Science.gov

Sample records for multiple immediate-early gene-deleted

  1. Properties of a herpes simplex virus multiple immediate-early gene-deleted recombinant as a vaccine vector

    SciTech Connect

    Watanabe, Daisuke; Brockman, Mark A.; Ndung'u, Thumbi; Mathews, Lydia; Lucas, William T.; Murphy, Cynthia G.; Felber, Barbara K.; Pavlakis, George N.; Deluca, Neal A.; Knipe, David M. . E-mail: david_knipe@hms.harvard.edu

    2007-01-20

    Herpes simplex virus (HSV) recombinants induce durable immune responses in rhesus macaques and mice and have induced partial protection in rhesus macaques against mucosal challenge with virulent simian immunodeficiency virus (SIV). In this study, we evaluated the properties of a new generation HSV vaccine vector, an HSV-1 multiple immediate-early (IE) gene deletion mutant virus, d106, which contains deletions in the ICP4, ICP27, ICP22, and ICP47 genes. Because several of the HSV IE genes have been implicated in immune evasion, inactivation of the genes encoding these proteins was expected to result in enhanced immunogenicity. The d106 virus expresses few HSV gene products and shows minimal cytopathic effect in cultured cells. When d106 was inoculated into mice, viral DNA accumulated at high levels in draining lymph nodes, consistent with an ability to transduce dendritic cells and activate their maturation and movement to lymph nodes. A d106 recombinant expressing Escherichia coli {beta}-galactosidase induced durable {beta}-gal-specific IgG and CD8{sup +} T cell responses in naive and HSV-immune mice. Finally, d106-based recombinants have been constructed that express simian immunodeficiency virus (SIV) gag, env, or a rev-tat-nef fusion protein for several days in cultured cells. Thus, d106 shows many of the properties desirable in a vaccine vector: limited expression of HSV gene products and cytopathogenicity, high level expression of transgenes, ability to induce durable immune responses, and an ability to transduce dendritic cells and induce their maturation and migration to lymph nodes.

  2. Assessment of the Toxicity of CuO Nanoparticles by Using Saccharomyces cerevisiae Mutants with Multiple Genes Deleted

    PubMed Central

    Bao, Shaopan; Lu, Qicong; Dai, Heping; Zhang, Chao

    2015-01-01

    To develop applicable and susceptible models to evaluate the toxicity of nanoparticles, the antimicrobial effects of CuO nanoparticles (CuO-NPs) on various Saccharomyces cerevisiae (S. cerevisiae) strains (wild type, single-gene-deleted mutants, and multiple-gene-deleted mutants) were determined and compared. Further experiments were also conducted to analyze the mechanisms associated with toxicity using copper salt, bulk CuO (bCuO), carbon-shelled copper nanoparticles (C/Cu-NPs), and carbon nanoparticles (C-NPs) for comparisons. The results indicated that the growth inhibition rates of CuO-NPs for the wild-type and the single-gene-deleted strains were comparable, while for the multiple-gene deletion mutant, significantly higher toxicity was observed (P < 0.05). When the toxicity of the CuO-NPs to yeast cells was compared with the toxicities of copper salt and bCuO, we concluded that the toxicity of CuO-NPs should be attributed to soluble copper rather than to the nanoparticles. The striking difference in adverse effects of C-NPs and C/Cu-NPs with equivalent surface areas also proved this. A toxicity assay revealed that the multiple-gene-deleted mutant was significantly more sensitive to CuO-NPs than the wild type. Specifically, compared with the wild-type strain, copper was readily taken up by mutant strains when cell permeability genes were knocked out, and the mutants with deletions of genes regulated under oxidative stress (OS) were likely producing more reactive oxygen species (ROS). Hence, as mechanism-based gene inactivation could increase the susceptibility of yeast, the multiple-gene-deleted mutants should be improved model organisms to investigate the toxicity of nanoparticles. PMID:26386067

  3. Zinc transporter 3 (ZnT3) gene deletion reduces spinal cord white matter damage and motor deficits in a murine MOG-induced multiple sclerosis model.

    PubMed

    Choi, Bo Young; Kim, In Yeol; Kim, Jin Hee; Kho, A Ra; Lee, Song Hee; Lee, Bo Eun; Sohn, Min; Koh, Jae-Young; Suh, Sang Won

    2016-10-01

    The present study aimed to evaluate the role of zinc transporter 3 (ZnT3) on multiple sclerosis (MS) pathogenesis. Experimental autoimmune encephalomyelitis (EAE), a disease model of multiple sclerosis, was induced by immunization with myelin oligodendrocyte glycoprotein (MOG35-55) in female mice. Three weeks after the initial immunization, demyelination, immune cell infiltration and blood brain barrier (BBB) disruption in the spinal cord were analyzed. Clinical signs of EAE first appeared on day 11 and reached a peak level on day 19 after the initial immunization. ZnT3 gene deletion profoundly reduced the daily clinical score of EAE. The ZnT3 gene deletion-mediated inhibition of the clinical course of EAE was accompanied by suppression of inflammation and demyelination in the spinal cord. The motor deficit accompanying neuropathological changes associated with EAE were mild in ZnT3 gene deletion mice. This reduction in motor deficit was accompanied by coincident reductions in demyelination and infiltration of encephalitogenic immune cells including CD4+ T cells, CD8+ T cells, CD20+ B cells and F4/80+ microglia in the spinal cord. These results demonstrate that ZnT3 gene deletion inhibits the clinical features and neuropathological changes associated with EAE. ZnT3 gene deletion also remarkably inhibited formation of EAE-associated aberrant synaptic zinc patches, matrix metalloproteinases-9 (MMP-9) activation and BBB disruption. Therefore, amelioration of EAE-induced clinical and neuropathological changes by ZnT3 gene deletion suggests that vesicular zinc may be involved in several steps of MS pathogenesis.

  4. Analysis of the CYP21A2 gene with intergenic recombination and multiple gene deletions in the RCCX module.

    PubMed

    Chang, Shwu-Fen; Lee, Hsien-Hsiung

    2011-01-01

    The most frequent bimodular RCCX module of the RP1-C4A-CYP21A1P-TNXA-RP2-C4B-CYP21A2-TNXB gene sequence is located on chromosome 6p21.3. To determine RCCX alterations, we used the polymerase chain reaction (PCR) product containing the tenascin B (TNXB) and CYP21A2 genes with TaqI digestion and Southern blot analysis with AseI and NdeI endonuclease digestion of genomic DNA from congenital adrenal hyperplasia patients with common mutations resulting from an intergenic conversion of CYP21A1P, such as an I2 splice, I172N, V281L, F306-L307insT, Q318X, and R356W, and dual mutations of I236N/V237E in the CYP21A2 gene. The results showed that a 3.7-kb fragment of the CYP21A2 gene was detected in each case, and 21.6- and 11.3-kb DNA fragments were found in the RCCX region by a Southern blot analysis with these corresponding mutations. However, the IVS2-12A/C- > G (I2 splice) haplotype in combination with the 707-714delGAGACTAC (without the P30L mutation) mutation produced a 3.2-kb TaqI fragment in the PCR product analysis and a specific 9.3-kb fragment by the Southern blot method. Therefore, we concluded that the rearrangement in the RCCX region resulting from processing of either an intergenic recombination or multiple gene deletions can be identified by the PCR analysis and Southern blot method based on a fragment-distinguishing configuration without a family study.

  5. Requirement of multiple cis-acting elements in the human cytomegalovirus major immediate-early distal enhancer for viral gene expression and replication.

    PubMed

    Meier, Jeffery L; Keller, Michael J; McCoy, James J

    2002-01-01

    We have shown previously that the human cytomegalovirus (HCMV) major immediate-early (MIE) distal enhancer is needed for MIE promoter-dependent transcription and viral replication at low multiplicities of infection (MOI). To understand how this region works, we constructed and analyzed a series of HCMVs with various distal enhancer mutations. We show that the distal enhancer is composed of at least two parts that function independently to coordinately activate MIE promoter-dependent transcription and viral replication. One such part is contained in a 47-bp segment that has consensus binding sites for CREB/ATF, SP1, and YY1. At low MOI, these working parts likely function in cis to directly activate MIE gene expression, thus allowing viral replication to ensue. Three findings support the view that these working parts are likely cis-acting elements. (i) Deletion of either part of a bisegmented distal enhancer only slightly alters MIE gene transcription and viral replication. (ii) Reversing the distal enhancer's orientation largely preserves MIE gene transcription and viral replication. (iii) Placement of stop codons at -300 or -345 in all reading frames does not impair MIE gene transcription and viral replication. Lastly, we show that these working parts are dispensable at high MOI, partly because of compensatory stimulation of MIE promoter activity and viral replication that is induced by a virion-associated component(s) present at a high viral particle/cell ratio. We conclude that the distal enhancer is a complex multicomponent cis-acting region that is required to augment both MIE promoter-dependent transcription and HCMV replication.

  6. Serum Leukocyte Immunoglobulin-Like Receptor A3 (LILRA3) Is Increased in Patients with Multiple Sclerosis and Is a Strong Independent Indicator of Disease Severity; 6.7kbp LILRA3 Gene Deletion Is Not Associated with Diseases Susceptibility

    PubMed Central

    An, Hongyan; Lim, Chai; Guillemin, Gilles J.; Vollmer-Conna, Ute; Rawlinson, William; Bryant, Katherine; Tedla, Nicodemus

    2016-01-01

    Leukocyte immunoglobulin-like receptor A3 (LILRA3) is a soluble immune regulatory molecule primarily expressed by monocytes and macrophages. A homozygous 6.7kbp LILRA3 gene deletion that removes the first seven of its eight exons is predicted to lead to lack of LILRA3 protein, although this has not been experimentally confirmed. Moreover, there are conflicting results with regards to the link between the LILRA3 homozygous genetic deletion and susceptibility to multiple sclerosis (MS) in different European populations. The aim of this study was to investigate whether LILRA3 gene deletion is associated with MS susceptibility in a North American cohort of European ancestry and assess if serum LILRA3 protein level is a marker of clinical subtype and/or disease severity in MS. A total of 456 patients with MS and 99 unrelated healthy controls were genotyped for the 6.7kbp LILRA3 gene deletion and levels of LILRA3 protein in sera determined by in-house sandwich ELISA. We showed that LILRA3 gene deletion was not associated with MS susceptibility and did not affect the age of disease onset, clinical subtype or disease severity. However, we discovered for the first time that homozygous LILRA3 gene deletion results in lack of production of LILRA3 protein. Importantly, LILRA3 protein level was significantly increased in sera of patients with MS when compared with control subjects, particularly in more severe type primary progressive MS. Multiple regression analysis showed that LILRA3 level in serum was one of the strongest independent markers of disease severity in MS, which potentially can be used as a diagnostic marker. PMID:26871720

  7. Multiple genetic origins of histidine-rich protein 2 gene deletion in Plasmodium falciparum parasites from Peru

    PubMed Central

    Akinyi, Sheila; Hayden, Tonya; Gamboa, Dionicia; Torres, Katherine; Bendezu, Jorge; Abdallah, Joseph F.; Griffing, Sean M.; Quezada, Wilmer Marquiño; Arrospide, Nancy; De Oliveira, Alexandre Macedo; Lucas, Carmen; Magill, Alan J.; Bacon, David J.; Barnwell, John W.; Udhayakumar, Venkatachalam

    2013-01-01

    The majority of malaria rapid diagnostic tests (RDTs) detect Plasmodium falciparum histidine-rich protein 2 (PfHRP2), encoded by the pfhrp2 gene. Recently, P. falciparum isolates from Peru were found to lack pfhrp2 leading to false-negative RDT results. We hypothesized that pfhrp2-deleted parasites in Peru derived from a single genetic event. We evaluated the parasite population structure and pfhrp2 haplotype of samples collected between 1998 and 2005 using seven neutral and seven chromosome 8 microsatellite markers, respectively. Five distinct pfhrp2 haplotypes, corresponding to five neutral microsatellite-based clonal lineages, were detected in 1998-2001; pfhrp2 deletions occurred within four haplotypes. In 2003-2005, outcrossing among the parasite lineages resulted in eight population clusters that inherited the five pfhrp2 haplotypes seen previously and a new haplotype; pfhrp2 deletions occurred within four of these haplotypes. These findings indicate that the genetic origin of pfhrp2 deletion in Peru was not a single event, but likely occurred multiple times. PMID:24077522

  8. Multiple genetic origins of histidine-rich protein 2 gene deletion in Plasmodium falciparum parasites from Peru.

    PubMed

    Akinyi, Sheila; Hayden, Tonya; Gamboa, Dionicia; Torres, Katherine; Bendezu, Jorge; Abdallah, Joseph F; Griffing, Sean M; Quezada, Wilmer Marquiño; Arrospide, Nancy; De Oliveira, Alexandre Macedo; Lucas, Carmen; Magill, Alan J; Bacon, David J; Barnwell, John W; Udhayakumar, Venkatachalam

    2013-09-30

    The majority of malaria rapid diagnostic tests (RDTs) detect Plasmodium falciparum histidine-rich protein 2 (PfHRP2), encoded by the pfhrp2 gene. Recently, P. falciparum isolates from Peru were found to lack pfhrp2 leading to false-negative RDT results. We hypothesized that pfhrp2-deleted parasites in Peru derived from a single genetic event. We evaluated the parasite population structure and pfhrp2 haplotype of samples collected between 1998 and 2005 using seven neutral and seven chromosome 8 microsatellite markers, respectively. Five distinct pfhrp2 haplotypes, corresponding to five neutral microsatellite-based clonal lineages, were detected in 1998-2001; pfhrp2 deletions occurred within four haplotypes. In 2003-2005, outcrossing among the parasite lineages resulted in eight population clusters that inherited the five pfhrp2 haplotypes seen previously and a new haplotype; pfhrp2 deletions occurred within four of these haplotypes. These findings indicate that the genetic origin of pfhrp2 deletion in Peru was not a single event, but likely occurred multiple times.

  9. Gene Deletion by Synthesis in Yeast.

    PubMed

    Kim, Jinsil; Kim, Dong-Uk; Hoe, Kwang-Lae

    2017-01-01

    Targeted gene deletion is a useful tool for understanding the function of a gene and its protein product. We have developed an efficient and robust gene deletion approach in yeast that employs oligonucleotide-based gene synthesis. This approach requires a deletion cassette composed of three modules: a central 1397-bp KanMX4 selection marker module and two 366-bp gene-specific flanking modules. The invariable KanMX4 module can be used in combination with different pairs of flanking modules targeting different genes. The two flanking modules consist of both sequences unique to each cassette (chromosomal homologous regions and barcodes) and those common to all deletion constructs (artificial linkers and restriction enzyme sites). Oligonucleotides for each module and junction regions are designed using the BatchBlock2Oligo program and are synthesized on a 96-well basis. The oligonucleotides are ligated into a single deletion cassette by ligase chain reaction, which is then amplified through two rounds of nested PCR to obtain sufficient quantities for yeast transformation. After removal of the artificial linkers, the deletion cassettes are transformed into wild-type diploid fission yeast SP286 cells. Verification of correct clone and gene deletion is achieved by performing check PCR and tetrad analysis. This method with proven effectiveness, as evidenced by a high success rate of gene deletion, can be potentially applicable to create systematic gene deletion libraries in a variety of yeast species. PMID:27671940

  10. IAP gene deletion and conditional knockout models.

    PubMed

    Silke, John; Vaux, David L

    2015-03-01

    Gene deletion studies have helped reveal the unique and overlapping roles played by IAP proteins. Crossing IAP mutant mice has helped unravel the complex feed-back regulatory circuits in which cIAP1, cIAP2 and XIAP allow innate defensive responses to microbial pathogens, without the development of auto-inflammatory syndromes. Deletion of genes for Survivin and its homologs in yeasts, invertebrates and mammals has shown that it functions differently, as it is not a regulator of innate immunity or apoptosis, but acts together with INCENP, aurora kinase B and Borealin to allow chromosome segregation during mitosis. PMID:25545814

  11. Transcriptionally active immediate-early protein of pseudorabies virus binds to specific sites on class II gene promoters.

    PubMed Central

    Cromlish, W A; Abmayr, S M; Workman, J L; Horikoshi, M; Roeder, R G

    1989-01-01

    In the presence of partially purified pseudorabies virus immediate-early protein, multiple sites of DNase I protection were observed on the adenovirus major late and human hsp 70 promoters. Southwestern (DNA-protein blot) analysis demonstrated that the immediate-early protein bound directly to the sequences contained in these sites. These sequences share only limited homology, differ in their affinities for the immediate-early protein, and are located at different positions on these two promoters. In addition, the site-specific binding of a temperature-sensitive immediate-early protein was eliminated by the same heat treatment which eliminates its transcriptional activating function, whereas the binding of the wild-type protein was unaffected by heat treatment. Thus, site-specific binding requires a functionally active immediate-early protein. Furthermore, immediate-early-protein-dependent in vitro transcription from the major late promoter was preferentially inhibited by oligonucleotides which are homologous to the high-affinity binding sites on the major late or hsp 70 promoters. These observations suggest that transcriptional stimulation by the immediate-early protein involves binding to cis-acting elements. Images PMID:2539489

  12. Somatic mosaicism for a DMD gene deletion

    SciTech Connect

    Saito, Kayoko; Ikeya, Kiyoko; Kondo, Eri

    1995-03-13

    Mosaicism is a mixed state, with two cell populations of different genetic origins caused by a cell mutation occurring after fertilization. In the present case, DNA analysis of lymphocytes led to a DMD diagnosis before death. Postmortem immunocytochemical and DNA analysis showed somatic mosaicism. At age 18 years, blood lymphocyte DNA analysis showed a DMD gene deletion, upstream from exon 7 to the 5{prime} end containing both muscle and brain promoters. As the patient`s mother and elder sister had no deletions, he was considered to have a new mutation. Immunocytochemical studies of postmortem tissues showed that dystrophin was absent from the tongue, deltoid, intercostal, psoas and rectus femoris muscles, but there was a mix of dystrophin-positive and negative fibers in the rectus abdominis, cardiac, temporalis and sternocleidomastoid muscles. All diaphragm cells were dystrophin positive. Polymerase chain reaction (PCR) amplification from all tissues except the temporalis and sternocleidomastoid muscles, diaphragm and kidney, in which no deletion was found, showed the deletion from at least exon 6 to the 5{prime} end containing both muscle and brain promoters. In this case, a genomic deletion of the DMD gene contributed to the formation of tissues derived from both ectoderm and endoderm, and cells of mesodermal origin showed genotypic and phenotypic heterogeneity. Our results indicate a mutation of the present case may have occurred just before the period of germ layer formation. 34 refs., 7 figs.

  13. Using Immediate-Early Genes to Map Hippocampal Subregional Functions

    ERIC Educational Resources Information Center

    Kubik, Stepan; Miyashita, Teiko; Guzowski, John F.

    2007-01-01

    Different functions have been suggested for the hippocampus and its subdivisions along both transversal and longitudinal axes. Expression of immediate-early genes (IEGs) has been used to map specific functions onto neuronal activity in different areas of the brain including the hippocampus (IEG imaging). Here we review IEG studies on hippocampal…

  14. Learning About Gene Regulatory Networks From Gene Deletion Experiments

    PubMed Central

    Brazma, Alvis

    2002-01-01

    Gene regulatory networks are a major focus of interest in molecular biology. A crucial question is how complex regulatory systems are encoded and controlled by the genome. Three recent publications have raised the question of what can be learned about gene regulatory networks from microarray experiments on gene deletion mutants. Using this indirect approach, topological features such as connectivity and modularity have been studied. PMID:18629255

  15. Immunological evasion of immediate-early varicella zoster virus proteins.

    PubMed

    Meysman, Pieter; Fedorov, Dmitry; Van Tendeloo, Viggo; Ogunjimi, Benson; Laukens, Kris

    2016-07-01

    The varicella zoster virus (VZV) causes the childhood disease commonly known as chickenpox and can later in life reactivate as herpes zoster. The adaptive immune system is known to play an important role in suppressing VZV reactivation. A central aspect of this system is the presentation of VZV-derived peptides by the major histocompatibility complex (MHC) proteins. Here, we investigate if key VZV proteins have evolved their amino acid sequence to avoid presentation by MHC based on predictive models of MHC-peptide affinity. This study shows that the immediate-early proteins of all characterized VZV strains are profoundly depleted for high-affinity MHC-I-restricted epitopes. The same depletion can be found in its closest animal analog, the simian varicella virus. Further orthology analysis towards other herpes viruses suggests that the protein amino acid frequency is one of the primary drivers of targeted epitope depletion. PMID:27020058

  16. Infectious bronchitis viruses with naturally occurring genomic rearrangement and gene deletion.

    PubMed

    Hewson, Kylie A; Ignjatovic, Jagoda; Browning, Glenn F; Devlin, Joanne M; Noormohammadi, Amir H

    2011-02-01

    Infectious bronchitis viruses (IBVs) are group III coronaviruses that infect poultry worldwide. Genetic variations, including whole-gene deletions, are key to IBV evolution. Australian subgroup 2 IBVs contain sequence insertions and multiple gene deletions that have resulted in a substantial genomic divergence from international IBVs. The genomic variations present in Australian IBVs were investigated and compared to those of another group III coronavirus, turkey coronavirus (TCoV). Open reading frames (ORFs) found throughout the genome of Australian IBVs were analogous in sequence and position to TCoV ORFs, except for ORF 4b, which appeared to be translocated to a different position in the subgroup 2 strains. Subgroup 2 strains were previously reported to lack genes 3a, 3b and 5a, with some also lacking 5b. Of these, however, genes 3b and 5b were found to be present but contained various mutations that may affect transcription. In this study, it was found that subgroup 2 IBVs have undergone a more substantial genomic rearrangements than previously thought.

  17. Cytomegalovirus immediate early proteins promote stemness properties in glioblastoma

    PubMed Central

    Soroceanu, Liliana; Matlaf, Lisa; Khan, Sabeena; Akhavan, Armin; Singer, Eric; Bezrookove, Vladimir; Decker, Stacy; Ghanny, Saleena; Hadaczek, Piotr; Bengtsson, Henrik; Ohlfest, John; Luciani-Torres, Maria-Gloria; Harkins, Lualhati; Perry, Arie; Guo, Hong; Soteropoulos, Patricia; Cobbs, Charles S

    2015-01-01

    Glioblastoma (GBM) is the most common and aggressive human brain tumor. Human cytomegalovirus (HCMV) immediate early (IE) proteins that are endogenously expressed in GBM cells are strong viral transactivators with onconcogenic properties. Here, we show how HCMV IE are preferentially expressed in glioma stem-like cells (GSC), where they co-localize with the other GBM stemness markers, CD133, Nestin, and Sox2. In patient-derived GSC that are endogenously infected with HCMV, attenuating IE expression by an RNA-i-based strategy, was sufficient to inhibit tumorsphere formation, Sox2 expression, cell cycle progression, and cell survival. Conversely, HCMV infection of HMCV-negative GSC elicited robust self-renewal and proliferation of cells that could be partially reversed by IE attenuation. In HCMV-positive GSC, IE attenuation induced a molecular program characterized by enhanced expression of mesenchymal markers and pro-inflammatory cytokines, resembling the therapeutically-resistant GBM phenotype. Mechanistically, HCMV/IE regulation of Sox2 occurred via inhibition of miRNA-145, a negative regulator of Sox2 protein expression. In a spontaneous mouse model of glioma, ectopic expression of the IE1 gene (UL123) specifically increased Sox2 and Nestin levels in the IE1-positive tumors, upregulating stemness and proliferation markers in vivo. Similarly, human GSC infected with the HCMV strain Towne but not the IE1-deficient strain CR208 showed enhanced growth as tumorspheres and intracranial tumor xenografts, compared to mock-infected human GSC. Overall, our findings offer new mechanistic insights into how HCMV/IE control stemness properties in glioblastoma cells. PMID:26239477

  18. Influence of Isoflurane on Immediate-Early Gene Expression

    PubMed Central

    Bunting, Kristopher M.; Nalloor, Rebecca I.; Vazdarjanova, Almira

    2016-01-01

    Background: Anterograde amnesia is a hallmark effect of volatile anesthetics. Isoflurane is known to affect both the translation and transcription of plasticity-associated genes required for normal memory formation in many brain regions. What is not known is whether isoflurane anesthesia prevents the initiation of transcription or whether it halts transcription already in progress. We tested the hypothesis that general anesthesia with isoflurane prevents learning-induced initiation of transcription of several memory-associated immediate-early genes (IEGs) correlated with amnesia; we also assessed whether it stops transcription initiated prior to anesthetic administration. Methods: Using a Tone Fear Conditioning paradigm, rats were trained to associate a tone with foot-shock. Animals received either no anesthesia, anesthesia immediately after training, or anesthesia before, during, and after training. Animals were either sacrificed after training or tested 24 h later for long-term memory. Using Cellular Compartment Analysis of Temporal Activity by Fluorescence in situ Hybridization (catFISH), we examined the percentage of neurons expressing the IEGs Arc/Arg3.1 and Zif268/Egr1/Ngfi-A/Krox-24 in the dorsal hippocampus, primary somatosensory cortex, and primary auditory cortex. Results: On a cellular level, isoflurane administered at high doses (general anesthesia) prevented initiation of transcription, but did not stop transcription of Arc and Zif268 mRNA initiated prior to anesthesia. On a behavioral level, the same level of isoflurane anesthesia produced anterograde amnesia for fear conditioning when administered before and during training, but did not produce retrograde amnesia when administered immediately after training. Conclusion: General anesthesia with isoflurane prevents initiation of learning-related transcription but does not stop ongoing transcription of two plasticity-related IEGs, Arc and Zif268, a pattern of disruption that parallels the effects of

  19. Tetranectin gene deletion induces Parkinson's disease by enhancing neuronal apoptosis.

    PubMed

    Chen, Zhifeng; Wang, Ersong; Hu, Rong; Sun, Yu; Zhang, Lei; Jiang, Jue; Zhang, Ying; Jiang, Hong

    Parkinson's disease (PD) is a chronic neurodegenerative disorder characterized by the progressive degeneration of dopaminergic neurons in the substantia nigra pars compacta (SNpc). We previously identified tetranectin (TET) as a potential biomarker for PD whose expression is downregulated in the cerebrospinal fluid of PD patients. In the present study, we investigate the role of TET in neurodegeneration in vitro and in vivo. Our results showed that siRNA knockdown of TET decreased cell viability and the number of tyrosine hydroxylase (TH) positive cells, whereas it increased caspase-3 activity and the Bax/Bcl-2 ratio in cultured primary dopaminergic neurons. Overexpression of TET protected dopaminergic neurons against neuronal apoptosis in 1-methyl-4-phenylpyridinium cell culture model in vitro. In TET knockdown mouse model of PD, TET gene deletion decreased the number of TH positive cells in the SNpc, induced apoptosis via the p53/Bax pathway, and significantly impaired the motor behavior of transgenic mice. The findings suggest that TET plays a neuroprotective role via reducing neuron apoptosis and could be a valuable biomarker or potential therapeutic target for the treatment of patients with PD. PMID:26597345

  20. Ped gene deletion polymorphism frequency in wild mice.

    PubMed

    Newmark, Judith A; Sacher, Frank; Jones, Gwilym S; Warner, Carol M

    2002-07-01

    The Ped gene influences the rate of cleavage of preimplantation embryos and their subsequent survival. Embryos that express the product of the Ped gene, Qa-2 protein, cleave at a faster rate than embryos with an absence of Qa-2 protein. In addition, the Ped gene has pleiotropic effects on reproduction. Thus, there is a reproductive advantage to those mouse strains that are Qa-2 positive. The presence or absence of Qa-2 is reflected at the DNA level by the presence or absence (deletion polymorphism) of the gene(s) encoding Qa-2 protein. Many inbred and wild-derived mouse strains have been characterized as Qa-2 positive or negative, but no previous studies have looked at the distribution of the Ped gene in a population of free-living wild mice. The purpose of this study was to determine the Ped gene deletion polymorphism frequency in a sample of free-living wild mice. Twenty-nine mice were collected and identified as Mus musculus. Genomic DNA extraction was performed on tail tips, and PCR was used to amplify a region from the Ped gene. Known Qa-2 positive and negative mice were used as controls. Results showed that all 29 wild mice were positive for the Ped gene. Since the Ped gene is dominant and provides a reproductive advantage, it is not surprising that all of the wild mice were Qa-2 positive. However, our assay could not distinguish homozygous from heterozygous mice. It is possible that the Qa-2 deletion polymorphism is segregating in the population, and a larger sample size would identify some Qa-2 negative mice. PMID:12115912

  1. Negative elongation factor NELF controls transcription of immediate early genes in a stimulus-specific manner

    SciTech Connect

    Fujita, Toshitsugu; Piuz, Isabelle; Schlegel, Werner

    2009-01-15

    The transcription rate of immediate early genes (IEGs) is controlled directly by transcription elongation factors at the transcription elongation step. Negative elongation factor (NELF) and 5,6-dichloro-1-{beta}-D-ribofuranosylbenzimidazole (DRB) sensitivity-inducing factor (DSIF) stall RNA polymerase II (pol II) soon after transcription initiation. Upon induction of IEG transcription, DSIF is converted into an accelerator for pol II elongation. To address whether and how NELF as well as DSIF controls overall IEG transcription, its expression was reduced using stable RNA interference in GH4C1 cells. NELF knock-down reduced thyrotropin-releasing hormone (TRH)-induced transcription of the IEGs c-fos, MKP-1, and junB. In contrast, epidermal growth factor (EGF)-induced transcription of these IEGs was unaltered or even slightly increased by NELF knock-down. Thus, stable knock-down of NELF affects IEG transcription stimulation-specifically. Conversely, DSIF knock-down reduced both TRH- and EGF-induced transcription of the three IEGs. Interestingly, TRH-induced activation of the MAP kinase pathway, a pathway essential for transcription of the three IEGs, was down-regulated by NELF knock-down. Thus, stable knock-down of NELF, by modulating intracellular signaling pathways, caused stimulation-specific loss of IEG transcription. These observations indicate that NELF controls overall IEG transcription via multiple mechanisms both directly and indirectly.

  2. Sub-optimal phenotypes of double-knockout mutants of Escherichia coli depend on the order of gene deletions.

    PubMed

    Gawand, Pratish; Said Abukar, Fatumina; Venayak, Naveen; Partow, Siavash; Motter, Adilson E; Mahadevan, Radhakrishnan

    2015-08-01

    Metabolic networks are characterized by multiple redundant reactions that do not have a clear biological function. The redundancies in the metabolic networks are implicated in adaptation to random mutations and survival under different environmental conditions. Reactions that are not active under wild-type growth conditions, but get transiently activated after a mutation event such as gene deletion are known as latent reactions. Characterization of multiple-gene knockout mutants can identify the physiological roles of latent reactions. In this study, we characterized double-gene deletion mutants of E. coli with the aim of investigating the sub-optimal physiology of the mutants and the possible roles of latent reactions. Specifically, we investigated the effects of the deletion of the glyoxylate-shunt gene aceA (encoding a latent reaction enzyme, isocitrate lyase) on the growth characteristics of the mutant E. coli Δpgi. The deletion of aceA reduced the growth rate of E. coli Δpgi, indicating that the activation of the glyoxylate shunt plays an important role in adaptation of the mutant E. coli Δpgi when no other latent reactions are concurrently inactivated. We also investigated the effect of the order of the gene deletions on the growth rates and substrate uptake rates of the double-gene deletion mutants. The results indicate that the order in which genes are deleted determines the phenotype of the mutants during the sub-optimal growth phase. To elucidate the mechanism behind the difference between the observed phenotypes, we carried out transcriptomic analysis and constraint-based modeling of the mutants. Transcriptomic analysis showed differential expression of the gene aceK (encoding the protein isocitrate dehydrogenase kinase) involved in controlling the isocitrate flux through the TCA cycle and the glyoxylate shunt. Higher acetate production in the E. coli ΔaceA1 Δpgi2 mutant was consistent with the increased aceK expression, which limits the TCA cycle

  3. L1CAM whole gene deletion in a child with L1 syndrome.

    PubMed

    Chidsey, Brandalyn A; Baldwin, Erin E; Toydemir, Reha; Ahles, Lauren; Hanson, Heather; Stevenson, David A

    2014-06-01

    L1 syndrome is a group of overlapping, X-linked disorders caused by mutations in L1CAM. Clinical phenotypes within L1 syndrome include X-linked hydrocephalus with stenosis of the aqueduct of sylvius (HSAS); mental retardation, adducted thumbs, shuffling gait, and aphasia (MASA) syndrome; spastic paraplegia type 1; and agenesis of the corpus callosum. Over 200 mutations in L1CAM have been reported; however, only a few large gene deletions have been observed. We report on a 4-month-old male with a de novo whole gene deletion of L1CAM presenting with congenital hydrocephalus, aqueductal stenosis, and adducted thumbs. Initial failure of L1CAM gene sequencing suggested the possibility of a whole gene deletion of L1CAM. Further investigation through chromosome microarray analysis showed a 62Kb deletion encompassing the first exon of the PDZD4 gene and the entire L1CAM gene. Investigations into genotype-phenotype correlations have suggested that mutations leading to truncated or absent L1 protein cause more severe forms of L1 syndrome. Based on the presentation of the proband and other reported patients with whole gene deletions, we provide further evidence that L1CAM whole gene deletions result in L1 syndrome with a severe phenotype, deletions of PDZD4 do not cause additional manifestations, and that X-linked nephrogenic diabetes insipidus reported in a subset of patients with large L1CAM deletions results from the loss of AVPR2. PMID:24668863

  4. Fine specificity of cellular immune responses in humans to human cytomegalovirus immediate-early 1 protein.

    PubMed Central

    Alp, N J; Allport, T D; Van Zanten, J; Rodgers, B; Sissons, J G; Borysiewicz, L K

    1991-01-01

    Cell-mediated immunity is important in maintaining the virus-host equilibrium in persistent human cytomegalovirus (HCMV) infection. The HCMV 72-kDa major immediate early 1 protein (IE1) is a target for CD8+ cytotoxic T cells in humans, as is the equivalent 89-kDa protein in mouse. Less is known about responses against this protein by CD4+ T cells, which may be important as direct effector cells or helper cells for antibody and CD8+ responses. Proliferative-T-cell responses to HCMV IE1 were studied in normal seropositive subjects. Peripheral blood mononuclear cells from 85% of seropositive subjects proliferated in response to HCMV from infected fibroblasts, and of these, 73% responded to recombinant baculovirus IE1. Responding cells were predominantly CD3+ CD4+. IE1 antigen preparations, including baculovirus recombinant protein, transfected rat cell nuclei, and synthetic peptides, induced IE1-specific T-cell lines which cross-reacted between the preparations. The fine specificity of these IE1-specific T-cell lines was studied by using overlapping synthetic peptides encompassing the entire sequence of the IE1 protein. The regions of the IE1 molecule recognized were identified and these varied between individuals, possibly reflecting differences in major histocompatibility complex (MHC) class II haplotype. In one subject, the peptide specificities of proliferative and MHC class I-restricted cytotoxic determinants on IE1 were spatially distinct. Thus, no single immunodominant T-cell determinant within HCMV IE1 was identified, suggesting that multiple peptides or a region of the 72-kDa IE1 protein would be required to induce specific T-cell responses in humans. PMID:1714519

  5. Ethological concepts revisited: immediate early gene induction in response to sexual stimuli in birds.

    PubMed

    Ball, G F; Balthazar, J

    2001-05-01

    Courtship behaviors were interpreted by ethologists as being examples of 'sign stimuli' that would act as 'releasers' of stereotypic species-typical behaviors in conspecifics. A key component of the sign stimulus concept is that some form of stimulus filtering occurs that is responsible for the marked selective behavioral responsiveness. Studies of immediate early gene induction in the avian brain in response to conspecific stimuli associated with courtship and mating reveal that such gene induction is highly selective. In male Japanese quail (Coturnix japonica), studies of the immediate early gene c-fos or zenk have been conducted in birds engaging in both appetitive and consummatory aspects of male sexual behavior. High induction of immediate early genes occurs in hypothalamic and limbic areas such as the medial preoptic nucleus, bed nucleus striae terminalis and parts of the archistriatum in birds who had copulated and/or who had expressed a learned social proximity response, reflecting appetitive sexual behavior. Immediate early gene expression was also increased in telencephalic areas such as the hyperstriatum ventrale that presumably plays a role in the integration of sensory cues related to female recognition. In European starlings, studies of zenk induction have been conducted in females who hear male-typical courtship song. Clayton and Mello had shown that zenk is induced in the auditory telencephalon of canaries and zebra finches at high levels specifically in response to conspecific song. Immediate early genes such as fos and zenk are also expressed in song control nuclei specifically in association with song production. In starlings it was found that song was effective in rapidly inducing zenk expression in the auditory telencephalon in males and in females in the breeding as well as in the non-breeding season. Thus, the expression is not greater in females who use song to choose mates or during the breeding season when females are choosing mates

  6. Establishment of a Cre recombinase based mutagenesis protocol for markerless gene deletion in Streptococcus suis.

    PubMed

    Koczula, A; Willenborg, J; Bertram, R; Takamatsu, D; Valentin-Weigand, P; Goethe, R

    2014-12-01

    The lack of knowledge about pathogenicity mechanisms of Streptococcus (S.) suis is, at least partially, attributed to limited methods for its genetic manipulation. Here, we established a Cre-lox based recombination system for markerless gene deletions in S. suis serotype 2 with high selective pressure and without undesired side effects.

  7. Direct cellobiose production from cellulose using sextuple beta-glucosidase gene deletion Neurospora crassa mutants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Direct cellobiose production from cellulose by a genetically modified fungus—Neurospora crassa, was explored in this study. A library of N. crassa sextuple beta-glucosidase (bgl) gene deletion strains was constructed. Various concentrations of cellobiose were detected in the culture broth of the N. ...

  8. Gene expression profiling in spleens of deoxynivalenol-exposed mice: immediate early genes as primary targets.

    PubMed

    Kinser, Shawn; Jia, Qunshan; Li, Maioxing; Laughter, Ashley; Cornwell, Paul; Corton, J Christopher; Pestka, James

    2004-09-24

    signaling, were increased, while Jun kinase 2 (JNK2) was decreased. Taken together, data suggest that DON upregulated the expression of multiple immediate early genes, many of which are likely to contribute to the complex immunological effects reported for this and other trichothecenes.

  9. Expression of immediate early genes after treatment of human astrocytoma cells with radiation and taxol

    SciTech Connect

    Gubits, R.M.; Geard, C.R.; Schiff, P.B.

    1993-10-20

    The promising chemotherapeutic agent, taxol, has been shown to sensitize the G18 line of human astrocytoma cells to ionizing radiation. The present studies were performed to identify specific changes in gene expression associated with this altered sensitivity. The products of immediate early genes, which are induced transiently in cells in response to a variety of treatments, including growth factors, neurotransmitters, and irradiation with UV light or X rays, are thought to initiate a cascade of genetic responses to alterations in cellular environment. The present results demonstrate a dramatic attenuation in one immediate early gene response in association with a treatment that enhances radiosensitivity in a refractory human brain tumor line. 22 refs., 5 figs., 1 tab.

  10. Transcriptional dynamics reveal critical roles for non-coding RNAs in the immediate-early response.

    PubMed

    Aitken, Stuart; Magi, Shigeyuki; Alhendi, Ahmad M N; Itoh, Masayoshi; Kawaji, Hideya; Lassmann, Timo; Daub, Carsten O; Arner, Erik; Carninci, Piero; Forrest, Alistair R R; Hayashizaki, Yoshihide; Khachigian, Levon M; Okada-Hatakeyama, Mariko; Semple, Colin A

    2015-04-01

    The immediate-early response mediates cell fate in response to a variety of extracellular stimuli and is dysregulated in many cancers. However, the specificity of the response across stimuli and cell types, and the roles of non-coding RNAs are not well understood. Using a large collection of densely-sampled time series expression data we have examined the induction of the immediate-early response in unparalleled detail, across cell types and stimuli. We exploit cap analysis of gene expression (CAGE) time series datasets to directly measure promoter activities over time. Using a novel analysis method for time series data we identify transcripts with expression patterns that closely resemble the dynamics of known immediate-early genes (IEGs) and this enables a comprehensive comparative study of these genes and their chromatin state. Surprisingly, these data suggest that the earliest transcriptional responses often involve promoters generating non-coding RNAs, many of which are produced in advance of canonical protein-coding IEGs. IEGs are known to be capable of induction without de novo protein synthesis. Consistent with this, we find that the response of both protein-coding and non-coding RNA IEGs can be explained by their transcriptionally poised, permissive chromatin state prior to stimulation. We also explore the function of non-coding RNAs in the attenuation of the immediate early response in a small RNA sequencing dataset matched to the CAGE data: We identify a novel set of microRNAs responsible for the attenuation of the IEG response in an estrogen receptor positive cancer cell line. Our computational statistical method is well suited to meta-analyses as there is no requirement for transcripts to pass thresholds for significant differential expression between time points, and it is agnostic to the number of time points per dataset. PMID:25885578

  11. Transcriptional dynamics reveal critical roles for non-coding RNAs in the immediate-early response.

    PubMed

    Aitken, Stuart; Magi, Shigeyuki; Alhendi, Ahmad M N; Itoh, Masayoshi; Kawaji, Hideya; Lassmann, Timo; Daub, Carsten O; Arner, Erik; Carninci, Piero; Forrest, Alistair R R; Hayashizaki, Yoshihide; Khachigian, Levon M; Okada-Hatakeyama, Mariko; Semple, Colin A

    2015-04-01

    The immediate-early response mediates cell fate in response to a variety of extracellular stimuli and is dysregulated in many cancers. However, the specificity of the response across stimuli and cell types, and the roles of non-coding RNAs are not well understood. Using a large collection of densely-sampled time series expression data we have examined the induction of the immediate-early response in unparalleled detail, across cell types and stimuli. We exploit cap analysis of gene expression (CAGE) time series datasets to directly measure promoter activities over time. Using a novel analysis method for time series data we identify transcripts with expression patterns that closely resemble the dynamics of known immediate-early genes (IEGs) and this enables a comprehensive comparative study of these genes and their chromatin state. Surprisingly, these data suggest that the earliest transcriptional responses often involve promoters generating non-coding RNAs, many of which are produced in advance of canonical protein-coding IEGs. IEGs are known to be capable of induction without de novo protein synthesis. Consistent with this, we find that the response of both protein-coding and non-coding RNA IEGs can be explained by their transcriptionally poised, permissive chromatin state prior to stimulation. We also explore the function of non-coding RNAs in the attenuation of the immediate early response in a small RNA sequencing dataset matched to the CAGE data: We identify a novel set of microRNAs responsible for the attenuation of the IEG response in an estrogen receptor positive cancer cell line. Our computational statistical method is well suited to meta-analyses as there is no requirement for transcripts to pass thresholds for significant differential expression between time points, and it is agnostic to the number of time points per dataset.

  12. Transcriptional Dynamics Reveal Critical Roles for Non-coding RNAs in the Immediate-Early Response

    PubMed Central

    Aitken, Stuart; Magi, Shigeyuki; Alhendi, Ahmad M. N.; Itoh, Masayoshi; Kawaji, Hideya; Lassmann, Timo; Daub, Carsten O.; Arner, Erik; Carninci, Piero; Forrest, Alistair R. R.; Hayashizaki, Yoshihide; Khachigian, Levon M.; Okada-Hatakeyama, Mariko; Semple, Colin A.

    2015-01-01

    The immediate-early response mediates cell fate in response to a variety of extracellular stimuli and is dysregulated in many cancers. However, the specificity of the response across stimuli and cell types, and the roles of non-coding RNAs are not well understood. Using a large collection of densely-sampled time series expression data we have examined the induction of the immediate-early response in unparalleled detail, across cell types and stimuli. We exploit cap analysis of gene expression (CAGE) time series datasets to directly measure promoter activities over time. Using a novel analysis method for time series data we identify transcripts with expression patterns that closely resemble the dynamics of known immediate-early genes (IEGs) and this enables a comprehensive comparative study of these genes and their chromatin state. Surprisingly, these data suggest that the earliest transcriptional responses often involve promoters generating non-coding RNAs, many of which are produced in advance of canonical protein-coding IEGs. IEGs are known to be capable of induction without de novo protein synthesis. Consistent with this, we find that the response of both protein-coding and non-coding RNA IEGs can be explained by their transcriptionally poised, permissive chromatin state prior to stimulation. We also explore the function of non-coding RNAs in the attenuation of the immediate early response in a small RNA sequencing dataset matched to the CAGE data: We identify a novel set of microRNAs responsible for the attenuation of the IEG response in an estrogen receptor positive cancer cell line. Our computational statistical method is well suited to meta-analyses as there is no requirement for transcripts to pass thresholds for significant differential expression between time points, and it is agnostic to the number of time points per dataset. PMID:25885578

  13. Structural analysis of the major immediate early gene of human cytomegalovirus

    SciTech Connect

    Stenberg, R.M.; Thomsen, D.R.; Stinski, M.F.

    1984-01-01

    The most abundant species of human cytomegalovirus (Towne) immediate early polysome-associated RNA originates from a region of ca. 2.8 kilobases within the XbaI-E DNA fragment. These sequences code for a 1.95-kilobase mRNA and are referred to as immediate early coding region one. The authors have utilized the nuclease mapping technique of Berk and Sharp to examine this gene in detail. Cloned fragments of human cytomegalovirus DNA, either labeled with /sup 32/P in vivo or end labeled in vitro at the 5' or 3' termini, were hybridized to immediate early polysome-associated RNA. The hybrids were treated with single-strand-specific nuclease and subjected to electrophoresis in either neutral or denaturing gels. The major transcript was shown to be spliced molecule containing a 3' terminal exon of 1341 nucleotides. The sequence of the exons as well as the locations of the intro-exon splice junctions were determined. The predicted molecular weight of the polypeptide originating from this region was estimated to be 64,000. The properties of the viral gene and its protein product are discussed.

  14. Dissecting the phenotypes of Dravet syndrome by gene deletion

    PubMed Central

    Rubinstein, Moran; Han, Sung; Tai, Chao; Westenbroek, Ruth E.; Hunker, Avery; Scheuer, Todd

    2015-01-01

    Neurological and psychiatric syndromes often have multiple disease traits, yet it is unknown how such multi-faceted deficits arise from single mutations. Haploinsufficiency of the voltage-gated sodium channel Nav1.1 causes Dravet syndrome, an intractable childhood-onset epilepsy with hyperactivity, cognitive deficit, autistic-like behaviours, and premature death. Deletion of Nav1.1 channels selectively impairs excitability of GABAergic interneurons. We studied mice having selective deletion of Nav1.1 in parvalbumin- or somatostatin-expressing interneurons. In brain slices, these deletions cause increased threshold for action potential generation, impaired action potential firing in trains, and reduced amplification of postsynaptic potentials in those interneurons. Selective deletion of Nav1.1 in parvalbumin- or somatostatin-expressing interneurons increases susceptibility to thermally-induced seizures, which are strikingly prolonged when Nav1.1 is deleted in both interneuron types. Mice with global haploinsufficiency of Nav1.1 display autistic-like behaviours, hyperactivity and cognitive impairment. Haploinsufficiency of Nav1.1 in parvalbumin-expressing interneurons causes autistic-like behaviours, but not hyperactivity, whereas haploinsufficiency in somatostatin-expressing interneurons causes hyperactivity without autistic-like behaviours. Heterozygous deletion in both interneuron types is required to impair long-term spatial memory in context-dependent fear conditioning, without affecting short-term spatial learning or memory. Thus, the multi-faceted phenotypes of Dravet syndrome can be genetically dissected, revealing synergy in causing epilepsy, premature death and deficits in long-term spatial memory, but interneuron-specific effects on hyperactivity and autistic-like behaviours. These results show that multiple disease traits can arise from similar functional deficits in specific interneuron types. PMID:26017580

  15. Construction and characterization of a herpes simplex virus type 1 mutant unable to transinduce immediate-early gene expression.

    PubMed

    Ace, C I; McKee, T A; Ryan, J M; Cameron, J M; Preston, C M

    1989-05-01

    A herpes simplex virus mutant, in1814, possessing a 12-base-pair insertion in the gene encoding the transinducing factor Vmw65 has been constructed. The insertion abolished the ability of Vmw65 to transinduce immediate-early (IE) gene expression and to form a protein-DNA complex with cell proteins and the IE-specific regulatory element TAATGAGAT. Accumulation of IE RNA 1 and 2 was reduced four- to fivefold in in1814-infected cells, but the level of IE RNA 4 was reduced only by twofold, and IE RNA 3 was unaffected. Mutant in1814 had a high particle/PFU ratio, but many of the particles, although unable to form plaques, were capable of normal participation in the early stages of infection at high multiplicity of infection. The defect of in1814 was overcome partially by transfection of a plasmid encoding the IE protein Vmw110 into cells prior to titration and by prior infection with ultraviolet light-inactivated herpes simplex virus. Mutant in1814 was essentially avirulent when injected into mice. The results demonstrate that transinduction of IE transcription by Vmw65 is important at low multiplicity of infection and in vivo but that at high multiplicity of infection the function is redundant.

  16. Large-scale Phenotypic Profiling of Gene Deletion Mutants in Candida glabrata

    PubMed Central

    Tscherner, Michael; Kuchler, Karl

    2016-01-01

    Here, we describe a method enabling the phenotypic profiling of genome-scale deletion collections of fungal mutants to detect phenotypes for various stress conditions. These stress conditions include among many others antifungal drug susceptibility, temperature-induced and osmotic as well as heavy metal or oxidative stress. The protocol was extensively used to phenotype a collection of gene deletion mutants in the human fungal pathogen Candida glabrata (C. glabrata) (Schwarzmüller et al., 2014). PMID:27774498

  17. Mullerian Duct Cyst Causing Bladder Outlet Obstruction in a Patient with HNF-1β Gene Deletion

    PubMed Central

    Honore, Matthew; Fowler, Ross; Kiosoglous, Anthony J.

    2016-01-01

    A 24-year-old male was referred to a tertiary hospital for a possible prostatic abscess. The patient went into acute urinary retention. Transurethral drainage was performed. MRI pelvis three days post-operatively identified the prostatic cystic structure as a müllerian duct cyst. Several other phenotypical features were noted on examination as well as findings on investigations. From these diagnosis of hepatocyte nuclear factor-1β (HNF-1β) gene deletion was made. PMID:27390584

  18. The human immediate early gene BRF1 maps to chromosome 14q22-q24

    SciTech Connect

    Maclean, K.N.; Bustin, S.A.; McKay, I.A.; See, C.G.

    1995-11-01

    BRF1 (Butyrate response factor 1) is a member of an immediate early gene family specifying putative nuclear transcription factors. A repeat motif incorporating two Cys and two His is highly conserved between family members identified from yeast, Drosophila, mouse, rat, and human. The chromosome localization of none of the human genes has been determined thus far. Using the polymerase chain reaction on a human-rodent hybrid panel, we have localized BRF1 to chromosome 14. This was confirmed by direct sequencing of the PCR fragment. Using fluorescence in situ hybridization, the chromosome localization of BRF1 was further determined as 14q22-q24. 15 refs., 1 fig.

  19. Pheromone-induced expression of immediate early genes in the mouse vomeronasal sensory system.

    PubMed

    Haga-Yamanaka, Sachiko; Touhara, Kazushige

    2013-01-01

    Immediate early genes (IEGs) are powerful tools for visualizing activated neurons and extended circuits that are stimulated by sensory input. Several kinds of IEGs (e.g., c-fos, egr-1) have been utilized for detecting activated receptor neurons in the pheromone sensory organ called the vomeronasal organ (VNO), as well as for mapping the neurons within the central nervous system (CNS) excited by pheromones.In this chapter, we describe the procedure for the detection of pheromone-induced neural activation in the VNO and CNS using the c-Fos immunostaining technique.

  20. Nucleotide sequence of an immediate-early frog virus 3 gene.

    PubMed

    Willis, D; Foglesong, D; Granoff, A

    1984-12-01

    We have used "gene walking" with synthetic oligonucleotides and M13 dideoxynucleotide sequencing techniques to obtain the complete coding and flanking sequences of the gene encoding a major immediate-early RNA (molecular weight, 169,000) of frog virus 3. R-loop mapping of the cloned XbaI K fragment of frog virus 3 DNA with immediate-early RNA from infected cells showed that an RNA of approximately 500 to 600 nucleotides (the right size to code for the immediate-early viral 18-kilodalton protein of unknown function) hybridized to a region within 100 base pairs of one end of the XbaI K fragment; no evidence for splicing was observed in the electron microscope or by single-strand nuclease analysis. Further restriction mapping narrowed the location of the gene to the XbaI end of a 2-kilobase-pair XbaI-Bg/II fragment, which was bidirectionally subcloned into the bacteriophage pair mp10 and mp11 for sequencing. Mung bean nuclease mapping was used to identify both the 5' and the 3' ends of the mRNA. The 5' end mapped within an AT-rich region 19 base pairs upstream from two in-phase AUG start codons that were immediately followed by an open reading frame of 157 amino acids. Another AT-rich sequence was found at -29 base pairs from the 5' end of the mRNA start site; this sequence may function as a TATA box. The 3' end of the message displayed considerable microheterogeneity, but clearly terminated within a third AT-rich region 50 to 60 base pairs from the translation stop codon. The eucaryotic polyadenylic acid addition signal (AATAAA) was not present, a finding to be expected since frog virus 3 mRNA is not polyadenylated. Both the single-stranded mp10 clone of the XbaI-Bg/II fragment and a 15-base oligonucleotide complementary to the region flanking the two AUG translation start codons inhibited translation of the immediate-early 18-kilodalton protein in vitro, confirming the identity of the sequenced gene. As the regulatory sequences of this gene did not resemble those of

  1. Satb1 Ablation Alters Temporal Expression of Immediate Early Genes and Reduces Dendritic Spine Density during Postnatal Brain Development

    PubMed Central

    Balamotis, Michael A.; Tamberg, Nele; Woo, Young Jae; Li, Jingchuan; Davy, Brian

    2012-01-01

    Complex behaviors, such as learning and memory, are associated with rapid changes in gene expression of neurons and subsequent formation of new synaptic connections. However, how external signals are processed to drive specific changes in gene expression is largely unknown. We found that the genome organizer protein Satb1 is highly expressed in mature neurons, primarily in the cerebral cortex, dentate hilus, and amygdala. In Satb1-null mice, cortical layer morphology was normal. However, in postnatal Satb1-null cortical pyramidal neurons, we found a substantial decrease in the density of dendritic spines, which play critical roles in synaptic transmission and plasticity. Further, we found that in the cerebral cortex, Satb1 binds to genomic loci of multiple immediate early genes (IEGs) (Fos, Fosb, Egr1, Egr2, Arc, and Bdnf) and other key neuronal genes, many of which have been implicated in synaptic plasticity. Loss of Satb1 resulted in greatly alters timing and expression levels of these IEGs during early postnatal cerebral cortical development and also upon stimulation in cortical organotypic cultures. These data indicate that Satb1 is required for proper temporal dynamics of IEG expression. Based on these findings, we propose that Satb1 plays a critical role in cortical neurons to facilitate neuronal plasticity. PMID:22064485

  2. Gene deletion strategy to examine the involvement of the two chondroitin lyases in Flavobacterium columnare virulence.

    PubMed

    Li, Nan; Qin, Ting; Zhang, Xiao Lin; Huang, Bei; Liu, Zhi Xin; Xie, Hai Xia; Zhang, Jin; McBride, Mark J; Nie, Pin

    2015-11-01

    Flavobacterium columnare is an important bacterial pathogen of freshwater fish that causes high mortality of infected fish and heavy economic losses in aquaculture. The pathogenesis of this bacterium is poorly understood, in part due to the lack of efficient methods for genetic manipulation. In this study, a gene deletion strategy was developed and used to determine the relationship between the production of chondroitin lyases and virulence. The F. johnsoniae ompA promoter (PompA) was fused to sacB to construct a counterselectable marker for F. columnare. F. columnare carrying PompA-sacB failed to grow on media containing 10% sucrose. A suicide vector carrying PompA-sacB was constructed, and a gene deletion strategy was developed. Using this approach, the chondroitin lyase-encoding genes, cslA and cslB, were deleted. The ΔcslA and ΔcslB mutants were both partially deficient in digestion of chondroitin sulfate A, whereas a double mutant (ΔcslA ΔcslB) was completely deficient in chondroitin lyase activity. Cells of F. columnare wild-type strain G4 and of the chondroitin lyase-deficient ΔcslA ΔcslB mutant exhibited similar levels of virulence toward grass carp in single-strain infections. Coinfections, however, revealed a competitive advantage for the wild type over the chondroitin lyase mutant. The results indicate that chondroitin lyases are not essential virulence factors of F. columnare but may contribute to the ability of the pathogen to compete and cause disease in natural infections. The gene deletion method developed in this study may be employed to investigate the virulence factors of this bacterium and may have wide application in many other members of the phylum Bacteroidetes.

  3. Gene deletion strategy to examine the involvement of the two chondroitin lyases in Flavobacterium columnare virulence.

    PubMed

    Li, Nan; Qin, Ting; Zhang, Xiao Lin; Huang, Bei; Liu, Zhi Xin; Xie, Hai Xia; Zhang, Jin; McBride, Mark J; Nie, Pin

    2015-11-01

    Flavobacterium columnare is an important bacterial pathogen of freshwater fish that causes high mortality of infected fish and heavy economic losses in aquaculture. The pathogenesis of this bacterium is poorly understood, in part due to the lack of efficient methods for genetic manipulation. In this study, a gene deletion strategy was developed and used to determine the relationship between the production of chondroitin lyases and virulence. The F. johnsoniae ompA promoter (PompA) was fused to sacB to construct a counterselectable marker for F. columnare. F. columnare carrying PompA-sacB failed to grow on media containing 10% sucrose. A suicide vector carrying PompA-sacB was constructed, and a gene deletion strategy was developed. Using this approach, the chondroitin lyase-encoding genes, cslA and cslB, were deleted. The ΔcslA and ΔcslB mutants were both partially deficient in digestion of chondroitin sulfate A, whereas a double mutant (ΔcslA ΔcslB) was completely deficient in chondroitin lyase activity. Cells of F. columnare wild-type strain G4 and of the chondroitin lyase-deficient ΔcslA ΔcslB mutant exhibited similar levels of virulence toward grass carp in single-strain infections. Coinfections, however, revealed a competitive advantage for the wild type over the chondroitin lyase mutant. The results indicate that chondroitin lyases are not essential virulence factors of F. columnare but may contribute to the ability of the pathogen to compete and cause disease in natural infections. The gene deletion method developed in this study may be employed to investigate the virulence factors of this bacterium and may have wide application in many other members of the phylum Bacteroidetes. PMID:26253667

  4. Alarm pheromone induces immediate-early gene expression and slow behavioral response in honey bees.

    PubMed

    Alaux, Cédric; Robinson, Gene E

    2007-07-01

    Primer and releaser pheromones are molecules used for communication that induce species-specific responses. In contrast to primer pheromones, it is not known whether the quicker-acting releaser pheromones can affect brain gene expression. We show here that isopentyl acetate (IPA), a releaser pheromone that communicates alarm in honey bees, not only provokes a quick defensive response but also influences behavior for a longer period of time and affects brain gene expression. Exposure to IPA affected behavioral responsiveness to subsequent exposures to IPA and induced the expression of the immediate early gene and transcription factor c-Jun in the antennal lobes. Our findings blur the long-standing distinction between primer and releaser pheromone and highlight the pervasiveness of environmental regulation of brain gene expression. PMID:17505874

  5. Central Renin Injections: Effects on Drinking and Expression of Immediate Early Genes

    NASA Technical Reports Server (NTRS)

    Xu, Zhice; Johnson, Alan Kim

    1998-01-01

    This study investigated the drinking response and the expression of Fos- and Egr-1-immunoreactivity (Fos-ir, Egr-1-ir) in the brain induced by endogenous angiotensin generated by intracerebroventricular (i.c.v.) injection of renin. Renin induced Fos-ir in the subformical organ (SFO), median preoptic (MnPO), supraoptic and paraventricular nuclei (SON and PVN), area postrema (AP), nuclei of the solitary tract (NTS) and lateral parabrachial nuclei (LPBN). Renin-induced Egr-1-ir exhibited a similar pattern of distribution as that observed for Fos-ir. The dose of i.c.v. renin that induced expression of immediate early gene (IEG) product immunoreactivity also produced vigorous drinking. When renin-injected rats were pretreated with captopril, an angiotensin converting enzyme inhibitor, drinking was blocked. With the same captopril pretreatment, both Fos- and Egr-1-ir in the SFO, MnPO, SON, PVN, AP and LPBN were also significantly reduced.

  6. Inositol polyphosphate multikinase is a transcriptional coactivator required for immediate early gene induction.

    PubMed

    Xu, Risheng; Paul, Bindu D; Smith, Dani R; Tyagi, Richa; Rao, Feng; Khan, A Basit; Blech, Daniel J; Vandiver, M Scott; Harraz, Maged M; Guha, Prasun; Ahmed, Ishrat; Sen, Nilkantha; Gallagher, Michela; Snyder, Solomon H

    2013-10-01

    Profound induction of immediate early genes (IEGs) by neural activation is a critical determinant for plasticity in the brain, but intervening molecular signals are not well characterized. We demonstrate that inositol polyphosphate multikinase (IPMK) acts noncatalytically as a transcriptional coactivator to mediate induction of numerous IEGs. IEG induction by electroconvulsive stimulation is virtually abolished in the brains of IPMK-deleted mice, which also display deficits in spatial memory. Neural activity stimulates binding of IPMK to the histone acetyltransferase CBP and enhances its recruitment to IEG promoters. Interestingly, IPMK regulation of CBP recruitment and IEG induction does not require its catalytic activities. Dominant-negative constructs, which prevent IPMK-CBP binding, substantially decrease IEG induction. As IPMK is ubiquitously expressed, its epigenetic regulation of IEGs may influence diverse nonneural and neural biologic processes.

  7. Nrf2 gene deletion fails to alter psychostimulant-induced behavior or neurotoxicity.

    PubMed

    Pacchioni, Alejandra M; Vallone, Joseph; Melendez, Roberto I; Shih, Andy; Murphy, Timothy H; Kalivas, Peter W

    2007-01-01

    The transcription factor NF-E2-related factor (Nrf2) regulates the induction of phase 2 detoxifying enzymes by oxidative stress, including synthesis of the catalytic subunit (xCT) of the heterodimeric cystine-glutamate exchanger (system xc-). Repeated cocaine treatment in rats causes persistent neuroadaptations in glutamate neurotransmission in the nucleus accumbens that result, in part, from reduced activity of system xc-. Since in vitro under- or over-expression of Nrf2 regulates system xc- activity and xCT content, it was hypothesized that in vivo deletion of the Nrf2 gene would: 1) decrease system xc- activity, 2) produce a behavioral phenotype resembling that elicited by chronic cocaine administration, and 3) enhance dopamine depletion after methamphetamine-induced oxidative stress. In all three experiments no genotypic difference was measured between mice sustaining homozygous Nrf2 gene deletion and wild-type littermates. Thus, while Nrf2 is a transcriptional regulator of xCT and capable of protecting cells from oxidative stress, following Nrf2 gene deletion this role can be partially compensated by other mechanisms and methamphetamine-induced oxidative stress and dopamine toxicity does not significantly involve Nrf2.

  8. Generation of stable mutants and targeted gene deletion strains in Cryptococcus neoformans through electroporation.

    PubMed

    Lin, Xiaorong; Chacko, Nadia; Wang, Linqi; Pavuluri, Yashwant

    2015-04-01

    Cryptococcus neoformans is the etiologic agent of cryptococcal meningitis that causes more than half a million deaths worldwide each year. This capsulated basidiomycetous yeast also serves as a model for micropathogenic studies. The ability to make stable mutants, either via ectopic integration or homologous recombination, has been accomplished using biolistic transformation. This technical advance has greatly facilitated the research on the basic biology and pathogenic mechanisms of this pathogen in the past two decades. However, biolistic transformation is costly, and its reproducibility varies widely. Here we found that stable ectopic integration or targeted gene deletion via homologous replacement could be accomplished through electroporative transformation. The stability of the transformants obtained through electroporation and the frequency of homologous replacement is highly dependent on the selective marker. A frequency of homologous recombination among the stable transformants obtained by electroporation is comparable to those obtained by biolistic transformation (∼10%) when dominant drug selection markers are used, which is much higher than what has been previously reported for electroporation when auxotrophic markers were used (0.001% to 0.1%). Furthermore, disruption of the KU80 gene or generation of gene deletion constructs using the split marker strategy, two approaches known to increase homologous replacement among transformants obtained through biolistic transformation, also increase the frequency of homologous replacement among transformants obtained through electroporation. Therefore, electroporation provides a low cost alternative for mutagenesis in Cryptococcus.

  9. Rb and p53 gene deletions in lung adenocarcinomas from irradiated and control mice

    SciTech Connect

    Zhang, Y.; Woloschak, G.E.

    1997-08-01

    This study was conducted on mouse lung adenocarcinoma tissues that were formalin-treated and paraffin-embedded 25 years ago to investigate the large gene deletions of mRb and p53 in B6CF{sub 1} male mice. A total of 80 lung tissue samples from irradiated mice and 40 lung samples from nonirradiated controls were randomly selected and examined in the mRb portion of this study. The results showed a significant (P < 0.05) higher percentage of mRb deletions in lung adenocarcinomas from mice exposed to 60 once-weekly {gamma}-ray doses than those from mice receiving 24 once-weekly {gamma}-ray doses at low doses and low dose rates; however, the percentage was not significantly different (P > 0.05) from that for spontaneous lung adenocarcinomas or lung adenocarcinomas from mice exposed to single-dose {gamma} irradiation at a similar total dose. mRb fragments 3 (71%) and 5 (67%), the parts of the gene that encoded the pocket binding region of Rb protein to adenovirus E1A and SV40 T-antigen, were the most frequently deleted fragments. p53 gene deletion analysis was carried out on normal lungs and lung adenocarcinomas that were initially found to bear mRb deletions. Exons 1,4,5,6, and 9 were chosen to be analyzed.

  10. Specific interactions between transcription factors and the promoter-regulatory region of the human cytomegalovirus major immediate-early gene

    SciTech Connect

    Ghazal, P.; Lubon, H.; Hennighausen, L. )

    1988-03-01

    Repeat sequence motifs as well as unique sequences between nucleotides {minus}150 and {minus}22 of the human cytomegalovirus immediate-early 1 gene interact in vitro with nuclear proteins. The authors show that a transcriptional element between nucleotides {minus}91 and {minus}65 stimulated promoter activity in vivo and in vitro by binding specific cellular transcription factors. Finally, a common sequence motif, (T)TGG/AC, present in 15 of the determined binding sites suggests a particular class of nuclear factors associated with the immediate-early 1 gene.

  11. Cell-specific activity of the modulator region in the human cytomegalovirus major immediate-early gene

    SciTech Connect

    Lubon, H.K.; Hennighausen, L. ); Ghazal, P.; Reynolds-Kohler, C.; Lockshin, C.; Nelson, J. )

    1989-03-01

    In this paper the authors demonstrate that modular sequences upstream of the enhancer of the major immediate-early promoter of human cytomegalovirus exert a differential effort on the level of transcription in a variety of cells and that this region has the capacity to interact with specific nuclear protein. Depending on the cell type, these modulator sequences increased or decreased transcriptional activation from the IE1 gene promoter-enhancer. The cell lines identified in this report should be useful to study the molecular mechanism of cell-specific transcriptional repression and activation exerted by the major immediate-early promoter upstream region.

  12. Chronic granulomatous disease, the McLeod phenotype and the contiguous gene deletion syndrome-a review

    PubMed Central

    2011-01-01

    Chronic Granulomatous Disease (CGD), a disorder of the NADPH oxidase system, results in phagocyte functional defects and subsequent infections with bacterial and fungal pathogens (such as Aspergillus species and Candida albicans). Deletions and missense, frameshift, or nonsense mutations in the gp91phox gene (also termed CYBB), located in the Xp21.1 region of the X chromosome, are associated with the most common form of CGD. When larger X-chromosomal deletions occur, including the XK gene deletion, a so-called "Contiguous Gene Deletion Syndrome" may result. The contiguous gene deletion syndrome is known to associate the Kell phenotype/McLeod syndrome with diseases such as X-linked chronic granulomatous disease, Duchenne muscular dystrophy, and X-linked retinitis pigmentosa. These patients are often complicated and management requires special attention to the various facets of the syndrome. PMID:22111908

  13. The pseudorabies immediate early protein stimulates in vitro transcription by facilitating TFIID: promoter interactions.

    PubMed

    Abmayr, S M; Workman, J L; Roeder, R G

    1988-05-01

    The pseudorabies virus immediate early (IE) protein, partially purified from infected HeLa cells, stimulated transcription initiation by RNA polymerase II and associated factors in HeLa nuclear extracts. This stimulation was maximal at low template concentrations, where the basal level of transcription was also low. In an analysis of the limitations on transcription under these conditions, it was found that transcription could be increased drastically not only by IE addition but also by (1) the addition of nonpromoter-containing DNA, which titrated nonspecific DNA-binding proteins in the crude nuclear extract, and (2) preincubation of the template with either the nuclear extract (in the absence of Mg2+) or with the TATA box-binding factor, TFIID. These results suggest that in the absence of IE, nonspecific DNA-binding proteins competed with TFIID for binding to the promoter, thus making TFIID: promoter interactions limiting for transcription. The stimulation of transcription effected by IE was essentially the same as that observed following preassociation of TFIID with the template or by titration of nonspecific DNA-binding proteins. Moreover, the presence of IE under the latter conditions did not stimulate transcription further. These observations strongly suggest that all of these manipulations affected the same limiting step and, thus, that IE accentuated the rate or extent of formation of a preinitiation complex involving the TATA factor, rather than subsequent initiation or elongation steps.

  14. Role of Immediate-Early Genes in Synaptic Plasticity and Neuronal Ensembles Underlying the Memory Trace

    PubMed Central

    Minatohara, Keiichiro; Akiyoshi, Mika; Okuno, Hiroyuki

    2016-01-01

    In the brain, neuronal gene expression is dynamically changed in response to neuronal activity. In particular, the expression of immediate-early genes (IEGs) such as egr-1, c-fos, and Arc is rapidly and selectively upregulated in subsets of neurons in specific brain regions associated with learning and memory formation. IEG expression has therefore been widely used as a molecular marker for neuronal populations that undergo plastic changes underlying formation of long-term memory. In recent years, optogenetic and pharmacogenetic studies of neurons expressing c-fos or Arc have revealed that, during learning, IEG-positive neurons encode and store information that is required for memory recall, suggesting that they may be involved in formation of the memory trace. However, despite accumulating evidence for the role of IEGs in synaptic plasticity, the molecular and cellular mechanisms associated with this process remain unclear. In this review, we first summarize recent literature concerning the role of IEG-expressing neuronal ensembles in organizing the memory trace. We then focus on the physiological significance of IEGs, especially Arc, in synaptic plasticity, and describe our hypotheses about the importance of Arc expression in various types of input-specific circuit reorganization. Finally, we offer perspectives on Arc function that would unveil the role of IEG-expressing neurons in the formation of memory traces in the hippocampus and other brain areas. PMID:26778955

  15. Expression of immediate-early genes in the dorsal cochlear nucleus in salicylate-induced tinnitus.

    PubMed

    Hu, Shou-Sen; Mei, Ling; Chen, Jian-Yong; Huang, Zhi-Wu; Wu, Hao

    2016-02-01

    Spontaneous neuronal activity in dorsal cochlear nucleus (DCN) may be involved in the physiological processes underlying salicylate-induced tinnitus. As a neuronal activity marker, immediate-early gene (IEG) expression, especially activity-dependent cytoskeletal protein (Arc/Arg3.1) and the early growth response gene-1 (Egr-1), appears to be highly correlated with sensory-evoked neuronal activity. However, their relationships with tinnitus induced by salicylate have rarely been reported in the DCN. In this study, we assessed the effect of acute and chronic salicylate treatment on the expression of N-methyl D-aspartate receptor subunit 2B (NR2B), Arg3.1, and Egr-1. We also observed ultrastructural alterations in the DCN synapses in an animal model of tinnitus. Levels of mRNA and protein expression of NR2B and Arg3.1 were increased in rats that were chronically administered salicylate (200 mg/kg, twice daily for 3, 7, or 14 days). These levels returned to baseline 14 days after cessation of treatment. However, no significant changes were observed in Egr-1 gene expression in any groups. Furthermore, rats subjected to long-term salicylate administration showed more presynaptic vesicles, thicker and longer postsynaptic densities, and increased synaptic interface curvature. Alterations of Arg3.1 and NR2B may be responsible for the changes in the synaptic ultrastructure. These changes confirm that salicylate can cause neural plasticity changes at the DCN level. PMID:25636249

  16. Salicylate-induced changes in immediate-early genes in the hippocampal CA1 area.

    PubMed

    Wu, Hao; Xu, Feng-Lei; Yin, Yong; Da, Peng; You, Xiao-Dong; Xu, Hui-Min; Tang, Yan

    2015-08-01

    Studies have suggested that salicylate affects neuronal function via interactions with specific membrane channels/receptors. However, the effect of salicylate on activity and synaptic morphology of the hippocampal Cornu Ammonis (CA) 1 area remains to be elucidated. The activation of immediate-early genes (IEGs) was reported to correlate with neuronal activity, in particular activity-regulated cytoskeleton-associated protein and early growth response gene 1. The aim of the present study was to evaluate the expression of these IEGs, as well that of N-methyl D-aspartate (NMDA) receptor subunit 2B in rats following acute and chronic salicylate treatment. Protein and messenger RNA levels of all three genes were increased in rats following chronic administration of salicylate (300 mg/kg for 10 days), returning to baseline levels 14 days post-cessation of treatment. The transient upregulation of gene expression following treatment was accompanied by ultrastructural alterations in hippocampal CA1 area synapses. An increase in synaptic interface curvature was observed as well as an increased number of presynaptic vesicles; in addition, postsynaptic densities thickened and lengthened. In conclusion, the results of the present study indicated that chronic exposure to salicylate may lead to structural alteration of hippocampal CA1 neurons, and it was suggested that this process occurs through induced expression of IEGs via NMDA receptor activation. PMID:25873216

  17. Measurement of immediate-early gene activation- c-fos and beyond.

    PubMed

    Kovács, K J

    2008-06-01

    Immediate-early genes (IEG) are powerful tools for identifying activated neurosecretory neurones and extended circuits that affect neuroendocrine functions. The generally acknowledged scenario is when cells became activated, IEGs expressed and IEG-encoded transcription factors affect target gene expression. However, there are several examples in which: (i) neuronal activation occurs without induction of IEGs; (ii) IEG induction is not related to challenge-induced neuropeptide expression; and (iii) markers of neuronal activation are not expressed in chronically activated neurones. In spite of these limitations, the use of c-Fos and other regulatory- or effector transcription factors as markers of neuronal activation will continue to be an extremely powerful technique. Recently-developed models, including transgenic mice expressing different marker genes under the regulation of IEG promoters, will help to monitor neuronal activity in vivo or ex vivo and to reveal connection between activated neurones. Furthermore, combinations between novel imaging techniques, such as magnetic resonance and IEG-based mapping strategies, will open new means with which to study functional activity in the neurosecretory systems.

  18. Modeling the Kinetics of a Memory-Associated Immediate Early Gene's Compartmental Expression After Sensory Experience

    NASA Astrophysics Data System (ADS)

    Willats, Adam; Ivanova, Tamara; Prinz, Astrid; Liu, Robert

    2015-03-01

    Immediate Early Genes (IEGs) are rapidly and transiently transcribed in neurons after a sensory experience. Some of these genes act as effector IEGs, which mediate specific effects on cellular function. Arc is one such effector IEG that is essential for synaptic plasticity and memory consolidation in hippocampus and cortex. The expression of Arc in neurons has previously been examined using an imaging method known as Compartmental Analysis of Temporal Fluorescent In-Situ Hybridization. Previous work found that the time course of Arc expression within the nuclear and perinuclear cytoplasmic compartments of a neuron is altered by prior sensory experience. We explore a simple model of the kinetics of IEG transcription and nuclear export, with the aim of eventually uncovering possible mechanisms for how experience alters expression kinetics. Thus far, we characterize our compartmental model using phase-plane analysis and validate it against several IEG expression data sets, including one where prior experience with vocalizing mice alters the time course of call-induced Arc expression in the auditory cortex of a listening mouse. Our model provides a framework to explore why Arc expression may change depending on a receiver's past sound experience and internal state. Adam Willats was supported by NIH Training Grant 5T90DA032466. This research was also supported by NIDCD R01 DC8343.

  19. Role of Immediate-Early Genes in Synaptic Plasticity and Neuronal Ensembles Underlying the Memory Trace.

    PubMed

    Minatohara, Keiichiro; Akiyoshi, Mika; Okuno, Hiroyuki

    2015-01-01

    In the brain, neuronal gene expression is dynamically changed in response to neuronal activity. In particular, the expression of immediate-early genes (IEGs) such as egr-1, c-fos, and Arc is rapidly and selectively upregulated in subsets of neurons in specific brain regions associated with learning and memory formation. IEG expression has therefore been widely used as a molecular marker for neuronal populations that undergo plastic changes underlying formation of long-term memory. In recent years, optogenetic and pharmacogenetic studies of neurons expressing c-fos or Arc have revealed that, during learning, IEG-positive neurons encode and store information that is required for memory recall, suggesting that they may be involved in formation of the memory trace. However, despite accumulating evidence for the role of IEGs in synaptic plasticity, the molecular and cellular mechanisms associated with this process remain unclear. In this review, we first summarize recent literature concerning the role of IEG-expressing neuronal ensembles in organizing the memory trace. We then focus on the physiological significance of IEGs, especially Arc, in synaptic plasticity, and describe our hypotheses about the importance of Arc expression in various types of input-specific circuit reorganization. Finally, we offer perspectives on Arc function that would unveil the role of IEG-expressing neurons in the formation of memory traces in the hippocampus and other brain areas. PMID:26778955

  20. Salicylate-induced changes in immediate-early genes in the hippocampal CA1 area

    PubMed Central

    WU, HAO; XU, FENG-LEI; YIN, YONG; DA, PENG; YOU, XIAO-DONG; XU, HUI-MIN; TANG, YAN

    2015-01-01

    Studies have suggested that salicylate affects neuronal function via interactions with specific membrane channels/receptors. However, the effect of salicylate on activity and synaptic morphology of the hippocampal Cornu Ammonis (CA) 1 area remains to be elucidated. The activation of immediate-early genes (IEGs) was reported to correlate with neuronal activity, in particular activity-regulated cytoskeleton-associated protein and early growth response gene 1. The aim of the present study was to evaluate the expression of these IEGs, as well that of N-methyl D-aspartate (NMDA) receptor subunit 2B in rats following acute and chronic salicylate treatment. Protein and messenger RNA levels of all three genes were increased in rats following chronic administration of salicylate (300 mg/kg for 10 days), returning to baseline levels 14 days post-cessation of treatment. The transient upregulation of gene expression following treatment was accompanied by ultrastructural alterations in hippocampal CA1 area synapses. An increase in synaptic interface curvature was observed as well as an increased number of presynaptic vesicles; in addition, postsynaptic densities thickened and lengthened. In conclusion, the results of the present study indicated that chronic exposure to salicylate may lead to structural alteration of hippocampal CA1 neurons, and it was suggested that this process occurs through induced expression of IEGs via NMDA receptor activation. PMID:25873216

  1. Soluble epoxide hydrolase gene deletion improves blood flow and reduces infarct size after cerebral ischemia in reproductively senescent female mice

    PubMed Central

    Zuloaga, Kristen L.; Zhang, Wenri; Roese, Natalie E.; Alkayed, Nabil J.

    2015-01-01

    Soluble epoxide hydrolase (sEH), a key enzyme in the metabolism of vasodilatory epoxyeicosatrienoic acids (EETs), is sexually dimorphic, suppressed by estrogen, and contributes to underlying sex differences in cerebral blood flow and injury after cerebral ischemia. We tested the hypothesis that sEH inhibition or gene deletion in reproductively senescent (RS) female mice would increase cerebral perfusion and decrease infarct size following stroke. RS (15–18 month old) and young (3–4 month old) female sEH knockout (sEHKO) mice and wild type (WT) mice were subjected to 45 min middle cerebral artery occlusion (MCAO) with laser Doppler perfusion monitoring. WT mice were treated with vehicle or a sEH inhibitor t-AUCB at the time of reperfusion and every 24 h thereafter for 3 days. Differences in regional cerebral blood flow were measured in vivo using optical microangiography (OMAG). Infarct size was measured 3 days after reperfusion. Infarct size and cerebral perfusion 24 h after MCAO were not altered by age. Both sEH gene deletion and sEH inhibition increased cortical perfusion 24 h after MCAO. Neither sEH gene deletion nor sEH inhibition reduced infarct size in young mice. However, sEH gene deletion, but not sEH inhibition of the hydrolase domain of the enzyme, decreased infarct size in RS mice. Results of these studies show that sEH gene deletion and sEH inhibition enhance cortical perfusion following MCAO and sEH gene deletion reduces damage after ischemia in RS female mice; however this neuroprotection in absent is young mice. PMID:25642188

  2. Expression of the Immediate-Early Gene-Encoded Protein Egr-1 ("zif268") during in Vitro Classical Conditioning

    ERIC Educational Resources Information Center

    Mokin, Maxim; Keifer, Joyce

    2005-01-01

    Expression of the immediate-early genes (IEGs) has been shown to be induced by activity-dependent synaptic plasticity or behavioral training and is thought to play an important role in long-term memory. In the present study, we examined the induction and expression of the IEG-encoded protein Egr-1 during an in vitro neural correlate of eyeblink…

  3. A Form of Perforant Path LTP Can Occur without ERK1/2 Phosphorylation or Immediate Early Gene Induction

    ERIC Educational Resources Information Center

    Steward, Oswald; Huang, Fen; Guzowski, John F.

    2007-01-01

    Stimulation paradigms that induce perforant path long-term potentiation (LTP) initiate phosphorylation of ERK1/2 and induce expression of a variety of immediate early genes (IEGs). These events are thought to be critical components of the mechanism for establishing the changes in synaptic efficacy that endure for hours or longer. Here we show that…

  4. Immediate-early gene region of human cytomegalovirus trans-activates the promoter of human immunodeficiency virus

    SciTech Connect

    Davis, M.G.; Kenney, S.C.; Kamine, J.; Pagano, J.S.; Huang, E.S.

    1987-12-01

    Almost all homosexual patients with acquired immunodeficiency syndrome are also actively infected with human cytomegalovirus (HCMV). The authors have hypothesized that an interaction between HCMV and human immunodeficiency virus (HIV), the agent that causes acquired immunodeficiency syndrome, may exist at a molecular level and contribute to the manifestations of HIV infection. In this report, they demonstrate that the immediate-early gene region of HCMV, in particular immediate-early region 2, trans-activates the expression of the bacterial gene chloramphenicol acetyltransferase that is fused to the HIV long terminal repeat and carried by plasmid pHIV-CAT. The HCMV immediate-early trans-activator increases the level of mRNA from the plamid pHIV-CAT. The sequences of HIV that are responsive to trans-activation by the HDMV immediate-early region are distinct from HIV sequences that are required for response to the HIV tat. The stimulation of HIV gene expression by HDMV gene functions could enhance the consequences of HIV infection in persons with previous or concurrent HCMV infection.

  5. Novel heterozygous OTX2 mutations and whole gene deletions in anophthalmia, microphthalmia and coloboma.

    PubMed

    Wyatt, Alexander; Bakrania, Preeti; Bunyan, David J; Osborne, Robert J; Crolla, John A; Salt, Alison; Ayuso, Carmen; Newbury-Ecob, Ruth; Abou-Rayyah, Y; Collin, J Richard O; Robinson, David; Ragge, Nicola

    2008-11-01

    Severe ocular malformations, including anophthalmia-microphthalmia (AM), are responsible for around 25% of severe visual impairment in childhood. Recurrent interstitial deletions of 14q22-23 are associated with AM and a wide range of extra-ocular phenotypes including brain anomalies. The homeobox gene OTX2 is located at 14q22.3 and has recently been identified as mutated in AM patients. Eight human OTX2 mutations have been reported in subjects with severe eye malformations, including AM, and variable developmental delay. We screened a novel AM cohort for mutations and deletions in OTX2, and identified four new mutations in six individuals and two cases of whole gene deletions. Our data suggest that OTX2 mutations and deletions account for 2-3% of AM cases.

  6. Genome-scale genetic screen of lead ion-sensitive gene deletion mutations in Saccharomyces cerevisiae.

    PubMed

    Du, J; Cao, C; Jiang, L

    2015-06-01

    Pb (lead) is one of the most widespread and toxic heavy metal contaminants and imposes potential harm to human health. Pb ions cause cellular damage and induce loss of cell viability. However, mechanisms regulating Pb toxicity remain poorly understood. Through a genome-scale screen, we have identified 30 yeast single-gene deletion mutants that are sensitive to lead ions. These genes are involved in the metabolism, transcription, protein synthesis, cell cycle and DNA processing, protein folding, modification, destination, as well as cellular transport process. Comparative analyses to cadmium-sensitive mutations identified from previous studies indicate that overlapping genes of lead- and cadmium-sensitive mutations are involved in both the metabolism and the cellular transport process. Furthermore, eleven lead-sensitive mutants show elevated levels of lead contents in response to lead stress. Our findings provide a basis to understand molecular mechanisms underlying the detoxification of lead ions by yeast cells.

  7. Two Italian families with ITPR1 gene deletion presenting a broader phenotype of SCA15.

    PubMed

    Di Gregorio, Eleonora; Orsi, Laura; Godani, Massimiliano; Vaula, Giovanna; Jensen, Stella; Salmon, Eric; Ferrari, Giancarlo; Squadrone, Stefania; Abete, Maria Cesarina; Cagnoli, Claudia; Brussino, Alessandro; Brusco, Alfredo

    2010-03-01

    Spinocerebellar ataxia type15 (SCA15) is a pure ataxia characterized by very slow progression. Only seven families have been identified worldwide, in which partial deletions and a missense mutation of the inositol triphosphate receptor type I gene (ITPR1) have been reported. We examined a four-generation Italian family segregating an autosomal dominant cerebellar ataxia, in which linkage analysis was positive for the SCA15 locus. We performed a genomic real-time polymerase chain reaction to search for ITPR1 gene deletions in this family and in 60 SCA index cases negative for mutations in the SCA1-3, 6-8, 10, 12,and dentatorubral-pallidoluysian atrophy genes. The deleted segments were characterized using a custom array comparative genomic hybridization analysis. We have identified two families with an ITPR1 gene deletion: in one, the deletion involved ITPR1 only, while in the other both sulfatase-modifying factor 1 and ITPR1. Clinical data of ten patients and brain MRI (available for six) showed that the phenotype substantially overlapped known SCA15 cases,but we also noted buccolingual dyskinesias, facial myokymias,and pyramidal signs never reported in SCA15. ITPR1 expression analysis of two deleted cases showed a half dose. Our results further support ITPR1 gene as causative of SCA15. The families reported show that SCA15 is present in Italy and has a greater variability in the age at onset and clinical features than previously reported. We propose that the search for ITPR1 deletions is mandatory in the clinical hypothesis of SCA15 and that ITPR1-reduced expression in blood may be a useful marker to identify SCA15 patients harboring genomic deletions and possibly point mutations causing reduction of mRNA level.

  8. Candida albicans Gene Deletion with a Transient CRISPR-Cas9 System.

    PubMed

    Min, Kyunghun; Ichikawa, Yuichi; Woolford, Carol A; Mitchell, Aaron P

    2016-01-01

    Clustered regularly interspaced short palindromic repeat (CRISPR) and CRISPR-associated gene 9 (CRISPR-Cas9) systems are used for a wide array of genome-editing applications in organisms ranging from fungi to plants and animals. Recently, a CRISPR-Cas9 system has been developed for the diploid fungal pathogen Candida albicans; the system accelerates genetic manipulation dramatically [V. K. Vyas, M. I. Barrasa, and G. R. Fink, Sci Adv 1(3):e1500248, 2015, http://dx.doi.org/10.1126/sciadv.1500248]. We show here that the CRISPR-Cas9 genetic elements can function transiently, without stable integration into the genome, to enable the introduction of a gene deletion construct. We describe a transient CRISPR-Cas9 system for efficient gene deletion in C. albicans. Our observations suggest that there are two mechanisms that lead to homozygous deletions: (i) independent recombination of transforming DNA into each allele and (ii) recombination of transforming DNA into one allele, followed by gene conversion of the second allele. Our approach will streamline gene function analysis in C. albicans, and our results indicate that DNA can function transiently after transformation of this organism. IMPORTANCE The fungus Candida albicans is a major pathogen. Genetic analysis of this organism has revealed determinants of pathogenicity, drug resistance, and other unique biological features, as well as the identities of prospective drug targets. The creation of targeted mutations has been greatly accelerated recently through the implementation of CRISPR genome-editing technology by Vyas et al. [Sci Adv 1(3):e1500248, 2015, http://dx.doi.org/10.1126/sciadv.1500248]. In this study, we find that CRISPR elements can be expressed from genes that are present only transiently, and we develop a transient CRISPR system that further accelerates C. albicans genetic manipulation.

  9. Candida albicans Gene Deletion with a Transient CRISPR-Cas9 System.

    PubMed

    Min, Kyunghun; Ichikawa, Yuichi; Woolford, Carol A; Mitchell, Aaron P

    2016-01-01

    Clustered regularly interspaced short palindromic repeat (CRISPR) and CRISPR-associated gene 9 (CRISPR-Cas9) systems are used for a wide array of genome-editing applications in organisms ranging from fungi to plants and animals. Recently, a CRISPR-Cas9 system has been developed for the diploid fungal pathogen Candida albicans; the system accelerates genetic manipulation dramatically [V. K. Vyas, M. I. Barrasa, and G. R. Fink, Sci Adv 1(3):e1500248, 2015, http://dx.doi.org/10.1126/sciadv.1500248]. We show here that the CRISPR-Cas9 genetic elements can function transiently, without stable integration into the genome, to enable the introduction of a gene deletion construct. We describe a transient CRISPR-Cas9 system for efficient gene deletion in C. albicans. Our observations suggest that there are two mechanisms that lead to homozygous deletions: (i) independent recombination of transforming DNA into each allele and (ii) recombination of transforming DNA into one allele, followed by gene conversion of the second allele. Our approach will streamline gene function analysis in C. albicans, and our results indicate that DNA can function transiently after transformation of this organism. IMPORTANCE The fungus Candida albicans is a major pathogen. Genetic analysis of this organism has revealed determinants of pathogenicity, drug resistance, and other unique biological features, as well as the identities of prospective drug targets. The creation of targeted mutations has been greatly accelerated recently through the implementation of CRISPR genome-editing technology by Vyas et al. [Sci Adv 1(3):e1500248, 2015, http://dx.doi.org/10.1126/sciadv.1500248]. In this study, we find that CRISPR elements can be expressed from genes that are present only transiently, and we develop a transient CRISPR system that further accelerates C. albicans genetic manipulation. PMID:27340698

  10. A Genetic Screen for Fission Yeast Gene Deletion Mutants Exhibiting Hypersensitivity to Latrunculin A

    PubMed Central

    Asadi, Farzad; Michalski, Dorothy; Karagiannis, Jim

    2016-01-01

    Fission yeast cells treated with low doses of the actin depolymerizing drug, latrunculin A (LatA), delay entry into mitosis via a mechanism that is dependent on both the Clp1p and Rad24p proteins. During this delay, cells remain in a cytokinesis-competent state that is characterized by continuous repair and/or reestablishment of the actomyosin ring. In this manner, cells ensure the faithful completion of the preceding cytokinesis in response to perturbation of the cell division machinery. To uncover other genes with a role in this response, or simply genes with roles in adapting to LatA-induced stress, we carried out a genome-wide screen and identified a group of 38 gene deletion mutants that are hyper-sensitive to the drug. As expected, we found genes affecting cytokinesis and/or the actin cytoskeleton within this set (ain1, acp2, imp2). We also identified genes with roles in histone modification (tra1, ngg1), intracellular transport (apl5, aps3), and glucose-mediated signaling (git3, git5, git11, pka1, cgs2). Importantly, while the identified gene deletion mutants are prone to cytokinesis failure in the presence of LatA, they are nevertheless fully capable of cell division in the absence of the drug. These results indicate that fission yeast cells make use of a diverse set of regulatory modules to counter abnormal cytoskeletal perturbations, and furthermore, that these modules act redundantly to ensure cell survival and proliferation. PMID:27466272

  11. Identification of ocular dominance domains in New World owl monkeys by immediate-early gene expression.

    PubMed

    Takahata, Toru; Miyashita, Masanobu; Tanaka, Shigeru; Kaas, Jon H

    2014-03-18

    Ocular dominance columns (ODCs) have been well studied in the striate cortex (V1) of macaques, as well defined arrays of columnar structure that receive inputs from one eye or the other, whereas ODC expression seems more obscure in some New World primate species. ODCs have been identified by means of eye injections of transneuronal transporters and examination of cytochrome oxidase (CO) activity patterns after monocular enucleation. More recently, live-imaging techniques have been used to reveal ODCs. Here, we used the expression of immediate-early genes (IEGs), protooncogene, c-Fos, and zinc finger protein, Zif268, after monocular inactivation (MI) to identify ODCs in V1 of New World owl monkeys. Because IEG expression is more sensitive to activity changes than CO expression, it is capable of revealing activity maps in all layers throughout V1 and demonstrating brief activity changes within a couple of hours. Using IEGs, we not only revealed apparent ODCs in owl monkeys but also discovered a number of unique features of their ODCs. Distinct from those in macaques, these ODCs sometimes bridged to other columns in layer 4 (Brodmann layer 4C). CO blobs straddled ODC borders in the central visual field, whereas they centered ODC patches in the peripheral visual field. In one case, the ODC pattern continued into V2. Finally, an elevation of IEG expression in layer 4 (4C) was observed along ODC borders after only brief MI. Our data provide insights into the structure and variability of ODCs in primates and revive debate over the functions and development of ODCs.

  12. Amygdala kindling potentiates seizure-stimulated immediate-early gene expression in rat cerebral cortex.

    PubMed

    Duman, R S; Craig, J S; Winston, S M; Deutch, A Y; Hernandez, T D

    1992-11-01

    Kindling induces long-term adaptations in neuronal function that lead to a decreased threshold for induction of seizures. In the present study, the influence of amygdala kindling on levels of mRNA for the immediate-early genes (IEGs) c-fos, c-jun, and NGF1-A were examined both before and after an acute electroconvulsive seizure (ECS). Although amygdala kindling did not significantly influence resting levels of c-fos mRNA in cerebral cortex, ECS-stimulated levels of c-fos mRNA (examined 45 min after ECS) were approximately twofold greater in the cerebral cortex of kindled rats relative to sham-treated controls. The influence of kindling on IEG expression was dependent on the time course of kindling, as ECS-stimulated levels of c-fos mRNA were not significantly increased in stage 2 kindled animals. ECS-stimulated levels of c-jun and NGF1-A mRNA were also significantly increased in cerebral cortex of kindled rats relative to sham-treated controls. The influence of kindling on IEG expression was long-lasting because an acute ECS stimulus significantly elevated levels of c-fos and c-jun mRNA in the cerebral cortex of animals that were kindled 5 months previously. In contrast to these effects in cerebral cortex, kindling did not influence ECS-stimulated levels of c-fos mRNA in hippocampus. Finally, immunohistochemical studies revealed lamina-specific changes in the cerebral cortex.(ABSTRACT TRUNCATED AT 250 WORDS)

  13. A self-excising beta-recombinase/six cassette for repetitive gene deletion and homokaryon purification in Neurospora crassa

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In a previous study we developed a cassette employing a bacterial beta-recombinase acting on six recognition sequences (beta-rec/six), which allowed repetitive site-specific gene deletion and marker recycling in Neurospora crassa. However, only one positive selection marker was used in the cassette...

  14. Structure and transcription of an immediate-early region in the human herpesvirus 6 genome.

    PubMed Central

    Schiewe, U; Neipel, F; Schreiner, D; Fleckenstein, B

    1994-01-01

    The unique segment of the human herpesvirus 6 (HHV-6) genome is essentially collinear to the unique long DNA segment of another betaherpesvirus, the human cytomegalovirus (HCMV). However, the HHV-6 genomic section that is analogous in position to the major immediate-early (IE) locus of HCMV does not exhibit recognizable sequence homologies. The respective HHV-6 region of 5.5 kbp is flanked on one side by 25 to 28 incomplete tandem repeats of 105 to 110 bp that contain, with one exception, a single KpnI restriction site (KpnI repeats). About 250 reiterations of the sequence motif CACATA are located on the other end. We identified two open reading frames of 375 and 2,595 nucleotides, respectively, on one strand. Strand-specific Northern blot analyses with RNA harvested from HHV-6 (strain U1102)-infected HSB-2 cells or cord blood lymphocytes revealed two transcripts of about 3.5 and 4.7 kb in the corresponding orientation. Sequence analyses of the respective cDNA clones and primer extension experiments were used to map the mRNAs. The two transcripts are coterminal and multiply spliced and code for the same putative 104.6-kDa protein, but they are initiated from different promoters. Characterization of smaller cDNA clones and Northern blotting with other strand-specific probes showed that singly spliced mRNAs of 1.0 and 1.5 kb are transcribed from the opposite strand; they could code for a 17.2-kDa polypeptide. Blocking experiments with cycloheximide led to the conclusion that only the 3.5-kb mRNA is synthesized in the absence of protein biosynthesis upon infection with cell-free virus. This identifies a single IE gene of HHV-6 at the genomic position corresponding to the major IE region of HCMV, although the coding content and transcriptional regulation are quite different for these two herpesvirus IE regions. Images PMID:8151768

  15. Impact of UGT2B17 gene deletion on the steroid profile of an athlete.

    PubMed

    Martín-Escudero, Pilar; Muñoz-Guerra, Jesús; Del Prado, Nayade; Galindo Canales, Mercedes; Fuentes Ferrer, Manuel; Vargas, Soledad; Soldevilla, Ana B; Serrano-Garde, Ester; Miguel-Tobal, Francisco; Maestro de Las Casas, Marisa; Fernandez-Pérez, Cristina

    2015-12-01

    The measurement of the testosterone to epitestosterone ratio (T/E ratio) in urine is often used as a marker for testosterone administration in the doping control field. This study examines the frequencies of the different expression forms of the UGT2B17 gene, and assesses their effects on this marker in volunteer subjects. The sample for this descriptive study was composed of male and female athletes aged between 16 and 55 years old who practiced different sports disciplines. All participants underwent a sports-medical physical examination, and subsequently provided 10 urine samples consecutively over a period of 48 h. The dependent variable examined was T/E and the main independent variable was the UGT2B17 gene polymorphism. During 1 year, 1410 urine samples were obtained from 141 athletes. The frequencies of the three genotypes were as follows: wt homozygotes (ins/ins) 48.2% (n = 68), mutant homozygotes (del/del) 12.1% (n = 17), and heterozygotes (ins/del) 39.7% (n = 56). Genotype distributions varied significantly (P < 0.001) according to ethnicity, 80% of Asian subjects being homozygous for the gene deletion (del/del) compared to 6.9% of Caucasian subjects. A multivariate analysis adjusted for genotype, age, sex, and sports discipline revealed that athletes with the del/del polymorphism showed a significantly lower mean T/E than heterozygotes (ins/del). In contrast, homozygous athletes for the gene insertion (ins/ins) showed higher mean T/E ratios than heterozygotes (ins/del). UGT2B17 gene deletion has a strong influence on the T/E ratio in urine, which is the most efficient indicator of testosterone prohormone misuse. Others factors studied seem not to have such an impact. The genotyping of UGT2B17 is an important source of information for understanding steroid profiling in the doping control field; therefore it is suggested that it be included in the Athletes Biological Passport.

  16. The macrophage-colony stimulating factor gene is a growth factor-inducible immediate early gene in fibroblasts.

    PubMed

    Ryseck, R P; Macdonald-Bravo, H; Bravo, R

    1991-02-01

    Polypeptide growth factors rapidly induce the expression of a group of genes during the onset of cell proliferation. We report that one of these genes, which is induced by several mitogens in NIH 3T3 cells, is identical to the gene for macrophage-colony stimulating factor (M-CSF). In contrast to other immediate early genes, the expression of the M-CSF gene lasted for several hours. Run-on assays demonstrated that the increased level of M-CSF mRNA following stimulation was mainly due to transcriptional activation. Our results support the notion that the products of the immediate early genes are not all mediators of fibroblasts growth but that some play an important role in other physiological responses such as wound repair. PMID:1712227

  17. Mouse cytomegalovirus immediate-early protein 1 binds with host cell repressors to relieve suppressive effects on viral transcription and replication during lytic infection.

    PubMed

    Tang, Qiyi; Maul, Gerd G

    2003-01-01

    Herpesviruses start their transcriptional cascade at nuclear domain 10 (ND10). The deposition of virus genomes at these nuclear sites occurs due to the binding of the interferon-inducible repressor protein promyelocytic leukemia protein (PML) and/or Daxx to a viral DNA-protein complex. However, the presence of repressive proteins at the nuclear site of virus transcription has remained unexplained. We investigated the mouse cytomegalovirus (MCMV) immediate-early 1 protein (IE1), which is necessary for productive infection at low multiplicities of infection and therefore likely to be involved in overcoming cellular repression. Temporal analysis of IE1 distribution revealed its initial segregation into ND10 by binding to PML and/or Daxx and IE1-dependent recruitment of the transcriptional repressor histone deacetylase-2 (HDAC-2) to this site. However, these protein aggregates are dissociated in cells producing sufficient IE1 through titration of PML, Daxx, and HDAC-2. Importantly, binding of IE1 to HDAC-2 decreased deacetylation activity. Moreover, inhibition of HDAC by trichostatin-A resulted in an increase in viral protein synthesis, an increase in cells starting the formation of prereplication compartments, and an increase in the total infectious viruses produced. Thus, IE1, like trichostatin-A, reverses the repressive effect of HDAC evident in the presence of acetylated histones in the immediate-early promoter region. Since HDAC also binds to the promoter region of IE1, as determined by the chromatin immunoprecipitation assay, these combined results suggest that IE1 inhibits or reverses HDAC-mediated repression of the infecting viral genomes, possibly by a process akin to activation of heterochromatin. We propose that even permissive cells can repress transcription of infecting viral genomes through repressors, including HDAC, Daxx, and PML, and the segregation of IE1 to ND10 that would inactivate those repressors. The virus can counter this repression by

  18. Protein Kinase Cδ Blocks Immediate-Early Gene Expression in Senescent Cells by Inactivating Serum Response Factor

    PubMed Central

    Wheaton, Keith; Riabowol, Karl

    2004-01-01

    Fibroblasts lose the ability to replicate in response to growth factors and become unable to express growth-associated immediate-early genes, including c-fos and egr-1, as they become senescent. The serum response factor (SRF), a major transcriptional activator of immediate-early gene promoters, loses the ability to bind to the serum response element (SRE) and becomes hyperphosphorylated in senescent cells. We identify protein kinase C delta (PKCδ) as the kinase responsible for inactivation of SRF both in vitro and endogenously in senescent cells. This is due to a higher level of PKCδ activity as cells age, production of the PKCδ catalytic fragment, and its nuclear localization in senescent but not in low-passage-number cells. The phosphorylation of T160 of SRF by PKCδ in vitro and in vivo led to loss of SRF DNA binding activity. Both the PKCδ inhibitor rottlerin and ectopic expression of a dominant negative form of PKCδ independently restored SRE-dependent transcription and immediate-early gene expression in senescent cells. Modulation of PKCδ activity in vivo with rottlerin or bistratene A altered senescent- and young-cell morphology, respectively. These observations support the idea that the coordinate transcriptional inhibition of several growth-associated genes by PKCδ contributes to the senescent phenotype. PMID:15282327

  19. Splitting hares and tortoises: a classification of neuronal immediate early gene transcription based on poised RNA polymerase II.

    PubMed

    Saha, R N; Dudek, S M

    2013-09-01

    Immediate early transcription is an integral part of the neuronal response to environmental stimulation and serves many brain processes including development, learning, triggers of programmed cell death, and reaction to injury and drugs. Following a stimulus, neurons express a select few genes within a short period of time without undergoing de novo protein translation. Referred to as the 'gateway to genetic response', these immediate early genes (IEGs) are either expressed within a few minutes of stimulation or later within the hour. In neuronal IEGs that are expressed rapidly, productive elongation in response to neuronal activity is jump-started by constitutive transcription initiation together with RNA polymerase II stalling in the vicinity of the promoter. IEGs expressed later in the hour do not depend on this mechanism. On the basis of this Polymerase II poising, we propose that the immediate early genes can be grouped in two distinct classes: the rapid and the delayed IEGs. The possible biological relevance of these classes in neurons is discussed.

  20. Application of the FLP/FRT system for conditional gene deletion in yeast Saccharomyces cerevisiae.

    PubMed

    Park, Yang-Nim; Masison, Daniel; Eisenberg, Evan; Greene, Lois E

    2011-09-01

    The yeast Saccharomyces cerevisiae has proved to be an excellent model organism to study the function of proteins. One of the many advantages of yeast is the many genetic tools available to manipulate gene expression, but there are still limitations. To complement the many methods used to control gene expression in yeast, we have established a conditional gene deletion system by using the FLP/FRT system on yeast vectors to conditionally delete specific yeast genes. Expression of Flp recombinase, which is under the control of the GAL1 promoter, was induced by galactose, which in turn excised FRT sites flanked genes. The efficacy of this system was examined using the FRT site-flanked genes HSP104, URA3 and GFP. The pre-excision frequency of this system, which might be caused by the basal activity of the GAL1 promoter or by spontaneous recombination between FRT sites, was detected ca. 2% under the non-selecting condition. After inducing expression of Flp recombinase, the deletion efficiency achieved ca. 96% of cells in a population within 9 h. After conditional deletion of the specific gene, protein degradation and cell division then diluted out protein that was expressed from this gene prior to its excision. Most importantly, the specific protein to be deleted could be expressed under its own promoter, so that endogenous levels of protein expression were maintained prior to excision by the Flp recombinase. Therefore, this system provides a useful tool for the conditional deletion of genes in yeast.

  1. Protective effect of myostatin gene deletion on aging-related muscle metabolic decline.

    PubMed

    Chabi, B; Pauly, M; Carillon, J; Carnac, G; Favier, F B; Fouret, G; Bonafos, B; Vanterpool, F; Vernus, B; Coudray, C; Feillet-Coudray, C; Bonnieu, A; Lacan, D; Koechlin-Ramonatxo, C

    2016-06-01

    While myostatin gene deletion is a promising therapy to fight muscle loss during aging, this approach induces also skeletal muscle metabolic changes such as mitochondrial deficits, redox alteration and increased fatigability. In the present study, we evaluated the effects of aging on these features in aged wild-type (WT) and mstn knockout (KO) mice. Moreover, to determine whether an enriched-antioxidant diet may be useful to prevent age-related disorders, we orally administered to the two genotypes a melon concentrate rich in superoxide dismutase for 12 weeks. We reported that mitochondrial functional abnormalities persisted (decreased state 3 and 4 of respiration; p<0.05) in skeletal muscle from aged KO mice; however, differences with WT mice were attenuated at old age in line with reduced difference on running endurance between the two genotypes. Interestingly, we showed an increase in glutathione levels, associated with lower lipid peroxidation levels in KO muscle. Enriched antioxidant diet reduced the aging-related negative effects on maximal aerobic velocity and running limit time (p<0.05) in both groups, with systemic adaptations on body weight. The redox status and the hypertrophic phenotype appeared to be beneficial to KO mice, mitigating the effect of aging on the skeletal muscle metabolic remodeling.

  2. A mouse model for adult cardiac-specific gene deletion with CRISPR/Cas9

    PubMed Central

    Carroll, Kelli J.; Makarewich, Catherine A.; McAnally, John; Anderson, Douglas M.; Zentilin, Lorena; Liu, Ning; Giacca, Mauro; Bassel-Duby, Rhonda; Olson, Eric N.

    2016-01-01

    Clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas)9 genomic editing has revolutionized the generation of mutant animals by simplifying the creation of null alleles in virtually any organism. However, most current approaches with this method require zygote injection, making it difficult to assess the adult, tissue-specific functions of genes that are widely expressed or which cause embryonic lethality when mutated. Here, we describe the generation of cardiac-specific Cas9 transgenic mice, which express high levels of Cas9 in the heart, but display no overt defects. In proof-of-concept experiments, we used Adeno-Associated Virus 9 (AAV9) to deliver single-guide RNA (sgRNA) that targets the Myh6 locus exclusively in cardiomyocytes. Intraperitoneal injection of postnatal cardiac-Cas9 transgenic mice with AAV9 encoding sgRNA against Myh6 resulted in robust editing of the Myh6 locus. These mice displayed severe cardiomyopathy and loss of cardiac function, with elevation of several markers of heart failure, confirming the effectiveness of this method of adult cardiac gene deletion. Mice with cardiac-specific expression of Cas9 provide a tool that will allow rapid and accurate deletion of genes following a single injection of AAV9-sgRNAs, thereby circumventing embryonic lethality. This method will be useful for disease modeling and provides a means of rapidly editing genes of interest in the heart. PMID:26719419

  3. A novel method to generate unmarked gene deletions in the intracellular pathogen Rhodococcus equi using 5-fluorocytosine conditional lethality

    PubMed Central

    van der Geize, R.; de Jong, W.; Hessels, G. I.; Grommen, A. W. F.; Jacobs, A. A. C.; Dijkhuizen, L.

    2008-01-01

    A novel method to efficiently generate unmarked in-frame gene deletions in Rhodococcus equi was developed, exploiting the cytotoxic effect of 5-fluorocytosine (5-FC) by the action of cytosine deaminase (CD) and uracil phosphoribosyltransferase (UPRT) enzymes. The opportunistic, intracellular pathogen R. equi is resistant to high concentrations of 5-FC. Introduction of Escherichia coli genes encoding CD and UPRT conferred conditional lethality to R. equi cells incubated with 5-FC. To exemplify the use of the codA::upp cassette as counter-selectable marker, an unmarked in-frame gene deletion mutant of R. equi was constructed. The supA and supB genes, part of a putative cholesterol catabolic gene cluster, were efficiently deleted from the R. equi wild-type genome. Phenotypic analysis of the generated ΔsupAB mutant confirmed that supAB are essential for growth of R. equi on cholesterol. Macrophage survival assays revealed that the ΔsupAB mutant is able to survive and proliferate in macrophages comparable to wild type. Thus, cholesterol metabolism does not appear to be essential for macrophage survival of R. equi. The CD-UPRT based 5-FC counter-selection may become a useful asset in the generation of unmarked in-frame gene deletions in other actinobacteria as well, as actinobacteria generally appear to be 5-FC resistant and 5-FU sensitive. PMID:18984616

  4. Patterns of dystrophin gene deletion in Egyptian Duchenne/Becker muscular dystrophy patients

    PubMed Central

    El Sherif, RM; Aly Fahmy, N; Nonaka, I; Etribi, MA

    2007-01-01

    Summary Large variations in the proportion of intragenic deletion in the dystrophin gene have been observed in different populations. Although dystrophin gene deletion was extensively studied all over the world, only few studies were done on Egyptian population and there was no account on the dystrophin gene duplication. In this study, we present our results on the pattern of deletion of the dystrophin gene together with the usage of quantitative polymerase chain reaction (PCR) as a method for duplication analysis within the dystrophin gene in Egyptian patients. Forty one Duchene/Becker muscular dystrophy patients were included in this study. The diagnosis was based on detailed clinical assessment, serum creatine kinase (CK) level, neurophysiologic study and muscle biopsy for histopathological analysis. DNA was extracted from ten milliliter peripheral blood according to basic protocol, and multiplex polymerase chain reaction for dystrophin gene using both Chamberlin and Beggs sets of primers amplifying eighteen exons covering the two main dystrophin gene hot spots. In addition primers from Abbs set were used when it was necessary to check the exon borders. DNA from cases with no detectable deletion was analyzed for dystrophin gene duplication using quantitative PCR technique. We had a percentage of 61.1% deletion which is higher than data from previous Egyptian studies and most of the deletion was localized in the major hotspot region between exons 44 and 52 and we had 5% of the cases with duplication. Our results were compared with previous studies from Egypt and with studies from different populations especially with data recorded in the Middle East and North Africa. PMID:18646563

  5. The 19S proteasome activator promotes human cytomegalovirus immediate early gene expression through proteolytic and nonproteolytic mechanisms.

    PubMed

    Winkler, Laura L; Kalejta, Robert F

    2014-10-01

    Proteasomes are large, multisubunit complexes that support normal cellular activities by executing the bulk of protein turnover. During infection, many viruses have been shown to promote viral replication by using proteasomes to degrade cellular factors that restrict viral replication. For example, the human cytomegalovirus (HCMV) pp71 protein induces the proteasomal degradation of Daxx, a cellular transcriptional repressor that can silence viral immediate early (IE) gene expression. We previously showed that this degradation requires both the proteasome catalytic 20S core particle (CP) and the 19S regulatory particle (RP). The 19S RP associates with the 20S CP to facilitate protein degradation but also plays a 20S CP-independent role promoting transcription. Here, we present a nonproteolytic role of the 19S RP in HCMV IE gene expression. We demonstrate that 19S RP subunits are recruited to the major immediate early promoter (MIEP) that directs IE transcription. Depletion of 19S RP subunits generated a defect in RNA polymerase II elongation through the MIE locus during HCMV infection. Our results reveal that HCMV commandeers proteasome components for both proteolytic and nonproteolytic roles to promote HCMV lytic infection. Importance: Proteasome inhibitors decrease or eliminate 20S CP activity and are garnering increasing interest as chemotherapeutics. However, an increasing body of evidence implicates 19S RP subunits in important proteolytic-independent roles during transcription. Thus, pharmacological inhibition of the 20S CP as a means to modulate proteasome function toward therapeutic effect is an incomplete capitalization on the potential of this approach. Here, we provide an additional example of nonproteolytic 19S RP function in promoting HCMV transcription. These data provide a novel system with which to study the roles of different proteasome components during transcription, a rationale for previously described shifts in 19S RP subunit localization during

  6. Reiterated sequences within the intron of an immediate-early gene of herpes simplex virus type 1.

    PubMed Central

    Watson, R J; Umene, K; Enquist, L W

    1981-01-01

    We describe the nucleotide sequence of a herpes simplex virus type 1 DNA fragment containing the intron of the immediate-early mRNA-5 (IE mRNA-5) gene. The location of the intron within this fragment was determined by a Berk & Sharp nuclease S1 protection analysis, and by cloning and sequencing cDNA containing sequences overlapping t he IE mRNA-5 splice point. We found that the 149 base pair (bp) intron contained four copies of an identical 23 bp GC rich tandem repeat followed by a further reiteration consisting of the first 15 bp only. Images PMID:6272198

  7. PYRETHROID INDUCED ALTERATIONS IN TRANSCRIPTION OF CALCIUM RESPONSIVE AND IMMEDIATE EARLY GENES IN VIVO.

    EPA Science Inventory

    Multiple molecular targets for pyrethroid insecticides have been evaluated in in vitro preparations, including but not limited to voltage-sensitive sodium channels (VSSCs), voltage-sensitive calcium channels (VSCCs), GABAergic receptors, ATPases and mitochondrial respiratory chai...

  8. Role of the human cytomegalovirus major immediate-early promoter's 19-base-pair-repeat cyclic AMP-response element in acutely infected cells.

    PubMed

    Keller, M J; Wheeler, D G; Cooper, E; Meier, J L

    2003-06-01

    Prior studies have suggested a role of the five copies of the 19-bp-repeat cyclic AMP (cAMP)-response element (CRE) in major immediate-early (MIE) promoter activation, the rate-limiting step in human cytomegalovirus (HCMV) replication. We used two different HCMV genome modification strategies to test this hypothesis in acutely infected cells. We report the following: (i) the CREs do not govern basal levels of MIE promoter activity at a high or low multiplicity of infection (MOI) in human foreskin fibroblast (HFF)- or NTera2-derived neuronal cells; (ii) serum and virion components markedly increase MIE promoter-dependent transcription at a low multiplicity of infection (MOI), but this increase is not mediated by the CREs; (iii) forskolin stimulation of the cAMP signaling pathway induces a two- to threefold increase in MIE RNA levels in a CRE-specific manner at a low MOI in both HFF- and NTera2-derived neuronal cells; and (iv) the CREs do not regulate basal levels of HCMV DNA replication at a high or low MOI in HFF. Their presence does impart a forskolin-induced increase in viral DNA replication at a low MOI but only when basal levels of MIE promoter activity are experimentally diminished. In conclusion, the 19-bp-repeat CREs add to the robust MIE promoter activity that occurs in the acutely infected stimulated cells, although the CREs' greater role may be in other settings.

  9. Total beta-globin gene deletion has high frequency in Filipinos

    SciTech Connect

    Patrick, N.; Miyakawa, F.; Hunt, J.A.

    1994-09-01

    The distribution of {beta}-thalassemia [{beta}{sup Th}] mutations is unique to each ethnic group. Most mutations affect one or a few bases; large deletions have been rare. Among families screened in Hawaii, [{beta}{sup Th}] heterozygotes were diagnosed by microcytosis, absence of abnormal hemoglobins on isoelectric focusing, and raised Hb A{sub 2} by chromatography. Gene frequency for {beta}{sup Th} was 0.02 in Filipinos. In Filipinos, polymerase chain reaction [PCR] with denaturing gradient gel electrophoresis for {beta}{sup Th} mutations detected a mutation in only 6 of 42 {beta}{sup Th} heterozygotes; an IVS2-666 C/T polymorphism showed non-heterozygosity in 37 and heterozygosity in only 5 of these {beta}{sup Th} heterozygotes. One {beta}{sup Th}/{beta}{sup Th} major patient and his mother had no mutation detected by allele-specific oligomer hybridization; PCR failed to amplify any DNA from his {beta}-globin gene. After a total {beta}-globin gene deletion [{beta}{sup Del}] was found in a Filipino family in Ontario, specific PCR amplification for {beta}{sup Del} detected this in 43 of 53 {beta}{sup Th} Filipino samples tested; the above {beta}{sup Th}/{beta}{sup Th} patient was a ({beta}{sup Del}/{beta}{sup Del}) homozygote. The {beta}{sup Del} may account for over 60% of all {beta}{sup Th} alleles in Filipinos; this is the highest proportion of a deletion {beta}{sup Th} mutation reported from any population. Most but not all {beta}{sup Del} heterozygotes had high Hb F [5.13 {plus_minus} 3.94 mean {plus_minus} 1 s.d.] compared to the codon 41/42 four base deletion common in Chinese [2.30 {plus_minus} 0.86], or to {beta}{sup Th} heterozygotes with normal {alpha}-globin genes [2.23 {plus_minus} 0.80].

  10. A VNTR element associated with steroid sulfatase gene deletions stimulates recombination in cultured cells

    SciTech Connect

    Gong, Y.; Li, X.M.; Shapiro, L.J.

    1994-09-01

    Steroid sulfatase deficiency is a common genetic disorder, with a prevalence of approximately one in every 3500 males world wide. About 90% of these patients have complete gene deletions, which appear to result from recombination between members of a low-copy repeat family (CRI-232 is the prototype) that flank the gene. RU1 and RU2 are two VNTR elements found within each of these family members. RU1 consists of 30 bp repeating units and its length shows minimal variation among individuals. The RU2 element consists of repeating sequences which are highly asymmetric, with about 90% purines and no C`s on one strand, and range from 0.6 kb to over 23 kb among different individuals. We conducted a study to determine if the RU1 or RU2 elements can promote recombination in an in vivo test system. We inserted these elements adjacent to the neo gene in each of two pSV2neo derivatives, one of which has a deletion in the 5{prime} portion of the neo gene and the other having a deletion in the 3{prime} portion. These plasmids were combined and used to transfect EJ cells. Survival of cells in G418 indicates restoration of a functional neo gene by recombination between two deletion constructs. Thus counting G418 resistant colonies gives a quantitative measure of the enhancement of recombination by the inserted VNTR elements. The results showed no effect on recombination by the inserted RU1 element (compared to the insertion of a nonspecific sequence), while the RU2 element stimulated recombination by 3.5-fold (P<0.01). A separate set of constructs placed RU1 or RU2 within the intron of an exon trapping vector. Following tranfection of cells, recombination events were monitored by a PCR assay that detected the approximation of primer binding sites (as a result of recombination). These studies showed that, as in the first set of experiments, the highly variable RU2 element is capable of stimulating somatic recombination in mammalian cells.

  11. OMP gene deletion results in an alteration in odorant-induced mucosal activity patterns.

    PubMed

    Youngentob, S L; Kent, P F; Margolis, F L

    2003-12-01

    Previous behavioral work, using a complex five-odorant identification task, demonstrated that olfactory marker protein (OMP) is critically involved in odor processing to the extent that its loss results in an alteration in odorant quality perception. Exactly how the lack of OMP exerts its influence on the perception of odorant quality is unknown. However, there is considerable neurophysiological evidence that different odorants produce different spatiotemporal patterns of neural activity at the level of the mucosa and that these patterns predict the psychophysically determined perceptual relationship among odorants. In this respect, OMP gene deletion is known to result in a constellation of physiologic defects (i.e., marked reduction in the electroolfactogram (EOG) and altered response and recovery kinetics) that would be expected to alter the odorant-induced spatiotemporal activity patterns that are characteristic of different odorants. This, in turn, would be expected to alter the spatiotemporal patterning of information that results from the mucosal projection onto the bulb, thereby changing odorant quality perception. To test the hypothesis that odorant-induced mucosal activity patterns are altered in mice lacking the gene for OMP, we optically recorded the fluorescent changes in response to odorant stimulation from both the septum and turbinates of both OMP-null and control mice using a voltage-sensitive dye (di-4-ANEPPS Molecular Probes, Eugene, OR) and a Dalsa 120 x 120, 12-bit CCD camera. To maintain continuity with the previous behavioral work, the odorants 2-propanol, citral, carvone, ethylacetoacetate, and propyl acetate were again used. Each odorant was randomly presented to each mucosal surface in a Latin-Square design. The results of this study demonstrated that, for both mouse strains, there do indeed exist different spatiotemporal activity patterns for different odorants. More importantly, however, these patterns significantly differed between OMP

  12. Immediate-Early (IE) gene regulation of cytomegalovirus: IE1- and pp71-mediated viral strategies against cellular defenses.

    PubMed

    Torres, Lilith; Tang, Qiyi

    2014-12-01

    Three crucial hurdles hinder studies on human cytomegalovirus (HCMV): strict species specificity, differences between in vivo and in vitro infection, and the complexity of gene regulation. Ever since the sequencing of the whole genome was first accomplished, functional studies on individual genes have been the mainstream in the CMV field. Gene regulation has therefore been elucidated in a more detailed fashion. However, viral gene regulation is largely controlled by both cellular and viral components. In other words, viral gene expression is determined by the virus-host interaction. Generally, cells respond to viral infection in a defensive pattern; at the same time, viruses try to counteract the cellular defense or else hide in the host (latency). Viruses evolve effective strategies against cellular defense in order to achieve replicative success. Whether or not they are successful, cellular defenses remain in the whole viral replication cycle: entry, immediate-early (IE) gene expression, early gene expression, DNA replication, late gene expression, and viral egress. Many viral strategies against cellular defense, and which occur in the immediate-early time of viral infection, have been documented. In this review, we will summarize the documented biological functions of IE1 and pp71 proteins, especially with regard to how they counteract cellular intrinsic defenses.

  13. The Immediate Early Gene Product EGR1 and Polycomb Group Proteins Interact in Epigenetic Programming during Chondrogenesis

    PubMed Central

    Caron, Marjolein M. J.; Prickaerts, Peggy; Rofel, Celine; Dahlmans, Vivian E. H.; Surtel, Don A. M.; Paulis, Yvette; Schweizer, Finja; Welting, Tim J. M.; Eijssen, Lars M.; Voncken, Jan Willem

    2013-01-01

    Initiation of and progression through chondrogenesis is driven by changes in the cellular microenvironment. At the onset of chondrogenesis, resting mesenchymal stem cells are mobilized in vivo and a complex, step-wise chondrogenic differentiation program is initiated. Differentiation requires coordinated transcriptomic reprogramming and increased progenitor proliferation; both processes require chromatin remodeling. The nature of early molecular responses that relay differentiation signals to chromatin is poorly understood. We here show that immediate early genes are rapidly and transiently induced in response to differentiation stimuli in vitro. Functional ablation of the immediate early factor EGR1 severely deregulates expression of key chondrogenic control genes at the onset of differentiation. In addition, differentiating cells accumulate DNA damage, activate a DNA damage response and undergo a cell cycle arrest and prevent differentiation associated hyper-proliferation. Failed differentiation in the absence of EGR1 affects global acetylation and terminates in overall histone hypermethylation. We report novel molecular connections between EGR1 and Polycomb Group function: Polycomb associated histone H3 lysine27 trimethylation (H3K27me3) blocks chromatin access of EGR1. In addition, EGR1 ablation results in abnormal Ezh2 and Bmi1 expression. Consistent with this functional interaction, we identify a number of co-regulated targets genes in a chondrogenic gene network. We here describe an important role for EGR1 in early chondrogenic epigenetic programming to accommodate early gene-environment interactions in chondrogenesis. PMID:23483971

  14. THOC5 controls 3′end-processing of immediate early genes via interaction with polyadenylation specific factor 100 (CPSF100)

    PubMed Central

    Tran, Doan Duy Hai; Saran, Shashank; Williamson, Andrew J.K.; Pierce, Andrew; Dittrich-Breiholz, Oliver; Wiehlmann, Lutz; Koch, Alexandra; Whetton, Anthony D.; Tamura, Teruko

    2014-01-01

    Transcription of immediate early genes (IEGs) in response to extrinsic and intrinsic signals is tightly regulated at multiple stages. It is known that untranslated regions of the RNA can play a role in these processes. Here we show that THOC5, a member of the TREX (transcription/export) complex, plays a role in expression of only a subset of constitutively active genes, however transcriptome analysis reveals that more than 90% of IEG were not induced by serum in THOC5 depleted cells. Furthermore, THOC5 depletion does not influence the expression of the most rapidly induced IEGs, e.g. Fos and Jun. One group of THOC5 target genes, including Id1, Id3 and Wnt11 transcripts, were not released from chromatin in THOC5 depleted cells. Genes in another group, including Myc and Smad7 transcripts, were released with shortening of 3′UTR by alternative cleavage, and were spliced but export was impaired in THOC5 depleted cells. By interactome analysis using THOC5 as bait, we show that upon stimulation with serum THOC5 forms a complex with polyadenylation-specific factor 100 (CPSF100). THOC5 is required for recruitment of CPSF100 to 3′UTR of THOC5 target genes. These data suggest the presence of a novel mechanism for the control of IEG response by THOC5 via 3′end-processing. PMID:25274738

  15. Identification of single gene deletions at 15q13.3: further evidence that CHRNA7 causes the 15q13.3 microdeletion syndrome phenotype.

    PubMed

    Hoppman-Chaney, N; Wain, K; Seger, P R; Superneau, D W; Hodge, J C

    2013-04-01

    The 15q13.3 microdeletion syndrome (OMIM #612001) is characterized by a wide range of phenotypic features, including intellectual disability, seizures, autism, and psychiatric conditions. This deletion is inherited in approximately 75% of cases and has been found in mildly affected and normal parents, consistent with variable expressivity and incomplete penetrance. The common deletion is approximately 2 Mb and contains several genes; however, the gene(s) responsible for the resulting clinical features have not been clearly defined. Recently, four probands were reported with small deletions including only the CHRNA7 gene. These patients showed a wide range of phenotypic features similar to those associated with the larger 15q13.3 microdeletion. To further correlate genotype and phenotype, we queried our database of >15,000 patients tested in the Mayo Clinic Cytogenetics Laboratory from 2008 to 2011 and identified 19 individuals (10 probands and 9 family members) with isolated heterozygous CHRNA7 gene deletions. All but two infants displayed multiple features consistent with 15q13.3 microdeletion syndrome. We also identified the first de novo deletion confined to CHRNA7 as well as the second known case with homozygous deletion of CHRNA7 only. These results provide further evidence implicating CHRNA7 as the gene responsible for the clinical findings associated with 15q13.3 microdeletion.

  16. An Adenovirus Type 5 Mutant with the Preterminal Protein Gene Deleted Efficiently Provides Helper Functions for the Production of Recombinant Adeno-Associated Virus

    PubMed Central

    Maxwell, Ian H.; Maxwell, Francoise; Schaack, Jerome

    1998-01-01

    Production of recombinant adeno-associated virus (rAAV) requires helper functions that have routinely been provided by infection of the producer cells with adenovirus. Complete removal and/or inactivation of progeny adenovirus, present in such rAAV preparations, presents significant difficulty. Here, we report that an adenovirus type 5 (Ad5) mutant with the preterminal protein (pTP) gene deleted can provide helper function for the growth of rAAV. At high multiplicity, Ad5dl308ΔpTP was as efficient as the phenotypically wild-type Ad5dl309 in permitting growth of rAAV. Use of Ad5dl308ΔpTP, which is incapable of replication in the absence of complementation for pTP, as a helper avoids the need to remove contaminating adenovirus infectious activity by heat inactivation or by purification. Comparison of the transducing ability of rAAV generated with either Ad5dl308ΔpTP or Ad5dl309 as a helper demonstrated that the heat inactivation protocol generally used does not remove all of the helper Ad5dl309 function. PMID:9733887

  17. Diverse fission yeast genes required for responding to oxidative and metal stress: Comparative analysis of glutathione-related and other defense gene deletions.

    PubMed

    Pluskal, Tomáš; Sajiki, Kenichi; Becker, Joanne; Takeda, Kojiro; Yanagida, Mitsuhiro

    2016-06-01

    Living organisms have evolved multiple sophisticated mechanisms to deal with reactive oxygen species. We constructed a collection of twelve single-gene deletion strains of the fission yeast Schizosaccharomyces pombe designed for the study of oxidative and heavy metal stress responses. This collection contains deletions of biosynthetic enzymes of glutathione (Δgcs1 and Δgsa1), phytochelatin (Δpcs2), ubiquinone (Δabc1) and ergothioneine (Δegt1), as well as catalase (Δctt1), thioredoxins (Δtrx1 and Δtrx2), Cu/Zn- and Mn- superoxide dismutases (SODs; Δsod1 and Δsod2), sulfiredoxin (Δsrx1) and sulfide-quinone oxidoreductase (Δhmt2). First, we employed metabolomic analysis to examine the mutants of the glutathione biosynthetic pathway. We found that ophthalmic acid was produced by the same enzymes as glutathione in S. pombe. The identical genetic background of the strains allowed us to assess the severity of the individual gene knockouts by treating the deletion strains with oxidative agents. Among other results, we found that glutathione deletion strains were not particularly sensitive to peroxide or superoxide, but highly sensitive to cadmium stress. Our results show the astonishing diversity in cellular adaptation mechanisms to various types of oxidative and metal stress and provide a useful tool for further research into stress responses. PMID:27005325

  18. Expression of the immediate-early gene-encoded protein Egr-1 (zif268) during in vitro classical conditioning.

    PubMed

    Mokin, Maxim; Keifer, Joyce

    2005-01-01

    Expression of the immediate-early genes (IEGs) has been shown to be induced by activity-dependent synaptic plasticity or behavioral training and is thought to play an important role in long-term memory. In the present study, we examined the induction and expression of the IEG-encoded protein Egr-1 during an in vitro neural correlate of eyeblink classical conditioning. The results showed that Egr-1 protein expression as determined by immunocytochemistry and Western blot analysis rapidly increased during the early stages of conditioning and remained elevated during the later stages. Further, expression of Egr-1 protein required NMDA receptor activation as it was blocked by bath application of AP-5. These findings suggest that the IEG-encoded proteins such as Egr-1 are activated during relatively simple forms of learning in vertebrates. In this case, Egr-1 may have a functional role in the acquisition phase of conditioning as well as in maintaining expression of conditioned responses.

  19. Transactivation, dimerization, and DNA-binding activity of white spot syndrome virus immediate-early protein IE1.

    PubMed

    Liu, Wang-Jing; Chang, Yun-Shiang; Wang, Hao-Ching; Leu, Jiann-Horng; Kou, Guang-Hsiung; Lo, Chu-Fang

    2008-11-01

    Immediate-early proteins from many viruses function as transcriptional regulators and exhibit transactivation activity, DNA binding activity, and dimerization. In this study, we investigated these characteristics in white spot syndrome virus (WSSV) immediate-early protein 1 (IE1) and attempted to map the corresponding functional domains. Transactivation was investigated by transiently expressing a protein consisting of the DNA binding domain of the yeast transactivator GAL4 fused to full-length IE1. This GAL4-IE1 fusion protein successfully activated the Autographa californica multicapsid nucleopolyhedrovirus p35 basal promoter when five copies of the GAL4 DNA binding site were inserted upstream of the TATA box. A deletion series of GAL4-IE1 fusion proteins suggested that the transactivation domain of WSSV IE1 was carried within its first 80 amino acids. A point mutation assay further showed that all 12 of the acidic residues in this highly acidic domain were important for IE1's transactivation activity. DNA binding activity was confirmed by an electrophoresis mobility shift assay using a probe with (32)P-labeled random oligonucleotides. The DNA binding region of WSSV IE1 was located in its C-terminal end (amino acids 81 to 224), but mutation of a putative zinc finger motif in this C-terminal region suggested that this motif was not directly involved in the DNA binding activity. A homotypic interaction between IE1 molecules was demonstrated by glutathione S-transferase pull-down assay and a coimmunoprecipitation analysis. A glutaraldehyde cross-linking experiment and gel filtration analysis showed that this self-interaction led to the formation of stable IE1 dimers. PMID:18768963

  20. The pnk/pnl gene (ORF 86) of Autographa californica nucleopolyhedrovirus is a non-essential, immediate early gene.

    PubMed

    Durantel, D; Croizier, L; Ayres, M D; Croizier, G; Possee, R D; López-Ferber, M

    1998-03-01

    Autographa californica nucleopolyhedrovirus (AcMNPV) ORF 86, located within the HindIII C fragment, potentially encodes a protein which shares sequence similarity with two T4 bacteriophage gene products, RNA ligase and polynucleotide kinase. This AcMNPV gene has been designated pnk/pnl but has yet to be assigned a function in virus replication. It has been classified as an immediate early virus gene, since the promoter was active in uninfected insect cells and mRNA transcripts were detectable from 4 to 48 h post-infection and in the presence of cycloheximide or aphidicolin in virus-infected cells. The extremities of the transcript have been mapped by primer extension and 3' RACE-PCR to positions -18 from the translational start codon and +15 downstream of the stop codon. The function of pnk/pnl was investigated by producing a recombinant virus (Acdel86lacZ) with the coding region replaced with that of lacZ. This virus replicated normally in Spodoptera frugiperda (Sf 21) cells, indicating that pnk/pnl is not essential for propagation in these cells. Virus protein production in Acdel86lacZ-infected Sf 21 cells also appeared to be unaffected, with normal synthesis of the IE-1, GP64, VP39 and polyhedrin proteins. Shut-down of host protein synthesis was not abolished in recombinant infection. When other baculovirus genomes were examined for the presence of pnk/pnl by restriction enzyme digestion and PCR, a deletion was found in AcMNPV 1.2, Galleria mellonella NPV (GmMNPV) and Bombyx mori NPV (BmNPV), suggesting that in many isolates this gene has either never been acquired or has been lost during genome evolution. This is one of the first baculovirus immediate early genes that appears to be nonessential for virus survival.

  1. Improving freeze-tolerance of baker's yeast through seamless gene deletion of NTH1 and PUT1.

    PubMed

    Dong, Jian; Chen, Didi; Wang, Guanglu; Zhang, Cuiying; Du, Liping; Liu, Shanshan; Zhao, Yu; Xiao, Dongguang

    2016-06-01

    Baker's yeast strains with freeze-tolerance are highly desirable to maintain high leavening ability after freezing. Enhanced intracellular concentration of trehalose and proline in yeast is linked with freeze-tolerance. In this study, we constructed baker's yeast with enhanced freeze-tolerance by simultaneous deletion of the neutral trehalase-encoded gene NTH1 and the proline oxidase-encoded gene PUT1. We first used the two-step integration-based seamless gene deletion method to separately delete NTH1 and PUT1 in haploid yeast. Subsequently, through two rounds of hybridization and sporulation-based allelic exchange and colony PCR-mediated tetrad analysis, we obtained strains with restored URA3 and deletion of NTH1 and/or PUT1. The resulting strain showed higher cell survival and dough-leavening ability after freezing compared to the wild-type strain due to enhanced accumulation of trehalose and/or proline. Moreover, mutant with simultaneous deletion of NTH1 and PUT1 exhibits the highest relative dough-leavening ability after freezing compared to mutants with single-gene deletion perhaps due to elevated levels of both trehalose and proline. These results verified that it is applicable to construct frozen dough baker's yeast using the method proposed in this paper.

  2. Robust Parameter Identification to Perform the Modeling of pta and poxB Genes Deletion Effect on Escherichia Coli.

    PubMed

    Guerrero-Torres, V; Rios-Lozano, M; Badillo-Corona, J A; Chairez, I; Garibay-Orijel, C

    2016-08-01

    The aim of this study was to design a robust parameter identification algorithm to characterize the effect of gene deletion on Escherichia coli (E. coli) MG1655. Two genes (pta and poxB) in the competitive pathways were deleted from this microorganism to inhibit pyruvate consumption. This condition deviated the E. coli metabolism toward the Krebs cycle. As a consequence, the biomass, substrate (glucose), lactic, and acetate acids as well as ethanol concentrations were modified. A hybrid model was proposed to consider the effect of gene deletion on the metabolism of E. coli. The model parameters were estimated by the application of a least mean square method based on the instrument variable technique. To evaluate the parametric identifier method, a set of robust exact differentiators, based on the super-twisting algorithm, was implemented. The hybrid model was successfully characterized by the parameters obtained from experimental information of E. coli MG1655. The significant difference between parameters obtained with wild-type strain and the modified (with deleted genes) justifies the application of the parametric identification algorithm. This characterization can be used to optimize the production of different byproducts of commercial interest.

  3. Improving freeze-tolerance of baker's yeast through seamless gene deletion of NTH1 and PUT1.

    PubMed

    Dong, Jian; Chen, Didi; Wang, Guanglu; Zhang, Cuiying; Du, Liping; Liu, Shanshan; Zhao, Yu; Xiao, Dongguang

    2016-06-01

    Baker's yeast strains with freeze-tolerance are highly desirable to maintain high leavening ability after freezing. Enhanced intracellular concentration of trehalose and proline in yeast is linked with freeze-tolerance. In this study, we constructed baker's yeast with enhanced freeze-tolerance by simultaneous deletion of the neutral trehalase-encoded gene NTH1 and the proline oxidase-encoded gene PUT1. We first used the two-step integration-based seamless gene deletion method to separately delete NTH1 and PUT1 in haploid yeast. Subsequently, through two rounds of hybridization and sporulation-based allelic exchange and colony PCR-mediated tetrad analysis, we obtained strains with restored URA3 and deletion of NTH1 and/or PUT1. The resulting strain showed higher cell survival and dough-leavening ability after freezing compared to the wild-type strain due to enhanced accumulation of trehalose and/or proline. Moreover, mutant with simultaneous deletion of NTH1 and PUT1 exhibits the highest relative dough-leavening ability after freezing compared to mutants with single-gene deletion perhaps due to elevated levels of both trehalose and proline. These results verified that it is applicable to construct frozen dough baker's yeast using the method proposed in this paper. PMID:26965428

  4. Robust Parameter Identification to Perform the Modeling of pta and poxB Genes Deletion Effect on Escherichia Coli.

    PubMed

    Guerrero-Torres, V; Rios-Lozano, M; Badillo-Corona, J A; Chairez, I; Garibay-Orijel, C

    2016-08-01

    The aim of this study was to design a robust parameter identification algorithm to characterize the effect of gene deletion on Escherichia coli (E. coli) MG1655. Two genes (pta and poxB) in the competitive pathways were deleted from this microorganism to inhibit pyruvate consumption. This condition deviated the E. coli metabolism toward the Krebs cycle. As a consequence, the biomass, substrate (glucose), lactic, and acetate acids as well as ethanol concentrations were modified. A hybrid model was proposed to consider the effect of gene deletion on the metabolism of E. coli. The model parameters were estimated by the application of a least mean square method based on the instrument variable technique. To evaluate the parametric identifier method, a set of robust exact differentiators, based on the super-twisting algorithm, was implemented. The hybrid model was successfully characterized by the parameters obtained from experimental information of E. coli MG1655. The significant difference between parameters obtained with wild-type strain and the modified (with deleted genes) justifies the application of the parametric identification algorithm. This characterization can be used to optimize the production of different byproducts of commercial interest. PMID:27093969

  5. Time Course of Immediate Early Gene Protein Expression in the Spinal Cord following Conditioning Stimulation of the Sciatic Nerve in Rats

    PubMed Central

    Bojovic, Ognjen; Panja, Debabrata; Bittins, Margarethe; Bramham, Clive R.; Tjølsen, Arne

    2015-01-01

    Long-term potentiation induced by conditioning electrical stimulation of afferent fibers is a widely studied form of synaptic plasticity in the brain and the spinal cord. In the spinal cord dorsal horn, long-term potentiation is induced by a series of high-frequency trains applied to primary afferent fibers. Conditioning stimulation (CS) of sciatic nerve primary afferent fibers also induces expression of immediate early gene proteins in the lumbar spinal cord. However, the time course of immediate early gene expression and the rostral-caudal distribution of expression in the spinal cord have not been systematically studied. Here, we examined the effects of sciatic nerve conditioning stimulation (10 stimulus trains, 0.5 ms stimuli, 7.2 mA, 100 Hz, train duration 2 s, 8 s intervals between trains) on cellular expression of immediate early genes, Arc, c-Fos and Zif268, in anesthetized rats. Immunohistochemical analysis was performed on sagittal sections obtained from Th13- L5 segments of the spinal cord at 1, 2, 3, 6 and 12 h post-CS. Strikingly, all immediate early genes exhibited a monophasic increase in expression with peak increases detected in dorsal horn neurons at 2 hours post-CS. Regional analysis showed peak increases at the location between the L3 and L4 spinal segments. Both Arc, c-Fos and Zif268 remained significantly elevated at 2 hours, followed by a sharp decrease in immediate early gene expression between 2 and 3 hours post-CS. Colocalization analysis performed at 2 hours post-CS showed that all c-Fos and Zif268 neurons were positive for Arc, while 30% and 43% of Arc positive neurons were positive for c-Fos and Zif268, respectively. The present study identifies the spinal cord level and time course of immediate early gene (IEGP) expression of relevance for analysis of IEGPs function in neuronal plasticity and nociception. PMID:25860146

  6. The synergy of tobacco and alcohol and glutathione S-transferase θ 1 gene deletion and oral squamous cell carcinoma

    PubMed Central

    D’ Mello, Sarah; Bavle, Radhika Manoj; Paremala, K; Makarla, Soumya; Sudhakara, M; Bhatt, Madhura

    2016-01-01

    Background: Oral squamous cell carcinoma (OSCC) is the leading cancer among males in India. It is related to tobacco habits and alcohol consumption as well as the individual susceptibility for xenobiotic metabolizing enzyme polymorphisms. Glutathione S-transferase θ 1 (GSTT1) is a Phase II metabolic enzyme which is directly involved in catalyzing chemicals to mutagenic intermediates. This gene is characterized by genetic polymorphism resulting in complete gene deletion and subsequent absence of the enzyme, which ultimately dictates the risk of cancer development. Scraping buccal mucosa to obtain DNA from the cells is a simple, readily acceptable and rapid method to detect and assess the gene. Aim: To assess GSTT1 gene deletion in individuals giving a history of tobacco smoking and/or chewing and alcohol consumption and absence of clinically detectable lesions; and in OSCC cases to gauge if GSTT1 gene deletion confers protection to an individual and whether it can be used as a “single” marker to arrive at this conclusion. To validate the use of buccal scrape for determining the genotype of an individual by assessing the polymorphism at GSTT1 gene locus (22q11.2). Materials and Methods: Fifty-two cases were evaluated using buccal mucosal scrapes of tobacco habituates for 8 or more years, without clinically evident lesion (Group I) and from mucosa of tobacco habituates with clinically evident and histopathologically confirmed OSCC (Group II). DNA extraction and genotype at GSTT1 gene locus was determined by polymerase chain reaction assay. Statistical Analysis: The results were statistically analyzed using Chi-square test. Results: 90.66% of subjects had GSTT1 null genotype in Group I subjects. In Group II, subjects with both clinically and histopathologically diagnosed oral cancer, about 76.96% had GSTT1 null genotype. Conclusion: GSTT1 null genotype confers protection to individuals with tobacco habits and alcohol consumption, predominantly to those who used

  7. Priming of a D1 dopamine receptor behavioural response is dissociated from striatal immediate-early gene activity.

    PubMed

    Paul, M L; Currie, R W; Robertson, H A

    1995-05-01

    Repeated administration of direct-acting (apomorphine, SKF-38393, quinpirole) or indirect-acting (amphetamine, cocaine) dopaminergic agonists can produce enhancement of locomotor and sterotypic behaviours in response to subsequent dopamine agonist challenge. This sensitization of dopamine receptors, known as priming or reverse tolerance, is long-lasting and appears to be dependent upon the participation of the N-methyl-D-asparate excitatory amino acid receptor. The mechanism underlying dopamine receptor sensitization is not understood. Mounting evidence suggests that immediate-early genes may provide a link whereby extracellular stimuli are converted into long-term changes in neuronal activity. In the present study, behavioural measurements and immunohistochemical techniques were used to determine whether induction of the immediate-early gene c-fos is critical to the mechanism underlying priming of a D1-mediated behavioural response. It was demonstrated that in drug-naive rats bearing unilateral 6-hydroxydopamine lesions of the dopaminergic nigrostriatal pathway, the mixed D1/D2 agonist apomorphine produced a dramatic increase in the expression of Fos-like immunoreactivity in the ipsilateral caudoputamen, nucleus accumbens and globus pallidus, and was a potent primer of SKF-38393-mediated rotational behaviour. In contrast, saline administration did not increase Fos expression and did not prime SKF-38393-elicited rotation. Preadministration of MK-801 at 0.5 mg/kg significantly reduced apomorphine's effect on Fos expression and prevented apomorphine priming of SKF-38393-induced rotation. However, at a lower dose of 0.1 mg/kg, MK-801 had little effect on apomorphine-mediated Fos expression but did block the priming response. In another experiment, the D2 family-selective agonist quinpirole was found to be an affective primer of SKF-38393-mediated rotation, and to produce increase Fos expression in the ipsilateral globus pallidus only. Preadministration of MK-801 at 0

  8. MK-801 Impairs Cognitive Coordination on a Rotating Arena (Carousel) and Contextual Specificity of Hippocampal Immediate-Early Gene Expression in a Rat Model of Psychosis.

    PubMed

    Kubík, Stěpán; Buchtová, Helena; Valeš, Karel; Stuchlík, Aleš

    2014-01-01

    Flexible behavior in dynamic, real-world environments requires more than static spatial learning and memory. Discordant and unstable cues must be organized in coherent subsets to give rise to meaningful spatial representations. We model this form of cognitive coordination on a rotating arena - Carousel where arena- and room-bound spatial cues are dissociated. Hippocampal neuronal ensemble activity can repeatedly switch between multiple representations of such an environment. Injection of tetrodotoxin into one hippocampus prevents cognitive coordination during avoidance of a stationary room-defined place on the Carousel and increases coactivity of previously unrelated neurons in the uninjected hippocampus. Place avoidance on the Carousel is impaired after systemic administration of non-competitive NMDAr blockers (MK-801) used to model schizophrenia in animals and people. We tested if this effect is due to cognitive disorganization or other effect of NMDAr antagonism such as hyperlocomotion, spatial memory impairment, or general learning deficit. We also examined if the same dose of MK-801 alters patterns of immediate-early gene (IEG) expression in the hippocampus. IEG expression is triggered in neuronal nuclei in a context-specific manner after behavioral exploration and it is used to map activity in neuronal populations. IEG expression is critical for maintenance of synaptic plasticity and memory consolidation. We show that the same dose of MK-801 that impairs spatial coordination of rats on the Carousel also eliminates contextual specificity of IEG expression in hippocampal CA1 ensembles. This effect is due to increased similarity between ensembles activated in different environments, consistent with the idea that it is caused by increased coactivity between neurons, which did not previously fire together. Our data support the proposition of the Hypersynchrony theory that cognitive disorganization in psychosis is due to increased coactivity between unrelated

  9. MK-801 Impairs Cognitive Coordination on a Rotating Arena (Carousel) and Contextual Specificity of Hippocampal Immediate-Early Gene Expression in a Rat Model of Psychosis

    PubMed Central

    Kubík, Štěpán; Buchtová, Helena; Valeš, Karel; Stuchlík, Aleš

    2014-01-01

    Flexible behavior in dynamic, real-world environments requires more than static spatial learning and memory. Discordant and unstable cues must be organized in coherent subsets to give rise to meaningful spatial representations. We model this form of cognitive coordination on a rotating arena – Carousel where arena- and room-bound spatial cues are dissociated. Hippocampal neuronal ensemble activity can repeatedly switch between multiple representations of such an environment. Injection of tetrodotoxin into one hippocampus prevents cognitive coordination during avoidance of a stationary room-defined place on the Carousel and increases coactivity of previously unrelated neurons in the uninjected hippocampus. Place avoidance on the Carousel is impaired after systemic administration of non-competitive NMDAr blockers (MK-801) used to model schizophrenia in animals and people. We tested if this effect is due to cognitive disorganization or other effect of NMDAr antagonism such as hyperlocomotion, spatial memory impairment, or general learning deficit. We also examined if the same dose of MK-801 alters patterns of immediate-early gene (IEG) expression in the hippocampus. IEG expression is triggered in neuronal nuclei in a context-specific manner after behavioral exploration and it is used to map activity in neuronal populations. IEG expression is critical for maintenance of synaptic plasticity and memory consolidation. We show that the same dose of MK-801 that impairs spatial coordination of rats on the Carousel also eliminates contextual specificity of IEG expression in hippocampal CA1 ensembles. This effect is due to increased similarity between ensembles activated in different environments, consistent with the idea that it is caused by increased coactivity between neurons, which did not previously fire together. Our data support the proposition of the Hypersynchrony theory that cognitive disorganization in psychosis is due to increased coactivity between unrelated

  10. Complement factor I deficiency: a not so rare immune defect. Characterization of new mutations and the first large gene deletion

    PubMed Central

    2012-01-01

    Background Complement Factor I (CFI) is a serine protease with an important role in complement alternative pathway regulation. Complete factor I deficiency is strongly associated with severe infections. Approximately 30 families with this deficiency have been described worldwide. Patients and methods We have studied five new Spanish families suffering from CFI deficiency. From 19 screened people, 7 homozygous, 10 heterozygous and 2 healthy subjects were identified. Clinical, biochemical and genetic descriptions are included. Results Molecular studies demonstrated 4 novel mutations in the screened individuals; amongst them, we describe here the first great gene deletion reported in the CFI locus, which includes full exon 2 and part of the large intron 1. Conclusion CFI deficiency is possibly an underestimated defect and the eventual existence of this deficiency should be tested in those patients exhibiting low C3 and recurrent bacterial infections. We propose a simple diagnostic flowchart to help clinicians in the identification and correct diagnosis of such patients. PMID:22710145

  11. [Analysis of a GSTM1 gene deletion in the context of the GSTM genomic cluster diversity in three Russian populations].

    PubMed

    Filippova, I N; Khrunin, A V; Limborskaia, S A

    2014-01-01

    A total of 16 to 60% of individuals in human populations are homozygous with respect to a deletion of the Glutathione-S-transferase M1 gene. In this study, we evaluated the relationship between the GSTM1 gene deletion and genetic diversity of the GSTM cluster, which includes this gene, in three Russian populations. The study was based on the comparison of the haplotype distribution in two groups of individuals subdivided accordingly to the presence of the deletion. The first group included individuals with completely deleted GSTM1 gene, and the second group comprised individuals having at least one functional variant of GSTM1 gene. The analysis of the haplotype frequencies in groups revealed no specificity in their distribution both within the populations and between them.

  12. Tightly Regulated Expression of Autographa californica Multicapsid Nucleopolyhedrovirus Immediate Early Genes Emerges from Their Interactions and Possible Collective Behaviors

    PubMed Central

    Taka, Hitomi; Asano, Shin-ichiro; Matsuura, Yoshiharu; Bando, Hisanori

    2015-01-01

    To infect their hosts, DNA viruses must successfully initiate the expression of viral genes that control subsequent viral gene expression and manipulate the host environment. Viral genes that are immediately expressed upon infection play critical roles in the early infection process. In this study, we investigated the expression and regulation of five canonical regulatory immediate-early (IE) genes of Autographa californica multicapsid nucleopolyhedrovirus: ie0, ie1, ie2, me53, and pe38. A systematic transient gene-expression analysis revealed that these IE genes are generally transactivators, suggesting the existence of a highly interactive regulatory network. A genetic analysis using gene knockout viruses demonstrated that the expression of these IE genes was tolerant to the single deletions of activator IE genes in the early stage of infection. A network graph analysis on the regulatory relationships observed in the transient expression analysis suggested that the robustness of IE gene expression is due to the organization of the IE gene regulatory network and how each IE gene is activated. However, some regulatory relationships detected by the genetic analysis were contradictory to those observed in the transient expression analysis, especially for IE0-mediated regulation. Statistical modeling, combined with genetic analysis using knockout alleles for ie0 and ie1, showed that the repressor function of ie0 was due to the interaction between ie0 and ie1, not ie0 itself. Taken together, these systematic approaches provided insight into the topology and nature of the IE gene regulatory network. PMID:25816136

  13. Microarray and RT-PCR screening for white spot syndrome virus immediate-early genes in cycloheximide-treated shrimp

    SciTech Connect

    Liu Wangjing; Chang Yunshiang; Wang Chunghsiung; Kou, Guang-Hsiung; Lo Chufang . E-mail: gracelow@ntu.edu.tw

    2005-04-10

    Here, we report for the first time the successful use of cycloheximide (CHX) as an inhibitor to block de novo viral protein synthesis during WSSV (white spot syndrome virus) infection. Sixty candidate IE (immediate-early) genes were identified using a global analysis microarray technique. RT-PCR showed that the genes corresponding to ORF126, ORF242 and ORF418 in the Taiwan isolate were consistently CHX-insensitive, and these genes were designated ie1, ie2 and ie3, respectively. The sequences for these IE genes also appear in the two other WSSV isolates that have been sequenced. Three corresponding ORFs were identified in the China WSSV isolate, but only an ORF corresponding to ie1 was predicted in the Thailand isolate. In a promoter activity assay in Sf9 insect cells using EGFP (enhanced green fluorescence protein) as a reporter, ie1 showed very strong promoter activity, producing higher EGFP signals than the insect Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus (OpMNPV) ie2 promoter.

  14. Clinical outcomes of immediate/early loading of dental implants. A literature review of recent controlled prospective clinical studies.

    PubMed

    Sennerby, L; Gottlow, J

    2008-06-01

    Two previous reviews have evaluated the clinical outcomes of immediate/early loading of dental implants based on studies published until 2005.(1,2) The aim of the present paper was to review controlled clinical studies on the subject published since 2005 including at least 10 patients in each group followed for at least one year in function. Six comparative studies were found and none of these showed any differences in survival rates or marginal bone loss after one to five years. Most authors used specified inclusion criteria to avoid known risk factors such as soft bone, short implants and bruxism. Data from one randomized study in the edentulous maxilla showed no differences between early and delayed loading in consecutive clinical routine cases including short implants and soft bone. Three additional studies comparing different surfaces or implant designs under immediate loading were reviewed. No differences between implants with a moderately rough or smooth surface topography were observed. The data add to the previous bulk of evidence that various designs of implants can be loaded shortly after their placement in both the mandible and the maxilla. However, one study reported on marginal bone loss around a novel one-piece implant design leading to implant failure which was not seen for control two-piece implants.(3). PMID:18498589

  15. The growth factor-inducible immediate-early gene 3CH134 encodes a protein-tyrosine-phosphatase.

    PubMed Central

    Charles, C H; Sun, H; Lau, L F; Tonks, N K

    1993-01-01

    Stimulation of fibroblasts with serum growth factors results in the rapid activation of a set of immediate-early genes, among them 3CH134. We have purified a bacterially expressed form of the 3CH134-encoded polypeptide and demonstrated that it has intrinsic protein-tyrosine-phosphatase (PTPase; protein-tyrosine-phosphate phosphohydrolase, EC 3.1.3.48) activity in vitro. This activity is optimal at pH 7.5, is sensitive to vanadate and cysteinyl modifying agents, and is insensitive to a panel of serine/threonine phosphatase inhibitors. Purified 3CH134 protein displays a high degree of selectivity among the tyrosine-phosphorylated polypeptide substrates tested. Under our assay conditions, the rates of dephosphorylation are in the order EDNDYINASL peptide < myelin basic protein < reduced, carboxyamidomethylated, and maleylated lysozyme (RCML) < p42mapk. There is a 200-fold range in rates for these substrates, with p42mapk dephosphorylated 15-fold more rapidly than RCML. Although 3CH134 is most closely related to the tyrosine/serine dual-specificity phosphatase VH1, we failed to detect any 3CH134-directed activity on casein or RCML phosphorylated on serine/threonine residues by cAMP-dependent protein kinase. Since 3CH134 expression is controlled transcriptionally and posttranscriptionally, it may represent a class of PTPases whose activity is regulated at the level of protein synthesis and degradation. Images Fig. 1 Fig. 4 Fig. 5 Fig. 6 PMID:8389479

  16. Human cytomegalovirus (HCMV) immediate-early enhancer/promoter specificity during embryogenesis defines target tissues of congenital HCMV infection.

    PubMed Central

    Koedood, M; Fichtel, A; Meier, P; Mitchell, P J

    1995-01-01

    Congenital human cytomegalovirus (HCMV) infection is a common cause of deafness and neurological disabilities. Many aspects of this prenatal infection, including which cell types are infected and how infection proceeds, are poorly understood. Transcription of HCMV immediate-early (IE) genes is required for expression of all other HCMV genes and is dependent on host cell transcription factors. Cell type-specific differences in levels of IE transcription are believed to underlie differences in infection permissivity. However, DNA transfection experiments have paradoxically suggested that the HCMV major IE enhancer/promoter is a broadly active transcriptional element with little cell type specificity. In contrast, we show here that expression of a lacZ gene driven by the HCMV major IE enhancer/promoter -524 to +13 segment is restricted in transgenic mouse embryos to sites that correlate with known sites of congenital HCMV infection in human fetuses. This finding suggests that the IE enhancer/promoter is a major determinant of HCMV infection sites in humans and that transcription factors responsible for its regulation are cell type-specifically conserved between humans and mice. The lacZ expression patterns of these transgenic embryos yield insight into congenital HCMV pathogenesis by providing a spatiotemporal map of the sets of vascular, neural, and epithelial cells that are likely targets of infection. These transgenic mice may constitute a useful model system for investigating IE enhancer/promoter regulation in vivo and for identifying factors that modulate active and latent HCMV infections in humans. PMID:7884867

  17. Tightly regulated expression of Autographa californica multicapsid nucleopolyhedrovirus immediate early genes emerges from their interactions and possible collective behaviors.

    PubMed

    Ono, Chikako; Sato, Masanao; Taka, Hitomi; Asano, Shin-ichiro; Matsuura, Yoshiharu; Bando, Hisanori

    2015-01-01

    To infect their hosts, DNA viruses must successfully initiate the expression of viral genes that control subsequent viral gene expression and manipulate the host environment. Viral genes that are immediately expressed upon infection play critical roles in the early infection process. In this study, we investigated the expression and regulation of five canonical regulatory immediate-early (IE) genes of Autographa californica multicapsid nucleopolyhedrovirus: ie0, ie1, ie2, me53, and pe38. A systematic transient gene-expression analysis revealed that these IE genes are generally transactivators, suggesting the existence of a highly interactive regulatory network. A genetic analysis using gene knockout viruses demonstrated that the expression of these IE genes was tolerant to the single deletions of activator IE genes in the early stage of infection. A network graph analysis on the regulatory relationships observed in the transient expression analysis suggested that the robustness of IE gene expression is due to the organization of the IE gene regulatory network and how each IE gene is activated. However, some regulatory relationships detected by the genetic analysis were contradictory to those observed in the transient expression analysis, especially for IE0-mediated regulation. Statistical modeling, combined with genetic analysis using knockout alleles for ie0 and ie1, showed that the repressor function of ie0 was due to the interaction between ie0 and ie1, not ie0 itself. Taken together, these systematic approaches provided insight into the topology and nature of the IE gene regulatory network.

  18. Regulation of pseudorabies virus gG glycoprotein gene promoter independently of pseudorabies immediate early IE180 protein.

    PubMed

    Muñoz, A L; Torres, M; Martín, B; Lerma, L; Tabarés, E

    2010-04-01

    The pseudorabies virus (PRV) glycoprotein known as gG is generally regarded as an early protein, and the immediate early IE180 protein regulates its expression during infection. This study, however, provides evidence that although induction by IE180 is observed, the expression of a marker protein (EGFP), or gG itself, under the control of the gG promoter, can also occur independently of the expression of IE180. This result was demonstrated both with transient transfection assays using plasmids and with viral infections. In transient transfections, the expression under control of the gG promoter depends on the cell type and surprisingly, can be 1.3-fold higher than the expression under the control of the IE180 promoter in Hela Tet-Off cells. Recombinant PRV S3 was constructed by replacing gE in the PRV genome with a chimeric transgene, expressing EGFP under the control of the gG promoter. In PK15 cells infected with NIA-3 wild-type virus or with S3 recombinant virus, expression of gG PRV mRNA (or EGFP mRNA) under the control of the gG promoter in the presence of cycloheximide was detected by RT-PCR. This again indicates that some basal expression was produced in infected cells independently of IE180. This expression was augmented by IE180 protein in both plasmid transfections and viral infections.

  19. Calcium-dependent immediate-early gene induction in lymphocytes is negatively regulated by p21Ha-ras.

    PubMed

    Chen, C Y; Forman, L W; Faller, D V

    1996-11-01

    The induction of immediate-early (IE) response genes, such as egr-1, c-fos, and c-jun, occurs rapidly after the activation of T lymphocytes. The process of activation involves calcium mobilization, activation of protein kinase C (PKC), and phosphorylation of tyrosine kinases. p21(ras), a guanine nucleotide binding factor, mediates T-cell signal transduction through PKC-dependent and PKC-independent pathways. The involvement of p21(ras) in the regulation of calcium-dependent signals has been suggested through analysis of its role in the activation of NF-AT. We have investigated the inductions of the IE genes in response to calcium signals in Jurkat cells (in the presence of activated p21(ras)) and their correlated consequences. The expression of activated p21(ras) negatively regulated the induction of IE genes by calcium ionophore. This inhibition of calcium-activated IE gene induction was reversed by treatment with cyclosporin A, suggesting the involvement of calcineurin in this regulation. A later result of inhibition of this activation pathway by p21(ras) was down-regulation of the activity of the transcription factor AP-1 and subsequent coordinate reductions in IL-2 gene expression and protein production. These results suggest that p2l(ras) is an essential mediator in generating not only positive but also negative modulatory mechanisms controlling the competence of T cells in response to inductive stimulations.

  20. Immediate early gene response to hearing song correlates with receptive behavior and depends on dialect in a female songbird.

    PubMed

    Maney, D L; MacDougall-Shackleton, E A; MacDougall-Shackleton, S A; Ball, G F; Hahn, T P

    2003-09-01

    Stimulus-induced expression of the immediate early gene ZENK (egr-1) in the songbird's auditory forebrain presumably depends on the behavioral significance of the stimulus. Few studies, however, have quantified both the ZENK and behavioral responses to a stimulus in the same individuals. We played conspecific male song of either hatch (local) or foreign dialect to female white-crowned sparrows (Zonotrichia leucophrys oriantha) and quantified both the auditory ZENK response and their behavioral response, which is known to depend on dialect. Birds hearing hatch dialect showed greater ZENK induction in the caudomedial hyperstriatum ventrale and the dorsal portion of the caudomedial neostriatum than birds hearing foreign dialect, supporting previous work showing a relationship between ZENK and salience of the stimulus. In the dorsal portion of the caudomedial neostriatum, ZENK induction was correlated with the amount of non-vocal courtship behavior; however, in the caudomedial hyperstriatum ventrale, ZENK induction was more highly correlated with the females' own vocal behavior and thus may have been partly self-induced. Some females sang and showed a male-like pattern of ZENK induction in their song systems. This study provides the first evidence that the ZENK response in a sensory area to a social stimulus is proportional to the animal's preference for the stimulus.

  1. Identification of an immediate-early salicylic acid-inducible tobacco gene and characterization of induction by other compounds.

    PubMed

    Horvath, D M; Chua, N H

    1996-08-01

    Tobacco genes that are induced in response to salicylic acid (SA) treatment with immediate-early kinetics were identified by differential mRNA display. Detailed analysis of IS10a, one cDNA clone identified by this method, revealed induction within 30 min of treatment, with a peak of expression at 3 h, that decayed rapidly thereafter. Treatment with the protein synthesis inhibitor, cycloheximide (CHX), also caused induction of IS10a mRNA to comparable levels, but the IS10a mRNA continued to accumulate after 3 h of induction. In combination, CHX and SA led to a superinduction of IS10a mRNA levels that was also sustained. Half-maximal induction was evident at ca. 100-150 microM SA. In addition to SA, induction of IS10a occurred to varying degrees upon treatment with acetylsalicylic acid, benzoic acid, 2,4-dichlorophenoxyacetic acid, methyl jasmonate, and hydrogen peroxide, whereas treatment with other compounds had no effect. The proteins encoded by IS10a and a second highly homologous cDNA show sequence similarity to UDP-glucose: flavonoid glucosyltransferases.

  2. Late-phase expression of a murine cytomegalovirus immediate-early antigen recognized by cytolytic T lymphocytes.

    PubMed Central

    Reddehase, M J; Fibi, M R; Keil, G M; Koszinowski, U H

    1986-01-01

    The cloned murine cytolytic T-lymphocyte line IE1-IL and several sublines detect a murine cytomegalovirus immediate-early (IE) membrane determinant in conjunction with Ld class I major histocompatibility glycoprotein. The lines retained cytolytic activity, strict antigen specificity, and self-restriction even when adapted to long-term, antigen-independent growth in the presence of interleukin-2 only (M. J. Reddehase, H.-J. Bühring, and U. H. Koszinowski, J. Virol. 57:408-412). These attributes allowed us to use IE1-IL as a stable, monospecific probe for tracing the expression of the IE membrane antigen throughout the viral replication cycle. Presentation of the antigen at the cell membrane proved to be most effective when expression of IE genes in infected mouse embryo fibroblasts was selectively enhanced by consecutive cycloheximide-actinomycin D treatment, whereas without enhancement high numbers of IE1-IL cytolytic T lymphocytes were required to demonstrate the antigen in the IE phase. In the early phase of infection when IE genes were no longer transcribed, cytolysis was not observed, although IE proteins were detectable in the nuclei of the infected cells. Without application of inhibitors IE membrane antigen expression was most prominent during the late phase of infection. Reinitiation of transcription from the genomic region encoding the major IE protein (pp89) and de novo synthesis of pp89 correlated with this reexpression of the IE membrane antigen. Images PMID:2431160

  3. Saccule contribution to immediate early gene induction in the gerbil brainstem with posterior canal galvanic or hypergravity stimulation.

    PubMed

    Marshburn, T H; Kaufman, G D; Purcell, I M; Perachio, A A

    1997-06-27

    Immunolabeling patterns of the immediate early gene-related protein Fos in the gerbil brainstem were studied following stimulation of the sacculus by both hypergravity and galvanic stimulation. Head-restrained, alert animals were exposed to a prolonged (1 h) inertial vector of 2 G (19.6 m/s2) head acceleration directed in a dorso-ventral head axis to maximally stimulate the sacculus. Fos-defined immunoreactivity was quantified, and the results compared to a control group. The hypergravity stimulus produced Fos immunolabeling in the dorsomedial cell column (dmcc) of the inferior olive independently of other subnuclei. Similar dmcc labeling was induced by a 30 min galvanic stimulus of up to -100 microA applied through a stimulating electrode placed unilaterally on the bony labyrinth overlying the posterior canal (PC). The pattern of vestibular afferent firing activity induced by this galvanic stimulus was quantified in anesthetized gerbils by simultaneously recording from Scarpa's ganglion. Only saccular and PC afferent neurons exhibited increases in average firing rates of 200-300%, suggesting a pattern of current spread involving only PC and saccular afferent neurons at this level of stimulation. These results suggest that alteration in saccular afferent firing rates are sufficient to induce Fos-defined genomic activation of the dmcc, and lend further evidence to the existence of a functional vestibulo-olivary-cerebellar pathway of adaptation to novel gravito-inertial environments.

  4. Saccule contribution to immediate early gene induction in the gerbil brainstem with posterior canal galvanic or hypergravity stimulation

    NASA Technical Reports Server (NTRS)

    Marshburn, T. H.; Kaufman, G. D.; Purcell, I. M.; Perachio, A. A.

    1997-01-01

    Immunolabeling patterns of the immediate early gene-related protein Fos in the gerbil brainstem were studied following stimulation of the sacculus by both hypergravity and galvanic stimulation. Head-restrained, alert animals were exposed to a prolonged (1 h) inertial vector of 2 G (19.6 m/s2) head acceleration directed in a dorso-ventral head axis to maximally stimulate the sacculus. Fos-defined immunoreactivity was quantified, and the results compared to a control group. The hypergravity stimulus produced Fos immunolabeling in the dorsomedial cell column (dmcc) of the inferior olive independently of other subnuclei. Similar dmcc labeling was induced by a 30 min galvanic stimulus of up to -100 microA applied through a stimulating electrode placed unilaterally on the bony labyrinth overlying the posterior canal (PC). The pattern of vestibular afferent firing activity induced by this galvanic stimulus was quantified in anesthetized gerbils by simultaneously recording from Scarpa's ganglion. Only saccular and PC afferent neurons exhibited increases in average firing rates of 200-300%, suggesting a pattern of current spread involving only PC and saccular afferent neurons at this level of stimulation. These results suggest that alteration in saccular afferent firing rates are sufficient to induce Fos-defined genomic activation of the dmcc, and lend further evidence to the existence of a functional vestibulo-olivary-cerebellar pathway of adaptation to novel gravito-inertial environments.

  5. Activation of immediate-early response gene c-Fos protein in the rat paralimbic cortices after myocardial infarction

    PubMed Central

    Ahn, Ji Yun; Tae, Hyun-Jin; Cho, Jeong-Hwi; Kim, In Hye; Ahn, Ji Hyeon; Park, Joon Ha; Kim, Dong Won; Cho, Jun Hwi; Won, Moo-Ho; Hong, Seongkweon; Lee, Jae-Chul; Seo, Jeong Yeol

    2015-01-01

    c-Fos is a good biological marker for detecting the pathogenesis of central nervous system disorders. Few studies are reported on the change in myocardial infarction-induced c-Fos expression in the paralimbic regions. Thus, in this study, we investigated the changes in c-Fos expression in the rat cingulate and piriform cortices after myocardial infarction. Neuronal degeneration in cingulate and piriform cortices after myocardial infarction was detected using cresyl violet staining, NeuN immunohistochemistry and Fluoro-Jade B histofluorescence staining. c-Fos-immunoreactive cells were observed in cingulate and piriform cortices at 3 days after myocardial infarction and peaked at 7 and 14 days after myocardial infarction. But they were hardly observed at 56 days after myocardial infarction. The chronological change of c-Fos expression determined by western blot analysis was basically the same as that of c-Fos immunoreactivity. These results indicate that myocardial infarction can cause the chronological change of immediate-early response gene c-Fos protein expression, which might be associated with the neural activity induced by myocardial infarction. PMID:26487852

  6. Luteolin inhibits Epstein-Barr virus lytic reactivation by repressing the promoter activities of immediate-early genes.

    PubMed

    Wu, Chung-Chun; Fang, Chih-Yeu; Hsu, Hui-Yu; Chen, Yen-Ju; Chou, Sheng-Ping; Huang, Sheng-Yen; Cheng, Yu-Jhen; Lin, Su-Fang; Chang, Yao; Tsai, Ching-Hwa; Chen, Jen-Yang

    2016-08-01

    The lytic reactivation of Epstein-Barr virus (EBV) has been reported to be strongly associated with several human diseases, including nasopharyngeal carcinoma (NPC). Inhibition of the EBV lytic cycle has been shown to be of great benefit in the treatment of EBV-associated diseases. The administration of dietary compounds is safer and more convenient than other approaches to preventing EBV reactivation. We screened several dietary compounds for their ability to inhibit EBV reactivation in NPC cells. Among them, the flavonoid luteolin showed significant inhibition of EBV reactivation. Luteolin inhibited protein expression from EBV lytic genes in EBV-positive epithelial and B cell lines. It also reduced the numbers of EBV-reactivating cells detected by immunofluorescence analysis and reduced the production of virion. Furthermore, luteolin reduced the activities of the promoters of the immediate-early genes Zta (Zp) and Rta (Rp) and also inhibited Sp1-luc activity, suggesting that disruption of Sp1 binding is involved in the inhibitory mechanism. CHIP analysis revealed that luteolin suppressed the activities of Zp and Rp by deregulating Sp1 binding. Taken together, luteolin inhibits EBV reactivation by repressing the promoter activities of Zp and Rp, suggesting luteolin is a potential dietary compound for prevention of virus infection.

  7. Central precocious puberty in a patient with X-linked adrenal hypoplasia congenita and Xp21 contiguous gene deletion syndrome.

    PubMed

    Koh, Ji Won; Kang, So Young; Kim, Gu Hwan; Yoo, Han Wook; Yu, Jeesuk

    2013-06-01

    X-linked adrenal hypoplasia congenita is caused by the mutation of DAX-1 gene (dosage-sensitive sex reversal, adrenal hypoplasia critical region, on chromosome X, gene 1), and can occur as part of a contiguous gene deletion syndrome in association with glycerol kinase (GK) deficiency, Duchenne muscular dystrophy and X-linked interleukin-1 receptor accessory protein-like 1 (IL1RAPL1) gene deficiency. It is usually associated with hypogonadotropic hypogonadism, although in rare cases, it has been reported to occur in normal puberty or even central precocious puberty. This study addresses a case in which central precocious puberty developed in a boy with X-linked adrenal hypoplasia congenita who had complete deletion of the genes DAX-1, GK and IL1RAPL1 (Xp21 contiguous gene deletion syndrome). Initially he was admitted for the management of adrenal crisis at the age of 2 months, and managed with hydrocortisone and florinef. At 45 months of age, his each testicular volumes of 4 mL and a penile length of 5 cm were noted, with pubic hair of Tanner stage 2. His bone age was advanced and a gonadotropin-releasing hormone (GnRH) stimulation test showed a luteinizing hormone peak of 8.26 IU/L, confirming central precocious puberty. He was then treated with a GnRH agonist, as well as steroid replacement therapy. In Korea, this is the first case of central precocious puberty developed in a male patient with X-linked adrenal hypoplasia congenita. PMID:24904859

  8. Immediate-Early Gene Transcriptional Activation in Hippocampus Ca1 and Ca3 Does Not Accurately Reflect Rapid, Pattern Completion-Based Retrieval of Context Memory

    ERIC Educational Resources Information Center

    Pevzner, Aleksandr; Guzowski, John F.

    2015-01-01

    No studies to date have examined whether immediate-early gene (IEG) activation is driven by context memory recall. To address this question, we utilized the context preexposure facilitation effect (CPFE) paradigm. In CPFE, animals acquire contextual fear conditioning through hippocampus-dependent rapid retrieval of a previously formed contextual…

  9. Downregulation of immediate-early genes linking to suppression of neuronal plasticity in rats after 28-day exposure to glycidol.

    PubMed

    Akane, Hirotoshi; Saito, Fumiyo; Shiraki, Ayako; Takeyoshi, Masahiro; Imatanaka, Nobuya; Itahashi, Megu; Murakami, Tomoaki; Shibutani, Makoto

    2014-09-01

    We previously found that the 28-day oral toxicity study of glycidol at 200mg/kg/day in rats resulted in axonopathy in both the central and peripheral nervous systems and aberrations in the late-stage of hippocampal neurogenesis targeting the process of neurite extension. To capture the neuronal parameters in response to glycidol toxicity, these animals were subjected to region-specific global gene expression profiling in four regions of cerebral and cerebellar architectures, followed by immunohistochemical analysis of selected gene products. Expression changes of genes related to axonogenesis and synaptic transmission were observed in the hippocampal dentate gyrus, cingulate cortex and cerebellar vermis at 200mg/kg showing downregulation in most genes. In the corpus callosum, genes related to growth, survival and functions of glial cells fluctuated their expression. Immunohistochemically, neurons expressing gene products of immediate-early genes, i.e., Arc, Fos and Jun, decreased in their number in the dentate granule cell layer, cingulate cortex and cerebellar vermis. We also applied immunohistochemical analysis in rat offspring after developmental exposure to glycidol through maternal drinking water. The results revealed increases of Arc(+) neurons at 1000ppm and Fos(+) neurons at ≥300ppm in the dentate granule cell layer of offspring only at the adult stage. These results suggest that glycidol suppressed neuronal plasticity in the brain after 28-day exposure to young adult animals, in contrast to the operation of restoration mechanism to increase neuronal plasticity at the adult stage in response to aberrations in neurogenesis after developmental exposure.

  10. Downregulation of immediate-early genes linking to suppression of neuronal plasticity in rats after 28-day exposure to glycidol

    SciTech Connect

    Akane, Hirotoshi; Saito, Fumiyo; Shiraki, Ayako; Takeyoshi, Masahiro; Imatanaka, Nobuya; Itahashi, Megu; Murakami, Tomoaki; Shibutani, Makoto

    2014-09-01

    We previously found that the 28-day oral toxicity study of glycidol at 200 mg/kg/day in rats resulted in axonopathy in both the central and peripheral nervous systems and aberrations in the late-stage of hippocampal neurogenesis targeting the process of neurite extension. To capture the neuronal parameters in response to glycidol toxicity, these animals were subjected to region-specific global gene expression profiling in four regions of cerebral and cerebellar architectures, followed by immunohistochemical analysis of selected gene products. Expression changes of genes related to axonogenesis and synaptic transmission were observed in the hippocampal dentate gyrus, cingulate cortex and cerebellar vermis at 200 mg/kg showing downregulation in most genes. In the corpus callosum, genes related to growth, survival and functions of glial cells fluctuated their expression. Immunohistochemically, neurons expressing gene products of immediate-early genes, i.e., Arc, Fos and Jun, decreased in their number in the dentate granule cell layer, cingulate cortex and cerebellar vermis. We also applied immunohistochemical analysis in rat offspring after developmental exposure to glycidol through maternal drinking water. The results revealed increases of Arc{sup +} neurons at 1000 ppm and Fos{sup +} neurons at ≥ 300 ppm in the dentate granule cell layer of offspring only at the adult stage. These results suggest that glycidol suppressed neuronal plasticity in the brain after 28-day exposure to young adult animals, in contrast to the operation of restoration mechanism to increase neuronal plasticity at the adult stage in response to aberrations in neurogenesis after developmental exposure. - Highlights: • Neuronal toxicity parameters after 28-day glycidol treatment were examined in rats. • Region-specific global gene expression profiling was conducted in brain regions. • Cortical tissues downregulated genes on axonogenesis and synaptic transmission. • Cortical tissues

  11. Immediate early gene expression reveals interactions between social and nicotine rewards on brain activity in adolescent male rats.

    PubMed

    Bastle, Ryan M; Peartree, Natalie A; Goenaga, Julianna; Hatch, Kayla N; Henricks, Angela; Scott, Samantha; Hood, Lauren E; Neisewander, Janet L

    2016-10-15

    Smoking initiation predominantly occurs during adolescence, often in the presence of peers. Therefore, understanding the neural mechanisms underlying the rewarding effects of nicotine and social stimuli is vital. Using the conditioned place preference (CPP) procedure, we measured immediate early gene (IEG) expression in animals following exposure either to a reward-conditioned environment or to the unconditioned stimuli (US). Adolescent, male rats were assigned to the following CPP US conditions: (1) Saline+Isolated, (2) Nicotine+Isolated, (3) Saline+Social, or (4) Nicotine+Social. For Experiment 1, brain tissue was collected 90min following the CPP expression test and processed for Fos immunohistochemistry. We found that rats conditioned with nicotine with or without a social partner exhibited CPP; however, we found no group differences in Fos expression in any brain region analyzed, with the exception of the nucleus accumbens core that exhibited a social-induced attenuation in Fos expression. For Experiment 2, brain tissue was collected 90min following US exposure during the last conditioning session. We found social reward-induced increases in IEG expression in striatal and amydalar subregions. In contrast, nicotine reduced IEG expression in prefrontal and striatal subregions. Reward interactions were also found in the dorsolateral striatum, basolateral amygdala, and ventral tegmental area where nicotine alone attenuated IEG expression and social reward reversed this effect. These results suggest that in general social rewards enhance, whereas nicotine attenuates, activation of mesocorticolimbic regions; however, the rewards given together interact to enhance activation in some regions. The findings contribute to knowledge of how a social environment influences nicotine effects.

  12. Human Immunodeficiency Virus Type 1 (HIV-1) Vpr Functions as an Immediate-Early Protein during HIV-1 Infection

    PubMed Central

    Hrimech, Mohammed; Yao, Xiao-Jian; Bachand, François; Rougeau, Nicole; Cohen, Éric A.

    1999-01-01

    Human immunodeficiency virus type 1 (HIV-1) Vpr is a virion-associated protein which facilitates HIV-1 infection of nondividing cells by contributing to the nuclear transport of the preintegration complex (PIC). Vpr was also shown to induce a cell cycle G2 arrest in infected proliferating cells that optimizes HIV-1 long terminal repeat (LTR)-directed gene expression and viral production. However, it is unclear whether this activity is mediated primarily early by virion-associated Vpr or alternatively late during infection when Vpr is de novo expressed. We report here that in the absence of de novo expression, virion-associated Vpr induces a transient G2 arrest that can subsequently lead to cell killing by apoptosis. Interestingly, the induction of both cell cycle G2 arrest and apoptosis by virion-associated Vpr requires viral entry but not viral replication, since reverse transcriptase and protease inhibitor treatments do not prevent these Vpr effects. These results raise the possibility that in vivo both infectious and noninfectious viruses contribute to the dysfunction and killing of CD4+ cells. In addition, our results reveal that virion-associated Vpr stimulates viral replication in proliferating cells after establishing a cell cycle G2 arrest by increasing LTR-directed gene expression. Importantly, this Vpr-mediated LTR activation appears to be a requirement for subsequent optimal Tat transactivation. Taken together, these results strongly suggest that in addition to participating in the HIV PIC nuclear transport in nondividing cells, virion-associated Vpr activates HIV-1 LTR-directed gene expression by manipulating the host cell cycle. From this, we conclude that Vpr functions as an immediate-early protein during HIV-1 infection. PMID:10196306

  13. Possible involvement of hippocampal immediate-early genes in contextual fear memory deficit induced by cranial irradiation.

    PubMed

    Son, Yeonghoon; Kang, Sohi; Kim, Jinwook; Lee, Sueun; Kim, Jong-Choon; Kim, Sung-Ho; Kim, Joong-Sun; Jo, Sung-Kee; Jung, Uhee; Youn, BuHyun; Shin, Taekyun; Yang, Miyoung; Moon, Changjong

    2016-09-01

    Cranial irradiation can trigger adverse effects on brain functions, including cognitive ability. However, the cellular and molecular mechanisms underlying radiation-induced cognitive impairments remain still unknown. Immediate-early genes (IEGs) are implicated in neuronal plasticity and the related functions (i.e., memory formation) in the hippocampus. The present study quantitatively assessed changes in the mRNA and protein levels of the learning-induced IEGs, including Arc, c-fos, and zif268, in the mouse hippocampus after cranial irradiation using quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) and immunohistochemistry, respectively. Mice (male, 8-week-old C57BL/6) received whole-brain irradiation with 0 or 10Gy of gamma-ray and, 2weeks later, contextual fear conditioning (CFC) was used to induce IEGs. In the CFC task, mice evaluated 2weeks after irradiation exhibited significant memory deficits compared with sham (0Gy)-irradiated controls. The levels of mRNA encoding IEGs were significantly upregulated in the hippocampus 10 and 30min after CFC training. The mRNA levels in the irradiated hippocampi were significantly lower than those in the sham-irradiated controls. The IEG protein levels were significantly increased in all hippocampal regions, including the hippocampal dentate gyrus, cornu ammonis (CA)1, and CA3, after CFC training. The CFC-induced upregulation of Arc and c-fos in 10Gy-irradiated hippocampi was significantly lower than that in sham-irradiated controls, although there were no significant differences in the protein levels of the learning-induced zif268 between sham-irradiated and 10Gy-irradiated hippocampi. Thus, cranial irradiation with 10Gy of gamma-ray impairs the induction of hippocampal IEGs (particularly Arc and c-fos) via behavioral contextual fear memory, and this disturbance may be associated with the memory deficits evident in mice after cranial irradiation, possibly through the dysregulation of neuronal

  14. Sex and strategy use matters for pattern separation, adult neurogenesis, and immediate early gene expression in the hippocampus.

    PubMed

    Yagi, Shunya; Chow, Carmen; Lieblich, Stephanie E; Galea, Liisa A M

    2016-01-01

    Adult neurogenesis in the dentate gyrus (DG) plays a crucial role for pattern separation, and there are sex differences in the regulation of neurogenesis. Although sex differences, favoring males, in spatial navigation have been reported, it is not known whether there are sex differences in pattern separation. The current study was designed to determine whether there are sex differences in the ability for separating similar or distinct patterns, learning strategy choice, adult neurogenesis, and immediate early gene (IEG) expression in the DG in response to pattern separation training. Male and female Sprague-Dawley rats received a single injection of the DNA synthesis marker, bromodeoxyuridine (BrdU), and were tested for the ability of separating spatial patterns in a spatial pattern separation version of delayed nonmatching to place task using the eight-arm radial arm maze. Twenty-seven days following BrdU injection, rats received a probe trial to determine whether they were idiothetic or spatial strategy users. We found that male spatial strategy users outperformed female spatial strategy users only when separating similar, but not distinct, patterns. Furthermore, male spatial strategy users had greater neurogenesis in response to pattern separation training than all other groups. Interestingly, neurogenesis was positively correlated with performance on similar pattern trials during pattern separation in female spatial strategy users but negatively correlated with performance in male idiothetic strategy users. These results suggest that the survival of new neurons may play an important positive role for pattern separation of similar patterns in females. Furthermore, we found sex and strategy differences in IEG expression in the CA1 and CA3 regions in response to pattern separation. These findings emphasize the importance of studying biological sex on hippocampal function and neural plasticity.

  15. Levetiracetam attenuates hippocampal expression of synaptic plasticity-related immediate early and late response genes in amygdala-kindled rats

    PubMed Central

    2010-01-01

    Background The amygdala-kindled rat is a model for human temporal lobe epilepsy and activity-dependent synaptic plasticity. Hippocampal RNA isolated from amygdala-kindled rats at different kindling stages was analyzed to identify kindling-induced genes. Furthermore, effects of the anti-epileptic drug levetiracetam on kindling-induced gene expression were examined. Results Cyclooxygenase-2 (Cox-2), Protocadherin-8 (Pcdh8) and TGF-beta-inducible early response gene-1 (TIEG1) were identified and verified as differentially expressed transcripts in the hippocampus of kindled rats by in situ hybridization and quantitative RT-PCR. In addition, we identified a panel of 16 additional transcripts which included Arc, Egr3/Pilot, Homer1a, Ania-3, MMP9, Narp, c-fos, NGF, BDNF, NT-3, Synaptopodin, Pim1 kinase, TNF-α, RGS2, Egr2/krox-20 and β-A activin that were differentially expressed in the hippocampus of amygdala-kindled rats. The list consists of many synaptic plasticity-related immediate early genes (IEGs) as well as some late response genes encoding transcription factors, neurotrophic factors and proteins that are known to regulate synaptic remodelling. In the hippocampus, induction of IEG expression was dependent on the afterdischarge (AD) duration. Levetiracetam, 40 mg/kg, suppressed the development of kindling measured as severity of seizures and AD duration. In addition, single animal profiling also showed that levetiracetam attenuated the observed kindling-induced IEG expression; an effect that paralleled the anti-epileptic effect of the drug on AD duration. Conclusions The present study provides mRNA expression data that suggest that levetiracetam attenuates expression of genes known to regulate synaptic remodelling. In the kindled rat, levetiracetam does so by shortening the AD duration thereby reducing the seizure-induced changes in mRNA expression in the hippocampus. PMID:20105316

  16. Type I Interferon Released by Myeloid Dendritic Cells Reversibly Impairs Cytomegalovirus Replication by Inhibiting Immediate Early Gene Expression

    PubMed Central

    Holzki, Julia Katharina; Dağ, Franziska; Dekhtiarenko, Iryna; Rand, Ulfert; Casalegno-Garduño, Rosaely; Trittel, Stephanie; May, Tobias; Riese, Peggy

    2015-01-01

    ABSTRACT Cytomegalovirus (CMV) is a ubiquitous beta-herpesvirus whose reactivation from latency is a major cause of morbidity and mortality in immunocompromised hosts. Mouse CMV (MCMV) is a well-established model virus to study virus-host interactions. We showed in this study that the CD8-independent antiviral function of myeloid dendritic cells (mDC) is biologically relevant for the inhibition of MCMV replication in vivo and in vitro. In vivo ablation of CD11c+ DC resulted in higher viral titers and increased susceptibility to MCMV infection in the first 3 days postinfection. We developed in vitro coculture systems in which we cocultivated MCMV-infected endothelial cells or fibroblasts with T cell subsets and/or dendritic cells. While CD8 T cells failed to control MCMV replication, bone marrow-derived mDC reduced viral titers by a factor of up to 10,000. Contact of mDC with the infected endothelial cells was crucial for their antiviral activity. Soluble factors secreted by the mDC blocked MCMV replication at the level of immediate early (IE) gene expression, yet the viral lytic cycle reinitiated once the mDC were removed from the cells. On the other hand, the mDC did not impair MCMV replication in cells deficient for the interferon (IFN) alpha/beta receptor (IFNAR), arguing that type I interferons were critical for viral control by mDC. In light of our recent observation that type I IFN is sufficient for the induction of latency immediately upon infection, our results imply that IFN secreted by mDC may play an important role in the establishment of CMV latency. IMPORTANCE Numerous studies have focused on the infection of DC with cytomegaloviruses and on the establishment of latency within them. However, almost all of these studies have relied on the infection of DC monocultures in vitro, whereas DC are just one among many cell types present in an infection site in vivo. To mimic this aspect of the in vivo situation, we cocultured DC with infected endothelial cells

  17. Gene Deletion Screen for Cardiomyopathy in Adult Drosophila Identifies a New Notch Ligand

    PubMed Central

    Kim, Il-Man; Wolf, Matthew J.; Rockman, Howard A.

    2010-01-01

    Rationale Drosophila has been recognized as a model to study human cardiac diseases. Objective Despite these findings, and the wealth of tools that are available to the fly community, forward genetic screens for adult heart phenotypes have been rarely performed due to the difficulty in accurately measuring cardiac function in adult Drosophila. Methods and Results Using optical coherence tomography to obtain real-time analysis of cardiac function in awake Drosophila, we performed a genomic deficiency screen in adult flies. Based on multiple complementary approaches, we identified CG31665 as a novel gene causing dilated cardiomyopathy. CG31665, which we name weary (wry), has structural similarities to members of the Notch family. Using cell aggregation assays and γ-secretase inhibitors we show that Wry is a novel Notch ligand that can mediate cellular adhesion with Notch expressing cells and transactivates Notch to promote signaling and nuclear transcription. Importantly, Wry lacks a DSL (Delta-Serrate-Lag) domain that is common feature to the other Drosophila Notch ligands. We further show that Notch signaling is critically important for the maintenance of normal heart function of the adult fly. Conclusions In conclusion, we identify a previously unknown Notch ligand in Drosophila that when deleted causes cardiomyopathy. Our study suggests that Notch signaling components may be a therapeutic target for dilated cardiomyopathy. PMID:20203305

  18. Sensitive non-isotopic DNA hybridisation assay or immediate-early antigen detection for rapid identification of human cytomegalovirus in urine.

    PubMed

    Kimpton, C P; Morris, D J; Corbitt, G

    1991-04-01

    A sensitive non-radioactive DNA hybridisation assay employing digoxigenin-labelled probes was compared with immediate-early antigen detection and conventional virus isolation for the identification of human cytomegalovirus (HCMV) in 249 urine samples. Of 44 specimens yielding HCMV by virus isolation, more were positive by DNA hybridisation (32; 73%) than by immediate-early antigen detection (25; 52%) (P = 0.05). The specificity of the hybridisation assay in 45 apparently falsely positive specimens was supported by detection of HCMV DNA in 40 of these specimens using the polymerase chain reaction. Many urine specimens may thus contain large amounts of non-viable virus or free viral DNA. Evaluation of various protocols for the extraction and denaturation of virus DNA prior to hybridisation showed that proteinase K digestion with phenol/chloroform extraction was the most sensitive and reliable procedure. We conclude that the non-radioactive DNA hybridisation assay described is a potentially valuable routine diagnostic test.

  19. The Contribution of Whole Gene Deletions and Large Rearrangements to the Mutation Spectrum in Inherited Tumor Predisposing Syndromes.

    PubMed

    Smith, Miriam J; Urquhart, Jill E; Harkness, Elaine F; Miles, Emma K; Bowers, Naomi L; Byers, Helen J; Bulman, Michael; Gokhale, Carolyn; Wallace, Andrew J; Newman, William G; Evans, D Gareth

    2016-03-01

    Heterozygous whole gene deletions (WGDs), and intragenic microdeletions, account for a significant proportion of mutations underlying cancer predisposition syndromes. We analyzed the frequency and genotype-phenotype correlations of microdeletions in 12 genes (BRCA1, BRCA2, TP53, MSH2, MLH1, MSH6, PMS2, NF1, NF2, APC, PTCH1, and VHL) representing seven tumor predisposition syndromes in 5,897 individuals (2,611 families) from our center. Overall, microdeletions accounted for 14% of identified mutations. As expected, smaller deletions or duplications were more common (12%) than WGDs (2.2%). Where a WGD was identified in the germline in NF2, the mechanism of somatic second hit was not deletion, as previously described for NF1. For neurofibromatosis type 1 and 2, we compared the mechanism of germline deletion. Unlike NF1, where three specific deletion sizes account for most germline WGDs, NF2 deletion breakpoints were different across seven samples tested. One of these deletions was 3.93 Mb and conferred a severe phenotype, thus refining the region for a potential NF2 modifier gene to a 2.04-Mb region on chromosome 22. The milder phenotype of NF2 WGDs may be due to the apparent absence of chromosome 22 loss as the second hit. These observations of WGD phenotypes will be helpful for interpreting incidental findings from microarray analysis and next-generation sequencing. PMID:26615784

  20. Gene deleted live attenuated Leishmania vaccine candidates against visceral leishmaniasis elicit pro-inflammatory cytokines response in human PBMCs.

    PubMed

    Avishek, Kumar; Kaushal, Himanshu; Gannavaram, Sreenivas; Dey, Ranadhir; Selvapandiyan, Angamuthu; Ramesh, V; Negi, Narender Singh; Dubey, Uma S; Nakhasi, Hira L; Salotra, Poonam

    2016-01-01

    Currently no effective vaccine is available for human visceral leishmaniasis(VL) caused by Leishmania donovani. Previously, we showed that centrin1 and p27gene deleted live attenuated Leishmania parasites (LdCen1(-/-) and Ldp27(-/-)) are safe, immunogenic and protective in animal models. Here, to assess the correlates of protection, we evaluated immune responses induced by LdCen1(-/-) and Ldp27(-/-) in human blood samples obtained from healthy, healed VL (HVL), post kala-azar dermal leishmaniasis(PKDL) and VL subjects. Both parasites infected human macrophages, as effectively as the wild type parasites. Further, LdCen1(-/-) and Ldp27(-/-) strongly stimulated production of pro-inflammatory cytokines including, IL-12, IFN-γ, TNF-α, IL-2, IL-6 and IL-17 in the PBMCs obtained from individuals with a prior exposure to Leishmania (HVL and PKDL). There was no significant stimulation of anti-inflammatory cytokines (IL-4 and IL-10). Induction of Th1 biased immune responses was supported by a remarkable increase in IFN-γ secreting CD4(+) and CD8(+) T cells and IL-17 secreting CD4(+) cells in PBMCs from HVL cases with no increase in IL-10 secreting T cells. Hence, LdCen1(-/-) and Ldp27(-/-) are promising as live vaccine candidates against VL since they elicit strong protective immune response in human PBMCs from HVL, similar to the wild type parasite infection, mimicking a naturally acquired protection following cure. PMID:27624408

  1. Topographical evaluation of behavioural phenotype in a line of mice with targeted gene deletion of the D2 dopamine receptor.

    PubMed

    Clifford, J J; Usiello, A; Vallone, D; Kinsella, A; Borrelli, E; Waddington, J L

    2000-01-28

    The phenotype of spontaneous and dopamine D2-like agonist-induced behaviour was assessed topographically in a line of mice with targeted gene deletion of the D1 receptor. An ethologically-based, rapid time-sampling behavioural check-list technique was used to resolve and quantify all behaviours in the natural repertoire of the mouse. Relative to wildtypes [D2+/+], D2-null [D2-/-] mice evidenced over a 1 h period of initial exploration modest but significant reductions in locomotion, grooming, rearing free and rearing to wall; rearing seated, sniffing, sifting and stillness were not altered. Individual elements of behaviour habituated similarly over a 6 h period for both genotypes. The dose-dependent induction of stereotyped sniffing and ponderous locomotion by the D2-like agonist RU 24213 (0.1-12.5 mg/kg) in wildtypes was essentially absent in D2-null mice. The ethogram of spontaneous behaviour in D2-null mice was characterised by only modest reductions in, and topographical shifts between, certain individual elements of behaviour. Essential abolition of D2-like agonist responsivity in D2-null mice vis-à-vis considerable preservation of spontaneous behavioural topography suggests compensatory processes subsequent to developmental absence of the D2 receptor that are able to sustain function under naturalistic, tonic conditions but not during phasic challenge. PMID:10698004

  2. CNS-restricted Transduction and CRISPR/Cas9-mediated Gene Deletion with an Engineered AAV Vector.

    PubMed

    Murlidharan, Giridhar; Sakamoto, Kensuke; Rao, Lavanya; Corriher, Travis; Wang, Dan; Gao, Guangping; Sullivan, Patrick; Asokan, Aravind

    2016-01-01

    Gene therapy using recombinant adeno-associated viral (AAV) vectors is emerging as a promising approach to treat central nervous system disorders such as Spinal muscular atrophy, Batten, Parkinson and Alzheimer disease amongst others. A critical remaining challenge for central nervous system-targeted gene therapy, silencing or gene editing is to limit potential vector dose-related toxicity in off-target cells and organs. Here, we characterize a lab-derived AAV chimeric (AAV2g9), which displays favorable central nervous system attributes derived from both parental counterparts, AAV2 and AAV9. This synthetic AAV strain displays preferential, robust, and widespread neuronal transduction within the brain and decreased glial tropism. Importantly, we observed minimal systemic leakage, decreased sequestration and gene transfer in off-target organs with AAV2g9, when administered into the cerebrospinal fluid. A single intracranial injection of AAV2g9 vectors encoding guide RNAs targeting the schizophrenia risk gene MIR137 (encoding MIR137) in CRISPR/Cas9 knockin mice resulted in brain-specific gene deletion with no detectable events in the liver. This engineered AAV vector is a promising platform for treating neurological disorders through gene therapy, silencing or editing modalities. PMID:27434683

  3. Double gene deletion reveals the lack of cooperation between PPAR{alpha} and PPAR{beta} in skeletal muscle

    SciTech Connect

    Bedu, E.; Desplanches, D.; Pequignot, J.; Bordier, B.; Desvergne, B. . E-mail: beatrice.desvergne@unil.ch

    2007-06-15

    The peroxisome proliferator-activated receptors (PPARs) are involved in the regulation of most of the pathways linked to lipid metabolism. PPAR{alpha} and PPAR{beta} isotypes are known to regulate muscle fatty acid oxidation and a reciprocal compensation of their function has been proposed. Herein, we investigated muscle contractile and metabolic phenotypes in PPAR{alpha}-/-, PPAR{beta}-/-, and double PPAR{alpha}-/- {beta}-/- mice. Heart and soleus muscle analyses show that the deletion of PPAR{alpha} induces a decrease of the HAD activity ({beta}-oxidation) while soleus contractile phenotype remains unchanged. A PPAR{beta} deletion alone has no effect. However, these mild phenotypes are not due to a reciprocal compensation of PPAR{beta} and PPAR{alpha} functions since double gene deletion PPAR{alpha}-PPAR{beta} mostly reproduces the null PPAR{alpha}-mediated reduced {beta}-oxidation, in addition to a shift from fast to slow fibers. In conclusion, PPAR{beta} is not required for maintaining skeletal muscle metabolic activity and does not compensate the lack of PPAR{alpha} in PPAR{alpha} null mice.

  4. In-Frame and Unmarked Gene Deletions in Burkholderia cenocepacia via an Allelic Exchange System Compatible with Gateway Technology

    PubMed Central

    Fazli, Mustafa; Harrison, Joe J.; Gambino, Michela; Givskov, Michael

    2015-01-01

    Burkholderia cenocepacia is an emerging opportunistic pathogen causing life-threatening infections in immunocompromised individuals and in patients with cystic fibrosis, which are often difficult, if not impossible, to treat. Understanding the genetic basis of virulence in this emerging pathogen is important for the development of novel treatment regimes. Generation of deletion mutations in genes predicted to encode virulence determinants is fundamental to investigating the mechanisms of pathogenesis. However, there is a lack of appropriate selectable and counterselectable markers for use in B. cenocepacia, making its genetic manipulation problematic. Here we describe a Gateway-compatible allelic exchange system based on the counterselectable pheS gene and the I-SceI homing endonuclease. This system provides efficiency in cloning homology regions of target genes and allows the generation of precise and unmarked gene deletions in B. cenocepacia. As a proof of concept, we demonstrate its utility by deleting the Bcam1349 gene, encoding a cyclic di-GMP (c-di-GMP)-responsive regulator protein important for biofilm formation. PMID:25795676

  5. Analysis of Noncanonical Calcium-Dependent Protein Kinases in Toxoplasma gondii by Targeted Gene Deletion Using CRISPR/Cas9

    PubMed Central

    Long, Shaojun; Wang, Qiuling

    2016-01-01

    Calcium-dependent protein kinases (CDPKs) are expanded in apicomplexan parasites, especially in Toxoplasma gondii where 14 separate genes encoding these enzymes are found. Although previous studies have shown that several CDPKs play a role in controlling invasion, egress, and cell division in T. gondii, the roles of most of these genes are unexplored. Here we developed a more efficient method for gene disruption using CRISPR (clustered regularly interspaced short palindromic repeats)/Cas9 (CRISPR-associated protein 9) that was modified to completely delete large, multiexonic genes from the genome and to allow serial replacement by recycling of the selectable marker using Cre-loxP. Using this system, we generated a total of 24 mutants in type 1 and 2 genetic backgrounds to ascertain the functions of noncanonical CDPKs. Remarkably, although we were able to confirm the essentiality of CDPK1 and CDPK7, the majority of CDPKs had no discernible phenotype for growth in vitro or infection in the mouse model. The exception to this was CDPK6, loss of which leads to reduced plaquing, fitness defect in a competition assay, and reduced tissue cyst formation in chronically infected mice. Our findings highlight the utility of CRISPR/Cas9 for rapid serial gene deletion and also suggest that additional models are needed to reveal the functions of many genes in T. gondii. PMID:26755159

  6. Use of the Meganuclease I-SceI of Saccharomyces cerevisiae to select for gene deletions in actinomycetes

    PubMed Central

    Fernández-Martínez, Lorena T.; Bibb, Mervyn J.

    2014-01-01

    The search for new natural products is leading to the isolation of novel actinomycete species, many of which will ultimately require genetic analysis. Some of these isolates will likely exhibit low intrinsic frequencies of homologous recombination and fail to sporulate under laboratory conditions, exacerbating the construction of targeted gene deletions and replacements in genetically uncharacterised strains. To facilitate the genetic manipulation of such species, we have developed an efficient method to generate gene or gene cluster deletions in actinomycetes by homologous recombination that does not introduce any other changes to the targeted organism's genome. We have synthesised a codon optimised I-SceI gene for expression in actinomycetes that results in the production of the yeast I-SceI homing endonuclease which produces double strand breaks at a unique introduced 18 base pair recognition sequence. Only those genomes that undergo homologous recombination survive, providing a powerful selection for recombinants, approximately half of which possess the desired mutant genotype. To demonstrate the efficacy and efficiency of the system, we deleted part of the gene cluster for the red-pigmented undecylprodiginine complex of compounds in Streptomyces coelicolor M1141. We believe that the system we have developed will be broadly applicable across a wide range of actinomycetes. PMID:25403842

  7. Use of the meganuclease I-SceI of Saccharomyces cerevisiae to select for gene deletions in actinomycetes.

    PubMed

    Fernández-Martínez, Lorena T; Bibb, Mervyn J

    2014-11-18

    The search for new natural products is leading to the isolation of novel actinomycete species, many of which will ultimately require genetic analysis. Some of these isolates will likely exhibit low intrinsic frequencies of homologous recombination and fail to sporulate under laboratory conditions, exacerbating the construction of targeted gene deletions and replacements in genetically uncharacterised strains. To facilitate the genetic manipulation of such species, we have developed an efficient method to generate gene or gene cluster deletions in actinomycetes by homologous recombination that does not introduce any other changes to the targeted organism's genome. We have synthesised a codon optimised I-SceI gene for expression in actinomycetes that results in the production of the yeast I-SceI homing endonuclease which produces double strand breaks at a unique introduced 18 base pair recognition sequence. Only those genomes that undergo homologous recombination survive, providing a powerful selection for recombinants, approximately half of which possess the desired mutant genotype. To demonstrate the efficacy and efficiency of the system, we deleted part of the gene cluster for the red-pigmented undecylprodiginine complex of compounds in Streptomyces coelicolor M1141. We believe that the system we have developed will be broadly applicable across a wide range of actinomycetes.

  8. The product of Kaposi's sarcoma-associated herpesvirus immediate early gene K4.2 regulates immunoglobulin secretion and calcium homeostasis by interacting with and inhibiting pERP1.

    PubMed

    Wong, Lai-Yee; Brulois, Kevin; Toth, Zsolt; Inn, Kyung-Soo; Lee, Sun-Hwa; O'Brien, Kathryn; Lee, Hyera; Gao, Shou-Jiang; Cesarman, Ethel; Ensser, Armin; Jung, Jae U

    2013-11-01

    Chaperones are proteins that assist the noncovalent folding and assembly of macromolecular polypeptide chains, ultimately preventing the formation of nonfunctional or potentially toxic protein aggregates. Plasma cell-induced-endoplasmic reticulum (ER)-resident protein 1 (pERP1) is a cellular chaperone that is preferentially expressed in marginal-zone B cells and is highly upregulated during plasma cell differentiation. While initially identified as a dedicated factor for the assembly of secreted IgM, pERP1 has since been implicated in suppressing calcium mobilization, and its expression is misregulated in multiple tumors. A number of herpesvirus immediate early gene products play important roles in the regulation of viral gene expression and/or evasion of host immune responses. Here, we report that the Kaposi's sarcoma-associated herpesvirus (KSHV) immediate early viral gene K4.2 encodes an endoplasmic reticulum-localized protein that interacts with and inhibits pERP1. Consequently, K4.2 expression interfered with immunoglobulin secretion by delaying the kinetics of immunoglobulin assembly and also led to increased responsiveness of B-cell receptor signal transduction by enhancing phosphotyrosine signals and intracellular calcium fluxes. Furthermore, K4.2 expression also appeared to contribute to maximal lytic replication by enhancing viral glycoprotein expression levels and ultimately promoting infectious-virus production. Finally, immunohistochemistry analysis showed that pERP1 expression was readily detected in KSHV-positive cells from multicentric Castleman's disease (MCD) and Kaposi's sarcoma (KS) lesions, suggesting that pERP1 may have potential roles in the KSHV life cycle and malignancy. In conclusion, our data suggest that K4.2 participates in lytic replication by enhancing calcium flux and viral glycoprotein expression, but also by interfering with immunoglobulin assembly to potentially dampen the adaptive immune response. PMID:23986581

  9. Inhibition of the FACT Complex Reduces Transcription from the Human Cytomegalovirus Major Immediate Early Promoter in Models of Lytic and Latent Replication.

    PubMed

    O'Connor, Christine M; Nukui, Masatoshi; Gurova, Katerina V; Murphy, Eain A

    2016-04-01

    The successful colonization of the majority of the population by human cytomegalovirus is a direct result of the virus's ability to establish and, more specifically, reactivate from latency. The underlying cellular factors involved in viral reactivation remain unknown. Here, we show that the host complexfacilitateschromatintranscription (FACT) binds to the major immediate early promoter (MIEP) and that inhibition of this complex reduces MIEP transactivation, thus inhibiting viral reactivation. PMID:26865717

  10. Novel Comparative Pattern Count Analysis Reveals a Chronic Ethanol-Induced Dynamic Shift in Immediate Early NF-κB Genome-wide Promoter Binding During Liver Regeneration

    PubMed Central

    Kuttippurathu, Lakshmi; Patra, Biswanath; Hoek, Jan B; Vadigepalli, Rajanikanth

    2016-01-01

    Liver regeneration after partial hepatectomy is a clinically important process that is impaired by adaptation to chronic alcohol intake. We focused on the initial time points following partial hepatectomy (PHx) to analyze genome-wide binding activity of NF-κB, a key immediate early regulator. We investigated the effect of chronic alcohol intake on immediate early NF-κB genome-wide localization, in the adapted state as well as in response to partial hepatectomy, using chromatin immunoprecipitation followed by promoter microarray analysis. We found many ethanol-specific NF-κB binding target promoters in the ethanol-adapted state, corresponding to regulation of biosynthetic processes, oxidation-reduction and apoptosis. Partial hepatectomy induced a diet-independent shift in NF-κB binding loci relative to the transcription start sites. We employed a novel pattern count analysis to exhaustively enumerate and compare the number of promoters corresponding to the temporal binding patterns in ethanol and pair-fed control groups. The highest pattern count corresponded to promoters with NF-κB binding exclusively in the ethanol group at 1h post PHx. This set was associated with regulation of cell death, response to oxidative stress, histone modification, mitochondrial function, and metabolic processes. Integration with the global gene expression profiles to identify putative transcriptional consequences of NF-κB binding patterns revealed that several of ethanol-specific 1h binding targets showed ethanol-specific differential expression through 6h post PHx. Motif analysis yielded co-incident binding loci for STAT3, AP-1, CREB, C/EBP-β, PPAR-γ and C/EBP-α, likely participating in co-regulatory modules with NF-κB in shaping the immediate early response to PHx. We conclude that adaptation to chronic ethanol intake disrupts the NF-κB promoter binding landscape with consequences for the immediate early gene regulatory response to the acute challenge of PHx. PMID:26847025

  11. Negative and positive regulation by a short segment in the 5'-flanking region of the human cytomegalovirus major immediate-early gene

    SciTech Connect

    Nelson, J.A.; Reynolds-Kohler, C.; Smith, B.A.

    1987-11-01

    To analyze the significance of inducible DNase I-hypersensitive sites occurring in the 5'-flanking sequence of the major immediate-early gene of human cytomegalovirus (HCMV), various deleted portions of the HCMV immediate-early promoter regulatory region were attached to the chloramphenicol acetyltransferase (CAT) gene and assayed for activity in transiently transfected undifferentiated and differentiated human teratocarcinoma cells, Tera-2. Assays of progressive deletions in the promoter regulatory region indicated that removal of a 395-base-pair portion of this element (nucleotides -750 to -1145) containing two inducible DNase I sites which correlate with gene expression resulted in a 7.5-fold increase in CAT activity in undifferentiated cells. However, in permissive differentiated Tera-2, human foreskin fibroblast, and HeLa cells, removal of this regulatory region resulted in decreased activity. In addition, attachment of this HCMV upstream element to a homologous or heterologous promoter increased activity three-to fivefold in permissive cells. Therefore, a cis regulatory element exists 5' to the enhancer of the major immediate-early gene of HCMV. This element negatively modulates expression in nonpermissive cells but positively influences expression in permissive cells.

  12. Prevalence of inositol 1, 4, 5-triphosphate receptor type 1 gene deletion, the mutation for spinocerebellar ataxia type 15, in Japan screened by gene dosage.

    PubMed

    Obayashi, Masato; Ishikawa, Kinya; Izumi, Yuishin; Takahashi, Makoto; Niimi, Yusuke; Sato, Nozomu; Onodera, Osamu; Kaji, Ryuji; Nishizawa, Masatoyo; Mizusawa, Hidehiro

    2012-03-01

    Spinocerebellar ataxia type 15 (SCA15) is an autosomal dominant neurodegenerative disorder clinically characterized by late-onset, slowly progressive pure cerebellar ataxia. This disease is caused by a heterozygous deletion of the inositol 1, 4, 5-triphosphate receptor type 1 (ITPR1) gene, suggesting that haploinsufficiency of the receptor function is the plausible disease mechanism. To clarify the prevalence of SCA15 in Japan, we designed four sets of probes and primers in different regions of ITPR1 and performed TaqMan PCR assay to search for gene deletions in 226 index SCA patients excluded for repeat expansion disorders. Deletion was found in only one patient, in whom gait ataxia started at 51 years of age and progressed to show cerebellar ataxia. This study demonstrates a simple but efficient method for screening ITPR1 deletion. We also conclude that ITPR1 gene deletions are much rare in Japan than in Europe, comprising only 0.3% in all SCAs in Japan.

  13. Aquaporin-1 gene deletion reduces breast tumor growth and lung metastasis in tumor-producing MMTV-PyVT mice

    PubMed Central

    Esteva-Font, Cristina; Jin, Byung-Ju; Verkman, A. S.

    2014-01-01

    Aquaporin 1 (AQP1) is a plasma membrane water-transporting protein expressed strongly in tumor microvascular endothelia. We previously reported impaired angiogenesis in implanted tumors in AQP1-deficient mice and reduced migration of AQP1-deficient endothelial cells in vitro. Here, we investigated the consequences of AQP1 deficiency in mice that spontaneously develop well-differentiated, luminal-type breast adenomas with lung metastases [mouse mammary tumor virus-driven polyoma virus middle T oncogene (MMTV-PyVT)]. AQP1+/+ MMTV-PyVT mice developed large breast tumors with total tumor mass 3.5 ± 0.5 g and volume 265 ± 36 mm3 (se, 11 mice) at age 98 d. Tumor mass (1.6±0.2 g) and volume (131±15 mm3, 12 mice) were greatly reduced in AQP1−/− MMTV-PyVT mice (P<0.005). CD31 immunofluorescence showed abnormal microvascular anatomy in tumors of AQP1−/− MMTV-PyVT mice, with reduced vessel density. HIF-1α expression was increased in tumors in AQP1−/− MMTV-PyVT mice. The number of lung metastases (5±1/mouse) was much lower than in AQP1+/+ MMTV-PyVT mice (31±8/mouse, P<0.005). These results implicate AQP1 as an important determinant of tumor angiogenesis and, hence, as a potential drug target for adjuvant therapy of solid tumors.—Esteva-Font, C., Jin, B.-J., Verkman, A. S. Aquaporin-1 gene deletion reduces breast tumor growth and lung metastasis in tumor-producing MMTV-PyVT mice. PMID:24334548

  14. Dissecting the functional significance of endothelin A receptors in peripheral nociceptors in vivo via conditional gene deletion.

    PubMed

    Stösser, Sebastian; Agarwal, Nitin; Tappe-Theodor, Anke; Yanagisawa, Masashi; Kuner, Rohini

    2010-02-01

    The peptide endothelin-1 (ET1), which was originally identified as a vasoconstrictor, has emerged as a critical regulator of a number of painful conditions, including inflammatory pain and tumor-associated pain. There is considerable pharmacological evidence supporting a role for endothelin A receptors (ET(A)) in mediating ET1-induced pro-algesic functions. ET(A) receptors are expressed in small-diameter nociceptive neurons, but also found in a variety of other cell types in peripheral tissues, including immune cells, keratinocytes, endothelial cells, which have the potential to modulate nociception. To elucidate the functional contribution of ET(A) receptors expressed in sensory neurons towards the functions of the ET1 axis in pathological pain states, we undertook a conditional gene deletion approach to selectively deplete expression of ET(A) in sensory nerves, preserving expression in non-neural peripheral tissues; the expression of ET(B) remained unchanged. Behavioural and pharmacological experiments showed that only late nociceptive hypersensitivity caused by ET1 is abrogated upon a loss of ET(A) receptors on nociceptors and further suggest that ET1-induced early nociceptive hypersensitivity involves activation of ET(A) as well as ET(B) receptors in non-neural peripheral cells. Furthermore, in the context of alleviation of cancer pain and chronic inflammatory pain by ET(A) receptor antagonists, we observed in corresponding mouse models that the contribution of ET(A) receptors expressed in nociceptors is most significant. These results help understand the role of ET(A) receptors in complex biological processes and peripheral cell-cell interactions involved in inflammatory and tumor-associated pain.

  15. Tph2 gene deletion enhances amphetamine-induced hypermotility: effect of 5-HT restoration and role of striatal noradrenaline release.

    PubMed

    Carli, Mirjana; Kostoula, Chrysaugi; Sacchetti, Giuseppina; Mainolfi, Pierangela; Anastasia, Alessia; Villani, Claudia; Invernizzi, Roberto William

    2015-11-01

    Variants of tryptophan hydroxylase-2 (Tph2), the gene encoding enzyme responsible for the synthesis of brain serotonin (5-HT), have been associated with neuropsychiatric disorders, substance abuse and addiction. This study assessed the effect of Tph2 gene deletion on motor behavior and found that motor activity induced by 2.5 and 5 mg/kg amphetamine was enhanced in Tph2(-/-) mice. Using the in vivo microdialysis technique we found that the ability of amphetamine to stimulate noradrenaline (NA) release in the striatum was reduced by about 50% in Tph2(-/-) mice while the release of dopamine (DA) was not affected. Tph2 deletion did not affect the release of NA and DA in the prefrontal cortex. The role of endogenous 5-HT in enhancing the effect of amphetamine was confirmed showing that treatment with the 5-HT precursor 5-hydroxytryptophan (10 mg/kg) restored tissue and extracellular levels of brain 5-HT and the effects of amphetamine on striatal NA release and motor activity in Tph2(-/-) mice. Treatment with the NA precursor dihydroxyphenylserine (400 mg/kg) was sufficient to restore the effect of amphetamine on striatal NA release and motor activity in Tph2(-/-) mice. These findings indicate that amphetamine-induced hyperactivity is attenuated by endogenous 5-HT through the inhibition of striatal NA release. Tph2(-/-) mice may be a useful preclinical model to assess the role of 5-HT-dependent mechanisms in the action of psychostimulants. Acute sensitivity to the motor effects of amphetamine has been associated to increased risk of psychostimulant abuse. Here, we show that deletion of Tph2, the gene responsible for brain 5-HT synthesis, enhances the motor effect of amphetamine in mice through the inhibition of striatal NA release. This suggests that Tph2(-/-) mice is a useful preclinical model to assess the role of 5-HT-dependent mechanisms in psychostimulants action. Tph2, tryptophan hydroxylase-2.

  16. Gene deleted live attenuated Leishmania vaccine candidates against visceral leishmaniasis elicit pro-inflammatory cytokines response in human PBMCs

    PubMed Central

    Avishek, Kumar; Kaushal, Himanshu; Gannavaram, Sreenivas; Dey, Ranadhir; Selvapandiyan, Angamuthu; Ramesh, V.; Negi, Narender Singh; Dubey, Uma S.; Nakhasi, Hira L.; Salotra, Poonam

    2016-01-01

    Currently no effective vaccine is available for human visceral leishmaniasis(VL) caused by Leishmania donovani. Previously, we showed that centrin1 and p27gene deleted live attenuated Leishmania parasites (LdCen1−/− and Ldp27−/−) are safe, immunogenic and protective in animal models. Here, to assess the correlates of protection, we evaluated immune responses induced by LdCen1−/− and Ldp27−/− in human blood samples obtained from healthy, healed VL (HVL), post kala-azar dermal leishmaniasis(PKDL) and VL subjects. Both parasites infected human macrophages, as effectively as the wild type parasites. Further, LdCen1−/− and Ldp27−/− strongly stimulated production of pro-inflammatory cytokines including, IL-12, IFN-γ, TNF-α, IL-2, IL-6 and IL-17 in the PBMCs obtained from individuals with a prior exposure to Leishmania (HVL and PKDL). There was no significant stimulation of anti-inflammatory cytokines (IL-4 and IL-10). Induction of Th1 biased immune responses was supported by a remarkable increase in IFN-γ secreting CD4+ and CD8+ T cells and IL-17 secreting CD4+ cells in PBMCs from HVL cases with no increase in IL-10 secreting T cells. Hence, LdCen1−/− and Ldp27−/− are promising as live vaccine candidates against VL since they elicit strong protective immune response in human PBMCs from HVL, similar to the wild type parasite infection, mimicking a naturally acquired protection following cure. PMID:27624408

  17. The Rel/NF-κB pathway and transcription of immediate early genes in T cell activation are inhibited by microgravity

    PubMed Central

    Chang, Tammy T.; Walther, Isabelle; Li, Chai-Fei; Boonyaratanakornkit, Jim; Galleri, Grazia; Meloni, Maria Antonia; Pippia, Proto; Cogoli, Augusto; Hughes-Fulford, Millie

    2012-01-01

    This study tested the hypothesis that transcription of immediate early genes is inhibited in T cells activated in μg. Immunosuppression during spaceflight is a major barrier to safe, long-term human space habitation and travel. The goals of these experiments were to prove that μg was the cause of impaired T cell activation during spaceflight, as well as understand the mechanisms controlling early T cell activation. T cells from four human donors were stimulated with Con A and anti-CD28 on board the ISS. An on-board centrifuge was used to generate a 1g simultaneous control to isolate the effects of μg from other variables of spaceflight. Microarray expression analysis after 1.5 h of activation demonstrated that μg- and 1g-activated T cells had distinct patterns of global gene expression and identified 47 genes that were significantly, differentially down-regulated in μg. Importantly, several key immediate early genes were inhibited in μg. In particular, transactivation of Rel/NF-κB, CREB, and SRF gene targets were down-regulated. Expression of cREL gene targets were significantly inhibited, and transcription of cREL itself was reduced significantly in μg and upon anti-CD3/anti-CD28 stimulation in simulated μg. Analysis of gene connectivity indicated that the TNF pathway is a major early downstream effector pathway inhibited in μg and may lead to ineffective proinflammatory host defenses against infectious pathogens during spaceflight. Results from these experiments indicate that μg was the causative factor for impaired T cell activation during spaceflight by inhibiting transactivation of key immediate early genes. PMID:22750545

  18. The Rel/NF-κB pathway and transcription of immediate early genes in T cell activation are inhibited by microgravity.

    PubMed

    Chang, Tammy T; Walther, Isabelle; Li, Chai-Fei; Boonyaratanakornkit, Jim; Galleri, Grazia; Meloni, Maria Antonia; Pippia, Proto; Cogoli, Augusto; Hughes-Fulford, Millie

    2012-12-01

    This study tested the hypothesis that transcription of immediate early genes is inhibited in T cells activated in μg. Immunosuppression during spaceflight is a major barrier to safe, long-term human space habitation and travel. The goals of these experiments were to prove that μg was the cause of impaired T cell activation during spaceflight, as well as understand the mechanisms controlling early T cell activation. T cells from four human donors were stimulated with Con A and anti-CD28 on board the ISS. An on-board centrifuge was used to generate a 1g simultaneous control to isolate the effects of μg from other variables of spaceflight. Microarray expression analysis after 1.5 h of activation demonstrated that μg- and 1g-activated T cells had distinct patterns of global gene expression and identified 47 genes that were significantly, differentially down-regulated in μg. Importantly, several key immediate early genes were inhibited in μg. In particular, transactivation of Rel/NF-κB, CREB, and SRF gene targets were down-regulated. Expression of cREL gene targets were significantly inhibited, and transcription of cREL itself was reduced significantly in μg and upon anti-CD3/anti-CD28 stimulation in simulated μg. Analysis of gene connectivity indicated that the TNF pathway is a major early downstream effector pathway inhibited in μg and may lead to ineffective proinflammatory host defenses against infectious pathogens during spaceflight. Results from these experiments indicate that μg was the causative factor for impaired T cell activation during spaceflight by inhibiting transactivation of key immediate early genes.

  19. Platelet-Derived Growth Factor-Stimulated Expression of the MCP-1 Immediate-Early Gene Involves an Inhibitory Multiprotein Complex

    PubMed Central

    Sridhar, Padma; Liu, Yu; Chin, Lisa D.; Borja, Charlene E.; Mann, Mana; Skopicki, Hal A.; Freter, Rolf R.

    1999-01-01

    We have demonstrated previously that the seven-nucleotide (nt) motif TTTTGTA (the heptamer) that is present within the proximal 3′ untranslated sequences of numerous immediate-early genes is essential for platelet-derived growth factor (PDGF)-stimulated induction of the MCP-1 immediate-early gene. On this basis, the heptamer was suggested to be a conserved regulatory element involved in immediate-early gene expression, although its mechanism of action was unknown. Herein, we demonstrate that the heptamer functions to remove an inhibition of PDGF induction of MCP-1 maintained by two independently acting inhibitory elements present in the MCP-1 5′ flanking sequences (designated I* elements). PDGF treatment relieves the I*-mediated inhibition of MCP-1 expression only if the heptamer is also present. One inhibitory element is contained within a 59-nt portion of MCP-1 5′ flanking sequences and functions in an orientation-independent and heptamer-regulated manner. Significantly, proteins binding to two DNA sequences contribute to the formation of a single multiprotein complex on the 59-nt I* element. The I*-binding complex contains Sp3, an Sp1-like protein, and a novel DNA-binding protein. Moreover, the complex does not form on two 59-nt sequences containing mutations that reverse the inhibition of PDGF induction maintained by the wild-type I* element. We propose to call the multiprotein I*-binding complex a repressosome and suggest that it acts to repress PDGF-stimulated transcription of MCP-1 in the absence of the heptamer TTTTGTA. PMID:10330162

  20. Identification of kakusei, a Nuclear Non-Coding RNA, as an Immediate Early Gene from the Honeybee, and Its Application for Neuroethological Study

    PubMed Central

    Kiya, Taketoshi; Ugajin, Atsushi; Kunieda, Takekazu; Kubo, Takeo

    2012-01-01

    The honeybee is a social insect that exhibits various social behaviors. To elucidate the neural basis of honeybee behavior, we detected neural activity in freely-moving honeybee workers using an immediate early gene (IEG) that is expressed in a neural activity-dependent manner. In European honeybees (Apis mellifera), we identified a novel nuclear non-coding RNA, termed kakusei, as the first insect IEG, and revealed the neural activity pattern in foragers. In addition, we isolated a homologue of kakusei, termed Acks, from the Japanese honeybee (Apis cerana), and detected active neurons in workers fighting with the giant hornet. PMID:23443077

  1. Cystathionine-Gamma-Lyase Gene Deletion Protects Mice against Inflammation and Liver Sieve Injury following Polymicrobial Sepsis

    PubMed Central

    Gaddam, Ravinder Reddy; Fraser, Robin; Badiei, Alireza; Chambers, Stephen; Cogger, Victoria C; Le Couteur, David G; Ishii, Isao; Bhatia, Madhav

    2016-01-01

    Background Hydrogen sulfide (H2S), produced by the activity of cystathionine-gamma-lyase (CSE), is a key mediator of inflammation in sepsis. The liver sinusoidal endothelial cells (LSECs) are important target and mediator of sepsis. The aim of this study was to investigate the role of CSE-derived H2S on inflammation and LSECs fenestrae in caecal-ligation and puncture (CLP)-induced sepsis using CSE KO mice. Methods Sepsis was induced by CLP, and mice (C57BL/6J, male) were sacrificed after 8 hours. Liver, lung, and blood were collected and processed to measure CSE expression, H2S synthesis, MPO activity, NF-κB p65, ERK1/2, and cytokines/chemokines levels. Diameter, frequency, porosity and gap area of the liver sieve were calculated from scanning electron micrographs of the LSECs. Results An increased CSE expression and H2S synthesizing activity in the liver and lung of wild-type mice following CLP-induced sepsis. This was associated with an increased liver and lung MPO activity, and increased liver and lung and plasma levels of the pro-inflammatory cytokines TNF-α, IL-6, and IL-1β, and the chemokines MCP-1 and MIP-2α. Conversely, CSE KO mice had less liver and lung injury and reduced inflammation following CLP-induced sepsis as evidenced by decreased levels of H2S synthesizing activity, MPO activity, and pro-inflammatory cytokines/chemokines production. Extracellular-regulated kinase (ERK1/2) and nuclear factor-κB p65 (NF-κB) became significantly activated after the CLP in WT mice but not in CSE KO mice. In addition, CLP-induced damage to the LSECs, as indicated by increased defenestration and gaps formation in the LSECs compared to WT sham control. CSE KO mice showed decreased defenestration and gaps formation following sepsis. Conclusions Mice with CSE (an H2S synthesising enzyme) gene deletion are less susceptible to CLP-induced sepsis and associated inflammatory response through ERK1/2-NF-κB p65 pathway as evidenced by reduced inflammation, tissue damage

  2. Na+ dependent acid-base transporters in the choroid plexus; insights from slc4 and slc9 gene deletion studies

    PubMed Central

    Christensen, Henriette L.; Nguyen, An T.; Pedersen, Fredrik D.; Damkier, Helle H.

    2013-01-01

    The choroid plexus epithelium (CPE) is located in the ventricular system of the brain, where it secretes the majority of the cerebrospinal fluid (CSF) that fills the ventricular system and surrounds the central nervous system. The CPE is a highly vascularized single layer of cuboidal cells with an unsurpassed transepithelial water and solute transport rate. Several members of the slc4a family of bicarbonate transporters are expressed in the CPE. In the basolateral membrane the electroneutral Na+ dependent Cl−/HCO3− exchanger, NCBE (slc4a10) is expressed. In the luminal membrane, the electrogenic Na+:HCO3− cotransporter, NBCe2 (slc4a5) is expressed. The electroneutral Na+:HCO3− cotransporter, NBCn1 (slc4a7), has been located in both membranes. In addition to the bicarbonate transporters, the Na+/H+ exchanger, NHE1 (slc9a1), is located in the luminal membrane of the CPE. Genetically modified mice targeting slc4a2, slc4a5, slc4a7, slc4a10, and slc9a1 have been generated. Deletion of slc4a5, 7 or 10, or slc9a1 has numerous impacts on CP function and structure in these mice. Removal of the transporters affects brain ventricle size (slc4a5 and slc4a10) and intracellular pH regulation (slc4a7 and slc4a10). In some instances, removal of the proteins from the CPE (slc4a5, 7, and 10) causes changes in abundance and localization of non-target transporters known to be involved in pH regulation and CSF secretion. The focus of this review is to combine the insights gathered from these knockout mice to highlight the impact of slc4 gene deletion on the CSF production and intracellular pH regulation resulting from the deletion of slc4a5, 7 and 10, and slc9a1. Furthermore, the review contains a comparison of the described human mutations of these genes to the findings in the knockout studies. Finally, the future perspective of utilizing these proteins as potential targets for the treatment of CSF disorders will be discussed. PMID:24155723

  3. Epstein-Barr viral latency is disrupted by the immediate-early BRLF1 protein through a cell-specific mechanism.

    PubMed Central

    Zalani, S; Holley-Guthrie, E; Kenney, S

    1996-01-01

    Epstein-Barr virus (EBV), the causative agent of infectious mononucleosis, is a human herpesvirus associated with epithelial cell malignancies (nasopharyngeal carcinoma) as well as B-cell malignancies. Understanding how viral latency is disrupted is a central issue in herpesvirus biology. Epithelial cells are the major site of lytic EBV replication within the human host, and viral reactivation occurs in EBV-associated nasopharyngeal carcinomas. It is known that expression of a single viral immediate-early protein, BZLF1, is sufficient to initiate the switch from latent to lytic infection in B cells. Cellular regulation of BZLF1 transcription is therefore thought to play a key role in regulating the stringency of viral latency. Here we show that, unexpectedly, expression of another viral immediate-early protein, BRLF1, can disrupt viral latency in an epithelial cell-specific fashion. Therefore, the mechanisms leading to disruption of EBV latency appear to be cell-type specific. Images Fig. 2 Fig. 3 Fig. 4 PMID:8799177

  4. HBV polymerase overexpression due to large core gene deletion enhances hepatoma cell growth by binding inhibition of microRNA-100.

    PubMed

    Huang, Ya-Hui; Tseng, Ying-Hsin; Lin, Wey-Ran; Hung, George; Chen, Tse-Ching; Wang, Tong-Hong; Lee, Wei-Chen; Yeh, Chau-Ting

    2016-02-23

    Different types of hepatitis B virus (HBV) core gene deletion mutants were identified in chronic hepatitis B patients. However, their clinical roles in different stages of natural chronic HBV infection remained unclear. To address this issue, HBV core genes were sequenced in three gender- and age-matched patient groups diagnosed as chronic hepatitis, cirrhosis and hepatocellular carcinoma (HCC), respectively. Functional analysis of the identified mutants was performed. A novel type of large-fragment core gene deletion (LFCD) was identified exclusively in HCC patients and significantly associated with unfavorable postoperative survival. The presence of LFCDs resulted in generation of precore-polymerase fusion protein or brought the polymerase reading frame under direct control of HBV precore/core promoter, leading to its over-expression. Enhanced cell proliferation and increased tumorigenicity in nude mice were found in hepatoma cells expressing LFCDs. Because of the epsilon-binding ability of HBV polymerase, we hypothesized that the over-expressed polymerase carrying aberrant amino-terminal sequence could bind to cellular microRNAs. Screening of a panel of microRNAs revealed physical association of a precore-polymerase fusion protein with microRNA-100. A binding inhibition effect on microRNA-100 by the precore-polymerase fusion protein with up-regulation of its target, polo-like kinase 1 (PLK1), was discovered. The binding inhibition and growth promoting effects could be reversed by overexpressing microRNA-100. Together, HCC patients carrying hepatitis B large-fragment core gene deletion mutants had an unfavorable postoperative prognosis. The growth promoting effect was partly due to polymerase overexpression, leading to binding inhibition of microRNA-100 and up-regulation of PLK1. PMID:26824500

  5. Development of a Double-Crossover Markerless Gene Deletion System in Bifidobacterium longum: Functional Analysis of the α-Galactosidase Gene for Raffinose Assimilation

    PubMed Central

    Hirayama, Yosuke; Sakanaka, Mikiyasu; Fukuma, Hidenori; Murayama, Hiroki; Kano, Yasunobu; Yokota, Atsushi

    2012-01-01

    Functional analysis of Bifidobacterium genes is essential for understanding host-Bifidobacterium interactions with beneficial effects on human health; however, the lack of an effective targeted gene inactivation system in bifidobacteria has prevented the development of functional genomics in this bacterium. Here, we report the development of a markerless gene deletion system involving a double crossover in Bifidobacterium longum. Incompatible plasmid vectors were used to facilitate a second crossover step. The conditional replication vector pBS423-ΔrepA, which lacks the plasmid replication gene repA, was integrated into the target gene by a first crossover event. Subsequently, the replicative plasmid pTBR101-CM, which harbors repA, was introduced into this integrant to facilitate the second crossover step and subsequent elimination of the excised conditional replication vector from the cells by plasmid incompatibility. The proposed system was confirmed to work as expected in B. longum 105-A using the chromosomal full-length β-galactosidase gene as a target. Markerless gene deletion was tested using the aga gene, which encodes α-galactosidase, whose substrates include raffinose. Almost all the pTBR101-CM-transformed strains became double-crossover recombinants after subculture, and 4 out of the 270 double-crossover recombinants had lost the ability to assimilate raffinose. Genotype analysis of these strains revealed markerless gene deletion of aga. Carbohydrate assimilation analysis and α-galactosidase activity measurement were conducted using both the representative mutant and a plasmid-based aga-complemented strain. These functional analyses revealed that aga is the only gene encoding a functional α-galactosidase enzyme in B. longum 105-A. PMID:22582061

  6. Development of a double-crossover markerless gene deletion system in Bifidobacterium longum: functional analysis of the α-galactosidase gene for raffinose assimilation.

    PubMed

    Hirayama, Yosuke; Sakanaka, Mikiyasu; Fukuma, Hidenori; Murayama, Hiroki; Kano, Yasunobu; Fukiya, Satoru; Yokota, Atsushi

    2012-07-01

    Functional analysis of Bifidobacterium genes is essential for understanding host-Bifidobacterium interactions with beneficial effects on human health; however, the lack of an effective targeted gene inactivation system in bifidobacteria has prevented the development of functional genomics in this bacterium. Here, we report the development of a markerless gene deletion system involving a double crossover in Bifidobacterium longum. Incompatible plasmid vectors were used to facilitate a second crossover step. The conditional replication vector pBS423-ΔrepA, which lacks the plasmid replication gene repA, was integrated into the target gene by a first crossover event. Subsequently, the replicative plasmid pTBR101-CM, which harbors repA, was introduced into this integrant to facilitate the second crossover step and subsequent elimination of the excised conditional replication vector from the cells by plasmid incompatibility. The proposed system was confirmed to work as expected in B. longum 105-A using the chromosomal full-length β-galactosidase gene as a target. Markerless gene deletion was tested using the aga gene, which encodes α-galactosidase, whose substrates include raffinose. Almost all the pTBR101-CM-transformed strains became double-crossover recombinants after subculture, and 4 out of the 270 double-crossover recombinants had lost the ability to assimilate raffinose. Genotype analysis of these strains revealed markerless gene deletion of aga. Carbohydrate assimilation analysis and α-galactosidase activity measurement were conducted using both the representative mutant and a plasmid-based aga-complemented strain. These functional analyses revealed that aga is the only gene encoding a functional α-galactosidase enzyme in B. longum 105-A.

  7. Cellular homeoproteins, SATB1 and CDP, bind to the unique region between the human cytomegalovirus UL127 and major immediate-early genes

    SciTech Connect

    Lee Jialing; Klase, Zachary; Gao Xiaoqi; Caldwell, Jeremy S.; Stinski, Mark F.; Kashanchi, Fatah; Chao, S.-H.

    2007-09-15

    An AT-rich region of the human cytomegalovirus (CMV) genome between the UL127 open reading frame and the major immediate-early (MIE) enhancer is referred to as the unique region (UR). It has been shown that the UR represses activation of transcription from the UL127 promoter and functions as a boundary between the divergent UL127 and MIE genes during human CMV infection [Angulo, A., Kerry, D., Huang, H., Borst, E.M., Razinsky, A., Wu, J., Hobom, U., Messerle, M., Ghazal, P., 2000. Identification of a boundary domain adjacent to the potent human cytomegalovirus enhancer that represses transcription of the divergent UL127 promoter. J. Virol. 74 (6), 2826-2839; Lundquist, C.A., Meier, J.L., Stinski, M.F., 1999. A strong negative transcriptional regulatory region between the human cytomegalovirus UL127 gene and the major immediate-early enhancer. J. Virol. 73 (11), 9039-9052]. A putative forkhead box-like (FOX-like) site, AAATCAATATT, was identified in the UR and found to play a key role in repression of the UL127 promoter in recombinant virus-infected cells [Lashmit, P.E., Lundquist, C.A., Meier, J.L., Stinski, M.F., 2004. Cellular repressor inhibits human cytomegalovirus transcription from the UL127 promoter. J. Virol. 78 (10), 5113-5123]. However, the cellular factors which associate with the UR and FOX-like region remain to be determined. We reported previously that pancreatic-duodenal homeobox factor-1 (PDX1) bound to a 45-bp element located within the UR [Chao, S.H., Harada, J.N., Hyndman, F., Gao, X., Nelson, C.G., Chanda, S.K., Caldwell, J.S., 2004. PDX1, a Cellular Homeoprotein, Binds to and Regulates the Activity of Human Cytomegalovirus Immediate Early Promoter. J. Biol. Chem. 279 (16), 16111-16120]. Here we demonstrate that two additional cellular homeoproteins, special AT-rich sequence binding protein 1 (SATB1) and CCAAT displacement protein (CDP), bind to the human CMV UR in vitro and in vivo. Furthermore, CDP is identified as a FOX-like binding protein

  8. Heterozygous Hfe gene deletion leads to impaired glucose homeostasis, but not liver injury in mice fed a high-calorie diet.

    PubMed

    Britton, Laurence; Jaskowski, Lesley; Bridle, Kim; Santrampurwala, Nishreen; Reiling, Janske; Musgrave, Nick; Subramaniam, V Nathan; Crawford, Darrell

    2016-06-01

    Heterozygous mutations of the Hfe gene have been proposed as cofactors in the development and progression of nonalcoholic fatty liver disease (NAFLD). Homozygous Hfe deletion previously has been shown to lead to dysregulated hepatic lipid metabolism and accentuated liver injury in a dietary mouse model of NAFLD We sought to establish whether heterozygous deletion of Hfe is sufficient to promote liver injury when mice are exposed to a high-calorie diet (HCD). Eight-week-old wild-type and Hfe(+/-) mice received 8 weeks of a control diet or HCD Liver histology and pathways of lipid and iron metabolism were analyzed. Liver histology demonstrated that mice fed a HCD had increased NAFLD activity score (NAS), steatosis, and hepatocyte ballooning. However, liver injury was unaffected by Hfe genotype. Hepatic iron concentration (HIC) was increased in Hfe(+/-) mice of both dietary groups. HCD resulted in a hepcidin-independent reduction in HIC Hfe(+/-) mice demonstrated raised fasting serum glucose concentrations and HOMA-IR score, despite unaltered serum adiponectin concentrations. Downstream regulators of hepatic de novo lipogenesis (pAKT, SREBP-1, Fas, Scd1) and fatty acid oxidation (AdipoR2, Pparα, Cpt1) were largely unaffected by genotype. In summary, heterozygous Hfe gene deletion is associated with impaired iron and glucose metabolism. However, unlike homozygous Hfe deletion, heterozygous gene deletion did not affect lipid metabolism pathways or liver injury in this model.

  9. Impact of alg3 gene deletion on growth, development, pigment production, protein secretion, and functions of recombinant Trichoderma reesei cellobiohydrolases in Aspergillus niger

    SciTech Connect

    Dai, Ziyu; Aryal, Uma K.; Shukla, Anil; Qian, Wei-Jun; Smith, Richard D.; Magnuson, Jon K.; Adney, William S.; Beckham, Gregg T.; Brunecky, Roman; Himmel, Michael E.; Decker, Stephen R.; Ju, Xiaohui; Zhang, Xiao; Baker, Scott E.

    2013-12-01

    ALG3 is a Family 58 glycosyltransferase enzyme involved in early N-linked glycan synthesis. Here, we investigated the effect of the alg3 gene disruption on growth, development, metabolism, and protein secretion in Aspergillus niger. The alg3 gene deletion resulted in a significant reduction of growth on complete (CM) and potato dextrose agar (PDA) media and a substantial reduction of spore production on CM. It also delayed spore germination in the liquid cultures of both CM and PDA media, but led to a significant accumulation of red pigment on both CM and liquid modified minimal medium (MM) supplemented with yeast extract. The relative abundance of 55 proteins of the total 190 proteins identified in the secretome was significantly different as a result of alg3 gene deletion. Comparison of a Trichoderma reesei cellobiohydrolase (Cel7A) heterologously expressed in A. niger parental and Δalg3 strains showed that the recombinant Cel7A expressed in the mutant background was smaller in size than that from the parental strains. This study suggests that ALG3 is critical for growth and development, pigment production, and protein secretion in A. niger. Functional analysis of recombinant Cel7A with aberrant glycosylation demonstrates the feasibility of this alternative approach to evaluate the role of N-linked glycosylation in glycoprotein secretion and function.

  10. Investigation of TBX1 gene deletion in Iranian children with 22q11.2 deletion syndrome: correlation with conotruncal heart defects

    PubMed Central

    Ganji, Hamid; Salehi, Mansoor; Sedghi, Maryam; Abdali, Hossein; Nouri, Nayereh; Sadri, Leyli; Hosseinzadeh, Majid; Vakili, Bahareh; Lotfi, Mahdi

    2013-01-01

    Background DiGeorge syndrome (DGS) is the result of a microdeletion in chromosome 22q11.2 in over 90% of cases. DGS is the second most frequent syndrome after Down syndrome and has an incidence of 1/4000 births. Unequal crossover between low-copy repeats, on the proximal part of the long arm of chromosome 22, usually results in a 3 Mb deletion in one of the chromosome 22 and a reciprocal and similarly sized duplication on the other one. Several studies have indicated that TBX1 (T-box 1) haploinsufficiency is responsible for many of the phenotypic traits of 22q11.2 deletion syndrome. Conotruncal heart defects (CTDs) are present in 75–85% of patients with 22q11.2 deletion syndrome in Western countries. Methods Among 78 patients fulfilling the criteria for DGS diagnosed by the fluorescence in situ hybridisation test, 24 had 22q11.2 deletion. Screening for TBX1 gene deletion was performed by multiplex ligation-dependent probe amplification (MLPA). Results Our results revealed that of 24 patients with TBX1 gene deletion, 12 had CTDs while 12 did not show any heart defects. Conclusions Our findings indicate that other genes or gene interactions may play a role in penetrance or the severity of heart disease among patients with DGS. PMID:27326128

  11. Heterozygous Hfe gene deletion leads to impaired glucose homeostasis, but not liver injury in mice fed a high-calorie diet.

    PubMed

    Britton, Laurence; Jaskowski, Lesley; Bridle, Kim; Santrampurwala, Nishreen; Reiling, Janske; Musgrave, Nick; Subramaniam, V Nathan; Crawford, Darrell

    2016-06-01

    Heterozygous mutations of the Hfe gene have been proposed as cofactors in the development and progression of nonalcoholic fatty liver disease (NAFLD). Homozygous Hfe deletion previously has been shown to lead to dysregulated hepatic lipid metabolism and accentuated liver injury in a dietary mouse model of NAFLD We sought to establish whether heterozygous deletion of Hfe is sufficient to promote liver injury when mice are exposed to a high-calorie diet (HCD). Eight-week-old wild-type and Hfe(+/-) mice received 8 weeks of a control diet or HCD Liver histology and pathways of lipid and iron metabolism were analyzed. Liver histology demonstrated that mice fed a HCD had increased NAFLD activity score (NAS), steatosis, and hepatocyte ballooning. However, liver injury was unaffected by Hfe genotype. Hepatic iron concentration (HIC) was increased in Hfe(+/-) mice of both dietary groups. HCD resulted in a hepcidin-independent reduction in HIC Hfe(+/-) mice demonstrated raised fasting serum glucose concentrations and HOMA-IR score, despite unaltered serum adiponectin concentrations. Downstream regulators of hepatic de novo lipogenesis (pAKT, SREBP-1, Fas, Scd1) and fatty acid oxidation (AdipoR2, Pparα, Cpt1) were largely unaffected by genotype. In summary, heterozygous Hfe gene deletion is associated with impaired iron and glucose metabolism. However, unlike homozygous Hfe deletion, heterozygous gene deletion did not affect lipid metabolism pathways or liver injury in this model. PMID:27354540

  12. An inducible promoter mediates abundant expression from the immediate-early 2 gene region of human cytomegalovirus at late times after infection.

    PubMed Central

    Puchtler, E; Stamminger, T

    1991-01-01

    An abundant late transcript of 1.5 kb originates from the immediate-early 2 (IE-2) gene region of human cytomegalovirus (HCMV) at late times after infection. The transcriptional start of this RNA was precisely mapped, and the putative promoter region was cloned in front of the CAT gene as reporter. This region, which comprises 78 nucleotides of IE-2 sequence upstream of the determined cap site, was strongly activated by viral superinfection at late times in the replicative cycle. As shown by RNase protection analyses, the authentic transcription start is used. No activation of this late promoter was observed after cotransfection with an expression plasmid containing the HCMV IE-1 and -2 gene region. This result suggests that, compared with early and early late promoters of HCMV, different or additional viral functions are required for the activation of true late promoters. Images PMID:1656096

  13. Human T-lymphotropic virus tax activates human cytomegalovirus major-immediate early promoter and improves production of recombinant proteins in HEK293 cells.

    PubMed

    Lwa, Teng Rhui; Lee, Jialing; Ng, Chew Har; Lew, Qiao Jing; Hia, Hui Ching; Chao, Sheng-Hao

    2011-01-01

    The human cytomegalovirus (CMV) major immediate-early (MIE) promoter is widely used in mammalian cells for production of recombinant proteins. It is of great interest to further enhance protein production driven by the CMV promoter. Here, we report that the Tax protein of human T-lymphotropic virus stimulates the transgene expression under the control of CMV MIE promoter in HEK293 cells. At least threefold increases in transient production of recombinant proteins, including luciferase and two biopharmaceutical proteins (erythropoietin and interferon-γ), were detected. Furthermore, cyclic adenosine monophosphate (AMP)-response element binding protein 2 (CREB2) was identified as a cellular cofactor, which might be responsible for Tax transactivation of the CMV MIE promoter. Our results not only demonstrate the potential use of this novel expression strategy for improvement of recombinant protein production in HEK293 cells but also provide the molecular mechanism for Tax-mediated activation of CMV MIE promoter. PMID:21425252

  14. Recruitment of the transcriptional coactivator HCF-1 to viral immediate-early promoters during initiation of reactivation from latency of herpes simplex virus type 1.

    PubMed

    Whitlow, Zackary; Kristie, Thomas M

    2009-09-01

    The transcriptional coactivator host cell factor 1 (HCF-1) is critical for the expression of immediate-early (IE) genes of the alphaherpesviruses herpes simplex virus type 1 (HSV-1) and varicella-zoster virus. HCF-1 may also be involved in the reactivation of these viruses from latency as it is sequestered in the cytoplasm of sensory neurons but is rapidly relocalized to the nucleus upon stimulation that results in reactivation. Here, chromatin immunoprecipitation assays demonstrate that HCF-1 is recruited to IE promoters of viral genomes during the initiation of reactivation, correlating with RNA polymerase II occupancy and IE expression. The data support the model whereby HCF-1 plays a pivotal role in the reactivation of HSV-1 from latency.

  15. Hippocampus and medial striatum dissociation during goal navigation by geometry or features in the domestic chick: An immediate early gene study.

    PubMed

    Mayer, Uwe; Pecchia, Tommaso; Bingman, Verner Peter; Flore, Michele; Vallortigara, Giorgio

    2016-01-01

    We employed a standard reference memory task to study the involvement of the hippocampal formation (HF) of domestic chicks that used the boundary geometry of a test environment to orient to and locate a reward. Using the immediate early gene product c-Fos as a neuronal activity marker, we found enhanced HF activation in chicks that learned to locate rewarded corners using the shape of a rectangular arena compared to chicks trained to solve the task by discriminating local features in a square-shaped arena. We also analyzed neuronal activity in the medial part of the medial striatum (mMSt). Surprisingly, in mMSt we observed a reverse pattern, with higher activity in the chicks that were trained to locate the goal by local features. Our results identify two seemingly parallel, memory systems in chicks, with HF central to the processing of spatial-geometrical information and mMSt important in supporting local feature discrimination. PMID:26135386

  16. The varicella-zoster virus-mediated delayed host shutoff: open reading frame 17 has no major function, whereas immediate-early 63 protein represses heterologous gene expression.

    PubMed

    Desloges, Nathalie; Rahaus, Markus; Wolff, Manfred H

    2005-12-01

    We reported that varicella-zoster virus (VZV) causes a delayed host shutoff during its replicative cycle. VZV open reading frame 17 (ORF17) is the homologue of the herpes simplex virus (HSV) UL41 gene encoding the virion host shutoff (vhs) protein which is responsible for the shutoff effect observed in HSV-infected cells. In the present study, we demonstrated that ORF17 is expressed as a late protein during the VZV replicative cycle in different infected permissive cell lines which showed a delayed shutoff of cellular RNA. A cell line with stable expression of VZV ORF17 was infected with VZV. In these cells, VZV replication and delayed host shutoff remained unchanged when compared to normal infected cells. ORF17 was not capable of repressing the expression of the beta-gal reporter gene under the control of the human cytomegalovirus immediate-early gene promoter or to inhibit the expression of a CAT reporter gene under the control of the human GAPDH promoter, indicating that ORF17 has no major function in the VZV-mediated delayed host shutoff. To determine whether other viral factors are involved in the host shutoff, a series of cotransfection assays was performed. We found that the immediate-early 63 protein (IE63) was able to downregulate the expression of reporter genes under the control of the two heterologous promoters, indicating that this viral factor can be involved in the VZV-mediated delayed host shutoff. Other factors can be also implicated to modulate the repressing action of IE63 to achieve a precise balance between the viral and cellular gene expression.

  17. Prolidase Deficiency in a Mexican-American Patient Identified by Array CGH Reveals a Novel and the Largest PEPD Gene Deletion

    PubMed Central

    Hintze, Jonathan P.; Kirby, Amelia; Torti, Erin; Batanian, Jacqueline R.

    2016-01-01

    Prolidase deficiency (PD) is a rare genetic disorder caused by mutations in the peptidase D (PEPD) gene, affecting collagen degradation. Features include lower extremity ulcers, facial dysmorphism, frequent respiratory infections, and intellectual disability, though there is significant intra- and interfamilial variability. Twenty-eight mutations have been previously reported, all either small deletions/duplications or point mutations discovered by enzyme or DNA assays. PD has been reported in patients of various ethnic backgrounds, but never in the Mexican-American population. We describe the first Mexican-American patient with PD, who presented with typical facial features, developmental delay, microcephaly, and xerosis. Chromosome microarray analysis (CMA) revealed a homozygous deletion in the region of 19q13.11, estimated to be between 124.79 and 195.72 kb in size, representing the largest PEPD gene deletion reported to date and the first discovered by CMA. PMID:27385964

  18. Construction of a cytosolic firefly luciferase reporter cassette for use in PCR-mediated gene deletion and fusion in Saccharomyces cerevisiae.

    PubMed

    Ainsworth, W B; Rome, C M; Hjortsø, M A; Benton, M G

    2012-12-01

    Monitoring promoter response to environmental changes using reporter systems has provided invaluable information regarding cellular state. With the development of in vivo luciferase reporter systems, inexpensive, sensitive and accurate promoter assays have been developed without the variability reported between in vitro samplings. Current luciferase reporter systems, however, are largely inflexible to modifications to the promoter of interest. To overcome problems in flexibility and stability of these expression vectors, we report the creation of a novel vector system which introduces a cytosol-localized Photinus pyralis luciferase [LUC*(-SKL)] capable of one-step, in vivo measurements into a promoter-reporter system via PCR-based gene deletion and fusion. After introduction of the reporter under HUG1 promoter control, cytosolic localization was confirmed by fluorescence microscopy. The dose-response of this novel construct was then compared with that of a similar HUG1Δ::yEGFP1 promoter-reporter system and shown to give a similar response pattern.

  19. Prolidase Deficiency in a Mexican-American Patient Identified by Array CGH Reveals a Novel and the Largest PEPD Gene Deletion.

    PubMed

    Hintze, Jonathan P; Kirby, Amelia; Torti, Erin; Batanian, Jacqueline R

    2016-05-01

    Prolidase deficiency (PD) is a rare genetic disorder caused by mutations in the peptidase D (PEPD) gene, affecting collagen degradation. Features include lower extremity ulcers, facial dysmorphism, frequent respiratory infections, and intellectual disability, though there is significant intra- and interfamilial variability. Twenty-eight mutations have been previously reported, all either small deletions/duplications or point mutations discovered by enzyme or DNA assays. PD has been reported in patients of various ethnic backgrounds, but never in the Mexican-American population. We describe the first Mexican-American patient with PD, who presented with typical facial features, developmental delay, microcephaly, and xerosis. Chromosome microarray analysis (CMA) revealed a homozygous deletion in the region of 19q13.11, estimated to be between 124.79 and 195.72 kb in size, representing the largest PEPD gene deletion reported to date and the first discovered by CMA. PMID:27385964

  20. A new reporter mouse cytomegalovirus reveals maintained immediate-early gene expression but poor virus replication in cycling liver sinusoidal endothelial cells

    PubMed Central

    2013-01-01

    Background The MCMV major immediate early promoter/enhancer (MIEP) is a bidirectional promoter that drives the expression of the three immediate early viral genes, namely ie1, ie2 and ie3. The regulation of their expression is intensively studied, but still incompletely understood. Methods We constructed a reporter MCMV, (MCMV-MIEPr) expressing YFP and tdTomato under the control of the MIEP as proxies of ie1 and ie2, respectively. Moreover, we generated a liver sinusoidal endothelial cell line (LSEC-uniLT) where cycling is dependent on doxycycline. We used these novel tools to study the kinetics of MIEP-driven gene expression in the context of infection and at the single cell level by flow cytometry and by live imaging of proliferating and G0-arrested cells. Results MCMV replicated to higher titers in G0-arrested LSEC, and cycling cells showed less cytopathic effect or YFP and tdTomato expression at 5 days post infection. In the first 24 h post infection, however, there was no difference in MIEP activity in cycling or G0-arrested cells, although we could observe different profiles of MIEP gene expression in different cell types, like LSECs, fibroblasts or macrophages. We monitored infected LSEC-uniLT in G0 by time lapse microscopy over five days and noticed that most cells survived infection for at least 96 h, arguing that quick lysis of infected cells could not account for the spread of the virus. Interestingly, we noticed a strong correlation between the ratio of median YFP and tdTomato expression and length of survival of infected cells. Conclusion By means of our newly developed genetic tools, we showed that the expression pattern of MCMV IE1 and IE2 genes differs between macrophages, endothelial cells and fibroblasts. Substantial and cell-cycle independent differences in the ie1 and ie2 transcription could also be observed within individual cells of the same population, and marked ie2 gene expression was associated with longer survival of the infected cells

  1. CTCF Binding to the First Intron of the Major Immediate Early (MIE) Gene of Human Cytomegalovirus (HCMV) Negatively Regulates MIE Gene Expression and HCMV Replication

    PubMed Central

    Martínez, Francisco Puerta; Cruz, Ruth; Lu, Fang; Plasschaert, Robert; Deng, Zhong; Rivera-Molina, Yisel A.; Bartolomei, Marisa S.; Lieberman, Paul M.

    2014-01-01

    ABSTRACT Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV-infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by short hairpin RNA results in an increase in major IE (MIE) and E gene expression and an about 50-fold increase in HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts directly with CTCF. Deletion of this CTCF-binding site led to an increase in MIE gene expression in both transient-transfection and infection assays. Deletion of the CTCF-binding site in the HCMV bacterial artificial chromosome plasmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF-binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved, as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF. IMPORTANCE Our findings that CTCF binds to intron A of the cytomegalovirus (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. For the first time, a chromatin

  2. eNOS gene deletion restores blood-brain barrier integrity and attenuates neurodegeneration in the thiamine-deficient mouse brain.

    PubMed

    Beauchesne, Elizabeth; Desjardins, Paul; Hazell, Alan S; Butterworth, Roger F

    2009-10-01

    Wernicke's encephalopathy is a cerebral disorder caused by thiamine (vitamin B(1)) deficiency (TD). Neuropathologic consequences of TD include region-selective neuronal cell loss and blood-brain barrier (BBB) breakdown. Early increased expression of the endothelial isoform of nitric oxide synthase (eNOS) occurs selectively in vulnerable brain regions in TD. We hypothesize that region-selective eNOS induction in TD leads to altered expression of tight junction proteins and BBB breakdown. In order to address this issue, TD was induced in C57BL/6 wild-type (WT) and eNOS(-/-) mice by feeding a thiamine-deficient diet and treatment with the thiamine antagonist pyrithiamine. Pair-fed control mice were fed the same diet with additional thiamine. In medial thalamus of TD-WT mice (vulnerable area), increased heme oxygenase-1 and S-nitrosocysteine immunostaining was observed in vessel walls, compared to pair-fed control-WT mice. Concomitant increases in IgG extravasation, decreases in expression of the tight junction proteins occludin, zona occludens-1 and zona occludens-2, and up-regulation of matrix metalloproteinase-9 in endothelial cells were observed in the medial thalamus of TD-WT mice. eNOS gene deletion restored these BBB alterations, suggesting that eNOS-derived nitric oxide is a major factor leading to cerebrovascular alterations in TD. However, eNOS gene deletion only partially attenuated TD-related neuronal cell loss, suggesting the presence of mechanisms additional to BBB disruption in the pathogenesis of these changes.

  3. Transcriptional regulation of the human cytomegalovirus major immediate-early gene is associated with induction of DNase I-hypersensitive sites.

    PubMed Central

    Nelson, J A; Groudine, M

    1986-01-01

    Human teratocarcinoma cells were used to examine structural features associated with expression of the major immediate-early (IE) gene of human cytomegalovirus. By immunofluorescence, comparison of RNA levels, and in vitro transcription of nuclei, we showed that the major IE gene is inactive in undifferentiated but active in differentiated cells. Therefore, the block in human cytomegalovirus replication in teratocarcinoma cells appears to be at the transcriptional level, in one of the initial genes transcribed. In addition, the in vitro transcription experiments demonstrated that in permissive infections the gene was transcriptionally inactive late in infection. A comparison of the structural features of the promoter region with the active and inactive IE genes showed the presence of constitutive and inducible DNase I-hypersensitive sites. The majority of the constitutive sites existed at -175, -275, -375, -425, and -525 relative to the cap site in an area which has been shown to be capable of simian virus 40 enhancer function. In contrast, the inducible DNase I sites were located outside this region at -650, -775, -875, and -975. Images PMID:3023848

  4. Controlled crystal dehydration triggers a space-group switch and shapes the tertiary structure of cytomegalovirus immediate-early 1 (IE1) protein.

    PubMed

    Klingl, Stefan; Scherer, Myriam; Stamminger, Thomas; Muller, Yves A

    2015-07-01

    Cytomegalovirus immediate-early 1 (IE1) protein is a key viral effector protein that reprograms host cells. Controlled dehydration experiments with IE1 crystals not only extended their diffraction limit from 2.85 to 2.3 Å resolution but also triggered a monoclinic to tetragonal space-group transition with only minor alterations in the unit-cell parameters. An analysis of the pre-dehydration and post-dehydration crystal structures shows how dehydration rearranges the packing of IE1 molecules to meet the unit-cell constraints of the higher lattice symmetry. The transition from P21 to P43 reduces the number of copies in the asymmetric unit from four to two, and molecules previously related by noncrystallographic symmetry merge into identical crystallographic copies in the tetragonal space group. At the same time, dehydration considerably alters the tertiary structure of one of the two remaining IE1 chains in the asymmetric unit. It appears that this conformational switch is required to compensate for a transition that is assumed to be unfavourable, namely from a highly preferred to a rarely observed space group. At the same time, the dehydration-triggered molecular reshaping could reveal an inherent molecular flexibility that possibly informs on the biological function of IE1, namely on its binding to target proteins from the host cell.

  5. Voxel-based analysis of the immediate early gene, c-jun, in the honey bee brain after a sucrose stimulus.

    PubMed

    McNeill, M S; Robinson, G E

    2015-06-01

    Immediate early genes (IEGs) have served as useful markers of brain neuronal activity in mammals, and more recently in insects. The mammalian canonical IEG, c-jun, is part of regulatory pathways conserved in insects and has been shown to be responsive to alarm pheromone in honey bees. We tested whether c-jun was responsive in honey bees to another behaviourally relevant stimulus, sucrose, in order to further identify the brain regions involved in sucrose processing. To identify responsive regions, we developed a new method of voxel-based analysis of c-jun mRNA expression. We found that c-jun is expressed in somata throughout the brain. It was rapidly induced in response to sucrose stimuli, and it responded in somata near the antennal and mechanosensory motor centre, mushroom body calices and lateral protocerebrum, which are known to be involved in sucrose processing. c-jun also responded to sucrose in somata near the lateral suboesophageal ganglion, dorsal optic lobe, ventral optic lobe and dorsal posterior protocerebrum, which had not been previously identified by other methods. These results demonstrate the utility of voxel-based analysis of mRNA expression in the insect brain.

  6. Glucocorticoids facilitate the transcription from the human cytomegalovirus major immediate early promoter in glucocorticoid receptor- and nuclear factor-I-like protein-dependent manner

    SciTech Connect

    Inoue-Toyoda, Maki; Kato, Kohsuke; Nagata, Kyosuke; Yoshikawa, Hiroyuki

    2015-02-27

    Human cytomegalovirus (HCMV) is a common and usually asymptomatic virus agent in healthy individuals. Initiation of HCMV productive infection depends on expression of the major immediate early (MIE) genes. The transcription of HCMV MIE genes is regulated by a diverse set of transcription factors. It was previously reported that productive HCMV infection is triggered probably by elevation of the plasma hydroxycorticoid level. However, it is poorly understood whether the transcription of MIE genes is directly regulated by glucocorticoid. Here, we found that the dexamethasone (DEX), a synthetic glucocorticoid, facilitates the transcription of HCMV MIE genes through the MIE promoter and enhancer in a glucocorticoid receptor (GR)-dependent manner. By competitive EMSA and reporter assays, we revealed that an NF-I like protein is involved in DEX-mediated transcriptional activation of the MIE promoter. Thus, this study supports a notion that the increased level of hydroxycorticoid in the third trimester of pregnancy reactivates HCMV virus production from the latent state. - Highlights: • DEX facilitates the transcription from the HCMV MIE promoter. • GR is involved in DEX-dependent transcription from the HCMV MIE promoter. • A 17 bp repeat is responsible for the HCMV MIE promoter activation by DEX. • An NF-I-like protein is involved in the HCMV MIE promoter activation by DEX.

  7. CAMKII-conditional deletion of histone deacetylase 2 potentiates acute methamphetamine-induced expression of immediate early genes in the mouse nucleus accumbens.

    PubMed

    Torres, Oscar V; McCoy, Michael T; Ladenheim, Bruce; Jayanthi, Subramaniam; Brannock, Christie; Tulloch, Ingrid; Krasnova, Irina N; Cadet, Jean Lud

    2015-08-24

    Methamphetamine (METH) produces increases in the expression of immediate early genes (IEGs) and of histone deacetylase 2 (HDAC2) in the rat nucleus accumbens (NAc). Here, we tested whether HDAC2 deletion influenced the effects of METH on IEG expression in the NAc. Microarray analyses showed no baseline differences in IEG expression between wild-type (WT) and HDAC2 knockout (KO) mice. Quantitative-PCR analysis shows that an acute METH injection produced time-dependent increases in mRNA levels of several IEGs in both genotypes. Interestingly, HDAC2KO mice displayed greater METH-induced increases in Egr1 and Egr2 mRNA levels measured at one hour post-injection. The levels of Fosb, Fra2, Egr1, and Egr3 mRNAs stayed elevated in the HDAC2KO mice 2 hours after the METH injection whereas these mRNAs had normalized in the WT mice. In WT mice, METH caused increased HDAC2 recruitment to the promoters some IEGs at 2 hours post injection. METH-induced prolonged increases in Fosb, Fra2, Egr1, and Egr3 mRNA levels in HDAC2KO mice were associated with increased enrichment of phosphorylated CREB (pCREB) on the promoters of these genes. Based on our observations, we hypothesize that HDAC2 may regulate the expression of these genes, in part, by prolonging the actions of pCREB in the mouse NAc.

  8. Development of a quantitative real-time RT-PCR for kinetic analysis of immediate-early transcripts of rat cytomegalovirus.

    PubMed

    Loh, H S; Mohd-Azmi, M L

    2009-01-01

    One-step real-time RT-PCR assay was developed for quantification of the immediate-early (IE), namely IE1 and IE2 transcripts of Rat cytomegalovirus (RCMV), strain ALL-03 in rat embryonic fibroblast cells (REF). This in-house SYBR Green I based RT-PCR was shown to have higher amplification efficiency and detection limit as compared to a commercially available real-time RT-PCR kit in quantifying these two transcripts. The quantification histogram revealed the divergence of transcription activities of the two IE genes. The IE1 transcript had a concentration peak at 7 hrs post infection (p.i.), whereas IE2 transcript at 20 hrs p.i. Regulation of IE expression is critical for determination, whether the infection is going to be abortive, lytic or latent. Therefore, this in-house developed quantitative RT-PCR assay offers an alternative for diagnosis and monitoring of the acute cytomegalovirus (CMV) infection directed at IE transcript detection.

  9. CAMKII-conditional deletion of histone deacetylase 2 potentiates acute methamphetamine-induced expression of immediate early genes in the mouse nucleus accumbens

    PubMed Central

    Torres, Oscar V.; McCoy, Michael T.; Ladenheim, Bruce; Jayanthi, Subramaniam; Brannock, Christie; Tulloch, Ingrid; Krasnova, Irina N.; Cadet, Jean Lud

    2015-01-01

    Methamphetamine (METH) produces increases in the expression of immediate early genes (IEGs) and of histone deacetylase 2 (HDAC2) in the rat nucleus accumbens (NAc). Here, we tested whether HDAC2 deletion influenced the effects of METH on IEG expression in the NAc. Microarray analyses showed no baseline differences in IEG expression between wild-type (WT) and HDAC2 knockout (KO) mice. Quantitative-PCR analysis shows that an acute METH injection produced time-dependent increases in mRNA levels of several IEGs in both genotypes. Interestingly, HDAC2KO mice displayed greater METH-induced increases in Egr1 and Egr2 mRNA levels measured at one hour post-injection. The levels of Fosb, Fra2, Egr1, and Egr3 mRNAs stayed elevated in the HDAC2KO mice 2 hours after the METH injection whereas these mRNAs had normalized in the WT mice. In WT mice, METH caused increased HDAC2 recruitment to the promoters some IEGs at 2 hours post injection. METH-induced prolonged increases in Fosb, Fra2, Egr1, and Egr3 mRNA levels in HDAC2KO mice were associated with increased enrichment of phosphorylated CREB (pCREB) on the promoters of these genes. Based on our observations, we hypothesize that HDAC2 may regulate the expression of these genes, in part, by prolonging the actions of pCREB in the mouse NAc. PMID:26300473

  10. Presentation of noise during acute restraint stress attenuates expression of immediate early genes and arginine vasopressin in the hypothalamic paraventricular nucleus but not corticosterone secretion in rats.

    PubMed

    Sugimoto, Koji; Ohmomo, Hideki; Shutoh, Fumihiro; Nogami, Haruo; Hisano, Setsuji

    2015-07-01

    The present study investigated the effect of acoustic stimulation on the activation of the hypothalamic-pituitary-adrenal (HPA) axis in rats submitted to acute restraint stress, through semi-quantitative histochemical analysis of expression of immediate early gene products (c-Fos, JunB and phosphorylated c-Jun) and arginine vasopressin (AVP) hnRNA in the paraventricular nucleus (PVN). Simultaneous presentation of white or pink noise with restraint resulted in a significant attenuation of stress-induced c-Fos and JunB expression in the dorsal body of dorsal medial parvicellular subdivision (mpdd) of the PVN, as compared with restraint without noise. However, this presentation did not change phosphorylation of c-Jun and the plasma corticosterone level. Moreover, white noise presentation during restraint led to a reduction in the number of c-Fos- or JunB-expressing corticotropin-releasing hormone (CRH) neurons and the number of neurons expressing AVP hnRNA in the mpdd. Dual-histochemical labeling revealed co-expression of c-Fos and JunB, as well as JunB and AVP hnRNA in mpdd neurons. These data suggest that acoustic stimuli have an attenuation effect on the restraint-induced activation of neuroendocrine CRH neurons, resulting in the reduction in AVP production as an adaptation of HPA axis to repeated stress.

  11. An investigation of herpes simplex virus promoter activity compatible with latency establishment reveals VP16-independent activation of immediate-early promoters in sensory neurones.

    PubMed

    Proença, João T; Coleman, Heather M; Nicoll, Michael P; Connor, Viv; Preston, Christopher M; Arthur, Jane; Efstathiou, Stacey

    2011-11-01

    Herpes simplex virus (HSV) type-1 establishes lifelong latency in sensory neurones and it is widely assumed that latency is the consequence of a failure to initiate virus immediate-early (IE) gene expression. However, using a Cre reporter mouse system in conjunction with Cre-expressing HSV-1 recombinants we have previously shown that activation of the IE ICP0 promoter can precede latency establishment in at least 30% of latently infected cells. During productive infection of non-neuronal cells, IE promoter activation is largely dependent on the transactivator VP16 a late structural component of the virion. Of significance, VP16 has recently been shown to exhibit altered regulation in neurones; where its de novo synthesis is necessary for IE gene expression during both lytic infection and reactivation from latency. In the current study, we utilized the Cre reporter mouse model system to characterize the full extent of viral promoter activity compatible with cell survival and latency establishment. In contrast to the high frequency activation of representative IE promoters prior to latency establishment, cell marking using a virus recombinant expressing Cre under VP16 promoter control was very inefficient. Furthermore, infection of neuronal cultures with VP16 mutants reveals a strong VP16 requirement for IE promoter activity in non-neuronal cells, but not sensory neurones. We conclude that only IE promoter activation can efficiently precede latency establishment and that this activation is likely to occur through a VP16-independent mechanism. PMID:21752961

  12. Activity-dependent expression of miR-132 regulates immediate-early gene induction during olfactory learning in the greater short-nosed fruit bat, Cynopterus sphinx.

    PubMed

    Mukilan, Murugan; Ragu Varman, Durairaj; Sudhakar, Sivasubramaniam; Rajan, Koilmani Emmanuvel

    2015-04-01

    The activity-dependent expression of immediate-early genes (IEGs) and microRNA (miR)-132 has been implicated in synaptic plasticity and the formation of long-term memory (LTM). In the present study, we show that olfactory training induces the expression of IEGs (EGR-1, C-fos, C-jun) and miR-132 at similar time scale in olfactory bulb (OB) of Cynopterus sphinx. We examined the role of miR-132 in the OB using antisense oligodeoxynucleotide (AS-ODN) and demonstrated that a local infusion of AS-ODN in the OB 2h prior to training impaired olfactory memory formation in C. sphinx. However, the infusion of AS-ODN post-training did not cause a deficit in memory formation. Furthermore, the inhibition of miR-132 reduced the olfactory training-induced expression of IEGs and post synaptic density protein-95 (PSD-95) in the OB. Additionally, we show that miR-132 regulates the activation of calcium/calmodulin-dependent protein kinase-II (CaMKII) and cAMP response element binding protein (CREB), possibly through miR-148a. These data suggest that olfactory training induces the expression of miR-132 and IEGs, which in turn activates post-synaptic proteins that regulate olfactory memory formation. PMID:25725166

  13. Monoclonal antibody E-13 (M-810) to human cytomegalovirus recognizes an epitope encoded by exon 2 of the major immediate early gene.

    PubMed

    Mazeron, M C; Jahn, G; Plachter, B

    1992-10-01

    Monoclonal antibody (MAb) E-13 to human cytomegalovirus is used widely for diagnostic and fundamental studies, and has been shown to be directed against an immediate early (IE) protein(s). To determine which viral antigen is detected by MAb E-13, four subfragments from the open reading frame encoded by exons 2, 3 or 4 of IE-1 were cloned in the bacterial expression vector pROS. The resulting fusion proteins contained amino acids 77 to 491 encoded by mainly exon 4, amino acids 25 to 78 encoded by exon 3, amino acids 1 to 85 encoded by exons 2 and 3, and amino acids 1 to 24 encoded by exon 2. The reactivity of MAb E-13 with the fusion proteins was assayed by Western blotting. MAb E-13 was shown to react exclusively with proteins encoded by exon 2 and therefore recognizes IE proteins which contain the N-terminal amino acid sequence encoded by exon 2, namely the major 72K IE protein, the 82K to 86K IE-2 protein and the 52K to 55K IE-2 protein. MAb E-13 can be used to detect both IE-1- and IE-2-encoded proteins, which share the polypeptide encoded by exon 2. PMID:1383398

  14. Effect of hypergravity on expression of the immediate early gene, c-fos, in central nervous system of medaka (Oryzias latipes)

    NASA Astrophysics Data System (ADS)

    Sayaka, Shimomura-Umemura; Ijiri, Kenichi

    2006-01-01

    Immediate-early genes serve as useful neurobiological tools for mapping brain activity induced by a sensory stimulation. In this study, we have examined brain activity related to gravity perception of medaka (Oryzias latipes) by use of c-fos. The gene, which is homologous to the c-fos genes of other vertebrates, was identified in medaka. Functionally important domains are highly conserved among all the vertebrate species analyzed. Intraperitoneal administration of kainic acid transiently induced the c-fos mRNAs in medaka brains. The results indicate that the expression of c-fos can be utilized as a suitable anatomical marker for the increased neural activities in the central nervous system of medaka. Fish were continuously exposed to 3 g hypergravity by centrifugation. Investigation of c-fos mRNA expression indicated that c-fos mRNA significantly increased 30 min after a start of 3 g exposure. The distribution of its transcripts within the brains was analyzed by an in situ hybridization method. The 3-g treated medakas displayed c-fos positive cells in their brainstem regions, which are related to vestibular function, such as torus semicircularis, nucleus tangentialis, posterior octavu nucleus, and inferior olive. Our results established a method to follow the effect of gravity stimulation, which can be used to investigate gravity perception.

  15. Activation of stress-activated MAP protein kinases up-regulates expression of transgenes driven by the cytomegalovirus immediate/early promoter.

    PubMed Central

    Bruening, W; Giasson, B; Mushynski, W; Durham, H D

    1998-01-01

    The immediate/early promoter/enhancer of cytomegalovirus (CMV promoter) is one of the most commonly used promoters for expression of transgenes in eukaryotic cells. In practice, the CMV promoter is often thought of as a constitutively active unregulated promoter. However, we have observed that transcription from the CMV promoter can be up-regulated by a variety of environmental stresses. Many forms of cellular stress stimulate MAP kinase signalling pathways, resulting in activation of stress-activated protein kinases [SAPKs, also called Jun N-terminal kinases (JNKs)] and p38 kinases. We have found that the same conditions that lead to activation of SAPK/JNKs and p38 kinases can also dramatically increase expression from the CMV promoter. Inhibitors of p38 kinases abolished basal transcription from the CMV promoter and completely blocked stress-induced up-regulation of the CMV promoter. Overexpression of a dominant negative JNK kinase had no effect on basal transcription, but significantly reduced up-regulation caused by stress. These results have grave implications for use of the CMV promoter. If the CMV promoter can be up-regulated by cellular stresses, inadvertent activation of the stress kinase pathways may complicate, if not invalidate, the interpretation of a wide range of experiments. PMID:9421504

  16. Barrier-to-Autointegration Factor 1 (BAF/BANF1) Promotes Association of the SETD1A Histone Methyltransferase with Herpes Simplex Virus Immediate-Early Gene Promoters

    PubMed Central

    Oh, Hyung Suk; Traktman, Paula

    2015-01-01

    ABSTRACT We have shown previously that A-type lamins and intranuclear localization of the herpes simplex virus (HSV) genome are critical for the formation of the VP16 activator complex on HSV immediate-early (IE) gene promoters in murine cells, which implies a critical role for lamin A and its associated proteins in HSV gene expression. Because barrier-to-autointegration factor 1 (BAF/BANF1) has been thought to bridge chromosomes to the nuclear lamina, we hypothesized that BAF might mediate viral genome targeting to the nuclear lamina. We found that overexpression of BAF enhances HSV-1 replication and knockdown of BAF decreases HSV gene expression, delays the kinetics of viral early replication compartment formation, and reduces viral yield compared to those in control small interfering RNA-transfected cells. However, BAF depletion did not affect genome complex targeting to the nuclear periphery. Instead, we found that the levels of a histone-modifying enzyme, SETD1A methyltransferase, and histone H3 lysine 4 trimethylation were reduced on IE and early (E) gene promoters in BAF-depleted cells during HSV lytic infection. Our results demonstrate a novel function of BAF as an epigenetic regulator of HSV lytic infection. We hypothesize that BAF facilitates IE and E gene expression by recruiting the SETD1A methyltransferase to viral IE and E gene promoters. PMID:26015494

  17. Dynamic shifts in corticostriatal expression patterns of the immediate early genes Homer 1a and Zif268 during early and late phases of instrumental training.

    PubMed

    Hernandez, Pepe J; Schiltz, Craig A; Kelley, Ann E

    2006-01-01

    Adaptive motor actions require prior knowledge of instrumental contingencies. With practice, these actions can become highly automatic in nature. However, the molecular and anatomical substrates mediating these related forms of learning are not understood. In the present study, we used in situ hybridization to measure the mRNA levels of two immediate early genes (IEGs) in an instrumental paradigm where rats learned to lever-press for food. We report that after three training sessions, Homer 1a and Zif268 (an effector and regulatory IEG, respectively) were significantly induced within an extensive corticostriatal network relative to untrained controls. With extended training (23 sessions), however, a shift in the expression patterns of the two genes was evident. Expression of Homer 1a (official symbol Homer1) decreased significantly in frontal and cingulate cortices, whereas striatal expression was generally maintained. Interestingly, Homer 1a expression markedly increased with extensive training in the ventrolateral region of the striatum (VLS) relative to early learners, suggesting that plasticity in the VLS is required for the efficient production of the learned behavior or in habit formation. Zif268 (official symbol Egr1) expression generally decreased with extensive training; however, these changes were not significant. These results demonstrate for the first time, on a molecular level, a dynamic shift in the contribution of corticostriatal systems mediating the early acquisition and consolidation of goal-directed responses to those engaged after extensive training. PMID:17015857

  18. Expression of immediate early genes in the hippocampal formation of the black-capped chickadee (Poecile atricapillus) during a food-hoarding task.

    PubMed

    Smulders, T V; DeVoogd, T J

    2000-09-01

    Black-capped chickadees store food in many different locations in their home range and are able to accurately remember these locations. We measured the number of cells immunopositive for three different Immediate Early Gene products (Fra-1, c-Fos and ZENK) to map neuronal activity in the chickadee Hippocampal Formation (HF) during food storing and retrieval. Fra-1-like immunoreactivity is downregulated in the dorsal HF of both storing and retrieving chickadees compared to controls. In retrieving birds, the number of Fos-like immunoreactive neurons relates to the number of items remembered, while the number of ZENK-like immunoreactive neurons in the HF may be related to the accuracy of cache retrieval. These results imply that the brain might process complex information by recruiting more neurons into the network of active neurons. Thus, our results could help explain why food-hoarding birds have more HF neurons than non-hoarders, and why this number increases in autumn when large numbers of food items are cached.

  19. miR-30c negatively regulates the migration and invasion by targeting the immediate early response protein 2 in SMMC-7721 and HepG2 cells

    PubMed Central

    Wu, Wenjuan; Zhang, Xizhi; Liao, Yuexia; Zhang, Weicheng; Cheng, Haichao; Deng, Zijing; Shen, Jingyuan; Yuan, Qing; Zhang, Yu; Shen, Weigan

    2015-01-01

    miR-30c has been reported to act as a tumor suppressor and negatively regulate cancer metastasis by directly targeting metastasis associated genes; however, miR-30c has also been shown to promote the invasion of metastatic breast cancer cells, suggesting that miR-30c might be involved in cancer cell metastasis in different ways via targeting different genes. In this study, we demonstrated that over-expression and knockdown of immediate early response protein 2 (IER2) modulated the general capacity of the migration and invasion in hepatocellular carcinoma cell line SMMC-7721 and HepG2, whereas overexpression and knockdown of miR-30c decreased and promoted cell motility, respectively. Further studies revealed that miR-30c overexpression down-regulated the expression of IER2 protein but not its mRNA level, and miR-30c can directly target the 3’ untranslated region (3’UTR) of IER2, and subsequently reducing its expression. Moreover, we also showed that suppression of cell motility by miR-30c was partially rescued by IER2 re-expression. Our results indicated that miR-30c may function as a negative regulator in cell motility, with IER2 as a direct and functional target in SMMC-7721 and HepG2 cells. PMID:26101708

  20. Direct combinatorial interaction between a herpes simplex virus regulatory protein and a cellular octamer-binding factor mediates specific induction of virus immediate-early gene expression.

    PubMed Central

    O'Hare, P; Goding, C R; Haigh, A

    1988-01-01

    We provide evidence for a novel mechanism of transcriptional regulation in which the immediate-early (IE) transactivating protein of herpes simplex virus, Vmw65, is assembled into a specific DNA-binding complex together with a cellular octamer-binding factor (TRF). The assembly of Vmw65/TRF complex requires not only the core TRF recognition site, but also flanking sequences which are dispensable for TRF binding alone. We show from functional analyses that TRF binding by a motif is required but not sufficient to confer induction on a heterologous promoter, and it is the ability of the motif to allow TRF/Vmw65 complex assembly which correlates with functional activity. Thus, for the induction of HSV IE expression, Vmw65 forms a complex with TRF by recognition of the specific subset of appropriately flanked TRF binding sites present in each of the IE genes. This mechanism may provide a paradigm for the selective utilization of the same transcription factor in differential gene expression. Images PMID:2854058

  1. The hallucinogen d-lysergic acid diethylamide (d-LSD) induces the immediate-early gene c-Fos in rat forebrain.

    PubMed

    Frankel, Paul S; Cunningham, Kathryn A

    2002-12-27

    The hallucinogen d-lysergic acid diethylamide (d-LSD) evokes dramatic somatic and psychological effects. In order to analyze the neural activation induced by this unique psychoactive drug, we tested the hypothesis that expression of the immediate-early gene product c-Fos is induced in specific regions of the rat forebrain by a relatively low, behaviorally active, dose of d-LSD (0.16 mg/kg, i.p.); c-Fos protein expression was assessed at 30 min, and 1, 2 and 4 h following d-LSD injection. A time- and region-dependent expression of c-Fos was observed with a significant increase (P<0.05) in the number of c-Fos-positive cells detected in the anterior cingulate cortex at 1 h, the shell of the nucleus accumbens at 1 and 2 h, the bed nucleus of stria terminalis lateral at 2 h and the paraventricular hypothalamic nucleus at 1, 2 and 4 h following systemic d-LSD administration. These data demonstrate a unique pattern of c-Fos expression in the rat forebrain following a relatively low dose of d-LSD and suggest that activation of these forebrain regions contributes to the unique behavioral effects of d-LSD.

  2. The immediate early gene Arc is associated with behavioral resilience to stress exposure in an animal model of posttraumatic stress disorder.

    PubMed

    Kozlovsky, Nitsan; Matar, Michael A; Kaplan, Zeev; Kotler, Moshe; Zohar, Joseph; Cohen, Hagit

    2008-02-01

    Mechanisms involved in adaptative and maladaptive changes in neural plasticity and synaptic efficacy in various brain areas are pivotal to understanding the physiology of the response to stress and the pathophysiology of posttraumatic stress disorder (PTSD). Activity-regulated cytoskeletal-associated protein (Arc) is an effector immediate early gene (IEG) which has direct effects on intracellular homeostatic functions. Increased expression of Arc has been associated with increased neuronal activity and with consolidation of long-term memory. It may thus play an important role in mediating experience-induced reorganization and/or development of synaptic connections. This study sought to characterize the pattern of expression of mRNA for the Arc gene in selected brain areas of test subjects classified according to their individual pattern of behavioral response to a stressor, correlated with circulating levels of corticosterone (as a physiological marker of stress response). The hippocampal CA1 and CA3 subregions of individuals whose behavior was minimally or partially disrupted in response to predator scent stress demonstrated significantly increased levels of mRNA for Arc, compared to unexposed controls. The group whose behavior was severely disrupted demonstrated no such upregulation. Consistent with the hypothesis that the Arc gene has a promoting effect on neuronal function and/or structural changes, the lack of Arc expression in the behaviorally and physiologically more severely affected individuals raises the possibility that Arc may be associated with resilience and/or recovery after stress exposure. PMID:17611082

  3. Rapid and long-term induction of effector immediate early genes (BDNF, Neuritin and Arc) in peri-infarct cortex and dentate gyrus after ischemic injury in rat brain.

    PubMed

    Rickhag, Mattias; Teilum, Maria; Wieloch, Tadeusz

    2007-06-01

    The genomic response following brain ischemia is very complex and involves activation of both protective and detrimental signaling pathways. Immediate early genes (IEGs) represent the first wave of gene expression following ischemia and are induced in extensive regions of the ischemic brain including cerebral cortex and hippocampus. Brain-derived neurotrophic factor (BDNF), Neuritin and Activity-regulated cytoskeleton-associated protein (Arc) belong to a subgroup of immediate early genes implicated in synaptic plasticity known as effector immediate early genes. Here, we investigated the spatial and temporal activation pattern for these genes during the first 24 h of reperfusion following 2-h occlusion of the middle cerebral artery. Neuritin showed a persistent activation in frontal-cingulate cortex while Arc displayed a biphasic response. Also, in dentate gyrus, activation was observed at 0-6 h of reperfusion for Neuritin and 0-12 h of reperfusion for Arc while BDNF was induced 0-9 h of reperfusion. Our study demonstrates a rapid and long-term activation of effector immediate early genes in distinct brain areas following ischemic injury in rat. Effector gene activation may be part of long-term synaptic responses of ischemic brain tissue. PMID:17397810

  4. Seven gene deletions in seven days: Fast generation of Escherichia coli strains tolerant to acetate and osmotic stress.

    PubMed

    Jensen, Sheila I; Lennen, Rebecca M; Herrgård, Markus J; Nielsen, Alex T

    2015-12-08

    Generation of multiple genomic alterations is currently a time consuming process. Here, a method was established that enables highly efficient and simultaneous deletion of multiple genes in Escherichia coli. A temperature sensitive plasmid containing arabinose inducible lambda Red recombineering genes and a rhamnose inducible flippase recombinase was constructed to facilitate fast marker-free deletions. To further speed up the procedure, we integrated the arabinose inducible lambda Red recombineering genes and the rhamnose inducible FLP into the genome of E. coli K-12 MG1655. This system enables growth at 37 °C, thereby facilitating removal of integrated antibiotic cassettes and deletion of additional genes in the same day. Phosphorothioated primers were demonstrated to enable simultaneous deletions during one round of electroporation. Utilizing these methods, we constructed strains in which four to seven genes were deleted in E. coli W and E. coli K-12. The growth rate of an E. coli K-12 quintuple deletion strain was significantly improved in the presence of high concentrations of acetate and NaCl. In conclusion, we have generated a method that enables efficient and simultaneous deletion of multiple genes in several E. coli variants. The method enables deletion of up to seven genes in as little as seven days.

  5. Seven gene deletions in seven days: Fast generation of Escherichia coli strains tolerant to acetate and osmotic stress

    PubMed Central

    Jensen, Sheila I.; Lennen, Rebecca M.; Herrgård, Markus J.; Nielsen, Alex T.

    2015-01-01

    Generation of multiple genomic alterations is currently a time consuming process. Here, a method was established that enables highly efficient and simultaneous deletion of multiple genes in Escherichia coli. A temperature sensitive plasmid containing arabinose inducible lambda Red recombineering genes and a rhamnose inducible flippase recombinase was constructed to facilitate fast marker-free deletions. To further speed up the procedure, we integrated the arabinose inducible lambda Red recombineering genes and the rhamnose inducible FLP into the genome of E. coli K-12 MG1655. This system enables growth at 37 °C, thereby facilitating removal of integrated antibiotic cassettes and deletion of additional genes in the same day. Phosphorothioated primers were demonstrated to enable simultaneous deletions during one round of electroporation. Utilizing these methods, we constructed strains in which four to seven genes were deleted in E. coli W and E. coli K-12. The growth rate of an E. coli K-12 quintuple deletion strain was significantly improved in the presence of high concentrations of acetate and NaCl. In conclusion, we have generated a method that enables efficient and simultaneous deletion of multiple genes in several E. coli variants. The method enables deletion of up to seven genes in as little as seven days. PMID:26643270

  6. Seven gene deletions in seven days: Fast generation of Escherichia coli strains tolerant to acetate and osmotic stress.

    PubMed

    Jensen, Sheila I; Lennen, Rebecca M; Herrgård, Markus J; Nielsen, Alex T

    2015-01-01

    Generation of multiple genomic alterations is currently a time consuming process. Here, a method was established that enables highly efficient and simultaneous deletion of multiple genes in Escherichia coli. A temperature sensitive plasmid containing arabinose inducible lambda Red recombineering genes and a rhamnose inducible flippase recombinase was constructed to facilitate fast marker-free deletions. To further speed up the procedure, we integrated the arabinose inducible lambda Red recombineering genes and the rhamnose inducible FLP into the genome of E. coli K-12 MG1655. This system enables growth at 37 °C, thereby facilitating removal of integrated antibiotic cassettes and deletion of additional genes in the same day. Phosphorothioated primers were demonstrated to enable simultaneous deletions during one round of electroporation. Utilizing these methods, we constructed strains in which four to seven genes were deleted in E. coli W and E. coli K-12. The growth rate of an E. coli K-12 quintuple deletion strain was significantly improved in the presence of high concentrations of acetate and NaCl. In conclusion, we have generated a method that enables efficient and simultaneous deletion of multiple genes in several E. coli variants. The method enables deletion of up to seven genes in as little as seven days. PMID:26643270

  7. Color-deficient cone mosaics associated with Xq28 opsin mutations: A stop codon versus gene deletions

    PubMed Central

    Wagner-Schuman, Melissa; Neitz, Jay; Rha, Jungtae; Williams, David R.; Neitz, Maureen; Carroll, Joseph

    2010-01-01

    Our understanding of the etiology of red-green color vision defects is evolving. While missense mutations within the long- (L-) and middle-wavelength sensitive (M-) photopigments and gross rearrangements within the L/M-opsin gene array are commonly associated with red-green defects, recent work using adaptive optics retinal imaging has shown that different genotypes can have distinct consequences for the cone mosaic. Here we examined the cone mosaic in red-green color deficient individuals with multiple X-chromosome opsin genes that encode L opsin, as well as individuals with a single X-chromosome opsin gene that encodes L opsin and a single patient with a novel premature termination codon in his M-opsin gene and a normal L-opsin gene. We observed no difference in cone density between normal trichomats and multiple or single gene dichromats. In addition, we demonstrate different phenotypic effects of a nonsense mutation versus the previously described deleterious polymorphism, (LIAVA), both of which differ from multiple and single gene dichromats. Our results help refine the relationship between opsin genotype and cone photoreceptor mosaic phenotype. PMID:20854834

  8. SUMO-conjugating enzyme E2 UBC9 mediates viral immediate-early protein SUMOylation in crayfish to facilitate reproduction of white spot syndrome virus.

    PubMed

    Chen, An-Jing; Gao, Lu; Wang, Xian-Wei; Zhao, Xiao-Fan; Wang, Jin-Xing

    2013-01-01

    Successful viruses have evolved superior strategies to escape host defenses or exploit host biological pathways. Most of the viral immediate-early (ie) genes are essential for viral infection and depend solely on host proteins; however, the molecular mechanisms are poorly understood. In this study, we focused on the modification of viral IE proteins by the crayfish small ubiquitin-related modifier (SUMO) and investigated the role of SUMOylation during the viral life cycle. SUMO and SUMO ubiquitin-conjugating enzyme 9 (UBC9) involved in SUMOylation were identified in red swamp crayfish (Procambarus clarkii). Both SUMO and UBC9 were upregulated in crayfish challenged with white spot syndrome virus (WSSV). Replication of WSSV genes increased in crayfish injected with recombinant SUMO or UBC9, but injection of mutant SUMO or UBC9 protein had no effect. Subsequently, we analyzed the mechanism by which crayfish SUMOylation facilitates WSSV replication. Crayfish UBC9 bound to all three WSSV IE proteins tested, and one of these IE proteins (WSV051) was covalently modified by SUMO in vitro. The expression of viral ie genes was affected and that of late genes was significantly inhibited in UBC9-silenced or SUMO-silenced crayfish, and the inhibition effect was rescued by injection of recombinant SUMO or UBC9. The results of this study demonstrate that viral IE proteins can be modified by crayfish SUMOylation, prompt the expression of viral genes, and ultimately benefit WSSV replication. Understanding of the mechanisms by which viruses exploit host components will greatly improve our knowledge of the virus-host "arms race" and contribute to the development of novel methods against virulent viruses.

  9. Expression pattern of immediate early genes in the cerebellum of D1R KO, D2R KO, and wild type mice under vestibular-controlled activity.

    PubMed

    Nakamura, Toru; Sato, Asako; Kitsukawa, Takashi; Sasaoka, Toshikuni; Yamamori, Tetsuo

    2015-01-01

    We previously reported the different motor abilities of D1R knockout (KO), D2R KO and wild-type (WT) mice. To understand the interaction between the cerebellum and the striatal direct and indirect pathways, we examined the expression patterns of immediate early genes (IEG) in the cerebellum of these three genotypes of mice. In the WT naive mice, there was little IEG expression. However, we observed a robust expression of c-fos mRNA in the vermis and hemisphere after running rota-rod tasks. In the vermis, c-fos was expressed throughout the lobules except lobule 7, and also in crus 1 of the ansiform lobule (Crus1), copula of the pyramis (Cop) and most significantly in the flocculus in the hemisphere. jun-B was much less expressed but more preferentially expressed in Purkinje cells. In addition, we observed significant levels of c-fos and jun-B expressions after handling mice, and after the stationary rota-rod task in naive mice. Surprisingly, we observed significant expression of c-fos and jun-B even 30 min after single weighing. Nonetheless, certain additional c-fos and jun-B expressions were observed in three genotypes of the mice that experienced several sessions of motor tasks 24 h after stationary rota-rod task and on days 1 and 5 after rota-rod tasks, but no significant differences in expressions after the running rota-rod tasks were observed among the three genotypes. In addition, there may be some differences 24 h after the stationary rota-rod task between the naive mice and the mice that experienced several sessions of motor tasks.

  10. Genome-wide identification of palmitate-regulated immediate early genes and target genes in pancreatic beta-cells reveals a central role of NF-κB.

    PubMed

    Choi, Hyung Jin; Hwang, Seungwoo; Lee, Se-Hee; Lee, You Ri; Shin, Jiyon; Park, Kyong Soo; Cho, Young Min

    2012-06-01

    Free fatty acid-induced pancreatic β-cell dysfunction plays a key role in the pathogenesis of type 2 diabetes. We conducted gene expression microarray analysis to comprehensively investigate the transcription machinery of palmitate-regulated genes in pancreatic β-cells in vitro. In particular, mouse pancreatic βTC3 cells were treated with palmitate in the presence or absence of cycloheximide (CHX), which blocks protein synthesis and thereby allows us to distinguish immediate early genes (IEGs) from their target genes. The microarray experiments identified 34 palmitate-regulated IEGs and 74 palmitate-regulated target genes. In silico promoter analysis revealed that transcription factor binding sites for NF-κB were over-represented, regulating approximately one-third of the palmitate-regulated target genes. In cells treated with CHX, nfkb1 showed an up-regulation by palmitate, suggesting that NF-κB could be an IEG. Functional enrichment analysis of 27 palmitate-regulated genes with NF-κB binding sites showed an over-representation of genes involved in immune response, inflammatory response, defense response, taxis, regulation of cell proliferation, and regulation of cell death pathways. Electrophoretic mobility shift assay showed that palmitate stimulates NF-κB activity both in the presence and absence of CHX. In conclusion, by identifying IEGs and target genes, the present study depicted a comprehensive view of transcription machinery underlying palmitate-induced inflammation and cell proliferation/death in pancreatic β-cells and our data demonstrated the central role of NF-κB.

  11. HSV-2 immediate-early protein US1 inhibits IFN-β production by suppressing association of IRF-3 with IFN-β promoter.

    PubMed

    Zhang, Mudan; Liu, Yalan; Wang, Ping; Guan, Xinmeng; He, Siyi; Luo, Sukun; Li, Chang; Hu, Kai; Jin, Wei; Du, Tao; Yan, Yan; Zhang, Zhenfeng; Zheng, Zhenhua; Wang, Hanzhong; Hu, Qinxue

    2015-04-01

    HSV-2 is the major cause of genital herpes, and its infection increases the risk of HIV-1 acquisition and transmission. After initial infection, HSV-2 can establish latency within the nervous system and thus maintains lifelong infection in humans. It has been suggested that HSV-2 can inhibit type I IFN signaling, but the underlying mechanism has yet to be determined. In this study, we demonstrate that productive HSV-2 infection suppresses Sendai virus (SeV) or polyinosinic-polycytidylic acid-induced IFN-β production. We further reveal that US1, an immediate-early protein of HSV-2, contributes to such suppression, showing that US1 inhibits IFN-β promoter activity and IFN-β production at both mRNA and protein levels, whereas US1 knockout significantly impairs such capability in the context of HSV-2 infection. US1 directly interacts with DNA binding domain of IRF-3, and such interaction suppresses the association of nuclear IRF-3 with the IRF-3 responsive domain of IFN-β promoter, resulting in the suppression of IFN-β promoter activation. Additional studies demonstrate that the 217-414 aa domain of US1 is critical for the suppression of IFN-β production. Our results indicate that HSV-2 US1 downmodulates IFN-β production by suppressing the association of IRF-3 with the IRF-3 responsive domain of IFN-β promoter. Our findings highlight the significance of HSV-2 US1 in inhibiting IFN-β production and provide insights into the molecular mechanism by which HSV-2 evades the host innate immunity, representing an unconventional strategy exploited by a dsDNA virus to interrupt type I IFN signaling pathway. PMID:25712217

  12. Expression pattern of immediate early genes in the cerebellum of D1R KO, D2R KO, and wild type mice under vestibular-controlled activity

    PubMed Central

    Nakamura, Toru; Sato, Asako; Kitsukawa, Takashi; Sasaoka, Toshikuni; Yamamori, Tetsuo

    2015-01-01

    We previously reported the different motor abilities of D1R knockout (KO), D2R KO and wild-type (WT) mice. To understand the interaction between the cerebellum and the striatal direct and indirect pathways, we examined the expression patterns of immediate early genes (IEG) in the cerebellum of these three genotypes of mice. In the WT naive mice, there was little IEG expression. However, we observed a robust expression of c-fos mRNA in the vermis and hemisphere after running rota-rod tasks. In the vermis, c-fos was expressed throughout the lobules except lobule 7, and also in crus 1 of the ansiform lobule (Crus1), copula of the pyramis (Cop) and most significantly in the flocculus in the hemisphere. jun-B was much less expressed but more preferentially expressed in Purkinje cells. In addition, we observed significant levels of c-fos and jun-B expressions after handling mice, and after the stationary rota-rod task in naive mice. Surprisingly, we observed significant expression of c-fos and jun-B even 30 min after single weighing. Nonetheless, certain additional c-fos and jun-B expressions were observed in three genotypes of the mice that experienced several sessions of motor tasks 24 h after stationary rota-rod task and on days 1 and 5 after rota-rod tasks, but no significant differences in expressions after the running rota-rod tasks were observed among the three genotypes. In addition, there may be some differences 24 h after the stationary rota-rod task between the naive mice and the mice that experienced several sessions of motor tasks. PMID:26137459

  13. Contrasting role of phospholipase C-{gamma}1 in the expression of immediate early genes induced by epidermal or platelet-derived growth factors

    SciTech Connect

    Liao Hongjun; Santos, Josue de los; Carpenter, Graham . E-mail: graham.carpenter@vanderbilt.edu

    2006-04-01

    While significant progress has been achieved in identifying the signal transduction elements that operate downstream of activated receptor tyrosine kinases, it remains unclear how different receptors utilize these signaling elements to achieve a common response. This study compares the capacity of epidermal growth factor (EGF) and platelet-derived growth factor (PDGF) to elicit the induction of immediate early gene (IEG) mRNAs in the presence or absence of phospholipase C-{gamma}1 (PLC-{gamma}1). The results show that while PDGF induction of nearly all IEG mRNAs is abrogated in plcg1 null cells, EGF induction of the same genes is variable in the null cells and exhibits three distinct responses. Five IEG mRNAs (Nup475, Cyr61, TF, Gly, TS7) are completely inducible by EGF in the presence or absence of PLC-{gamma}1, while three others (JE, KC, FIC) exhibit a stringent requirement for the presence of PLC-{gamma}1. The third type of response is exhibited by c-fos and COX-2. While these mRNAs are completely induced by EGF in the absence of PLC-{gamma}1, the time course of their accumulation is significantly delayed. No IEG was identified as completely inducible by EGF and PDGF in the absence of PLC-{gamma}1. Electrophoretic mobility shift assays (EMSA) demonstrate that PLC-{gamma}1 is necessary for nuclear extracts from PDGF-treated cells, but not EGF-treated cells, to interact with probes for AP-1 or NF-{kappa}B.

  14. Stressor and glucocorticoid-dependent induction of the immediate early gene kruppel-like factor 9: implications for neural development and plasticity.

    PubMed

    Bonett, Ronald M; Hu, Fang; Bagamasbad, Pia; Denver, Robert J

    2009-04-01

    Krüppel-like factor 9 (KLF9) is a thyroid hormone-induced, immediate early gene implicated in neural development in vertebrates. We analyzed stressor and glucocorticoid (GC)-dependent regulation of KLF9 expression in the brain of the frog Xenopus laevis, and investigated a possible role for KLF9 in neuronal differentiation. Exposure to shaking/confinement stressor increased plasma corticosterone (CORT) concentration, and KLF9 immunoreactivity in several brain regions, which included the medial amygdala and bed nucleus of the stria terminalis, anterior preoptic area (homologous to the mammalian paraventricular nucleus), and optic tectum (homologous to the mammalian superior colliculus). The stressor-induced KLF9 mRNA expression in the brain was blocked by pretreatment with the GC receptor antagonist RU486, or mimicked by injection of CORT. Treatment with CORT also caused a rapid and dose-dependent increase in KLF9 mRNA in X. laevis XTC-2 cells that was resistant to inhibition of protein synthesis. The action of CORT on KLF9 expression in XTC-2 cells was blocked by RU486, but not by the mineralocorticoid receptor antagonist spironolactone. To test for functional consequences of up-regulation of KLF9, we introduced a KLF9 expression plasmid into living tadpole brain by electroporation-mediated gene transfer. Forced expression of KLF9 in tadpole brain caused an increase in Golgi-stained cells, reflective of neuronal differentiation/maturation. Our results support that KLF9 is a direct, GC receptor target gene that is induced by stress, and functions as an intermediary in the actions of GCs on brain gene expression and neuronal structure.

  15. Motor-Coordination-Dependent Learning, More than Others, Is Impaired in Transgenic Mice Expressing Pseudorabies Virus Immediate-Early Protein IE180

    PubMed Central

    López-Ramos, Juan C.; Tomioka, Yukiko; Morimatsu, Masami; Yamamoto, Sayo; Ozaki, Kinuyo; Ono, Etsuro; Delgado-García, José M.

    2010-01-01

    The cerebellum in transgenic mice expressing pseudorabies virus immediate-early protein IE180 (TgIE96) was substantially diminished in size, and its histoarchitecture was severely disorganized, resulting in severe ataxia. TgIE96 mice can therefore be used as an experimental model to study the involvement of cerebellar circuits in different learning tasks. The performance of three-month-old TgIE96 mice was studied in various behavioral tests, including associative learning (classical eyeblink conditioning), object recognition, spatial orientation (water maze), startle response and prepulse inhibition, and passive avoidance, and compared with that of wild-type mice. Wild-type and TgIE96 mice presented similar reflexively evoked eyeblinks, and acquired classical conditioned eyelid responses with similar learning curves for both trace and delay conditioning paradigms. The two groups of mice also had similar performances during the object recognition test. However, they showed significant differences for the other three tests included in this study. Although both groups of animals were capable of swimming, TgIE96 mice failed to learn the water maze task during the allowed time. The startle response to a severe tone was similar in both control and TgIE96 mice, but the latter were unable to produce a significant prepulse inhibition. TgIE96 mice also presented evident deficits for the proper accomplishment of a passive avoidance test. These results suggest that the cerebellum is not indispensable for the performance of classical eyeblink conditioning and for object recognition tasks, but seems to be necessary for the proper performance of water maze, prepulse inhibition, and passive avoidance tests. PMID:20711341

  16. Structural Characterization of Interaction between Human Ubiquitin-specific Protease 7 and Immediate-Early Protein ICP0 of Herpes Simplex Virus-1*

    PubMed Central

    Pozhidaeva, Alexandra K.; Mohni, Kareem N.; Dhe-Paganon, Sirano; Arrowsmith, Cheryl H.; Weller, Sandra K.; Korzhnev, Dmitry M.; Bezsonova, Irina

    2015-01-01

    Human ubiquitin-specific protease 7 (USP7) is a deubiquitinating enzyme that prevents protein degradation by removing polyubiquitin chains from its substrates. It regulates the stability of a number of human transcription factors and tumor suppressors and plays a critical role in the development of several types of cancer, including prostate and small cell lung cancer. In addition, human USP7 is targeted by several viruses of the Herpesviridae family and is required for effective herpesvirus infection. The USP7 C-terminal region (C-USP7) contains five ubiquitin-like domains (UBL1–5) that interact with several USP7 substrates. Although structures of the USP7 C terminus bound to its substrates could provide vital information for understanding USP7 substrate specificity, no such data has been available to date. In this work we have demonstrated that the USP7 ubiquitin-like domains can be studied in isolation by solution NMR spectroscopy, and we have determined the structure of the UBL1 domain. Furthermore, we have employed NMR and viral plaque assays to probe the interaction between the C-USP7 and HSV-1 immediate-early protein ICP0 (infected cell protein 0), which is essential for efficient lytic infection and virus reactivation from latency. We have shown that depletion of the USP7 in HFF-1 cells negatively affects the efficiency of HSV-1 lytic infection. We have also found that USP7 directly binds ICP0 via its C-terminal UBL1–2 domains and mapped the USP7-binding site for ICP0. Therefore, this study represents a first step toward understanding the molecular mechanism of C-USP7 specificity toward its substrates and may provide the basis for future development of novel antiviral and anticancer therapies. PMID:26224631

  17. Prenatal exposure to moderate levels of ethanol alters social behavior in adult rats: Relationship to structural plasticity and immediate early gene expression in frontal cortex

    PubMed Central

    Hamilton, Derek A.; Akers, Katherine G.; Rice, James P.; Johnson, Travis E.; Candelaria-Cook, Felicha T.; Maes, Levi I.; Rosenberg, Martina; Valenzuela, C. Fernando; Savage, Daniel D.

    2009-01-01

    The goals of the present study were to characterize the effects of prenatal exposure to moderate levels of ethanol on adult social behavior, and to evaluate fetal-ethanol-related effects on dendritic morphology, structural plasticity and activity-related immediate early gene (IEG) expression in the agranular insular (AID) and prelimbic (Cg3) regions of frontal cortex. Baseline fetal-ethanol-related alterations in social behavior were limited to reductions in social investigation in males. Repeated experience with novel cage-mates resulted in comparable increases in wrestling and social investigation among saccharin- and ethanol-exposed females, whereas social behavioral effects among males were more evident in ethanol-exposed animals. Male ethanol-exposed rats also displayed profound increases in wrestling when social interaction was motivated by 24 hours of isolation. Baseline decreases in dendritic length and spine density in AID were observed in ethanol-exposed rats that were always housed with the same cage-mate. Modest experience-related decreases in dendritic length and spine density in AID were observed in saccharin-exposed rats housed with various cage-mates. In contrast, fetal-ethanol-exposed rats displayed experience-related increases in dendritic length in AID, and no experience-related changes in spine density. The only effect observed in Cg3 was a baseline increase in basilar dendritic length among male ethanol-exposed rats. Robust increases in activity-related IEG expression in AID (c-fos and Arc) and Cg3 (c-fos) were observed following social interaction in saccharin-exposed rats, however, activity-related increases in IEG expression were not observed in fetal-ethanol-exposed rats in either region. The results indicate that deficits in social behavior are among the long-lasting behavioral consequences of moderate ethanol exposure during brain development, and implicate AID, and to a lesser degree Cg3, in fetal-ethanol-related social behavior

  18. Abundant constitutive expression of the immediate-early 94K protein from cytomegalovirus (Colburn) in a DNA-transfected mouse cell line

    SciTech Connect

    Jeang, K.T.; Cho, M.S.; Hayward, G.S.

    1984-10-01

    A 94-kilodalton phosphoprotein known as IE94 is the only viral polypeptide synthesized in abundance under immediate-early conditions after infection by cytomegalovirus (CMV) strain Colburn in either permissive primate or nonpermissive rodent cells. The authors isolated a clonal Ltk/sup +/ cell line which expressed the /sup 35/methionine-labeled IE94 polypeptide in sufficient abundance to be visualized directly in autoradiographs after gel electrophoresis of total-cell-culture protein extracts. The IE94 polypeptide synthesized in the transfected cells was indistinguishable in size and overall net charge from that produced in virus-infected cells. In addition, the IE94 protein expressed in LH/sub 2/p198-3 cells was phosphorylated (presumably by a cellular protein kinase) and generated similar phosphopeptide patterns after partial tryptic digestion to those obtained with the CMV IE94 protein from infected cells. The cell line contained two to four stably integrated copies of the IE94 gene and synthesized a single virus-specific mRNA of 2.5 kilobases detectable on Northern blots. A new antigen, detectable by indirect anticomplement immunofluorescence with monoclonal antibody against the human CMV IE68 protein, was present in the nuclei of more than 95% of the LH/sub 2/l198-3 cells. This evidence suggests that (unlike most herpesvirus genes) the CMV IE94 gene, together with its complex promoter and spliced mRNA structure, may contain all of the regulatory elements necessary for strong constitutive expression in mammalian cells in the absence of other viral factors.

  19. The time course of systems consolidation of spatial memory from recent to remote retention: A comparison of the Immediate Early Genes Zif268, c-Fos and Arc.

    PubMed

    Barry, Daniel N; Coogan, Andrew N; Commins, Sean

    2016-02-01

    Systems consolidation is a process involving the stabilisation of memory traces in the neocortex over time. The medial prefrontal cortex becomes increasingly important during the retrieval of older memories, however the timescale of its involvement is unclear, and the contribution of other neocortical brain regions to remote memory have received little attention. The Immediate Early Genes (IEGs) Zif268, c-Fos and Arc have been utilised as markers of neural activity during spatial memory retrieval, however the lack of a direct comparison between them hinders the interpretation of results. To address these questions, we examined the expression of Zif268, Arc and c-Fos protein in the medial prefrontal cortex, as well as the hippocampus, and the entorhinal, perirhinal, retrosplenial and parietal cortices of male Wistar rats following a probe trial of the Morris water maze either one day, seven days, 14 days or 30 days after acquisition. Activity of the medial prefrontal cortex during retrieval, as measured by all three IEGs, increased in correspondence with the age of the memory, reaching significance between 14 and 30 days. Similar increases in c-Fos and Arc were observed over the course of consolidation in other neocortical and parahippocampal areas, however this pattern was not observed with Zif268. Activity of the hippocampus remained largely unchanged across retention intervals. These findings suggest that systems consolidation of spatial memory takes at least two weeks, are consistent with an ongoing role for the hippocampus in the retrieval of spatial memory, and suggest that c-Fos and Arc may be a more sensitive measure of neural activity in response to behavioural tasks than Zif268. PMID:26748021

  20. BZLF1, an Epstein-Barr virus immediate-early protein, induces p65 nuclear translocation while inhibiting p65 transcriptional function

    SciTech Connect

    Morrison, Thomas E.; Kenney, Shannon C. . E-mail: shann@med.unc.edu

    2004-10-25

    We have previously demonstrated that the Epstein-Barr virus immediate-early BZLF1 protein interacts with, and is inhibited by, the NF-{kappa}B family member p65. However, the effects of BZLF1 on NF-{kappa}B activity have not been intensively studied. Here we show that BZLF1 inhibits p65-dependent gene expression. BZLF1 inhibited the ability of IL-1, as well as transfected p65, to activate the expression of two different NF-{kappa}B-responsive genes, ICAM-1 and I{kappa}B-{alpha}. BZLF1 also reduced the constitutive level of I{kappa}B-{alpha} protein in HeLa and A549 cells, and increased the amount of nuclear NF-{kappa}B to a similar extent as tumor necrosis factor-alpha (TNF-{alpha}) treatment. In spite of this BZLF1-associated increase in the nuclear form of NF-{kappa}B, BZLF1 did not induce binding of NF-{kappa}B to NF-{kappa}B responsive promoters (as determined by chromatin immunoprecipitation assay) in vivo, although TNF-{alpha} treatment induced NF-{kappa}B binding as expected. Overexpression of p65 dramatically inhibited the lytic replication cycle of EBV in 293-EBV cells, confirming that NF-{kappa}B also inhibits BZLF1 transcriptional function. Our results are consistent with a model in which BZLF1 inhibits the transcriptional function of p65, resulting in decreased transcription of I{kappa}B-{alpha}, decreased expression of I{kappa}B-{alpha} protein, and subsequent translocation of NF-{kappa}B to the nucleus. This nuclear translocation of NF-{kappa}B may promote viral latency by negatively regulating BZLF1 transcriptional activity. In situations where p65 activity is limiting in comparison to BZLF1, the ability of BZLF1 to inhibit p65 transcriptional function may protect the virus from the host immune system during the lytic form of infection.

  1. Characterization of Xylan Utilization and Discovery of a New Endoxylanase in Thermoanaerobacterium saccharolyticum through Targeted Gene Deletions

    PubMed Central

    Podkaminer, Kara K.; Guss, Adam M.; Trajano, Heather L.; Hogsett, David A.

    2012-01-01

    The economical production of fuels and commodity chemicals from lignocellulose requires the utilization of both the cellulose and hemicellulose fractions. Xylanase enzymes allow greater utilization of hemicellulose while also increasing cellulose hydrolysis. Recent metabolic engineering efforts have resulted in a strain of Thermoanaerobacterium saccharolyticum that can convert C5 and C6 sugars, as well as insoluble xylan, into ethanol at high yield. To better understand the process of xylan solubilization in this organism, a series of targeted deletions were constructed in the homoethanologenic T. saccharolyticum strain M0355 to characterize xylan hydrolysis and xylose utilization in this organism. While the deletion of β-xylosidase xylD slowed the growth of T. saccharolyticum on birchwood xylan and led to an accumulation of short-chain xylo-oligomers, no other single deletion, including the deletion of the previously characterized endoxylanase XynA, had a phenotype distinct from that of the wild type. This result indicates a multiplicity of xylanase enzymes which facilitate xylan degradation in T. saccharolyticum. Growth on xylan was prevented only when a previously uncharacterized endoxylanase encoded by xynC was also deleted in conjunction with xynA. Sequence analysis of xynC indicates that this enzyme, a low-molecular-weight endoxylanase with homology to glycoside hydrolase family 11 enzymes, is secreted yet untethered to the cell wall. Together, these observations expand our understanding of the enzymatic basis of xylan hydrolysis by T. saccharolyticum. PMID:23023741

  2. Screening of ARHSP-TCC patients expands the spectrum of SPG11 mutations and includes a large scale gene deletion.

    PubMed

    Denora, Paola S; Schlesinger, David; Casali, Carlo; Kok, Fernando; Tessa, Alessandra; Boukhris, Amir; Azzedine, Hamid; Dotti, Maria Teresa; Bruno, Claudio; Truchetto, Jeremy; Biancheri, Roberta; Fedirko, Estelle; Di Rocco, Maja; Bueno, Clarissa; Malandrini, Alessandro; Battini, Roberta; Sickl, Elisabeth; de Leva, Maria Fulvia; Boespflug-Tanguy, Odile; Silvestri, Gabriella; Simonati, Alessandro; Said, Edith; Ferbert, Andreas; Criscuolo, Chiara; Heinimann, Karl; Modoni, Anna; Weber, Peter; Palmeri, Silvia; Plasilova, Martina; Pauri, Flavia; Cassandrini, Denise; Battisti, Carla; Pini, Antonella; Tosetti, Michela; Hauser, Erwin; Masciullo, Marcella; Di Fabio, Roberto; Piccolo, Francesca; Denis, Elodie; Cioni, Giovanni; Massa, Roberto; Della Giustina, Elvio; Calabrese, Olga; Melone, Marina A B; De Michele, Giuseppe; Federico, Antonio; Bertini, Enrico; Durr, Alexandra; Brockmann, Knut; van der Knaap, Marjo S; Zatz, Mayana; Filla, Alessandro; Brice, Alexis; Stevanin, Giovanni; Santorelli, Filippo M

    2009-03-01

    Autosomal recessive spastic paraplegia with thinning of corpus callosum (ARHSP-TCC) is a complex form of HSP initially described in Japan but subsequently reported to have a worldwide distribution with a particular high frequency in multiple families from the Mediterranean basin. We recently showed that ARHSP-TCC is commonly associated with mutations in SPG11/KIAA1840 on chromosome 15q. We have now screened a collection of new patients mainly originating from Italy and Brazil, in order to further ascertain the spectrum of mutations in SPG11, enlarge the ethnic origin of SPG11 patients, determine the relative frequency at the level of single Countries (i.e., Italy), and establish whether there is one or more common mutation. In 25 index cases we identified 32 mutations; 22 are novel, including 9 nonsense, 3 small deletions, 4 insertions, 1 in/del, 1 small duplication, 1 missense, 2 splice-site, and for the first time a large genomic rearrangement. This brings the total number of SPG11 mutated patients in the SPATAX collection to 111 cases in 44 families and in 17 isolated cases, from 16 Countries, all assessed using homogeneous clinical criteria. While expanding the spectrum of mutations in SPG11, this larger series also corroborated the notion that even within apparently homogeneous population a molecular diagnosis cannot be achieved without full gene sequencing.

  3. Efficient dual sgRNA-directed large gene deletion in rabbit with CRISPR/Cas9 system.

    PubMed

    Song, Yuning; Yuan, Lin; Wang, Yong; Chen, Mao; Deng, Jichao; Lv, Qingyan; Sui, Tingting; Li, Zhanjun; Lai, Liangxue

    2016-08-01

    The CRISPR RNA-guided Cas9 nuclease gene-targeting system has been extensively used to edit the genome of several organisms. However, most mutations reported to date have been are indels, resulting in multiple mutations and numerous alleles in targeted genes. In the present study, a large deletion of 105 kb in the TYR (tyrosinase) gene was generated in rabbit via a dual sgRNA-directed CRISPR/Cas9 system. The typical symptoms of albinism accompanied significantly decreased expression of TYR in the TYR knockout rabbits. Furthermore, the same genotype and albinism phenotype were found in the F1 generation, suggesting that large-fragment deletions can be efficiently transmitted to the germline and stably inherited in offspring. Taken together, our data demonstrate that mono and biallelic large deletions can be achieved using the dual sgRNA-directed CRISPR/Cas9 system. This system produces no mosaic mutations or off-target effects, making it an efficient tool for large-fragment deletions in rabbit and other organisms. PMID:26817461

  4. Sustained inflammation and differential expression of interferons type I and III in PVM-infected interferon-gamma (IFNγ) gene-deleted mice.

    PubMed

    Glineur, Stephanie F; Bowen, Aaron B; Percopo, Caroline M; Garcia-Crespo, Katia E; Dyer, Kimberly D; Ochkur, Sergei I; Lee, Nancy A; Lee, James J; Domachowske, Joseph B; Rosenberg, Helene F

    2014-11-01

    Interferon gamma (IFNγ) has complex immunomodulatory and antiviral properties. While IFNγ is detected in the airways in response to infection with the pneumovirus pathogen, pneumonia virus of mice (PVM; Family Paramyxoviridae), its role in promoting disease has not been fully explored. Here, we evaluate PVM infection in IFNγ(-/-) mice. Although the IFNγ gene-deletion has no impact on weight loss, survival or virus kinetics, expression of IFNβ, IFNλ2/3 and IFN-stimulated 2-5' oligoadenylate synthetases was significantly diminished compared to wild-type counterparts. Furthermore, PVM infection in IFNγ(-/-) mice promoted prominent inflammation, including eosinophil and neutrophil infiltration into the airways and lung parenchyma, observed several days after peak virus titer. Potential mechanisms include over-production of chemoattractant and eosinophil-active cytokines (CXCL1, CCL11, CCL3 and IL5) in PVM-infected IFNγ(-/-) mice; likewise, IFNγ actively antagonized IL5-dependent eosinophil survival ex vivo. Our results may have clinical implications for pneumovirus infection in individuals with IFNγ signaling defects.

  5. Association of GSTM1 and GSTT1 gene deletions with susceptibility to DNA damage in the pesticide-exposed workers of Punjab.

    PubMed

    Abhishek, S; Kaur, N; Kaur, S; Lata, M; Sharma, J K; Sharma, A

    2010-01-01

    The main aim of this study was to evaluate genotoxic effects of pesticides in association with glutathione S-transferase (GST) polymorphism. To achieve this aim, DNA damage and the genotypes of the GSTM1 and GSTT1 genes were studied from blood lymphocytes of pesticide-exposed and unexposed (control) agricultural workers of the Punjab region of northwestern India. The blood samples were collected from 40 exposed and 27 unexposed subjects from the Kakrala and Sanour villages of Patiala district. DNA damage was evaluated by using an alkaline comet assay. The analysis of the comets was done through visual scoring and image analysis software (Tritek's CometScore). Damage Index (DI), Damage Frequency (DF) (calculated by visual scoring method), and % DNA in tail (measured by image analysis software) were considered for assessing DNA damage. The DNA extraction from blood cells was done using proteinase K and the phenol-chloroform method, and genotyping of GSTM1 and GSTT1 was done using multiplex PCR. It was found that all the pesticide-exposed subjects showed higher DI, DF, and % DNA in tail in comparison to the controls. The statistical comparison of DNA damage between the exposed group and unexposed group revealed highly significant differences (p < 0.05; Mann-Whitney U-test). In addition, the GSTT1 gene deletion and simultaneous deletions of GSTM1 and GSTT1 genes in increasing DNA damage were observed in the exposed group. PMID:20370484

  6. Analysis of Two Complementary Single-Gene Deletion Mutant Libraries of Salmonella Typhimurium in Intraperitoneal Infection of BALB/c Mice

    PubMed Central

    Silva-Valenzuela, Cecilia A.; Molina-Quiroz, Roberto C.; Desai, Prerak; Valenzuela, Camila; Porwollik, Steffen; Zhao, Ming; Hoffman, Robert M.; Andrews-Polymenis, Helene; Contreras, Inés; Santiviago, Carlos A.; McClelland, Michael

    2016-01-01

    Two pools of individual single gene deletion (SGD) mutants of S. Typhimurium 14028s encompassing deletions of 3,923 annotated non-essential ORFs and sRNAs were screened by intraperitoneal (IP) injection in BALB/c mice followed by recovery from spleen and liver 2 days post infection. The relative abundance of each mutant was measured by microarray hybridization. The two mutant libraries differed in the orientation of the antibiotic resistance cassettes (either sense-oriented KanR, SGD-K, or antisense-oriented CamR, SGD-C). Consistent systemic colonization defects were observed in both libraries and both organs for hundreds of mutants of genes previously reported to be important after IP injection in this animal model, and for about 100 new candidate genes required for systemic colonization. Four mutants with a range of apparent fitness defects were confirmed using competitive infections with the wild-type parental strain: ΔSTM0286, ΔSTM0551, ΔSTM2363, and ΔSTM3356. Two mutants, ΔSTM0286 and ΔSTM2363, were then complemented in trans with a plasmid encoding an intact copy of the corresponding wild-type gene, and regained the ability to fully colonize BALB/c mice systemically. These results suggest the presence of many more undiscovered Salmonella genes with phenotypes in IP infection of BALB/c mice, and validate the libraries for application to other systems. PMID:26779130

  7. Third case of 8q23.3-q24.13 deletion in a patient with Langer-Giedion syndrome phenotype without TRPS1 gene deletion.

    PubMed

    Pereza, Nina; Severinski, Srećko; Ostojić, Saša; Volk, Marija; Maver, Aleš; Dekanić, Kristina Baraba; Kapović, Miljenko; Peterlin, Borut

    2012-03-01

    Langer-Giedion syndrome (LGS) is a contiguous gene syndrome caused by a hemizygous deletion on chromosome 8q23.3-q24.11 involving TRPS1 and EXT1 genes. We report on a girl with LGS phenotype and a 7.5 Mb interstitial deletion at chromosome 8q23.3-q24.13. Array-comparative genomic hybridization (a-CGH) revealed a deletion encompassing only the EXT1 and not the TRPS1 gene. Even though the deletion of TRPS1 and EXT1 genes is responsible for craniofacial and skeletal features of LGS, there have been previous reports of patients with LGS phenotype and 8q24 deletions leaving the TRPS1 gene intact. To our knowledge, this is the third such case. Our patient differs from previously reported LGS patients without TRPS1 gene deletion in that she has the typical LGS facial dysmorphism and skeletal abnormalities. However, the girl is of normal height and has only a mild developmental delay. Additionally, she has dyslalia and premature adrenarche classified as Tanner stage 3 premature pubarche which have not yet been described as features of LGS. We examine the molecular breakpoints and phenotypes of our patient and previously reported cases.

  8. Analysis of Two Complementary Single-Gene Deletion Mutant Libraries of Salmonella Typhimurium in Intraperitoneal Infection of BALB/c Mice.

    PubMed

    Silva-Valenzuela, Cecilia A; Molina-Quiroz, Roberto C; Desai, Prerak; Valenzuela, Camila; Porwollik, Steffen; Zhao, Ming; Hoffman, Robert M; Andrews-Polymenis, Helene; Contreras, Inés; Santiviago, Carlos A; McClelland, Michael

    2015-01-01

    Two pools of individual single gene deletion (SGD) mutants of S. Typhimurium 14028s encompassing deletions of 3,923 annotated non-essential ORFs and sRNAs were screened by intraperitoneal (IP) injection in BALB/c mice followed by recovery from spleen and liver 2 days post infection. The relative abundance of each mutant was measured by microarray hybridization. The two mutant libraries differed in the orientation of the antibiotic resistance cassettes (either sense-oriented Kan(R), SGD-K, or antisense-oriented Cam(R), SGD-C). Consistent systemic colonization defects were observed in both libraries and both organs for hundreds of mutants of genes previously reported to be important after IP injection in this animal model, and for about 100 new candidate genes required for systemic colonization. Four mutants with a range of apparent fitness defects were confirmed using competitive infections with the wild-type parental strain: ΔSTM0286, ΔSTM0551, ΔSTM2363, and ΔSTM3356. Two mutants, ΔSTM0286 and ΔSTM2363, were then complemented in trans with a plasmid encoding an intact copy of the corresponding wild-type gene, and regained the ability to fully colonize BALB/c mice systemically. These results suggest the presence of many more undiscovered Salmonella genes with phenotypes in IP infection of BALB/c mice, and validate the libraries for application to other systems. PMID:26779130

  9. Combined metabonomic and quantitative real-time PCR analyses reveal systems metabolic changes of Fusarium graminearum induced by Tri5 gene deletion.

    PubMed

    Chen, Fangfang; Zhang, Jingtao; Song, Xiushi; Yang, Jian; Li, Heping; Tang, Huiru; Liao, Yu-Cai

    2011-05-01

    Fusarium graminearum (FG) is a serious plant pathogen causing huge losses in global production of wheat and other cereals. Tri5-gene encoded trichodiene synthase is the first key enzyme for biosynthesis of trichothecene mycotoxins in FG. To further our understandings of FG metabolism which is essential for developing novel strategies for controlling FG, we conducted a comprehensive investigation on the metabolic changes caused by Tri5-deletion by comparing metabolic differences between the wild-type FG5035 and an FG strain, Tri5(-), with Tri5 deleted. NMR methods identified more than 50 assigned fungal metabolites. Combined metabonomic and quantitative RT-PCR (qRT-PCR) analyses revealed that Tri5 deletion caused significant and comprehensive metabolic changes for FG apart from mycotoxin biosynthesis. These changes involved both carbon and nitrogen metabolisms including alterations in GABA shunt, TCA cycle, shikimate pathway, and metabolisms of lipids, amino acids, inositol, choline, pyrimidine, and purine. The hexose transporter has also been affected. These findings have shown that Tri5 gene deletion induces widespread changes in FG primary metabolism and demonstrated the combination of NMR-based metabonomics and qRT-PCR analyses as a useful way to understand the systems metabolic changes resulting from a single specific gene knockout in an eukaryotic genome and thus Tri5 gene functions. PMID:21413710

  10. Conditional gene deletion with DiCre demonstrates an essential role for CRK3 in L eishmania mexicana cell cycle regulation

    PubMed Central

    Duncan, Samuel M.; Myburgh, Elmarie; Philipon, Cintia; Brown, Elaine; Meissner, Markus; Brewer, James

    2016-01-01

    Summary Leishmania mexicana has a large family of cyclin‐dependent kinases (CDKs) that reflect the complex interplay between cell cycle and life cycle progression. Evidence from previous studies indicated that Cdc2‐related kinase 3 (CRK3) in complex with the cyclin CYC6 is a functional homologue of the major cell cycle regulator CDK1, yet definitive genetic evidence for an essential role in parasite proliferation is lacking. To address this, we have implemented an inducible gene deletion system based on a dimerised Cre recombinase (diCre) to target CRK3 and elucidate its role in the cell cycle of L. mexicana. Induction of diCre activity in promastigotes with rapamycin resulted in efficient deletion of floxed CRK3, resulting in G2/M growth arrest. Co‐expression of a CRK3 transgene during rapamycin‐induced deletion of CRK3 resulted in complementation of growth, whereas expression of an active site CRK3 T178E mutant did not, showing that protein kinase activity is crucial for CRK3 function. Inducible deletion of CRK3 in stationary phase promastigotes resulted in attenuated growth in mice, thereby confirming CRK3 as a useful therapeutic target and diCre as a valuable new tool for analyzing essential genes in Leishmania. PMID:26991545

  11. Herpes simplex virus mutants defective in the virion-associated shutoff of host polypeptide synthesis and exhibiting abnormal synthesis of alpha (immediate early) viral polypeptides.

    PubMed

    Read, G S; Frenkel, N

    1983-05-01

    Six mutants isolated from herpes simplex virus type 1 were judged to be defective with respect to the virion-associated function acting to rapidly shut off host polypeptide synthesis in herpes simplex virus-infected cells. The mutants were capable of proper entry into the cells, but, unlike the parent wild-type virus, they failed to shut off host polypeptide syntehsis in the presence of actinomycin D. They were consequently designated as virion-associated host shutoff (vhs) mutants. In the presence of actinomycin D, three of the mutants, vhs1, -2, and -3, failed to shut off the host at both 34 and 39 degrees C, whereas vhs4, -5, and -6 exhibited a temperature-dependent vhs phenotype. Since the mutants were capable of growth at 34 degrees C, it appeared that the vhs function was not essential for virus replication in cultured cells. Temperature-shift experiments performed with the vhs4 mutant showed that an active vhs function was required throughout the shutoff process and that, once established, the translational shutoff could not be reversed. In the absence of actinomycin D, the mutants induced a generalized, secondary shutoff of host translation, which required the synthesis of beta (early) or gamma (late) viral polypeptide(s). The vhs mutants appeared to be defective also with respect to post-transcriptional shutoff of alpha (immediate early) viral gene expression, since (i) cells infected with mutant viruses overproduced alpha viral polypeptides, (ii) there was an increased functional stability of alpha mRNA in the vhs1 mutant virus-infected cells, and (iii) superinfection of vhs1-infected cells with wild-type virus, in the presence of actinomycin D, resulted in a more pronounced shutoff of alpha polypeptide synthesis from preformed alpha mRNA than equivalent superinfection with vhs1 virus. The data suggest that the synthesis of alpha polypeptides in wild-type virus infections is subject to a negative post-transcriptional control involving viral gene product

  12. Human Cytomegalovirus Immediate-Early 1 Protein Rewires Upstream STAT3 to Downstream STAT1 Signaling Switching an IL6-Type to an IFNγ-Like Response

    PubMed Central

    Lukas, Simone; Zenger, Marion; Reitberger, Tobias; Danzer, Daniela; Übner, Theresa; Munday, Diane C.; Paulus, Christina

    2016-01-01

    The human cytomegalovirus (hCMV) major immediate-early 1 protein (IE1) is best known for activating transcription to facilitate viral replication. Here we present transcriptome data indicating that IE1 is as significant a repressor as it is an activator of host gene expression. Human cells induced to express IE1 exhibit global repression of IL6- and oncostatin M-responsive STAT3 target genes. This repression is followed by STAT1 phosphorylation and activation of STAT1 target genes normally induced by IFNγ. The observed repression and subsequent activation are both mediated through the same region (amino acids 410 to 445) in the C-terminal domain of IE1, and this region serves as a binding site for STAT3. Depletion of STAT3 phenocopies the STAT1-dependent IFNγ-like response to IE1. In contrast, depletion of the IL6 receptor (IL6ST) or the STAT kinase JAK1 prevents this response. Accordingly, treatment with IL6 leads to prolonged STAT1 instead of STAT3 activation in wild-type IE1 expressing cells, but not in cells expressing a mutant protein (IE1dl410-420) deficient for STAT3 binding. A very similar STAT1-directed response to IL6 is also present in cells infected with a wild-type or revertant hCMV, but not an IE1dl410-420 mutant virus, and this response results in restricted viral replication. We conclude that IE1 is sufficient and necessary to rewire upstream IL6-type to downstream IFNγ-like signaling, two pathways linked to opposing actions, resulting in repressed STAT3- and activated STAT1-responsive genes. These findings relate transcriptional repressor and activator functions of IE1 and suggest unexpected outcomes relevant to viral pathogenesis in response to cytokines or growth factors that signal through the IL6ST-JAK1-STAT3 axis in hCMV-infected cells. Our results also reveal that IE1, a protein considered to be a key activator of the hCMV productive cycle, has an unanticipated role in tempering viral replication. PMID:27387064

  13. E2F/Rb Family Proteins Mediate Interferon Induced Repression of Adenovirus Immediate Early Transcription to Promote Persistent Viral Infection.

    PubMed

    Zheng, Yueting; Stamminger, Thomas; Hearing, Patrick

    2016-01-01

    Interferons (IFNs) are cytokines that have pleiotropic effects and play important roles in innate and adaptive immunity. IFNs have broad antiviral properties and function by different mechanisms. IFNs fail to inhibit wild-type Adenovirus (Ad) replication in established cancer cell lines. In this study, we analyzed the effects of IFNs on Ad replication in normal human cells. Our data demonstrate that both IFNα and IFNγ blocked wild-type Ad5 replication in primary human bronchial epithelial cells (NHBEC) and TERT-immortalized normal human diploid fibroblasts (HDF-TERT). IFNs inhibited the replication of divergent adenoviruses. The inhibition of Ad5 replication by IFNα and IFNγ is the consequence of repression of transcription of the E1A immediate early gene product. Both IFNα and IFNγ impede the association of the transactivator GABP with the E1A enhancer region during the early phase of infection. The repression of E1A expression by IFNs requires a conserved E2F binding site in the E1A enhancer, and IFNs increased the enrichment of the E2F-associated pocket proteins, Rb and p107, at the E1A enhancer in vivo. PD0332991 (Pabociclib), a specific CDK4/6 inhibitor, dephosphoryles pocket proteins to promote their interaction with E2Fs and inhibited wild-type Ad5 replication dependent on the conserved E2F binding site. Consistent with this result, expression of the small E1A oncoprotein, which abrogates E2F/pocket protein interactions, rescued Ad replication in the presence of IFNα or IFNγ. Finally, we established a persistent Ad infection model in vitro and demonstrated that IFNγ suppresses productive Ad replication in a manner dependent on the E2F binding site in the E1A enhancer. This is the first study that probes the molecular basis of persistent adenovirus infection and reveals a novel mechanism by which adenoviruses utilize IFN signaling to suppress lytic virus replication and to promote persistent infection. PMID:26809031

  14. A novel comparative pattern count analysis reveals a chronic ethanol-induced dynamic shift in immediate early NF-κB genome-wide promoter binding during liver regeneration.

    PubMed

    Kuttippurathu, Lakshmi; Patra, Biswanath; Hoek, Jan B; Vadigepalli, Rajanikanth

    2016-03-01

    Liver regeneration after partial hepatectomy is a clinically important process that is impaired by adaptation to chronic alcohol intake. We focused on the initial time points following partial hepatectomy (PHx) to analyze the genome-wide binding activity of NF-κB, a key immediate early regulator. We investigated the effect of chronic alcohol intake on immediate early NF-κB genome-wide localization, in the adapted state as well as in response to partial hepatectomy, using chromatin immunoprecipitation followed by promoter microarray analysis. We found many ethanol-specific NF-κB binding target promoters in the ethanol-adapted state, corresponding to the regulation of biosynthetic processes, oxidation-reduction and apoptosis. Partial hepatectomy induced a diet-independent shift in NF-κB binding loci relative to the transcription start sites. We employed a novel pattern count analysis to exhaustively enumerate and compare the number of promoters corresponding to the temporal binding patterns in ethanol and pair-fed control groups. The highest pattern count corresponded to promoters with NF-κB binding exclusively in the ethanol group at 1 h post PHx. This set was associated with the regulation of cell death, response to oxidative stress, histone modification, mitochondrial function, and metabolic processes. Integration with the global gene expression profiles to identify putative transcriptional consequences of NF-κB binding patterns revealed that several of ethanol-specific 1 h binding targets showed ethanol-specific differential expression through 6 h post PHx. Motif analysis yielded co-incident binding loci for STAT3, AP-1, CREB, C/EBP-β, PPAR-γ and C/EBP-α, likely participating in co-regulatory modules with NF-κB in shaping the immediate early response to PHx. We conclude that adaptation to chronic ethanol intake disrupts the NF-κB promoter binding landscape with consequences for the immediate early gene regulatory response to the acute challenge of PHx.

  15. Dataset for genotyping validation of cytochrome P450 2A6 whole-gene deletion (CYP2A6*4) by real-time polymerase chain reaction platforms

    PubMed Central

    Shimizu, Makiko; Koyama, Tomoki; Kishimoto, Izumi; Yamazaki, Hiroshi

    2015-01-01

    This data article contains a supplementary figure and validation data relating to the research article entitled “Genotyping of wild-type cytochrome P450 2A6 and whole-gene deletion using human blood samples and a multiplex real-time polymerase chain reaction method with dual-labeled probes” (Shimizu et al., Clinica Chimica Acta 441, 71–74, 2015), which presents a multiplex real-time polymerase chain reaction method with dual-labeled probes for human P450 2A6 wild-type and whole-gene deletion. Real-time methods have dramatically improved the speed of complex genetic diagnostics compared to conventional assays based on restriction enzyme digestion. Here, we show the basic assay validation data by single and multiplex determinations in comparison with commercial TaqMan copy number assays for P450 2A6. PMID:26958620

  16. Prevalence of pfhrp2 and/or pfhrp3 Gene Deletion in Plasmodium falciparum Population in Eight Highly Endemic States in India

    PubMed Central

    Bharti, Praveen Kumar; Chandel, Himanshu Singh; Ahmad, Amreen; Krishna, Sri; Udhayakumar, Venkatachalam; Singh, Neeru

    2016-01-01

    Background Plasmodium falciparum encoded histidine rich protein (HRP2) based malaria rapid diagnostic tests (RDTs) are used in India. Deletion of pfhrp2 and pfhrp3 genes contributes to false negative test results, and large numbers of such deletions have been reported from South America, highlighting the importance of surveillance to detect such deletions. Methods This is the first prospective field study carried out at 16 sites located in eight endemic states of India to assess the performance of PfHRP2 based RDT kits used in the national malaria control programme. In this study, microscopically confirmed P. falciparum but RDT negative samples were assessed for presence of pfhrp2, pfhrp3, and their flanking genes using PCR. Results Among 1521 microscopically positive P. falciparum samples screened, 50 were negative by HRP2 based RDT test. Molecular testing was carried out using these 50 RDT negative samples by assuming that 1471 RDT positive samples carried pfhrp2 gene. It was found that 2.4% (36/1521) and 1.8% (27/1521) of samples were negative for pfhrp2 and pfhrp3 genes, respectively. However, the frequency of pfhrp2 deletions varied between the sites ranging from 0–25% (2.4, 95% CI; 1.6–3.3). The frequency of both pfhrp2 and pfhrp3 gene deletion varied from 0–8% (1.6, 95% CI; 1.0–2.4). Conclusion This study provides evidence for low level presence of pfhrp2 and pfhrp3 deleted P. falciparum parasites in different endemic regions of India, and periodic surveillance is warranted for reliable use of PfHRP2 based RDTs. PMID:27518538

  17. From Whole Gene Deletion to Point Mutations of EP300-Positive Rubinstein-Taybi Patients: New Insights into the Mutational Spectrum and Peculiar Clinical Hallmarks.

    PubMed

    Negri, Gloria; Magini, Pamela; Milani, Donatella; Colapietro, Patrizia; Rusconi, Daniela; Scarano, Emanuela; Bonati, Maria Teresa; Priolo, Manuela; Crippa, Milena; Mazzanti, Laura; Wischmeijer, Anita; Tamburrino, Federica; Pippucci, Tommaso; Finelli, Palma; Larizza, Lidia; Gervasini, Cristina

    2016-02-01

    Rubinstein-Taybi syndrome (RSTS) is a rare congenital neurodevelopmental disorder characterized by growth deficiency, skeletal abnormalities, dysmorphic features, and intellectual disability. Causative mutations in CREBBP and EP300 genes have been identified in ∼55% and ∼8% of affected individuals. To date, only 28 EP300 alterations in 29 RSTS clinically described patients have been reported. EP300 analysis of 22 CREBBP-negative RSTS patients from our cohort led us to identify six novel mutations: a 376-kb deletion depleting EP300 gene; an exons 17-19 deletion (c.(3141+1_3142-1)_(3590+1_3591-1)del/p.(Ile1047Serfs*30)); two stop mutations, (c.3829A>T/p.(Lys1277*) and c.4585C>T/p.(Arg1529*)); a splicing mutation (c.1878-12A>G/p.(Ala627Glnfs*11)), and a duplication (c.4640dupA/p.(Asn1547Lysfs*3)). All EP300-mutated individuals show a mild RSTS phenotype and peculiar findings including maternal gestosis, skin manifestation, especially nevi or keloids, back malformations, and a behavior predisposing to anxiety. Furthermore, the patient carrying the complete EP300 deletion does not show a markedly severe clinical picture, even if a more composite phenotype was noticed. By characterizing six novel EP300-mutated patients, this study provides further insights into the EP300-specific clinical presentation and expands the mutational repertoire including the first case of a whole gene deletion. These new data will enhance EP300-mutated cases identification highlighting distinctive features and will improve the clinical practice allowing a better genotype-phenotype correlation.

  18. Reduction of sympathetic activity via adrenal-targeted GRK2 gene deletion attenuates heart failure progression and improves cardiac function after myocardial infarction.

    PubMed

    Lymperopoulos, Anastasios; Rengo, Giuseppe; Gao, Erhe; Ebert, Steven N; Dorn, Gerald W; Koch, Walter J

    2010-05-21

    Chronic heart failure (HF) is characterized by sympathetic overactivity and enhanced circulating catecholamines (CAs), which significantly increase HF morbidity and mortality. We recently reported that adrenal G protein-coupled receptor kinase 2 (GRK2) is up-regulated in chronic HF, leading to enhanced CA release via desensitization/down-regulation of the chromaffin cell alpha(2)-adrenergic receptors that normally inhibit CA secretion. We also showed that adrenal GRK2 inhibition decreases circulating CAs and improves cardiac inotropic reserve and function. Herein, we hypothesized that adrenal-targeted GRK2 gene deletion before the onset of HF might be beneficial by reducing sympathetic activation. To specifically delete GRK2 in the chromaffin cells of the adrenal gland, we crossed PNMTCre mice, expressing Cre recombinase under the chromaffin cell-specific phenylethanolamine N-methyltransferase (PNMT) gene promoter, with floxedGRK2 mice. After confirming a significant ( approximately 50%) reduction of adrenal GRK2 mRNA and protein levels, the PNMT-driven GRK2 knock-out (KO) offspring underwent myocardial infarction (MI) to induce HF. At 4 weeks post-MI, plasma levels of both norepinephrine and epinephrine were reduced in PNMT-driven GRK2 KO, compared with control mice, suggesting markedly reduced post-MI sympathetic activation. This translated in PNMT-driven GRK2 KO mice into improved cardiac function and dimensions as well as amelioration of abnormal cardiac beta-adrenergic receptor signaling at 4 weeks post-MI. Thus, adrenal-targeted GRK2 gene KO decreases circulating CAs, leading to improved cardiac function and beta-adrenergic reserve in post-MI HF. GRK2 inhibition in the adrenal gland might represent a novel sympatholytic strategy that can aid in blocking HF progression.

  19. Oncolytic Adenoviral Mutants with E1B19K Gene Deletions Enhance Gemcitabine-induced Apoptosis in Pancreatic Carcinoma Cells and Anti-Tumor Efficacy In vivo

    PubMed Central

    Leitner, Stephan; Sweeney, Katrina; Öberg, Daniel; Davies, Derek; Miranda, Enrique; Lemoine, Nick R.; Halldén, Gunnel

    2010-01-01

    Purpose Pancreatic adenocarcinoma is a rapidly progressive malignancy that is highly resistant to current chemotherapeutic modalities and almost uniformly fatal.We show that a novel targeting strategy combining oncolytic adenoviral mutants with the standard cytotoxic treatment, gemcitabine, can markedly improve the anticancer potency. Experimental Design Adenoviral mutants with the E1B19K gene deleted with and without E3B gene expression (AdΔE1B19K and dl337 mutants, respectively) were assessed for synergistic interactions in combination with gemcitabine. Cell viability, mechanism of cell death, and antitumor efficacy in vivo were determined in the pancreatic carcinoma cells PT45 and Suit2, normal human bronchial epithelial cells, and in PT45 xenografts. Results The ΔE1B19K-deleted mutants synergized with gemcitabine to selectively kill cultured pancreatic cancer cells and xenografts in vivo with no effect in normal cells. The corresponding wild-type virus (Ad5) stimulated drug-induced cell killing to a lesser degree. Gemcitabine blocked replication of all viruses despite the enhanced cell killing activity due to gemcitabine-induced delay in G1/S-cell cycle progression, with repression of cyclin E and cdc25A, which was not abrogated by viral E1A-expression. Synergistic cell death occurred through enhancement of gemcitabine-induced apoptosis in the presence of both AdΔE1B19K and dl337 mutants, shown by increased cell membrane fragmentation, caspase-3 activation, and mitochondrial dysfunction. Conclusions Our data suggest that oncolytic mutants lacking the antiapoptotic E1B19K gene can improve efficacy of DNA-damaging drugs such as gemcitabine through convergence on cellular apoptosis pathways.These findings imply that less toxic doses than currently practicedin the clinic could efficiently target pancreatic adenocarcinomas when combined with adenoviral mutants. PMID:19223497

  20. CuZnSOD gene deletion targeted to skeletal muscle leads to loss of contractile force but does not cause muscle atrophy in adult mice

    PubMed Central

    Zhang, Yiqiang; Davis, Carol; Sakellariou, George K.; Shi, Yun; Kayani, Anna C.; Pulliam, Daniel; Bhattacharya, Arunabh; Richardson, Arlan; Jackson, Malcolm J.; McArdle, Anne; Brooks, Susan V.; Van Remmen, Holly

    2013-01-01

    We have previously shown that deletion of CuZnSOD in mice (Sod1−/− mice) leads to accelerated loss of muscle mass and contractile force during aging. To dissect the relative roles of skeletal muscle and motor neurons in this process, we used a Cre-Lox targeted approach to establish a skeletal muscle-specific Sod1-knockout (mKO) mouse to determine whether muscle-specific CuZnSOD deletion is sufficient to cause muscle atrophy. Surprisingly, mKO mice maintain muscle masses at or above those of wild-type control mice up to 18 mo of age. In contrast, maximum isometric specific force measured in gastrocnemius muscle is significantly reduced in the mKO mice. We found no detectable increases in global measures of oxidative stress or ROS production, no reduction in mitochondrial ATP production, and no induction of adaptive stress responses in muscle from mKO mice. However, Akt-mTOR signaling is elevated and the number of muscle fibers with centrally located nuclei is increased in skeletal muscle from mKO mice, which suggests elevated regenerative pathways. Our data demonstrate that lack of CuZnSOD restricted to skeletal muscle does not lead to muscle atrophy but does cause muscle weakness in adult mice and suggest loss of CuZnSOD may potentiate muscle regenerative pathways.—Zhang, Y., Davis, C., Sakellariou, G.K., Shi, Y., Kayani, A.C., Pulliam, D., Bhattacharya, A., Richardson, A., Jackson, M.J., McArdle, A., Brooks, S.V., Van Remmen, H. CuZnSOD gene deletion targeted to skeletal muscle leads to loss of contractile force but does not cause muscle atrophy in adult mice. PMID:23729587

  1. Microcephaly, Intellectual Impairment, Bilateral Vesicoureteral Reflux, Distichiasis and Glomuvenous Malformations Associated with a 16q24.3 Contiguous Gene Deletion and a Glomulin Mutation

    PubMed Central

    Butler, Matthew G.; Dagenais, Susan L.; Garcia-Perez, José L.; Brouillard, Pascal; Vikkula, Miikka; Strouse, Peter; Innis, Jeffrey W.; Glover, Thomas W.

    2012-01-01

    Two hereditary syndromes, lymphedema-distichiasis syndrome (LD) and blepharo-chelio-dontic (BCD) syndrome include the aberrant growth of eyelashes from the meibomian glands, known as distichiasis. LD is an autosomal dominant syndrome primarily characterized by distichiasis and the onset of lymphedema usually during puberty. Mutations in the forkhead transcription factor FOXC2 are the only known cause of LD. BCD syndrome consists of autosomal dominant abnormalities of the eyelid, lip, and teeth, and the etiology remains unknown. In this report, we describe a proband that presented with distichiasis, microcephaly, bilateral grade IV vesicoureteral reflux requiring ureteral re-implantation, mild intellectual impairment and apparent glomuvenous malformations. Distichiasis was present in three generations of the proband’s maternal side of the family. The glomuvenous malformations were severe in the proband, and maternal family members exhibited lower extremity varicosities of variable degree. A GLMN (glomulin) gene mutation was identified in the proband that accounts for the observed glomuvenous malformations; no other family member could be tested. TIE2 sequencing revealed no mutations. In the proband, an additional submicroscopic 265 kb contiguous gene deletion was identified in 16q24.3, located 609 kb distal to the FOXC2 locus, which was inherited from the proband’s mother. The deletion includes the C16ORF95, FBXO31, MAP1LC3B, and ZCCHC14 loci and 115 kb of a gene desert distal to FOXC2 and FOXL1. Thus, it is likely that the microcephaly, distichiasis, vesicoureteral and intellectual impairment in this family may be caused by the deletion of one or more of these genes and/or deletion of distant cis-regulatory elements of FOXC2 expression. PMID:22407726

  2. The Canonical Immediate Early 3 Gene Product pIE611 of Mouse Cytomegalovirus Is Dispensable for Viral Replication but Mediates Transcriptional and Posttranscriptional Regulation of Viral Gene Products

    PubMed Central

    Rattay, Stephanie; Trilling, Mirko; Megger, Dominik A.; Sitek, Barbara; Meyer, Helmut E.; Hengel, Hartmut

    2015-01-01

    ABSTRACT Transcription of mouse cytomegalovirus (MCMV) immediate early ie1 and ie3 is controlled by the major immediate early promoter/enhancer (MIEP) and requires differential splicing. Based on complete loss of genome replication of an MCMV mutant carrying a deletion of the ie3-specific exon 5, the multifunctional IE3 protein (611 amino acids; pIE611) is considered essential for viral replication. Our analysis of ie3 transcription resulted in the identification of novel ie3 isoforms derived from alternatively spliced ie3 transcripts. Construction of an IE3-hemagglutinin (IE3-HA) virus by insertion of an in-frame HA epitope sequence allowed detection of the IE3 isoforms in infected cells, verifying that the newly identified transcripts code for proteins. This prompted the construction of an MCMV mutant lacking ie611 but retaining the coding capacity for the newly identified isoforms ie453 and ie310. Using Δie611 MCMV, we demonstrated the dispensability of the canonical ie3 gene product pIE611 for viral replication. To determine the role of pIE611 for viral gene expression during MCMV infection in an unbiased global approach, we used label-free quantitative mass spectrometry to delineate pIE611-dependent changes of the MCMV proteome. Interestingly, further analysis revealed transcriptional as well as posttranscriptional regulation of MCMV gene products by pIE611. IMPORTANCE Cytomegaloviruses are pathogenic betaherpesviruses persisting in a lifelong latency from which reactivation can occur under conditions of immunosuppression, immunoimmaturity, or inflammation. The switch from latency to reactivation requires expression of immediate early genes. Therefore, understanding of immediate early gene regulation might add insights into viral pathogenesis. The mouse cytomegalovirus (MCMV) immediate early 3 protein (611 amino acids; pIE611) is considered essential for viral replication. The identification of novel protein isoforms derived from alternatively spliced ie3

  3. Co-ordinate regulation of herpes simplex virus gene expression is mediated by the functional interaction of two immediate early gene products.

    PubMed

    Gelman, I H; Silverstein, S

    1986-10-01

    At early times after infection with herpes simplex virus, transcription from beta-promoters is initiated only in the presence of a functional 174,000 Mr phosphoprotein (ICP4), encoded by an immediate early (alpha) gene (IE4). A transient expression assay was used to analyze the requirement for two (ICP4 and ICP0) of the five alpha-gene products in the transcriptional regulation of model alpha and beta-gene promoters. These studies reveal that cells cotransfected with plasmids containing the alpha-gene sequences for infected cell proteins (ICPs) 4 and 0 and a thymidine kinase (TK, a beta-gene) gene or the thymidine kinase promoter fused to a chloramphenicol acetyltransferase (CAT) cassette accumulate 10 to 20-fold more RNA or exhibit 10 to 20-fold more CAT activity than cells cotransfected with a plasmid encoding either alpha-gene protein and a thymidine kinase indicator gene. Functional ICP4 is required for enhanced transcriptional activation in the transient expression assay system. It is also required for the uniform dispersal of ICP0 throughout the nucleus as shown by immunofluorescence staining analysis of transfected cells. Two alpha-promoter-CAT fusions were used as targets to study what effects ICP4, ICP0 and Vmw65 (the virion-associated alpha-gene transactivator) have on expression from alpha-promoters that contain all of the sequences that confer alpha-gene regulation, or only the core sequence governing basal level expression. We conclude that ICP4 can activate alpha-gene expression from the core sequence and, depending on its abundance, activate or repress expression from a promoter containing the sequences required for alpha-gene regulation. Independent of these alpha-regulatory sequences cotransfection with low levels of sequences encoding both ICP0 and ICP4 activate expression. At higher ratios of effector (both ICP4 and ICP0) the target accumulation of CAT activity decreases. Although a ts allele of IE4 (cloned from the mutant virus tsK) does not

  4. Sleep research in space: expression of immediate early genes in forebrain structures of rats during the nasa neurolab mission (STS-90).

    PubMed

    Centini, C; Pompeiano, O

    2007-05-01

    1. Electrophysiological and behavioural observations have shown that changes in the sleep-waking activity occur in astronauts during the space flight. Experiments performed in ground-based experiments have previously shown that the immediate early gene (IEG) c-fos, a marker of neuronal activation, can be used as a molecular correlate of sleep and waking. However, while Fos expression peaks within 2-4 hours after the stimulus and returns to baseline within 6-8 hours, other IEGs as the FRA proteins which are also synthetized soon after their induction, persist in the cell nuclei for longer periods of time, ranging from 1-2 days to weeks. 2. Both Fos and FRA expression were evaluated in several adult albino rats sacrificed at different time points of the space flight, i.e. either at FD2 and FD14, i.e. at launch and about two weeks after launch, respectively, or at R + 1 and R + 13, i.e. at the reentry and about two weeks after landing. The changes in Fos and FRA expression were then compared with those obtained in ground controls. These experiments demonstrate activation of several brain areas which varies during the different phases of the space flight. Due to their different time of persistence, Fos and FRA immunohistochemistry can provide only correlative observations. In particular, FRA expression has been quite helpful to identify the occurrence of short-lasting events such as those related either to stress or to REM-sleep, whose episodes last in the rat only a few min and could hardly be detected by using only Fos expression. 3. Evidence was presented indicating that at FD2 and FD14 Fos-labeled cells were observed in several brain areas in which Fos had been previously identified as being induced by spontaneous or forced waking in ground-based experiments. In contrast to these findings FLT rats sacrificed at R + 1 showed low levels of Fos immunostaining in the cerebral cortex (neocortex) and several forebrain structures such as the hypothalamus and thalamus

  5. Binding sites for the herpes simplex virus immediate-early protein ICP4 impose an increased dependence on viral DNA replication on simple model promoters located in the viral genome.

    PubMed

    Koop, K E; Duncan, J; Smiley, J R

    1993-12-01

    We examined the ability of binding sites for the herpes simplex virus immediate-early protein ICP4 to alter the regulation of closely linked promoters by placing strong ICP4 binding sites upstream or downstream of simple TATA promoters in the intact viral genome. We found that binding sites strongly reduced the levels of expression at early times postinfection and that this effect was partially overcome after the onset of viral DNA replication. These data confirm that DNA-bound ICP4 can inhibit the activity of a closely linked promoter and raise the possibility that ICP4 binding sites contribute to temporal regulation during infection.

  6. Human cytomegalovirus miR-UL112-1 promotes the down-regulation of viral immediate early-gene expression during latency to prevent T-cell recognition of latently infected cells.

    PubMed

    Lau, Betty; Poole, Emma; Van Damme, Ellen; Bunkens, Lieve; Sowash, Madeleine; King, Harry; Murphy, Eain; Wills, Mark; Van Loock, Marnix; Sinclair, John

    2016-09-01

    Human cytomegalovirus, a member of the herpesvirus family, can cause significant morbidity and mortality in immune compromised patients resulting from either primary lytic infection or reactivation from latency. Latent infection is associated with a restricted viral transcription programme compared to lytic infection which consists of defined protein coding RNAs but also includes a number of virally encoded microRNAs (miRNAs). One of these, miR-UL112-1, is known to target the major lytic IE72 transcript but, to date, a functional role for miR-UL112-1 during latent infection has not been shown. To address this, we have analysed latent infection in myeloid cells using a virus in which the target site for miR-UL112-1 in the 3' UTR of IE72 was removed such that any IE72 RNA present during latent infection would no longer be subject to regulation by miR-UL112-1 through the RNAi pathway. Our data show that removal of the miR-UL112-1 target site in IE72 results in increased levels of IE72 RNA in experimentally latent primary monocytes. Furthermore, this resulted in induction of immediate early (IE) gene expression that is detectable by IE-specific cytotoxic T-cells (CTLs); no such CTL recognition of monocytes latently infected with wild-type virus was observed. We also recapitulated these findings in the more tractable THP-1 cell line model of latency. These observations argue that an important role for miR-UL112-1 during latency is to ensure tight control of lytic viral immediate early (IE) gene expression thereby preventing recognition of latently infected cells by the host's potent pre-existing anti-viral CTL response.

  7. Krüppel-like factor 4 is widely expressed in the mouse male and female reproductive tract and responds as an immediate early gene to activation of the protein kinase A in TM4 Sertoli cells.

    PubMed

    Godmann, M; Kosan, C; Behr, R

    2010-04-01

    Krüppel-like factor 4 (KLF4) is a zinc finger transcription factor critically involved in cell proliferation, differentiation, and carcinogenesis. Recently, KLF4 has also been used for the generation of induced pluripotent stem cells. In this study, we analyzed Klf4 expression in different mouse tissues using northern blot analysis and immunohistochemistry. Focusing on the male and female reproductive tract, we showed for the first time that KLF4 is expressed in the epithelia of the murine uterus and the vagina. In the male reproductive tract, we detected KLF4 in the epithelia of the epididymis, ductus deferens, coagulating gland, and the penis. As KLF4 is strongly inducible by FSH signaling in Sertoli cells and as this transcription factor is also involved in Sertoli cell development, we employed the mouse Sertoli cell line TM4 as a model system to investigate i) the induction kinetics of Klf4 upon activation of the cAMP/protein kinase A pathway by forskolin and ii) the effects of Klf4 induction on TM4 cell cycle progression. Interestingly, Klf4 mRNA and protein were rapidly but transiently induced, reaching peak levels after 90-120 min and declining to basal levels within 4 h. Compared with the inducible cAMP early repressor, an immediate early response gene, the induction kinetics of Klf4 is much faster. In conclusion, Klf4 is an immediate early gene in TM4 cells and its expression in several epithelia of the male and female reproductive tract suggests an important role of Klf4 in mouse reproductive functions.

  8. Varicella-Zoster Virus Immediate-Early 63 Protein Interacts with Human Antisilencing Function 1 Protein and Alters Its Ability To Bind Histones H3.1 and H3.3▿

    PubMed Central

    Ambagala, Aruna P.; Bosma, Trent; Ali, Mir A.; Poustovoitov, Maxim; Chen, Jason J.; Gershon, Michael D.; Adams, Peter D.; Cohen, Jeffrey I.

    2009-01-01

    Varicella-zoster virus (VZV) immediate-early 63 protein (IE63) is abundantly expressed during both acute infection in vitro and latent infection in human ganglia. Using the yeast two-hybrid system, we found that VZV IE63 interacts with human antisilencing function 1 protein (ASF1). ASF1 is a nucleosome assembly factor which is a member of the H3/H4 family of histone chaperones. IE63 coimmunoprecipitated and colocalized with ASF1 in transfected cells expressing IE63 and in VZV-infected cells. IE63 also colocalized with ASF1 in both lytic and latently VZV-infected enteric neurons. ASF1 exists in two isoforms, ASF1a and ASF1b, in mammalian cells. IE63 preferentially bound to ASF1a, and the amino-terminal 30 amino acids of ASF1a were critical for its interaction with IE63. VZV IE63 amino acids 171 to 208 and putative phosphorylation sites of IE63, both of which are critical for virus replication and latency in rodents, were important for the interaction of IE63 with ASF1. Finally, we found that IE63 increased the binding of ASF1 to histone H3.1 and H3.3, which suggests that IE63 may help to regulate levels of histones in virus-infected cells. Since ASF1 mediates eviction and deposition of histones during transcription, the interaction of VZV IE63 with ASF1 may help to regulate transcription of viral or cellular genes during lytic and/or latent infection. PMID:18971269

  9. Effects of A-CREB, a dominant negative inhibitor of CREB, on the expression of c-fos and other immediate early genes in the rat SON during hyperosmotic stimulation in vivo

    PubMed Central

    Lubelski, Daniel; Ponzio, Todd A.; Gainer, Harold

    2016-01-01

    Intraperitoneal administration of hypertonic saline to the rat supraoptic nucleus (SON) increases the expression of several immediate early genes (IEG) and the vasopressin gene. These increases have usually been attributed to action of the cyclic-AMP Response Element Binding Protein (CREB). In this paper, we study the role of CREB in these events in vivo by delivering a potent dominant-negative form of CREB, known as A-CREB, to the rat SON through the use of an adeno-associated viral (AAV) vector. Preliminary experiments on HEK 293 cells in vitro showed that the A-CREB vector that we used completely eliminated CREB-induced c-fos expression. We stereotaxically injected this AAV-A-CREB into one SON and a control AAV into the contralateral SON of the same rat. Two weeks following these injections we injected hypertonic saline intraperitoneally into the rat. Using this paradigm, we could measure the relative effects of inhibiting CREB on the induced expression of c-fos, ngfi-a, ngfi-b, and vasopressin genes in the A-CREB AAV injected SON versus the control AAV injected SON in the same rat. We found only a small (20%) decrease of c-fos expression and a 30% decrease of ngfi-b expression in the presence of the A-CREB. There were no significant changes in expression found in the other IEGs nor in vasopressin that were produced by the A-CREB. This suggests that CREB may play only a minor role in the expression of IEGs and vasopressin in the osmotically activated SON in vivo. PMID:22079318

  10. Inhibition of iridovirus protein synthesis and virus replication by antisense morpholino oligonucleotides targeted to the major capsid protein, the 18 kDa immediate-early protein, and a viral homolog of RNA polymerase II

    SciTech Connect

    Sample, Robert; Bryan, Locke; Long, Scott; Majji, Sai; Hoskins, Glenn; Sinning, Allan; Olivier, Jake; Chinchar, V. Gregory . E-mail: vchinchar@microbio.umsmed.edu

    2007-02-20

    Frog virus 3 (FV3) is a large DNA virus that encodes {approx} 100 proteins. Although the general features of FV3 replication are known, the specific roles that most viral proteins play in the virus life cycle have not yet been elucidated. To address the question of viral gene function, antisense morpholino oligonucleotides (asMOs) were used to transiently knock-down expression of specific viral genes and thus infer their role in virus replication. We designed asMOs directed against the major capsid protein (MCP), an 18 kDa immediate-early protein (18K) that was thought to be a viral regulatory protein, and the viral homologue of the largest subunit of RNA polymerase II (vPol-II{alpha}). All three asMOs successfully inhibited translation of the targeted protein, and two of the three asMOs resulted in marked phenotypic changes. Knock-down of the MCP resulted in a marked reduction in viral titer without a corresponding drop in the synthesis of other late viral proteins. Transmission electron microscopy (TEM) showed that in cells treated with the anti-MCP MO assembly sites were devoid of viral particles and contained numerous aberrant structures. In contrast, inhibition of 18K synthesis did not block virion formation, suggesting that the 18K protein was not essential for replication of FV3 in fathead minnow (FHM) cells. Finally, consistent with the view that late viral gene expression is catalyzed by a virus-encoded or virus-modified Pol-II-like protein, knock-down of vPol-II{alpha} triggered a global decline in late gene expression and virus yields without affecting the synthesis of early viral genes. Collectively, these results demonstrate the utility of using asMOs to elucidate the function of FV3 proteins.

  11. Combinatorial Strategies for Improving Multiple-Stress Resistance in Industrially Relevant Escherichia coli Strains

    PubMed Central

    Herrgård, Markus J.

    2014-01-01

    High-cell-density fermentation for industrial production of chemicals can impose numerous stresses on cells due to high substrate, product, and by-product concentrations; high osmolarity; reactive oxygen species; and elevated temperatures. There is a need to develop platform strains of industrial microorganisms that are more tolerant toward these typical processing conditions. In this study, the growth of six industrially relevant strains of Escherichia coli was characterized under eight stress conditions representative of fed-batch fermentation, and strains W and BL21(DE3) were selected as platforms for transposon (Tn) mutagenesis due to favorable resistance characteristics. Selection experiments, followed by either targeted or genome-wide next-generation-sequencing-based Tn insertion site determination, were performed to identify mutants with improved growth properties under a subset of three stress conditions and two combinations of individual stresses. A subset of the identified loss-of-function mutants were selected for a combinatorial approach, where strains with combinations of two and three gene deletions were systematically constructed and tested for single and multistress resistance. These approaches allowed identification of (i) strain-background-specific stress resistance phenotypes, (ii) novel gene deletion mutants in E. coli that confer single and multistress resistance in a strain-background-dependent manner, and (iii) synergistic effects of multiple gene deletions that confer improved resistance over single deletions. The results of this study underscore the suboptimality and strain-specific variability of the genetic network regulating growth under stressful conditions and suggest that further exploration of the combinatorial gene deletion space in multiple strain backgrounds is needed for optimizing strains for microbial bioprocessing applications. PMID:25085490

  12. Nonrecurrent PMP22-RAI1 contiguous gene deletions arise from replication-based mechanisms and result in Smith-Magenis syndrome with evident peripheral neuropathy.

    PubMed

    Yuan, Bo; Neira, Juanita; Gu, Shen; Harel, Tamar; Liu, Pengfei; Briceño, Ignacio; Elsea, Sarah H; Gómez, Alberto; Potocki, Lorraine; Lupski, James R

    2016-10-01

    Hereditary neuropathy with liability to pressure palsies (HNPP) and Smith-Magenis syndrome (SMS) are genomic disorders associated with deletion copy number variants involving chromosome 17p12 and 17p11.2, respectively. Nonallelic homologous recombination (NAHR)-mediated recurrent deletions are responsible for the majority of HNPP and SMS cases; the rearrangement products encompass the key dosage-sensitive genes PMP22 and RAI1, respectively, and result in haploinsufficiency for these genes. Less frequently, nonrecurrent genomic rearrangements occur at this locus. Contiguous gene duplications encompassing both PMP22 and RAI1, i.e., PMP22-RAI1 duplications, have been investigated, and replication-based mechanisms rather than NAHR have been proposed for these rearrangements. In the current study, we report molecular and clinical characterizations of six subjects with the reciprocal phenomenon of deletions spanning both genes, i.e., PMP22-RAI1 deletions. Molecular studies utilizing high-resolution array comparative genomic hybridization and breakpoint junction sequencing identified mutational signatures that were suggestive of replication-based mechanisms. Systematic clinical studies revealed features consistent with SMS, including features of intellectual disability, speech and gross motor delays, behavioral problems and ocular abnormalities. Five out of six subjects presented clinical signs and/or objective electrophysiologic studies of peripheral neuropathy. Clinical profiling may improve the clinical management of this unique group of subjects, as the peripheral neuropathy can be more severe or of earlier onset as compared to SMS patients having the common recurrent deletion. Moreover, the current study, in combination with the previous report of PMP22-RAI1 duplications, contributes to the understanding of rare complex phenotypes involving multiple dosage-sensitive genes from a genetic mechanistic standpoint.

  13. Nonrecurrent PMP22-RAI1 contiguous gene deletions arise from replication-based mechanisms and result in Smith-Magenis syndrome with evident peripheral neuropathy.

    PubMed

    Yuan, Bo; Neira, Juanita; Gu, Shen; Harel, Tamar; Liu, Pengfei; Briceño, Ignacio; Elsea, Sarah H; Gómez, Alberto; Potocki, Lorraine; Lupski, James R

    2016-10-01

    Hereditary neuropathy with liability to pressure palsies (HNPP) and Smith-Magenis syndrome (SMS) are genomic disorders associated with deletion copy number variants involving chromosome 17p12 and 17p11.2, respectively. Nonallelic homologous recombination (NAHR)-mediated recurrent deletions are responsible for the majority of HNPP and SMS cases; the rearrangement products encompass the key dosage-sensitive genes PMP22 and RAI1, respectively, and result in haploinsufficiency for these genes. Less frequently, nonrecurrent genomic rearrangements occur at this locus. Contiguous gene duplications encompassing both PMP22 and RAI1, i.e., PMP22-RAI1 duplications, have been investigated, and replication-based mechanisms rather than NAHR have been proposed for these rearrangements. In the current study, we report molecular and clinical characterizations of six subjects with the reciprocal phenomenon of deletions spanning both genes, i.e., PMP22-RAI1 deletions. Molecular studies utilizing high-resolution array comparative genomic hybridization and breakpoint junction sequencing identified mutational signatures that were suggestive of replication-based mechanisms. Systematic clinical studies revealed features consistent with SMS, including features of intellectual disability, speech and gross motor delays, behavioral problems and ocular abnormalities. Five out of six subjects presented clinical signs and/or objective electrophysiologic studies of peripheral neuropathy. Clinical profiling may improve the clinical management of this unique group of subjects, as the peripheral neuropathy can be more severe or of earlier onset as compared to SMS patients having the common recurrent deletion. Moreover, the current study, in combination with the previous report of PMP22-RAI1 duplications, contributes to the understanding of rare complex phenotypes involving multiple dosage-sensitive genes from a genetic mechanistic standpoint. PMID:27386852

  14. The equine herpesvirus-1 IR3 gene that lies antisense to the sole immediate-early (IE) gene is trans-activated by the IE protein, and is poorly expressed to a protein

    SciTech Connect

    Ahn, Byung Chul; Breitenbach, Jonathan E.; Kim, Seong K.; O'Callaghan, Dennis J. . E-mail: docall@lsuhsc.edu

    2007-06-20

    The unique IR3 gene of equine herpesvirus 1 (EHV-1) is expressed as a late 1.0-kb transcript. Previous studies confirmed the IR3 transcription initiation site and tentatively identified other cis-acting elements specific to IR3 such as a TATA box, a 443 base pair 5'untranslated region (UTR), a 285 base pair open reading frame (ORF), and a poly adenylation (A) signal [Holden, V.R., Harty, R.N., Yalamanchili, R.R., O'Callaghan, D.J., 1992. The IR3 gene of equine herpesvirus type 1: a unique gene regulated by sequences within the intron of the immediate-early gene. DNA Seq. 3, 143-152]. Transient transfection assays revealed that the IR3 promoter is strongly trans-activated by the IE protein (IEP) and that coexpression of the IEP with the early EICP0 and IR4 regulatory proteins results in maximal trans-activation of the IR3 promoter. Gel shift assays revealed that the IEP directly binds to the IR3 promoter region. Western blot analysis showed that the IR3 protein produced in E. coli was detected by antibodies to IR3 synthetic peptides; however, the IR3 protein was not detected in EHV-1 infected cell extracts by these same anti-IR3 antibodies, even though the IR3 transcript was detected by northern blot. These findings suggest that the IR3 may not be expressed to a protein. Expression of an IR3/GFP fusion gene was not observed, but expression of a GFP/IR3 fusion gene was detected by fluorescent microscopy. In further attempts to detect the IR3/GFP fusion protein using anti-GFP antibody, western blot analysis showed that the IR3/GFP fusion protein was not detected in vivo. Interestingly, a truncated form of the GFP/IR3 protein was synthesized from the GFP/IR3 fusion gene. However, GFP/IR3 and IR3/GFP fusion proteins of the predicted sizes were synthesized by in vitro coupled transcription and translation of the fusion genes, suggesting poor expression of the IR3 protein in vivo. The possible role of the IR3 transcript in EHV-1 infection is discussed.

  15. The role of N-methyl-d-aspartate-type glutamatergic neurotransmission in the photic induction of immediate-early gene expression in the suprachiasmatic nuclei of the Syrian hamster.

    PubMed

    Ebling, F J; Maywood, E S; Staley, K; Humby, T; Hancock, D C; Waters, C M; Evant, G I; Hastings, M H

    1991-12-01

    Abstract This study investigated the role of N-methyl-D-aspartate (NMDA)-type glutamatergic neurotransmission in mediating the photic induction of immediate-early gene expression in the Suprachiasmatic nucleus (SCN) of the Syrian hamster. Activation of c-fos, c-jun and egr-1 was assessed by immunocytochemical detection of their protein products. To characterize the circadian basis to the inductive effects of light, hamsters were allowed to free-run in constant dim red light and received a 1 h light pulse at different circadian phases relative to activity onset (defined as CT 12). In control animals which did not receive light pulses, c-fos and egr-1 expression was absent or restricted to a small area of the dorsolateral region of the SCN, and expression of c-jun could not be detected in the SCN. In hamsters killed after presentation of a light pulse at either CT 14 or CT 20, there was a marked increase in c-fos and egr-1 immunoreactivities throughout the ventrolateral division of the SCN. In contrast, light pulses given at CT4 or CT 8 failed to activate immediate-early gene expression. Light pulses did not induce c-jun immunoreactivity at any circadian phase tested. Staining for c-fos was maximal 1 h after the start of the light pulse and had started to decline by 2 h. At this later time, c-jun expression was still undetectable. To compare the distribution of retinal afferents with that of c-fos induction, hamsters held on a light schedule of 16 h light: 8 h dark received an intraocular injection of cholera toxin-horseradish peroxidase conjugate 3 days before exposure to a 1 h light pulse given 2 h after lights off. Comparison of adjacent sections processed for c-fos immunoreactivity or for cholera toxin-horseradish peroxidase revealed that light-induced c-fos expression was precisely restricted to retinal terminal fields in the SCN. Light pulses also induced c-fos expression in the retinoreceptive ventral lateral geniculate nucleus and intergeniculate leaflet but

  16. Profiling of the toxicity mechanisms of coated and uncoated silver nanoparticles to yeast Saccharomyces cerevisiae BY4741 using a set of its 9 single-gene deletion mutants defective in oxidative stress response, cell wall or membrane integrity and endocytosis.

    PubMed

    Käosaar, Sandra; Kahru, Anne; Mantecca, Paride; Kasemets, Kaja

    2016-09-01

    The widespread use of nanosilver in various antibacterial, antifungal, and antiviral products warrants the studies of the toxicity pathways of nanosilver-enabled materials toward microbes and viruses. We profiled the toxicity mechanisms of uncoated, casein-coated, and polyvinylpyrrolidone-coated silver nanoparticles (AgNPs) using Saccharomyces cerevisiae wild-type (wt) and its 9 single-gene deletion mutants defective in oxidative stress (OS) defense, cell wall/membrane integrity, and endocytosis. The 48-h growth inhibition assay in organic-rich growth medium and 24-h cell viability assay in deionized (DI) water were applied whereas AgNO3, H2O2, and SDS served as positive controls. Both coated AgNPs (primary size 8-12nm) were significantly more toxic than the uncoated (~85nm) AgNPs. All studied AgNPs were ~30 times more toxic if exposed to yeast cells in DI water than in the rich growth medium: the IC50 based on nominal concentration of AgNPs in the growth inhibition test ranged from 77 to 576mg Ag/L and in the cell viability test from 2.7 to 18.7mg Ag/L, respectively. Confocal microscopy showed that wt but not endocytosis mutant (end3Δ) internalized AgNPs. Comparison of toxicity patterns of wt and mutant strains defective in OS defense and membrane integrity revealed that the toxicity of the studied AgNPs to S. cerevisiae was not caused by the OS or cell wall/membrane permeabilization. PMID:27260961

  17. Synergistic interactions between overlapping binding sites for the serum response factor and ELK-1 proteins mediate both basal enhancement and phorbol ester responsiveness of primate cytomegalovirus major immediate-early promoters in monocyte and T-lymphocyte cell types.

    PubMed Central

    Chan, Y J; Chiou, C J; Huang, Q; Hayward, G S

    1996-01-01

    Cytomegalovirus (CMV) infection is nonpermissive or persistent in many lymphoid and myeloid cell types but can be activated in differentiated macrophages. We have shown elsewhere that both the major immediate-early gene (MIE) and lytic cycle infectious progeny virus expression can be induced in otherwise nonpermissive monocyte-like U-937 cell cultures infected with either human CMV (HCMV) or simian CMV (SCMV) by treatment with the phorbol ester 12-O-tetradecanoylphorbol-13-acetate (TPA). Two multicopy basal enhancer motifs within the SCMV MIE enhancer, namely, 11 copies of the 16-bp cyclic AMP response element (CRE) and 3 copies of novel 17-bp serum response factor (SRF) binding sites referred to as the SNE (SRF/NFkappaB-like element), as well as four classical NFkappaB sites within the HCMV version, contribute to TPA responsiveness in transient assays in monocyte and T-cell types. The SCMV SNE sites contain potential overlapping core recognition binding motifs for SRF, Rel/NFkappaB, ETS, and YY1 class transcription factors but fail to respond to either serum or tumor necrosis factor alpha. Therefore, to evaluate the mechanism of TPA responsiveness of the SNE motifs and of a related 16-bp SEE (SRF/ETS element) motif found in the HCMV and chimpanzee CMV MIE enhancers, we have examined the functional responses and protein binding properties of multimerized wild-type and mutant elements added upstream to the SCMV MIE or simian virus 40 minimal promoter regions in the U-937, K-562, HL-60, THP-1, and Jurkat cell lines. Unlike classical NFkappaB sites, neither the SNE nor the SEE motif responded to phosphatase inhibition by okadaic acid. However, the TPA responsiveness of both CMV elements proved to involve synergistic interactions between the core SRF binding site (CCATATATGG) and the adjacent inverted ETS binding motifs (TTCC), which correlated directly with formation of a bound tripartite complex containing both the cellular SRF and ELK-1 proteins. This protein

  18. 3-Hydroxy-3-methylglutaryl CoA lyase (HL): Mouse and human HL gene (HMGCL) cloning and detection of large gene deletions in two unrelated HL-deficient patients

    SciTech Connect

    Wang, S.P.; Robert, M.F.; Mitchell, G.A.

    1996-04-01

    3-hydroxy-3-methylglutaryl CoA lyase (HL, EC 4.1.3.4) catalyzes the cleavage of 3-hydroxy-3-methylglutaryl CoA to acetoacetic acid and acetyl CoA, the final reaction of both ketogenesis and leucine catabolism. Autosomal-recessive HL deficiency in humans results in episodes of hypoketotic hypoglycemia and coma. Using a mouse HL cDNA as a probe, we isolated a clone containing the full-length mouse HL gene that spans about 15 kb of mouse chromosome 4 and contains nine exons. The promoter region of the mouse HL gene contains elements characteristic of a housekeeping gene: a CpG island containing multiple Sp1 binding sites surrounds exon 1, and neither a TATA nor a CAAT box are present. We identified multiple transcription start sites in the mouse HL gene, 35 to 9 bases upstream of the translation start codon. We also isolated two human HL genomic clones that include HL exons 2 to 9 within 18 kb. The mouse and human HL genes (HGMW-approved symbol HMGCL) are highly homologous, with identical locations of intron-exon junctions. By genomic Southern blot analysis and exonic PCR, was found 2 of 33 HL-deficient probands to be homozygous for large deletions in the HL gene. 26 refs., 4 figs., 2 tabs.

  19. Bilateral hand amyotrophy with PMP-22 gene deletion.

    PubMed

    Gochard, A; Guennoc, A M; Praline, J; Malinge, M C; de Toffol, B; Corcia, P

    2007-01-01

    Hereditary neuropathy with liability to pressure palsies (HNPP) phenotypes are heterogeneous. We report the case of a 52-year-old woman without medical history, who complained of bilateral hand weakness suggestive first of a motor neuron disorder. The presence of a diffuse predominant distal demyelinating neuropathy suggested a deletion of PMP-22 gene, which was confirmed by genetic analysis. This case report underlines a novel phenotype related to the deletion of PMP-22 gene.

  20. Multiple Pregnancy

    MedlinePlus

    ... is called multiple pregnancy . If more than one egg is released during the menstrual cycle and each ... fraternal twins (or more). When a single fertilized egg splits, it results in multiple identical embryos. This ...

  1. Multiple myeloma

    MedlinePlus

    Plasma cell dyscrasia; Plasma cell myeloma; Malignant plasmacytoma; Plasmacytoma of bone; Myeloma - multiple ... Multiple myeloma most commonly causes: Low red blood cell count ( anemia ), which can lead to fatigue and ...

  2. Multiple Sclerosis

    MedlinePlus

    Multiple sclerosis (MS) is a nervous system disease that affects your brain and spinal cord. It damages the ... attacks healthy cells in your body by mistake. Multiple sclerosis affects women more than men. It often begins ...

  3. Finger Multiplication

    ERIC Educational Resources Information Center

    Simanihuruk, Mudin

    2011-01-01

    Multiplication facts are difficult to teach. Therefore many researchers have put a great deal of effort into finding multiplication strategies. Sherin and Fuson (2005) provided a good survey paper on the multiplication strategies research area. Kolpas (2002), Rendtorff (1908), Dabell (2001), Musser (1966) and Markarian (2009) proposed the finger…

  4. Multiple Sclerosis

    MedlinePlus

    ... Awards Enhancing Diversity Find People About NINDS NINDS Multiple Sclerosis Information Page Condensed from Multiple Sclerosis: Hope Through ... en Español Additional resources from MedlinePlus What is Multiple Sclerosis? An unpredictable disease of the central nervous system, ...

  5. Multiplicity Counting

    SciTech Connect

    Geist, William H.

    2015-12-01

    This set of slides begins by giving background and a review of neutron counting; three attributes of a verification item are discussed: 240Pueff mass; α, the ratio of (α,n) neutrons to spontaneous fission neutrons; and leakage multiplication. It then takes up neutron detector systems – theory & concepts (coincidence counting, moderation, die-away time); detector systems – some important details (deadtime, corrections); introduction to multiplicity counting; multiplicity electronics and example distributions; singles, doubles, and triples from measured multiplicity distributions; and the point model: multiplicity mathematics.

  6. Variation in Fumonisin and Ochratoxin Production Associated with Differences in Biosynthetic Gene Content in Aspergillus niger and A. welwitschiae Isolates from Multiple Crop and Geographic Origins

    PubMed Central

    Susca, Antonia; Proctor, Robert H.; Morelli, Massimiliano; Haidukowski, Miriam; Gallo, Antonia; Logrieco, Antonio F.; Moretti, Antonio

    2016-01-01

    The fungi Aspergillus niger and A. welwitschiae are morphologically indistinguishable species used for industrial fermentation and for food and beverage production. The fungi also occur widely on food crops. Concerns about their safety have arisen with the discovery that some isolates of both species produce fumonisin (FB) and ochratoxin A (OTA) mycotoxins. Here, we examined FB and OTA production as well as the presence of genes responsible for synthesis of the mycotoxins in a collection of 92 A. niger/A. welwitschiae isolates from multiple crop and geographic origins. The results indicate that (i) isolates of both species differed in ability to produce the mycotoxins; (ii) FB-nonproducing isolates of A. niger had an intact fumonisin biosynthetic gene (fum) cluster; (iii) FB-nonproducing isolates of A. welwitschiae exhibited multiple patterns of fum gene deletion; and (iv) OTA-nonproducing isolates of both species lacked the ochratoxin A biosynthetic gene (ota) cluster. Analysis of genome sequence data revealed a single pattern of ota gene deletion in the two species. Phylogenetic analysis suggest that the simplest explanation for this is that ota cluster deletion occurred in a common ancestor of A. niger and A. welwitschiae, and subsequently both the intact and deleted cluster were retained as alternate alleles during divergence of the ancestor into descendent species. Finally, comparison of results from this and previous studies indicate that a majority of A. niger isolates and a minority of A. welwitschiae isolates can produce FBs, whereas, a minority of isolates of both species produce OTA. The comparison also suggested that the relative abundance of each species and frequency of FB/OTA-producing isolates can vary with crop and/or geographic origin.

  7. Variation in Fumonisin and Ochratoxin Production Associated with Differences in Biosynthetic Gene Content in Aspergillus niger and A. welwitschiae Isolates from Multiple Crop and Geographic Origins

    PubMed Central

    Susca, Antonia; Proctor, Robert H.; Morelli, Massimiliano; Haidukowski, Miriam; Gallo, Antonia; Logrieco, Antonio F.; Moretti, Antonio

    2016-01-01

    The fungi Aspergillus niger and A. welwitschiae are morphologically indistinguishable species used for industrial fermentation and for food and beverage production. The fungi also occur widely on food crops. Concerns about their safety have arisen with the discovery that some isolates of both species produce fumonisin (FB) and ochratoxin A (OTA) mycotoxins. Here, we examined FB and OTA production as well as the presence of genes responsible for synthesis of the mycotoxins in a collection of 92 A. niger/A. welwitschiae isolates from multiple crop and geographic origins. The results indicate that (i) isolates of both species differed in ability to produce the mycotoxins; (ii) FB-nonproducing isolates of A. niger had an intact fumonisin biosynthetic gene (fum) cluster; (iii) FB-nonproducing isolates of A. welwitschiae exhibited multiple patterns of fum gene deletion; and (iv) OTA-nonproducing isolates of both species lacked the ochratoxin A biosynthetic gene (ota) cluster. Analysis of genome sequence data revealed a single pattern of ota gene deletion in the two species. Phylogenetic analysis suggest that the simplest explanation for this is that ota cluster deletion occurred in a common ancestor of A. niger and A. welwitschiae, and subsequently both the intact and deleted cluster were retained as alternate alleles during divergence of the ancestor into descendent species. Finally, comparison of results from this and previous studies indicate that a majority of A. niger isolates and a minority of A. welwitschiae isolates can produce FBs, whereas, a minority of isolates of both species produce OTA. The comparison also suggested that the relative abundance of each species and frequency of FB/OTA-producing isolates can vary with crop and/or geographic origin. PMID:27667988

  8. Variation in Fumonisin and Ochratoxin Production Associated with Differences in Biosynthetic Gene Content in Aspergillus niger and A. welwitschiae Isolates from Multiple Crop and Geographic Origins.

    PubMed

    Susca, Antonia; Proctor, Robert H; Morelli, Massimiliano; Haidukowski, Miriam; Gallo, Antonia; Logrieco, Antonio F; Moretti, Antonio

    2016-01-01

    The fungi Aspergillus niger and A. welwitschiae are morphologically indistinguishable species used for industrial fermentation and for food and beverage production. The fungi also occur widely on food crops. Concerns about their safety have arisen with the discovery that some isolates of both species produce fumonisin (FB) and ochratoxin A (OTA) mycotoxins. Here, we examined FB and OTA production as well as the presence of genes responsible for synthesis of the mycotoxins in a collection of 92 A. niger/A. welwitschiae isolates from multiple crop and geographic origins. The results indicate that (i) isolates of both species differed in ability to produce the mycotoxins; (ii) FB-nonproducing isolates of A. niger had an intact fumonisin biosynthetic gene (fum) cluster; (iii) FB-nonproducing isolates of A. welwitschiae exhibited multiple patterns of fum gene deletion; and (iv) OTA-nonproducing isolates of both species lacked the ochratoxin A biosynthetic gene (ota) cluster. Analysis of genome sequence data revealed a single pattern of ota gene deletion in the two species. Phylogenetic analysis suggest that the simplest explanation for this is that ota cluster deletion occurred in a common ancestor of A. niger and A. welwitschiae, and subsequently both the intact and deleted cluster were retained as alternate alleles during divergence of the ancestor into descendent species. Finally, comparison of results from this and previous studies indicate that a majority of A. niger isolates and a minority of A. welwitschiae isolates can produce FBs, whereas, a minority of isolates of both species produce OTA. The comparison also suggested that the relative abundance of each species and frequency of FB/OTA-producing isolates can vary with crop and/or geographic origin. PMID:27667988

  9. Representing Multiplication

    ERIC Educational Resources Information Center

    Harries, Tony; Barmby, Patrick

    2008-01-01

    In this study, the authors wish to explore the use of visual representations in facilitating the understanding of multiplication. In doing so, they examine the different aspects of multiplication that they can access through different representations. In addition, they draw on a study that they have been carrying out looking at pupils' actual use…

  10. Multiple homicides.

    PubMed

    Copeland, A R

    1989-09-01

    A study of multiple homicides or multiple deaths involving a solitary incident of violence by another individual was performed on the case files of the Office of the Medical Examiner of Metropolitan Dade County in Miami, Florida, during 1983-1987. A total of 107 multiple homicides were studied: 88 double, 17 triple, one quadruple, and one quintuple. The 236 victims were analyzed regarding age, race, sex, cause of death, toxicologic data, perpetrator, locale of the incident, and reason for the incident. This article compares this type of slaying with other types of homicide including those perpetrated by serial killers. Suggestions for future research in this field are offered.

  11. Multiple Sclerosis.

    ERIC Educational Resources Information Center

    Plummer, Nancy; Michael, Nancy, Ed.

    This module on multiple sclerosis is intended for use in inservice or continuing education programs for persons who administer medications in long-term care facilities. Instructor information, including teaching suggestions, and a listing of recommended audiovisual materials and their sources appear first. The module goal and objectives are then…

  12. Myeloma (multiple)

    PubMed Central

    2006-01-01

    Introduction Multiple myeloma is the most common primary cancer of the bones in adults, representing about 1% of all cancers diagnosed in the US in 2004, and 14% of all haematological malignancies. In the UK, multiple myeloma accounts for 1% of all new cases of cancer diagnosed each year. Methods and outcomes We conducted a systematic review and aimed to answer the following clinical questions: What are the effects of treatment in people with asymptomatic early stage multiple myeloma (stage I)? What are the effects of first-line treatments in people with advanced stage multiple myeloma (stages II and III)? What are the effect of salvage treatments, or supportive therapy, in people with advanced stage multiple myeloma (stages II and III)? We searched: Medline, Embase, The Cochrane Library and other important databases up to November 2004 (Clinical Evidence reviews are updated periodically, please check our website for the most up-to-date version of this review). We included harms alerts from relevant organisations such as the US Food and Drug Administration (FDA) and the UK Medicines and Healthcare products Regulatory Agency (MHRA). Results We found 71 systematic reviews, RCTs, or observational studies that met our inclusion criteria. Conclusions In this systematic review we present information relating to the effectiveness and safety of the following interventions: allogenic transplant (non-myeloablative), autologous stem cell transplant (early or late transplantation, double or single, purging of), bisphosphonates, bone marrow stem cells, bortezomib, chemotherapy (combination, conventional dose, intermediate dose plus stem cell rescue, high-dose plus stem cell rescue), combination chemotherapy plus corticosteroids, deferred treatment (in stage I disease), early chemotherapy plus corticosteroids (in stage I disease), epoetin alpha, first-line treatments, infection prophylaxis, interferon, maintenance therapy (in advanced multiple myeloma), melphalan (normal dose

  13. Multiple Sclerosis

    PubMed Central

    2013-01-01

    Multiple sclerosis (MS) is a chronic progressive demyelinating disease of the central nervous system. Common manifestations include paresthesias, diplopia, loss of vision, numbness or weakness of the limbs, bowel or bladder dysfunction, spasticity, ataxia, fatigue, and mental changes. Four main patterns of MS are recognized: relapsing remitting, primary progressive, secondary progressive, and progressive relapsing. The cause of MS is unknown, although it appears to be an autoimmune disease. Much of what is known about MS has been learned from an animal model of the disease, experimental allergic encephalomyelitis. PMID:24381825

  14. Multiple Sclerosis.

    PubMed

    Schiess, Nicoline; Calabresi, Peter A

    2016-08-01

    It is estimated that there are 300,000 people with multiple sclerosis (MS) in the United States and 2.3 million worldwide. Each MS attack can affect function in cognitive, emotional, motoric, sensory, or visual domains. Patients are often struck in the prime of their lives as they attempt to move forward with career, and family. Since the previous 2010 Seminars in Neurology Pearls and Pitfalls issue, the world of MS has drastically changed and advanced. Here the authors address the ever-changing MS world in both treatment options and diagnostics, covering easily missed differential diagnoses, newly available immunomodulatory therapy, and the challenges of safely treating patients. PMID:27643903

  15. Multiple myeloma

    PubMed Central

    Rajkumar, S. Vincent

    2008-01-01

    Multiple myeloma is a clonal plasma cell malignancy that accounts for slightly more than 10% of all hematologic cancers. In this paper, we present a historically focused review of the disease, from the description of the first case in 1844 to the present. The evolution of drug therapy and stem-cell transplantation for the treatment of myeloma, as well as the development of new agents, is discussed. We also provide an update on current concepts of diagnosis and therapy, with an emphasis on how treatments have emerged from a historical perspective after certain important discoveries and the results of experimental studies. PMID:18332230

  16. [Multiple myeloma].

    PubMed

    Abe, Masahiro; Miki, Hirokazu; Nakamura, Shingen

    2016-03-01

    Owing to the positive clinical benefits obtained with new agents, complete remission (CR) can be used as a surrogate for overall survival, and should be achieved. Although multiple myeloma is a heterogeneous disease in terms of myeloma cell- and patient-related risk factors, patients should receive the most effective combination therapy based on proteasome inhibitors and/or immunomodulatory drugs (IMiDs) as backbone medication irrespective of the risks encountered in the setting of induction therapy ("one-size-fits-all" therapy), followed by consolidation/maintenance therapy to achieve CR with the ultimate goal of extended survival. Myeloma-defining biomarkers have been established to identify high-risk smoldering myeloma requiring treatment. The development of salvage treatments yielding better outcomes for relapsed/refractory myeloma is urgently needed. Upcoming novel molecular targeting agents with different modes of action and immunotherapeutic agents will be integrated into myeloma treatment regimens with a great therapeutic impact, and further evolution of the treatment paradigm for multiple myeloma is eagerly anticipated. PMID:27076236

  17. CRISPR/Cas9: a molecular Swiss army knife for simultaneous introduction of multiple genetic modifications in Saccharomyces cerevisiae.

    PubMed

    Mans, Robert; van Rossum, Harmen M; Wijsman, Melanie; Backx, Antoon; Kuijpers, Niels G A; van den Broek, Marcel; Daran-Lapujade, Pascale; Pronk, Jack T; van Maris, Antonius J A; Daran, Jean-Marc G

    2015-03-01

    A variety of techniques for strain engineering in Saccharomyces cerevisiae have recently been developed. However, especially when multiple genetic manipulations are required, strain construction is still a time-consuming process. This study describes new CRISPR/Cas9-based approaches for easy, fast strain construction in yeast and explores their potential for simultaneous introduction of multiple genetic modifications. An open-source tool (http://yeastriction.tnw.tudelft.nl) is presented for identification of suitable Cas9 target sites in S. cerevisiae strains. A transformation strategy, using in vivo assembly of a guideRNA plasmid and subsequent genetic modification, was successfully implemented with high accuracies. An alternative strategy, using in vitro assembled plasmids containing two gRNAs, was used to simultaneously introduce up to six genetic modifications in a single transformation step with high efficiencies. Where previous studies mainly focused on the use of CRISPR/Cas9 for gene inactivation, we demonstrate the versatility of CRISPR/Cas9-based engineering of yeast by achieving simultaneous integration of a multigene construct combined with gene deletion and the simultaneous introduction of two single-nucleotide mutations at different loci. Sets of standardized plasmids, as well as the web-based Yeastriction target-sequence identifier and primer-design tool, are made available to the yeast research community to facilitate fast, standardized and efficient application of the CRISPR/Cas9 system.

  18. CRISPR/Cas9: a molecular Swiss army knife for simultaneous introduction of multiple genetic modifications in Saccharomyces cerevisiae

    PubMed Central

    Mans, Robert; van Rossum, Harmen M.; Wijsman, Melanie; Backx, Antoon; Kuijpers, Niels G.A.; van den Broek, Marcel; Daran-Lapujade, Pascale; Pronk, Jack T.; van Maris, Antonius J.A.; Daran, Jean-Marc G.

    2015-01-01

    A variety of techniques for strain engineering in Saccharomyces cerevisiae have recently been developed. However, especially when multiple genetic manipulations are required, strain construction is still a time-consuming process. This study describes new CRISPR/Cas9-based approaches for easy, fast strain construction in yeast and explores their potential for simultaneous introduction of multiple genetic modifications. An open-source tool (http://yeastriction.tnw.tudelft.nl) is presented for identification of suitable Cas9 target sites in S. cerevisiae strains. A transformation strategy, using in vivo assembly of a guideRNA plasmid and subsequent genetic modification, was successfully implemented with high accuracies. An alternative strategy, using in vitro assembled plasmids containing two gRNAs, was used to simultaneously introduce up to six genetic modifications in a single transformation step with high efficiencies. Where previous studies mainly focused on the use of CRISPR/Cas9 for gene inactivation, we demonstrate the versatility of CRISPR/Cas9-based engineering of yeast by achieving simultaneous integration of a multigene construct combined with gene deletion and the simultaneous introduction of two single-nucleotide mutations at different loci. Sets of standardized plasmids, as well as the web-based Yeastriction target-sequence identifier and primer-design tool, are made available to the yeast research community to facilitate fast, standardized and efficient application of the CRISPR/Cas9 system. PMID:25743786

  19. [Multiple apheresis].

    PubMed

    Coffe, C

    2007-05-01

    Multiple apheresis makes it possible to obtain at least two labile blood components from a single donor using a cell separator. It can be either multicomponent apheresis leading to the preparation of at least two different blood component types or red blood cell apheresis providing two identical red blood cell concentrates. These techniques available in addition to whole blood donation, are modifying collection strategies in many Etablissements Français du Sang and will contribute to improve stock logistics in the future. In areas with insufficient stock, these procedures will help achieve blood component self-sufficiency. The author first describes the principle underlying different--current or future--techniques as well as their advantages and drawbacks. He finally addresses the potential impact of these processes on the evolution of blood collection and the advantages to be gained. PMID:17521944

  20. A defect in nurturing in mice lacking the immediate early gene fosB.

    PubMed

    Brown, J R; Ye, H; Bronson, R T; Dikkes, P; Greenberg, M E

    1996-07-26

    Although expression of the Fos family of transcription factors is induced by environmental stimuli that trigger adaptive neuronal response, evidence that Fos family members mediate these responses is lacking. To address this issue, mice were generated with an inactivating mutation in the fosB gene. fosB mutant mice are profoundly deficient in their ability to nurture young animals but are normal with respect to other cognitive and sensory functions. The nurturing defect is likely due to the absence of FosB in the preoptic area, a region of the hypothalamus that is critical for nurturing. These observations suggest that a transcription factor controls a complex behavior by regulating a specific neuronal circuit and indicate that nurturing in mammals has a genetic component.

  1. Immediate, Early, and Conventional Implant Placement in a Patient with History of Periodontitis

    PubMed Central

    Lanza, Alessandro; Scognamiglio, Fabio; Femiano, Felice; Lanza, Michele

    2015-01-01

    The aim of this paper is to describe a case of implant-prosthetic rehabilitation in a patient with periodontitis, focusing on the different timing of implant placement. After initial periodontal treatment, teeth with advanced mobility degree and severe bone resorption were extracted. At different healing time oral implants were placed in a prosthetic-guided position. After osseointegration period the implants were loaded and the results at one year of follow-up are presented. PMID:25949833

  2. Immediate, early, and conventional implant placement in a patient with history of periodontitis.

    PubMed

    Lanza, Alessandro; Scognamiglio, Fabio; Femiano, Felice; Lanza, Michele

    2015-01-01

    The aim of this paper is to describe a case of implant-prosthetic rehabilitation in a patient with periodontitis, focusing on the different timing of implant placement. After initial periodontal treatment, teeth with advanced mobility degree and severe bone resorption were extracted. At different healing time oral implants were placed in a prosthetic-guided position. After osseointegration period the implants were loaded and the results at one year of follow-up are presented. PMID:25949833

  3. Water deprivation-induced sodium appetite: humoral and cardiovascular mediators and immediate early genes

    NASA Technical Reports Server (NTRS)

    De Luca, Laurival A Jr; Xu, Zhice; Schoorlemmer, Guus H M.; Thunhorst, Robert L.; Beltz, Terry G.; Menani, Jose V.; Johnson, Alan Kim

    2002-01-01

    Adult rats deprived of water for 24-30 h were allowed to rehydrate by ingesting only water for 1-2 h. Rats were then given access to both water and 1.8% NaCl. This procedure induced a sodium appetite defined by the operational criteria of a significant increase in 1.8% NaCl intake (3.8 +/- 0.8 ml/2 h; n = 6). Expression of Fos (as assessed by immunohistochemistry) was increased in the organum vasculosum of the lamina terminalis (OVLT), median preoptic nucleus (MnPO), subfornical organ (SFO), and supraoptic nucleus (SON) after water deprivation. After rehydration with water but before consumption of 1.8% NaCl, Fos expression in the SON disappeared and was partially reduced in the OVLT and MnPO. However, Fos expression did not change in the SFO. Water deprivation also 1) increased plasma renin activity (PRA), osmolality, and plasma Na+; 2) decreased blood volume; and 3) reduced total body Na+; but 4) did not alter arterial blood pressure. Rehydration with water alone caused only plasma osmolality and plasma Na+ concentration to revert to euhydrated levels. The changes in Fos expression and PRA are consistent with a proposed role for ANG II in the control of the sodium appetite produced by water deprivation followed by rehydration with only water.

  4. Sustained transcription of the immediate early gene Arc in the dentate gyrus after spatial exploration.

    PubMed

    Ramirez-Amaya, Victor; Angulo-Perkins, Arafat; Chawla, Monica K; Barnes, Carol A; Rosi, Susanna

    2013-01-23

    After spatial exploration in rats, Arc mRNA is expressed in ∼2% of dentate gyrus (DG) granule cells, and this proportion of Arc-positive neurons remains stable for ∼8 h. This long-term presence of Arc mRNA following behavior is not observed in hippocampal CA1 pyramidal cells. We report here that in rats ∼50% of granule cells with cytoplasmic Arc mRNA, induced some hours previously during exploration, also show Arc expression in the nucleus. This suggests that recent transcription can occur long after the exploration behavior that elicited it. To confirm that the delayed nuclear Arc expression was indeed recent transcription, Actinomycin D was administered immediately after exploration. This treatment resulted in inhibition of recent Arc expression both when evaluated shortly after exploratory behavior as well as after longer time intervals. Together, these data demonstrate a unique kinetic profile for Arc transcription in hippocampal granule neurons following behavior that is not observed in other cell types. Among a number of possibilities, this sustained transcription may provide a mechanism that ensures that the synaptic connection weights in the sparse population of granule cells recruited during a given behavioral event are able to be modified.

  5. LSD1 modulates stress-evoked transcription of immediate early genes and emotional behavior.

    PubMed

    Rusconi, Francesco; Grillo, Barbara; Ponzoni, Luisa; Bassani, Silvia; Toffolo, Emanuela; Paganini, Leda; Mallei, Alessandra; Braida, Daniela; Passafaro, Maria; Popoli, Maurizio; Sala, Mariaelvina; Battaglioli, Elena

    2016-03-29

    Behavioral changes in response to stressful stimuli can be controlled via adaptive epigenetic changes in neuronal gene expression. Here we indicate a role for the transcriptional corepressor Lysine-Specific Demethylase 1 (LSD1) and its dominant-negative splicing isoform neuroLSD1, in the modulation of emotional behavior. In mouse hippocampus, we show that LSD1 and neuroLSD1 can interact with transcription factor serum response factor (SRF) and set the chromatin state of SRF-targeted genes early growth response 1 (egr1) and c-fos Deletion or reduction of neuro LSD1 in mutant mice translates into decreased levels of activating histone marks at egr1 and c-fos promoters, dampening their psychosocial stress-induced transcription and resulting in low anxiety-like behavior. Administration of suberoylanilide hydroxamine to neuroLSD1(KO)mice reactivates egr1 and c-fos transcription and restores the behavioral phenotype. These findings indicate that LSD1 is a molecular transducer of stressful stimuli as well as a stress-response modifier. Indeed, LSD1 expression itself is increased acutely at both the transcriptional and splicing levels by psychosocial stress, suggesting that LSD1 is involved in the adaptive response to stress.

  6. Integrins as a primary signal transduction molecule regulating monocyte immediate-early gene induction.

    PubMed Central

    Yurochko, A D; Liu, D Y; Eierman, D; Haskill, S

    1992-01-01

    Integrins are cell surface receptors found on monocytes that facilitate adhesion to both cellular and extracellular substrates. These integrins are thought to be involved in the selective gene induction observed after monocyte adhesion to various extracellular matrices. To investigate this hypothesis, we stimulated monocytes with monoclonal antibodies to different integrin receptors to specifically mimic the integrin receptor-ligand interactions. Engagement of the common beta chain of the beta 1 subfamily of integrins resulted in expression of the inflammatory mediator genes, interleukin 1 beta, interleukin 1 receptor antagonist, and monocyte adherence-derived inflammatory gene 6 (MAD-6), whereas engagement of the common beta chain of the beta 2 family did not. Furthermore, to characterize integrin-mediated gene induction, we examined the ability of antibodies to the alpha chain of integrin receptors to regulate gene expression. Engagement of the very late antigen 4 (VLA-4) receptor resulted in induction of all the mediator genes. Receptor crosslinking was required because individual Fab fragments were unable to stimulate gene induction whereas the divalent F(ab')2 fragment and the whole IgG molecule could. Interleukin 1 beta secretion was dependent on the anti-integrin antibody used. Some antibodies required a second signal and, for others, direct engagement was sufficient for protein production. In conclusion, engagement of integrin receptors regulated the production of both inflammatory mediator mRNA and protein. These results suggest that integrin-dependent recognition and adherence may provide the key signals for initiation of the inflammatory response during monocyte diapedesis. Images PMID:1384041

  7. Water deprivation-induced sodium appetite: humoral and cardiovascular mediators and immediate early genes.

    PubMed

    De Luca, Laurival A; Xu, Zhice; Schoorlemmer, Guus H M; Thunhorst, Robert L; Beltz, Terry G; Menani, José V; Johnson, Alan Kim

    2002-02-01

    Adult rats deprived of water for 24-30 h were allowed to rehydrate by ingesting only water for 1-2 h. Rats were then given access to both water and 1.8% NaCl. This procedure induced a sodium appetite defined by the operational criteria of a significant increase in 1.8% NaCl intake (3.8 +/- 0.8 ml/2 h; n = 6). Expression of Fos (as assessed by immunohistochemistry) was increased in the organum vasculosum of the lamina terminalis (OVLT), median preoptic nucleus (MnPO), subfornical organ (SFO), and supraoptic nucleus (SON) after water deprivation. After rehydration with water but before consumption of 1.8% NaCl, Fos expression in the SON disappeared and was partially reduced in the OVLT and MnPO. However, Fos expression did not change in the SFO. Water deprivation also 1) increased plasma renin activity (PRA), osmolality, and plasma Na+; 2) decreased blood volume; and 3) reduced total body Na+; but 4) did not alter arterial blood pressure. Rehydration with water alone caused only plasma osmolality and plasma Na+ concentration to revert to euhydrated levels. The changes in Fos expression and PRA are consistent with a proposed role for ANG II in the control of the sodium appetite produced by water deprivation followed by rehydration with only water.

  8. Sustained transcription of the immediate early gene Arc in the dentate gyrus after spatial exploration.

    PubMed

    Ramirez-Amaya, Victor; Angulo-Perkins, Arafat; Chawla, Monica K; Barnes, Carol A; Rosi, Susanna

    2013-01-23

    After spatial exploration in rats, Arc mRNA is expressed in ∼2% of dentate gyrus (DG) granule cells, and this proportion of Arc-positive neurons remains stable for ∼8 h. This long-term presence of Arc mRNA following behavior is not observed in hippocampal CA1 pyramidal cells. We report here that in rats ∼50% of granule cells with cytoplasmic Arc mRNA, induced some hours previously during exploration, also show Arc expression in the nucleus. This suggests that recent transcription can occur long after the exploration behavior that elicited it. To confirm that the delayed nuclear Arc expression was indeed recent transcription, Actinomycin D was administered immediately after exploration. This treatment resulted in inhibition of recent Arc expression both when evaluated shortly after exploratory behavior as well as after longer time intervals. Together, these data demonstrate a unique kinetic profile for Arc transcription in hippocampal granule neurons following behavior that is not observed in other cell types. Among a number of possibilities, this sustained transcription may provide a mechanism that ensures that the synaptic connection weights in the sparse population of granule cells recruited during a given behavioral event are able to be modified. PMID:23345235

  9. The NR4A subgroup: immediate early response genes with pleiotropic physiological roles

    PubMed Central

    Maxwell, Megan A.; Muscat, George E.O.

    2006-01-01

    The nuclear hormone receptor (NR) superfamily includes the orphan NR4A subgroup, comprised of Nur77 (NR4A1), Nurr1 (NR4A2) and NOR-1 (NR4A3). These NRs are classified as early response genes, are induced by a diverse range of signals, including fatty acids, stress, growth factors, cytokines, peptide hormones, phorbol esters, neurotransmitters, and physical stimuli (for example magnetic fields, shear stress). The ability to sense and rapidly respond to changes in the cellular environment thus appears to be a hallmark of this subfamily. The members of the NR4A subgroup are well conserved in the DNA binding domain (~91-95%) and the C-terminal ligand-binding domain (~60%), but are divergent in the N-terminal AB region. These receptors bind as monomers, homodimers and heterodimers with RXRs (to mediate retinoid signaling) to different permutations of the canonical NR binding motif. The NR4A subgroup activates gene expression in a constitutive ligand-independent manner. NR4A-mediated trans-activation (LBD) involves unusually active N-terminal AF-1 domains that mediate coactivator recruitment. Moreover, the NR4A receptors encode atypical LBDs and AF-2 domains. For example, the LBDs contain no cavity due to bulky hydrophobic residue side chains, and lack the classical coactivator-binding cleft constituted by helices 3, 4 and 12. However, a hydrophobic patch exists between helices 11 and 12, that encodes a novel cofactor interface that modulates transcriptional activity. In line with the pleiotropic physiological stimuli that induce the NR4A subgroup, these orphan NRs have been implicated in cell cycle regulation (and apoptosis), neurological disease, steroidogenesis, inflammation, carcinogenesis and atherogenesis. PMID:16604165

  10. Sex differences in social interaction in rats: role of the immediate-early gene zif268.

    PubMed

    Stack, Ashley; Carrier, Nicole; Dietz, David; Hollis, Fiona; Sorenson, Jamie; Kabbaj, Mohamed

    2010-01-01

    Given both the high prevalence of anxiety disorders in women and the fact that little is known about the mechanisms of gender differences in anxiety, our primary aim in this study was to investigate the neurobiological mechanisms underlying sex differences in social anxiety-like behavior in rats. Through the use of zif268 antisense oligodeoxynucleotides (zif ASO), we induced a temporary downregulation of zif268 expression in the medial prefrontal cortex of male and female rats and found that zif268 ASO male rats show more social anxiety-like behaviors when compared with control male rats in the social interaction test. In fact, zif268 ASO males displayed social anxiety-like behaviors, which were similar to control females, thus downregulation of zif268 expression in the mPFC of male rats eliminated sex differences previously found in the social anxiety-like behavior tests. Interestingly, zif268 ASO in female rats had no effect on their social interaction. Our novel findings have led us to ascertain that sexually dimorphic zif268 expression in the mPFC is a key molecular factor in mediating sex-specific anxiety-like behavior in the social interaction test.

  11. Multiple sclerosis

    PubMed Central

    Boster, Aaron L.; Racke, Michael K.

    2013-01-01

    Summary Preliminary studies have suggested that a high salt diet may play a role in the development of autoimmune disease and possibly multiple sclerosis (MS). Promising clinical trial results for 2 new therapies for MS have been reported. Dimethyl fumarate, also known by its investigational name BG-12, became the third oral disease-modifying therapy for MS to be Food and Drug Administration (FDA)–approved in March 2013. Interestingly, dimethyl fumarate served as the active compound used for the treatment of psoriasis for decades. Alemtuzumab remains under investigation and is not currently FDA-approved for treatment of MS. Other drugs currently approved for alternative indications are being investigated for use in MS. Additionally, an investigation of alternative dosing strategies for glatiramer acetate suggests that patients may benefit from a higher dose formulation and less frequent medication administration. Advances in basic science research have identified another potential autoantigenic target in MS, KIR4.1, which may provide further insight into MS pathophysiology. PMID:24175156

  12. Multiple sclerosis.

    PubMed

    Filippi, Massimo; Preziosa, Paolo; Rocca, Maria A

    2016-01-01

    Due to its sensitivity to the different multiple sclerosis (MS)-related abnormalities, magnetic resonance imaging (MRI) has become an established tool to diagnose MS and to monitor its evolution. MRI has been included in the diagnostic workup of patients with clinically isolated syndromes suggestive of MS, and ad hoc criteria have been proposed and are regularly updated. In patients with definite MS, the ability of conventional MRI techniques to explain patients' clinical status and progression of disability is still suboptimal. Several advanced MRI-based technologies have been applied to estimate overall MS burden in the different phases of the disease. Their use has allowed the heterogeneity of MS pathology in focal lesions, normal-appearing white matter and gray matter to be graded in vivo. Recently, additional features of MS pathology, including macrophage infiltration and abnormal iron deposition, have become quantifiable. All of this, combined with functional imaging techniques, is improving our understanding of the mechanisms associated with MS evolution. In the near future, the use of ultrahigh-field systems is likely to provide additional insight into disease pathophysiology. However, the utility of advanced MRI techniques in clinical trial monitoring and in assessing individual patients' response to treatment still needs to be assessed. PMID:27432676

  13. Multiple System Atrophy

    MedlinePlus

    ... Enhancing Diversity Find People About NINDS NINDS Multiple System Atrophy Information Page Condensed from Multiple System Atrophy ... Trials Organizations Publicaciones en Español What is Multiple System Atrophy? Multiple system atrophy (MSA) is a progressive ...

  14. Multiple sclerosis - resources

    MedlinePlus

    Resources - multiple sclerosis ... The following organizations provide information on multiple sclerosis : Multiple Sclerosis Foundation -- www.msfocus.org National Institute of Neurological Disorders and Stroke -- www.ninds.nih.gov/disorders/multiple_sclerosis National ...

  15. Multiple overlapping homologies between two rheumatoid antigens and immunosuppressive viruses.

    PubMed Central

    Douvas, A; Sobelman, S

    1991-01-01

    Amino acid (aa) sequence homologies between viruses and autoimmune nuclear antigens are suggestive of viral involvement in disorders such as systemic lupus erythematosus (SLE) and scleroderma. We analyzed the frequency of exact homologies of greater than or equal to 5 aa between 61 viral proteins (19,827 aa), 8 nuclear antigens (3813 aa), and 41 control proteins (11,743 aa). Both pentamer and hexamer homologies between control proteins and viruses are unexpectedly abundant, with hexamer matches occurring in 1 of 3 control proteins (or once every 769 aa). However, 2 nuclear antigens, the SLE-associated 70-kDa antigen and the scleroderma-associated CENP-B protein, are highly unusual in containing multiple homologies to a group of synergizing immunosuppressive viruses. Two viruses, herpes simplex virus 1 (HSV-1) and human immunodeficiency virus 1 (HIV-1), contain sequences exactly duplicated at 15 sites in the 70-kDa antigen and at 10 sites in CENP-B protein. The immediate-early (IE) protein of HSV-1, which activates HIV-1 regulatory functions, contains three homologies to the 70-kDa antigen (two hexamers and a pentamer) and two to CENP-B (a hexamer and pentamer). There are four homologies (including a hexamer) common to the 70-kDa antigen and Epstein-Barr virus, and three homologies (including two hexamers) common to CENP-B and cytomegalovirus. The majority of homologies in both nuclear antigens are clustered in highly charged C-terminal domains containing epitopes for human autoantibodies. Furthermore, most homologies have a contiguous or overlapping distribution, thereby creating a high density of potential epitopes. In addition to the exact homologies tabulated, motifs of matching sequences are repeated frequently in these domains. Our analysis suggests that coexpression of heterologous viruses having common immunosuppressive functions may generate autoantibodies cross-reacting with certain nuclear proteins. PMID:1712488

  16. Effect of multiple mutations in tricarboxylic acid cycle and one-carbon metabolism pathways on Edwardsiella ictaluri pathogenesis.

    PubMed

    Dahal, N; Abdelhamed, H; Lu, J; Karsi, A; Lawrence, M L

    2014-02-21

    Edwardsiella ictaluri is a Gram-negative facultative intracellular pathogen causing enteric septicemia of catfish (ESC). We have shown recently that tricarboxylic acid cycle (TCA) and one-carbon (C1) metabolism are involved in E. ictaluri pathogenesis. However, the effect of multiple mutations in these pathways is unknown. Here, we report four novel E. ictaluri mutants carrying double gene mutations in TCA cycle (EiΔmdhΔsdhC, EiΔfrdAΔsdhC), C1 metabolism (EiΔglyAΔgcvP), and both TCA and C1 metabolism pathways (EiΔgcvPΔsdhC). In-frame gene deletions were constructed by allelic exchange and mutants' virulence and vaccine efficacy were evaluated using in vivo bioluminescence imaging (BLI) as well as end point mortality counts in catfish fingerlings. Results indicated that all the double gene mutants were attenuated compared to wild-type (wt) E. ictaluri. There was a 1.39-fold average reduction in bioluminescence, and hence bacterial numbers, from all the mutants except for EiΔfrdAΔsdhC at 144 h post-infection. Vaccination with mutants was very effective in protecting channel catfish against subsequent infection with virulent E. ictaluri 93-146 strain. In particular, immersion vaccination resulted in complete protection. Our results provide further evidence on the importance of TCA and C1 metabolism pathways in bacterial pathogenesis.

  17. Screening of point mutations by multiple SSCP analysis in the dystrophin gene

    SciTech Connect

    Lasa, A.; Baiget, M.; Gallano, P.

    1994-09-01

    Duchenne muscular dystrophy (DMD) is a lethal, X-linked neuromuscular disorder. The population frequency of DMD is one in approximately 3500 boys, of which one third is thought to be a new mutant. The DMD gene is the largest known to date, spanning over 2,3 Mb in band Xp21.2; 79 exons are transcribed into a 14 Kb mRNA coding for a protein of 427 kD which has been named dystrophin. It has been shown that about 65% of affected boys have a gene deletion with a wide variation in localization and size. The remaining affected individuals who have no detectable deletions or duplications would probably carry more subtle mutations that are difficult to detect. These mutations occur in several different exons and seem to be unique to single patients. Their identification represents a formidable goal because of the large size and complexity of the dystrophin gene. SSCP is a very efficient method for the detection of point mutations if the parameters that affect the separation of the strands are optimized for a particular DNA fragment. The multiple SSCP allows the simultaneous study of several exons, and implies the use of different conditions because no single set of conditions will be optimal for all fragments. Seventy-eight DMD patients with no deletion or duplication in the dystrophin gene were selected for the multiple SSCP analysis. Genomic DNA from these patients was amplified using the primers described for the diagnosis procedure (muscle promoter and exons 3, 8, 12, 16, 17, 19, 32, 45, 48 and 51). We have observed different mobility shifts in bands corresponding to exons 8, 12, 43 and 51. In exons 17 and 45, altered electrophoretic patterns were found in different samples identifying polymorphisms already described.

  18. The multiple sclerosis drug fingolimod (FTY720) stimulates neuronal gene expression, axonal growth and regeneration.

    PubMed

    Anastasiadou, Sofia; Knöll, Bernd

    2016-05-01

    Fingolimod (FTY720) is a new generation oral treatment for multiple sclerosis (MS). So far, FTY720 was mainly considered to target trafficking of immune cells but not brain cells such as neurons. Herein, we analyzed FTY720's potential to directly alter neuronal function. In CNS neurons, we identified a FTY720 governed gene expression response. FTY720 upregulated immediate early genes (IEGs) encoding for neuronal activity associated transcription factors such as c-Fos, FosB, Egr1 and Egr2 and induced actin cytoskeleton associated genes (actin isoforms, tropomyosin, calponin). Stimulation of primary neurons with FTY720 enhanced neurite growth and altered growth cone morphology. In accordance, FTY720 enhanced axon regeneration in mice upon facial nerve axotomy. We identified components of a FTY720 engaged signaling cascade including S1P receptors, G12/13G-proteins, RhoA-GTPases and the transcription factors SRF/MRTF. In summary, we uncovered a broader cellular and therapeutic operation mode of FTY720, suggesting beneficial FTY720 effects also on CNS neurons during MS therapy and for treatment of other neurodegenerative diseases requiring neuroprotective and neurorestorative processes. PMID:26980486

  19. Parathyroid hormone ablation alters erythrocyte parameters that are rescued by calcium-sensing receptor gene deletion.

    PubMed

    Romero, Jose R; Youte, Rodeler; Brown, Edward M; Pollak, Martin R; Goltzman, David; Karaplis, Andrew; Pong, Lie-Chin; Chien, Lawrence; Chattopadhyay, Naibedya; Rivera, Alicia

    2013-07-01

    The mechanisms by which parathyroid hormone (PTH) produces anemia are unclear. Parathyroid hormone secretion is regulated by the extracellular Ca2+ -sensing receptor. We investigated the effects of ablating PTH on hematological indices and erythrocytes volume regulation in wild-type, PTH-null, and Ca2+ -sensing receptor-null/PTH-null mice. The erythrocyte parameters were measured in whole mouse blood, and volume regulatory systems were determined by plasma membrane K+ fluxes, and osmotic fragility was measured by hemoglobin determination at varying osmolarities. We observed that the absence of PTH significantly increases mean erythrocyte volume and reticulocyte counts, while decreasing erythrocyte counts, hemoglobin, hematocrit, and mean corpuscular hemoglobin concentration. These changes were accompanied by increases in erythrocyte cation content, a denser cell population, and increased K+ permeability, which were in part mediated by activation of the K+ /Cl- cotransporter and Gardos channel. In addition we observed that erythrocyte osmotic fragility in PTH-null compared with wild-type mice was enhanced. When Ca2+ -sensing receptor gene was deleted on the background of PTH-null mice, we observed that several of the alterations in erythrocyte parameters of PTH-null mice were largely rescued, particularly those related to erythrocyte volume, K+ fluxes and osmotic fragility, and became similar to those observed in wild-type mice. Our results demonstrate that Ca2+ -sensing receptor and parathyroid hormone are functionally coupled to maintain erythrocyte homeostasis. PMID:23528155

  20. Gene deletion of KLF9 in mice results in aberrant endometrial proliferation and myometrial function

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Timely regulation of uterine function is critical for successful pregnancy. Our laboratory has previously identified Basic transcription element binding protein-1/Krüppel-like factor 9 (Bteb1/Klf9), a member of Sp/KLF family of transcription factor, as a progesterone receptor (Pgr) interacting prote...

  1. Nociceptor-specific gene deletion using heterozygous NaV1.8-Cre recombinase mice.

    PubMed

    Stirling, L Caroline; Forlani, Greta; Baker, Mark D; Wood, John N; Matthews, Elizabeth A; Dickenson, Anthony H; Nassar, Mohammed A

    2005-01-01

    NaV1.8 is a voltage-gated sodium channel expressed only in a subset of sensory neurons of which more than 85% are nociceptors. In order to delete genes in nociceptive neurons, we generated heterozygous transgenic mice expressing Cre recombinase under the control of the NaV1.8 promoter. Functional Cre recombinase expression replicated precisely the expression pattern of NaV1.8. Cre expression began at embryonic day 14 in small diameter neurons in dorsal root, trigeminal and nodose ganglia, but was absent in non-neuronal or CNS tissues into adulthood. Sodium channel subtypes were normal in isolated DRG neurons. Pain behaviour in response to mechanical or thermal stimuli, and in acute, inflammatory and neuropathic pain was also normal. These data demonstrate that the heterozygous NaV1.8-Cre mouse line is a useful tool to analyse the effects of deleting floxed genes on pain behaviour. PMID:15621361

  2. Increased biomass production and glycogen accumulation in apcE gene deleted Synechocystis sp. PCC 6803

    PubMed Central

    2014-01-01

    The effect of phycobilisome antenna-truncation in the cyanobacterium Synechocystis sp. PCC 6803 on biomass production and glycogen accumulation have not yet been fully clarified. To investigate these effects here, the apcE gene, which encodes the anchor protein linking the phycobilisome to the thylakoid membrane, was deleted in a glucose tolerant strain of Synechocystis sp. PCC 6803. Biomass production of the apcE-deleted strain under photoautotrophic and atmospheric air conditions was 1.6 times higher than that of strain PCC 6803 (1.32 ± 0.01 versus 0.84 ± 0.07 g cell-dry weight L−1, respectively) after 15 days of cultivation. In addition, the glycogen content of the apcE-deleted strain (24.2 ± 0.7%) was also higher than that of strain PCC 6803 (11.1 ± 0.3%). Together, these results demonstrate that antenna truncation by deleting the apcE gene was effective for increasing biomass production and glycogen accumulation under photoautotrophic and atmospheric air conditions in Synechocystis sp. PCC 6803. PMID:24949254

  3. Partial gene deletion in LEC rat: An animal model for Wilson disease

    SciTech Connect

    Wu, J.; Forbes, J.R.; Cox, D.W.

    1994-09-01

    Wilson disease is an inherited disorder of copper transport in which incorporation of copper into ceruloplasmin and excretion of copper into bile are greatly reduced. Copper accumulates to a toxic level in the liver and also in the brain and kidney, causing a spectrum of hepatic and neurological abnormalities. We have recently cloned the gene for Wilson disease (designated ATP7B), which encodes a putative copper-transporting P-type ATPase. The inbred mutant Long-Evans Cinnamon (LEC) rat strain shows similarity to Wilson disease in many clinical and biochemical features. We have cloned cDNAs for the rat homologue (Atp7b) of the human Wilson disease gene (ATP7B) and have shown that the two genes have {approximately}82% identity at the amino acid sequence level. Rat cDNA sequences were used to identify a partial deletion in the Atp7b gene in the LEC rat. The deletion removes at least 750 bp of the coding region at the 3{prime} end, which includes the crucial ATP binding domain and extends downstream of the gene. The proximal breakpoint has been precisely localized at the cDNA level. Our results provide convincing evidence that the LEC rat is an animal model for Wilson disease. This model will be important for studying liver pathophysiology, for developing therapy for Wilson disease, and for studying the pathway of copper transport and its possible interaction with other heavy metals.

  4. Deletion of pyruvate decarboxylase by a new method for efficient markerless gene deletions in Gluconobacter oxydans.

    PubMed

    Peters, Björn; Junker, Anja; Brauer, Katharina; Mühlthaler, Bernadette; Kostner, David; Mientus, Markus; Liebl, Wolfgang; Ehrenreich, Armin

    2013-03-01

    Gluconobacter oxydans, a biotechnologically relevant species which incompletely oxidizes a large variety of carbohydrates, alcohols, and related compounds, contains a gene for pyruvate decarboxylase (PDC). This enzyme is found only in very few species of bacteria where it is normally involved in anaerobic ethanol formation via acetaldehyde. In order to clarify the role of PDC in the strictly oxidative metabolism of acetic acid bacteria, we developed a markerless in-frame deletion system for strain G. oxydans 621H which uses 5-fluorouracil together with a plasmid-encoded uracil phosphoribosyltransferase as counter selection method and used this technique to delete the PDC gene (GOX1081) of G. oxydans 621H. The PDC deletion mutant accumulated large amounts of pyruvate but almost no acetate during growth on D-mannitol, D-fructose or in the presence of L-lactate. This suggested that in G. oxydans acetate formation occurs by decarboxylation of pyruvate and subsequent oxidation of acetaldehyde to acetate. This observation and the efficiency of the markerless deletion system were confirmed by constructing deletion mutants of two acetaldehyde dehydrogenases (GOX1122 and GOX2018) and of the acetyl-CoA-synthetase (GOX0412). Acetate formation during growth of these mutants on mannitol did not differ significantly from the wild-type strain.

  5. PCR detection of retinoblastoma gene deletions in radiation-induced mouse lung adenocarcinomas

    SciTech Connect

    Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

    1994-05-01

    From 1971--1986, Argonne National Laboratory conducted a series of large-scale studies of tumor incidence in 40,000 BCF{sub 1} mice irradiated with {sup 60}Co {gamma}-rays or JANUS fission-spectrum neutrons. Polymerase chain reaction (PCR) technique was used to detect deletions in the mouse retinoblastoma (mRb) gene. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. Absence of any of these fragments on a Southern blot indicated a deletion of that portion of the mRb gene. Tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death in post-mortem analyses. Spontaneous tumors as well as those from irradiated mice were analyzed for mRb deletions. In all normal mouse tissues studies all six mRb exon fragments were present on Southern blots. Tumors in six neutron-irradiated mice also had no mRb deletions. However, 1 of 6 tumors from {gamma}-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice showed a deletion in one or both mRb alleles. All deletions detected were in the 5{prime} region of the mRb gene.

  6. Astrocytic β2 Adrenergic Receptor Gene Deletion Affects Memory in Aged Mice

    PubMed Central

    Jensen, Cathy Joanna; Demol, Frauke; Bauwens, Romy; Kooijman, Ron; Massie, Ann; Villers, Agnès; Ris, Laurence; De Keyser, Jacques

    2016-01-01

    In vitro and in vivo studies suggest that the astrocytic adrenergic signalling enhances glycogenolysis which provides energy to be transported to nearby cells and in the form of lactate. This energy source is important for motor and cognitive functioning. While it is suspected that the β2-adrenergic receptor on astrocytes might contribute to this energy balance, it has not yet been shown conclusively in vivo. Inducible astrocyte specific β2-adrenergic receptor knock-out mice were generated by crossing homozygous β2-adrenergic receptor floxed mice (Adrb2flox) and mice with heterozygous tamoxifen-inducible Cre recombinase-expression driven by the astrocyte specific L-glutamate/L-aspartate transporter promoter (GLAST-CreERT2). Assessments using the modified SHIRPA (SmithKline/Harwell/Imperial College/Royal Hospital/Phenotype Assessment) test battery, swimming ability test, and accelerating rotarod test, performed at 1, 2 and 4 weeks, 6 and 12 months after tamoxifen (or vehicle) administration did not reveal any differences in physical health or motor functions between the knock-out mice and controls. However deficits were found in the cognitive ability of aged, but not young adult mice, reflected in impaired learning in the Morris Water Maze. Similarly, long-term potentiation (LTP) was impaired in hippocampal brain slices of aged knock-out mice maintained in low glucose media. Using microdialysis in cerebellar white matter we found no significant differences in extracellular lactate or glucose between the young adult knock-out mice and controls, although trends were detected. Our results suggest that β2-adrenergic receptor expression on astrocytes in mice may be important for maintaining cognitive health at advanced age, but is dispensable for motor function. PMID:27776147

  7. A Partial Gene Deletion of SLC45A2 Causes Oculocutaneous Albinism in Doberman Pinscher Dogs

    PubMed Central

    Winkler, Paige A.; Gornik, Kara R.; Ramsey, David T.; Dubielzig, Richard R.; Venta, Patrick J.; Petersen-Jones, Simon M.; Bartoe, Joshua T.

    2014-01-01

    The first white Doberman pinscher (WDP) dog was registered by the American Kennel Club in 1976. The novelty of the white coat color resulted in extensive line breeding of this dog and her offspring. The WDP phenotype closely resembles human oculocutaneous albinism (OCA) and clinicians noticed a seemingly high prevalence of pigmented masses on these dogs. This study had three specific aims: (1) produce a detailed description of the ocular phenotype of WDPs, (2) objectively determine if an increased prevalence of ocular and cutaneous melanocytic tumors was present in WDPs, and (3) determine if a genetic mutation in any of the genes known to cause human OCA is causal for the WDP phenotype. WDPs have a consistent ocular phenotype of photophobia, hypopigmented adnexal structures, blue irides with a tan periphery and hypopigmented retinal pigment epithelium and choroid. WDPs have a higher prevalence of cutaneous melanocytic neoplasms compared with control standard color Doberman pinschers (SDPs); cutaneous tumors were noted in 12/20 WDP (<5 years of age: 4/12; >5 years of age: 8/8) and 1/20 SDPs (p<0.00001). Using exclusion analysis, four OCA causative genes were investigated for their association with WDP phenotype; TYR, OCA2, TYRP1 and SLC45A2. SLC45A2 was found to be linked to the phenotype and gene sequencing revealed a 4,081 base pair deletion resulting in loss of the terminus of exon seven of SLC45A2 (chr4∶77,062,968–77,067,051). This mutation is highly likely to be the cause of the WDP phenotype and is supported by a lack of detectable SLC45A2 transcript levels by reverse transcriptase PCR. The WDP provides a valuable model for studying OCA4 visual disturbances and melanocytic neoplasms in a large animal model. PMID:24647637

  8. Gene-deleted live-attenuated Trypanosoma cruzi parasites as vaccines to protect against Chagas disease.

    PubMed

    Sánchez-Valdéz, Fernando J; Pérez Brandán, Cecilia; Ferreira, Arturo; Basombrío, Miguel Ángel

    2015-05-01

    Chagas disease is a neglected tropical disease caused by the protozoan parasite Trypanosoma cruzi. This illness is now becoming global, mainly due to congenital transmission, and so far, there are no prophylactic or therapeutic vaccines available to either prevent or treat Chagas disease. Therefore, different approaches aimed at identifying new protective immunogens are urgently needed. Live vaccines are likely to be more efficient in inducing protection, but safety issues linked with their use have been raised. The development of improved protozoan genetic manipulation tools and genomic and biological information has helped to increase the safety of live vaccines. These advances have generated a renewed interest in the use of genetically attenuated parasites as vaccines against Chagas disease. This review discusses the protective capacity of genetically attenuated parasite vaccines and the challenges and perspectives for the development of an effective whole-parasite Chagas disease vaccine.

  9. Fhf2 gene deletion causes temperature-sensitive cardiac conduction failure

    PubMed Central

    Park, David S.; Shekhar, Akshay; Marra, Christopher; Lin, Xianming; Vasquez, Carolina; Solinas, Sergio; Kelley, Kevin; Morley, Gregory; Goldfarb, Mitchell; Fishman, Glenn I.

    2016-01-01

    Fever is a highly conserved systemic response to infection dating back over 600 million years. Although conferring a survival benefit, fever can negatively impact the function of excitable tissues, such as the heart, producing cardiac arrhythmias. Here we show that mice lacking fibroblast growth factor homologous factor 2 (FHF2) have normal cardiac rhythm at baseline, but increasing core body temperature by as little as 3 °C causes coved-type ST elevations and progressive conduction failure that is fully reversible upon return to normothermia. FHF2-deficient cardiomyocytes generate action potentials upon current injection at 25 °C but are unexcitable at 40 °C. The absence of FHF2 accelerates the rate of closed-state and open-state sodium channel inactivation, which synergizes with temperature-dependent enhancement of inactivation rate to severely suppress cardiac sodium currents at elevated temperatures. Our experimental and computational results identify an essential role for FHF2 in dictating myocardial excitability and conduction that safeguards against temperature-sensitive conduction failure. PMID:27701382

  10. Tetrahydrodipicolinate N-Succinyltransferase and Dihydrodipicolinate Synthase from Pseudomonas aeruginosa: Structure Analysis and Gene Deletion

    PubMed Central

    Schnell, Robert; Oehlmann, Wulf; Sandalova, Tatyana; Braun, Yvonne; Huck, Carmen; Maringer, Marko; Singh, Mahavir; Schneider, Gunter

    2012-01-01

    The diaminopimelic acid pathway of lysine biosynthesis has been suggested to provide attractive targets for the development of novel antibacterial drugs. Here we report the characterization of two enzymes from this pathway in the human pathogen Pseudomonas aeruginosa, utilizing structural biology, biochemistry and genetics. We show that tetrahydrodipicolinate N-succinyltransferase (DapD) from P. aeruginosa is specific for the L-stereoisomer of the amino substrate L-2-aminopimelate, and its D-enantiomer acts as a weak inhibitor. The crystal structures of this enzyme with L-2-aminopimelate and D-2-aminopimelate, respectively, reveal that both compounds bind at the same site of the enzyme. Comparison of the binding interactions of these ligands in the enzyme active site suggests misalignment of the amino group of D-2-aminopimelate for nucleophilic attack on the succinate moiety of the co-substrate succinyl-CoA as the structural basis of specificity and inhibition. P. aeruginosa mutants where the dapA gene had been deleted were viable and able to grow in a mouse lung infection model, suggesting that DapA is not an optimal target for drug development against this organism. Structure-based sequence alignments, based on the DapA crystal structure determined to 1.6 Å resolution revealed the presence of two homologues, PA0223 and PA4188, in P. aeruginosa that could substitute for DapA in the P. aeruginosa PAO1ΔdapA mutant. In vitro experiments using recombinant PA0223 protein could however not detect any DapA activity. PMID:22359568

  11. 5S RRNA GENE DELETIONS CAUSE AN UNEXPECTEDLY HIGH FITNESS LOSS IN ESCHERICHIA COLI. (R825354)

    EPA Science Inventory

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  12. Gene deletions and amplifications in human hepatocellular carcinomas: correlation with hepatocyte growth regulation.

    PubMed

    Nalesnik, Michael A; Tseng, George; Ding, Ying; Xiang, Guo-Sheng; Zheng, Zhong-liang; Yu, YanPing; Marsh, James W; Michalopoulos, George K; Luo, Jian-Hua

    2012-04-01

    Tissues from 98 human hepatocellular carcinomas (HCCs) obtained from hepatic resections were subjected to somatic copy number variation (CNV) analysis. Most of these HCCs were discovered in livers resected for orthotopic transplantation, although in a few cases, the tumors themselves were the reason for the hepatectomies. Genomic analysis revealed deletions and amplifications in several genes, and clustering analysis based on CNV revealed five clusters. The LSP1 gene had the most cases with CNV (46 deletions and 5 amplifications). High frequencies of CNV were also seen in PTPRD (21/98), GNB1L (18/98), KIAA1217 (18/98), RP1-1777G6.2 (17/98), ETS1 (11/98), RSU1 (10/98), TBC1D22A (10/98), BAHCC1 (9/98), MAML2 (9/98), RAB1B (9/98), and YIF1A (9/98). The existing literature regarding hepatocytes or other cell types has connected many of these genes to regulation of cytoskeletal architecture, signaling cascades related to growth regulation, and transcription factors directly interacting with nuclear signaling complexes. Correlations with existing literature indicate that genomic lesions associated with HCC at the level of resolution of CNV occur on many genes associated directly or indirectly with signaling pathways operating in liver regeneration and hepatocyte growth regulation.

  13. Aquaporin-9 and urea transporter-A gene deletions affect urea transmembrane passage in murine hepatocytes.

    PubMed

    Jelen, Sabina; Gena, Patrizia; Lebeck, Janne; Rojek, Aleksandra; Praetorius, Jeppe; Frøkiaer, Jørgen; Fenton, Robert A; Nielsen, Søren; Calamita, Giuseppe; Rützler, Michael

    2012-12-01

    In mammals, the majority of nitrogen from protein degradation is disposed of as urea. Several studies have partly characterized expression of urea transporters (UTs) in hepatocytes, where urea is produced. Nevertheless, the contribution of these proteins to hepatocyte urea permeability (P(urea)) and their role in liver physiology remains unknown. The purpose of this study was to biophysically examine hepatocyte urea transport. We hypothesized that the water, glycerol, and urea channel aquaporin-9 (AQP9) is involved in hepatocyte urea release. Stopped-flow light-scattering measurements determined that the urea channel inhibitors phloretin and dimethylurea reduced urea permeability of hepatocyte basolateral membranes by 70 and 40%, respectively. In basolateral membranes isolated from AQP9(-/-) and UT-A1/3(-/-) single-knockout and AQP9(-/-):UT-A1/3(-/-) double-knockout mice, P(urea) was decreased by 30, 40, and 76%, respectively, compared with AQP9(+/-):UT-A1/3(+/-) mice. However, expression analysis by RT-PCR did not identify known UT-A transcripts in liver. High-protein diet followed by 24-h fasting affected the concentrations of urea and ammonium ions in AQP9(-/-) mouse liver and plasma without generating an apparent tissue-to-plasma urea gradient. We conclude that AQP9 and unidentified UT-A urea channels constitute primary but redundant urea facilitators in murine hepatocytes.

  14. Gene Deletion of VIP Leads to Increased Mortality Associated with Progressive Right Ventricular Hypertrophy

    PubMed Central

    Szema, Anthony M.; Hamidi, Sayyed A.

    2014-01-01

    Vasoactive Intestinal Peptide (VIP) knockout mice exhibit asthma, pulmonary hypertension, and left ventricular wall thinning. Humans with these disorders have premature death. We show here that VIP KO mice have reduced survival (100% mortality at 20 months), vs. 100% survival among WT C57BL/6 mice. Moreover, the ratios of weights of right ventricle divided by left ventricle plus septum were progressively increased in VIP KO mice with age. Core temperatures were lower in VIP KO mice when compared to WT littermates, with an associated pro-inflammatory cytokine milieu. Overall, our results indicate that VIP is important for survival in mice. Its absence leads to increased mortality, with progressive right ventricular hypertrophy as a surrogate of pulmonary hypertension, lower body weight, hypothermia, and pro-inflammatory milieu. These studies support VIP as a novel therapeutic agent in pulmonary hypertension. PMID:24860842

  15. Identification of a new DMD gene deletion by ectopic transcript analysis.

    PubMed Central

    Rininsland, F; Hahn, A; Niemann-Seyde, S; Slomski, R; Hanefeld, F; Reiss, J

    1992-01-01

    The detailed genetic analysis of the Duchenne/Becker muscular dystrophy gene is hindered by the large number of exons involved and their separation by huge introns. These problems can be overcome by the analysis of mRNA rather than genomic DNA and ectopic transcripts derived from peripheral blood lymphocytes provide a convenient source of material. Using reverse transcription and nested PCR, we show here a comprehensive strategy for the rapid and complete analysis of the coding sequences from complex genes and illustrate its potential by the identification of a hitherto undescribed single exon deletion. Images PMID:1383546

  16. Glyoxalase I Gene Deletion Mutants of Leishmania donovani Exhibit Reduced Methylglyoxal Detoxification

    PubMed Central

    Chauhan, Swati C.; Madhubala, Rentala

    2009-01-01

    Background Glyoxalase I is a metalloenzyme of the glyoxalase pathway that plays a central role in eliminating the toxic metabolite methyglyoxal. The protozoan parasite Leishmania donovani possesses a unique trypanothione dependent glyoxalase system. Principal Findings Analysis of the L. donovani GLOI sequence predicted a mitochondrial targeting sequence, suggesting that the enzyme is likely to be targeted to the mitochondria. In order to determine definitively the intracellular localization of GLOI in L. donovani, a full-length GLOI gene was fused to green fluorescent protein (GFP) gene to generate a chimeric construct. Confocal microscopy of L. donovani promastigotes carrying this chimeric construct and immunofluorescence microscopy using anti-GLOI antibodies demonstrated that GLOI is localized in the kinetoplast of the parasite apart from the cytosol. To study the physiological role of GLOI in Leishmania, we first created promastigote mutants heterozygous for GLOI by targeted gene replacement using either hygromycin or neomycin phosphotransferases as selectable markers. Heterozygous mutants of L. donovani display a slower growth rate, have lower glyoxalase I activity and have reduced ability to detoxify methylglyoxal in comparison to the wild-type parasites. Complementation of the heterozygous mutant with an episomal GLOI construct showed the restoration of heterozygous mutant phenotype nearly fully to that of the wild-type. Null mutants were obtained only after GLOI was expressed from an episome in heterozygous mutants. Conclusions We for the first time report localization of GLOI in L. donovani in the kinetoplast. To study the physiological role of GLOI in Leishmania, we have generated GLOI attenuated strains by targeted gene replacement and report that GLOI is likely to be an important gene since GLOI mutants in L. donovani showed altered phenotype. The present data supports that the GLOI plays an essential role in the survival of this pathogenic organism and that inhibition of the enzyme potentiates the toxicity of methylglyoxal. PMID:19710909

  17. Targeted gene deletion of Leishmania major genes encoding developmental stage-specific leishmanolysin (GP63).

    PubMed

    Joshi, P B; Sacks, D L; Modi, G; McMaster, W R

    1998-02-01

    The major surface glycoprotein of Leishmania major is a zinc metalloproteinase of 63 kDa referred to as leishmanolysin or GP63, which is encoded by a family of seven genes. Targeted gene replacement was used to delete gp63 genes 1-6 encoding the highly expressed promastigote and constitutively expressed GP63. In the L. major homozygous mutants deficient in gp63 genes 1-6, there was no expression of GP63 as detected by reverse transcription-polymerase chain reaction (RT-PCR) or fluorescent staining in promastigotes from the procyclic stage (logarithmic growth phase). The remaining L. major gP63 gene 7 was shown to be developmentally regulated, as it was expressed exclusively in infectious metacyclic stage (late stationary growth phase) promastigotes and in lesion amastigotes. The gp63 genes 1-6-deficient mutants showed increased sensitivity to complement-mediated lysis. The sensitivity to lysis was greater in procyclics than in metacyclics when compared with the equivalent wild-type stages. Increased resistance of the mutant metacyclic promastigotes correlated with the expression of gp63 gene 7 and was restored to the same levels as wild-type promastigotes by transfection with gp63 gene 1. Thus, expression of GP63 is clearly involved in conferring resistance to complement-mediated lysis. The L. major GP63 1-6 mutants were capable of infecting mouse macrophages and differentiating into amastigotes. Similar levels of infection and subsequent intracellular survival were observed when mouse macrophages were infected in vitro with wild type, GP63 1-6 mutants and mutants transfected with gp63 gene 1. The GP63 1-6 mutants were capable of lesion formation in BALB/c mice and, thus, gp63 genes 1-6 do not play a role in the survival of the parasite within mouse macrophages. The role of gp63 genes 1-6 in parasite development within the sandfly vector was studied. GP63 1-6 mutants grew normally in the blood-engorged midgut of both Phlebotomus argentipes and P. papatasi However, both wild-type and mutant promastigotes were lost after 2 days' growth in P. papatasi. The complete developmental pathway in P. argentipes was observed for wild-type promastigotes, GP63 1-6 mutants and mutants transfected with gp63 gene 1. Normal stage differentiation from amastigotes to procyclics, to nectomonads, to haptomonads and to infectious metacyclics was observed. Thus, the highly expressed promastigote forms of GP63, encoded by gp63 genes 1-6, do not appear to be required for nutrient utilization in the bloodmeal during the early stages of development in the sandfly or for midgut attachment and further development. gp63 1-6 genes do, however, play a major protective role against complement-mediated lysis when promastigotes are introduced into the mammalian host. PMID:9489664

  18. FOXP2 gene deletion and infant feeding difficulties: a case report.

    PubMed

    Zimmerman, Emily; Maron, Jill L

    2016-01-01

    Forkhead box protein P2 (FOXP2) is a well-studied gene known to play an essential role in normal speech development. Deletions in the gene have been shown to result in developmental speech disorders and regulatory disruption of downstream gene targets associated with common forms of language impairments. Despite similarities in motor planning and execution between speech development and oral feeding competence, there have been no reports to date linking deletions within the FOXP2 gene to oral feeding impairments in the newborn. The patient was a nondysmorphic, appropriately and symmetrically grown male infant born at 35-wk gestational age. He had a prolonged neonatal intensive care unit stay because of persistent oral feeding incoordination requiring gastrostomy tube placement. Cardiac and neurological imagings were within normal limits. A microarray analysis found an ∼9-kb loss within chromosome band 7q3.1 that contains exon 2 of FOXP2, demonstrating a single copy of this region instead of the normal two copies per diploid gene. This case study expands our current understanding of the role FOXP2 exerts on motor planning and coordination necessary for both oral feeding success and speech-language development. This case report has important consequences for future diagnosis and treatment for infants with FOXP2 deletions, mutations, and varying levels of gene expression.

  19. Forebrain glucocorticoid receptor gene deletion attenuates behavioral changes and antidepressant responsiveness during chronic stress.

    PubMed

    Jacobson, Lauren

    2014-10-01

    Stress is an important risk factor for mood disorders. Stress also stimulates the secretion of glucocorticoids, which have been found to influence mood. To determine the role of forebrain glucocorticoid receptors (GR) in behavioral responses to chronic stress, the present experiments compared behavioral effects of repeated social defeat in mice with forebrain GR deletion and in floxed GR littermate controls. Repeated defeat produced alterations in forced swim and tail suspension immobility in floxed GR mice that did not occur in mice with forebrain GR deletion. Defeat-induced changes in immobility in floxed GR mice were prevented by chronic antidepressant treatment, indicating that these behaviors were dysphoria-related. In contrast, although mice with forebrain GR deletion exhibited antidepressant-induced decreases in tail suspension immobility in the absence of stress, this response did not occur in mice with forebrain GR deletion after defeat. There were no marked differences in plasma corticosterone between genotypes, suggesting that behavioral differences depended on forebrain GR rather than on abnormal glucocorticoid secretion. Defeat-induced gene expression of the neuronal activity marker c-fos in the ventral hippocampus, paraventricular thalamus and lateral septum correlated with genotype-related differences in behavioral effects of defeat, whereas c-fos induction in the nucleus accumbens and central and basolateral amygdala correlated with genotype-related differences in behavioral responses to antidepressant treatment. The dependence of both negative (dysphoria-related) and positive (antidepressant-induced) behaviors on forebrain GR is consistent with the contradictory effects of glucocorticoids on mood, and implicates these or other forebrain regions in these effects.

  20. Gene Deletions Resulting in Increased Nitrogen Release by Azotobacter vinelandii: Application of a Novel Nitrogen Biosensor

    PubMed Central

    Eberhart, Lauren J.; Ohlert, Janet M.; Knutson, Carolann M.; Plunkett, Mary H.

    2015-01-01

    Azotobacter vinelandii is a widely studied model diazotrophic (nitrogen-fixing) bacterium and also an obligate aerobe, differentiating it from many other diazotrophs that require environments low in oxygen for the function of the nitrogenase. As a free-living bacterium, A. vinelandii has evolved enzymes and transporters to minimize the loss of fixed nitrogen to the surrounding environment. In this study, we pursued efforts to target specific enzymes and further developed screens to identify individual colonies of A. vinelandii producing elevated levels of extracellular nitrogen. Targeted deletions were done to convert urea into a terminal product by disrupting the urease genes that influence the ability of A. vinelandii to recycle the urea nitrogen within the cell. Construction of a nitrogen biosensor strain was done to rapidly screen several thousand colonies disrupted by transposon insertional mutagenesis to identify strains with increased extracellular nitrogen production. Several disruptions were identified in the ammonium transporter gene amtB that resulted in the production of sufficient levels of extracellular nitrogen to support the growth of the biosensor strain. Further studies substituting the biosensor strain with the green alga Chlorella sorokiniana confirmed that levels of nitrogen produced were sufficient to support the growth of this organism when the medium was supplemented with sufficient sucrose to support the growth of the A. vinelandii in coculture. The nature and quantities of nitrogen released by urease and amtB disruptions were further compared to strains reported in previous efforts that altered the nifLA regulatory system to produce elevated levels of ammonium. These results reveal alternative approaches that can be used in various combinations to yield new strains that might have further application in biofertilizer schemes. PMID:25888177

  1. Deletion of the trichodiene synthase gene of Fusarium venenatum: two systems for repeated gene deletions.

    PubMed

    Royer, J C; Christianson, L M; Yoder, W T; Gambetta, G A; Klotz, A V; Morris, C L; Brody, H; Otani, S

    1999-10-01

    The trichodiene synthase (tri5) gene of Fusarium venenatum was cloned from a genomic library. Vectors were created in which the tri5 coding sequence was replaced with the Neurospora crassa nitrate reductase (nit3) gene and with the Aspergillus nidulans acetamidase (amdS) gene flanked by direct repeats. The first vector was utilized to transform a nitrate reductase (niaD) mutant of F. venenatum to prototrophy, and the second vector was utilized to confer acetamide utilization to the wild-type strain. Several of the transformants lost the capacity to produce the trichothecene diacetoxyscirpenol and were shown by hybridization analysis to have gene replacements at the tri5 locus. The nit3 gene was removed by retransformation with a tri5 deletion fragment and selection on chlorate. The amdS gene was shown to excise spontaneously via the flanking direct repeats when spores were plated onto fluoroacetamide. PMID:10512673

  2. FOXP2 gene deletion and infant feeding difficulties: a case report

    PubMed Central

    Zimmerman, Emily; Maron, Jill L.

    2016-01-01

    Forkhead box protein P2 (FOXP2) is a well-studied gene known to play an essential role in normal speech development. Deletions in the gene have been shown to result in developmental speech disorders and regulatory disruption of downstream gene targets associated with common forms of language impairments. Despite similarities in motor planning and execution between speech development and oral feeding competence, there have been no reports to date linking deletions within the FOXP2 gene to oral feeding impairments in the newborn. The patient was a nondysmorphic, appropriately and symmetrically grown male infant born at 35-wk gestational age. He had a prolonged neonatal intensive care unit stay because of persistent oral feeding incoordination requiring gastrostomy tube placement. Cardiac and neurological imagings were within normal limits. A microarray analysis found an ∼9-kb loss within chromosome band 7q3.1 that contains exon 2 of FOXP2, demonstrating a single copy of this region instead of the normal two copies per diploid gene. This case study expands our current understanding of the role FOXP2 exerts on motor planning and coordination necessary for both oral feeding success and speech–language development. This case report has important consequences for future diagnosis and treatment for infants with FOXP2 deletions, mutations, and varying levels of gene expression. PMID:27148578

  3. Markerless Gene Deletion with Cytosine Deaminase in Thermus thermophilus Strain HB27

    PubMed Central

    Wang, Lei; Hoffmann, Jana; Watzlawick, Hildegard

    2015-01-01

    We developed a counterselectable deletion system for Thermus thermophilus HB27 based on cytosine deaminase (encoded by codA) from Thermaerobacter marianensis DSM 12885 and the sensitivity of T. thermophilus HB27 to the antimetabolite 5-fluorocytosine (5-FC). The deletion vector comprises the pUC18 origin of replication, a thermostable kanamycin resistance marker functional in T. thermophilus HB27, and codA under the control of a constitutive putative trehalose promoter from T. thermophilus HB27. The functionality of the system was demonstrated by deletion of the bglT gene, encoding a β-glycosidase, and three carotenoid biosynthesis genes, CYP175A1, crtY, and crtI, from the genome of T. thermophilus HB27. PMID:26655764

  4. Adenylate kinase 1 gene deletion disrupts muscle energetic economy despite metabolic rearrangement

    PubMed Central

    Janssen, Edwin; Dzeja, Petras P.; Oerlemans, Frank; Simonetti, Arjan W.; Heerschap, Arend; Haan, Arnold de; Rush, Paula S.; Terjung, Ronald R.; Wieringa, Bé; Terzic, Andre

    2000-01-01

    Efficient cellular energy homeostasis is a critical determinant of muscle performance, providing evolutionary advantages responsible for species survival. Phosphotransfer reactions, which couple ATP production and utilization, are thought to play a central role in this process. Here, we provide evidence that genetic disruption of AK1-catalyzed β-phosphoryl transfer in mice decreases the potential of myofibers to sustain nucleotide ratios despite up-regulation of high-energy phosphoryl flux through glycolytic, guanylate and creatine kinase phosphotransfer pathways. A maintained contractile performance of AK1-deficient muscles was associated with higher ATP turnover rate and larger amounts of ATP consumed per contraction. Metabolic stress further aggravated the energetic cost in AK1–/– muscles. Thus, AK1-catalyzed phosphotransfer is essential in the maintenance of cellular energetic economy, enabling skeletal muscle to perform at the lowest metabolic cost. PMID:11101510

  5. Relatively low proportion of dystrophin gene deletions in Israeili Duchenne and Becker muscular dystrophy patients

    SciTech Connect

    Shomrat, R.; Gluck, E.; Legum, C.; Shiloh, Y.

    1994-02-15

    Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) are allelic disorders caused by mutations in the X-linked dystrophin gene. The most common mutations in western populations are deletions that are spread non-randomly throughout the gene. Molecular analysis of the dystrophin gene structure by hybridization of the full length cDNA to Southern blots and by PCR in 62 unrelated Israeli male DMD/BMD patients showed deletions in 23 (37%). This proportion is significantly lower than that found in European and North American populations (55-65%). Seventy-eight percent of the deletions were confined to exons 44-52, half of these exons 44-45, and the remaining 22% to exons 1 and 19. There was no correlation between the size of the deletion and the severity of the disease. All the deletions causing frameshift resulted in the DMD phenotypes. 43 refs., 1 fig., 1 tab.

  6. A partial gene deletion of SLC45A2 causes oculocutaneous albinism in Doberman pinscher dogs.

    PubMed

    Winkler, Paige A; Gornik, Kara R; Ramsey, David T; Dubielzig, Richard R; Venta, Patrick J; Petersen-Jones, Simon M; Bartoe, Joshua T

    2014-01-01

    The first white Doberman pinscher (WDP) dog was registered by the American Kennel Club in 1976. The novelty of the white coat color resulted in extensive line breeding of this dog and her offspring. The WDP phenotype closely resembles human oculocutaneous albinism (OCA) and clinicians noticed a seemingly high prevalence of pigmented masses on these dogs. This study had three specific aims: (1) produce a detailed description of the ocular phenotype of WDPs, (2) objectively determine if an increased prevalence of ocular and cutaneous melanocytic tumors was present in WDPs, and (3) determine if a genetic mutation in any of the genes known to cause human OCA is causal for the WDP phenotype. WDPs have a consistent ocular phenotype of photophobia, hypopigmented adnexal structures, blue irides with a tan periphery and hypopigmented retinal pigment epithelium and choroid. WDPs have a higher prevalence of cutaneous melanocytic neoplasms compared with control standard color Doberman pinschers (SDPs); cutaneous tumors were noted in 12/20 WDP (<5 years of age: 4/12; >5 years of age: 8/8) and 1/20 SDPs (p<0.00001). Using exclusion analysis, four OCA causative genes were investigated for their association with WDP phenotype; TYR, OCA2, TYRP1 and SLC45A2. SLC45A2 was found to be linked to the phenotype and gene sequencing revealed a 4,081 base pair deletion resulting in loss of the terminus of exon seven of SLC45A2 (chr4∶77,062,968-77,067,051). This mutation is highly likely to be the cause of the WDP phenotype and is supported by a lack of detectable SLC45A2 transcript levels by reverse transcriptase PCR. The WDP provides a valuable model for studying OCA4 visual disturbances and melanocytic neoplasms in a large animal model. PMID:24647637

  7. Conditional gene deletion reveals functional redundancy of GABAB receptors in peripheral nociceptors in vivo

    PubMed Central

    2009-01-01

    Background γ-aminobutyric acid (GABA) is an important inhibitory neurotransmitter which mainly mediates its effects on neurons via ionotropic (GABAA) and metabotropic (GABAB) receptors. GABAB receptors are widely expressed in the central and the peripheral nervous system. Although there is evidence for a key function of GABAB receptors in the modulation of pain, the relative contribution of peripherally- versus centrally-expressed GABAB receptors is unclear. Results In order to elucidate the functional relevance of GABAB receptors expressed in peripheral nociceptive neurons in pain modulation we generated and analyzed conditional mouse mutants lacking functional GABAB(1) subunit specifically in nociceptors, preserving expression in the spinal cord and brain (SNS-GABAB(1)-/- mice). Lack of the GABAB(1) subunit precludes the assembly of functional GABAB receptor. We analyzed SNS-GABAB(1)-/- mice and their control littermates in several models of acute and neuropathic pain. Electrophysiological studies on peripheral afferents revealed higher firing frequencies in SNS-GABAB(1)-/- mice compared to corresponding control littermates. However no differences were seen in basal nociceptive sensitivity between these groups. The development of neuropathic and chronic inflammatory pain was similar across the two genotypes. The duration of nocifensive responses evoked by intraplantar formalin injection was prolonged in the SNS-GABAB(1)-/- animals as compared to their control littermates. Pharmacological experiments revealed that systemic baclofen-induced inhibition of formalin-induced nociceptive behaviors was not dependent upon GABAB(1) expression in nociceptors. Conclusion This study addressed contribution of GABAB receptors expressed on primary afferent nociceptive fibers to the modulation of pain. We observed that neither the development of acute and chronic pain nor the analgesic effects of a systematically-delivered GABAB agonist was significantly changed upon a specific deletion of GABAB receptors from peripheral nociceptive neurons in vivo. This lets us conclude that GABAB receptors in the peripheral nervous system play a less important role than those in the central nervous system in the regulation of pain. PMID:19925671

  8. Hepatic Xbp1 Gene Deletion Promotes Endoplasmic Reticulum Stress-induced Liver Injury and Apoptosis.

    PubMed

    Olivares, Shantel; Henkel, Anne S

    2015-12-11

    Endoplasmic reticulum (ER) stress activates the unfolded protein response (UPR), a highly conserved signaling cascade that functions to alleviate stress and promote cell survival. If, however, the cell is unable to adapt and restore homeostasis, then the UPR activates pathways that promote apoptotic cell death. The molecular mechanisms governing the critical transition from adaptation and survival to initiation of apoptosis remain poorly understood. We aim to determine the role of hepatic Xbp1, a key mediator of the UPR, in controlling the adaptive response to ER stress in the liver. Liver-specific Xbp1 knockout mice (Xbp1(LKO)) and Xbp1(fl/fl) control mice were subjected to varying levels and durations of pharmacologic ER stress. Xbp1(LKO) and Xbp1(fl/fl) mice showed robust and equal activation of the UPR acutely after induction of ER stress. By 24 h, Xbp1(fl/fl) controls showed complete resolution of UPR activation and no liver injury, indicating successful adaptation to the stress. Conversely, Xbp1(LKO) mice showed ongoing UPR activation associated with progressive liver injury, apoptosis, and, ultimately, fibrosis by day 7 after induction of ER stress. These data indicate that hepatic XBP1 controls the adaptive response of the UPR and is critical to restoring homeostasis in the liver in response to ER stress. PMID:26504083

  9. Development of an Unmarked Gene Deletion System for the Filamentous Fungi Aspergillus niger and Talaromyces versatilis

    PubMed Central

    Delmas, Stéphane; Llanos, Agustina; Parrou, Jean-Luc; Kokolski, Matthew; Pullan, Steven T.; Shunburne, Lee

    2014-01-01

    In this article, we present a method to delete genes in filamentous fungi that allows recycling of the selection marker and is efficient in a nonhomologous end-joining (NHEJ)-proficient strain. We exemplify the approach by deletion of the gene encoding the transcriptional regulator XlnR in the fungus Aspergillus niger. To show the efficiency and advantages of the method, we deleted 8 other genes and constructed a double mutant in this species. Moreover, we showed that the same principle also functions in a different genus of filamentous fungus (Talaromyces versatilis, basionym Penicillium funiculosum). This technique will increase the versatility of the toolboxes for genome manipulation of model and industrially relevant fungi. PMID:24682295

  10. Analysis of a large cluster of nonessential genes deleted from a vaccinia virus terminal transposition mutant.

    PubMed

    Kotwal, G J; Moss, B

    1988-12-01

    The principal objectives of this study were to analyze the structure and coding potential of a long segment of DNA missing from a previously isolated (B. Moss, E. Winters, and J. A. Cooper (1981) J. Virol. 40, 387-395) attenuated variant of vaccinia virus strain WR and to examine the precise changes in the genome accompanying the deletion. The sequences of a 14.5-kbp region located at the left end of the standard vaccinia virus genome, extending from within the inverted terminal repetition (ITR) of the HindIII C fragment to the end of the HindIII N fragment, and of a 3-kbp segment from a corresponding region of the variant genome were determined. A comparison of these sequences revealed that the variant contained a deletion of 12 kbp and an insertion of 2.1 kbp. The origin of the inserted DNA was traced to the HindIII B region by using oligonucleotide probes indicating that a transposition of unique DNA located adjacent to the right ITR had occurred. Structural analysis indicated no extensive homologies, nucleotide substitutions, additions, or deletions at the boundaries of the transposed DNA. Examination of the right end of the variant genome indicated that a copy of the transposed DNA was still present and, therefore, the length of the ITR had been increased by 2.1 kbp. The variant genome could have formed by a mechanism that resulted in the replacement of a 22-kbp left-terminal fragment with a 12-kbp right-terminal fragment. The DNA missing from the variant and contained within the standard vaccinia virus WR genome contains 17 contiguous open reading frames (ORFs), all of which are directed leftward and apparently not required for replication in cultured cells. One deleted ORF has a 60% sequence similarity to another gene encoding a 42,000-Da protein present within the ITR suggesting that duplications have previously occurred during the evolution of vaccinia virus. Another deleted ORF has a 39% sequence similarity to a complement 4b binding protein. The transposed DNA contains two complete ORFs one of which has a 40% identity to a cowpox gene and a 30% identity to a family of plasma serine protease inhibitors.

  11. Genome-wide analysis of syntenic gene deletion in the grasses.

    PubMed

    Schnable, James C; Freeling, Michael; Lyons, Eric

    2012-01-01

    The grasses, Poaceae, are one of the largest and most successful angiosperm families. Like many radiations of flowering plants, the divergence of the major grass lineages was preceded by a whole-genome duplication (WGD), although these events are not rare for flowering plants. By combining identification of syntenic gene blocks with measures of gene pair divergence and different frequencies of ancient gene loss, we have separated the two subgenomes present in modern grasses. Reciprocal loss of duplicated genes or genomic regions has been hypothesized to reproductively isolate populations and, thus, speciation. However, in contrast to previous studies in yeast and teleost fishes, we found very little evidence of reciprocal loss of homeologous genes between the grasses, suggesting that post-WGD gene loss may not be the cause of the grass radiation. The sets of homeologous and orthologous genes and predicted locations of deleted genes identified in this study, as well as links to the CoGe comparative genomics web platform for analyzing pan-grass syntenic regions, are provided along with this paper as a resource for the grass genetics community.

  12. Gene deletions in patients with haemophilia B and anti-factor IX antibodies.

    PubMed

    Giannelli, F; Choo, K H; Rees, D J; Boyd, Y; Rizza, C R; Brownlee, G G

    Christmas disease, or haemophilia B, is an inherited X-linked haemorrhagic disease which at present occurs in 798 known cases in the United Kingdom, corresponding to a frequency of about 1 in 30,000 males. Patients are deficient in the intrinsic clotting factor IX and are treated by replacement of this protein prepared from pooled plasma obtained from normal individuals. Occasionally treatment is complicated by the appearance of specific anti-factor IX antibodies. It seemed to us that this might be due to the absence of 'self' factor IX causing the immune system to regard the infused normal factor IX as foreign. The absence of all or part of the factor IX gene was an obvious possible reason for this, which we have now tested using our previously isolated gene probe. We have found four patients with gross gene defects.

  13. Forebrain glucocorticoid receptor gene deletion attenuates behavioral changes and antidepressant responsiveness during chronic stress

    PubMed Central

    Jacobson, Lauren

    2014-01-01

    Stress is an important risk factor for mood disorders. Stress also stimulates the secretion of glucocorticoids, which have been found to influence mood. To determine the role of forebrain glucocorticoid receptors (GR) in behavioral responses to chronic stress, the present experiments compared behavioral effects of repeated social defeat in mice with forebrain GR deletion and in floxed GR littermate controls. Repeated defeat produced alterations in forced swim and tail suspension immobility in floxed GR mice that did not occur in mice with forebrain GR deletion. Defeat-induced changes in immobility in floxed GR mice were prevented by chronic antidepressant treatment, indicating that these behaviors were dysphoria-related. In contrast, although mice with forebrain GR deletion exhibited antidepressant-induced decreases in tail suspension immobility in the absence of stress, this response did not occur in mice with forebrain GR deletion after defeat. There were no marked differences in plasma corticosterone between genotypes, suggesting that behavioral differences depended on forebrain GR rather than on abnormal glucocorticoid secretion. Defeat-induced gene expression of the neuronal activity marker c-fos in the ventral hippocampus, paraventricular thalamus and lateral septum correlated with genotype-related differences in behavioral effects of defeat, whereas c-fos induction in the nucleus accumbens and central and basolateral amygdala correlated with genotype-related differences in behavioral responses to antidepressant treatment. The dependence of both negative (dysphoria-related) and positive (antidepressant-induced) behaviors on forebrain GR is consistent with the contradictory effects of glucocorticoids on mood, and implicates these or other forebrain regions in these effects. PMID:25168761

  14. PCR detection of retinoblastoma gene deletions in radiation-induced mouse lung adenocarcinomas

    SciTech Connect

    Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

    1993-04-01

    From 1971 to 1986, Argonne National Laboratory conducted a series of large-scale studies of tumor incidence in 40,000 BCF{sub 1} mice irradiated with {sup 60}Co {gamma} rays or JANUS fission-spectrum neutrons; normal and tumor tissues from mice in these studies were preserved in paraffin blocks. A polymerase chain reaction (PCR) technique has been developed to detect deletions in the mouse retinoblastoma (mRb) gene in the paraffin-embedded tissues. Microtomed sections were used as the DNA source in PCR reaction mixtures. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. The absence of any of these fragments (relative to control PCR products) on a Southern blot indicated a deletion of that portion of the mRb gene. The tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death in post-mortem analyses. Spontaneous tumors as well as those from irradiated mice (569 cGy of {sup 60}Co {gamma} rays or 60 cGy of JANUS neutrons, doses that have been found to have approximately equal biological effectiveness in the BCF, mouse) were analyzed for mRb deletions. In all normal mouse tissues studies, all six mRb exon fragments were present on Southem blots. Tumors in six neutron-irradiated mice also had no mRb deletions. However, I of 6 tumors from {gamma}-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice had a deletion in one or both mRb alleles. All deletions detected were in the 5{prime} region of the mRb gene.

  15. PCR detection of retinoblastoma gene deletions in radiation-induced mouse lung adenocarcinomas

    SciTech Connect

    Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

    1993-01-01

    From 1971 to 1986, Argonne National Laboratory conducted a series of large-scale studies of tumor incidence in 40,000 BCF[sub 1] mice irradiated with [sup 60]Co [gamma] rays or JANUS fission-spectrum neutrons; normal and tumor tissues from mice in these studies were preserved in paraffin blocks. A polymerase chain reaction (PCR) technique has been developed to detect deletions in the mouse retinoblastoma (mRb) gene in the paraffin-embedded tissues. Microtomed sections were used as the DNA source in PCR reaction mixtures. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. The absence of any of these fragments (relative to control PCR products) on a Southern blot indicated a deletion of that portion of the mRb gene. The tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death in post-mortem analyses. Spontaneous tumors as well as those from irradiated mice (569 cGy of [sup 60]Co [gamma] rays or 60 cGy of JANUS neutrons, doses that have been found to have approximately equal biological effectiveness in the BCF, mouse) were analyzed for mRb deletions. In all normal mouse tissues studies, all six mRb exon fragments were present on Southem blots. Tumors in six neutron-irradiated mice also had no mRb deletions. However, I of 6 tumors from [gamma]-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice had a deletion in one or both mRb alleles. All deletions detected were in the 5[prime] region of the mRb gene.

  16. Multiple-Ring Digital Communication Network

    NASA Technical Reports Server (NTRS)

    Kirkham, Harold

    1992-01-01

    Optical-fiber digital communication network to support data-acquisition and control functions of electric-power-distribution networks. Optical-fiber links of communication network follow power-distribution routes. Since fiber crosses open power switches, communication network includes multiple interconnected loops with occasional spurs. At each intersection node is needed. Nodes of communication network include power-distribution substations and power-controlling units. In addition to serving data acquisition and control functions, each node acts as repeater, passing on messages to next node(s). Multiple-ring communication network operates on new AbNET protocol and features fiber-optic communication.

  17. Fatigue and Multiple Sclerosis

    MedlinePlus

    Fatigue - National Multiple Sclerosis Society Skip to navigation Skip to content Menu Navigation National Multiple Sclerosis Society Sign In In Your Area ... help* daily life for: positive-mom* The National MS Society is Here to Help Need More Information? ...

  18. What Is Multiple Myeloma?

    MedlinePlus

    ... other tissues. If someone has only a single plasma cell tumor, the disease is called an isolated (or solitary ) plasmacytoma . If someone has more than one plasmacytoma, they have multiple myeloma . Multiple myeloma is ...

  19. Challenges of Parenting Multiples

    MedlinePlus

    ... Parenting Multiples There are many psychological, social, and economic issues associated with multiple pregnancies. These issues should ... births can also be helpful during difficult times. ECONOMIC ISSUES • The health care cost for delivery and ...

  20. National Multiple Sclerosis Society

    MedlinePlus

    ... Join the Community Stay Informed Corporate Support National Multiple Sclerosis Society Our Mission: People affected by MS can ... 10.5 Million in New Research to Stop Multiple Sclerosis, Restore Function and End MS Forever October 11, ...

  1. MultipleColposcopyJCO

    Cancer.gov

    Performing multiple biopsies during a procedure known as colposcopy—visual inspection of the cervix—is more effective than performing only a single biopsy of the worst-appearing area for detecting cervical cancer precursors. This multiple biopsy approach

  2. Multiple Endocrine Neoplasia Syndromes

    MedlinePlus

    ... or cancerous (malignant) tumors or grow excessively without forming tumors. Multiple endocrine neoplasia syndromes are caused by ... This Article Generic Name Select Brand Names corticotropin H.P. ACTHAR GEL epinephrine ADRENALIN Multiple Endocrine Neoplasia ...

  3. Varicella Viruses Inhibit Interferon-Stimulated JAK-STAT Signaling through Multiple Mechanisms.

    PubMed

    Verweij, Marieke C; Wellish, Mary; Whitmer, Travis; Malouli, Daniel; Lapel, Martin; Jonjić, Stipan; Haas, Juergen G; DeFilippis, Victor R; Mahalingam, Ravi; Früh, Klaus

    2015-05-01

    Varicella zoster virus (VZV) causes chickenpox in humans and, subsequently, establishes latency in the sensory ganglia from where it reactivates to cause herpes zoster. Infection of rhesus macaques with simian varicella virus (SVV) recapitulates VZV pathogenesis in humans thus representing a suitable animal model for VZV infection. While the type I interferon (IFN) response has been shown to affect VZV replication, the virus employs counter mechanisms to prevent the induction of anti-viral IFN stimulated genes (ISG). Here, we demonstrate that SVV inhibits type I IFN-activated signal transduction via the JAK-STAT pathway. SVV-infected rhesus fibroblasts were refractory to IFN stimulation displaying reduced protein levels of IRF9 and lacking STAT2 phosphorylation. Since previous work implicated involvement of the VZV immediate early gene product ORF63 in preventing ISG-induction we studied the role of SVV ORF63 in generating resistance to IFN treatment. Interestingly, SVV ORF63 did not affect STAT2 phosphorylation but caused IRF9 degradation in a proteasome-dependent manner, suggesting that SVV employs multiple mechanisms to counteract the effect of IFN. Control of SVV ORF63 protein levels via fusion to a dihydrofolate reductase (DHFR)-degradation domain additionally confirmed its requirement for viral replication. Our results also show a prominent reduction of IRF9 and inhibition of STAT2 phosphorylation in VZV-infected cells. In addition, cells expressing VZV ORF63 blocked IFN-stimulation and displayed reduced levels of the IRF9 protein. Taken together, our data suggest that varicella ORF63 prevents ISG-induction both directly via IRF9 degradation and indirectly via transcriptional control of viral proteins that interfere with STAT2 phosphorylation. SVV and VZV thus encode multiple viral gene products that tightly control IFN-induced anti-viral responses.

  4. Colony-stimulating Factor-1 Receptor Utilizes Multiple Signaling Pathways to Induce Cyclin D2 Expression

    PubMed Central

    Dey, Arunangsu; She, Hongyun; Kim, Leopold; Boruch, Allan; Guris, Deborah L.; Carlberg, Kristen; Sebti, Saïd M.; Woodley, David T.; Imamoto, Akira; Li, Wei

    2000-01-01

    Colony-stimulating factor-1 (CSF-1) induces expression of immediate early gene, such as c-myc and c-fos and delayed early genes such as D-type cyclins (D1 and D2), whose products play essential roles in the G1 to S phase transition of the cell cycle. Little is known, however, about the cytoplasmic signal transduction pathways that connect the surface CSF-1 receptor to these genes in the nucleus. We have investigated the signaling mechanism of CSF-1-induced D2 expression. Analyses of CSF-1 receptor autophosphorylation mutants show that, although certain individual mutation has a partial inhibitory effect, only multiple combined mutations completely block induction of D2 in response to CSF-1. We report that at least three parallel pathways, the Src pathway, the MAPK/ERK kinase (MEK)/extracellular signal-regulated kinase (ERK) pathway, and the c-myc pathway, are involved. Induction of D2 is partially inhibited in Src−/− bone marrow-derived macrophages and by Src inhibitor PP1 and is enhanced in v-Src-overexpressing cells. Activation of myc's transactivating activity selectively induces D2 but not D1. Blockade of c-myc expression partially blocks CSF-1-induced D2 expression. Complete inhibition of the MEK/ERK pathway causes 50% decrease of D2 expression. Finally, simultaneous inhibition of Src, MEK activation, and c-myc expression additively blocks CSF-1-induced D2 expression. This study indicates that multiple signaling pathways are involved in full induction of a single gene, and this finding may also apply broadly to other growth factor-inducible genes. PMID:11071910

  5. Nuclear Translocation Sequence and Region in Autographa californica Multiple Nucleopolyhedrovirus ME53 That Are Important for Optimal Baculovirus Production

    PubMed Central

    Liu, Yang; de Jong, Jondavid; Nagy, Éva; Theilmann, David A.

    2016-01-01

    ABSTRACT Autographa californica multiple nucleopolyhedrovirus (AcMNPV) is in the family Baculoviridae, genus Alphabaculovirus. AcMNPV me53 is a highly conserved immediate early gene in all lepidopteran baculoviruses that have been sequenced and is transcribed up to late times postinfection. Although me53 is not essential for viral DNA synthesis, infectious budded virus (BV) production is greatly attenuated when it is deleted. ME53 associates with the nucleocapsid on both budded virus and occlusion-derived virus, but not with the virus envelope. ME53 colocalizes in plasma membrane foci with the envelope glycoprotein GP64 in a GP64-dependent manner. ME53 localizes in the cytoplasm early postinfection, and despite the lack of a reported nuclear localization signal (NLS), ME53 translocates to the nucleus at late times postinfection. To map determinants of ME53 that facilitate its nuclear translocation, recombinant AcMNPV bacmids containing a series of ME53 truncations, internal deletions, and peptides fused with hemagglutinin (HA) or green fluorescent protein (GFP) tags were constructed. Intracellular-localization studies identified residues within amino acids 109 to 137 at the N terminus of ME53 that acted as the nuclear translocation sequence (NTS), facilitating its nuclear transport at late times postinfection. The first 100 N-terminal amino acids and the last 50 C-terminal amino acids of ME53 are dispensable for high levels of budded virus production. The region within amino acids 101 to 398, which also contains the NTS, is critical for optimal levels of budded virus production. IMPORTANCE Baculovirus me53 is a conserved immediate early gene found in all sequenced lepidopteran alpha- and betabaculoviruses. We first identified residues within amino acids 109 to 137 at the N terminus that act as the ME53 nuclear translocation sequence (NTS) to facilitate its nuclear translocation and defined an internal region within amino acids 101 to 398, which includes the NTS, as

  6. Multiple alcohol dehydrogenases but no functional acetaldehyde dehydrogenase causing excessive acetaldehyde production from ethanol by oral streptococci.

    PubMed

    Pavlova, Sylvia I; Jin, Ling; Gasparovich, Stephen R; Tao, Lin

    2013-07-01

    Ethanol consumption and poor oral hygiene are risk factors for oral and oesophageal cancers. Although oral streptococci have been found to produce excessive acetaldehyde from ethanol, little is known about the mechanism by which this carcinogen is produced. By screening 52 strains of diverse oral streptococcal species, we identified Streptococcus gordonii V2016 that produced the most acetaldehyde from ethanol. We then constructed gene deletion mutants in this strain and analysed them for alcohol and acetaldehyde dehydrogenases by zymograms. The results showed that S. gordonii V2016 expressed three primary alcohol dehydrogenases, AdhA, AdhB and AdhE, which all oxidize ethanol to acetaldehyde, but their preferred substrates were 1-propanol, 1-butanol and ethanol, respectively. Two additional dehydrogenases, S-AdhA and TdhA, were identified with specificities to the secondary alcohol 2-propanol and threonine, respectively, but not to ethanol. S. gordonii V2016 did not show a detectable acetaldehyde dehydrogenase even though its adhE gene encodes a putative bifunctional acetaldehyde/alcohol dehydrogenase. Mutants with adhE deletion showed greater tolerance to ethanol in comparison with the wild-type and mutant with adhA or adhB deletion, indicating that AdhE is the major alcohol dehydrogenase in S. gordonii. Analysis of 19 additional strains of S. gordonii, S. mitis, S. oralis, S. salivarius and S. sanguinis showed expressions of up to three alcohol dehydrogenases, but none showed detectable acetaldehyde dehydrogenase, except one strain that showed a novel ALDH. Therefore, expression of multiple alcohol dehydrogenases but no functional acetaldehyde dehydrogenase may contribute to excessive production of acetaldehyde from ethanol by certain oral streptococci.

  7. Nutrition for Multiples.

    PubMed

    Luke, Barbara

    2015-09-01

    In 2012 there were 135,943 infants of multiple pregnancies born in the United States, nearly a 2-fold increase since 1980, with twins accounting for 96% of all multiple births. To date, most perinatal morbidities associated with multiple births have proven resistant to technological or pharmaceutical interventions. Maternal nutrition can have a profound effect on the course and outcome of multiple pregnancy, with the goal of achieving optimal intrauterine growth and birthweights, and minimizing prenatal and perinatal complications for the mother and her children.

  8. Multiple density layered insulator

    DOEpatents

    Alger, Terry W.

    1994-01-01

    A multiple density layered insulator for use with a laser is disclosed wh provides at least two different insulation materials for a laser discharge tube, where the two insulation materials have different thermoconductivities. The multiple layer insulation materials provide for improved thermoconductivity capability for improved laser operation.

  9. Multiple density layered insulator

    DOEpatents

    Alger, T.W.

    1994-09-06

    A multiple density layered insulator for use with a laser is disclosed which provides at least two different insulation materials for a laser discharge tube, where the two insulation materials have different thermoconductivities. The multiple layer insulation materials provide for improved thermoconductivity capability for improved laser operation. 4 figs.

  10. Multiple Myeloma Symptoms

    MedlinePlus

    ... it is multiple myeloma . Stay on top of discoveries, trials, research and more. Click here to sign up for the MMRF Newsletter First name Last name E-mail address CLOSE News & Press Multiple Myeloma Knowledge Center Privacy Policy Donor Privacy Policy Terms of ...

  11. Orchestrating Multiple Intelligences

    ERIC Educational Resources Information Center

    Moran, Seana; Kornhaber, Mindy; Gardner, Howard

    2006-01-01

    Education policymakers often go astray when they attempt to integrate multiple intelligences theory into schools, according to the originator of the theory, Howard Gardner, and his colleagues. The greatest potential of a multiple intelligences approach to education grows from the concept of a profile of intelligences. Each learner's intelligence…

  12. Twins, Triplets, Multiple Births

    MedlinePlus

    ... from alone. Multiple births are up in the United States. More women are having babies after age 30 and more are taking fertility drugs. Both boost the chance of carrying more than one baby. A family history of twins also makes multiples more likely. Years ...

  13. Prediction in Multiple Regression.

    ERIC Educational Resources Information Center

    Osborne, Jason W.

    2000-01-01

    Presents the concept of prediction via multiple regression (MR) and discusses the assumptions underlying multiple regression analyses. Also discusses shrinkage, cross-validation, and double cross-validation of prediction equations and describes how to calculate confidence intervals around individual predictions. (SLD)

  14. [Multiple pulmonary hyalinizing granuloma].

    PubMed

    Haro, M; Ruiz, J; Vila, X; Avellanet, M; Izquierdo, J

    1994-01-01

    The causes of multiple pulmonary nodules are many, with metastasis being the most feared. A rare but possible etiology, however, is hyalinizing multiple granuloma. We present a case that allows us to review this condition and its course, as well as a variety of associated immunological changes and possible complications. PMID:8087395

  15. Applying Multiple Intelligences

    ERIC Educational Resources Information Center

    Christodoulou, Joanna A.

    2009-01-01

    The ideas of multiple intelligences introduced by Howard Gardner of Harvard University more than 25 years ago have taken form in many ways, both in schools and in other sometimes-surprising settings. The silver anniversary of Gardner's learning theory provides an opportunity to reflect on the ways multiple intelligences theory has taken form and…

  16. Constraining Multiple Grammars

    ERIC Educational Resources Information Center

    Hopp, Holger

    2014-01-01

    This article offers the author's commentary on the Multiple Grammars (MG) language acquisition theory proposed by Luiz Amaral and Tom Roeper in the present issue. Multiple Grammars advances the claim that optionality is a constitutive characteristic of any one grammar, with interlanguage grammars being perhaps the clearest examples of a…

  17. Current multiplication by using multiple thyristors.

    PubMed

    Liu, Z; Pemen, A J M; Van Heesch, E J M; Winands, G J J

    2008-07-01

    This paper presents a circuit topology to obtain current multiplication by using multiple thyristors. To gain insight into this technique, an equivalent circuit model is introduced. Proper operation of the topology was demonstrated by experiments on a small-scale setup including three thyristors. One thyristor is triggered by a trigger circuit; the other two are autotriggered and require no external trigger circuit. The three thyristors could be synchronized automatically in sequence. During the closing process, the discharging of the energy storage capacitors via the thyristors is prevented. The discharging starts when all thyristors are closed, and the currents through each thyristor are simultaneous and identical. The output current is exactly three times the switching current.

  18. Characterization of baculovirus Autographa californica multiple nuclear polyhedrosis virus infection in mammalian cells.

    PubMed

    Kitajima, Masayuki; Hamazaki, Hiroyuki; Miyano-Kurosaki, Naoko; Takaku, Hiroshi

    2006-05-01

    The baculovirus Autographa californica multiple nuclear polyhedrosis virus (AcMNPV) is used as a vector in many gene therapy studies. Wild-type AcMNPV infects many mammalian cell types in vitro, but does not replicate. We investigated the dynamics of AcMNPV genomic DNA in infected mammalian cells and used flow cytometric analysis to demonstrate that recombinant baculovirus containing a cytomegalovirus immediate early promoter/enhancer with green fluorescent protein (GFP) expressed high levels of GFP in Huh-7 cells, but not B16, Raw264.7, or YAC-1 cells. The addition of butyrate, a deacetylase inhibitor, markedly enhanced the percentage of GFP-expressing Huh-7 and B16 cells, but not Raw264.7 and YAC-1 cells. The addition of 5-aza-2'-deoxycytidine, a DNA methylation inhibitor, had no enhancing effect. Polymerase chain reaction analysis using AcMNPV-gp64-specific primers indicated that AcMNPV infected not only Huh-7 and B16 cells, but also Raw264.7 and YAC-1 cells in vitro. The genomic DNA was detected in Huh-7 and B16 cells 96 h after infection. Genomic AcMNPV DNA in YAC-1 cells was not transported to the nucleus. Luciferase assay indicated that AcMNPV p35 gene mRNA and p35 promoter activity were clearly expressed only in Huh-7 and B16 cells. These results suggest that viral genomic DNA expression is restricted by different host cell factors, such as degradation, deacetylation, and inhibition of nuclear transport, depending on the mammalian cell type. PMID:16545777

  19. Reference genes for quantitative gene expression studies in multiple avian species.

    PubMed

    Olias, Philipp; Adam, Iris; Meyer, Anne; Scharff, Constance; Gruber, Achim D

    2014-01-01

    Quantitative real-time PCR (qPCR) rapidly and reliably quantifies gene expression levels across different experimental conditions. Selection of suitable reference genes is essential for meaningful normalization and thus correct interpretation of data. In recent years, an increasing number of avian species other than the chicken has been investigated molecularly, highlighting the need for an experimentally validated pan-avian primer set for reference genes. Here we report testing a set for 14 candidate reference genes (18S, ABL, GAPDH, GUSB, HMBS, HPRT, PGK1, RPL13, RPL19, RPS7, SDHA, TFRC, VIM, YWHAZ) on different tissues of the mallard (Anas platyrhynchos), domestic chicken (Gallus gallus domesticus), common crane (Grus grus), white-tailed eagle (Haliaeetus albicilla), domestic turkey (Meleagris gallopavo f. domestica), cockatiel (Nymphicus hollandicus), Humboldt penguin (Sphenicus humboldti), ostrich (Struthio camelus) and zebra finch (Taeniopygia guttata), spanning a broad range of the phylogenetic tree of birds. Primer pairs for six to 11 genes were successfully established for each of the nine species. As a proof of principle, we analyzed expression levels of 10 candidate reference genes as well as FOXP2 and the immediate early genes, EGR1 and CFOS, known to be rapidly induced by singing in the avian basal ganglia. We extracted RNA from microbiopsies of the striatal song nucleus Area X of adult male zebra finches after they had sang or remained silent. Using three different statistical algorithms, we identified five genes (18S, PGK1, RPS7, TFRC, YWHAZ) that were stably expressed within each group and also between the singing and silent conditions, establishing them as suitable reference genes. In conclusion, the newly developed pan-avian primer set allows accurate normalization and quantification of gene expression levels in multiple avian species. PMID:24926893

  20. Characterization of baculovirus Autographa californica multiple nuclear polyhedrosis virus infection in mammalian cells

    SciTech Connect

    Kitajima, Masayuki; Hamazaki, Hiroyuki; Miyano-Kurosaki, Naoko; Takaku, Hiroshi . E-mail: hiroshi.takaku@it-chiba.ac.jp

    2006-05-05

    The baculovirus Autographa californica multiple nuclear polyhedrosis virus (AcMNPV) is used as a vector in many gene therapy studies. Wild-type AcMNPV infects many mammalian cell types in vitro, but does not replicate. We investigated the dynamics of AcMNPV genomic DNA in infected mammalian cells and used flow cytometric analysis to demonstrate that recombinant baculovirus containing a cytomegalovirus immediate early promoter/enhancer with green fluorescent protein (GFP) expressed high levels of GFP in Huh-7 cells, but not B16, Raw264.7, or YAC-1 cells. The addition of butyrate, a deacetylase inhibitor, markedly enhanced the percentage of GFP-expressing Huh-7 and B16 cells, but not Raw264.7 and YAC-1 cells. The addition of 5-aza-2'-deoxycytidine, a DNA methylation inhibitor, had no enhancing effect. Polymerase chain reaction analysis using AcMNPV-gp64-specific primers indicated that AcMNPV infected not only Huh-7 and B16 cells, but also Raw264.7 and YAC-1 cells in vitro. The genomic DNA was detected in Huh-7 and B16 cells 96 h after infection. Genomic AcMNPV DNA in YAC-1 cells was not transported to the nucleus. Luciferase assay indicated that AcMNPV p35 gene mRNA and p35 promoter activity were clearly expressed only in Huh-7 and B16 cells. These results suggest that viral genomic DNA expression is restricted by different host cell factors, such as degradation, deacetylation, and inhibition of nuclear transport, depending on the mammalian cell type.

  1. Aging and walnut-rich diet supplementation affects the expression of immediate-early genes in critical brain regions

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Emerging evidence indicates a direct link between age-associated changes in epigenetic mechanisms and onset of neurodegenerative diseases, and that these genomic modulations are directly affected by diet. Diets deficient in folate, choline and methionine, or the trace elements zinc and selenium, are...

  2. Effects of aging and walnut diet on DNA methylation and expression of immediate-early genes in critical brain regions

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Emerging evidence indicates a direct link between age-associated changes in epigenetic mechanisms and onset of neurodegenerative diseases, and that these genomic modulations are directly affected by the diet. Diets deficient in folate, choline and methionine, or the trace elements zinc and selenium,...

  3. Group 2 coronaviruses prevent immediate early interferon induction by protection of viral RNA from host cell recognition

    SciTech Connect

    Versteeg, Gijs A.; Bredenbeek, Peter J.; Worm, Sjoerd H.E. van den; Spaan, Willy J.M. . E-mail: w.j.m.spaan@lumc.nl

    2007-04-25

    Many viruses encode antagonists to prevent interferon (IFN) induction. Infection of fibroblasts with the murine hepatitis coronavirus (MHV) and SARS-coronavirus (SARS-CoV) did not result in nuclear translocation of interferon-regulatory factor 3 (IRF3), a key transcription factor involved in IFN induction, and induction of IFN mRNA transcription. Furthermore, MHV and SARS-CoV infection could not prevent IFN induction by poly (I:C) or Sendai virus, suggesting that these CoVs do not inactivate IRF3-mediated transcription regulation, but apparently prevent detection of replicative RNA by cellular sensory molecules. Our data indicate that shielding of viral RNA to host cell sensors might be the main general mechanism for coronaviruses to prevent IFN induction.

  4. [Psychoneuroimmunology and multiple sclerosis].

    PubMed

    Mel'nikov, M V; Pashchenkov, M V; Boĭko, A N

    2015-01-01

    In this review, the authors discuss interactions between mental, nervous and immune systems in multiple sclerosis, an impact of psycho-emotional stress on disease development and progression as well as possible mechanisms of these interactions.

  5. Multiple shell fusion targets

    DOEpatents

    Lindl, J.D.; Bangerter, R.O.

    1975-10-31

    Multiple shell fusion targets for use with electron beam and ion beam implosion systems are described. The multiple shell targets are of the low-power type and use a separate relatively low Z, low density ablator at large radius for the outer shell, which reduces the focusing and power requirements of the implosion system while maintaining reasonable aspect ratios. The targets use a high Z, high density pusher shell placed at a much smaller radius in order to obtain an aspect ratio small enough to protect against fluid instability. Velocity multiplication between these shells further lowers the power requirements. Careful tuning of the power profile and intershell density results in a low entropy implosion which allows breakeven at low powers. For example, with ion beams as a power source, breakeven at 10-20 Terrawatts with 10 MeV alpha particles for imploding a multiple shell target can be accomplished.

  6. The Multiplicative Situation

    ERIC Educational Resources Information Center

    Hurst, Chris

    2015-01-01

    The relationships between three critical elements, and the associated mathematical language, to assist students to make the critical transition from additive to multiplicative thinking are examined in this article by Chris Hurst.

  7. Pomalidomide for Multiple Myeloma

    Cancer.gov

    A summary of results from a phase III trial that compared the combination of pomalidomide (Pomalyst®) and low-dose dexamethasone versus high-dose dexamethasone alone in patients with multiple myeloma that has progressed despite other treatments.

  8. Multiple beam ptychography

    NASA Astrophysics Data System (ADS)

    Karl, Robert; Bevis, Charles; Lopez-Rios, Raymond; Reichanadter, Jonathan; Gardner, Dennis F.; Porter, Christina; Shanblatt, Elisabeth; Tanksalvala, Michael; Mancini, Giulia F.; Murnane, Margaret; Kapteyn, Henry; Adams, Daniel

    2016-03-01

    We present an extension to ptychography that allows simultaneous deconvolution of multiple, spatially separate, illuminating probes. This enables an increased field of view and hence, an increase in imaging throughput, without increased exposure times. This technique can be used for any non-interfering probes: demonstrated with multiple wavelengths and orthogonal polarizations. The latter of which gives us spatially resolved polarization spectroscopy from a single scan.

  9. Mobile multiple access study

    NASA Technical Reports Server (NTRS)

    1977-01-01

    Multiple access techniques (FDMA, CDMA, TDMA) for the mobile user and attempts to identify the current best technique are discussed. Traffic loading is considered as well as voice and data modulation and spacecraft and system design. Emphasis is placed on developing mobile terminal cost estimates for the selected design. In addition, design examples are presented for the alternative techniques of multiple access in order to compare with the selected technique.

  10. Multiple stage multiple filter hydrate store

    DOEpatents

    Bjorkman, Jr., Harry K.

    1983-05-31

    An improved hydrate store for a metal halogen battery system is disclosed which employs a multiple stage, multiple filter means or separating the halogen hydrate from the liquid used in forming the hydrate. The filter means is constructed in the form of three separate sections which combine to substantially cover the interior surface of the store container. Exit conduit means is provided in association with the filter means for transmitting liquid passing through the filter means to a hydrate former subsystem. The hydrate former subsystem combines the halogen gas generated during the charging of the battery system with the liquid to form the hydrate in association with the store. Relief valve means is interposed in the exit conduit means for controlling the operation of the separate sections of the filter means, such that the liquid flow through the exit conduit means from each of the separate sections is controlled in a predetermined sequence. The three separate sections of the filter means operate in three discrete stages to provide a substantially uniform liquid flow to the hydrate former subsystem during the charging of the battery system. The separation of the liquid from the hydrate causes an increase in the density of the hydrate by concentrating the hydrate along the filter means.

  11. Trousseau's syndrome: multiple definitions and multiple mechanisms

    PubMed Central

    2007-01-01

    In 1865, Armand Trousseau noted that unexpected or migratory thrombophlebitis could be a forewarning of an occult visceral malignancy. An analysis by Sack and colleagues in 1977 extended the term Trousseau's syndrome to include chronic disseminated intravascular coagulopathy associated with microangiopathy, verrucous endocarditis, and arterial emboli in patients with cancer, often occurring with mucin-positive carcinomas. In recent times the term has been ascribed to various clinical situations, ranging all the way from these classic descriptions to any kind of coagulopathy occurring in the setting of any kind of malignancy. These multiple definitions of Trousseau's syndrome are partly the consequence of multiple pathophysiologic mechanisms that apparently contribute to the hypercoagulability associated with cancer. Even the classic syndrome probably represents a spectrum of disorders, ranging from exaggerated fluid-phased thrombosis dependent on prothrombotic agents such as tissue factor to a platelet- and endotheliumum-based selectin-dependent microangiopathy associated with mucin-producing carcinomas, along with thrombin and fibrin production. Also considered here are recent hypotheses about genetic pathways within tumor cells that might trigger these thrombotic phenomena, and the reasons why therapy with heparins of various kinds remain the preferred treatment, probably because of their salutary actions on several of the proposed pathologic mechanisms. PMID:17496204

  12. Multiple Indicators, Multiple Causes Measurement Error Models

    PubMed Central

    Tekwe, Carmen D.; Carter, Randy L.; Cullings, Harry M.; Carroll, Raymond J.

    2014-01-01

    Multiple Indicators, Multiple Causes Models (MIMIC) are often employed by researchers studying the effects of an unobservable latent variable on a set of outcomes, when causes of the latent variable are observed. There are times however when the causes of the latent variable are not observed because measurements of the causal variable are contaminated by measurement error. The objectives of this paper are: (1) to develop a novel model by extending the classical linear MIMIC model to allow both Berkson and classical measurement errors, defining the MIMIC measurement error (MIMIC ME) model, (2) to develop likelihood based estimation methods for the MIMIC ME model, (3) to apply the newly defined MIMIC ME model to atomic bomb survivor data to study the impact of dyslipidemia and radiation dose on the physical manifestations of dyslipidemia. As a by-product of our work, we also obtain a data-driven estimate of the variance of the classical measurement error associated with an estimate of the amount of radiation dose received by atomic bomb survivors at the time of their exposure. PMID:24962535

  13. Multiple stage multiple filter hydrate store

    DOEpatents

    Bjorkman, H.K. Jr.

    1983-05-31

    An improved hydrate store for a metal halogen battery system is disclosed which employs a multiple stage, multiple filter means for separating the halogen hydrate from the liquid used in forming the hydrate. The filter means is constructed in the form of three separate sections which combine to substantially cover the interior surface of the store container. Exit conduit means is provided in association with the filter means for transmitting liquid passing through the filter means to a hydrate former subsystem. The hydrate former subsystem combines the halogen gas generated during the charging of the battery system with the liquid to form the hydrate in association with the store. Relief valve means is interposed in the exit conduit means for controlling the operation of the separate sections of the filter means, such that the liquid flow through the exit conduit means from each of the separate sections is controlled in a predetermined sequence. The three separate sections of the filter means operate in three discrete stages to provide a substantially uniform liquid flow to the hydrate former subsystem during the charging of the battery system. The separation of the liquid from the hydrate causes an increase in the density of the hydrate by concentrating the hydrate along the filter means. 7 figs.

  14. Multiple indicators, multiple causes measurement error models.

    PubMed

    Tekwe, Carmen D; Carter, Randy L; Cullings, Harry M; Carroll, Raymond J

    2014-11-10

    Multiple indicators, multiple causes (MIMIC) models are often employed by researchers studying the effects of an unobservable latent variable on a set of outcomes, when causes of the latent variable are observed. There are times, however, when the causes of the latent variable are not observed because measurements of the causal variable are contaminated by measurement error. The objectives of this paper are as follows: (i) to develop a novel model by extending the classical linear MIMIC model to allow both Berkson and classical measurement errors, defining the MIMIC measurement error (MIMIC ME) model; (ii) to develop likelihood-based estimation methods for the MIMIC ME model; and (iii) to apply the newly defined MIMIC ME model to atomic bomb survivor data to study the impact of dyslipidemia and radiation dose on the physical manifestations of dyslipidemia. As a by-product of our work, we also obtain a data-driven estimate of the variance of the classical measurement error associated with an estimate of the amount of radiation dose received by atomic bomb survivors at the time of their exposure. PMID:24962535

  15. Breast-feeding multiples.

    PubMed

    Flidel-Rimon, O; Shinwell, E S

    2002-06-01

    Human breast milk is the best nutrition for human infants. Its advantages over the milk of other species, such as cows, include both a reduced risk for infections, allergies and chronic diseases, together with the full nutritional requirements for growth and development. Breast-feeding is as important for multiples as for singletons. Despite the advantages, multiples receive less breast-feeding than singletons. Common reasons for not breast-feeding multiples include the fear of not fulfilling the infants' needs and the difficulty of coping with the demands on the mother's time. In addition, many multiples are delivered prematurely and by Caesarean section. Maternal pain and discomfort together with anxiety over the infants' condition are not conducive to successful breast-feeding. During lactation, the mother needs to add calories to her daily diet. It has been recommended to add approximately 500-600 kcal/day for each infant. Thus, between eating, nursing and sleeping, life is very busy for the mother of multiples. However, there is evidence that, with appropriate nutrition, one mother can nourish more than one infant. Also, simultaneous breast-feeding can save much time. Combined efforts of parents, close family, friends and the medical team can help to make either full or partial breast-feeding of multiples possible. However, when breast-feeding is not possible, health care workers need to carefully avoid judgmental approaches that may induce feelings of guilt.

  16. Neuromaturation of multiples.

    PubMed

    Allen, Marilee C; Donohue, Pamela K

    2002-06-01

    Etiology of preterm birth and degree of maturation are the primary determinants of a preterm infant's survival and complications. Multiple gestation increases the likelihood of preterm birth but its influence on rate of maturation or complications of prematurity has been controversial, primarily because of confounding variables (e.g. race, aetiology of preterm delivery, degree of prematurity and pregnancy complications). Very low birthweight preterm multiples have virtually the same rates of neonatal mortality, complications and neuromaturation as preterm singletons of the same gestational age. There is no advantage of delivering twins or higher order multiples before 30 weeks gestation, unless a fetus decompensates in utero. Survival improves for near term intermediate-size preterm multiples while intrauterine growth decelerates and placental and fetal neuromaturation accelerate. These data and the high fetal death rate at term support delivery of multiples as soon as there is fetal lung maturity, and consideration of elective delivery of twins at 35-38 weeks gestation and triplets at 33-35 weeks gestation.

  17. The role of the PI3K-Akt signal transduction pathway in Autographa californica multiple nucleopolyhedrovirus infection of Spodoptera frugiperda cells

    SciTech Connect

    Xiao Wei; Yang Yi; Weng Qingbei; Lin Tiehao; Yuan Meijin; Yang Kai; Pang Yi

    2009-08-15

    Many viruses activate the phosphatidylinositol 3-kinase (PI3K)-Akt signaling pathway, thereby modulating diverse downstream signaling pathways associated with antiapoptosis, proliferation, cell cycling, protein synthesis and glucose metabolism, in order to augment their replication. To date, the role of the PI3K-Akt pathway in Baculovirus replication has not been defined. In the present study, we demonstrate that infection of Sf9 cells with Autographa californica multiple nucleopolyhedrovirus (AcMNPV) elevated cellular Akt phosphorylation at 1 h post-infection. The maximum Akt phosphorylation occurred at 6 h post-infection and remained unchanged until 18 h post-infection. The PI3K-specific inhibitor, LY294002, suppressed Akt phosphorylation in a dose-dependent manner, suggesting that AcMNPV-induced Akt phosphorylation is PI3K-dependent. The inhibition of PI3K-Akt activation by LY294002 significantly reduced the viral yield, including a reduction in budded viruses and occlusion bodies. The virus production was reduced only when the inhibitor was added within 24 h of infection, implying that activation of PI3K occurred early in infection. Correspondingly, both viral DNA replication and late (VP39) and very late (POLH) viral protein expression were impaired by LY294002 treatment; LY294002 had no effect on immediate-early (IE1) and early-late (GP64) protein expression. These results demonstrate that the PI3K-Akt pathway is required for efficient Baculovirus replication.

  18. Genetics Home Reference: multiple sclerosis

    MedlinePlus

    ... Me Understand Genetics Home Health Conditions multiple sclerosis multiple sclerosis Enable Javascript to view the expand/collapse boxes. Download PDF Open All Close All Description Multiple sclerosis is a condition characterized by areas of damage ( ...

  19. Multiple noncontiguous spine fractures.

    PubMed

    Henderson, R L; Reid, D C; Saboe, L A

    1991-02-01

    The data from a prospective study of 508 spine injuries were reviewed to determine the incidence of multiple noncontiguous spine fractures. All patients were examined at admission and at 1 and 2 years postinjury. This series identified 77 (15.2%) multilevel fractures. Motor vehicle accidents were the primary cause of these fractures. The incidence of neurologic injury was not significantly different between multiple noncontiguous and single fractures. Failure to use seat belts and ejection from the vehicle were the main factors associated with multiple noncontiguous spine injuries. Seven major fracture patterns were identified, which accounted for 60% of these injuries. The prognosis for multilevel spine fractures was not significantly worse that that for single-level injuries. PMID:2011766

  20. Enhancing multiple disciplinary teamwork.

    PubMed

    Weaver, Terri E

    2008-01-01

    Multiple disciplinary research provides an opportunity to bring together investigators across disciplines to provide new views and develop innovative approaches to important questions. Through this shared experience, novel paradigms are formed, original frameworks are developed, and new language is generated. Integral to the successful construction of effective cross-disciplinary teams is the recognition of antecedent factors that affect the development of the team such as intrapersonal, social, physical environmental, organizational, and institutional influences. Team functioning is enhanced with well-developed behavioral, affective, interpersonal, and intellectual processes. Outcomes of effective multiple disciplinary research teams include novel ideas, integrative models, new training programs, institutional change, and innovative policies that can also influence the degree to which antecedents and processes contribute to team performance. Ongoing evaluation of team functioning and achievement of designated outcomes ensures the continued development of the multiple disciplinary team and confirmation of this approach as important to the advancement of science.

  1. MAVID multiple alignment server.

    PubMed

    Bray, Nicolas; Pachter, Lior

    2003-07-01

    MAVID is a multiple alignment program suitable for many large genomic regions. The MAVID web server allows biomedical researchers to quickly obtain multiple alignments for genomic sequences and to subsequently analyse the alignments for conserved regions. MAVID has been successfully used for the alignment of closely related species such as primates and also for the alignment of more distant organisms such as human and fugu. The server is fast, capable of aligning hundreds of kilobases in less than a minute. The multiple alignment is used to build a phylogenetic tree for the sequences, which is subsequently used as a basis for identifying conserved regions in the alignment. The server can be accessed at http://baboon.math.berkeley.edu/mavid/.

  2. Multiple sort flow cytometer

    DOEpatents

    Engh, G. van den; Esposito, R.J.

    1996-01-09

    A flow cytometer utilizes multiple lasers for excitation and respective fluorescence of identified dyes bonded to specific cells or events to identify and verify multiple events to be sorted from a sheath flow and droplet stream. Once identified, verified and timed in the sheath flow, each event is independently tagged upon separation from the flow by an electrical charge of +60, +120, or +180 volts and passed through oppositely charged deflection plates with ground planes to yield a focused six way deflection of at least six events in a narrow plane. 8 figs.

  3. Multiple origins of life

    NASA Technical Reports Server (NTRS)

    Raup, D. M.; Valentine, J. W.

    1983-01-01

    There is some indication that life may have originated readily under primitive earth conditions. If there were multiple origins of life, the result could have been a polyphyletic biota today. Using simple stochastic models for diversification and extinction, we conclude: (1) the probability of survival of life is low unless there are multiple origins, and (2) given survival of life and given as many as 10 independent origins of life, the odds are that all but one would have gone extinct, yielding the monophyletic biota we have now. The fact of the survival of our particular form of life does not imply that it was unique or superior.

  4. Neutron multiplicity analysis tool

    SciTech Connect

    Stewart, Scott L

    2010-01-01

    I describe the capabilities of the EXCOM (EXcel based COincidence and Multiplicity) calculation tool which is used to analyze experimental data or simulated neutron multiplicity data. The input to the program is the count-rate data (including the multiplicity distribution) for a measurement, the isotopic composition of the sample and relevant dates. The program carries out deadtime correction and background subtraction and then performs a number of analyses. These are: passive calibration curve, known alpha and multiplicity analysis. The latter is done with both the point model and with the weighted point model. In the current application EXCOM carries out the rapid analysis of Monte Carlo calculated quantities and allows the user to determine the magnitude of sample perturbations that lead to systematic errors. Neutron multiplicity counting is an assay method used in the analysis of plutonium for safeguards applications. It is widely used in nuclear material accountancy by international (IAEA) and national inspectors. The method uses the measurement of the correlations in a pulse train to extract information on the spontaneous fission rate in the presence of neutrons from ({alpha},n) reactions and induced fission. The measurement is relatively simple to perform and gives results very quickly ({le} 1 hour). By contrast, destructive analysis techniques are extremely costly and time consuming (several days). By improving the achievable accuracy of neutron multiplicity counting, a nondestructive analysis technique, it could be possible to reduce the use of destructive analysis measurements required in safeguards applications. The accuracy of a neutron multiplicity measurement can be affected by a number of variables such as density, isotopic composition, chemical composition and moisture in the material. In order to determine the magnitude of these effects on the measured plutonium mass a calculational tool, EXCOM, has been produced using VBA within Excel. This

  5. Multiple sort flow cytometer

    DOEpatents

    Van den Engh, Ger; Esposito, Richard J.

    1996-01-01

    A flow cytometer utilizes multiple lasers for excitation and respective fluorescence of identified dyes bonded to specific cells or events to identify and verify multiple events to be sorted from a sheath flow and droplet stream. Once identified, verified and timed in the sheath flow, each event is independently tagged upon separation from the flow by an electrical charge of +60, +120, or +180 volts and passed through oppositely charged deflection plates with ground planes to yield a focused six way deflection of at least six events in a narrow plane.

  6. [Multiple bowenoid arsenic keratoses].

    PubMed

    Leyh, F; Rothlaender, J P

    1985-01-01

    Case report of multiple keratoses and chronic lymphatic leukemia after arsenic poisoning 30 years ago during a one-year exposure to copper acetoarsenate in a pesticide factory. Absorption through the skin with local arsenic skin damage is discussed. Etretinate therapy (1 mg/kg b. w.) was ineffective.

  7. Multiple Cutaneous Reticulohistiocytoma

    PubMed Central

    Hemmady, Karishma D; Someshwar, Shylaja S; Jerajani, Hemangi R

    2016-01-01

    Multicentric reticulohistiocytosis is a rare non-Langerhans cell histiocytosis characterized in its full form by severe destructive arthritis, cutaneous nodules, and systemic manifestations. Cutaneous lesions may precede, accompany, or more commonly develop later than other features in this disease. We describe a case of multiple cutaneous reticulohistiocytoma without any systemic associations after thorough investigations. PMID:26955136

  8. Managing Multiple Measures

    ERIC Educational Resources Information Center

    DePascale, Charles A.

    2012-01-01

    Regardless of how one might feel about the recent developments in teacher evaluation systems, No Child Left Behind (NCLB) and adequate yearly progress (AYP), or student assessments for high-stakes promotion decisions, educators overwhelmingly agree that use of multiple measures is better than reliance on a single measure such as a large-scale,…

  9. Automatic multiple applicator electrophoresis

    NASA Technical Reports Server (NTRS)

    Grunbaum, B. W.

    1977-01-01

    Easy-to-use, economical device permits electrophoresis on all known supporting media. System includes automatic multiple-sample applicator, sample holder, and electrophoresis apparatus. System has potential applicability to fields of taxonomy, immunology, and genetics. Apparatus is also used for electrofocusing.

  10. [Smoldering multiple myeloma].

    PubMed

    Fouquet, G; Guidez, S; Herbaux, C; Demarquette, H; Leleu, X

    2014-04-01

    Smoldering multiple myeloma (SMM) is an asymptomatic plasma cell neoplasia, characterized by monoclonal plasma cell proliferation in the absence of end-organ damage, but with a high risk of progression to multiple myeloma. It has therefore to be distinguished from monoclonal gammapathy of undetermined significance (MGUS), which has a much lower risk of progression, but also from multiple myeloma, which remains an incurable disease and requires a specific treatment. The critical question in the management of SMM is whether an early therapeutic strategy could help delaying the progression to multiple myeloma, in order to lower the risk of serious complications related to this progression, or even to cure the disease. This early treatment could not be proposed to all SMM patients, who are indeed asymptomatic, and in whom the risk of toxicity could make it difficult to justify the potential benefit obtained. The challenge is to target early at diagnosis SMM patients with a high risk of progression, using available routine tests sufficiently reliable to warrant the therapeutic sanction which relies on it. Today however, apart from randomized studies, recommendations are to maintain therapeutic abstention in SMM patients. PMID:24050785

  11. Patterns in Multiples.

    ERIC Educational Resources Information Center

    Robold, Alice I.

    1982-01-01

    Activities that allow students to represent patterns concretely before showing the patterns in color on paper are presented. Three basic activities are described, with suggestions made for extensions that allow further pupil exploration of multiples. Student discovery of relationships not found by the teacher is expected. (MP)

  12. Higher-order Multiples.

    PubMed

    Stone, Joanne; Kohari, Katherine S

    2015-09-01

    Higher-order multiple gestations have increased since the advent of advanced reproductive technologies. These pregnancies present unique risks to both mothers and fetuses. It is imperative that early diagnosis of chronicity be determined and that proper counseling is performed, so patients understand the risks, evaluation, and management needed.

  13. Multiple Primary Cancer Monograph

    Cancer.gov

    To identify groups of cancer survivors that are at increased risk for multiple primary cancers, investigators led an effort to provide the first comprehensive population-based analysis of the risk of subsequent cancer in the U.S., resulting in a monograph.

  14. Multiple gap photovoltaic device

    DOEpatents

    Dalal, Vikram L.

    1981-01-01

    A multiple gap photovoltaic device having a transparent electrical contact adjacent a first cell which in turn is adjacent a second cell on an opaque electrical contact, includes utilizing an amorphous semiconductor as the first cell and a crystalline semiconductor as the second cell.

  15. Multiple Grammars and MOGUL

    ERIC Educational Resources Information Center

    Truscott, John

    2014-01-01

    Optionality is a central phenomenon in second language acquisition (SLA), for which any adequate theory must account. Amaral and Roeper (this issue; henceforth A&R) offer an appealing approach to it, using Roeper's Multiple Grammars Theory, which was created with first language in mind but which extends very naturally to SLA. They include…

  16. Mastering the Multiplication Facts

    ERIC Educational Resources Information Center

    D'Ettorre, Jenna

    2009-01-01

    The purpose of this paper is to share the results of a six-week research project (after baseline data was collected) that focused on three different strategies (flashcards, interactive games, and music) and their effectiveness in helping fifth grade students memorize the basic multiplication facts. Many teachers face a serious problem when their…

  17. Multiple Access Trade Study

    NASA Technical Reports Server (NTRS)

    Motamedi, Masoud

    1990-01-01

    The Personal Access Satellite System (PASS) strawman design uses a hybrid Time Division Multiple Access (TDMA)/Frequency Division Multiple Access (FDMA) implementation. TDMA is used for the forward direction (from Suppliers to Users), and FDMA for the return direction (from Users to Suppliers). An alternative architecture is proposed that will require minimal real time coordination and yet provide a fast access method by using random access Code Division Multiple Access (CDMA). The CDMA system issues are addressed such as connecting suppliers and users, both of whom may be located anywhere in the CONUS, when the user terminals are constrained in size and weight; and providing efficient traffic routing under highly variable traffic requirements. It is assumed that bandwidth efficiency is not of paramount importance. CDMA or Spread Spectrum Multiple Access (SSMA) communication is a method in which a group of carriers operate at the same nominal center frequency but are separable from each other by the low cross correlation of the spreading codes used. Interference and multipath rejection capability, ease of selective addressing and message screening, low density power spectra for signal hiding and security, and high resolution ranging are among the benefits of spread spectrum communications.

  18. Genome duplications within the Xenopodinae do not increase the multiplicity of antimicrobial peptides in Silurana paratropicalis and Xenopus andrei skin secretions.

    PubMed

    Mechkarska, Milena; Eman, Ahmed; Coquet, Laurent; Jérôme, Leprince; Jouenne, Thierry; Vaudry, Hubert; King, Jay D; Takada, Koji; Conlon, J Michael

    2011-06-01

    A putative genome duplication event within the Silurana lineage has given rise to the tetraploid frog S. paratropicalis and a second polyploidization within the Xenopus lineage has produced the octoploid frog X. andrei. Peptidomic analysis of norepinephrine-stimulated skin secretions of S. paratropicalis and X. andrei led to identification of multiple peptides with growth-inhibitory activity against Escherichia coli and Staphylococcus aureus. Structural characterization demonstrated that the S. paratropicalis components comprised three peptides belonging to the caerulein-precursor fragment family (CPF-SP1, -SP2 and -SP3), two peptides from the xenopsin-precursor fragment family (XPF-SP1 and -SP2), and one peptide orthologous to peptide glycine-leucine-amide (PGLa-SP1). The CPF peptides showed potent, broad-spectrum antimicrobial activity. The X. andrei components comprised two peptides from the magainin family, (magainin-AN1 and -AN2), two from the XPF family (XPF-AN1 and -AN2), two from the PGLa family(PGLa-AN1 and -AN2), and one caerulein-precursor fragment (CPF-AN1).The primary structures of these peptides indicate a close phylogenetic relationship between X. andrei and the octoploid frog X. amieti. Under the same experimental conditions, seven orthologous antimicrobial peptides were previously isolated from the diploid frog S. tropicalis, nine from the tetraploid frog X. borealis, and five from the tetraploid frog X. clivii. The data indicate, therefore, that nonfunctionalization (gene deletion) has been the most common fate of duplicated antimicrobial peptide genes following polyploidization events in the Silurana and Xenopus lineages. PMID:21498136

  19. Multiplicative Calculus and Student Projects.

    ERIC Educational Resources Information Center

    Campbell, Duff

    1999-01-01

    Multiplicative calculus is based on a multiplicative rate of change whereas the usual calculus is based on an additive rate of change. Describes some student investigations into multiplicative calculus, including an original student idea about multiplicative Euler's Method. (Author/ASK)

  20. Core multiplication in childhood.

    PubMed

    McCrink, Koleen; Spelke, Elizabeth S

    2010-08-01

    A dedicated, non-symbolic, system yielding imprecise representations of large quantities (approximate number system, or ANS) has been shown to support arithmetic calculations of addition and subtraction. In the present study, 5-7-year-old children without formal schooling in multiplication and division were given a task requiring a scalar transformation of large approximate numerosities, presented as arrays of objects. In different conditions, the required calculation was doubling, quadrupling, or increasing by a fractional factor (2.5). In all conditions, participants were able to represent the outcome of the transformation at above-chance levels, even on the earliest training trials. Their performance could not be explained by processes of repeated addition, and it showed the critical ratio signature of the ANS. These findings provide evidence for an untrained, intuitive process of calculating multiplicative numerical relationships, providing a further foundation for formal arithmetic instruction. PMID:20537618

  1. Multiple zeros of polynomials

    NASA Technical Reports Server (NTRS)

    Wood, C. A.

    1974-01-01

    For polynomials of higher degree, iterative numerical methods must be used. Four iterative methods are presented for approximating the zeros of a polynomial using a digital computer. Newton's method and Muller's method are two well known iterative methods which are presented. They extract the zeros of a polynomial by generating a sequence of approximations converging to each zero. However, both of these methods are very unstable when used on a polynomial which has multiple zeros. That is, either they fail to converge to some or all of the zeros, or they converge to very bad approximations of the polynomial's zeros. This material introduces two new methods, the greatest common divisor (G.C.D.) method and the repeated greatest common divisor (repeated G.C.D.) method, which are superior methods for numerically approximating the zeros of a polynomial having multiple zeros. These methods were programmed in FORTRAN 4 and comparisons in time and accuracy are given.

  2. Multiple pulse laser

    SciTech Connect

    Hughes, R.S.; Jernigan, J.L.

    1981-02-10

    A multiple pulse laser from a single resonant cavity is disclosed. An acousto-optic cell is used to modulate coherent light from a lasing element. Either multiple chirp signals or a masked mirror are used to provide distinct pulses of light. Through proper choice of materials for the acousto-optic cell and use of divergent optics, a higher power level is obtained. Use of a multi-tapped delay line permits a shorter period between pulses due to the linear superposition principle. When the mask embodiment is used, the acousto-optic cell focuses light which scans across the mask. Whenever the focused light passes through the mask, lasing occurs which generates an output pulse.

  3. Portable multiplicity counter

    DOEpatents

    Newell, Matthew R.; Jones, David Carl

    2009-09-01

    A portable multiplicity counter has signal input circuitry, processing circuitry and a user/computer interface disposed in a housing. The processing circuitry, which can comprise a microcontroller integrated circuit operably coupled to shift register circuitry implemented in a field programmable gate array, is configured to be operable via the user/computer interface to count input signal pluses receivable at said signal input circuitry and record time correlations thereof in a total counting mode, coincidence counting mode and/or a multiplicity counting mode. The user/computer interface can be for example an LCD display/keypad and/or a USB interface. The counter can include a battery pack for powering the counter and low/high voltage power supplies for biasing external detectors so that the counter can be configured as a hand-held device for counting neutron events.

  4. Multiple wavelength diffractive imaging

    NASA Astrophysics Data System (ADS)

    Chen, Bo; Dilanian, Ruben A.; Teichmann, Sven; Abbey, Brian; Peele, Andrew G.; Williams, Garth J.; Hannaford, Peter; van Dao, Lap; Quiney, Harry M.; Nugent, Keith A.

    2009-02-01

    We demonstrate coherent diffraction imaging using multiple harmonics from a high-harmonic generation source. An algorithm is presented that builds the known incident spectrum into the reconstruction procedure with the result that the useable flux is increased by more than an order of magnitude. Excellent images are obtained with a resolution of (165±5)nm and compare very well with images from a scanning electron microscope.

  5. Multiple muons in MACRO

    NASA Technical Reports Server (NTRS)

    Heinz, R.

    1985-01-01

    An analysis of the multiple muon events in the Monopole Astrophysics and Cosmic Ray Observatory detector was conducted to determine the cosmic ray composition. Particular emphasis is placed on the interesting primary cosmic ray energy region above 2000 TeV/nucleus. An extensive study of muon production in cosmic ray showers has been done. Results were used to parameterize the characteristics of muon penetration into the Earth to the location of a detector.

  6. Universality of particle multiplicities

    SciTech Connect

    Goulianos, K. |

    1994-09-01

    We discuss the scaling properties and universality aspects of the rapidity and multiplicity distributions of particles produced in high energy hadronic and e{sup +}e{sup {minus}} interactions. This paper is based on material presented in three lectures on pomeron phenomenology, which included a review of traditional soft pomeron physics and selected topics on hard diffraction processes probing the structure function of the pomeron.

  7. Multiple quantum coherence spectroscopy.

    PubMed

    Mathew, Nathan A; Yurs, Lena A; Block, Stephen B; Pakoulev, Andrei V; Kornau, Kathryn M; Wright, John C

    2009-08-20

    Multiple quantum coherences provide a powerful approach for studies of complex systems because increasing the number of quantum states in a quantum mechanical superposition state increases the selectivity of a spectroscopic measurement. We show that frequency domain multiple quantum coherence multidimensional spectroscopy can create these superposition states using different frequency excitation pulses. The superposition state is created using two excitation frequencies to excite the symmetric and asymmetric stretch modes in a rhodium dicarbonyl chelate and the dynamic Stark effect to climb the vibrational ladders involving different overtone and combination band states. A monochromator resolves the free induction decay of different coherences comprising the superposition state. The three spectral dimensions provide the selectivity required to observe 19 different spectral features associated with fully coherent nonlinear processes involving up to 11 interactions with the excitation fields. The different features act as spectroscopic probes of the diagonal and off-diagonal parts of the molecular potential energy hypersurface. This approach can be considered as a coherent pump-probe spectroscopy where the pump is a series of excitation pulses that prepares a multiple quantum coherence and the probe is another series of pulses that creates the output coherence. PMID:19507812

  8. MULTIPLE OSCILLATION STABILIZING CONTROL.

    SciTech Connect

    YUE,M.; SCHLUETER,R.; AZARM,M.; BARI,R.

    2004-07-23

    This paper presents a strategy that may be used to guide stabilizing control design for multiple oscillations, which are difficult to control using conventional control design procedures. A multiple oscillation phenomena is observed in an example power system. A local bifurcation and an interarea bifurcation develop in an example power system due to multiple bifurcation parameter variations. The dynamic behaviors of the bifurcating system are complex due to the overlapping of the two different bifurcation subsystems and are shown to be difficult to control. The double bifurcations are studied in this paper and in order to stabilize them, three kind of {mu}-synthesis robust controls are designed, (a) {mu}-synthesis power system stabilizer (MPSS); (b) {mu}-synthesis SVC control (MSVC); and (c) a mixed MPSS/MSVC control. Based on the bifurcation subsystem analysis, the measurement signals and locations of the controls are selected. The control performances of three kind of controls are evaluated and compared. The conclusions are given according to the analysis and time simulation results.

  9. Multiple Core Galaxies

    NASA Technical Reports Server (NTRS)

    Miller, R.H.; Morrison, David (Technical Monitor)

    1994-01-01

    Nuclei of galaxies often show complicated density structures and perplexing kinematic signatures. In the past we have reported numerical experiments indicating a natural tendency for galaxies to show nuclei offset with respect to nearby isophotes and for the nucleus to have a radial velocity different from the galaxy's systemic velocity. Other experiments show normal mode oscillations in galaxies with large amplitudes. These oscillations do not damp appreciably over a Hubble time. The common thread running through all these is that galaxies often show evidence of ringing, bouncing, or sloshing around in unexpected ways, even though they have not been disturbed by any external event. Recent observational evidence shows yet another phenomenon indicating the dynamical complexity of central regions of galaxies: multiple cores (M31, Markarian 315 and 463 for example). These systems can hardly be static. We noted long-lived multiple core systems in galaxies in numerical experiments some years ago, and we have more recently followed up with a series of experiments on multiple core galaxies, starting with two cores. The relevant parameters are the energy in the orbiting clumps, their relative.masses, the (local) strength of the potential well representing the parent galaxy, and the number of cores. We have studied the dependence of the merger rates and the nature of the final merger product on these parameters. Individual cores survive much longer in stronger background potentials. Cores can survive for a substantial fraction of a Hubble time if they travel on reasonable orbits.

  10. Multiple mechanisms are implicated in the regulation of NF-kappa B activity during human cytomegalovirus infection.

    PubMed Central

    Kowalik, T F; Wing, B; Haskill, J S; Azizkhan, J C; Baldwin, A S; Huang, E S

    1993-01-01

    Infection-induced activation of the human cytomegalovirus major immediate early enhancer/promoter has been shown to be regulated primarily by transcription factor NF-kappa B cis elements. However, the mechanism(s) by which human cytomegalovirus induces NF-kappa B activity is unknown. A study was therefore undertaken to determine how this virus would affect normal NF-kappa B regulation. Viral infection of fibroblasts resulted in the specific stimulation of promoters containing major histocompatibility complex NF-kappa B cis elements fused upstream of the chloramphenicol acetyltransferase reporter gene. Electrophoretic mobility shift assays of nuclear extracts derived from mock- and virus-infected cells showed dramatic and sustained increases in DNA-binding proteins specific for these NF-kappa B sequences. Experiments using MAD-3 I kappa B, a specific inhibitor of NF-kappa B, and antibodies directed against rel family members demonstrated that the induced binding activities contained p50 and p65 proteins but not c-rel. Northern analysis indicated maximal levels of p50 mRNA by 4 h postinfection, whereas p65 and MAD-3 I kappa B mRNA accumulation peaked at 48-72 h postinfection, suggesting different regulatory mechanisms for p50 and p65/I kappa B genes. Electrophoretic mobility shift assays with deoxycholate-treated cytoplasmic extracts demonstrated a 3- to 4-fold decrease in the cytosolic stores of NF-kappa B binding activity by 4 h postinfection. Western blots probed with antibodies directed against MAD-3 I kappa B or pp40 (a protein isolated from chicken with sequence and biochemical properties similar to those of MAD-3 I kappa B) indicated that a cross-reactive peptide of 39 kDa was no longer detectable after 24 h postinfection. These results demonstrate that the activation and maintenance of nuclear NF-kappa B DNA binding and enhancer activities upon human cytomegalovirus infection occurs by multiple mechanisms. Images PMID:8381532

  11. Effects of Early or Overexpression of the Autographa californica Multiple Nucleopolyhedrovirus orf94 (ODV-e25) on Virus Replication.

    PubMed

    Luo, Xiao-Chun; Wang, Shan-Shan; Zhang, Jie; Qian, Duo-Duo; Wang, Si-Min; Li, Lu-Lin

    2013-01-01

    odv-e25(e25) is one of the core genes of baculoviruses. To investigate how it functions in the replication cycle of a baculovirus, a number of Autographa californica multiple nucleopolyhedrovirus recombinants with e25 under control of the promoter of immediate early gene ie1, or the promoter of the very late hyperexpressed gene p10, were constructed using a bacmid system, and the effects of early expression or overexpression of e25 on replication of the virus were evaluated. Microscopy and titration assays demonstrated that bacmids with e25 under control of ie1 promoter were unable to produce budded viruses; and that the recombinant viruses with e25 under control of p10 promoter generated budded virus normally, but formation of occlusion bodies were dramatically reduced and delayed in the infected cells. Electron microscopy showed that there were no mature virions or intact nucleocapsids present in the cells transfected with a recombinant bacmid with e25 under control of ie1 promoter. Quantitative real-time PCR analysis demonstrated that alteration of the e25 promoter did not affect viral DNA synthesis. The reporter gene expression from the promoter of the major capsid protein gene vp39 was reduced 63% by early expression of e25. Confocal microscopy revealed that E25 was predominantly localized in nuclei by 24 hours post infection with wild-type virus, but it remained in the cytoplasm in the cells transfected with a recombinant bacmid with e25 under control of the ie1 promoter, suggesting that the transport of E25 into nuclei was regulated in a specific and strict time dependent manner.

  12. Multiple sclerosis and infections.

    PubMed

    Venkatesan, Arun

    2015-01-01

    The intersection between infections and multiple sclerosis (MS) is complex and bidirectional. Numerous infectious agents have been posited to play a role in the initiation of MS, while emerging evidence suggests a potential relationship between established MS and the gut microbiome. As both systemic and CNS infections are major complications of MS, the clinical manifestations and evolving epidemiology of these infections over the lifespan of the MS patient are examined in this review. Data from animal models and human studies are discussed. PMID:26611265

  13. Multiple-chemical sensitivity.

    PubMed

    Glinton, Gloria J

    2005-12-01

    Multiple-chemical sensitivity (MCS) is a condition in which individuals have an acute hypersensitivity to low levels of chemicals found in everyday substances, such as household cleaning agents, pesticides, fresh paint, new carpeting, synthetic building materials, newsprint, perfume, and numerous other petrochemical products. This condition continues to remain somewhat of a mystery to the medical community, and its true prevalence rate is unknown because many cases are not identified and reported as MCS. This article will inform the reader about the condition of MCS.

  14. Multiple personality disorder.

    PubMed

    Piper, A

    1994-05-01

    Five aspects of the diagnosis and treatment of multiple personality disorder (MPD) were examined. The following five conclusions were made: the contemporary diagnostic criteria are vague and overinclusive; the recent alleged increase in prevalence of the disorder is almost certainly artefactual; legal proceedings involving MPD patients raise disturbing questions about personal responsibility; there is little literature support for the theory that MPD results from childhood trauma; and many of the techniques used to diagnose and treat the condition reinforce its symptoms. A careful revision of diagnostic criteria for the disorder is recommended.

  15. Multiple granular cell tumor.

    PubMed

    Jones, J K; Kuo, T T; Griffiths, C M; Itharat, S

    1980-10-01

    Eleven cases of granular cell tumor were reviewed. In two of the cases multiple sites of involvement were seen. The tumor occurred in the oral cavity in both of these cases and each was initially wrongly diagnosed as squamous cell carcinoma. The most common site was the subcutaneous tissue (nine patients) and the tongue was involved in three cases. In one patient the parotid gland was involved. Eight of the patients were females and three were males; seven were black and four were white. The importance of differentiating between squamous cell carcinoma and granular cell tumor is stressed, as is the need for a simple wide surgical excision. PMID:7421377

  16. In ovo vaccination of commercial broilers with a glycoprotein J gene-deleted strain of infectious laryngotracheitis virus.

    PubMed

    Mashchenko, Anna; Riblet, Sylva M; Zavala, Guillermo; García, Maricarmen

    2013-06-01

    Conventional live attenuated vaccines have been used as the main tool worldwide for the control of infectious laryngotracheitis. However, their suboptimal attenuation combined with poor mass administration practices allowed chicken embryo origin vaccine-derived isolates to circulate in the field, regain virulence, and be the cause of continuous outbreaks of the disease. Previous studies indicated that stable attenuation of infectious laryngotracheitis virus (ILTV) can be achieved by the deletion of individual viral genes that are not essential for viral replication in vitro. One of these genes is the glycoprotein J (gJ) gene. Its deletion provided significant attenuation to virulent ILTV strains from Europe and the United States. The objective of this study was to construct an attenuated gJ-deleted ILTV strain and evaluate its safety and efficacy for in ovo (IO) administration of commercial broilers. A novel gJ-deleted virus (N(delta)gJ) was constructed, and a 10(3) median tissue culture infective dose administered at 18 days of embryo age was considered safe because it did not affect hatchability or survivability of chickens during the first week posthatch. Broilers vaccinated IO and IO + eye drop at 14 days of age presented a significant reduction in clinical signs and reduction of virus loads after challenge, as compared with the nonvaccinated challenged group of chickens. Therefore, this study presents initial proof that the N(delta)gJ strain is a potential ILTV live-attenuated vaccine candidate suitable for IO vaccination of commercial broilers. PMID:23901771

  17. A 'suicide' CRISPR-Cas9 system to promote gene deletion and restoration by electroporation in Cryptococcus neoformans.

    PubMed

    Wang, Yu; Wei, Dongsheng; Zhu, Xiangyang; Pan, Jiao; Zhang, Ping; Huo, Liang; Zhu, Xudong

    2016-01-01

    Loss-of-function mutagenesis is an important tool used to characterize gene functions, and the CRISPR-Cas9 system is a powerful method for performing targeted mutagenesis in organisms that present low recombination frequencies, such as the serotype D strains of Cryptococcus neoformans. However, when the CRISPR-Cas9 system persists in the host cells, off-target effects and Cas9 cytotoxicity may occur, which might block subsequent genetic manipulation. Here, we report a method of spontaneously eliminating the CRISPR-Cas9 system without impairing its robust editing function. We successfully expressed single guide RNA under the driver of an endogenous U6 promoter and the human codon-optimized Cas9 endonuclease with an ACT1 promoter. This system can effectively generate an indel mutation and efficiently perform targeted gene disruption via homology-directed repair by electroporation in yeast. We then demonstrated the spontaneous elimination of the system via a cis arrangement of the CRISPR-Cas9 expression cassettes to the recombination construct. After a system-mediated double crossover, the CRISPR-Cas9 cassettes were cleaved and degraded, which was validated by Southern blotting. This 'suicide' CRISPR-Cas9 system enables the validation of gene functions by subsequent complementation and has the potential to minimize off-target effects. Thus, this technique has the potential for use in functional genomics studies of C. neoformans. PMID:27503169

  18. α2δ-1 Gene Deletion Affects Somatosensory Neuron Function and Delays Mechanical Hypersensitivity in Response to Peripheral Nerve Damage

    PubMed Central

    Patel, Ryan; Bauer, Claudia S.; Nieto-Rostro, Manuela; Margas, Wojciech; Ferron, Laurent; Chaggar, Kanchan; Crews, Kasumi; Ramirez, Juan D.; Bennett, David L. H.; Schwartz, Arnold; Dickenson, Anthony H.

    2013-01-01

    The α2δ-1 subunit of voltage-gated calcium channels is upregulated after sensory nerve injury and is also the therapeutic target of gabapentinoid drugs. It is therefore likely to play a key role in the development of neuropathic pain. In this study, we have examined mice in which α2δ-1 gene expression is disrupted, to determine whether α2δ-1 is involved in various modalities of nociception, and for the development of behavioral hypersensitivity after partial sciatic nerve ligation (PSNL). We find that naive α2δ-1−/− mice show a marked behavioral deficit in mechanical and cold sensitivity, but no change in thermal nociception threshold. The lower mechanical sensitivity is mirrored by a reduced in vivo electrophysiological response of dorsal horn wide dynamic range neurons. The CaV2.2 level is reduced in brain and spinal cord synaptosomes from α2δ-1−/− mice, and α2δ-1−/− DRG neurons exhibit lower calcium channel current density. Furthermore, a significantly smaller number of DRG neurons respond to the TRPM8 agonist menthol. After PSNL, α2δ-1−/− mice show delayed mechanical hypersensitivity, which only develops at 11 d after surgery, whereas in wild-type littermates it is maximal at the earliest time point measured (3 d). There is no compensatory upregulation of α2δ-2 or α2δ-3 after PSNL in α2δ-1−/− mice, and other transcripts, including neuropeptide Y and activating transcription factor-3, are upregulated normally. Furthermore, the ability of pregabalin to alleviate mechanical hypersensitivity is lost in PSNL α2δ-1−/− mice. Thus, α2δ-1 is essential for rapid development of mechanical hypersensitivity in a nerve injury model of neuropathic pain. PMID:24133248

  19. Anophthalmia-esophageal atresia syndrome caused by an SOX2 gene deletion in monozygotic twin brothers with markedly discordant phenotypes.

    PubMed

    Zenteno, Juan Carlos; Perez-Cano, Hector J; Aguinaga, Monica

    2006-09-15

    The clinical combination of anophthalmia/microphthalmia and esophageal atresia was first recognized in 1988 as a distinct variable multi-system malformation syndrome and since then at least 17 cases of the disease have been described, all of them sporadic in occurrence. We report a heterozygous SOX2 gene mutation underlying the syndrome of anophthalmia/microphthalmia-esophageal atresia and demonstrate that this entity can be associated to considerable clinical variability as shown by the discordant ocular phenotype observed in monozygotic twin brothers carrying an SOX2 deletion. This is the first report describing a strikingly discordant eye phenotype in monozygotic twins with the condition, with one of our patients being the first reported individual carrying an SOX2 lesion associated with unilateral eye defect. We discuss the probable sources for this remarkable phenotypic heterogeneity of the anophthalmia/microphthalmia syndrome in individuals with an identical genetic constitution.

  20. Nontoxic Strains of Cyanobacteria Are the Result of Major Gene Deletion Events Induced by a Transposable Element

    PubMed Central

    Christiansen, Guntram; Molitor, Carole; Philmus, Benjamin

    2008-01-01

    Blooms that are formed by cyanobacteria consist of toxic and nontoxic strains. The mechanisms that result in the occurrence of nontoxic strains are enigmatic. All the nontoxic strains of the filamentous cyanobacterium Planktothrix that were isolated from 9 European countries were found to have lost 90% of a large microcystin synthetase (mcy) gene cluster that encoded the synthesis of the toxic peptide microcystin (MC). Those strains still contain the flanking regions of the mcy gene cluster along with remnants of the transposable elements that are found in between. The majority of the strains still contain a gene coding for a distinct thioesterase type II (mcyT), which is putatively involved in MC synthesis. The insertional inactivation of mcyT in an MC-producing strain resulted in the reduction of MC synthesis by 94 ± 2% (1 standard deviation). Nontoxic strains that occur in shallow lakes throughout Europe form a monophyletic lineage. A second lineage consists of strains that contain the mcy gene cluster but differ in their photosynthetic pigment composition, which is due to the occurrence of strains that contain phycocyanin or large amounts of phycoerythrin in addition to phycocyanin. Strains containing phycoerythrin typically occur in deep-stratified lakes. The rare occurrence of gene cluster deletion, paired with the evolutionary diversification of the lineages of strains that lost or still contain the mcy gene cluster, needs to be invoked in order to explain the absence or dominance of toxic cyanobacteria in various habitats. PMID:18502770

  1. Virulence Associated Genes-Deleted Salmonella Montevideo Is Attenuated, Highly Immunogenic and Confers Protection against Virulent Challenge in Chickens

    PubMed Central

    Lalsiamthara, Jonathan; Lee, John H.

    2016-01-01

    To construct a novel live vaccine against Salmonella enterica serovar Montevideo (SM) infection in chickens, two important bacterial regulatory genes, lon and cpxR, which are associated with invasion and virulence, were deleted from the wild type SM genome. Attenuated strains, JOL1625 (Δlon), JOL1597 (ΔcpxR), and JOL1599 (ΔlonΔcpxR) were thereby generated. Observations with scanning electron microscopy suggested that JOL1625 and JOL1599 cells showed increased ruffled surface which may be related to abundant extracellular polysaccharide (EPS) production. JOL1597 depicted milder ruffled surface but showed increased surface corrugation. ConA affinity-based fluorometric quantification and fluorescence microscopy revealed significant increases in EPS production in JOL1625 and JOL1599. Four weeks old chickens were used for safety and immunological studies. The mutants were not observed in feces beyond day 3 nor in spleen and cecum beyond day 7, whereas wild type SM was detected for at least 2 weeks in spleen and cecum. JOL1599 was further evaluated as a vaccine candidate. Chickens immunized with JOL1599 showed strong humoral responses, as indicated by systemic IgG and secretory IgA levels, as well as strong cell-mediated immune response, as indicated by increased lymphocyte proliferation. JOL1599-immunized groups also showed significant degree of protection against wild type challenge. Our results indicate that Δlon- and/or ΔcpxR-deleted SM exhibited EPS-enhanced immunogenicity and attenuation via reduced bacterial cell intracellular replication, conferred increased protection, and possess safety qualities favorable for effective vaccine development against virulent SM infections. PMID:27785128

  2. The NPHP1 gene deletion associated with juvenile nephronophthisis is present in a subset of individuals with Joubert syndrome.

    PubMed

    Parisi, Melissa A; Bennett, Craig L; Eckert, Melissa L; Dobyns, William B; Gleeson, Joseph G; Shaw, Dennis W W; McDonald, Ruth; Eddy, Allison; Chance, Phillip F; Glass, Ian A

    2004-07-01

    Joubert syndrome (JS) is an autosomal recessive multisystem disease characterized by cerebellar vermis hypoplasia with prominent superior cerebellar peduncles (the "molar tooth sign" [MTS] on axial magnetic resonance imaging), mental retardation, hypotonia, irregular breathing pattern, and eye-movement abnormalities. Some individuals with JS have retinal dystrophy and/or progressive renal failure characterized by nephronophthisis (NPHP). Thus far, no mutations in the known NPHP genes, particularly the homozygous deletion of NPHP1 at 2q13, have been identified in subjects with JS. A cohort of 25 subjects with JS and either renal and/or retinal complications and 2 subjects with only juvenile NPHP were screened for mutations in the NPHP1 gene by standard methods. Two siblings affected with a mild form of JS were found to have a homozygous deletion of the NPHP1 gene identical, by mapping, to that in subjects with NPHP alone. A control subject with NPHP and with a homozygous NPHP1 deletion was also identified, retrospectively, as having a mild MTS and borderline intelligence. The NPHP1 deletion represents the first molecular defect associated with JS in a subset of mildly affected subjects. Cerebellar malformations consistent with the MTS may be relatively common in patients with juvenile NPHP without classic symptoms of JS.

  3. Targeted Gene Deletion Demonstrates that Cell Adhesion MoleculeICAM-4 is Critical for Erythroblastic Island Formation

    SciTech Connect

    Lee, Gloria; Lo, Annie; Short, Sarah A.; Mankelow, Tosti J.; Spring, Frances; Parsons, Stephen F.; Mohandas, Narla; Anstee, David J.; Chasis, Joel Anne

    2006-02-15

    Erythroid progenitors differentiate in erythroblastic islands, bone marrow niches composed of erythroblasts surrounding a central macrophage. Evidence suggests that within islands adhesive interactions regulate erythropoiesis and apoptosis. We are exploring whether erythroid intercellular adhesion molecule-4 (ICAM-4), animmunoglobulin superfamily member, participates in island formation. Earlier, we identified alpha V integrins as ICAM-4 counter receptors. Since macrophages express alpha V, ICAM-4 potentially mediates island attachments. To test this, we generated ICAM-4 knockout mice and developed quantitative, live cell techniques for harvesting intact islands and for reforming islands in vitro. We observed a 47 percent decrease in islands reconstituted from ICAM-4 null marrow compared to wild type. We also found a striking decrease in islands formed in vivo in knockout mice. Further, peptides that block ICAM-4 alpha V adhesion produced a 53-57 percent decrease in reconstituted islands, strongly suggesting that ICAM-4 binding to macrophage alpha V functions in island integrity. Importantly, we documented that alpha V integrin is expressed in macrophages isolated from erythro blastic islands. Collectively, these data provide convincing evidence that ICAM-4 is critical in erythroblastic island formation via ICAM-4/alpha V adhesion and also demonstrate that the novel experimental strategies we developed will be valuable in exploring molecular mechanisms of erythroblastic island formation and their functional role in regulating erythropoiesis.

  4. Hereditary fructose intolerance: functional study of two novel ALDOB natural variants and characterization of a partial gene deletion.

    PubMed

    Esposito, Gabriella; Imperato, Maria Rosaria; Ieno, Luigi; Sorvillo, Rosa; Benigno, Vincenzo; Parenti, Giancarlo; Parini, Rossella; Vitagliano, Luigi; Zagari, Adriana; Salvatore, Francesco

    2010-12-01

    Hereditary fructose intolerance (HFI) is an autosomal recessive metabolic disease caused by impaired functioning of human liver aldolase (ALDOB). At least 54 subtle/point mutations and only two large intragenic deletions have been found in the ALDOB gene. Here we report two novel ALDOB variants (p.R46W and p.Y343H) and an intragenic deletion that we found in patients with suspected HFI. The residual catalytic activity of the recombinant p.R46W and p.Y343H variants toward F1P was particularly altered. We also characterized a large intragenic deletion that we found in six unrelated patients. This is the first report of six unrelated patients sharing the same ALDOB deletion, thus indicating a founder effect for this allele in our geographic area. Because this deletion involves ALDOB exon 5, it can mimic worldwide common pathogenic genotypes, that is, homozygous p.A150P and p.A175D. Finally, the identification of only one ALDOB mutation in symptomatic patients suggests that HFI symptoms can, albeit rarely, appear also in heterozygotes. Therefore, an excessive and continuous fructose dietary intake may have deleterious effects even in apparently asymptomatic HFI carriers.

  5. Secretory leukocyte protease inhibitor gene deletion alters bleomycin-induced lung injury, but not development of pulmonary fibrosis

    PubMed Central

    Habgood, Anthony N; Tatler, Amanda L; Porte, Joanne; Wahl, Sharon M; Laurent, Geoffrey J; John, Alison E; Johnson, Simon R; Jenkins, Gisli

    2016-01-01

    Idiopathic Pulmonary Fibrosis (IPF) is a progressive, fatal disease with limited treatment options. Protease mediated transforming growth factor-β (TGF-β) activation has been proposed as a pathogenic mechanism of lung fibrosis. Protease activity in the lung is tightly regulated by protease inhibitors, particularly secretory leukocyte protease inhibitor (SLPI). The bleomycin model of lung fibrosis was used to determine the effect of increased protease activity in the lungs of Slpi−/− mice following injury. Slpi−/−, and wild-type, mice received oropharyngeal administration of bleomycin (30 IU) and the development of pulmonary fibrosis was assessed. Pro and active forms of matrix metalloproteinase-2 (MMP-2) and MMP-9 were measured. Lung fibrosis was determined by collagen subtype specific gene expression, hydroxyproline concentration, and histological assessment. Alveolar TGF-β activation was measured using bronchoalveolar lavage cell pSmad2 levels and global TGF-β activity was assessed by pSmad2 immunohistochemistry. The active-MMP-9 to pro-MMP-9 ratio was significantly increased in Slpi−/− animals compared with wild-type animals, demonstrating enhanced metalloproteinase activity. Wild-type animals showed an increase in TGF-β activation following bleomycin, with a progressive and sustained increase in collagen type I, alpha 1 (Col1α1), III, alpha 1(Col3α1), IV, alpha 1(Col4α1) mRNA expression, and a significant increase in total lung collagen 28 days post-bleomycin. In contrast Slpi−/− mice showed no significant increase of alveolar TGF-β activity following bleomycin, above their already elevated levels, although global TGF-β activity did increase. Slpi−/− mice had impaired collagen gene expression but animals demonstrated minimal reduction in lung fibrosis compared with wild-type animals. These data suggest that enhanced proteolysis does not further enhance TGF-β activation, and inhibits sustained Col1α1, Col3α1 and Col4α1 gene expression following lung injury. However, these changes do not prevent the development of lung fibrosis. Overall, these data suggest that the absence of Slpi does not dramatically modify the development of lung fibrosis following bleomycin-induced lung injury. PMID:26974397

  6. Detection of an atypical teratoid rhabdoid brain tumor gene deletion in circulating blood using next-generation sequencing.

    PubMed

    Chakravadhanula, Madhavi; Tembe, Waibhav; Legendre, Christophe; Carpentieri, David; Liang, Winnie S; Bussey, Kimberly J; Carpten, John; Berens, Michael E; Bhardwaj, Ratan D

    2014-09-01

    Circulating biomarkers such as somatic chromosome mutations are novel diagnostic tools to detect cancer noninvasively. We describe focal deletions found in a patient with atypical teratoid rhabdoid tumor, a highly aggressive early childhood pediatric tumor. First, we used magnetic resonance imaging (MRI) and histopathology to study the tumor anatomy. Next, we used whole genome sequencing (Next Gen Sequencing) and Bioinformatics interrogation to discover the presence of 3 focal deletions in tumor tissue and 2 of these 3 focal deletions in patient's blood also. About 20% of the blood DNA sequencing reads matched the tumor DNA reads at the SMARCB1 gene locus. Circulating, tumor-specific DNA aberrations are a promising biomarker for atypical teratoid rhabdoid tumor patients. The high percentage of tumor DNA detected in blood indicates that either circulating brain tumor cells lyse in the blood or that contents of brain tumor cells traverse a possibly compromised blood-brain barrier in this patient.

  7. Fluid reabsorption in proximal convoluted tubules of mice with gene deletions of claudin-2 and/or aquaporin1

    PubMed Central

    Huang, Yuning; Mizel, Diane

    2013-01-01

    Deletions of claudin-2 (Cldn2) and aquaporin1 (AQP1) reduce proximal fluid reabsorption (PFR) by about 30% and 50%, respectively. Experiments were done to replicate these observations and to determine in AQP1/claudin-2 double knockout mice (DKO) if the effects of deletions of these established water pores are additive. PFR was determined in inactin/ketamine-anesthetized mice by free-flow micropuncture using single-nephron I125-iothalamate (io) clearance. Animal means of PFR [% of glomerular filtration rate (GFR)] derived from TF/Piothalamate ratios in 12 mice in each of four groups [wild type (WT), Cldn2−/−, AQP1−/−, and DKO) were 45.8 ± 0.85 (51 tubules), 35.4 ± 1 (54 tubules; P < 0.01 vs. WT), 36.8 ± 1 (63 tubules; P < 0.05 vs. WT), and 33.9 ± 1.4 (69 tubules; P < 0.01 vs. WT). Kidney and single-nephron GFRs (SNGFR) were significantly reduced in all mutant strains. The direct relationship between PFR and SNGFR was maintained in mutant mice, but the slope of this relationship was reduced in the absence of Cldn2 and/or AQP1. Transtubular osmotic pressure differences were not different between WT and Cldn2−/− mice, but markedly increased in DKO. In conclusion, the deletion of Cldn2, AQP1, or of both Cldn2 and AQP1 reduces PFR by 22.7%, 19.6%, and 26%, respectively. Our data are consistent with an up to 25% paracellular contribution to PFR. The reduced osmotic water permeability caused by absence of AQP1 augments luminal hypotonicity. Aided by a fall in filtered load, the capacity of non-AQP1-dependent transcellular reabsorption is sufficient to maintain PFR without AQP1 and claudin-2 at 75% of control. PMID:24049145

  8. Analysis of GzmbCre as a Model System for Gene Deletion in the Natural Killer Cell Lineage.

    PubMed

    Xu, Yiying; Evaristo, Cesar; Alegre, Maria-Luisa; Gurbuxani, Sandeep; Kee, Barbara L

    2015-01-01

    The analysis of gene function in mature and activated natural killer cells has been hampered by the lack of model systems for Cre-mediated recombination in these cells. Here we have investigated the utility of GzmbCre for recombination of loxp sequences in these cells predicated on the observation that Gzmb mRNA is highly expressed in mature and activated natural killer cells. Using two different reporter strains we determined that gene function could be investigated in mature natural killer cells after GzmbCre mediated recombination in vitro in conditions that lead to natural killer cell activation such as in the cytokine combination of interleukin 2 and interleukin 12. We demonstrated the utility of this model by creating GzmbCre;Rosa26IKKbca mice in which Cre-mediated recombination resulted in expression of constitutively active IKKβ, which results in activation of the NFκB transcription factor. In vivo and in vitro activation of IKKβ in natural killer cells revealed that constitutive activation of this pathway leads to natural killer cell hyper-activation and altered morphology. As a caveat to the use of GzmbCre we found that this transgene can lead to recombination in all hematopoietic cells the extent of which varies with the particular loxp flanked allele under investigation. We conclude that GzmbCre can be used under some conditions to investigate gene function in mature and activated natural killer cells.

  9. Lethal osteogenesis imperfecta congenita and a 300 base pair gene deletion for an alpha 1(I)-like collagen.

    PubMed Central

    Pope, F M; Cheah, K S; Nicholls, A C; Price, A B; Grosveld, F G

    1984-01-01

    Broad boned lethal osteogenesis imperfecta is a severely crippling disease of unknown cause. By means of recombinant DNA technology a 300 base pair deletion in an alpha 1(I)-like collagen gene was detected in six patients and four complete parent-child groups including patients with this disease. One from each set of the patients' clinically unaffected parents also carried the deletion, implying that affected patients were genetic compounds. The study suggests that prenatal diagnosis should be possible with 100% accuracy in subjects without the deletion and with 50% accuracy in those who possess it (who would be either heterozygous--normal, or affected with the disease). Images FIG 1 FIG 2 FIG 3 FIG 4 PMID:6419953

  10. Unexpected effects of gene deletion on mercury interactions with the methylation-deficient mutant hgcAB

    SciTech Connect

    Lin, Hui; Hurt, Jr., Richard Ashley; Johs, Alexander; Parks, Jerry M; Morrell-Falvey, Jennifer L; Liang, Liyuan; Elias, Dwayne A; Gu, Baohua

    2014-01-01

    The hgcA and hgcB gene pair is essential for mercury (Hg) methylation by certain anaerobic bacteria,1 but little is known about how deletion of hgcAB affects cell surface interactions and intracellular uptake of Hg. Here, we compare hgcAB mutants with the wild-type (WT) strains of both Geobacter sulfurreducens PCA and Desulfovibrio desulfuricans ND132 and observe differences in Hg redox transformations, adsorption, and uptake in laboratory incubation studies. In both strains, deletion of hgcAB increased the reduction of Hg(II) but decreased the oxidation of Hg(0) under anaerobic conditions. The measured cellular thiol content in hgcAB mutants was lower than the WT, accounting for decreased adsorption and uptake of Hg. Despite the lack of methylation activity, Hg uptake by the hgcAB continued, albeit at a slower rate than the WT. These findings demonstrate that deletion of the hgcAB gene not only eliminates Hg methylation but also alters cell physiology, resulting in changes to Hg redox reactions, sorption, and uptake by cells.

  11. Oculo-facio-cardio-dental (OFCD) syndrome: the first Italian case of BCOR and co-occurring OTC gene deletion.

    PubMed

    Di Stefano, C; Lombardo, B; Fabbricatore, C; Munno, C; Caliendo, I; Gallo, F; Pastore, L

    2015-04-01

    Oculo-facio-cardio-dental (OFCD) syndrome is a rare genetic disorder affecting ocular, facial, dental and cardiac systems. The syndrome is an X-linked dominant trait and it might be lethal in males. This syndrome is usually caused by mutations in the BCL6 interacting co-repressor gene (BCOR). We described a female child with mild phenotype of oculo-facio-cardio-dental syndrome. Array-comparative genomic hybridization (a-CGH) analysis revealed a de novo heterozygous deletion in the Xp11.4 region of approximately 2.3 Mb, involving BCOR and ornithine carbamoyl-transferase (OTC) genes. The deletion observed was subsequently confirmed by real time PCR. In this study we report a first case with co-occurrence of BCOR and OTC genes completely deleted in OFCD syndrome.

  12. The restriction mapping of c gene deletions in Streptomyces bacteriophage phi C31 and their use in cloning vector development.

    PubMed

    Harris, J E; Chater, K F; Bruton, C J; Piret, J M

    1983-01-01

    In addition to 20 previously mapped restriction sites in the DNA of phi C31, we have determined eight sites for SphI, four for EcoRV, and two for SstII; there are none for BglII or SstI. Nine sites were in a 12-kb segment of DNA containing no previously mapped sites. Deletions causing clear-plaque morphology were located in this part of the DNA, in a 3-kb interval between an EcoRV and an SphI site at the centre of the DNA molecule. One of the deletions (delta C3) was obtained in a previously described phi C31c+::vph (viomycin phosphotransferase) derivative containing two PstI sites separated by 3.9-kb of inessential DNA. After in vitro PstI treatment, plaque-forming phages lacking the 3.9-kb fragment were obtained from the c+ phage but not from its delta C3 derivative. Thus a 36.2-kb genome, but not one of 34.4 kb, was able to give infectious virions. PstI-generated DNA fragments of up to 8 kb can be inserted in vitro into the delta C3 derivative with retention of the vph selective marker. With the insertion of a 6.03-kb PstI fragment of plasmid SCP2, the latter phage became a potential vector (with loss of vph) for BamHI-generated DNA fragments of up to 9 kb. In the course of this work, several ClaI sites in phi C31::pBR322 bifunctional replicons were shown to be lost when the DNA was propagated in a dam+ Escherichia coli strain. This will allow the use of such replicons for the cloning of ClaI-generated DNA fragments of up to 6.7 kb.

  13. Secretory leukocyte protease inhibitor gene deletion alters bleomycin-induced lung injury, but not development of pulmonary fibrosis.

    PubMed

    Habgood, Anthony N; Tatler, Amanda L; Porte, Joanne; Wahl, Sharon M; Laurent, Geoffrey J; John, Alison E; Johnson, Simon R; Jenkins, Gisli

    2016-06-01

    Idiopathic pulmonary fibrosis is a progressive, fatal disease with limited treatment options. Protease-mediated transforming growth factor-β (TGF-β) activation has been proposed as a pathogenic mechanism of lung fibrosis. Protease activity in the lung is tightly regulated by protease inhibitors, particularly secretory leukocyte protease inhibitor (SLPI). The bleomycin model of lung fibrosis was used to determine the effect of increased protease activity in the lungs of Slpi(-/-) mice following injury. Slpi(-/-), and wild-type, mice received oropharyngeal administration of bleomycin (30 IU) and the development of pulmonary fibrosis was assessed. Pro and active forms of matrix metalloproteinase (MMP)-2 and MMP-9 were measured. Lung fibrosis was determined by collagen subtype-specific gene expression, hydroxyproline concentration, and histological assessment. Alveolar TGF-β activation was measured using bronchoalveolar lavage cell pSmad2 levels and global TGF-β activity was assessed by pSmad2 immunohistochemistry. The active-MMP-9 to pro-MMP-9 ratio was significantly increased in Slpi(-/-) animals compared with wild-type animals, demonstrating enhanced metalloproteinase activity. Wild-type animals showed an increase in TGF-β activation following bleomycin, with a progressive and sustained increase in collagen type I, alpha 1 (Col1α1), III, alpha 1(Col3α1), IV, alpha 1(Col4α1) mRNA expression, and a significant increase in total lung collagen 28 days post bleomycin. In contrast Slpi(-/-) mice showed no significant increase of alveolar TGF-β activity following bleomycin, above their already elevated levels, although global TGF-β activity did increase. Slpi(-/-) mice had impaired collagen gene expression but animals demonstrated minimal reduction in lung fibrosis compared with wild-type animals. These data suggest that enhanced proteolysis does not further enhance TGF-β activation, and inhibits sustained Col1α1, Col3α1, and Col4α1 gene expression following lung injury. However, these changes do not prevent the development of lung fibrosis. Overall, these data suggest that the absence of Slpi does not markedly modify the development of lung fibrosis following bleomycin-induced lung injury.

  14. Oculo-facio-cardio-dental (OFCD) syndrome: the first Italian case of BCOR and co-occurring OTC gene deletion.

    PubMed

    Di Stefano, C; Lombardo, B; Fabbricatore, C; Munno, C; Caliendo, I; Gallo, F; Pastore, L

    2015-04-01

    Oculo-facio-cardio-dental (OFCD) syndrome is a rare genetic disorder affecting ocular, facial, dental and cardiac systems. The syndrome is an X-linked dominant trait and it might be lethal in males. This syndrome is usually caused by mutations in the BCL6 interacting co-repressor gene (BCOR). We described a female child with mild phenotype of oculo-facio-cardio-dental syndrome. Array-comparative genomic hybridization (a-CGH) analysis revealed a de novo heterozygous deletion in the Xp11.4 region of approximately 2.3 Mb, involving BCOR and ornithine carbamoyl-transferase (OTC) genes. The deletion observed was subsequently confirmed by real time PCR. In this study we report a first case with co-occurrence of BCOR and OTC genes completely deleted in OFCD syndrome. PMID:25620158

  15. A Tailored galK Counterselection System for Efficient Markerless Gene Deletion and Chromosomal Tagging in Magnetospirillum gryphiswaldense

    PubMed Central

    Raschdorf, Oliver; Plitzko, Jürgen M.; Schüler, Dirk

    2014-01-01

    Magnetotactic bacteria have emerged as excellent model systems to study bacterial cell biology, biomineralization, vesicle formation, and protein targeting because of their ability to synthesize single-domain magnetite crystals within unique organelles (magnetosomes). However, only few species are amenable to genetic manipulation, and the limited methods for site-specific mutagenesis are tedious and time-consuming. Here, we report the adaptation and application of a fast and convenient technique for markerless chromosomal manipulation of Magnetospirillum gryphiswaldense using a single antibiotic resistance cassette and galK-based counterselection for marker recycling. We demonstrate the potential of this technique by genomic excision of the phbCAB operon, encoding enzymes for polyhydroxyalkanoate (PHA) synthesis, followed by chromosomal fusion of magnetosome-associated proteins to fluorescent proteins. Because of the absence of interfering PHA particles, these engineered strains are particularly suitable for microscopic analyses of cell biology and magnetosome biosynthesis. PMID:24814778

  16. Vaccination with a live multi-gene deletion strain protects horses against virulent challenge with Streptococcus equi.

    PubMed

    Robinson, Carl; Heather, Zoe; Slater, Josh; Potts, Nicola; Steward, Karen F; Maskell, Duncan J; Fontaine, Michael C; Lee, Jeong-Jin; Smith, Ken; Waller, Andrew S

    2015-02-25

    Strangles, caused by Streptococcus equi subspecies equi (S. equi) is one of the most frequently diagnosed infectious diseases of horses and there remains a significant need to develop new preventative vaccines. We generated a live vaccine strain of S. equi containing deletions in six genes: sagA, hasA, aroB, pyrC, seM and recA, which was administered to nine Welsh mountain ponies via the intramuscular route. Four vaccinated ponies developed adverse reactions following the first vaccination from which the live vaccine strain was isolated. Two of these ponies were withdrawn from the study and seven ponies received a second vaccination, one of which then developed an adverse reaction. Nine control ponies injected with culture media alone developed no adverse reactions. Following challenge with a virulent strain of S. equi, none of the seven vaccinated ponies had developed clinical signs of strangles eleven days post-challenge, compared to six of nine control ponies over the same period (P=0.0114). A lymph node abscess was identified in one of the seven vaccinated ponies at post-mortem examination, whilst all nine control ponies had at least one lymph node abscess (P=0.0009). Three of the six vaccinated ponies that were protected from strangles had not developed an adverse reaction following vaccination, suggesting that a better understanding of the pro-inflammatory responses to S. equi could lead to the development of a live attenuated vaccine against strangles that is safe for administration via intramuscular injection.

  17. Col2CreERT2, A MOUSE MODEL FOR A CHONDROCYTE-SPECIFIC AND INDUCIBLE GENE DELETION

    PubMed Central

    Chen, M.; Li, S.; Xie, W.; Wang, B.; Chen, D.

    2014-01-01

    In 2007 and 2008, we published two articles reporting a tamoxifen (TM)-inducible, chondrocyte-specific gene-targeting mouse model in which the expression of CreERT2 is driven by the type II collagen promoter (Col2CreERT2). The fusion protein is specifically expressed and translocated into the nucleus upon TM administration, which in turn triggers gene recombination. Since then, this animal model has become a powerful tool to study the molecular mechanism of skeletal development and degenerative cartilage diseases, including knee joint osteoarthritis (OA), temporomandibular joint (TMJ) OA, and intervertebral disc (IVD) degeneration. In this review article, we summarise the application of Col2CreERT2 mice and discuss the potential usage of this animal model in a broad spectrum of cartilage development and molecular pathology studies. PMID:25340803

  18. Col2CreER(T2), a mouse model for a chondrocyte-specific and inducible gene deletion.

    PubMed

    Chen, M; Li, S; Xie, W; Wang, B; Chen, D

    2014-01-01

    In 2007 and 2008, we published two articles reporting a tamoxifen (TM)-inducible, chondrocyte-specific gene-targeting mouse model in which the expression of CreER(T2) is driven by the type II collagen promoter (Col2CreER(T2)). The fusion protein is specifically expressed and translocated into the nucleus upon TM administration, which in turn triggers gene recombination. Since then, this animal model has become a powerful tool to study the molecular mechanism of skeletal development and degenerative cartilage diseases, including knee joint osteoarthritis (OA), temporomandibular joint (TMJ) OA, and intervertebral disc (IVD) degeneration. In this review article, we summarise the application of Col2CreER(T2) mice and discuss the potential usage of this animal model in a broad spectrum of cartilage development and molecular pathology studies. PMID:25340803

  19. AIRE variations in Addison's disease and autoimmune polyendocrine syndromes (APS): partial gene deletions contribute to APS I.

    PubMed

    Bøe Wolff, A S; Oftedal, B; Johansson, S; Bruland, O; Løvås, K; Meager, A; Pedersen, C; Husebye, E S; Knappskog, P M

    2008-03-01

    Autoimmune Addison's disease (AAD) is often associated with other components in autoimmune polyendocrine syndromes (APS). Whereas APS I is caused by mutations in the AIRE gene, the susceptibility genes for AAD and APS II are unclear. In the present study, we investigated whether polymorphisms or copy number variations in the AIRE gene were associated with AAD and APS II. First, nine SNPs in the AIRE gene were analyzed in 311 patients with AAD and APS II and 521 healthy controls, identifying no associated risk. Second, in a subgroup of 25 of these patients, AIRE sequencing revealed three novel polymorphisms. Finally, the AIRE copy number was determined by duplex quantitative PCR in 14 patients with APS I, 161 patients with AAD and APS II and in 39 healthy subjects. In two Scandinavian APS I patients previously reported to be homozygous for common AIRE mutations, we identified large deletions of the AIRE gene covering at least exon 2 to exon 8. We conclude that polymorphisms in the AIRE gene are not associated with AAD and APS II. We further suggest that DNA analysis of the parents of patients found to be homozygous for mutations in AIRE, always should be performed.

  20. Single Gene Deletions of Orexin, Leptin, Neuropeptide Y, and Ghrelin Do Not Appreciably Alter Food Anticipatory Activity in Mice

    PubMed Central

    Gunapala, Keith M.; Gallardo, Christian M.; Hsu, Cynthia T.; Steele, Andrew D.

    2011-01-01

    Timing activity to match resource availability is a widely conserved ability in nature. Scheduled feeding of a limited amount of food induces increased activity prior to feeding time in animals as diverse as fish and rodents. Typically, food anticipatory activity (FAA) involves temporally restricting unlimited food access (RF) to several hours in the middle of the light cycle, which is a time of day when rodents are not normally active. We compared this model to calorie restriction (CR), giving the mice 60% of their normal daily calorie intake at the same time each day. Measurement of body temperature and home cage behaviors suggests that the RF and CR models are very similar but CR has the advantage of a clearly defined food intake and more stable mean body temperature. Using the CR model, we then attempted to verify the published result that orexin deletion diminishes food anticipatory activity (FAA) but observed little to no diminution in the response to CR and, surprisingly, that orexin KO mice are refractory to body weight loss on a CR diet. Next we tested the orexigenic neuropeptide Y (NPY) and ghrelin and the anorexigenic hormone, leptin, using mouse mutants. NPY deletion did not alter the behavior or physiological response to CR. Leptin deletion impaired FAA in terms of some activity measures, such as walking and rearing, but did not substantially diminish hanging behavior preceding feeding time, suggesting that leptin knockout mice do anticipate daily meal time but do not manifest the full spectrum of activities that typify FAA. Ghrelin knockout mice do not have impaired FAA on a CR diet. Collectively, these results suggest that the individual hormones and neuropepetides tested do not regulate FAA by acting individually but this does not rule out the possibility of their concerted action in mediating FAA. PMID:21464907

  1. CONSTRUCTION AND CHARACTERIZATION OF PTA GENE DELETED MUTANT OF C CLOSTRIDIUM TYROBUTYRICUM FOR BUTYRIC ACID FERMENTATION. (R829479C016)

    EPA Science Inventory

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  2. A 'suicide' CRISPR-Cas9 system to promote gene deletion and restoration by electroporation in Cryptococcus neoformans.

    PubMed

    Wang, Yu; Wei, Dongsheng; Zhu, Xiangyang; Pan, Jiao; Zhang, Ping; Huo, Liang; Zhu, Xudong

    2016-08-09

    Loss-of-function mutagenesis is an important tool used to characterize gene functions, and the CRISPR-Cas9 system is a powerful method for performing targeted mutagenesis in organisms that present low recombination frequencies, such as the serotype D strains of Cryptococcus neoformans. However, when the CRISPR-Cas9 system persists in the host cells, off-target effects and Cas9 cytotoxicity may occur, which might block subsequent genetic manipulation. Here, we report a method of spontaneously eliminating the CRISPR-Cas9 system without impairing its robust editing function. We successfully expressed single guide RNA under the driver of an endogenous U6 promoter and the human codon-optimized Cas9 endonuclease with an ACT1 promoter. This system can effectively generate an indel mutation and efficiently perform targeted gene disruption via homology-directed repair by electroporation in yeast. We then demonstrated the spontaneous elimination of the system via a cis arrangement of the CRISPR-Cas9 expression cassettes to the recombination construct. After a system-mediated double crossover, the CRISPR-Cas9 cassettes were cleaved and degraded, which was validated by Southern blotting. This 'suicide' CRISPR-Cas9 system enables the validation of gene functions by subsequent complementation and has the potential to minimize off-target effects. Thus, this technique has the potential for use in functional genomics studies of C. neoformans.

  3. A ‘suicide’ CRISPR-Cas9 system to promote gene deletion and restoration by electroporation in Cryptococcus neoformans

    PubMed Central

    Wang, Yu; Wei, Dongsheng; Zhu, Xiangyang; Pan, Jiao; Zhang, Ping; Huo, Liang; Zhu, Xudong

    2016-01-01

    Loss-of-function mutagenesis is an important tool used to characterize gene functions, and the CRISPR-Cas9 system is a powerful method for performing targeted mutagenesis in organisms that present low recombination frequencies, such as the serotype D strains of Cryptococcus neoformans. However, when the CRISPR-Cas9 system persists in the host cells, off-target effects and Cas9 cytotoxicity may occur, which might block subsequent genetic manipulation. Here, we report a method of spontaneously eliminating the CRISPR-Cas9 system without impairing its robust editing function. We successfully expressed single guide RNA under the driver of an endogenous U6 promoter and the human codon-optimized Cas9 endonuclease with an ACT1 promoter. This system can effectively generate an indel mutation and efficiently perform targeted gene disruption via homology-directed repair by electroporation in yeast. We then demonstrated the spontaneous elimination of the system via a cis arrangement of the CRISPR-Cas9 expression cassettes to the recombination construct. After a system-mediated double crossover, the CRISPR-Cas9 cassettes were cleaved and degraded, which was validated by Southern blotting. This ‘suicide’ CRISPR-Cas9 system enables the validation of gene functions by subsequent complementation and has the potential to minimize off-target effects. Thus, this technique has the potential for use in functional genomics studies of C. neoformans. PMID:27503169

  4. Factorial Invariance in Multiple Populations: A Multiple Testing Procedure

    ERIC Educational Resources Information Center

    Raykov, Tenko; Marcoulides, George A.; Millsap, Roger E.

    2013-01-01

    A multiple testing method for examining factorial invariance for latent constructs evaluated by multiple indicators in distinct populations is outlined. The procedure is based on the false discovery rate concept and multiple individual restriction tests and resolves general limitations of a popular factorial invariance testing approach. The…

  5. Pediatric Multiple Sclerosis.

    PubMed

    Lee, Ji Y; Chitnis, Tanuja

    2016-04-01

    Pediatric multiple sclerosis (MS) is a chronic inflammatory neurologic disease that is challenging to diagnose and treat. Although there are many clinical parallels between pediatric-onset MS and adult-onset MS, there is also accumulating evidence of distinguishing clinical features that may, in part, arise from development-specific, neuroimmune processes governing MS pathogenesis in children. Here the authors describe the clinical features, diagnosis, and treatment of pediatric MS, with a particular focus on describing clinical features and highlighting new developments that promise a better understanding of pediatric MS pathogenesis. An important task that lies ahead for pediatric neurologists is better understanding the early gene-environment interaction that precipitates the first demyelinating event in pediatric MS. This area is of particular importance for understanding the MS etiology and the natural history of pediatric MS. Such understanding should in turn inform new developments in diagnostic tools, long-term therapies, and much-needed biomarkers. Such biomarkers are not only valuable for defining the disease onset, but also for monitoring both the treatment response and a disease evolution that spans multiple decades in children with MS. PMID:27116721

  6. Albumin and multiple sclerosis.

    PubMed

    LeVine, Steven M

    2016-04-12

    Leakage of the blood-brain barrier (BBB) is a common pathological feature in multiple sclerosis (MS). Following a breach of the BBB, albumin, the most abundant protein in plasma, gains access to CNS tissue where it is exposed to an inflammatory milieu and tissue damage, e.g., demyelination. Once in the CNS, albumin can participate in protective mechanisms. For example, due to its high concentration and molecular properties, albumin becomes a target for oxidation and nitration reactions. Furthermore, albumin binds metals and heme thereby limiting their ability to produce reactive oxygen and reactive nitrogen species. Albumin also has the potential to worsen disease. Similar to pathogenic processes that occur during epilepsy, extravasated albumin could induce the expression of proinflammatory cytokines and affect the ability of astrocytes to maintain potassium homeostasis thereby possibly making neurons more vulnerable to glutamate exicitotoxicity, which is thought to be a pathogenic mechanism in MS. The albumin quotient, albumin in cerebrospinal fluid (CSF)/albumin in serum, is used as a measure of blood-CSF barrier dysfunction in MS, but it may be inaccurate since albumin levels in the CSF can be influenced by multiple factors including: 1) albumin becomes proteolytically cleaved during disease, 2) extravasated albumin is taken up by macrophages, microglia, and astrocytes, and 3) the location of BBB damage affects the entry of extravasated albumin into ventricular CSF. A discussion of the roles that albumin performs during MS is put forth.

  7. Smoldering multiple myeloma.

    PubMed

    Gao, Minjie; Yang, Guang; Kong, Yuanyuan; Wu, Xiaosong; Shi, Jumei

    2015-01-01

    Smoldering multiple myeloma (SMM) is an asymptomatic precursor stage of multiple myeloma (MM) characterized by clonal bone marrow plasma cells (BMPC) ≥ 10% and/or M protein level ≥ 30 g/L in the absence of end organ damage. It represents an intermediate stage between monoclonal gammopathy of undetermined significance (MGUS) and symptomatic MM. The risk of progression to symptomatic MM is not uniform, and several parameters have been reported to predict the risk of progression. These include the level of M protein and the percentage of BMPC, the proportion of immunophenotypically aberrant plasma cells, and the presence of immunoparesis, free light-chain (FLC) ratio, peripheral blood plasma cells (PBPC), pattern of serum M protein evolution, abnormal magnetic resonance imaging (MRI), cytogenetic abnormalities, IgA isotype, and Bence Jones proteinuria. So far treatment is still not recommended for SMM, because several trials suggested that patients with SMM do not benefit from early treatment. However, the Mateos et al. trial showed a survival benefit after early treatment with lenalidomide plus dexamethasone in patients with high-risk SMM. This trial has prompted a reevaluation of early treatment in an asymptomatic patient population. PMID:26000300

  8. Smoldering Multiple Myeloma

    PubMed Central

    Gao, Minjie; Yang, Guang; Kong, Yuanyuan; Wu, Xiaosong; Shi, Jumei

    2015-01-01

    Smoldering multiple myeloma (SMM) is an asymptomatic precursor stage of multiple myeloma (MM) characterized by clonal bone marrow plasma cells (BMPC) ≥ 10% and/or M protein level ≥ 30 g/L in the absence of end organ damage. It represents an intermediate stage between monoclonal gammopathy of undetermined significance (MGUS) and symptomatic MM. The risk of progression to symptomatic MM is not uniform, and several parameters have been reported to predict the risk of progression. These include the level of M protein and the percentage of BMPC, the proportion of immunophenotypically aberrant plasma cells, and the presence of immunoparesis, free light-chain (FLC) ratio, peripheral blood plasma cells (PBPC), pattern of serum M protein evolution, abnormal magnetic resonance imaging (MRI), cytogenetic abnormalities, IgA isotype, and Bence Jones proteinuria. So far treatment is still not recommended for SMM, because several trials suggested that patients with SMM do not benefit from early treatment. However, the Mateos et al. trial showed a survival benefit after early treatment with lenalidomide plus dexamethasone in patients with high-risk SMM. This trial has prompted a reevaluation of early treatment in an asymptomatic patient population. PMID:26000300

  9. Smoldering multiple myeloma

    PubMed Central

    Landgren, Ola; Mateos, María-Victoria

    2015-01-01

    Smoldering multiple myeloma (SMM) is an asymptomatic clonal plasma cell disorder. SMM is distinguished from monoclonal gammopathy of undetermined significance by a much higher risk of progression to multiple myeloma (MM). There have been major advances in the diagnosis, prognosis, and management of SMM in the last few years. These include a revised disease definition, identification of several new prognostic factors, a classification based on underlying cytogenetic changes, and new treatment options. Importantly, a subset of patients previously considered SMM is now reclassified as MM on the basis of biomarkers identifying patients with an ≥80% risk of progression within 2 years. SMM has assumed greater significance on the basis of recent trials showing that early therapy can be potentially beneficial to patients. As a result, there is a need to accurately diagnose and risk-stratify patients with SMM, including routine incorporation of modern imaging and laboratory techniques. In this review, we outline current concepts in diagnosis and risk stratification of SMM, and provide specific recommendations on the management of SMM. PMID:25838344

  10. Smoldering multiple myeloma.

    PubMed

    Rajkumar, S Vincent; Landgren, Ola; Mateos, María-Victoria

    2015-05-14

    Smoldering multiple myeloma (SMM) is an asymptomatic clonal plasma cell disorder. SMM is distinguished from monoclonal gammopathy of undetermined significance by a much higher risk of progression to multiple myeloma (MM). There have been major advances in the diagnosis, prognosis, and management of SMM in the last few years. These include a revised disease definition, identification of several new prognostic factors, a classification based on underlying cytogenetic changes, and new treatment options. Importantly, a subset of patients previously considered SMM is now reclassified as MM on the basis of biomarkers identifying patients with an ≥80% risk of progression within 2 years. SMM has assumed greater significance on the basis of recent trials showing that early therapy can be potentially beneficial to patients. As a result, there is a need to accurately diagnose and risk-stratify patients with SMM, including routine incorporation of modern imaging and laboratory techniques. In this review, we outline current concepts in diagnosis and risk stratification of SMM, and provide specific recommendations on the management of SMM. PMID:25838344

  11. Multiple symbol differential detection

    NASA Technical Reports Server (NTRS)

    Divsalar, Dariush (Inventor); Simon, Marvin K. (Inventor)

    1991-01-01

    A differential detection technique for multiple phase shift keying (MPSK) signals is provided which uses a multiple symbol observation interval on the basis of which a joint decision is made regarding the phase of the received symbols. In accordance with the invention, a first difference phase is created between first and second received symbols. Next, the first difference phase is correlated with the possible values thereof to provide a first plurality of intermediate output signals. A second difference phase is next created between second and third received symbols. The second difference phase is correlated with plural possible values thereof to provide a second plurality of intermediate output signals. Next, a third difference phase is created between the first and third symbols. The third difference phase is correlated with plural possible values thereof to provide a third plurality of intermediate output signals. Each of the first plurality of intermediate outputs are combined with each of the second plurality of intermediate outputs and each of the third plurality of intermediate outputs to provide a plurality of possible output values. Finally, a joint decision is made by choosing from the plurality of possible output values the value which represents the best combined correlation of the first, second and third difference values with the possible values thereof.

  12. Multiple organ dysfunction syndrome.

    PubMed

    Ramírez, Michelle

    2013-01-01

    Initially known as multiple system organ failure, the term multiple organ dysfunction syndrome (MODS) was first described in the 1960s in adults with bleeding, respiratory failure, and sepsis. It is defined as "the development of potentially reversible physiologic derangement involving two or more organ systems not involved in the disorder that resulted in ICU admission, and arising in the wake of a potentially life threatening physiologic insult."(3) There are many risk factors predisposing to MODS; however, the most common risk factors are shock due to any cause, sepsis, and tissue hypoperfusion. A dysregulated immune response, or immuneparalysis, in which the homeostasis between pro-inflammatory and anti-inflammatory reaction is lost is thought to be key in the development of MODS. The clinical course and evolution of MODS is dependent on a combination of acquired and genetic factors. There are several nonspecific therapies for the prevention and resolution of MODS, mostly care is supportive. Mortality from MODS in septic pediatric patients varies between 11% and 54%.

  13. Multiple capillary biochemical analyzer

    DOEpatents

    Dovichi, Norman J.; Zhang, Jian Z.

    1995-01-01

    A multiple capillary analyzer allows detection of light from multiple capillaries with a reduced number of interfaces through which light must pass in detecting light emitted from a sample being analyzed, using a modified sheath flow cuvette. A linear or rectangular array of capillaries is introduced into a rectangular flow chamber. Sheath fluid draws individual sample streams through the cuvette. The capillaries are closely and evenly spaced and held by a transparent retainer in a fixed position in relation to an optical detection system. Collimated sample excitation radiation is applied simultaneously across the ends of the capillaries in the retainer. Light emitted from the excited sample is detected by the optical detection system. The retainer is provided by a transparent chamber having inward slanting end walls. The capillaries are wedged into the chamber. One sideways dimension of the chamber is equal to the diameter of the capillaries and one end to end dimension varies from, at the top of the chamber, slightly greater than the sum of the diameters of the capillaries to, at the bottom of the chamber, slightly smaller than the sum of the diameters of the capillaries. The optical system utilizes optic fibres to deliver light to individual photodetectors, one for each capillary tube. A filter or wavelength division demultiplexer may be used for isolating fluorescence at particular bands.

  14. Multiple capillary biochemical analyzer

    DOEpatents

    Dovichi, N.J.; Zhang, J.Z.

    1995-08-08

    A multiple capillary analyzer allows detection of light from multiple capillaries with a reduced number of interfaces through which light must pass in detecting light emitted from a sample being analyzed, using a modified sheath flow cuvette. A linear or rectangular array of capillaries is introduced into a rectangular flow chamber. Sheath fluid draws individual sample streams through the cuvette. The capillaries are closely and evenly spaced and held by a transparent retainer in a fixed position in relation to an optical detection system. Collimated sample excitation radiation is applied simultaneously across the ends of the capillaries in the retainer. Light emitted from the excited sample is detected by the optical detection system. The retainer is provided by a transparent chamber having inward slanting end walls. The capillaries are wedged into the chamber. One sideways dimension of the chamber is equal to the diameter of the capillaries and one end to end dimension varies from, at the top of the chamber, slightly greater than the sum of the diameters of the capillaries to, at the bottom of the chamber, slightly smaller than the sum of the diameters of the capillaries. The optical system utilizes optic fibers to deliver light to individual photodetectors, one for each capillary tube. A filter or wavelength division demultiplexer may be used for isolating fluorescence at particular bands. 21 figs.

  15. Albumin and multiple sclerosis.

    PubMed

    LeVine, Steven M

    2016-01-01

    Leakage of the blood-brain barrier (BBB) is a common pathological feature in multiple sclerosis (MS). Following a breach of the BBB, albumin, the most abundant protein in plasma, gains access to CNS tissue where it is exposed to an inflammatory milieu and tissue damage, e.g., demyelination. Once in the CNS, albumin can participate in protective mechanisms. For example, due to its high concentration and molecular properties, albumin becomes a target for oxidation and nitration reactions. Furthermore, albumin binds metals and heme thereby limiting their ability to produce reactive oxygen and reactive nitrogen species. Albumin also has the potential to worsen disease. Similar to pathogenic processes that occur during epilepsy, extravasated albumin could induce the expression of proinflammatory cytokines and affect the ability of astrocytes to maintain potassium homeostasis thereby possibly making neurons more vulnerable to glutamate exicitotoxicity, which is thought to be a pathogenic mechanism in MS. The albumin quotient, albumin in cerebrospinal fluid (CSF)/albumin in serum, is used as a measure of blood-CSF barrier dysfunction in MS, but it may be inaccurate since albumin levels in the CSF can be influenced by multiple factors including: 1) albumin becomes proteolytically cleaved during disease, 2) extravasated albumin is taken up by macrophages, microglia, and astrocytes, and 3) the location of BBB damage affects the entry of extravasated albumin into ventricular CSF. A discussion of the roles that albumin performs during MS is put forth. PMID:27067000

  16. The Functions of Multiple Representations.

    ERIC Educational Resources Information Center

    Ainsworth, Shaaron

    1999-01-01

    Discusses multiple representations and multimedia learning environments; describes a functional taxonomy of MERs (multiple external representations); and considers how MERs are used to support cognitive processes in learning and problem solving with computers. (Contains 41 references.) (Author/LRW)

  17. Sesterterpene ophiobolin biosynthesis involving multiple gene clusters in Aspergillus ustus

    PubMed Central

    Chai, Hangzhen; Yin, Ru; Liu, Yongfeng; Meng, Huiying; Zhou, Xianqiang; Zhou, Guolin; Bi, Xupeng; Yang, Xue; Zhu, Tonghan; Zhu, Weiming; Deng, Zixin; Hong, Kui

    2016-01-01

    Terpenoids are the most diverse and abundant natural products among which sesterterpenes account for less than 2%, with very few reports on their biosynthesis. Ophiobolins are tricyclic 5–8–5 ring sesterterpenes with potential pharmaceutical application. Aspergillus ustus 094102 from mangrove rizhosphere produces ophiobolin and other terpenes. We obtained five gene cluster knockout mutants, with altered ophiobolin yield using genome sequencing and in silico analysis, combined with in vivo genetic manipulation. Involvement of the five gene clusters in ophiobolin synthesis was confirmed by investigation of the five key terpene synthesis relevant enzymes in each gene cluster, either by gene deletion and complementation or in vitro verification of protein function. The results demonstrate that ophiobolin skeleton biosynthesis involves five gene clusters, which are responsible for C15, C20, C25, and C30 terpenoid biosynthesis. PMID:27273151

  18. Screening and testing in multiples.

    PubMed

    Evans, Mark I; Andriole, Stephanie

    2010-09-01

    The same principles for diagnosis and screening in singleton pregnancies apply to multiples. However, there can be significant differences in the safety and efficacy of all approaches with multiple gestations. This article deals with specific aspects of screening in multiple pregnancies.

  19. Bayes multiple decision functions.

    PubMed

    Wu, Wensong; Peña, Edsel A

    2013-01-01

    This paper deals with the problem of simultaneously making many (M) binary decisions based on one realization of a random data matrix X. M is typically large and X will usually have M rows associated with each of the M decisions to make, but for each row the data may be low dimensional. Such problems arise in many practical areas such as the biological and medical sciences, where the available dataset is from microarrays or other high-throughput technology and with the goal being to decide which among of many genes are relevant with respect to some phenotype of interest; in the engineering and reliability sciences; in astronomy; in education; and in business. A Bayesian decision-theoretic approach to this problem is implemented with the overall loss function being a cost-weighted linear combination of Type I and Type II loss functions. The class of loss functions considered allows for use of the false discovery rate (FDR), false nondiscovery rate (FNR), and missed discovery rate (MDR) in assessing the quality of decision. Through this Bayesian paradigm, the Bayes multiple decision function (BMDF) is derived and an efficient algorithm to obtain the optimal Bayes action is described. In contrast to many works in the literature where the rows of the matrix X are assumed to be stochastically independent, we allow a dependent data structure with the associations obtained through a class of frailty-induced Archimedean copulas. In particular, non-Gaussian dependent data structure, which is typical with failure-time data, can be entertained. The numerical implementation of the determination of the Bayes optimal action is facilitated through sequential Monte Carlo techniques. The theory developed could also be extended to the problem of multiple hypotheses testing, multiple classification and prediction, and high-dimensional variable selection. The proposed procedure is illustrated for the simple versus simple hypotheses setting and for the composite hypotheses setting

  20. MULTIPLE GALAXY COLLISIONS

    NASA Technical Reports Server (NTRS)

    2002-01-01

    Here is a sampling of 15 ultraluminous infrared galaxies viewed by NASA's Hubble Space Telescope. Hubble's sharp vision reveals more complexity within these galaxies, which astronomers are interpreting as evidence of a multiple-galaxy pileup. These images, taken by the Wide Field and Planetary Camera 2, are part of a three-year study of 123 galaxies within 3 billion light-years of Earth. The study was conducted in 1996, 1997, and 1999. False colors were assigned to these photos to enhance fine details within these coalescing galaxies. Credits: NASA, Kirk Borne (Raytheon and NASA Goddard Space Flight Center, Greenbelt, Md.), Luis Colina (Instituto de Fisica de Cantabria, Spain), and Howard Bushouse and Ray Lucas (Space Telescope Science Institute, Baltimore, Md.)

  1. MULTIPLE SPARK GAP SWITCH

    DOEpatents

    Schofield, A.E.

    1958-07-22

    A multiple spark gap switch of unique construction is described which will permit controlled, simultaneous discharge of several capacitors into a load. The switch construction includes a disc electrode with a plurality of protuberances of generally convex shape on one surface. A firing electrode is insulatingly supponted In each of the electrode protuberances and extends substantially to the apex thereof. Individual electrodes are disposed on an insulating plate parallel with the disc electrode to form a number of spark gaps with the protuberances. These electrodes are each connected to a separate charged capacitor and when a voltage ls applied simultaneously between the trigger electrodes and the dlsc electrode, each spark gap fires to connect its capacitor to the disc electrode and a subsequent load.

  2. Multiple asteroid rendezvous missions

    NASA Technical Reports Server (NTRS)

    Bender, D. F.; Friedlander, A. L.

    1979-01-01

    Asteroid missions, centered on multiple asteroid rendezvous missions to main belt asteroids, are discussed and the required solar electric propulsion for these missions as well as the current performance estimates are examined. A brief statistical analysis involving asteroid availability transfer requirements and propulsion system capabilities is given, leading to a prediction that 5 to 8 asteroids can be encountered with a single launch. Measurement techniques include visual imaging, radio tracking, magnetometry, and in the case of landers, seismometry. The spacecraft will be propelled by a solar electric system with a power level of 25 kW to 40 kW and tour possibilities for 13 different asteroids have been developed. Preliminary estimates of asteroid triaxiality are made to calculate the effect of close orbits.

  3. Multiple-port valve

    DOEpatents

    Doody, Thomas J.

    1978-08-22

    A multiple-port valve assembly is designed to direct flow from a primary conduit into any one of a plurality of secondary conduits as well as to direct a reverse flow. The valve includes two mating hemispherical sockets that rotatably receive a spherical valve plug. The valve plug is attached to the primary conduit and includes diverging passageways from that conduit to a plurality of ports. Each of the ports is alignable wih one or more of a plurality of secondary conduits fitted into one of the hemispherical sockets. The other hemispherical socket includes a slot for the primary conduit such that the conduit's motion along that slot with rotation of the spherical plug about various axes will position the valve-plug ports in respect to the secondary conduits.

  4. Multiple detectors "Influence Method".

    PubMed

    Rios, I J; Mayer, R E

    2016-05-01

    The "Influence Method" is conceived for the absolute determination of a nuclear particle flux in the absence of known detector efficiency and without the need to register coincidences of any kind. This method exploits the influence of the presence of one detector in the count rate of another detector, when they are placed one behind the other and define statistical estimators for the absolute number of incident particles and for the efficiency (Rios and Mayer, 2015a). Its detailed mathematical description was recently published (Rios and Mayer, 2015b) and its practical implementation in the measurement of a moderated neutron flux arising from an isotopic neutron source was exemplified in (Rios and Mayer, 2016). With the objective of further reducing the measurement uncertainties, in this article we extend the method for the case of multiple detectors placed one behind the other. The new estimators for the number of particles and the detection efficiency are herein derived.

  5. On multiple Einstein rings

    NASA Astrophysics Data System (ADS)

    Werner, M. C.; An, J.; Evans, N. W.

    2008-12-01

    A number of recent surveys for gravitational lenses have found examples of double Einstein rings. Here, we analytically investigate the occurrence of multiple Einstein rings. We prove, under very general assumptions, that at the most one Einstein ring can arise from a mass distribution in a single plane lensing a single background source. Two or more Einstein rings can therefore only occur in multiplane lensing. Surprisingly, we show that it is possible for a single source to produce more than one Einstein ring. If two point masses, or two isothermal spheres, in different planes are aligned with observer and source on the optical axis, we show that there are up to three Einstein rings. We also discuss the image morphologies for these two models if axisymmetry is broken, and give the first instances of magnification invariants in the case of two-lens planes.

  6. Multiple detectors "Influence Method".

    PubMed

    Rios, I J; Mayer, R E

    2016-05-01

    The "Influence Method" is conceived for the absolute determination of a nuclear particle flux in the absence of known detector efficiency and without the need to register coincidences of any kind. This method exploits the influence of the presence of one detector in the count rate of another detector, when they are placed one behind the other and define statistical estimators for the absolute number of incident particles and for the efficiency (Rios and Mayer, 2015a). Its detailed mathematical description was recently published (Rios and Mayer, 2015b) and its practical implementation in the measurement of a moderated neutron flux arising from an isotopic neutron source was exemplified in (Rios and Mayer, 2016). With the objective of further reducing the measurement uncertainties, in this article we extend the method for the case of multiple detectors placed one behind the other. The new estimators for the number of particles and the detection efficiency are herein derived. PMID:26943904

  7. IRON IN MULTIPLE MYELOMA

    PubMed Central

    VanderWall, Kristina; Daniels-Wells, Tracy R; Penichet, Manuel; Lichtenstein, Alan

    2013-01-01

    Multiple myeloma is a non-curable B cell malignancy in which iron metabolism plays an important role. Patients with this disorder almost universally suffer from a clinically significant anemia, which is often symptomatic, and which is due to impaired iron utilization. Recent studies indicate that the proximal cause of dysregulated iron metabolism and anemia in these patients is cytokine-induced upregulation of hepcidin expression. Malignant myeloma cells are dependent on an increased influx of iron and therapeutic efforts are being made to target this requirement. The studies detailing the characteristics and biochemical abnormalities in iron metabolism causing anemia and the initial attempts to target iron therapeutically are described in this review. PMID:23879589

  8. Swamp Works- Multiple Projects

    NASA Technical Reports Server (NTRS)

    Carelli, Jonathan M.; Schuler, Jason M.; Chandler, Meredith L.

    2013-01-01

    My Surface Systems internship over the summer 2013 session covered a broad range of projects that utilized multiple fields of engineering and technology. This internship included a project to create a command center for a 120 ton regolith bin, for the design and assembly of a blast shield to add further protection for the Surface Systems engineers, for the design and assembly of a portable four monitor hyper wall strip that could extend as large as needed, research and programming a nano drill that could be utilized on a next generation robot or rover, and social media tasks including the making of videos, posting to social networking websites and creation of a new outreach program to help spread the word about the Swamp Works laboratory.

  9. Immunology of Multiple Sclerosis.

    PubMed

    Sospedra, Mireia; Martin, Roland

    2016-04-01

    Multiple sclerosis (MS) is considered a prototypic autoimmune disease of the central nervous system (CNS). A complex genetic background with the HLA-DR15 haplotype as the main genetic risk factor and over 100 mostly immune-related minor risk alleles as well as several environmental factors contribute to the etiology of MS. With respect to pathomechanisms, autoimmune inflammation in early MS is primarily mediated by adaptive immune responses and involves autoreactive T cells, B cells, and antibodies, while the later, chronic stages of MS are characterized by a compartmentalized immune response in the CNS with activated microglia and macrophages. A host of immune cells and mediators can contribute to the autoimmune process, but CNS-related factors such as localization of lesions, vulnerability of oligodendrocytes, neurons/axons, and secondary metabolic changes all play a role in the heterogeneous expression of the disease, including different pathologic lesion patterns, neuroimaging findings, disease courses, and severity and response to treatment. PMID:27116718

  10. Aging and multiple sclerosis.

    PubMed

    Sanai, Shaik Ahmed; Saini, Vasu; Benedict, Ralph Hb; Zivadinov, Robert; Teter, Barbara E; Ramanathan, Murali; Weinstock-Guttman, Bianca

    2016-05-01

    The life expectancy and average age of persons with multiple sclerosis (MS) have increased significantly during the last two decades. The introduction of disease-modifying therapies and a better delineation and understanding of the superimposed comorbidities often diagnosed in MS patients are probably the most important factors accountable for the increase in aging MS population worldwide. Healthcare teams must therefore address the problems arising due to advancing age superimposed on this chronic neurologic disease. In this review, we focus on the physiology of aging, its effects on MS disease course, and the pathological and immunological changes associated with aging and disease progression. Additionally, we discuss the common comorbidities that occur in aging persons with MS that may arise either as a result of the aging process or from relentless chronic MS disease progression as well as the challenges on differentiating the two processes for a more appropriate therapeutic approach. PMID:26895718

  11. Multiple layer insulation cover

    DOEpatents

    Farrell, James J.; Donohoe, Anthony J.

    1981-11-03

    A multiple layer insulation cover for preventing heat loss in, for example, a greenhouse, is disclosed. The cover is comprised of spaced layers of thin foil covered fabric separated from each other by air spaces. The spacing is accomplished by the inflation of spaced air bladders which are integrally formed in the cover and to which the layers of the cover are secured. The bladders are inflated after the cover has been deployed in its intended use to separate the layers of the foil material. The sizes of the material layers are selected to compensate for sagging across the width of the cover so that the desired spacing is uniformly maintained when the cover has been deployed. The bladders are deflated as the cover is stored thereby expediting the storage process and reducing the amount of storage space required.

  12. Mixed Mode Matrix Multiplication

    SciTech Connect

    Meng-Shiou Wu; Srinivas Aluru; Ricky A. Kendall

    2004-09-30

    In modern clustering environments where the memory hierarchy has many layers (distributed memory, shared memory layer, cache,...), an important question is how to fully utilize all available resources and identify the most dominant layer in certain computations. When combining algorithms on all layers together, what would be the best method to get the best performance out of all the resources we have? Mixed mode programming model that uses thread programming on the shared memory layer and message passing programming on the distributed memory layer is a method that many researchers are using to utilize the memory resources. In this paper, they take an algorithmic approach that uses matrix multiplication as a tool to show how cache algorithms affect the performance of both shared memory and distributed memory algorithms. They show that with good underlying cache algorithm, overall performance is stable. When underlying cache algorithm is bad, superlinear speedup may occur, and an increasing number of threads may also improve performance.

  13. Aging and multiple sclerosis.

    PubMed

    Sanai, Shaik Ahmed; Saini, Vasu; Benedict, Ralph Hb; Zivadinov, Robert; Teter, Barbara E; Ramanathan, Murali; Weinstock-Guttman, Bianca

    2016-05-01

    The life expectancy and average age of persons with multiple sclerosis (MS) have increased significantly during the last two decades. The introduction of disease-modifying therapies and a better delineation and understanding of the superimposed comorbidities often diagnosed in MS patients are probably the most important factors accountable for the increase in aging MS population worldwide. Healthcare teams must therefore address the problems arising due to advancing age superimposed on this chronic neurologic disease. In this review, we focus on the physiology of aging, its effects on MS disease course, and the pathological and immunological changes associated with aging and disease progression. Additionally, we discuss the common comorbidities that occur in aging persons with MS that may arise either as a result of the aging process or from relentless chronic MS disease progression as well as the challenges on differentiating the two processes for a more appropriate therapeutic approach.

  14. Vaccines in Multiple Sclerosis.

    PubMed

    Williamson, Eric M L; Chahin, Salim; Berger, Joseph R

    2016-04-01

    Vaccinations help prevent communicable disease. To be valuable, a vaccine's ability to prevent disease must exceed the risk of adverse effects from administration. Many vaccines present no risk of infection as they are comprised of killed or non-infectious components while other vaccines consist of live attenuated microorganisms which carry a potential risk of infection-particularly, in patients with compromised immunity. There are several unique considerations with respect to vaccination in the multiple sclerosis (MS) population. First, there has been concern that vaccination may trigger or aggravate the disease. Second, disease-modifying therapies (DMTs) employed in the treatment of MS may increase the risk of infectious complications from vaccines or alter their efficacy. Lastly, in some cases, vaccination strategies may be part of the treatment paradigm in attempts to avoid complications of therapy. PMID:26922172

  15. Vaccines in Multiple Sclerosis.

    PubMed

    Williamson, Eric M L; Chahin, Salim; Berger, Joseph R

    2016-04-01

    Vaccinations help prevent communicable disease. To be valuable, a vaccine's ability to prevent disease must exceed the risk of adverse effects from administration. Many vaccines present no risk of infection as they are comprised of killed or non-infectious components while other vaccines consist of live attenuated microorganisms which carry a potential risk of infection-particularly, in patients with compromised immunity. There are several unique considerations with respect to vaccination in the multiple sclerosis (MS) population. First, there has been concern that vaccination may trigger or aggravate the disease. Second, disease-modifying therapies (DMTs) employed in the treatment of MS may increase the risk of infectious complications from vaccines or alter their efficacy. Lastly, in some cases, vaccination strategies may be part of the treatment paradigm in attempts to avoid complications of therapy.

  16. Neutron-multiplication measurement instrument

    SciTech Connect

    Nixon, K.V.; Dowdy, E.J.; France, S.W.; Millegan, D.R.; Robba, A.A.

    1982-01-01

    The Advanced Nuclear Technology Group of the Los Alamos National Laboratory is now using intelligent data-acquisition and analysis instrumentation for determining the multiplication of nuclear material. Earlier instrumentation, such as the large NIM-crate systems, depended on house power and required additional computation to determine multiplication or to estimate error. The portable, battery-powered multiplication measurement unit, with advanced computational power, acquires data, calculates multiplication, and completes error analysis automatically. Thus, the multiplication is determined easily and an available error estimate enables the user to judge the significance of results.

  17. Multiple molecular penumbras after focal cerebral ischemia.

    PubMed

    Sharp, F R; Lu, A; Tang, Y; Millhorn, D E

    2000-07-01

    Though the ischemic penumbra has been classically described on the basis of blood flow and physiologic parameters, a variety of ischemic penumbras can be described in molecular terms. Apoptosis-related genes induced after focal ischemia may contribute to cell death in the core and the selective cell death adjacent to an infarct. The HSP70 heat shock protein is induced in glia at the edges of an infarct and in neurons often at some distance from the infarct. HSP70 proteins are induced in cells in response to denatured proteins that occur as a result of temporary energy failure. Hypoxia-inducible factor (HIF) is also induced after focal ischemia in regions that can extend beyond the HSP70 induction. The region of HIF induction is proposed to represent the areas of decreased cerebral blood flow and decreased oxygen delivery. Immediate early genes are induced in cortex, hippocampus, thalamus, and other brain regions. These distant changes in gene expression occur because of ischemia-induced spreading depression or depolarization and could contribute to plastic changes in brain after stroke. PMID:10908035

  18. The Telomerase Inhibitor MST-312 Interferes with Multiple Steps in the Herpes Simplex Virus Life Cycle

    PubMed Central

    Haberichter, Jarod; Roberts, Scott; Abbasi, Imran; Dedthanou, Phonphanh; Pradhan, Prajakta

    2015-01-01

    ABSTRACT The life cycle of herpes simplex virus (HSV) has the potential to be further manipulated to yield novel, more effective therapeutic treatments. Recent research has demonstrated that HSV-1 can increase telomerase activity and that expression of the catalytic component of telomerase, telomerase reverse transcriptase (TERT), alters sensitivity to HSV-dependent apoptosis. Telomerase is a cellular enzyme that synthesizes nucleotide repeats at the ends of chromosomes (telomeres), which prevents shortening of the 3′ ends of DNA with each cell division. Once telomeres reach a critical length, cells undergo senescence and apoptosis. Here, we used a cell-permeable, reversible inhibitor of the telomerase enzyme, MST-312, to investigate telomerase activity during HSV infection. Human mammary epithelial cells immortalized through TERT expression and human carcinoma HEp-2 cells were infected with the KOS1.1 strain of HSV-1 in the presence of MST-312. MST-312 treatment reduced the number of cells displaying a cytopathic effect and the accumulation of immediate early and late viral proteins. Moreover, the presence of 20 μM to 100 μM MST-312 during infection led to a 2.5- to 5.5-log10 decrease in viral titers. MST-312 also inhibited the replication of HSV-2 and a recent clinical isolate of HSV-1. Additionally, we determined that MST-312 has the largest impact on viral events that take place prior to 5 h postinfection (hpi). Furthermore, MST-312 treatment inhibited virus replication, as measured by adsorption assays and quantification of genome replication. Together, these findings demonstrate that MST-312 interferes with the HSV life cycle. Further investigation into the mechanism for MST-312 is warranted and may provide novel targets for HSV therapies. IMPORTANCE Herpes simplex virus (HSV) infections can lead to cold sores, blindness, and brain damage. Identification of host factors that are important for the virus life cycle may provide novel targets for HSV

  19. Multiple valence superatoms.

    PubMed

    Reveles, J U; Khanna, S N; Roach, P J; Castleman, A W

    2006-12-01

    We recently demonstrated that, in gas phase clusters containing aluminum and iodine atoms, an Al(13) cluster behaves like a halogen atom, whereas an Al(14) cluster exhibits properties analogous to an alkaline earth atom. These observations, together with our findings that Al(13)(-) is inert like a rare gas atom, have reinforced the idea that chosen clusters can exhibit chemical behaviors reminiscent of atoms in the periodic table, offering the exciting prospect of a new dimension of the periodic table formed by cluster elements, called superatoms. As the behavior of clusters can be controlled by size and composition, the superatoms offer the potential to create unique compounds with tailored properties. In this article, we provide evidence of an additional class of superatoms, namely Al(7)(-), that exhibit multiple valences, like some of the elements in the periodic table, and hence have the potential to form stable compounds when combined with other atoms. These findings support the contention that there should be no limitation in finding clusters, which mimic virtually all members of the periodic table.

  20. [Smoking and multiple sclerosis].

    PubMed

    Arruti, Maialen; Castillo-Triviño, Tamara; Egüés, Nerea; Olascoaga, Javier

    2015-02-16

    Introduccion. La esclerosis multiple (EM) es una enfermedad autoinmune de etiologia compleja, hoy por hoy desconocida, en la que factores geneticos y ambientales determinan la susceptibilidad. En los ultimos años, el efecto del tabaco ha sido uno de los factores ambientales que ha emergido en la EM, y se ha asociado tanto a un aumento de la susceptibilidad como a un aumento de la progresion. Objetivo. Revisar la evidencia actual sobre el papel del tabaco en la EM. Desarrollo. Se incluye una actualizacion de los estudios publicados que han analizado distintos aspectos del tabaco en la EM: vias patogenicas implicadas, asociacion del tabaco y riesgo de EM, interaccion con otros factores de riesgo y efecto del tabaco en el curso de la enfermedad. Conclusiones. Los estudios observacionales demuestran que el tabaquismo incrementa de forma significativa el riesgo de EM (odds ratio ~ 1,5) y es un factor de riesgo independiente. Sin embargo, la EM es una enfermedad compleja y el aumento de riesgo por el tabaco puede diferir en funcion de la interaccion con otros factores geneticos y ambientales. El papel del tabaco como factor de progresion es mas controvertido, con resultados contradictorios y estudios de gran variabilidad, lo que dificulta establecer una conclusion firme. Los mecanismos por los que el tabaquismo modifica el riesgo y posiblemente la progresion de la enfermedad no son aun conocidos.

  1. Viruses and Multiple Sclerosis

    PubMed Central

    Owens, Gregory P.; Gilden, Don; Burgoon, Mark P.; Yu, Xiaoli; Bennett, Jeffrey L.

    2012-01-01

    Multiple sclerosis (MS) is a chronic demyelinating disorder of unknown etiology, possibly caused by a virus or virus-triggered immunopathology. The virus might reactivate after years of latency and lyse oligodendrocytes, as in progressive multifocal leukoencephalopathy, or initiate immunopathological demyelination, as in animals infected with Theiler’s murine encephalomyelitis virus or coronaviruses. The argument for a viral cause of MS is supported by epidemiological analyses and studies of MS in identical twins, indicating that disease is acquired. However, the most important evidence is the presence of bands of oligoclonal IgG (OCBs) in MS brain and CSF that persist throughout the lifetime of the patient. OCBs are found almost exclusively in infectious CNS disorders, and antigenic targets of OCBs represent the agent that causes disease. Here, the authors review past attempts to identify an infectious agent in MS brain cells and discuss the promise of using recombinant antibodies generated from clonally expanded plasma cells in brain and CSF to identify disease-relevant antigens. They show how this strategy has been used successfully to analyze antigen specificity in subacute sclerosing panencephalitis, a chronic encephalitis caused by measles virus, and in neuromyelitis optica, a chronic autoimmune demyelinating disease produced by antibodies directed against the aquaporin-4 water channel. PMID:22130640

  2. Viruses and Multiple Sclerosis

    PubMed Central

    Virtanen, Jussi Oskari; Jacobson, Steve

    2016-01-01

    Multiple sclerosis (MS) is a heterogeneous disease that develops as an interplay between the immune system and environmental stimuli in genetically susceptible individuals. There is increasing evidence that viruses may play a role in MS pathogenesis acting as these environmental triggers. However, it is not known if any single virus is causal, or rather several viruses can act as triggers in disease development. Here, we review the association of different viruses to MS with an emphasis on two herpesviruses, Epstein-Barr virus (EBV) and human herpesvirus 6 (HHV-6). These two agents have generated the most impact during recent years as possible co-factors in MS disease development. The strongest argument for association of EBV with MS comes from the link between symptomatic infectious mononucleosis and MS and from seroepidemiological studies. In contrast to EBV, HHV-6 has been found significantly more often in MS plaques than in MS normal appearing white matter or non-MS brains and HHV-6 re-activation has been reported during MS clinical relapses. In this review we also suggest new strategies, including the development of new infectious animal models of MS and antiviral MS clinical trials, to elucidate roles of different viruses in the pathogenesis of this disease. Furthermore, we introduce the idea of using unbiased sequence-independent pathogen discovery methodologies, such as next generation sequencing, to study MS brain tissue or body fluids for detection of known viral sequences or potential novel viral agents. PMID:22583435

  3. Neuroimaging in multiple sclerosis.

    PubMed

    Zivadinov, Robert; Cox, Jennifer L

    2007-01-01

    Conventional magnetic resonance imaging (MRI) has routinely been used to improve the accuracy of multiple sclerosis (MS) diagnosis and prognosis. Metrics derived from conventional MRI are now routinely used to detect therapeutic effects and extend clinical observations. However, conventional MRI measures, such as the use of lesion volume and count of gadolinium-enhancing and T2 lesions, have insufficient sensitivity and specificity to reveal the true degree of pathological changes occurring in MS. They cannot distinguish between inflammation, edema, demyelination, Wallerian degeneration, and axonal loss. In addition, they do not show a reliable correlation with clinical measures of disability and do not provide a complete assessment of therapeutic outcomes. Recent neuropathologic studies of typical chronic MS brains reveal macroscopic demyelination in cortical and deep gray matter (GM) that cannot be detected by currently available MRI techniques. Therefore, there is a pressing need for the development of newer MRI techniques to detect these lesions. Newer metrics of MRI analysis, including T1-weighted hypointense lesions, central nervous system atrophy measures, magnetization transfer imaging, magnetic resonance spectroscopy, and diffusion tensor imaging, are able to capture a more global picture of the range of tissue alterations caused by inflammation and neurodegeneration. At this time, they provide the only proof--albeit indirect--that important occult pathology is occurring in the GM. However, evidence is increasing that these nonconventional MRI measures correlate better with both existing and developing neurological impairment and disability when compared to conventional metrics. PMID:17531854

  4. MULTIPLE SHAFT TOOL HEAD

    DOEpatents

    Colbert, H.P.

    1962-10-23

    An improved tool head arrangement is designed for the automatic expanding of a plurality of ferruled tubes simultaneously. A plurality of output shafts of a multiple spindle drill head are driven in unison by a hydraulic motor. A plurality of tube expanders are respectively coupled to the shafts through individual power train arrangements. The axial or thrust force required for the rolling operation is provided by a double acting hydraulic cylinder having a hollow through shaft with the shaft cooperating with an internally rotatable splined shaft slidably coupled to a coupling rigidly attached to the respectlve output shaft of the drill head, thereby transmitting rotary motion and axial thrust simultaneously to the tube expander. A hydraulic power unit supplies power to each of the double acting cylinders through respective two-position, four-way valves, under control of respective solenoids for each of the cylinders. The solenoids are in turn selectively controlled by a tool selection control unit which in turn is controlled by signals received from a programmed, coded tape from a tape reader. The number of expanders that are extended in a rolling operation, which may be up to 42 expanders, is determined by a predetermined program of operations depending upon the arrangement of the ferruled tubes to be expanded in the tube bundle. The tape reader also supplies dimensional information to a machine tool servo control unit for imparting selected, horizontal and/or vertical movement to the tool head assembly. (AEC)

  5. Multiple system atrophy.

    PubMed

    Peeraully, Tasneem

    2014-04-01

    Multiple system atrophy (MSA) is a rare adult-onset synucleinopathy associated with dysautonomia and the variable presence of poorly levodopa-responsive parkinsonism and/or cerebellar ataxia. Other clinical symptoms that can be associated with MSA include hyperreflexia, stridor, sleep apnea, and rapid eye movement sleep behavior disorder (RBD). Mean survival from time of diagnosis ranges between 6 to 10 years, and definitive diagnosis is made on autopsy with demonstration of oligodendroglial cytoplasmic inclusions consisting of fibrillar α-synuclein. Magnetic resonance imaging (MRI) may be positive for cruciform T2 hyperintensity within the pons (the "hot cross bun sign"), volume loss in the pons and cerebellum, and T2 signal loss in the dorsolateral putamen with hyperintense rim on fluid attenuated inversion recovery (FLAIR) sequencing. Although most cases are sporadic, genetic polymorphisms have been identified both in familial and sporadic cases of MSA, and influence observed phenotypes. Treatment is symptomatic, with both pharmacological and nonpharmacological strategies. There are currently no consensus guidelines on management. Current and future research is aimed at identifying biomarkers and developing disease-modifying therapies.

  6. Progressive multiple sclerosis

    PubMed Central

    Ontaneda, Daniel; Fox, Robert J.

    2015-01-01

    Purpose to Review To highlight the pathological features and clinical aspects of progressive multiple sclerosis (PMS). To highlight results of clinical trial experience to date and review ongoing clinical trials and perspective new treatment options. Explain the challenges of clinical trial design in PMS. Recent Findings MS has been identified as a chronic immune mediated disease, and the progressive phase of the disease appears to have significant neurodegenerative mechanisms. The classification of the course of PMS has been re-organized into categories of active vs. inactive inflammatory disease and the presence vs. absence of gradual disease progression. This differentiation allows clearer conceptualization of PMS and possibly even more efficient recruitment of PMS subjects into clinical trials. Clinical trial experience to date in PMS has been negative with anti-inflammatory medications used in relapsing MS. Simvastatin was recently tested in a phase II trial and showed a 43% reduction on annualized atrophy progression in secondary progressive MS. Ongoing PMS trials are currently being conducted with the phosphodiesterase inhibitor ibudilast, S1P modulator siponimod, and anti-B-cell therapy ocrelizumab. Several efforts for development of outcome measures in PMS are ongoing. Summary PMS represents a significant challenge, as the pathogenesis of the disease is not well understood, no validated outcome metrics have been established, and clinical trial experience to date has been disappointing. Advances in the understanding of the disease and lessons learned in previous clinical trials are paving the way for successful development of disease modifying agents for this disease. PMID:25887766

  7. Multiple valence superatoms

    PubMed Central

    Reveles, J. U.; Khanna, S. N.; Roach, P. J.; Castleman, A. W.

    2006-01-01

    We recently demonstrated that, in gas phase clusters containing aluminum and iodine atoms, an Al13 cluster behaves like a halogen atom, whereas an Al14 cluster exhibits properties analogous to an alkaline earth atom. These observations, together with our findings that Al13− is inert like a rare gas atom, have reinforced the idea that chosen clusters can exhibit chemical behaviors reminiscent of atoms in the periodic table, offering the exciting prospect of a new dimension of the periodic table formed by cluster elements, called superatoms. As the behavior of clusters can be controlled by size and composition, the superatoms offer the potential to create unique compounds with tailored properties. In this article, we provide evidence of an additional class of superatoms, namely Al7−, that exhibit multiple valences, like some of the elements in the periodic table, and hence have the potential to form stable compounds when combined with other atoms. These findings support the contention that there should be no limitation in finding clusters, which mimic virtually all members of the periodic table. PMID:17121987

  8. Viruses and multiple sclerosis.

    PubMed

    Owens, Gregory P; Gilden, Don; Burgoon, Mark P; Yu, Xiaoli; Bennett, Jeffrey L

    2011-12-01

    Multiple sclerosis (MS) is a chronic demyelinating disorder of unknown etiology, possibly caused by a virus or virus-triggered immunopathology. The virus might reactivate after years of latency and lyse oligodendrocytes, as in progressive multifocal leukoencephalopathy, or initiate immunopathological demyelination, as in animals infected with Theiler's murine encephalomyelitis virus or coronaviruses. The argument for a viral cause of MS is supported by epidemiological analyses and studies of MS in identical twins, indicating that disease is acquired. However, the most important evidence is the presence of bands of oligoclonal IgG (OCBs) in MS brain and CSF that persist throughout the lifetime of the patient. OCBs are found almost exclusively in infectious CNS disorders, and antigenic targets of OCBs represent the agent that causes disease. Here, the authors review past attempts to identify an infectious agent in MS brain cells and discuss the promise of using recombinant antibodies generated from clonally expanded plasma cells in brain and CSF to identify disease-relevant antigens. They show how this strategy has been used successfully to analyze antigen specificity in subacute sclerosing panencephalitis, a chronic encephalitis caused by measles virus, and in neuromyelitis optica, a chronic autoimmune demyelinating disease produced by antibodies directed against the aquaporin-4 water channel. PMID:22130640

  9. Multiple stage railgun

    DOEpatents

    Hawke, Ronald S.; Scudder, Jonathan K.; Aaland, Kristian

    1982-01-01

    A multiple stage magnetic railgun accelerator (10) for accelerating a projectile (15) by movement of a plasma arc (13) along the rails (11,12). The railgun (10) is divided into a plurality of successive rail stages (10a-n) which are sequentially energized by separate energy sources (14a-n) as the projectile (15) moves through the bore (17) of the railgun (10). Propagation of energy from an energized rail stage back towards the breech end (29) of the railgun (10) can be prevented by connection of the energy sources (14a-n) to the rails (11,12) through isolation diodes (34a-n). Propagation of energy from an energized rail stage back towards the breech end of the railgun can also be prevented by dividing the rails (11,12) into electrically isolated rail sections (11a-n, 12a-n). In such case means (55a-n) are used to extinguish the arc at the end of each energized stage and a fuse (31) or laser device (61) is used to initiate a new plasma arc in the next energized rail stage.

  10. [Diet and multiple sclerosis].

    PubMed

    Pozuelo-Moyano, Beatriz; Benito-León, Julián

    2014-05-16

    Introduccion. El tipo de dieta se ha relacionado con el proceso inflamatorio que forma parte de la esclerosis multiple (EM). En los ultimos años, distintas lineas de investigacion han generado una gran cantidad de conocimiento sobre la participacion de la dieta en la patogenesis de la EM. Objetivo. Elucidar de modo critico las evidencias que relacionan distintos tipos de dietas y alimentos con la EM. Desarrollo. Se incluye una actualizacion de los estudios publicados mas significativos que han analizado el papel de la dieta en la patogenesis y en el tratamiento de la EM. Para explorar la asociacion entre la dieta y el riesgo de EM se ha revisado la evidencia disponible hasta el momento, pasando por estudios observacionales hasta terminar con estudios de intervencion. Conclusiones. Se necesita mas investigacion sobre la nutricion como factor de riesgo, ya que podria tener relacion con la enfermedad, y el control de esta podria llevar a una disminucion significativa de la incidencia o progresion de la patologia.

  11. [Familial multiple cavernomatosis].

    PubMed

    Terriza, F; Amrani, Y; Asencio, J J; Goberna, E; Casado, A; Peralta, J I

    1997-04-01

    We present a family study of multiple cavernomatosis which affected a boy of six, his mother and two brothers. It was seen clinically as epileptic crises, focal neurological defects and frequent headaches. In our case, the condition started as a syndrome of intracranial hypertension with progressive headache and vomiting. During the illness, localizing neurological signs due to bleeding were seen. Amongst these were acute left hemiparesia and paralysis of vertical gaze. Other members of the family remain symptom-free. In a search for angiomas at other sites none were found in the patient or his family. Recently the gene giving rise to the familial cerebral cavernosa malformation has been found to be a locus on chromosome 7. We discuss the findings on neuro-imaging, emphasizing the importance of magnetic resonance (MR) both in diagnosis and finding affected asymptomatic family members, because of its great sensitivity and specificity. Angiography is not a suitable technique for this since they behave as hidden malformations. We also point out its importance as a way of following-up the illness and for evaluation of possible complications due to progressive growth or sudden haemorrhage, which may indicate the need for treatment. Finally we emphasize the different characteristics of MR signals in this type of lesion since cavernomatasa malformations are dynamic lesions. PMID:9172920

  12. Swamp Works- Multiple Projects

    NASA Technical Reports Server (NTRS)

    Carelli, Jonathan M.

    2013-01-01

    My Surface Systems internship over the summer 2013 session covered a broad range of projects that ranged multiple aspects and fields of engineering and technology. This internship included a project to create a command center for a 120 ton regolith bin, a design and build for a blast shield to add further protection for the Surface Systems engineers, a design for a portable four monitor hyper wall that can extend as large as needed, research and programming a nano drill for a next generation robot, and social media tasks including the making of videos, posting to social networking websites and implementation of a new weekly outreach program to help spread the word about the Swamp Works laboratory. The objectives for the command center were to create a central computer controlled area for the still in production lunar regolith bin. It needed to be easy to use and the operating systems had to be Linux. The objectives for the hyper wall were to build a mobile transport of monitors that could potentially attach to one another. It needed to be light but sturdy, and have the ability to last. The objectives for the blast shield included a robust design that could withstand a small equipment malfunction, while also being convenient for use. The objectives for the nano-drill included the research and implementation of programming for vertical and horizontal movement. The hyper wall and blasts shield project were designed by me in the Pro/Engineer/Creo2 software. Each project required a meeting with the Swamp Works engineers and was declared successful.

  13. Multiple epiphyseal dysplasia

    PubMed Central

    2009-01-01

    Background Multiple epiphyseal dysplasia (MED) is a common genetically and clinically heterogeneous skeletal dysplasia characterized by early-onset osteoarthritis, mainly in the hip and knee, and mild-to-moderate short stature. Here we report on a 6-generation MED family with 17 affected members. Method The clinical and radiographic data on the 12 affected members still living were scrutinized. A structured inquiry comprising state of health and MED-related symptoms since birth up to the present time and the osteoarthritis outcome (KOOS) questionnaire were sent to all living family members with MED. The 5 known gene loci for autosomal dominant MED were analyzed for linkage, using fluorescence-labeled microsatellite markers. Linkage was ascertained with markers close to the COL9A2 gene, which was analyzed for mutations by sequencing. Results We identified an exon 3 donor splice mutation in the COL9A2 gene in all affected family members. Clinical, radiographic, and questionnaire data from affected family members suggested that MED caused by COL9A2 mutations starts in early childhood with knee pain accompanied by delayed ossification of femoral epiphyses. The disease then either stabilizes during puberty or progresses with additional joints becoming affected; joint surgery might be necessary. The progression of the disease also affects muscles, with increasing atrophy, resulting in muscle fatigue and pain. Muscular atrophy has not been reported earlier in cases with COL9A2 mutations. Interpretation In a patient with clinically suspected or verified MED, it is important to perform DNA-based analysis to identify a possible disease-causing mutation. This information can be used to carry out genetic risk assessment of other family members and to achieve an early and correct diagnosis in the children. PMID:19995321

  14. Injectable Multiple Sclerosis Medications

    PubMed Central

    Tran, Zung Vu

    2012-01-01

    Although injection-site reactions (ISRs) occur with US Food and Drug Administration–approved injectable disease-modifying therapies (DMTs) for multiple sclerosis, there are currently few reports of real-world data on ISR management strategies or possible correlations between ISRs and patient demographics, disease characteristics, and missed injections. Patient-reported data on the use of DMTs, patient demographic and disease characteristics, missed injections, and ISR reduction strategies were collected via e-mail, a patient registry (www.ms-cam.org), and a Web-based survey. Of the 1380 respondents, 1201 (87%) indicated that they had used injectable DMTs, of whom 377 (31%) had used intramuscular (IM) interferon beta-1a (IFNβ-1a), 172 (14%) had used subcutaneous (SC) IFNβ-1a, 183 (15%) had used SC IFNβ-1b, and 469 (39%) had used glatiramer acetate (GA). The majority of respondents were older (73% were ≥40 years), female (79%), married or living with a partner (72%), white (94%), and nonsmoking (82%). Injection-site reaction incidence, grouped according to severity, varied among DMTs, with IM IFNβ-1a causing significantly (P < .001) fewer mild, moderate, or severe ISRs than the other therapies. Female sex and younger age were significantly (P < .05) associated with more moderate ISRs among users of IM IFNβ-1a, SC IFNβ-1b, and GA. Nonwhites reported severe ISRs more often than whites. For all DMTs injection-site massage and avoidance of sensitive sites were the most frequently used strategies to minimize ISRs. These data may help identify patients with characteristics associated with a higher risk for ISRs, allowing health-care professionals to provide anticipatory guidance to patients at risk for decreased adherence or discontinuation. PMID:24453732

  15. Zinc in Multiple Sclerosis

    PubMed Central

    Frederiksen, Jette Lautrup

    2016-01-01

    In the last 35 years, zinc (Zn) has been examined for its potential role in the disease multiple sclerosis (MS). This review gives an overview of the possible role of Zn in the pathogenesis of MS as well as a meta-analysis of studies having measured Zn in serum or plasma in patients with MS. Searching the databases PubMed and EMBASE as well as going through reference lists in included articles 24 studies were found measuring Zn in patients with MS. Of these, 13 met inclusion criteria and were included in the meta-analysis. The result of the meta-analysis shows a reduction in serum or plasma Zn levels in patients with MS with a 95% CI of [−3.66, −0.93] and a p value of .001 for the difference in Zn concentration in μM. One of six studies measuring cerebrospinal fluid, Zn levels found a significant increase in patients with MS with controls. The studies measuring whole blood and erythrocyte Zn levels found up to several times higher levels of Zn in patients with MS compared with healthy controls with decreasing levels during attacks in relapsing-remitting MS patients. Future studies measuring serum or plasma Zn are encouraged to analyze their data through homogenous MS patient subgroups on especially age, sex, and disease subtype since the difference in serum or plasma Zn in these subgroups have been found to be significantly different. It is hypothesized that local alterations of Zn may be actively involved in the pathogenesis of MS. PMID:27282383

  16. Multiple chronic benign pulmonary nodules.

    PubMed

    Kalifa, L G; Schimmel, D H; Gamsu, G

    1976-11-01

    Four cases are discussed in which were found unusual multiple chronic pulmonary nodules: leiomyomatous hamartomas, rheumatoid nodules, multiple histoplasmomas, and possible multiple plasma cell granulomas (hyalinizing pulmonary nodules). In each case the initial impression of metastic malignancy was countered by more than 2 years' observation, during which time the lesions appeared to be benign. Histologic examination is necessary to exclude malignancy, although a definitive diagnosis may be difficult to establish. PMID:981596

  17. Involvement of two type 2C protein phosphatases BcPtc1 and BcPtc3 in the regulation of multiple stress tolerance and virulence of Botrytis cinerea.

    PubMed

    Yang, Qianqian; Jiang, Jinhua; Mayr, Christiane; Hahn, Matthias; Ma, Zhonghua

    2013-10-01

    Type 2C Ser/Thr phosphatases (PP2Cs) are involved in various cellular processes in many eukaryotes, but little has been known about their functions in filamentous fungi. Botrytis cinerea contains four putative PP2C genes, named BcPTC1, -3, -5, and -6. Biological functions of these genes were analysed by gene deletion and complementation. While no phenotypes aberrant from the wild type were observed with mutants of BcPTC5 and BcPTC6, mutants of BcPTC1 and BcPTC3 had reduced hyphal growth, increased conidiation, and impaired sclerotium development. Additionally, BcPTC1 and BcPTC3 mutants exhibited increased sensitivity to osmotic and oxidative stresses, and to cell wall degrading enzymes. Both mutants exhibited dramatically decreased virulence on host plant tissues. All of the defects were restored by genetic complementation of the mutants with wild-type BcPTC1 and BcPTC3 respectively. Different from what is known in Saccharomyces cerevisiae, BcPtc3, but not BcPtc1, negatively regulates phosphorylation of BcSak1 (the homologue of S. cerevisiae Hog1) in B. cinerea, although both BcPTC1 and BcPTC3 were able to rescue the growth defects of a yeast PTC1 deletion mutant under various stress conditions. These results demonstrated that BcPtc1 and BcPtc3 play important roles in the regulation of multiple stress tolerance and virulence of B. cinerea. PMID:23601355

  18. Multiplicative Thinking: Much More than Knowing Multiplication Facts and Procedures

    ERIC Educational Resources Information Center

    Hurst, Chris; Hurrell, Derek

    2016-01-01

    Multiplicative thinking is accepted as a "big idea" of mathematics that underpins important mathematical concepts such as fraction understanding, proportional reasoning, and algebraic thinking. It is characterised by understandings such as the multiplicative relationship between places in the number system, basic and extended number…

  19. Multiple-hypothesis multiple-model line tracking

    NASA Astrophysics Data System (ADS)

    Pace, Donald W.; Owen, Mark W.; Cox, Henry

    2000-07-01

    Passive sonar signal processing generally includes tracking of narrowband and/or broadband signature components observed on a Lofargram or on a Bearing-Time-Record (BTR) display. Fielded line tracking approaches to date have been recursive and single-hypthesis-oriented Kalman- or alpha-beta filters, with no mechanism for considering tracking alternatives beyond the most recent scan of measurements. While adaptivity is often built into the filter to handle changing track dynamics, these approaches are still extensions of single target tracking solutions to multiple target tracking environment. This paper describes an application of multiple-hypothesis, multiple target tracking technology to the sonar line tracking problem. A Multiple Hypothesis Line Tracker (MHLT) is developed which retains the recursive minimum-mean-square-error tracking behavior of a Kalman Filter in a maximum-a-posteriori delayed-decision multiple hypothesis context. Multiple line track filter states are developed and maintained using the interacting multiple model (IMM) state representation. Further, the data association and assignment problem is enhanced by considering line attribute information (line bandwidth and SNR) in addition to beam/bearing and frequency fit. MHLT results on real sonar data are presented to demonstrate the benefits of the multiple hypothesis approach. The utility of the system in cluttered environments and particularly in crossing line situations is shown.

  20. Bent Bonds and Multiple Bonds.

    ERIC Educational Resources Information Center

    Robinson, Edward A.; Gillespie, Ronald J.

    1980-01-01

    Considers carbon-carbon multiple bonds in terms of Pauling's bent bond model, which allows direct calculation of double and triple bonds from the length of a CC single bond. Lengths of these multiple bonds are estimated from direct measurements on "bent-bond" models constructed of plastic tubing and standard kits. (CS)