nuclei. Electron Spectroscopic Imaging (ESI) of chromatin fibers demonstrates that ultrastructural heterochromatin is primarily perinuclear and does not reorganize. Finally, we transmit intron-modified globin transgenes through insulated self-inactivating (SIN) lentivirus vectors into erythroid cells. We show efficient transfer and robust mRNA and protein expression by the BGT158 vector, and virus titer improvements mediated by the modified intron 2 in the presence of an LCR cassette composed of 5'HS2-4. Our results have important implications for the mechanism of LCR activity at ectopic integration sites. The modified transgenes are the first to transfer intronic elements that potentiate LCR activity and are designed to facilitate correction of hemoglobinopathies using single copy vectors.

VNTR internal structure mapping at the {alpha}-globin 3{prime}HVR locus reveals a hierachy of related lineages in oceania

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martinson, J.J.; Clegg, J.B.; Boyce, A.J.

1994-09-01

Analysis of the {alpha}-globin gene complex in Oceania has revealed many different rearrangements which remove one of the adult globin genes. Frequencies of these deletion chromosomes are elevated by malarial resistance conferred by the resulting {alpha}-thalassaemia. One particular deletion chromosome, designated -{alpha}{sup 3.7}III, is found at high levels in Melanesia and Polynesia: RFLP haplotype analysis shows that this deletion is always found on chromosomes bearing the IIIa haplotype and is likely to be the product of one single rearrangement event. A subset of the -{alpha}{sup 3.7}III chromosomes carries a more recent mutation which generates the haemoglobin variant HbJ{sup Tongariki}. Wemore » have characterized the allelic variation at the 3{prime}HVR VNTR locus located 6 kb from the globin genes in each of these groups of chromosomes. We have determined the internal structure of these alleles by RFLP mapping of PCR-amplified DNA: within each group, the allelic diversity results from the insertion and/or deletion of small {open_quotes}motifs{close_quotes} of up to 6 adjacent repeats. Mapping of 3{prime}HVR alleles associated with other haplotypes reveals that these are composed of repeat arrays that are substantially different to those derived from IIIa chromosomes, indicating that interchromosomal recombination between heterologous haplotypes does not account for any of the diversity seen to date. We have recently shown that allelic size variation at the two VNTR loci flanking the {alpha}-globin complex is very closely linked to the haplotypes known to be present at this locus. Here we show that, within a haplotype, VNTR alleles are very closely related to each other on the basis of internal structure and demonstrate that intrachromosomal mutation processes involving small numbers of tandem repeats are the main cause of variation at this locus.« less

Familial congenital cyanosis caused by Hb-MYantai(α-76 GAC → TAC, Asp → Tyr)

PubMed Central

2010-01-01

Methemoglobin (Hb-M) is a rare hemoglobinopathy in China. We hereby report on a family living in Yantai, East China, with congenital cyanosis due to Hb-M mutation. The proband, a 65-year-old female, presented 63% oxygen saturation. Both Hb-M concentration and arterial oxygen saturation remained unchanged, even following intravenous treatment with methylene blue. There was also no change in blood-color (chocolate-brown) after adding 0.1% KCN. A fast-moving band (Hb-X) in hemolysates was found by cellulose acetate electrophoresis, the Hb-X/Hb-A ratio exceeding 10%. GT transition at 131nt of exon 2, although present in one of the α2 -globin alleles, was not found in α1 -globin alleles as a whole. This mutation leads to the aspartic acid to tyrosine substitution (Asp76Tyr). In this family, the novel mutation in the α2 -globin gene resulted in a rare form of congenital cyanosis due to Hb-M. This hemoglobin was named Hb-M Yantai . PMID:21637412

Genetic Basis and Genetic Modifiers of β-Thalassemia and Sickle Cell Disease.

PubMed

Thein, Swee Lay

2017-01-01

β-thalassemia and sickle cell disease (SCD) are prototypical Mendelian single gene disorders, both caused by mutations affecting the adult β-globin gene. Despite the apparent genetic simplicity, both disorders display a remarkable spectrum of phenotypic severity and share two major genetic modifiers-α-globin genotype and innate ability to produce fetal hemoglobin (HbF, α 2 γ 2 ).This article provides an overview of the genetic basis for SCD and β-thalassemia, and genetic modifiers identified through phenotype correlation studies. Identification of the genetic variants modifying HbF production in combination with α-globin genotype provide some prediction of disease severity for β-thalassemia and SCD but generation of a personalized genetic risk score to inform prognosis and guide management requires a larger panel of genetic modifiers yet to be discovered.Nonetheless, genetic studies have been successful in characterizing some of the key variants and pathways involved in HbF regulation, providing new therapeutic targets for HbF reactivation.

Identification of Mutations Causing Aberrant Termination and Deficient Splice Donor Site on the HBA1 Gene.

PubMed

Farashi, Samaneh; Vakili, Shadi; Garous, Negin F; Ashki, Mehri; Forouzesh Pour, Fatemeh; Zeinali, Fatemeh; Rad, Fariba; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein

2016-01-01

α-Thalassemia (α-thal) is a common genetic disorder in Iran and many parts of the world. Genetic defects on the α-globin gene cluster can result in α-thal that may develop a clinical phenotype varying from almost asymptomatic to a lethal hemolytic anemia. In the present study, four Iranian individuals with hypochromic microcytic anemia, who revealed none of the known mutations responsible for α-thal, were subjected for further investigations. The thalassemic phenotype of these patients resulted from abnormal RNA splicing sites owing to a missense at the splice donor site, a truncated protein or hemoglobin (Hb) variants as a result of two different substitutions on the α1-globin gene. The clinical presentation of mild anemia in these individuals showed the contribution of these novel mutations in α-thal in spite of the dominantly expressed α2-globin gene. This study describes hematological manifestations of subjects carrying some novel mutations comparable to the reported phenotype of α(+)-thal trait.

Hb Mozhaisk [β92(F8)His→Arg; HBB: c.278A>G] as a De Novo Mutation in a Child of Mixed Ethnic Origins.

PubMed

Benzoni, Elena; Giannone, Valentina; Michetti, Laura; Seia, Manuela; Cavalleri, Laura; Curcio, Cristina

Approximately 150 variants described in the HbVar database have been found to be unstable and about 80.0% of these are on the β-globin gene. We describe the case of a 3-year-old child who presented at the emergency room with fever and asthenia. Hematological data suggested severe hemolytic anemia. Sequencing of the β-globin gene revealed the mutation HBB: c.278A>G at codon 92 in a heterozygous state, reported as Hb Mozhaisk in the HbVar database. Other family members did not have Hb Mozhaisk, thus, this variant is due to a de novo mutation. Because of the rarity of this globin variant, we believe it is important to report similar cases, to have a more complete phenotype description of the pathology and define an adequate reproductive risk for couples, considering the dominant inheritance pattern (hence an inheritance risk of 50.0%).

Development and characterization of K562 cell clones expressing BCL11A-XL: Decreased hemoglobin production with fetal hemoglobin inducers and its rescue with mithramycin.

PubMed

Finotti, Alessia; Gasparello, Jessica; Breveglieri, Giulia; Cosenza, Lucia Carmela; Montagner, Giulia; Bresciani, Alberto; Altamura, Sergio; Bianchi, Nicoletta; Martini, Elisa; Gallerani, Eleonora; Borgatti, Monica; Gambari, Roberto

2015-12-01

Induction of fetal hemoglobin (HbF) is considered a promising strategy in the treatment of β-thalassemia, in which production of adult hemoglobin (HbA) is impaired by mutations affecting the β-globin gene. Recent results indicate that B-cell lymphoma/leukemia 11A (BCL11A) is a major repressor of γ-globin gene expression. Therefore, disrupting the binding of the BCL11A transcriptional repressor complex to the γ-globin gene promoter provides a novel approach for inducing expression of the γ-globin genes. To develop a cellular screening system for the identification of BCL11A inhibitors, we produced K562 cell clones with integrated copies of a BCL11A-XL expressing vector. We characterized 12 K562 clones expressing different levels of BCL11A-XL and found that a clear inverse relationship does exist between the levels of BCL11A-XL and the extent of hemoglobinization induced by a panel of HbF inducers. Using mithramycin as an inducer, we found that this molecule was the only HbF inducer efficient in rescuing the ability to differentiate along the erythroid program, even in K562 cell clones expressing high levels of BCL11A-XL, suggesting that BCL11A-XL activity is counteracted by mithramycin. Copyright © 2015 ISEH - International Society for Experimental Hematology. Published by Elsevier Inc. All rights reserved.

Improving enrichment of circulating fetal DNA for genetic testing: size fractionation followed by whole gene amplification.

PubMed

Jorgez, Carolina J; Bischoff, Farideh Z

2009-01-01

Among the pitfalls of using cell-free fetal DNA in plasma for prenatal diagnosis is quality of the recovered DNA fragments and concomitant presence of maternal DNA (>95%). Our objective is to provide alternative methods for achieving enrichment and high-quality fetal DNA from plasma. Cell-free DNA from 31 pregnant women and 18 controls (10 males and 8 females) were size separated using agarose gel electrophoresis. DNA fragments of 100-300, 500-700 and 1,500-2,000 bp were excised and extracted, followed by whole genome amplification (WGA) of recovered fragments. Levels of beta-globin and DYS1 were measured. Distribution of beta-globin size fragments was similar among pregnant women and controls. Among control male cases, distribution of size fragments was the same for both beta-globin and DYS1. Among maternal cases confirmed to be male, the smallest size fragment (100-300 bp) accounted for nearly 50% (39.76 +/- 17.55%) of the recovered DYS1-DNA (fetal) and only 10% (10.40 +/- 6.49%) of beta-globin (total) DNA. After WGA of plasma fragments from pregnant women, DYS1 sequence amplification was best observed when using the 100-300 bp fragments as template. Combination of electrophoresis for size separation and WGA led to enriched fetal DNA from plasma. This novel combination of strategies is more likely to permit universal clinical applications of cell-free fetal DNA. Copyright 2009 S. Karger AG, Basel.

Comparative inhibition of rabbit globin mRNA translation by modified antisense oligodeoxynucleotides.

PubMed Central

Cazenave, C; Stein, C A; Loreau, N; Thuong, N T; Neckers, L M; Subasinghe, C; Hélène, C; Cohen, J S; Toulmé, J J

1989-01-01

We have studied the translation of rabbit globin mRNA in cell free systems (reticulocyte lysate and wheat germ extract) and in microinjected Xenopus oocytes in the presence of anti-sense oligodeoxynucleotides. Results obtained with the unmodified all-oxygen compounds were compared with those obtained when phosphorothioate or alpha-DNA was used. In the wheat germ system a 17-mer sequence targeted to the coding region of beta-globin mRNA was specifically inhibitory when either the unmodified phosphodiester oligonucleotide or its phosphorothioate analogue were used. In contrast no effect was observed with the alpha-oligomer. These results were ascribed to the fact that phosphorothioate oligomers elicit an RNase-H activity comparable to the all-oxygen congeners, while alpha-DNA/mRNA hybrids were a poor substrate. Microinjected Xenopus oocytes followed a similar pattern. The phosphorothioate oligomer was more efficient to prevent translation than the unmodified 17-mer. Inhibition of beta-globin synthesis was observed in the nanomolar concentration range. This result can be ascribed to the nuclease resistance of phosphorothioates as compared to natural phosphodiester linkages, alpha-oligomers were devoid of any inhibitory effect up to 30 microM. Phosphorothioate oligodeoxyribonucleotides were shown to be non-specific inhibitors of protein translation, at concentrations in the micromolar range, in both cell-free systems and oocytes. Non-specific inhibition of translation was dependent on the length of the phosphorothioate oligomer. These non-specific effects were not observed with the unmodified or the alpha-oligonucleotides. Images PMID:2472605

Prevalence of βS-globin gene haplotypes, α-thalassemia (3.7 kb deletion) and redox status in patients with sickle cell anemia in the state of Paraná, Brazil

PubMed Central

Shimauti, Eliana LitsukoTomimatsu; Silva, Danilo Grunig Humberto; de Souza, Eniuce Menezes; de Almeida, Eduardo Alves; Leal, Francismar Prestes; Bonini-Domingos, Claudia Regina

2015-01-01

The aim of this study was to determine the frequency of beta S-globin gene (βS globin) haplotypes and alpha thalassemia with 3.7 kb deletion (−α3.7kb thalassemia) in the northwest region of Paraná state, and to investigate the oxidative and clinical-hematological profile of βS globin carriers in this population. Of the 77 samples analyzed, 17 were Hb SS, 30 were Hb AS and 30 were Hb AA. The βSglobin haplotypes and −α3.7kb thalassemia were identified using polymerase chain reaction.Trolox equivalent antioxidant capacity (TEAC) and lipid peroxidation (LPO) were assessed spectophotometrically. Serum melatonin levels were determined using high-performance liquid chromatography coupled to coulometric electrochemical detection. The haplotype frequencies in the SS individuals were as follows: Bantu- 21 (62%), Benin - 11 (32%) and Atypical- 2 (6%). Bantu/Benin was the most frequent genotype. Of the 47 SS and AS individuals assessed, 17% (n = 8) had the −α3.7kb mutation. Clinical manifestations, as well as serum melatonin, TEAC and LPO levels did not differ between Bantu/Bantu and Bantu/Benin individuals (p > 0.05). Both genotypes were associated with high LPO and TEAC levels and decreased melatonin concentration. These data suggest that the level of oxidative stress in patients with Bantu/Bantu and Bantu/Benin genotypes may overload the antioxidant capacity. PMID:26500435

The New Self-Inactivating Lentiviral Vector for Thalassemia Gene Therapy Combining Two HPFH Activating Elements Corrects Human Thalassemic Hematopoietic Stem Cells

PubMed Central

Papanikolaou, Eleni; Georgomanoli, Maria; Stamateris, Evangelos; Panetsos, Fottes; Karagiorga, Markisia; Tsaftaridis, Panagiotis; Graphakos, Stelios

2012-01-01

Abstract To address how low titer, variable expression, and gene silencing affect gene therapy vectors for hemoglobinopathies, in a previous study we successfully used the HPFH (hereditary persistence of fetal hemoglobin)-2 enhancer in a series of oncoretroviral vectors. On the basis of these data, we generated a novel insulated self-inactivating (SIN) lentiviral vector, termed GGHI, carrying the Aγ-globin gene with the −117 HPFH point mutation and the HPFH-2 enhancer and exhibiting a pancellular pattern of Aγ-globin gene expression in MEL-585 clones. To assess the eventual clinical feasibility of this vector, GGHI was tested on CD34+ hematopoietic stem cells from nonmobilized peripheral blood or bone marrow from 20 patients with β-thalassemia. Our results show that GGHI increased the production of γ-globin by 32.9% as measured by high-performance liquid chromatography (p=0.001), with a mean vector copy number per cell of 1.1 and a mean transduction efficiency of 40.3%. Transduced populations also exhibited a lower rate of apoptosis and resulted in improvement of erythropoiesis with a higher percentage of orthochromatic erythroblasts. This is the first report of a locus control region (LCR)-free SIN insulated lentiviral vector that can be used to efficiently produce the anticipated therapeutic levels of γ-globin protein in the erythroid progeny of primary human thalassemic hematopoietic stem cells in vitro. PMID:21875313

Distinct modes of gene regulation by a cell-specific transcriptional activator.

PubMed

Sengupta, Tanushri; Cohet, Nathalie; Morlé, François; Bieker, James J

2009-03-17

The architectural layout of a eukaryotic RNA polymerase II core promoter plays a role in general transcriptional activation. However, its role in tissue-specific expression is not known. For example, differing modes of its recognition by general transcription machinery can provide an additional layer of control within which a single tissue-restricted transcription factor may operate. Erythroid Kruppel-like factor (EKLF) is a hematopoietic-specific transcription factor that is critical for the activation of subset of erythroid genes. We find that EKLF interacts with TATA binding protein-associated factor 9 (TAF9), which leads to important consequences for expression of adult beta-globin. First, TAF9 functionally supports EKLF activity by enhancing its ability to activate the beta-globin gene. Second, TAF9 interacts with a conserved beta-globin downstream promoter element, and ablation of this interaction by beta-thalassemia-causing mutations decreases its promoter activity and disables superactivation. Third, depletion of EKLF prevents recruitment of TAF9 to the beta-globin promoter, whereas depletion of TAF9 drastically impairs beta-promoter activity. However, a TAF9-independent mode of EKLF transcriptional activation is exhibited by the alpha-hemoglobin-stabilizing protein (AHSP) gene, which does not contain a discernable downstream promoter element. In this case, TAF9 does not enhance EKLF activity and depletion of TAF9 has no effect on AHSP promoter activation. These studies demonstrate that EKLF directs different modes of tissue-specific transcriptional activation depending on the architecture of its target core promoter.

Histone- and protamine-DNA association: conservation of different patterns within the beta-globin domain in human sperm.

PubMed

Gardiner-Garden, M; Ballesteros, M; Gordon, M; Tam, P P

1998-06-01

Most DNA in human sperm is bound to highly basic proteins called protamines, but a small proportion is complexed with histones similar to those found in active chromatin. This raises the intriguing possibility that histones in sperm are marking sets of genes that will be preferentially activated during early development. We have examined the chromatin structure of members of the beta-globin gene family, which are expressed at different times in development, and the protamine 2 gene, which is expressed in spermatids prior to the widespread displacement of histones by transition proteins. The genes coding for epsilon and gamma globin, which are active in the embryonic yolk sac, contain regions which are histone associated in the sperm. No histone-associated regions are present at the sites tested within the beta- and delta-globin genes which are silent in the embryonic yolk sac. The trends of histone or protamine association are consistent for samples from the same person, and no significant between-subject variations in these trends are found for 13 of the 15 fragments analyzed in the two donors. The results suggest that sperm chromatin structures are generally similar in different men but that the length of the histone-associated regions can vary. The association of sperm DNA with histones or protamines sometimes changes within as little as 400 bp of DNA, suggesting that there is fine control over the retention of histones.

Two genetic markers closely linked to adult polycystic kidney disease on chromosome 16.

PubMed Central

Reeders, S T; Breuning, M H; Corney, G; Jeremiah, S J; Meera Khan, P; Davies, K E; Hopkinson, D A; Pearson, P L; Weatherall, D J

1986-01-01

The genetic locus for autosomal dominant adult polycystic kidney disease was recently assigned to chromosome 16 by the finding of genetic linkage to the alpha globin gene cluster. Further study showed that the phosphoglycolate phosphatase locus is also closely linked to both the locus for adult polycystic kidney disease and the alpha globin gene cluster. These findings have important implications for the prenatal and presymptomatic diagnosis of adult polycystic kidney disease and for a better understanding of its pathogenesis. Images FIG 1 PMID:3008903

Rapid determination of human globin chains using reversed-phase high-performance liquid chromatography.

PubMed

Wan, Jun-Hui; Tian, Pei-Ling; Luo, Wei-Hao; Wu, Bing-Yi; Xiong, Fu; Zhou, Wan-Jun; Wei, Xiang-Cai; Xu, Xiang-Min

2012-07-15

Reversed-phase high-performance liquid chromatography (RP-HPLC) of human globin chains is an important tool for detecting thalassemias and hemoglobin variants. The challenges of this method that limit its clinical application are a long analytical time and complex sample preparation. The aim of this study was to establish a simple, rapid and high-resolution RP-HPLC method for the separation of globin chains in human blood. Red blood cells from newborns and adults were diluted in deionized water and injected directly onto a micro-jupiter C18 reversed-phase column (250 mm × 4.6 mm) with UV detection at 280 nm. Under the conditions of varying pH or the HPLC gradient, the globin chains (pre-β, β, δ, α, (G)γ and (A)γ) were denatured and separated from the heme groups in 12 min with a retention time coefficient of variation (CV) ranging from 0.11 to 1.29% and a peak area CV between 0.32% and 4.86%. Significant differences (P<0.05) among three groups (normal, Hb H and β thalassemia) were found in the area ratio of α/pre-β+β applying the rapid elution procedure, while P≥0.05 was obtained between the normal and α thalassemia silent/trait group. Based on the ANOVA results, receiver operating characteristic (ROC) curve analysis of the δ/β and α/pre-β+β area ratios showed a sensitivity of 100.0%, and a specificity of 100.0% for indicating β thalassemia carriers, and a sensitivity of 96.6% and a specificity of 89.6% for the prediction of hemoglobin H (Hb H) disease. The proposed cut-off was 0.026 of δ/β for β thalassemia carriers and 0.626 of α/pre-β+β for Hb H disease. In addition, abnormal hemoglobin hemoglobin E (Hb E) and Hb Westmead (Hb WS) were successfully identified using this RP-HPLC method. Our experience in developing this RP-HPLC method for the rapid separation of human globin chains could be of use for similar work. Copyright © 2012 Elsevier B.V. All rights reserved.

Hematopoietic stem cell transplantation for people with ß-thalassaemia major.

PubMed

Jagannath, Vanitha A; Fedorowicz, Zbys; Al Hajeri, Amani; Sharma, Akshay

2016-11-30

Thalassemia is an inherited autosomal recessive blood disorder, caused by mutations in globin genes or their regulatory regions. This results in a reduced rate of synthesis of one of the globin chains that make up haemoglobin. In ß-thalassaemia major there is an underproduction of ß-globin chains combined with excess of free α-globin chains. The excess free α-globin chains precipitate in red blood cells, leading to their destruction (haemolysis) and ineffective erythropoiesis. The conventional approach to treatment is based on the correction of haemoglobin status through regular blood transfusions and iron chelation therapy for iron overload. Although conventional treatment has the capacity to improve the quality of life of people with ß-thalassaemia major, allogeneic hematopoietic stem cell transplantation is the only currently available procedure which has the curative potential. This is an update of a previously published Cochrane Review. To evaluate the effectiveness and safety of different types of allogeneic hematopoietic stem cell transplantation, in people with severe transfusion-dependant ß-thalassaemia major, ß-thalassaemia intermedia or ß0/+- thalassaemia variants requiring chronic blood transfusion. We searched the Cochrane Cystic Fibrosis and Genetic Disorders Group Haemoglobinopathies Trials Register comprising references identified from comprehensive electronic database searches and handsearches of relevant journals and abstract books of conference proceedings.Date of the most recent search: 18 August 2016. Randomised controlled trials and quasi-randomised controlled trials comparing allogeneic hematopoietic stem cell transplantation with each other or with standard therapy (regular transfusion and chelation regimen). Two review authors independently screened studies and had planned to extract data and assess risk of bias using standard Cochrane methodologies but no studies were identified for inclusion. No relevant studies were retrieved after a comprehensive search of the literature. We were unable to identify any randomised controlled trials or quasi-randomised controlled trials on the effectiveness and safety of different types of allogeneic stem cell transplantation in people with severe transfusion-dependant ß-thalassaemia major or ß0/+- thalassaemia variants requiring chronic blood transfusion. The absence of high-level evidence for the effectiveness of these interventions emphasises the need for well-designed, adequately-powered, randomised controlled clinical trials.

Monitoring exposure to acrylonitrile using adducts with N-terminal valine in hemoglobin.

PubMed

Osterman-Golkar, S M; MacNeela, J P; Turner, M J; Walker, V E; Swenberg, J A; Sumner, S J; Youtsey, N; Fennell, T R

1994-12-01

Human exposure to acrylonitrile (ACN), a carcinogen in rats, may occur in industrial settings, through waste water and tobacco smoke. ACN is an electrophilic compound and binds covalently to nucleophilic sites in macromolecules. Measurements of adducts with hemoglobin could be utilized for improved exposure assessments. In this study, a method for quantification of N-(2-cyanoethyl)valine (CEVal), the product of reaction of ACN with N-terminal valine in hemoglobin has been developed. The method is based on the N-alkyl Edman procedure, which involves derivatization of the globin with pentafluorophenyl isothiocyanate and gas chromatographic-mass spectrometric analysis of the resulting thiohydantoin. An internal standard was prepared by reacting valylglycylglycine with [2H3]ACN, spiked with [14C]ACN to a known sp. act. Levels of CEVal were measured in globin from rats exposed to 3-300 p.p.m. ACN in drinking water for 105 days and from humans (four smokers and four non-smokers). CEVal was detected at all exposure levels in the drinking water study. The relationship between adduct level and water concentration was linear at concentrations of 10 p.p.m. (corresponding to an average daily uptake of c. 0.74 mg ACN/kg body wt during the 65 days prior to sacrifice) and below, with a slope of 37.7 pmol CEVal/g globin/p.p.m. At higher concentrations, adduct levels increased sublinearly, indicating saturation of a metabolic process for elimination of ACN. Comparison of adduct formation with the estimated dose (mg/kg/day) of ACN indicated that at low dose (0-10 p.p.m.) CEVal = 0.508 x ACN dose + 0.048 and at high dose (35-300 p.p.m.) CEVal = 1.142 x ACN dose - 1.098. Globin from the smokers (10-20 cigarettes/day) contained about 90 pmol CEVal/g, whereas the adduct levels in globin from non-smokers were below the detection limit. The analytical sensitivity should be sufficient to allow monitoring of occupationally exposed workers at levels well below the current Occupational Safety and Health Administration standard of 2 p.p.m.

Novel Antimicrobial Peptides That Inhibit Gram Positive Bacterial Exotoxin Synthesis

PubMed Central

Merriman, Joseph A.; Nemeth, Kimberly A.; Schlievert, Patrick M.

2014-01-01

Gram-positive bacteria, such as Staphylococcus aureus, cause serious human illnesses through combinations of surface virulence factors and secretion of exotoxins. Our prior studies using the protein synthesis inhibitor clindamycin and signal transduction inhibitors glycerol monolaurate and α-globin and β-globin chains of hemoglobin indicate that their abilities to inhibit exotoxin production by S. aureus are separable from abilities to inhibit growth of the organism. Additionally, our previous studies suggest that inhibition of exotoxin production, in absence of ability to kill S. aureus and normal flora lactobacilli, will prevent colonization by pathogenic S. aureus, while not interfering with lactobacilli colonization. These disparate activities may be important in development of novel anti-infective agents that do not alter normal flora. We initiated studies to explore the exotoxin-synthesis-inhibition activity of hemoglobin peptides further to develop potential agents to prevent S. aureus infections. We tested synthesized α-globin chain peptides, synthetic variants of α-globin chain peptides, and two human defensins for ability to inhibit exotoxin production without significantly inhibiting S. aureus growth. All of these peptides were weakly or not inhibitory to bacterial growth. However, the peptides were inhibitory to exotoxin production with increasing activity dependent on increasing numbers of positively-charged amino acids. Additionally, the peptides could be immobilized on agarose beads or have amino acid sequences scrambled and still retain exotoxin-synthesis-inhibition. The peptides are not toxic to human vaginal epithelial cells and do not inhibit growth of normal flora L. crispatus. These peptides may interfere with plasma membrane signal transduction in S. aureus due to their positive charges. PMID:24748386

Red blood cells free α-haemoglobin pool: a biomarker to monitor the β-thalassemia intermedia variability. The ALPHAPOOL study.

PubMed

Vasseur, Corinne; Domingues-Hamdi, Elisa; Ledudal, Katia; Le Corvoisier, Philippe; Barau, Caroline; Ghaleh, Bijan; Rialland, Amandine; Pissard, Serge; Galactéros, Frédéric; Baudin-Creuza, Véronique

2017-10-01

The severity of β-thalassaemia (β-thal) intermedia is mainly correlated to the degree of imbalanced α/non α-globin chain synthesis. The phenotypic diversity of β-thal depends on this imbalance and reflects all possible combinations of α- and β-globin genotypes, levels of fetal haemoglobin (HbF) and co-inheritance of other modulating factors. This study aimed to demonstrate the validity of a new surrogate of α/non α-globin biosynthetic ratio by measuring the soluble α-Hb pool in lysed red blood cells. Our results confirm that the α-Hb pool measurement allows a good discrimination between β-thal intermedia patients, controls and α-thal patients (P < 0·003). Receiver operator characteristic analyses revealed an area under the curve of 0·978 for the α-Hb pool measurement at a threshold of 120 ng free α-Hb/mg of total Hb/ml of haemolysate (ppm) with a sensitivity and specificity of 86% and 100%, respectively, to discriminate between β-thal and not β-thal subjects. Significant correlations were observed between the α-Hb pool and biological parameters of β-thal, the most significant association being observed with red cell hexokinase activity. This study indicates that the α-Hb pool could be a new marker for assistance in diagnostic orientation of β-thal intermedia patients and may be clinically useful for monitoring the evolution of the disequilibrium of globin synthesis in response to treatments. © 2017 John Wiley & Sons Ltd.

Molecular Mechanism of Yisui Shengxue Granule, a Complex Chinese Medicine, on Thalassemia Patients Suffering from Hemolysis and Anemia of Erythrocytes

PubMed Central

Chu, Na-Li; Wu, Zhi-kui; Zhang, Xin-Hua; Fang, Su-Ping; Wang, Wen-Juan; Cheng, Yan-Ling

2014-01-01

The objective of this study was to investigate the therapeutic biological mechanism of Yisui Shengxue Granule (YSSXG), a complex Chinese medicine, on the hemolysis and anemia of erythrocytes from patient with thalassemia disease. Sixteen patients with thalassemia (8 cases of α-thalassemia and 8 cases of β-thalassemia) disease were collected and treated with YSSXG for 3 months. The improvements of blood parameter demonstrated that YSSXG had a positive clinical effect on patients with thalassemia disease. For patients with α-thalassemia disease, RT-PCR showed that YSSXG upregulated the relative mRNA expression level of α-globin to β-globin and downregulated DNMT1, DNMT3a, and DNMT3b mRNA compared with pretreatment. Western blotting showed that YSSXG downregulated the expression of DNMT1 and DNMT3a. For patients with β-thalassemia disease, the relative expression level of A γ-globin to α-globin had an increasing trend and the level of BCL11A mRNA expression obviously increased. For all patients, RT-PCR showed that YSSXG upregulated mRNA expression of SPTA1 and SPTB. Activities of SOD and GSH-Px significantly increased and MDA obviously reduced on erythrocyte and blood serum after YSSXG treatment. TEM showed that YSSXG decreased the content of inclusion bodies. Activities of Na+K+-ATPtase and T-ATPtase of erythrocyte increased significantly after YSSXG treatment. This study provides the basis for mechanisms of YSSXG on thalassemia suffering with hemolysis and anemia of erythrocytes from patient. PMID:25574177

Sequential changes in chromatin structure during transcriptional activation in the beta globin LCR and its target gene.

PubMed

Kim, Kihoon; Kim, AeRi

2010-09-01

Chromatin structure is modulated during transcriptional activation. The changes include the association of transcriptional activators, formation of hypersensitive sites and covalent modifications of histones. To understand the order of the various changes accompanying transcriptional activation, we analyzed the mouse beta globin gene, which is transcriptionally inducible in erythroid MEL cells over a time course of HMBA treatment. Transcription of the globin genes requires the locus control region (LCR) consisting of several hypersensitive sites (HSs). Erythroid specific transcriptional activators such as NF-E2, GATA-1, TAL1 and EKLF were associated with the LCR in the uninduced state before transcriptional activation. The HSs of the LCR were formed in this state as revealed by high sensitivity to DNase I and MNase attack. However the binding of transcriptional activators and the depletion of histones were observed in the promoter of the beta globin gene only after transcriptional activation. In addition, various covalent histone modifications were sequentially detected in lysine residues of histone H3 during the activation. Acetylation of K9, K36 and K27 was notable in both LCR HSs and gene after induction but before transcriptional initiation. Inactive histone marks such as K9me2, K36me2 and K27me2 were removed coincident with transcriptional initiation in the gene region. Taken together, these results indicate that LCR has a substantially active structure in the uninduced state while transcriptional activation serially adds active marks, including histone modifications, and removes inactive marks in the target gene of the LCR. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

Stabilization and cytoskeletal-association of LDL receptor mRNA are mediated by distinct domains in its 3' untranslated region.

PubMed

Wilson, G M; Vasa, M Z; Deeley, R G

1998-05-01

The mRNA encoding the human low density lipoprotein (LDL) receptor is transiently stabilized after phorbol ester treatment of HepG2 cells and has been shown to associate with components of the cytoskeleton in this cell line (G. M. Wilson, E. A. Roberts, and R. G. Deeley, J. Lipid Res. 1997. 38: 437-446). Using an episomal expression system, fragments of the 3' untranslated region (3'UTR) of LDL receptor mRNA were transcribed in fusion with the coding region of beta-globin mRNA in HepG2 cells. Analyses of the decay kinetics of these beta-globin-LDL receptor fusion mRNA deletion mutants showed that sequences in the proximal 3'UTR of LDL receptor mRNA including several AU-rich elements (AREs) were sufficient to confer short constitutive mRNA half-life in the heterologous system. Stabilization of LDL receptor mRNA in the presence of PMA required sequences in the distal 3'UTR, at or near three Alu-like repetitive elements. Furthermore, the 3'UTR of LDL receptor mRNA conferred cytoskeletal association on the otherwise unassociated beta-globin mRNA, by a mechanism involving at least two distinct RNA elements. Comparisons of decay kinetics and subcellular localization of endogenous LDL receptor mRNA and beta-globin-LDL receptor mRNA fusions in HepG2 cells have demonstrated that several cis-acting elements in the receptor 3'UTR contribute to post-transcriptional regulation of receptor expression, and provide further support for involvement of the cytoskeleton in the regulation of LDL receptor mRNA turnover.

Life style and biochemical adaptation in Antarctic fishes

NASA Astrophysics Data System (ADS)

di Prisco, Guido

2000-12-01

Respiration and metabolism are under investigation in Antarctic fish, in an effort to understand the interplay between ecology and biochemical and physiological processes. Fish of the dominant suborder Notothenioidei are red-blooded, except Channichthyidae (the most phyletically derived family), whose genomes retain transcriptionally inactive DNA sequences closely related to the α-globin gene of red-blooded notothenioids and have lost the β-globin locus. Our structure/function studies on 38 of the 80 red-blooded species are aimed at correlating sequence, multiplicity and oxygen binding with ecological constraints and at obtaining phylogenetic information on evolution. For comparative purposes, this work has been extended to non-Antarctic notothenioids. All sluggish bottom dwellers have a single major hemoglobin (Hb) and often a minor, functionally similar one. Three species of the family Nototheniidae have different life styles. They have uniquely specialised oxygen-transport systems, adjusted to the mode of life of each species. Artedidraconidae have a single Hb, lacking oxygen-binding cooperativity, similar to the ancestral hemoproteins of primitive organisms. The amino acid sequences are currently used in the molecular modelling approach. The study of several enzymes with key roles in metabolism (e.g. glucose-6-phosphate dehydrogenase, L-glutamate dehydrogenase, phosphorylase b, carbonic anhydrase) indicate that some aspects of the molecular structure (e.g. molecular mass, number of subunits, amino acid sequence, temperature of irreversible heat inactivation) have been conserved during development of cold adaptation. However, high catalytic efficiency, possibly due to subtle molecular changes, is observed at low temperature.

Gene Addition Strategies for β-Thalassemia and Sickle Cell Anemia.

PubMed

Dong, Alisa C; Rivella, Stefano

2017-01-01

Beta-thalassemia and sickle cell anemia are two of the most common diseases related to the hemoglobin protein. In these diseases, the beta-globin gene is mutated, causing severe anemia and ineffective erythropoiesis. Patients can additionally present with a number of life-threatening co-morbidities, such as stroke or spontaneous fractures. Current treatment involves transfusion and iron chelation; allogeneic bone marrow transplant is the only curative option, but is limited by the availability of matching donors and graft-versus-host disease. As these two diseases are monogenic diseases, they make an attractive setting for gene therapy. Gene therapy aims to correct the mutated beta-globin gene or add back a functional copy of beta- or gamma-globin. Initial gene therapy work was done with oncoretroviral vectors, but has since shifted to lentiviral vectors. Currently, there are a few clinical trials underway to test the curative potential of some of these lentiviral vectors. This review will highlight the work done thus far, and present the challenges still facing gene therapy, such as genome toxicity concerns and achieving sufficient transgene expression to cure those with the most severe forms of thalassemia.

Expression of transcription factors during sodium phenylacetate induced erythroid differentiation in K562 cells.

PubMed

Rath, A V; Schmahl, G E; Niemeyer, C M

1997-01-01

During 15 days of treatment of K562 cells with sodium phenylacetate, we observed an increase in the cellular hemoglobin concentration with a similar increase in the expression of gamma-globin mRNA. Morphological studies demonstrated characteristic features of erythroid differentiation and maturation. At the same time there was no change in the level of expression of the cell surface antigenes CD33, CD34, CD45, CD71 and glycophorin A. Likewise, the level of expression of the erythroid transcription factors GATA-1, GATA-2, NF-E2, SCL and RBTN2, all expressed in untreated K562 cells, did not increase during sodium phenylacetate induced erythroid differentiation. The expression of the nuclear factors Evi-1 and c-myb, known to inhibit erythroid differentiation, did not decrease. We conclude that sodium phenylacetate treatment of K562 cells increases gamma-globin mRNA and induces cell maturation as judged by morphology without affecting the expression of the erythroid transcription factors, some of which are known to be involved in the regulation of beta-like globin genes.

Dynamics of active sites in biological macromolecules using a Green-function approach: An application to heme vibrational dynamics in myoglobin

NASA Astrophysics Data System (ADS)

Rai, Brajesh; Prohofsky, Earl

2003-03-01

Dynamics of functionally active regions of biological macromolecules can be studied using a Green-function technique. This approach uses the fact that in most cases one has a good set of force constants for active sites, and rather poorly defined force field parameters for other regions of the macromolecule. The Green-function method is applied to study the iron vibrational modes of the heme active site in myoglobin. In this approach, the heme active site is viewed as a system interacting with surrounding globin, which acts as an excitation bath. The normal modes of heme and globin are separately calculated using the best available force fields for the two entities. The iron vibrational spectrum of myoglobin is then obtained using the solutions of the heme and globin, and by considering physically meaningful interactions between the two units. The refinement of the Green-function calculations to the experimental data from an x-ray synchrotron-based Nuclear Resonance Vibrational Spectroscopy provides important insights into the character of iron normal modes of myoglobin.

A Luciferase Reporter Gene System for High-Throughput Screening of γ-Globin Gene Activators.

PubMed

Xie, Wensheng; Silvers, Robert; Ouellette, Michael; Wu, Zining; Lu, Quinn; Li, Hu; Gallagher, Kathleen; Johnson, Kathy; Montoute, Monica

2016-01-01

Luciferase reporter gene assays have long been used for drug discovery due to their high sensitivity and robust signal. A dual reporter gene system contains a gene of interest and a control gene to monitor non-specific effects on gene expression. In our dual luciferase reporter gene system, a synthetic promoter of γ-globin gene was constructed immediately upstream of the firefly luciferase gene, followed downstream by a synthetic β-globin gene promoter in front of the Renilla luciferase gene. A stable cell line with the dual reporter gene was cloned and used for all assay development and HTS work. Due to the low activity of the control Renilla luciferase, only the firefly luciferase activity was further optimized for HTS. Several critical factors, such as cell density, serum concentration, and miniaturization, were optimized using tool compounds to achieve maximum robustness and sensitivity. Using the optimized reporter assay, the HTS campaign was successfully completed and approximately 1000 hits were identified. In this chapter, we also describe strategies to triage hits that non-specifically interfere with firefly luciferase.

Hb Dartmouth (HBA2: c.200T>C): An α2-Globin Gene Associated with Hb H Disease in One Homozygous Patient.

PubMed

Farashi, Samaneh; Faramarzi Garous, Negin; Ashki, Mehri; Vakili, Shadi; Zeinali, Fatemah; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein

2015-01-01

Hb H (β4) disease is caused by deletion or inactivation of three out of four α-globin genes. A high incidence of Hb H disease has been reported all over the world. There is a wide spectrum of phenotypic presentations, from clinically asymptomatic to having significant hepatosplenomegaly and requiring occasional or even regular blood transfusions, even more severe anemia, Hb Bart's (γ4) hydrops fetalis syndrome that can cause death in the affected fetuses late in gestation. We here present a case who was diagnosed with Hb H disease that represents a new genotype for this hereditary disorder. Hb Dartmouth is a variant caused by a missense mutation at codon 66 of the α2-globin gene (HBA2: c.200T>C), resulting in the substitution of leucine by proline. We here emphasize the importance of this point mutation involving Hb H disease and also the necessity for prenatal diagnosis (PND) for those who carry this point mutation in the heterozygous state.

Discovery of phenylsulfonylfuroxan derivatives as gamma globin inducers by histone acetylation.

PubMed

Melo, Thais Regina Ferreira de; Kumkhaek, Chutima; Fernandes, Guilherme Felipe Dos Santos; Lopes Pires, Maria Elisa; Chelucci, Rafael Consolin; Barbieri, Karina Pereira; Coelho, Fernanda; Capote, Ticiana Sidorenko de Oliveira; Lanaro, Carolina; Carlos, Iracilda Zeppone; Marcondes, Sisi; Chegaev, Konstantin; Guglielmo, Stefano; Fruttero, Roberta; Chung, Man Chin; Costa, Fernando Ferreira; Rodgers, Griffin P; Dos Santos, Jean Leandro

2018-05-28

N-oxide derivatives 5(a-b), 8(a-b), and 11(a-c) were designed, synthesized and evaluated in vitro and in vivo as potential drugs that are able to ameliorate sickle cell disease (SCD) symptoms. All of the compounds demonstrated the capacity to releasing nitric oxide at different levels ranging from 0.8 to 30.1%, in vivo analgesic activity and ability to reduce TNF-α levels in the supernatants of monocyte cultures. The most active compound (8b) protected 50.1% against acetic acid-induced abdominal constrictions, while dipyrone, which was used as a control only protected 35%. Compounds 8a and 8b inhibited ADP-induced platelet aggregation by 84% and 76.1%, respectively. Both compounds increased γ-globin in K562 cells at 100 μM. The mechanisms involved in the γ-globin increase are related to the acetylation of histones H3 and H4 that is induced by these compounds. In vitro, the most promising compound (8b) was not cytotoxic, mutagenic and genotoxic. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

Thalassaemia.

PubMed

Higgs, Douglas R; Engel, James Douglas; Stamatoyannopoulos, George

2012-01-28

Thalassaemia is one of the most common genetic diseases worldwide, with at least 60,000 severely affected individuals born every year. Individuals originating from tropical and subtropical regions are most at risk. Disorders of haemoglobin synthesis (thalassaemia) and structure (eg, sickle-cell disease) were among the first molecular diseases to be identified, and have been investigated and characterised in detail over the past 40 years. Nevertheless, treatment of thalassaemia is still largely dependent on supportive care with blood transfusion and iron chelation. Since 1978, scientists and clinicians in this specialty have met regularly in an international effort to improve the management of thalassaemia, with the aim of increasing the expression of unaffected fetal genes to improve the deficiency in adult β-globin synthesis. In this Seminar we discuss important advances in the understanding of the molecular and cellular basis of normal and abnormal expression of globin genes. We will summarise new approaches to the development of tailored pharmacological agents to alter regulation of globin genes, the first trial of gene therapy for thalassaemia, and future prospects of cell therapy. Copyright © 2012 Elsevier Ltd. All rights reserved.

Specific and straightforward molecular investigation of β-thalassemia mutations in the Malaysian Malays and Chinese using direct TaqMan genotyping assays.

PubMed

Kho, S L; Chua, K H; George, E; Tan, J A M A

2013-07-15

Beta-thalassemia is a life-threatening inherited blood disorder. Rapid characterization of β-globin gene mutations is necessary because of the high frequency of Malaysian β-thalassemia carriers. A combination real-time polymerase chain reaction genotyping assay using TaqMan probes was developed to confirm β-globin gene mutations. In this study, primers and probes were designed to specifically identify 8 common β-thalassemia mutations in the Malaysian Malay and Chinese ethnic groups using the Primer Express software. "Blind tests" using DNA samples from healthy individuals and β-thalassemia patients with different genotypes were performed to determine the specificity and sensitivity of this newly designed assay. Our results showed 100% sensitivity and specificity for this novel assay. In conclusion, the TaqMan genotyping assay is a straightforward assay that allows detection of β-globin gene mutations in less than 40 min. The simplicity and reproducibility of the TaqMan genotyping assay permit its use in laboratories as a rapid and cost-effective diagnostic tool for confirmation of common β-thalassemia mutations in Malaysia.

Sickle cell disease caused by Hb S/Québec-CHORI: treatment with hydroxyurea and response.

PubMed

Tubman, Venée N; Bennett, Carolyn M; Luo, Hong-yuan; Chui, David H K; Heeney, Matthew M

2007-08-01

Sickle hemoglobin (Hb S;betaGlu 6 Val) is due to an A>T transversion in codon 6 of the beta-globin gene. Other variant hemoglobins mimic Hb A, S, or C on newborn screening and clinical laboratory diagnostic tools, thus making their correct identification potentially difficult. Sickling disorders can result in individuals who are compound heterozygous for beta-globin mutations (e.g., Hb SC, HbSO(Arab)). The authors report a second case of HbS/Québec-CHORI, a severe compound heterozygous sickling disorder and their experience managing this patient with hydroxyurea.

Oxidative stress in β-thalassaemia and sickle cell disease

PubMed Central

Voskou, S.; Aslan, M.; Fanis, P.; Phylactides, M.; Kleanthous, M.

2015-01-01

Sickle cell disease and β-thalassaemia are inherited haemoglobinopathies resulting in structural and quantitative changes in the β-globin chain. These changes lead to instability of the generated haemoglobin or to globin chain imbalance, which in turn impact the oxidative environment both intracellularly and extracellularly. The ensuing oxidative stress and the inability of the body to adequately overcome it are, to a large extent, responsible for the pathophysiology of these diseases. This article provides an overview of the main players and control mechanisms involved in the establishment of oxidative stress in these haemoglobinopathies. PMID:26285072

Multiple oxygen entry pathways in globin proteins revealed by intrinsic pathway identification method

NASA Astrophysics Data System (ADS)

Takayanagi, Masayoshi; Kurisaki, Ikuo; Nagaoka, Masataka

2015-12-01

Each subunit of human hemoglobin (HbA) stores an oxygen molecule (O2) in the binding site (BS) cavity near the heme group. The BS is buried in the interior of the subunit so that there is a debate over the O2 entry pathways from solvent to the BS; histidine gate or multiple pathways. To elucidate the O2 entry pathways, we executed ensemble molecular dynamics (MD) simulations of T-state tetramer HbA in high concentration O2 solvent to simulate spontaneous O2 entry from solvent into the BS. By analyzing 128 independent 8 ns MD trajectories by intrinsic pathway identification by clustering (IPIC) method, we found 141 and 425 O2 entry events into the BS of the α and β subunits, respectively. In both subunits, we found that multiple O2 entry pathways through inside cavities play a significant role for O2 entry process of HbA. The rate constants of O2 entry estimated from the MD trajectories correspond to the experimentally observed values. In addition, by analyzing monomer myoglobin, we verified that the high O2 concentration condition can reproduce the ratios of each multiple pathway in the one-tenth lower O2 concentration condition. These indicate the validity of the multiple pathways obtained in our MD simulations.

Repeated evolution of chimeric fusion genes in the β-globin gene family of laurasiatherian mammals.

PubMed

Gaudry, Michael J; Storz, Jay F; Butts, Gary Tyler; Campbell, Kevin L; Hoffmann, Federico G

2014-05-09

The evolutionary fate of chimeric fusion genes may be strongly influenced by their recombinational mode of origin and the nature of functional divergence between the parental genes. In the β-globin gene family of placental mammals, the two postnatally expressed δ- and β-globin genes (HBD and HBB, respectively) have a propensity for recombinational exchange via gene conversion and unequal crossing-over. In the latter case, there are good reasons to expect differences in retention rates for the reciprocal HBB/HBD and HBD/HBB fusion genes due to thalassemia pathologies associated with the HBD/HBB "Lepore" deletion mutant in humans. Here, we report a comparative genomic analysis of the mammalian β-globin gene cluster, which revealed that chimeric HBB/HBD fusion genes originated independently in four separate lineages of laurasiatherian mammals: Eulipotyphlans (shrews, moles, and hedgehogs), carnivores, microchiropteran bats, and cetaceans. In cases where an independently derived "anti-Lepore" duplication mutant has become fixed, the parental HBD and/or HBB genes have typically been inactivated or deleted, so that the newly created HBB/HBD fusion gene is primarily responsible for synthesizing the β-type subunits of adult and fetal hemoglobin (Hb). Contrary to conventional wisdom that the HBD gene is a vestigial relict that is typically inactivated or expressed at negligible levels, we show that HBD-like genes often encode a substantial fraction (20-100%) of β-chain Hbs in laurasiatherian taxa. Our results indicate that the ascendancy or resuscitation of genes with HBD-like coding sequence requires the secondary acquisition of HBB-like promoter sequence via unequal crossing-over or interparalog gene conversion. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Postnatal and non-invasive prenatal detection of β-thalassemia mutations based on Taqman genotyping assays

PubMed Central

Breveglieri, Giulia; Travan, Anna; D’Aversa, Elisabetta; Cosenza, Lucia Carmela; Pellegatti, Patrizia; Guerra, Giovanni; Gambari, Roberto

2017-01-01

The β-thalassemias are genetic disorder caused by more than 200 mutations in the β-globin gene, resulting in a total (β0) or partial (β+) deficit of the globin chain synthesis. The most frequent Mediterranean mutations for β-thalassemia are: β039, β+IVSI-110, β+IVSI-6 and β0IVSI-1. Several molecular techniques for the detection of point mutations have been developed based on the amplification of the DNA target by polymerase chain reaction (PCR), but they could be labor-intensive and technically demanding. On the contrary, TaqMan® genotyping assays are a simple, sensitive and versatile method suitable for the single nucleotide polymorphism (SNP) genotyping affecting the human β-globin gene. Four TaqMan® genotyping assays for the most common β-thalassemia mutations present in the Mediterranean area were designed and validated for the genotype characterization of genomic DNA extracted from 94 subjects comprising 25 healthy donors, 33 healthy carriers and 36 β-thalassemia patients. In addition, 15 specimens at late gestation (21–39 gestational weeks) and 11 at early gestation (5–18 gestational weeks) were collected from pregnant women, and circulating cell-free fetal DNAs were extracted and analyzed with these four genotyping assays. We developed four simple, inexpensive and versatile genotyping assays for the postnatal and prenatal identification of the thalassemia mutations β039, β+IVSI-110, β+IVSI-6, β0IVSI-1. These genotyping assays are able to detect paternally inherited point mutations in the fetus and could be efficiently employed for non-invasive prenatal diagnosis of β-globin gene mutations, starting from the 9th gestational week. PMID:28235086

Molecular analysis and association with clinical and laboratory manifestations in children with sickle cell anemia

PubMed Central

Camilo-Araújo, Roberta Faria; Amancio, Olga Maria Silverio; Figueiredo, Maria Stella; Cabanãs-Pedro, Ana Carolina; Braga, Josefina Aparecida Pellegrini

2014-01-01

Objectives To analyze the frequency of βS-globin haplotypes and alpha-thalassemia, and their influence on clinical manifestations and the hematological profile of children with sickle cell anemia. Method The frequency of βS-globin haplotypes and alpha-thalassemia and any association with clinical and laboratorial manifestations were determined in 117 sickle cell anemia children aged 3–71 months. The confirmation of hemoglobin SS and determination of the haplotypes were achieved by polymerase chain reaction-restriction fragment length polymorphism, and alpha-thalassemia genotyping was by multiplex polymerase chain reaction (single-tube multiplex-polymerase chain reaction). Results The genotype distribution of haplotypes was 43 (36.7%) Central African Republic/Benin, 41 (35.0%) Central African Republic/Central African Republic, 20 (17.0%) Rare/atypical, and 13 (11.1%) Benin/Benin. The frequency of the α3.7 deletion was 1.71% as homozygous (−α3.7/−α3.7) and 11.9% as heterozygous (−α3.7/αα). The only significant association in respect to haplotypes was related to the mean corpuscular volume. The presence of alpha-thalassemia was significantly associated to decreases in mean corpuscular volume, mean corpuscular hemoglobin and reticulocyte count and to an increase in the red blood cell count. There were no significant associations of βS-globin haplotypes and alpha-thalassemia with clinical manifestations. Conclusions In the study population, the frequency of alpha-thalassemia was similar to published data in Brazil with the Central African Republic haplotype being the most common, followed by the Benin haplotype. βS-globin haplotypes and interaction between alpha-thalassemia and sickle cell anemia did not influence fetal hemoglobin concentrations or the number of clinical manifestations. PMID:25305165

Human beta-globin mRNAs that harbor a nonsense codon are degraded in murine erythroid tissues to intermediates lacking regions of exon I or exons I and II that have a cap-like structure at the 5' termini.

PubMed Central

Lim, S K; Maquat, L E

1992-01-01

Previous studies have demonstrated that nonsense codons within beta zero-thalassemic or in vitro-mutagenized human beta-globin transgenes result in the production of mRNAs that are degraded abnormally rapidly in the cytoplasm of murine erythroid cells. As a consequence, three RNA degradative intermediates are formed that lack sequences from either exon I or exons I and II. We show here that the intermediates, like the full-length mRNA from which they derive and the endogenous murine beta maj-globin mRNA, bind to the anticap monoclonal antibody H-20 in a way that is competed by the cap analogue m7G and eliminated by prior exposure to tobacco acid pyrophosphatase. Furthermore, the intermediates, like the two full-length mRNAs, are resistant to a 5'----3' exonuclease activity isolated from HeLa cell nuclei that degrades uncapped but not capped ribopolymers. Based on these observations, the intermediates appear to possess a structure that is indistinguishable from the cap at the 5' end of mRNA, i.e. a methylated nucleoside that is linked to the RNA by a 5'-5' phosphodiester bond. Detection of the intermediates during murine development was concomitant with detection of full-length thalassemic mRNA. Intermediate production appears to be influenced by RNA structure as indicated by the products that derive from a beta zero-thalassemic beta-globin transgene harboring a structural alteration (a 4 bp deletion) that was larger than any of those previously studied. Images PMID:1324170

Potentially Therapeutic Levels of Anti-Sickling Globin Gene Expression Following Lentivirus-mediated Gene Transfer in Sickle Cell Disease Bone Marrow CD34+ Cells

PubMed Central

Urbinati, Fabrizia; Hargrove, Philip W.; Geiger, Sabine; Romero, Zulema; Wherley, Jennifer; Kaufman, Michael L.; Hollis, Roger P.; Chambers, Christopher B.; Persons, Derek A.; Kohn, Donald B.; Wilber, Andrew

2015-01-01

Sickle cell disease (SCD) can be cured by allogeneic hematopoietic stem cell (HSC) transplant. However, this is only possible when a matched donor is available making the development of gene therapy using autologous HSCs a highly desired alternative. We used a culture model of human erythropoiesis to directly compare two insulated, self-inactivating, and erythroid-specific lentiviral vectors, encoding for γ-globin (V5m3-400) or a modified β-globin (βAS3-FB) for production of anti-sickling hemoglobin (Hb) and correction of red cell deformability after deoxygenation. Bone marrow CD34+ cells from three SCD patients were transduced using V5m3-400 or βAS3-FB and compared to mock transduced SCD or healthy donor CD34+ cells. Lentiviral transduction did not impair cell growth or differentiation, as gauged by proliferation and acquisition of erythroid markers. Vector copy number averaged ~1 copy per cell and corrective globin mRNA levels were increased more than 7-fold over mock-transduced controls. Erythroblasts derived from healthy donor and mock-transduced SCD cells produced a low level of HbF that was increased to 23.6 ± 4.1% per vector copy for cells transduced with V5m3-400. Equivalent levels of modified HbA of 17.6 ± 3.8% per vector copy were detected for SCD cells transduced with βAS3-FB. These levels of anti-sickling Hb production were sufficient to reduce sickling of terminal stage RBCs upon deoxygenation. We conclude that the achieved levels of HbF and modified HbA would likely prove therapeutic to SCD patients who lack matched donors. PMID:25681747

Adult, embryonic and fetal hemoglobin are expressed in human glioblastoma cells.

PubMed

Emara, Marwan; Turner, A Robert; Allalunis-Turner, Joan

2014-02-01

Hemoglobin is a hemoprotein, produced mainly in erythrocytes circulating in the blood. However, non-erythroid hemoglobins have been previously reported in other cell types including human and rodent neurons of embryonic and adult brain, but not astrocytes and oligodendrocytes. Human glioblastoma multiforme (GBM) is the most aggressive tumor among gliomas. However, despite extensive basic and clinical research studies on GBM cells, little is known about glial defence mechanisms that allow these cells to survive and resist various types of treatment. We have shown previously that the newest members of vertebrate globin family, neuroglobin (Ngb) and cytoglobin (Cygb), are expressed in human GBM cells. In this study, we sought to determine whether hemoglobin is also expressed in GBM cells. Conventional RT-PCR, DNA sequencing, western blot analysis, mass spectrometry and fluorescence microscopy were used to investigate globin expression in GBM cell lines (M006x, M059J, M059K, M010b, U87R and U87T) that have unique characteristics in terms of tumor invasion and response to radiotherapy and hypoxia. The data showed that α, β, γ, δ, ζ and ε globins are expressed in all tested GBM cell lines. To our knowledge, we are the first to report expression of fetal, embryonic and adult hemoglobin in GBM cells under normal physiological conditions that may suggest an undefined function of those expressed hemoglobins. Together with our previous reports on globins (Ngb and Cygb) expression in GBM cells, the expression of different hemoglobins may constitute a part of series of active defence mechanisms supporting these cells to resist various types of treatments including chemotherapy and radiotherapy.

Effects of common hemoglobin variants on HbA1c measurements in China: results for α- and β-globin variants measured by six methods.

PubMed

Xu, Anping; Chen, Weidong; Xia, Yong; Zhou, Yu; Ji, Ling

2018-04-07

HbA1c is a widely used biomarker for diabetes mellitus management. Here, we evaluated the accuracy of six methods for determining HbA1c values in Chinese patients with common α- and β-globin chains variants in China. Blood samples from normal subjects and individuals exhibiting hemoglobin variants were analyzed for HbA1c, using Sebia Capillarys 2 Flex Piercing (C2FP), Bio-Rad Variant II Turbo 2.0, Tosoh HLC-723 G8 (ver. 5.24), Arkray ADAMS A1c HA-8180V fast mode, Cobas c501 and Trinity Ultra2 systems. DNA sequencing revealed five common β-globin chain variants and three common α-globin chain variants. The most common variant was Hb E, followed by Hb New York, Hb J-Bangkok, Hb G-Coushatta, Hb Q-Thailand, Hb G-Honolulu, Hb Ube-2 and Hb G-Taipei. Variant II Turbo 2.0, Ultra2 and Cobas c501 showed good agreement with C2FP for most samples with variants. HLC-723 G8 yielded no HbA1c values for Hb J-Bangkok, Hb Q-Thailand and Hb G-Honolulu. Samples with Hb E, Hb G-Coushatta, Hb G-Taipei and Hb Ube-2 produced significant negative biases for HLC-723 G8. HA-8180V showed statistically significant differences for Hb E, Hb G-Coushatta, Hb G-Taipei, Hb Q-Thailand and Hb G-Honolulu. HA-8180V yielded no HbA1c values for Hb J-Bangkok. All methods showed good agreement for samples with Hb New York. Some common hemoglobin variants can interfere with HbA1c determination by the most popular methods in China.

Double addition of diethylamine to biacetylene (in Russian)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Trofimov, B.A.; Vavilova, A.N.

1986-03-01

Biacetylene reacts with an excess of diethylamine in dilute solutions of anhydrous acetonitrile, methanol, ethanol, and THF to form the diadduct 1,3-bis(diethyl-amino)-1,3-butadiene (lambda/sub max/ 325 nm). During concentration of the reaction mixture the latter undergoes hydration by the residual amounts of water in the 3-(diethylamino)-2-butenal. The spectral characteristics (UV, IR, PMR) of the intermediate reaction products are given. The kinetics of the stage of addition of the diethylamine and water to the monoadduct, 1-(diethylamino)-1-buten-3-yne, were studied. It was concluded that the addition of the nucleophile to the triple bond during its secondary amination and hydration is facilitated by the concertedmore » transfer of a proton.« less

[Hemolytic anemia due to hemoglobin Evans in an Argentinean family].

PubMed

Zanotto, María I; Calvo, Karina; Schvartzman, Gabriel; Deana, Alejandra; Noguera, Nélida; Bragós, Irma; Milani, Angela

2010-12-01

Unstable hemoglobins are structural variants of the hemoglobin molecule, mostly originated by single amino-acid replacement in some globin chains. These changes affect molecule stability, leading to loss of solubility, precipitation, and cellular lysis. Patients carrying these unstable hemoglobins may present mild to severe chronic hemolytic anemia. Hemoglobin Evans is an unstable variant originated by replacement of valine with methionine at position 62 of the α-globin chain. We have identified this variant in a girl with an acute hemolytic crisis associated to pharyngitis, as well as in two of her family members. This is the third case of hemolytic anemia due to hemoglobin Evans reported in the literature.

Temporal regulation of Stat5 activity in determination of cell differentiation program

PubMed Central

Hoshino, Akemi; Fujii, Hodaka

2007-01-01

Although Stat5 is activated by various cytokines, only ethrytopoietin (Epo) and a small number of cytokines induce Stat5-dependent erythroid differentiation. Here, by using a reporter gene system to monitor transcriptional activity of Stat5, we showed that Epo but not interleukin (IL)-3 supports sustained activation of Stat5, which induces globin gene expression. IL-3 or IL-2 stimulation inhibits Epo-induced globin gene expression. The acidic region of the IL-2 receptor β chain was essential for this inhibition. These results underscore the importance of temporal regulation of Stat activity for regulation of cytokine-specific cell differentiation. PMID:17511959

Molecular Diagnosis of Thalassemias and Hemoglobinopathies: An ACLPS Critical Review.

PubMed

Sabath, Daniel E

2017-07-01

To describe the use of molecular diagnostic techniques for patients with hemoglobin disorders. A clinical scenario is presented in which molecular diagnosis is important for genetic counseling. Globin disorders, techniques for their diagnosis, and the role of molecular genetic testing in managing patients with these disorders are described in detail. Hemoglobin disorders, including thalassemias and hemoglobinopathies, are among the commonest genetic diseases, and the clinical laboratory is essential for the diagnosis of patients with these abnormalities. Most disorders can be diagnosed with protein-based techniques such as electrophoresis and chromatography. Since severe syndromes can result due to inheritance of combinations of globin genetic disorders, genetic counseling is important to prevent adverse outcomes. Protein-based methods cannot always detect potentially serious thalassemia disorders; in particular, α-thalassemia may be masked in the presence of β-thalassemia. Deletional forms of β-thalassemia are also sometimes difficult to diagnose definitively with standard methods. Molecular genetic testing serves an important role in identifying individuals carrying thalassemia traits that can cause adverse outcomes in offspring. Furthermore, prenatal genetic testing can identify fetuses with severe globin phenotypes. © American Society for Clinical Pathology, 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

A Brg1 mutation that uncouples ATPase activity from chromatin remodeling reveals an essential role for SWI/SNF-related complexes in β-globin expression and erythroid development

PubMed Central

Bultman, Scott J.; Gebuhr, Thomas C.; Magnuson, Terry

2005-01-01

The Brg1 catalytic subunit of SWI/SNF-related complexes has been implicated in many developmental and physiological processes, but null homozygotes die as blastocysts prior to implantation. To circumvent this early embryonic lethality, we performed an ENU mutagenesis screen and generated a Brg1 hypomorph mutation in the ATPase domain. The mutant Brg1 protein is stable, assembles into SWI/SNF-related complexes, and exhibits normal ATPase activity but is unable to establish DNase I hypersensitivity sites characteristic of open chromatin. Mutant embryos develop normally until midgestation but then exhibit a distinct block in the development of the erythroid lineage, leading to anemia and death. The mutant Brg1 protein is recruited to the β-globin locus, but chromatin remodeling and transcription are perturbed. Histone acetylation and DNA methylation are also affected. To our knowledge, Brg1 is the first chromatin-modifying factor shown to be required for β-globin regulation and erythropoiesis in vivo. Not only does this mutation establish a role for Brg1 during organogenesis, it also demonstrates that ATPase activity can be uncoupled from chromatin remodeling. PMID:16287714

The tyrosine B10 hydroxyl is crucial for oxygen avidity of Ascaris hemoglobin.

PubMed

Kloek, A P; Yang, J; Mathews, F S; Frieden, C; Goldberg, D E

1994-01-28

The parasitic nematode Ascaris suum has a gene encoding a two-domain hemoglobin with remarkable oxygen avidity. The strong interaction with oxygen is a consequence of a particularly slow oxygen off-rate. The single polypeptide chain consists of two domains, each of which can be expressed separately in Escherichia coli as a globin-like protein exhibiting oxygen binding characteristics comparable with the native molecule. Site-directed mutagenesis was performed on the gene segment encoding domain one. The E7 position, involved in forming a hydrogen bond with the liganded oxygen in vertebrate globins, is a glutamine in both Ascaris domains. Conversion of this residue to leucine or alanine produced a hemoglobin variant with an oxygen off-rate 5- or 60-fold faster than that of unaltered domain one. Replacement of the tyrosine B10 with either phenylalanine or leucine (as found in vertebrate globins) yielded hemoglobin mutants with oxygen off-rates 280- or 570-fold faster, approaching rates found with vertebrate myoglobins. The data suggest that the distal glutamine hydrogen bonds with the liganded oxygen and that the tyrosine B10 hydroxyl contributes an additional hydrogen bond that appears substantially responsible for the extreme oxygen avidity of Ascaris hemoglobin.

The effects of old and recent migration waves in the distribution of HBB*S globin gene haplotypes

PubMed Central

Lindenau, Juliana D.; Wagner, Sandrine C.; de Castro, Simone M.; Hutz, Mara H.

2016-01-01

Abstract Sickle cell hemoglobin is the result of a mutation at the sixth amino acid position of the beta (β) globin chain. The HBB*S gene is in linkage disequilibrium with five main haplotypes in the β-globin-like gene cluster named according to their ethnic and geographic origins: Bantu (CAR), Benin (BEN), Senegal (SEN), Cameroon (CAM) and Arabian-Indian (ARAB). These haplotypes demonstrated that the sickle cell mutation arose independently at least five times in human history. The distribution of βS haplotypes among Brazilian populations showed a predominance of the CAR haplotype. American populations were clustered in two groups defined by CAR or BEN haplotype frequencies. This scenario is compatible with historical records about the slave trade in the Americas. When all world populations where the sickle cell gene occurs were analyzed, three clusters were disclosed based on CAR, BEN or ARAB haplotype predominance. These patterns may change in the next decades due to recent migrations waves. Since these haplotypes show different clinical characteristics, these recent migrations events raise the necessity to develop optimized public health programs for sickle cell disease screening and management. PMID:27706371

Molecular analysis of abnormal hemoglobins in beta chain in Aegean region of Turkey and first reports of hemoglobin Andrew-Minneapolis and Hb Hinsdale from Turkey.

PubMed

Aykut, Ayça; Onay, Hüseyin; Durmaz, Asude; Karaca, Emin; Vergin, Canan; Aydınok, Yeşim; Özkınay, Ferda

2015-07-01

The Agean is one of the regions in Turkey where thalassemias and abnormal hemoglobins (Hbs) are prevalent. Combined heterozygosity of thalassemia mutations with a variety of structural Hb variants lead to an extremely wide spectrum of clinical and hematological phenotypes which is of importance for prenatal diagnosis. One hundred and seventeen patients and carriers diagnosed by hemoglobin electrophoresis (HPLC), at risk for abnormal hemoglobinopathies were screened for mutational analysis of the beta-globin gene. The full coding the 5' UTR, and the 3' UTR sequences of beta-globin gene (GenBank accession no. U01317) were amplified and sequenced. In this study, a total of 118 (12.24%) structural Hb variant alleles were identified in 1341 mutated beta-chain alleles in Medical Genetics Department of Ege University between January 2006 and November 2013. Here, we report the mutation spectrum of abnormal Hbs associated with the beta-globin gene in Aegean region of Turkey. In the present study, the Hb Hinsdale and Hb Andrew-Minneapolis variants are demonstrated for the first time in the Turkish population.

Two-photon excited fluorescence emission from hemoglobin

NASA Astrophysics Data System (ADS)

Sun, Qiqi; Zeng, Yan; Zhang, Wei; Zheng, Wei; Luo, Yi; Qu, Jianan Y.

2015-03-01

Hemoglobin, one of the most important proteins in blood, is responsible for oxygen transportation in almost all vertebrates. Recently, we discovered two-photon excited hemoglobin fluorescence and achieved label-free microvascular imaging based on the hemoglobin fluorescence. However, the mechanism of its fluorescence emission still remains unknown. In this work, we studied the two-photon excited fluorescence properties of the hemoglobin subunits, heme/hemin (iron (II)/(III) protoporphyrin IX) and globin. We first studied the properties of heme and the similar spectral and temporal characteristics of heme and hemoglobin fluorescence provide strong evidence that heme is the fluorophore in hemoglobin. Then we studied the fluorescence properties of hemin, globin and methemoglobin, and found that the hemin may have the main effect on the methemoglobin fluorescence and that globin has tryptophan fluorescence like other proteins. Finally, since heme is a centrosymmetric molecule, that the Soret band fluorescence of heme and hemoglobin was not observed in the single photon process in the previous study may be due to the parity selection rule. The discovery of heme two-photon excited fluorescence may open a new window for heme biology research, since heme as a cofactor of hemoprotein has many functions, including chemical catalysis, electron transfer and diatomic gases transportation.

Globins Scavenge Sulfur Trioxide Anion Radical*

PubMed Central

Gardner, Paul R.; Gardner, Daniel P.; Gardner, Alexander P.

2015-01-01

Ferrous myoglobin was oxidized by sulfur trioxide anion radical (STAR) during the free radical chain oxidation of sulfite. Oxidation was inhibited by the STAR scavenger GSH and by the heme ligand CO. Bimolecular rate constants for the reaction of STAR with several ferrous globins and biomolecules were determined by kinetic competition. Reaction rate constants for myoglobin, hemoglobin, neuroglobin, and flavohemoglobin are large at 38, 120, 2,600, and ≥ 7,500 × 106 m−1 s−1, respectively, and correlate with redox potentials. Measured rate constants for O2, GSH, ascorbate, and NAD(P)H are also large at ∼100, 10, 130, and 30 × 106 m−1 s−1, respectively, but nevertheless allow for favorable competition by globins and a capacity for STAR scavenging in vivo. Saccharomyces cerevisiae lacking sulfite oxidase and deleted of flavohemoglobin showed an O2-dependent growth impairment with nonfermentable substrates that was exacerbated by sulfide, a precursor to mitochondrial sulfite formation. Higher O2 exposures inactivated the superoxide-sensitive mitochondrial aconitase in cells, and hypoxia elicited both aconitase and NADP+-isocitrate dehydrogenase activity losses. Roles for STAR-derived peroxysulfate radical, superoxide radical, and sulfo-NAD(P) in the mechanism of STAR toxicity and flavohemoglobin protection in yeast are suggested. PMID:26381408

Leghemoglobin green derivatives with nitrated hemes evidence production of highly reactive nitrogen species during aging of legume nodules.

PubMed

Navascués, Joaquín; Pérez-Rontomé, Carmen; Gay, Marina; Marcos, Manuel; Yang, Fei; Walker, F Ann; Desbois, Alain; Abián, Joaquín; Becana, Manuel

2012-02-14

Globins constitute a superfamily of proteins widespread in all kingdoms of life, where they fulfill multiple functions, such as efficient O(2) transport and modulation of nitric oxide bioactivity. In plants, the most abundant Hbs are the symbiotic leghemoglobins (Lbs) that scavenge O(2) and facilitate its diffusion to the N(2)-fixing bacteroids in nodules. The biosynthesis of Lbs during nodule formation has been studied in detail, whereas little is known about the green derivatives of Lbs generated during nodule senescence. Here we characterize modified forms of Lbs, termed Lba(m), Lbc(m), and Lbd(m), of soybean nodules. These green Lbs have identical globins to the parent red Lbs but their hemes are nitrated. By combining UV-visible, MS, NMR, and resonance Raman spectroscopies with reconstitution experiments of the apoprotein with protoheme or mesoheme, we show that the nitro group is on the 4-vinyl. In vitro nitration of Lba with excess nitrite produced several isomers of nitrated heme, one of which is identical to those found in vivo. The use of antioxidants, metal chelators, and heme ligands reveals that nitration is contingent upon the binding of nitrite to heme Fe, and that the reactive nitrogen species involved derives from nitrous acid and is most probably the nitronium cation. The identification of these green Lbs provides conclusive evidence that highly oxidizing and nitrating species are produced in nodules leading to nitrosative stress. These findings are consistent with a previous report showing that the modified Lbs are more abundant in senescing nodules and have aberrant O(2) binding.

Exploring the Common Dynamics of Homologous Proteins. Application to the Globin Family

PubMed Central

Maguid, Sandra; Fernandez-Alberti, Sebastian; Ferrelli, Leticia; Echave, Julian

2005-01-01

We present a procedure to explore the global dynamics shared between members of the same protein family. The method allows the comparison of patterns of vibrational motion obtained by Gaussian network model analysis. After the identification of collective coordinates that were conserved during evolution, we quantify the common dynamics within a family. Representative vectors that describe these dynamics are defined using a singular value decomposition approach. As a test case, the globin heme-binding family is considered. The two lowest normal modes are shown to be conserved within this family. Our results encourage the development of models for protein evolution that take into account the conservation of dynamical features. PMID:15749782

A new stable alpha chain variant: Hb Basel [alpha14(A12)Trp-->Leu (alpha1)].

PubMed

Hergersberg, Martin; Brunner-Agten, Saskia; Kühne, Thomas; Paulussen, Michael; Huber, Andreas R

2010-06-01

We describe a heterozygosity for a new missense mutation on the alpha1-globin gene of an 18-year-old woman of Portuguese ancestry with severe hypochromic anemia and iron deficiency. Hemoglobin (Hb) analysis by high performance liquid chromatography (HPLC) found a prominent peak constituting about 12% of total Hb. Sequencing of the globin genes of the index patient found the mutation alpha14(A12)Trp-->Leu (alpha1), HBA1:c.44G

A Hemoglobin Variant Associated with Neonatal Cyanosis and Anemia

PubMed Central

Crowley, Moira A.; Mollan, Todd L.; Abdulmalik, Osheisa Y.; Butler, Andrew D.; Goodwin, Emily F.; Sarkar, Arindam; Stolle, Catherine A.; Gow, Andrew J.; Olson, John S.; Weiss, Mitchell J.

2013-01-01

SUMMARY Globin-gene mutations are a rare but important cause of cyanosis. We identified a missense mutation in the fetal G γ-globin gene (HBG2) in a father and daughter with transient neonatal cyanosis and anemia. This new mutation modifies the ligand-binding pocket of fetal hemoglobin by means of two mechanisms. First, the relatively large side chain of methionine decreases both the affinity of oxygen for binding to the mutant hemoglobin subunit and the rate at which it does so. Second, the mutant methionine is converted to aspartic acid post-translationally, probably through oxidative mechanisms. The presence of this polar amino acid in the heme pocket is predicted to enhance hemoglobin denaturation, causing anemia. PMID:21561349

Hb Alesha [beta67(E11)Val-->Met, GTG-->ATG] in an Argentinean girl.

PubMed

Eberle, Silvia Eandi; Noguera, Nélida I; Sciuccati, Gabriela; Bonduel, Mariana; Díaz, Lilian; Staciuk, Raquel; Targovnik, Héctor M; Feliu-Torres, Aurora

2007-01-01

Hb Alesha is caused by a GTG-->ATG mutation at codon 67 of the beta-globin gene, resulting in abnormal beta-globin chains in which the normal beta67(E11) valine is changed to methionine. This hemoglobin (Hb) is also known as Hb Bristol, the first unstable Hb described, since in a fraction of the variant the methionine is modified into an aspartic acid by a posttranslational modification. This replacement disrupts the apolar bonds between the valine and the heme group, producing an unstable Hb and severe hemolysis. We have identified this rare hemoglobinopathy in an Argentinean girl with severe hemolytic anemia, splenomegaly and frequent requirement for red blood cell transfusions.

NF-E2 and GATA binding motifs are required for the formation of DNase I hypersensitive site 4 of the human beta-globin locus control region.

PubMed Central

Stamatoyannopoulos, J A; Goodwin, A; Joyce, T; Lowrey, C H

1995-01-01

The beta-like globin genes require the upstream locus control region (LCR) for proper expression. The active elements of the LCR coincide with strong erythroid-specific DNase I-hypersensitive sites (HSs). We have used 5' HS4 as a model to study the formation of these HSs. Previously, we identified a 101 bp element that is required for the formation of this HS. This element binds six proteins in vitro. We now report a mutational analysis of the HS4 HS-forming element (HSFE). This analysis indicates that binding sites for the hematopoietic transcription factors NF-E2 and GATA-1 are required for the formation of the characteristic chromatin structure of the HS following stable transfection into murine erythroleukemia cells. Similarly arranged NF-E2 and GATA binding sites are present in the other HSs of the human LCR, as well as in the homologous mouse and goat sequences and the chicken beta-globin enhancer. A combination of DNase I and micrococcal nuclease sensitivity assays indicates that the characteristic erythroid-specific hypersensitivity of HS4 to DNase I is the result of tissue-specific alterations in both nucleosome positioning and tertiary DNA structure. Images PMID:7828582

Genetic heterogeneity of Beta thalassemia in Lebanon reflects historic and recent population migration.

PubMed

Makhoul, N J; Wells, R S; Kaspar, H; Shbaklo, H; Taher, A; Chakar, N; Zalloua, P A

2005-01-01

Beta thalassemia is an autosomal recessive disorder characterized by reduced (beta(+)) or absent (beta(0)) beta-globin chain synthesis. In Lebanon it is the most predominant genetic defect. In this study we investigated the religious and geographic distribution of the beta-thalassemia mutations identified in Lebanon, and traced their precise origins. A total of 520 beta-globin chromosomes from patients of different religious and regional backgrounds was studied. Beta thalassemia mutations were identified using Amplification Refractory Mutation System (ARMS) PCR or direct gene sequencing. Six (IVS-I-110, IVS-I-1, IVS-I-6, IVS-II-1, cd 5 and the C > T substitution at cd 29) out of 20 beta-globin defects identified accounted for more than 86% of the total beta-thalassemia chromosomes. Sunni Muslims had the highest beta-thalassemia carrier rate and presented the greatest heterogeneity, with 16 different mutations. Shiite Muslims followed closely with 13 mutations, whereas Maronites represented 11.9% of all beta-thalassemic subjects and carried 7 different mutations. RFLP haplotype analysis showed that the observed genetic diversity originated from both new mutational events and gene flow from population migration. This study provides information about the types and distribution of beta-thalassemia mutations within each religious group and geographic region, which is essential for the implementation of screening and prevention programs.

Genetic correction of β-thalassemia patient-specific iPS cells and its use in improving hemoglobin production in irradiated SCID mice.

PubMed

Wang, Yixuan; Zheng, Chen-Guang; Jiang, Yonghua; Zhang, Jiqin; Chen, Jiayu; Yao, Chao; Zhao, Qingguo; Liu, Sheng; Chen, Ke; Du, Juan; Yang, Ze; Gao, Shaorong

2012-04-01

The generation of induced pluripotent stem cells (iPSCs) from differentiated somatic cells by over-expression of several transcription factors has the potential to cure many genetic and degenerative diseases currently recalcitrant to traditional clinical approaches. One such genetic disease is β-thalassemia major (Cooley's anemia). This disease is caused by either a point mutation or the deletion of several nucleotides in the β-globin gene, and it threatens the lives of millions of people in China. In the present study, we successfully generated iPSCs from fibroblasts collected from a 2-year-old patient who was diagnosed with a homozygous 41/42 deletion in his β-globin gene. More importantly, we successfully corrected this genetic mutation in the β-thalassemia iPSCs by homologous recombination. Furthermore, transplantation of the genetically corrected iPSCs-derived hematopoietic progenitors into sub-lethally irradiated immune deficient SCID mice showed improved hemoglobin production compared with the uncorrected iPSCs. Moreover, the generation of human β-globin could be detected in the mice transplanted with corrected iPSCs-derived hematopietic progenitors. Our study provides strong evidence that iPSCs generated from a patient with a genetic disease can be corrected by homologous recombination and that the corrected iPSCs have potential clinical uses.

The Prevalence and Molecular Spectrum of α- and β-Globin Gene Mutations in 14,332 Families of Guangdong Province, China

PubMed Central

Xu, Longchang; Wu, Li; Zhang, Liang; Ma, Yuanzhu; Chen, Tingting; Gao, Shuang; Liang, Juqing; Guo, Hao; Qin, Danqing; Wang, Jicheng; Yuan, Tenglong; Wang, Yixia; Huang, Wei-wei; He, Wen-Fei; Zhang, Yanxia; Liu, Chang; Xia, Sujian; Chen, Qingshan; Zhao, Qingguo; Zhang, Xiaozhuang

2014-01-01

Objective To reveal the familial prevalence and molecular variation of α- and β-globin gene mutations in Guangdong Province. Methods A total of 40,808 blood samples from 14,332 families were obtained and analyzed for both hematological and molecular parameters. Results A high prevalence of α- and β-globin gene mutations was found. Overall, 17.70% of pregnant women, 15.94% of their husbands, 16.03% of neonates, and 16.83% of couples (pregnant women and their husbands) were heterozygous carriers of α- or β-thalassemia. The regions with the highest prevalence were the mountainous and western regions, followed by the Pearl River Delta; the region with the lowest prevalence was Chaoshan. The total familial carrier rate (both spouses were α- or β-thalassemia carriers) was 1.87%, and the individual carrier rates of α- and β-thalassemia were 1.68% and 0.20%, respectively. The total rate of moderate-to-severe fetal thalassemia was 12.78% among couples in which both parents were carriers. Conclusions There was a high prevalence of α- and β-thalassemia in Guangdong Province. This study will contribute to the development of thalassemia prevention and control strategies in Guangdong Province. PMID:24587075

Multivariate analysis of matrix-assisted laser desorption/ionization mass spectrometric data related to glycoxidation products of human globins in nephropathic patients.

PubMed

Lapolla, Annunziata; Ragazzi, Eugenio; Andretta, Barbara; Fedele, Domenico; Tubaro, Michela; Seraglia, Roberta; Molin, Laura; Traldi, Pietro

2007-06-01

To clarify the possible pathogenetic role of oxidation products originated from the glycation of proteins, human globins from nephropathic patients have been studied by matrix-assisted laser desorption/ionization mass spectrometry (MALDI), revealing not only unglycated and monoglycated globins, but also a series of different species. For the last ones, structural assignments were tentatively done on the basis of observed masses and expectations for the Maillard reaction pattern. Consequently, they must be considered only propositive, and the discussion which will follow must be considered in this view. In our opinion this approach does not seem to compromise the intended diagnostic use of the data because distinctions are valid even if the assignments are uncertain. We studied nine healthy subjects and 19 nephropathic patients and processed the data obtained from the MALDI spectra using a multivariate analysis. Our results showed that multivariate analytical techniques enable differential aspects of the profile of molecular species to be identified in the blood of end stage nephropathic patients. A correct grouping can be achieved by principal component analysis (PCA) and the results suggest that several products involved in carbonyl stress exist in nephropathic patients. These compounds may have a relevant role as specific markers of the pathological state.

Synthesis of hemoglobin Gun Hill: increased synthesis of the heme-free βGH globin chain and subunit exchange with a free α-chain pool

PubMed Central

Rieder, Ronald F.

1971-01-01

Hemoglobin Gun Hill is an unstable mutant hemoglobin associated with mild compensated hemolysis. This abnormal protein has a deletion of five amino acids in the β-chains. The deletion includes the heme-binding proximal histidine at position 92. The β-chains of hemoglobin Gun Hill lack heme groups. Approximately 32% of the circulating hemoglobin in heterozygous subjects consists of the mutant hemoglobin. When reticulocytes were incubated with radioactive amino acid the specific activity of hemoglobin Gun Hill was three to six times that of hemoglobin A. Total incorporation of radioactivity into hemoglobin Gun Hill was two to three times that into hemoglobin A. There were 20-50% more total counts in β-Gun Hill (βGH) than in βA. These results indicate that in reticulocytes there was greater synthesis of the abnormal β-chains than βA-chains. The ratio of the specific activities of the α-chains of hemoglobin Gun Hill to the α-chains of hemoglobin A was 20: 1. There was evidence of a free pool of α-chains in the reticulocytes containing hemoglobin Gun Hill. After 10 min of incubation approximately 40% of the total α-chain radioactivity was in the free pool. When protein synthesis was blocked by incubation of reticulocytes with puromycin, the specific activity of the α-chains of hemoglobin Gun Hill continued to increase due to direct exchange of α-subunits between the free pool and preformed hemoglobin Gun Hill. Studies of the assembly of βA and βGH revealed that the rates of translation of the two polypeptide chains were equal and uniform. No evidence was obtained for the existence of “slow points” in the process of globin chain assembly. The studies also suggest that lack of strong heme-globin binding does not hinder the synthesis of globin chains. PMID:5540175

Molecular Epidemiological Survey of Glucose-6-Phosphate Dehydrogenase Deficiency and Thalassemia in Uygur and Kazak Ethnic Groups in Xinjiang, Northwest China.

PubMed

Han, Luhao; Su, Hai; Wu, Hao; Jiang, Weiying; Chen, Suqin

2016-06-01

Glucose-6-phosphate dehydrogenase (G6PD) deficiency and thalassemia occur frequently in tropical and subtropical regions, while the prevalence of relationship between the two diseases in Xinjiang has not been reported. We aimed to determine the prevalence of these diseases and clarify the relationship between genotypes and phenotypes of the two diseases in the Uygur and Kazak ethnic groups in Xinjiang. We measured G6PD activity by G6PD:6PGD (glucose acid-6-phosphate dehydrogenase) ratio, identified the gene variants of G6PD and α- and β-globin genes by polymerase chain reaction (PCR)-DNA sequencing and gap-PCR and compared these variants in different ethnic groups in Xinjiang with those adjacent to it. Of the 149 subjects with molecular analysis of G6PD deficiency conducted, a higher prevalence of the combined mutations c.1311C > T/IVSXI + 93T > C and IVSXI + 93T > C, both with normal enzymatic activities, were observed in the Uygur and Kazak subjects. A case of rare mutation HBB: c.135delC [codon 44 (-C) in the heterozygous state], a heterozygous case of HBB: c.68A > G [Hb G-Taipei or β22(B4)Glu→Gly] and several common single nucleotide polymorphisms (SNPs) were found on the β-globin gene. In conclusion, G6PD deficiency with pathogenic mutations and three common α-thalassemia (α-thal) [- -(SEA), -α(3.7) (rightward), -α(4.2) (leftward)] deletions and point mutations of the α-globin gene were not detected in the present study. The average incidence of β-thalassemia (β-thal) in Uygurs was 1.45% (2/138) in Xinjiang. The polymorphisms of G6PD and β-globin genes might be useful genetic markers to trace the origin and migration of the Uygur and Kazak in Xinjiang.

CCAR1/CoCoA pair-mediated recruitment of the Mediator defines a novel pathway for GATA1 function.

PubMed

Mizuta, Shumpei; Minami, Tomoya; Fujita, Haruka; Kaminaga, Chihiro; Matsui, Keiji; Ishino, Ruri; Fujita, Azusa; Oda, Kasumi; Kawai, Asami; Hasegawa, Natsumi; Urahama, Norinaga; Roeder, Robert G; Ito, Mitsuhiro

2014-01-01

The MED1 subunit of the Mediator transcriptional coregulator complex coactivates GATA1 and induces erythropoiesis. Here, we show the dual mechanism of GATA1- and MED1-mediated transcription. MED1 expression levels in K562 erythroleukemia cells paralleled the levels of GATA1-targeted gene transcription and erythroid differentiation. An N-terminal fragment of MED1, MED1(1-602), which is incapable of interacting with GATA1, enhanced GATA1-targeted gene transcription and erythroid differentiation, and introduction of MED1(1-602) into Med1(-/-) mouse embryonic fibroblasts (MEFs) partially rescued GATA1-mediated transcription. The C-terminal zinc-finger domain of GATA1 interacts with the MED1(1-602)-interacting coactivator CCAR1, CoCoA and MED1(681-715). CCAR1 and CoCoA synergistically enhanced GATA1-mediated transcription from the γ-globin promoter in MEFs. Recombinant GATA1, CCAR1, CoCoA and MED1(1-602) formed a complex in vitro, and GATA1, CCAR1, CoCoA and MED1 were recruited to the γ-globin promoter in K562 cells during erythroid differentiation. Therefore, in addition to the direct interaction between GATA1 and MED1, CoCoA and CCAR1 appear to relay the GATA1 signal to MED1, and multiple modes of the GATA1-MED1 axis may help to fine-tune GATA1 function during GATA1-mediated homeostasis events. © 2013 The Authors Genes to Cells © 2013 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd.

Genome-wide association analysis of red blood cell traits in African Americans: the COGENT Network

PubMed Central

Chen, Zhao; Tang, Hua; Qayyum, Rehan; Schick, Ursula M.; Nalls, Michael A.; Handsaker, Robert; Li, Jin; Lu, Yingchang; Yanek, Lisa R.; Keating, Brendan; Meng, Yan; van Rooij, Frank J.A.; Okada, Yukinori; Kubo, Michiaki; Rasmussen-Torvik, Laura; Keller, Margaux F.; Lange, Leslie; Evans, Michele; Bottinger, Erwin P.; Linderman, Michael D.; Ruderfer, Douglas M.; Hakonarson, Hakon; Papanicolaou, George; Zonderman, Alan B.; Gottesman, Omri; Thomson, Cynthia; Ziv, Elad; Singleton, Andrew B.; Loos, Ruth J.F.; Sleiman, Patrick M.A.; Ganesh, Santhi; McCarroll, Steven; Becker, Diane M.; Wilson, James G.; Lettre, Guillaume; Reiner, Alexander P.

2013-01-01

Laboratory red blood cell (RBC) measurements are clinically important, heritable and differ among ethnic groups. To identify genetic variants that contribute to RBC phenotypes in African Americans (AAs), we conducted a genome-wide association study in up to ∼16 500 AAs. The alpha-globin locus on chromosome 16pter [lead SNP rs13335629 in ITFG3 gene; P < 1E−13 for hemoglobin (Hgb), RBC count, mean corpuscular volume (MCV), MCH and MCHC] and the G6PD locus on Xq28 [lead SNP rs1050828; P < 1E − 13 for Hgb, hematocrit (Hct), MCV, RBC count and red cell distribution width (RDW)] were each associated with multiple RBC traits. At the alpha-globin region, both the common African 3.7 kb deletion and common single nucleotide polymorphisms (SNPs) appear to contribute independently to RBC phenotypes among AAs. In the 2p21 region, we identified a novel variant of PRKCE distinctly associated with Hct in AAs. In a genome-wide admixture mapping scan, local European ancestry at the 6p22 region containing HFE and LRRC16A was associated with higher Hgb. LRRC16A has been previously associated with the platelet count and mean platelet volume in AAs, but not with Hgb. Finally, we extended to AAs the findings of association of erythrocyte traits with several loci previously reported in Europeans and/or Asians, including CD164 and HBS1L-MYB. In summary, this large-scale genome-wide analysis in AAs has extended the importance of several RBC-associated genetic loci to AAs and identified allelic heterogeneity and pleiotropy at several previously known genetic loci associated with blood cell traits in AAs. PMID:23446634

Frequency and origin of haplotypes associated with the beta-globin gene cluster in individuals with trait and sickle cell anemia in the Atlantic and Pacific coastal regions of Colombia

PubMed Central

Fong, Cristian; Lizarralde-Iragorri, María Alejandra; Rojas-Gallardo, Diana; Barreto, Guillermo

2013-01-01

Sickle cell anemia is a genetic disease with high prevalence in people of African descent. There are five typical haplotypes associated with this disease and the haplotypes associated with the beta-globin gene cluster have been used to establish the origin of African-descendant people in America. In this work, we determined the frequency and the origin of haplotypes associated with hemoglobin S in a sample of individuals with sickle cell anemia (HbSS) and sickle cell hemoglobin trait (HbAS) in coastal regions of Colombia. Blood samples from 71 HbAS and 79 HbSS individuals were obtained. Haplotypes were determined based on the presence of variable restriction sites within the β-globin gene cluster. On the Pacific coast of Colombia the most frequent haplotype was Benin, while on the Atlantic coast Bantu was marginally higher than Benin. Eight atypical haplotypes were observed on both coasts, being more diverse in the Atlantic than in the Pacific region. These results suggest a differential settlement of the coasts, dependent on where slaves were brought from, either from the Gulf of Guinea or from Angola, where the haplotype distributions are similar. Atypical haplotypes probably originated from point mutations that lost or gained a restriction site and/or by recombination events. PMID:24385850

Combination of a triple alpha-globin gene with beta-thalassemia in a gypsy family: importance of the genetic testing in the diagnosis and search for a donor for bone marrow transplantation for one of their children.

PubMed

Yus Cebrian, Flor; Recasens Flores, María del Valle; Izquierdo Álvarez, Silvia; Parra Salinas, Ingrid; Rodriguez-Vigil Iturrate, Carmen

2016-04-14

The simultaneous presence of a heterozygous β-thalassemia with α-gene triplication may cause anything from a thalassemia trait to thalassemia intermedia of mild to moderate severity. An 8-month-old ethnic Gypsy male infant with failure to thrive from birth, mild jaundice and splenomegaly. Clinical signs were compatible with severe microcytic anemia requiring bi-monthly blood transfusions. The β-thalassemia gene analysis found homozygous mutation IVS-I-110 (G>A) (c.93-21G>A) in intron 1 of the hemoglobin beta globin gene and a non-pathogenic sequence variant (single nucleotide polimorfism (SNP) Rs1609812). In addition, the patient had α gene triplication (ααα(anti 3.7)/αα) caused by double heterozygosity for a 3.7 kb fragment that contained only the hemoglobin alpha globin gene-2 gene. This finding led to screening and follow up in first-degree relatives, twin brothers and a sister and parents to provide them with appropriate genetic counseling. Nowadays, new horizons could open a new therapeutic management until definitive cure of these diseases through gene therapy or mutation-specific genome editing. Genetic testing can provide an early diagnosis and facilitates the search for a suitable donor for transplantation.

Interaction of hemoglobin Grey Lynn (Vientiane) with a non-deletional α(+)-thalassemia in an adult Thai proband.

PubMed

Singha, Kritsada; Fucharoen, Goonnapa; Fucharoen, Supan

2014-01-01

Hemoglobin (Hb) Grey Lynn is a Hb variant caused by a substitution of Phe for Leu at position 91 of α1-globin chain, originally described in individual of unknown ethnic background. This article addresses the interaction of Hb Grey Lynn with a non-deletional α(+)-thalassemia found in Thailand, a hitherto un-described condition. The proband was adult Thai woman referred for investigation of mild anemia with Hb 90 g/L. Hb analyses using low pressure liquid chromatography raised a suspicion of abnormal Hb presence, which was failed to demonstrate by cellulose acetate electrophoresis and capillary electrophoresis. DNA sequencing identified a CTT (Leu) to TTT (Phe) mutation at codon 91 corresponding to the Hb Grey Lynn (Vientiane) [α91(FG3)Leu>Phe (α1) on α1-globin gene and a C deletion between codons 36 and 37 on α2-globin gene causing α(+)-thalassemia. As compared to those observed in a compound heterozygote for Hb Grey Lynn / α(0)-thalassemia reported previously, higher MCV (81.7 fL) and MCH (26.3 pg) values with a lower level of Hb Grey Lynn (19.7%) were observed in the proband. The normochromic normocytic anemia observed could be due to the interaction of Hb Grey Lynn with α(+)-thalassemia. The two mutations could be identified using PCR-RFLP and allele-specific PCR assays developed.

Differences in Hematological Traits between High- and Low-Altitude Lizards (Genus Phrynocephalus)

PubMed Central

Lu, Songsong; Xin, Ying; Tang, Xiaolong; Yue, Feng; Wang, Huihui; Bai, Yucheng; Niu, Yonggang; Chen, Qiang

2015-01-01

Phrynocephalus erythrurus (Lacertilia: Agamidae) is considered to be the highest living reptile in the world (about 4500-5000 m above sea level), whereas Phrynocephalus przewalskii inhabits low altitudes (about 1000-1500 m above sea level). Here, we report the differences in hematological traits between these two different Phrynocephalus species. Compared with P. przewalskii, the results indicated that P. erythrurus own higher oxygen carrying capacity by increasing red blood cell count (RBC), hemoglobin concentration ([Hb]) and hematocrit (Hct) and these elevations could promote oxygen carrying capacity without disadvantage of high viscosity. The lower partial pressure of oxygen in arterial blood (PaO2) of P. erythrurus did not cause the secondary alkalosis, which may be attributed to an efficient pulmonary system for oxygen (O2) loading. The elevated blood-O2 affinity in P. erythrurus may be achieved by increasing intrinsic O2 affinity of isoHbs and balancing the independent effects of potential heterotropic ligands. We detected one α-globin gene and three β-globin genes with 1 and 33 amino acid substitutions between these two species, respectively. Molecular dynamics simulation results showed that amino acids substitutions in β-globin chains could lead to the elimination of hydrogen bonds in T-state Hb models of P. erythrurus. Based on the present data, we suggest that P. erythrurus have evolved an efficient oxygen transport system under the unremitting hypobaric hypoxia. PMID:25955247

Structural analysis of an oxygen-regulated diguanylate cyclase.

PubMed

Tarnawski, Miroslaw; Barends, Thomas R M; Schlichting, Ilme

2015-11-01

Cyclic di-GMP is a bacterial second messenger that is involved in switching between motile and sessile lifestyles. Given the medical importance of biofilm formation, there has been increasing interest in understanding the synthesis and degradation of cyclic di-GMPs and their regulation in various bacterial pathogens. Environmental cues are detected by sensing domains coupled to GGDEF and EAL or HD-GYP domains that have diguanylate cyclase and phosphodiesterase activities, respectively, producing and degrading cyclic di-GMP. The Escherichia coli protein DosC (also known as YddV) consists of an oxygen-sensing domain belonging to the class of globin sensors that is coupled to a C-terminal GGDEF domain via a previously uncharacterized middle domain. DosC is one of the most strongly expressed GGDEF proteins in E. coli, but to date structural information on this and related proteins is scarce. Here, the high-resolution structural characterization of the oxygen-sensing globin domain, the middle domain and the catalytic GGDEF domain in apo and substrate-bound forms is described. The structural changes between the iron(III) and iron(II) forms of the sensor globin domain suggest a mechanism for oxygen-dependent regulation. The structural information on the individual domains is combined into a model of the dimeric DosC holoprotein. These findings have direct implications for the oxygen-dependent regulation of the activity of the cyclase domain.

Generation of Mice Deficient in both KLF3/BKLF and KLF8 Reveals a Genetic Interaction and a Role for These Factors in Embryonic Globin Gene Silencing

PubMed Central

Funnell, Alister P. W.; Mak, Ka Sin; Twine, Natalie A.; Pelka, Gregory J.; Norton, Laura J.; Radziewic, Tania; Power, Melinda; Wilkins, Marc R.; Bell-Anderson, Kim S.; Fraser, Stuart T.; Perkins, Andrew C.; Tam, Patrick P.; Pearson, Richard C. M.

2013-01-01

Krüppel-like factors 3 and 8 (KLF3 and KLF8) are highly related transcriptional regulators that bind to similar sequences of DNA. We have previously shown that in erythroid cells there is a regulatory hierarchy within the KLF family, whereby KLF1 drives the expression of both the Klf3 and Klf8 genes and KLF3 in turn represses Klf8 expression. While the erythroid roles of KLF1 and KLF3 have been explored, the contribution of KLF8 to this regulatory network has been unknown. To investigate this, we have generated a mouse model with disrupted KLF8 expression. While these mice are viable, albeit with a reduced life span, mice lacking both KLF3 and KLF8 die at around embryonic day 14.5 (E14.5), indicative of a genetic interaction between these two factors. In the fetal liver, Klf3 Klf8 double mutant embryos exhibit greater dysregulation of gene expression than either of the two single mutants. In particular, we observe derepression of embryonic, but not adult, globin expression. Taken together, these results suggest that KLF3 and KLF8 have overlapping roles in vivo and participate in the silencing of embryonic globin expression during development. PMID:23716600

Genetic dissection of the α-globin super-enhancer in vivo

PubMed Central

Hay, Deborah; Hughes, Jim R.; Rode, Christina; Li, Pik-Shan; Pennacchio, Len A.; Sloane-Stanley, Jacqueline A.; Ayyub, Helena; Butler, Sue; Sauka-Spengler, Tatjana; Gibbons, Richard J.; Smith, Andrew J.H.; Wood, William G.; Higgs, Douglas R.

2016-01-01

Many genes determining cell identity are regulated by clusters of mediator-bound enhancer elements collectively referred to as super-enhancers. These have been proposed to manifest higher-order properties important in development and disease. Here, we report a comprehensive functional dissection of one of the strongest putative super-enhancers in erythroid cells. By generating a series of mouse models, deleting each of the five regulatory elements of the α-globin super-enhancer singly and in informative combinations, we demonstrate that each constituent enhancer appears to act independently and in an additive fashion with respect to hematologic phenotype, gene expression, chromatin structure and chromosome conformation, without clear evidence of synergistic or higher-order effects. Our study highlights the importance of functional genetic analyses for the identification of new concepts in transcriptional regulation. PMID:27376235

Customizing the genome as therapy for the β-hemoglobinopathies

PubMed Central

Canver, Matthew C.

2016-01-01

Despite nearly complete understanding of the genetics of the β-hemoglobinopathies for several decades, definitive treatment options have lagged behind. Recent developments in technologies for facile manipulation of the genome (zinc finger nucleases, transcription activator-like effector nucleases, or clustered regularly interspaced short palindromic repeats–based nucleases) raise prospects for their clinical application. The use of genome-editing technologies in autologous CD34+ hematopoietic stem and progenitor cells represents a promising therapeutic avenue for the β-globin disorders. Genetic correction strategies relying on the homology-directed repair pathway may repair genetic defects, whereas genetic disruption strategies relying on the nonhomologous end joining pathway may induce compensatory fetal hemoglobin expression. Harnessing the power of genome editing may usher in a second-generation form of gene therapy for the β-globin disorders. PMID:27053533

Hemoglobin stability: observations on the denaturation of normal and abnormal hemoglobins by oxidant dyes, heat, and alkali

PubMed Central

Rieder, Ronald F.

1970-01-01

Several unstable mutant hemoglobins have alterations which affect areas of the molecule involved in the attachment of heme to globin. Loss of heme from globin has been demonstrated during the denaturation of some of these unstable mutants. The importance of heme ligands for the stability of hemoglobin was illustrated in the present experiments on the denaturation of several hemoglobins and hemoglobin derivatives by heat, oxidative dyes, and alkali. Heating of normal hemolysates diluted to 4 g of hemoglobin per 100 ml at 50°C for 20 hr in 0.05 M sodium phosphate, pH 7.4, caused precipitation of 23-54% of the hemoglobin. Dialysis against water or dilution of the sample decreased denaturation to 12-20%. Precipitation was decreased to less than 3.5% by the presence of 0.015 M potassium cyanide. Increasing the ionic strength of the medium increased precipitation. Cyanide prevented the formation of inclusion bodies when red cells containing unstable hemoglobin Philly, β35 tyr → phe, were incubated with the redox dye new methylene blue. Conversion to methemoglobin increased the rate of alkali denaturation of hemoglobin but the presence of potassium cyanide returned the denaturation rate to that of ferrohemoglobin. The ability of cyanide to decrease heat precipitation of hemoglobin may depend on a dimeric or tetrameric state of the hemoglobin molecule. Purified β-chains, which exist as tetramers, were stabilized but purified monomeric α-chains were not rendered more heat resistant by the ligand. Stabilization of hemoglobin by cyanide required binding of the ligand to only one heme of an αβ-dimer. Hemoglobin Gun Hill, an unstable molecule with heme groups present only on the α-chains was quite heat stable in the presence of cyanide. The binding of cyanide to the iron atom in methemoglobin is thought to be associated with increased planarity of the heme group and increased stability of the heme-globin complex. The stabilizing effect of cyanide in the above experiments suggests that Heinz body formation, heat precipitation of hemoglobin, and the increased alkali denaturation of methemoglobin depend on changes of heme-globin binding. Images PMID:5480860

Hematopoietic stem cell transplantation for people with ß-thalassaemia major.

PubMed

Jagannath, Vanitha A; Fedorowicz, Zbys; Al Hajeri, Amani; Sharma, Akshay

2014-10-15

Thalassemia is an inherited blood disorder, caused by mutations in regulatory genes and transmitted as an autosomal recessive disorder, which results in a reduced rate of synthesis of one of the globin chains that make up haemoglobin. In ß-thalassaemia major there is an underproduction of ß-globin chains combined with excess of free α-globin chains. The excess free α-globin chains damage the red blood cell membranes, leading to their destruction and a phenomenon termed ineffective erythropoiesis. The conventional approach to treatment is based on the correction of haemoglobin status through regular blood transfusions and iron chelation therapy for iron overload. Although conventional treatment has the capacity to improve the quality of life of people with ß-thalassaemia major, allogeneic hematopoietic stem cell transplantation is the only currently available procedure which has the potential to definitively cure the disease. To evaluate the effectiveness and safety of different types of allogeneic hematopoietic stem cell transplantation, in people with severe transfusion-dependant ß-thalassaemia major, ß-thalassaemia intermedia or ß0/+- thalassaemia variants requiring chronic blood transfusion. We searched the Cochrane Cystic Fibrosis and Genetic Disorders Group Haemoglobinopathies Trials Register comprising references identified from comprehensive electronic database searches and handsearches of relevant journals and abstract books of conference proceedings.Date of the most recent search: 11 November 2013. Randomised controlled trials and quasi-randomised controlled trials comparing allogeneic hematopoietic stem cell transplantation with each other or with standard therapy (regular transfusion and chelation regimen). Two review authors independently screened studies and had planned to extract data and assess risk of bias using standard Cochrane Collaboration methodologies but no studies were identified for inclusion. No relevant studies were retrieved after a comprehensive search of the literature. We were unable to identify any randomised controlled trials or quasi-randomised controlled trials on the effectiveness and safety of different types of allogeneic stem cell transplantation in people with severe transfusion-dependant ß-thalassaemia major or ß0/+- thalassaemia variants requiring chronic blood transfusion. The absence of high-level evidence for the effectiveness of these interventions emphasises the need for well-designed, adequately-powered, randomised controlled clinical trials.

Finding Order in Randomness: Single-Molecule Studies Reveal Stochastic RNA Processing | Center for Cancer Research

Cancer.gov

Producing a functional eukaryotic messenger RNA (mRNA) requires the coordinated activity of several large protein complexes to initiate transcription, elongate nascent transcripts, splice together exons, and cleave and polyadenylate the 3’ end. Kinetic competition between these various processes has been proposed to regulate mRNA maturation, but this model could lead to multiple, randomly determined, or stochastic, pathways or outcomes. Regulatory checkpoints have been suggested as a means of ensuring quality control. However, current methods have been unable to tease apart the contributions of these processes at a single gene or on a time scale that could provide mechanistic insight. To begin to investigate the kinetic relationship between transcription and splicing, Daniel Larson, Ph.D., of CCR’s Laboratory of Receptor Biology and Gene Expression, and his colleagues employed a single-molecule RNA imaging approach to monitor production and processing of a human β-globin reporter gene in living cells.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bank, A.; Anderson, W.F.; Zaino, E.C.

This book discusses the topics presented at the symposium on the subject of 'Thalassemia'. Sickle cell anemia is also briefly discussed. The aspects discussed are chromosomal defects of anemias particularly globin synthesis, and the role of messenger RNA and other chromosomes.

Genetic dissection of the α-globin super-enhancer in vivo

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hay, Deborah; Hughes, Jim R.; Babbs, Christian

Many genes determining cell identity are regulated by clusters of Mediator-bound enhancer elements collectively referred to as super-enhancers. Furthermore, these super-enhancers have been proposed to manifest higher-order properties important in development and disease. Here we report a comprehensive functional dissection of one of the strongest putative super-enhancers in erythroid cells. By generating a series of mouse models, deleting each of the five regulatory elements of the α-globin super-enhancer individually and in informative combinations, we demonstrate that each constituent enhancer seems to act independently and in an additive fashion with respect to hematological phenotype, gene expression, chromatin structure and chromosome conformation,more » without clear evidence of synergistic or higher-order effects. This study highlights the importance of functional genetic analyses for the identification of new concepts in transcriptional regulation.« less

Customizing the genome as therapy for the β-hemoglobinopathies.

PubMed

Canver, Matthew C; Orkin, Stuart H

2016-05-26

Despite nearly complete understanding of the genetics of the β-hemoglobinopathies for several decades, definitive treatment options have lagged behind. Recent developments in technologies for facile manipulation of the genome (zinc finger nucleases, transcription activator-like effector nucleases, or clustered regularly interspaced short palindromic repeats-based nucleases) raise prospects for their clinical application. The use of genome-editing technologies in autologous CD34(+) hematopoietic stem and progenitor cells represents a promising therapeutic avenue for the β-globin disorders. Genetic correction strategies relying on the homology-directed repair pathway may repair genetic defects, whereas genetic disruption strategies relying on the nonhomologous end joining pathway may induce compensatory fetal hemoglobin expression. Harnessing the power of genome editing may usher in a second-generation form of gene therapy for the β-globin disorders. © 2016 by The American Society of Hematology.

Genetic dissection of the α-globin super-enhancer in vivo

DOE PAGES

Hay, Deborah; Hughes, Jim R.; Babbs, Christian; ...

2016-07-04

Many genes determining cell identity are regulated by clusters of Mediator-bound enhancer elements collectively referred to as super-enhancers. Furthermore, these super-enhancers have been proposed to manifest higher-order properties important in development and disease. Here we report a comprehensive functional dissection of one of the strongest putative super-enhancers in erythroid cells. By generating a series of mouse models, deleting each of the five regulatory elements of the α-globin super-enhancer individually and in informative combinations, we demonstrate that each constituent enhancer seems to act independently and in an additive fashion with respect to hematological phenotype, gene expression, chromatin structure and chromosome conformation,more » without clear evidence of synergistic or higher-order effects. This study highlights the importance of functional genetic analyses for the identification of new concepts in transcriptional regulation.« less

[RDBH-method and big DyeTM terminator technology in accurate diagnosis of β-thalassemia and the allelic polymorphism of β-globin cluster].

PubMed

Akperova, G A

2014-11-01

IThe purpose of this study was to evaluate of the efficiency of RDBH-method and Big DyeTM Terminator technology in an accurate diagnosis of β-thalassemia and the allelic polymorphism of β-globin cluster. It was done a complete hematology analysis (HB, MCH, MCV, MCHC, RBC, Hct, HbA2, HbF, Serum iron, Serum ferritin at four children (males, 6-10 years old) and their parents. Molecular analysis included Reverse Dot-Blot Hybridization StripAssay (RDBH) and DNA sequencing on ABI PRISM Big DyeTM Terminator. Hematologic and molecular parameters were contradictory. The homozygosity for β0-thalassemia (β0IVS2.1[G>A] and β0codon 8[-AA]) at three boys with the mild clinical manifestation and heterozygosity of their parents for mutations, and the absence of β-globin mutations at parents and a boy who holds monthly transfusion was established by RDBH-analysis. DNA sequencing by technology Big DyeTM Terminator showed polymorphism at positions -551 and -521 of Cap5'-region (-650-250) - (AT)7(T)7 and (AT)8(T)5. Application of the integrated clinical-molecular approach is an ideal method for an accurate diagnosis, identification of asymptomatic carriers and a reduce of the risk of complications from β-thalassemia, moreover screening of γG-gene and the level of fetal hemoglobin in early childhood will help manage of β-thalassemia clinic and prevent heavy consequences of the disease.

Insulation of the Chicken β-Globin Chromosomal Domain from a Chromatin-Condensing Protein, MENT

PubMed Central

Istomina, Natalia E.; Shushanov, Sain S.; Springhetti, Evelyn M.; Karpov, Vadim L.; A. Krasheninnikov, Igor; Stevens, Kimberly; Zaret, Kenneth S.; Singh, Prim B.; Grigoryev, Sergei A.

2003-01-01

Active genes are insulated from developmentally regulated chromatin condensation in terminally differentiated cells. We mapped the topography of a terminal stage-specific chromatin-condensing protein, MENT, across the active chicken β-globin domain. We observed two sharp transitions of MENT concentration coinciding with the β-globin boundary elements. The MENT distribution profile was opposite to that of acetylated core histones but correlated with that of histone H3 dimethylated at lysine 9 (H3me2K9). Ectopic MENT expression in NIH 3T3 cells caused a large-scale and specific remodeling of chromatin marked by H3me2K9. MENT colocalized with H3me2K9 both in chicken erythrocytes and NIH 3T3 cells. Mutational analysis of MENT and experiments with deacetylase inhibitors revealed the essential role of the reaction center loop domain and an inhibitory affect of histone hyperacetylation on the MENT-induced chromatin remodeling in vivo. In vitro, the elimination of the histone H3 N-terminal peptide containing lysine 9 by trypsin blocked chromatin self-association by MENT, while reconstitution with dimethylated but not acetylated N-terminal domain of histone H3 specifically restored chromatin self-association by MENT. We suggest that histone H3 modification at lysine 9 directly regulates chromatin condensation by recruiting MENT to chromatin in a fashion that is spatially constrained from active genes by gene boundary elements and histone hyperacetylation. PMID:12944473

Creating a monomeric endonuclease TALE-I-SceI with high specificity and low genotoxicity in human cells.

PubMed

Lin, Jianfei; Chen, He; Luo, Ling; Lai, Yongrong; Xie, Wei; Kee, Kehkooi

2015-01-01

To correct a DNA mutation in the human genome for gene therapy, homology-directed repair (HDR) needs to be specific and have the lowest off-target effects to protect the human genome from deleterious mutations. Zinc finger nucleases, transcription activator-like effector nuclease (TALEN) and CRISPR-CAS9 systems have been engineered and used extensively to recognize and modify specific DNA sequences. Although TALEN and CRISPR/CAS9 could induce high levels of HDR in human cells, their genotoxicity was significantly higher. Here, we report the creation of a monomeric endonuclease that can recognize at least 33 bp by fusing the DNA-recognizing domain of TALEN (TALE) to a re-engineered homing endonuclease I-SceI. After sequentially re-engineering I-SceI to recognize 18 bp of the human β-globin sequence, the re-engineered I-SceI induced HDR in human cells. When the re-engineered I-SceI was fused to TALE (TALE-ISVB2), the chimeric endonuclease induced the same HDR rate at the human β-globin gene locus as that induced by TALEN, but significantly reduced genotoxicity. We further demonstrated that TALE-ISVB2 specifically targeted at the β-globin sequence in human hematopoietic stem cells. Therefore, this monomeric endonuclease has the potential to be used in therapeutic gene targeting in human cells. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Comparison of MicroRNAs Mediated in Reactivation of the γ-Globin in β-Thalassemia Patients, Responders and Non-Responders to Hydroxyurea.

PubMed

Hojjati, Mohammad T; Azarkeivan, Azita; Pourfathollah, Ali A; Amirizadeh, Naser

2017-03-01

Drug induction of Hb F seems to be an ideal therapy for patients with hemoglobin (Hb) disorders, and many efforts have been made to reveal the mechanism behind it. Thus, we examined in vivo expression of some microRNAs (miRNAs) that are thought to be involved in this process. Among β-thalassemia (β-thal) patients who were undergoing hydroxyurea (HU) therapy in the past 3 months and five healthy individuals, five responders and five non-responders, were also included in the study. Erythroid progenitors were isolated by magnetic activated cell sorting (MACS) and miRNA expression analyzed using reverse transcription-polymerase chain reaction (RT-PCR). We showed that γ-globin, miR-210 and miR-486-3p had higher levels in the responders than the non-responders group. Moreover, miR-150 and miR-320 had higher levels in the healthy group than both non-responders and responders groups, but the expression of miR-96 did not show any significant difference between the study groups. To the best of our knowledge, this is the first study proposing that 'induction of cellular hypoxic condition by Hb F inducing agents' could be the milestone of possible mechanisms that explain why responders are able to reactivate γ-globin genes and subsequently, more production of Hb F, in response to these agents in comparison to non-responders. However, further investigations need to be performed to verify this hypothesis.

Iron-heme-Bach1 axis is involved in erythroblast adaptation to iron deficiency.

PubMed

Kobayashi, Masahiro; Kato, Hiroki; Hada, Hiroshi; Itoh-Nakadai, Ari; Fujiwara, Tohru; Muto, Akihiko; Inoguchi, Yukihiro; Ichiyanagi, Kenji; Hojo, Wataru; Tomosugi, Naohisa; Sasaki, Hiroyuki; Harigae, Hideo; Igarashi, Kazuhiko

2017-03-01

Iron plays the central role in oxygen transport by erythrocytes as a constituent of heme and hemoglobin. The importance of iron and heme is also to be found in their regulatory roles during erythroblast maturation. The transcription factor Bach1 may be involved in their regulatory roles since it is deactivated by direct binding of heme. To address whether Bach1 is involved in the responses of erythroblasts to iron status, low iron conditions that induced severe iron deficiency in mice were established. Under iron deficiency, extensive gene expression changes and mitophagy disorder were induced during maturation of erythroblasts. Bach1 -/- mice showed more severe iron deficiency anemia in the developmental phase of mice and a retarded recovery once iron was replenished when compared with wild-type mice. In the absence of Bach1, the expression of globin genes and Hmox1 (encoding heme oxygenase-1) was de-repressed in erythroblasts under iron deficiency, suggesting that Bach1 represses these genes in erythroblasts under iron deficiency to balance the levels of heme and globin. Moreover, an increase in genome-wide DNA methylation was observed in erythroblasts of Bach1 -/- mice under iron deficiency. These findings reveal the principle role of iron as a regulator of gene expression in erythroblast maturation and suggest that the iron-heme-Bach1 axis is important for a proper adaptation of erythroblast to iron deficiency to avoid toxic aggregates of non-heme globin. Copyright© Ferrata Storti Foundation.

4,4',5'-trimethyl-8-azapsoralen, a new-photoreactive and non-skin-phototoxic bifunctional bioisoster of psoralen.

PubMed

Vedaldi, D; Dall'Acqua, F; Caffieri, S; Baccichetti, F; Carlassare, F; Bordin, F; Chilin, A; Guiotto, A

1991-01-01

Photochemical and photobiological properties of a new isoster of psoralen, 4,4',5'-trimethyl-8-azapsoralen (4,4',5'-TMAP), have been studied. This compound shows a high DNA-photobinding rate, higher than that of 8-methoxypsoralen (8-MOP), forming both monoadducts and inter-strand cross-links. The yield of cross-links, however, is markedly lower than that of 8-MOP. Antiproliferative activity of 4,4',5'-TMAP, in terms of DNA synthesis inhibition in Ehrlich ascites tumor cells, is higher than that of 8-MOP. Mutagenic activity on E. coli WP2 R46+ cells appeared similar to or even lower than that of 8-MOP. This new compound applied on depilated guinea pig skin and irradiated with UVA did not show any skin-phototoxicity. On the basis of these properties 4,4',5'-TMAP appears to be a potential photochemotherapeutic agent.

Genetics Home Reference: methemoglobinemia, beta-globin type

MedlinePlus

... American Society of Hematology Resource List from the University of Kansas Medical Center: ... Melarkode K, Prinzhausen H. Hemoglobin M variant and congenital methemoglobinemia: methylene blue will not be effective in the presence of hemoglobin M. Can J ...

Heterozygous Hb Hope [beta136(H14)Gly --> Asp] in association with heterozygous beta0-thalassemia with apparent homozygous expression, in a Spanish patient.

PubMed

Beneitez, David; Carrera, Alícia; Duran-Suárez, Joan Ramón; Paz, Victoria; León, Antonio; García Talavera, Juan

2006-01-01

Hb Hope [beta136(H14)Gly --> Asp (GGT --> GAT)] has been found alone or in combination with other globin gene mutations in several African-American families, as well as in Japanese, Thai, Laotian, Cuban and Mauritanian families. We report the hematological and molecular characteristics of a heterozygous association of Hb Hope with beta0-thalassemia (thal) in a Spanish patient, in whom the level of expression of abnormal hemoglobin (Hb) by cation exchange high performance liquid chromatography (HPLC) and electrophoresis suggested initially a homozygous expression of the abnormal Hb, although sequencing of the polymerase chain reaction (PCR)-amplified beta-globin gene demonstrated a heterozygous genotype for Hb Hope. To the best of our knowledge, this is the first description of a case of Hb Hope in a Spanish family.

Beta-globin gene cluster haplotypes of Amerindian populations from the Brazilian Amazon region.

PubMed

Guerreiro, J F; Figueiredo, M S; Zago, M A

1994-01-01

We have determined the beta-globin cluster haplotypes for 80 Indians from four Brazilian Amazon tribes: Kayapó, Wayampí, Wayana-Apalaí, and Arára. The results are analyzed together with 20 Yanomámi previously studied. From 2 to 4 different haplotypes were identified for each tribe, and 7 of the possible 32 haplotypes were found in a sample of 172 chromosomes for which the beta haplotypes were directly determined or derived from family studies. The haplotype distribution does not differ significantly among the five populations. The two most common haplotypes in all tribes were haplotypes 2 and 6, with average frequencies of 0.843 and 0.122, respectively. The genetic affinities between Brazilian Indians and other human populations were evaluated by estimates of genetic distance based on haplotype data. The lowest values were observed in relation to Asians, especially Chinese, Polynesians, and Micronesians.

Genetic association studies in β-hemoglobinopathies.

PubMed

Thein, Swee Lay

2013-01-01

Characterization of the molecular basis of the β-thalassemias and sickle cell disease (SCD) clearly showed that individuals with the same β-globin genotypes can have extremely diverse clinical severity. Two key modifiers, an innate ability to produce fetal hemoglobin and coinheritance of α-thalassemia, both derived from family and population studies, affect the pathophysiology of both disorders at the primary level. In the past 2 decades, scientific research had applied genetic approaches to identify additional genetic modifiers. The review summarizes recent genetic studies and key genetic modifiers identified and traces the story of fetal hemoglobin genetics, which has led to an emerging network of globin gene regulation. The discoveries have provided insights on new targets for therapeutic intervention and raise possibilities of developing fetal hemoglobin predictive diagnostics for predicting disease severity in the newborn and for integration into prenatal diagnosis to better inform genetic counseling.

Systematic documentation and analysis of human genetic variation in hemoglobinopathies using the microattribution approach.

PubMed

Giardine, Belinda; Borg, Joseph; Higgs, Douglas R; Peterson, Kenneth R; Philipsen, Sjaak; Maglott, Donna; Singleton, Belinda K; Anstee, David J; Basak, A Nazli; Clark, Barnaby; Costa, Flavia C; Faustino, Paula; Fedosyuk, Halyna; Felice, Alex E; Francina, Alain; Galanello, Renzo; Gallivan, Monica V E; Georgitsi, Marianthi; Gibbons, Richard J; Giordano, Piero C; Harteveld, Cornelis L; Hoyer, James D; Jarvis, Martin; Joly, Philippe; Kanavakis, Emmanuel; Kollia, Panagoula; Menzel, Stephan; Miller, Webb; Moradkhani, Kamran; Old, John; Papachatzopoulou, Adamantia; Papadakis, Manoussos N; Papadopoulos, Petros; Pavlovic, Sonja; Perseu, Lucia; Radmilovic, Milena; Riemer, Cathy; Satta, Stefania; Schrijver, Iris; Stojiljkovic, Maja; Thein, Swee Lay; Traeger-Synodinos, Jan; Tully, Ray; Wada, Takahito; Waye, John S; Wiemann, Claudia; Zukic, Branka; Chui, David H K; Wajcman, Henri; Hardison, Ross C; Patrinos, George P

2011-03-20

We developed a series of interrelated locus-specific databases to store all published and unpublished genetic variation related to hemoglobinopathies and thalassemia and implemented microattribution to encourage submission of unpublished observations of genetic variation to these public repositories. A total of 1,941 unique genetic variants in 37 genes, encoding globins and other erythroid proteins, are currently documented in these databases, with reciprocal attribution of microcitations to data contributors. Our project provides the first example of implementing microattribution to incentivise submission of all known genetic variation in a defined system. It has demonstrably increased the reporting of human variants, leading to a comprehensive online resource for systematically describing human genetic variation in the globin genes and other genes contributing to hemoglobinopathies and thalassemias. The principles established here will serve as a model for other systems and for the analysis of other common and/or complex human genetic diseases.

Point mutations which should not be overlooked in Hb H disease.

PubMed

Farashi, Samaneh; Bayat, Nooshin; Vakili, Shadi; Faramarzi Garous, Negin; Ashki, Mehri; Imanian, Hashem; Najmabadi, Hossein; Azarkeivan, Azita

2016-01-01

Hb H disease is an alpha-thalassemia (α-thal) syndrome characterized by chronic hemolytic anemia that occurs when three of total four α-globin genes lost their function due to completely deletions or different kind of mutations. We here described 66 patients who have been diagnosed for Hb H disease during the last five years in our center. The genotypes involving point mutations present more severe phenotype than deletional forms that make them of primary important to health management. Hb H subjects carry different α-globin genotypes including deletional and non-deletional mutations showing heterogenous clinical manifestations. The Hb H patients presenting a wide range of phenotype carried different deletional, non-deletional mutations or compound heterozygosity of them. We emphasize the importance of some point mutations responsible for more severe form of Hb H disease in Iranian population and the necessity for consideration of prenatal diagnosis (PND) in high-risk couples.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Filon, D.; Oron, V.; Krichevski, S.

The authors characterized nearly 500 [beta]-thalassemia genes from the Israeli population representing a variety of ethnic subgroups. They found 28 different mutations in the [beta]-globin gene, including three mutations ([beta][sup S], [beta][sup C], and [beta][sup O-Arab]) causing hemoglobinopathies. Marked genetic heterogeneity was observed in both the Arab (20 mutations) and Jewish (17 mutations) populations. On the other hand, two ethnic isolates - Druze and Samaritans - had a single mutation each. Fifteen of the [beta]-thalassemia alleles are Mediterranean in type, 5 originated in Kurdistan, 2 are of Indian origin, and 2 sporadic alleles came from Europe. Only one mutant allele-nonsensemore » codon 37-appears to be indigenous to Israel. While human habitation in Israel dates back to early prehistory, the present-day spectrum of [beta]-globin mutations can be largely explained by migration events that occurred in the past millennium. 26 refs., 2 figs., 3 tabs.« less

Contribution of Long-Range Interactions to the Secondary Structure of an Unfolded Globin

PubMed Central

Fedyukina, Daria V.; Rajagopalan, Senapathy; Sekhar, Ashok; Fulmer, Eric C.; Eun, Ye-Jin; Cavagnero, Silvia

2010-01-01

This work explores the effect of long-range tertiary contacts on the distribution of residual secondary structure in the unfolded state of an α-helical protein. N-terminal fragments of increasing length, in conjunction with multidimensional nuclear magnetic resonance, were employed. A protein representative of the ubiquitous globin fold was chosen as the model system. We found that, while most of the detectable α-helical population in the unfolded ensemble does not depend on the presence of the C-terminal region (corresponding to the native G and H helices), specific N-to-C long-range contacts between the H and A-B-C regions enhance the helical secondary structure content of the N terminus (A-B-C regions). The simple approach introduced here, based on the evaluation of N-terminal polypeptide fragments of increasing length, is of general applicability to identify the influence of long-range interactions in unfolded proteins. PMID:20816043

Transcriptional regulation of fetal to adult hemoglobin switching: new therapeutic opportunities

PubMed Central

Wilber, Andrew; Nienhuis, Arthur W.

2011-01-01

In humans, embryonic, fetal, and adult hemoglobins are sequentially expressed in developing erythroblasts during ontogeny. For the past 40 years, this process has been the subject of intensive study because of its value to enlighten the biology of developmental gene regulation and because fetal hemoglobin can significantly ameliorate the clinical manifestations of both sickle cell disease and β-thalassemia. Understanding the normal process of loss of fetal globin expression and activation of adult globin expression could potentially lead to new therapeutic approaches for these hemoglobin disorders. Herein, we briefly review the history of the study of hemoglobin switching and then focus on recent discoveries in the field that now make new therapeutic approaches seem feasible in the future. Erythroid-specific knockdown of fetal gene repressors or enforced expression of fetal gene activators may provide clinically applicable approaches for genetic treatment of hemoglobin disorders that would benefit from increased fetal hemoglobin levels. PMID:21321359

Translational Control of Hemoglobin Synthesis by an Initiation Factor Required for Recycling of Ribosomes and for their Binding to Messenger RNA

PubMed Central

Kaempfer, Raymond; Kaufman, Jennifer

1972-01-01

The continued recycling of ribosomes during protein synthesis in rabbit reticulocyte lysates at 37° requires an initiation factor whose activity is rapidly lost in the absence of added heme. Partially purified factor (i) fully maintains the polysomes; (ii) inhibits the association of 40S and 60S ribosomal subunits into single ribosomes; (iii) promotes the quantitative entry of added 60S subunits into polysomes; (iv) allows the accumulation of ribosomal subunits, instead of single ribosomes, when initiation is blocked with aurin tricarboxylate; and (v) is absolutely required for the binding of globin messenger RNA to ribosomes. These properties suggest that this mammalian initiation factor functions analogously to bacterial IF-3. In addition, the translational control of globin synthesis by heme is exerted, directly or indirectly, through this factor. PMID:4508325

Characterization of Nitrogen Mustard Formamidopyrimidine Adduct Formation of bis-(2-Chloroethyl)ethylamine with Calf Thymus DNA and a Human Mammary Cancer Cell Line

PubMed Central

Gruppi, Francesca; Hejazi, Leila; Christov, Plamen P.; Krishnamachari, Sesha; Turesky, Robert J.; Rizzo, Carmelo J.

2015-01-01

A robust, quantitative ultraperformance liquid chromatography ion trap multistage scanning mass spectrometric (UPLC/MS3) method was established to characterize and measure five deoxyguanosine (dG) adducts formed by reaction of the chemotherapeutic nitrogen mustard (NM) bis-(2-chloroethyl)ethylamine with calf thymus (CT) DNA. In addition to the known N7-guanine (NM-G) adduct and its crosslink (G-NM-G), the ring-opened formamidopyrimidine (FapyG) mono-adduct (NM-FapyG) and cross-links in which one (FapyG-NM-G) or both (FapyG-NM-FapyG) guanines underwent ring-opening to FapyG units were identified. Authentic standards of all adducts were synthesized and characterized by NMR and mass spectrometry. These adducts were quantified in CT DNA treated with NM (1 μM) as their deglycosylated bases. A two-stage neutral thermal hydrolysis was developed to mitigate the artifactual formation of ring-opened FapyG adducts involving hydrolysis of the cationic adduct at 37 °C, followed by hydrolysis of the FapyG adducts at 95 °C. The limit of quantification values ranged between 0.3 and 1.6 adducts per 107 DNA bases, when the equivalent of 5 μg DNA hydrolysate was assayed on column. The principal adduct formed was the G-NM-G cross-link, followed by the NM-G mono-adduct; the FapyG-NM-FapyG adduct was at the limit of detection. The NM-FapyG adducts formed in CT DNA at a level of ~20% that of the NM-G adduct. NM-FapyG has not been previously quanitified and the FapyG-NM-G and FapyG-NM-FapyG adducts have not be previously characterized. Our validated analytical method was then applied to measure DNA adduct formation in the MDA-MB-231 mammary tumor cell line exposed to NM (100 μM) for 24 h. The major adduct formed was NM-G (970 adducts per 107 bases), followed by G-NM-G (240 adducts per 107 bases) and NM-FapyG (180 adducts per 107 bases), and lastly the FapyG-NM-G cross-link adduct (6.0 adducts per 107 bases). These lesions are expected to contribute to the NM-mediated toxicity and genotoxicity in vivo. PMID:26285869

Differential structural status of the RNA counterpart of an undecamer quasi-palindromic DNA sequence present in LCR of human β-globin gene cluster.

PubMed

Kaushik, Mahima; Kukreti, Shrikant

2015-01-01

Our previous work on structural polymorphism shown at a single nucleotide polymorphism (SNP) (A → G) site located on HS4 region of locus control region (LCR) of β-globin gene has established a hairpin → duplex equilibrium corresponding to A → B like DNA transition (Kaushik M, Kukreti, R., Grover, D., Brahmachari, S.K. and Kukreti S. Nucleic Acids Res. 2003; Kaushik M, Kukreti S. Nucleic Acids Res. 2006). The G-allele of A → G SNP has been shown to be significantly associated with the occurrence of β-thalassemia. Considering the significance of this 11-nt long quasi-palindromic sequence [5'-TGGGG(G/A)CCCCA; HP(G/A)11] of β-globin gene LCR, we further explored the differential behavior of the same DNA sequence with its RNA counterpart, using various biophysical and biochemical techniques. In contrast to its DNA counterpart exhibiting a A → B structural transition and an equilibrium between duplex and hairpin forms, the studied RNA oligonucleotide sequence [5'-UGGGG(G/A)CCCCA; RHP(G/A)11] existed only in duplex form (A-conformation) and did not form hairpin. The single residue difference from A to G led to the unusual thermal stability of the RNA structure formed by the studied sequence. Since, naturally occurring mutations and various SNP sites may stabilize or destabilize the local DNA/RNA secondary structures, these structural transitions may affect the gene expression by a change in the protein-DNA recognition patterns.

Number and location of mouse mammary tumor virus proviral DNA in mouse DNA of normal tissue and of mammary tumors.

PubMed Central

Groner, B; Hynes, N E

1980-01-01

The Southern DNA filter transfer technique was used to characterize the genomic location of the mouse mammary tumor proviral DNA in different inbred strains of mice. Two of the strains (C3H and CBA) arose from a cross of a Bagg albino (BALB/c) mouse and a DBA mouse. The mouse mammary tumor virus-containing restriction enzyme DNA fragments of these strains had similar patterns, suggesting that the proviruses of these mice are in similar genomic locations. Conversely, the pattern arising from the DNA of the GR mouse, a strain genetically unrelated to the others, appeared different, suggesting that its mouse mammary tumor proviruses are located in different genomic sites. The structure of another gene, that coding for beta-globin, was also compared. The mice strains which we studied can be categorized into two classes, expressing either one or two beta-globin proteins. The macroenvironment of the beta-globin gene appeared similar among the mice strains belonging to one genetic class. Female mice of the C3H strain exogenously transmit mouse mammary tumor virus via the milk, and their offspring have a high incidence of mammary tumor occurrence. DNA isolated from individual mammary tumors taken from C3H mice or from BALB/c mice foster nursed on C3H mothers was analyzed by the DNA filter transfer technique. Additional mouse mammary tumor virus-containing fragments were found in the DNA isolated from each mammary tumor. These proviral sequences were integrated into different genomic sites in each tumor. Images PMID:6245257

Large-scale production of embryonic red blood cells from human embryonic stem cells.

PubMed

Olivier, Emmanuel N; Qiu, Caihong; Velho, Michelle; Hirsch, Rhoda Elison; Bouhassira, Eric E

2006-12-01

To develop a method to produce in culture large number of erythroid cells from human embryonic stem cells. Human H1 embryonic stem cells were differentiated into hematopoietic cells by coculture with a human fetal liver cell line, and the resulting CD34-positive cells were expanded in vitro in liquid culture using a three-step method. The erythroid cells produced were then analyzed by light microscopy and flow cytometry. Globin expression was characterized by quantitative reverse-transcriptase polymerase chain reaction and by high-performance liquid chromatography. CD34-positive cells produced from human embryonic stem cells could be efficiently differentiated into erythroid cells in liquid culture leading to a more than 5000-fold increase in cell number. The erythroid cells produced are similar to primitive erythroid cells present in the yolk sac of early human embryos and did not enucleate. They are fully hemoglobinized and express a mixture of embryonic and fetal globins but no beta-globin. We have developed an experimental protocol to produce large numbers of primitive erythroid cells starting from undifferentiated human embryonic stem cells. As the earliest human erythroid cells, the nucleated primitive erythroblasts, are not very well characterized because experimental material at this stage of development is very difficult to obtain, this system should prove useful to answer a number of experimental questions regarding the biology of these cells. In addition, production of mature red blood cells from human embryonic stem cells is of great potential practical importance because it could eventually become an alternate source of cell for transfusion.

Biophysical Characterisation of Neuroglobin of the Icefish, a Natural Knockout for Hemoglobin and Myoglobin. Comparison with Human Neuroglobin

PubMed Central

Giordano, Daniela; Boron, Ignacio; Abbruzzetti, Stefania; Van Leuven, Wendy; Nicoletti, Francesco P.; Forti, Flavio; Bruno, Stefano; Cheng, C-H. Christina; Moens, Luc; di Prisco, Guido; Nadra, Alejandro D.; Estrin, Darío; Smulevich, Giulietta; Dewilde, Sylvia; Viappiani, Cristiano; Verde, Cinzia

2012-01-01

The Antarctic icefish Chaenocephalus aceratus lacks the globins common to most vertebrates, hemoglobin and myoglobin, but has retained neuroglobin in the brain. This conserved globin has been cloned, over-expressed and purified. To highlight similarities and differences, the structural features of the neuroglobin of this colourless-blooded fish were compared with those of the well characterised human neuroglobin as well as with the neuroglobin from the retina of the red blooded, hemoglobin and myoglobin-containing, closely related Antarctic notothenioid Dissostichus mawsoni. A detailed structural and functional analysis of the two Antarctic fish neuroglobins was carried out by UV-visible and Resonance Raman spectroscopies, molecular dynamics simulations and laser-flash photolysis. Similar to the human protein, Antarctic fish neuroglobins can reversibly bind oxygen and CO in the Fe2+ form, and show six-coordination by distal His in the absence of exogenous ligands. A very large and structured internal cavity, with discrete docking sites, was identified in the modelled three-dimensional structures of the Antarctic neuroglobins. Estimate of the free-energy barriers from laser-flash photolysis and Implicit Ligand Sampling showed that the cavities are accessible from the solvent in both proteins. Comparison of structural and functional properties suggests that the two Antarctic fish neuroglobins most likely preserved and possibly improved the function recently proposed for human neuroglobin in ligand multichemistry. Despite subtle differences, the adaptation of Antarctic fish neuroglobins does not seem to parallel the dramatic adaptation of the oxygen carrying globins, hemoglobin and myoglobin, in the same organisms. PMID:23226490

Triplication of a four-gene set during evolution of the goat beta-globin locus produced three genes now expressed differentially during development.

PubMed Central

Townes, T M; Fitzgerald, M C; Lingrel, J B

1984-01-01

Distinct hemoglobins are synthesized in goats at different stages of development, similar to humans. Embryonic hemoglobins (zeta 2 epsilon 2 and alpha 2 epsilon 2) are synthesized initially and are followed sequentially by fetal (alpha 2 beta F2), preadult (alpha 2 beta C2), and adult (alpha 2 beta A2) hemoglobins. To help understand the basis of these switches, the genes of the beta-globin locus have been cloned and their linkage arrangement has been determined by the isolation of lambda phage carrying overlapping inserts of genomic goat DNA. The locus extends over 120 kilobase pairs and consists of 12 genes arranged in the following order: epsilon I-epsilon II-psi beta X-beta C-epsilon III-epsilon IV-psi beta Z-beta A-epsilon V-epsilon VI-psi beta Y-beta F. Comparison of the nucleotide sequence of the 12 genes shows that the locus is organized into three homologous four-gene sets that presumably evolved by the triplication of an ancestral set of four genes (epsilon-epsilon-psi beta-beta). Interestingly, the three genes (beta C, beta A, and beta F) located at the ends of the four-gene sets are expressed at different stages of development. Therefore, the goat beta F-, beta C-, and beta A-globin genes appear to have evolved by a mechanism that includes the triplication of 40-50 kilobase pairs of DNA and the recruitment of newly formed genes for expression in fetal, preadult, and adult life. PMID:6593719

Fever of unclear origin and cytopenia because of acute splenic sequestration in a young immunocompetent carrier of beta-globin mutation for Hb Valletta.

PubMed

Parrinello, Gaspare; Torres, Daniele; Paterna, Salvatore; Di Pasquale, Pietro; Licata, Giuseppe

2008-12-01

Fever of unclear origin is a clinical challenge in medical practice. Infectious diseases, neoplasms, and collagen vascular illnesses are its main causes in adults and children. Acute splenic sequestration crises, a known potentially fatal complication of sickle cell disease and sickle beta-thalassemia, are uncommon in beta-heterozygosis. We describe a case of prolonged recurrent episodes of fever with spontaneous resolution, commencing at age 10 in a 15-year-old boy with a history of hypochromic microcytic anemia attributed to a thalassemic trait. He was admitted twice to our university hospital for continuous-remittent fever with a pruritic, macular evanescent Still's skin rash, severe splenomegaly, leucopenia, thrombocytopenia, and sudden aggravation of anemia. Infectious, rheumatologic, autoimmune, and hematologic illnesses were excluded. A genetic-based study revealed heterozygosis of the beta-globin gene for a A>C (Thr>Pro) substitution at position 87 called Hemoglobin Valletta (alpha 2 beta 2 87 PRO) with a C>G transition in homozygosis in beta-globin intronic polymorphism intervening sequence 2 at nucleotide 745. After a follow-up period of 1 year without treatment, the young patient remains apyretic and in good general clinical health with persistent microcythemia and hepatosplenomegaly. Acute splenic sequestration crisis and related cytopenia may be an unusual complication of fever of unclear origin in a beta-thalassemic carrier of a Hemoglobin Valletta mutation and polymorphism in homozygosis of intervening sequence 2 at nucleotide 745. This hemoglobinopathy may predispose to a clinical phenotype of minor or intermediate thalassemia and, during a febrile illness, to hemoglobin instability and splenic sequestration.

Dietary determinants for Hb-acrylamide and Hb-glycidamide adducts in Danish non-smoking women.

PubMed

Outzen, Malene; Egeberg, Rikke; Dragsted, Lars; Christensen, Jane; Olesen, Pelle T; Frandsen, Henrik; Overvad, Kim; Tjønneland, Anne; Olsen, Anja

2011-05-01

Acrylamide (AA) is a probable human carcinogen that is formed in heat-treated carbohydrate-rich foods. The validity of FFQ to assess AA exposure has been questioned. The aim of the present cross-sectional study was to investigate dietary determinants of Hb-AA and Hb-glycidamide (GA) adducts. The study included 537 non-smoking women aged 50-65 years who participated in the Diet, Cancer and Health cohort (1993-97). At study baseline, blood samples and information on dietary and lifestyle variables obtained from self-administered questionnaires were collected. From blood samples, Hb-AA and Hb-GA in erythrocytes were analysed by liquid chromatography/MS/MS. Dietary determinants were evaluated by multiple linear regression analyses adjusted for age and smoking behaviour among ex-smokers. The median for Hb-AA was 35 pmol/g globin (5th percentile 17, 95th percentile 89) and for Hb-GA 21 pmol/g globin (5th percentile 8, 95th percentile 49). Of the dietary factors studied, intakes of coffee and chips were statistically significantly associated with a 4 % per 200 g/d (95 % CI 2, 7; P < 0·0001) and an 18 % per 5 g/d (95 % CI 6, 31; P = 0·002) higher Hb-AA, respectively. This model explained 17 % of the variation in Hb-AA. Intakes of coffee and biscuits/crackers were statistically significantly associated with a 3 % per 200 g/d (95 % CI 1, 6; P = 0·005) and 12 % per 10 g/d (95 % CI 3, 23; P = 0·01) higher Hb-GA, respectively. This model explained 12 % of the variation in Hb-GA. In conclusion, only a few dietary determinants of Hb-AA and Hb-GA were identified. Thus, the present study implies that dietary intake measured by an FFQ explains only to a limited extent the variation in Hb-AA and Hb-GA concentrations.

The developmental genetics of human hemoglobin.

PubMed

Weatherall, D J; Wood, W G; Jones, R W; Clegg, J B

1985-01-01

Clearly, it is impossible to combine the diverse information briefly outlined in this review to provide a coherent model of the regulation of globin gene expression during development. One of the great difficulties in this field is uncertainty as to whether the mutations which are associated with persistent gamma chain production or, for the matter, the experimental models which have been used to study the differential expression of the fetal and adult globin genes, have any real relevance to an understanding of the normal switching process. Probably they do, but only with respect to one aspect of what must be an extremely complex multi-step regulatory system. The consistent changes in chromatin and methylation state of the beta globin gene cluster which are associated with activation of the different gene loci at different stages of development provide an anatomical explanation for the activity of these loci but tell us nothing about their mode of regulation. However, the gene or chromosome transfer experiments suggest that there may be developmental-stage specific trans regulatory factors which may be involved in the regulation of these genes, presumably by interacting in some way with chromatin. This is a very promising lead. Equally interesting is the possibility that the upstream mutations which are being found in some of the forms of non-deletion HPFH could provide a clue as to the site of these interactions. Thus at least we have an indication of what might be the most productive area of investigation for trying to characterize the mechanisms of regulation at the chromosomal level. This may be as far as we can go in the immediate future. The central question remains, however. How is the differential expression of the globin genes during development actually timed? All we know at the moment is that it is related fairly closely to gestational age. The only experimental data relating to this question is derived from the sheep transplant model, and suggests that there might be some form of "developmental clock' built into the hemopoietic stem cell. Here we are in considerable difficulties because we don't have an obvious experimental model with which to analyze time-related events. None of the forms of HPFH is, strictly speaking, a heterochronic mutation.(ABSTRACT TRUNCATED AT 400 WORDS)

Hemoglobins, Hemorphins, and 11p15.5 Chromosomal Region in Cancer Biology and İmmunity with Special Emphasis for Brain Tumors.

PubMed

Altinoz, Meric Adil; Elmaci, Ilhan; Ince, Bahri; Ozpinar, Aysel; Sav, Aydin Murat

2016-05-01

In systemic cancers, increased hemolysis leads to extracellular hemoglobin (HB), and experimental studies have shown its provoking role on tumor growth and metastasis. However, investigations have shown that HB chains presented by tumor vascular pericytes or serum protein complexes of HB could also induce antitumor immunity, which may be harnessed to treat refractory cancers and brain tumors. Mounting recent evidence shows that expression of HBs is not restricted to erythrocytes and that HBs exist in the cells of lung and kidney, in macrophages, and in neurons and glia of the central nervous system (CNS). HBs mediate coping with hypoxia and free radical stress in normal and tumor cells, and they are increased in certain tumors including breast, lung, colon, and squamous cell cancers. Recent studies showed HBs in meningioma, in the cyst fluid of craniopharyngioma, in the cerebrospinal fluid (CSF) of pediatric patients with posterior fossa tumors, and in glioblastoma cell lines. Hemorphins, abundant brain peptides formed via HB-chain cleavage, exert opioid activity and antiproliferative and immunomodifier effects. Hence mutations in HBs may modify brain tumorigenesis via influencing hemorphins and perturbing regulations of immune surveillance and cell growth in the neuroectodermal tissues. The β-globin gene cluster resides in the chromosome region 11p15.5, harboring important immunity genes and IGF2, H19, PHLDA2/TSSC3, TRIM3, and SLC22A18 genes associated with cancers and gliomas. 11p15.5 is a prominent region subject to epigenetic regulation. Thus the β-globin loci may exert haplotypal interactions with these. Some clues support this theory. It is well established that iron load induces liver cancer in thalassemia major; however iron load-independent associations also exist. Enhanced rates of hematologic malignancies are associated with HB Lepore, association of hemoglobin E with cholangiocarcinoma, and enhanced gastric cancer rates in the thalassemia trait. In the African Herero population, a mutant form of δ-globin is very prevalent, and this population has higher rates of pediatric brain tumors. Globins are also expressed in healthy endothelia and in tumoral vessels, indicating potential involvement in angiogenesis. Studies on HBs and their cleavage peptides in cancers and brain tumors may lead to innovative treatment strategies. Georg Thieme Verlag KG Stuttgart · New York.

AN ENZYMATIC GLOBIN FROM A MARINE WORM. (R824776)

EPA Science Inventory

The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

Production of Gene-Corrected Adult Beta Globin Protein in Human Erythrocytes Differentiated from Patient iPSCs After Genome Editing of the Sickle Point Mutation.

PubMed

Huang, Xiaosong; Wang, Ying; Yan, Wei; Smith, Cory; Ye, Zhaohui; Wang, Jing; Gao, Yongxing; Mendelsohn, Laurel; Cheng, Linzhao

2015-05-01

Human induced pluripotent stem cells (iPSCs) and genome editing provide a precise way to generate gene-corrected cells for disease modeling and cell therapies. Human iPSCs generated from sickle cell disease (SCD) patients have a homozygous missense point mutation in the HBB gene encoding adult β-globin proteins, and are used as a model system to improve strategies of human gene therapy. We demonstrate that the CRISPR/Cas9 system designer nuclease is much more efficient in stimulating gene targeting of the endogenous HBB locus near the SCD point mutation in human iPSCs than zinc finger nucleases and TALENs. Using a specific guide RNA and Cas9, we readily corrected one allele of the SCD HBB gene in human iPSCs by homologous recombination with a donor DNA template containing the wild-type HBB DNA and a selection cassette that was subsequently removed to avoid possible interference of HBB transcription and translation. We chose targeted iPSC clones that have one corrected and one disrupted SCD allele for erythroid differentiation assays, using an improved xeno-free and feeder-free culture condition we recently established. Erythrocytes from either the corrected or its parental (uncorrected) iPSC line were generated with similar efficiencies. Currently ∼6%-10% of these differentiated erythrocytes indeed lacked nuclei, characteristic of further matured erythrocytes called reticulocytes. We also detected the 16-kDa β-globin protein expressed from the corrected HBB allele in the erythrocytes differentiated from genome-edited iPSCs. Our results represent a significant step toward the clinical applications of genome editing using patient-derived iPSCs to generate disease-free cells for cell and gene therapies. Stem Cells 2015;33:1470-1479. © 2015 AlphaMed Press.

Running exercise alleviates trabecular bone loss and osteopenia in hemizygous β-globin knockout thalassemic mice.

PubMed

Thongchote, Kanogwun; Svasti, Saovaros; Teerapornpuntakit, Jarinthorn; Krishnamra, Nateetip; Charoenphandhu, Narattaphol

2014-06-15

A marked decrease in β-globin production led to β-thalassemia, a hereditary anemic disease associated with bone marrow expansion, bone erosion, and osteoporosis. Herein, we aimed to investigate changes in bone mineral density (BMD) and trabecular microstructure in hemizygous β-globin knockout thalassemic (BKO) mice and to determine whether endurance running (60 min/day, 5 days/wk for 12 wk in running wheels) could effectively alleviate bone loss in BKO mice. Both male and female BKO mice (1-2 mo old) showed growth retardation as indicated by smaller body weight and femoral length than their wild-type littermates. A decrease in BMD was more severe in female than in male BKO mice. Bone histomorphometry revealed that BKO mice had decreases in trabecular bone volume, trabecular number, and trabecular thickness, presumably due to suppression of osteoblast-mediated bone formation and activation of osteoclast-mediated bone resorption, the latter of which was consistent with elevated serum levels of osteoclastogenic cytokines IL-1α and -1β. As determined by peripheral quantitative computed tomography, running increased cortical density and thickness in the femoral and tibial diaphyses of BKO mice compared with those of sedentary BKO mice. Several histomorphometric parameters suggested an enhancement of bone formation (e.g., increased mineral apposition rate) and suppression of bone resorption (e.g., decreased osteoclast surface), which led to increases in trabecular bone volume and trabecular thickness in running BKO mice. In conclusion, BKO mice exhibited pervasive osteopenia and impaired bone microstructure, whereas running exercise appeared to be an effective intervention in alleviating bone microstructural defect in β-thalassemia. Copyright © 2014 the American Physiological Society.

Genome-wide association study of red blood cell traits in Hispanics/Latinos: The Hispanic Community Health Study/Study of Latinos

PubMed Central

Morrison, Jean V.; Brown, Lisa; Schurmann, Claudia; Chen, Diane D.; Liu, Yong Mei; Auer, Paul L.; Taylor, Kent D.; Papanicolaou, George; Kurita, Ryo; Nakamura, Yukio; Loos, Ruth J. F.; North, Kari E.; Thornton, Timothy A.; Pankratz, Nathan; Bauer, Daniel E.

2017-01-01

Prior GWAS have identified loci associated with red blood cell (RBC) traits in populations of European, African, and Asian ancestry. These studies have not included individuals with an Amerindian ancestral background, such as Hispanics/Latinos, nor evaluated the full spectrum of genomic variation beyond single nucleotide variants. Using a custom genotyping array enriched for Amerindian ancestral content and 1000 Genomes imputation, we performed GWAS in 12,502 participants of Hispanic Community Health Study and Study of Latinos (HCHS/SOL) for hematocrit, hemoglobin, RBC count, RBC distribution width (RDW), and RBC indices. Approximately 60% of previously reported RBC trait loci generalized to HCHS/SOL Hispanics/Latinos, including African ancestral alpha- and beta-globin gene variants. In addition to the known 3.8kb alpha-globin copy number variant, we identified an Amerindian ancestral association in an alpha-globin regulatory region on chromosome 16p13.3 for mean corpuscular volume and mean corpuscular hemoglobin. We also discovered and replicated three genome-wide significant variants in previously unreported loci for RDW (SLC12A2 rs17764730, PSMB5 rs941718), and hematocrit (PROX1 rs3754140). Among the proxy variants at the SLC12A2 locus we identified rs3812049, located in a bi-directional promoter between SLC12A2 (which encodes a red cell membrane ion-transport protein) and an upstream anti-sense long-noncoding RNA, LINC01184, as the likely causal variant. We further demonstrate that disruption of the regulatory element harboring rs3812049 affects transcription of SLC12A2 and LINC01184 in human erythroid progenitor cells. Together, these results reinforce the importance of genetic study of diverse ancestral populations, in particular Hispanics/Latinos. PMID:28453575

Plant hemoglobins may be maintained in functional form by reduced flavins in the nuclei, and confer differential tolerance to nitro-oxidative stress.

PubMed

Sainz, Martha; Pérez-Rontomé, Carmen; Ramos, Javier; Mulet, Jose Miguel; James, Euan K; Bhattacharjee, Ujjal; Petrich, Jacob W; Becana, Manuel

2013-12-01

The heme of bacteria, plant and animal hemoglobins (Hbs) must be in the ferrous state to bind O(2) and other physiological ligands. Here we have characterized the full set of non-symbiotic (class 1 and 2) and 'truncated' (class 3) Hbs of Lotus japonicus. Class 1 Hbs are hexacoordinate, but class 2 and 3 Hbs are pentacoordinate. Three of the globins, Glb1-1, Glb2 and Glb3-1, are nodule-enhanced proteins. The O(2) affinity of Glb1-1 (50 pm) was the highest known for any Hb, and the protein may function as an O(2) scavenger. The five globins were reduced by free flavins, which transfer electrons from NAD(P)H to the heme iron under aerobic and anaerobic conditions. Class 1 Hbs were reduced at very fast rates by FAD, class 2 Hbs at slower rates by both FMN and FAD, and class 3 Hbs at intermediate rates by FMN. The members of the three globin classes were immunolocalized predominantly in the nuclei. Flavins were quantified in legume nodules and nuclei, and their concentrations were sufficient to maintain Hbs in their functional state. All Hbs, except Glb1-1, were expressed in a flavohemoglobin-deficient yeast mutant and found to confer tolerance to oxidative stress induced by methyl viologen, copper or low temperature, indicating an anti-oxidative role for the hemes. However, only Glb1-2 and Glb2 afforded protection against nitrosative stress induced by S-nitrosoglutathione. Because this compound is specifically involved in transnitrosylation reactions with thiol groups, our results suggest a contribution of the single cysteine residues of both proteins in the stress response. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

Prenatal diagnosis of hemoglobinopathies: evaluation of techniques for analysing globin-chain synthesis in blood samples obtained by fetoscopy.

PubMed Central

Congote, L. F.; Hamilton, E. F.; Chow, J. C.; Perry, T. B.

1982-01-01

Three techniques for analysing hemoglobin synthesis in blood samples obtained by fetoscopy were evaluated. Of the fetuses studied, 12 were not at risk of genetic disorders, 10 were at risk of beta-thalassemia, 2 were at risk of sickle cell anemia and 1 was at risk of both diseases. The conventional method of prenatal diagnosis of hemoglobinopathies, involving the separation of globin chains labelled with a radioactive isotope on carboxymethyl cellulose (CMC) columns, was compared with a method involving globin-chain separation by high-pressure liquid chromatography (HPLC) and with direct analysis of labelled hemoglobin tetramers obtained from cell lysates by chromatography on ion-exchange columns. The last method is technically the simplest and can be used for diagnosing beta-thalassemia and sickle cell anemia. However, it gives spuriously high levels of adult hemoglobin in samples containing nonlabelled adult hemoglobin. HPLC is the fastest method for prenatal diagnosis of beta-thalassemia and may prove as reliable as the CMC method. Of the 13 fetuses at risk for hemoglobinopathies, 1 was predicted to be affected, and the diagnosis was confirmed in the abortus. Of 12 predicted to be unaffected, 1 was aborted spontaneously and was unavailable for confirmatory studies, as were 3 of the infants; however, the diagnosis was confirmed in seven cases and is awaiting confirmation when the infant in 6 months old in one case. Couples at risk of bearing a child with a hemoglobinopathy should be referred for genetic counselling before pregnancy or, at the latest, by the 12th week of gestation so that prenatal diagnosis can be attempted by amniocentesis, safer procedure, with restriction endonuclease analysis of the amniotic fluid cells. PMID:7139502

The orbital ground state of the azide-substrate complex of human heme oxygenase is an indicator of distal H-bonding: implications for the enzyme mechanism.

PubMed

Ogura, Hiroshi; Evans, John P; Peng, Dungeng; Satterlee, James D; Ortiz de Montellano, Paul R; La Mar, Gerd N

2009-04-14

The active site electronic structure of the azide complex of substrate-bound human heme oxygenase 1 (hHO) has been investigated by (1)H NMR spectroscopy to shed light on the orbital/spin ground state as an indicator of the unique distal pocket environment of the enzyme. Two-dimensional (1)H NMR assignments of the substrate and substrate-contact residue signals reveal a pattern of substrate methyl contact shifts that places the lone iron pi-spin in the d(xz) orbital, rather than the d(yz) orbital found in the cyanide complex. Comparison of iron spin relaxivity, magnetic anisotropy, and magnetic susceptibilities argues for a low-spin, (d(xy))(2)(d(yz),d(xz))(3), ground state in both azide and cyanide complexes. The switch from singly occupied d(yz) for the cyanide to d(xz) for the azide complex of hHO is shown to be consistent with the orbital hole determined by the azide pi-plane in the latter complex, which is approximately 90 degrees in-plane rotated from that of the imidazole pi-plane. The induction of the altered orbital ground state in the azide relative to the cyanide hHO complex, as well as the mean low-field bias of methyl hyperfine shifts and their paramagnetic relaxivity relative to those in globins, indicates that azide exerts a stronger ligand field in hHO than in the globins, or that the distal H-bonding to azide is weaker in hHO than in globins. The Asp140 --> Ala hHO mutant that abolishes activity retains the unusual WT azide complex spin/orbital ground state. The relevance of our findings for other HO complexes and the HO mechanism is discussed.

The orbital ground state of the azide-substrate complex of human heme oxygenase is an indicator of distal H-bonding: Implications for the enzyme mechanism‡

PubMed Central

Ogura, Hiroshi; Evans, John P.; Peng, Dungeng; Satterlee, James D.; de Montellano, Paul R. Ortiz; Mar, Gerd N. La

2009-01-01

The active site electronic structure of the azide complex of substrate-bound human heme oxygenase-1, (hHO) has been investigated by 1H NMR spectroscopy to shed light on the orbital/spin ground state as an indicator of the unique distal pocket environment of the enzyme. 2D 1H NMR assignments of the substrate and substrate-contact residue signals reveal a pattern of substrate methyl contact shifts, that places the lone iron π-spin in the dxz orbital, rather than the dyz orbital found in the cyanide complex. Comparison of iron spin relaxivity, magnetic anisotropy and magnetic susceptibilities argues for a low-spin, (dxy)2(dyz,dxz)3, ground state in both azide and cyanide complexes. The switch from singly-occupied dyz for the cyanide to dxz for the azide complex of hHO is shown to be consistent with the orbital hole determined by the azide π-plane in the latter complex, which is ∼90° in-plane rotated from that of the imidazole π-plane. The induction of the altered orbital ground state in the azide relative to the cyanide hHO complex, as well as the mean low-field bias of methyl hyperfine shifts and their paramagnetic relaxivity relative to those in globins, indicate that azide exerts a stronger ligand field in hHO than in the globins, or that the distal H-bonding to azide is weaker in hHO than in globins. The Asp140 → Ala hHO mutant that abolishes activity retains the unusual WT azide complex spin/orbital ground state. The relevance of our findings for other HO complexes and the HO mechanism is discussed. PMID:19243105

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thein, S.L.; Weatherall, D.J.; Sampietro, M.

[open quotes]Heterocellular hereditary persistence of fetal hemoglobin[close quotes] (HPFH) is the term used to describe the genetically determined persistence of fetal hemoglobin (Hb F) production into adult life, in the absence of any related hematological disorder. Whereas some forms are caused by mutations in the [beta]-globin gene cluster on chromosome 11, others segregate independently. While the latter are of particular interest with respect to the regulation of globin gene switching, it has not been possible to determine their chromosomal location, mainly because their mode of inheritance is not clear, but also because several other factors are known to modify Hbmore » F production. The authors have examined a large Asian Indian pedigree which includes individuals with heterocellular HPFH associated with [beta]-thalassemia and/or [alpha]-thalassemia. Segregation analysis was conducted on the HPFH trait FC, defined to be the percentage of Hb F-containing cells (F-cells), using the class D regressive model. The results provide evidence for the presence of a major gene, dominant or codominant, which controls the FC values with residual familial correlations. The major gene was detected when the effects of genetic modifiers, notably [beta]-thalassemia and the XmnI-[sup G][gamma] polymorphism, are accounted for in this analysis. Linkage with the [beta]-globin gene cluster is excluded. The transmission of the FC values in this pedigree is informative enough to allow detection of linkage with an appropriate marker(s). The analytical approach outlined in this study, using simple regression to allow for genetic modifiers and thus allowing the mode of inheritance of a trait to be dissected out, may be useful as a model for segregation and linkage analyses of other complex phenotypes. 39 refs., 4 figs., 6 tabs.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Patrick, N.; Miyakawa, F.; Hunt, J.A.

The distribution of {beta}-thalassemia [{beta}{sup Th}] mutations is unique to each ethnic group. Most mutations affect one or a few bases; large deletions have been rare. Among families screened in Hawaii, [{beta}{sup Th}] heterozygotes were diagnosed by microcytosis, absence of abnormal hemoglobins on isoelectric focusing, and raised Hb A{sub 2} by chromatography. Gene frequency for {beta}{sup Th} was 0.02 in Filipinos. In Filipinos, polymerase chain reaction [PCR] with denaturing gradient gel electrophoresis for {beta}{sup Th} mutations detected a mutation in only 6 of 42 {beta}{sup Th} heterozygotes; an IVS2-666 C/T polymorphism showed non-heterozygosity in 37 and heterozygosity in only 5more » of these {beta}{sup Th} heterozygotes. One {beta}{sup Th}/{beta}{sup Th} major patient and his mother had no mutation detected by allele-specific oligomer hybridization; PCR failed to amplify any DNA from his {beta}-globin gene. After a total {beta}-globin gene deletion [{beta}{sup Del}] was found in a Filipino family in Ontario, specific PCR amplification for {beta}{sup Del} detected this in 43 of 53 {beta}{sup Th} Filipino samples tested; the above {beta}{sup Th}/{beta}{sup Th} patient was a ({beta}{sup Del}/{beta}{sup Del}) homozygote. The {beta}{sup Del} may account for over 60% of all {beta}{sup Th} alleles in Filipinos; this is the highest proportion of a deletion {beta}{sup Th} mutation reported from any population. Most but not all {beta}{sup Del} heterozygotes had high Hb F [5.13 {plus_minus} 3.94 mean {plus_minus} 1 s.d.] compared to the codon 41/42 four base deletion common in Chinese [2.30 {plus_minus} 0.86], or to {beta}{sup Th} heterozygotes with normal {alpha}-globin genes [2.23 {plus_minus} 0.80].« less

Molecular Characterization of β-Thalassemia in the Czech and Slovak Populations: Mediterranean, Asian and Unique Mutations.

PubMed

Divoka, Martina; Partschova, Martina; Kucerova, Jana; Mojzikova, Renata; Cermak, Jaroslav; Pospisilova, Dagmar; Fabryova, Viera; Prochazkova, Daniela; Indrak, Karel; Divoky, Vladimir

2016-06-01

β-Thalassemia (β-thal) is considered rare in Central Europe. As in other malaria-free regions, the presence of β-thal in Central Europe reflects historical and recent immigration, and demographic changes that have influenced the genetic variability of the current populations living in this area. This study assesses the frequency and spectrum of mutations on the β-globin gene in Czech and Slovak subjects with clinical symptoms of thalassemia. The results of the initial part of this research were published more than two decades ago; the aim of this study was to update these original reports. During the period from 2002 to 2015, 400 cases from Czech and Slovak hematological centers were analyzed. Twenty-nine β-thal mutations, identified in 356 heterozygotes from 218 unrelated families, involve five unique mutations including a recently described insertion of a transposable L1 element into the β-globin gene. One mutation described here is reported for the first time. Most of the mutations were of Mediterranean origin and accounted for 82.0% of cases. All but one case studied were heterozygous carriers, manifesting β-thal minor, with rare exceptions represented by the rare (β(0)) codons 46/47 (+G) (HBB: c.142_142dupG) mutation associated with an α-globin gene quadruplication and by dominantly inherited β-thal with a more severe phenotype. One double heterozygous β-thal patient was a recent immigrant from Moldavia. The list of δβ-thal alleles (26 carriers, 16 families) contains Hb Lepore and two types of δβ(0)-thal deletions. In the past, genetic drift and migration as well as recent immigrations were responsible for the introduction of Mediterranean alleles, while several mutations described in single families were of local origin.

β-Globin gene sequencing of hemoglobin Austin revises the historically reported electrophoretic migration pattern.

PubMed

Racsa, Lori D; Luu, Hung S; Park, Jason Y; Mitui, Midori; Timmons, Charles F

2014-06-01

Hemoglobin (Hb) Austin was defined in 1977, using amino acid sequencing of samples from 3 unrelated Mexican-Americans, as a substitution of serine for arginine at position 40 of the β-globin chain (Arg40Ser). Its electrophoretic migration on both cellulose acetate (pH 8.4) and citrate agar (pH 6.2) was reported between Hb F and Hb A, and this description persists in reference literature. OBJECTIVES.-To review the clinical features and redefine the diagnostic characteristics of Hb Austin. Eight samples from 6 unrelated individuals and 2 siblings, all with Hispanic surnames, were submitted for abnormal Hb identification between June 2010 and September 2011. High-performance liquid chromatography, isoelectric focusing (IEF), citrate agar electrophoresis, and bidirectional DNA sequencing of the entire β-globin gene were performed. DNA sequencing confirmed all 8 individuals to be heterozygous for Hb Austin (Arg40Ser). Retention time on high-performance liquid chromatography and migration on citrate agar electrophoresis were consistent with that identification. Migration on IEF, however, was not between Hb F and Hb A, as predicted from the report of cellulose acetate electrophoresis. By IEF, Hb Austin migrated anodal to ("faster than") Hb A. Hemoglobin Austin (Arg40Ser) appears on IEF as a "fast," anodally migrating, Hb variant, just as would be expected from its amino acid substitution. The cited historic report is, at best, not applicable to IEF and is probably erroneous. Our observation of 8 cases in 16 months suggests that this variant may be relatively common in some Hispanic populations, making its recognition important. Furthermore, gene sequencing is proving itself a powerful and reliable tool for definitive identification of Hb variants.

Tangential Flow Filtration of Hemoglobin

PubMed Central

Sun, Guoyong; Harris, David R.

2009-01-01

Bovine and human hemoglobin (bHb and hHb, respectively) was purified from bovine and human red blood cells (bRBCs and hRBCs, respectively) via tangential flow filtration (TFF) in four successive stages. TFF is a fast and simple method to purify Hb from RBCs using filtration through hollow fiber (HF) membranes. Most of the Hb was retained in stage III (100 kDa HF membrane) and displayed methemoglobin levels less than 1%, yielding final concentrations of 318 and 300 mg/mL for bHb and hHb, respectively. Purified Hb exhibited much lower endotoxin levels than their respective RBCs. The purity of Hb was initially assessed via SDS-PAGE, and showed tiny impurity bands for the stage III retentate. The oxygen affinity (P50), and cooperativity coefficient (n) were regressed from the measured oxygen-RBC/Hb equilibrium curves of RBCs and purified Hb. These results suggest that TFF yielded oxygen affinities of bHb and hHb that are comparable to values in the literature. LC-MS was used to measure the molecular weight of the alpha (α) and beta (β) globin chains of purified Hb. No impurity peaks were present in the HPLC chromatograms of purified Hb. The mass of the molecular ions corresponding to the α and β globin chains agreed well with the calculated theoretical mass of the α-and β-globin chains. Taken together, our results demonstrate that HPLC grade Hb can be generated via TFF. In general, this method can be more broadly applied to purify Hb from any source of RBCs. This work is significant, since it outlines a simple method for generating Hb for synthesis and/or formulation of Hb-based oxygen carriers (HBOCs). PMID:19224583

Evolutionary context for the association of γ-globin, serum uric acid, and hypertension in African Americans.

PubMed

Shriner, Daniel; Kumkhaek, Chutima; Doumatey, Ayo P; Chen, Guanjie; Bentley, Amy R; Charles, Bashira A; Zhou, Jie; Adeyemo, Adebowale; Rodgers, Griffin P; Rotimi, Charles N

2015-11-05

Hyperuricemia and associated cardio-metabolic disorders are more prevalent in African Americans than in European Americans. We used genome-wide admixture mapping and association testing to identify loci with ancestry effects on serum uric acid levels. We analyzed 1,976 African Americans from Washington, D.C, including 1,322 individuals from 328 pedigrees and 654 unrelated individuals, enrolled in the Howard University Family Study. We performed admixture mapping and genome-wide association testing using ~800 k autosomal single-nucleotide polymorphisms (SNPs). We performed fine mapping by dense genotyping. We assessed functionality by a combination of bioinformatic annotation, reporter gene assays, and gel shift experiments. We also analyzed 12,641 individuals enrolled in the National Health and Nutrition Examination Survey. We detected a genome-wide significant locus on chromosome 11p15.4 at which serum uric acid levels increased with increasing African ancestry, independent of kidney function. Fine-mapping identified two independent signals in the β-globin locus. The ancestral allele at SNP rs2855126, located upstream of the hemoglobin, gamma A gene HBG1, was associated with increased serum uric acid levels and higher expression of a reporter gene relative to the derived allele. Hyperuricemia was associated with increased risk of hypertension in 3,767 African Americans (Odds Ratio = 2.48, p = 2.71 × 10(-19)). Given that increased expression of γ-globin leads to increased levels of fetal hemoglobin which confers protection against malaria, we hypothesize that evolution in Africa of protection against malaria may have occurred at the cost of increased serum uric acid levels, contributing to the high rates of hyperuricemia and associated cardio-metabolic disorders observed in African Americans.

Integrating Evolutionary and Functional Tests of Adaptive Hypotheses: A Case Study of Altitudinal Differentiation in Hemoglobin Function in an Andean Sparrow, Zonotrichia capensis

PubMed Central

Cheviron, Zachary A.; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Eddy, Douglas K.; Jones, Jennifer; Carling, Matthew D.; Witt, Christopher C.; Moriyama, Hideaki; Weber, Roy E.; Fago, Angela; Storz, Jay F.

2014-01-01

In air-breathing vertebrates, the physiologically optimal blood-O2 affinity is jointly determined by the prevailing partial pressure of atmospheric O2, the efficacy of pulmonary O2 transfer, and internal metabolic demands. Consequently, genetic variation in the oxygenation properties of hemoglobin (Hb) may be subject to spatially varying selection in species with broad elevational distributions. Here we report the results of a combined functional and evolutionary analysis of Hb polymorphism in the rufous-collared sparrow (Zonotrichia capensis), a species that is continuously distributed across a steep elevational gradient on the Pacific slope of the Peruvian Andes. We integrated a population genomic analysis that included all postnatally expressed Hb genes with functional studies of naturally occurring Hb variants, as well as recombinant Hb (rHb) mutants that were engineered through site-directed mutagenesis. We identified three clinally varying amino acid polymorphisms: Two in the αA-globin gene, which encodes the α-chain subunits of the major HbA isoform, and one in the αD-globin gene, which encodes the α-chain subunits of the minor HbD isoform. We then constructed and experimentally tested single- and double-mutant rHbs representing each of the alternative αA-globin genotypes that predominate at different elevations. Although the locus-specific patterns of altitudinal differentiation suggested a history of spatially varying selection acting on Hb polymorphism, the experimental tests demonstrated that the observed amino acid mutations have no discernible effect on respiratory properties of the HbA or HbD isoforms. These results highlight the importance of experimentally validating the hypothesized effects of genetic changes in protein function to avoid the pitfalls of adaptive storytelling. PMID:25135942

PROTEIN STRUCTURE - AN ENZYMATIC GLOBIN FROM A MARINE WORM. (R827612E02)

EPA Science Inventory

The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

β-Thalassemia: HiJAKing Ineffective Erythropoiesis and Iron Overload

PubMed Central

Melchiori, Luca; Gardenghi, Sara; Rivella, Stefano

2010-01-01

β-thalassemia encompasses a group of monogenic diseases that have in common defective synthesis of β-globin. The defects involved are extremely heterogeneous and give rise to a large phenotypic spectrum, with patients that are almost asymptomatic to cases in which regular blood transfusions are required to sustain life. As a result of the inefficient synthesis of β-globin, the patients suffer from chronic anemia due to a process called ineffective erythropoiesis (IE). The sequelae of IE lead to extramedullary hematopoiesis (EMH) with massive splenomegaly and dramatic iron overload, which in turn is responsible for many of the secondary pathologies observed in thalassemic patients. The processes are intimately linked such that an ideal therapeutic approach should address all of the complications. Although β-thalassemia is one of the first monogenic diseases to be described and represents a global health problem, only recently has the scientific community started to focus on the real molecular mechanisms that underlie this disease, opening new and exciting therapeutic perspectives for thalassemic patients worldwide. PMID:20508726

Neuroglobin Overexpression Inhibits AMPK Signaling and Promotes Cell Anabolism

PubMed Central

Cai, Bin; Li, Wenjun; Mao, XiaoOu; Winters, Ali; Ryou, Myoung-Gwi; Liu, Ran; Greenberg, David A.; Wang, Ning; Jin, Kunlin; Yang, Shao-Hua

2017-01-01

Neuroglobin (Ngb) is a recently discovered globin with preferential localization to neurons. Growing evidence indicates that Ngb has distinct physiological functions separate from the oxygen storage and transport roles of other globins, such as hemoglobin and myoglobin. We found increased ATP production and decreased glycolysis in Ngb-overexpressing immortalized murine hippocampal cell line (HT-22), in parallel with inhibition of AMPK signaling and activation of acetyl-CoA carboxylase (ACC). In addition, lipid and glycogen content was increased in Ngb-overexpressing HT-22 cells. AMPK signaling was also inhibited in brain and heart from Ngb-overexpressing transgenic mice. Although Ngb overexpression did not change glycogen content in whole brain, glycogen synthase was activated in cortical neurons of Ngb overexpressing mouse brain and Ngb overexpression primary neurons. Moreover, lipid and glycogen content was increased in hearts derived from Ngb-overexpressing mice. These findings suggest that Ngb functions as a metabolic regulator and enhances cellular anabolism through the inhibition of AMPK signaling. PMID:25616953

Neuroglobin Overexpression Inhibits AMPK Signaling and Promotes Cell Anabolism.

PubMed

Cai, Bin; Li, Wenjun; Mao, XiaoOu; Winters, Ali; Ryou, Myoung-Gwi; Liu, Ran; Greenberg, David A; Wang, Ning; Jin, Kunlin; Yang, Shao-Hua

2016-03-01

Neuroglobin (Ngb) is a recently discovered globin with preferential localization to neurons. Growing evidence indicates that Ngb has distinct physiological functions separate from the oxygen storage and transport roles of other globins, such as hemoglobin and myoglobin. We found increased ATP production and decreased glycolysis in Ngb-overexpressing immortalized murine hippocampal cell line (HT-22), in parallel with inhibition of AMP-activated protein kinase (AMPK) signaling and activation of acetyl-CoA carboxylase (ACC). In addition, lipid and glycogen content was increased in Ngb-overexpressing HT-22 cells. AMPK signaling was also inhibited in the brain and heart from Ngb-overexpressing transgenic mice. Although Ngb overexpression did not change glycogen content in whole brain, glycogen synthase was activated in cortical neurons of Ngb-overexpressing mouse brain and Ngb overexpression primary neurons. Moreover, lipid and glycogen content was increased in hearts derived from Ngb-overexpressing mice. These findings suggest that Ngb functions as a metabolic regulator and enhances cellular anabolism through the inhibition of AMPK signaling.

Phylogenetic relations of humans and African apes from DNA sequences in the Psi eta-globin region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miyamoto, M.M.; Slightom, J.L.; Goodman, M.

Sequences from the upstream and downstream flanking DNA regions of the Psi eta-globin locus in Pan troglodytes (common chimpanzee), Gorilla gorilla (gorilla), and Pongo pygmaeus (orangutan, the closest living relative to Homo, Pan, and Gorilla) provided further data for evaluating the phylogenetic relations of humans and African apes. These newly sequenced orthologs (an additional 4.9 kilobase pairs (kbp) for each species) were combined with published Psi eta-gene sequences and then compared to the same orthologous stretch (a continuous 7.1-kbp region) available for humans. Phylogenetic analysis of these nucleotide sequences by the parsimony method indicated (i) that human and chimpanzee aremore » more closely related to each other than either is to gorilla and (ii) that the slowdown in the rate of sequence evolution evident in higher primates is especially pronounced in humans. These results indicate that features unique to African apes (but not to humans) are primitive and that even local molecular clocks should be applied with caution.« less

Gene therapy for sickle cell disease: An update.

PubMed

Demirci, Selami; Uchida, Naoya; Tisdale, John F

2018-05-30

Sickle cell disease (SCD) is one of the most common life-threatening monogenic diseases affecting millions of people worldwide. Allogenic hematopietic stem cell transplantation is the only known cure for the disease with high success rates, but the limited availability of matched sibling donors and the high risk of transplantation-related side effects force the scientific community to envision additional therapies. Ex vivo gene therapy through globin gene addition has been investigated extensively and is currently being tested in clinical trials that have begun reporting encouraging data. Recent improvements in our understanding of the molecular pathways controlling mammalian erythropoiesis and globin switching offer new and exciting therapeutic options. Rapid and substantial advances in genome engineering tools, particularly CRISPR/Cas9, have raised the possibility of genetic correction in induced pluripotent stem cells as well as patient-derived hematopoietic stem and progenitor cells. However, these techniques are still in their infancy, and safety/efficacy issues remain that must be addressed before translating these promising techniques into clinical practice. Published by Elsevier Inc.

Contribution of long-range interactions to the secondary structure of an unfolded globin.

PubMed

Fedyukina, Daria V; Rajagopalan, Senapathy; Sekhar, Ashok; Fulmer, Eric C; Eun, Ye-Jin; Cavagnero, Silvia

2010-09-08

This work explores the effect of long-range tertiary contacts on the distribution of residual secondary structure in the unfolded state of an alpha-helical protein. N-terminal fragments of increasing length, in conjunction with multidimensional nuclear magnetic resonance, were employed. A protein representative of the ubiquitous globin fold was chosen as the model system. We found that, while most of the detectable alpha-helical population in the unfolded ensemble does not depend on the presence of the C-terminal region (corresponding to the native G and H helices), specific N-to-C long-range contacts between the H and A-B-C regions enhance the helical secondary structure content of the N terminus (A-B-C regions). The simple approach introduced here, based on the evaluation of N-terminal polypeptide fragments of increasing length, is of general applicability to identify the influence of long-range interactions in unfolded proteins. Copyright 2010 Biophysical Society. Published by Elsevier Inc. All rights reserved.

The molecular spectrum and distribution of haemoglobinopathies in Cyprus: a 20-year retrospective study

PubMed Central

Kountouris, Petros; Kousiappa, Ioanna; Papasavva, Thessalia; Christopoulos, George; Pavlou, Eleni; Petrou, Miranda; Feleki, Xenia; Karitzie, Eleni; Phylactides, Marios; Fanis, Pavlos; Lederer, Carsten W.; Kyrri, Andreani R.; Kalogerou, Eleni; Makariou, Christiana; Ioannou, Christiana; Kythreotis, Loukas; Hadjilambi, Georgia; Andreou, Nicoletta; Pangalou, Evangelia; Savvidou, Irene; Angastiniotis, Michael; Hadjigavriel, Michael; Sitarou, Maria; Kolnagou, Annita; Kleanthous, Marina; Christou, Soteroula

2016-01-01

Haemoglobinopathies are the most common monogenic diseases, posing a major public health challenge worldwide. Cyprus has one the highest prevalences of thalassaemia in the world and has been the first country to introduce a successful population-wide prevention programme, based on premarital screening. In this study, we report the most significant and comprehensive update on the status of haemoglobinopathies in Cyprus for at least two decades. First, we identified and analysed all known 592 β-thalassaemia patients and 595 Hb H disease patients in Cyprus. Moreover, we report the molecular spectrum of α-, β- and δ-globin gene mutations in the population and their geographic distribution, using a set of 13824 carriers genotyped from 1995 to 2015, and estimate relative allele frequencies in carriers of β- and δ-globin gene mutations. Notably, several mutations are reported for the first time in the Cypriot population, whereas important differences are observed in the distribution of mutations across different districts of the island. PMID:27199182

Hb lepore/β0-thalassaemia with α+-thalassaemia interactions, a potential diagnostic pitfall.

PubMed

Alauddin, Hafiza; Mohamad Nasir, Suziana; Ahadon, Madzlifah; Raja Sabudin, Raja Zahratul Azma; Ithnin, Azlin; Hussin, Noor Hamidah; Alias, Hamidah; Loh, C-Khai; Abdul Latiff, Zarina; Abdul Murad, Nor Azian; Othman, Ainoon

2015-12-01

Haemoglobin (Hb) Lepore is a variant Hb consisting of two α-globin and two δβ-globin chains. In a heterozygote, it is associated with clinical findings of thalassaemia minor, but interactions with other haemoglobinopathies can lead to various clinical phenotypes and pose diagnostic challenges. We reported a pair of siblings from a Malay family, who presented with pallor and hepatosplenomegaly at the ages of 21 months and 14 months old. The red cell indices and peripheral blood smears of both patients showed features of thalassaemia intermedia. Other laboratory investigations of the patients showed conflicting results. However, laboratory investigation results of the parents had led to a presumptive diagnosis of compound heterozygote Hb Lepore/β-thalassaemia and co-inheritance α+-thalassaemia (-α3.7). Hb Lepore has rarely been detected in Southeast Asian countries, particularly in Malaysia. These two cases highlight the importance of family studies for accurate diagnosis, hence appropriate clinical management and genetic counseling.

Hb S [β6(A3)Glu→Val, GAG>GTG] in Mexican Mestizos: frequency and analysis of the 5' β-globin haplotype.

PubMed

Guzmán, Luis F; Perea, Francisco J; Magaña, María T; Morales-González, Karina R; Chávez-Velazco, M Luz; Ibarra, Bertha

2010-01-01

Between 1978 and 2009, we studied 1,863 Mexican Mestizo patients with clinical data compatible with a hemoglobinopathy. Of these patients, 382 had some hemoglobin (Hb) abnormality (20.5%), 128 had a sickle cell hemoglobinopathy, representing a general frequency of 6.9%, which is similar to the percentage observed in previous studies on Mexican Mestizos. We analyzed the 5' β-globin haplotype (5'Hp) in 79 unrelated β(S) chromosomes (26 β(S)/β(S), 14 β(S)/β(Thal), nine β(S)/β(A) and four β(S)/β(D)), and four haplotypes were observed: 72.2% CAR 24.1% Benin, 2.5% Senegal and 1.2% Cameroon; the last two are reported for first time in Mexico. In some Latin American populations such as Brazil, the Bantu haplotype predominates, while in others such as Jamaica, the Benin haplotype is the most frequent, showing heterogeneity of African genes as a consequence of different regions involved in the slave trade.

The role of ROS in hydroquinone-induced inhibition of K562 cell erythroid differentiation.

PubMed

Yu, Chun Hong; Suriguga; Li, Yang; Li, Yi Ran; Tang, Ke Ya; Jiang, Liang; Yi, Zong Chun

2014-03-01

The role of ROS in hydroquinone-induced inhibition of K562 cell erythroid differentiation was investigated. After K562 cells were treated with hydroquinone for 24 h, and hemin was later added to induce erythroid differentiation for 48 h, hydroquinone inhibited hemin-induced hemoglobin synthesis and mRNA expression of γ-globin in K562 cells in a concentration-dependent manner. The 24-h exposure to hydroquinone also caused a concentration-dependent increase at an intracellular ROS level, while the presence of N- acetyl-L-cysteine prevented hydroquinone- induced ROS production in K562 cells. The presence of N-acetyl-L-cysteine also prevented hydroquinone inhibiting hemin-induced hemoglobin synthesis and mRNA expression of γ-globin in K562 cells. These evidences indicated that ROS production played a role in hydroquinone-induced inhibition of erythroid differentiation. Copyright © 2014 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

Identification of the -α(2.4) Deletion in One Family and in One Hb H Disease Patient in Guangxi, People's Republic of China.

PubMed

Pang, Wanrong; Sun, Lei; Long, Ju; Weng, Xunjin; Ye, Xuehe; Wang, Junjie; Liao, Yan; Tang, Weijun; Fan, Zuqian; Wu, Suping; Song, Chuanlu; Wei, Xiaoying; Zhang, Chenghong

2016-06-01

The 2.4 kb (or -α(2.4)) deletion in the α-globin gene cluster (NG_000006.1) is an α(+)-thalassemia (α(+)-thal) allele. The molecular basis of -α(2.4) is a deletion from 36860 to 39251 of the α-globin gene cluster. It was reported by three research groups in 2005, 2012 and 2014, respectively. In routine thalassemia screening studies by this research group, we found an individual with the -α(2.4)/αα genotype and an Hb H (β4) disease patient whose genotype was - -(SEA)/-α(2.4). Samples from the parents of the carrier of the -α(2.4)/αα genotype were collected to perform pedigree analysis, and the proband's mother's genotype was diagnosed to be - -(SEA)/-α(2.4). The research revealed that the -α(2.4) allele exists in the population of southern Guangxi, People's Republic of China.

Process to Selectively Distinguish Viable from Non-Viable Bacterial Cells

NASA Technical Reports Server (NTRS)

LaDuc, Myron T.; Bernardini, Jame N.; Stam, Christina N.

2010-01-01

The combination of ethidium monoazide (EMA) and post-fragmentation, randomly primed DNA amplification technologies will enhance the analytical capability to discern viable from non-viable bacterial cells in spacecraft-related samples. Intercalating agents have been widely used since the inception of molecular biology to stain and visualize nucleic acids. Only recently, intercalating agents such as EMA have been exploited to selectively distinguish viable from dead bacterial cells. Intercalating dyes can only penetrate the membranes of dead cells. Once through the membrane and actually inside the cell, they intercalate DNA and, upon photolysis with visible light, produce stable DNA monoadducts. Once the DNA is crosslinked, it becomes insoluble and unable to be fragmented for post-fragmentation, randomly primed DNA library formation. Viable organisms DNA remains unaffected by the intercalating agents, allowing for amplification via post-fragmentation, randomly primed technologies. This results in the ability to carry out downstream nucleic acid-based analyses on viable microbes to the exclusion of all non-viable cells.

The conserved Phe GH5 of importance for hemoglobin intersubunit contact is mutated in gadoid fish

PubMed Central

2014-01-01

Background Functionality of the tetrameric hemoglobin molecule seems to be determined by a few amino acids located in key positions. Oxygen binding encompasses structural changes at the interfaces between the α1β2 and α2β1 dimers, but also subunit interactions are important for the oxygen binding affinity and stability. The latter packing contacts include the conserved Arg B12 interacting with Phe GH5, which is replaced by Leu and Tyr in the αA and αD chains, respectively, of birds and reptiles. Results Searching all known hemoglobins from a variety of gnathostome species (jawed vertebrates) revealed the almost invariant Arg B12 coded by the AGG triplet positioned at an exon-intron boundary. Rare substitutions of Arg B12 in the gnathostome β globins were found in pig, tree shrew and scaled reptiles. Phe GH5 is also highly conserved in the β globins, except for the Leu replacement in the β1 globin of five marine gadoid species, gilthead seabream and the Comoran coelacanth, while Cys and Ile were found in burbot and yellow croaker, respectively. Atlantic cod β1 globin showed a Leu/Met polymorphism at position GH5 dominated by the Met variant in northwest-Atlantic populations that was rarely found in northeast-Atlantic cod. Site-specific analyses identified six consensus codons under positive selection, including 122β(GH5), indicating that the amino acid changes identified at this position may offer an adaptive advantage. In fact, computational mutation analysis showed that the replacement of Phe GH5 with Leu or Cys decreased the number of van der Waals contacts essentially in the deoxy form that probably causes a slight increase in the oxygen binding affinity. Conclusions The almost invariant Arg B12 and the AGG codon seem to be important for the packing contacts and pre-mRNA processing, respectively, but the rare mutations identified might be beneficial. The Leu122β1(GH5)Met and Met55β1(D6)Val polymorphisms in Atlantic cod hemoglobin modify the intradimer contacts B12-GH5 and H2-D6, while amino acid replacements at these positions in avian hemoglobin seem to be evolutionary adaptive in air-breathing vertebrates. The results support the theory that adaptive changes in hemoglobin functions are caused by a few substitutions at key positions. PMID:24655798

Assessment of Molecular Construction in Undergraduate Biochemistry

ERIC Educational Resources Information Center

Booth, Deborah; Bateman, Robert C., Jr.; Sirochman, Rudy; Richardson, David C.; Richardson, Jane S.; Weiner, Steven W.; Farwell, Mary; Putnam-Evans, Cindy

2005-01-01

White and group used a two question, open-ended tests to separately evaluate students' learning of specific biochemical concepts in the general biology lecture and laboratory, in the first performance assessment of molecular visualization in teaching biochemistry. Two studies were devoted to protein structure using globins followed by one…

Problem-Solving Test: The Mechanism of Protein Synthesis

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2009-01-01

Terms to be familiar with before you start to solve the test: protein synthesis, ribosomes, amino acids, peptides, peptide bond, polypeptide chain, N- and C-terminus, hemoglobin, [alpha]- and [beta]-globin chains, radioactive labeling, [[to the third power]H] and [[to the fourteenth power]C]leucine, cytosol, differential centrifugation, density…

MACROMOLECULAR ADDUCTION BY TRICHLOROACETONITRILE IN THE FISCHER 344 RAT FOLLOWING ORAL GAVAGE

EPA Science Inventory

Male Fischer 344 rats were administered 1- or 2-[14C]-trichloroacetonitrile (TCAN) by ral gavage. NA was isolated from the liver, kidneys and stomach and several protein fractions (globin, albumin and blobulins) were isolated from blood. CAN binds to both the DNA and the blood pr...

Utility of next-generation RNA-sequencing in identifying chimeric transcription involving human endogenous retroviruses.

PubMed

Sokol, Martin; Jessen, Karen Margrethe; Pedersen, Finn Skou

2016-01-01

Several studies have shown that human endogenous retroviruses and endogenous retrovirus-like repeats (here collectively HERVs) impose direct regulation on human genes through enhancer and promoter motifs present in their long terminal repeats (LTRs). Although chimeric transcription in which novel gene isoforms containing retroviral and human sequence are transcribed from viral promoters are commonly associated with disease, regulation by HERVs is beneficial in other settings; for example, in human testis chimeric isoforms of TP63 induced by an ERV9 LTR protect the male germ line upon DNA damage by inducing apoptosis, whereas in the human globin locus the γ- and β-globin switch during normal hematopoiesis is mediated by complex interactions of an ERV9 LTR and surrounding human sequence. The advent of deep sequencing or next-generation sequencing (NGS) has revolutionized the way researchers solve important scientific questions and develop novel hypotheses in relation to human genome regulation. We recently applied next-generation paired-end RNA-sequencing (RNA-seq) together with chromatin immunoprecipitation with sequencing (ChIP-seq) to examine ERV9 chimeric transcription in human reference cell lines from Encyclopedia of DNA Elements (ENCODE). This led to the discovery of advanced regulation mechanisms by ERV9s and other HERVs across numerous human loci including transcription of large gene-unannotated genomic regions, as well as cooperative regulation by multiple HERVs and non-LTR repeats such as Alu elements. In this article, well-established examples of human gene regulation by HERVs are reviewed followed by a description of paired-end RNA-seq, and its application in identifying chimeric transcription genome-widely. Based on integrative analyses of RNA-seq and ChIP-seq, data we then present novel examples of regulation by ERV9s of tumor suppressor genes CADM2 and SEMA3A, as well as transcription of an unannotated region. Taken together, this article highlights the high suitability of contemporary sequencing methods in future analyses of human biology in relation to evolutionary acquired retroviruses in the human genome. © 2016 APMIS. Published by John Wiley & Sons Ltd.

The Role of CREB in CML

DTIC Science & Technology

2008-02-01

Feng YQ et al. Anti-beta s- ribozyme reduces beta s mRNA levels in transgenic mice: Potential application to the gene therapy of sickle cell anemia... ribozymes . RNA 2003;9:1254–1263. 13 Pace BS, Qian X, Ofori-Acquah SF. Selective inhibition of beta-globin RNA transcripts by antisense RNA molecules. Cell

THE CRYSTAL STRUCTURE AND AMINO ACID SEQUENCE OF DEHALOPEROXIDASE FROM AMPHITRITE ORNATA INDICATE COMMON ANCESTRY WITH GLOBINS. (R827612E02)

EPA Science Inventory

The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

Molecular dynamic simulations reveal the structural determinants of fatty acid binding to oxy-myoglobin

USDA-ARS?s Scientific Manuscript database

The mechanism(s) by which fatty acids are sequestered and transported in muscle have not been fully elucidated. A potential key player in this process is the protein myoglobin (Mb). Indeed, there is a catalogue of empirical evidence supporting direct interaction of globins with fatty acid metabolite...

Balanced globin protein expression and heme biosynthesis improve production of human hemoglobin in Saccharomyces cerevisiae.

PubMed

Liu, Lifang; Martínez, José L; Liu, Zihe; Petranovic, Dina; Nielsen, Jens

2014-01-01

Due to limitations associated with whole blood for transfusions (antigen compatibility, transmission of infections, supply and storage), the use of cell-free hemoglobin as an oxygen carrier substitute has been in the center of research interest for decades. Human hemoglobin has previously been synthesized in yeast, however the challenge is to balance the expression of the two different globin subunits, as well as the supply of the prosthetic heme required for obtaining the active hemoglobin (α2β2). In this work we evaluated the expression of different combinations of α and β peptides and combined this with metabolic engineering of the heme biosynthetic pathway. Through evaluation of several different strategies we showed that engineering the biosynthesis pathway can substantially increase the heme level in yeast cells, and this resulted in a significant enhancement of human hemoglobin production. Besides demonstration of improved hemoglobin production our work demonstrates a novel strategy for improving the production of complex proteins, especially multimers with a prosthetic group. © 2013 Published by International Metabolic Engineering Society on behalf of International Metabolic Engineering Society.

Human papillomavirus in normal conjunctival tissue and in conjunctival papilloma: types and frequencies in a large series.

PubMed

Sjö, Nicolai Christian; von Buchwald, Christian; Cassonnet, Patricia; Norrild, Bodil; Prause, Jan Ulrik; Vinding, Troels; Heegaard, Steffen

2007-08-01

To examine conjunctival papilloma and normal conjunctival tissue for the presence of human papillomavirus (HPV). Archival paraffin wax-embedded tissue from 165 conjunctival papillomas and from 20 histological normal conjunctival biopsy specimens was analysed for the presence of HPV by PCR. Specimens considered HPV positive using consensus primers, but with a negative or uncertain PCR result using type-specific HPV probes, were analysed with DNA sequencing. HPV was present in 86 of 106 (81%) beta-globin-positive papillomas. HPV type 6 was positive in 80 cases, HPV type 11 was identified in 5 cases and HPV type 45 was present in a single papilloma. All the 20 normal conjunctival biopsy specimens were beta-globin positive and HPV negative. There is a strong association between HPV and conjunctival papilloma. The study presents the largest material of conjunctival papilloma investigated for HPV and the first investigation of HPV in normal conjunctival tissue. HPV types 6 and 11 are the most common HPV types in conjunctival papilloma. This also is the first report of HPV type 45 in conjunctival papilloma.

Recent advance on genome editing for therapy of β-hemoglobinopathies.

PubMed

Liu, Jia-Wei; Hong, Tao; Qin, Xin; Liang, Ying-Min; Zhang, Ping

2018-02-20

β-hemoglobinopathies are one of six groups of common illnesses affecting human health. Although the genetic mechanisms have been elucidated for several decades, curable treatment options, other than allogeneic bone marrow transplantation, are still lacking. In recent years, rapid development in genome editing technologies and their clinical applications have opened up new directions for treatment of β-hemoglobinopathies. Genome editing technologies, as applied in autologous CD34 + hematopoietic stem and progenitor cells, represents a promising remedial means for the β-globin disorders. Hemoglobin gene mutations could be corrected with homologous recombination-mediated DNA repair pathway to repair the genetic defects, while the nonhomologous end-joining pathway may be used to silence the key repressor of fetal globin expression and reactivate fetal hemoglobin expression, thereby alleviating the clinical symptoms of β-hemoglobinopathies in patients. This review summarizes the recent advances on genome editing of β-hemoglobinopathies from the bench design to the establishment of clinical translational platforms, thereby providing critical insights and references on the application of genome editing technologies for the development of therapeutic strategies for β-hemoglobinopathies.

Induction of Fetal Hemoglobin by Propionic and Butyric Acid Derivatives: Correlations between Chemical Structure and Potency of Hb F Induction1

PubMed Central

Liakopoulou, Effie; Li, Qiliang; Stamatoyannopoulos, George

2010-01-01

Short-chain fatty acids (C2-C9) induce fetal hemoglobin synthesis in primary cell cultures, primates, and patients. We carried out experiments to test whether relationships exist between chemical structure and the Hb F-inducing potential of several short-chain fatty acid derivatives. BFUe cultures were performed in the presence of propionic and butyric congeners, covering the full spectrum of substitutions of these molecules, including polar and non-polar groups, esters, and double bonds. We found that the fetal hemoglobin inducibility is related to the chemical structure of the inducing compound. This structure–activity relation depends on the length of carbon chain, the nature of the substitutions, and the position of more potent substitutions on the carbon chain. It appears that substitutions enhancing the inducibility of these compounds are (with decreasing potency): methyl > phenyl > hydroxy ≫ amino groups. Placement of these substitutions at a position distal to the carboxyl group enhances γ-globin inducibility. Presence of the carboxyl group is prerequisite for γ-globin inducibility. PMID:12482403

Integrating evolutionary and functional tests of adaptive hypotheses: a case study of altitudinal differentiation in hemoglobin function in an Andean Sparrow, Zonotrichia capensis.

PubMed

Cheviron, Zachary A; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Eddy, Douglas K; Jones, Jennifer; Carling, Matthew D; Witt, Christopher C; Moriyama, Hideaki; Weber, Roy E; Fago, Angela; Storz, Jay F

2014-11-01

In air-breathing vertebrates, the physiologically optimal blood-O2 affinity is jointly determined by the prevailing partial pressure of atmospheric O2, the efficacy of pulmonary O2 transfer, and internal metabolic demands. Consequently, genetic variation in the oxygenation properties of hemoglobin (Hb) may be subject to spatially varying selection in species with broad elevational distributions. Here we report the results of a combined functional and evolutionary analysis of Hb polymorphism in the rufous-collared sparrow (Zonotrichia capensis), a species that is continuously distributed across a steep elevational gradient on the Pacific slope of the Peruvian Andes. We integrated a population genomic analysis that included all postnatally expressed Hb genes with functional studies of naturally occurring Hb variants, as well as recombinant Hb (rHb) mutants that were engineered through site-directed mutagenesis. We identified three clinally varying amino acid polymorphisms: Two in the α(A)-globin gene, which encodes the α-chain subunits of the major HbA isoform, and one in the α(D)-globin gene, which encodes the α-chain subunits of the minor HbD isoform. We then constructed and experimentally tested single- and double-mutant rHbs representing each of the alternative α(A)-globin genotypes that predominate at different elevations. Although the locus-specific patterns of altitudinal differentiation suggested a history of spatially varying selection acting on Hb polymorphism, the experimental tests demonstrated that the observed amino acid mutations have no discernible effect on respiratory properties of the HbA or HbD isoforms. These results highlight the importance of experimentally validating the hypothesized effects of genetic changes in protein function to avoid the pitfalls of adaptive storytelling. © The Author 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Molecular analysis of beta-globin gene mutations among Thai beta-thalassemia children: results from a single center study

PubMed Central

Boonyawat, Boonchai; Monsereenusorn, Chalinee; Traivaree, Chanchai

2014-01-01

Background Beta-thalassemia is one of the most common genetic disorders in Thailand. Clinical phenotype ranges from silent carrier to clinically manifested conditions including severe beta-thalassemia major and mild beta-thalassemia intermedia. Objective This study aimed to characterize the spectrum of beta-globin gene mutations in pediatric patients who were followed-up in Phramongkutklao Hospital. Patients and methods Eighty unrelated beta-thalassemia patients were enrolled in this study including 57 with beta-thalassemia/hemoglobin E, eight with homozygous beta-thalassemia, and 15 with heterozygous beta-thalassemia. Mutation analysis was performed by multiplex amplification refractory mutation system (M-ARMS), direct DNA sequencing of beta-globin gene, and gap polymerase chain reaction for 3.4 kb deletion detection, respectively. Results A total of 13 different beta-thalassemia mutations were identified among 88 alleles. The most common mutation was codon 41/42 (-TCTT) (37.5%), followed by codon 17 (A>T) (26.1%), IVS-I-5 (G>C) (8%), IVS-II-654 (C>T) (6.8%), IVS-I-1 (G>T) (4.5%), and codon 71/72 (+A) (2.3%), and all these six common mutations (85.2%) were detected by M-ARMS. Six uncommon mutations (10.2%) were identified by DNA sequencing including 4.5% for codon 35 (C>A) and 1.1% initiation codon mutation (ATG>AGG), codon 15 (G>A), codon 19 (A>G), codon 27/28 (+C), and codon 123/124/125 (-ACCCCACC), respectively. The 3.4 kb deletion was detected at 4.5%. The most common genotype of beta-thalassemia major patients was codon 41/42 (-TCTT)/codon 26 (G>A) or betaE accounting for 40%. Conclusion All of the beta-thalassemia alleles have been characterized by a combination of techniques including M-ARMS, DNA sequencing, and gap polymerase chain reaction for 3.4 kb deletion detection. Thirteen mutations account for 100% of the beta-thalassemia genes among the pediatric patients in our study. PMID:25525381

Review: correlations between oxygen affinity and sequence classifications of plant hemoglobins.

PubMed

Smagghe, Benoit J; Hoy, Julie A; Percifield, Ryan; Kundu, Suman; Hargrove, Mark S; Sarath, Gautam; Hilbert, Jean-Louis; Watts, Richard A; Dennis, Elizabeth S; Peacock, W James; Dewilde, Sylvia; Moens, Luc; Blouin, George C; Olson, John S; Appleby, Cyril A

2009-12-01

Plants express three phylogenetic classes of hemoglobins (Hb) based on sequence analyses. Class 1 and 2 Hbs are full-length globins with the classical eight helix Mb-like fold, whereas Class 3 plant Hbs resemble the truncated globins found in bacteria. With the exception of the specialized leghemoglobins, the physiological functions of these plant hemoglobins remain unknown. We have reviewed and, in some cases, measured new oxygen binding properties of a large number of Class 1 and 2 plant nonsymbiotic Hbs and leghemoglobins. We found that sequence classification correlates with distinct extents of hexacoordination with the distal histidine and markedly different overall oxygen affinities and association and dissociation rate constants. These results suggest strong selective pressure for the evolution of distinct physiological functions. The leghemoglobins evolved from the Class 2 globins and show no hexacoordination, very high rates of O(2) binding ( approximately 250 muM(-1) s(-1)), moderately high rates of O(2) dissociation ( approximately 5-15 s(-1)), and high oxygen affinity (K(d) or P(50) approximately 50 nM). These properties both facilitate O(2) diffusion to respiring N(2) fixing bacteria and reduce O(2) tension in the root nodules of legumes. The Class 1 plant Hbs show weak hexacoordination (K(HisE7) approximately 2), moderate rates of O(2) binding ( approximately 25 muM(-1) s(-1)), very small rates of O(2) dissociation ( approximately 0.16 s(-1)), and remarkably high O(2) affinities (P(50) approximately 2 nM), suggesting a function involving O(2) and nitric oxide (NO) scavenging. The Class 2 Hbs exhibit strong hexacoordination (K(HisE7) approximately 100), low rates of O(2) binding ( approximately 1 muM(-1) s(-1)), moderately low O(2) dissociation rate constants ( approximately 1 s(-1)), and moderate, Mb-like O(2) affinities (P(50) approximately 340 nM), perhaps suggesting a sensing role for sustained low, micromolar levels of oxygen.

Hemoglobins emerging roles in mental disorders. Metabolical, genetical and immunological aspects.

PubMed

Altinoz, Meric A; Ince, Bahri

2017-10-01

Hemoglobin (Hb) expression in the central nervous system is recently shown. Cooccurences of mental disorders (mainly bipolar disorder (BD) and tic disorders) with β- or α-thalassemia trait or erythrocytosis were witnessed, which may be due to peripheral or central hypoxia/hyperoxia or haplotypal gene interactions. β-Globin genes reside at 11p15.5 close to tyrosine hydroxylase, dopamine receptor DRD4 and Brain Derived Neurotrophic Factor, which involve in psychiatric diseases. α-Globin genes reside at 16p13.3 which associates with BD, tic disorders, ATR-16 Syndrome and Rubinstein Taybi Syndrome (RTS). CREB-Binding Protein (CEBBP)-gene is mutated in RTS, which commonly associates with mood disorders. 16p13.3 region also contains GRIN2A gene encoding N-methyl-d-aspartate receptor-2A and SSTR5 (Somatostatin Receptor-5), again involving in mental disorders. We demonstrated a protective role of minor HbA2 against post-partum episodes in BD and association of higher minor HbF (fetal hemoglobin) levels with family history of psychosis in a BD-patient cohort. HbA2 increases in cardiac ischemia and in mountain dwellers indicating its likely protection against ischemia/hypoxia. HMGIY, a repressive transcription factor of δ-globin chain of HbA2 is increased in lymphocytes of schizophrenics. In autism, deletional mutations were found in BCL11A gene, which cause persistence of HbF at high levels in adulthood. Also, certain polymorphisms in BCL11A strongly associate with schizophrenia. Further, many drugs from anabolic steroids to antimalarial agents elevate HbF and may cause mania. We ascribe a protective role to HbA2 and a maladaptive detrimental role to HbF in psychopathology. We believe that future studies on hemoglobins may pave to discover novel pathogenesis mechanisms in mental disorders. Copyright © 2017 ISDN. Published by Elsevier Ltd. All rights reserved.

Sequence variations of the alpha-globin genes: scanning of high CG content genes with DHPLC and DG-DGGE.

PubMed

Lacerra, Giuseppina; Fiorito, Mirella; Musollino, Gennaro; Di Noce, Francesca; Esposito, Maria; Nigro, Vincenzo; Gaudiano, Carlo; Carestia, Clementina

2004-10-01

The alpha-globin chains are encoded by two duplicated genes (HBA2 and HBA1, 5'-3') showing overall sequence homology >96% and average CG content >60%. alpha-Thalassemia, the most prevalent worldwide autosomal recessive disorder, is a hereditary anemia caused by sequence variations of these genes in about 25% of carriers. We evaluated the overall sensitivity and suitability of DHPLC and DG-DGGE in scanning both the alpha-globin genes by carrying out a retrospective analysis of 19 variant alleles in 29 genotypes. The HBA2 alleles c.1A>G, c.79G>A, and c.281T>G, and the HBA1 allele c.475C>A were new. Three pathogenic sequence variations were associated in cis with nonpathogenic variations in all families studied; they were the HBA2 variation c.2T>C associated with c.-24C>G, and the HBA2 variations c.391G>C and c.427T>C, both associated with c.565G>A. We set up original experimental conditions for DHPLC and DG-DGGE and analyzed 10 normal subjects, 46 heterozygotes, seven homozygotes, seven compound heterozygotes, and six compound heterozygotes for a hybrid gene. Both the methodologies gave reproducible results and no false-positive was detected. DHPLC showed 100% sensitivity and DG-DGGE nearly 90%. About 100% of the sequence from the cap site to the polyA addition site could be scanned by DHPLC, about 87% by DG-DGGE. It is noteworthy that the three most common pathogenic sequence variations (HBA2 alleles c.2T>C, c.95+2_95+6del, and c.523A>G) were unambiguously detected by both the methodologies. Genotype diagnosis must be confirmed with PCR sequencing of single amplicons or with an allele-specific method. This study can be helpful for scanning genes with high CG content and offers a model suitable for duplicated genes with high homology. Copyright 2004 Wiley-Liss, Inc.

A Large Cohort of Hemoglobin Variants in Thailand: Molecular Epidemiological Study and Diagnostic Consideration

PubMed Central

Srivorakun, Hataichanok; Singha, Kritsada; Fucharoen, Goonnapa; Sanchaisuriya, Kanokwan; Fucharoen, Supan

2014-01-01

Background Hemoglobin (Hb) variants are structurally inherited changes of globin chains. Accurate diagnoses of these variants are important for planning of appropriate management and genetic counseling. Since no epidemiological study has been conducted before, we have investigated frequencies, molecular and hematological features of Hb variants found in a large cohort of Thai subjects. Materials and Methods Study was conducted on 26,013 unrelated subjects, inhabiting in all geographical parts of Thailand over a period of 11 years from January 2002-December 2012. Hb analysis was done on high performance liquid chromatography (HPLC) or capillary electrophoresis (CE). Mutations causing Hb variants were identified using PCR and related techniques. Results Among 26,013 subjects investigated, 636 (2.4%) were found to carry Hb variants. Of these 636 subjects, 142 (22.4%) carried α-chain variants with 13 different mutations. The remaining included 451 (70.9%) cases with 16 β-chain variants, 37 (5.8%) cases with Hb Lepore (δβ-hybrid Hb) and 6 (0.9%) cases with a single δ-chain variant. The most common α-globin chain variant was the Hb Q-Thailand (α74GAC-CAC, Asp-His) which was found in 101 cases (15.8%). For β-globin chain variants, Hb Hope (β136GGT-GAT, Gly-Asp) and Hb Tak (β146+AC, Ter-Thr) are the two most common ones, found in 121 (19.0%) and 90 (14.2%) cases, respectively. Seven Hb variants have never been found in Thai population. Hb analysis profiles on HPLC or CE of these variants were illustrated to guide presumptive diagnostics. Conclusions Hb variants are common and heterogeneous in Thai population. With varieties of thalassemias and hemoglobinopathies in the population, interactions between them leading to complex syndromes are common and render their diagnoses difficult in routine practices. Knowledge of the spectrum, molecular basis, genotype-phenotype correlation and diagnostic features should prove useful for prevention and control of the diseases in the region. PMID:25244406

Classical sickle beta-globin haplotypes exhibit a high degree of long-range haplotype similarity in African and Afro-Caribbean populations

PubMed Central

Hanchard, Neil; Elzein, Abier; Trafford, Clare; Rockett, Kirk; Pinder, Margaret; Jallow, Muminatou; Harding, Rosalind; Kwiatkowski, Dominic; McKenzie, Colin

2007-01-01

Background The sickle (βs) mutation in the beta-globin gene (HBB) occurs on five "classical" βs haplotype backgrounds in ethnic groups of African ancestry. Strong selection in favour of the βs allele – a consequence of protection from severe malarial infection afforded by heterozygotes – has been associated with a high degree of extended haplotype similarity. The relationship between classical βs haplotypes and long-range haplotype similarity may have both anthropological and clinical implications, but to date has not been explored. Here we evaluate the haplotype similarity of classical βs haplotypes over 400 kb in population samples from Jamaica, The Gambia, and among the Yoruba of Nigeria (Hapmap YRI). Results The most common βs sub-haplotype among Jamaicans and the Yoruba was the Benin haplotype, while in The Gambia the Senegal haplotype was observed most commonly. Both subtypes exhibited a high degree of long-range haplotype similarity extending across approximately 400 kb in all three populations. This long-range similarity was significantly greater than that seen for other haplotypes sampled in these populations (P < 0.001), and was independent of marker choice and marker density. Among the Yoruba, Benin haplotypes were highly conserved, with very strong linkage disequilibrium (LD) extending a megabase across the βs mutation. Conclusion Two different classical βs haplotypes, sampled from different populations, exhibit comparable and extensive long-range haplotype similarity and strong LD. This LD extends across the adjacent recombination hotspot, and is discernable at distances in excess of 400 kb. Although the multi-centric geographic distribution of βs haplotypes indicates strong subdivision among early Holocene sub-Saharan populations, we find no evidence that selective pressures imposed by falciparum malaria varied in intensity or timing between these subpopulations. Our observations also suggest that cis-acting loci, which may influence outcomes in sickle cell disease, could lie considerable distances away from β-globin. PMID:17688704

Classical sickle beta-globin haplotypes exhibit a high degree of long-range haplotype similarity in African and Afro-Caribbean populations.

PubMed

Hanchard, Neil; Elzein, Abier; Trafford, Clare; Rockett, Kirk; Pinder, Margaret; Jallow, Muminatou; Harding, Rosalind; Kwiatkowski, Dominic; McKenzie, Colin

2007-08-10

The sickle (betas) mutation in the beta-globin gene (HBB) occurs on five "classical" betas haplotype backgrounds in ethnic groups of African ancestry. Strong selection in favour of the betas allele - a consequence of protection from severe malarial infection afforded by heterozygotes - has been associated with a high degree of extended haplotype similarity. The relationship between classical betas haplotypes and long-range haplotype similarity may have both anthropological and clinical implications, but to date has not been explored. Here we evaluate the haplotype similarity of classical betas haplotypes over 400 kb in population samples from Jamaica, The Gambia, and among the Yoruba of Nigeria (Hapmap YRI). The most common betas sub-haplotype among Jamaicans and the Yoruba was the Benin haplotype, while in The Gambia the Senegal haplotype was observed most commonly. Both subtypes exhibited a high degree of long-range haplotype similarity extending across approximately 400 kb in all three populations. This long-range similarity was significantly greater than that seen for other haplotypes sampled in these populations (P < 0.001), and was independent of marker choice and marker density. Among the Yoruba, Benin haplotypes were highly conserved, with very strong linkage disequilibrium (LD) extending a megabase across the betas mutation. Two different classical betas haplotypes, sampled from different populations, exhibit comparable and extensive long-range haplotype similarity and strong LD. This LD extends across the adjacent recombination hotspot, and is discernable at distances in excess of 400 kb. Although the multi-centric geographic distribution of betas haplotypes indicates strong subdivision among early Holocene sub-Saharan populations, we find no evidence that selective pressures imposed by falciparum malaria varied in intensity or timing between these subpopulations. Our observations also suggest that cis-acting loci, which may influence outcomes in sickle cell disease, could lie considerable distances away from beta-globin.

Stability and Application of Reactive Nitrogen and Oxygen Species-Induced Hemoglobin Modifications in Dry Blood Spots As Analyzed by Liquid Chromatography Tandem Mass Spectrometry.

PubMed

Chen, Hauh-Jyun Candy; Fan, Chih-Huang; Yang, Ya-Fen

2016-12-19

Dried blood spot (DBS) is an emerging microsampling technique for the bioanalysis of small molecules, including fatty acids, metabolites, drugs, and toxicants. DBS offers many advantages as a sample format including easy sample collection and cheap sample shipment. Hemoglobin adducts have been recognized as a suitable biomarker for monitoring chemical exposure. We previously reported that certain modified peptides in hemoglobin derived from reactive chlorine, nitrogen, and oxygen species are associated with factors including smoking, diabetes mellitus, and aging. However, the stability of these oxidation-induced modifications of hemoglobin remains unknown and whether they can be formed artifactually during storage of DBS. To answer these questions, globin extracted from the DBS cards was analyzed, and the stability of the modifications was evaluated. After storage of the DBS cards at 4 °C or room temperature up to 7 weeks, we isolated globin from a quarter of the spot every week. The extents of 11 sites and types of post-translational modifications (PTMs), including nitration and nitrosylation of tyrosine and oxidation of cysteine and methionine residues, in human hemoglobin were measured in the trypsin digest by nanoflow liquid chromatography-nanospray ionization tandem mass spectrometry (nanoLC-NSI/MS/MS) using selected reaction monitoring. The extents of all these PTMs are stable within 14 days when stored on DBS at room temperature and at 4 °C, while those from direct extraction of fresh blood are stable for at least 8 weeks when stored as an aqueous solution at -20 °C. Extraction of globin from a DBS card is of particular importance for hemolytic blood samples. To our knowledge, this is the first report on the stability of oxidative modifications of hemoglobin on DBSs, which are stable for 14 days under ambient conditions (room temperature, in air). Therefore, it is feasible and convenient to analyze these hemoglobin modifications from DBSs in studies involving large populations.

β-Thalassemia Distribution in the Old World: an Ancient Disease Seen from a Historical Standpoint

PubMed Central

De Sanctis, Vincenzo; Kattamis, Christos; Canatan, Duran; Soliman, Ashraf T.; Elsedfy, Heba; Karimi, Mehran; Daar, Shahina; Wali, Yasser; Yassin, Mohamed; Soliman, Nada; Sobti, Praveen; Al Jaouni, Soad; El Kholy, Mohamed; Fiscina, Bernadette; Angastiniotis, Michael

2017-01-01

Background Haemoglobinopathies constitute the commonest recessive monogenic disorders worldwide, and the treatment of affected individuals presents a substantial global disease burden. β-thalassaemia is characterised by the reduced synthesis (β+) or absence (βo) of the β-globin chains in the HbA molecule, resulting in accumulation of excess unbound α-globin chains that precipitate in erythroid precursors in the bone marrow and in the mature erythrocytes, leading to ineffective erythropoiesis and peripheral haemolysis. Approximately 1.5% of the global population are heterozygotes (carriers) of the β-thalassemias; there is a high incidence in populations from the Mediterranean basin, throughout the Middle East, the Indian subcontinent, Southeast Asia, and Melanesia to the Pacific Islands. Aim The principal aim of this paper is to review, from a historical standpoint, our knowledge about an ancient disease, the β-thalassemias, and in particular, when, how and in what way β-thalassemia spread worldwide to reach such high incidences in certain populations. Results Mutations involving the β-globin gene are the most common cause of genetic disorders in humans. To date, more than 350 β-thalassaemia mutations have been reported. Considering the current distribution of β- thalassemia, the wide diversity of mutations and the small number of specific mutations in individual populations, it seems unlikely that β-thalassemia originated in a single place and time. Conclusions Various processes are known to determine the frequency of genetic disease in human populations. However, it is almost impossible to decide to what extent each process is responsible for the presence of a particular genetic disease. The wide spectrum of β-thalassemia mutations could well be explained by looking at their geographical distribution, the history of malaria, wars, invasions, mass migrations, consanguinity, and settlements. An analysis of the distribution of the molecular spectrum of haemoglobinopathies allows for the development and improvement of diagnostic tests and management of these disorders. PMID:28293406

Multiple biogeographical barriers identified across the monsoon tropics of northern Australia: phylogeographic analysis of the brachyotis group of rock-wallabies.

PubMed

Potter, Sally; Eldridge, Mark D B; Taggart, David A; Cooper, Steven J B

2012-05-01

The monsoon tropics of northern Australia are a globally significant biodiversity hotspot, but its phylogeography is poorly known. A major challenge for this region is to understand the biogeographical processes that have shaped the distribution and diversity of taxa, without detailed knowledge of past climatic and environmental fluctuations. Although molecular data have great potential to address these questions, only a few species have been examined phylogeographically. Here, we use the widely distributed and abundant short-eared rock-wallaby (Petrogale brachyotis; n = 101), together with the sympatric monjon (P. burbidgei; n = 11) and nabarlek (P. concinna; n = 1), to assess historical evolutionary and biogeographical processes in northern Australia. We sequenced ∼1000 bp of mitochondrial DNA (control region, ND2) and ∼3000 bp of nDNA (BRCA1, ω-globin and two anonymous loci) to investigate phylogeographic structuring and delineate the time-scale of diversification within the region. Our results indicate multiple barriers between the Top End (Northern Territory) and Kimberley (Western Australia), which have caused divergence throughout the Plio-Pleistocene. Eight geographically discrete and genetically distinct lineages within the brachyotis group were identified, five of which are separated by major river valleys (Ord, Victoria, Daly), arid lowlands and discontinuous sandstone ranges. It is likely that these barriers have similarly influenced genetic structure in other monsoonal biota. © 2012 Blackwell Publishing Ltd.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rund, D.; Cohen, T.; Filon, D.

{beta}-Thalassemia is a hereditary disease caused by any of 90 different point mutations in the {beta}-globin gene. Specific populations generally carry a small number of mutations, the most common of which are those that are widely distributed regionally. The present study constitutes an extensive molecular characterization of this disease in a small, highly inbred ethnic group with a high incidence of {beta}-thalassemia-the Jews of Kurdistan. An unusual mutational diversity was observed. In 42 sibships 13 different mutations were identified, of which 3 are newly discovered. Four of the mutations are unique to Kurdish Jews and have not been discovered inmore » any other population. A fifth was found outside Kurdish Jews only in an Iranian from Khuzistan, a region bordering Kurdistan. Two-thirds of the mutant chromosomes carry the mutations unique to Kurdish Jews. The authors traced the origin of the mutations to specific geographic regions within Kurdistan. This information, supported by haplotype analysis, suggests that thalassemia in central Kurdistan (northern Iraq) has evolved primarily from multiple mutational events. They conclude that several evolutionary mechanisms contributed to the evolution of {beta}-thalassemia in this small ethnic isolate.« less

LC/MSMS STUDY OF BENZO[A]PYRENE-7,8-QUINONE ADDUCTION TO GLOBIN TRYPTIC PEPTIDES AND N-ACETYLAMINO ACIDS

EPA Science Inventory

Benzo[a]pyrene-7,8-quinone (BPQ) is regarded as a reactive genotoxic compound enzymatically formed from a xenobiotic precursor benzo[a]pyrene-7,8-diol by aldo-keto-reductase family of enzymes. Because BPQ, a Michael electrophile, was previously shown to react with oligonucleotide...

Genotoxic activity of 4,4',5'-trimethylazapsoralen on plasmid DNA.

PubMed

Lagatolla, C; Dolzani, L; Granzotto, M; Monti-Bragadin, C

1998-01-01

The genotoxic activities of 8-methoxypsoralen (8-MOP) and 4,4',5'-trimethylazapsoralen (4,4',5'-TMAP) on plasmid DNA have been compared. In a previous work, 4,4',5'-TMAP, a methyl derivative of a psoralen isoster, had shown potential photochemotherapeutic activity. The mutagenic activity of mono- and bifunctional lesions caused by these compounds was evaluated both after UVA irradiation, which causes the formation of both kinds of lesions, and after a two-step irradiation procedure of the psoralen-plasmid DNA complex, which allowed monoadducts and interstrand crosslinks to be studied separately. Furthermore, we used a procedure that allowed us to evaluate both the mutagenic and recombinogenic activity of the two compounds. Results indicate that the most important difference between 8-MOP and 4,4',5'-TMAP consists in their mode of photoreaction with DNA rather than in their mutagenic potential. In fact, in all of the experimental procedures, 4,4',5'-TMAP shows a lower ability than 8-MOP to generate interstrand crosslinks. However, when comparable toxicity levels are reached, the two compounds show the same mutagenic potentiality.

Analysis of a Mouse α-Globin Gene Mutation Induced by Ethylnitrosourea

PubMed Central

Popp, R. A.; Bailiff, E. G.; Skow, L. C.; Johnson, F. M.; Lewis, Susan E.

1983-01-01

A DBA/2 mouse treated with ethylnitrosourea sired an offspring whose hemoglobin showed an extra band following starch gel electrophoresis. The variant hemoglobin migrated to a more cathodal position in starch gel. Isoelectric focusing indicated that chain 5 of the mutant hemoglobin migrated to a more cathodal position than the normal chain 5 from DBA/2 mice and that the other α-globin, chain 1, was not affected. On focusing gels the phenotype of the mutant allele, Hbay9, was expressed without dominance to normal chain 5, and Hbay9/Hbay9 homozygotes were fully viable in the laboratory. The molecular basis for the germinal mutation was investigated by analyzing the amino acid sequence of chain 5y9, the mutant form of α-chain 5. A single amino acid substitution (His → Leu) at position 89 was found in chain 5y9. We propose that ethylnitrosourea induced an A → T transversion in the histidine codon at position 89 (CAC → CTC). This mutation has apparently not been observed previously in humans, mice or other mammals, and its novel occurrence may be indicative of other unusual mutational events that do not ordinarily occur in the absence of specific mutagen exposure. PMID:6618166

Translation of globin messenger RNA by the mouse ovum

PubMed Central

Brinster, R. L.; Chen, H. Y.; Trumbauer, M. E.; Avarbock, M. R.

2016-01-01

It has been demonstrated that the Xenopus oocyte can translate rabbit haemoglobin messenger RNA (mRNA) following microinjection of the message into the cell1. The Xenopus oocyte has since been shown to be capable of translating a variety of messenger RNAs from different species2–4. This system has proved useful in understanding the mechanism of message translation and has also provided information about the translation capability of the Xenopus oocyte5,6. Several other cell types, including HeLa cells and fibroblasts, can also translate exogenous message injected into the cell7,8. However, there have been no reports of injection of mRNA into oocytes or fertilised one-cell ova of mammalian species. Nevertheless, the latter system could be of considerable use in studying the processing of exogenous messages in a mammalian system undergoing development, as well as providing insight into the way the early embryo processes injected messages and the protein products of such messages. We report here the results of injecting message into the fertilised one-cell mouse ovum and show that both mouse and rabbit globin mRNA are translated in this system. PMID:7352032

A phased SNP-based classification of sickle cell anemia HBB haplotypes.

PubMed

Shaikho, Elmutaz M; Farrell, John J; Alsultan, Abdulrahman; Qutub, Hatem; Al-Ali, Amein K; Figueiredo, Maria Stella; Chui, David H K; Farrer, Lindsay A; Murphy, George J; Mostoslavsky, Gustavo; Sebastiani, Paola; Steinberg, Martin H

2017-08-11

Sickle cell anemia causes severe complications and premature death. Five common β-globin gene cluster haplotypes are each associated with characteristic fetal hemoglobin (HbF) levels. As HbF is the major modulator of disease severity, classifying patients according to haplotype is useful. The first method of haplotype classification used restriction fragment length polymorphisms (RFLPs) to detect single nucleotide polymorphisms (SNPs) in the β-globin gene cluster. This is labor intensive, and error prone. We used genome-wide SNP data imputed to the 1000 Genomes reference panel to obtain phased data distinguishing parental alleles. We successfully haplotyped 813 sickle cell anemia patients previously classified by RFLPs with a concordance >98%. Four SNPs (rs3834466, rs28440105, rs10128556, and rs968857) marking four different restriction enzyme sites unequivocally defined most haplotypes. We were able to assign a haplotype to 86% of samples that were either partially or misclassified using RFLPs. Phased data using only four SNPs allowed unequivocal assignment of a haplotype that was not always possible using a larger number of RFLPs. Given the availability of genome-wide SNP data, our method is rapid and does not require high computational resources.

Iron deficiency anaemia: with the conclusion of a need for iron reader

NASA Astrophysics Data System (ADS)

Lim, Wai Feng; Yap, Boon Kar; Lai, Mei I.; Talik, Noorazrina; Nasser, Ammar Ahmed; Al-Haiqi, Ahmed Mubarak Ahmed; Sankar Krishnan, Prajindra

2017-10-01

In our bloodstream, there are plenty of red blood cells (RBC), which function as an important oxygen carrier in our bodies. Each RBC consists of millions of haemoglobin (Hb), which is made up from globin and iron. If any deficiency/malfunction of any globin, it will lead to anaemia as indicated in low Hb level while iron deficiency anaemia (IDA) is anaemic due to the lacking of iron as indicated in low Hb and ferritin levels. IDA affects almost two billion people globally while anaemia without iron deficiency, such as thalassaemia, affects almost 4.5% in Malaysian population. These anaemic conditions have similar clinical symptoms like fatigue, dizziness, in which disturb their cognitive development and productivity in workplace. In areas without proper medical access, many anaemic individuals were misdiagnosed and treated with iron tablets because they were thought to have iron deficiency anaemia due to low Hb content. But, excess iron is toxic to the body. Misdiagnosis can be avoided by iron status assessment. We hereby review the currently available iron status parameters in laboratory and field study with the conclusion of demonstrating the importance of a need for iron reader, in the effort to reduce the prevalence of IDA globally.

A bimetallic nanocomposite modified genosensor for recognition and determination of thalassemia gene.

PubMed

Hamidi-Asl, Ezat; Raoof, Jahan Bakhsh; Naghizadeh, Nahid; Akhavan-Niaki, Haleh; Ojani, Reza; Banihashemi, Ali

2016-10-01

The main roles of DNA in the cells are to maintain and properly express genetic information. It is important to have analytical methods capable of fast and sensitive detection of DNA damage. DNA hybridization sensors are well suited for diagnostics and other purposes, including determination of bacteria and viruses. Beta thalassemias (βth) are due to mutations in the β-globin gene. In this study, an electrochemical biosensor which detects the sequences related to the β-globin gene issued from real samples amplified by polymerase chain reaction (PCR) is described for the first time. The biosensor relies on the immobilization of 20-mer single stranded oligonucleotide (probe) related to βth sequence on the carbon paste electrode (CPE) modified by 15% silver (Ag) and platinum (Pt) nanoparticles to prepare the bimetallic nanocomposite electrode and hybridization of this oligonucleotide with its complementary sequence (target). The extent of hybridization between the probe and target sequences was shown by using linear sweep voltammetry (LSV) with methylene blue (MB) as hybridization indicator. The selectivity of sensor was investigated using PCR samples containing non-complementary oligonucleotides. The detection limit of biosensor was calculated about 470.0pg/μL. Copyright © 2016 Elsevier B.V. All rights reserved.

Three 3D graphical representations of DNA primary sequences based on the classifications of DNA bases and their applications.

PubMed

Xie, Guosen; Mo, Zhongxi

2011-01-21

In this article, we introduce three 3D graphical representations of DNA primary sequences, which we call RY-curve, MK-curve and SW-curve, based on three classifications of the DNA bases. The advantages of our representations are that (i) these 3D curves are strictly non-degenerate and there is no loss of information when transferring a DNA sequence to its mathematical representation and (ii) the coordinates of every node on these 3D curves have clear biological implication. Two applications of these 3D curves are presented: (a) a simple formula is derived to calculate the content of the four bases (A, G, C and T) from the coordinates of nodes on the curves; and (b) a 12-component characteristic vector is constructed to compare similarity among DNA sequences from different species based on the geometrical centers of the 3D curves. As examples, we examine similarity among the coding sequences of the first exon of beta-globin gene from eleven species and validate similarity of cDNA sequences of beta-globin gene from eight species. Copyright © 2010 Elsevier Ltd. All rights reserved.

Phytomedicines and Nutraceuticals: Alternative Therapeutics for Sickle Cell Anemia

PubMed Central

Imaga, Ngozi Awa

2013-01-01

Sickle cell anemia is a genetically inherited disease in which the “SS” individual possesses an abnormal beta globin gene. A single base substitution in the gene encoding the human β-globin subunit results in replacement of β6 glutamic acid by valine, leading to the devastating clinical manifestations of sickle cell disease. This substitution causes drastic reduction in the solubility of sickle cell hemoglobin (HbS) when deoxygenated. Under these conditions, the HbS molecules polymerize to form long crystalline intracellular mass of fibers which are responsible for the deformation of the biconcave disc shaped erythrocyte into a sickle shape. First-line clinical management of sickle cell anemia include, use of hydroxyurea, folic acid, amino acids supplementation, penicillinprophylaxis, and antimalarial prophylaxis to manage the condition and blood transfusions to stabilize the patient's hemoglobin level. These are quite expensive and have attendant risk factors. However, a bright ray of hope involving research into antisickling properties of medicinal plants has been rewarding. This alternative therapy using phytomedicines has proven to not only reduce crisis but also reverse sickling (in vitro). The immense benefits of phytomedicines and nutraceuticals used in the management of sickle cell anemia are discussed in this paper. PMID:23476125

Deletion of transcription factor binding motifs using the CRISPR/spCas9 system in the β-globin LCR.

PubMed

Kim, Yea Woon; Kim, AeRi

2017-07-20

Transcription factors play roles in gene transcription through direct binding to their motifs in genome, and inhibiting this binding provides an effective strategy for studying their roles. Here we applied the CRISPR/spCas9 system to mutate the binding motifs of transcription factors. Binding motifs for erythroid specific transcription factors were mutated in the locus control region hypersensitive sites of the human β-globin locus. Guide RNAs targeting binding motifs were cloned into lentiviral CRISPR vector containing the spCas9 gene, and transduced into MEL/ch11 cells carrying a human chromosome 11. DNA mutations in clonal cells were initially screened by quantitative PCR in genomic DNA and then clarified by sequencing. Mutations in binding motifs reduced occupancy by transcription factors in a chromatin environment. Characterization of mutations revealed that the CRISPR/spCas9 system mainly induced deletions in short regions of <20 bp and preferentially deleted nucleotides around the fifth nucleotide upstream of Protospacer adjacent motifs. These results indicate that the CRISPR/Cas9 system is suitable for mutating the binding motifs of transcription factors, and, consequently, would contribute to elucidate the direct roles of transcription factors. ©2017 The Author(s).

Interaction of Hb South Florida (codon 1; GTG-->ATG) and HbE, with beta-thalassemia (IVS1-1; G-->A): expression of different clinical phenotypes.

PubMed

Tan, Jin-Ai Mary Anne; Tan, Kim-Lian; Omar, Khairul Zaman; Chan, Lee-Lee; Wee, Yong-Chui; George, Elizabeth

2009-09-01

Interactions of different hemoglobin variants with thalassemia alleles can result in various clinical phenotypes. HbE-beta-thalassemia generally manifests with severe anemia where individuals exhibit beta-thalassemia major with regular blood transfusions or beta-thalassemia intermedia with periodic blood transfusions. This study presents a unique Malay family with three beta-globin gene defects-HbE, Hb South Florida, and IVS1-1 (G-->A). HbE activates a cryptic splice site that produces non-functional mRNAs. Hb South Florida is a rare beta-hemoglobin variant, and its interactions with other beta-thalassemia alleles have not been reported. IVS1-1 is a Mediterranean mutation that affects mRNA processing giving rise to beta(o)-thalassemia. Fifteen mutations along the beta-globin gene complex were analyzed using the amplification refractory mutation system. Hb South Florida was identified by direct sequencing using genomic DNA. The affected child with HbE/IVS1-1 produced a beta-thalassemia major phenotype. Compound heterozygosity for Hb South Florida/IVS1-1 produced a beta-thalassemia carrier phenotype in the mother.

DNA Stimulates ATP-Dependent Proteolysis and Protein-Dependent ATPase Activity of Protease La from Escherichia coli

NASA Astrophysics Data System (ADS)

Chung, Chin Ha; Goldberg, Alfred L.

1982-02-01

The product of the lon gene in Escherichia coli is an ATP-dependent protease, protease La, that also binds strongly to DNA. Addition of double-stranded or single-stranded DNA to the protease in the presence of ATP was found to stimulate the hydrolysis of casein or globin 2- to 7-fold, depending on the DNA concentration. Native DNA from several sources (plasmid pBR322, phage T7, or calf thymus) had similar effects, but after denaturation the DNA was 20-100% more effective than the native form. Although poly(rA), globin mRNA, and various tRNAs did not stimulate proteolysis, poly(rC) and poly(rU) were effective. Poly(dT) was stimulatory but (dT)10 was not. In the presence of DNA as in its absence, proteolysis required concomitant ATP hydrolysis, and the addition of DNA also enhanced ATP hydrolysis by protease La 2-fold, but only in the presence of casein. At much higher concentrations, DNA inhibited proteolysis as well as ATP cleavage. Thus, association of this enzyme with DNA may regulate the degradation of cell proteins in vivo.

Molecular Characterization of β-Thalassemia Intermedia in Southeast Iran.

PubMed

Miri-Moghaddam, Ebrahim; Bahrami, Sara; Naderi, Majid; Bazi, Ali; Karimipoor, Morteza

2016-06-01

Inheritance of mild mutations within the β-globin gene and coinheritance of α-thalassemia (α-thal) are known as two important genetic modifiers in β-thalassemia (β-thal) intermedia (β-TI). We aimed to evaluate the spectrum of β- and α-thal mutations in β-TI patients in Southeast Iran. Common β- and α-globin gene mutations were detected by amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) and multiplex gap-PCR, respectively. There were 26 male (57.8%) and 19 female (42.2%) patients. HBB: c.92 + 5T > C [IVS-I-5 (G > C)] and HBB: c.-138C + 1G > A [IVS-II-I (G > A)] represented the prevalent alleles with respective frequencies of 60.0 and 10.0%. Other β-globin mutations included HBB: c.-138C > T [-88 (C > T)], HBB: c.27_28insG [frameshift codons (FSC) 8/9 (+G)], HBB: c.46delT [codon 15 (-T)], HBB: c.93-22_95del (IVS-I, 25 del), and the 619 bp deletion (NG_000007.3: g.71609_72227del619). The predominant genotypic combinations were β(0)/β(0) (68.9%), β(0)/β(+ )(8.9%) and β(+)/β(+ )(2.2%). Coinheritance of α-thal was observed in 33.0% of the patients, with the -α(3.7) (rightward) (NG_000006.1: g.34164_37967del3804) as the most common deletion (86.0%). One patient was diagnosed with the -α(4.2) (leftward) (AF221717) and one with the - -(MED) (g.24664_41064del16401) deletions, while no patients carried the -(α)(20.5) (g.15164_37864del22701), α(-5 nt) (HBA2: c.95 + 2_95_6delTGAGG) or codon 19 (-G) (HBA2: c.56delG) mutations. The alleviating molecular mechanism was not explainable by β(+ )or concurrent α-thal in more than half of our β-TI patients. This encourages conducting more studies to identify other contributing factors, especially Hb F-inducing genetic modifiers.

A Comprehensive Molecular Investigation of α-Thalassemia in an Iranian Cohort from Different Provinces of North Iran.

PubMed

Eftekhari, Hajar; Tamaddoni, Ahmad; Mahmoudi Nesheli, Hassan; Vakili, Mohsen; Sedaghat, Sadegh; Banihashemi, Ali; Azizi, Mandana; Youssefi Kamangar, Reza; Akhavan-Niaki, Haleh

2017-01-01

α-Thalassemia (α-thal) is the most common monogenic disease that is caused by the absence or reduced expression of α-globin genes. The aim of this study was to investigate common α-globin mutations and their associated haplotypes in four northern provinces of Iran (Gilan, Mazandaran, Golestan, Khorasan). One thousand, one hundred and ninety-one persons were tested for α-thal mutations by gap-polymerase chain reaction (PCR), reverse dot-blot hybridization, restriction fragment length polymorphism (RFLP) analysis and sequencing. Of the nine different mutations found, the most frequent were -α 3.7 (rightward deletion) (45.6%), polyadenylation site (α p ° lyA2 α) (α2) (AATAAA>AATGAA; HBA2: c.*92 A>G) (15.27%), - - MED (Mediterranean deletion) (6.86%), -α 4.2 (leftward deletion), (6.17%), α CS α [Hb Constant Spring (Hb CS) (HBA2: c.427 T>C)] (4.62%), -α -5 nt (HBA2: c.95+2_95+6delTGAGG) (3.70%). All chromosomes bearing an α-globin point mutation [α p ° lyA2 α, -α -5 nt α, α CS α, α p ° lyA1 α (AATAAA> AATAAG; HBA2: c.*94 A>G)] showed only one haplotype that was present in most normal chromosomes, while the -α 3.7 deletion was associated with three distinct haplotypes. Our results indicate that α-thal mutations are heterogeneous and -α 3.7 and α p ° lyA2 α are the most prevalent mutations in this region. The presence of -α 3.7 with three different haplotypes suggests an older history for this mutation. The high prevalence of α p ° lyA2 α in Mazandaran Province, Iran compared to other parts of the country and the world, suggests a founder effect. Altogether, we here provide further data confirming the heterogeneity of the northern population of Iran. These data may contribute to the establishment of a national mutation database, more accurate genetic counseling and prenatal diagnosis (PND).

In Silico Analysis of Single Nucleotide Polymorphism (SNPs) in Human β-Globin Gene

PubMed Central

Alanazi, Mohammed; Abduljaleel, Zainularifeen; Khan, Wajahatullah; Warsy, Arjumand S.; Elrobh, Mohamed; Khan, Zahid; Amri, Abdullah Al; Bazzi, Mohammad D.

2011-01-01

Single amino acid substitutions in the globin chain are the most common forms of genetic variations that produce hemoglobinopathies- the most widespread inherited disorders worldwide. Several hemoglobinopathies result from homozygosity or compound heterozygosity to beta-globin (HBB) gene mutations, such as that producing sickle cell hemoglobin (HbS), HbC, HbD and HbE. Several of these mutations are deleterious and result in moderate to severe hemolytic anemia, with associated complications, requiring lifelong care and management. Even though many hemoglobinopathies result from single amino acid changes producing similar structural abnormalities, there are functional differences in the generated variants. Using in silico methods, we examined the genetic variations that can alter the expression and function of the HBB gene. Using a sequence homology-based Sorting Intolerant from Tolerant (SIFT) server we have searched for the SNPs, which showed that 200 (80%) non-synonymous polymorphism were found to be deleterious. The structure-based method via PolyPhen server indicated that 135 (40%) non-synonymous polymorphism may modify protein function and structure. The Pupa Suite software showed that the SNPs will have a phenotypic consequence on the structure and function of the altered protein. Structure analysis was performed on the key mutations that occur in the native protein coded by the HBB gene that causes hemoglobinopathies such as: HbC (E→K), HbD (E→Q), HbE (E→K) and HbS (E→V). Atomic Non-Local Environment Assessment (ANOLEA), Yet Another Scientific Artificial Reality Application (YASARA), CHARMM-GUI webserver for macromolecular dynamics and mechanics, and Normal Mode Analysis, Deformation and Refinement (NOMAD-Ref) of Gromacs server were used to perform molecular dynamics simulations and energy minimization calculations on β-Chain residue of the HBB gene before and after mutation. Furthermore, in the native and altered protein models, amino acid residues were determined and secondary structures were observed for solvent accessibility to confirm the protein stability. The functional study in this investigation may be a good model for additional future studies. PMID:22028795

Hydroxylamine-induced oxidation of ferrous carbonylated truncated hemoglobins from Mycobacterium tuberculosis and Campylobacter jejuni is limited by carbon monoxide dissociation.

PubMed

Ascenzi, Paolo; Ciaccio, Chiara; Gasperi, Tecla; Pesce, Alessandra; Caporaso, Lucia; Coletta, Massimo

2017-08-01

Hydroxylamine (HA) is an oxidant of ferrous globins and its action has been reported to be inhibited by CO, even though this mechanism has not been clarified. Here, kinetics of the HA-mediated oxidation of ferrous carbonylated Mycobacterium tuberculosis truncated hemoglobin N and O (Mt-trHbN(II)-CO and Mt-trHbO(II)-CO, respectively) and Campylobacter jejuni truncated hemoglobin P (Cj-trHbP(II)-CO), at pH 7.2 and 20.0 °C, are reported. Mixing Mt-trHbN(II)-CO, Mt-trHbO(II)-CO, and Cj-trHbP(II)-CO solution with the HA solution brings about absorption spectral changes reflecting the disappearance of the ferrous carbonylated derivatives with the concomitant formation of the ferric species. HA oxidizes irreversibly Mt-trHbN(II)-CO, Mt-trHbO(II)-CO, and Cj-trHbP(II)-CO with the 1:2 stoichiometry. The dissociation of CO turns out to be the rate-limiting step for the oxidation of Mt-trHbN(II)-CO, Mt-trHbO(II)-CO, and Cj-trHbP(II)-CO by HA. Values of the second-order rate constant for HA-mediated oxidation of Mt-trHbN(II)-CO, Mt-trHbO(II)-CO, and Cj-trHbP(II)-CO range between 8.8 × 10 4 and 8.6 × 10 7 M -1 s -1 , reflecting different structural features of the heme distal pocket. This study (1) demonstrates that the inhibitory effect of CO is linked to the dissociation of this ligand, giving a functional basis to previous studies, (2) represents the first comparative investigation of the oxidation of ferrous carbonylated bacterial 2/2 globins belonging to the N, O, and P groups by HA, (3) casts light on the correlation between kinetics of HA-mediated oxidation and carbonylation of globins, and (4) focuses on structural determinants modulating the HA-induced oxidation process.

Prosomes. Ubiquity and inter-species structural variation.

PubMed

Martins de Sa, C; Grossi de Sa, M F; Akhayat, O; Broders, F; Scherrer, K; Horsch, A; Schmid, H P

1986-02-20

The "prosomes", a novel type of ubiquitous ribonucleoprotein particle of extraordinary stability and of defined electron microscopical structure, have been characterized in several cell types and species. Identified as a 19 S sub-component of free mRNA-protein complexes, including globin and other repressed mRNA, in the cytoplasm of duck, mouse and HeLa cells, they were previously found to inhibit protein synthesis in vitro. In all cells studied, electron microscopy shows an identical, seemingly ring-like but rather raspberry-shaped particle of 12 nm diameter, resistant to EDTA and 1% (w/v) Sarkosyl. Two-dimensional electrophoretic analysis of prosomal proteins shows a characteristic pattern in the 19,000 to 35,000 Mr range of pI 4 to 7, with an additional 56,000 Mr component specific to avian species. The prosomes found in globin mRNA-protein complexes contain about 25 protein components, 16 of which have identical molecular weight and pI values in duck and mouse, and which are also found in the prosomes of the heterogeneous free mRNPs of HeLa cells. Seral and monoclonal antibodies raised in mice against the prosomes of duck erythroblasts cross-react with some of the proteins of the mouse and HeLa cell particles. Prosomes isolated from duck and mouse globin mRNP, both contain small cytoplasmic RNAs of 70 to 90 nucleotides, which represent about 15% of the particle mass. The molecular weight and the 3'-terminal oligonucleotide of each one of these small cytoplasmic RNAs are identical in the two animal species; fingerprints of their oligonucleotides generated by RNase T1 show that more than 80% of spots are identical. In contrast, the prosomes of HeLa cells, associated with a large population of repressed mRNA, contain at least 12 small cytoplasmic RNA species. All prosomal RNAs tested so far hybridize to mRNA. The data available indicate that prosomes constitute a novel class of ubiquitous cellular ribonucleoprotein complexes, present in the nucleus and cytoplasm that, in its structural variations shown here, reflects function and species.

Coexpression of Human α- and Circularly Permuted β-Globins Yields a Hemoglobin with Normal R State but Modified T State Properties†

PubMed Central

Asmundson, Anna L.; Taber, Alexandria M.; van der Walde, Adella; Lin, Danielle H.; Olson, John S.; Anthony-Cahill, Spencer J.

2009-01-01

For the first time, a circularly permuted human β-globin (cpβ) has been coexpressed with human α-globin in bacterial cells and shown to associate to form α-cpβ hemoglobin in solution. Flash photolysis studies of α-cpβ show markedly biphasic CO and O2 kinetics with the amplitudes for the fast association phases being dominant due the presence of large amounts of high-affinity liganded hemoglobin dimers. Extensive dimerization of liganded but not deoxygenated α-cpβ was observed by gel chromatography. The rate constants for O2 and CO binding to the R state forms of α-cpβ are almost identical to those of native HbA (k′R(CO) ≈ 5.0 μM−1 s−1; k′R(O2) ≈ 50 μM−1 s−1), and the rate of O2 dissociation from fully oxygenated α-cpβ is also very similar to that observed for HbA (kR(O2) ≈ 21–28 s−1). When the equilibrium deoxyHb form of α-cpβ is reacted with CO in rapid mixing experiments, the observed time courses are monophasic and the observed bimolecular association rate constant is ∼1.0 μM−1 s−1, which is intermediate between the R state rate measured in partial photolysis experiments (∼5 μM−1 s−1) and that observed for T state deoxyHbA (k′T(CO) ≈ 0.1 to 0.2 μM−1 s−1). Thus the deoxygenated permutated β subunits generate an intermediate, higher affinity, deoxyHb quaternary state. This conclusion is supported by equilibrium oxygen binding measurements in which α-cpβ exhibits a P50 of ∼1.5 mmHg and a low n-value (∼1.3) at pH 7, 20 °C, compared to 8.5 mmHg and n ≈ 2.8 for native HbA under identical, dilute conditions. PMID:19397368

Post-transcriptional regulation mediated by specific neurofilament introns in vivo.

PubMed

Wang, Chen; Szaro, Ben G

2016-04-01

Neurons regulate genes post-transcriptionally to coordinate the supply of cytoskeletal proteins, such as the medium neurofilament (NEFM), with demand for structural materials in response to extracellular cues encountered by developing axons. By using a method for evaluating functionality of cis-regulatory gene elements in vivo through plasmid injection into Xenopus embryos, we discovered that splicing of a specific nefm intron was required for robust transgene expression, regardless of promoter or cell type. Transgenes utilizing the nefm 3'-UTR but substituting other nefm introns expressed little or no protein owing to defects in handling of the messenger (m)RNA as opposed to transcription or splicing. Post-transcriptional events at multiple steps, but mainly during nucleocytoplasmic export, contributed to these varied levels of protein expression. An intron of the β-globin gene was also able to promote expression in a manner identical to that of the nefm intron, implying a more general preference for certain introns in controlling nefm expression. These results expand our knowledge of intron-mediated gene expression to encompass neurofilaments, indicating an additional layer of complexity in the control of a cytoskeletal gene needed for developing and maintaining healthy axons. © 2016. Published by The Company of Biologists Ltd.

Red blood cells release factors with growth and survival bioactivities for normal and leukemic T cells.

PubMed

Antunes, Ricardo F; Brandão, Cláudia; Maia, Margarida; Arosa, Fernando A

2011-01-01

Human red blood cells are emerging as a cell type capable to regulate biological processes of neighboring cells. Hereby, we show that human red blood cell conditioned media contains bioactive factors that favor proliferation of normal activated T cells and leukemic Jurkat T cells, and therefore called erythrocyte-derived growth and survival factors. Flow cytometry and electron microscopy in parallel with bioactivity assays revealed that the erythrocyte factors are present in the vesicle-free supernatant, which contains up to 20 different proteins. The erythrocyte factors are thermosensitive and do not contain lipids. Native polyacrylamide gel electrophoresis followed by passive elution and mass spectrometry identification reduced the potential erythrocyte factors to hemoglobin and peroxiredoxin II. Two-dimensional differential gel electrophoresis of the erythrocyte factors revealed the presence of multiple hemoglobin oxy-deoxy states and peroxiredoxin II isoforms differing in their isoelectric point akin to the presence of β-globin chains. Our results show that red blood cells release protein factors with the capacity to sustain T-cell growth and survival. These factors may have an unforeseen role in sustaining malignant cell growth and survival in vivo.

Inflammatory targets of therapy in sickle cell disease

PubMed Central

Owusu-Ansah, Amma; Ihunnah, Chibueze A.; Walker, Aisha L.; Ofori-Acquah, Solomon F.

2015-01-01

Sickle cell disease (SCD) is a monogenic globin disorder characterized by the production of a structurally abnormal hemoglobin (Hb) variant Hb S, which causes severe hemolytic anemia, episodic painful vaso-occlusion and ultimately end-organ damage. The primary disease pathophysiology is intracellular Hb S polymerization and consequent sickling of erythrocytes. It has become evident over several decades that a more complex disease process contributes to the myriad of clinical complications seen in SCD patients with inflammation playing a central role. Drugs targeting specific inflammatory pathways therefore offer an attractive therapeutic strategy to ameliorate many of the clinical events in SCD. In addition they are useful tools to dissecting the molecular and cellular mechanisms that promote individual clinical events, and for developing improved therapeutics to address more challenging clinical dilemmas such as refractoriness to opioids or hyperalgesia. Here, we discuss the prospect of targeting multiple inflammatory pathways implicated in the pathogenesis of SCD with a focus on new therapeutics, striving to link the actions of the anti-inflammatory agents to a defined pathobiology, and specific clinical manifestations of SCD. We also review the anti-inflammatory attributes and the cognate inflammatory targets of hydroxyurea, the only FDA approved drug for SCD. PMID:26226206

Free-energy landscape, principal component analysis, and structural clustering to identify representative conformations from molecular dynamics simulations: the myoglobin case.

PubMed

Papaleo, Elena; Mereghetti, Paolo; Fantucci, Piercarlo; Grandori, Rita; De Gioia, Luca

2009-01-01

Several molecular dynamics (MD) simulations were used to sample conformations in the neighborhood of the native structure of holo-myoglobin (holo-Mb), collecting trajectories spanning 0.22 micros at 300 K. Principal component (PCA) and free-energy landscape (FEL) analyses, integrated by cluster analysis, which was performed considering the position and structures of the individual helices of the globin fold, were carried out. The coherence between the different structural clusters and the basins of the FEL, together with the convergence of parameters derived by PCA indicates that an accurate description of the Mb conformational space around the native state was achieved by multiple MD trajectories spanning at least 0.14 micros. The integration of FEL, PCA, and structural clustering was shown to be a very useful approach to gain an overall view of the conformational landscape accessible to a protein and to identify representative protein substates. This method could be also used to investigate the conformational and dynamical properties of Mb apo-, mutant, or delete versions, in which greater conformational variability is expected and, therefore identification of representative substates from the simulations is relevant to disclose structure-function relationship.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thein, S.L.; Hesketh, C.; Wood, W.G.

Analysis of the molecular basis of dominantly inherited {beta}-thalassemia in four families has revealed different mutations involving exon 3 of the {beta}-globin gene. It is suggested that the phenotypic difference between this condition and the more common recessive forms of {beta}-thalassemia lies mainly in the length and stability of the abnormal translation products that are synthesized and, in particular, whether they are capable of binding heme and producing aggregations that are relatively resistant to proteolytic degradation.

Hemoglobin adducts as biomarkers of 1,3-butadiene in occupationally low exposed Italian workers and a few diesel-exposed miners.

PubMed

Begemann, P; Upton, P B; Ranasinghe, A; Swenberg, J A; Soleo, L; Vimercati, L; Gelormini, A; Fustinoni, S; Zwirner-Baier, I; Neumann, H G

2001-06-01

Hemoglobin adducts were determined as biomarkers of 1,3-butadiene (BD) in 30 workers and 10 controls from an Italian BD plant and in 14 diesel-exposed miners. N-(2,3,4-trihydroxybutyl)valine (THBVal), an N-terminal valine globin adduct of reactive butadiene metabolites, was analyzed by gas chromatography/high resolution mass spectrometry after a modified Edman degradation and further acetylation. The BD exposure for the plant workers was 31 microg/m(3) (personal sampling). Whereas there was no detectable difference in hemoglobin adduct levels (range 17.7-61.4 pmol/g globin) between the total group of exposed and controls, slight but significant differences could be found between two subgroups of workers from different production units as well as one subgroup and controls (P<0.05), between smoking (n=13) and non-smoking exposed workers (n=17; P=0.066) as well as between smoking exposed workers and controls (P=0.055). Adduct levels of the miners (all non-smokers) were in the same range as those of the Italian BD-workers and controls. The internal exposure and strain measured by THBVal levels resulting from a very low occupational BD exposure was in the range of the contribution of moderate smoking.

Association between Oxidative Stress, Genetic Factors, and Clinical Severity in Children with Sickle Cell Anemia.

PubMed

Renoux, Céline; Joly, Philippe; Faes, Camille; Mury, Pauline; Eglenen, Buse; Turkay, Mine; Yavas, Gokce; Yalcin, Ozlem; Bertrand, Yves; Garnier, Nathalie; Cuzzubbo, Daniela; Gauthier, Alexandra; Romana, Marc; Möckesch, Berenike; Cannas, Giovanna; Antoine-Jonville, Sophie; Pialoux, Vincent; Connes, Philippe

2018-04-01

To investigate the associations between several sickle cell disease genetic modifiers (beta-globin haplotypes, alpha-thalassemia, and glucose-6-phosphate dehydrogenase deficiency) and the level of oxidative stress and to evaluate the association between oxidative stress and the rates of vaso-occlusive events. Steady-state oxidative and nitrosative stress markers, biological variables, genetic modulators, and vaso-occlusive crisis events requiring emergency admissions were measured during a 2-year period in 62 children with sickle cell anemia (58 SS and 4 Sβ 0 ). Twelve ethnic-matched children without sickle cell anemia also participated as healthy controls (AA) for oxidative and nitrosative stress level measurement. Oxidative and nitrosative stress were greater in patients with sickle cell anemia compared with control patients, but the rate of vaso-occlusive crisis events in sickle cell anemia was not associated with the level of oxidative stress. The presence of alpha-thalassemia, but not glucose-6-phosphate dehydrogenase deficiency or beta-globin haplotype, modulated the level of oxidative stress in children with sickle cell anemia. Mild hemolysis in children with alpha-thalassemia may limit oxidative stress and could explain the protective role of alpha-thalassemia in hemolysis-related sickle cell complications. Copyright © 2017 Elsevier Inc. All rights reserved.

High-resolution melting analysis for prenatal diagnosis of beta-thalassemia in northern Thailand.

PubMed

Charoenkwan, Pimlak; Sirichotiyakul, Supatra; Phusua, Arunee; Suanta, Sudjai; Fanhchaksai, Kanda; Sae-Tung, Rattika; Sanguansermsri, Torpong

2017-12-01

High-resolution melting (HRM) analysis is a rapid mutation analysis which assesses the pattern of reduction of fluorescence signal after subjecting the amplified PCR product with saturated fluorescence dye to an increasing temperature. We used HRM analysis for prenatal diagnosis of beta-thalassemia disease in northern Thailand. Five PCR-HRM protocols were used to detect point mutations in five different segments of the beta-globin gene, and one protocol to detect the 3.4 kb beta-globin deletion. We sought to characterize the mutations in carriers and to enable prenatal diagnosis in 126 couples at risk of having a fetus with beta-thalassemia disease. The protocols identified 18 common mutations causing beta-thalassemia, including the rare codon 132 (A-T) mutation. Each mutation showed a specific HRM pattern and all results were in concordance with those from direct DNA sequencing or gap-PCR methods. In cases of beta-thalassemia disease resulting from homozygosity for a mutation or compound heterozygosity for two mutations on the same amplified segment, the HRM patterns were different to those of a single mutation and were specific for each combination. HRM analysis is a simple and useful method for mutation identification in beta-thalassemia carriers and prenatal diagnosis of beta-thalassemia in northern Thailand.

β-Thalassemia gene mutations in Antalya, Turkey: results from a single centre study.

PubMed

Kurtoğlu, Ayşegül; Karakuş, Volkan; Erkal, Özgür; Kurtoğlu, Erdal

2016-11-01

β-Thalassemia (β-thal) is a common autosomal recessive disorder resulting from over 300 different mutations of the β-globin genes. Our aim was to create a mutation map of β-thal in the province of Antalya, Turkey. In this study, mutation analysis of a total 146 of β-thal patients followed at the Thalassemia Center of the Antalya Education and Research Hospital, Antalya, Turkey, were included. Direct DNA sequence analysis was performed for mutation scanning of the β-globin gene. One hundred and forty-six patients with β-thal including all types were analyzed, and 14 different β-thal mutations were detected. The most frequently seen mutation was HBB: c.93 - 21G > A [IVS-I-110 (G > A)] (52.7%), followed by HBB: .c.92 + 6T > C [IVS-I-6 (T > C)] (14.4%), HBB: c.-80T > A [-30 (T > A)] (8.2%), HBB: c.315 + 1G > A [IVS-II-1 (G > A)] (8.2%), which made up 83.1% of the observed mutations. Our results indicate the importance of micromapping and epidemiology studies of thalassemia, which will assist in establishing the national prevention and control program in Turkey.

Evaluation of Signaling Pathways Involved in γ-Globin Gene Induction Using Fetal Hemoglobin Inducer Drugs.

PubMed

Rahim, Fakher; Allahmoradi, Hossein; Salari, Fatemeh; Shahjahani, Mohammad; Fard, Ali Dehghani; Hosseini, Seyed Ahmad; Mousakhani, Hadi

2013-01-01

Potent induction of fetal hemoglobin (HbF) production results in alleviating the complications of β-thalassemia and sickle cell disease (SCD). HbF inducer agents can trigger several molecular signaling pathways critical for erythropoiesis. Janus kinase/Signal transducer and activator of transcription (JAK/STAT), mitogen activated protein kinas (MAPK) and Phosphoinositide 3-kinase (PI3K) are considered as main signaling pathways, which may play a significant role in HbF induction. All these signaling pathways are triggered by erythropoietin (EPO) as the main growth factor inducing erythroid differentiation, when it binds to its cell surface receptor, erythropoietin receptor (EPO-R) HbF inducer agents have been shown to upregulate HbF production level by triggering certain signaling pathways. As a result, understanding the pivotal signaling pathways influencing HbF induction leads to effective upregulation of HbF. In this mini review article, we try to consider the correlation between HbF inducer agents and their molecular mechanisms of γ-globin upregulation. Several studies suggest that activating P38 MAPK, RAS and STAT5 signaling pathways result in efficient HbF induction. Nevertheless, the role of other erythroid signaling pathways in HbF induction seems to be indispensible and should be emphasized.

Annotated definition of BCL11A and HMIP-2 haplotypes through the analysis of sicilian β-thalassemia patients with high levels of fetal hemoglobin.

PubMed

Buccheri, Maria A; Spina, Sonia; Ruberto, Concetta; Lombardo, Turi; Labie, Dominique; Ragusa, And Angela

2013-01-01

Fetal hemoglobin (Hb F) is the principal ameliorating factor of β-thalassemia (β-thal) and sickle cell disease. Persistent production in adult life is a quantitative trait regulated by loci inside or outside the β-globin gene cluster. From genome-wide association studies, principal quantitative trait loci (QTL) (accounting for 50.0% of Hb F variability in different populations) have been identified in the BCL11A gene, HBS1L-MYB intergenic polymorphism and the β-globin gene cluster itself. In this study, we analyzed quantitative trait haplotypes in two Sicilian families with extremely mild β-thal and unusually high Hb F expression, in order to examine possible genetic background variations in a similar β-thalassemic phenotype. This study redefines the linkage disequilibrium blocks at these loci, but also shows slight differences between probands in haplotype combinations which could reflect different mechanisms of high Hb F production in patients with β-thal. We proposed a haplotype-based approach as a useful tool for the understanding of β-thal phenotype variation in patients with similar β-thalassemic backgrounds in an attempt to answer the recurring question of why patients with the same β-thalassemic genotype show different phenotypes.

Structure of dehaloperoxidase B at 1.58 Å resolution and structural characterization of the AB dimer from Amphitrite ornata

DOE Office of Scientific and Technical Information (OSTI.GOV)

de Serrano, Vesna; D; Antonio, Jennifer

2012-04-18

As members of the globin superfamily, dehaloperoxidase (DHP) isoenzymes A and B from the marine annelid Amphitrite ornata possess hemoglobin function, but they also exhibit a biologically relevant peroxidase activity that is capable of converting 2,4,6-trihalophenols to the corresponding 2,6-dihaloquinones in the presence of hydrogen peroxide. Here, a comprehensive structural study of recombinant DHP B, both by itself and cocrystallized with isoenzyme A, using X-ray diffraction is presented. The structure of DHP B refined to 1.58 {angstrom} resolution exhibits the same distal histidine (His55) conformational flexibility as that observed in isoenzyme A, as well as additional changes to the distalmore » and proximal hydrogen-bonding networks. Furthermore, preliminary characterization of the DHP AB heterodimer is presented, which exhibits differences in the AB interface that are not observed in the A-only or B-only homodimers. These structural investigations of DHP B provide insights that may relate to the mechanistic details of the H{sub 2}O{sub 2}-dependent oxidative dehalogenation reaction catalyzed by dehaloperoxidase, present a clearer description of the function of specific residues in DHP at the molecular level and lead to a better understanding of the paradigms of globin structure-function relationships.« less

Spectroscopic characterization of a truncated hemoglobin from the nitrogen-fixing bacterium Herbaspirillum seropedicae.

PubMed

Razzera, Guilherme; Vernal, Javier; Baruh, Debora; Serpa, Viviane I; Tavares, Carolina; Lara, Flávio; Souza, Emanuel M; Pedrosa, Fábio O; Almeida, Fábio C L; Terenzi, Hernán; Valente, Ana Paula

2008-09-01

The Herbaspirillum seropedicae genome sequence encodes a truncated hemoglobin typical of group II (Hs-trHb1) members of this family. We show that His-tagged recombinant Hs-trHb1 is monomeric in solution, and its optical spectrum resembles those of previously reported globins. NMR analysis allowed us to assign heme substituents. All data suggest that Hs-trHb1 undergoes a transition from an aquomet form in the ferric state to a hexacoordinate low-spin form in the ferrous state. The close positions of Ser-E7, Lys-E10, Tyr-B10, and His-CD1 in the distal pocket place them as candidates for heme coordination and ligand regulation. Peroxide degradation kinetics suggests an easy access to the heme pocket, as the protein offered no protection against peroxide degradation when compared with free heme. The high solvent exposure of the heme may be due to the presence of a flexible loop in the access pocket, as suggested by a structural model obtained by using homologous globins as templates. The truncated hemoglobin described here has unique features among truncated hemoglobins and may function in the facilitation of O(2) transfer and scavenging, playing an important role in the nitrogen-fixation mechanism.

Use of Genome Editing Tools to Treat Sickle Cell Disease

PubMed Central

Tasan, Ipek; Jain, Surbhi; Zhao, Huimin

2016-01-01

Recent advances in genome editing techniques have made it possible to modify any desired DNA sequence by employing programmable nucleases. These next generation genome-modifying tools are the ideal candidates for therapeutic applications, especially for the treatment of genetic disorders like sickle cell disease (SCD). SCD is an inheritable monogenic disorder which is caused by a point mutation in the β-globin gene. Substantial success has been achieved in the development of supportive therapeutic strategies for SCD but unfortunately there is still a lack of long-term universal cure. The only existing curative treatment is based on allogeneic stem cell transplantation from healthy donors; however, this treatment is applicable to a limited number of patients only. Hence, a universally applicable therapy is highly desirable. In this review we will discuss the three programmable nucleases that are commonly used for genome editing purposes: zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and clustered regularly interspaced short palindromic repeats (CRISPR)-associated protein 9 (CRISPR/Cas9). We will continue by exemplifying uses of these methods to correct the sickle cell mutation. Additionally, we will present induction of fetal globin expression as an alternative approach to cure sickle cell disease. We will conclude by comparing the three methods and explaining the concerns about their use in therapy. PMID:27250347

Structural polymorphism exhibited by a quasipalindrome present in the locus control region (LCR) of the human beta-globin gene cluster.

PubMed

Kaushik, Mahima; Kukreti, Shrikant

2006-01-01

Structural polymorphism of DNA is a widely accepted property. A simple addition to this perception has been our recent finding, where a single nucleotide polymorphism (SNP) site present in a quasipalindromic sequence of beta-globin LCR exhibited a hairpin-duplex equilibrium. Our current studies explore that secondary structures adopted by individual complementary strands compete with formation of a perfect duplex. Using gel-electrophoresis, ultraviolet (UV)-thermal denaturation, circular dichroism (CD) techniques, we have demonstrated the structural transitions within a perfect duplex containing 11 bp quasipalindromic stretch (TGGGG(G/C)CCCCA), to hairpins and bulge duplex forms. The extended version of the 11 bp duplex, flanked by 5 bp on both sides also demonstrated conformational equilibrium between duplex and hairpin species. Gel-electrophoresis confirms that the duplex coexists with hairpin and bulge duplex/cruciform species. Further, in CD spectra of duplexes, presence of two overlapping positive peaks at 265 and 285 nm suggest the features of A- as well as B-type DNA conformation and show oligomer concentration dependence, manifested in A --> B transition. This indicates the possibility of an architectural switching at quasipalindromic region between linear duplex to a cruciform structure. Such DNA structural variations are likely to be found in the mechanics of molecular recognition and manipulation by proteins.

A Novel β-Globin Chain Hemoglobin Variant, Hb Allentown [β137(H15)Val→Trp (GTG>TGG) HBB: c.412_413delinsTG, p.Val138Trp], Associated with Low Oxygen Saturation, Intermittent Aplastic Crises and Splenomegaly.

PubMed

Collier, Anderson B; Coon, Lea M; Monteleone, Philip; Umaru, Samuel; Swanson, Kenneth C; Hoyer, James D; Oliveira, Jennifer L

2016-01-01

Hemoglobin (Hb) variants may be associated with low oxygen saturation and exacerbated episodes of anemia from common stressors such as viral infections. These attributes frequently cause increased clinical concern and unnecessary and expensive testing if not considered early in the evaluation of the patient. Some clinically significant Hb variants result in a normal Hb electrophoresis result, which can be method-dependent. Herein we describe a patient with low oxygen saturation and a history of hemolytic anemia who was subsequently found to carry a novel, unstable β-globin variant that we have named Hb Allentown [β137(H15)Val→Trp (GTG>TGG) HBB: c.412_413delinsTG, p.Val138Trp] for the place of identification of the variant. Hb Allentown is formed by a rare double nucleotide substitution within the same codon. Additionally, positive identification of rare Hb variants characterized by a single method is discouraged, as the Hb variant was misclassified as Hb S-South End or β6(A3)Glu→Val;β132(H10)Lys→Asn (HBB: c.[20A > T;399A > C]) by the initial laboratory.

Transient absorption spectroscopy of a monofullerene C60-bis-(pyropheophorbide a) molecular system in polar and nonpolar environments

NASA Astrophysics Data System (ADS)

Al Omari, S.; Ermilov, E. A.; Helmreich, M.; Jux, N.; Hirsch, A.; Röder, B.

2004-09-01

The population dynamics of the excited and ground states of the monofullerene-bis (pyropheophorbide a) complex (FP1) were studied in polar (DMF) and nonpolar (toluene) solvents using picosecond transient absorption techniques. A strong quenching of the fluorescence signal of FP1 was observed in both solvents, in comparison to the fluorescence of bis (pyropheophorbide a) (P2). This quenching is due to an intramolecular photoinduced electron transfer from the pyropheophorbide a (pyroPheo) moiety to the fullerene C60 monoadduct. In DMF the charge-separated (CS) state of FP1 has a lifetime of 0.32 ns and undergoes a direct transition to the ground state, resulting in a very low value of photosensitised singlet oxygen generation. In toluene, energy transfer from the first excited triplet state of pyroPheo, which has been populated via relaxation of the CS state, generates a considerable amount of singlet oxygen. The lifetime of the CS state in the nonpolar solvent was estimated to be 0.29 ns. It was also shown that in both DMF and toluene the first excited singlet state as well as the triplet state of the fullerene moiety in FP1 are not occupied.

Chloroethylating nitrosoureas in cancer therapy: DNA damage, repair and cell death signaling.

PubMed

Nikolova, Teodora; Roos, Wynand P; Krämer, Oliver H; Strik, Herwig M; Kaina, Bernd

2017-08-01

Chloroethylating nitrosoureas (CNU), such as lomustine, nimustine, semustine, carmustine and fotemustine are used for the treatment of malignant gliomas, brain metastases of different origin, melanomas and Hodgkin disease. They alkylate the DNA bases and give rise to the formation of monoadducts and subsequently interstrand crosslinks (ICL). ICL are critical cytotoxic DNA lesions that link the DNA strands covalently and block DNA replication and transcription. As a result, S phase progression is inhibited and cells are triggered to undergo apoptosis and necrosis, which both contribute to the effectiveness of CNU-based cancer therapy. However, tumor cells resist chemotherapy through the repair of CNU-induced DNA damage. The suicide enzyme O 6 -methylguanine-DNA methyltransferase (MGMT) removes the precursor DNA lesion O 6 -chloroethylguanine prior to its conversion into ICL. In cells lacking MGMT, the formed ICL evoke complex enzymatic networks to accomplish their removal. Here we discuss the mechanism of ICL repair as a survival strategy of healthy and cancer cells and DNA damage signaling as a mechanism contributing to CNU-induced cell death. We also discuss therapeutic implications and strategies based on sequential and simultaneous treatment with CNU and the methylating drug temozolomide. Copyright © 2017 Elsevier B.V. All rights reserved.

High resolution melting curve analysis targeting the HBB gene mutational hot-spot offers a reliable screening approach for all common as well as most of the rare beta-globin gene mutations in Bangladesh.

PubMed

Islam, Md Tarikul; Sarkar, Suprovath Kumar; Sultana, Nusrat; Begum, Mst Noorjahan; Bhuyan, Golam Sarower; Talukder, Shezote; Muraduzzaman, A K M; Alauddin, Md; Islam, Mohammad Sazzadul; Biswas, Pritha Promita; Biswas, Aparna; Qadri, Syeda Kashfi; Shirin, Tahmina; Banu, Bilquis; Sadya, Salma; Hussain, Manzoor; Sarwardi, Golam; Khan, Waqar Ahmed; Mannan, Mohammad Abdul; Shekhar, Hossain Uddin; Chowdhury, Emran Kabir; Sajib, Abu Ashfaqur; Akhteruzzaman, Sharif; Qadri, Syed Saleheen; Qadri, Firdausi; Mannoor, Kaiissar

2018-01-02

Bangladesh lies in the global thalassemia belt, which has a defined mutational hot-spot in the beta-globin gene. The high carrier frequencies of beta-thalassemia trait and hemoglobin E-trait in Bangladesh necessitate a reliable DNA-based carrier screening approach that could supplement the use of hematological and electrophoretic indices to overcome the barriers of carrier screening. With this view in mind, the study aimed to establish a high resolution melting (HRM) curve-based rapid and reliable mutation screening method targeting the mutational hot-spot of South Asian and Southeast Asian countries that encompasses exon-1 (c.1 - c.92), intron-1 (c.92 + 1 - c.92 + 130) and a portion of exon-2 (c.93 - c.217) of the HBB gene which harbors more than 95% of mutant alleles responsible for beta-thalassemia in Bangladesh. Our HRM approach could successfully differentiate ten beta-globin gene mutations, namely c.79G > A, c.92 + 5G > C, c.126_129delCTTT, c.27_28insG, c.46delT, c.47G > A, c.92G > C, c.92 + 130G > C, c.126delC and c.135delC in heterozygous states from the wild type alleles, implying the significance of the approach for carrier screening as the first three of these mutations account for ~85% of total mutant alleles in Bangladesh. Moreover, different combinations of compound heterozygous mutations were found to generate melt curves that were distinct from the wild type alleles and from one another. Based on the findings, sixteen reference samples were run in parallel to 41 unknown specimens to perform direct genotyping of the beta-thalassemia specimens using HRM. The HRM-based genotyping of the unknown specimens showed 100% consistency with the sequencing result. Targeting the mutational hot-spot, the HRM approach could be successfully applied for screening of beta-thalassemia carriers in Bangladesh as well as in other countries of South Asia and Southeast Asia. The approach could be a useful supplement of hematological and electrophortic indices in order to avoid false positive and false negative results.

Two cloned β thalassemia genes are associated with amber mutations at codon 39

PubMed Central

Pergolizzi, Robert; Spritz, Richard A.; Spence, Sally; Goossens, Michel; Kan, Yuet Wai; Bank, Arthur

1981-01-01

Two β globin genes from patients with the β+ thalassemia phenotype have been cloned and sequenced. A single nucleotide change from CAG to TAG (an amber mutation) at codon 39 is the only difference from normal in both genes analyzed. The results are consistent with the assumption that both patients are doubly heterozygous for β+ and β° thalassemia, and that we have isolated and analyzed the β° thalassemia gene. Images PMID:6278453

DOE Office of Scientific and Technical Information (OSTI.GOV)

Anderson, W.F.; Martinell, J.; Whitney, J.B. III

The group of diseases called the thalassemias is the largest single-gene health problem in the world according the World Health Organization. The thalassemias are lethal hereditary anemias in which the infants cannot make their own blood. Three mouse mutants are shown to be models of the human disease ..cap alpha..-thalassemia. However, since an additional gene is affected, these mutants represent a particularly severe condition in which death occurs in the homozygous embryo even before globin genes are activated. Phenotypic and genotypic characteristics are described. (ACR)

Predicting Natural Neuroprotection in Marine Mammals: Environmental and Biological Factors Affecting the Vulnerability to Acoustically Mediated Tissue Trauma in Marine Species

DTIC Science & Technology

2013-09-30

comparing both globin deposition profiles from carcasses ranging in age from neonates to adults, as well as the change in mass-specific metabolic demands...to acoustically mediated trauma, 1) molecular and biochemical evaluation of neuroprotection at the tissue level, and 2) whole animal /physiological...Noren, UCSC.) The second component of this study examined the susceptibility of marine mammals to decompression illness at the whole animal

Purification of swine haptoglobin by affinity chromatography.

PubMed Central

Eurell, T E; Hall, W F; Bane, D P

1990-01-01

A globin-agarose affinity chromatography technique was used to purify swine haptoglobin. This technique provides a highly specific, single-step purification method without the contamination of extraneous serum proteins reported by previous studies. Complex formation between the haptoglobin isolate and swine hemoglobin confirmed that biological activity was maintained during the purification process. Immunoelectrophoretic and Ouchterlony immunodiffusion methods revealed that the swine haptoglobin isolate cross-reacted with polyvalent antisera against human haptoglobin. Images Fig. 2. Fig. 3. PMID:2123414

Development of an Ammonium Sulfate DNA Extraction Method for Obtaining Amplifiable DNA in a Small Number of Cells and Its Application to Clinical Specimens

PubMed Central

Oh, Seo Young; Kim, Wook Youn; Hwang, Tae Sook; Han, Hye Seung; Lim, So Dug; Kim, Wan Seop

2013-01-01

DNA extraction from microdissected cells has become essential for handling clinical specimens with advances in molecular pathology. Conventional methods have limitations for extracting amplifiable DNA from specimens containing a small number of cells. We developed an ammonium sulfate DNA extraction method (A) and compared it with two other methods (B and C). DNA quality and quantity, β-globin amplification, and detectability of two cancer associated gene mutations were evaluated. Method A showed the best DNA yield, particularly when the cell number was very low. Amplification of the β-globin gene using DNA from the SNU 790 cell line and papillary thyroid carcinoma (PTC) cells extracted with Method A demonstrated the strongest band. BRAF V600E mutation analysis using ethanol-fixed PTC cells from a patient demonstrated both a “T” peak increase and an adjacent “A” peak decrease when 25 and 50 cells were extracted, whereas mutant peaks were too low to be analyzed using the other two methods. EGFR mutation analysis using formalin-fixed paraffin-embedded lung cancer tissues demonstrated a mutant peak with Method A, whereas the mutant peak was undetectable with Methods B or C. Method A yielded the best DNA quantity and quality with outstanding efficiency, particularly when paucicellular specimens were used. PMID:23691506

Na+/H+ exchanger 3 inhibitor diminishes hepcidin-enhanced duodenal calcium transport in hemizygous β-globin knockout thalassemic mice.

PubMed

Charoenphandhu, Narattaphol; Kraidith, Kamonshanok; Lertsuwan, Kornkamon; Sripong, Chanakarn; Suntornsaratoon, Panan; Svasti, Saovaros; Krishnamra, Nateetip; Wongdee, Kannikar

2017-03-01

Recent investigation has shown that the liver-derived iron-regulating hormone, hepcidin, can potentiate intestinal calcium absorption in hemizygous β-globin knockout thalassemic (BKO) mice. Since the upregulation of Fe 2+ and H + cotransporter, divalent metal transporter (DMT)-1, has been shown to correlate with thalassemia-induced intestinal calcium absorption impairment, the inhibition of the apical Na + /H + exchanger (NHE)-3 that is essential for cytoplasmic pH regulation and transepithelial sodium absorption was hypothesized to negatively affect hepcidin action. Herein, the positive effect of hepcidin on the duodenal calcium transport was evaluated using Ussing chamber technique. The results showed that BKO mice had lower absorptive surface area and duodenal calcium transport than wild-type mice. Besides, paracellular transport of zinc in BKO mice was compromised. Hepcidin administration completely restored calcium transport. Since this hepcidin action was totally abolished by inhibitors of the basolateral calcium transporters, Na + /Ca 2+ exchanger (NCX1) and plasma membrane Ca 2+ -ATPase (PMCA 1b ), the enhanced calcium flux potentially occurred through the transcellular pathway rather than paracellular pathway. Interestingly, the selective NHE3 inhibitor, 100 nM tenapanor, markedly inhibited hepcidin-enhanced calcium transport. Accordingly, hepcidin is one of the promising therapeutic agents for calcium malabsorption in β-thalassemia. It mainly stimulates the transcellular calcium transport across the duodenal epithelium in an NHE3-dependent manner.

Setup of a Protocol of Molecular Diagnosis of β-Thalassemia Mutations in Tunisia using Denaturing High-Performance Liquid Chromatography (DHPLC).

PubMed

Sahli, Chaima Abdelhafidh; Ben Salem, Ikbel; Jouini, Latifa; Laouini, Naouel; Dabboubi, Rym; Hadj Fredj, Sondes; Siala, Hajer; Othmeni, Rym; Dakhlaoui, Boutheina; Fattoum, Slaheddine; Bibi, Amina; Messaoud, Taieb

2016-09-01

β-Thalassemia is one of the most prevalent worldwide autosomal recessive disorders. It presents a great molecular heterogeneity resulting from more than 200 causative mutations in the β-globin gene. In Tunisia, β-thalassemia represents the most prevalent monogenic hemoglobin disorder with 2.21% of carriers. Efficient and reliable mutation-screening methods are essential in order to establish appropriate prevention programs for at risk couples. The aim of the present study is to develop an efficient method based on the denaturing high-performance liquid chromatography (DHPLC) in which the whole β-globin gene (HBB) is screened for mutations covering about 90% of the spectrum. We have performed the validation of a DHPLC assay for direct genotyping of 11 known β-thalassemia mutations in the Tunisian population. DHPLC assay was established based on the analysis of 62 archival β-thalassemia samples previously genotyped then validated with full concordance on 50 tests with blind randomized samples previously genotyped with DNA sequencing and with 96% of consistency on 40 samples as a prospective study. Compared to other genotyping techniques, the DHPLC method can meet the requirements of direct genotyping of known β-thalassemia mutations in Tunisia and to be applied as a powerful tool for the genetic screening of prenatal and postnatal individuals. © 2016 Wiley Periodicals, Inc.

Optimized Lentiviral Vector Design Improves Titer and Transgene Expression of Vectors Containing the Chicken β-Globin Locus HS4 Insulator Element

PubMed Central

Hanawa, Hideki; Yamamoto, Motoko; Zhao, Huifen; Shimada, Takashi; Persons, Derek A

2009-01-01

Hematopoietic cell gene therapy using retroviral vectors has achieved success in clinical trials. However, safety issues regarding vector insertional mutagenesis have emerged. In two different trials, vector insertion resulted in the transcriptional activation of proto-oncogenes. One strategy for potentially diminishing vector insertional mutagenesis is through the use of self-inactivating lentiviral vectors containing the 1.2-kb insulator element derived from the chicken β-globin locus. However, use of this element can dramatically decrease both vector titer and transgene expression, thereby compromising its practical use. Here, we studied lentiviral vectors containing either the full-length 1.2-kb insulator or the smaller 0.25-kb core element in both orientations in the partially deleted long-terminal repeat. We show that use of the 0.25-kb core insulator rescued vector titer by alleviating a postentry block to reverse transcription associated with the 1.2-kb element. In addition, in an orientation-dependent manner, the 0.25-kb core element significantly increased transgene expression from an internal promoter due to improved transcriptional termination. This element also demonstrated barrier activity, reducing variability of expression due to position effects. As it is known that the 0.25-kb core insulator has enhancer-blocking activity, this particular insulated lentiviral vector design may be useful for clinical application. PMID:19223867

Preclinical Evaluation of Efficacy and Safety of an Improved Lentiviral Vector for the Treatment of β-Thalassemia and Sickle Cell Disease

PubMed Central

Negre, Olivier; Bartholomae, Cynthia; Beuzard, Yves; Cavazzana, Marina; Christiansen, Lauryn; Courne, Céline; Deichmann, Annette; Denaro, Maria; de Dreuzy, Edouard; Finer, Mitchell; Fronza, Raffaele; Gillet-Legrand, Béatrix; Joubert, Christophe; Kutner, Robert; Leboulch, Philippe; Maouche, Leïla; Paulard, Anaïs; Pierciey, Francis J.; Rothe, Michael; Ryu, Byoung; Schmidt, Manfred; von Kalle, Christof; Payen, Emmanuel; Veres, Gabor

2015-01-01

A previously published clinical trial demonstrated the benefit of autologous CD34+ cells transduced with a self-inactivating lentiviral vector (HPV569) containing an engineered β-globin gene (βA-T87Q-globin) in a subject with β-thalassemia major. This vector has been modified to increase transduction efficacy without compromising safety. In vitro analyses indicated that the changes resulted in both increased vector titers (3 to 4 fold) and increased transduction efficacy (2 to 3 fold). An in vivo study in which 58 β-thalassemic mice were transplanted with vector- or mock-transduced syngenic bone marrow cells indicated sustained therapeutic efficacy. Secondary transplantations involving 108 recipients were performed to evaluate long-term safety. The six month study showed no hematological or biochemical toxicity. Integration site (IS) profile revealed an oligo/polyclonal hematopoietic reconstitution in the primary transplants and reduced clonality in secondary transplants. Tumor cells were detected in the secondary transplant mice in all treatment groups (including the control group), without statistical differences in the tumor incidence. Immunohistochemistry and quantitative PCR demonstrated that tumor cells were not derived from transduced donor cells. This comprehensive efficacy and safety data provided the basis for initiating two clinical trials with this second generation vector (BB305) in Europe and in the USA in patients with β-thalassemia major and sickle cell disease. PMID:25429463

MRG15 Regulates Embryonic Development and Cell Proliferation

PubMed Central

Tominaga, Kaoru; Kirtane, Bhakti; Jackson, James G.; Ikeno, Yuji; Ikeda, Takayoshi; Hawks, Christina; Smith, James R.; Matzuk, Martin M.; Pereira-Smith, Olivia M.

2005-01-01

MRG15 is a highly conserved protein, and orthologs exist in organisms from yeast to humans. MRG15 associates with at least two nucleoprotein complexes that include histone acetyltransferases and/or histone deacetylases, suggesting it is involved in chromatin remodeling. To study the role of MRG15 in vivo, we generated knockout mice and determined that the phenotype is embryonic lethal, with embryos and the few stillborn pups exhibiting developmental delay. Immunohistochemical analysis indicates that apoptosis in Mrg15−/− embryos is not increased compared with wild-type littermates. However, the number of proliferating cells is significantly reduced in various tissues of the smaller null embryos compared with control littermates. Cell proliferation defects are also observed in Mrg15−/− mouse embryonic fibroblasts. The hearts of the Mrg15−/− embryos exhibit some features of hypertrophic cardiomyopathy. The increase in size of the cardiomyocytes is most likely a response to decreased growth of the cells. Mrg15−/− embryos appeared pale, and microarray analysis revealed that α-globin gene expression was decreased in null versus wild-type embryos. We determined by chromatin immunoprecipitation that MRG15 was recruited to the α-globin promoter during dimethyl sulfoxide-induced mouse erythroleukemia cell differentiation. These findings demonstrate that MRG15 has an essential role in embryonic development via chromatin remodeling and transcriptional regulation. PMID:15798182

Factor IX gene haplotypes in Amerindians.

PubMed

Franco, R F; Araújo, A G; Zago, M A; Guerreiro, J F; Figueiredo, M S

1997-02-01

We have determined the haplotypes of the factor IX gene for 95 Indians from 5 Brazilian Amazon tribes: Wayampí, Wayana-Apalaí, Kayapó, Arára, and Yanomámi. Eight polymorphisms linked to the factor IX gene were investigated: MseI (at 5', nt -698), BamHI (at 5', nt -561), DdeI (intron 1), BamHI (intron 2), XmnI (intron 3), TaqI (intron 4), MspI (intron 4), and HhaI (at 3', approximately 8 kb). The results of the haplotype distribution and the allele frequencies for each of the factor IX gene polymorphisms in Amerindians were similar to the results reported for Asian populations but differed from results for other ethnic groups. Only five haplotypes were identified within the entire Amerindian study population, and the haplotype distribution was significantly different among the five tribes, with one (Arára) to four (Wayampí) haplotypes being found per tribe. These findings indicate a significant heterogeneity among the Indian tribes and contrast with the homogeneous distribution of the beta-globin gene cluster haplotypes but agree with our recent findings on the distribution of alpha-globin gene cluster haplotypes and the allele frequencies for six VNTRs in the same Amerindian tribes. Our data represent the first study of factor IX-associated polymorphisms in Amerindian populations and emphasizes the applicability of these genetic markers for population and human evolution studies.

Oxygen-Dependent Globin Coupled Sensor Signaling Modulates Motility and Virulence of the Plant Pathogen Pectobacterium carotovorum.

PubMed

Burns, Justin L; Jariwala, Parth B; Rivera, Shannon; Fontaine, Benjamin M; Briggs, Laura; Weinert, Emily E

2017-08-18

Bacterial pathogens utilize numerous signals to identify the presence of their host and coordinate changes in gene expression that allow for infection. Within plant pathogens, these signals typically include small molecules and/or proteins from their plant hosts and bacterial quorum sensing molecules to ensure sufficient bacterial cell density for successful infection. In addition, bacteria use environmental signals to identify conditions when the host defenses are weakened and potentially to signal entry into an appropriate host/niche for infection. A globin coupled sensor protein (GCS), termed PccGCS, within the soft rot bacterium Pectobacterium carotovorum ssp. carotovorum WPP14 has been identified as an O 2 sensor and demonstrated to alter virulence factor excretion and control motility, with deletion of PccGCS resulting in decreased rotting of a potato host. Using small molecules that modulate bacterial growth and quorum sensing, PccGCS signaling also has been shown to modulate quorum sensing pathways, resulting in the PccGCS deletion strain being more sensitive to plant-derived phenolic acids, which can function as quorum sensing inhibitors, and exhibiting increased N-acylhomoserine lactone (AHL) production. These findings highlight a role for GCS proteins in controlling key O 2 -dependent phenotypes of pathogenic bacteria and suggest that modulating GCS signaling to limit P. carotovorum motility may provide a means to decrease rotting of plant hosts.

The reaction between GSNO and H2S: On the generation of NO, HNO and N2O.

PubMed

Kumar, Murugaeson R; Clover, Tara; Olaitan, Abayomi D; Becker, Christopher; Solouki, Touradj; Farmer, Patrick J

2018-04-26

Several recent reports suggest that HNO may be produced endogenously by reaction of H 2 S and S-nitrosoglutathione (GSNO). This hypothesis was tested using deoxymyoglobin (MbFe II ) to trap the expected HNO released from the target reaction, which should generate the stable HNO adduct, HNO-Mb, under anaerobic conditions. Under numerous experimental conditions, the sole globin product was NO-Mb, as characterized by absorbance, EPR, and NMR spectroscopies. Analogous reactions of GSNO with other biological reductants such as ascorbic acid, dithiothreitol, glutathione, and dithionite also yielded NO-Mb as the sole globin product; however, whereas analogous reduction of GSNO using NaBH 4 generates HNO-Mb in high yield. Quantitative GC/MS analyses of reactions of GS 15 NO with H 2 S showed that the main reaction product was 15 NO, with 15 N 2 produced at a comparable level to 15 N 2 O. Overall yield of N 2 O is unchanged by the presence of MbFe II , discounting the intermediacy of either NO or HNO in its formation. Taken together, these results argue against the generation of free HNO as a major pathway in the reactions of GSNO with H 2 S, and instead imply some as yet uncharacterized intermediates generate the nitrogenic gases. Copyright © 2018 Elsevier Inc. All rights reserved.

αCP Poly(C) Binding Proteins Act as Global Regulators of Alternative Polyadenylation

PubMed Central

Ji, Xinjun; Wan, Ji; Vishnu, Melanie

2013-01-01

We have previously demonstrated that the KH-domain protein αCP binds to a 3′ untranslated region (3′UTR) C-rich motif of the nascent human alpha-globin (hα-globin) transcript and enhances the efficiency of 3′ processing. Here we assess the genome-wide impact of αCP RNA-protein (RNP) complexes on 3′ processing with a specific focus on its role in alternative polyadenylation (APA) site utilization. The major isoforms of αCP were acutely depleted from a human hematopoietic cell line, and the impact on mRNA representation and poly(A) site utilization was determined by direct RNA sequencing (DRS). Bioinformatic analysis revealed 357 significant alterations in poly(A) site utilization that could be specifically linked to the αCP depletion. These APA events correlated strongly with the presence of C-rich sequences in close proximity to the impacted poly(A) addition sites. The most significant linkage was the presence of a C-rich motif within a window 30 to 40 bases 5′ to poly(A) signals (AAUAAA) that were repressed upon αCP depletion. This linkage is consistent with a general role for αCPs as enhancers of 3′ processing. These findings predict a role for αCPs in posttranscriptional control pathways that can alter the coding potential and/or levels of expression of subsets of mRNAs in the mammalian transcriptome. PMID:23629627

Erythroid Promoter Confines FGF2 Expression to the Marrow after Hematopoietic Stem Cell Gene Therapy and Leads to Enhanced Endosteal Bone Formation

PubMed Central

Meng, Xianmei; Baylink, David J.; Sheng, Matilda; Wang, Hongjie; Gridley, Daila S.; Lau, K.-H. William; Zhang, Xiao-Bing

2012-01-01

Fibroblast growth factor-2 (FGF2) has been demonstrated to be a promising osteogenic factor for treating osteoporosis. Our earlier study shows that transplantation of mouse Sca-1+ hematopoietic stem/progenitor cells that are engineered to express a modified FGF2 leads to considerable endosteal/trabecular bone formation, but it also induces adverse effects like hypocalemia and osteomalacia. Here we report that the use of an erythroid specific promoter, β-globin, leads to a 5-fold decrease in the ratio of serum FGF2 to the FGF2 expression in the marrow cavity when compared to the use of a ubiquitous promoter spleen focus-forming virus (SFFV). The confined FGF2 expression promotes considerable trabeculae bone formation in endosteum and does not yield anemia and osteomalacia. The avoidance of anemia in the mice that received Sca1+ cells transduced with FGF2 driven by the β-globin promoter is likely due to attenuation of high-level serum FGF2-mediated stem cell mobilization observed in the SFFV-FGF2 animals. The prevention of osteomalacia is associated with substantially reduced serum Fgf23/hypophosphatemia, and less pronounced secondary hyperparathyroidism. Our improved stem cell gene therapy strategy represents one step closer to FGF2-based clinical therapy for systemic skeletal augmentation. PMID:22629419

Globin switches in yolk sac-like primitive and fetal-like definitive red blood cells produced from human embryonic stem cells.

PubMed

Qiu, Caihong; Olivier, Emmanuel N; Velho, Michelle; Bouhassira, Eric E

2008-02-15

We have previously shown that coculture of human embryonic stem cells (hESCs) for 14 days with immortalized fetal hepatocytes yields CD34(+) cells that can be expanded in serum-free liquid culture into large numbers of megaloblastic nucleated erythroblasts resembling yolk sac-derived cells. We show here that these primitive erythroblasts undergo a switch in hemoglobin (Hb) composition during late terminal erythroid maturation with the basophilic erythroblasts expressing predominantly Hb Gower I (zeta(2)epsilon(2)) and the orthochromatic erythroblasts hemoglobin Gower II (alpha(2)epsilon(2)). This suggests that the switch from Hb Gower I to Hb Gower II, the first hemoglobin switch in humans is a maturation switch not a lineage switch. We also show that extending the coculture of the hESCs with immortalized fetal hepatocytes to 35 days yields CD34(+) cells that differentiate into more developmentally mature, fetal liver-like erythroblasts, that are smaller, express mostly fetal hemoglobin, and can enucleate. We conclude that hESC-derived erythropoiesis closely mimics early human development because the first 2 human hemoglobin switches are recapitulated, and because yolk sac-like and fetal liver-like cells are sequentially produced. Development of a method that yields erythroid cells with an adult phenotype remains necessary, because the most mature cells that can be produced with current systems express less than 2% adult beta-globin mRNA.

Successful application of preimplantation genetic diagnosis for beta-thalassaemia and sickle cell anaemia in Italy.

PubMed

Chamayou, S; Alecci, C; Ragolia, C; Giambona, A; Siciliano, S; Maggio, A; Fichera, M; Guglielmino, A

2002-05-01

In Italy, the autosomal recessive diseases beta-thalassaemia and sickle cell anaemia are so widespread that in some regions they can be defined as 'social diseases'. In this study, nine clinical applications of preimplantation genetic diagnosis (PGD) were performed for beta-thalassaemia and sickle cell anaemia on seven Sicilian couples and carriers of beta-globin gene mutations. The studied mutations were: Cd39, HbS, IVS1 nt1, IVS1 nt6 and IVS1 nt110. ICSI was performed with partner's sperm on 131 out of 147 retrieved oocytes, and this resulted in 72 zygotes; 32 embryos were successfully biopsied on day 3. The biopsied blastomeres were lysed and the beta-globin alleles amplified by nested PCR. The mutation diagnosis was performed by restriction enzyme digestion and reverse dot-blot. The amplification efficacy was 97.2%. The genotype study of non-transferred and surplus embryos showed that the allele drop-out rate was 8.6%. Seventeen embryos were transferred in utero on day 4. All couples received an embryo transfer; of the four pregnancies obtained, three resulted in live births and one miscarried at 11 weeks. Prenatal diagnosis at the 11th week and miscarriage material analysis confirmed the PGD results. These studies represent the first successful application of PGD for beta-thalassaemia and sickle cell anaemia in Italy.

Real-time monitoring of stress erythropoiesis in vivo using Gata1 and beta-globin LCR luciferase transgenic mice.

PubMed

Suzuki, Mikiko; Ohneda, Kinuko; Hosoya-Ohmura, Sakie; Tsukamoto, Saho; Ohneda, Osamu; Philipsen, Sjaak; Yamamoto, Masayuki

2006-07-15

Erythroid progenitors have the potential to proliferate rapidly in response to environmental stimuli. This process is referred to as stress erythropoiesis, with erythropoietin (EPO) playing central roles in its promotion. In this study, we wanted to elucidate the molecular mechanisms governing the regulation of stress erythropoiesis and the maintenance of red-cell homeostasis. This was achieved by our development of a noninvasive real-time monitoring system for erythropoiesis using transgenic mouse lines expressing luciferase under the control of the mouse Gata1 hematopoietic regulatory domain (G1-HRD-luc) or human beta-globin locus control region (Hbb-LCR-luc). Optical bioluminescence images revealed that the luciferase was specifically expressed in spleen and bone marrow and was induced rapidly in response to anemia and hypoxia stimuli. The G1-HRD-luc activity tracked the emergence and disappearance of proerythroblast-stage progenitors, whereas the Hbb-LCR-luc activity tracked erythroblasts and later stage erythroid cells. Increased plasma EPO concentration preceded an increase in G1-HRD-luc, supporting our contention that EPO acts as the key upstream signal in stress erythropoiesis. Hence, we conclude that G1-HRD-luc and Hbb-LCR-luc reporters are differentially activated during stress erythropoiesis and that the transgenic mouse lines used serve as an important means for understanding the homeostatic regulation of erythropoiesis.

Hb Koln [β98(FG5) [GTG → ATG, Val → Met]: the first report from India.

PubMed

Warang, Prashant; Nair, Sona; Nadkarni, Anita; Kedar, Prabhakar; Bhave, Abhay; Ghosh, Kanjaksha; Colah, Roshan

2014-06-01

The group of unstable hemoglobins are associated with congenital non-spherocytic hemolytic anemia due to instability of the hemoglobin molecule. They often lead to formation of the characteristic inclusion bodies or Heinz bodies. To identity the cause of mild anemia, reticulocytosis, and hepatosplenomegly in a case of non-spherocytic hemolytic anemia. A 34-year-old female patient originating from Maharashtra, western India presented with mild anemia and jaundice which had persisted since childhood. Investigations included a complete blood count, screening for red cell membrane protein defects, Hb analysis by high-performance liquid chromatography (HPLC) and cellulose acetate electrophoresis (pH 8.9), heat instability test and DNA sequencing. Hemoglobin analysis by HPLC showed an abnormal peak in the Hb C window (9.8%) with a retention time of 4.90 minutes. Cellulose acetate electrophoresis (pH 8.9) showed a slow moving band (6.15%) between Hb A2 and Hb S. The heat instability test was positive. DNA analysis of α globin genes showed absence of both deletional and non- deletional α thalassemia. DNA sequencing of the β globin gene revealed heterozygosity for a mutation at codon 98 [GTG → ATG, Val → Met], which gives rise to Hb-Koln. Hb Koln is the commonest unstable Hb variant reported from many populations in the world. However, this is the first report of this unstable Hb variant from India.

Epigenetic and molecular profiles of erythroid cells after hydroxyurea treatment in sickle cell anemia

PubMed Central

Steward, Shirley; Howard, Thad A.; Mortier, Nicole; Smeltzer, Matthew; Wang, Yong-Dong; Ware, Russell E.

2011-01-01

Hydroxyurea has been shown to be efficacious for the treatment of sickle cell anemia (SCA), primarily through the induction of fetal hemoglobin (HbF). However, the exact mechanisms by which hydroxyurea can induce HbF remain incompletely defined, although direct transcriptional effects and altered cell cycle kinetics have been proposed. In this study, we investigated potential epigenetic and alternative molecular mechanisms of hydroxyurea-mediated HbF induction by examining methylation patterns within the Gγ-globin promoter and miRNA expression within primary CD71+ erythrocytes of patients with SCA, both at baseline before beginning hydroxyurea therapy and after reaching maximum tolerated dose (MTD). Using both cross-sectional analysis and paired-sample analysis, we found that the highly methylated Gγ-globin promoter was inversely correlated to baseline HbF levels, but only slightly altered by hydroxyurea treatment. Conversely, expression of several specific miRNAs was significantly increased after hydroxyurea treatment, and expression of miR-26b and miR-151-3p were both associated with HbF levels at MTD. The significant associations identified in these studies suggest that methylation may be important for regulation of baseline HbF, but not after hydroxyurea treatment, whereas changes in miRNA expression may be associated with hydroxyurea-mediated HbF induction. This study was registered at ClinicalTrials.gov (NCT00305175). PMID:21921042

A relational extension of the notion of motifs: application to the common 3D protein substructures searching problem.

PubMed

Pisanti, Nadia; Soldano, Henry; Carpentier, Mathilde; Pothier, Joel

2009-12-01

The geometrical configurations of atoms in protein structures can be viewed as approximate relations among them. Then, finding similar common substructures within a set of protein structures belongs to a new class of problems that generalizes that of finding repeated motifs. The novelty lies in the addition of constraints on the motifs in terms of relations that must hold between pairs of positions of the motifs. We will hence denote them as relational motifs. For this class of problems, we present an algorithm that is a suitable extension of the KMR paradigm and, in particular, of the KMRC as it uses a degenerate alphabet. Our algorithm contains several improvements that become especially useful when-as it is required for relational motifs-the inference is made by partially overlapping shorter motifs, rather than concatenating them. The efficiency, correctness and completeness of the algorithm is ensured by several non-trivial properties that are proven in this paper. The algorithm has been applied in the important field of protein common 3D substructure searching. The methods implemented have been tested on several examples of protein families such as serine proteases, globins and cytochromes P450 additionally. The detected motifs have been compared to those found by multiple structural alignments methods.

DNA fingerprinting in zoology: past, present, future.

PubMed

Chambers, Geoffrey K; Curtis, Caitlin; Millar, Craig D; Huynen, Leon; Lambert, David M

2014-02-03

In 1962, Thomas Kuhn famously argued that the progress of scientific knowledge results from periodic 'paradigm shifts' during a period of crisis in which new ideas dramatically change the status quo. Although this is generally true, Alec Jeffreys' identification of hypervariable repeat motifs in the human beta-globin gene, and the subsequent development of a technology known now as 'DNA fingerprinting', also resulted in a dramatic shift in the life sciences, particularly in ecology, evolutionary biology, and forensics. The variation Jeffreys recognized has been used to identify individuals from tissue samples of not just humans, but also of many animal species. In addition, the technology has been used to determine the sex of individuals, as well as paternity/maternity and close kinship. We review a broad range of such studies involving a wide diversity of animal species. For individual researchers, Jeffreys' invention resulted in many ecologists and evolutionary biologists being given the opportunity to develop skills in molecular biology to augment their whole organism focus. Few developments in science, even among the subsequent genome discoveries of the 21st century, have the same wide-reaching significance. Even the later development of PCR-based genotyping of individuals using microsatellite repeats sequences, and their use in determining multiple paternity, is conceptually rooted in Alec Jeffreys' pioneering work.

Cyanide Antidotes for Mass Casualties: Comparison of Intramuscular Injector by Autoinjector, Intraosseous Injection, and Inhalational Delivery

DTIC Science & Technology

2015-12-01

oxygen consump- tion,46,47 we studied the effects of cyanide on cellular oxygen consumption using an XF extracellular flux analyzer (Seahorse...baseline values during whole blood resuscitation (−0.24 0.14 μM at the end of resuscita- tion). Figure 2 also shows the effect of inspired oxygen concen...during respiratory challenges. This composite effect demonstrates uncoupling of the hemo- globin oxygen signal changes from CcO redox state signals

Which one among the Pt-containing anticancer drugs more easily forms monoadducts with G and A DNA bases? A comparative study among oxaliplatin, nedaplatin, and carboplatin.

PubMed

Alberto, Marta E; Butera, Valeria; Russo, Nino

2011-08-01

The platination processes of DNA bases with second- and third-generation Pt(II) anticancer drugs have been investigated using density functional theory (DFT) combined with the conductor-like dielectric continuum model (CPCM) approach, in order to describe their binding mechanisms and to obtain detailed data on the reaction energy profiles. Although there is no doubt that a Pt-N7 bond forms during initial attack, the energetic profiles for the formation of the monofunctional adducts are not known. Herein, a direct comparison between the rate of formation of the monofunctional adducts of the second- and third-generation anticancer drugs with guanine (G) and adenine (A) DNA bases has been made in order to spotlight possible common or different behavior. The guanine as target for platination process is confirmed to be preferred over adenine for all the investigated compounds and for both the hydrolyzed forms considered in our investigation. The preference for G purine base is dominated by electronic factors and promoted by a more favorable hydrogen-bonds pattern, confirming the important role played by H-bonds in determining both structural and kinetic control on the purine platination process. © 2011 American Chemical Society

Psoralen-induced DNA adducts are substrates for the base excision repair pathway in human cells

PubMed Central

Couvé-Privat, Sophie; Macé, Gaëtane; Saparbaev, Murat K.

2007-01-01

Interstrand cross-link (ICL) is a covalent modification of both strands of DNA, which prevents DNA strand separation during transcription and replication. Upon photoactivation 8-methoxypsoralen (8-MOP+UVA) alkylates both strands of DNA duplex at the 5,6-double bond of thymidines, generating monoadducts (MAs) and ICLs. It was thought that bulky DNA lesions such as MAs are eliminated only in the nucleotide excision repair pathway. Instead, non-bulky DNA lesions are substrates for DNA glycosylases and AP endonucleases which initiate the base excision repair (BER) pathway. Here we examined whether BER might be involved in the removal of psoralen–DNA photoadducts. The results show that in human cells DNA glycosylase NEIL1 excises the MAs in duplex DNA, subsequently the apurinic/apyrimidinic endonuclease 1, APE1, removes the 3′-phosphate residue at single-strand break generated by NEIL1. The apparent kinetic parameters suggest that NEIL1 excises MAs with high efficiency. Consistent with these results HeLa cells lacking APE1 and/or NEIL1 become hypersensitive to 8-MOP+UVA exposure. Furthermore, we demonstrate that bacterial homologues of NEIL1, the Fpg and Nei proteins, also excise MAs. New substrate specificity of the Fpg/Nei protein family provides an alternative repair pathway for ICLs and bulky DNA damage. PMID:17715144

Human papillomavirus (HPV) types 16, 18, 31, 45 DNA loads and HPV-16 integration in persistent and transient infections in young women

PubMed Central

2010-01-01

Background HPV burden is a predictor for high-grade cervical intraepithelial neoplasia and cancer. The natural history of HPV load in young women being recently exposed to HPV is described in this paper. Methods A total of 636 female university students were followed for 2 years. Cervical specimens with HPV-16, -18, -31, or -45 DNA by consensus PCR were further evaluated with type-specific and β-globin real-time PCR assays. Proportional hazards regression was used to estimate hazard ratios (HR) of infection clearance. Generalized estimating equations assessed whether HPV loads was predictive of HPV infection at the subsequent visit. Results HPV loads were consistently higher among women <25 years old, and those who had multiple sex partners, multiple HPV type infections and smokers. HPV-16 integration was encountered only in one sample. Infection clearance was faster among women at lower tertiles of HPV-16 (HR = 2.8, 95%CI: 1.0-8.1), HPV-18 (HR = 3.5, 95%CI: 1.1-11.2) or combined (HR = 2.4, 95%CI: 1.8-6.2) DNA loads. The relationship between HPV-16 and HPV-18 DNA loads and infection clearance followed a clear dose-response pattern, after adjusting for age and number of sexual partners. GEE Odds Ratios for HPV persistence of the middle and upper tertiles relative to the lower tertile were 2.7 and 3.0 for HPV-16 and 3.8 and 39.1 for HPV-18, respectively. There was no association between HPV-31 or -45 DNA loads and persistence. Conclusions The association between HPV load and persistence is not uniform across high-risk genital genotypes. HPV-16 integration was only rarely demonstrated in young women. PMID:21070660

Human papillomavirus genotype distribution and cervical squamous intraepithelial lesions among high-risk women with and without HIV-1 infection in Burkina Faso

PubMed Central

Didelot-Rousseau, M-N; Nagot, N; Costes-Martineau, V; Vallès, X; Ouedraogo, A; Konate, I; Weiss, H A; Van de Perre, P; Mayaud, P; Segondy, M

2006-01-01

Human papillomavirus (HPV) infection and cervical squamous intraepithelial lesions (SILs) were studied in 379 high-risk women. Human papillomavirus DNA was detected in 238 of 360 (66.1%) of the beta-globin-positive cervical samples, and 467 HPV isolates belonging to 35 types were identified. Multiple (2–7 types) HPV infections were observed in 52.9% of HPV-infected women. The most prevalent HPV types were HPV-52 (14.7%), HPV-35 (9.4%), HPV-58 (9.4%), HPV-51 (8.6%), HPV-16 (7.8%), HPV-31 (7.5%), HPV-53 (6.7%), and HPV-18 (6.4%). Human immunodeficiency virus type 1 (HIV-1) seroprevalence was 36.0%. Human papillomavirus prevalence was significantly higher in HIV-1-infected women (87 vs 54%, prevalence ratio (PR)=1.61, 95% confidence interval (CI): 1.4–1.8). High-risk HPV types (71 vs 40%, PR=1.79, 95% CI: 1.5–2.2), in particular HPV-16+18 (22 vs 9%, PR=2.35, 95% CI: 1.4–4.0), and multiple HPV infections (56 vs 23%, PR=2.45, 95% CI: 1.8–3.3) were more prevalent in HIV-1-infected women. High-grade SIL (HSIL) was identified in 3.8% of the women. Human immunodeficiency virus type 1 infection was strongly associated with presence of HSIL (adjusted odds ratio=17.0; 95% CI 2.2–134.1, P=0.007) after controlling for high-risk HPV infection and other risk factors for HSIL. Nine of 14 (63%) HSIL cases were associated with HPV-16 or HPV-18 infection, and might have been prevented by an effective HPV-16/18 vaccine. PMID:16832413

Mithramycin encapsulated in polymeric micelles by microfluidic technology as novel therapeutic protocol for beta-thalassemia

PubMed Central

Capretto, Lorenzo; Mazzitelli, Stefania; Brognara, Eleonora; Lampronti, Ilaria; Carugo, Dario; Hill, Martyn; Zhang, Xunli; Gambari, Roberto; Nastruzzi, Claudio

2012-01-01

This report shows that the DNA-binding drug, mithramycin, can be efficiently encapsulated in polymeric micelles (PM-MTH), based on Pluronic® block copolymers, by a new microfluidic approach. The effect of different production parameters has been investigated for their effect on PM-MTH characteristics. The compared analysis of PM-MTH produced by microfluidic and conventional bulk mixing procedures revealed that microfluidics provides a useful platform for the production of PM-MTH with improved controllability, reproducibility, smaller size, and polydispersity. Finally, an investigation of the effects of PM-MTH, produced by microfluidic and conventional bulk mixing procedures, on the erythroid differentiation of both human erythroleukemia and human erythroid precursor cells is reported. It is demonstrated that PM-MTH exhibited a slightly lower toxicity and more pronounced differentiative activity when compared to the free drug. In addition, PM-MTH were able to upregulate preferentially γ-globin messenger ribonucleic acid production and to increase fetal hemoglobin (HbF) accumulation, the percentage of HbF-containing cells, and their HbF content without stimulating α-globin gene expression, which is responsible for the clinical symptoms of β-thalassemia. These results represent an important first step toward a potential clinical application, since an increase in HbF could alleviate the symptoms underlying β-thalassemia and sickle cell anemia. In conclusion, this report suggests that PM-MTH produced by microfluidic approach warrants further evaluation as a potential therapeutic protocol for β-thalassemia. PMID:22287841

Strong linkage disequilibrium of a HbE variant with the (AT)9(T)5 repeat in the BP1 binding site upstream of the beta-globin gene in the Thai population.

PubMed

Ohashi, Jun; Naka, Izumi; Patarapotikul, Jintana; Hananantachai, Hathairad; Brittenham, Gary; Looareesuwan, Sornchai; Clark, Andrew G; Tokunaga, Katsushi

2005-01-01

A binding site for the repressor protein BP1, which contains a tandem (AT)x(T)y repeat, is located approximately 530 bp 5' to the human beta-globin gene (HBB). There is accumulating evidence that BP1 binds to the (AT)9(T)5 allele more strongly than to other alleles, thereby reducing the expression of HBB. In this study, we investigated polymorphisms in the (AT)x(T)y repeat in 57 individuals living in Thailand, including three homozygotes for the hemoglobin E variant (HbE; beta26Glu-->Lys), 22 heterozygotes, and 32 normal homozygotes. We found that (AT)9(T)5 and (AT)7(T)7 alleles were predominant in the studied population and that the HbE variant is in strong linkage disequilibrium with the (AT)9(T)5 allele, which can explain why the betaE chain is inefficiently synthesized compared to the normal betaA chain. Moreover, the mildness of the HbE disease compared to other hemoglobinopathies in Thai may be due, in part, to the presence of the (AT)9(T)5 repeat on the HbE chromosome. In addition, a novel (AC)n polymorphism adjacent to the (AT)x(T)y repeat (i.e., (AC)3(AT)7(T)5) was found through the variation screening in this study.

Both TALENs and CRISPR/Cas9 directly target the HBB IVS2–654 (C > T) mutation in β-thalassemia-derived iPSCs

PubMed Central

Xu, Peng; Tong, Ying; Liu, Xiu-zhen; Wang, Ting-ting; Cheng, Li; Wang, Bo-yu; Lv, Xiang; Huang, Yue; Liu, De-pei

2015-01-01

β-Thalassemia is one of the most common genetic blood diseases and is caused by either point mutations or deletions in the β-globin (HBB) gene. The generation of patient-specific induced pluripotent stem cells (iPSCs) and subsequent correction of the disease-causing mutations may be a potential therapeutic strategy for this disease. Due to the low efficiency of typical homologous recombination, endonucleases, including TALENs and CRISPR/Cas9, have been widely used to enhance the gene correction efficiency in patient-derived iPSCs. Here, we designed TALENs and CRISPR/Cas9 to directly target the intron2 mutation site IVS2-654 in the globin gene. We observed different frequencies of double-strand breaks (DSBs) at IVS2-654 loci using TALENs and CRISPR/Cas9, and TALENs mediated a higher homologous gene targeting efficiency compared to CRISPR/Cas9 when combined with the piggyBac transposon donor. In addition, more obvious off-target events were observed for CRISPR/Cas9 compared to TALENs. Finally, TALENs-corrected iPSC clones were selected for erythroblast differentiation using the OP9 co-culture system and detected relatively higher transcription of HBB than the uncorrected cells. This comparison of using TALENs or CRISPR/Cas9 to correct specific HBB mutations in patient-derived iPSCs will guide future applications of TALENs- or CRISPR/Cas9-based gene therapies in monogenic diseases. PMID:26156589

CRISPR/Cas9-mediated gene editing in human tripronuclear zygotes.

PubMed

Liang, Puping; Xu, Yanwen; Zhang, Xiya; Ding, Chenhui; Huang, Rui; Zhang, Zhen; Lv, Jie; Xie, Xiaowei; Chen, Yuxi; Li, Yujing; Sun, Ying; Bai, Yaofu; Songyang, Zhou; Ma, Wenbin; Zhou, Canquan; Huang, Junjiu

2015-05-01

Genome editing tools such as the clustered regularly interspaced short palindromic repeat (CRISPR)-associated system (Cas) have been widely used to modify genes in model systems including animal zygotes and human cells, and hold tremendous promise for both basic research and clinical applications. To date, a serious knowledge gap remains in our understanding of DNA repair mechanisms in human early embryos, and in the efficiency and potential off-target effects of using technologies such as CRISPR/Cas9 in human pre-implantation embryos. In this report, we used tripronuclear (3PN) zygotes to further investigate CRISPR/Cas9-mediated gene editing in human cells. We found that CRISPR/Cas9 could effectively cleave the endogenous β-globin gene (HBB). However, the efficiency of homologous recombination directed repair (HDR) of HBB was low and the edited embryos were mosaic. Off-target cleavage was also apparent in these 3PN zygotes as revealed by the T7E1 assay and whole-exome sequencing. Furthermore, the endogenous delta-globin gene (HBD), which is homologous to HBB, competed with exogenous donor oligos to act as the repair template, leading to untoward mutations. Our data also indicated that repair of the HBB locus in these embryos occurred preferentially through the non-crossover HDR pathway. Taken together, our work highlights the pressing need to further improve the fidelity and specificity of the CRISPR/Cas9 platform, a prerequisite for any clinical applications of CRSIPR/Cas9-mediated editing.

Hemoglobin switching in sheep and goats. VI. Commitment of erythroid colony-forming cells to the synthesis of betaC globin

PubMed Central

1976-01-01

Bone marrow from mature goats and sheep was cultured in plasma clots, and three erythropoietin (ESF)-dependent responses-growth (colony formation), differentiation (globin production), and initiation of hemoglobin C (alpha2beta2C) synthesis--were quantitated. ESF concentrations below 0.01 U/ml supported colony growth and adult hemoglobin production in cultures of goat marrow, while maximal hemoglobin C synthesis (70%), as measured between 72 and 96 h in culture, required a 100-fold higher ESF concentration. Sheep marrow was cultured in a medium enriched to enhance growth and to permit complete maturation of colonies. These colonies active in hemoglobin synthesis between 24 and 96 h produced mainly adult hemoglobin, and only between 96 and 120 h did sheep colonies develop which produced mainly hemoglobin C (up to 70%). A similar heterogeneity may exist among goat colonies. Thus, when goat bone marrow was fractionated by unit gravity sedimentation, more hemoglobin C synthesis was observed in colonies derived from cells of intermediate sedimentation velocity than in colonies derived from the most rapidly sedimenting cells. Brief exposure of sheep (in vivo) and goat (in vitro) bone marrow to a high ESF concentration committed precursor cells to the generation of colonies which, even at low ESF concentration, produced hemoglobin C. Committment to hemoglobin phenotype appears to be an early and probably irreversible event in the development of an erythroid cell. PMID:993267

Genetics of Iranian Alpha-Thalassemia Patients: A Comprehensive Original Study.

PubMed

Keikhaei, Bijan; Slehi-Fard, Pejman; Shariati, Gholamreza; Khosravi, Abbas

2018-04-07

Alpha thalassemia is the most prevalent monogenic gene disorder in the world, especially in Mediterranean countries. In the current hematological phenotype of patients with different genotypes, the effects of missense mutations on the protein function and also stability were evaluated in a large cohort study. A total of 1,560 subjects were enrolled in the study and divided into two groups: 259 normal subjects; and 1301 alpha-thalassemia carriers. Genomic DNA was extracted and analyzed using ARMS PCR, Multiplex Gap, and direct sequencing. The effects of single nucleotide change on the protein function and stability were predicted by freely available databases of human polymorphisms. Sixty-three different genotypes were seen in the patients. The more prevalent was heterozygote form of -α3.7 (41.4%) followed by -α3.7 homozygote (11.6%) and -MED (3.8%). The significant differences were seen in mean hemoglobin level [F = 20.5, p < 0.001] between the Alpha-globin genotypes, when adjusted for gender. Moreover, 28 different mutations were found in our study. A significant relationship was seen between ethnicity and the alpha-globin mutation frequency χ 2 (df;8) = 38.36, p < 0.0001). Different genotypes could display as different phenotypes. The mutation frequency distributions in our region are different from those of other parts of Iran. Significant differences are seen in the spectrum of mutation frequency among various ethnicities. Finally, some missense mutations might not have considerable effect on the proteins, and they could be neutral mutations.

Electron microscope studies

NASA Astrophysics Data System (ADS)

Crewe, A. V.; Kapp, O. H.

1991-06-01

This year our laboratory has continued to make progress in the design of electron-optical systems, in the study of structure-function relationships of large multi-subunit proteins, in the development of new image processing software and in achieving a workable sub-angstrom STEM. We present an algebraic approach to the symmetrical Einzel (unipotential) lens wherein we simplify the analysis by specifying a field shape that meets some preferred set of boundary or other conditions and then calculate the fields. In a second study we generalize this approach to study of three element electrostatic lenses of which the symmetrical Einzel lens is a particular form. The purpose is to develop a method for assisting in the design of a lens for a particular purpose. In our biological work we study a stable and functional dodecameric complex of globin chains from the hemoglobin of Lumbricus terrestris. This is a complex lacking the 'linker' subunit first imaged in this lab and required for maintenance of the native structure. In addition, we do a complete work-up on the hemoglobin of the marine polychaete Eudistylia vancouverii, demonstrating the presence of a hierarchy of globin complexes. We demonstrate stable field-emission in the sub-angstrom STEM and the preliminary alignment of the beam. We continue our exploration of a algorithms for alignment of sequences of protein and DNA. Our computer facilities now include four second generation RISC workstations and we continue to take increasing advantage of the floating-point and graphical performance of these devices.

Influence of heme environment structure on dioxygen affinity for the dual function Amphitrite ornata hemoglobin/dehaloperoxidase. Insights into the evolutional structure-function adaptations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun, Shengfang; Sono, Masanori; Wang, Chunxue

Sea worm, Amphitrite ornata, has evolved its globin (an O 2 carrier) also to serves as a dehaloperoxidase (DHP) to detoxify haloaromatic pollutants generated by competing species. A previous mutagenesis study by our groups on both DHP and sperm whale myoglobin (SW Mb) revealed some structural factors that influence the dehaloperoxidase activities (significantly lower for Mb) of both proteins. Using an isocyanide/O 2 partition constant measurement method in this study, we have examined the effects of these structural factors on the O 2 equilibrium constants (K O2) of DHP, SW Mb, and their mutants. A clear trend of decreasing Omore » 2 affinity and increasing catalytic activity along with the increase in the distal His N ε–heme iron distance is observed. An H93K/T95H Mb double mutant mimicking the DHP proximal His positioning exhibited markedly enhanced O 2 affinity, confirming the essential effect of proximal His rotation on the globin function of DHP. For DHP, the L100F, T56G and M86E variants showed the effects of distal volume, distal His flexibility and proximal electronic push, respectively, on the O 2 affinity. This study provides insights into how DHP has evolved its heme environment to gain significantly enhanced peroxidase capability without compromising its primary function as an O 2 carrier.« less

High-Efficiency Synthesis of Human α-Endorphin and Magainin in the Erythrocytes of Transgenic Mice: A Production System for Therapeutic Peptides

NASA Astrophysics Data System (ADS)

Sharma, Ajay; Khoury-Christianson, Anastasia M.; White, Steven P.; Dhanjal, Nirpal K.; Huang, Wen; Paulhiac, Clara; Friedman, Eric J.; Manjula, Belur N.; Kumar, Ramesh

1994-09-01

Chemical synthesis of peptides, though feasible, is hindered by considerations of cost, purity, and efficiency of synthesizing longer chains. Here we describe a transgenic system for producing peptides of therapeutic interest as fusion proteins at low cost and high purity. Transgenic hemoglobin expression technology using the locus control region was employed to produce fusion hemoglobins in the erythrocytes of mice. The fusion hemoglobin contains the desired peptide as an extension at the C end of human α-globin. A protein cleavage site is inserted between the C end of the α-globin chain and the N-terminal residue of the desired peptide. The peptide is recovered after cleavage of the fusion protein with enzymes that recognize this cleavage signal as their substrate. Due to the selective compartmentalization of hemoglobin in the erythrocytes, purification of the fusion hemoglobin is easy and efficient. Because of its compact and highly ordered structure, the internal sites of hemoglobin are resistant to protease digestion and the desired peptide is efficiently released and recovered. The applicability of this approach was established by producing a 16-mer α-endorphin peptide and a 26-mer magainin peptide in transgenic mice. Transgenic animals and their progeny expressing these fusion proteins remain healthy, even when the fusion protein is expressed at >25% of the total hemoglobin in the erythrocytes. Additional applications and potential improvements of this methodology are discussed.

Novel, high-yield red blood cell production methods from CD34-positive cells derived from human embryonic stem, yolk sac, fetal liver, cord blood, and peripheral blood.

PubMed

Olivier, Emmanuel; Qiu, Caihong; Bouhassira, Eric E

2012-08-01

The current supply of red blood cells expressing rare blood groups is not sufficient to cover all the existing transfusion needs for chronically transfused patients, such as sickle cell disease homozygous carriers, because of alloimmunization. In vitro production of cultured red blood cells is slowly emerging as a possible complement to the existing collection-based red blood cell procurement system. The yield of cultured red blood cells can theoretically be maximized by amplifying the stem, progenitor, or precursor compartment. Here, we combined methods designed to expand these three compartments to optimize the yield of cultured red blood cells and found that exposing CD34(+) cells to a short pulse of cytokines favorable for erythroid differentiation prior to stem cell expansion followed by progenitor expansion produced the highest yield of erythroid cells. This novel serum-free red blood cell production protocol was efficient on CD34(+) cells derived from human embryonic stem cells, 6-8-week yolk sacs, 16-18-week fetal livers, cord blood, and peripheral blood. The yields of cells obtained with these new protocols were larger by an order of magnitude than the yields observed previously. Globin expression analysis by high-performance liquid chromatography revealed that these expansion protocols generally yielded red blood cells that expressed a globin profile similar to that expected for the developmental age of the CD34(+) cells.

Structure of dehaloperoxidase B at 1.58 Å resolution and structural characterization of the AB dimer from Amphitrite ornata

DOE Office of Scientific and Technical Information (OSTI.GOV)

Serrano, Vesna de; D’Antonio, Jennifer; Franzen, Stefan

2010-05-01

The crystal structure of dehaloperoxidase (DHP) isoenzyme B from the terebellid polychaete A. ornata, which exhibits both hemoglobin and peroxidase functions, has been determined at 1.58 Å resolution. As members of the globin superfamily, dehaloperoxidase (DHP) isoenzymes A and B from the marine annelid Amphitrite ornata possess hemoglobin function, but they also exhibit a biologically relevant peroxidase activity that is capable of converting 2,4,6-trihalophenols to the corresponding 2,6-dihaloquinones in the presence of hydrogen peroxide. Here, a comprehensive structural study of recombinant DHP B, both by itself and cocrystallized with isoenzyme A, using X-ray diffraction is presented. The structure of DHPmore » B refined to 1.58 Å resolution exhibits the same distal histidine (His55) conformational flexibility as that observed in isoenzyme A, as well as additional changes to the distal and proximal hydrogen-bonding networks. Furthermore, preliminary characterization of the DHP AB heterodimer is presented, which exhibits differences in the AB interface that are not observed in the A-only or B-only homodimers. These structural investigations of DHP B provide insights that may relate to the mechanistic details of the H{sub 2}O{sub 2}-dependent oxidative dehalogenation reaction catalyzed by dehaloperoxidase, present a clearer description of the function of specific residues in DHP at the molecular level and lead to a better understanding of the paradigms of globin structure–function relationships.« less

Energetic Differences at The Subunit Interfaces of Normal Human Hemoglobins Correlate with Their Developmental Profile†

PubMed Central

Manning, Lois R.; Russell, J. Eric; Popowicz, Anthony M.; Manning, Robert S.; Padovan, Julio C.; Manning, James M.

2013-01-01

A previously unrecognized function of normal human hemoglobins occurring during protein assembly is described - - self-regulation of subunit pairings and their durations arising from the variable strengths of their subunit interactions. Although it is known that many mutant human hemoglobins have altered subunit interface strengths, those of the normal embryonic, fetal, and adult human hemoglobins have not been considered to differ significantly. However, in a comprehensive study of both types of subunit interfaces of seven of the eight normal oxy human hemoglobins, we found that the strength, i.e. the free energies of the tetramer-dimer interfaces, contrary to previous reports, differ by 3-orders of magnitude and display an undulating profile similar to the transitions (“switches”) of various globin subunit types over time. The dimer interface strengths are also variable and correlate linearly with their developmental profile; embryonic hemoglobins are the weakest, fetal hemoglobin is of intermediate strength, and adult hemoglobins are the strongest. The pattern also correlates generally with their different O2 affinities and responses to allosteric regulatory molecules. Acetylation of fetal hemoglobin weakens its unusually strong subunit interactions and occurs progressively as its expression diminishes and adult hemoglobin A formations begins; a causal relationship is suggested. The relative contributions of globin gene order and competition among subunits due to differences in their interface strengths were found to be complementary and establish a connection between genetics, thermodynamics, and development. PMID:19583196

Both TALENs and CRISPR/Cas9 directly target the HBB IVS2-654 (C > T) mutation in β-thalassemia-derived iPSCs.

PubMed

Xu, Peng; Tong, Ying; Liu, Xiu-zhen; Wang, Ting-ting; Cheng, Li; Wang, Bo-yu; Lv, Xiang; Huang, Yue; Liu, De-pei

2015-07-09

β-Thalassemia is one of the most common genetic blood diseases and is caused by either point mutations or deletions in the β-globin (HBB) gene. The generation of patient-specific induced pluripotent stem cells (iPSCs) and subsequent correction of the disease-causing mutations may be a potential therapeutic strategy for this disease. Due to the low efficiency of typical homologous recombination, endonucleases, including TALENs and CRISPR/Cas9, have been widely used to enhance the gene correction efficiency in patient-derived iPSCs. Here, we designed TALENs and CRISPR/Cas9 to directly target the intron2 mutation site IVS2-654 in the globin gene. We observed different frequencies of double-strand breaks (DSBs) at IVS2-654 loci using TALENs and CRISPR/Cas9, and TALENs mediated a higher homologous gene targeting efficiency compared to CRISPR/Cas9 when combined with the piggyBac transposon donor. In addition, more obvious off-target events were observed for CRISPR/Cas9 compared to TALENs. Finally, TALENs-corrected iPSC clones were selected for erythroblast differentiation using the OP9 co-culture system and detected relatively higher transcription of HBB than the uncorrected cells. This comparison of using TALENs or CRISPR/Cas9 to correct specific HBB mutations in patient-derived iPSCs will guide future applications of TALENs- or CRISPR/Cas9-based gene therapies in monogenic diseases.

Hb San Cataldo [β144(HC1)Lys→Thr; HBB: C.434A > C]: A New Hemoglobin Variant with Increased Affinity for Oxygen.

PubMed

Vinciguerra, Margherita; Passarello, Cristina; Cassarà, Filippo; Leto, Filippo; Cannata, Monica; Crivello, Anna; Di Salvo, Veronica; Maggio, Aurelio; Giambona, Antonino

2016-08-01

A 59-year-old Italian woman came to our center for revaluation of a previous diagnosis of polycythemia vera. The patient presented with a lifelong history of polycythemia, no increase in white blood cells (WBCs) and platelets, and a negative bone marrow biopsy. Analysis of hemoglobin (Hb) fractions showed an abnormal fast moving Hb component. We aimed to determine if this variant was the cause of polycythemia in this patient. A complete blood count (CBC) was performed by an automated cell counter and Hb fractions were determined by high performance liquid chromatography (HPLC). Standard stability tests and oxygen affinity evaluation were also performed. Genomic DNA was extracted from peripheral blood leukocytes using the phenol chloroform method and the entire β-globin gene was analyzed by direct sequencing. At the hematological level, no anemia or hemolysis was observed but an abnormal Hb fraction was detected using cation exchange HPLC. Molecular analysis of the β-globin gene showed heterozygosity for an AAG > ACG substitution at codon 144, resulting in a Lys→Thr amino acid replacement. We demonstrated that this is a new Hb variant with increased oxygen affinity. Its altered physiology is caused by the reduction of 2,3-diphosphoglycerate (2,3-DPG) effects, due to an amino acid substitution in the central pocket near the C-terminal of the β chain. We called this new variant Hb San Cataldo for the native city of proband.

Increased levels of advanced glycation end products positively correlate with iron overload and oxidative stress markers in patients with β-thalassemia major.

PubMed

Mirlohi, Maryam Sadat; Yaghooti, Hamid; Shirali, Saeed; Aminasnafi, Ali; Olapour, Samaneh

2018-04-01

The impaired biosynthesis of the β-globin chain in β-thalassemia leads to the accumulation of unpaired alpha globin chains, failure in hemoglobin formation, and iron overload due to frequent blood transfusion. Iron excess causes oxidative stress and massive tissue injuries. Advanced glycation end products (AGEs) are harmful agents, and their production accelerates in oxidative conditions. This study was conducted on 45 patients with major β-thalassemia who received frequent blood transfusions and chelation therapy and were compared to 40 healthy subjects. Metabolic parameters including glycemic and iron indices, hepatic and renal functions tests, oxidative stress markers, and AGEs (carboxymethyl-lysine and pentosidine) levels were measured. All parameters were significantly increased in β-thalassemia compared to the control except for glutathione levels. Blood glucose, iron, serum ferritin, non-transferrin-bound iron (NTBI), MDA, soluble form of low-density lipoprotein receptor, glutathione peroxidase, total reactive oxygen species (ROS), and AGE levels were significantly higher in the β-thalassemia patients. Iron and ferritin showed a significant positive correlation with pentosidine (P < 0.01) but not with carboxymethyl-lysine. The NTBI was markedly increased in the β-thalassemia patients, and its levels correlated significantly with both carboxymethyl-lysine and pentosidine (P < 0.05). Our findings confirm the oxidative status generated by the iron overload in β-thalassemia major patients and highlight the enhanced formation of AGEs, which may play an important role in the pathogenesis of β-thalassemia major.

Molecular Characterisation of α- and β-Thalassaemia among Indigenous Senoi Orang Asli Communities in Peninsular Malaysia.

PubMed

Koh, Danny Xuan Rong; Raja Sabudin, Raja Zahratul Azma; Mohd Yusoff, Malisa; Hussin, Noor Hamidah; Ahmad, Rahimah; Othman, Ainoon; Ismail, Endom

2017-09-01

Thalassaemia is a public health problem in Malaysia, with each ethnic group having their own common mutations. However, there is a lack on data on the prevalence and common mutations among the indigenous people. This cross-sectional study was performed to determine the common mutations of α- and β-thalassaemia among the subethnic groups of Senoi, the largest Orang Asli group in Peninsular Malaysia. Blood samples collected from six Senoi subethnic groups were analysed for full blood count and haemoglobin analysis (HbAn). Samples with abnormal findings were then screened for α- and β-globin gene mutations. Out of the 752 samples collected, 255 showed abnormal HbAn results, and 122 cases showing abnormal red cell indices with normal HbAn findings were subjected to molecular screening. DNA analysis revealed a mixture of α- and β-globin gene mutations with 25 concomitant cases. The types of gene abnormalities detected for α-thalassaemia were termination codon (T>C) Hb CS (α CS α), Cd59 (G>A) haemoglobin Adana (Hb Adana) (α Cd59 α), initiation codon (ATG>A-G) (α IniCd α), two-gene deletion (- SEA ), and single-gene 3.7-kb deletion (-α 3.7 ). For β-thalassaemia, there were Cd26 (G>A) Hb E (β E ), Cd19 (A>G) Haemoglobin Malay (Hb Malay) (β Cd19 ), and IVS 1-5 (G>C) (β IVS 1-5 ). © 2017 John Wiley & Sons Ltd/University College London.

Correlation of MFOLD-predicted DNA secondary structures with separation patterns obtained by capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) analysis.

PubMed

Glavac, Damjan; Potocnik, Uros; Podpecnik, Darja; Zizek, Teofil; Smerkolj, Sava; Ravnik-Glavac, Metka

2002-04-01

We have studied 57 different mutations within three beta-globin gene promoter fragments with sizes 52 bp, 77 bp, and 193 bp by fluorescent capillary electrophoresis CE-SSCP analysis. For each mutation and wild type, energetically most-favorable predicted secondary structures were calculated for sense and antisense strands using the MFOLD DNA-folding algorithm in order to investigate if any correlation exists between predicted DNA structures and actual CE migration time shifts. The overall CE-SSCP detection rate was 100% for all mutations in three studied DNA fragments. For shorter 52 bp and 77 bp DNA fragments we obtained a positive correlation between the migration time shifts and difference in free energy values of predicted secondary structures at all temperatures. For longer 193 bp beta-globin gene fragments with 46 mutations MFOLD predicted different secondary structures for 89% of mutated strands at 25 degrees C and 40 degrees C. However, the magnitude of the mobility shifts did not necessarily correlate with their secondary structures and free energy values except for the sense strand at 40 degrees C where this correlation was statistically significant (r = 0.312, p = 0.033). Results of this study provided more direct insight into the mechanism of CE-SSCP and showed that MFOLD prediction could be helpful in making decisions about the running temperatures and in prediction of CE-SSCP data patterns, especially for shorter (50-100 bp) DNA fragments. Copyright 2002 Wiley-Liss, Inc.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Crewe, A.V.; Kapp, O.H.

This year our laboratory has continued to make progress in the design of electron-optical systems, in the study of structure-function relationships of large multi-subunit proteins, in the development of new image processing software and in achieving a workable sub-angstrom STEM. We present an algebraic approach to the symmetrical Einzel (unipotential) lens wherein we simplify the analysis by specifying a field shape that meets some preferred set of boundary or other conditions and then calculate the fields. In a second study we generalize this approach to study of three element electrostatic lenses of which the symmetrical Einzel lens is a particularmore » form. The purpose is to develop a method for assisting in the design of a lens for a particular purpose. In our biological work we study a stable and functional dodecameric complex of globin chains from the hemoglobin of Lumbricus terrestris. This is a complex lacking the linker'' subunit first imaged in this lab and required for maintenance of the native structure. In addition, we do a complete work-up on the hemoglobin of the marine polychaete Eudistylia vancouverii demonstrating the presence of a hierarchy of globin complexes. We demonstrate stable field-emission in the sub-angstrom STEM and the preliminary alignment of the beam. We continue our exploration of a algorithms for alignment of sequences of protein and DNA. Our computer facilities now include four second generation RISC workstations and we continue to take increasing advantage of the floating-point and graphical performance of these devices.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Crewe, A.V.; Kapp, O.H.

This year our laboratory has continued to make progress in the design of electron-optical systems, in the study of structure-function relationships of large multi-subunit proteins, in the development of new image processing software and in achieving a workable sub-angstrom STEM. We present an algebraic approach to the symmetrical Einzel (unipotential) lens wherein we simplify the analysis by specifying a field shape that meets some preferred set of boundary or other conditions and then calculate the fields. In a second study we generalize this approach to study of three element electrostatic lenses of which the symmetrical Einzel lens is a particularmore » form. The purpose is to develop a method for assisting in the design of a lens for a particular purpose. In our biological work we study a stable and functional dodecameric complex of globin chains from the hemoglobin of Lumbricus terrestris. This is a complex lacking the ``linker`` subunit first imaged in this lab and required for maintenance of the native structure. In addition, we do a complete work-up on the hemoglobin of the marine polychaete Eudistylia vancouverii demonstrating the presence of a hierarchy of globin complexes. We demonstrate stable field-emission in the sub-angstrom STEM and the preliminary alignment of the beam. We continue our exploration of a algorithms for alignment of sequences of protein and DNA. Our computer facilities now include four second generation RISC workstations and we continue to take increasing advantage of the floating-point and graphical performance of these devices.« less

The Molecular Basis of β-Thalassemia

PubMed Central

Thein, Swee Lay

2013-01-01

The β-thalassemias are characterized by a quantitative deficiency of β-globin chains underlaid by a striking heterogeneity of molecular defects. Although most of the molecular lesions involve the structural β gene directly, some down-regulate the gene through distal cis effects, and rare trans-acting mutations have also been identified. Most β-thalassemias are inherited in a Mendelian recessive fashion but there is a subgroup of β-thalassemia alleles that behave as dominant negatives. Unraveling the molecular basis of β-thalassemia has provided a paradigm for understanding of much of human genetics. PMID:23637309