Science.gov

Sample records for multiple immediate-early gene-deleted

  1. Properties of a herpes simplex virus multiple immediate-early gene-deleted recombinant as a vaccine vector

    SciTech Connect

    Watanabe, Daisuke; Brockman, Mark A.; Ndung'u, Thumbi; Mathews, Lydia; Lucas, William T.; Murphy, Cynthia G.; Felber, Barbara K.; Pavlakis, George N.; Deluca, Neal A.; Knipe, David M. . E-mail: david_knipe@hms.harvard.edu

    2007-01-20

    Herpes simplex virus (HSV) recombinants induce durable immune responses in rhesus macaques and mice and have induced partial protection in rhesus macaques against mucosal challenge with virulent simian immunodeficiency virus (SIV). In this study, we evaluated the properties of a new generation HSV vaccine vector, an HSV-1 multiple immediate-early (IE) gene deletion mutant virus, d106, which contains deletions in the ICP4, ICP27, ICP22, and ICP47 genes. Because several of the HSV IE genes have been implicated in immune evasion, inactivation of the genes encoding these proteins was expected to result in enhanced immunogenicity. The d106 virus expresses few HSV gene products and shows minimal cytopathic effect in cultured cells. When d106 was inoculated into mice, viral DNA accumulated at high levels in draining lymph nodes, consistent with an ability to transduce dendritic cells and activate their maturation and movement to lymph nodes. A d106 recombinant expressing Escherichia coli {beta}-galactosidase induced durable {beta}-gal-specific IgG and CD8{sup +} T cell responses in naive and HSV-immune mice. Finally, d106-based recombinants have been constructed that express simian immunodeficiency virus (SIV) gag, env, or a rev-tat-nef fusion protein for several days in cultured cells. Thus, d106 shows many of the properties desirable in a vaccine vector: limited expression of HSV gene products and cytopathogenicity, high level expression of transgenes, ability to induce durable immune responses, and an ability to transduce dendritic cells and induce their maturation and migration to lymph nodes.

  2. Reduced expression of the immediate-early protein IE0 enables efficient replication of Autographa californica multiple nucleopolyhedrovirus in poorly permissive Spodoptera littoralis cells.

    PubMed

    Lu, Liqun; Du, Quansheng; Chejanovsky, Nor

    2003-01-01

    Infection of Spodoptera littoralis SL2 cells with the baculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV) results in apoptosis and low yields of viral progeny, in contrast to infection with S. littoralis nucleopolyhedrovirus (SlNPV). By cotransfecting SL2 cells with AcMNPV genomic DNA and a cosmid library representing the complete SlNPV genome, we were able to rescue AcMNPV replication and to isolate recombinant virus vAcSL2, which replicated efficiently in SL2 cells. Moreover, vAcSL2 showed enhanced infectivity for S. littoralis larvae compared to AcMNPV. The genome of vAcSL2 carried a 519-bp insert fragment that increased the distance between the TATA element and the transcriptional initiation site (CAGT) of immediate-early gene ie0. This finding correlated with low steady-state levels of IE0 and higher steady-state levels of IE1 (the product of the ie1 gene, a major AcMNPV transactivator, and a multifunctional protein) than of IE0. Mutagenesis of the ie0 promoter locus by insertion of the chloramphenical acetyltransferase (cat) gene yielded a new recombinant AcMNPV with replication properties identical to those of vAcSL2. Thus, the analysis indicated that increasing the steady-state levels of IE1 relative to IE0 should enable AcMNPV replication in SL2 cells. This suggestion was confirmed by constructing a recombinant AcMNPV bearing an extra copy of the ie1 gene under the control of the Drosophila hsp70 promoter. These results suggest that IE0 plays a role in the regulation of AcMNPV infection and show, for the first time, that significant improvement in the ability of AcMNPV to replicate in a poorly permissive cell line and organism can be achieved by increasing the expression of the main multiple functional protein, IE1.

  3. Equine herpesvirus 1 gene 12 can substitute for vmw65 in the growth of herpes simplex virus (HSV) type 1, allowing the generation of optimized cell lines for the propagation of HSV vectors with multiple immediate-early gene defects.

    PubMed

    Thomas, S K; Lilley, C E; Latchman, D S; Coffin, R S

    1999-09-01

    Herpes simplex virus (HSV) has often been suggested for development as a vector, particularly for the nervous system. Considerable evidence has shown that for use of HSV as a vector, immediate-early (IE) gene expression must be minimized or abolished, otherwise such vectors are likely to be highly cytotoxic. Mutations of vmw65 which abolish IE promoter transactivating activity may also be included to reduce IE gene expression generally. However, when vmw65 mutations are combined with an IE gene deletion, such viruses are hard to propagate, even on cells which otherwise complement the IE gene deletion effectively. We have found that vmw65 mutants can be effectively grown on cell lines expressing equine herpesvirus 1 gene 12, a non-HSV homologue of vmw65 with little sequence similarity to its HSV counterpart. This prevents repair by homologous recombination of vmw65 mutations in the virus, which would occur if mutations were complemented by vmw65 itself. The gene 12 protein is not packaged into HSV virions, which is important if viruses grown on such cells are to be used as vectors. These results not only further strengthen the evidence for direct functional homology between and similar modes of action of the two proteins but have allowed the generation of gene 12-containing cell lines in which ICP4 and ICP27 expression is induced by virus infection (probably by ICP0) and which give efficient growth of viruses deficient in ICP27, ICP4, and vmw65 (the viruses also have ICP34.5/ORFP deleted). Efficient growth of such viruses has not previously been possible. As these viruses are highly deficient in IE gene expression generally, such virus-cell line combinations may provide an alternative to HSV vectors with deletions of all four of the regulatory IE genes which, for optimal growth, require cell lines containing all four IE genes but which are hard to generate due to the intrinsic cytotoxicity of each of the proteins.

  4. Interstitial deletion of 11(p11.2p12): A newly described contiguous gene deletion syndrome involving the gene for hereditary multiple exostoses

    SciTech Connect

    Potocki, L.; Shaffer, L.G.

    1996-03-29

    Individuals with deletions of the proximal portion of the short arm of chromosome 11 share many manifestations including mental retardation, biparietal foramina, minor facial anomalies, and multiple cartilaginous exostoses. The finding of multiple exostoses in these patients is remarkable as the disorder hereditary multiple exostoses, which is inherited in an autosomal dominant manner, has recently been mapped by linkage to three regions, including proximal 11p. We report the clinical and molecular findings in an additional patient with an 11(p11.2p12) deletion. Cytogenetic and molecular analysis demonstrated a de novo, paternally derived deletion for markers which have been shown to be tightly linked to the 11p locus (EXT2). These data support the location of EXT2 within this region and also provide information regarding the ordering of polymorphic markers on 11p. Deletion 11(p11.2p12) is a rare, yet specific, deletion syndrome involving the EXT2 locus, a gene for parietal foramina, and a mental retardation locus, and therefore can be classified as a contiguous gene deletion syndrome. 24 refs., 4 figs., 1 tab.

  5. Serum Leukocyte Immunoglobulin-Like Receptor A3 (LILRA3) Is Increased in Patients with Multiple Sclerosis and Is a Strong Independent Indicator of Disease Severity; 6.7kbp LILRA3 Gene Deletion Is Not Associated with Diseases Susceptibility.

    PubMed

    An, Hongyan; Lim, Chai; Guillemin, Gilles J; Vollmer-Conna, Ute; Rawlinson, William; Bryant, Katherine; Tedla, Nicodemus

    2016-01-01

    Leukocyte immunoglobulin-like receptor A3 (LILRA3) is a soluble immune regulatory molecule primarily expressed by monocytes and macrophages. A homozygous 6.7kbp LILRA3 gene deletion that removes the first seven of its eight exons is predicted to lead to lack of LILRA3 protein, although this has not been experimentally confirmed. Moreover, there are conflicting results with regards to the link between the LILRA3 homozygous genetic deletion and susceptibility to multiple sclerosis (MS) in different European populations. The aim of this study was to investigate whether LILRA3 gene deletion is associated with MS susceptibility in a North American cohort of European ancestry and assess if serum LILRA3 protein level is a marker of clinical subtype and/or disease severity in MS. A total of 456 patients with MS and 99 unrelated healthy controls were genotyped for the 6.7kbp LILRA3 gene deletion and levels of LILRA3 protein in sera determined by in-house sandwich ELISA. We showed that LILRA3 gene deletion was not associated with MS susceptibility and did not affect the age of disease onset, clinical subtype or disease severity. However, we discovered for the first time that homozygous LILRA3 gene deletion results in lack of production of LILRA3 protein. Importantly, LILRA3 protein level was significantly increased in sera of patients with MS when compared with control subjects, particularly in more severe type primary progressive MS. Multiple regression analysis showed that LILRA3 level in serum was one of the strongest independent markers of disease severity in MS, which potentially can be used as a diagnostic marker.

  6. Serum Leukocyte Immunoglobulin-Like Receptor A3 (LILRA3) Is Increased in Patients with Multiple Sclerosis and Is a Strong Independent Indicator of Disease Severity; 6.7kbp LILRA3 Gene Deletion Is Not Associated with Diseases Susceptibility

    PubMed Central

    An, Hongyan; Lim, Chai; Guillemin, Gilles J.; Vollmer-Conna, Ute; Rawlinson, William; Bryant, Katherine; Tedla, Nicodemus

    2016-01-01

    Leukocyte immunoglobulin-like receptor A3 (LILRA3) is a soluble immune regulatory molecule primarily expressed by monocytes and macrophages. A homozygous 6.7kbp LILRA3 gene deletion that removes the first seven of its eight exons is predicted to lead to lack of LILRA3 protein, although this has not been experimentally confirmed. Moreover, there are conflicting results with regards to the link between the LILRA3 homozygous genetic deletion and susceptibility to multiple sclerosis (MS) in different European populations. The aim of this study was to investigate whether LILRA3 gene deletion is associated with MS susceptibility in a North American cohort of European ancestry and assess if serum LILRA3 protein level is a marker of clinical subtype and/or disease severity in MS. A total of 456 patients with MS and 99 unrelated healthy controls were genotyped for the 6.7kbp LILRA3 gene deletion and levels of LILRA3 protein in sera determined by in-house sandwich ELISA. We showed that LILRA3 gene deletion was not associated with MS susceptibility and did not affect the age of disease onset, clinical subtype or disease severity. However, we discovered for the first time that homozygous LILRA3 gene deletion results in lack of production of LILRA3 protein. Importantly, LILRA3 protein level was significantly increased in sera of patients with MS when compared with control subjects, particularly in more severe type primary progressive MS. Multiple regression analysis showed that LILRA3 level in serum was one of the strongest independent markers of disease severity in MS, which potentially can be used as a diagnostic marker. PMID:26871720

  7. The sequence and antiapoptotic functional domains of the human cytomegalovirus UL37 exon 1 immediate early protein are conserved in multiple primary strains.

    PubMed

    Hayajneh, W A; Colberg-Poley, A M; Skaletskaya, A; Bartle, L M; Lesperance, M M; Contopoulos-Ioannidis, D G; Kedersha, N L; Goldmacher, V S

    2001-01-05

    The human cytomegalovirus UL37 exon 1 gene encodes the immediate early protein pUL37x1 that has antiapoptotic and regulatory activities. Deletion mutagenesis analysis of the open reading frame of UL37x1 identified two domains that are necessary and sufficient for its antiapoptotic activity. These domains are confined within the segments between amino acids 5 to 34, and 118 to 147, respectively. The first domain provides the targeting of the protein to mitochondria. Direct PCR sequencing of UL37 exon 1 amplified from 26 primary strains of human cytomegalovirus demonstrated that the promoter, polyadenylation signal, and the two segments of pUL37x1 required for its antiapoptotic function were invariant in all sequenced strains and identical to those in AD169 pUL37x1. In total, UL37 exon 1 varies between 0.0 and 1.6% at the nucleotide level from strain AD169. Only 11 amino acids were found to vary in one or more viral strains, and these variations occurred only in the domains of pUL37x1 dispensable for its antiapoptotic function. We infer from this remarkable conservation of pUL37x1 in primary strains that this protein and, probably, its antiapoptotic function are required for productive replication of human cytomegalovirus in humans.

  8. Multiple immediate-early gene-deficient herpes simplex virus vectors allowing efficient gene delivery to neurons in culture and widespread gene delivery to the central nervous system in vivo.

    PubMed

    Lilley, C E; Groutsi, F; Han, Z; Palmer, J A; Anderson, P N; Latchman, D S; Coffin, R S

    2001-05-01

    Herpes simplex virus (HSV) has several potential advantages as a vector for delivering genes to the nervous system. The virus naturally infects and remains latent in neurons and has evolved the ability of highly efficient retrograde transport from the site of infection at the periphery to the site of latency in the spinal ganglia. HSV is a large virus, potentially allowing the insertion of multiple or very large transgenes. Furthermore, HSV does not integrate into the host chromosome, removing any potential for insertional activation or inactivation of cellular genes. However, the development of HSV vectors for the central nervous system that exploit these properties has been problematical. This has mainly been due to either vector toxicity or an inability to maintain transgene expression. Here we report the development of highly disabled versions of HSV-1 deleted for ICP27, ICP4, and ICP34.5/open reading frame P and with an inactivating mutation in VP16. These viruses express only minimal levels of any of the immediate-early genes in noncomplementing cells. Transgene expression is maintained for extended periods with promoter systems containing elements from the HSV latency-associated transcript promoter (J. A. Palmer et al., J. Virol. 74:5604-5618, 2000). Unlike less-disabled viruses, these vectors allow highly effective gene delivery both to neurons in culture and to the central nervous system in vivo. Gene delivery in vivo is further enhanced by the retrograde transport capabilities of HSV. Here the vector is efficiently transported from the site of inoculation to connected sites within the nervous system. This is demonstrated by gene delivery to both the striatum and substantia nigra following striatal inoculation; to the spinal cord, spinal ganglia, and brainstem following injection into the spinal cord; and to retinal ganglion neurons following injection into the superior colliculus and thalamus.

  9. Site-specific deletions involving the tal-1 and sil genes are restricted to cells of the T cell receptor alpha/beta lineage: T cell receptor delta gene deletion mechanism affects multiple genes

    PubMed Central

    1993-01-01

    Site-specific deletions in the tal-1 gene are reported to occur in 12- 26% of T cell acute lymphoblastic leukemias (T-ALL). So far two main types of tal-1 deletions have been described. Upon analysis of 134 T- ALL we have found two new types of tal-1 deletions. These four types of deletions juxtapose the 5' part of the tal-1 gene to the sil gene promoter, thereby deleting all coding sil exons but leaving the coding tal-1 exons undamaged. The recombination signal sequences (RSS) and fusion regions of the tal-1 deletion breakpoints strongly resemble the RSS and junctional regions of immunoglobulin/T cell receptor (TCR) gene rearrangements, which implies that they are probably caused by the same V(D)J recombinase complex. Analysis of the 134 T-ALL suggested that the occurrence of tal-1 deletions is associated with the CD3 phenotype, because no tal-1 deletions were found in 25 TCR-gamma/delta + T-ALL, whereas 8 of the 69 CD3- T-ALL and 11 of the 40 TCR-alpha/beta + T-ALL contained such a deletion. Careful examination of all TCR genes revealed that tal-1 deletions exclusively occurred in CD3- or CD3+ T- ALL of the alpha/beta lineage with a frequency of 18% in T-ALL with one deleted TCR-delta allele, and a frequency of 34% in T-ALL with TCR- delta gene deletions on both alleles. Therefore, we conclude that alpha/beta lineage commitment of the T-ALL and especially the extent of TCR-delta gene deletions determines the chance of a tal-1 deletion. This suggests that tal-1 deletions are mediated via the same deletion mechanism as TCR-delta gene deletions. PMID:8459224

  10. Transcriptionally active immediate-early protein of pseudorabies virus binds to specific sites on class II gene promoters.

    PubMed Central

    Cromlish, W A; Abmayr, S M; Workman, J L; Horikoshi, M; Roeder, R G

    1989-01-01

    In the presence of partially purified pseudorabies virus immediate-early protein, multiple sites of DNase I protection were observed on the adenovirus major late and human hsp 70 promoters. Southwestern (DNA-protein blot) analysis demonstrated that the immediate-early protein bound directly to the sequences contained in these sites. These sequences share only limited homology, differ in their affinities for the immediate-early protein, and are located at different positions on these two promoters. In addition, the site-specific binding of a temperature-sensitive immediate-early protein was eliminated by the same heat treatment which eliminates its transcriptional activating function, whereas the binding of the wild-type protein was unaffected by heat treatment. Thus, site-specific binding requires a functionally active immediate-early protein. Furthermore, immediate-early-protein-dependent in vitro transcription from the major late promoter was preferentially inhibited by oligonucleotides which are homologous to the high-affinity binding sites on the major late or hsp 70 promoters. These observations suggest that transcriptional stimulation by the immediate-early protein involves binding to cis-acting elements. Images PMID:2539489

  11. Somatic mosaicism for a DMD gene deletion

    SciTech Connect

    Saito, Kayoko; Ikeya, Kiyoko; Kondo, Eri

    1995-03-13

    Mosaicism is a mixed state, with two cell populations of different genetic origins caused by a cell mutation occurring after fertilization. In the present case, DNA analysis of lymphocytes led to a DMD diagnosis before death. Postmortem immunocytochemical and DNA analysis showed somatic mosaicism. At age 18 years, blood lymphocyte DNA analysis showed a DMD gene deletion, upstream from exon 7 to the 5{prime} end containing both muscle and brain promoters. As the patient`s mother and elder sister had no deletions, he was considered to have a new mutation. Immunocytochemical studies of postmortem tissues showed that dystrophin was absent from the tongue, deltoid, intercostal, psoas and rectus femoris muscles, but there was a mix of dystrophin-positive and negative fibers in the rectus abdominis, cardiac, temporalis and sternocleidomastoid muscles. All diaphragm cells were dystrophin positive. Polymerase chain reaction (PCR) amplification from all tissues except the temporalis and sternocleidomastoid muscles, diaphragm and kidney, in which no deletion was found, showed the deletion from at least exon 6 to the 5{prime} end containing both muscle and brain promoters. In this case, a genomic deletion of the DMD gene contributed to the formation of tissues derived from both ectoderm and endoderm, and cells of mesodermal origin showed genotypic and phenotypic heterogeneity. Our results indicate a mutation of the present case may have occurred just before the period of germ layer formation. 34 refs., 7 figs.

  12. Targeted gene deletion in Zygosaccharomyces bailii.

    PubMed

    Mollapour, M; Piper, P

    2001-01-30

    Yeasts of the genus Zygosaccharomyces are notable agents of large-scale food spoilage. Despite the economic importance of these organisms, little is known about the stress adaptations whereby they adapt to many of the more severe conditions of food preservation. In this study it was shown that genes of Z. bailii, a yeast notable for its high resistances to food preservatives and ethanol, can be isolated by complementation of the corresponding mutant strains of Saccharomyces cerevisiae. It was also discovered that the acquisition by S. cerevisiae of a single small Z. bailii gene (ZbYME2) was sufficient for the former yeast to acquire the ability to degrade two major food preservatives, benzoic acid and sorbic acid. Using DNA cassettes containing dominant selectable markers and methods originally developed for performing gene deletions in S. cerevisiae, the two copies of ZbYME2 in the Z. bailii genome were sequentially deleted. The resulting Zbyme2/Zbyme2 homozygous deletant strain had lost any ability to utilize benzoate as sole carbon source and was more sensitive to weak acid preservatives during growth on glucose. Thus, ZbYME2, probably the nuclear gene for a mitochondrial mono-oxygenase function, is essential for Z. bailii to degrade food preservatives. This ability to catabolize weak acid preservatives is a significant factor contributing to the preservative resistance of Z. bailii under aerobic conditions. This study is the first to demonstrate that it is possible to delete in Z. bailii genes that are suspected as being important for growth of this organism in preserved foods and beverages. With the construction of further mutant of Z. bailii strains, a clearer picture should emerge of how this yeast adapts to the conditions of food preservation. This information will, in turn, allow the design of new preservation strategies. GenBank Accession Nos: ZbURA3 (AF279259), ZbTIM9 (AF279260), ZbYME2 (AF279261), ZbTRP1 (AF279262), ZbHHT1(AF296170).

  13. Using Immediate-Early Genes to Map Hippocampal Subregional Functions

    ERIC Educational Resources Information Center

    Kubik, Stepan; Miyashita, Teiko; Guzowski, John F.

    2007-01-01

    Different functions have been suggested for the hippocampus and its subdivisions along both transversal and longitudinal axes. Expression of immediate-early genes (IEGs) has been used to map specific functions onto neuronal activity in different areas of the brain including the hippocampus (IEG imaging). Here we review IEG studies on hippocampal…

  14. Efficient sequential repetitive gene deletions in Neurospora crassa

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Despite its long-standing history as a model organism, Neurospora crassa has limited tools for repetitive gene deletions utilizing recyclable self-excising marker systems. Here we describe, for the first time, the functionality of a bacterial recombination system employing ß-recombinase acting on si...

  15. Infectious bronchitis viruses with naturally occurring genomic rearrangement and gene deletion.

    PubMed

    Hewson, Kylie A; Ignjatovic, Jagoda; Browning, Glenn F; Devlin, Joanne M; Noormohammadi, Amir H

    2011-02-01

    Infectious bronchitis viruses (IBVs) are group III coronaviruses that infect poultry worldwide. Genetic variations, including whole-gene deletions, are key to IBV evolution. Australian subgroup 2 IBVs contain sequence insertions and multiple gene deletions that have resulted in a substantial genomic divergence from international IBVs. The genomic variations present in Australian IBVs were investigated and compared to those of another group III coronavirus, turkey coronavirus (TCoV). Open reading frames (ORFs) found throughout the genome of Australian IBVs were analogous in sequence and position to TCoV ORFs, except for ORF 4b, which appeared to be translocated to a different position in the subgroup 2 strains. Subgroup 2 strains were previously reported to lack genes 3a, 3b and 5a, with some also lacking 5b. Of these, however, genes 3b and 5b were found to be present but contained various mutations that may affect transcription. In this study, it was found that subgroup 2 IBVs have undergone a more substantial genomic rearrangements than previously thought.

  16. Cytomegalovirus immediate early proteins promote stemness properties in glioblastoma

    PubMed Central

    Soroceanu, Liliana; Matlaf, Lisa; Khan, Sabeena; Akhavan, Armin; Singer, Eric; Bezrookove, Vladimir; Decker, Stacy; Ghanny, Saleena; Hadaczek, Piotr; Bengtsson, Henrik; Ohlfest, John; Luciani-Torres, Maria-Gloria; Harkins, Lualhati; Perry, Arie; Guo, Hong; Soteropoulos, Patricia; Cobbs, Charles S

    2015-01-01

    Glioblastoma (GBM) is the most common and aggressive human brain tumor. Human cytomegalovirus (HCMV) immediate early (IE) proteins that are endogenously expressed in GBM cells are strong viral transactivators with onconcogenic properties. Here, we show how HCMV IE are preferentially expressed in glioma stem-like cells (GSC), where they co-localize with the other GBM stemness markers, CD133, Nestin, and Sox2. In patient-derived GSC that are endogenously infected with HCMV, attenuating IE expression by an RNA-i-based strategy, was sufficient to inhibit tumorsphere formation, Sox2 expression, cell cycle progression, and cell survival. Conversely, HCMV infection of HMCV-negative GSC elicited robust self-renewal and proliferation of cells that could be partially reversed by IE attenuation. In HCMV-positive GSC, IE attenuation induced a molecular program characterized by enhanced expression of mesenchymal markers and pro-inflammatory cytokines, resembling the therapeutically-resistant GBM phenotype. Mechanistically, HCMV/IE regulation of Sox2 occurred via inhibition of miRNA-145, a negative regulator of Sox2 protein expression. In a spontaneous mouse model of glioma, ectopic expression of the IE1 gene (UL123) specifically increased Sox2 and Nestin levels in the IE1-positive tumors, upregulating stemness and proliferation markers in vivo. Similarly, human GSC infected with the HCMV strain Towne but not the IE1-deficient strain CR208 showed enhanced growth as tumorspheres and intracranial tumor xenografts, compared to mock-infected human GSC. Overall, our findings offer new mechanistic insights into how HCMV/IE control stemness properties in glioblastoma cells. PMID:26239477

  17. Neuroinflammation and the plasticity-related immediate-early gene Arc

    PubMed Central

    Rosi, Susanna

    2011-01-01

    Neurons exist within a microenvironment that significantly influences their function and survival. While there are many environmental factors that can potentially impact neuronal function, activation of the innate immune system (microglia) is an important element common to many neurological and pathological conditions associated with memory loss. Learning and memory processes rely on the ability of neurons to alter their transcriptional programs in response to synaptic input. Recent advances in cell-based imaging of plasticity-related immediate-early gene (IEG) expression have provided a tool to investigate plasticity-related changes across multiple brain regions. The activity-regulated, cytoskeleton-associated IEG Arc is a regulator of protein synthesis–dependent forms of synaptic plasticity, which are essential for memory formation. Visualisation of Arc provides cellular level resolution for the mapping of neuronal networks. Chronic activation of the innate immune system alters Arc activity patterns, and this may be a mechanism by which it induces the cognitive dysfunction frequently associated with neuroinflammatory conditions. This review discusses the use of Arc expression during activation of the innate immune system as a valid marker of altered plasticity and a predictor of cognitive dysfunction. PMID:21320587

  18. The sub-optimal phenotypes of double-knockout mutants of Escherichia coli depend on the order of gene deletions.†

    PubMed Central

    Gawand, Pratish; Abukar, Fatumina Said; Venayak, Naveen; Partow, Siavash; Motter, Adilson E.; Mahadevan, Radhakrishnan

    2016-01-01

    Metabolic networks are characterized by multiple redundant reactions that do not have a clear biological function. The redundancies in the metabolic networks are implicated in adaptation to random mutations and survival under different environmental conditions. Reactions that are not active under wild-type growth conditions, but get transiently activated after a mutation event such as gene deletion are known as latent reactions. Characterization of multiple-gene knockout mutants can identify the physiological roles of latent reactions. In this study, we characterized double-gene deletion mutants of E. coli with an aim to investigate the sub-optimal physiology of the mutants and the plausible roles of latent reactions. Specifically, we investigated the effects of deletion of the glyoxylate-shunt gene aceA (encoding a latent reaction enzyme, isocitrate lyase) on the growth characteristics of the mutant E. coli Δpgi. The deletion of aceA reduced the growth rate of E. coli Δpgi, indicating that the activation of the glyoxylate shunt plays an important role in adaptation of the mutant E. coli Δpgi. We also investigated the effect of the order of the gene deletions on the growth rates and substrate uptake rates of the double-gene deletion mutants. The results indicate that the order in which genes are deleted determines the phenotype of the mutants during the sub-optimal growth phase. To elucidate the mechanism behind the difference between the observed phenotypes, we carried out transcriptomic analysis and constraint-based modeling of the mutants. Transcriptomic analysis showed differential expression of the gene aceK (encoding the protein isocitrate dehydrogenase kinase) involved in controlling the isocitrate flux through the TCA cycle and the glyoxylate shunt. Higher acetate production in the E. coli ΔaceA1 Δpgi2 mutant was consistent with the increased aceK expression, which limits the TCA cycle flux and causes acetate production via overflow metabolism. PMID

  19. Induction of transcription of {open_quotes}Immediate early genes{close_quotes} by low-dose ionizing radiation

    SciTech Connect

    Prasad, A.V.; Mohan, N.; Chandrasekar, B.; Meltz, M.L.

    1995-09-01

    The induction of transition of specific genes after exposure to ionizing radiation has previously been reported after lethal doses of radiation (2-50 Gy). Little attention has been focused on expression of {open_quotes}immediate early genes{close_quotes} after low doses of ionizing radiation, where cell viability remains high. This dose range (0.25-2.0 Gy) is above the diagnostic dose level but at or below the doses typical for a single exposure in fractionated radiotherapy treatment of cancer. In this study, it was observed that doses in the range of 0.25-2.0 Gy induced different amounts of the mRNAs of the proto-oncogenes c-fos, c-jun, c-myc and c-Ha-ras at a given dose and time in Epstein-Barr virus-transformed human lymphoblastoid 244B cells. A maximum response was seen after a dose of 0.5 Gy for all but c-fos, which showed a maximum response after exposure to 0.25 Gy. Time-course studies demonstrated that the induction was transient, reaching a maximum at 1 h and declining to the constitutive level at 4 h after irradiation. Using second-messenger specific inhibitors, the signaling pathways involved in the induction of these proto-oncogenes was also investigated. The results showed that all four of the proto-oncogenes induced after 0.5 Gy shared a common pathway of tyrosine kinase activation. Other signaling pathways included protein kinase C, reactive oxygen intermediates and calcium-dependent kinases; these were found to be differentially involved in the induction of transcription of the individual proto-oncogenes. In summary, this study suggests that low-dose ionizing radiation (0.25-2.0 Gy) can modulate expression of immediate early genes. Secondly, the activation of immediate early genes after low-dose exposure involves multiple second-messenger signaling pathways. Third, the magnitude of involvement of the different signaling pathways after low-dose radiation is different for each proto-oncogene expressed. 43 refs., 6 figs., 1 tab.

  20. Food-associated cues alter forebrain functional connectivity as assessed with immediate early gene and proenkephalin expression

    PubMed Central

    Schiltz, Craig A; Bremer, Quentin Z; Landry, Charles F; Kelley, Ann E

    2007-01-01

    Background Cues predictive of food availability are powerful modulators of appetite as well as food-seeking and ingestive behaviors. The neurobiological underpinnings of these conditioned responses are not well understood. Monitoring regional immediate early gene expression is a method used to assess alterations in neuronal metabolism resulting from upstream intracellular and extracellular signaling. Furthermore, assessing the expression of multiple immediate early genes offers a window onto the possible sequelae of exposure to food cues, since the function of each gene differs. We used immediate early gene and proenkephalin expression as a means of assessing food cue-elicited regional activation and alterations in functional connectivity within the forebrain. Results Contextual cues associated with palatable food elicited conditioned motor activation and corticosterone release in rats. This motivational state was associated with increased transcription of the activity-regulated genes homer1a, arc, zif268, ngfi-b and c-fos in corticolimbic, thalamic and hypothalamic areas and of proenkephalin within striatal regions. Furthermore, the functional connectivity elicited by food cues, as assessed by an inter-regional multigene-expression correlation method, differed substantially from that elicited by neutral cues. Specifically, food cues increased cortical engagement of the striatum, and within the nucleus accumbens, shifted correlations away from the shell towards the core. Exposure to the food-associated context also induced correlated gene expression between corticostriatal networks and the basolateral amygdala, an area critical for learning and responding to the incentive value of sensory stimuli. This increased corticostriatal-amygdalar functional connectivity was absent in the control group exposed to innocuous cues. Conclusion The results implicate correlated activity between the cortex and the striatum, especially the nucleus accumbens core and the basolateral

  1. The immediate early gene arc/arg3.1: regulation, mechanisms, and function.

    PubMed

    Bramham, Clive R; Worley, Paul F; Moore, Melissa J; Guzowski, John F

    2008-11-12

    In a manner unique among activity-regulated immediate early genes (IEGs), mRNA encoded by Arc (also known as Arg3.1) undergoes rapid transport to dendrites and local synaptic translation. Despite this intrinsic appeal, relatively little is known about the neuronal and behavioral functions of Arc or its molecular mechanisms of action. Here, we attempt to distill recent advances on Arc spanning its transcriptional and translational regulation, the functions of the Arc protein in multiple forms of neuronal plasticity [long-term potentiation (LTP), long-term depression (LTD), and homeostatic plasticity], and its broader role in neural networks of behaving animals. Worley and colleagues have shown that Arc interacts with endophilin and dynamin, creating a postsynaptic trafficking endosome that selectively modifies the expression of AMPA-type glutamate receptors at the excitatory synapses. Both LTD and homeostatic plasticity in the hippocampus are critically dependent on Arc-mediated endocytosis of AMPA receptors. LTD evoked by activation of metabotropic glutamate receptors depends on rapid Arc translation controlled by elongation factor 2. Bramham and colleagues have shown that sustained translation of newly induced Arc mRNA is necessary for cofilin phosphorylation and stable expansion of the F-actin cytoskeleton underlying LTP consolidation in the dentate gyrus of live rats. In addition to regulating F-actin, Arc synthesis maintains the activity of key translation factors during LTP consolidation. This process of Arc-dependent consolidation is activated by the secretory neurotrophin, BDNF. Moore and colleagues have shown that Arc mRNA is a natural target for nonsense-mediated mRNA decay (NMD) by virtue of its two conserved 3'-UTR introns. NMD and other related translation-dependent mRNA decay mechanisms may serve as critical brakes on protein expression that contribute to the fine spatial-temporal control of Arc synthesis. In studies in behaving rats, Guzowski and

  2. Transcriptional dynamics reveal critical roles for non-coding RNAs in the immediate-early response.

    PubMed

    Aitken, Stuart; Magi, Shigeyuki; Alhendi, Ahmad M N; Itoh, Masayoshi; Kawaji, Hideya; Lassmann, Timo; Daub, Carsten O; Arner, Erik; Carninci, Piero; Forrest, Alistair R R; Hayashizaki, Yoshihide; Khachigian, Levon M; Okada-Hatakeyama, Mariko; Semple, Colin A

    2015-04-01

    The immediate-early response mediates cell fate in response to a variety of extracellular stimuli and is dysregulated in many cancers. However, the specificity of the response across stimuli and cell types, and the roles of non-coding RNAs are not well understood. Using a large collection of densely-sampled time series expression data we have examined the induction of the immediate-early response in unparalleled detail, across cell types and stimuli. We exploit cap analysis of gene expression (CAGE) time series datasets to directly measure promoter activities over time. Using a novel analysis method for time series data we identify transcripts with expression patterns that closely resemble the dynamics of known immediate-early genes (IEGs) and this enables a comprehensive comparative study of these genes and their chromatin state. Surprisingly, these data suggest that the earliest transcriptional responses often involve promoters generating non-coding RNAs, many of which are produced in advance of canonical protein-coding IEGs. IEGs are known to be capable of induction without de novo protein synthesis. Consistent with this, we find that the response of both protein-coding and non-coding RNA IEGs can be explained by their transcriptionally poised, permissive chromatin state prior to stimulation. We also explore the function of non-coding RNAs in the attenuation of the immediate early response in a small RNA sequencing dataset matched to the CAGE data: We identify a novel set of microRNAs responsible for the attenuation of the IEG response in an estrogen receptor positive cancer cell line. Our computational statistical method is well suited to meta-analyses as there is no requirement for transcripts to pass thresholds for significant differential expression between time points, and it is agnostic to the number of time points per dataset.

  3. Direct cellobiose production from cellulose using sextuple beta-glucosidase gene deletion Neurospora crassa mutants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Direct cellobiose production from cellulose by a genetically modified fungus—Neurospora crassa, was explored in this study. A library of N. crassa sextuple beta-glucosidase (bgl) gene deletion strains was constructed. Various concentrations of cellobiose were detected in the culture broth of the N. ...

  4. Simple Method for Markerless Gene Deletion in Multidrug-Resistant Acinetobacter baumannii

    PubMed Central

    Oh, Man Hwan; Lee, Je Chul; Kim, Jungmin

    2015-01-01

    The traditional markerless gene deletion technique based on overlap extension PCR has been used for generating gene deletions in multidrug-resistant Acinetobacter baumannii. However, the method is time-consuming because it requires restriction digestion of the PCR products in DNA cloning and the construction of new vectors containing a suitable antibiotic resistance cassette for the selection of A. baumannii merodiploids. Moreover, the availability of restriction sites and the selection of recombinant bacteria harboring the desired chimeric plasmid are limited, making the construction of a chimeric plasmid more difficult. We describe a rapid and easy cloning method for markerless gene deletion in A. baumannii, which has no limitation in the availability of restriction sites and allows for easy selection of the clones carrying the desired chimeric plasmid. Notably, it is not necessary to construct new vectors in our method. This method utilizes direct cloning of blunt-end DNA fragments, in which upstream and downstream regions of the target gene are fused with an antibiotic resistance cassette via overlap extension PCR and are inserted into a blunt-end suicide vector developed for blunt-end cloning. Importantly, the antibiotic resistance cassette is placed outside the downstream region in order to enable easy selection of the recombinants carrying the desired plasmid, to eliminate the antibiotic resistance cassette via homologous recombination, and to avoid the necessity of constructing new vectors. This strategy was successfully applied to functional analysis of the genes associated with iron acquisition by A. baumannii ATCC 19606 and to ompA gene deletion in other A. baumannii strains. Consequently, the proposed method is invaluable for markerless gene deletion in multidrug-resistant A. baumannii. PMID:25746991

  5. Gene deletion in urothelium by specific expression of Cre recombinase.

    PubMed

    Mo, Lan; Cheng, Jin; Lee, Eva Y-H P; Sun, Tung-Tien; Wu, Xue-Ru

    2005-09-01

    Urothelium that lines almost the entire urinary tract acts as a permeability barrier and is involved in the pathogenesis of major urinary diseases, including urothelial carcinoma, urinary tract infection, and interstitial cystitis. However, investigation of urothelial biology and diseases has been hampered by the lack of tissue-specific approaches. To address this deficiency, we sought to develop a urothelium-specific knockout system using the Cre/loxP strategy. Transgenic mouse lines were generated in which a 3.6-kb mouse uroplakin II (UPII) promoter was used to drive the expression of Cre recombinase (Cre). Among the multiple tissues analyzed, Cre was found to be expressed exclusively in the urothelia of the transgenic mice. Crossing a UPII-Cre transgenic line with a ROSA26-LacZ reporter line, in which LacZ expression depends on Cre-mediated deletion of a floxed "stop" sequence, led to LacZ expression only in the urothelium. Gene recombination was also observed when the UPII-Cre line was crossed to an independent line in which a part of the p53 gene was flanked by the loxP sequences (floxed p53). Truncation of the p53 gene and mRNA was observed exclusively in the urothelia of double transgenic mice harboring both the UPII-Cre transgene and the floxed p53 allele. These results demonstrate for the first time the feasibility and potentially wide applicability of the UPII-Cre transgenic mice to inactivate any genes of interest in the urothelium.

  6. Impaired ventilatory acclimatization to hypoxia in mice lacking the immediate early gene fos B.

    PubMed

    Malik, Mohammad T; Peng, Ying-Jie; Kline, David D; Adhikary, Gautam; Prabhakar, Nanduri R

    2005-01-15

    Earlier studies on cell culture models suggested that immediate early genes (IEGs) play an important role in cellular adaptations to hypoxia. Whether IEGs are also necessary for hypoxic adaptations in intact animals is not known. In the present study we examined the potential importance of fos B, an IEG in ventilatory acclimatization to hypoxia. Experiments were performed on wild type and mutant mice lacking the fos B gene. Ventilation was monitored by whole body plethysmography in awake animals. Baseline ventilation under normoxia, and ventilatory response to acute hypoxia and hypercapnia were comparable between wild type and mutant mice. Hypobaric hypoxia (0.4 atm; 3 days) resulted in a significant elevation of baseline ventilation in wild type but not in mutant mice. Wild type mice exposed to hypobaric hypoxia manifested an enhanced hypoxic ventilatory response compared to pre-hypobaric hypoxia. In contrast, hypobaric hypoxia had no effect on the hypoxic ventilatory response in mutant mice. Hypercapnic ventilatory responses, however, were unaffected by hypobaric hypoxia in both groups of mice. These results suggest that the fos B, an immediate early gene, plays an important role in ventilatory acclimatization to hypoxia in mice.

  7. Transcriptional activation of cloned human beta-globin genes by viral immediate-early gene products.

    PubMed

    Green, M R; Treisman, R; Maniatis, T

    1983-11-01

    When the human beta-globin gene is transfected into Hela cells, no beta-globin RNA is detected unless the gene is linked to a viral transcription enhancer. In this paper we show that trans-acting adenovirus and herpesvirus (pseudorabies) transcriptional regulatory proteins can circumvent this enhancer requirement for detectable beta-globin transcription in transient expression assays. The viral gene products can be provided by constitutively expressed, integrated viral genes in established cell lines, by viral infection of permissive cells, or by transfection of cells with bacterial plasmids carrying the viral immediate-early genes. These results demonstrate the utility of transient expression assays for studying regulatory mechanisms involving trans-acting factors. Analysis of beta-globin promoter mutants indicates that between 75 and 128 bp of sequence 5' to the mRNA cap site is required for enhancer-dependent transcription in Hela cells. In contrast, beta-globin transcription in the presence of viral immediate-early gene products requires only 36 bp of 5'-flanking sequence, which includes the TATA box. Thus both cis and trans-acting viral factors activate beta-globin gene transcription in transient expression experiments, but the mechanisms by which they act appear to be fundamentally different.

  8. Large-scale Phenotypic Profiling of Gene Deletion Mutants in Candida glabrata

    PubMed Central

    Tscherner, Michael; Kuchler, Karl

    2016-01-01

    Here, we describe a method enabling the phenotypic profiling of genome-scale deletion collections of fungal mutants to detect phenotypes for various stress conditions. These stress conditions include among many others antifungal drug susceptibility, temperature-induced and osmotic as well as heavy metal or oxidative stress. The protocol was extensively used to phenotype a collection of gene deletion mutants in the human fungal pathogen Candida glabrata (C. glabrata) (Schwarzmüller et al., 2014). PMID:27774498

  9. Effects of G-gene Deletion and Replacement on Rabies Virus Vector Gene Expression

    PubMed Central

    Sato, Sho; Ohara, Shinya; Tsutsui, Ken-Ichiro; Iijima, Toshio

    2015-01-01

    The glycoprotein-gene (G gene) -deleted rabies virus (RV) vector is a powerful tool to examine the function and structure of neural circuits. We previously reported that the deletion of the G gene enhances the transgene expression level of the RV vector. However, the mechanism of this enhancement remains to be clarified. We presume that there are two possible factors for this enhancement. The first factor is the glycoprotein of RV, which shows cytotoxicity; thus, may cause a dysfunction in the translation process of infected cells. The second possible factor is the enhanced expression of the L gene, which encodes viral RNA polymerase. In the RV, it is known that the gene expression level is altered depending on the position of the gene. Since G-gene deletion displaces the L gene in the genome, the expression of the L gene and viral transcription may be enhanced. In this study, we compared the transgene expression level and viral transcription of three recombinant RV vectors. The effect of glycoprotein was examined by comparing the viral gene expression of G-gene-intact RV and G-gene-replaced RV. Despite the fact that the L-gene transcription level of these two RV vectors was similar, the G-gene-replaced RV vector showed higher viral transcription and transgene expression level than the G-gene-intact RV vector. To examine the effect of the position of the L gene, we compared the viral gene expression of the G-gene-deleted RV and G-gene-replaced RV. The G-gene-deleted RV vector showed higher L-gene transcription, viral transcription, and transgene expression level than the G-gene-replaced RV vector. These results indicate that G-gene deletion enhances the transgene expression level through at least two factors, the absence of glycoprotein and enhancement of L-gene expression. These findings enable investigators to design a useful viral vector that shows a controlled desirable transgene expression level in applications. PMID:26023771

  10. Mapping of Brain Activity by Automated Volume Analysis of Immediate Early Genes.

    PubMed

    Renier, Nicolas; Adams, Eliza L; Kirst, Christoph; Wu, Zhuhao; Azevedo, Ricardo; Kohl, Johannes; Autry, Anita E; Kadiri, Lolahon; Umadevi Venkataraju, Kannan; Zhou, Yu; Wang, Victoria X; Tang, Cheuk Y; Olsen, Olav; Dulac, Catherine; Osten, Pavel; Tessier-Lavigne, Marc

    2016-06-16

    Understanding how neural information is processed in physiological and pathological states would benefit from precise detection, localization, and quantification of the activity of all neurons across the entire brain, which has not, to date, been achieved in the mammalian brain. We introduce a pipeline for high-speed acquisition of brain activity at cellular resolution through profiling immediate early gene expression using immunostaining and light-sheet fluorescence imaging, followed by automated mapping and analysis of activity by an open-source software program we term ClearMap. We validate the pipeline first by analysis of brain regions activated in response to haloperidol. Next, we report new cortical regions downstream of whisker-evoked sensory processing during active exploration. Last, we combine activity mapping with axon tracing to uncover new brain regions differentially activated during parenting behavior. This pipeline is widely applicable to different experimental paradigms, including animal species for which transgenic activity reporters are not readily available.

  11. Central Renin Injections: Effects on Drinking and Expression of Immediate Early Genes

    NASA Technical Reports Server (NTRS)

    Xu, Zhice; Johnson, Alan Kim

    1998-01-01

    This study investigated the drinking response and the expression of Fos- and Egr-1-immunoreactivity (Fos-ir, Egr-1-ir) in the brain induced by endogenous angiotensin generated by intracerebroventricular (i.c.v.) injection of renin. Renin induced Fos-ir in the subformical organ (SFO), median preoptic (MnPO), supraoptic and paraventricular nuclei (SON and PVN), area postrema (AP), nuclei of the solitary tract (NTS) and lateral parabrachial nuclei (LPBN). Renin-induced Egr-1-ir exhibited a similar pattern of distribution as that observed for Fos-ir. The dose of i.c.v. renin that induced expression of immediate early gene (IEG) product immunoreactivity also produced vigorous drinking. When renin-injected rats were pretreated with captopril, an angiotensin converting enzyme inhibitor, drinking was blocked. With the same captopril pretreatment, both Fos- and Egr-1-ir in the SFO, MnPO, SON, PVN, AP and LPBN were also significantly reduced.

  12. Evidence of gene deletion of p21 (WAF1/CIP1), a cyclin-dependent protein kinase inhibitor, in thyroid carcinomas.

    PubMed Central

    Shi, Y.; Zou, M.; Farid, N. R.; al-Sedairy, S. T.

    1996-01-01

    Eukaryotic cell cycle progression is controlled by a host of cyclin/cyclin-dependent kinases (Cdks), that are themselves regulated by multiple factors, including a group of small cyclin-Cdk inhibitor proteins (p15, p16, p21 and p27). The involvement of Cdk inhibitors in carcinogenesis has been demonstrated by the studies of p16. p53 is frequently mutated in thyroid carcinomas and p21/Waf1 is a downstream effector of p53. It is conceivable that genetic defects of genes downstream in the p53 pathway could also be oncogenic. We, therefore, examined a series of 57 thyroid tumour specimens (eight follicular adenomas and 49 carcinomas) for deletion and point mutation of the p21/Waf1 gene. Three different kinds of deletions ranging from 349 to 450 bp were detected in five papillary carcinoma specimens by reverse transcription-polymerase chain reaction (RT-PCR). All the deletions were involved in the second exon of the p21/Waf1 gene. RT-PCR single strand conformational polymorphism (SSCP) analysis of remaining samples failed to reveal any point mutations in the coding region of the gene, except for a polymorphism at codon 31 (Ser to Arg). Genomic Southern blot analysis did not demonstrate any gene deletion or rearrangement in these samples, indicating abnormal RNA splicing may be involved. Analysis of intron-exon boundary and the coding region of the second exon did not reveal any mutation except for a point mutation (C to G) located 16 bp downstream from the splice donor site of the second intron in three out of five samples with p21/Waf1 deletions. Whether the mutation plays any role in aberrant RNA splicing remains to be determined. Among the five samples with p21/Waf1 gene deletions, none of them simultaneously carried a p53 or retinoblastoma (Rb) gene mutation. No p21/Waf1 abnormality was found in the benign adenomas. Thus, 12.5% (5/40) of thyroid papillary carcinoma specimens harboured p21/Waf1 gene deletions. Our data suggest that p21/Waf1 gene deletion is involved

  13. Gene Deletion Strategy To Examine the Involvement of the Two Chondroitin Lyases in Flavobacterium columnare Virulence

    PubMed Central

    Li, Nan; Qin, Ting; Zhang, Xiao Lin; Huang, Bei; Liu, Zhi Xin; Xie, Hai Xia; Zhang, Jin; McBride, Mark J.

    2015-01-01

    Flavobacterium columnare is an important bacterial pathogen of freshwater fish that causes high mortality of infected fish and heavy economic losses in aquaculture. The pathogenesis of this bacterium is poorly understood, in part due to the lack of efficient methods for genetic manipulation. In this study, a gene deletion strategy was developed and used to determine the relationship between the production of chondroitin lyases and virulence. The F. johnsoniae ompA promoter (PompA) was fused to sacB to construct a counterselectable marker for F. columnare. F. columnare carrying PompA-sacB failed to grow on media containing 10% sucrose. A suicide vector carrying PompA-sacB was constructed, and a gene deletion strategy was developed. Using this approach, the chondroitin lyase-encoding genes, cslA and cslB, were deleted. The ΔcslA and ΔcslB mutants were both partially deficient in digestion of chondroitin sulfate A, whereas a double mutant (ΔcslA ΔcslB) was completely deficient in chondroitin lyase activity. Cells of F. columnare wild-type strain G4 and of the chondroitin lyase-deficient ΔcslA ΔcslB mutant exhibited similar levels of virulence toward grass carp in single-strain infections. Coinfections, however, revealed a competitive advantage for the wild type over the chondroitin lyase mutant. The results indicate that chondroitin lyases are not essential virulence factors of F. columnare but may contribute to the ability of the pathogen to compete and cause disease in natural infections. The gene deletion method developed in this study may be employed to investigate the virulence factors of this bacterium and may have wide application in many other members of the phylum Bacteroidetes. PMID:26253667

  14. Gene deletion strategy to examine the involvement of the two chondroitin lyases in Flavobacterium columnare virulence.

    PubMed

    Li, Nan; Qin, Ting; Zhang, Xiao Lin; Huang, Bei; Liu, Zhi Xin; Xie, Hai Xia; Zhang, Jin; McBride, Mark J; Nie, Pin

    2015-11-01

    Flavobacterium columnare is an important bacterial pathogen of freshwater fish that causes high mortality of infected fish and heavy economic losses in aquaculture. The pathogenesis of this bacterium is poorly understood, in part due to the lack of efficient methods for genetic manipulation. In this study, a gene deletion strategy was developed and used to determine the relationship between the production of chondroitin lyases and virulence. The F. johnsoniae ompA promoter (PompA) was fused to sacB to construct a counterselectable marker for F. columnare. F. columnare carrying PompA-sacB failed to grow on media containing 10% sucrose. A suicide vector carrying PompA-sacB was constructed, and a gene deletion strategy was developed. Using this approach, the chondroitin lyase-encoding genes, cslA and cslB, were deleted. The ΔcslA and ΔcslB mutants were both partially deficient in digestion of chondroitin sulfate A, whereas a double mutant (ΔcslA ΔcslB) was completely deficient in chondroitin lyase activity. Cells of F. columnare wild-type strain G4 and of the chondroitin lyase-deficient ΔcslA ΔcslB mutant exhibited similar levels of virulence toward grass carp in single-strain infections. Coinfections, however, revealed a competitive advantage for the wild type over the chondroitin lyase mutant. The results indicate that chondroitin lyases are not essential virulence factors of F. columnare but may contribute to the ability of the pathogen to compete and cause disease in natural infections. The gene deletion method developed in this study may be employed to investigate the virulence factors of this bacterium and may have wide application in many other members of the phylum Bacteroidetes.

  15. VIP Gene Deletion in Mice Causes Cardiomyopathy Associated with Upregulation of Heart Failure Genes

    SciTech Connect

    Szema, Anthony M.; Hamidi, Sayyed A.; Smith, S. David; Benveniste, Helene; Katare, Rajesh Gopalrao

    2013-05-20

    Vasoactive Intestinal Peptide (VIP), a pulmonary vasodilator and inhibitor of vascular smooth muscle proliferation, is absent in pulmonary arteries of patients with idiopathic pulmonary arterial hypertension (PAH). We previously determined that targeted deletion of the VIP gene in mice leads to PAH with pulmonary vascular remodeling and right ventricular (RV) dilatation. Whether the left ventricle is also affected by VIP gene deletion is unknown. In the current study, we examined if VIP knockout mice (VIP-/-) develop both right (RV) and left ventricular (LV) cardiomyopathy, manifested by LV dilatation and systolic dysfunction, as well as overexpression of genes conducive to heart failure.

  16. Rb and p53 gene deletions in lung adenocarcinomas from irradiated and control mice

    SciTech Connect

    Zhang, Y.; Woloschak, G.E.

    1997-08-01

    This study was conducted on mouse lung adenocarcinoma tissues that were formalin-treated and paraffin-embedded 25 years ago to investigate the large gene deletions of mRb and p53 in B6CF{sub 1} male mice. A total of 80 lung tissue samples from irradiated mice and 40 lung samples from nonirradiated controls were randomly selected and examined in the mRb portion of this study. The results showed a significant (P < 0.05) higher percentage of mRb deletions in lung adenocarcinomas from mice exposed to 60 once-weekly {gamma}-ray doses than those from mice receiving 24 once-weekly {gamma}-ray doses at low doses and low dose rates; however, the percentage was not significantly different (P > 0.05) from that for spontaneous lung adenocarcinomas or lung adenocarcinomas from mice exposed to single-dose {gamma} irradiation at a similar total dose. mRb fragments 3 (71%) and 5 (67%), the parts of the gene that encoded the pocket binding region of Rb protein to adenovirus E1A and SV40 T-antigen, were the most frequently deleted fragments. p53 gene deletion analysis was carried out on normal lungs and lung adenocarcinomas that were initially found to bear mRb deletions. Exons 1,4,5,6, and 9 were chosen to be analyzed.

  17. Efficient BLG-Cre mediated gene deletion in the mammary gland.

    PubMed

    Selbert, S; Bentley, D J; Melton, D W; Rannie, D; Lourenço, P; Watson, C J; Clarke, A R

    1998-09-01

    Using the phage P1-derived Cre/loxP recombination system, we have developed a strategy for efficient mammary tissue specific inactivation of floxed genes. Transgenic mice were generated which express Cre DNA-recombinase under the control of the mammary gland specific promoter of the ovine beta-lactoglobulin (BLG) gene. To test the specificity of Cre mediated recombination, we crossed these mice to animals harbouring a floxed DNA ligase I allele. We show that the BLG-Cre construct specifies mammary specific gene deletion, and furthermore that it is temporally regulated, predominantly occurring during lactation. We fully characterised the extent of gene deletion in one line (line 74). In this strain the virgin gland is characterised by low levels (7%) of Cre mediated deletion, whereas 70-80% of cells within the lactating mammary gland have undergone recombination. Immunohistochemistry and indirect in situ PCR were used respectively to demonstrate that both Cre protein and Cre activity were evenly distributed throughout the population of secretory epithelial cells. The level of background recombination in non-mammary tissues was found to be < or = 1.1%, irrespective of mammary gland developmental status. Crossing the transgenic BLG-Cre strain described here to mice harbouring other floxed alleles will facilitate the functional analysis of those genes during differentiation and development of the mammary gland.

  18. Defined single-gene and multi-gene deletion mutant collections in Salmonella enterica sv Typhimurium.

    PubMed

    Porwollik, Steffen; Santiviago, Carlos A; Cheng, Pui; Long, Fred; Desai, Prerak; Fredlund, Jennifer; Srikumar, Shabarinath; Silva, Cecilia A; Chu, Weiping; Chen, Xin; Canals, Rocío; Reynolds, M Megan; Bogomolnaya, Lydia; Shields, Christine; Cui, Ping; Guo, Jinbai; Zheng, Yi; Endicott-Yazdani, Tiana; Yang, Hee-Jeong; Maple, Aimee; Ragoza, Yury; Blondel, Carlos J; Valenzuela, Camila; Andrews-Polymenis, Helene; McClelland, Michael

    2014-01-01

    We constructed two collections of targeted single gene deletion (SGD) mutants and two collections of targeted multi-gene deletion (MGD) mutants in Salmonella enterica sv Typhimurium 14028s. The SGD mutant collections contain (1), 3517 mutants in which a single gene is replaced by a cassette containing a kanamycin resistance (KanR) gene oriented in the sense direction (SGD-K), and (2), 3376 mutants with a chloramphenicol resistance gene (CamR) oriented in the antisense direction (SGD-C). A combined total of 3773 individual genes were deleted across these SGD collections. The MGD collections contain mutants bearing deletions of contiguous regions of three or more genes and include (3), 198 mutants spanning 2543 genes replaced by a KanR cassette (MGD-K), and (4), 251 mutants spanning 2799 genes replaced by a CamR cassette (MGD-C). Overall, 3476 genes were deleted in at least one MGD collection. The collections with different antibiotic markers permit construction of all viable combinations of mutants in the same background. Together, the libraries allow hierarchical screening of MGDs for different phenotypic followed by screening of SGDs within the target MGD regions. The mutants of these collections are stored at BEI Resources (www.beiresources.org) and publicly available.

  19. A Human Minor Histocompatibility Antigen Resulting from Differential Expression due to a Gene Deletion

    PubMed Central

    Murata, Makoto; Warren, Edus H.; Riddell, Stanley R.

    2003-01-01

    Minor histocompatibility antigens (minor H antigens) are targets of graft-versus-host disease and graft-versus-leukemia responses after allogeneic human leukocyte antigen identical hematopoietic stem cell transplantation. Only a few human minor H antigens have been molecularly characterized and in all cases, amino acid differences between homologous donor and recipient proteins due to nucleotide polymorphisms in the respective genes were responsible for immunogenicity. Here, we have used cDNA expression cloning to identify a novel human minor H antigen encoded by UGT2B17, an autosomal gene in the multigene UDP-glycosyltransferase 2 family that is selectively expressed in liver, intestine, and antigen-presenting cells. In contrast to previously defined human minor H antigens, UGT2B17 is immunogenic because of differential expression of the protein in donor and recipient cells as a consequence of a homozygous gene deletion in the donor. Deletion of individual members of large gene families is a common form of genetic variation in the population and our results provide the first evidence that differential protein expression as a consequence of gene deletion is a mechanism for generating minor H antigens in humans. PMID:12743171

  20. Role of Immediate-Early Genes in Synaptic Plasticity and Neuronal Ensembles Underlying the Memory Trace

    PubMed Central

    Minatohara, Keiichiro; Akiyoshi, Mika; Okuno, Hiroyuki

    2016-01-01

    In the brain, neuronal gene expression is dynamically changed in response to neuronal activity. In particular, the expression of immediate-early genes (IEGs) such as egr-1, c-fos, and Arc is rapidly and selectively upregulated in subsets of neurons in specific brain regions associated with learning and memory formation. IEG expression has therefore been widely used as a molecular marker for neuronal populations that undergo plastic changes underlying formation of long-term memory. In recent years, optogenetic and pharmacogenetic studies of neurons expressing c-fos or Arc have revealed that, during learning, IEG-positive neurons encode and store information that is required for memory recall, suggesting that they may be involved in formation of the memory trace. However, despite accumulating evidence for the role of IEGs in synaptic plasticity, the molecular and cellular mechanisms associated with this process remain unclear. In this review, we first summarize recent literature concerning the role of IEG-expressing neuronal ensembles in organizing the memory trace. We then focus on the physiological significance of IEGs, especially Arc, in synaptic plasticity, and describe our hypotheses about the importance of Arc expression in various types of input-specific circuit reorganization. Finally, we offer perspectives on Arc function that would unveil the role of IEG-expressing neurons in the formation of memory traces in the hippocampus and other brain areas. PMID:26778955

  1. Immediate early transcription activation by salicylic acid via the cauliflower mosaic virus as-1 element.

    PubMed Central

    Qin, X F; Holuigue, L; Horvath, D M; Chua, N H

    1994-01-01

    Transgenic tobacco plants carrying a number of regulatory sequences derived from the cauliflower mosaic virus 35S promoter were tested for their response to treatment with salicylic acid (SA), an endogenous signal involved in plant defense responses. beta-Glucuronidase (GUS) gene fusions with the full-length (-343 to +8) 35S promoter or the -90 truncation were found to be induced by SA. Time course experiments revealed that, in the continuous presence of SA, the -90 promoter construct (-90 35S-GUS) displayed rapid and transient induction kinetics, with maximum RNA levels at 1 to 4 hr, which declined to low levels by 24 hr. Induction was still apparent in the presence of the protein synthesis inhibitor cycloheximide (CHX). Moreover, mRNA levels continued to accumulate over 24 hr rather than to decline. By contrast, mRNA from the endogenous pathogenesis-related protein-1a (PR-1a) gene began to accumulate at later times during SA treatment and steadily increased through 24 hr; transcription of this gene was almost completely blocked by the presence of CHX. Further dissection of the region from -90 and -46 of the 35S promoter revealed that the SA-responsive element corresponds to the previously characterized activation sequence-1 (as-1). These results represent a definitive analysis of immediate early responses to SA, relative to the late induction of PR genes, and potentially elucidate the early events of SA signal transduction during the plant defense response. PMID:8061520

  2. Mapping vocalization-related immediate early gene expression in echolocating bats

    PubMed Central

    Schwartz, Christine P.; Smotherman, Michael S.

    2011-01-01

    Recent studies of spontaneously vocalizing primates, cetaceans, bats and rodents suggests these animals possess a limited but meaningful capacity to manipulate the timing and acoustic structure of their vocalizations, yet the neural substrate for even the simplest forms of vocal modulation in mammals remains unknown. Echolocating bats rapidly and routinely manipulate the acoustic structure of their outgoing vocalizations to improve echolocation efficiency, reflecting cognitive rather than limbic control of the vocal motor pathways. In this study, we used immunohistochemical localization of immediate early gene (c-fos) expression to map neural activity in the brains of spontaneously echolocating stationary Mexican free-tailed bats. Our results support the current model of vocal control obtained largely through microstimulation studies, but also provide evidence for the contributions of two novel regions, the dorsolateral caudate nucleus and mediodorsal thalamic nucleus, which together suggest a striatothalamic feedback loop may be involved in the control of echolocation pulse production. Additionally, we found evidence of a motivation pathway, including the lateral habenula, substantia nigra pars compacta, and raphe nuclei. These data provide novel insights into where and how mammalian vocalizations may be regulated by sensory, contextual and motivational cues. PMID:21726584

  3. Cloning and localization of immediate early response 2 (ier2) gene in the brain of medaka.

    PubMed

    Moriya, Shogo; Chourasia, Dipti; Ng, Kai We; Khel, Nazmina Bahadur; Parhar, Ishwar S

    2016-11-01

    Immediate early response (IER) 2 gene, a member of the IER family, is a gene of unknown function which is affected by external stimuli in the brain. In the present study, the full length sequence and localization of medaka (Oryzias latipes) ier2 was investigated in the brain to understand the functions of Ier2 in the future studies. The full length sequence of medaka ier2 was identified using a 3'-, 5'- rapid amplification of cDNA ends method, and distribution in the brain was identified using in situ hybridization. The identified full length ier2 mRNA consisted of 939 nucleotides spanning along 1 exon. The deduced amino acid sequence consisted of 171 amino acid residues which contains a highly conserved sequence, nuclear localization signal. ier2 mRNA was distributed in the telencephalon, midbrain and the hypothalamus. This highly conserved primary response gene Ier2 can be used to visualize and map functionally activated neuronal circuitry in the brain of medaka.

  4. Modeling the Kinetics of a Memory-Associated Immediate Early Gene's Compartmental Expression After Sensory Experience

    NASA Astrophysics Data System (ADS)

    Willats, Adam; Ivanova, Tamara; Prinz, Astrid; Liu, Robert

    2015-03-01

    Immediate Early Genes (IEGs) are rapidly and transiently transcribed in neurons after a sensory experience. Some of these genes act as effector IEGs, which mediate specific effects on cellular function. Arc is one such effector IEG that is essential for synaptic plasticity and memory consolidation in hippocampus and cortex. The expression of Arc in neurons has previously been examined using an imaging method known as Compartmental Analysis of Temporal Fluorescent In-Situ Hybridization. Previous work found that the time course of Arc expression within the nuclear and perinuclear cytoplasmic compartments of a neuron is altered by prior sensory experience. We explore a simple model of the kinetics of IEG transcription and nuclear export, with the aim of eventually uncovering possible mechanisms for how experience alters expression kinetics. Thus far, we characterize our compartmental model using phase-plane analysis and validate it against several IEG expression data sets, including one where prior experience with vocalizing mice alters the time course of call-induced Arc expression in the auditory cortex of a listening mouse. Our model provides a framework to explore why Arc expression may change depending on a receiver's past sound experience and internal state. Adam Willats was supported by NIH Training Grant 5T90DA032466. This research was also supported by NIDCD R01 DC8343.

  5. Poly(ADP-ribosyl)ation of a herpes simplex virus immediate early polypeptide

    SciTech Connect

    Preston, C.M.; Notarianni, E.L.

    1983-12-01

    In vitro poly(ADP-ribosyl)ation of the herpes simplex virus type 1 (HSV-1) immediate early polypeptide Vmw175 is reported. The phenomenon was most clearly observed by use of the temperature-sensitive mutant tsK, which overproduces Vmw175 at the nonpermissive temperature (NPT) and has a mutation in the coding sequences for this polypeptide. Nuclei prepared from cells which were infected with tsK at NPT and subsequently downshifted to the permissive temperature incorporated (/sup 32/P)NAD into Vmw175. This reaction did not occur when nuclei were prepared from cells constantly maintained at NPT, showing that only functional Vmw175 can be radiolabeled with (/sup 32/P)NAD. The identity of the acceptor protein was confirmed by demonstrating the expected electrophoretic mobility differences between the HSV-1 and HSV-2 counterparts of Vmw175. The use of suitable inhibitors demonstrated that the reaction represented mono- or poly(ADP-ribosyl)ation, and further analysis showed the presence of long poly(ADP-ribose) chains attached to Vmw175. Poly(ADP-ribosyl)ation may be important as a cause or result of the regulation of viral transcription by Vmw175. Radiolabeling of another virus-specified polypeptide (approximate molecular weight 38,000), thought to be a structural component of the input virus, is also reported.

  6. A Form of Perforant Path LTP Can Occur without ERK1/2 Phosphorylation or Immediate Early Gene Induction

    ERIC Educational Resources Information Center

    Steward, Oswald; Huang, Fen; Guzowski, John F.

    2007-01-01

    Stimulation paradigms that induce perforant path long-term potentiation (LTP) initiate phosphorylation of ERK1/2 and induce expression of a variety of immediate early genes (IEGs). These events are thought to be critical components of the mechanism for establishing the changes in synaptic efficacy that endure for hours or longer. Here we show that…

  7. Expression of the Immediate-Early Gene-Encoded Protein Egr-1 ("zif268") during in Vitro Classical Conditioning

    ERIC Educational Resources Information Center

    Mokin, Maxim; Keifer, Joyce

    2005-01-01

    Expression of the immediate-early genes (IEGs) has been shown to be induced by activity-dependent synaptic plasticity or behavioral training and is thought to play an important role in long-term memory. In the present study, we examined the induction and expression of the IEG-encoded protein Egr-1 during an in vitro neural correlate of eyeblink…

  8. Visualizing changes in circuit activity resulting from denervation and reinnervation using immediate early gene expression.

    PubMed

    Temple, Meredith D; Worley, Paul F; Steward, Oswald

    2003-04-01

    We describe a novel strategy to evaluate circuit function after brain injury that takes advantage of experience-dependent immediate early gene (IEG) expression. When normal rats undergo training or are exposed to a novel environment, there is a strong induction of IEG expression in forebrain regions, including the hippocampus. This gene induction identifies the neurons that are engaged during the experience. Here, we demonstrate that experience-dependent IEG induction is diminished after brain injury in young adult rats (120-200 gm), specifically after unilateral lesions of the entorhinal cortex (EC), and then recovers with a time course consistent with reinnervation. In situ hybridization techniques were used to assess the expression of the activity-regulated cytoskeleton-associated protein Arc at various times after the lesion (4, 8, 12, 16, or 30 d). One group of rats was allowed to explore a complex novel environment for 1 hr; control operated animals remained in their home cage. In unoperated animals, exposure to the novel environment induced Arc mRNA levels in most pyramidal neurons in CA1, in many pyramidal neurons in CA3, and in a small number of dentate granule cells. This characteristic pattern of induction was absent at early time points after unilateral EC lesions (4 and 8 d) but recovered progressively at later time points. The recovery of Arc expression occurred with approximately the same time course as the reinnervation of the dentate gyrus as a result of postlesion sprouting. These results document a novel approach for quantitatively assessing activity-regulated gene expression in polysynaptic circuits after trauma.

  9. HVC lesions modify immediate early gene expression in auditory forebrain regions of female songbirds.

    PubMed

    Lynch, Kathleen S; Kleitz-Nelson, Hayley K; Ball, Gregory F

    2013-04-01

    It is well established that auditory forebrain regions of oscine birds are essential for the encoding of species-typical songs and are, therefore, vital for recognition of song during sociosexual interactions. Regions such as the caudal medial nidopallium (NCM) and the caudal medial mesopallium (CMM) are involved in perceptual processing of song and the formation of auditory memories. There is an additional telencephalic nucleus, however, that has also been implicated in species recognition. This nucleus is HVC, a prominent nucleus that sits at the apex of the song system, and is well known for its critical role in song learning and song production in male songbirds. Here, we explore the functional relationship between auditory forebrain regions (i.e., NCM and CMM) and HVC in female canaries (Serinus canaria). We lesion HVC and examine immediate early gene responses to conspecific song presentation within CMM and NCM to explore whether HVC can modulate auditory responses within these forebrain regions. Our results reveal robust deficits in ZENK-ir in CMM and NCM of HVC-lesioned females when compared with control- and sham-lesioned females, indicating that functional connections exists between HVC and NCM/CMM. Although these connected regions have been implicated in song learning and production in males, they likely serve distinct functions in female songbirds that face the task of song recognition rather than song production. Identifying functional connections between HVC and auditory regions involved in song perception is an essential step toward developing a comprehensive understanding of the neural basis of song recognition.

  10. Efficient sequential repetitive gene deletions in Neurospora crassa employing a self-excising β-recombinase/six cassette.

    PubMed

    Szewczyk, Edyta; Kasuga, Takao; Fan, Zhiliang

    2013-03-01

    Despite its long-standing history as a model organism, Neurospora crassa has limited tools for repetitive gene deletions utilizing recyclable self-excising marker systems. Here we describe, for the first time, the functionality of a bacterial recombination system employing β-recombinase acting on six recognition sequences (β-rec/six) in N. crassa, which allowed repetitive site-specific gene deletion and marker recycling. We report generating the mus-51 deletion strain using this system, recycling the marker cassette, and subsequently deleting the global transcriptional regulator gene cre-1.

  11. Contiguous gene deletion syndrome in a female with ornithine transcarbamylase deficiency.

    PubMed

    Balasubramaniam, S; Rudduck, C; Bennetts, B; Peters, G; Wilcken, B; Ellaway, C

    2010-01-01

    OTC deficiency, a partially dominant X-linked trait, is the most frequent inborn error of the urea cycle. We describe a female patient with a contiguous gene deletion syndrome encompassing the OTC, DMD, RPGR, CYBB and XK genes, amongst others, only manifesting features of OTC deficiency. Molecular characterization was ascertained by MLPA and confirmed by CGH microarray, which revealed an 8.7 Mb deletion of the X-chromosome. Complete de novo deletion of the OTC gene led to a severe clinical phenotype in the proband. The application of high resolution molecular genetic techniques such as MLPA and array CGH, in mutation negative OTC cases allows the identification of chromosomal rearrangements, such as large deletions and provides information for accurate genetic counseling and prenatal diagnosis.

  12. Immunogenic response induced by wzm and wzt gene deletion mutants from Brucella abortus S19.

    PubMed

    Wang, Xiu-Ran; Yan, Guang-Mou; Zhang, Rui; Lang, Xu-Long; Yang, Yan-Ling; Li, Xiao-Yan; Chen, Si; Qian, Jing; Wang, Xing-Long

    2014-02-01

    Brucellosis is an infectious disease affecting humans and animals worldwide. Effective methods of control include inducing immunity in animals by vaccination and elimination. Brucella abortus S19 is one of the popular vaccines for control of cattle brucellosis, as it has low virulence. In this paper, allelic exchange plasmids of wzm and wzt genes were constructed and partially knocked out to evaluate the effects on the induction of immunity to Brucella abortus S19 mutants. Cytokine secretion in vitro, INF-γ induction in vivo and antibody dynamics were evaluated. These data suggested that the immunity-eliciting ability of the wzm and wzt gene deletion mutants was similar, although reduced compared with the S19 strain. The results demonstrated that the wzt gene may be more important in the regulation of the induction of immunity than the wzm gene.

  13. A Genetic Screen for Fission Yeast Gene Deletion Mutants Exhibiting Hypersensitivity to Latrunculin A

    PubMed Central

    Asadi, Farzad; Michalski, Dorothy; Karagiannis, Jim

    2016-01-01

    Fission yeast cells treated with low doses of the actin depolymerizing drug, latrunculin A (LatA), delay entry into mitosis via a mechanism that is dependent on both the Clp1p and Rad24p proteins. During this delay, cells remain in a cytokinesis-competent state that is characterized by continuous repair and/or reestablishment of the actomyosin ring. In this manner, cells ensure the faithful completion of the preceding cytokinesis in response to perturbation of the cell division machinery. To uncover other genes with a role in this response, or simply genes with roles in adapting to LatA-induced stress, we carried out a genome-wide screen and identified a group of 38 gene deletion mutants that are hyper-sensitive to the drug. As expected, we found genes affecting cytokinesis and/or the actin cytoskeleton within this set (ain1, acp2, imp2). We also identified genes with roles in histone modification (tra1, ngg1), intracellular transport (apl5, aps3), and glucose-mediated signaling (git3, git5, git11, pka1, cgs2). Importantly, while the identified gene deletion mutants are prone to cytokinesis failure in the presence of LatA, they are nevertheless fully capable of cell division in the absence of the drug. These results indicate that fission yeast cells make use of a diverse set of regulatory modules to counter abnormal cytoskeletal perturbations, and furthermore, that these modules act redundantly to ensure cell survival and proliferation. PMID:27466272

  14. The Major Immediate-Early Protein IE2 of Human Cytomegalovirus Is Sufficient to Induce Proteasomal Degradation of CD83 on Mature Dendritic Cells

    PubMed Central

    Heilingloh, Christiane S.; Grosche, Linda; Kummer, Mirko; Mühl-Zürbes, Petra; Kamm, Lisa; Scherer, Myriam; Latzko, Melanie; Stamminger, Thomas; Steinkasserer, Alexander

    2017-01-01

    Human cytomegalovirus (HCMV) is the prototypic beta-herpesvirus and widespread throughout the human population. While infection is asymptomatic in healthy individuals, it can lead to high morbidity and mortality in immunocompromised persons. Importantly, HCMV evolved multiple strategies to interfere with immune cell function in order to establish latency in infected individuals. As mature DCs (mDCs) are antigen-presenting cells able to activate naïve T cells they play a crucial role during induction of effective antiviral immune responses. Interestingly, earlier studies demonstrated that the functionally important mDC surface molecule CD83 is down-regulated upon HCMV infection resulting in a reduced T cell stimulatory capacity of the infected cells. However, the viral effector protein and the precise mechanism of HCMV-mediated CD83 reduction remain to be discovered. Using flow cytometric analyses, we observed significant down-modulation of CD83 surface expression becoming significant already 12 h after HCMV infection. Moreover, Western bot analyses revealed that, in sharp contrast to previous studies, loss of CD83 is not restricted to the membrane-bound molecule, but also occurs intracellularly. Furthermore, inhibition of the proteasome almost completely restored CD83 surface expression during HCMV infection. Results of infection kinetics and cycloheximide-actinomycin D-chase experiments, strongly suggested that an HCMV immediate early gene product is responsible for the induction of CD83 down-modulation. Consequently, we were able to identify the major immediate early protein IE2 as the viral effector protein that induces proteasomal CD83 degradation. PMID:28203230

  15. A self-excising beta-recombinase/six cassette for repetitive gene deletion and homokaryon purification in Neurospora crassa

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In a previous study we developed a cassette employing a bacterial beta-recombinase acting on six recognition sequences (beta-rec/six), which allowed repetitive site-specific gene deletion and marker recycling in Neurospora crassa. However, only one positive selection marker was used in the cassette...

  16. Improved Techniques for Endogenous Epitope Tagging and Gene Deletion in Toxoplasma gondii

    PubMed Central

    Upadhya, Rajendra; Kim, Kami; Hogue-Angeletti, Ruth; Weiss, Louis M

    2011-01-01

    Toxoplasma gondii is an excellent model organism for studies on the biology of the Apicomplexa due to its ease of in vitro cultivation and genetic manipulation. Large-scale reverse genetic studies in T. gondii have, however, been difficult due to the low frequency of homologous recombination. Efforts to ensure homologous recombination have necessitated engineering long flanking regions in the targeting construct. This requirement makes it difficult to engineer chromosomally targeted epitope tags or gene knock out constructs only by restriction enzyme mediated cloning steps. To address this issue we employed multisite Gateway® recombination techniques to generate chromosomal gene manipulation targeting constructs. Incorporation of 1.5 to 2.0 kb flanking homologous sequences in PCR generated targeting constructs resulted in 90% homologous recombination events in wild type T. gondii (RH strain) as determined by epitope tagging and target gene deletion experiments. Furthermore, we report that split marker constructs were equally efficient for targeted gene disruptions using the T. gondii UPRT gene locus as a test case. The methods described in this paper represent an improved strategy for efficient epitope tagging and gene disruptions in T. gondii. PMID:21352857

  17. Mouse model of inducible nephrogenic diabetes insipidus produced by floxed aquaporin-2 gene deletion.

    PubMed

    Yang, Baoxue; Zhao, Dan; Qian, Liman; Verkman, A S

    2006-08-01

    Transgenic mouse models of defective urinary concentrating ability produced by deletion of various membrane transport or receptor proteins, including aquaporin-2 (AQP2), are associated with neonatal mortality from polyuria. Here, we report an inducible mouse model of AQP2 gene deletion with severe polyuria in adult mice. LoxP sequences were inserted into introns 1 and 2 in the mouse AQP2 gene by homologous recombination in embryonic stem cells. Mating of germ-line AQP2-loxP mice with tamoxifen-inducible Cre-expressing mice produced offspring with inducible homozygous Cre-AQP2-loxP, which had a normal phenotype. Tamoxifen injections over 10 days resulted in AQP2 gene excision, with undetectable full-length AQP2 transcript in kidney and a >95% reduction in immunoreactive AQP2 protein. Urine osmolality decreased from approximately 2,000 to <500 mosmol/kgH(2)O after 4-5 days, with urine output increasing from 2 to 25 ml/day. Urine osmolality did not increase after water deprivation. Interestingly, AQP3 protein expression in the collecting duct was increased by about fivefold after AQP2 gene excision. Mild renal damage was seen after 6 wk of polyuria, with collecting duct dilatation, yet normal creatinine clearance and serum chemistries. These results establish the first adult model of nephrogenic diabetes insipidus (NDI) caused by AQP2 deficiency, with daily urine output comparable to body weight, although remarkable preservation of renal function compared with non-inducible NDI models.

  18. A next-generation genetically attenuated Plasmodium falciparum parasite created by triple gene deletion.

    PubMed

    Mikolajczak, Sebastian A; Lakshmanan, Viswanathan; Fishbaugher, Matthew; Camargo, Nelly; Harupa, Anke; Kaushansky, Alexis; Douglass, Alyse N; Baldwin, Michael; Healer, Julie; O'Neill, Matthew; Phuong, Thuan; Cowman, Alan; Kappe, Stefan H I

    2014-09-01

    Immunization with live-attenuated Plasmodium sporozoites completely protects against malaria infection. Genetic engineering offers a versatile platform to create live-attenuated sporozoite vaccine candidates. We previously generated a genetically attenuated parasite (GAP) by deleting the P52 and P36 genes in the NF54 wild-type (WT) strain of Plasmodium falciparum (Pf p52(-)/p36(-) GAP). Preclinical assessment of p52(-)/p36(-) GAP in a humanized mouse model indicated an early and severe liver stage growth defect. However, human exposure to >200 Pf p52(-)/p36(-) GAP-infected mosquito bites in a safety trial resulted in peripheral parasitemia in one of six volunteers, revealing that this GAP was incompletely attenuated. We have now created a triple gene deleted GAP by additionally removing the SAP1 gene (Pf p52(-)/p36(-)/sap1(-) GAP) and employed flippase (FLP)/flippase recognition target (FRT) recombination for drug selectable marker cassette removal. This next-generation GAP was indistinguishable from WT parasites in blood stage and mosquito stage development. Using an improved humanized mouse model transplanted with human hepatocytes and human red blood cells, we show that despite a high-dose sporozoite challenge, Pf p52(-)/p36(-)/sap1(-) GAP did not transition to blood stage infection and appeared to be completely attenuated. Thus, clinical testing of Pf p52(-)/p36(-)/sap1(-) GAP assessing safety, immunogenicity, and efficacy against sporozoite challenge is warranted.

  19. Cardiac characterization of 16 patients with large NF1 gene deletions.

    PubMed

    Nguyen, R; Mir, T S; Kluwe, L; Jett, K; Kentsch, M; Mueller, G; Kehrer-Sawatzki, H; Friedman, J M; Mautner, V-F

    2013-10-01

    The aim of this study was to characterize cardiac features of patients with neurofibromatosis 1 (NF1) and large deletions of the NF1 gene region. The study participants were 16 patients with large NF1 deletions and 16 age- and sex-matched NF1 patients without such deletions. All the patients were comprehensively characterized clinically and by echocardiography. Six of 16 NF1 deletion patients but none of 16 non-deletion NF1 patients have major cardiac abnormalities (p = 0.041). Congenital heart defects (CHDs) include mitral insufficiency in two patients and ventricular septal defect, aortic stenosis, and aortic insufficiency in one patient each. Three deletion patients have hypertrophic cardiomyopathy. Two patients have intracardiac tumors. NF1 patients without large deletions have increased left ventricular (LV) diastolic posterior wall thickness (p < 0.001) and increased intraventricular diastolic septal thickness (p = 0.001) compared with a healthy reference population without NF1, suggestive of eccentric LV hypertrophy. CHDs and other cardiovascular anomalies are more frequent among patients with large NF1 deletion and may cause serious clinical complications. Eccentric LV hypertrophy may occur in NF1 patients without whole gene deletions, but the clinical significance of this finding is uncertain. All patients with clinical suspicion for NF1 should be referred to a cardiologist for evaluation and surveillance.

  20. Application of the FLP/FRT system for conditional gene deletion in yeast Saccharomyces cerevisiae.

    PubMed

    Park, Yang-Nim; Masison, Daniel; Eisenberg, Evan; Greene, Lois E

    2011-09-01

    The yeast Saccharomyces cerevisiae has proved to be an excellent model organism to study the function of proteins. One of the many advantages of yeast is the many genetic tools available to manipulate gene expression, but there are still limitations. To complement the many methods used to control gene expression in yeast, we have established a conditional gene deletion system by using the FLP/FRT system on yeast vectors to conditionally delete specific yeast genes. Expression of Flp recombinase, which is under the control of the GAL1 promoter, was induced by galactose, which in turn excised FRT sites flanked genes. The efficacy of this system was examined using the FRT site-flanked genes HSP104, URA3 and GFP. The pre-excision frequency of this system, which might be caused by the basal activity of the GAL1 promoter or by spontaneous recombination between FRT sites, was detected ca. 2% under the non-selecting condition. After inducing expression of Flp recombinase, the deletion efficiency achieved ca. 96% of cells in a population within 9 h. After conditional deletion of the specific gene, protein degradation and cell division then diluted out protein that was expressed from this gene prior to its excision. Most importantly, the specific protein to be deleted could be expressed under its own promoter, so that endogenous levels of protein expression were maintained prior to excision by the Flp recombinase. Therefore, this system provides a useful tool for the conditional deletion of genes in yeast.

  1. Epigenetic regulations of immediate early genes expression involved in memory formation by the amyloid precursor protein of Alzheimer disease.

    PubMed

    Hendrickx, Aurélie; Pierrot, Nathalie; Tasiaux, Bernadette; Schakman, Olivier; Kienlen-Campard, Pascal; De Smet, Charles; Octave, Jean-Noël

    2014-01-01

    We previously demonstrated that APP epigenetically regulates Egr1 expression both in cultured neurons and in vivo. Since Egr1 is an immediate early gene involved in memory formation, we wondered whether other early genes involved in memory were regulated by APP and we studied molecular mechanisms involved. By comparing prefrontal (PF) cortex from wild type (APP+/+) and APP knockout mice (APP-/-), we observed that APP down regulates expression of four immediate early genes, Egr1, c-Fos, Bdnf and Arc. Down regulation of Egr1, c-Fos and Bdnf transcription resulted from a decreased enrichment of acetylated histone H4 on the corresponding gene promoter. Further characterization of H4 acetylation at Egr1 and c-Fos promoters revealed increased acetylation of H4K5 and H4K12 residues in APP-/- mice. Whereas APP affected Egr1 promoter activity by reducing access of the CREB transcription factor, its effect on c-Fos appeared to depend on increased recruitment of HDAC2 histone deacetylase to the gene promoter. The physiological relevance of the epigenetic regulation of Egr1 and c-Fos gene transcription by APP was further analyzed following exposure of mice to novelty. Although transcription of Egr1 and c-Fos was increased following exposure of APP+/+ mice to novelty, such an induction was not possible in APP-/- mice with a high basal level of expression of these immediate early genes. Altogether, these results demonstrate that APP-mediated regulation of c-Fos and Egr1 by different epigenetic mechanisms is needed for their induction during exposure to novelty.

  2. Medial amygdala lesions modify aggressive behavior and immediate early gene expression in oxytocin and vasopressin neurons during intermale exposure.

    PubMed

    Wang, Yu; He, Zhiyi; Zhao, Chuansheng; Li, Lei

    2013-05-15

    The medial amygdala and neuropeptides oxytocin (OXT) and vasopressin (VSP) have been associated aggressive behavior regulation. However, the specific mechanism involved in OXT and VSP modulation in distinct brain regions during hostile intermale aggressive behavior is undetermined. A retrograde tracer mouse model was employed using male C57BL/6 mice injected with rhodamine-conjugated latex microsphere suspensions in the right hypothalamic paraventricular nucleus. Adult male C57BL/6 mice (aged 14-16 weeks) were subjected to resident-intruder testing using juvenile intruder mice (aged 3 weeks) or adult intruder mice (aged 8 weeks). Following exposure, Fos protein expression was increased in the medial amygdala neurons of resident mice receiving the retrograde tracer. Thus, medial amygdala neurons projecting to or localized in the vicinity of the hypothalamic paraventricular nucleus showed immediate early gene (IEG) expression following resident-intruder testing that was considered an indirect marker of activation. Additionally, intermale aggression-related behaviors were inhibited or modified by exposure to juvenile or adult intruders, respectively, in mice that underwent medial amygdala lesioning. Furthermore, Fos protein expression in OXT-positive neurons was attenuated. Thus, ablation of medial amygdala neurons prevented immediate early gene expression in OXT- and VSP-positive neurons in the hypothalamus, bed nucleus of stria terminalis, and medial preoptic area during intermale exposure. These findings indicate that the medial amygdala likely modulates hostile aggressive behavior associated with immediate early gene expression in OXT and VSP neurons in specific brain areas, which may actually be instrumental in beneficial social interaction-related aggressive responses associated with mating, territorial defense, and offspring protection.

  3. Reiterated sequences within the intron of an immediate-early gene of herpes simplex virus type 1.

    PubMed Central

    Watson, R J; Umene, K; Enquist, L W

    1981-01-01

    We describe the nucleotide sequence of a herpes simplex virus type 1 DNA fragment containing the intron of the immediate-early mRNA-5 (IE mRNA-5) gene. The location of the intron within this fragment was determined by a Berk & Sharp nuclease S1 protection analysis, and by cloning and sequencing cDNA containing sequences overlapping t he IE mRNA-5 splice point. We found that the 149 base pair (bp) intron contained four copies of an identical 23 bp GC rich tandem repeat followed by a further reiteration consisting of the first 15 bp only. Images PMID:6272198

  4. PYRETHROID INDUCED ALTERATIONS IN TRANSCRIPTION OF CALCIUM RESPONSIVE AND IMMEDIATE EARLY GENES IN VIVO.

    EPA Science Inventory

    Multiple molecular targets for pyrethroid insecticides have been evaluated in in vitro preparations, including but not limited to voltage-sensitive sodium channels (VSSCs), voltage-sensitive calcium channels (VSCCs), GABAergic receptors, ATPases and mitochondrial respiratory chai...

  5. Yatein from Chamaecyparis obtusa suppresses herpes simplex virus type 1 replication in HeLa cells by interruption the immediate-early gene expression.

    PubMed

    Kuo, Yuh-Chi; Kuo, Yueh-Hsiung; Lin, Yuang-Lian; Tsai, Wei-Jern

    2006-07-01

    Inhibitory effects of methanolic extracts from nine Chinese herbs on herpes simplex virus type 1 (HSV-1) replication were studied. By a bioassay-guided fractionation procedure, yatein (C(22)H(23)O(7); M.W.399) was isolated from Chamaecyparis obtusa; yatein significantly suppressed HSV-1 multiplication in HeLa cells without apparent cytotoxicity. To further localize the point in the HSV-1 replication cycle where arrest occurred, a set of key regulatory events leading to the viral multiplication was examined, including viral immediate-early (alpha) and late (gamma) gene expression and DNA replication. Results indicated that levels of glycoprotein B (gB) and gC mRNA expression in HeLa cells were impeded by yatein. Data from polymerase chain reaction showed that replication of HSV-1 DNA in HeLa cells was arrested by yatein. Furthermore, yatein decreased ICP0 and ICP4 gene expression in HeLa cells. Results of an electrophoretic mobility shift assay demonstrated that yatein interrupted the formation of alpha-trans-induction factor/C1/Oct-1/GARAT multiprotein complex. The mechanisms of antiviral action of yatein seem to be mediated, by inhibiting HSV-1 alpha gene expression, including expression of the ICP0 and ICP4 genes, and by arresting HSV-1 DNA synthesis and structural protein expression in HeLa cells. These results suggest that yatein is an antiviral agent against HSV-1 replication.

  6. Rapid Diagnostic Tests for Malaria Diagnosis in the Peruvian Amazon: Impact of pfhrp2 Gene Deletions and Cross-Reactions

    PubMed Central

    Maltha, Jessica; Gamboa, Dionicia; Bendezu, Jorge; Sanchez, Luis; Cnops, Lieselotte; Gillet, Philippe; Jacobs, Jan

    2012-01-01

    Background In the Peruvian Amazon, Plasmodium falciparum and Plasmodium vivax malaria are endemic in rural areas, where microscopy is not available. Malaria rapid diagnostic tests (RDTs) provide quick and accurate diagnosis. However, pfhrp2 gene deletions may limit the use of histidine-rich protein-2 (PfHRP2) detecting RDTs. Further, cross-reactions of P. falciparum with P. vivax-specific test lines and vice versa may impair diagnostic specificity. Methods Thirteen RDT products were evaluated on 179 prospectively collected malaria positive samples. Species diagnosis was performed by microscopy and confirmed by PCR. Pfhrp2 gene deletions were assessed by PCR. Results Sensitivity for P. falciparum diagnosis was lower for PfHRP2 compared to P. falciparum-specific Plasmodium lactate dehydrogenase (Pf-pLDH)- detecting RDTs (71.6% vs. 98.7%, p<0.001). Most (19/21) false negative PfHRP2 results were associated with pfhrp2 gene deletions (25.7% of 74 P. falciparum samples). Diagnostic sensitivity for P. vivax (101 samples) was excellent, except for two products. In 10/12 P. vivax-detecting RDT products, cross-reactions with the PfHRP2 or Pf-pLDH line occurred at a median frequency of 2.5% (range 0%–10.9%) of P. vivax samples assessed. In two RDT products, two and one P. falciparum samples respectively cross-reacted with the Pv-pLDH line. Two Pf-pLDH/pan-pLDH-detecting RDTs showed excellent sensitivity with few (1.0%) cross-reactions but showed faint Pf-pLDH lines in 24.7% and 38.9% of P. falciparum samples. Conclusion PfHRP2-detecting RDTs are not suitable in the Peruvian Amazon due to pfhrp2 gene deletions. Two Pf-pLDH-detecting RDTs performed excellently and are promising RDTs for this region although faint test lines are of concern. PMID:22952633

  7. Functional profiling in Streptococcus mutans: construction and examination of a genomic collection of gene deletion mutants.

    PubMed

    Quivey, R G; Grayhack, E J; Faustoferri, R C; Hubbard, C J; Baldeck, J D; Wolf, A S; MacGilvray, M E; Rosalen, P L; Scott-Anne, K; Santiago, B; Gopal, S; Payne, J; Marquis, R E

    2015-12-01

    A collection of tagged deletion mutant strains was created in Streptococcus mutans UA159 to facilitate investigation of the aciduric capability of this oral pathogen. Gene-specific barcoded deletions were attempted in 1432 open reading frames (representing 73% of the genome), and resulted in the isolation of 1112 strains (56% coverage) carrying deletions in distinct non-essential genes. As S. mutans virulence is predicated upon the ability of the organism to survive an acidic pH environment, form biofilms on tooth surfaces, and out-compete other oral microflora, we assayed individual mutant strains for the relative fitness of the deletion strain, compared with the parent strain, under acidic and oxidative stress conditions, as well as for their ability to form biofilms in glucose- or sucrose-containing medium. Our studies revealed a total of 51 deletion strains with defects in both aciduricity and biofilm formation. We have also identified 49 strains whose gene deletion confers sensitivity to oxidative damage and deficiencies in biofilm formation. We demonstrate the ability to examine competitive fitness of mutant organisms using the barcode tags incorporated into each deletion strain to examine the representation of a particular strain in a population. Co-cultures of deletion strains were grown either in vitro in a chemostat to steady-state values of pH 7 and pH 5 or in vivo in an animal model for oral infection. Taken together, these data represent a mechanism for assessing the virulence capacity of this pathogenic microorganism and a resource for identifying future targets for drug intervention to promote healthy oral microflora.

  8. VIP Gene Deletion in Mice Causes Cardiomyopathy Associated with Upregulation of Heart Failure Genes

    PubMed Central

    Szema, Anthony M.; Hamidi, Sayyed A.; Smith, S. David; Benveniste, Helene

    2013-01-01

    Rationale Vasoactive Intestinal Peptide (VIP), a pulmonary vasodilator and inhibitor of vascular smooth muscle proliferation, is absent in pulmonary arteries of patients with idiopathic pulmonary arterial hypertension (PAH). We previously determined that targeted deletion of the VIP gene in mice leads to PAH with pulmonary vascular remodeling and right ventricular (RV) dilatation. Whether the left ventricle is also affected by VIP gene deletion is unknown. In the current study, we examined if VIP knockout mice (VIP−/−) develop both right (RV) and left ventricular (LV) cardiomyopathy, manifested by LV dilatation and systolic dysfunction, as well as overexpression of genes conducive to heart failure. Methods We examined VIP−/−and wild type (WT) mice using Magnetic Resonance Imaging (MRI) for evidence of cardiomyopathy associated with biventricular dilation and wall thickness changes. Lung tissue from VIP−/− and WT mice was subjected to whole-genome gene microarray analysis. Results Lungs from VIP−/− mice showed overexpression of cardiomyopathy genes: Myh1 was upregulated 224 times over WT, and Mylpf was increased 72 fold. Tnnt3 was increased 105 times and tnnc2 181 fold. Hearts were dilated in VIP−/− mice, with thinning of LV wall and increase in RV and LV chamber size, though RV enlargement varied. Weights of VIP−/− mice were consistently lower. Conclusions Critically-important heart failure-related genes are upregulated in VIP−/− mice associated with the spontaneous cardiomyopathy phenotype, involving both left and right ventricles, suggesting that loss of the VIP gene orchestrates a panoply of pathogenic genes which are detrimental to both left and right cardiac homeostasis. PMID:23700405

  9. Gene Deletion by Fluorescence-Reported Allelic Exchange Mutagenesis in Chlamydia trachomatis

    PubMed Central

    Mueller, Konrad E.; Wolf, Katerina

    2016-01-01

    ABSTRACT Although progress in Chlamydia genetics has been rapid, genomic modification has previously been limited to point mutations and group II intron insertions which truncate protein products. The bacterium has thus far been intractable to gene deletion or more-complex genomic integrations such as allelic exchange. Herein, we present a novel suicide vector dependent on inducible expression of a chlamydial gene that renders Chlamydia trachomatis fully genetically tractable and permits rapid reverse genetics by fluorescence-reported allelic exchange mutagenesis (FRAEM). We describe the first available system of targeting chlamydial genes for deletion or allelic exchange as well as curing plasmids from C. trachomatis serovar L2. Furthermore, this approach permits the monitoring of mutagenesis by fluorescence microscopy without disturbing bacterial growth, a significant asset when manipulating obligate intracellular organisms. As proof of principle, trpA was successfully deleted and replaced with a sequence encoding both green fluorescent protein (GFP) and β-lactamase. The trpA-deficient strain was unable to grow in indole-containing medium, and this phenotype was reversed by complementation with trpA expressed in trans. To assess reproducibility at alternate sites, FRAEM was repeated for genes encoding type III secretion effectors CTL0063, CTL0064, and CTL0065. In all four cases, stable mutants were recovered one passage after the observation of transformants, and allelic exchange was limited to the specific target gene, as confirmed by whole-genome sequencing. Deleted sequences were not detected by quantitative real-time PCR (qPCR) from isogenic mutant populations. We demonstrate that utilization of the chlamydial suicide vector with FRAEM renders C. trachomatis highly amenable to versatile and efficient genetic manipulation. PMID:26787828

  10. A Next-generation Genetically Attenuated Plasmodium falciparum Parasite Created by Triple Gene Deletion

    PubMed Central

    Mikolajczak, Sebastian A; Lakshmanan, Viswanathan; Fishbaugher, Matthew; Camargo, Nelly; Harupa, Anke; Kaushansky, Alexis; Douglass, Alyse N; Baldwin, Michael; Healer, Julie; O'Neill, Matthew; Phuong, Thuan; Cowman, Alan; Kappe, Stefan H I

    2014-01-01

    Immunization with live-attenuated Plasmodium sporozoites completely protects against malaria infection. Genetic engineering offers a versatile platform to create live-attenuated sporozoite vaccine candidates. We previously generated a genetically attenuated parasite (GAP) by deleting the P52 and P36 genes in the NF54 wild-type (WT) strain of Plasmodium falciparum (Pf p52−/p36− GAP). Preclinical assessment of p52−/p36− GAP in a humanized mouse model indicated an early and severe liver stage growth defect. However, human exposure to >200 Pf p52−/p36− GAP-infected mosquito bites in a safety trial resulted in peripheral parasitemia in one of six volunteers, revealing that this GAP was incompletely attenuated. We have now created a triple gene deleted GAP by additionally removing the SAP1 gene (Pf p52−/p36−/sap1− GAP) and employed flippase (FLP)/flippase recognition target (FRT) recombination for drug selectable marker cassette removal. This next-generation GAP was indistinguishable from WT parasites in blood stage and mosquito stage development. Using an improved humanized mouse model transplanted with human hepatocytes and human red blood cells, we show that despite a high-dose sporozoite challenge, Pf p52−/p36−/sap1− GAP did not transition to blood stage infection and appeared to be completely attenuated. Thus, clinical testing of Pf p52−/p36−/sap1− GAP assessing safety, immunogenicity, and efficacy against sporozoite challenge is warranted. PMID:24827907

  11. High-frequency stimulation induces gradual immediate early gene expression in maturing adult-generated hippocampal granule cells.

    PubMed

    Jungenitz, Tassilo; Radic, Tijana; Jedlicka, Peter; Schwarzacher, Stephan W

    2014-07-01

    Increasing evidence shows that adult neurogenesis of hippocampal granule cells is advantageous for learning and memory. We examined at which stage of structural maturation and age new granule cells can be activated by strong synaptic stimulation. High-frequency stimulation of the perforant pathway in urethane-anesthetized rats elicited expression of the immediate early genes c-fos, Arc, zif268 and pCREB133 in almost 100% of mature, calbindin-positive granule cells. In contrast, it failed to induce immediate early gene expression in immature doublecortin-positive granule cells. Furthermore, doublecortin-positive neurons did not react with c-fos or Arc expression to mild theta-burst stimulation or novel environment exposure. Endogenous expression of pCREB133 was increasingly present in young cells with more elaborated dendrites, revealing a close correlation to structural maturation. Labeling with bromodeoxyuridine revealed cell age dependence of stimulation-induced c-fos, Arc and zif268 expression, with only a few cells reacting at 21 days, but with up to 75% of cells activated at 35-77 days of cell age. Our results indicate an increasing synaptic integration of maturing granule cells, starting at 21 days of cell age, but suggest a lack of ability to respond to activation with synaptic potentiation on the transcriptional level as long as immature cells express doublecortin.

  12. Total beta-globin gene deletion has high frequency in Filipinos

    SciTech Connect

    Patrick, N.; Miyakawa, F.; Hunt, J.A.

    1994-09-01

    The distribution of {beta}-thalassemia [{beta}{sup Th}] mutations is unique to each ethnic group. Most mutations affect one or a few bases; large deletions have been rare. Among families screened in Hawaii, [{beta}{sup Th}] heterozygotes were diagnosed by microcytosis, absence of abnormal hemoglobins on isoelectric focusing, and raised Hb A{sub 2} by chromatography. Gene frequency for {beta}{sup Th} was 0.02 in Filipinos. In Filipinos, polymerase chain reaction [PCR] with denaturing gradient gel electrophoresis for {beta}{sup Th} mutations detected a mutation in only 6 of 42 {beta}{sup Th} heterozygotes; an IVS2-666 C/T polymorphism showed non-heterozygosity in 37 and heterozygosity in only 5 of these {beta}{sup Th} heterozygotes. One {beta}{sup Th}/{beta}{sup Th} major patient and his mother had no mutation detected by allele-specific oligomer hybridization; PCR failed to amplify any DNA from his {beta}-globin gene. After a total {beta}-globin gene deletion [{beta}{sup Del}] was found in a Filipino family in Ontario, specific PCR amplification for {beta}{sup Del} detected this in 43 of 53 {beta}{sup Th} Filipino samples tested; the above {beta}{sup Th}/{beta}{sup Th} patient was a ({beta}{sup Del}/{beta}{sup Del}) homozygote. The {beta}{sup Del} may account for over 60% of all {beta}{sup Th} alleles in Filipinos; this is the highest proportion of a deletion {beta}{sup Th} mutation reported from any population. Most but not all {beta}{sup Del} heterozygotes had high Hb F [5.13 {plus_minus} 3.94 mean {plus_minus} 1 s.d.] compared to the codon 41/42 four base deletion common in Chinese [2.30 {plus_minus} 0.86], or to {beta}{sup Th} heterozygotes with normal {alpha}-globin genes [2.23 {plus_minus} 0.80].

  13. Mutational analysis of varicella-zoster virus (VZV) immediate early protein (IE62) subdomains and their importance in viral replication.

    PubMed

    Khalil, Mohamed I; Che, Xibing; Sung, Phillip; Sommer, Marvin H; Hay, John; Arvin, Ann M

    2016-05-01

    VZV IE62 is an essential, immediate-early, tegument protein and consists of five domains. We generated recombinant viruses carrying mutations in the first three IE62 domains and tested their influence on VZV replication kinetics. The mutations in domain I did not affect replication kinetics while domain II mutations, disrupting the DNA binding and dimerization domain (DBD), were lethal for VZV replication. Mutations in domain III of the nuclear localization signal (NLS) and the two phosphorylation sites S686A/S722A resulted in slower growth in early and late infection respectively and were associated with IE62 accumulation in the cytoplasm and nucleus respectively. This study mapped the functional domains of IE62 in context of viral infection, indicating that DNA binding and dimerization domain is essential for VZV replication. In addition, the correct localization of IE62, whether nuclear or cytoplasmic, at different points in the viral life cycle, is important for normal progression of VZV replication.

  14. Bovine herpesvirus 1 productive infection and immediate early transcription unit 1 promoter are stimulated by the synthetic corticosteroid dexamethasone.

    PubMed

    Kook, Insun; Henley, Caitlin; Meyer, Florencia; Hoffmann, Federico G; Jones, Clinton

    2015-10-01

    The primary site for life-long latency of bovine herpesvirus 1 (BHV-1) is sensory neurons. The synthetic corticosteroid dexamethasone consistently induces reactivation from latency; however the mechanism by which corticosteroids mediate reactivation is unclear. In this study, we demonstrate for the first time that dexamethasone stimulates productive infection, in part, because the BHV-1 genome contains more than 100 potential glucocorticoid receptor (GR) response elements (GREs). Immediate early transcription unit 1 (IEtu1) promoter activity, but not IEtu2 or VP16 promoter activity, was stimulated by dexamethasone. Two near perfect consensus GREs located within the IEtu1 promoter were necessary for dexamethasone-mediated stimulation. Electrophoretic mobility shift assays and chromatin immunoprecipitation studies demonstrated that the GR interacts with IEtu1 promoter sequences containing the GREs. Although we hypothesize that DEX-mediated stimulation of IEtu1 promoter activity is important during productive infection and perhaps reactivation from latency, stress likely has pleiotropic effects on virus-infected cells.

  15. The pnk/pnl gene (ORF 86) of Autographa californica nucleopolyhedrovirus is a non-essential, immediate early gene.

    PubMed

    Durantel, D; Croizier, L; Ayres, M D; Croizier, G; Possee, R D; López-Ferber, M

    1998-03-01

    Autographa californica nucleopolyhedrovirus (AcMNPV) ORF 86, located within the HindIII C fragment, potentially encodes a protein which shares sequence similarity with two T4 bacteriophage gene products, RNA ligase and polynucleotide kinase. This AcMNPV gene has been designated pnk/pnl but has yet to be assigned a function in virus replication. It has been classified as an immediate early virus gene, since the promoter was active in uninfected insect cells and mRNA transcripts were detectable from 4 to 48 h post-infection and in the presence of cycloheximide or aphidicolin in virus-infected cells. The extremities of the transcript have been mapped by primer extension and 3' RACE-PCR to positions -18 from the translational start codon and +15 downstream of the stop codon. The function of pnk/pnl was investigated by producing a recombinant virus (Acdel86lacZ) with the coding region replaced with that of lacZ. This virus replicated normally in Spodoptera frugiperda (Sf 21) cells, indicating that pnk/pnl is not essential for propagation in these cells. Virus protein production in Acdel86lacZ-infected Sf 21 cells also appeared to be unaffected, with normal synthesis of the IE-1, GP64, VP39 and polyhedrin proteins. Shut-down of host protein synthesis was not abolished in recombinant infection. When other baculovirus genomes were examined for the presence of pnk/pnl by restriction enzyme digestion and PCR, a deletion was found in AcMNPV 1.2, Galleria mellonella NPV (GmMNPV) and Bombyx mori NPV (BmNPV), suggesting that in many isolates this gene has either never been acquired or has been lost during genome evolution. This is one of the first baculovirus immediate early genes that appears to be nonessential for virus survival.

  16. Time course of immediate early gene protein expression in the spinal cord following conditioning stimulation of the sciatic nerve in rats.

    PubMed

    Bojovic, Ognjen; Panja, Debabrata; Bittins, Margarethe; Bramham, Clive R; Tjølsen, Arne

    2015-01-01

    Long-term potentiation induced by conditioning electrical stimulation of afferent fibers is a widely studied form of synaptic plasticity in the brain and the spinal cord. In the spinal cord dorsal horn, long-term potentiation is induced by a series of high-frequency trains applied to primary afferent fibers. Conditioning stimulation (CS) of sciatic nerve primary afferent fibers also induces expression of immediate early gene proteins in the lumbar spinal cord. However, the time course of immediate early gene expression and the rostral-caudal distribution of expression in the spinal cord have not been systematically studied. Here, we examined the effects of sciatic nerve conditioning stimulation (10 stimulus trains, 0.5 ms stimuli, 7.2 mA, 100 Hz, train duration 2 s, 8 s intervals between trains) on cellular expression of immediate early genes, Arc, c-Fos and Zif268, in anesthetized rats. Immunohistochemical analysis was performed on sagittal sections obtained from Th13- L5 segments of the spinal cord at 1, 2, 3, 6 and 12 h post-CS. Strikingly, all immediate early genes exhibited a monophasic increase in expression with peak increases detected in dorsal horn neurons at 2 hours post-CS. Regional analysis showed peak increases at the location between the L3 and L4 spinal segments. Both Arc, c-Fos and Zif268 remained significantly elevated at 2 hours, followed by a sharp decrease in immediate early gene expression between 2 and 3 hours post-CS. Colocalization analysis performed at 2 hours post-CS showed that all c-Fos and Zif268 neurons were positive for Arc, while 30% and 43% of Arc positive neurons were positive for c-Fos and Zif268, respectively. The present study identifies the spinal cord level and time course of immediate early gene (IEGP) expression of relevance for analysis of IEGPs function in neuronal plasticity and nociception.

  17. Robust Parameter Identification to Perform the Modeling of pta and poxB Genes Deletion Effect on Escherichia Coli.

    PubMed

    Guerrero-Torres, V; Rios-Lozano, M; Badillo-Corona, J A; Chairez, I; Garibay-Orijel, C

    2016-08-01

    The aim of this study was to design a robust parameter identification algorithm to characterize the effect of gene deletion on Escherichia coli (E. coli) MG1655. Two genes (pta and poxB) in the competitive pathways were deleted from this microorganism to inhibit pyruvate consumption. This condition deviated the E. coli metabolism toward the Krebs cycle. As a consequence, the biomass, substrate (glucose), lactic, and acetate acids as well as ethanol concentrations were modified. A hybrid model was proposed to consider the effect of gene deletion on the metabolism of E. coli. The model parameters were estimated by the application of a least mean square method based on the instrument variable technique. To evaluate the parametric identifier method, a set of robust exact differentiators, based on the super-twisting algorithm, was implemented. The hybrid model was successfully characterized by the parameters obtained from experimental information of E. coli MG1655. The significant difference between parameters obtained with wild-type strain and the modified (with deleted genes) justifies the application of the parametric identification algorithm. This characterization can be used to optimize the production of different byproducts of commercial interest.

  18. MK-801 Impairs Cognitive Coordination on a Rotating Arena (Carousel) and Contextual Specificity of Hippocampal Immediate-Early Gene Expression in a Rat Model of Psychosis.

    PubMed

    Kubík, Stěpán; Buchtová, Helena; Valeš, Karel; Stuchlík, Aleš

    2014-01-01

    Flexible behavior in dynamic, real-world environments requires more than static spatial learning and memory. Discordant and unstable cues must be organized in coherent subsets to give rise to meaningful spatial representations. We model this form of cognitive coordination on a rotating arena - Carousel where arena- and room-bound spatial cues are dissociated. Hippocampal neuronal ensemble activity can repeatedly switch between multiple representations of such an environment. Injection of tetrodotoxin into one hippocampus prevents cognitive coordination during avoidance of a stationary room-defined place on the Carousel and increases coactivity of previously unrelated neurons in the uninjected hippocampus. Place avoidance on the Carousel is impaired after systemic administration of non-competitive NMDAr blockers (MK-801) used to model schizophrenia in animals and people. We tested if this effect is due to cognitive disorganization or other effect of NMDAr antagonism such as hyperlocomotion, spatial memory impairment, or general learning deficit. We also examined if the same dose of MK-801 alters patterns of immediate-early gene (IEG) expression in the hippocampus. IEG expression is triggered in neuronal nuclei in a context-specific manner after behavioral exploration and it is used to map activity in neuronal populations. IEG expression is critical for maintenance of synaptic plasticity and memory consolidation. We show that the same dose of MK-801 that impairs spatial coordination of rats on the Carousel also eliminates contextual specificity of IEG expression in hippocampal CA1 ensembles. This effect is due to increased similarity between ensembles activated in different environments, consistent with the idea that it is caused by increased coactivity between neurons, which did not previously fire together. Our data support the proposition of the Hypersynchrony theory that cognitive disorganization in psychosis is due to increased coactivity between unrelated

  19. MK-801 Impairs Cognitive Coordination on a Rotating Arena (Carousel) and Contextual Specificity of Hippocampal Immediate-Early Gene Expression in a Rat Model of Psychosis

    PubMed Central

    Kubík, Štěpán; Buchtová, Helena; Valeš, Karel; Stuchlík, Aleš

    2014-01-01

    Flexible behavior in dynamic, real-world environments requires more than static spatial learning and memory. Discordant and unstable cues must be organized in coherent subsets to give rise to meaningful spatial representations. We model this form of cognitive coordination on a rotating arena – Carousel where arena- and room-bound spatial cues are dissociated. Hippocampal neuronal ensemble activity can repeatedly switch between multiple representations of such an environment. Injection of tetrodotoxin into one hippocampus prevents cognitive coordination during avoidance of a stationary room-defined place on the Carousel and increases coactivity of previously unrelated neurons in the uninjected hippocampus. Place avoidance on the Carousel is impaired after systemic administration of non-competitive NMDAr blockers (MK-801) used to model schizophrenia in animals and people. We tested if this effect is due to cognitive disorganization or other effect of NMDAr antagonism such as hyperlocomotion, spatial memory impairment, or general learning deficit. We also examined if the same dose of MK-801 alters patterns of immediate-early gene (IEG) expression in the hippocampus. IEG expression is triggered in neuronal nuclei in a context-specific manner after behavioral exploration and it is used to map activity in neuronal populations. IEG expression is critical for maintenance of synaptic plasticity and memory consolidation. We show that the same dose of MK-801 that impairs spatial coordination of rats on the Carousel also eliminates contextual specificity of IEG expression in hippocampal CA1 ensembles. This effect is due to increased similarity between ensembles activated in different environments, consistent with the idea that it is caused by increased coactivity between neurons, which did not previously fire together. Our data support the proposition of the Hypersynchrony theory that cognitive disorganization in psychosis is due to increased coactivity between unrelated

  20. fra-1: a serum-inducible, cellular immediate-early gene that encodes a fos-related antigen.

    PubMed Central

    Cohen, D R; Curran, T

    1988-01-01

    A set of proteins antigenically related to the c-fos protein (Fos) are induced by serum in fibroblasts. To isolate cDNA clones of genes encoding such proteins, a lambda gt11 expression cDNA library constructed from serum-stimulated rat fibroblasts was screened with antibodies raised against a hydrophilic region (amino acids 127 to 152) of Fos. One of the positive clones identified, termed fra-1 (Fos-related antigen) was characterized. It encoded a protein that shared several regions of extensive amino acid homology with Fos (including the region that showed similarity to both the yeast GCN4 regulatory protein and the protein encoded by the jun oncogene), although its nucleotide sequence was considerably diverged from that of the c-fos gene. Only a subset of the agents and conditions that activated c-fos also induced fra-1. Induction of fra-1 expression following serum stimulation was delayed compared with that of c-fos. However, like c-fos, fra-1 was induced rapidly by serum in the presence of protein synthesis inhibitors. Thus, a family of Fos-related, inducible genes are involved in the cellular immediate-early transcriptional response to extracellular stimuli. Images PMID:3133553

  1. Microarray and RT-PCR screening for white spot syndrome virus immediate-early genes in cycloheximide-treated shrimp

    SciTech Connect

    Liu Wangjing; Chang Yunshiang; Wang Chunghsiung; Kou, Guang-Hsiung; Lo Chufang . E-mail: gracelow@ntu.edu.tw

    2005-04-10

    Here, we report for the first time the successful use of cycloheximide (CHX) as an inhibitor to block de novo viral protein synthesis during WSSV (white spot syndrome virus) infection. Sixty candidate IE (immediate-early) genes were identified using a global analysis microarray technique. RT-PCR showed that the genes corresponding to ORF126, ORF242 and ORF418 in the Taiwan isolate were consistently CHX-insensitive, and these genes were designated ie1, ie2 and ie3, respectively. The sequences for these IE genes also appear in the two other WSSV isolates that have been sequenced. Three corresponding ORFs were identified in the China WSSV isolate, but only an ORF corresponding to ie1 was predicted in the Thailand isolate. In a promoter activity assay in Sf9 insect cells using EGFP (enhanced green fluorescence protein) as a reporter, ie1 showed very strong promoter activity, producing higher EGFP signals than the insect Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus (OpMNPV) ie2 promoter.

  2. Mutational analysis of varicella-zoster virus (VZV) immediate early protein (IE62) subdomains and their importance in viral replication

    SciTech Connect

    Khalil, Mohamed I.; Che, Xibing; Sung, Phillip; Sommer, Marvin H.; Hay, John; Arvin, Ann M.

    2016-05-15

    VZV IE62 is an essential, immediate-early, tegument protein and consists of five domains. We generated recombinant viruses carrying mutations in the first three IE62 domains and tested their influence on VZV replication kinetics. The mutations in domain I did not affect replication kinetics while domain II mutations, disrupting the DNA binding and dimerization domain (DBD), were lethal for VZV replication. Mutations in domain III of the nuclear localization signal (NLS) and the two phosphorylation sites S686A/S722A resulted in slower growth in early and late infection respectively and were associated with IE62 accumulation in the cytoplasm and nucleus respectively. This study mapped the functional domains of IE62 in context of viral infection, indicating that DNA binding and dimerization domain is essential for VZV replication. In addition, the correct localization of IE62, whether nuclear or cytoplasmic, at different points in the viral life cycle, is important for normal progression of VZV replication. - Highlights: • Mutation of IE62 domain I did not affect VZV replication in melanoma cells. • IE62 domain II and III are important for VZV replication in melanoma cells. • Mutations of IE62 domain II (DBD) were lethal for virus replication. • Mutations of IE62 NLS and phosphorylation sites inhibited VZV replication. • NLS and S686A/S722A mutations altered localization of IE62 during early and late infection.

  3. Insights into immediate-early gene function in hippocampal memory consolidation using antisense oligonucleotide and fluorescent imaging approaches.

    PubMed

    Guzowski, John F

    2002-01-01

    In the 14 years since it was discovered that specific genes could be dynamically regulated in the brain by neural activity, there has been a substantial research focus attempting to understand the role immediate-early genes (IEGs) play in various brain functions. This article examines the involvement of IEGs in hippocampal synaptic plasticity and in memory consolidation processes performed by the hippocampus. Studies employing conventional IEG detection methodologies and a novel gene-imaging approach that provides temporal and cellular resolution (cellular compartment analysis of emporal activity by fluorescence in situ hybridization or catFISH) provide evidence supporting the assertion that IEG expression reflects the integration of information processed by hippocampal neurons. However, IEG expression is not merely correlated with neural activity, but also plays a pivotal role in stabilizing recent changes in synaptic efficacy. As such, localized disruption of IEGs Arc or c-fos by intrahippocampal administration of antisense oligonucleotides or germline disruption of the IEGs c-fos, tissue plasminogen activator, or zif268 impairs consolidation of long-term memory formation, without affecting learning or short-term memory. Further investigation into the expression and function of IEGs using catFISH and antisense approaches will likely increase understanding of the molecular and cellular bases of information processing involving the hippocampus.

  4. Glucocorticoids activate Epstein Barr Virus lytic replication through the upregulation of immediate early BZLF1 gene expression

    PubMed Central

    Yang, Eric V.; Webster Marketon, Jeanette I.; Chen, Min; Lo, Kwok Wai; Kim, Seung-jae; Glaser, Ronald

    2010-01-01

    Psychological stress-associated immune dysregulation has been shown to disrupt the steady state expression and reactivate latent herpes viruses. One such virus is the Epstein Barr virus (EBV), which is associated with several human malignancies. EBV infects >90% of people living in North America and persists for life in latently infected cells. Although several studies have shown that glucocorticoids (GCs) can directly induce reactivation of the latent virus, the mechanism of stress hormone involvement in the control of EBV gene expression is not well understood. In this study, we tested the hypothesis that GCs can induce the latent EBV genome to lytically replicate through the induction of the EBV immediate early gene BZLF1 which encodes the lytic transactivator protein ZEBRA. We show a dose-dependent upregulation of BZLF1 mRNA expression by hydrocortisone (HC) and dexamethasone (Dex) in Daudi cells, an EBV genome positive Burkitt’s lymphoma cell line, and Dex-induction of the early gene products BLLF3 (encoding for the EBV dUTPase) and BALF5 (encoding for the EBV DNA polymerase). We show that Daudi cells express glucocorticoid receptors (GR) that mediate Dex-dependent upregulation of BZLF1 mRNA levels. This effect was inhibited by both the glucocorticoid receptor antagonist RU486 and by cycloheximide. The results suggest that GCs, in addition to inducing stress-related immune dysregulation, can mediate latent EBV reactivation through the induction of the BZLF1 gene. PMID:20466055

  5. An immediate-early protein of white spot syndrome virus modulates the phosphorylation of focal adhesion kinase of shrimp.

    PubMed

    Lu, Huasong; Ruan, Lingwei; Xu, Xun

    2011-10-25

    WSSV interacts with integrin during infection of shrimps and modulate the focal adhesion kinase which is known as a regulator of several downstream signaling pathways. Viral protein kinases are thought to be important for virus infection by regulating the host signaling pathways. WSV083 is an immediate-early gene of white spot syndrome virus that contains a Ser/Thr protein kinase domain. So, does WSSV modulate FAK phosphorylation via the WSV083 molecule? In this study, co-transfection of WSV083 and MjFAK genes proceeded in insect cells revealed that the MjFAK phosphorylation and cell adhesion activity could be inhibited by the expression of WSV083. Kinase domain mutants of WSV083 lost its ability of inhibiting FAK phosphorylation. Moreover, silencing of FAK gene through RNAi accelerated the shrimp death rate upon WSSV challenge. These results demonstrate for the first time that modulation of FAK phosphorylation by WSV083 plays a critical role in the pathogenesis of WSSV infection.

  6. Induction of immediate early genes in the mouse auditory cortex after auditory cued fear conditioning to complex sounds.

    PubMed

    Peter, M; Scheuch, H; Burkard, T R; Tinter, J; Wernle, T; Rumpel, S

    2012-04-01

    Immediate early genes (IEGs) are widely used as markers to delineate neuronal circuits because they show fast and transient expression induced by various behavioral paradigms. In this study, we investigated the expression of the IEGs c-fos and Arc in the auditory cortex of the mouse after auditory cued fear conditioning using quantitative polymerase chain reaction and microarray analysis. To test for the specificity of the IEG induction, we included several control groups that allowed us to test for factors other than associative learning to sounds that could lead to an induction of IEGs. We found that both c-fos and Arc showed strong and robust induction after auditory fear conditioning. However, we also observed increased expression of both genes in any control paradigm that involved shocks, even when no sounds were presented. Using mRNA microarrays and comparing the effect of the various behavioral paradigms on mRNA expression levels, we did not find genes being selectively upregulated in the auditory fear conditioned group. In summary, our results indicate that the use of IEGs to identify neuronal circuits involved specifically in processing of sound cues in the fear conditioning paradigm can be limited by the effects of the aversive unconditional stimulus and that activity levels in a particular primary sensory cortical area can be strongly influenced by stimuli mediated by other modalities.

  7. Immediate-early regulatory gene mutants define different stages in the establishment and reactivation of herpes simplex virus latency.

    PubMed Central

    Leib, D A; Coen, D M; Bogard, C L; Hicks, K A; Yager, D R; Knipe, D M; Tyler, K L; Schaffer, P A

    1989-01-01

    Using nonsense and deletion mutants of herpes simplex virus type 1, we investigated the roles of three immediate-early proteins (ICP4, ICP27 and ICP0) in the establishment and reactivation of ganglionic latency in a mouse ocular model. DNA hybridization, superinfection-rescue, and cocultivation techniques provided quantitative data that distinguished between the failure of a virus to establish latency in the ganglion and its failure to reactivate. Null mutants with lesions in the genes for ICP4 and ICP27 did not replicate in the eye or in ganglia and failed to establish reactivatable latent infections. Three ICP0 deletion mutants which could replicate in the eye and ganglia varied in their ability to establish and reactivate from the latent state, demonstrating that ICP0 plays a role both in the establishment and the reactivation of latency. The use of viral mutants and a variety of stage-specific assays allowed us to better define the stages in the establishment and reactivation of herpes simplex virus type 1 latency. Images PMID:2536101

  8. Antiviral activity of a phosphorothioate oligonucleotide complementary to RNA of the human cytomegalovirus major immediate-early region.

    PubMed Central

    Azad, R F; Driver, V B; Tanaka, K; Crooke, R M; Anderson, K P

    1993-01-01

    Phosphorothioate oligonucleotides complementary to mRNA of the human cytomegalovirus (HCMV) DNA polymerase gene or to RNA transcripts of the major immediate-early regions 1 and 2 (IE1 and IE2) of HCMV were evaluated for antiviral activity in a 96-well immunoassay with primary human dermal fibroblasts as host cells. Oligonucleotides complementary to RNA of the IE2 region exhibited the most potent antiviral activity. One of these oligonucleotides, ISIS 2922, was at least 30-fold more potent than the nucleoside analog, ganciclovir, with a 50% effective concentration of 0.37 microM in the 96-well immunoassay. In an infectious virus yield reduction assay, ISIS 2922 and ganciclovir reduced production of infectious virus by 2 log units at concentrations of 2.2 and 36 microM, respectively. A control oligonucleotide showed no inhibition of virus production at concentrations as high as 3 microM. ISIS 2922 reduced IE protein synthesis in HCMV-infected cells in a dose-dependent manner which correlated with antiviral activity. The antiviral activity of ISIS 2922 was not due to oligonucleotide-induced cytotoxicity since effects on cell viability or proliferation were observed only at concentrations well in excess of effective antiviral concentrations. The specificity and potency of ISIS 2922 suggest that it may be useful for the treatment of cytomegalovirus disease in humans. Images PMID:8239610

  9. Cytomegalovirus immediate-early promoter efficiently drives heterogeneous gene expression in Spodoptera frugiperda (Sf9) insect cells.

    PubMed

    Li, S; Zhang, Q N; Zhang, X T; Zheng, X Y; Lv, Y F; Hao, Z M

    2014-03-05

    Recently, wide attention has been given to the potential of recombinant baculovirus as a gene transfer vehicle for mammalian gene therapy. In this study, we packaged the recombinant baculoviruses with cytomegalovirus immediate-early (CMV-IE) promoter in Spodoptera frugiperda (Sf9) insect cells, and found that the CMV-IE promoter could efficiently drive the exogenic gene expression in the cells 12 h post-infection (h.p.i.). The expression level at 72 h.p.i. was only around half of that driven by polyhedrin promoter (Ppolh). However, the biological activity of the reporter proteins at 72 h.p.i. were similar with that driven by Ppolh. In addition, the Sf9 cells transfected with CMV-IE-containing plasmids also expressed foreign genes, suggesting that the CMV-IE-directed heterogeneous gene expression in the Sf9 cells was baculovirus-independent. These results demonstrate that the CMV-IE promoter might be used as a regular promoter in Sf9 cells.

  10. Rotation and immediate-early gene expression in rats treated with the atypical D1 dopamine agonist SKF 83822.

    PubMed

    Wirtshafter, David

    2007-03-01

    Classical agonists of the dopamine D1 receptor activate both adenylyl cyclase and phospholipase C (PLC) signaling pathways. As a result, the extent to which these two pathways are essentially involved in various effects produced by D1 receptor agonists is currently uncertain. In the present report we examined the effects of SKF 83822, a dopamine D1 agonist which has been reported to activate adenylyl cyclase, but not PLC, on behavior and immediate early gene (IEG) expression in rats with unilateral 6-hydroxydopamine lesions. SKF 83822 (25-100 microg/kg) induced dose dependent contralateral rotation in these subjects, and, additionally, stimulated strong expression of the IEG products c-Fos, Fra2, Zif/268 and Arc in the deinnervated striatum. All of these effects could be antagonized by pretreatment with the selective D1 dopamine antagonist SCH 23390 (0.5 mg/kg). Although PLC may be involved in many effects mediated through dopamine D1 receptors, these results suggest that direct activation of PLC is not necessary for the induction of either rotation or IEG expression in dopamine depleted rats.

  11. Decreased approach behavior and nucleus accumbens immediate early gene expression in response to Parkinsonian ultrasonic vocalizations in rats

    PubMed Central

    Kelm-Nelson, Cynthia A.; Holt, Lauren R.; Blue, Katherine V.; Ciucci, Michelle R.; Johnson, Aaron M.

    2015-01-01

    Many individuals with Parkinson disease (PD) have difficulty producing normal speech and voice, resulting in problems with interpersonal communication and reduced quality of life. Translational animal models of communicative dysfunction have been developed to assess disease pathology. However, it is unknown whether acoustic feature changes associated with vocal production deficits in these animal models lead to compromised communication. In rodents, male ultrasonic vocalizations (USVs) have a well-established role in functional inter-sexual communication. To test whether acoustic deficits in USVs observed in a PINK1 knockout (KO) PD rat model compromise communication, we presented recordings of male PINK1 KO USVs and normal wild-type (WT) USVs to female rat listeners. We measured approached behavior and immediate early gene expression (c-Fos) in brain regions implicated in auditory processing and sexual motivation. Our results suggest that females show reduced approach in response to PINK1 KO USVs compared to WT. Moreover, females exposed to PINK1 KO USVs had lower c-Fos immunolabeling in the nucleus accumbens, a region implicated in sexual motivation. These results are the first to demonstrate that vocalization deficits in a rat PD model result in compromised communication. Thus, the PINK1 KO PD model may be valuable for assessing treatments aimed at restoring vocal communicative function. PMID:26313334

  12. Saccule contribution to immediate early gene induction in the gerbil brainstem with posterior canal galvanic or hypergravity stimulation

    NASA Technical Reports Server (NTRS)

    Marshburn, T. H.; Kaufman, G. D.; Purcell, I. M.; Perachio, A. A.

    1997-01-01

    Immunolabeling patterns of the immediate early gene-related protein Fos in the gerbil brainstem were studied following stimulation of the sacculus by both hypergravity and galvanic stimulation. Head-restrained, alert animals were exposed to a prolonged (1 h) inertial vector of 2 G (19.6 m/s2) head acceleration directed in a dorso-ventral head axis to maximally stimulate the sacculus. Fos-defined immunoreactivity was quantified, and the results compared to a control group. The hypergravity stimulus produced Fos immunolabeling in the dorsomedial cell column (dmcc) of the inferior olive independently of other subnuclei. Similar dmcc labeling was induced by a 30 min galvanic stimulus of up to -100 microA applied through a stimulating electrode placed unilaterally on the bony labyrinth overlying the posterior canal (PC). The pattern of vestibular afferent firing activity induced by this galvanic stimulus was quantified in anesthetized gerbils by simultaneously recording from Scarpa's ganglion. Only saccular and PC afferent neurons exhibited increases in average firing rates of 200-300%, suggesting a pattern of current spread involving only PC and saccular afferent neurons at this level of stimulation. These results suggest that alteration in saccular afferent firing rates are sufficient to induce Fos-defined genomic activation of the dmcc, and lend further evidence to the existence of a functional vestibulo-olivary-cerebellar pathway of adaptation to novel gravito-inertial environments.

  13. Chronic morphine treatment enhances sciatic nerve stimulation-induced immediate early gene expression in the rat dorsal horn.

    PubMed

    Bojovic, Ognjen; Bramham, Clive R; Tjølsen, Arne

    2015-01-01

    Synaptic plasticity is a property of neurons that can be induced by conditioning electrical stimulation (CS) of afferent fibers in the spinal cord. This is a widely studied property of spinal cord and hippocampal neurons. CS has been shown to trigger enhanced expression of immediate early gene proteins (IEGPs), with peak increases observed 2 hour post stimulation. Chronic morphine treatment has been shown to promoteinduce opioid-induced hyperalgesia, and also to increase CS-induced central sensitization in the dorsal horn. As IEGP expression may contribute to development of chronic pain states, we aimed to determine whether chronic morphine treatment affects the expression of IEGPs following sciatic nerve CS. Changes in expression of the IEGPs Arc, c-Fos or Zif268 were determined in cells of the lumbar dorsal horn of the spinal cord. Chronic Morphine pretreatment over 7 days led to a significant increase in the number of IEGP positive cells observed at both 2 h and 6 h after CS. The same pattern of immunoreactivity was obtained for all IEGPs, with peak increases occurring at 2 h post CS. In contrast, morphine treatment alone in sham operated animals had no effect on IEGP expression. We conclude that chronic morphine treatment enhances stimulus-induced expression of IEGPs in the lumbar dorsal horn. These data support the notion that morphine alters gene expression responses linked to nociceptive stimulation and plasticity.

  14. Newly paired zebra finches have higher dopamine levels and immediate early gene Fos expression in dopaminergic neurons.

    PubMed

    Banerjee, Sunayana B; Dias, Brian G; Crews, David; Adkins-Regan, Elizabeth

    2013-12-01

    Most birds are socially monogamous, yet little is known about the neural pathways underlying avian monogamy. Recent studies have implicated dopamine as playing a role in courtship and affiliation in a socially monogamous songbird, the zebra finch (Taeniopygia guttata). In the present study, we sought to understand the specific contribution to pair formation in zebra finches of the mesolimbic dopaminergic pathway that projects from the midbrain ventral tegmental area to the nucleus accumbens. We observed that paired birds had higher levels of dopamine and its metabolite 3,4-dihydroxyphenylacetic acid in the ventral medial striatum, where the nucleus accumbens is situated, than unpaired birds. Additionally, we found that the percentage of dopaminergic neurons expressing immediate early gene Fos, a marker of neuronal activity, was higher in the ventral tegmental area of paired birds than in that of unpaired birds. These data are consistent with a role for the mesolimbic dopaminergic pathway in pair formation in zebra finches, suggesting the possibility of a conserved neural mechanism of monogamy in birds and mammals.

  15. Immediate-Early Gene Transcriptional Activation in Hippocampus Ca1 and Ca3 Does Not Accurately Reflect Rapid, Pattern Completion-Based Retrieval of Context Memory

    ERIC Educational Resources Information Center

    Pevzner, Aleksandr; Guzowski, John F.

    2015-01-01

    No studies to date have examined whether immediate-early gene (IEG) activation is driven by context memory recall. To address this question, we utilized the context preexposure facilitation effect (CPFE) paradigm. In CPFE, animals acquire contextual fear conditioning through hippocampus-dependent rapid retrieval of a previously formed contextual…

  16. Echovirus 1 replication, not only virus binding to its receptor, VLA-2, is required for the induction of cellular immediate-early genes.

    PubMed Central

    Huttunen, P; Heino, J; Hyypiä, T

    1997-01-01

    Induction of immediate-early genes c-jun, junB, and c-fos was demonstrated during echovirus 1 infection in a human osteogenic sarcoma (HOS) cell line. Tenfold induction was seen at 10 h postinfection, corresponding approximately to the end of the first replication cycle of the virus. Echovirus 1 uses VLA-2 integrin as its cellular receptor, and ligand binding by integrin is known to trigger signal transduction pathways ultimately activating immediate-early genes. In the present study, however, VLA-2 binding alone was not sufficient to induce their expression; viral replication was needed. This conclusion was based on the observations that no stimulation of the immediate-early genes occurred in the MG-63 cell line where the virus attached only to VLA-2 but was not able to replicate and that induction of these genes was observed when the HOS cells were infected with echovirus type 7, known to use a different cellular receptor. Induction was not seen in the presence of the antiviral compound WIN 54954, which evidently inhibits the uncoating but not receptor binding of echovirus 1, suggesting that viral replication triggers the activation of the immediate-early genes. The induction of these genes may have a role in viral replication and in the pathogenesis of infection. PMID:9094704

  17. The synergy of tobacco and alcohol and glutathione S-transferase θ 1 gene deletion and oral squamous cell carcinoma

    PubMed Central

    D’ Mello, Sarah; Bavle, Radhika Manoj; Paremala, K; Makarla, Soumya; Sudhakara, M; Bhatt, Madhura

    2016-01-01

    Background: Oral squamous cell carcinoma (OSCC) is the leading cancer among males in India. It is related to tobacco habits and alcohol consumption as well as the individual susceptibility for xenobiotic metabolizing enzyme polymorphisms. Glutathione S-transferase θ 1 (GSTT1) is a Phase II metabolic enzyme which is directly involved in catalyzing chemicals to mutagenic intermediates. This gene is characterized by genetic polymorphism resulting in complete gene deletion and subsequent absence of the enzyme, which ultimately dictates the risk of cancer development. Scraping buccal mucosa to obtain DNA from the cells is a simple, readily acceptable and rapid method to detect and assess the gene. Aim: To assess GSTT1 gene deletion in individuals giving a history of tobacco smoking and/or chewing and alcohol consumption and absence of clinically detectable lesions; and in OSCC cases to gauge if GSTT1 gene deletion confers protection to an individual and whether it can be used as a “single” marker to arrive at this conclusion. To validate the use of buccal scrape for determining the genotype of an individual by assessing the polymorphism at GSTT1 gene locus (22q11.2). Materials and Methods: Fifty-two cases were evaluated using buccal mucosal scrapes of tobacco habituates for 8 or more years, without clinically evident lesion (Group I) and from mucosa of tobacco habituates with clinically evident and histopathologically confirmed OSCC (Group II). DNA extraction and genotype at GSTT1 gene locus was determined by polymerase chain reaction assay. Statistical Analysis: The results were statistically analyzed using Chi-square test. Results: 90.66% of subjects had GSTT1 null genotype in Group I subjects. In Group II, subjects with both clinically and histopathologically diagnosed oral cancer, about 76.96% had GSTT1 null genotype. Conclusion: GSTT1 null genotype confers protection to individuals with tobacco habits and alcohol consumption, predominantly to those who used

  18. Targeted viral delivery of Cre recombinase induces conditional gene deletion in cardiovascular circuits of the mouse brain.

    PubMed

    Sinnayah, Puspha; Lindley, Timothy E; Staber, Patrick D; Davidson, Beverly L; Cassell, Martin D; Davisson, Robin L

    2004-06-17

    The Cre/loxP system has shown promise for investigating genes involved in nervous system function and pathology, although its application for studying central neural regulation of cardiovascular function and disease has not been explored. Here, we report for the first time that recombination of loxP-flanked genes can be achieved in discrete cardiovascular regulatory nuclei of adult mouse brain using targeted delivery of adenovirus (Ad) or feline immunodeficiency virus (FIV) bearing Cre recombinase (Ad-Cre, FIV-Cre). Single stereotaxic microinjections of Ad-Cre or FIV-Cre into specific nuclei along the subfornical organ-hypothalamic-hypophysial and brain stem-parabrachial axes resulted in robust and highly localized gene deletion as early as 7 days and for as long as 3 wk in a reporter mouse model in which Cre recombinase activates beta-galactosidase expression. An even greater selectivity in Cre-mediated gene deletion could be achieved in unique subpopulations of cells, such as vasopressin-synthesizing magnocellular neurons, by delivering Ad-Cre via retrograde transport. Moreover, Ad-Cre and FIV-Cre induced gene recombination in differential cell populations within these cardiovascular nuclei. FIV-Cre infection resulted in LacZ activation selectively in neurons, whereas both neuronal and glial cell types underwent gene recombination upon infection with Ad-Cre. These results establish the feasibility of using a combination of viral and Cre/loxP technologies to target specific cardiovascular nuclei in the brain for conditional gene modification and suggest the potential of this approach for determining the functional role of genes within these sites.

  19. Central precocious puberty in a patient with X-linked adrenal hypoplasia congenita and Xp21 contiguous gene deletion syndrome.

    PubMed

    Koh, Ji Won; Kang, So Young; Kim, Gu Hwan; Yoo, Han Wook; Yu, Jeesuk

    2013-06-01

    X-linked adrenal hypoplasia congenita is caused by the mutation of DAX-1 gene (dosage-sensitive sex reversal, adrenal hypoplasia critical region, on chromosome X, gene 1), and can occur as part of a contiguous gene deletion syndrome in association with glycerol kinase (GK) deficiency, Duchenne muscular dystrophy and X-linked interleukin-1 receptor accessory protein-like 1 (IL1RAPL1) gene deficiency. It is usually associated with hypogonadotropic hypogonadism, although in rare cases, it has been reported to occur in normal puberty or even central precocious puberty. This study addresses a case in which central precocious puberty developed in a boy with X-linked adrenal hypoplasia congenita who had complete deletion of the genes DAX-1, GK and IL1RAPL1 (Xp21 contiguous gene deletion syndrome). Initially he was admitted for the management of adrenal crisis at the age of 2 months, and managed with hydrocortisone and florinef. At 45 months of age, his each testicular volumes of 4 mL and a penile length of 5 cm were noted, with pubic hair of Tanner stage 2. His bone age was advanced and a gonadotropin-releasing hormone (GnRH) stimulation test showed a luteinizing hormone peak of 8.26 IU/L, confirming central precocious puberty. He was then treated with a GnRH agonist, as well as steroid replacement therapy. In Korea, this is the first case of central precocious puberty developed in a male patient with X-linked adrenal hypoplasia congenita.

  20. Immediate Early Gene Activity-Regulated Cytoskeletal-Associated Protein Regulates Estradiol-Induced Lordosis Behavior in Female Rats

    PubMed Central

    Christensen, Amy; Dewing, Phoebe; Micevych, Pavel

    2016-01-01

    Sensory feedback is an important component of any behavior, with each instance influencing subsequent activity. Female sexual receptivity is mediated both by the steroid hormone milieu and interaction with the male. We tested the influence of repeated mating on the level of sexual receptivity in ovariectomized rats treated with estradiol benzoate (EB) once every fourth day to mimic the normal phasic changes of circulating estradiol. Females were divided into two groups: naïve, which were tested for lordosis behavior once, and experienced rats, which were tested for lordosis after each EB injection. To monitor the effect of mating, the number of neurons expressing the immediate early gene activity-regulated cytoskeleton-associated protein (Arc) were counted in the mediobasal hypothalamus. Females were unreceptive following the first EB treatment, but the mating induced Arc expression. In naïve rats, each subsequent EB injection increased the levels of sexual receptivity. This ramping was not observed in experienced rats, which achieved only a moderate level of sexual receptivity. However, experienced females treated with EB and progesterone were maximally receptive and did not have Arc expresion. To test whether the expression of Arc attenuated lordosis, Arc antisense oligodeoxynucleotides (asODN) were microinjected into experienced females’ arcuate nuclei. Arc expression was attenuated, and the experienced EB-treated females achieved maximal sexual receptivity. These results demonstrate that Arc expression in the hypothalamus might influence future sexual receptivity and provides evidence of learning in the arcuate nucleus. The loss of Arc results in unrestrained sexual receptivity. PMID:25088303

  1. Identification of Cellular Proteins that Interact with Human Cytomegalovirus Immediate-Early Protein 1 by Protein Array Assay

    PubMed Central

    Puerta Martínez, Francisco; Tang, Qiyi

    2013-01-01

    Human cytomegalovirus (HCMV) gene expression during infection is characterized as a sequential process including immediate-early (IE), early (E), and late (L)-stage gene expression. The most abundantly expressed gene at the IE stage of infection is the major IE (MIE) gene that produces IE1 and IE2. IE1 has been the focus of study because it is an important protein, not only for viral gene expression but also for viral replication. It is believed that IE1 plays important roles in viral gene regulation by interacting with cellular proteins. In the current study, we performed protein array assays and identified 83 cellular proteins that interact with IE1. Among them, seven are RNA-binding proteins that are important in RNA processing; more than half are nuclear proteins that are involved in gene regulations. Tumorigenesis-related proteins are also found to interact with IE1, implying that the role of IE1 in tumorigenesis might need to be reevaluated. Unexpectedly, cytoplasmic proteins, such as Golgi autoantigen and GGA1 (both related to the Golgi trafficking protein), are also found to be associated with IE1. We also employed a coimmunoprecipitation assay to test the interactions of IE1 and some of the proteins identified in the protein array assays and confirmed that the results from the protein array assays are reliable. Many of the proteins identified by the protein array assay have not been previously reported. Therefore, the functions of the IE1-protein interactions need to be further explored in the future. PMID:24385082

  2. Roles of polypyrimidine tract binding proteins in major immediate-early gene expression and viral replication of human cytomegalovirus.

    PubMed

    Cosme, Ruth S Cruz; Yamamura, Yasuhiro; Tang, Qiyi

    2009-04-01

    Human cytomegalovirus (HCMV), a member of the beta subgroup of the family Herpesviridae, causes serious health problems worldwide. HCMV gene expression in host cells is a well-defined sequential process: immediate-early (IE) gene expression, early-gene expression, DNA replication, and late-gene expression. The most abundant IE gene, major IE (MIE) gene pre-mRNA, needs to be spliced before being exported to the cytoplasm for translation. In this study, the regulation of MIE gene splicing was investigated; in so doing, we found that polypyrimidine tract binding proteins (PTBs) strongly repressed MIE gene production in cotransfection assays. In addition, we discovered that the repressive effects of PTB could be rescued by splicing factor U2AF. Taken together, the results suggest that PTBs inhibit MIE gene splicing by competing with U2AF65 for binding to the polypyrimidine tract in pre-mRNA. In intron deletion mutation assays and RNA detection experiments (reverse transcription [RT]-PCR and real-time RT-PCR), we further observed that PTBs target all the introns of the MIE gene, especially intron 2, and affect gene splicing, which was reflected in the variation in the ratio of pre-mRNA to mRNA. Using transfection assays, we demonstrated that PTB knockdown cells induce a higher degree of MIE gene splicing/expression. Consistently, HCMV can produce more viral proteins and viral particles in PTB knockdown cells after infection. We conclude that PTB inhibits HCMV replication by interfering with MIE gene splicing through competition with U2AF for binding to the polypyrimidine tract in MIE gene introns.

  3. 1991 Volvo Award in experimental studies. Cauda equina syndrome: neurologic recovery following immediate, early, or late decompression.

    PubMed

    Delamarter, R B; Sherman, J E; Carr, J B

    1991-09-01

    An animal model of cauda equina syndrome was developed. Neurologic recovery was analyzed following immediate, early, and delayed decompression. Five experimental groups, each containing six dogs, were studied. Compression of the cauda equina was performed in all 30 dogs following an L6-7 laminectomy. The cauda equina was constricted by 75% in each group. The first group was constricted and immediately decompressed. The remaining groups were constricted for 1 hour, 6 hours, 24 hours, and 1 week, respectively, before being decompressed. Somatosensory evoked potentials were performed before and after surgery, before and immediately after decompression, and 6 weeks following decompression. Daily neurologic exams using the Tarlov grading scale were performed. At 6 weeks postdecompression, all dogs were killed, and the neural elements analyzed histologically. Following compression, all 30 dogs had significant lower extremity weakness, tail paralysis, and urinary incontinence. All dogs recovered significant motor function 6 weeks following decompression. The dogs with immediate decompression generally recovered neurologic function within 2-5 days. The dogs receiving 1-hour and 6-hour compression recovered within 5-7 days. The dogs receiving 24-hour compression remained paraparetic 5-7 days, with bladder dysfunction for 7-10 days and tail dysfunction persisting for 4 weeks. The dogs with compression for 1 week were paraparetic (Tarlov Grade 2 or 3) and incontinent during the duration of cauda equina compression. They recovered to walking by 1 week and Tarlov Grade 5 with bladder and tail control at the time of euthanasia. Immediately after compression, all five groups demonstrated at least 50% deterioration of the posterior tibial nerve evoked potential amplitudes.(ABSTRACT TRUNCATED AT 250 WORDS)

  4. Downregulation of immediate-early genes linking to suppression of neuronal plasticity in rats after 28-day exposure to glycidol.

    PubMed

    Akane, Hirotoshi; Saito, Fumiyo; Shiraki, Ayako; Takeyoshi, Masahiro; Imatanaka, Nobuya; Itahashi, Megu; Murakami, Tomoaki; Shibutani, Makoto

    2014-09-01

    We previously found that the 28-day oral toxicity study of glycidol at 200mg/kg/day in rats resulted in axonopathy in both the central and peripheral nervous systems and aberrations in the late-stage of hippocampal neurogenesis targeting the process of neurite extension. To capture the neuronal parameters in response to glycidol toxicity, these animals were subjected to region-specific global gene expression profiling in four regions of cerebral and cerebellar architectures, followed by immunohistochemical analysis of selected gene products. Expression changes of genes related to axonogenesis and synaptic transmission were observed in the hippocampal dentate gyrus, cingulate cortex and cerebellar vermis at 200mg/kg showing downregulation in most genes. In the corpus callosum, genes related to growth, survival and functions of glial cells fluctuated their expression. Immunohistochemically, neurons expressing gene products of immediate-early genes, i.e., Arc, Fos and Jun, decreased in their number in the dentate granule cell layer, cingulate cortex and cerebellar vermis. We also applied immunohistochemical analysis in rat offspring after developmental exposure to glycidol through maternal drinking water. The results revealed increases of Arc(+) neurons at 1000ppm and Fos(+) neurons at ≥300ppm in the dentate granule cell layer of offspring only at the adult stage. These results suggest that glycidol suppressed neuronal plasticity in the brain after 28-day exposure to young adult animals, in contrast to the operation of restoration mechanism to increase neuronal plasticity at the adult stage in response to aberrations in neurogenesis after developmental exposure.

  5. Promoter-specific trans activation and repression by human cytomegalovirus immediate-early proteins involves common and unique protein domains.

    PubMed Central

    Stenberg, R M; Fortney, J; Barlow, S W; Magrane, B P; Nelson, J A; Ghazal, P

    1990-01-01

    trans activation of promoters by viral regulatory proteins provides a useful tool to study coordinate control of gene expression. Immediate-early (IE) regions 1 and 2 of human cytomegalovirus (CMV) code for a series of proteins that originate from differentially spliced mRNAs. These IE proteins are proposed to regulate the temporal expression of the viral genome. To examine the structure and function of the IE proteins, we used linker insertion mutagenesis of the IE gene region as well as cDNA expression vector cloning of the abundant IE mRNAs. We showed that IE1 and IE2 proteins of CMV exhibit promoter-specific differences in their modes of action by either trans activating early and IE promoters or repressing the major IE promoter (MIEP). Transient cotransfection experiments with permissive human cells revealed a synergistic interaction between the 72- and the 86-kilodalton (kDa) IE proteins in trans activating an early promoter. In addition, transfection studies revealed that the 72-kDa protein was capable of trans activating the MIEP. In contrast, the 86-kDa protein specifically repressed the MIEP and this repression was suppressed by the 72-kDa protein. Furthermore, observations based on the primary sequence structure revealed a modular arrangement of putative regulatory motifs that could either potentiate or repress gene expression. These modular domains are either shared or unique among the IE proteins. From these data, we propose a model for IE protein function in the coordinate control of CMV gene expression. Images PMID:2157043

  6. Downregulation of immediate-early genes linking to suppression of neuronal plasticity in rats after 28-day exposure to glycidol

    SciTech Connect

    Akane, Hirotoshi; Saito, Fumiyo; Shiraki, Ayako; Takeyoshi, Masahiro; Imatanaka, Nobuya; Itahashi, Megu; Murakami, Tomoaki; Shibutani, Makoto

    2014-09-01

    We previously found that the 28-day oral toxicity study of glycidol at 200 mg/kg/day in rats resulted in axonopathy in both the central and peripheral nervous systems and aberrations in the late-stage of hippocampal neurogenesis targeting the process of neurite extension. To capture the neuronal parameters in response to glycidol toxicity, these animals were subjected to region-specific global gene expression profiling in four regions of cerebral and cerebellar architectures, followed by immunohistochemical analysis of selected gene products. Expression changes of genes related to axonogenesis and synaptic transmission were observed in the hippocampal dentate gyrus, cingulate cortex and cerebellar vermis at 200 mg/kg showing downregulation in most genes. In the corpus callosum, genes related to growth, survival and functions of glial cells fluctuated their expression. Immunohistochemically, neurons expressing gene products of immediate-early genes, i.e., Arc, Fos and Jun, decreased in their number in the dentate granule cell layer, cingulate cortex and cerebellar vermis. We also applied immunohistochemical analysis in rat offspring after developmental exposure to glycidol through maternal drinking water. The results revealed increases of Arc{sup +} neurons at 1000 ppm and Fos{sup +} neurons at ≥ 300 ppm in the dentate granule cell layer of offspring only at the adult stage. These results suggest that glycidol suppressed neuronal plasticity in the brain after 28-day exposure to young adult animals, in contrast to the operation of restoration mechanism to increase neuronal plasticity at the adult stage in response to aberrations in neurogenesis after developmental exposure. - Highlights: • Neuronal toxicity parameters after 28-day glycidol treatment were examined in rats. • Region-specific global gene expression profiling was conducted in brain regions. • Cortical tissues downregulated genes on axonogenesis and synaptic transmission. • Cortical tissues

  7. Hormonal induction of an immediate-early gene response in myogenic cell lines--a paradigm for heart growth.

    PubMed

    Maass, A; Grohé, C; Kubisch, C; Wollnik, B; Vetter, H; Neyses, L

    1995-05-01

    Cardiac hypertrophy is characterized by growth of myocardial cells without proliferation. Many endo- paracrine stimuli such as angiotensin II, endothelin, alpha 1-adrenergic agonists, and insulin have been shown to be able to induce cardiac hypertrophy either in vivo or in vitro. We have used the myoblast model of differentiation and proliferation to determine nuclear signal transduction mechanisms in muscle and (by analogy) cardiac growth. The first nuclear event known to occur when a growth stimulus acts upon a cell is induction of a family of immediate-early genes. Our group focused on the role of one of these genes, the early growth response gene-1 (Egr-1). We have shown that this gene is induced in isolated adult cardiac myocytes in the presence of endothelin. An anti-sense oligonucleotide complementary to the first six codons of the Egr-1 mRNA abolishes the stimulation of protein synthesis induced by endothelin. In the present study we further characterized paracrine growth stimuli in the myogenic cell line Sol8, which was used as a paradigm to further investigate mechanisms of paracrine growth induction. We demonstrated that a variety of candidate endo- paracrine stimuli for the induction of cardiac hypertrophy induced the Egr-1 messenger RNA in the myogenic cell line Sol8. Among these are endothelin, insulin, basic fibroblast growth factor, and platelet-derived growth factor BB (PDGF BB). We conclude: (1) In analogy to the myocardium, these growth factors act upon myoblasts. (2) This line appears to be a suitable model for the molecular characterization of Egr-1 target genes.

  8. Sex and strategy use matters for pattern separation, adult neurogenesis, and immediate early gene expression in the hippocampus.

    PubMed

    Yagi, Shunya; Chow, Carmen; Lieblich, Stephanie E; Galea, Liisa A M

    2016-01-01

    Adult neurogenesis in the dentate gyrus (DG) plays a crucial role for pattern separation, and there are sex differences in the regulation of neurogenesis. Although sex differences, favoring males, in spatial navigation have been reported, it is not known whether there are sex differences in pattern separation. The current study was designed to determine whether there are sex differences in the ability for separating similar or distinct patterns, learning strategy choice, adult neurogenesis, and immediate early gene (IEG) expression in the DG in response to pattern separation training. Male and female Sprague-Dawley rats received a single injection of the DNA synthesis marker, bromodeoxyuridine (BrdU), and were tested for the ability of separating spatial patterns in a spatial pattern separation version of delayed nonmatching to place task using the eight-arm radial arm maze. Twenty-seven days following BrdU injection, rats received a probe trial to determine whether they were idiothetic or spatial strategy users. We found that male spatial strategy users outperformed female spatial strategy users only when separating similar, but not distinct, patterns. Furthermore, male spatial strategy users had greater neurogenesis in response to pattern separation training than all other groups. Interestingly, neurogenesis was positively correlated with performance on similar pattern trials during pattern separation in female spatial strategy users but negatively correlated with performance in male idiothetic strategy users. These results suggest that the survival of new neurons may play an important positive role for pattern separation of similar patterns in females. Furthermore, we found sex and strategy differences in IEG expression in the CA1 and CA3 regions in response to pattern separation. These findings emphasize the importance of studying biological sex on hippocampal function and neural plasticity.

  9. Activation of immediate-early, early, and late promoters by temperature-sensitive and wild-type forms of herpes simplex virus type 1 protein ICP4.

    PubMed Central

    DeLuca, N A; Schaffer, P A

    1985-01-01

    To better define the activities on herpes simplex virus type 1 gene expression of temperature-sensitive and wild-type forms of the transcriptional regulatory protein ICP4, regulatory sequences from immediate-early, early, and late herpes simplex virus genes were fused to the gene for chloramphenicol acetyltransferase (CAT). These constructs were used in trans induction and cotransfection experiments with wild-type and temperature-sensitive mutant alleles of ICP4. The ICP4 genes used in this study were cloned from the KOS strain (wild type) and two phenotypically distinct temperature-sensitive ICP4 mutants, tsB32 and tsL14 (DeLuca et al., J. Virol. 52:767-776, 1984), both alone and in conjunction with three other immediate-early genes. The latter series of plasmids was used to assess the influence of additional immediate-early gene products on gene expression in the presence of a given ICP4 allele. The results of this study demonstrate that the phenotypes of these ICP4 mutants observed in cell culture at the nonpermissive temperature were determined in part by activities associated with the mutant ICP4 polypeptides and that these activities differed from those of wild-type ICP4. Low levels of wild-type ICP4 had a marginal but reproducible stimulatory effect on immediate-early CAT gene expression, especially the pIE4/5CAT chimera. This effect was diminished with increasing quantities of ICP4, suggesting an inhibitory role for the wild-type form of the protein. The ICP4 mutants had a strong stimulatory effect on immediate-early CAT expression, consistent with their phenotypes at 39 degrees C. The mutant forms of the ICP4 polypeptide differed in their ability to induce CAT activity from an early chimeric gene. Thus, the tsL14 form of ICP4 was effective in early gene induction (i.e., ptkCAT was induced), whereas the ICP4 derived from tsB32 was slightly inhibitory. Cotransfection of tsB32 ICP4 simultaneously with other immediate-early genes resulted in a marginal

  10. Expression and Functions of Immediate Early Response Gene X-1 (IEX-1) in Rheumatoid Arthritis Synovial Fibroblasts

    PubMed Central

    Morinobu, Akio; Tanaka, Shino; Nishimura, Keisuke; Takahashi, Soshi; Kageyama, Goichi; Miura, Yasushi; Kurosaka, Masahiro; Saegusa, Jun; Kumagai, Shunichi

    2016-01-01

    In rheumatoid arthritis (RA), synovial fibroblasts (RA-SFs) accumulate in affected joints, where they play roles in inflammation and joint destruction. RA-SFs exhibit tumor-like proliferation and are resistant to apoptosis. Although RA-SF activation is well described, negative regulators of RA-SF activation are unknown. We previously reported that histone deacetylase (HDAC) inhibitors facilitate apoptosis in RA-SFs. Here we found that RA-SFs treated with the HDAC inhibitor Trichostatin A (TSA) exhibited an upregulation of the immediate early response gene X-1 (IEX-1). IEX-1 has roles in apoptosis sensitivity, cell-cycle progression, and proliferation, and is reported to be involved in immune responses, inflammation, and tumorigenesis, and to have anti-arthritic properties. To investigate IEX-1’s role in RA-SFs, we used in vitro-cultured synovial fibroblasts from RA and osteoarthritis (OA) patients. We confirmed that TSA upregulated the IEX-1 protein and mRNA expressions in RA-SFs by western blotting and quantitative RT-PCR. Inhibiting HDAC1, 2, and 3 (but not 6 or 8) also upregulated IEX-1. The IEX-1 mRNA levels were higher in RA-SFs than in OA-SFs, and were further upregulated in RA-SFs by the pro-inflammatory cytokines TNFα and IL-1β. The staining of surgical specimens showed that IEX-1 was present in the pannus from affected RA joints. Si-RNA-mediated IEX-1 knockdown upregulated the lipopolysaccharide (LPS)-induced expression of TNFα and various chemokine mRNAs, indicating that IEX-1 downregulates TNFα and chemokines. Furthermore, apoptosis analysis showed that IEX-1 knockdown protected RA-SFs from apoptosis induced by TSA or by an anti-Fas mAb, indicating that IEX-1 is pro-apoptotic in RA-SFs. Collectively, our results showed that IEX-1 is induced by TNFα and IL-1β in RA-SFs, in which it suppresses TNFα and chemokine production and induces apoptosis; thus, IEX-1 negatively regulates RA-SF activation. Further investigation of IEX1’s functions in RA

  11. Immediate early gene expression in the vestibular nuclei and related vegetative areas in rats during space flight.

    PubMed

    Pompeiano, O; d'Ascanio, P; Centini, C; Pompeiano, M; Cirelli, C; Tononi, G

    2001-01-01

    Changes in neuronal activity resulting in somatic and vegetative deficits occur during different space flight conditions. Immediate early genes (IEGs: c-fos and Fos-related antigen [FRA]) are useful indicators of changes in neuronal activity and plasticity. They are induced within minutes of several extracellular stimulations, while the corresponding proteins persist for hours (Fos) or days (FRAs). Changes in IEG expression are likely to contribute to adaptation to microgravity and readaptation to the terrestrial environment. During the NASA Neurolab Mission (STS-90), changes in IEG expression were studied in adult male albino rats (Fisher 344) sacrificed at flight day (FD) 2 (24 h after launch), FD14 and at similar time points after re-entry (R + 1, 24 h after re-entry, and R + 13). These time points were chosen to maximize the probability of detecting changes in IEG expression related to changes in gravitational fields occurring during the mission, e.g. (i) increase in gravitational force from 1 to 3 g during the launch, before reaching about 0 g at FD2; (ii) adaptation to 0 g at FD14; (iii) increase in gravity from 0 to approximately 1.5-1.8 g before reaching 1 g at R + 1; and (iv) readaptation to 1 g at R + 13. Fos- and FRA-positive cells were identified in the brainstem of flight rats and ground-based controls using immunocytochemistry. With respect to control rats, the number of labeled cells increased in flight animals in the medial and spinal vestibular nuclei (but not in the lateral vestibular nucleus) at FD2, decreased at FD14, greatly increased at R + 1 and returned to baseline levels at R + 13. Similar changes in IEG expression were also observed in the nucleus of the solitary tract, the area postrema and the central nucleus of the amygdala. In particular, in these vegetative areas the number of Fos-positive cells decreased in flight rats with respect to controls at FD14, i.e. after exposure to 0 g, but significantly increased at R + 1, i.e. after

  12. Familial spinal neurofibromatosis due to a multiexonic NF1 gene deletion.

    PubMed

    Pizzuti, Antonio; Bottillo, Irene; Inzana, Francesca; Lanari, Valentina; Buttarelli, Francesca; Torrente, Isabella; Giallonardo, Anna Teresa; De Luca, Alessandro; Dallapiccola, Bruno

    2011-08-01

    We report the detailed clinical presentation and molecular features of a spinal neurofibromatosis familial case where a 40-year-old woman, presenting with multiple bilateral spinal neurofibromas and no other clinical feature of neurofibromatosis type 1 (NF1), inherited a paternal large multiexonic deletion (c.5944-?_7126+?del) which resulted in NF1 gene haploinsufficiency at the RNA level. In the clinically unaffected 73-year-old father, spinal cord MRI disclosed bilateral and symmetrical hypertrophy of spinal lumbosacral roots. Our study widens the phenotypic and mutational spectrum of NF1 and illustrates the difficulties of counseling patients with border-line or atypical presentation of this disorder.

  13. Novel Comparative Pattern Count Analysis Reveals a Chronic Ethanol-Induced Dynamic Shift in Immediate Early NF-κB Genome-wide Promoter Binding During Liver Regeneration

    PubMed Central

    Kuttippurathu, Lakshmi; Patra, Biswanath; Hoek, Jan B; Vadigepalli, Rajanikanth

    2016-01-01

    Liver regeneration after partial hepatectomy is a clinically important process that is impaired by adaptation to chronic alcohol intake. We focused on the initial time points following partial hepatectomy (PHx) to analyze genome-wide binding activity of NF-κB, a key immediate early regulator. We investigated the effect of chronic alcohol intake on immediate early NF-κB genome-wide localization, in the adapted state as well as in response to partial hepatectomy, using chromatin immunoprecipitation followed by promoter microarray analysis. We found many ethanol-specific NF-κB binding target promoters in the ethanol-adapted state, corresponding to regulation of biosynthetic processes, oxidation-reduction and apoptosis. Partial hepatectomy induced a diet-independent shift in NF-κB binding loci relative to the transcription start sites. We employed a novel pattern count analysis to exhaustively enumerate and compare the number of promoters corresponding to the temporal binding patterns in ethanol and pair-fed control groups. The highest pattern count corresponded to promoters with NF-κB binding exclusively in the ethanol group at 1h post PHx. This set was associated with regulation of cell death, response to oxidative stress, histone modification, mitochondrial function, and metabolic processes. Integration with the global gene expression profiles to identify putative transcriptional consequences of NF-κB binding patterns revealed that several of ethanol-specific 1h binding targets showed ethanol-specific differential expression through 6h post PHx. Motif analysis yielded co-incident binding loci for STAT3, AP-1, CREB, C/EBP-β, PPAR-γ and C/EBP-α, likely participating in co-regulatory modules with NF-κB in shaping the immediate early response to PHx. We conclude that adaptation to chronic ethanol intake disrupts the NF-κB promoter binding landscape with consequences for the immediate early gene regulatory response to the acute challenge of PHx. PMID:26847025

  14. RNA from an immediate early region of the type 1 herpes simplex virus genome is present in the trigeminal ganglia of latently infected mice

    SciTech Connect

    Deatly, A.M.; Spivack, J.G.; Lavi, E.; Fraser, N.W.

    1987-05-01

    Transcription of the type 1 herpes simplex virus (HSV-1) genome in trigeminal ganglia of latently infected mice was studied using in situ hybridization. Probes representative of each temporal gene class were used to determine the regions of the genome that encode the transcripts present in latently infected cells. Probes encoding HSV-1 sequences of the five immediate early genes and representative early (thymidine kinase), early-late (major capsid protein), and late (glycoprotein C) genes were used in these experiments. Of the probes tested, only those encoding the immediate early gene product infected-cell polypeptide (ICP) 0 hybridized to RNA in latently infected tissues. Probes containing the other immediate early genes (ICP4, ICP22, ICP27, and ICP47) and the representative early, early-late, and late genes did not hybridize. Two probes covering approx. = 30% of the HSV-1 genome and encoding over 20 early and late transcripts also did not hybridize to RNA in latently infected tissues. These results, with probes spanning > 60% of the HSV-1 genome, suggest that transcription of the HSV-1 genome is restricted to one region in latently infected mouse trigeminal ganglia.

  15. Is NF-1 gene deletion the molecular mechanism of neurofibromatosis type 1 with destinctive facies?

    SciTech Connect

    Leppig, K.A.; Stephens, K.G.; Viskochill, D.; Kaplan, P.

    1994-09-01

    We have studied a patient with neurofibromatosis type 1 and unusual facial features using fluorescence in situ hybridization (FISH) and found that the patient had a deletion that minimially encompasses exon 2-11 of the NF-1 gene. The patient was one of two individuals initially described by Kaplan and Rosenblatt who suggested that another condition aside from neurofibromatosis type 1 may account for the unusual facial features observed in these patients with neurofibromatosis type 1. FISH studies were performed using a P1 clone probe, P1-9, which contains exons 2-11 of the NF-1 gene on chromosomes prepared from the patients. In all 20 metaphase cells analyzed, one of the chromosome 17 homologues was deleted for the P1-9 probe. Therefore, this patient had neurofibromatosis type 1 and unusual facial features as the result of a deletion which minimally includes exons 2-11 of the NF-1 gene. The extent of the deletion is being mapped by FISH and somatic cell hybrid analysis. The patient studied was a 7-year-old male with mild developmental delays, normal growth parameters, and physical findings consistent with neurofibromatosis type 1, including multiple cafe au lait spots, several curaneous neurofibroma, and speckling of the irises. In addition, his unusual facial features consisted of telecanthus, antimongoloid slant of the palpebral fissures, a broad base of the nose, low set and mildly posteriorly rotated ears, thick helices, high arched palate, short and pointed chin, and low posterior hairline. We propose that deletions of the NF-1 gene and/or contiguous genes are the etiology of neurofibromatosis type 1 and unusual facial features. This particular facial appearance was inherited from the patient`s mother and has been described in other individuals with neurofibromatosis type 1. We are using FISH to rapidly screen patients with this phenotype for large deletions involving the NF-1 gene and flanking DNA sequences.

  16. CNS-restricted Transduction and CRISPR/Cas9-mediated Gene Deletion with an Engineered AAV Vector

    PubMed Central

    Murlidharan, Giridhar; Sakamoto, Kensuke; Rao, Lavanya; Corriher, Travis; Wang, Dan; Gao, Guangping; Sullivan, Patrick; Asokan, Aravind

    2016-01-01

    Gene therapy using recombinant adeno-associated viral (AAV) vectors is emerging as a promising approach to treat central nervous system disorders such as Spinal muscular atrophy, Batten, Parkinson and Alzheimer disease amongst others. A critical remaining challenge for central nervous system-targeted gene therapy, silencing or gene editing is to limit potential vector dose-related toxicity in off-target cells and organs. Here, we characterize a lab-derived AAV chimeric (AAV2g9), which displays favorable central nervous system attributes derived from both parental counterparts, AAV2 and AAV9. This synthetic AAV strain displays preferential, robust, and widespread neuronal transduction within the brain and decreased glial tropism. Importantly, we observed minimal systemic leakage, decreased sequestration and gene transfer in off-target organs with AAV2g9, when administered into the cerebrospinal fluid. A single intracranial injection of AAV2g9 vectors encoding guide RNAs targeting the schizophrenia risk gene MIR137 (encoding MIR137) in CRISPR/Cas9 knockin mice resulted in brain-specific gene deletion with no detectable events in the liver. This engineered AAV vector is a promising platform for treating neurological disorders through gene therapy, silencing or editing modalities. PMID:27434683

  17. In-Frame and Unmarked Gene Deletions in Burkholderia cenocepacia via an Allelic Exchange System Compatible with Gateway Technology.

    PubMed

    Fazli, Mustafa; Harrison, Joe J; Gambino, Michela; Givskov, Michael; Tolker-Nielsen, Tim

    2015-06-01

    Burkholderia cenocepacia is an emerging opportunistic pathogen causing life-threatening infections in immunocompromised individuals and in patients with cystic fibrosis, which are often difficult, if not impossible, to treat. Understanding the genetic basis of virulence in this emerging pathogen is important for the development of novel treatment regimes. Generation of deletion mutations in genes predicted to encode virulence determinants is fundamental to investigating the mechanisms of pathogenesis. However, there is a lack of appropriate selectable and counterselectable markers for use in B. cenocepacia, making its genetic manipulation problematic. Here we describe a Gateway-compatible allelic exchange system based on the counterselectable pheS gene and the I-SceI homing endonuclease. This system provides efficiency in cloning homology regions of target genes and allows the generation of precise and unmarked gene deletions in B. cenocepacia. As a proof of concept, we demonstrate its utility by deleting the Bcam1349 gene, encoding a cyclic di-GMP (c-di-GMP)-responsive regulator protein important for biofilm formation.

  18. In-Frame and Unmarked Gene Deletions in Burkholderia cenocepacia via an Allelic Exchange System Compatible with Gateway Technology

    PubMed Central

    Fazli, Mustafa; Harrison, Joe J.; Gambino, Michela; Givskov, Michael

    2015-01-01

    Burkholderia cenocepacia is an emerging opportunistic pathogen causing life-threatening infections in immunocompromised individuals and in patients with cystic fibrosis, which are often difficult, if not impossible, to treat. Understanding the genetic basis of virulence in this emerging pathogen is important for the development of novel treatment regimes. Generation of deletion mutations in genes predicted to encode virulence determinants is fundamental to investigating the mechanisms of pathogenesis. However, there is a lack of appropriate selectable and counterselectable markers for use in B. cenocepacia, making its genetic manipulation problematic. Here we describe a Gateway-compatible allelic exchange system based on the counterselectable pheS gene and the I-SceI homing endonuclease. This system provides efficiency in cloning homology regions of target genes and allows the generation of precise and unmarked gene deletions in B. cenocepacia. As a proof of concept, we demonstrate its utility by deleting the Bcam1349 gene, encoding a cyclic di-GMP (c-di-GMP)-responsive regulator protein important for biofilm formation. PMID:25795676

  19. Molecular demonstration of SLC4A1 gene deletion in two Mexican patients with Southeast Asian ovalocytosis.

    PubMed

    Ramos-Kuri, Manuel; Carrillo Farga, Joaquín; Zúñiga, Joaquín; Amador Guerrero, María Teresa; Granados, Julio; Estrada, Francisco J

    2005-06-01

    We describe the finding of two Mexican patients with a specific 27-bp deletion in the solute carrier family 4 gene (SLC4A1delta27) (also known as the band 3 gene found on chromosome 17q21-q22), characteristic of Southeast Asian ovalocytosis (SAO). The patients were asymptomatic, and the initial diagnosis was made by microscopic observation of the presence of typical stomatocytic ovalocytes. The gene deletion was confirmed by PCR and DNA sequencing. Both patients were heterozygous for the deletion. One patient is from Tabasco state, in southeastern Mexico, a malaria-endemic zone. The other patient is from Mexico City, which is not a malaria-endemic area. Their families have no non-Mexican ancestors and their previous generations were born in Mexico. Both patients carry the HLA-B*3501 subtype, characteristic of Amerindians and Asian populations. Familial and HLA data led us to conclude that these two patients are the first report of SLC4A1delta27 in Amerindians. The nucleotide analysis showing a perfect match sequence between Southeast Asian and Mexican patients suggests, but does not prove, that the Mexican gene is not a de novo mutation. Instead, this gene might be the result of migration of individuals with Asian ancestry into the Mexican gene pool. We are looking for other families with the mutation to detect, by HLA analysis, the ancient ethnic origin of these patients.

  20. An Efficient Method To Generate Gene Deletion Mutants of the Rapamycin-Producing Bacterium Streptomyces iranensis HM 35

    PubMed Central

    Netzker, Tina; Schroeckh, Volker; Gregory, Matthew A.; Flak, Michal; Krespach, Mario K. C.; Leadlay, Peter F.

    2016-01-01

    ABSTRACT Streptomyces iranensis HM 35 is an alternative rapamycin producer to Streptomyces rapamycinicus. Targeted genetic modification of rapamycin-producing actinomycetes is a powerful tool for the directed production of rapamycin derivatives, and it has also revealed some key features of the molecular biology of rapamycin formation in S. rapamycinicus. The approach depends upon efficient conjugational plasmid transfer from Escherichia coli to Streptomyces, and the failure of this step has frustrated its application to Streptomyces iranensis HM 35. Here, by systematically optimizing the process of conjugational plasmid transfer, including screening of various media, and by defining optimal temperatures and concentrations of antibiotics and Ca2+ ions in the conjugation media, we have achieved exconjugant formation for each of a series of gene deletions in S. iranensis HM 35. Among them were rapK, which generates the starter unit for rapamycin biosynthesis, and hutF, encoding a histidine catabolizing enzyme. The protocol that we have developed may allow efficient generation of targeted gene knockout mutants of Streptomyces species that are genetically difficult to manipulate. IMPORTANCE The developed protocol of conjugational plasmid transfer from Escherichia coli to Streptomyces iranensis may allow efficient generation of targeted gene knockout mutants of other genetically difficult to manipulate, but valuable, Streptomyces species. PMID:27037115

  1. Isolation and characterization of a novel transcript embedded within HIRA, a gene deleted in DiGeorge syndrome.

    PubMed

    Pizzuti, A; Novelli, G; Ratti, A; Amati, F; Bordoni, R; Mandich, P; Bellone, E; Conti, E; Bengala, M; Mari, A; Silani, V; Dallapiccola, B

    1999-07-01

    We have isolated a few cDNAs from different human tissues, transcribed from the first intron of HIRA, a gene deleted in the DiGeorge syndrome. These cDNAs are produced by an intronic gene (22k48) which is transcribed by the HIRA opposite strand and is itself arranged in exons and subjected to alternative splicing. The longest continuum cDNA sequence we obtained is 3.6 kb long and contains 3 different exons and 2 introns. 22k48 cDNA is composed of several tandemly arranged repeated elements (Alu, LINEs, CAn) surrounding a unique sequence. In situ hybridization showed the presence of 22k48 RNA in the cytoplasm of CNS and PNS neurons. 22k48 RNA is able to bind cytoplasmic proteins in the range of 45 to 60 kDa. 22k48 is a new member of the small group of genes that are transcribed but not translated, and its haploinsufficiency could contribute to the pathogenesis of the DiGeorge syndrome.

  2. [Orthopoxvirus genes for kelch-like proteins. III. Construction of mousepox (ectromelia) virus variants with targeted gene deletions].

    PubMed

    Kochneva, G V; Kolosova, I V; Lupan, T A; Sivolobova, G F; Iudin, P V; Grazhdantseva, A A; Riabchikova, E I; Kandrina, N Iu; Shchelkunov, S N

    2009-01-01

    Mousepox (ectromelia) virus genome contains four genes encoding for kelch-like proteins EVM018, EVM027, EVM150 and EVM167. A complete set of insertion plasmids was constructed to allow the production of recombinant ectromelia viruses with targeted deletions of one to four genes of kelch family both individually (single mutants) and in different combinations (double, triple and quadruple mutants). It was shown that deletion of any of the three genes EVMO18, EVM027 or EVM167 resulted in reduction of 50% lethal dose (LD50) by five and more orders in outbred white mice infected intraperitoneally. Deletion of mousepox kelch-gene EVM150 did not influence the virus virulence. Two or more kelch-genes deletion also resulted in high level of attenuation, which could evidently be due to the lack of three genes EVM167, EVM018 and/or EVM027 identified as virulence factors. The local inflammatory process on the model of intradermal injection of mouse ear pinnae (vasodilatation level, hyperemia, cutaneous edema, arterial thrombosis) was significantly more intensive for wild type virus and virulent mutant deltaEVM150 in comparison with avirulent mutant AEVM167.

  3. pNEB193-derived suicide plasmids for gene deletion and protein expression in the methane-producing archaeon, Methanosarcina acetivorans

    PubMed Central

    Shea, Mitchell T.; Walter, Mary E.; Duszenko, Nikolas; Ducluzeau, Anne-Lise; Aldridge, Jared; King, Shannon K.; Buan, Nicole R.

    2016-01-01

    Gene deletion and protein expression are cornerstone procedures for studying metabolism in any organism, including methane-producing archaea (methanogens). Methanogens produce coenzymes and cofactors not found in most bacteria, therefore it is sometimes necessary to express and purify methanogen proteins from the natural host. Protein expression in the native organism is also useful when studying post-translational modifications and their effect on gene expression or enzyme activity. We have created several new suicide plasmids to complement existing genetic tools for use in the methanogen, Methanosarcina acetivorans. The new plasmids are derived from the commercially available E. coli plasmid, pNEB193, and cannot replicate autonomously in methanogens. The designed plasmids facilitate markerless gene deletion, gene transcription, protein expression, and purification of proteins with cleavable affinity tags from the methanogen, Methanosarcina acetivorans. PMID:26876941

  4. Tph2 gene deletion enhances amphetamine-induced hypermotility: effect of 5-HT restoration and role of striatal noradrenaline release.

    PubMed

    Carli, Mirjana; Kostoula, Chrysaugi; Sacchetti, Giuseppina; Mainolfi, Pierangela; Anastasia, Alessia; Villani, Claudia; Invernizzi, Roberto William

    2015-11-01

    Variants of tryptophan hydroxylase-2 (Tph2), the gene encoding enzyme responsible for the synthesis of brain serotonin (5-HT), have been associated with neuropsychiatric disorders, substance abuse and addiction. This study assessed the effect of Tph2 gene deletion on motor behavior and found that motor activity induced by 2.5 and 5 mg/kg amphetamine was enhanced in Tph2(-/-) mice. Using the in vivo microdialysis technique we found that the ability of amphetamine to stimulate noradrenaline (NA) release in the striatum was reduced by about 50% in Tph2(-/-) mice while the release of dopamine (DA) was not affected. Tph2 deletion did not affect the release of NA and DA in the prefrontal cortex. The role of endogenous 5-HT in enhancing the effect of amphetamine was confirmed showing that treatment with the 5-HT precursor 5-hydroxytryptophan (10 mg/kg) restored tissue and extracellular levels of brain 5-HT and the effects of amphetamine on striatal NA release and motor activity in Tph2(-/-) mice. Treatment with the NA precursor dihydroxyphenylserine (400 mg/kg) was sufficient to restore the effect of amphetamine on striatal NA release and motor activity in Tph2(-/-) mice. These findings indicate that amphetamine-induced hyperactivity is attenuated by endogenous 5-HT through the inhibition of striatal NA release. Tph2(-/-) mice may be a useful preclinical model to assess the role of 5-HT-dependent mechanisms in the action of psychostimulants. Acute sensitivity to the motor effects of amphetamine has been associated to increased risk of psychostimulant abuse. Here, we show that deletion of Tph2, the gene responsible for brain 5-HT synthesis, enhances the motor effect of amphetamine in mice through the inhibition of striatal NA release. This suggests that Tph2(-/-) mice is a useful preclinical model to assess the role of 5-HT-dependent mechanisms in psychostimulants action. Tph2, tryptophan hydroxylase-2.

  5. Congenital complete absence of GH, TSH and PRL in infants: a consequence of Pit-1 gene deletion.

    PubMed

    Preeyasombat, C; Suprasongsin, C; Chiranuphab, A; Mahachoklertwattana, P; Sriphrapradang, A; Choubtum, L

    1993-10-01

    The patient was the first child of a short mother (140 cm) born at term with a birthweight of 2,700 g. On arrival, she was 1 4/12-year-old, weighed 4,150 g and 47 cm long. Her bone age was at the 6 month-old level. Endocrine investigation revealed undetectable plasma growth hormone (GH), thyrotropin (TSH) and prolactin (PRL) levels. CT scan of ovaries revealed bilateral ovarian agenesis in spite of normal, 46 XX karyotype. MRI of the brain did not demonstrate intracranial tumor or congenital malformation. Peak plasma GH level after oral clonidine provocation, insulin induced hypoglycemia, and I.V. GH-RF stimulation were 0.6, 0, and 0 ng/ml respectively. Peak plasma TSH response after I.V. TRH stimulation was 0.04 microU/ml. The patient could not secrete PRL at any time after insulin induced hypoglycemia, TRH and metoclopramide stimulations. On the other hand the child had elevated basal plasma cortisol (38 micrograms/dl at 8.00 AM) and raised 24 hr urinary 17 OHCS excretion (50 mg/1 g Cr against normal value of 3 mg/1 g Cr) without evidence of Cushing syndrome probably indicate partial glucocorticoid resistance. Peak plasma cortisol responses after intravenous metoclopramide and insulin induced hypoglycemia were 46 and 42.9 micrograms/dl respectively. Dexamethasone administration reduced plasma cortisol to 2.9 micrograms/dl. The child had also elevated basal plasma FSH (36 microU/ml) and LH (5 microU/ml) with further elevation to the peak of 123 and 99 microU/ml respectively after LHRH stimulation. All evidence suggested the diagnosis of congenital complete absence of GH, TSH, and PRL which is characteristic of Pit-1-gene deletion.(ABSTRACT TRUNCATED AT 250 WORDS)

  6. The Rel/NF-κB pathway and transcription of immediate early genes in T cell activation are inhibited by microgravity

    PubMed Central

    Chang, Tammy T.; Walther, Isabelle; Li, Chai-Fei; Boonyaratanakornkit, Jim; Galleri, Grazia; Meloni, Maria Antonia; Pippia, Proto; Cogoli, Augusto; Hughes-Fulford, Millie

    2012-01-01

    This study tested the hypothesis that transcription of immediate early genes is inhibited in T cells activated in μg. Immunosuppression during spaceflight is a major barrier to safe, long-term human space habitation and travel. The goals of these experiments were to prove that μg was the cause of impaired T cell activation during spaceflight, as well as understand the mechanisms controlling early T cell activation. T cells from four human donors were stimulated with Con A and anti-CD28 on board the ISS. An on-board centrifuge was used to generate a 1g simultaneous control to isolate the effects of μg from other variables of spaceflight. Microarray expression analysis after 1.5 h of activation demonstrated that μg- and 1g-activated T cells had distinct patterns of global gene expression and identified 47 genes that were significantly, differentially down-regulated in μg. Importantly, several key immediate early genes were inhibited in μg. In particular, transactivation of Rel/NF-κB, CREB, and SRF gene targets were down-regulated. Expression of cREL gene targets were significantly inhibited, and transcription of cREL itself was reduced significantly in μg and upon anti-CD3/anti-CD28 stimulation in simulated μg. Analysis of gene connectivity indicated that the TNF pathway is a major early downstream effector pathway inhibited in μg and may lead to ineffective proinflammatory host defenses against infectious pathogens during spaceflight. Results from these experiments indicate that μg was the causative factor for impaired T cell activation during spaceflight by inhibiting transactivation of key immediate early genes. PMID:22750545

  7. Induction of the plasticity-associated immediate early gene Arc by stress and hallucinogens: role of brain-derived neurotrophic factor.

    PubMed

    Benekareddy, Madhurima; Nair, Amrita R; Dias, Brian G; Suri, Deepika; Autry, Anita E; Monteggia, Lisa M; Vaidya, Vidita A

    2013-03-01

    Exposure to stress and hallucinogens in adulthood evokes persistent alterations in neurocircuitry and emotional behaviour. The structural and functional changes induced by stress and hallucinogen exposure are thought to involve transcriptional alterations in specific effector immediate early genes. The immediate early gene, activity regulated cytoskeletal-associated protein (Arc), is important for both activity and experience dependent plasticity. We sought to examine whether trophic factor signalling through brain-derived neurotrophic factor (BDNF) contributes to the neocortical regulation of Arc mRNA in response to distinct stimuli such as immobilization stress and the hallucinogen 2,5-dimethoxy-4-iodoamphetamine (DOI). Acute exposure to either immobilization stress or DOI induced Arc mRNA levels within the neocortex. BDNF infusion into the neocortex led to a robust up-regulation of local Arc transcript expression. Further, baseline Arc mRNA expression in the neocortex was significantly decreased in inducible BDNF knockout mice with an adult-onset, forebrain specific BDNF loss. The induction of Arc mRNA levels in response to both acute immobilization stress or a single administration of DOI was significantly attenuated in the inducible BDNF knockout mice. Taken together, our results implicate trophic factor signalling through BDNF in the regulation of cortical Arc mRNA expression, both under baseline conditions and following stress and hallucinogen exposure. These findings suggest the possibility that the regulation of Arc expression via BDNF provides a molecular substrate for the structural and synaptic plasticity observed following stimuli such as stress and hallucinogens.

  8. The extreme carboxyl terminus of the equine herpesvirus 1 homolog of herpes simplex virus VP16 is essential for immediate-early gene activation.

    PubMed

    Elliott, G D

    1994-08-01

    Gene 12 of equine herpesvirus 1 (EHV-1), the homolog of herpes simplex virus (HSV) VP16 (alpha TIF, Vmw65), was cloned into a eukaryotic expression vector by PCR and used in transactivation studies of both the EHV-1 and HSV-1 IE1 promoters. Results demonstrated that the product of gene 12 is a potent transactivator of immediate-early gene expression of both viruses, which requires sequences in the upstream HSV-1 promoter for activity. Mutational analysis of the gene 12 open reading frame indicated that removal of the C-terminal 7 amino acids, which contain a short region of homology with the extreme C terminus of VP16, inactivated the protein. Within this region, only a single methionine residue appeared to be essential for activity, implying that gene 12 may have a modular array of organization similar to that of VP16. However, fusion of the gene 12 C terminus to a truncated form of VP16, which contained the complex formation domain, did not restore activity to the HSV-1 protein. These data demonstrate that the EHV-1 immediate-early transactivator may not be functionally colinear with VP16, with transactivation requiring both the C terminus and another region(s) present within the N-terminal portion.

  9. The promoter of the white spot syndrome virus immediate-early gene WSSV108 is activated by the cellular KLF transcription factor.

    PubMed

    Liu, Wang-Jing; Lo, Chu-Fang; Kou, Guang-Hsiung; Leu, Jiann-Horng; Lai, Ying-Jang; Chang, Li-Kwan; Chang, Yun-Shiang

    2015-03-01

    A series of deletion and mutation assays of the white spot syndrome virus (WSSV) immediate-early gene WSSV108 promoter showed that a Krüppel-like factor (KLF) binding site located from -504 to -495 (relative to the transcription start site) is important for the overall level of WSSV108 promoter activity. Electrophoretic mobility shift assays further showed that overexpressed recombinant Penaeus monodon KLF (rPmKLF) formed a specific protein-DNA complex with the (32)P-labeled KLF binding site of the WSSV108 promoter, and that higher levels of Litopenaeus vannamei KLF (LvKLF) were expressed in WSSV-infected shrimp. A transactivation assay indicated that the WSSV108 promoter was strongly activated by rPmKLF in a dose-dependent manner. Lastly, we found that specific silencing of LvKLF expression in vivo by dsRNA injection dramatically reduced both WSSV108 expression and WSSV replication. We conclude that shrimp KLF is important for WSSV genome replication and gene expression, and that it binds to the WSSV108 promoter to enhance the expression of this immediate-early gene.

  10. Shrimp STAT was hijacked by white spot syndrome virus immediate-early protein IE1 involved in modulation of viral genes.

    PubMed

    Yao, Defu; Ruan, Lingwei; Lu, Huasong; Shi, Hong; Xu, Xun

    2016-12-01

    STATs are a family of transcription factors that regulate a cascade of cellular processes including cell growth, differentiation, apoptosis and immune responses. However, they are usually targeted by viruses to assist infection. In this study, we identified that white spot syndrome virus (WSSV) immediate-early protein IE1 interacted with Litopenaeus vannamei STAT (LvSTAT) and thereby led to its phosphorylation activation. In addition, we demonstrated that LvSTAT could bind to the promoters of the viral immediate-early genes wsv051 and ie1 through STAT-binding motifs in vitro and vivo, allowing the enhancement of their promoters' activities. Moreover, IE1 could promote the transcriptional activation activity of LvSTAT to augment the transcription of wsv051 and ie1. In conclusion, our findings revealed a novel linkage between WSSV IE1 and shrimp STAT, which was a clue to well understand how WSSV adopted the active strategies to modulate the shrimp signaling pathway.

  11. A major transactivator of varicella-zoster virus, the immediate-early protein IE62, contains a potent N-terminal activation domain.

    PubMed Central

    Perera, L P; Mosca, J D; Ruyechan, W T; Hayward, G S; Straus, S E; Hay, J

    1993-01-01

    Accumulating evidence indicates that the product of the putative immediate-early gene ORF62 (IE62) activates varicella-zoster virus (VZV) genes thought to represent all three kinetic classes, namely, immediate-early (alpha), early (beta), and late (gamma) classes, of VZV genes as well as a variety heterologous gene promoters. However, the mechanism(s) by which IE62 protein mediates transactivation of these diverse VZV and heterologous gene promoters remains to be elucidated. In this study, by using yeast GAL4 protein chimeras, the coding regions of VZV ORF62 possessing activation domains have been assessed. We demonstrate that the VZV IE62 protein contains a potent activation domain in the N-terminal portion of the molecule, encoded within the first 86 codons of ORF62. The predicted secondary structure profile and the acid-base composition of this IE62 domain resemble those of other transregulatory proteins whose activation is mediated through acidic, hydrophobic elements. In addition, we show that deletion of this activation domain from the 1,310-residue native IE62 protein results in ablation of the transactivator function of IE62. We also present evidence that the mutant IE62 protein lacking the activation domain, though devoid of transactivation ability, was still capable of interfering with the activation of target promoters by the native, full-length IE62. Images PMID:8392592

  12. Hippocampal activation of immediate early genes Zenk and c-Fos in zebra finches (Taeniopygia guttata) during learning and recall of a spatial memory task.

    PubMed

    Mayer, Uwe; Watanabe, Shigeru; Bischof, Hans-Joachim

    2010-03-01

    Zebra finches (Taeniopygia guttata) are able to learn the position of food by orienting on spatial cues in a 'dry water maze'. In the course of spatial learning, the hippocampus shows high expression of the immediate early genes (IEGs) Zenk and c-Fos, indicating high activation of this area during learning. In contrast, the IEG activity is nearly absent if the birds do not have to rely on spatial cues. In the present experiment it was investigated whether hippocampal activation can also be observed if the learned spatial task is recalled. For this purpose, the hippocampal Zenk and c-Fos activation of birds in an early learning stage was compared with that of others having well reached their maximal performance. The results show that the avian hippocampus is also active during recall of a learned spatial task, but the activation is significantly lower than in animals learning actually. As in previous experiments, hippocampal IEG expression showed strong variation not only in the position of the active patches of neurons, but also in size and cell density. The observed difference contributes to the view that immediate early genes may not be indicators of activation alone, but may be due to a combination of activation and plastic changes.

  13. Na+ dependent acid-base transporters in the choroid plexus; insights from slc4 and slc9 gene deletion studies

    PubMed Central

    Christensen, Henriette L.; Nguyen, An T.; Pedersen, Fredrik D.; Damkier, Helle H.

    2013-01-01

    The choroid plexus epithelium (CPE) is located in the ventricular system of the brain, where it secretes the majority of the cerebrospinal fluid (CSF) that fills the ventricular system and surrounds the central nervous system. The CPE is a highly vascularized single layer of cuboidal cells with an unsurpassed transepithelial water and solute transport rate. Several members of the slc4a family of bicarbonate transporters are expressed in the CPE. In the basolateral membrane the electroneutral Na+ dependent Cl−/HCO3− exchanger, NCBE (slc4a10) is expressed. In the luminal membrane, the electrogenic Na+:HCO3− cotransporter, NBCe2 (slc4a5) is expressed. The electroneutral Na+:HCO3− cotransporter, NBCn1 (slc4a7), has been located in both membranes. In addition to the bicarbonate transporters, the Na+/H+ exchanger, NHE1 (slc9a1), is located in the luminal membrane of the CPE. Genetically modified mice targeting slc4a2, slc4a5, slc4a7, slc4a10, and slc9a1 have been generated. Deletion of slc4a5, 7 or 10, or slc9a1 has numerous impacts on CP function and structure in these mice. Removal of the transporters affects brain ventricle size (slc4a5 and slc4a10) and intracellular pH regulation (slc4a7 and slc4a10). In some instances, removal of the proteins from the CPE (slc4a5, 7, and 10) causes changes in abundance and localization of non-target transporters known to be involved in pH regulation and CSF secretion. The focus of this review is to combine the insights gathered from these knockout mice to highlight the impact of slc4 gene deletion on the CSF production and intracellular pH regulation resulting from the deletion of slc4a5, 7 and 10, and slc9a1. Furthermore, the review contains a comparison of the described human mutations of these genes to the findings in the knockout studies. Finally, the future perspective of utilizing these proteins as potential targets for the treatment of CSF disorders will be discussed. PMID:24155723

  14. Cystathionine-Gamma-Lyase Gene Deletion Protects Mice against Inflammation and Liver Sieve Injury following Polymicrobial Sepsis

    PubMed Central

    Gaddam, Ravinder Reddy; Fraser, Robin; Badiei, Alireza; Chambers, Stephen; Cogger, Victoria C; Le Couteur, David G; Ishii, Isao; Bhatia, Madhav

    2016-01-01

    Background Hydrogen sulfide (H2S), produced by the activity of cystathionine-gamma-lyase (CSE), is a key mediator of inflammation in sepsis. The liver sinusoidal endothelial cells (LSECs) are important target and mediator of sepsis. The aim of this study was to investigate the role of CSE-derived H2S on inflammation and LSECs fenestrae in caecal-ligation and puncture (CLP)-induced sepsis using CSE KO mice. Methods Sepsis was induced by CLP, and mice (C57BL/6J, male) were sacrificed after 8 hours. Liver, lung, and blood were collected and processed to measure CSE expression, H2S synthesis, MPO activity, NF-κB p65, ERK1/2, and cytokines/chemokines levels. Diameter, frequency, porosity and gap area of the liver sieve were calculated from scanning electron micrographs of the LSECs. Results An increased CSE expression and H2S synthesizing activity in the liver and lung of wild-type mice following CLP-induced sepsis. This was associated with an increased liver and lung MPO activity, and increased liver and lung and plasma levels of the pro-inflammatory cytokines TNF-α, IL-6, and IL-1β, and the chemokines MCP-1 and MIP-2α. Conversely, CSE KO mice had less liver and lung injury and reduced inflammation following CLP-induced sepsis as evidenced by decreased levels of H2S synthesizing activity, MPO activity, and pro-inflammatory cytokines/chemokines production. Extracellular-regulated kinase (ERK1/2) and nuclear factor-κB p65 (NF-κB) became significantly activated after the CLP in WT mice but not in CSE KO mice. In addition, CLP-induced damage to the LSECs, as indicated by increased defenestration and gaps formation in the LSECs compared to WT sham control. CSE KO mice showed decreased defenestration and gaps formation following sepsis. Conclusions Mice with CSE (an H2S synthesising enzyme) gene deletion are less susceptible to CLP-induced sepsis and associated inflammatory response through ERK1/2-NF-κB p65 pathway as evidenced by reduced inflammation, tissue damage

  15. Cellular homeoproteins, SATB1 and CDP, bind to the unique region between the human cytomegalovirus UL127 and major immediate-early genes

    SciTech Connect

    Lee Jialing; Klase, Zachary; Gao Xiaoqi; Caldwell, Jeremy S.; Stinski, Mark F.; Kashanchi, Fatah; Chao, S.-H.

    2007-09-15

    An AT-rich region of the human cytomegalovirus (CMV) genome between the UL127 open reading frame and the major immediate-early (MIE) enhancer is referred to as the unique region (UR). It has been shown that the UR represses activation of transcription from the UL127 promoter and functions as a boundary between the divergent UL127 and MIE genes during human CMV infection [Angulo, A., Kerry, D., Huang, H., Borst, E.M., Razinsky, A., Wu, J., Hobom, U., Messerle, M., Ghazal, P., 2000. Identification of a boundary domain adjacent to the potent human cytomegalovirus enhancer that represses transcription of the divergent UL127 promoter. J. Virol. 74 (6), 2826-2839; Lundquist, C.A., Meier, J.L., Stinski, M.F., 1999. A strong negative transcriptional regulatory region between the human cytomegalovirus UL127 gene and the major immediate-early enhancer. J. Virol. 73 (11), 9039-9052]. A putative forkhead box-like (FOX-like) site, AAATCAATATT, was identified in the UR and found to play a key role in repression of the UL127 promoter in recombinant virus-infected cells [Lashmit, P.E., Lundquist, C.A., Meier, J.L., Stinski, M.F., 2004. Cellular repressor inhibits human cytomegalovirus transcription from the UL127 promoter. J. Virol. 78 (10), 5113-5123]. However, the cellular factors which associate with the UR and FOX-like region remain to be determined. We reported previously that pancreatic-duodenal homeobox factor-1 (PDX1) bound to a 45-bp element located within the UR [Chao, S.H., Harada, J.N., Hyndman, F., Gao, X., Nelson, C.G., Chanda, S.K., Caldwell, J.S., 2004. PDX1, a Cellular Homeoprotein, Binds to and Regulates the Activity of Human Cytomegalovirus Immediate Early Promoter. J. Biol. Chem. 279 (16), 16111-16120]. Here we demonstrate that two additional cellular homeoproteins, special AT-rich sequence binding protein 1 (SATB1) and CCAAT displacement protein (CDP), bind to the human CMV UR in vitro and in vivo. Furthermore, CDP is identified as a FOX-like binding protein

  16. HBV polymerase overexpression due to large core gene deletion enhances hepatoma cell growth by binding inhibition of microRNA-100

    PubMed Central

    Huang, Ya-Hui; Tseng, Ying-Hsin; Lin, Wey-Ran; Hung, George; Chen, Tse-Ching; Wang, Tong-Hong; Lee, Wei-Chen; Yeh, Chau-Ting

    2016-01-01

    Different types of hepatitis B virus (HBV) core gene deletion mutants were identified in chronic hepatitis B patients. However, their clinical roles in different stages of natural chronic HBV infection remained unclear. To address this issue, HBV core genes were sequenced in three gender- and age-matched patient groups diagnosed as chronic hepatitis, cirrhosis and hepatocellular carcinoma (HCC), respectively. Functional analysis of the identified mutants was performed. A novel type of large-fragment core gene deletion (LFCD) was identified exclusively in HCC patients and significantly associated with unfavorable postoperative survival. The presence of LFCDs resulted in generation of precore-polymerase fusion protein or brought the polymerase reading frame under direct control of HBV precore/core promoter, leading to its over-expression. Enhanced cell proliferation and increased tumorigenicity in nude mice were found in hepatoma cells expressing LFCDs. Because of the epsilon-binding ability of HBV polymerase, we hypothesized that the over-expressed polymerase carrying aberrant amino-terminal sequence could bind to cellular microRNAs. Screening of a panel of microRNAs revealed physical association of a precore-polymerase fusion protein with microRNA-100. A binding inhibition effect on microRNA-100 by the precore-polymerase fusion protein with up-regulation of its target, polo-like kinase 1 (PLK1), was discovered. The binding inhibition and growth promoting effects could be reversed by overexpressing microRNA-100. Together, HCC patients carrying hepatitis B large-fragment core gene deletion mutants had an unfavorable postoperative prognosis. The growth promoting effect was partly due to polymerase overexpression, leading to binding inhibition of microRNA-100 and up-regulation of PLK1. PMID:26824500

  17. Histidine-rich protein 2 (pfhrp2) and pfhrp3 gene deletions in Plasmodium falciparum isolates from select sites in Brazil and Bolivia.

    PubMed

    Rachid Viana, Giselle Maria; Akinyi Okoth, Sheila; Silva-Flannery, Luciana; Lima Barbosa, Danielle Regina; Macedo de Oliveira, Alexandre; Goldman, Ira F; Morton, Lindsay C; Huber, Curtis; Anez, Arletta; Dantas Machado, Ricardo Luiz; Aranha Camargo, Luís Marcelo; Costa Negreiros do Valle, Suiane; Marins Póvoa, Marinete; Udhayakumar, Venkatachalam; Barnwell, John W

    2017-01-01

    More than 80% of available malaria rapid diagnostic tests (RDTs) are based on the detection of histidine-rich protein-2 (PfHRP2) for diagnosis of Plasmodium falciparum malaria. Recent studies have shown the genes that code for this protein and its paralog, histidine-rich protein-3 (PfHRP3), are absent in parasites from the Peruvian Amazon Basin. Lack of PfHRP2 protein through deletion of the pfhrp2 gene leads to false-negative RDT results for P. falciparum. We have evaluated the extent of pfhrp2 and pfhrp3 gene deletions in a convenience sample of 198 isolates from six sites in three states across the Brazilian Amazon Basin (Acre, Rondonia and Para) and 25 isolates from two sites in Bolivia collected at different times between 2010 and 2012. Pfhrp2 and pfhrp3 gene and their flanking genes on chromosomes 7 and 13, respectively, were amplified from 198 blood specimens collected in Brazil. In Brazil, the isolates collected in Acre state, located in the western part of the Brazilian Amazon, had the highest percentage of deletions for pfhrp2 25 (31.2%) of 79, while among those collected in Rondonia, the prevalence of pfhrp2 gene deletion was only 3.3% (2 out of 60 patients). In isolates from Para state, all parasites were pfhrp2-positive. In contrast, we detected high proportions of isolates from all 3 states that were pfhrp3-negative ranging from 18.3% (11 out of 60 samples) to 50.9% (30 out of 59 samples). In Bolivia, only one of 25 samples (4%) tested had deleted pfhrp2 gene, while 68% (17 out of 25 samples) were pfhrp3-negative. Among the isolates tested, P. falciparum pfhrp2 gene deletions were present mainly in those from Acre State in the Brazilian Amazon. These results indicate it is important to reconsider the use of PfHRP2-based RDTs in the western region of the Brazilian Amazon and to implement appropriate surveillance systems to monitor pfhrp2 gene deletions in this and other parts of the Amazon region.

  18. Histidine-rich protein 2 (pfhrp2) and pfhrp3 gene deletions in Plasmodium falciparum isolates from select sites in Brazil and Bolivia

    PubMed Central

    Rachid Viana, Giselle Maria; Akinyi Okoth, Sheila; Silva-Flannery, Luciana; Lima Barbosa, Danielle Regina; Macedo de Oliveira, Alexandre; Goldman, Ira F.; Morton, Lindsay C.; Huber, Curtis; Anez, Arletta; Dantas Machado, Ricardo Luiz; Aranha Camargo, Luís Marcelo; Costa Negreiros do Valle, Suiane; Marins Póvoa, Marinete; Barnwell, John W.

    2017-01-01

    More than 80% of available malaria rapid diagnostic tests (RDTs) are based on the detection of histidine-rich protein-2 (PfHRP2) for diagnosis of Plasmodium falciparum malaria. Recent studies have shown the genes that code for this protein and its paralog, histidine-rich protein-3 (PfHRP3), are absent in parasites from the Peruvian Amazon Basin. Lack of PfHRP2 protein through deletion of the pfhrp2 gene leads to false-negative RDT results for P. falciparum. We have evaluated the extent of pfhrp2 and pfhrp3 gene deletions in a convenience sample of 198 isolates from six sites in three states across the Brazilian Amazon Basin (Acre, Rondonia and Para) and 25 isolates from two sites in Bolivia collected at different times between 2010 and 2012. Pfhrp2 and pfhrp3 gene and their flanking genes on chromosomes 7 and 13, respectively, were amplified from 198 blood specimens collected in Brazil. In Brazil, the isolates collected in Acre state, located in the western part of the Brazilian Amazon, had the highest percentage of deletions for pfhrp2 25 (31.2%) of 79, while among those collected in Rondonia, the prevalence of pfhrp2 gene deletion was only 3.3% (2 out of 60 patients). In isolates from Para state, all parasites were pfhrp2-positive. In contrast, we detected high proportions of isolates from all 3 states that were pfhrp3-negative ranging from 18.3% (11 out of 60 samples) to 50.9% (30 out of 59 samples). In Bolivia, only one of 25 samples (4%) tested had deleted pfhrp2 gene, while 68% (17 out of 25 samples) were pfhrp3-negative. Among the isolates tested, P. falciparum pfhrp2 gene deletions were present mainly in those from Acre State in the Brazilian Amazon. These results indicate it is important to reconsider the use of PfHRP2-based RDTs in the western region of the Brazilian Amazon and to implement appropriate surveillance systems to monitor pfhrp2 gene deletions in this and other parts of the Amazon region. PMID:28301474

  19. Glucocorticoids facilitate the transcription from the human cytomegalovirus major immediate early promoter in glucocorticoid receptor- and nuclear factor-I-like protein-dependent manner.

    PubMed

    Inoue-Toyoda, Maki; Kato, Kohsuke; Nagata, Kyosuke; Yoshikawa, Hiroyuki

    2015-02-27

    Human cytomegalovirus (HCMV) is a common and usually asymptomatic virus agent in healthy individuals. Initiation of HCMV productive infection depends on expression of the major immediate early (MIE) genes. The transcription of HCMV MIE genes is regulated by a diverse set of transcription factors. It was previously reported that productive HCMV infection is triggered probably by elevation of the plasma hydroxycorticoid level. However, it is poorly understood whether the transcription of MIE genes is directly regulated by glucocorticoid. Here, we found that the dexamethasone (DEX), a synthetic glucocorticoid, facilitates the transcription of HCMV MIE genes through the MIE promoter and enhancer in a glucocorticoid receptor (GR)-dependent manner. By competitive EMSA and reporter assays, we revealed that an NF-I like protein is involved in DEX-mediated transcriptional activation of the MIE promoter. Thus, this study supports a notion that the increased level of hydroxycorticoid in the third trimester of pregnancy reactivates HCMV virus production from the latent state.

  20. Hippocampus and medial striatum dissociation during goal navigation by geometry or features in the domestic chick: An immediate early gene study.

    PubMed

    Mayer, Uwe; Pecchia, Tommaso; Bingman, Verner Peter; Flore, Michele; Vallortigara, Giorgio

    2016-01-01

    We employed a standard reference memory task to study the involvement of the hippocampal formation (HF) of domestic chicks that used the boundary geometry of a test environment to orient to and locate a reward. Using the immediate early gene product c-Fos as a neuronal activity marker, we found enhanced HF activation in chicks that learned to locate rewarded corners using the shape of a rectangular arena compared to chicks trained to solve the task by discriminating local features in a square-shaped arena. We also analyzed neuronal activity in the medial part of the medial striatum (mMSt). Surprisingly, in mMSt we observed a reverse pattern, with higher activity in the chicks that were trained to locate the goal by local features. Our results identify two seemingly parallel, memory systems in chicks, with HF central to the processing of spatial-geometrical information and mMSt important in supporting local feature discrimination.

  1. Epstein-Barr virus immediate-early gene product trans-activates gene expression from the human immunodeficiency virus long terminal repeat

    SciTech Connect

    Kenney, S.; Kamine, J.; Markovitz, D.; Fenrick, R.; Pagano, J.

    1988-03-01

    Acquired immunodeficiency syndrome patients are frequently coinfected with Epstein-Barr virus (EBV). In this report, the authors demonstrate that an EBV immediate-early gene product, BamHI MLF1, stimulates expression of the bacterial chloramphenicol acetyltransferase (CAT) gene linked to the human immunodeficiency virus (HIV) promoter. The HIV promoter sequences necessary for trans-activation by EBV do not include the tat-responsive sequences. In addition, in contrast to the other herpesvirus trans-activators previously studied, the EBV BamHI MLF1 gene product appears to function in part by a posttranscriptional mechanism, since it increases pHIV-CAT protein activity more than it increases HIV-CAT mRNA. This ability of an EBV gene product to activate HIV gene expression may have biologic consequences in persons coinfected with both viruses.

  2. A long and complex enhancer activates transcription of the gene coding for the highly abundant immediate early mRNA in murine cytomegalovirus.

    PubMed Central

    Dorsch-Häsler, K; Keil, G M; Weber, F; Jasin, M; Schaffner, W; Koszinowski, U H

    1985-01-01

    Using the simian virus 40 "enhancer trap" approach, we have identified a transcription enhancer located just upstream of the major immediate early gene of murine cytomegalovirus. This enhancer has several striking properties. (i) Together with the enhancer of human cytomegalovirus, it is the strongest transcription enhancer found to date. (ii) It is an extremely long enhancer, spanning greater than 700 base pairs. (iii) It consists of a rather complex pattern of sequence repeats, the longest of which is 181 base pairs. Also, several types of short sequence motifs are scattered throughout the enhancer in monomeric, heterodimeric, or homodimeric (palindromic) form. These motifs have been identified to be components of other enhancers and promoters, and they are presumably binding sites for specific nuclear factors. Our analysis suggests that enhancers are composed of a modular arrangement of short conserved sequence motifs and that enhancer strength is correlated with the redundancy of these motifs. Images PMID:3001696

  3. [Influence of dexamethasone on the expression of immediate early genes c-fos and c-jun in different regions of the neonatal brain].

    PubMed

    Sukhareva, E V; Dygalo, N N; Kalinina, T S

    2016-01-01

    The ratio of the expression levels of the immediate early genes c-jun and c-fos that encode components of the AP-1 transcription complex determines the direction of changes in the expression of genes controlled by the complex, including changes induced by glucocorticoids. The aim of the present work was to assess the levels of mRNA encoded by genes c-jun and c-fos and the ratio of expression levels of these genes in various regions of the neonatal rat brain after the administration of dexamethasone, a selective ligand of the glucocorticoid receptor. The level of mRNA encoded by the immediate early gene c-fos in the hippocampus and prefrontal cortex of 3-day-old rat pups was elevated at 30, 60, and 120 min after dexamethasone administration. The basal level of c-fos gene expression in the brainstem was higher than in the cortex and hippocampus, and administration of the hormone was followed by a reduction in the amount of transcript detectable in the brainstem after 2 h. As a result, the ratio of c-jun to c-fos transcript levels in the brainstem of neonatal rats was doubled after dexamethasone administration. The dexamethasone-induced shift of the ratio of c-jun to c-fos transcript levels in the brainstem of neonatal rats towards a predominance of c-jun reported for the first time in the present work may induce the expression of genes that contain AP-1 response elements in the promoters, since the glucocorticoid receptor can be involved in protein-protein interactions with the Jun/Jun homodimer of the AP-1 complex.

  4. Herpes simplex virus 1 immediate-early and early gene expression during reactivation from latency under conditions that prevent infectious virus production.

    PubMed

    Pesola, Jean M; Zhu, Jia; Knipe, David M; Coen, Donald M

    2005-12-01

    The program of gene expression exhibited by herpes simplex virus during productive infection of cultured cells is well established; however, less is known about the regulatory controls governing reactivation from latency in neurons. One difficulty in examining gene regulation during reactivation lies in distinguishing between events occurring in initial reactivating cells versus events occurring in secondarily infected cells. Thus, two inhibitors were employed to block production of infectious virus: acyclovir, which inhibits viral DNA synthesis, and WAY-150138, which permits viral DNA synthesis but inhibits viral DNA encapsidation. Latently infected murine ganglia were explanted in the presence of either inhibitor, and then amounts of RNA, DNA, or infectious virus were quantified. In ganglia explanted for 48 h, the levels of five immediate-early and early RNAs did not exhibit meaningful differences between acyclovir and WAY-150138 treatments when analyzed by in situ hybridization or quantitative reverse transcription-PCR. However, comparative increases in viral DNA and RNA content in untreated ganglia suggested that virus was produced before 48 h postexplant. This was confirmed by the detection of infectious virus as early as 14 h postexplant. Together, these results suggest that high levels of viral gene expression at 48 h postexplant are due largely to the production of infectious virus and subsequent spread through the tissue. These results lead to a reinterpretation of previous results indicating a role for DNA replication in immediate-early and early viral gene expression; however, it remains possible that viral gene expression is regulated differently in neurons than in cultured cells.

  5. Isolation rearing impairs wound healing and is associated with increased locomotion and decreased immediate early gene expression in the medial prefrontal cortex of juvenile rats.

    PubMed

    Levine, J B; Leeder, A D; Parekkadan, B; Berdichevsky, Y; Rauch, S L; Smoller, J W; Konradi, C; Berthiaume, F; Yarmush, M L

    2008-01-24

    In addition to its maladaptive effects on psychiatric function, psychosocial deprivation impairs recovery from physical illness. Previously, we found that psychosocial deprivation, modeled by isolation rearing, depressed immediate early gene (IEG) expression in the medial prefrontal cortex (mPFC) and increased locomotion in the open field test [Levine JB, Youngs RM, et al. (2007) Isolation rearing and hyperlocomotion are associated with reduced immediate early gene expression levels in the medial prefrontal cortex. Neuroscience 145(1):42-55]. In the present study, we examined whether similar changes in behavior and gene expression are associated with the maladaptive effects of psychosocial deprivation on physical injury healing. After weaning, anesthetized rats were subjected to a 20% total body surface area third degree burn injury and were subsequently either group or isolation reared. After 4 weeks of either isolation or group rearing (a period that encompasses post-wearing and early adolescence), rats were killed, and their healing and gene expression in the mPFC were assessed. Locomotion in the open field test was examined at 3 weeks post-burn injury. We found that: 1) gross wound healing was significantly impaired in isolation-reared rats compared with group-reared rats, 2) locomotion was increased and IEG expression was suppressed for isolation-reared rats during burn injury healing, 3) the decreased activity in the open field and increased IEG expression was greater for burn injury healing group-reared rats than for uninjured group-reared rats, 4) the degree of hyperactivity and IEG suppression was relatively similar between isolation-reared rats during burn injury compared with uninjured isolation-reared rats. Thus, in the mPFC, behavioral hyperactivity to novelty (the open field test) along with IEG suppression may constitute a detectable biomarker of isolation rearing during traumatic physical injury. Implications of the findings for understanding

  6. Investigation of TBX1 gene deletion in Iranian children with 22q11.2 deletion syndrome: correlation with conotruncal heart defects

    PubMed Central

    Ganji, Hamid; Salehi, Mansoor; Sedghi, Maryam; Abdali, Hossein; Nouri, Nayereh; Sadri, Leyli; Hosseinzadeh, Majid; Vakili, Bahareh; Lotfi, Mahdi

    2013-01-01

    Background DiGeorge syndrome (DGS) is the result of a microdeletion in chromosome 22q11.2 in over 90% of cases. DGS is the second most frequent syndrome after Down syndrome and has an incidence of 1/4000 births. Unequal crossover between low-copy repeats, on the proximal part of the long arm of chromosome 22, usually results in a 3 Mb deletion in one of the chromosome 22 and a reciprocal and similarly sized duplication on the other one. Several studies have indicated that TBX1 (T-box 1) haploinsufficiency is responsible for many of the phenotypic traits of 22q11.2 deletion syndrome. Conotruncal heart defects (CTDs) are present in 75–85% of patients with 22q11.2 deletion syndrome in Western countries. Methods Among 78 patients fulfilling the criteria for DGS diagnosed by the fluorescence in situ hybridisation test, 24 had 22q11.2 deletion. Screening for TBX1 gene deletion was performed by multiplex ligation-dependent probe amplification (MLPA). Results Our results revealed that of 24 patients with TBX1 gene deletion, 12 had CTDs while 12 did not show any heart defects. Conclusions Our findings indicate that other genes or gene interactions may play a role in penetrance or the severity of heart disease among patients with DGS. PMID:27326128

  7. Construction of brewing-wine Aspergillus oryzae pyrG- mutant by pyrG gene deletion and its application in homology transformation.

    PubMed

    Du, Yu; Xie, Guizhen; Yang, Chunfa; Fang, Baishan; Chen, Hongwen

    2014-06-01

    pyrG(-) host cells are indispensable for pyrG(-) based transformation system. Isolations of pyrG(-) host cells by random mutations are limited by time-consuming, unclear genetic background and potential interferences of homogenous recombination. The purpose of this study was to construct brewing-wine Aspergillus oryzae pyrG(-) mutant by site-directed mutation of pyrG gene deletion which would be used as a host for further transformation. pMD-pyrGAB, a vector carrying pyrG deletion cassette, was used to construct pyrG(-) mutant of A. oryzae. Three stable pyrG deletion mutants of A. oryzae were isolated by resistant to 5-fluoroorotic acid and confirmed by polymerase chain reaction analysis, indicating that pyrG was completely excised. The ΔpyrG mutants were applied as pyrG(-) host cells to disrupt xdh gene encoding xylitol dehydrogenase, which involves in xylitol production of A. oryzae. The xdh disruption mutants were efficiently constructed by transforming a pMD-pyrG-xdh disruption plasmid carrying pyrG, and the produced xylitol concentration of the Δxdh mutant was three times as much as that of the ΔpyrG recipient. Site-directed pyrG gene deletion is thus an effective way for the isolation of pyrG(-) host cells, and the established host-vector system could be applied in further functional genomics analysis and molecular breeding of A. oryzae.

  8. Heterozygous Hfe gene deletion leads to impaired glucose homeostasis, but not liver injury in mice fed a high-calorie diet.

    PubMed

    Britton, Laurence; Jaskowski, Lesley; Bridle, Kim; Santrampurwala, Nishreen; Reiling, Janske; Musgrave, Nick; Subramaniam, V Nathan; Crawford, Darrell

    2016-06-01

    Heterozygous mutations of the Hfe gene have been proposed as cofactors in the development and progression of nonalcoholic fatty liver disease (NAFLD). Homozygous Hfe deletion previously has been shown to lead to dysregulated hepatic lipid metabolism and accentuated liver injury in a dietary mouse model of NAFLD We sought to establish whether heterozygous deletion of Hfe is sufficient to promote liver injury when mice are exposed to a high-calorie diet (HCD). Eight-week-old wild-type and Hfe(+/-) mice received 8 weeks of a control diet or HCD Liver histology and pathways of lipid and iron metabolism were analyzed. Liver histology demonstrated that mice fed a HCD had increased NAFLD activity score (NAS), steatosis, and hepatocyte ballooning. However, liver injury was unaffected by Hfe genotype. Hepatic iron concentration (HIC) was increased in Hfe(+/-) mice of both dietary groups. HCD resulted in a hepcidin-independent reduction in HIC Hfe(+/-) mice demonstrated raised fasting serum glucose concentrations and HOMA-IR score, despite unaltered serum adiponectin concentrations. Downstream regulators of hepatic de novo lipogenesis (pAKT, SREBP-1, Fas, Scd1) and fatty acid oxidation (AdipoR2, Pparα, Cpt1) were largely unaffected by genotype. In summary, heterozygous Hfe gene deletion is associated with impaired iron and glucose metabolism. However, unlike homozygous Hfe deletion, heterozygous gene deletion did not affect lipid metabolism pathways or liver injury in this model.

  9. [THE EFFECT OF waaL LIGASE GENES DELETION ON MOTILITY AND STRESS ADAPTATION REACTIONS OF YERSINIA ENTEROCOLITICA 6471/76].

    PubMed

    Shevchenko, J I; Shilina, J V; Pozur, V K; Skurnik, M

    2015-01-01

    The aim of current study was to estimate the influence of waaL(OS) and waaL(PS) genes deletion on lipopolysaccharide (LPS) synthesis, bacterial motility and stress resistance of bacteria Yersinia enterocolitica 6471/76. Single and double waaL mutants were created by replacing the wild-type alleles in bacterial chromosome for mutant ones. The phenotypes of mutants were visualized by DOC-PAGE gels stained with silver and immunoblot with specific to O-polysaccharide and outer core monoclonal antibodies. Bacterial motility was evaluated by the diameter of the migration zone. Wild type bacteria and mutants were analyzed by bacterial growth curves in a hypertonic medium. Participation of WaaL ligases in resistance to osmotic pressure was found only in case of both ligese genes deletion. Also the YeO3_os_ps mutants showed motility decreasing, which recovered after adding a functionally active gene. Thus, deletion of both waaL ligase genes lead to a drastic reduction in bacterial motility and increase their sensitivity to hypertonic medium that can indirectly characterize biological role of WaaL ligases.

  10. Impact of alg3 gene deletion on growth, development, pigment production, protein secretion, and functions of recombinant Trichoderma reesei cellobiohydrolases in Aspergillus niger

    SciTech Connect

    Dai, Ziyu; Aryal, Uma K.; Shukla, Anil; Qian, Wei-Jun; Smith, Richard D.; Magnuson, Jon K.; Adney, William S.; Beckham, Gregg T.; Brunecky, Roman; Himmel, Michael E.; Decker, Stephen R.; Ju, Xiaohui; Zhang, Xiao; Baker, Scott E.

    2013-12-01

    ALG3 is a Family 58 glycosyltransferase enzyme involved in early N-linked glycan synthesis. Here, we investigated the effect of the alg3 gene disruption on growth, development, metabolism, and protein secretion in Aspergillus niger. The alg3 gene deletion resulted in a significant reduction of growth on complete (CM) and potato dextrose agar (PDA) media and a substantial reduction of spore production on CM. It also delayed spore germination in the liquid cultures of both CM and PDA media, but led to a significant accumulation of red pigment on both CM and liquid modified minimal medium (MM) supplemented with yeast extract. The relative abundance of 55 proteins of the total 190 proteins identified in the secretome was significantly different as a result of alg3 gene deletion. Comparison of a Trichoderma reesei cellobiohydrolase (Cel7A) heterologously expressed in A. niger parental and Δalg3 strains showed that the recombinant Cel7A expressed in the mutant background was smaller in size than that from the parental strains. This study suggests that ALG3 is critical for growth and development, pigment production, and protein secretion in A. niger. Functional analysis of recombinant Cel7A with aberrant glycosylation demonstrates the feasibility of this alternative approach to evaluate the role of N-linked glycosylation in glycoprotein secretion and function.

  11. Differential regulation by MK801 of immediate-early genes, brain-derived neurotrophic factor and trk receptor mRNA induced by a kindling after-discharge.

    PubMed

    Hughes, P E; Young, D; Preston, K M; Yan, Q; Dragunow, M

    1998-01-01

    Transient changes in immediate-early genes and neurotrophin expression produced by kindling stimulation may mediate secondary downstream events involved in kindling development. Recent experiments have demonstrated conclusively that both kindling progression and mossy fibre sprouting are significantly impaired by administration of the N-methyl-D-aspartate (NMDA) receptor antagonist MK801. To further examine the link between kindling, changes in gene expression and the NMDA receptor, we examined the effects of MK801 on neuronal induction of immediate-early genes, brain-derived neurotrophic factor (BDNF) and trk receptor mRNA expression produced by a single electrically induced hippocampal after-discharge in rats. The after-discharge produced a rapid (after 1 h) increase in Fos, Jun-B, c-Jun, Krox-24 mRNA and protein and Krox-20 protein in dentate granule neurons and a delayed, selective expression of Fos, Jun-D and Krox-24 in hilar interneurons. MK801 pretreatment produced a very strong inhibition of Fos, Jun-D and Krox-20 increases in dentate neurons but had a much smaller effect on Jun-B and c-Jun expression. MK801 did not inhibit Krox-24 expression in granule neurons or the delayed expression of Fos, Jun-D and Krox-24 in hilar interneurons. BDNF protein and trk B and trk C mRNA expression were also strongly induced in dentate granule cells 4 h following an after-discharge. MK801 abolished the increase in BDNF protein and trk B, but not trk C mRNA in granule cells at 4 h. These results demonstrate that MK801 differentially regulates the AD-increased expression of a group of genes previously identified as being likely candidates for an involvement in kindling. Because MK801 significantly retards the development of kindling and mossy fibre sprouting, it can be argued that those genes whose induction is not significantly attenuated by MK801 are unlikely to play an important role in the MK801-sensitive component of kindling and the changes in neural connectivity

  12. Role of Litopenaeus vannamei Yin Yang 1 in the Regulation of the White Spot Syndrome Virus Immediate Early Gene ie1.

    PubMed

    Huang, Ping-Han; Huang, Ting-Yi; Cai, Pei-Si; Chang, Li-Kwan

    2017-03-15

    Yin Yang 1 (YY1) is a multifunctional zinc finger transcription factor that regulates many key cellular processes. In this study, we report the cloning of YY1 from Litopenaeus vannamei shrimp (LvYY1). This study shows that LvYY1 is ubiquitously expressed in shrimp tissues, and knockdown of LvYY1 expression by double-stranded RNA (dsRNA) injection in white spot syndrome virus (WSSV)-infected shrimp reduced both mRNA levels of the WSSV immediate early gene ie1 as well as overall copy numbers of the WSSV genome. The cumulative mortality rate of infected shrimp also declined with LvYY1 dsRNA injection. Using an insect cell model, we observed that LvYY1 activates ie1 expression, and a mutation introduced into the ie1 promoter subsequently repressed this capability. Moreover, reporter assay results suggested that LvYY1 is involved in basal transcriptional regulation via an interaction with L. vannamei TATA-binding protein (LvTBP). Electrophoretic mobility shift assay (EMSA) results further indicated that LvYY1 binds to a YY1-binding site in the region between positions -119 and -126 in the ie1 promoter. Chromatin immunoprecipitation analysis also confirmed that LvYY1 binds to the ie1 promoter in WSSV-infected shrimp. Taken together, these results indicate that WSSV uses host LvYY1 to enhance ie1 expression via a YY1-binding site and the TATA box in the ie1 promoter, thereby facilitating lytic activation and viral replication.IMPORTANCE WSSV has long been a scourge of the shrimp industry and remains a serious global threat. Thus, there is a pressing need to understand how the interactions between WSSV and its host drive infection, lytic development, pathogenesis, and mortality. Our successful cloning of L. vannamei YY1 (LvYY1) led to the elucidation of a critical virus-host interaction between LvYY1 and the WSSV immediate early gene ie1 We observed that LvYY1 regulates ie1 expression via a consensus YY1-binding site and TATA box. LvYY1 was also found to interact with L

  13. Human Cytomegalovirus miR-UL148D Facilitates Latent Viral Infection by Targeting Host Cell Immediate Early Response Gene 5

    PubMed Central

    Li, Limin; Li, Donghai; Liu, Fenyong; Zhang, Chen-Yu; Zen, Ke

    2016-01-01

    The mechanisms underlying human cytomegalovirus (HCMV) latency remain incompletely understood. Here, we showed that a HCMV-encoded miRNA, miR-UL148D, robustly accumulates during late stages of experimental latent HCMV infection in host cells and promotes HCMV latency by modulating the immediate early response gene 5 (IER5)-cell division cycle 25B (CDC25B) axis in host cells. miR-UL148D inhibited IER5 expression by directly targeting the three-prime untranslated region(3’UTR) of IER5 mRNA and thus rescued CDC25B expression during the establishment of viral latency. Infection with NR-1ΔmiR-UL148D, a derivative of the HCMV clinical strain NR-1 with a miR-UL148D knockout mutation, resulted in sustained induction of IER5 expression but decreased CDC25B expression in host cells. Mechanistically, we further showed that CDC25B plays an important role in suppressing HCMV IE1 and lytic gene transcription by activating cyclin-dependent kinase 1 (CDK-1). Both gain-of-function and lose-of-function assays demonstrated that miR-UL148D promotes HCMV latency by helping maintain CDC25B activity in host cells. These results provide a novel mechanism through which a HCMV miRNA regulates viral latency. PMID:27824944

  14. Full trans-activation mediated by the immediate-early protein of equine herpesvirus 1 requires a consensus TATA box, but not its cognate binding sequence.

    PubMed

    Kim, Seong K; Shakya, Akhalesh K; O'Callaghan, Dennis J

    2016-01-04

    The immediate-early protein (IEP) of equine herpesvirus 1 (EHV-1) has extensive homology to the IEP of alphaherpesviruses and possesses domains essential for trans-activation, including an acidic trans-activation domain (TAD) and binding domains for DNA, TFIIB, and TBP. Our data showed that the IEP directly interacted with transcription factor TFIIA, which is known to stabilize the binding of TBP and TFIID to the TATA box of core promoters. When the TATA box of the EICP0 promoter was mutated to a nonfunctional TATA box, IEP-mediated trans-activation was reduced from 22-fold to 7-fold. The IEP trans-activated the viral promoters in a TATA motif-dependent manner. Our previous data showed that the IEP is able to repress its own promoter when the IEP-binding sequence (IEBS) is located within 26-bp from the TATA box. When the IEBS was located at 100 bp upstream of the TATA box, IEP-mediated trans-activation was very similar to that of the minimal IE(nt -89 to +73) promoter lacking the IEBS. As the distance from the IEBS to the TATA box decreased, IEP-mediated trans-activation progressively decreased, indicating that the IEBS located within 100 bp from the TATA box sequence functions as a distance-dependent repressive element. These results indicated that IEP-mediated full trans-activation requires a consensus TATA box of core promoters, but not its binding to the cognate sequence (IEBS).

  15. Controlled crystal dehydration triggers a space-group switch and shapes the tertiary structure of cytomegalovirus immediate-early 1 (IE1) protein.

    PubMed

    Klingl, Stefan; Scherer, Myriam; Stamminger, Thomas; Muller, Yves A

    2015-07-01

    Cytomegalovirus immediate-early 1 (IE1) protein is a key viral effector protein that reprograms host cells. Controlled dehydration experiments with IE1 crystals not only extended their diffraction limit from 2.85 to 2.3 Å resolution but also triggered a monoclinic to tetragonal space-group transition with only minor alterations in the unit-cell parameters. An analysis of the pre-dehydration and post-dehydration crystal structures shows how dehydration rearranges the packing of IE1 molecules to meet the unit-cell constraints of the higher lattice symmetry. The transition from P21 to P43 reduces the number of copies in the asymmetric unit from four to two, and molecules previously related by noncrystallographic symmetry merge into identical crystallographic copies in the tetragonal space group. At the same time, dehydration considerably alters the tertiary structure of one of the two remaining IE1 chains in the asymmetric unit. It appears that this conformational switch is required to compensate for a transition that is assumed to be unfavourable, namely from a highly preferred to a rarely observed space group. At the same time, the dehydration-triggered molecular reshaping could reveal an inherent molecular flexibility that possibly informs on the biological function of IE1, namely on its binding to target proteins from the host cell.

  16. Immediate early gene X-1 (IEX-1), a hydroxytamoxifen regulated gene with increased stimulation in MCF-7 derived resistant breast cancer cells.

    PubMed

    Semlali, Abdelhabib; Oliva, Joan; Badia, Eric; Pons, Michel; Duchesne, Marie-Josèphe

    2004-03-01

    The efficacy of tamoxifen in breast cancer treatment only lasts a few years and the tumor eventually recurs. We performed selective subtractive hybridization to isolate mRNAs that were differentially expressed in MCF-7 derived cells, in which resistance had been induced through long-term culture in the presence of hydroxytamoxifen (OHT). Among the 15 mRNAs found to be overexpressed, we focused on Immediate early gene X-1 (IEX-1) mRNA because of the recognized contribution of its expression to apoptosis or cell cycle progression, depending on the cell type and culture conditions. We observed that IEX-1 expression was stimulated by OHT, that the degree of increase was greater in resistant cells (four-fold versus 1.5-fold) and that this OHT regulation was estrogen receptor dependent. A detailed study of the IEX-1 promoter indicated that it involved NF-kappaB. Our cells were not cross-resistant to faslodex, a pure antiestrogen, which moreover was inefficient in regulating IEX-1 expression. Altogether, our data suggest that the greater IEX-1 expression in OHT resistant cells is related to their ability to grow in the presence of OHT. Knowledge on the capacity of OHT to stimulate gene expression and its NF-kappaB dependence should contribute to a better understanding of tamoxifen pharmacology and allow new drug strategies to be designed that would delay antiestrogen resistance acquisition.

  17. The immediate early gene Arc is associated with behavioral resilience to stress exposure in an animal model of posttraumatic stress disorder.

    PubMed

    Kozlovsky, Nitsan; Matar, Michael A; Kaplan, Zeev; Kotler, Moshe; Zohar, Joseph; Cohen, Hagit

    2008-02-01

    Mechanisms involved in adaptative and maladaptive changes in neural plasticity and synaptic efficacy in various brain areas are pivotal to understanding the physiology of the response to stress and the pathophysiology of posttraumatic stress disorder (PTSD). Activity-regulated cytoskeletal-associated protein (Arc) is an effector immediate early gene (IEG) which has direct effects on intracellular homeostatic functions. Increased expression of Arc has been associated with increased neuronal activity and with consolidation of long-term memory. It may thus play an important role in mediating experience-induced reorganization and/or development of synaptic connections. This study sought to characterize the pattern of expression of mRNA for the Arc gene in selected brain areas of test subjects classified according to their individual pattern of behavioral response to a stressor, correlated with circulating levels of corticosterone (as a physiological marker of stress response). The hippocampal CA1 and CA3 subregions of individuals whose behavior was minimally or partially disrupted in response to predator scent stress demonstrated significantly increased levels of mRNA for Arc, compared to unexposed controls. The group whose behavior was severely disrupted demonstrated no such upregulation. Consistent with the hypothesis that the Arc gene has a promoting effect on neuronal function and/or structural changes, the lack of Arc expression in the behaviorally and physiologically more severely affected individuals raises the possibility that Arc may be associated with resilience and/or recovery after stress exposure.

  18. Promoter chromatin remodeling of immediate-early genes is mediated through H3 phosphorylation at either serine 28 or 10 by the MSK1 multi-protein complex

    PubMed Central

    Drobic, Bojan; Pérez-Cadahía, Beatriz; Yu, Jenny; Kung, Sam Kam-Pun; Davie, James R.

    2010-01-01

    Upon activation of the ERK and p38 MAPK pathways, the MSK1/2-mediated nucleosomal response, including H3 phosphorylation at serine 28 or 10, is coupled with the induction of immediate-early (IE) gene transcription. The outcome of this response, varying with the stimuli and cellular contexts, ranges from neoplastic transformation to neuronal synaptic plasticity. Here, we used sequential co-immunoprecipitation assays and sequential chromatin immunoprecipitation (ChIP) assays on mouse fibroblast 10T1/2 and MSK1 knockdown 10T1/2 cells to show that H3 serine 28 and 10 phosphorylation leads to promoter remodeling. MSK1, in complexes with phospho-serine adaptor 14-3-3 proteins and BRG1 the ATPase subunit of the SWI/SNF remodeler, is recruited to the promoter of target genes by transcription factors such as Elk-1 or NF-κB. Following MSK1-mediated H3 phosphorylation, BRG1 associates with the promoter of target genes via 14-3-3 proteins, which act as scaffolds. The recruited SWI/SNF remodels nucleosomes at the promoter of IE genes enabling the binding of transcription factors like JUN and the onset of transcription. PMID:20129940

  19. Glucocorticoids facilitate the transcription from the human cytomegalovirus major immediate early promoter in glucocorticoid receptor- and nuclear factor-I-like protein-dependent manner

    SciTech Connect

    Inoue-Toyoda, Maki; Kato, Kohsuke; Nagata, Kyosuke; Yoshikawa, Hiroyuki

    2015-02-27

    Human cytomegalovirus (HCMV) is a common and usually asymptomatic virus agent in healthy individuals. Initiation of HCMV productive infection depends on expression of the major immediate early (MIE) genes. The transcription of HCMV MIE genes is regulated by a diverse set of transcription factors. It was previously reported that productive HCMV infection is triggered probably by elevation of the plasma hydroxycorticoid level. However, it is poorly understood whether the transcription of MIE genes is directly regulated by glucocorticoid. Here, we found that the dexamethasone (DEX), a synthetic glucocorticoid, facilitates the transcription of HCMV MIE genes through the MIE promoter and enhancer in a glucocorticoid receptor (GR)-dependent manner. By competitive EMSA and reporter assays, we revealed that an NF-I like protein is involved in DEX-mediated transcriptional activation of the MIE promoter. Thus, this study supports a notion that the increased level of hydroxycorticoid in the third trimester of pregnancy reactivates HCMV virus production from the latent state. - Highlights: • DEX facilitates the transcription from the HCMV MIE promoter. • GR is involved in DEX-dependent transcription from the HCMV MIE promoter. • A 17 bp repeat is responsible for the HCMV MIE promoter activation by DEX. • An NF-I-like protein is involved in the HCMV MIE promoter activation by DEX.

  20. Isolation rearing attenuates social interaction-induced expression of immediate early gene protein products in the medial prefrontal cortex of male and female rats.

    PubMed

    Wall, Vanessa L; Fischer, Eva K; Bland, Sondra T

    2012-10-10

    Early life adversity and stress in humans have been related to a number of psychological disorders including anxiety, depression, and addiction. The present study used isolation rearing, a well-characterized animal model of early life adversity, to examine its effects on social behavior and immediate early gene (IEG) expression produced by exposure to a novel social experience. Male and female rats were housed in same-sex groups or in isolation for 4 weeks beginning at weaning and were tested during late adolescence. The protein products of the IEGs c-fos and Arc, as well as the neurotrophic factor BDNF were assessed in medial prefrontal cortex (mPFC) subregions (anterior cingulate, prelimbic and infralimbic) using immunohistochemistry. Aggressive and non-aggressive behaviors during novel social exposure were also assessed. Exposure to a novel conspecific produced increases in Arc and c-fos activation in the mPFC of group reared animals in a sex- and subregion-dependent fashion compared to no social exposure controls, but this increase was blunted or absent in isolated animals. Isolates engaged in more social interactions and more aggressive behavior than group reared rats. Sex differences in some behaviors as well as in Arc and BDNF expression were observed. These results indicate that isolation rearing alters IEG activation in the mPFC produced by exposure to a novel conspecific, in addition to changing social behavior, and that these effects depend in part on sex.

  1. The hallucinogen d-lysergic acid diethylamide (d-LSD) induces the immediate-early gene c-Fos in rat forebrain.

    PubMed

    Frankel, Paul S; Cunningham, Kathryn A

    2002-12-27

    The hallucinogen d-lysergic acid diethylamide (d-LSD) evokes dramatic somatic and psychological effects. In order to analyze the neural activation induced by this unique psychoactive drug, we tested the hypothesis that expression of the immediate-early gene product c-Fos is induced in specific regions of the rat forebrain by a relatively low, behaviorally active, dose of d-LSD (0.16 mg/kg, i.p.); c-Fos protein expression was assessed at 30 min, and 1, 2 and 4 h following d-LSD injection. A time- and region-dependent expression of c-Fos was observed with a significant increase (P<0.05) in the number of c-Fos-positive cells detected in the anterior cingulate cortex at 1 h, the shell of the nucleus accumbens at 1 and 2 h, the bed nucleus of stria terminalis lateral at 2 h and the paraventricular hypothalamic nucleus at 1, 2 and 4 h following systemic d-LSD administration. These data demonstrate a unique pattern of c-Fos expression in the rat forebrain following a relatively low dose of d-LSD and suggest that activation of these forebrain regions contributes to the unique behavioral effects of d-LSD.

  2. Regulation of the immediate-early genes of white spot syndrome virus by Litopenaeus vannamei kruppel-like factor (LvKLF).

    PubMed

    Huang, Ping-Han; Lu, Shao-Chia; Yang, Shu-Han; Cai, Pei-Si; Lo, Chu-Fang; Chang, Li-Kwan

    2014-10-01

    Kruppel-like factors (KLFs) belong to a subclass of Cys2/His2 zinc-finger DNA-binding proteins, and act as important regulators with diverse roles in cell growth, proliferation, differentiation, apoptosis and tumorigenesis. Our previous research showed that PmKLF from Penaeus monodon is crucial for white spot syndrome virus (WSSV) infection, yet the mechanisms by which PmKLF influences WSSV infection remain unclear. This study cloned KLF from Litopenaeus vannamei (LvKLF), which had 93% similarity with PmKLF. LvKLF formed a dimer via the C-terminal zinc-finger motif. Knockdown of LvKLF expression by dsRNA injection in WSSV-challenged shrimps was found to significantly inhibit the transcription of two important immediate-early (IE) genes, IE1 and WSSV304, and also reduced WSSV copy numbers. Moreover, reporter assays revealed that the promoter activities of these two WSSV IE genes were substantially enhanced by LvKLF. Mutations introduced in the promoter sequences of IE1 and WSSV304 were shown to abolish LvKLF activation of promoter activities; and an electrophoretic mobility shift assay demonstrated that LvKLF binds to putative KLF-response elements (KRE) in the promoters. Taken together, these results indicate that LvKLF transcriptional regulation of key IE genes is critical to WSSV replication.

  3. Voxel-based analysis of the immediate early gene, c-jun, in the honey bee brain after a sucrose stimulus.

    PubMed

    McNeill, M S; Robinson, G E

    2015-06-01

    Immediate early genes (IEGs) have served as useful markers of brain neuronal activity in mammals, and more recently in insects. The mammalian canonical IEG, c-jun, is part of regulatory pathways conserved in insects and has been shown to be responsive to alarm pheromone in honey bees. We tested whether c-jun was responsive in honey bees to another behaviourally relevant stimulus, sucrose, in order to further identify the brain regions involved in sucrose processing. To identify responsive regions, we developed a new method of voxel-based analysis of c-jun mRNA expression. We found that c-jun is expressed in somata throughout the brain. It was rapidly induced in response to sucrose stimuli, and it responded in somata near the antennal and mechanosensory motor centre, mushroom body calices and lateral protocerebrum, which are known to be involved in sucrose processing. c-jun also responded to sucrose in somata near the lateral suboesophageal ganglion, dorsal optic lobe, ventral optic lobe and dorsal posterior protocerebrum, which had not been previously identified by other methods. These results demonstrate the utility of voxel-based analysis of mRNA expression in the insect brain.

  4. Expression of immediate early genes in the hippocampal formation of the black-capped chickadee (Poecile atricapillus) during a food-hoarding task.

    PubMed

    Smulders, T V; DeVoogd, T J

    2000-09-01

    Black-capped chickadees store food in many different locations in their home range and are able to accurately remember these locations. We measured the number of cells immunopositive for three different Immediate Early Gene products (Fra-1, c-Fos and ZENK) to map neuronal activity in the chickadee Hippocampal Formation (HF) during food storing and retrieval. Fra-1-like immunoreactivity is downregulated in the dorsal HF of both storing and retrieving chickadees compared to controls. In retrieving birds, the number of Fos-like immunoreactive neurons relates to the number of items remembered, while the number of ZENK-like immunoreactive neurons in the HF may be related to the accuracy of cache retrieval. These results imply that the brain might process complex information by recruiting more neurons into the network of active neurons. Thus, our results could help explain why food-hoarding birds have more HF neurons than non-hoarders, and why this number increases in autumn when large numbers of food items are cached.

  5. Transcription factor Elk-1 participates in the interleukin-1β-dependent regulation of expression of immediate early response gene 3 (IER3).

    PubMed

    Kochan, Jakub; Wawro, Mateusz; Kolka, Agnieszka; Maczuga, Piotr; Kasza, Aneta

    2014-12-01

    Immediate early response gene 3 (IER3) encodes a protein involved in the regulation of apoptosis and differentiation. Recently the role of IER3 in the regulation of extracellular signal-regulated kinases (ERKs) was discovered. IER3 prolongs ERKs activation by inhibition of phosphatase PP2A. Here we show that interleukin-1β (IL-1β)-induced IER3 expression is mediated by the ERK1/2 target, transcription factor Elk-1. We identified sequences in the IER3 promoter responsible for its ERKs-dependent activation, namely ETS5/6. Elk-1 binds to these sequences and is phosphorylated following IL-1β stimulation. Mutation of ETS5/6 binding site abolishes activation of IER3 promoter by IL-1β as well as by the constitutively active form of Elk-1 (Elk-VP16). Thus IER3 acts not only as a regulator of ERKs activation, but also as a ERKs-Elk-1-dependent downstream effector.

  6. Effect of hypergravity on expression of the immediate early gene, c-fos, in central nervous system of medaka (Oryzias latipes)

    NASA Astrophysics Data System (ADS)

    Sayaka, Shimomura-Umemura; Ijiri, Kenichi

    2006-01-01

    Immediate-early genes serve as useful neurobiological tools for mapping brain activity induced by a sensory stimulation. In this study, we have examined brain activity related to gravity perception of medaka (Oryzias latipes) by use of c-fos. The gene, which is homologous to the c-fos genes of other vertebrates, was identified in medaka. Functionally important domains are highly conserved among all the vertebrate species analyzed. Intraperitoneal administration of kainic acid transiently induced the c-fos mRNAs in medaka brains. The results indicate that the expression of c-fos can be utilized as a suitable anatomical marker for the increased neural activities in the central nervous system of medaka. Fish were continuously exposed to 3 g hypergravity by centrifugation. Investigation of c-fos mRNA expression indicated that c-fos mRNA significantly increased 30 min after a start of 3 g exposure. The distribution of its transcripts within the brains was analyzed by an in situ hybridization method. The 3-g treated medakas displayed c-fos positive cells in their brainstem regions, which are related to vestibular function, such as torus semicircularis, nucleus tangentialis, posterior octavu nucleus, and inferior olive. Our results established a method to follow the effect of gravity stimulation, which can be used to investigate gravity perception.

  7. Presentation of noise during acute restraint stress attenuates expression of immediate early genes and arginine vasopressin in the hypothalamic paraventricular nucleus but not corticosterone secretion in rats.

    PubMed

    Sugimoto, Koji; Ohmomo, Hideki; Shutoh, Fumihiro; Nogami, Haruo; Hisano, Setsuji

    2015-07-01

    The present study investigated the effect of acoustic stimulation on the activation of the hypothalamic-pituitary-adrenal (HPA) axis in rats submitted to acute restraint stress, through semi-quantitative histochemical analysis of expression of immediate early gene products (c-Fos, JunB and phosphorylated c-Jun) and arginine vasopressin (AVP) hnRNA in the paraventricular nucleus (PVN). Simultaneous presentation of white or pink noise with restraint resulted in a significant attenuation of stress-induced c-Fos and JunB expression in the dorsal body of dorsal medial parvicellular subdivision (mpdd) of the PVN, as compared with restraint without noise. However, this presentation did not change phosphorylation of c-Jun and the plasma corticosterone level. Moreover, white noise presentation during restraint led to a reduction in the number of c-Fos- or JunB-expressing corticotropin-releasing hormone (CRH) neurons and the number of neurons expressing AVP hnRNA in the mpdd. Dual-histochemical labeling revealed co-expression of c-Fos and JunB, as well as JunB and AVP hnRNA in mpdd neurons. These data suggest that acoustic stimuli have an attenuation effect on the restraint-induced activation of neuroendocrine CRH neurons, resulting in the reduction in AVP production as an adaptation of HPA axis to repeated stress.

  8. Abetalipoproteinemia in Israel: evidence for a founder mutation in the Ashkenazi Jewish population and a contiguous gene deletion in an Arab patient.

    PubMed

    Benayoun, Liat; Granot, Esther; Rizel, Leah; Allon-Shalev, Stavit; Behar, Doron M; Ben-Yosef, Tamar

    2007-04-01

    Abetalipoproteinemia (ABL) is a rare autosomal recessive metabolic disorder, characterized by the absence of plasma apolipoprotein B-containing lipoproteins and very low levels of plasma triglycerides and cholesterol. ABL is caused by mutations of the MTP gene. We investigated the genetic basis for ABL in a cohort of Israeli families. In Ashkenazi Jewish patients we identified a conserved haplotype and a common MTP mutation, p.G865X, with a carrier frequency of 1:131 in this population. We also report the first case of ABL and additional abnormalities in a Muslim Arab patient, due to a homozygous contiguous gene deletion of approximately 481 kb, including MTP and eight other genes.

  9. Construction of a cytosolic firefly luciferase reporter cassette for use in PCR-mediated gene deletion and fusion in Saccharomyces cerevisiae.

    PubMed

    Ainsworth, W B; Rome, C M; Hjortsø, M A; Benton, M G

    2012-12-01

    Monitoring promoter response to environmental changes using reporter systems has provided invaluable information regarding cellular state. With the development of in vivo luciferase reporter systems, inexpensive, sensitive and accurate promoter assays have been developed without the variability reported between in vitro samplings. Current luciferase reporter systems, however, are largely inflexible to modifications to the promoter of interest. To overcome problems in flexibility and stability of these expression vectors, we report the creation of a novel vector system which introduces a cytosol-localized Photinus pyralis luciferase [LUC*(-SKL)] capable of one-step, in vivo measurements into a promoter-reporter system via PCR-based gene deletion and fusion. After introduction of the reporter under HUG1 promoter control, cytosolic localization was confirmed by fluorescence microscopy. The dose-response of this novel construct was then compared with that of a similar HUG1Δ::yEGFP1 promoter-reporter system and shown to give a similar response pattern.

  10. Prolidase Deficiency in a Mexican-American Patient Identified by Array CGH Reveals a Novel and the Largest PEPD Gene Deletion

    PubMed Central

    Hintze, Jonathan P.; Kirby, Amelia; Torti, Erin; Batanian, Jacqueline R.

    2016-01-01

    Prolidase deficiency (PD) is a rare genetic disorder caused by mutations in the peptidase D (PEPD) gene, affecting collagen degradation. Features include lower extremity ulcers, facial dysmorphism, frequent respiratory infections, and intellectual disability, though there is significant intra- and interfamilial variability. Twenty-eight mutations have been previously reported, all either small deletions/duplications or point mutations discovered by enzyme or DNA assays. PD has been reported in patients of various ethnic backgrounds, but never in the Mexican-American population. We describe the first Mexican-American patient with PD, who presented with typical facial features, developmental delay, microcephaly, and xerosis. Chromosome microarray analysis (CMA) revealed a homozygous deletion in the region of 19q13.11, estimated to be between 124.79 and 195.72 kb in size, representing the largest PEPD gene deletion reported to date and the first discovered by CMA. PMID:27385964

  11. SUMO-conjugating enzyme E2 UBC9 mediates viral immediate-early protein SUMOylation in crayfish to facilitate reproduction of white spot syndrome virus.

    PubMed

    Chen, An-Jing; Gao, Lu; Wang, Xian-Wei; Zhao, Xiao-Fan; Wang, Jin-Xing

    2013-01-01

    Successful viruses have evolved superior strategies to escape host defenses or exploit host biological pathways. Most of the viral immediate-early (ie) genes are essential for viral infection and depend solely on host proteins; however, the molecular mechanisms are poorly understood. In this study, we focused on the modification of viral IE proteins by the crayfish small ubiquitin-related modifier (SUMO) and investigated the role of SUMOylation during the viral life cycle. SUMO and SUMO ubiquitin-conjugating enzyme 9 (UBC9) involved in SUMOylation were identified in red swamp crayfish (Procambarus clarkii). Both SUMO and UBC9 were upregulated in crayfish challenged with white spot syndrome virus (WSSV). Replication of WSSV genes increased in crayfish injected with recombinant SUMO or UBC9, but injection of mutant SUMO or UBC9 protein had no effect. Subsequently, we analyzed the mechanism by which crayfish SUMOylation facilitates WSSV replication. Crayfish UBC9 bound to all three WSSV IE proteins tested, and one of these IE proteins (WSV051) was covalently modified by SUMO in vitro. The expression of viral ie genes was affected and that of late genes was significantly inhibited in UBC9-silenced or SUMO-silenced crayfish, and the inhibition effect was rescued by injection of recombinant SUMO or UBC9. The results of this study demonstrate that viral IE proteins can be modified by crayfish SUMOylation, prompt the expression of viral genes, and ultimately benefit WSSV replication. Understanding of the mechanisms by which viruses exploit host components will greatly improve our knowledge of the virus-host "arms race" and contribute to the development of novel methods against virulent viruses.

  12. SUMO-Conjugating Enzyme E2 UBC9 Mediates Viral Immediate-Early Protein SUMOylation in Crayfish To Facilitate Reproduction of White Spot Syndrome Virus

    PubMed Central

    Chen, An-Jing; Gao, Lu; Wang, Xian-Wei; Zhao, Xiao-Fan

    2013-01-01

    Successful viruses have evolved superior strategies to escape host defenses or exploit host biological pathways. Most of the viral immediate-early (ie) genes are essential for viral infection and depend solely on host proteins; however, the molecular mechanisms are poorly understood. In this study, we focused on the modification of viral IE proteins by the crayfish small ubiquitin-related modifier (SUMO) and investigated the role of SUMOylation during the viral life cycle. SUMO and SUMO ubiquitin-conjugating enzyme 9 (UBC9) involved in SUMOylation were identified in red swamp crayfish (Procambarus clarkii). Both SUMO and UBC9 were upregulated in crayfish challenged with white spot syndrome virus (WSSV). Replication of WSSV genes increased in crayfish injected with recombinant SUMO or UBC9, but injection of mutant SUMO or UBC9 protein had no effect. Subsequently, we analyzed the mechanism by which crayfish SUMOylation facilitates WSSV replication. Crayfish UBC9 bound to all three WSSV IE proteins tested, and one of these IE proteins (WSV051) was covalently modified by SUMO in vitro. The expression of viral ie genes was affected and that of late genes was significantly inhibited in UBC9-silenced or SUMO-silenced crayfish, and the inhibition effect was rescued by injection of recombinant SUMO or UBC9. The results of this study demonstrate that viral IE proteins can be modified by crayfish SUMOylation, prompt the expression of viral genes, and ultimately benefit WSSV replication. Understanding of the mechanisms by which viruses exploit host components will greatly improve our knowledge of the virus-host “arms race” and contribute to the development of novel methods against virulent viruses. PMID:23097446

  13. Genome-wide identification of palmitate-regulated immediate early genes and target genes in pancreatic beta-cells reveals a central role of NF-κB.

    PubMed

    Choi, Hyung Jin; Hwang, Seungwoo; Lee, Se-Hee; Lee, You Ri; Shin, Jiyon; Park, Kyong Soo; Cho, Young Min

    2012-06-01

    Free fatty acid-induced pancreatic β-cell dysfunction plays a key role in the pathogenesis of type 2 diabetes. We conducted gene expression microarray analysis to comprehensively investigate the transcription machinery of palmitate-regulated genes in pancreatic β-cells in vitro. In particular, mouse pancreatic βTC3 cells were treated with palmitate in the presence or absence of cycloheximide (CHX), which blocks protein synthesis and thereby allows us to distinguish immediate early genes (IEGs) from their target genes. The microarray experiments identified 34 palmitate-regulated IEGs and 74 palmitate-regulated target genes. In silico promoter analysis revealed that transcription factor binding sites for NF-κB were over-represented, regulating approximately one-third of the palmitate-regulated target genes. In cells treated with CHX, nfkb1 showed an up-regulation by palmitate, suggesting that NF-κB could be an IEG. Functional enrichment analysis of 27 palmitate-regulated genes with NF-κB binding sites showed an over-representation of genes involved in immune response, inflammatory response, defense response, taxis, regulation of cell proliferation, and regulation of cell death pathways. Electrophoretic mobility shift assay showed that palmitate stimulates NF-κB activity both in the presence and absence of CHX. In conclusion, by identifying IEGs and target genes, the present study depicted a comprehensive view of transcription machinery underlying palmitate-induced inflammation and cell proliferation/death in pancreatic β-cells and our data demonstrated the central role of NF-κB.

  14. RNA interference-mediated targeting of human cytomegalovirus immediate-early or early gene products inhibits viral replication with differential effects on cellular functions.

    PubMed

    Xiaofei, E; Stadler, Bradford M; Debatis, Michelle; Wang, Shixia; Lu, Shan; Kowalik, Timothy F

    2012-05-01

    Viral drug toxicity, resistance, and an increasing immunosuppressed population warrant continued research into new avenues for limiting diseases associated with human cytomegalovirus (HCMV). In this study, a small interfering RNA (siRNA), siX3, was designed to target coding sequences within shared exon 3 of UL123 and UL122 transcripts encoding IE1 and IE2 immediate-early proteins of HCMV. Pretreatment of cells with siX3 reduced the levels of viral protein expression, DNA replication, and progeny virus production compared to control siRNA. Two siRNAs against UL54 and overlapping transcripts (UL55-57) were compared to siX3 in HCMV infection and were also found to be effective at inhibiting HCMV replication. Further investigation into the effects of the siRNAs on viral replication showed that pretreatment with each of the siRNAs resulted in an inhibition in the formation of mature replication compartments. The ability of these siRNAs to prevent or reduce certain cytopathic effects associated with HCMV infection was also examined. Infected cells pretreated with siX3, but not siUL54, retained promyelocytic leukemia (PML) protein in cellular PML bodies, an essential component of this host intrinsic antiviral defense. DNA damage response proteins, which are localized in nuclear viral replication compartments, were reduced in the siX3- and siUL54-treated cells. siX3, but not siUL54, prevented DNA damage response signaling early after infection. Therapeutic efficacy was demonstrated by treating cells with siRNAs after HCMV replication had commenced. Together, these findings suggest that siRNAs targeting exon 3 of the major IE genes or the UL54-57 transcripts be further studied for their potential development into anti-HCMV therapeutics.

  15. HSV-2 immediate-early protein US1 inhibits IFN-β production by suppressing association of IRF-3 with IFN-β promoter.

    PubMed

    Zhang, Mudan; Liu, Yalan; Wang, Ping; Guan, Xinmeng; He, Siyi; Luo, Sukun; Li, Chang; Hu, Kai; Jin, Wei; Du, Tao; Yan, Yan; Zhang, Zhenfeng; Zheng, Zhenhua; Wang, Hanzhong; Hu, Qinxue

    2015-04-01

    HSV-2 is the major cause of genital herpes, and its infection increases the risk of HIV-1 acquisition and transmission. After initial infection, HSV-2 can establish latency within the nervous system and thus maintains lifelong infection in humans. It has been suggested that HSV-2 can inhibit type I IFN signaling, but the underlying mechanism has yet to be determined. In this study, we demonstrate that productive HSV-2 infection suppresses Sendai virus (SeV) or polyinosinic-polycytidylic acid-induced IFN-β production. We further reveal that US1, an immediate-early protein of HSV-2, contributes to such suppression, showing that US1 inhibits IFN-β promoter activity and IFN-β production at both mRNA and protein levels, whereas US1 knockout significantly impairs such capability in the context of HSV-2 infection. US1 directly interacts with DNA binding domain of IRF-3, and such interaction suppresses the association of nuclear IRF-3 with the IRF-3 responsive domain of IFN-β promoter, resulting in the suppression of IFN-β promoter activation. Additional studies demonstrate that the 217-414 aa domain of US1 is critical for the suppression of IFN-β production. Our results indicate that HSV-2 US1 downmodulates IFN-β production by suppressing the association of IRF-3 with the IRF-3 responsive domain of IFN-β promoter. Our findings highlight the significance of HSV-2 US1 in inhibiting IFN-β production and provide insights into the molecular mechanism by which HSV-2 evades the host innate immunity, representing an unconventional strategy exploited by a dsDNA virus to interrupt type I IFN signaling pathway.

  16. Chronic co-administration of nicotine and methamphetamine causes differential expression of immediate early genes in the dorsal striatum and nucleus accumbens of rats.

    PubMed

    Saint-Preux, F; Bores, L R; Tulloch, I; Ladenheim, B; Kim, R; Thanos, P K; Volkow, N D; Cadet, J L

    2013-07-23

    Nicotine and methamphetamine (METH) cause addiction by triggering neuroplastic changes in brain reward pathways though they each engage distinct molecular targets (nicotine receptors and dopamine transporters respectively). Addiction to both drugs is very prevalent, with the vast majority of METH users also being smokers of cigarettes. This co-morbid occurrence thus raised questions about potential synergistic rewarding effects of the drugs. However, few studies have investigated the chronic neurobiological changes associated with co-morbid nicotine and METH addiction. Here we investigated the effects of these two drugs alone and in combination on the expression of several immediate early genes (IEGs) that are sensitive to drug exposures. Chronic exposure to either nicotine or METH caused significant decreases in the expression of fosb, fra1, and fra2 in the nucleus accumbens (NAc) but not in the dorsal striatum whereas the drug combination increased fra2 expression in both structures. Except for junB mRNA levels that were decreased by the three drug treatments in the NAc, there were no significant changes in the Jun family members. Of the Egr family members, NAc egr2 expression was decreased after nicotine and the drug combination whereas NAc egr3 was decreased after METH and the drug combination. The drug combination also increased striatal egr3 expression. The Nr4a family member, nr4a2/nurr1, showed increased striatal expression after all three drug treatments, while striatal nr4a3/nor-1 expression was increased by the drug combination whereas NAc nr4a1/nurr77 was decreased by nicotine and the drug combination. These observations suggest that, when given in combination, the two drugs exert distinct effects on the expression of IEGs in dopaminergic projection areas from those elicited by each drug alone. The significance of these changes in IEG expression and in other molecular markers in fostering co-morbid METH and nicotine abuse needs to be further evaluated.

  17. The time course of systems consolidation of spatial memory from recent to remote retention: A comparison of the Immediate Early Genes Zif268, c-Fos and Arc.

    PubMed

    Barry, Daniel N; Coogan, Andrew N; Commins, Sean

    2016-02-01

    Systems consolidation is a process involving the stabilisation of memory traces in the neocortex over time. The medial prefrontal cortex becomes increasingly important during the retrieval of older memories, however the timescale of its involvement is unclear, and the contribution of other neocortical brain regions to remote memory have received little attention. The Immediate Early Genes (IEGs) Zif268, c-Fos and Arc have been utilised as markers of neural activity during spatial memory retrieval, however the lack of a direct comparison between them hinders the interpretation of results. To address these questions, we examined the expression of Zif268, Arc and c-Fos protein in the medial prefrontal cortex, as well as the hippocampus, and the entorhinal, perirhinal, retrosplenial and parietal cortices of male Wistar rats following a probe trial of the Morris water maze either one day, seven days, 14 days or 30 days after acquisition. Activity of the medial prefrontal cortex during retrieval, as measured by all three IEGs, increased in correspondence with the age of the memory, reaching significance between 14 and 30 days. Similar increases in c-Fos and Arc were observed over the course of consolidation in other neocortical and parahippocampal areas, however this pattern was not observed with Zif268. Activity of the hippocampus remained largely unchanged across retention intervals. These findings suggest that systems consolidation of spatial memory takes at least two weeks, are consistent with an ongoing role for the hippocampus in the retrieval of spatial memory, and suggest that c-Fos and Arc may be a more sensitive measure of neural activity in response to behavioural tasks than Zif268.

  18. BZLF1, an Epstein-Barr virus immediate-early protein, induces p65 nuclear translocation while inhibiting p65 transcriptional function

    SciTech Connect

    Morrison, Thomas E.; Kenney, Shannon C. . E-mail: shann@med.unc.edu

    2004-10-25

    We have previously demonstrated that the Epstein-Barr virus immediate-early BZLF1 protein interacts with, and is inhibited by, the NF-{kappa}B family member p65. However, the effects of BZLF1 on NF-{kappa}B activity have not been intensively studied. Here we show that BZLF1 inhibits p65-dependent gene expression. BZLF1 inhibited the ability of IL-1, as well as transfected p65, to activate the expression of two different NF-{kappa}B-responsive genes, ICAM-1 and I{kappa}B-{alpha}. BZLF1 also reduced the constitutive level of I{kappa}B-{alpha} protein in HeLa and A549 cells, and increased the amount of nuclear NF-{kappa}B to a similar extent as tumor necrosis factor-alpha (TNF-{alpha}) treatment. In spite of this BZLF1-associated increase in the nuclear form of NF-{kappa}B, BZLF1 did not induce binding of NF-{kappa}B to NF-{kappa}B responsive promoters (as determined by chromatin immunoprecipitation assay) in vivo, although TNF-{alpha} treatment induced NF-{kappa}B binding as expected. Overexpression of p65 dramatically inhibited the lytic replication cycle of EBV in 293-EBV cells, confirming that NF-{kappa}B also inhibits BZLF1 transcriptional function. Our results are consistent with a model in which BZLF1 inhibits the transcriptional function of p65, resulting in decreased transcription of I{kappa}B-{alpha}, decreased expression of I{kappa}B-{alpha} protein, and subsequent translocation of NF-{kappa}B to the nucleus. This nuclear translocation of NF-{kappa}B may promote viral latency by negatively regulating BZLF1 transcriptional activity. In situations where p65 activity is limiting in comparison to BZLF1, the ability of BZLF1 to inhibit p65 transcriptional function may protect the virus from the host immune system during the lytic form of infection.

  19. Expression pattern of immediate early genes in the cerebellum of D1R KO, D2R KO, and wild type mice under vestibular-controlled activity.

    PubMed

    Nakamura, Toru; Sato, Asako; Kitsukawa, Takashi; Sasaoka, Toshikuni; Yamamori, Tetsuo

    2015-01-01

    We previously reported the different motor abilities of D1R knockout (KO), D2R KO and wild-type (WT) mice. To understand the interaction between the cerebellum and the striatal direct and indirect pathways, we examined the expression patterns of immediate early genes (IEG) in the cerebellum of these three genotypes of mice. In the WT naive mice, there was little IEG expression. However, we observed a robust expression of c-fos mRNA in the vermis and hemisphere after running rota-rod tasks. In the vermis, c-fos was expressed throughout the lobules except lobule 7, and also in crus 1 of the ansiform lobule (Crus1), copula of the pyramis (Cop) and most significantly in the flocculus in the hemisphere. jun-B was much less expressed but more preferentially expressed in Purkinje cells. In addition, we observed significant levels of c-fos and jun-B expressions after handling mice, and after the stationary rota-rod task in naive mice. Surprisingly, we observed significant expression of c-fos and jun-B even 30 min after single weighing. Nonetheless, certain additional c-fos and jun-B expressions were observed in three genotypes of the mice that experienced several sessions of motor tasks 24 h after stationary rota-rod task and on days 1 and 5 after rota-rod tasks, but no significant differences in expressions after the running rota-rod tasks were observed among the three genotypes. In addition, there may be some differences 24 h after the stationary rota-rod task between the naive mice and the mice that experienced several sessions of motor tasks.

  20. Contrasting role of phospholipase C-{gamma}1 in the expression of immediate early genes induced by epidermal or platelet-derived growth factors

    SciTech Connect

    Liao Hongjun; Santos, Josue de los; Carpenter, Graham . E-mail: graham.carpenter@vanderbilt.edu

    2006-04-01

    While significant progress has been achieved in identifying the signal transduction elements that operate downstream of activated receptor tyrosine kinases, it remains unclear how different receptors utilize these signaling elements to achieve a common response. This study compares the capacity of epidermal growth factor (EGF) and platelet-derived growth factor (PDGF) to elicit the induction of immediate early gene (IEG) mRNAs in the presence or absence of phospholipase C-{gamma}1 (PLC-{gamma}1). The results show that while PDGF induction of nearly all IEG mRNAs is abrogated in plcg1 null cells, EGF induction of the same genes is variable in the null cells and exhibits three distinct responses. Five IEG mRNAs (Nup475, Cyr61, TF, Gly, TS7) are completely inducible by EGF in the presence or absence of PLC-{gamma}1, while three others (JE, KC, FIC) exhibit a stringent requirement for the presence of PLC-{gamma}1. The third type of response is exhibited by c-fos and COX-2. While these mRNAs are completely induced by EGF in the absence of PLC-{gamma}1, the time course of their accumulation is significantly delayed. No IEG was identified as completely inducible by EGF and PDGF in the absence of PLC-{gamma}1. Electrophoretic mobility shift assays (EMSA) demonstrate that PLC-{gamma}1 is necessary for nuclear extracts from PDGF-treated cells, but not EGF-treated cells, to interact with probes for AP-1 or NF-{kappa}B.

  1. Unexpected finding of a whole HNF1B gene deletion during the screening of rare MODY types in a series of Brazilian patients negative for GCK and HNF1A mutations.

    PubMed

    Dotto, Renata P; Giuffrida, Fernando M A; Franco, Luciana; Mathez, Andreia L G; Weinert, Leticia S; Silveiro, Sandra P; Sa, Joao R; Reis, Andre F; Dias-da-Silva, Magnus R

    2016-06-01

    Thirty-two patients with diabetes negative for point mutations in GCK and HNF1A underwent further molecular screening of GCK, HNF1A, HNF4A, and HNF1B by MLPA analysis. We described the first Brazilian case of MODY5 due to a heterozygous whole-gene deletion in HNF1B, who developed rapidly progressive renal failure and death.

  2. Improved cell survival by the reduction of immediate-early gene expression in replication-defective mutants of herpes simplex virus type 1 but not by mutation of the virion host shutoff function.

    PubMed Central

    Johnson, P A; Wang, M J; Friedmann, T

    1994-01-01

    Derivatives of herpes simplex virus type 1 (HSV-1) have elicited considerable interest as gene transfer vectors because of their ability to infect a wide range of cell types efficiently, including fully differentiated neurons. However, it has been found that infection of many types of cell with vectors derived from replication-defective mutants of HSV-1 is associated with cytopathic effects (CPE). We have previously shown that viral gene expression played an important role in the induction of CPE caused by an HSV-1 mutant deleted for the essential immediate-early gene 3 (IE 3) (P.A. Johnson, A. Miyanohara, F. Levine, T. Cahill, and T. Friedmann, J. Virol. 66:2952-2965, 1992). We have investigated which viral genes might be responsible for CPE by comparing the ability of each of the individual genes expressed by an IE 3 deletion mutant during a nonproductive infection to inhibit biochemical transformation after cotransfection of BHK or CV-1 cells with a selectable marker gene. Transfection of IE genes 1,2, and 4 individually all caused a marked inhibition of colony formation, while transfection of IE 5 and the large subunit of ribonucleotide reductase had little effect. These results suggested that it would be necessary to mutate or reduce the expression of nearly all HSV-1 IE genes to reduce virus-induced CPE. Therefore, we have used VP16 mutants, which are unable to transinduce IE gene expression (C. I. Ace, T. A. McKee, J. M. Ryan, J. M. Cameron, and C. M. Preston, J. Virol. 63:2260-2269, 1989), to derive two replication-defective strains: 14H delta 3, which is deleted for both copies of IE 3, and in 1850 delta 42, which has a deletion in the essential early gene UL42. The IE 3-VP16 double mutant, 14H delta 3, is significantly less toxic than a single IE 3 deletion mutant over a range of multiplicities of infection, as measured in a cell-killing assay, and has an enhanced ability to persist in infected cells in a biologically retrievable form. In contrast, the UL

  3. Immediate early gene expression in cat visual cortex during and after the critical period: differences between EGR-1 and Fos proteins.

    PubMed

    Kaplan, I V; Guo, Y; Mower, G D

    1996-02-01

    Immediate early gene (IEG) expression in the cat visual cortex is highly responsive to visual input and may initiate genetic mechanisms responsible for neuronal plasticity. The present study used immunohistochemical methods to address two issues regarding IEG expression in response to visual input. One was to define the differential response of distinct IEG families by comparing EGR-1 (also termed zif-268, NGFI-A, and Krox-24) and Fos proteins. The second was to determine whether IEG expression, in addition to reflecting neural activity, is related to the state of plasticity by comparing young and adult visual cortex. Immunoreactivity of the two IEG proteins was compared between 5-week-old and adult cats under three conditions of visual input: ambient light to assess basal levels of expression, 1 week of darkness to assess the effect of reduced activity, and exposure to light after 1 week of darkness to determine rapid changes in expression as a result of visual input. At both ages, there were marked differences in the expression of the two IEG proteins. EGR-1 responded to visual input with sustained changes in its level of expression. It showed high basal levels, reduced expression in darkness, and a rapid return to high constitutive levels with the introduction of light. Fos showed a markedly different profile. It had very low basal expression which was not demonstrably affected by darkness and its principal response was a marked transient induction upon exposure to light after darkness. These unique changes in expression highlight the complex response across IEGs to environmental input and suggest a genetic "on/off' signaling mechanism. There were marked differences in the laminar distribution of EGR-1 and Fos proteins between young and adult cats. In young animals, cells in all visual cortical layers showed high levels of EGR-1 and Fos proteins. In adults, immunostaining was largely specific to cells located above and below layer IV and only very faint labeling

  4. Human Cytomegalovirus Immediate-Early 1 Protein Rewires Upstream STAT3 to Downstream STAT1 Signaling Switching an IL6-Type to an IFNγ-Like Response

    PubMed Central

    Lukas, Simone; Zenger, Marion; Reitberger, Tobias; Danzer, Daniela; Übner, Theresa; Munday, Diane C.; Paulus, Christina

    2016-01-01

    The human cytomegalovirus (hCMV) major immediate-early 1 protein (IE1) is best known for activating transcription to facilitate viral replication. Here we present transcriptome data indicating that IE1 is as significant a repressor as it is an activator of host gene expression. Human cells induced to express IE1 exhibit global repression of IL6- and oncostatin M-responsive STAT3 target genes. This repression is followed by STAT1 phosphorylation and activation of STAT1 target genes normally induced by IFNγ. The observed repression and subsequent activation are both mediated through the same region (amino acids 410 to 445) in the C-terminal domain of IE1, and this region serves as a binding site for STAT3. Depletion of STAT3 phenocopies the STAT1-dependent IFNγ-like response to IE1. In contrast, depletion of the IL6 receptor (IL6ST) or the STAT kinase JAK1 prevents this response. Accordingly, treatment with IL6 leads to prolonged STAT1 instead of STAT3 activation in wild-type IE1 expressing cells, but not in cells expressing a mutant protein (IE1dl410-420) deficient for STAT3 binding. A very similar STAT1-directed response to IL6 is also present in cells infected with a wild-type or revertant hCMV, but not an IE1dl410-420 mutant virus, and this response results in restricted viral replication. We conclude that IE1 is sufficient and necessary to rewire upstream IL6-type to downstream IFNγ-like signaling, two pathways linked to opposing actions, resulting in repressed STAT3- and activated STAT1-responsive genes. These findings relate transcriptional repressor and activator functions of IE1 and suggest unexpected outcomes relevant to viral pathogenesis in response to cytokines or growth factors that signal through the IL6ST-JAK1-STAT3 axis in hCMV-infected cells. Our results also reveal that IE1, a protein considered to be a key activator of the hCMV productive cycle, has an unanticipated role in tempering viral replication. PMID:27387064

  5. Prolonged gene expression and cell survival after infection by a herpes simplex virus mutant defective in the immediate-early genes encoding ICP4, ICP27, and ICP22.

    PubMed Central

    Wu, N; Watkins, S C; Schaffer, P A; DeLuca, N A

    1996-01-01

    Very early in infection, herpes simplex virus (HSV) expresses four immediate-early (IE) regulatory proteins, ICP4, ICP0, ICP22, and ICP27. The systematic inactivation of sets of the IE proteins in cis, and the subsequent phenotypic analysis of the resulting mutants, should provide insights into how these proteins function in the HSV life cycle and also into the specific macromolecular events that are altered or perturbed in cells infected with virus strains blocked very early in infection. This approach may also provide a rational basis to assess the efficacy and safety of HSV mutants for use in gene transfer experiments. In this study, we generated and examined the phenotype of an HSV mutant simultaneously mutated in the ICP4, ICP27, and ICP22 genes of HSV. Unlike mutants deficient in ICP4 (d120), ICP4 and ICP27 (d92), and ICP4 and ICP22 (d96), mutants defective in ICP4, ICP27, and ICP22 (d95) were visually much less toxic to Vero and human embryonic lung cells. Cells infected with d95 at a multiplicity of infection of 10 PFU per cell retained a relatively normal morphology and expressed genes from the viral and cellular genomes for at least 3 days postinfection. The other mutant backgrounds were too toxic to allow examination of gene expression past 1 day postinfection. However, when cell survival was measured by the capacity of the infected cells to form colonies, d95 inhibited colony formation similarly to d92. This apparent paradox was reconciled by the observation that host cell DNA synthesis was inhibited in cells infected with d120, d92, d96, and d95. In addition, all of the mutants exhibited pronounced and distinctive alterations in nuclear morphology, as determined by electron microscopy. The appearance of d95-infected cells deviated from that of uninfected cells in that large circular structures formed in the nucleus. d95-infected cells abundantly expressed ICP0, which accumulated in fine punctate structures in the nucleus at early times postinfection

  6. Screening of ARHSP-TCC patients expands the spectrum of SPG11 mutations and includes a large scale gene deletion.

    PubMed

    Denora, Paola S; Schlesinger, David; Casali, Carlo; Kok, Fernando; Tessa, Alessandra; Boukhris, Amir; Azzedine, Hamid; Dotti, Maria Teresa; Bruno, Claudio; Truchetto, Jeremy; Biancheri, Roberta; Fedirko, Estelle; Di Rocco, Maja; Bueno, Clarissa; Malandrini, Alessandro; Battini, Roberta; Sickl, Elisabeth; de Leva, Maria Fulvia; Boespflug-Tanguy, Odile; Silvestri, Gabriella; Simonati, Alessandro; Said, Edith; Ferbert, Andreas; Criscuolo, Chiara; Heinimann, Karl; Modoni, Anna; Weber, Peter; Palmeri, Silvia; Plasilova, Martina; Pauri, Flavia; Cassandrini, Denise; Battisti, Carla; Pini, Antonella; Tosetti, Michela; Hauser, Erwin; Masciullo, Marcella; Di Fabio, Roberto; Piccolo, Francesca; Denis, Elodie; Cioni, Giovanni; Massa, Roberto; Della Giustina, Elvio; Calabrese, Olga; Melone, Marina A B; De Michele, Giuseppe; Federico, Antonio; Bertini, Enrico; Durr, Alexandra; Brockmann, Knut; van der Knaap, Marjo S; Zatz, Mayana; Filla, Alessandro; Brice, Alexis; Stevanin, Giovanni; Santorelli, Filippo M

    2009-03-01

    Autosomal recessive spastic paraplegia with thinning of corpus callosum (ARHSP-TCC) is a complex form of HSP initially described in Japan but subsequently reported to have a worldwide distribution with a particular high frequency in multiple families from the Mediterranean basin. We recently showed that ARHSP-TCC is commonly associated with mutations in SPG11/KIAA1840 on chromosome 15q. We have now screened a collection of new patients mainly originating from Italy and Brazil, in order to further ascertain the spectrum of mutations in SPG11, enlarge the ethnic origin of SPG11 patients, determine the relative frequency at the level of single Countries (i.e., Italy), and establish whether there is one or more common mutation. In 25 index cases we identified 32 mutations; 22 are novel, including 9 nonsense, 3 small deletions, 4 insertions, 1 in/del, 1 small duplication, 1 missense, 2 splice-site, and for the first time a large genomic rearrangement. This brings the total number of SPG11 mutated patients in the SPATAX collection to 111 cases in 44 families and in 17 isolated cases, from 16 Countries, all assessed using homogeneous clinical criteria. While expanding the spectrum of mutations in SPG11, this larger series also corroborated the notion that even within apparently homogeneous population a molecular diagnosis cannot be achieved without full gene sequencing.

  7. Characterization of xylan utilization and discovery of a new endoxylanase in Thermoanaerobacterium saccharolyticum through targeted gene deletions

    SciTech Connect

    Podkaminer, Kara K; Guss, Adam M; McKenzie, Heather; Hogsett, David; Lynd, Lee R

    2012-01-01

    The economical production of fuels and commodity chemicals from lignocellulose requires the utilization of both the cellulose and hemicellulose fractions. Xylanase enzymes allow greater utilization of hemicellulose while also increasing cellulose hydrolysis. Recent metabolic engineering efforts have resulted in a strain of Thermoanaerobacterium saccharolyticum that can convert C(5) and C(6) sugars, as well as insoluble xylan, into ethanol at high yield. To better understand the process of xylan solubilization in this organism, a series of targeted deletions were constructed in the homoethanologenic T. saccharolyticum strain M0355 to characterize xylan hydrolysis and xylose utilization in this organism. While the deletion of -xylosidase xylD slowed the growth of T. saccharolyticum on birchwood xylan and led to an accumulation of short-chain xylo-oligomers, no other single deletion, including the deletion of the previously characterized endoxylanase XynA, had a phenotype distinct from that of the wild type. This result indicates a multiplicity of xylanase enzymes which facilitate xylan degradation in T. saccharolyticum. Growth on xylan was prevented only when a previously uncharacterized endoxylanase encoded by xynC was also deleted in conjunction with xynA. Sequence analysis of xynC indicates that this enzyme, a low-molecular-weight endoxylanase with homology to glycoside hydrolase family 11 enzymes, is secreted yet untethered to the cell wall. Together, these observations expand our understanding of the enzymatic basis of xylan hydrolysis by T. saccharolyticum.

  8. Sustained inflammation and differential expression of interferons type I and III in PVM-infected interferon-gamma (IFNγ) gene-deleted mice.

    PubMed

    Glineur, Stephanie F; Bowen, Aaron B; Percopo, Caroline M; Garcia-Crespo, Katia E; Dyer, Kimberly D; Ochkur, Sergei I; Lee, Nancy A; Lee, James J; Domachowske, Joseph B; Rosenberg, Helene F

    2014-11-01

    Interferon gamma (IFNγ) has complex immunomodulatory and antiviral properties. While IFNγ is detected in the airways in response to infection with the pneumovirus pathogen, pneumonia virus of mice (PVM; Family Paramyxoviridae), its role in promoting disease has not been fully explored. Here, we evaluate PVM infection in IFNγ(-/-) mice. Although the IFNγ gene-deletion has no impact on weight loss, survival or virus kinetics, expression of IFNβ, IFNλ2/3 and IFN-stimulated 2-5' oligoadenylate synthetases was significantly diminished compared to wild-type counterparts. Furthermore, PVM infection in IFNγ(-/-) mice promoted prominent inflammation, including eosinophil and neutrophil infiltration into the airways and lung parenchyma, observed several days after peak virus titer. Potential mechanisms include over-production of chemoattractant and eosinophil-active cytokines (CXCL1, CCL11, CCL3 and IL5) in PVM-infected IFNγ(-/-) mice; likewise, IFNγ actively antagonized IL5-dependent eosinophil survival ex vivo. Our results may have clinical implications for pneumovirus infection in individuals with IFNγ signaling defects.

  9. Conditional VHL Gene Deletion Causes Hypoglycemic Death Associated with Disproportionately Increased Glucose Uptake by Hepatocytes through an Upregulated IGF-I Receptor

    PubMed Central

    Kurabayashi, Atsushi; Kakinuma, Yoshihiko; Morita, Taku; Inoue, Keiji; Sato, Takayuki; Furihata, Mutsuo

    2013-01-01

    Our conditional VHL knockout (VHL-KO) mice, having VHL gene deletion induced by tamoxifen, developed severe hypoglycemia associated with disproportionately increased storage of PAS-positive substances in the liver and resulted in the death of these mice. This hypoglycemic state was neither due to impaired insulin secretion nor insulin receptor hypersensitivity. By focusing on insulin-like growth factor I (IGF-I), which has a similar effect on glucose metabolism as the insulin receptor, we demonstrated that IGF-I receptor (IGF-IR) protein expression in the liver was upregulated in VHL-KO mice compared to that in the mice without VHL deletion, as was the expression of glucose transporter (GLUT) 1. The interaction of the receptor for activated C kinase (RACK) 1, which predominantly binds to VHL, was enhanced in VHL-KO livers with IGF-IR, because VHL deletion increased free RACK1 and facilitated the IGF-IR-RACKI interaction. An IGF-IR antagonist retarded hypoglycemic progression and sustained an euglycemic state. These IGF-IR antagonist effects on restoring blood glucose levels also attenuated PAS-positive substance storage in the liver. Because the effect of IGF-I on HIF-1α protein synthesis is mediated by IGF-IR, our results indicated that VHL inactivation accelerated hepatic glucose storage through the upregulation of IGF-IR and GLUT1 and that IGF-IR was a key regulator in VHL-deficient hepatocytes. PMID:23874892

  10. Conditional gene deletion with DiCre demonstrates an essential role for CRK3 in L eishmania mexicana cell cycle regulation

    PubMed Central

    Duncan, Samuel M.; Myburgh, Elmarie; Philipon, Cintia; Brown, Elaine; Meissner, Markus; Brewer, James

    2016-01-01

    Summary Leishmania mexicana has a large family of cyclin‐dependent kinases (CDKs) that reflect the complex interplay between cell cycle and life cycle progression. Evidence from previous studies indicated that Cdc2‐related kinase 3 (CRK3) in complex with the cyclin CYC6 is a functional homologue of the major cell cycle regulator CDK1, yet definitive genetic evidence for an essential role in parasite proliferation is lacking. To address this, we have implemented an inducible gene deletion system based on a dimerised Cre recombinase (diCre) to target CRK3 and elucidate its role in the cell cycle of L. mexicana. Induction of diCre activity in promastigotes with rapamycin resulted in efficient deletion of floxed CRK3, resulting in G2/M growth arrest. Co‐expression of a CRK3 transgene during rapamycin‐induced deletion of CRK3 resulted in complementation of growth, whereas expression of an active site CRK3 T178E mutant did not, showing that protein kinase activity is crucial for CRK3 function. Inducible deletion of CRK3 in stationary phase promastigotes resulted in attenuated growth in mice, thereby confirming CRK3 as a useful therapeutic target and diCre as a valuable new tool for analyzing essential genes in Leishmania. PMID:26991545

  11. Homozygous deletion of TRMT10A as part of a contiguous gene deletion in a syndrome of failure to thrive, delayed puberty, intellectual disability and diabetes mellitus.

    PubMed

    Zung, Amnon; Kori, Michal; Burundukov, Ella; Ben-Yosef, Tamar; Tatoor, Yasmin; Granot, Esther

    2015-12-01

    Two recent reports describe a new syndrome of intellectual disability, short stature, microcephaly, and young onset diabetes or disturbed glucose metabolism in association with inactivating mutations in the TRMT10A gene. We investigated the clinical spectrum presented by a 17-year-old female with a homozygous contiguous gene deletion involving the TRMT10A gene. From infancy, she presented with failure to thrive and microcephaly. Puberty was characterized by a slow and an inconsistent course of progression. Concomitantly, gonadotropin levels fluctuated between low and high levels which were compatible with gonadal failure. Unlike the previous reports, the patient had ketoacidosis at onset of diabetes and islet cell autoantibodies. Nevertheless, glycemic control was excellent (HbA1C 5.0%-6.2%). RT-PCR and Western blot analysis demonstrated a complete abolishment of TRMT10A mRNA and its translated protein. In order to elucidate the nature of diabetes in this patient, endogenous insulin secretion and glycemic control were evaluated by a glucagon stimulation test and continuous glucose monitoring both during insulin treatment and off therapy. Endogenous insulin secretion still persisted 22 months after onset of diabetes and relatively normal glucose levels were kept over 3 days without insulin treatment. The fluctuating course of puberty and diabetes may reflect intermittent apoptotic damages due to sensitization of the relevant cells to various stress agents in the absence of functional TRMT10A.

  12. Inducible Fli-1 gene deletion in adult mice modifies several myeloid lineage commitment decisions and accelerates proliferation arrest and terminal erythrocytic differentiation.

    PubMed

    Starck, Joëlle; Weiss-Gayet, Michèle; Gonnet, Colette; Guyot, Boris; Vicat, Jean-Michel; Morlé, François

    2010-12-02

    This study investigated the role of the ETS transcription factor Fli-1 in adult myelopoiesis using new transgenic mice allowing inducible Fli-1 gene deletion. Fli-1 deletion in adult induced mild thrombocytopenia associated with a drastic decrease in large mature megakaryocytes number. Bone marrow bipotent megakaryocytic-erythrocytic progenitors (MEPs) increased by 50% without increase in erythrocytic and megakaryocytic common myeloid progenitor progeny, suggesting increased production from upstream stem cells. These MEPs were almost unable to generate pure colonies containing large mature megakaryocytes, but generated the same total number of colonies mainly identifiable as erythroid colonies containing a reduced number of more differentiated cells. Cytological and fluorescence-activated cell sorting analyses of MEP progeny in semisolid and liquid cultures confirmed the drastic decrease in large mature megakaryocytes but revealed a surprisingly modest (50%) reduction of CD41-positive cells indicating the persistence of a megakaryocytic commitment potential. Symmetrical increase and decrease of monocytic and granulocytic progenitors were also observed in the progeny of purified granulocytic-monocytic progenitors and common myeloid progenitors. In summary, this study indicates that Fli-1 controls several lineages commitment decisions at the stem cell, MEP, and granulocytic-monocytic progenitor levels, stimulates the proliferation of committed erythrocytic progenitors at the expense of their differentiation, and is a major regulator of late stages of megakaryocytic differentiation.

  13. Analysis of Two Complementary Single-Gene Deletion Mutant Libraries of Salmonella Typhimurium in Intraperitoneal Infection of BALB/c Mice.

    PubMed

    Silva-Valenzuela, Cecilia A; Molina-Quiroz, Roberto C; Desai, Prerak; Valenzuela, Camila; Porwollik, Steffen; Zhao, Ming; Hoffman, Robert M; Andrews-Polymenis, Helene; Contreras, Inés; Santiviago, Carlos A; McClelland, Michael

    2015-01-01

    Two pools of individual single gene deletion (SGD) mutants of S. Typhimurium 14028s encompassing deletions of 3,923 annotated non-essential ORFs and sRNAs were screened by intraperitoneal (IP) injection in BALB/c mice followed by recovery from spleen and liver 2 days post infection. The relative abundance of each mutant was measured by microarray hybridization. The two mutant libraries differed in the orientation of the antibiotic resistance cassettes (either sense-oriented Kan(R), SGD-K, or antisense-oriented Cam(R), SGD-C). Consistent systemic colonization defects were observed in both libraries and both organs for hundreds of mutants of genes previously reported to be important after IP injection in this animal model, and for about 100 new candidate genes required for systemic colonization. Four mutants with a range of apparent fitness defects were confirmed using competitive infections with the wild-type parental strain: ΔSTM0286, ΔSTM0551, ΔSTM2363, and ΔSTM3356. Two mutants, ΔSTM0286 and ΔSTM2363, were then complemented in trans with a plasmid encoding an intact copy of the corresponding wild-type gene, and regained the ability to fully colonize BALB/c mice systemically. These results suggest the presence of many more undiscovered Salmonella genes with phenotypes in IP infection of BALB/c mice, and validate the libraries for application to other systems.

  14. Analysis of Two Complementary Single-Gene Deletion Mutant Libraries of Salmonella Typhimurium in Intraperitoneal Infection of BALB/c Mice

    PubMed Central

    Silva-Valenzuela, Cecilia A.; Molina-Quiroz, Roberto C.; Desai, Prerak; Valenzuela, Camila; Porwollik, Steffen; Zhao, Ming; Hoffman, Robert M.; Andrews-Polymenis, Helene; Contreras, Inés; Santiviago, Carlos A.; McClelland, Michael

    2016-01-01

    Two pools of individual single gene deletion (SGD) mutants of S. Typhimurium 14028s encompassing deletions of 3,923 annotated non-essential ORFs and sRNAs were screened by intraperitoneal (IP) injection in BALB/c mice followed by recovery from spleen and liver 2 days post infection. The relative abundance of each mutant was measured by microarray hybridization. The two mutant libraries differed in the orientation of the antibiotic resistance cassettes (either sense-oriented KanR, SGD-K, or antisense-oriented CamR, SGD-C). Consistent systemic colonization defects were observed in both libraries and both organs for hundreds of mutants of genes previously reported to be important after IP injection in this animal model, and for about 100 new candidate genes required for systemic colonization. Four mutants with a range of apparent fitness defects were confirmed using competitive infections with the wild-type parental strain: ΔSTM0286, ΔSTM0551, ΔSTM2363, and ΔSTM3356. Two mutants, ΔSTM0286 and ΔSTM2363, were then complemented in trans with a plasmid encoding an intact copy of the corresponding wild-type gene, and regained the ability to fully colonize BALB/c mice systemically. These results suggest the presence of many more undiscovered Salmonella genes with phenotypes in IP infection of BALB/c mice, and validate the libraries for application to other systems. PMID:26779130

  15. The Canonical Immediate Early 3 Gene Product pIE611 of Mouse Cytomegalovirus Is Dispensable for Viral Replication but Mediates Transcriptional and Posttranscriptional Regulation of Viral Gene Products

    PubMed Central

    Rattay, Stephanie; Trilling, Mirko; Megger, Dominik A.; Sitek, Barbara; Meyer, Helmut E.; Hengel, Hartmut

    2015-01-01

    ABSTRACT Transcription of mouse cytomegalovirus (MCMV) immediate early ie1 and ie3 is controlled by the major immediate early promoter/enhancer (MIEP) and requires differential splicing. Based on complete loss of genome replication of an MCMV mutant carrying a deletion of the ie3-specific exon 5, the multifunctional IE3 protein (611 amino acids; pIE611) is considered essential for viral replication. Our analysis of ie3 transcription resulted in the identification of novel ie3 isoforms derived from alternatively spliced ie3 transcripts. Construction of an IE3-hemagglutinin (IE3-HA) virus by insertion of an in-frame HA epitope sequence allowed detection of the IE3 isoforms in infected cells, verifying that the newly identified transcripts code for proteins. This prompted the construction of an MCMV mutant lacking ie611 but retaining the coding capacity for the newly identified isoforms ie453 and ie310. Using Δie611 MCMV, we demonstrated the dispensability of the canonical ie3 gene product pIE611 for viral replication. To determine the role of pIE611 for viral gene expression during MCMV infection in an unbiased global approach, we used label-free quantitative mass spectrometry to delineate pIE611-dependent changes of the MCMV proteome. Interestingly, further analysis revealed transcriptional as well as posttranscriptional regulation of MCMV gene products by pIE611. IMPORTANCE Cytomegaloviruses are pathogenic betaherpesviruses persisting in a lifelong latency from which reactivation can occur under conditions of immunosuppression, immunoimmaturity, or inflammation. The switch from latency to reactivation requires expression of immediate early genes. Therefore, understanding of immediate early gene regulation might add insights into viral pathogenesis. The mouse cytomegalovirus (MCMV) immediate early 3 protein (611 amino acids; pIE611) is considered essential for viral replication. The identification of novel protein isoforms derived from alternatively spliced ie3

  16. The de novo methyltransferases DNMT3a and DNMT3b target the murine gammaherpesvirus immediate-early gene 50 promoter during establishment of latency.

    PubMed

    Gray, Kathleen S; Forrest, J Craig; Speck, Samuel H

    2010-05-01

    The role of epigenetic modifications in the regulation of gammaherpesvirus latency has been a subject of active study for more than 20 years. DNA methylation, associated with transcriptional silencing in mammalian genomes, has been shown to be an important mechanism in the transcriptional control of several key gammaherpesvirus genes. In particular, DNA methylation of the functionally conserved immediate-early replication and transcription activator (RTA) has been shown to regulate Epstein-Barr virus and Kaposi's sarcoma-associated herpesvirus Rta expression. Here we demonstrate that the murine gammaherpesvirus (MHV68) homolog, encoded by gene 50, is also subject to direct repression by DNA methylation, both in vitro and in vivo. We observed that the treatment of latently MHV68-infected B-cell lines with a methyltransferase inhibitor induced virus reactivation. In addition, we show that the methylation of the recently characterized distal gene 50 promoter represses activity in a murine macrophage cell line. To evaluate the role of de novo methyltransferases (DNMTs) in the establishment of these methylation marks, we infected mice in which conditional DNMT3a and DNMT3b alleles were selectively deleted in B lymphocytes. DNMT3a/DNMT3b-deficient B cells were phenotypically normal, displaying no obvious compromise in cell surface marker expression or antibody production either in naïve mice or in the context of nonviral and viral immunogens. However, mice lacking functional DNMT3a and DNMT3b in B cells exhibited hallmarks of deregulated MHV68 lytic replication, including increased splenomegaly and the presence of infectious virus in the spleen at day 18 following infection. In addition, total gene 50 transcript levels were elevated in the spleens of these mice at day 18, which correlated with the hypomethylation of the distal gene 50 promoter. However, by day 42 postinfection, aberrant virus replication was resolved, and we observed wild-type frequencies of viral

  17. Gene expression of immediate early genes of AP-1 transcription factor in human peripheral blood mononuclear cells in response to ionizing radiation.

    PubMed

    Nishad, S; Ghosh, Anu

    2016-11-01

    Ionizing radiation (IR) is considered ubiquitous in nature. The immediate early genes are considered the earliest nuclear targets of IR and are induced in the absence of de novo protein synthesis. Many of these genes encode transcription factors that constitute the first step in signal transduction to couple cytoplasmic effects with long-term cellular response. In this paper, coordinated transcript response of fos and jun family members which constitute activator protein 1 transcription factor was studied in response to IR in human peripheral blood lymphocytes at the G0 stage. Gene expression was monitored 5 min, 1 h and 4 h post-irradiation with Co(60) γ-rays (dose rate of 0.417 Gy/min) and compared with sham-irradiated controls. When gene expression was analyzed at the early time point of 5 min post-irradiation with 0.3 Gy, the studied samples showed two distinct trends. Six out of ten individuals (called 'Group I responders') showed transient, but significant up-regulation for fosB, fosL1, fosL2 and c-jun with an average fold change (FC) ≥1.5 as compared to sham-irradiated controls. The Students's t test p value for all four genes was ≤0.001, indicating strong up-regulation. The remaining four individuals (called Group II responders) showed down-regulation for these same four genes. The average FC with 0.3 Gy in Group II individuals was 0.53 ± 0.22 (p = 0.006) for fosB, 0.60 ± 0.14 (p = 0.001) for fosL1, 0.52 ± 0.16 (p = 0.001) for fosL2 and 0.59 ± 0.28 (p = 0.03) for c-jun. The two groups could be clearly distinguished at this dose/time point using principal component analysis. Both Group I and Group II responders did not show any change in expression for three genes (c-fos, junB and junD) as compared to sham-irradiated controls. Though a similar trend was seen 5 min post-irradiation with a relatively high dose of 1 Gy, the average FC was lower and change in gene expression was not statistically significant (at p < 0

  18. Human Cytomegalovirus Immediate-Early mRNA Detection by Nucleic Acid Sequence-Based Amplification as a New Parameter for Preemptive Therapy in Bone Marrow Transplant Recipients

    PubMed Central

    Gerna, Giuseppe; Baldanti, Fausto; Lilleri, Daniele; Parea, Maurizio; Alessandrino, Emilio; Pagani, Ambrogio; Locatelli, Franco; Middeldorp, Jaap; Revello, M. Grazia

    2000-01-01

    Human cytomegalovirus (HCMV) infection was monitored retrospectively by qualitative determination of immediate-early (IE) mRNA by nucleic acid sequence-based amplification (NASBA) in a series of 51 bone marrow transplant (BMT) recipients. The qualitative results for IE mRNA obtained by NASBA were compared with those obtained by prospective quantitation of HCMV viremia and antigenemia and retrospective quantitation of DNA in blood (DNAemia) by PCR as well as by qualitative determination of late pp67 mRNA by NASBA. On the whole, of the 39 HCMV-positive patients (all asymptomatic), HCMV was detected in 14 (35.9%) by quantitation of viremia, 15 (38.5%) by detection of pp67 mRNA by NASBA, 32 (82.1%) by quantitation of DNAemia, and 33 (84.6%) by quantitation of antigenemia, while HCMV was detected in 38 (97.4%) patients by detection of IE mRNA by NASBA. In the immunocompetent host, IE mRNA was not detected by NASBA in 100 blood donors or during reactivated infections in 30 breast-feeding mothers. Likewise, NASBA did not detect IE mRNA in 56 solid-organ transplant recipients in the first 21 days after transplantation. By using NASBA for detection of IE mRNA as the reference standard for detection of HCMV infection in blood samples, the diagnostic sensitivities were 67.7% for quantitation of DNAemia, 59.0% for quantitation of antigenemia, 18.3% for detection of pp67 mRNA by NASBA, and 16.0% for quantitation of viremia. Specificities and negative and positive predictive values were >90.0, >70.0, and >80.0%, respectively, for all four assays. The mean times to first HCMV detection after bone marrow transplantation were 37.7 ± 15.4 days for detection of IE mRNA by NASBA, 39.6 ± 15.6 days for quantitation of antigenemia, 40.9 ± 15.2 days for quantitation of DNAemia, and 43.7 ± 16.3 or 43.7 ± 17.5 days for quantitation of viremia and detection of pp67 mRNA by NASBA, respectively. On the whole, 31 BMT recipients received preemptive therapy by using confirmed antigenemia

  19. Prevalence of pfhrp2 and/or pfhrp3 Gene Deletion in Plasmodium falciparum Population in Eight Highly Endemic States in India

    PubMed Central

    Bharti, Praveen Kumar; Chandel, Himanshu Singh; Ahmad, Amreen; Krishna, Sri; Udhayakumar, Venkatachalam; Singh, Neeru

    2016-01-01

    Background Plasmodium falciparum encoded histidine rich protein (HRP2) based malaria rapid diagnostic tests (RDTs) are used in India. Deletion of pfhrp2 and pfhrp3 genes contributes to false negative test results, and large numbers of such deletions have been reported from South America, highlighting the importance of surveillance to detect such deletions. Methods This is the first prospective field study carried out at 16 sites located in eight endemic states of India to assess the performance of PfHRP2 based RDT kits used in the national malaria control programme. In this study, microscopically confirmed P. falciparum but RDT negative samples were assessed for presence of pfhrp2, pfhrp3, and their flanking genes using PCR. Results Among 1521 microscopically positive P. falciparum samples screened, 50 were negative by HRP2 based RDT test. Molecular testing was carried out using these 50 RDT negative samples by assuming that 1471 RDT positive samples carried pfhrp2 gene. It was found that 2.4% (36/1521) and 1.8% (27/1521) of samples were negative for pfhrp2 and pfhrp3 genes, respectively. However, the frequency of pfhrp2 deletions varied between the sites ranging from 0–25% (2.4, 95% CI; 1.6–3.3). The frequency of both pfhrp2 and pfhrp3 gene deletion varied from 0–8% (1.6, 95% CI; 1.0–2.4). Conclusion This study provides evidence for low level presence of pfhrp2 and pfhrp3 deleted P. falciparum parasites in different endemic regions of India, and periodic surveillance is warranted for reliable use of PfHRP2 based RDTs. PMID:27518538

  20. Microcephaly, intellectual impairment, bilateral vesicoureteral reflux, distichiasis, and glomuvenous malformations associated with a 16q24.3 contiguous gene deletion and a Glomulin mutation.

    PubMed

    Butler, Matthew G; Dagenais, Susan L; Garcia-Perez, José L; Brouillard, Pascal; Vikkula, Miikka; Strouse, Peter; Innis, Jeffrey W; Glover, Thomas W

    2012-04-01

    Two hereditary syndromes, lymphedema-distichiasis (LD) syndrome and blepharo-chelio-dontic (BCD) syndrome include the aberrant growth of eyelashes from the meibomian glands, known as distichiasis. LD is an autosomal dominant syndrome primarily characterized by distichiasis and the onset of lymphedema usually during puberty. Mutations in the forkhead transcription factor FOXC2 are the only known cause of LD. BCD syndrome consists of autosomal dominant abnormalities of the eyelid, lip, and teeth, and the etiology remains unknown. In this report, we describe a proband that presented with distichiasis, microcephaly, bilateral grade IV vesicoureteral reflux requiring ureteral re-implantation, mild intellectual impairment and apparent glomuvenous malformations (GVM). Distichiasis was present in three generations of the proband's maternal side of the family. The GVMs were severe in the proband, and maternal family members exhibited lower extremity varicosities of variable degree. A GLMN (glomulin) gene mutation was identified in the proband that accounts for the observed GVMs; no other family member could be tested. TIE2 sequencing revealed no mutations. In the proband, an additional submicroscopic 265 kb contiguous gene deletion was identified in 16q24.3, located 609 kb distal to the FOXC2 locus, which was inherited from the proband's mother. The deletion includes the C16ORF95, FBXO31, MAP1LC3B, and ZCCHC14 loci and 115 kb of a gene desert distal to FOXC2 and FOXL1. Thus, it is likely that the microcephaly, distichiasis, vesicoureteral, and intellectual impairment in this family may be caused by the deletion of one or more of these genes and/or deletion of distant cis-regulatory elements of FOXC2 expression.

  1. Microcephaly, Intellectual Impairment, Bilateral Vesicoureteral Reflux, Distichiasis and Glomuvenous Malformations Associated with a 16q24.3 Contiguous Gene Deletion and a Glomulin Mutation

    PubMed Central

    Butler, Matthew G.; Dagenais, Susan L.; Garcia-Perez, José L.; Brouillard, Pascal; Vikkula, Miikka; Strouse, Peter; Innis, Jeffrey W.; Glover, Thomas W.

    2012-01-01

    Two hereditary syndromes, lymphedema-distichiasis syndrome (LD) and blepharo-chelio-dontic (BCD) syndrome include the aberrant growth of eyelashes from the meibomian glands, known as distichiasis. LD is an autosomal dominant syndrome primarily characterized by distichiasis and the onset of lymphedema usually during puberty. Mutations in the forkhead transcription factor FOXC2 are the only known cause of LD. BCD syndrome consists of autosomal dominant abnormalities of the eyelid, lip, and teeth, and the etiology remains unknown. In this report, we describe a proband that presented with distichiasis, microcephaly, bilateral grade IV vesicoureteral reflux requiring ureteral re-implantation, mild intellectual impairment and apparent glomuvenous malformations. Distichiasis was present in three generations of the proband’s maternal side of the family. The glomuvenous malformations were severe in the proband, and maternal family members exhibited lower extremity varicosities of variable degree. A GLMN (glomulin) gene mutation was identified in the proband that accounts for the observed glomuvenous malformations; no other family member could be tested. TIE2 sequencing revealed no mutations. In the proband, an additional submicroscopic 265 kb contiguous gene deletion was identified in 16q24.3, located 609 kb distal to the FOXC2 locus, which was inherited from the proband’s mother. The deletion includes the C16ORF95, FBXO31, MAP1LC3B, and ZCCHC14 loci and 115 kb of a gene desert distal to FOXC2 and FOXL1. Thus, it is likely that the microcephaly, distichiasis, vesicoureteral and intellectual impairment in this family may be caused by the deletion of one or more of these genes and/or deletion of distant cis-regulatory elements of FOXC2 expression. PMID:22407726

  2. From Whole Gene Deletion to Point Mutations of EP300-Positive Rubinstein-Taybi Patients: New Insights into the Mutational Spectrum and Peculiar Clinical Hallmarks.

    PubMed

    Negri, Gloria; Magini, Pamela; Milani, Donatella; Colapietro, Patrizia; Rusconi, Daniela; Scarano, Emanuela; Bonati, Maria Teresa; Priolo, Manuela; Crippa, Milena; Mazzanti, Laura; Wischmeijer, Anita; Tamburrino, Federica; Pippucci, Tommaso; Finelli, Palma; Larizza, Lidia; Gervasini, Cristina

    2016-02-01

    Rubinstein-Taybi syndrome (RSTS) is a rare congenital neurodevelopmental disorder characterized by growth deficiency, skeletal abnormalities, dysmorphic features, and intellectual disability. Causative mutations in CREBBP and EP300 genes have been identified in ∼55% and ∼8% of affected individuals. To date, only 28 EP300 alterations in 29 RSTS clinically described patients have been reported. EP300 analysis of 22 CREBBP-negative RSTS patients from our cohort led us to identify six novel mutations: a 376-kb deletion depleting EP300 gene; an exons 17-19 deletion (c.(3141+1_3142-1)_(3590+1_3591-1)del/p.(Ile1047Serfs*30)); two stop mutations, (c.3829A>T/p.(Lys1277*) and c.4585C>T/p.(Arg1529*)); a splicing mutation (c.1878-12A>G/p.(Ala627Glnfs*11)), and a duplication (c.4640dupA/p.(Asn1547Lysfs*3)). All EP300-mutated individuals show a mild RSTS phenotype and peculiar findings including maternal gestosis, skin manifestation, especially nevi or keloids, back malformations, and a behavior predisposing to anxiety. Furthermore, the patient carrying the complete EP300 deletion does not show a markedly severe clinical picture, even if a more composite phenotype was noticed. By characterizing six novel EP300-mutated patients, this study provides further insights into the EP300-specific clinical presentation and expands the mutational repertoire including the first case of a whole gene deletion. These new data will enhance EP300-mutated cases identification highlighting distinctive features and will improve the clinical practice allowing a better genotype-phenotype correlation.

  3. High-frequency structural gene deletion as the basis for functional hemizygosity of the adenine phosphoribosyltransferase locus in Chinese hamster ovary cells.

    PubMed

    Adair, G M; Stallings, R L; Nairn, R S; Siciliano, M J

    1983-10-01

    The CHO-AT3-2 Chinese hamster ovary cell line is functionally hemizygous for the adenine phosphoribosyltransferase (APRT; EC 2.4.2.7) locus. Class 1 APRT +/- heterozygotes, such as CHO-AT3-2, can be isolated at high spontaneous frequencies from wild-type CHO cell populations. Simon et al. [Simon, A. E., Taylor, M. W., Bradley, W. E. C. & Thompson, L. (1982) Mol. Cell. Biol. 2, 1126-1133] have proposed that a high-frequency event that inactivates one APRT allele might be responsible for both the spontaneous generation of class 1 APRT +/- heterozygotes and the high-frequency occurrence of APRT- mutants in class 2 APRT +/- heterozygote populations. This event appears to occur at only one of the two APRT alleles. To investigate the nature of this high-frequency event, and to determine the genetic basis for functional hemizygosity of the APRT locus in CHO-AT3-2 cells, we have mapped the APRT locus by using CHO-AT3-2-mouse somatic cell hybrids. Our data confirm that CHO-AT3-2 cells have a single functional APRT allele, which is located on the Z7 chromosome. Karyotypic analysis of CHO-AT3-2 revealed an interstitial deletion on the long arm of the Z4 chromosome, in the very region where the other APRT allele should be located. To determine whether the Z4q interstitial deletion had resulted in physical loss of the APRT gene, DNA from CHO-AT3-2-mouse cell hybrids that had either lost or retained the Z4q- chromosome was analyzed for the presence of CHO APRT coding sequences. Our data suggest that allele-specific high-frequency structural gene deletion events involving the long arm of chromosome Z4 are responsible for the spontaneous generation of functional hemizygosity at the APRT locus in CHO cells.

  4. Oncolytic Adenoviral Mutants with E1B19K Gene Deletions Enhance Gemcitabine-induced Apoptosis in Pancreatic Carcinoma Cells and Anti-Tumor Efficacy In vivo

    PubMed Central

    Leitner, Stephan; Sweeney, Katrina; Öberg, Daniel; Davies, Derek; Miranda, Enrique; Lemoine, Nick R.; Halldén, Gunnel

    2010-01-01

    Purpose Pancreatic adenocarcinoma is a rapidly progressive malignancy that is highly resistant to current chemotherapeutic modalities and almost uniformly fatal.We show that a novel targeting strategy combining oncolytic adenoviral mutants with the standard cytotoxic treatment, gemcitabine, can markedly improve the anticancer potency. Experimental Design Adenoviral mutants with the E1B19K gene deleted with and without E3B gene expression (AdΔE1B19K and dl337 mutants, respectively) were assessed for synergistic interactions in combination with gemcitabine. Cell viability, mechanism of cell death, and antitumor efficacy in vivo were determined in the pancreatic carcinoma cells PT45 and Suit2, normal human bronchial epithelial cells, and in PT45 xenografts. Results The ΔE1B19K-deleted mutants synergized with gemcitabine to selectively kill cultured pancreatic cancer cells and xenografts in vivo with no effect in normal cells. The corresponding wild-type virus (Ad5) stimulated drug-induced cell killing to a lesser degree. Gemcitabine blocked replication of all viruses despite the enhanced cell killing activity due to gemcitabine-induced delay in G1/S-cell cycle progression, with repression of cyclin E and cdc25A, which was not abrogated by viral E1A-expression. Synergistic cell death occurred through enhancement of gemcitabine-induced apoptosis in the presence of both AdΔE1B19K and dl337 mutants, shown by increased cell membrane fragmentation, caspase-3 activation, and mitochondrial dysfunction. Conclusions Our data suggest that oncolytic mutants lacking the antiapoptotic E1B19K gene can improve efficacy of DNA-damaging drugs such as gemcitabine through convergence on cellular apoptosis pathways.These findings imply that less toxic doses than currently practicedin the clinic could efficiently target pancreatic adenocarcinomas when combined with adenoviral mutants. PMID:19223497

  5. Screening of High-Level 4-Hydroxy-2 (or 5)-Ethyl-5 (or 2)-Methyl-3(2H)-Furanone-Producing Strains from a Collection of Gene Deletion Mutants of Saccharomyces cerevisiae

    PubMed Central

    Watanabe, Jun; Akao, Takeshi; Watanabe, Daisuke; Mogi, Yoshinobu; Shimoi, Hitoshi

    2014-01-01

    4-Hydroxy-2 (or 5)-ethyl-5 (or 2)-methyl-3(2H)-furanone (HEMF) is an important flavor compound that contributes to the sensory properties of many natural products, particularly soy sauce and soybean paste. The compound exhibits a caramel-like aroma and several important physiological activities, such as strong antioxidant activity. HEMF is produced by yeast species in soy sauce manufacturing; however, the enzymes involved in HEMF production remain unknown, hindering efforts to breed yeasts with high-level HEMF production. In this study, we identified high-level HEMF-producing mutants among a Saccharomyces cerevisiae gene deletion mutant collection. Fourteen deletion mutants were screened as high-level HEMF-producing mutants, and the ADH1 gene deletion mutant (adh1Δ) exhibited the maximum HEMF production capacity. Further investigations of the adh1Δ mutant implied that acetaldehyde accumulation contributes to HEMF production, agreeing with previous findings. Therefore, acetaldehyde might be a precursor for HEMF. The ADH1 gene deletion mutant of Zygosaccharomyces rouxii, which is the dominant strain of yeast found during soy sauce fermentation, also produces HEMF effectively, suggesting that acetaldehyde accumulation might be a benchmark for breeding industrial yeasts with excellent HEMF production abilities. PMID:25362059

  6. Sleep research in space: expression of immediate early genes in forebrain structures of rats during the nasa neurolab mission (STS-90).

    PubMed

    Centini, C; Pompeiano, O

    2007-05-01

    1. Electrophysiological and behavioural observations have shown that changes in the sleep-waking activity occur in astronauts during the space flight. Experiments performed in ground-based experiments have previously shown that the immediate early gene (IEG) c-fos, a marker of neuronal activation, can be used as a molecular correlate of sleep and waking. However, while Fos expression peaks within 2-4 hours after the stimulus and returns to baseline within 6-8 hours, other IEGs as the FRA proteins which are also synthetized soon after their induction, persist in the cell nuclei for longer periods of time, ranging from 1-2 days to weeks. 2. Both Fos and FRA expression were evaluated in several adult albino rats sacrificed at different time points of the space flight, i.e. either at FD2 and FD14, i.e. at launch and about two weeks after launch, respectively, or at R + 1 and R + 13, i.e. at the reentry and about two weeks after landing. The changes in Fos and FRA expression were then compared with those obtained in ground controls. These experiments demonstrate activation of several brain areas which varies during the different phases of the space flight. Due to their different time of persistence, Fos and FRA immunohistochemistry can provide only correlative observations. In particular, FRA expression has been quite helpful to identify the occurrence of short-lasting events such as those related either to stress or to REM-sleep, whose episodes last in the rat only a few min and could hardly be detected by using only Fos expression. 3. Evidence was presented indicating that at FD2 and FD14 Fos-labeled cells were observed in several brain areas in which Fos had been previously identified as being induced by spontaneous or forced waking in ground-based experiments. In contrast to these findings FLT rats sacrificed at R + 1 showed low levels of Fos immunostaining in the cerebral cortex (neocortex) and several forebrain structures such as the hypothalamus and thalamus

  7. Impact of alg3 gene deletion on growth, development, pigment production, protein secretion, and functions of recombinant Trichoderma reesei cellobiohydrolases in Aspergillus niger.

    PubMed

    Dai, Ziyu; Aryal, Uma K; Shukla, Anil; Qian, Wei-Jun; Smith, Richard D; Magnuson, Jon K; Adney, William S; Beckham, Gregg T; Brunecky, Roman; Himmel, Michael E; Decker, Stephen R; Ju, Xiaohui; Zhang, Xiao; Baker, Scott E

    2013-12-01

    Dolichyl-P-Man:Man(5)GlcNAc(2)-PP-dolichyl α-1,3-mannosyltransferase (also known as "asparagine-linked glycosylation 3", or ALG3) is involved in early N-linked glycan synthesis and thus is essential for formation of N-linked protein glycosylation. In this study, we examined the effects of alg3 gene deletion (alg3Δ) on growth, development, pigment production, protein secretion and recombinant Trichoderma reesei cellobiohydrolase (rCel7A) expressed in Aspergillus niger. The alg3Δ delayed spore germination in liquid cultures of complete medium (CM), potato dextrose (PD), minimal medium (MM) and CM with addition of cAMP (CM+cAMP), and resulted in significant reduction of hyphal growth on CM, potato dextrose agar (PDA), and CM+cAMP and spore production on CM. The alg3Δ also led to a significant accumulation of red pigment on both liquid and solid CM cultures. The relative abundances of 54 of the total 215 proteins identified in the secretome were significantly altered as a result of alg3Δ, 63% of which were secreted at higher levels in alg3Δ strain than the parent. The rCel7A expressed in the alg3Δ mutant was smaller in size than that expressed in both wild-type and parental strains, but still larger than T. reesei Cel7A. The circular dichroism (CD)-melt scans indicated that change in glycosylation of rCel7A does not appear to impact the secondary structure or folding. Enzyme assays of Cel7A and rCel7A on nanocrystalline cellulose and bleached kraft pulp demonstrated that the rCel7As have improved activities on hydrolyzing the nanocrystalline cellulose. Overall, the results suggest that alg3 is critical for growth, sporulation, pigment production, and protein secretion in A. niger, and demonstrate the feasibility of this alternative approach to evaluate the roles of N-linked glycosylation in glycoprotein secretion and function.

  8. Activation of the major immediate early gene of human cytomegalovirus by cis-acting elements in the promoter-regulatory sequence and by virus-specific trans-acting components.

    PubMed Central

    Stinski, M F; Roehr, T J

    1985-01-01

    Upstream of the major immediate early gene of human cytomegalovirus (Towne) is a strong promoter-regulatory region that promotes the synthesis of 1.95-kilobase mRNA (D. R. Thomsen, R. M. Stenberg, W. F. Goins, and M. F. Stinski, Proc. Natl. Acad. Sci. U.S.A. 81:659-663, 1984; M. F. Stinski, D. R. Thomsen, R. M. Stenberg, and L. C. Goldstein, J. Virol. 46:1-14, 1983). The wild-type promoter-regulatory region as well as deletions within this region were ligated upstream of the thymidine kinase, chloramphenicol acetyltransferase, or ovalbumin genes. These gene chimeras were constructed to investigate the role of the regulatory sequences in enhancing downstream expression. The regulatory region extends to approximately 465 nucleotides upstream of the cap site for the initiation of transcription. The extent and type of regulatory sequences upstream of the promoter influences the level of in vitro transcription as well as the amount of in vivo expression of the downstream gene. The regulatory elements for cis-activation appear to be repeated several times within the regulatory region. A direct correlation was established between the distribution of the 19 (5' CCCCAGTTGACGTCAATGGG 3')- and 18 (5' CACTAACGGGACTTTCCAA 3')-nucleotide repeats and the level of downstream expression. In contrast, the 16 (5' CTTGGCAGTACATCAA 3')-nucleotide repeat is not necessary for the enhancement of downstream expression. In a domain associated with the 19- or 18-nucleotide repeats are elements that can be activated in trans by a human cytomegalovirus-specified component but not a herpes simplex virus-specified component. Therefore, the regulatory sequences of the major immediate early gene of human cytomegalovirus have an important role in interacting with cellular and virus-specific factors of the transcription complex to enhance downstream expression of this critical viral gene. Images PMID:2991567

  9. Krüppel-like factor 4 is widely expressed in the mouse male and female reproductive tract and responds as an immediate early gene to activation of the protein kinase A in TM4 Sertoli cells.

    PubMed

    Godmann, M; Kosan, C; Behr, R

    2010-04-01

    Krüppel-like factor 4 (KLF4) is a zinc finger transcription factor critically involved in cell proliferation, differentiation, and carcinogenesis. Recently, KLF4 has also been used for the generation of induced pluripotent stem cells. In this study, we analyzed Klf4 expression in different mouse tissues using northern blot analysis and immunohistochemistry. Focusing on the male and female reproductive tract, we showed for the first time that KLF4 is expressed in the epithelia of the murine uterus and the vagina. In the male reproductive tract, we detected KLF4 in the epithelia of the epididymis, ductus deferens, coagulating gland, and the penis. As KLF4 is strongly inducible by FSH signaling in Sertoli cells and as this transcription factor is also involved in Sertoli cell development, we employed the mouse Sertoli cell line TM4 as a model system to investigate i) the induction kinetics of Klf4 upon activation of the cAMP/protein kinase A pathway by forskolin and ii) the effects of Klf4 induction on TM4 cell cycle progression. Interestingly, Klf4 mRNA and protein were rapidly but transiently induced, reaching peak levels after 90-120 min and declining to basal levels within 4 h. Compared with the inducible cAMP early repressor, an immediate early response gene, the induction kinetics of Klf4 is much faster. In conclusion, Klf4 is an immediate early gene in TM4 cells and its expression in several epithelia of the male and female reproductive tract suggests an important role of Klf4 in mouse reproductive functions.

  10. Analysis of sequences involved in IE2 transactivation of a baculovirus immediate-early gene promoter and identification of a new regulatory motif.

    PubMed

    Shippam-Brett, C E; Willis, L G; Theilmann, D A

    2001-05-01

    Opep-2 is a unique baculovirus early gene that has only been identified in the Orgyia pseudotsugata multiple capsid nucleopolyhedrovirus (OpMNPV). Previous analyses have shown this gene is expressed at very early times post-infection (p.i.) but is shut down by 36-48 h p.i. The promoter of opep-2 therefore, represents a class of early genes that is temporally regulated. In this study, a detailed analysis of the opep-2 promoter is performed to analyze the role individual motifs play in early gene expression. A new 13 base pair regulatory element was identified and shown to be essential in controlling high-level expression of this gene. In addition, mutational analysis revealed that GATA and CACGTG motifs, which have been shown to bind cellular factors in Sf9 and Ld652Y cells, played minor roles in influencing opep-2 expression in the absence of other viral factors. The OpMNPV transactivator IE2 causes a significant activation of the opep-2 promoter. Cotransfection of an extensive number of promoter deletions and mutations did not show any sequence specificity for IE2 transactivation. This is the first detailed analysis of the sequence requirements for IE2 transactivation, and these results suggest that IE2 does not bind directly to specific elements in the opep-2 promoter.

  11. A Luciferase Gene Driven by an Alphaherpesviral Promoter Also Responds to Immediate Early Antigens of the Betaherpesvirus HCMV, Allowing Comparative Analyses of Different Human Herpesviruses in One Reporter Cell Line

    PubMed Central

    Villinger, Clarissa; Schubert, Axel; Walther, Paul; Sinzger, Christian; Lieber, Diana

    2017-01-01

    Widely used methods for quantification of human cytomegalovirus (HCMV) infection in cell culture such as immunoblotting or plaque reduction assays are generally restricted to low throughput and require time-consuming evaluation. Up to now, only few HCMV reporter cell lines have been generated to overcome these restrictions and they are afflicted with other limitations because permanently expandable cell lines are normally not fully permissive to HCMV. In this work, a previously existing epithelial cell line hosting a luciferase gene under control of a Varicella-zoster virus promoter was adopted to investigate HCMV infection. The cells were susceptible to different HCMV strains at infection efficiencies that corresponded to their respective degree of epithelial cell tropism. Expression of early and late viral antigens, formation of nuclear inclusions, release of infectious virus progeny, and focal growth indicated productive viral replication. However, viral release and spread occurred at lower levels than in primary cell lines which appears to be due to a malfunction of virion morphogenesis during the nuclear stage. Expression of the luciferase reporter gene was specifically induced in HCMV infected cultures as a function of the virus dose and dependent on viral immediate early gene expression. The level of reporter activity accurately reflected infection efficiencies as determined by viral antigen immunostaining, and hence could discriminate the cell tropism of the tested virus strains. As proof-of-principle, we demonstrate that this cell line is applicable to evaluate drug resistance of clinical HCMV isolates and the neutralization capacity of human sera, and that it allows comparative and simultaneous analysis of HCMV and human herpes simplex virus type 1. In summary, the permanent epithelial reporter cell line allows robust, rapid and objective quantitation of HCMV infection and it will be particularly useful in higher throughput analyses as well as in

  12. Inhibition of iridovirus protein synthesis and virus replication by antisense morpholino oligonucleotides targeted to the major capsid protein, the 18 kDa immediate-early protein, and a viral homolog of RNA polymerase II

    SciTech Connect

    Sample, Robert; Bryan, Locke; Long, Scott; Majji, Sai; Hoskins, Glenn; Sinning, Allan; Olivier, Jake; Chinchar, V. Gregory . E-mail: vchinchar@microbio.umsmed.edu

    2007-02-20

    Frog virus 3 (FV3) is a large DNA virus that encodes {approx} 100 proteins. Although the general features of FV3 replication are known, the specific roles that most viral proteins play in the virus life cycle have not yet been elucidated. To address the question of viral gene function, antisense morpholino oligonucleotides (asMOs) were used to transiently knock-down expression of specific viral genes and thus infer their role in virus replication. We designed asMOs directed against the major capsid protein (MCP), an 18 kDa immediate-early protein (18K) that was thought to be a viral regulatory protein, and the viral homologue of the largest subunit of RNA polymerase II (vPol-II{alpha}). All three asMOs successfully inhibited translation of the targeted protein, and two of the three asMOs resulted in marked phenotypic changes. Knock-down of the MCP resulted in a marked reduction in viral titer without a corresponding drop in the synthesis of other late viral proteins. Transmission electron microscopy (TEM) showed that in cells treated with the anti-MCP MO assembly sites were devoid of viral particles and contained numerous aberrant structures. In contrast, inhibition of 18K synthesis did not block virion formation, suggesting that the 18K protein was not essential for replication of FV3 in fathead minnow (FHM) cells. Finally, consistent with the view that late viral gene expression is catalyzed by a virus-encoded or virus-modified Pol-II-like protein, knock-down of vPol-II{alpha} triggered a global decline in late gene expression and virus yields without affecting the synthesis of early viral genes. Collectively, these results demonstrate the utility of using asMOs to elucidate the function of FV3 proteins.

  13. Nonrecurrent PMP22-RAI1 contiguous gene deletions arise from replication-based mechanisms and result in Smith-Magenis syndrome with evident peripheral neuropathy.

    PubMed

    Yuan, Bo; Neira, Juanita; Gu, Shen; Harel, Tamar; Liu, Pengfei; Briceño, Ignacio; Elsea, Sarah H; Gómez, Alberto; Potocki, Lorraine; Lupski, James R

    2016-10-01

    Hereditary neuropathy with liability to pressure palsies (HNPP) and Smith-Magenis syndrome (SMS) are genomic disorders associated with deletion copy number variants involving chromosome 17p12 and 17p11.2, respectively. Nonallelic homologous recombination (NAHR)-mediated recurrent deletions are responsible for the majority of HNPP and SMS cases; the rearrangement products encompass the key dosage-sensitive genes PMP22 and RAI1, respectively, and result in haploinsufficiency for these genes. Less frequently, nonrecurrent genomic rearrangements occur at this locus. Contiguous gene duplications encompassing both PMP22 and RAI1, i.e., PMP22-RAI1 duplications, have been investigated, and replication-based mechanisms rather than NAHR have been proposed for these rearrangements. In the current study, we report molecular and clinical characterizations of six subjects with the reciprocal phenomenon of deletions spanning both genes, i.e., PMP22-RAI1 deletions. Molecular studies utilizing high-resolution array comparative genomic hybridization and breakpoint junction sequencing identified mutational signatures that were suggestive of replication-based mechanisms. Systematic clinical studies revealed features consistent with SMS, including features of intellectual disability, speech and gross motor delays, behavioral problems and ocular abnormalities. Five out of six subjects presented clinical signs and/or objective electrophysiologic studies of peripheral neuropathy. Clinical profiling may improve the clinical management of this unique group of subjects, as the peripheral neuropathy can be more severe or of earlier onset as compared to SMS patients having the common recurrent deletion. Moreover, the current study, in combination with the previous report of PMP22-RAI1 duplications, contributes to the understanding of rare complex phenotypes involving multiple dosage-sensitive genes from a genetic mechanistic standpoint.

  14. A new case of interstitial 6q16.2 deletion in a patient with Prader-Willi-like phenotype and investigation of SIM1 gene deletion in 87 patients with syndromic obesity.

    PubMed

    Varela, Monica C; Simões-Sato, Alex Y; Kim, Chong A; Bertola, Débora R; De Castro, Claudia I E; Koiffmann, Celia P

    2006-01-01

    The association of obesity, phenotypic abnormalities and mental retardation characterizes syndromic obesity. Its most common form is the Prader-Willi syndrome (PWS-- neonatal hypotonia, poor sucking, delayed psychomotor development, hyperphagia, severe obesity, short stature, small hands and feet, hypogonadism, mild to moderate mental retardation and behavioral disorders). A PWS-like phenotype has been described in patients with chromosome abnormalities involving the chromosome region 6q16.2 that includes the SIM1 gene. Herein we report cytogenetic and gene studies including a screening for the SIM1 gene deletion, performed on 87 patients with PWS-like phenotype, and describe the fifth case of syndromic obesity with an interstitial deletion of the chromosome segment 6q16-q21 and suggest that mutational analysis and further studies of the parental origin of chromosome alterations of 6q16.2 in patients with and without PWS-like phenotype are needed to evaluate possible imprinting effects of SIM1 gene and establish the contribution that alterations in this gene makes to the etiology of syndromic and non-syndromic obesity.

  15. A mouse gene (Dgcr6) related to the Drosophila gonadal gene is expressed in early embryogenesis and is the homolog of a human gene deleted in DiGeorge syndrome.

    PubMed

    Lindsay, E A; Baldini, A

    1997-01-01

    We report the identification of a mouse gene, Dgcr6, which shows high sequence similarity to gonadal (gdl), a Drosophila gene of unknown function. Dgcr6 is the mouse homolog of human DGCR6, previously shown to be deleted in DiGeorge syndrome, a developmental field defect affecting the derivatives of the pharyngeal arches which is associated with 22q11.2 deletions. The Dgcr6 transcript has a 594 nucleotide open reading frame (ORF) encoding 198 amino acids. We previously mapped Dgcr6 to mouse chromosome 16B1-B3, a region known to contain other mouse homologs of genes deleted in DiGeorge syndrome. Expression studies were performed by Northern blotting analysis on mouse embryo and adult tissues and by RNA in situ hybridization on mouse embryo sections. Results show that Dgcr6 transcripts are abundant during mouse embryogenesis, from at least 7 days post coitum. In particular, high expression was detected in the brain, spinal cord and pharyngeal arches. On adult tissues high expression was detected in testis. The function of Dgcr6 is to be determined, but its developmental expression suggests that this gene may play a role in the developmental defects associated with 22q11.2 deletions.

  16. ES2, a gene deleted in DiGeorge syndrome, encodes a nuclear protein and is expressed during early mouse development, where it shares an expression domain with a Goosecoid-like gene.

    PubMed

    Lindsay, E A; Harvey, E L; Scambler, P J; Baldini, A

    1998-04-01

    ES2 is a gene deleted in DiGeorge syndrome (DGS) and velocardiofacial syndrome (VCFS) which has homologs in species as distant as Caenorhabditis elegans and Drosophila . The function of ES2 is unknown, and the predicted protein sequence does not contain motifs which suggest a particular role in the developmental defects present in DGS and VCFS. Here we show that the mouse homolog, Es2 , is transcribed in two forms resulting from the use of alternative polyadenylation signals. Structural analysis programs predict that the Es2 -encoded peptide has a coiled-coil domain, and transfection experiments with an Es2 -green fluorescent protein (GFP) fusion construct show that the peptide is recruited into the nucleus. Es2 is highly expressed during mouse embryogenesis from E7 onwards. In situ hybridization with an RNA probe revealed that the gene is widely expressed; however, relatively higher expression was detected in the nervous system, with a particularly high area of expression in a sub-region of the pons. The Es2 expression domain in the pons is shared with a Goosecoid-like gene ( Gscl) which is located upstream of Es2 , and raises the possibility that the two genes share regulatory elements and/or interact in this region of the developing brain. This finding suggests that different genes in the deleted region may be functionally related and might explain the occurrence of the characteristic phenotype in patients with non-overlapping genetic lesions.

  17. The human analog of murine cystein rich protein 61 [correction of 16] is a 1alpha,25-dihydroxyvitamin D3 responsive immediate early gene in human fetal osteoblasts: regulation by cytokines, growth factors, and serum.

    PubMed

    Schütze, N; Lechner, A; Groll, C; Siggelkow, H; Hüfner, M; Köhrle, J; Jakob, F

    1998-04-01

    1Alpha,25-dihydroxyvitamin D3 (1,25-(OH)2D3) is a potent mediator of differentiation and maintenance of specific functions of osteoblasts. To detect novel targets for 1,25-(OH)2D3 action, we applied differential display PCR to human fetal osteoblast-like cells and identified the human analog of murine cystein rich protein 61 (hCYR61) as a 1,25-(OH)2D3-responsive immediate early gene in differentiated fetal osteoblast-like cells. The murine gene CYR61 is important for cell-cell and cell-matrix interactions, and it belongs to an emerging gene family of cysteine-rich proteins. hCYR61 messenger RNA (mRNA) steady-state levels were stimulated 11-fold by 10 nM 1,25-(OH)2D3 by 1 h and declined to control levels by 4 h. This transient stimulation of hCYR61 mRNA was not inhibited by cycloheximide but was prevented by actinomycin D, indicating that the 1,25-(OH)2D3 effect involves transcriptional events and does not require de novo protein synthesis. hCYR61 mRNA stability was not influenced by 1,25(OH)2D3, whereas cycloheximide treatment stabilized hCYR61 mRNA. FCS, as well as growth factors and cytokines such as basic fibroblast growth factor, epidermal growth factor, tumor necrosis factor alpha, and interleukin-1, strongly elevated hCYR61 mRNA steady-state levels within 1 h. hCYR61 mRNA was expressed also in primary human osteoblasts and osteosarcoma cell lines. Using a commercial tissue blot, hCYR61 mRNA was only observed in skeletal muscle. The fast and transient response of hCYR 61 to 1,25-(OH)2D3, serum, growth factors, and cytokines suggests an important role of hCYR61 for osteoblast function and differentiation.

  18. Extracellular-signal regulated kinase (Erk1/2), mitogen-activated protein kinase-activated protein kinase 2 (MK2) and tristetraprolin (TTP) comprehensively regulate injury-induced immediate early gene (IEG) response in in vitro liver organ culture.

    PubMed

    Tran, Doan Duy Hai; Koch, Alexandra; Saran, Shashank; Armbrecht, Marcel; Ewald, Florian; Koch, Martina; Wahlicht, Tom; Wirth, Dagmar; Braun, Armin; Nashan, Björn; Gaestel, Matthias; Tamura, Teruko

    2016-05-01

    Differentiated hepatocytes are long-lived and normally do not undergo cell division, however they have the unique capacity to autonomously decide their replication fate after liver injury. In this context, the key players of liver regeneration immediately after injury have not been adequately studied. Using an in vitro liver culture system, we show that after liver injury, p38 mitogen-activated protein kinase (p38MAPK), mitogen-activated protein kinase-activated protein kinase 2 (MK2) and extracellular-signal regulated kinase (Erk)1/2 were activated within 15 min and continued to be phosphorylated for more than 2h. Both p38MAPK and Erk1/2 were activated at the edge of the cut as well as on the liver surface where the mesothelial cell sheet expresses several cytokines. Notably, in human liver Erk1/2 was also activated under the mesothelial cell sheet shortly after liver resections. Furthermore, in in vitro liver slice culture immediate early genes (IEGs) were upregulated within 1-2 h and the S phase marker proliferation-cell-nuclear-antigen (PCNA) appeared 24 h after injury. Although Erk1/2 was activated after injury, in MK2 depleted liver a set of IEGs, such as Dusp1, Cox2, or c-Myc and proliferation marker gene Ki67 were not induced. In addition, in immortalized hepatocyte cells, THLE-2, the same subset of genes was upregulated upon stimulation with lipopolysaccharide (LPS), but not in the presence of MK2 inhibitor. The protein level of tristetraprolin (TTP), a substrate for MK2 that plays a role in mRNA degradation, was increased in the presence of MK2 inhibitor. In this context, the depletion of TTP gene rescued Dusp1, Cox2, or c-Myc upregulation in the presence of MK2 inhibitor. These data imply that MK2 pathway is positively involved in Erk1/2 induced IEG response after liver injury. These data also suggest that in vitro liver culture may be a useful tool for measuring the proliferation potential of hepatocytes in individual liver.

  19. mdv1-miR-M7-5p, located in the newly identified first intron of the latency-associated transcript of Marek's disease virus, targets the immediate-early genes ICP4 and ICP27.

    PubMed

    Strassheim, S; Stik, G; Rasschaert, D; Laurent, S

    2012-08-01

    Marek's disease virus serotype 1 (MDV-1) is an oncogenic alphaherpesvirus causing fatal T-cell lymphoma in chickens. MDV latency is characterized by the production of latency-associated transcripts (LATs), a family of non-protein-coding spliced RNAs. A cluster of four microRNAs (cluster mdv1-miR-M8-M10) was identified, but not formally mapped, at the predicted LAT 5' end. We established a LAT cDNA library from latently MDV-infected cell line MSB-1. We identified 22 highly variable LATs, which were due to the extensive alternative splicing of a total of 14 introns. RACE PCR confirmed the predicted 3' end and allowed identification of the 5' end, 400 nt upstream of the previously predicted LAT end. The LATs share their transcription start site with the microRNA-expressing transcript described previously, localizing the microRNAs to the first LAT intron and identifying the LATs as the primary transcripts of the microRNAs. We identified MDV immediate-early (IE) genes ICP4 and ICP27 as putative targets of mdv1-miR-M7-5p, the third microRNA of the cluster mdv1-miR-M8-M10. Endogenously expressed mdv1-miR-M7-5p in MSB-1 cells reduced luciferase activity significantly when microRNA-responsive elements from ICP4 or ICP27 were cloned in the 3' UTR of the firefly luciferase gene. ICP27 protein levels were decreased by 70 % when the mdv1-miR-M7-5p precursor was co-expressed with an ICP27 expression plasmid. Additionally, we showed a negative correlation between the decreased expression of mdv1-miR-M7-5p and an increase in ICP27 expression during virus reactivation. Our results suggest that, by targeting two IE genes, MDV microRNAs produced from LAT transcripts may contribute to establish and/or maintain latency.

  20. Detection of phase-dependent transcriptomic changes and Rubisco-mediated CO2 fixation into poly (3-hydroxybutyrate) under heterotrophic condition in Ralstonia eutropha H16 based on RNA-seq and gene deletion analyses

    PubMed Central

    2013-01-01

    Background Ralstonia eutropha H16 is well known to produce polyhydroxyalkanoates (PHAs), which are potential bio-based biodegradable plastics, in an efficient manner as an energy storage material under unbalanced growth conditions. To obtain further knowledge of PHA biosynthesis, this study performed a quantitative transcriptome analysis based on deep sequencing of the complementary DNA generated from the RNA (RNA-seq) of R. eutropha H16. Results Total RNAs were extracted from R. eutropha cells in growth, PHA production, and stationary phases on fructose. rRNAs in the preparation were removed by repeated treatments with magnetic beads specific to bacterial rRNAs, and then the 36 bp sequences were determined using an Illumina high-throughput sequencer. The RNA-seq results indicated the induction of gene expression for transcription, translation, cell division, peptidoglycan biosynthesis, pilus and flagella assembly, energy conservation, and fatty acid biosynthesis in the growth phase; and the repression trends of genes involved in central metabolisms in the PHA production phase. Interestingly, the transcription of genes for Calvin-Benson-Bassham (CBB) cycle and several genes for β-oxidation were significantly induced in the PHA production phase even when the cells were grown on fructose. Moreover, incorporation of 13C was observed in poly(3-hydroxybutyrate) synthesized by R. eutropha H16 from fructose in the presence of NaH13CO3, and further gene deletion analyses revealed that both of the two ribulose 1,5-bisphosphate carboxylase (Rubiscos) in CBB cycle were actually functional in CO2 fixation under the heterotrophic condition. Conclusions The results revealed the phase-dependent transcriptomic changes and a CO2 fixation capability under heterotrophic conditions by PHA-producing R. eutropha. PMID:23879744

  1. Two Polypyrimidine Tracts in Intron 4 of the Major Immediate Early Gene Are Critical for Gene Expression Switching from IE1 to IE2 and for Replication of Human Cytomegalovirus

    PubMed Central

    Hou, Wangheng; Torres, Lilith; Cruz-Cosme, Ruth; Arroyo, Fernando; Irizarry, Luis; Luciano, Dalia; Márquez, Arturo; Rivera, Leslie L.; Sala, Antonio L.; Luo, Min-hua

    2016-01-01

    ABSTRACT The human cytomegalovirus (HCMV) major immediate early (MIE) gene is essential for viral replication. The most abundant products encoded by the MIE gene include IE1 and IE2. Genes of IE1 and IE2 share the MIE promoter (MIEP), the first 3 exons, and the first 2 introns. IE1 is expressed earlier than IE2 after CMV infection or MIE gene transfection. In this study, we identified 2 polypyrimidine (Py) tracts in intron 4 (between exons 4 and 5) that are responsible for transcriptional switching from IE1 to IE2. The first Py is important and the second one is essential for the splicing and expression of IE2. In searching for the mechanisms of MIE gene switching from IE1 to IE2, we found that the second Py was required for the IE2's fourth intron to bind to a splicing factor such as U2AF65, as determined by an RNA electrophoretic mobility shift assay and a chromatin immunoprecipitation (ChIP) assay, while the first Py enhanced the binding of U2AF65 with the intron. An HCMV BACmid with the second Py mutated failed to produce any virus, while the HCMV with the first Py mutated replicated with a defective phenotype. Furthermore, we designed a small RNA (scRNAPy) that is complementary to the intron RNA covering the two Pys. The scRNAPy interfered with the interaction of U2AF65 with the intron and repressed the IE2 expression. Therefore, our studies implied that IE2 gene splicing might be an anti-CMV target. IMPORTANCE CMV is a ubiquitous herpesvirus and a significant cause of disease and death in the immunocompromised and elderly. Insights into its gene regulation will provide clues in designing anti-CMV strategies. The MIE gene is one of the earliest genes of CMV and is essential for CMV replication. It is known that the MIE gene needs to be spliced to produce more than two proteins; however, how MIE gene splicing is regulated remains elusive. In the present studies, we identified two Pys in intron 4 and found that the first Py is important and the second is

  2. Single gene deletions of mrpA to mrpG and mrpE point mutations affect activity of the Mrp Na+/H+ antiporter of alkaliphilic Bacillus and formation of hetero-oligomeric Mrp complexes.

    PubMed

    Morino, Masato; Natsui, Shinsuke; Swartz, Talia H; Krulwich, Terry A; Ito, Masahiro

    2008-06-01

    Mrp antiporters catalyze secondary Na(+)(Li(+))/H(+) antiport and/or K(+)/H(+) antiport that is physiologically important in diverse bacteria. An additional capacity for anion flux has been observed for a few systems. Mrp is unique among antiporters in that it requires all six or seven hydrophobic gene products (MrpA to MrpG) of the mrp operon for full antiporter activity, but MrpE has been reported to be dispensable. Here, the membrane complexes formed by Mrp proteins were examined using a cloned mrp operon from alkaliphilic Bacillus pseudofirmus OF4. The operon was engineered so that the seven Mrp proteins could be detected in single samples. Membrane extracts of an antiporter-deficient Escherichia coli strain expressing this construct were analyzed by blue native-sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Mrp complexes of two sizes were identified containing all seven Mrp proteins. Studies of the single nonpolar mrp gene deletions in the construct showed that a subcomplex of MrpA, MrpB, MrpC, and MrpD was formed in the absence of MrpE, MrpF, or MrpG. By contrast, MrpE, MrpF, and MrpG were not observed in membranes lacking MrpA, MrpB, MrpC, or MrpD. Although MrpA and MrpD have been hypothesized to be the antiporter proteins, the MrpA-to-D complex was inactive. Every Mrp protein was required for an activity level near that of the wild-type Na(+)/H(+) antiporter, but a very low activity level was observed in the absence of MrpE. The introduction of an MrpE(P114G) mutation into the full Mrp complex led to antiport activity with a greatly increased apparent K(m) value for Na(+). The results suggested that interactions among the proteins of heterooligomeric Mrp complexes strongly impact antiporter properties.

  3. 3-Hydroxy-3-methylglutaryl CoA lyase (HL): Mouse and human HL gene (HMGCL) cloning and detection of large gene deletions in two unrelated HL-deficient patients

    SciTech Connect

    Wang, S.P.; Robert, M.F.; Mitchell, G.A.

    1996-04-01

    3-hydroxy-3-methylglutaryl CoA lyase (HL, EC 4.1.3.4) catalyzes the cleavage of 3-hydroxy-3-methylglutaryl CoA to acetoacetic acid and acetyl CoA, the final reaction of both ketogenesis and leucine catabolism. Autosomal-recessive HL deficiency in humans results in episodes of hypoketotic hypoglycemia and coma. Using a mouse HL cDNA as a probe, we isolated a clone containing the full-length mouse HL gene that spans about 15 kb of mouse chromosome 4 and contains nine exons. The promoter region of the mouse HL gene contains elements characteristic of a housekeeping gene: a CpG island containing multiple Sp1 binding sites surrounds exon 1, and neither a TATA nor a CAAT box are present. We identified multiple transcription start sites in the mouse HL gene, 35 to 9 bases upstream of the translation start codon. We also isolated two human HL genomic clones that include HL exons 2 to 9 within 18 kb. The mouse and human HL genes (HGMW-approved symbol HMGCL) are highly homologous, with identical locations of intron-exon junctions. By genomic Southern blot analysis and exonic PCR, was found 2 of 33 HL-deficient probands to be homozygous for large deletions in the HL gene. 26 refs., 4 figs., 2 tabs.

  4. PHLPP1 gene deletion protects the brain from ischemic injury

    PubMed Central

    Chen, Bo; Van Winkle, Jessica A; Lyden, Patrick D; Brown, Joan H; Purcell, Nicole H

    2013-01-01

    A recently discovered protein phosphatase PHLPP (PH domain Leucine-rich repeat Protein Phosphatase) has been shown to dephosphorylate Akt on its hydrophobic motif (Ser473) thereby decreasing Akt kinase activity. We generated PHLPP1 knockout (KO) mice and used them to explore the ability of enhanced in vivo Akt signaling to protect the brain against ischemic insult. Brains from KO mice subjected to middle cerebral artery occlusion (MCAO) for 2 hours showed significantly greater increases in Akt activity and less neurovascular damage after reperfusion than wild-type (WT) mice. Remarkably, infarct volume in the PHLPP1 KO was significantly reduced compared with WT (12.7±2.7% versus 22.9±3.1%) and this was prevented by Akt inhibition. Astrocytes from KO mice and neurons in which PHLPP1 was downregulated showed enhanced Akt activation and diminished cell death in response to oxygen-glucose deprivation. Thus, deletion of PHLPP1 can enhance Akt activation in neurons and astrocytes, and can significantly increase cell survival and diminish infarct size after MCAO. Inhibition of PHLPP could be a therapeutic approach to minimize damage after focal ischemia. PMID:23072745

  5. Gene deletion in an Italian haemophilia B subject.

    PubMed Central

    Bernardi, F; del Senno, L; Barbieri, R; Buzzoni, D; Gambari, R; Marchetti, G; Conconi, F; Panicucci, F; Positano, M; Pitruzzello, S

    1985-01-01

    DNA from 20 Italian haemophilia B patients was analysed by the Southern blotting technique and hybridisation to a factor IX cDNA probe. A large deletion of factor IX gene was detected in one patient with antibodies to the infused factor; the EcoRI pattern of the other 19 subjects examined was normal. Images PMID:4045960

  6. Gene Deletion in Barley Mediated by LTR-retrotransposon BARE

    PubMed Central

    Shang, Yi; Yang, Fei; Schulman, Alan H.; Zhu, Jinghuan; Jia, Yong; Wang, Junmei; Zhang, Xiao-Qi; Jia, Qiaojun; Hua, Wei; Yang, Jianming; Li, Chengdao

    2017-01-01

    A poly-row branched spike (prbs) barley mutant was obtained from soaking a two-rowed barley inflorescence in a solution of maize genomic DNA. Positional cloning and sequencing demonstrated that the prbs mutant resulted from a 28 kb deletion including the inflorescence architecture gene HvRA2. Sequence annotation revealed that the HvRA2 gene is flanked by two LTR (long terminal repeat) retrotransposons (BARE) sharing 89% sequence identity. A recombination between the integrase (IN) gene regions of the two BARE copies resulted in the formation of an intact BARE and loss of HvRA2. No maize DNA was detected in the recombination region although the flanking sequences of HvRA2 gene showed over 73% of sequence identity with repetitive sequences on 10 maize chromosomes. It is still unknown whether the interaction of retrotransposons between barley and maize has resulted in the recombination observed in the present study. PMID:28252053

  7. Multiple Sclerosis

    MedlinePlus

    Multiple sclerosis Overview By Mayo Clinic Staff Multiple sclerosis (MS) is a potentially disabling disease of the brain and spinal cord (central nervous system). In MS, the immune system attacks the protective ...

  8. Multiple Sclerosis

    MedlinePlus

    Multiple sclerosis (MS) is a nervous system disease that affects your brain and spinal cord. It damages the ... attacks healthy cells in your body by mistake. Multiple sclerosis affects women more than men. It often begins ...

  9. Multiple myeloma

    MedlinePlus

    Plasma cell dyscrasia; Plasma cell myeloma; Malignant plasmacytoma; Plasmacytoma of bone; Myeloma - multiple ... Multiple myeloma most commonly causes: Low red blood cell count ( anemia ), which can lead to fatigue and ...

  10. The first Korean patient with Potocki-Shaffer syndrome: a rare cause of multiple exostoses.

    PubMed

    Sohn, Young Bae; Yim, Shin-Young; Cho, Eun-Hae; Kim, Ok-Hwa

    2015-02-01

    Potocki-Shaffer syndrome (PSS, OMIM #601224) is a rare contiguous gene deletion syndrome caused by haploinsufficiency of genes located on the 11p11.2p12. Affected individuals have a number of characteristic features including multiple exostoses, biparietal foramina, abnormalities of genitourinary system, hypotonia, developmental delay, and intellectual disability. We report here on the first Korean case of an 8-yr-old boy with PSS diagnosed by high resolution microarray. Initial evaluation was done at age 6 months because of a history of developmental delay, hypotonia, and dysmorphic face. Coronal craniosynostosis and enlarged parietal foramina were found on skull radiographs. At age 6 yr, he had severe global developmental delay. Multiple exostoses of long bones were detected during a radiological check-up. Based on the clinical and radiological features, PSS was highly suspected. Subsequently, chromosomal microarray analysis identified an 8.6 Mb deletion at 11p11.2 [arr 11p12p11.2 (Chr11:39,204,770-47,791,278)×1]. The patient continued rehabilitation therapy for profound developmental delay. The progression of multiple exostosis has being monitored. This case confirms and extends data on the genetic basis of PSS. In clinical and radiologic aspect, a patient with multiple exostoses accompanying with syndromic features, including craniofacial abnormalities and mental retardation, the diagnosis of PSS should be considered.

  11. Multiplicity Counting

    SciTech Connect

    Geist, William H.

    2015-12-01

    This set of slides begins by giving background and a review of neutron counting; three attributes of a verification item are discussed: 240Pueff mass; α, the ratio of (α,n) neutrons to spontaneous fission neutrons; and leakage multiplication. It then takes up neutron detector systems – theory & concepts (coincidence counting, moderation, die-away time); detector systems – some important details (deadtime, corrections); introduction to multiplicity counting; multiplicity electronics and example distributions; singles, doubles, and triples from measured multiplicity distributions; and the point model: multiplicity mathematics.

  12. Multiple myeloma.

    PubMed

    Peller, Patrick J

    2015-04-01

    This article presents a review of multiple myeloma, precursor states, and related plasma cell disorders. The clinical roles of fluorodeoxyglucose PET/computed tomography (CT) and the potential to improve the management of patients with multiple myeloma are discussed. The clinical and research data supporting the utility of PET/CT use in evaluating myeloma and other plasma cell dyscrasias continues to grow.

  13. Variation in Fumonisin and Ochratoxin Production Associated with Differences in Biosynthetic Gene Content in Aspergillus niger and A. welwitschiae Isolates from Multiple Crop and Geographic Origins

    PubMed Central

    Susca, Antonia; Proctor, Robert H.; Morelli, Massimiliano; Haidukowski, Miriam; Gallo, Antonia; Logrieco, Antonio F.; Moretti, Antonio

    2016-01-01

    The fungi Aspergillus niger and A. welwitschiae are morphologically indistinguishable species used for industrial fermentation and for food and beverage production. The fungi also occur widely on food crops. Concerns about their safety have arisen with the discovery that some isolates of both species produce fumonisin (FB) and ochratoxin A (OTA) mycotoxins. Here, we examined FB and OTA production as well as the presence of genes responsible for synthesis of the mycotoxins in a collection of 92 A. niger/A. welwitschiae isolates from multiple crop and geographic origins. The results indicate that (i) isolates of both species differed in ability to produce the mycotoxins; (ii) FB-nonproducing isolates of A. niger had an intact fumonisin biosynthetic gene (fum) cluster; (iii) FB-nonproducing isolates of A. welwitschiae exhibited multiple patterns of fum gene deletion; and (iv) OTA-nonproducing isolates of both species lacked the ochratoxin A biosynthetic gene (ota) cluster. Analysis of genome sequence data revealed a single pattern of ota gene deletion in the two species. Phylogenetic analysis suggest that the simplest explanation for this is that ota cluster deletion occurred in a common ancestor of A. niger and A. welwitschiae, and subsequently both the intact and deleted cluster were retained as alternate alleles during divergence of the ancestor into descendent species. Finally, comparison of results from this and previous studies indicate that a majority of A. niger isolates and a minority of A. welwitschiae isolates can produce FBs, whereas, a minority of isolates of both species produce OTA. The comparison also suggested that the relative abundance of each species and frequency of FB/OTA-producing isolates can vary with crop and/or geographic origin. PMID:27667988

  14. Parenting Multiples

    MedlinePlus

    ... parents. It's important for caretakers to spend time speaking directly to each child, as well as reading to them and encouraging language. Social skills can come earlier for multiples, simply because they' ...

  15. [Multiple meningiomas].

    PubMed

    Terrier, L-M; François, P

    2016-06-01

    Multiple meningiomas (MMs) or meningiomatosis are defined by the presence of at least 2 lesions that appear simultaneously or not, at different intracranial locations, without the association of neurofibromatosis. They present 1-9 % of meningiomas with a female predominance. The occurrence of multiple meningiomas is not clear. There are 2 main hypotheses for their development, one that supports the independent evolution of these tumors and the other, completely opposite, that suggests the propagation of tumor cells of a unique clone transformation, through cerebrospinal fluid. NF2 gene mutation is an important intrinsic risk factor in the etiology of multiple meningiomas and some exogenous risk factors have been suspected but only ionizing radiation exposure has been proven. These tumors can grow anywhere in the skull but they are more frequently observed in supratentorial locations. Their histologic types are similar to unique meningiomas of psammomatous, fibroblastic, meningothelial or transitional type and in most cases are benign tumors. The prognosis of these tumors is eventually good and does not differ from the unique tumors except for the cases of radiation-induced multiple meningiomas, in the context of NF2 or when diagnosed in children where the outcome is less favorable. Each meningioma lesion should be dealt with individually and their multiple character should not justify their resection at all costs.

  16. Finger Multiplication

    ERIC Educational Resources Information Center

    Holmes, Bill

    2010-01-01

    The author has been prompted to write this article about finger multiplication for a number of reasons. Firstly there are a number of related articles in past issues of "Mathematics Teaching" ("MT") which have connections to this algorithm. Secondly, very few of his primary teaching students and professional colleagues appear to be aware of the…

  17. Multiple Sclerosis.

    ERIC Educational Resources Information Center

    Plummer, Nancy; Michael, Nancy, Ed.

    This module on multiple sclerosis is intended for use in inservice or continuing education programs for persons who administer medications in long-term care facilities. Instructor information, including teaching suggestions, and a listing of recommended audiovisual materials and their sources appear first. The module goal and objectives are then…

  18. Multiple Intelligences.

    ERIC Educational Resources Information Center

    Laughlin, Janet

    1999-01-01

    Details the characteristics of Howard Gardner's seven multiple intelligences (MI): linguistic, logical-mathematical, bodily-kinesthetic, spatial, musical, interpersonal, and intrapersonal. Discusses the implications of MI for instruction. Explores how students can study using their preferred learning style - visual, auditory, and physical study…

  19. Multiple sclerosis.

    PubMed

    Files, Daniel Kane; Jausurawong, Tani; Katrajian, Ruba; Danoff, Robert

    2015-06-01

    Multiple sclerosis (MS) is a chronic, debilitating disease that can have devastating effects. Presentation varies widely in symptoms, pace, and progression. In addition to a thorough history and physical examination, diagnostic tools required to diagnose MS and exclude other diagnoses include MRI, evoked potential testing, and cerebrospinal fluid analysis. Although the disease is not curable presently, quality of life can be improved by minimizing the frequency and severity of disease burden. Disease modification, symptom management, preservation of function, and treatment of psychosocial issues are paramount to enhance the quality of life for the patient affected with MS.

  20. Multiple myeloma

    PubMed Central

    Rajkumar, S. Vincent

    2008-01-01

    Multiple myeloma is a clonal plasma cell malignancy that accounts for slightly more than 10% of all hematologic cancers. In this paper, we present a historically focused review of the disease, from the description of the first case in 1844 to the present. The evolution of drug therapy and stem-cell transplantation for the treatment of myeloma, as well as the development of new agents, is discussed. We also provide an update on current concepts of diagnosis and therapy, with an emphasis on how treatments have emerged from a historical perspective after certain important discoveries and the results of experimental studies. PMID:18332230

  1. Multiple Inflation

    NASA Astrophysics Data System (ADS)

    Murphy, Philip Joseph

    1987-09-01

    The Theory of Inflation, namely, that at some point the entropy content of the universe was greatly increased, has much promise. It may solve the puzzles of homogeneity and the creation of structure. However, no particle physics model has yet been found that can successfully drive inflation. The difficulty in satisfying the constraint that the isotropy of the microwave background places on the effective potential of prospective models is immense. In this work we have codified the requirements of such models in a most general form. We have carefully calculated the amounts of inflation the various problems of the Standard Model need for their solution. We have derived a completely model independent upper bound on the inflationary Hubble parameter. We have developed a general notation with which to probe the possibilities of Multiple Inflation. We have shown that only in very unlikely circumstances will any evidence of an earlier inflation, survive the de Sitter period of its successor. In particular, it is demonstrated that it is most unlikely that two bouts of inflation will yield high amplitudes of density perturbations on small scales and low amplitudes on large. We conclude that, while multiple inflation will be of great theoretical interest, it is unlikely to have any observational impact.

  2. Sustained transcription of the immediate early gene Arc in the dentate gyrus after spatial exploration.

    PubMed

    Ramirez-Amaya, Victor; Angulo-Perkins, Arafat; Chawla, Monica K; Barnes, Carol A; Rosi, Susanna

    2013-01-23

    After spatial exploration in rats, Arc mRNA is expressed in ∼2% of dentate gyrus (DG) granule cells, and this proportion of Arc-positive neurons remains stable for ∼8 h. This long-term presence of Arc mRNA following behavior is not observed in hippocampal CA1 pyramidal cells. We report here that in rats ∼50% of granule cells with cytoplasmic Arc mRNA, induced some hours previously during exploration, also show Arc expression in the nucleus. This suggests that recent transcription can occur long after the exploration behavior that elicited it. To confirm that the delayed nuclear Arc expression was indeed recent transcription, Actinomycin D was administered immediately after exploration. This treatment resulted in inhibition of recent Arc expression both when evaluated shortly after exploratory behavior as well as after longer time intervals. Together, these data demonstrate a unique kinetic profile for Arc transcription in hippocampal granule neurons following behavior that is not observed in other cell types. Among a number of possibilities, this sustained transcription may provide a mechanism that ensures that the synaptic connection weights in the sparse population of granule cells recruited during a given behavioral event are able to be modified.

  3. Water deprivation-induced sodium appetite: humoral and cardiovascular mediators and immediate early genes.

    PubMed

    De Luca, Laurival A; Xu, Zhice; Schoorlemmer, Guus H M; Thunhorst, Robert L; Beltz, Terry G; Menani, José V; Johnson, Alan Kim

    2002-02-01

    Adult rats deprived of water for 24-30 h were allowed to rehydrate by ingesting only water for 1-2 h. Rats were then given access to both water and 1.8% NaCl. This procedure induced a sodium appetite defined by the operational criteria of a significant increase in 1.8% NaCl intake (3.8 +/- 0.8 ml/2 h; n = 6). Expression of Fos (as assessed by immunohistochemistry) was increased in the organum vasculosum of the lamina terminalis (OVLT), median preoptic nucleus (MnPO), subfornical organ (SFO), and supraoptic nucleus (SON) after water deprivation. After rehydration with water but before consumption of 1.8% NaCl, Fos expression in the SON disappeared and was partially reduced in the OVLT and MnPO. However, Fos expression did not change in the SFO. Water deprivation also 1) increased plasma renin activity (PRA), osmolality, and plasma Na+; 2) decreased blood volume; and 3) reduced total body Na+; but 4) did not alter arterial blood pressure. Rehydration with water alone caused only plasma osmolality and plasma Na+ concentration to revert to euhydrated levels. The changes in Fos expression and PRA are consistent with a proposed role for ANG II in the control of the sodium appetite produced by water deprivation followed by rehydration with only water.

  4. LSD1 modulates stress-evoked transcription of immediate early genes and emotional behavior

    PubMed Central

    Rusconi, Francesco; Grillo, Barbara; Ponzoni, Luisa; Bassani, Silvia; Toffolo, Emanuela; Paganini, Leda; Mallei, Alessandra; Braida, Daniela; Passafaro, Maria; Popoli, Maurizio; Sala, Mariaelvina; Battaglioli, Elena

    2016-01-01

    Behavioral changes in response to stressful stimuli can be controlled via adaptive epigenetic changes in neuronal gene expression. Here we indicate a role for the transcriptional corepressor Lysine-Specific Demethylase 1 (LSD1) and its dominant-negative splicing isoform neuroLSD1, in the modulation of emotional behavior. In mouse hippocampus, we show that LSD1 and neuroLSD1 can interact with transcription factor serum response factor (SRF) and set the chromatin state of SRF-targeted genes early growth response 1 (egr1) and c-fos. Deletion or reduction of neuroLSD1 in mutant mice translates into decreased levels of activating histone marks at egr1 and c-fos promoters, dampening their psychosocial stress-induced transcription and resulting in low anxiety-like behavior. Administration of suberoylanilide hydroxamine to neuroLSD1KO mice reactivates egr1 and c-fos transcription and restores the behavioral phenotype. These findings indicate that LSD1 is a molecular transducer of stressful stimuli as well as a stress-response modifier. Indeed, LSD1 expression itself is increased acutely at both the transcriptional and splicing levels by psychosocial stress, suggesting that LSD1 is involved in the adaptive response to stress. PMID:26976584

  5. Immediate early responses of avian tracheal epithelial cells to infection with highly pathogenic avian influenza

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Highly pathogenic (HP) avian influenza viruses (AIV) present an on going threat to the U.S. poultry industry. In order to develop new AIV control strategies it is necessary to understand the underlying mechanism of viral infection. Because the early events of AIV infection can occur on tracheal ep...

  6. Immediate early responses of avian tracheal epithelial cells to infection with highly pathogenic avian invluenza virus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Highly pathogenic (HP) avian influenza viruses (AIV) present an ongoing threat to the world poultry industry. In order to develop new AIV control strategies it is necessary to understand the underlying mechanism of viral infection at mucosal respiratory sites. Chicken and duck tracheal epithelial ...

  7. Water deprivation-induced sodium appetite: humoral and cardiovascular mediators and immediate early genes

    NASA Technical Reports Server (NTRS)

    De Luca, Laurival A Jr; Xu, Zhice; Schoorlemmer, Guus H M.; Thunhorst, Robert L.; Beltz, Terry G.; Menani, Jose V.; Johnson, Alan Kim

    2002-01-01

    Adult rats deprived of water for 24-30 h were allowed to rehydrate by ingesting only water for 1-2 h. Rats were then given access to both water and 1.8% NaCl. This procedure induced a sodium appetite defined by the operational criteria of a significant increase in 1.8% NaCl intake (3.8 +/- 0.8 ml/2 h; n = 6). Expression of Fos (as assessed by immunohistochemistry) was increased in the organum vasculosum of the lamina terminalis (OVLT), median preoptic nucleus (MnPO), subfornical organ (SFO), and supraoptic nucleus (SON) after water deprivation. After rehydration with water but before consumption of 1.8% NaCl, Fos expression in the SON disappeared and was partially reduced in the OVLT and MnPO. However, Fos expression did not change in the SFO. Water deprivation also 1) increased plasma renin activity (PRA), osmolality, and plasma Na+; 2) decreased blood volume; and 3) reduced total body Na+; but 4) did not alter arterial blood pressure. Rehydration with water alone caused only plasma osmolality and plasma Na+ concentration to revert to euhydrated levels. The changes in Fos expression and PRA are consistent with a proposed role for ANG II in the control of the sodium appetite produced by water deprivation followed by rehydration with only water.

  8. Immediate, Early, and Conventional Implant Placement in a Patient with History of Periodontitis

    PubMed Central

    Lanza, Alessandro; Scognamiglio, Fabio; Femiano, Felice; Lanza, Michele

    2015-01-01

    The aim of this paper is to describe a case of implant-prosthetic rehabilitation in a patient with periodontitis, focusing on the different timing of implant placement. After initial periodontal treatment, teeth with advanced mobility degree and severe bone resorption were extracted. At different healing time oral implants were placed in a prosthetic-guided position. After osseointegration period the implants were loaded and the results at one year of follow-up are presented. PMID:25949833

  9. Immediate, early, and conventional implant placement in a patient with history of periodontitis.

    PubMed

    Lanza, Alessandro; Scognamiglio, Fabio; Femiano, Felice; Lanza, Michele

    2015-01-01

    The aim of this paper is to describe a case of implant-prosthetic rehabilitation in a patient with periodontitis, focusing on the different timing of implant placement. After initial periodontal treatment, teeth with advanced mobility degree and severe bone resorption were extracted. At different healing time oral implants were placed in a prosthetic-guided position. After osseointegration period the implants were loaded and the results at one year of follow-up are presented.

  10. LSD1 modulates stress-evoked transcription of immediate early genes and emotional behavior.

    PubMed

    Rusconi, Francesco; Grillo, Barbara; Ponzoni, Luisa; Bassani, Silvia; Toffolo, Emanuela; Paganini, Leda; Mallei, Alessandra; Braida, Daniela; Passafaro, Maria; Popoli, Maurizio; Sala, Mariaelvina; Battaglioli, Elena

    2016-03-29

    Behavioral changes in response to stressful stimuli can be controlled via adaptive epigenetic changes in neuronal gene expression. Here we indicate a role for the transcriptional corepressor Lysine-Specific Demethylase 1 (LSD1) and its dominant-negative splicing isoform neuroLSD1, in the modulation of emotional behavior. In mouse hippocampus, we show that LSD1 and neuroLSD1 can interact with transcription factor serum response factor (SRF) and set the chromatin state of SRF-targeted genes early growth response 1 (egr1) and c-fos Deletion or reduction of neuro LSD1 in mutant mice translates into decreased levels of activating histone marks at egr1 and c-fos promoters, dampening their psychosocial stress-induced transcription and resulting in low anxiety-like behavior. Administration of suberoylanilide hydroxamine to neuroLSD1(KO)mice reactivates egr1 and c-fos transcription and restores the behavioral phenotype. These findings indicate that LSD1 is a molecular transducer of stressful stimuli as well as a stress-response modifier. Indeed, LSD1 expression itself is increased acutely at both the transcriptional and splicing levels by psychosocial stress, suggesting that LSD1 is involved in the adaptive response to stress.

  11. Effects of Transcranial Direct Current Stimulation on Expression of Immediate Early Genes (IEG’s)

    DTIC Science & Technology

    2015-12-01

    positive behavioral results in human subjects, but our knowledge of biological processes occurring during stimulation to elicit behavioral outcomes is...cognitive, and psychiatric disorders5. There have been positive behavioral results in human subjects1, 2, 3, but our knowledge of biological processes...occurring during stimulation to elicit behavioral outcomes is limited. Our study utilizes a rodent tDCS (R- tDCS) model in which Sprague Dawley rats

  12. [Multiple apheresis].

    PubMed

    Coffe, C

    2007-05-01

    Multiple apheresis makes it possible to obtain at least two labile blood components from a single donor using a cell separator. It can be either multicomponent apheresis leading to the preparation of at least two different blood component types or red blood cell apheresis providing two identical red blood cell concentrates. These techniques available in addition to whole blood donation, are modifying collection strategies in many Etablissements Français du Sang and will contribute to improve stock logistics in the future. In areas with insufficient stock, these procedures will help achieve blood component self-sufficiency. The author first describes the principle underlying different--current or future--techniques as well as their advantages and drawbacks. He finally addresses the potential impact of these processes on the evolution of blood collection and the advantages to be gained.

  13. Multiple osteochondromas

    PubMed Central

    Bovée, Judith VMG

    2008-01-01

    Multiple osteochondromas (MO) is characterised by development of two or more cartilage capped bony outgrowths (osteochondromas) of the long bones. The prevalence is estimated at 1:50,000, and it seems to be higher in males (male-to-female ratio 1.5:1). Osteochondromas develop and increase in size in the first decade of life, ceasing to grow when the growth plates close at puberty. They are pedunculated or sessile (broad base) and can vary widely in size. The number of osteochondromas may vary significantly within and between families, the mean number of locations is 15–18. The majority are asymptomatic and located in bones that develop from cartilage, especially the long bones of the extremities, predominantly around the knee. The facial bones are not affected. Osteochondromas may cause pain, functional problems and deformities, especially of the forearm, that may be reason for surgical removal. The most important complication is malignant transformation of osteochondroma towards secondary peripheral chondrosarcoma, which is estimated to occur in 0.5–5%. MO is an autosomal dominant disorder and is genetically heterogeneous. In almost 90% of MO patients germline mutations in the tumour suppressor genes EXT1 or EXT2 are found. The EXT genes encode glycosyltransferases, catalyzing heparan sulphate polymerization. The diagnosis is based on radiological and clinical documentation, supplemented with, if available, histological evaluation of osteochondromas. If the exact mutation is known antenatal diagnosis is technically possible. MO should be distinguished from metachondromatosis, dysplasia epiphysealis hemimelica and Ollier disease. Osteochondromas are benign lesions and do not affect life expectancy. Management includes removal of osteochondromas when they give complaints. Removed osteochondromas should be examined for malignant transformation towards secondary peripheral chondrosarcoma. Patients should be well instructed and regular follow-up for early detection

  14. Disruption of multiple genes whose deletion causes lactic-acid resistance improves lactic-acid resistance and productivity in Saccharomyces cerevisiae.

    PubMed

    Suzuki, Toshihiro; Sakamoto, Takatoshi; Sugiyama, Minetaka; Ishida, Nobuhiro; Kambe, Hiromi; Obata, Shusei; Kaneko, Yoshinobu; Takahashi, Haruo; Harashima, Satoshi

    2013-05-01

    To create strains that have high productivity of lactic acid without neutralization, a genome-wide screening for strains showing hyper-resistance to 6% l-lactic acid (pH 2.6) was performed using the gene deletion collection of Saccharomyces cerevisiae. We identified 94 genes whose disruption led to resistance to 6% lactic acid in rich medium. We also found that multiple combinations of Δdse2, Δscw11, Δeaf3, and/or Δsed1 disruption led to enhanced resistance to lactic acid depending upon their combinations. In particular, the quadruple disruptant Δdse2Δscw11Δeaf3Δsed1 grew well in 6% lactic acid with the shortest lag phase. We then introduced an exogenous lactate dehydrogenase gene (LDH) into those single and multiple disruptants to evaluate their productivity of lactic acid. It was found that the quadruple disruptant displaying highest lactic-acid resistance showed a 27% increase of lactic-acid productivity as compared with the LDH-harboring wild-type strain. These observations suggest that disruption of multiple genes whose deletion leads to lactic-acid resistance is an effective way to enhance resistance to lactic acid, leading to high lactic-acid productivity without neutralization.

  15. Multiple sclerosis - resources

    MedlinePlus

    Resources - multiple sclerosis ... The following organizations provide information on multiple sclerosis : Multiple Sclerosis Foundation -- www.msfocus.org National Institute of Neurological Disorders and Stroke -- www.ninds.nih.gov/disorders/multiple_sclerosis National ...

  16. Screening of point mutations by multiple SSCP analysis in the dystrophin gene

    SciTech Connect

    Lasa, A.; Baiget, M.; Gallano, P.

    1994-09-01

    Duchenne muscular dystrophy (DMD) is a lethal, X-linked neuromuscular disorder. The population frequency of DMD is one in approximately 3500 boys, of which one third is thought to be a new mutant. The DMD gene is the largest known to date, spanning over 2,3 Mb in band Xp21.2; 79 exons are transcribed into a 14 Kb mRNA coding for a protein of 427 kD which has been named dystrophin. It has been shown that about 65% of affected boys have a gene deletion with a wide variation in localization and size. The remaining affected individuals who have no detectable deletions or duplications would probably carry more subtle mutations that are difficult to detect. These mutations occur in several different exons and seem to be unique to single patients. Their identification represents a formidable goal because of the large size and complexity of the dystrophin gene. SSCP is a very efficient method for the detection of point mutations if the parameters that affect the separation of the strands are optimized for a particular DNA fragment. The multiple SSCP allows the simultaneous study of several exons, and implies the use of different conditions because no single set of conditions will be optimal for all fragments. Seventy-eight DMD patients with no deletion or duplication in the dystrophin gene were selected for the multiple SSCP analysis. Genomic DNA from these patients was amplified using the primers described for the diagnosis procedure (muscle promoter and exons 3, 8, 12, 16, 17, 19, 32, 45, 48 and 51). We have observed different mobility shifts in bands corresponding to exons 8, 12, 43 and 51. In exons 17 and 45, altered electrophoretic patterns were found in different samples identifying polymorphisms already described.

  17. Effect of multiple mutations in tricarboxylic acid cycle and one-carbon metabolism pathways on Edwardsiella ictaluri pathogenesis.

    PubMed

    Dahal, N; Abdelhamed, H; Lu, J; Karsi, A; Lawrence, M L

    2014-02-21

    Edwardsiella ictaluri is a Gram-negative facultative intracellular pathogen causing enteric septicemia of catfish (ESC). We have shown recently that tricarboxylic acid cycle (TCA) and one-carbon (C1) metabolism are involved in E. ictaluri pathogenesis. However, the effect of multiple mutations in these pathways is unknown. Here, we report four novel E. ictaluri mutants carrying double gene mutations in TCA cycle (EiΔmdhΔsdhC, EiΔfrdAΔsdhC), C1 metabolism (EiΔglyAΔgcvP), and both TCA and C1 metabolism pathways (EiΔgcvPΔsdhC). In-frame gene deletions were constructed by allelic exchange and mutants' virulence and vaccine efficacy were evaluated using in vivo bioluminescence imaging (BLI) as well as end point mortality counts in catfish fingerlings. Results indicated that all the double gene mutants were attenuated compared to wild-type (wt) E. ictaluri. There was a 1.39-fold average reduction in bioluminescence, and hence bacterial numbers, from all the mutants except for EiΔfrdAΔsdhC at 144 h post-infection. Vaccination with mutants was very effective in protecting channel catfish against subsequent infection with virulent E. ictaluri 93-146 strain. In particular, immersion vaccination resulted in complete protection. Our results provide further evidence on the importance of TCA and C1 metabolism pathways in bacterial pathogenesis.

  18. Engineering multiple U7snRNA constructs to induce single and multiexon-skipping for Duchenne muscular dystrophy.

    PubMed

    Goyenvalle, Aurélie; Wright, Jordan; Babbs, Arran; Wilkins, Vivienne; Garcia, Luis; Davies, Kay E

    2012-06-01

    Duchenne muscular dystrophy (DMD) is a fatal muscle wasting disorder caused by mutations in the dystrophin gene. Antisense-mediated exon skipping is one of the most promising approaches for the treatment of DMD but still faces personalized medicine challenges as different mutations found in DMD patients require skipping of different exons. However, 70% of DMD patients harbor dystrophin gene deletions in a mutation-rich area or "hot-spot" in the central genomic region. In this study, we have developed 11 different U7 small-nuclear RNA, to shuttle antisense sequences designed to mask key elements involved in the splicing of exons 45 to 55. We demonstrate that these constructs induce efficient exon skipping both in vitro in DMD patients' myoblasts and in vivo in human DMD (hDMD) mice and that they can be combined into a single vector to achieve a multi skipping of at least 3 exons. These very encouraging results provide proof of principle that efficient multiexon-skipping can be achieved using adeno-associated viral (AAV) vectors encoding multiple U7 small-nuclear RNAs (U7snRNAs), offering therefore very promising tools for clinical treatment of DMD.

  19. The multiple sclerosis drug fingolimod (FTY720) stimulates neuronal gene expression, axonal growth and regeneration.

    PubMed

    Anastasiadou, Sofia; Knöll, Bernd

    2016-05-01

    Fingolimod (FTY720) is a new generation oral treatment for multiple sclerosis (MS). So far, FTY720 was mainly considered to target trafficking of immune cells but not brain cells such as neurons. Herein, we analyzed FTY720's potential to directly alter neuronal function. In CNS neurons, we identified a FTY720 governed gene expression response. FTY720 upregulated immediate early genes (IEGs) encoding for neuronal activity associated transcription factors such as c-Fos, FosB, Egr1 and Egr2 and induced actin cytoskeleton associated genes (actin isoforms, tropomyosin, calponin). Stimulation of primary neurons with FTY720 enhanced neurite growth and altered growth cone morphology. In accordance, FTY720 enhanced axon regeneration in mice upon facial nerve axotomy. We identified components of a FTY720 engaged signaling cascade including S1P receptors, G12/13G-proteins, RhoA-GTPases and the transcription factors SRF/MRTF. In summary, we uncovered a broader cellular and therapeutic operation mode of FTY720, suggesting beneficial FTY720 effects also on CNS neurons during MS therapy and for treatment of other neurodegenerative diseases requiring neuroprotective and neurorestorative processes.

  20. 5S RRNA GENE DELETIONS CAUSE AN UNEXPECTEDLY HIGH FITNESS LOSS IN ESCHERICHIA COLI. (R825354)

    EPA Science Inventory

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  1. Pex gene deletions in Gy and Hyp mice provide mouse models for X-linked hypophosphatemia.

    PubMed

    Strom, T M; Francis, F; Lorenz, B; Böddrich, A; Econs, M J; Lehrach, H; Meitinger, T

    1997-02-01

    X-linked hypophosphatemic rickets in humans is caused by mutations in the PEX gene which codes for a protein homologous to neutral endopeptidases. Hyp and Gy mice both have X-linked hypophosphatemic rickets, although genetic data and the different phenotypic spectra observed have previously suggested that two different genes are mutated. In addition to the metabolic disorder observed in Hyp mice, male Gy mice are sterile and show circling behavior and reduced viability. We now report the cloning of the mouse homolog of PEX which is highly conserved between man and mouse. The 3' end of this gene is deleted in Hyp mice. In Gy mice, the first three exons and the promotor region are deleted. Thus, Hyp and Gy are allelic mutations and both provide mouse models for X-linked hypophosphatemia.

  2. PCR detection of retinoblastoma gene deletions in radiation-induced mouse lung adenocarcinomas

    SciTech Connect

    Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

    1994-05-01

    From 1971--1986, Argonne National Laboratory conducted a series of large-scale studies of tumor incidence in 40,000 BCF{sub 1} mice irradiated with {sup 60}Co {gamma}-rays or JANUS fission-spectrum neutrons. Polymerase chain reaction (PCR) technique was used to detect deletions in the mouse retinoblastoma (mRb) gene. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. Absence of any of these fragments on a Southern blot indicated a deletion of that portion of the mRb gene. Tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death in post-mortem analyses. Spontaneous tumors as well as those from irradiated mice were analyzed for mRb deletions. In all normal mouse tissues studies all six mRb exon fragments were present on Southern blots. Tumors in six neutron-irradiated mice also had no mRb deletions. However, 1 of 6 tumors from {gamma}-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice showed a deletion in one or both mRb alleles. All deletions detected were in the 5{prime} region of the mRb gene.

  3. PCR detection of retinoblastoma gene deletions in radiation-induced mouse lung adenocarcinomas

    SciTech Connect

    Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

    1993-04-01

    From 1971 to 1986, Argonne National Laboratory conducted a series of large-scale studies of tumor incidence in 40,000 BCF{sub 1} mice irradiated with {sup 60}Co {gamma} rays or JANUS fission-spectrum neutrons; normal and tumor tissues from mice in these studies were preserved in paraffin blocks. A polymerase chain reaction (PCR) technique has been developed to detect deletions in the mouse retinoblastoma (mRb) gene in the paraffin-embedded tissues. Microtomed sections were used as the DNA source in PCR reaction mixtures. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. The absence of any of these fragments (relative to control PCR products) on a Southern blot indicated a deletion of that portion of the mRb gene. The tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death in post-mortem analyses. Spontaneous tumors as well as those from irradiated mice (569 cGy of {sup 60}Co {gamma} rays or 60 cGy of JANUS neutrons, doses that have been found to have approximately equal biological effectiveness in the BCF, mouse) were analyzed for mRb deletions. In all normal mouse tissues studies, all six mRb exon fragments were present on Southem blots. Tumors in six neutron-irradiated mice also had no mRb deletions. However, I of 6 tumors from {gamma}-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice had a deletion in one or both mRb alleles. All deletions detected were in the 5{prime} region of the mRb gene.

  4. PCR detection of retinoblastoma gene deletions in radiation-induced mouse lung adenocarcinomas

    SciTech Connect

    Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

    1993-01-01

    From 1971 to 1986, Argonne National Laboratory conducted a series of large-scale studies of tumor incidence in 40,000 BCF[sub 1] mice irradiated with [sup 60]Co [gamma] rays or JANUS fission-spectrum neutrons; normal and tumor tissues from mice in these studies were preserved in paraffin blocks. A polymerase chain reaction (PCR) technique has been developed to detect deletions in the mouse retinoblastoma (mRb) gene in the paraffin-embedded tissues. Microtomed sections were used as the DNA source in PCR reaction mixtures. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. The absence of any of these fragments (relative to control PCR products) on a Southern blot indicated a deletion of that portion of the mRb gene. The tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death in post-mortem analyses. Spontaneous tumors as well as those from irradiated mice (569 cGy of [sup 60]Co [gamma] rays or 60 cGy of JANUS neutrons, doses that have been found to have approximately equal biological effectiveness in the BCF, mouse) were analyzed for mRb deletions. In all normal mouse tissues studies, all six mRb exon fragments were present on Southem blots. Tumors in six neutron-irradiated mice also had no mRb deletions. However, I of 6 tumors from [gamma]-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice had a deletion in one or both mRb alleles. All deletions detected were in the 5[prime] region of the mRb gene.

  5. Gene-deleted live-attenuated Trypanosoma cruzi parasites as vaccines to protect against Chagas disease.

    PubMed

    Sánchez-Valdéz, Fernando J; Pérez Brandán, Cecilia; Ferreira, Arturo; Basombrío, Miguel Ángel

    2015-05-01

    Chagas disease is a neglected tropical disease caused by the protozoan parasite Trypanosoma cruzi. This illness is now becoming global, mainly due to congenital transmission, and so far, there are no prophylactic or therapeutic vaccines available to either prevent or treat Chagas disease. Therefore, different approaches aimed at identifying new protective immunogens are urgently needed. Live vaccines are likely to be more efficient in inducing protection, but safety issues linked with their use have been raised. The development of improved protozoan genetic manipulation tools and genomic and biological information has helped to increase the safety of live vaccines. These advances have generated a renewed interest in the use of genetically attenuated parasites as vaccines against Chagas disease. This review discusses the protective capacity of genetically attenuated parasite vaccines and the challenges and perspectives for the development of an effective whole-parasite Chagas disease vaccine.

  6. Goldenhar and cri-du-chat syndromes: a contiguous gene deletion syndrome?

    PubMed

    Choong, Yee Fong; Watts, Patrick; Little, Elizabeth; Beck, Lyn

    2003-06-01

    We report a full-term male infant born to nonconsanguinous parents who had clinical features of Goldenhar syndrome and cri du chat syndrome. At birth, the infant was noted to have dysmorphic features with bilateral preauricular tags, rotated ears, bilateral epicanthic folds, a left epibulbar lipodermoid, and an accessory left nipple. After he was assessed for feeding difficulty and tachypnea, he was found to have esophageal atresia with tracheoesophageal fistula. In addition, he had a high-pitched, cat-like cry, characteristic of cri-du-chat syndrome. He also failed a hearing test. Chromosomal analysis and fluorescence in situ hybridisation studies showed an unbalanced karyotype with a terminal deletion of the segment p14 on the short arm of chromosome 5, which is consistent with the cri-du-chat locus. The association of Goldenhar syndrome and cri-du-chat syndrome in this patient suggests that the chromosome 5p14 locus may harbor a gene implicated with Goldenhar syndrome.

  7. Identification of a PKP2 gene deletion in a family with arrhythmogenic right ventricular cardiomyopathy

    PubMed Central

    Li Mura, Ilena Egle Astrid; Bauce, Barbara; Nava, Andrea; Fanciulli, Manuela; Vazza, Giovanni; Mazzotti, Elisa; Rigato, Ilaria; De Bortoli, Marzia; Beffagna, Giorgia; Lorenzon, Alessandra; Calore, Martina; Dazzo, Emanuela; Nobile, Carlo; Luisa Mostacciuolo, Maria; Corrado, Domenico; Basso, Cristina; Daliento, Luciano; Thiene, Gaetano; Rampazzo, Alessandra

    2013-01-01

    Arrhythmogenic right ventricular cardiomyopathy (ARVC) is a primary heart muscle disease characterized by progressive myocardial loss, with fibro-fatty replacement, and high frequency of ventricular arrhythmias that can lead to sudden cardiac death. ARVC is a genetically determined disorder, usually caused by point mutations in components of the cardiac desmosome. Conventional mutation screening of ARVC genes fails to detect causative mutations in about 50% of index cases, suggesting a further genetic heterogeneity. We performed a genome-wide linkage study and a copy number variations (CNVs) analysis, using high−density SNP arrays, in an ARVC family showing no mutations in any of the desmosomal genes. The CNVs analysis identified a heterozygous deletion of about 122 kb on chromosome 12p11.21, including the entire plakophilin-2 gene and shared by all affected family members. It was not listed on any of available public CNVs databases and was confirmed by quantitative real-time PCR. This is the first SNP array-based genome-wide study leading to the identification of a CNV segregating with the disease phenotype in an ARVC family. This result underscores the importance of performing additional analysis for possible genomic deletions/duplications in ARVC patients without point mutations in known disease genes. PMID:23486541

  8. Partial gene deletion in LEC rat: An animal model for Wilson disease

    SciTech Connect

    Wu, J.; Forbes, J.R.; Cox, D.W.

    1994-09-01

    Wilson disease is an inherited disorder of copper transport in which incorporation of copper into ceruloplasmin and excretion of copper into bile are greatly reduced. Copper accumulates to a toxic level in the liver and also in the brain and kidney, causing a spectrum of hepatic and neurological abnormalities. We have recently cloned the gene for Wilson disease (designated ATP7B), which encodes a putative copper-transporting P-type ATPase. The inbred mutant Long-Evans Cinnamon (LEC) rat strain shows similarity to Wilson disease in many clinical and biochemical features. We have cloned cDNAs for the rat homologue (Atp7b) of the human Wilson disease gene (ATP7B) and have shown that the two genes have {approximately}82% identity at the amino acid sequence level. Rat cDNA sequences were used to identify a partial deletion in the Atp7b gene in the LEC rat. The deletion removes at least 750 bp of the coding region at the 3{prime} end, which includes the crucial ATP binding domain and extends downstream of the gene. The proximal breakpoint has been precisely localized at the cDNA level. Our results provide convincing evidence that the LEC rat is an animal model for Wilson disease. This model will be important for studying liver pathophysiology, for developing therapy for Wilson disease, and for studying the pathway of copper transport and its possible interaction with other heavy metals.

  9. Distribution of CCR5-delta 32 gene deletion across the Russian part of Eurasia.

    PubMed

    Yudin, N S; Vinogradov, S V; Potapova, T A; Naykova, T M; Sitnikova, V V; Kulikov, I V; Khasnulin, V I; Konchuk, C; Vloschinskii, P E; Ivanov, S V; Kobzev, V F; Romaschenko, A G; Voevoda, M I

    1998-06-01

    32-bp inactivating deletion in the beta-chemokine receptor 5 (CCR5) gene, common in Nothern European populations, is associated with reduced HIV-1 transmission risk and delayed disease progression. We have studied the deletion distribution in many populations in Eurasia by polymerase chain reaction analysis of 531 DNA samples representing West and East Siberian, Central Asian, and Far Eastern parts of Russia. An unusually high frequency (11.1%) of the deleted variant in natives of West Siberia, of Finno-Ugrian descent, was observed. Furthermore, the deletion was infrequent in indigenous populations of Central Asia, East Siberia, the Russian Far East, and Canada. We conclude that the delta(ccr5) distribution is limited primarily to Europeans and related western Siberian Finno-Ugrian populations, with a sharp negative gradient toward the east along the territory of Russian Asia.

  10. Gene Deletion of 7,8-Linoleate Diol Synthase of the Rice Blast Fungus

    PubMed Central

    Jernerén, Fredrik; Sesma, Ane; Francheschetti, Marina; Hamberg, Mats; Oliw, Ernst H.

    2010-01-01

    Linoleate diol synthases (LDS) are heme enzymes, which oxygenate 18:2n-6 sequentially to (8R)-hydroperoxylinoleic acid ((8R)-HPODE) and to (5S,8R)-dihydroxy-, (7S,8S)-dihydroxy-, or (8R,11S)-dihydroxylinoleic acids (DiHODE). The genome of the rice blast fungus, Magnaporthe oryzae, contains two genes with homology to LDS. M. oryzae oxidized 18:2n-6 to (8R)-HPODE and to (7S,8S)-DiHODE, (6S,8R)-DiHODE, and (8R,11S)-HODE. Small amounts of 10-hydroxy-(8E,12Z)-octadecadienoic acid and traces of 5,8-DiHODE were also detected by liquid chromatography-mass spectrometry. The contribution of the 7,8-LDS gene to M. oryzae pathogenicity was evaluated by replacement of the catalytic domain with hygromycin and green fluorescent protein variant (SGFP) cassettes. This genetically modified strain Δ7,8-LDS infected rice leaves and roots and formed appressoria and conidia as the native fungus. The Δ7,8-LDS mutant had lost the capacity to biosynthesize all the metabolites except small amounts of 8-hydroxylinoleic acid. Studies with stereospecifically deuterated linoleic acids showed that (8R)-HPODE was formed by abstraction of the pro-S hydrogen at C-8 and antarafacial oxygenation, whereas (7S,8S)-DiHODE and (8R,11S)-DiHODE were formed from (8R)-HPODE by suprafacial hydrogen abstraction and oxygenation at C-7 and C-11, respectively. A mac1 suppressor mutant (Δmac1 sum1–99) of M. oryzae, which shows cAMP-independent protein kinase A activity, oxygenated 18:2n-6 to increased amounts of (10R)-HPODE and (5S,8R)-DiHODE. Expression of the 7,8-LDS gene but not of the second homologue was detected in the suppressor mutant. This suggests that PKA-mediated signaling pathway regulates the dioxygenase and hydroperoxide isomerase activities of M. oryzae. PMID:20023302

  11. Markerless Gene Deletion with Cytosine Deaminase in Thermus thermophilus Strain HB27.

    PubMed

    Wang, Lei; Hoffmann, Jana; Watzlawick, Hildegard; Altenbuchner, Josef

    2015-12-11

    We developed a counterselectable deletion system for Thermus thermophilus HB27 based on cytosine deaminase (encoded by codA) from Thermaerobacter marianensis DSM 12885 and the sensitivity of T. thermophilus HB27 to the antimetabolite 5-fluorocytosine (5-FC). The deletion vector comprises the pUC18 origin of replication, a thermostable kanamycin resistance marker functional in T. thermophilus HB27, and codA under the control of a constitutive putative trehalose promoter from T. thermophilus HB27. The functionality of the system was demonstrated by deletion of the bglT gene, encoding a β-glycosidase, and three carotenoid biosynthesis genes, CYP175A1, crtY, and crtI, from the genome of T. thermophilus HB27.

  12. Detection of APC gene deletions in colorectal malignancies using quantitative PCR in a Chinese population.

    PubMed

    Fang, Zhengyu; Xiong, Yi; Li, Jiana; Liu, Li; Li, Manhui; Zhang, Wei; Shi, Lei; Wan, Jun

    2011-09-01

    The adenomatous polyposis coli (APC) gene has been shown to be involved in genetic instability and to be downregluated in several human carcinomas. The chromosome locus of APC, 5q21-22, is frequently deleted in colorectal cancers (CRCs). The functional impact of such regions needs to be extensively investigated in large amount of clinical samples. Case-matched tissues of CRC and adjacent normal epithelium (n = 134) were included in this study. Quantitative PCR was carried out to examine the copy number as well as mRNA expression of APC gene in colorectal malignancies. Our results showed that copy number deletions of APC were present in a relatively high percentage of colorectal cancer samples (26.1%, 35 out of 134). There was a positive correlation between copy number decrease of APC and tumor progression in CRCs. Furthermore, copy number loss of APC was correlated with decreased mRNA expression. However, mRNA levels of APC were also impaired in CRC samples with unaltered copy numbers, indicating that sporadic CRCs exhibit different mechanisms of APC regulation.

  13. A partial gene deletion of SLC45A2 causes oculocutaneous albinism in Doberman pinscher dogs.

    PubMed

    Winkler, Paige A; Gornik, Kara R; Ramsey, David T; Dubielzig, Richard R; Venta, Patrick J; Petersen-Jones, Simon M; Bartoe, Joshua T

    2014-01-01

    The first white Doberman pinscher (WDP) dog was registered by the American Kennel Club in 1976. The novelty of the white coat color resulted in extensive line breeding of this dog and her offspring. The WDP phenotype closely resembles human oculocutaneous albinism (OCA) and clinicians noticed a seemingly high prevalence of pigmented masses on these dogs. This study had three specific aims: (1) produce a detailed description of the ocular phenotype of WDPs, (2) objectively determine if an increased prevalence of ocular and cutaneous melanocytic tumors was present in WDPs, and (3) determine if a genetic mutation in any of the genes known to cause human OCA is causal for the WDP phenotype. WDPs have a consistent ocular phenotype of photophobia, hypopigmented adnexal structures, blue irides with a tan periphery and hypopigmented retinal pigment epithelium and choroid. WDPs have a higher prevalence of cutaneous melanocytic neoplasms compared with control standard color Doberman pinschers (SDPs); cutaneous tumors were noted in 12/20 WDP (<5 years of age: 4/12; >5 years of age: 8/8) and 1/20 SDPs (p<0.00001). Using exclusion analysis, four OCA causative genes were investigated for their association with WDP phenotype; TYR, OCA2, TYRP1 and SLC45A2. SLC45A2 was found to be linked to the phenotype and gene sequencing revealed a 4,081 base pair deletion resulting in loss of the terminus of exon seven of SLC45A2 (chr4∶77,062,968-77,067,051). This mutation is highly likely to be the cause of the WDP phenotype and is supported by a lack of detectable SLC45A2 transcript levels by reverse transcriptase PCR. The WDP provides a valuable model for studying OCA4 visual disturbances and melanocytic neoplasms in a large animal model.

  14. Phosphoinositide-specific Phospholipase C β1 gene deletion in bipolar disorder affected patient.

    PubMed

    Lo Vasco, Vincenza Rita; Longo, Lucia; Polonia, Patrizia

    2013-03-01

    The involvement of phosphoinositides (PI) signal transduction pathway and related molecules, such as the Phosphoinositide-specific Phospholipase C (PI-PLC) enzymes, in the pathophysiology of mood disorders is corroborated by a number of recent evidences. Our previous works identified the deletion of PLCB1 gene, which codifies for the PI-PLC β1 enzyme, in 4 out 15 patients affected with schizophrenia, and no deletion both in major depression affected patients and in normal controls. By using interphase fluorescent in situ hybridization methodology, we analyzed PLCB1 in paraffin embedded samples of orbito-frontal cortex of 15 patients affected with bipolar disorder. Deletion of PLCB1 was identified in one female patient.

  15. The effect of CSE gene deletion in caerulein-induced acute pancreatitis in the mouse.

    PubMed

    Ang, Abel D; Rivers-Auty, Jack; Hegde, Akhil; Ishii, Isao; Bhatia, Madhav

    2013-11-15

    Hydrogen sulfide (H2S) has been reported to be involved in the signaling of the inflammatory response; however, there are differing views as to whether it is pro- or anti-inflammatory. In this study, we sought to determine whether endogenously synthesized H2S via cystathionine-γ-lyase (CSE) plays a pro- or anti-inflammatory role in caerulein-induced pancreatitis. To investigate this, we used mice genetically deficient in CSE to elucidate the function of CSE in caerulein-induced acute pancreatitis. We compared the inflammatory response and tissue damage of wild-type (WT) and CSE knockout (KO) mice following 10 hourly administrations of 50 μg/kg caerulein or saline control. From this, we found that the CSE KO mice showed significantly less local pancreatic damage as well as acute pancreatitis-associated lung injury compared with the WT mice. There were also lower levels of pancreatic eicosanoid and cytokines, as well as reduced acinar cell NF-κB activation in the CSE KO mice compared with WT mice. Additionally, in WT mice, there was a greater level of pancreatic CSE expression and sulfide-synthesizing activity in caerulein-induced pancreatitis compared with the saline control. When comparing the two saline-treated control groups, we noted that the CSE KO mice showed significantly less pancreatic H2S-synthesizing activity relative to the WT mice. These results indicate that endogenous H2S generated by CSE plays a key proinflammatory role via NF-κB activation in caerulein-induced pancreatitis, and its genetic deletion affords significant protection against acute pancreatitis and associated lung injury.

  16. Targeted gene deletion of miRNAs in mice by TALEN system.

    PubMed

    Takada, Shuji; Sato, Tempei; Ito, Yoshiaki; Yamashita, Satoshi; Kato, Tomoko; Kawasumi, Miyuri; Kanai-Azuma, Masami; Igarashi, Arisa; Kato, Tomomi; Tamano, Moe; Asahara, Hiroshi

    2013-01-01

    Mice are among the most valuable model animal species with an enormous amount of heritage in genetic modification studies. However, targeting genes in mice is sometimes difficult, especially for small genes, such as microRNAs (miRNAs) and targeting genes in repeat sequences. Here we optimized the application of TALEN system for mice and successfully obtained gene targeting technique in mice for intergenic region and series of microRNAs. Microinjection of synthesized RNA of TALEN targeting each gene in one cell stage of embryo was carried out and injected oocytes were transferred into pseudopregnant ICR female mice, producing a high success rate of the targeted deletion of miRNA genes. In our condition, TALEN RNA without poly(A) tail worked better than that of with poly(A) tail. This mutated allele in miRNA was transmitted to the next generation, suggesting the successful germ line transmission of this targeting method. Consistent with our notion of miRNAs maturation mechanism, in homozygous mutant mice of miR-10a, the non- mutated strand of miRNAs expression was completely diminished. This method will lead us to expand and accelerate our genetic research using mice in a high throughput way.

  17. Astrocytic β2 Adrenergic Receptor Gene Deletion Affects Memory in Aged Mice

    PubMed Central

    Jensen, Cathy Joanna; Demol, Frauke; Bauwens, Romy; Kooijman, Ron; Massie, Ann; Villers, Agnès; Ris, Laurence; De Keyser, Jacques

    2016-01-01

    In vitro and in vivo studies suggest that the astrocytic adrenergic signalling enhances glycogenolysis which provides energy to be transported to nearby cells and in the form of lactate. This energy source is important for motor and cognitive functioning. While it is suspected that the β2-adrenergic receptor on astrocytes might contribute to this energy balance, it has not yet been shown conclusively in vivo. Inducible astrocyte specific β2-adrenergic receptor knock-out mice were generated by crossing homozygous β2-adrenergic receptor floxed mice (Adrb2flox) and mice with heterozygous tamoxifen-inducible Cre recombinase-expression driven by the astrocyte specific L-glutamate/L-aspartate transporter promoter (GLAST-CreERT2). Assessments using the modified SHIRPA (SmithKline/Harwell/Imperial College/Royal Hospital/Phenotype Assessment) test battery, swimming ability test, and accelerating rotarod test, performed at 1, 2 and 4 weeks, 6 and 12 months after tamoxifen (or vehicle) administration did not reveal any differences in physical health or motor functions between the knock-out mice and controls. However deficits were found in the cognitive ability of aged, but not young adult mice, reflected in impaired learning in the Morris Water Maze. Similarly, long-term potentiation (LTP) was impaired in hippocampal brain slices of aged knock-out mice maintained in low glucose media. Using microdialysis in cerebellar white matter we found no significant differences in extracellular lactate or glucose between the young adult knock-out mice and controls, although trends were detected. Our results suggest that β2-adrenergic receptor expression on astrocytes in mice may be important for maintaining cognitive health at advanced age, but is dispensable for motor function. PMID:27776147

  18. Gene deletion of KLF9 in mice results in aberrant endometrial proliferation and myometrial function

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Timely regulation of uterine function is critical for successful pregnancy. Our laboratory has previously identified Basic transcription element binding protein-1/Krüppel-like factor 9 (Bteb1/Klf9), a member of Sp/KLF family of transcription factor, as a progesterone receptor (Pgr) interacting prote...

  19. Upon Accounting for the Impact of Isoenzyme Loss, Gene Deletion Costs Anticorrelate with Their Evolutionary Rates.

    PubMed

    Jacobs, Christopher; Lambourne, Luke; Xia, Yu; Segrè, Daniel

    2017-01-01

    System-level metabolic network models enable the computation of growth and metabolic phenotypes from an organism's genome. In particular, flux balance approaches have been used to estimate the contribution of individual metabolic genes to organismal fitness, offering the opportunity to test whether such contributions carry information about the evolutionary pressure on the corresponding genes. Previous failure to identify the expected negative correlation between such computed gene-loss cost and sequence-derived evolutionary rates in Saccharomyces cerevisiae has been ascribed to a real biological gap between a gene's fitness contribution to an organism "here and now" and the same gene's historical importance as evidenced by its accumulated mutations over millions of years of evolution. Here we show that this negative correlation does exist, and can be exposed by revisiting a broadly employed assumption of flux balance models. In particular, we introduce a new metric that we call "function-loss cost", which estimates the cost of a gene loss event as the total potential functional impairment caused by that loss. This new metric displays significant negative correlation with evolutionary rate, across several thousand minimal environments. We demonstrate that the improvement gained using function-loss cost over gene-loss cost is explained by replacing the base assumption that isoenzymes provide unlimited capacity for backup with the assumption that isoenzymes are completely non-redundant. We further show that this change of the assumption regarding isoenzymes increases the recall of epistatic interactions predicted by the flux balance model at the cost of a reduction in the precision of the predictions. In addition to suggesting that the gene-to-reaction mapping in genome-scale flux balance models should be used with caution, our analysis provides new evidence that evolutionary gene importance captures much more than strict essentiality.

  20. Proteomics and bioinformatics analysis of mouse hypothalamic neurogenesis with or without EPHX2 gene deletion

    PubMed Central

    Zhong, Lijun; Zhou, Juntuo; Wang, Dawei; Zou, Xiajuan; Lou, Yaxin; Liu, Dan; Yang, Bin; Zhu, Yi; Li, Xiaoxia

    2015-01-01

    The aim of this study was to identify differently expressed proteins in the presence and absence of EPHX2 gene in mouse hypothalamus using proteomics profiling and bioinformatics analysis. This study was performed on 3 wild type (WT) and 3 EPHX2 gene global knockout (KO) mice (EPHX2 -/-). Using the nano- electrospray ionization (ESI)-LC-MS/MS detector, we identified 31 over-expressed proteins in WT mouse hypothalamus compared to the KO counterparts. Gene Ontology (GO) annotation in terms of the protein-protein interaction network indicated that cellular metabolic process, protein metabolic process, signaling transduction and protein post-translation biological processes involved in EPHX2 -/- regulatory network. In addition, signaling pathway enrichment analysis also highlighted chronic neurodegenerative diseases and some other signaling pathways, such as TGF-beta signaling pathway, T cell receptor signaling pathway, ErbB signaling pathway, Neurotrophin signaling pathway and MAPK signaling pathway, were strongly coupled with EPHX2 gene knockout. Further studies into the molecular functions of EPHX2 gene in hypothalamus will help to provide new perspective in neurogenesis. PMID:26722453

  1. Relatively low proportion of dystrophin gene deletions in Israeili Duchenne and Becker muscular dystrophy patients

    SciTech Connect

    Shomrat, R.; Gluck, E.; Legum, C.; Shiloh, Y.

    1994-02-15

    Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) are allelic disorders caused by mutations in the X-linked dystrophin gene. The most common mutations in western populations are deletions that are spread non-randomly throughout the gene. Molecular analysis of the dystrophin gene structure by hybridization of the full length cDNA to Southern blots and by PCR in 62 unrelated Israeli male DMD/BMD patients showed deletions in 23 (37%). This proportion is significantly lower than that found in European and North American populations (55-65%). Seventy-eight percent of the deletions were confined to exons 44-52, half of these exons 44-45, and the remaining 22% to exons 1 and 19. There was no correlation between the size of the deletion and the severity of the disease. All the deletions causing frameshift resulted in the DMD phenotypes. 43 refs., 1 fig., 1 tab.

  2. FOXP2 gene deletion and infant feeding difficulties: a case report

    PubMed Central

    Zimmerman, Emily; Maron, Jill L.

    2016-01-01

    Forkhead box protein P2 (FOXP2) is a well-studied gene known to play an essential role in normal speech development. Deletions in the gene have been shown to result in developmental speech disorders and regulatory disruption of downstream gene targets associated with common forms of language impairments. Despite similarities in motor planning and execution between speech development and oral feeding competence, there have been no reports to date linking deletions within the FOXP2 gene to oral feeding impairments in the newborn. The patient was a nondysmorphic, appropriately and symmetrically grown male infant born at 35-wk gestational age. He had a prolonged neonatal intensive care unit stay because of persistent oral feeding incoordination requiring gastrostomy tube placement. Cardiac and neurological imagings were within normal limits. A microarray analysis found an ∼9-kb loss within chromosome band 7q3.1 that contains exon 2 of FOXP2, demonstrating a single copy of this region instead of the normal two copies per diploid gene. This case study expands our current understanding of the role FOXP2 exerts on motor planning and coordination necessary for both oral feeding success and speech–language development. This case report has important consequences for future diagnosis and treatment for infants with FOXP2 deletions, mutations, and varying levels of gene expression. PMID:27148578

  3. Isolation and characterization of a novel gene deleted in DiGeorge syndrome.

    PubMed

    Kurahashi, H; Akagi, K; Inazawa, J; Ohta, T; Niikawa, N; Kayatani, F; Sano, T; Okada, S; Nishisho, I

    1995-04-01

    The region commonly deleted in DiGeorge syndrome (DGS) has been localized at 22q11.1-q11.2 with the aid of a high resolution banding technique. A 22q11 specific plasmid library was constructed with a microdissection and microcloning method. Dosage analysis proved three of 144 randomly selected microclones to detect hemizygosity in two patients with DGS. Two of the clones were found to contain independent low-copy-number repetitive sequences, all of which were included in the region deleted in the DGS patients. Screening of the cosmid library and subsequent cosmid walking allowed us to obtain two cosmid contigs corresponding to the microclones within the deletion (contig 1 and contig 2), whose order fluorescence in situ hybridization identified as centromere-contig 1-contig 2-telomere on 22q. By direct selection strategy using one of the cosmids of contig 1, a 4.3 kb cDNA was obtained from fetal brain cDNA library. Sequence analysis of the cDNA revealed an open reading frame encoding 552 amino acids which had several characteristics of DNA-binding proteins. The gene, designated LZTR-1, which was transcribed in several essential fetal organs, proved to be hemizygously deleted in seven of eight DGS patients or its variants, but not in one DGS patient and GM00980. Although LZTR-1 does not locate in the shortest region of overlap, several of its structural characteristics identifying it as transcriptional regulator suggest that it plays a crucial role in embryogenesis and that haploinsufficiency of this gene may be partly related to the development of DGS.

  4. Gene Deletions Resulting in Increased Nitrogen Release by Azotobacter vinelandii: Application of a Novel Nitrogen Biosensor

    PubMed Central

    Eberhart, Lauren J.; Ohlert, Janet M.; Knutson, Carolann M.; Plunkett, Mary H.

    2015-01-01

    Azotobacter vinelandii is a widely studied model diazotrophic (nitrogen-fixing) bacterium and also an obligate aerobe, differentiating it from many other diazotrophs that require environments low in oxygen for the function of the nitrogenase. As a free-living bacterium, A. vinelandii has evolved enzymes and transporters to minimize the loss of fixed nitrogen to the surrounding environment. In this study, we pursued efforts to target specific enzymes and further developed screens to identify individual colonies of A. vinelandii producing elevated levels of extracellular nitrogen. Targeted deletions were done to convert urea into a terminal product by disrupting the urease genes that influence the ability of A. vinelandii to recycle the urea nitrogen within the cell. Construction of a nitrogen biosensor strain was done to rapidly screen several thousand colonies disrupted by transposon insertional mutagenesis to identify strains with increased extracellular nitrogen production. Several disruptions were identified in the ammonium transporter gene amtB that resulted in the production of sufficient levels of extracellular nitrogen to support the growth of the biosensor strain. Further studies substituting the biosensor strain with the green alga Chlorella sorokiniana confirmed that levels of nitrogen produced were sufficient to support the growth of this organism when the medium was supplemented with sufficient sucrose to support the growth of the A. vinelandii in coculture. The nature and quantities of nitrogen released by urease and amtB disruptions were further compared to strains reported in previous efforts that altered the nifLA regulatory system to produce elevated levels of ammonium. These results reveal alternative approaches that can be used in various combinations to yield new strains that might have further application in biofertilizer schemes. PMID:25888177

  5. Oxytocin gene deletion mice overconsume palatable sucrose solution but not palatable lipid emulsions.

    PubMed

    Miedlar, J A; Rinaman, L; Vollmer, R R; Amico, J A

    2007-09-01

    We previously reported that oxytocin knockout (OT KO) mice display markedly enhanced intake of sweet and nonsweet carbohydrate solutions compared with intake by wild-type (WT) mice of the same background strain. The present study was conducted to determine whether OT KO mice demonstrate enhanced intake of Intralipid, a palatable lipid emulsion. Male or female mice of both genotypes that were naive to the test solution were given continuous two-bottle access to Intralipid and water with food available ad libitum for 3 days. Throughout the experiment, mice of both genotypes showed a marked preference for Intralipid over water. On the 1st day, OT KO mice displayed twofold greater preference and consumed nearly twice as much Intralipid compared with WT cohorts. However, on subsequent days of exposure, Intralipid preference and intake did not differ between genotypes over a range of lipid concentrations presented in descending or ascending order. Daily and hourly measures of lipid vs. sucrose intake confirmed that OT KO mice consumed more sucrose solution, but not lipid emulsion, than WT mice. During ad libitum access to Intralipid, both genotypes consumed significantly more calories from the emulsion as concentration increased. Both genotypes maintained consistent total daily caloric intake (lipid plus chow) and compensated by decreasing chow intake over the course of the study. These findings, coupled with prior reports from our laboratory, support the view that OT signaling pathways participate in limiting intake of palatable carbohydrate-containing solutions, but do not appear to play a role in limiting intake of Intralipid.

  6. A Partial Gene Deletion of SLC45A2 Causes Oculocutaneous Albinism in Doberman Pinscher Dogs

    PubMed Central

    Winkler, Paige A.; Gornik, Kara R.; Ramsey, David T.; Dubielzig, Richard R.; Venta, Patrick J.; Petersen-Jones, Simon M.; Bartoe, Joshua T.

    2014-01-01

    The first white Doberman pinscher (WDP) dog was registered by the American Kennel Club in 1976. The novelty of the white coat color resulted in extensive line breeding of this dog and her offspring. The WDP phenotype closely resembles human oculocutaneous albinism (OCA) and clinicians noticed a seemingly high prevalence of pigmented masses on these dogs. This study had three specific aims: (1) produce a detailed description of the ocular phenotype of WDPs, (2) objectively determine if an increased prevalence of ocular and cutaneous melanocytic tumors was present in WDPs, and (3) determine if a genetic mutation in any of the genes known to cause human OCA is causal for the WDP phenotype. WDPs have a consistent ocular phenotype of photophobia, hypopigmented adnexal structures, blue irides with a tan periphery and hypopigmented retinal pigment epithelium and choroid. WDPs have a higher prevalence of cutaneous melanocytic neoplasms compared with control standard color Doberman pinschers (SDPs); cutaneous tumors were noted in 12/20 WDP (<5 years of age: 4/12; >5 years of age: 8/8) and 1/20 SDPs (p<0.00001). Using exclusion analysis, four OCA causative genes were investigated for their association with WDP phenotype; TYR, OCA2, TYRP1 and SLC45A2. SLC45A2 was found to be linked to the phenotype and gene sequencing revealed a 4,081 base pair deletion resulting in loss of the terminus of exon seven of SLC45A2 (chr4∶77,062,968–77,067,051). This mutation is highly likely to be the cause of the WDP phenotype and is supported by a lack of detectable SLC45A2 transcript levels by reverse transcriptase PCR. The WDP provides a valuable model for studying OCA4 visual disturbances and melanocytic neoplasms in a large animal model. PMID:24647637

  7. Absence of human chorionic somatomammotropin during pregnancy associated with two types of gene deletion.

    PubMed

    Simon, P; Decoster, C; Brocas, H; Schwers, J; Vassart, G

    1986-11-01

    Complete absence of human somatomammotropin (hCS) was demonstrated in two patients experiencing an otherwise uneventful pregnancy. After delivery, DNA was prepared from the neonate blood or from the placenta and the integrity of the hCS-hGH gene cluster was investigated by Southern blotting and hybridization with an hCS cDNA probe. Patient 1 was found to be homozygous for a deletion involving hCS-A, hGH-V, and hCS-B. Patient 2 was a double heterozygote, with one chromosome bearing the same deletion as that of patient 1, while in the other, only the hCS-A gene was missing. Considerations relative to the frequency of the defect are derived from the present results.

  8. Sensitivity of hematopoietic stem cells to mitochondrial dysfunction by SdhD gene deletion

    PubMed Central

    Bejarano-García, José Antonio; Millán-Uclés, África; Rosado, Iván V; Sánchez-Abarca, Luís Ignacio; Caballero-Velázquez, Teresa; Durán-Galván, María José; Pérez-Simón, José Antonio; Piruat, José I

    2016-01-01

    It is established that hematopoietic stem cells (HSC) in the hypoxic bone marrow have adapted their metabolism to oxygen-limiting conditions. This adaptation includes suppression of mitochondrial activity, induction of anerobic glycolysis, and activation of hypoxia-inducible transcription factor 1α (Hif1α)-dependent gene expression. During progression of hematopoiesis, a metabolic switch towards mitochondrial oxidative phosphorylation is observed, making this organelle essential for determining cell fate choice in bone marrow. However, given that HSC metabolism is essentially oxygen-independent, it is still unclear whether functional mitochondria are absolutely required for their survival. To assess the actual dependency of these undifferentiated cells on mitochondrial function, we have performed an analysis of the hematopoiesis in a mouse mutant, named SDHD-ESR, with inducible deletion of the mitochondrial protein-encoding SdhD gene. This gene encodes one of the subunits of the mitochondrial complex II (MCII). In this study, we demonstrate that, in contrast to what has been previously established, survival of HSC, and also myeloid and B-lymphoid progenitors, depends on proper mitochondrial activity. In addition, gene expression analysis of these hematopoietic lineages in SDHD-ESR mutants calls into question the proposed activation of Hif1α in response to MCII dysfunction. PMID:27929539

  9. Fhf2 gene deletion causes temperature-sensitive cardiac conduction failure

    PubMed Central

    Park, David S.; Shekhar, Akshay; Marra, Christopher; Lin, Xianming; Vasquez, Carolina; Solinas, Sergio; Kelley, Kevin; Morley, Gregory; Goldfarb, Mitchell; Fishman, Glenn I.

    2016-01-01

    Fever is a highly conserved systemic response to infection dating back over 600 million years. Although conferring a survival benefit, fever can negatively impact the function of excitable tissues, such as the heart, producing cardiac arrhythmias. Here we show that mice lacking fibroblast growth factor homologous factor 2 (FHF2) have normal cardiac rhythm at baseline, but increasing core body temperature by as little as 3 °C causes coved-type ST elevations and progressive conduction failure that is fully reversible upon return to normothermia. FHF2-deficient cardiomyocytes generate action potentials upon current injection at 25 °C but are unexcitable at 40 °C. The absence of FHF2 accelerates the rate of closed-state and open-state sodium channel inactivation, which synergizes with temperature-dependent enhancement of inactivation rate to severely suppress cardiac sodium currents at elevated temperatures. Our experimental and computational results identify an essential role for FHF2 in dictating myocardial excitability and conduction that safeguards against temperature-sensitive conduction failure. PMID:27701382

  10. Upon Accounting for the Impact of Isoenzyme Loss, Gene Deletion Costs Anticorrelate with Their Evolutionary Rates

    PubMed Central

    Xia, Yu; Segrè, Daniel

    2017-01-01

    System-level metabolic network models enable the computation of growth and metabolic phenotypes from an organism’s genome. In particular, flux balance approaches have been used to estimate the contribution of individual metabolic genes to organismal fitness, offering the opportunity to test whether such contributions carry information about the evolutionary pressure on the corresponding genes. Previous failure to identify the expected negative correlation between such computed gene-loss cost and sequence-derived evolutionary rates in Saccharomyces cerevisiae has been ascribed to a real biological gap between a gene’s fitness contribution to an organism “here and now” and the same gene’s historical importance as evidenced by its accumulated mutations over millions of years of evolution. Here we show that this negative correlation does exist, and can be exposed by revisiting a broadly employed assumption of flux balance models. In particular, we introduce a new metric that we call “function-loss cost”, which estimates the cost of a gene loss event as the total potential functional impairment caused by that loss. This new metric displays significant negative correlation with evolutionary rate, across several thousand minimal environments. We demonstrate that the improvement gained using function-loss cost over gene-loss cost is explained by replacing the base assumption that isoenzymes provide unlimited capacity for backup with the assumption that isoenzymes are completely non-redundant. We further show that this change of the assumption regarding isoenzymes increases the recall of epistatic interactions predicted by the flux balance model at the cost of a reduction in the precision of the predictions. In addition to suggesting that the gene-to-reaction mapping in genome-scale flux balance models should be used with caution, our analysis provides new evidence that evolutionary gene importance captures much more than strict essentiality. PMID:28107392

  11. Multiple-Ring Digital Communication Network

    NASA Technical Reports Server (NTRS)

    Kirkham, Harold

    1992-01-01

    Optical-fiber digital communication network to support data-acquisition and control functions of electric-power-distribution networks. Optical-fiber links of communication network follow power-distribution routes. Since fiber crosses open power switches, communication network includes multiple interconnected loops with occasional spurs. At each intersection node is needed. Nodes of communication network include power-distribution substations and power-controlling units. In addition to serving data acquisition and control functions, each node acts as repeater, passing on messages to next node(s). Multiple-ring communication network operates on new AbNET protocol and features fiber-optic communication.

  12. Bortezomib plus melphalan and prednisone in elderly untreated patients with multiple myeloma: results of a multicenter phase 1/2 study.

    PubMed

    Mateos, María-Victoria; Hernández, José-M; Hernández, Miguel-T; Gutiérrez, Norma-C; Palomera, Luis; Fuertes, Marta; Díaz-Mediavilla, Joaquín; Lahuerta, Juan-J; de la Rubia, Javier; Terol, María-José; Sureda, Ana; Bargay, Joan; Ribas, Paz; de Arriba, Felipe; Alegre, Adrian; Oriol, Albert; Carrera, Dolores; García-Laraña, José; García-Sanz, Ramón; Bladé, Joan; Prósper, Felipe; Mateo, Gemma; Esseltine, Dixie-Lee; van de Velde, Helgi; San Miguel, Jesús-F

    2006-10-01

    Standard first-line treatment for elderly multiple myeloma (MM) patients ineligible for stem cell transplantation is melphalan plus prednisone (MP). However, complete responses (CRs) are rare. Bortezomib is active in patients with relapsed MM, including elderly patients. This phase 1/2 trial in 60 untreated MM patients aged at least 65 years (half older than 75 years) was designed to determine dosing, safety, and efficacy of bortezomib plus MP (VMP). VMP response rate was 89%, including 32% immunofixation-negative CRs, of whom half of the IF- CR patients analyzed achieved immunophenotypic remission (no detectable plasma cells at 10(-4) to 10(-5) sensitivity). VMP appeared to overcome the poor prognosis conferred by retinoblastoma gene deletion and IgH translocations. Results compare favorably with our historical control data for MP--notably, response rate (89% versus 42%), event-free survival at 16 months (83% versus 51%), and survival at 16 months (90% versus 62%). Side effects were predictable and manageable; principal toxicities were hematologic, gastrointestinal, and peripheral neuropathy and were more evident during early cycles and in patients aged 75 years or more. In conclusion, in elderly patients ineligible for transplantation, the combination of bortezomib plus MP appears significantly superior to MP, producing very high CR rates, including immunophenotypic CRs, even in patients with poor prognostic features.

  13. Multiple sclerosis - discharge

    MedlinePlus

    ... this page: //medlineplus.gov/ency/patientinstructions/000129.htm Multiple sclerosis - discharge To use the sharing features on this ... Your doctor has told you that you have multiple sclerosis (MS). This disease affects the brain and spinal ...

  14. Challenges of Parenting Multiples

    MedlinePlus

    ... the American Society for Reproductive Medicine Challenges of Parenting Multiples There are many psychological, social, and economic ... the unique challenges and rewards that come from parenting multiples. For more information on the medical aspects ...

  15. Twins, Triplets, Multiple Births

    MedlinePlus

    ... deliver by C-section, especially if there are three babies or more. Parenting multiples can be a challenge. Volunteer help and support groups for parents of multiples can help. Dept. of Health and ...

  16. MultipleColposcopyJCO

    Cancer.gov

    Performing multiple biopsies during a procedure known as colposcopy—visual inspection of the cervix—is more effective than performing only a single biopsy of the worst-appearing area for detecting cervical cancer precursors. This multiple biopsy approach

  17. Nuclear Translocation Sequence and Region in Autographa californica Multiple Nucleopolyhedrovirus ME53 That Are Important for Optimal Baculovirus Production

    PubMed Central

    Liu, Yang; de Jong, Jondavid; Nagy, Éva; Theilmann, David A.

    2016-01-01

    ABSTRACT Autographa californica multiple nucleopolyhedrovirus (AcMNPV) is in the family Baculoviridae, genus Alphabaculovirus. AcMNPV me53 is a highly conserved immediate early gene in all lepidopteran baculoviruses that have been sequenced and is transcribed up to late times postinfection. Although me53 is not essential for viral DNA synthesis, infectious budded virus (BV) production is greatly attenuated when it is deleted. ME53 associates with the nucleocapsid on both budded virus and occlusion-derived virus, but not with the virus envelope. ME53 colocalizes in plasma membrane foci with the envelope glycoprotein GP64 in a GP64-dependent manner. ME53 localizes in the cytoplasm early postinfection, and despite the lack of a reported nuclear localization signal (NLS), ME53 translocates to the nucleus at late times postinfection. To map determinants of ME53 that facilitate its nuclear translocation, recombinant AcMNPV bacmids containing a series of ME53 truncations, internal deletions, and peptides fused with hemagglutinin (HA) or green fluorescent protein (GFP) tags were constructed. Intracellular-localization studies identified residues within amino acids 109 to 137 at the N terminus of ME53 that acted as the nuclear translocation sequence (NTS), facilitating its nuclear transport at late times postinfection. The first 100 N-terminal amino acids and the last 50 C-terminal amino acids of ME53 are dispensable for high levels of budded virus production. The region within amino acids 101 to 398, which also contains the NTS, is critical for optimal levels of budded virus production. IMPORTANCE Baculovirus me53 is a conserved immediate early gene found in all sequenced lepidopteran alpha- and betabaculoviruses. We first identified residues within amino acids 109 to 137 at the N terminus that act as the ME53 nuclear translocation sequence (NTS) to facilitate its nuclear translocation and defined an internal region within amino acids 101 to 398, which includes the NTS, as

  18. Overexpression of N-acetylgalactosamine-4-sulphatase induces a multiple sulphatase deficiency in mucopolysaccharidosis-type-VI fibroblasts.

    PubMed

    Anson, D S; Muller, V; Bielicki, J; Harper, G S; Hopwood, J J

    1993-09-15

    High-titre stocks of an amphotropic retrovirus, constructed so as to express a full-length cDNA encoding the human lysosomal enzyme N-acetylgalactosamine-4-sulphatase (4-sulphatase) from the cytomegalovirus immediate early promoter, were used to infect skin fibroblasts from a clinically severe mucopolysaccharidosis type VI (MPS VI) patient. The infected MPS VI cells showed correction of the enzymic defect with the enzyme being expressed at high levels and in the correct subcellular compartment. Surprisingly this did not result in correction of glycosaminoglycan turnover as measured by accumulation of 35S in metabolically labelled cells. We demonstrate that this is apparently caused by an induced reduction of the activities of other lysosomal sulphatases, presumably due to competition for a sulphatase-specific processing mechanism by the over-expressed 4-sulphatase. The level of steroid sulphatase, which is a microsomal sulphatase, was also reduced. Infection of skin fibroblasts from a second, clinically mildly affected, MPS VI patient with the same virus also resulted in no significant change in the level of glycosaminoglycan storage. However, in this case the cause of the observed phenomenon was less clear. These results are of obvious practical importance when considering gene therapy for a sulphatase deficiency such as MPS VI and also provide possible new avenues for exploration of the processes involved in sulphatase synthesis and genetically determined multiple sulphatase deficiency.

  19. Overexpression of N-acetylgalactosamine-4-sulphatase induces a multiple sulphatase deficiency in mucopolysaccharidosis-type-VI fibroblasts.

    PubMed Central

    Anson, D S; Muller, V; Bielicki, J; Harper, G S; Hopwood, J J

    1993-01-01

    High-titre stocks of an amphotropic retrovirus, constructed so as to express a full-length cDNA encoding the human lysosomal enzyme N-acetylgalactosamine-4-sulphatase (4-sulphatase) from the cytomegalovirus immediate early promoter, were used to infect skin fibroblasts from a clinically severe mucopolysaccharidosis type VI (MPS VI) patient. The infected MPS VI cells showed correction of the enzymic defect with the enzyme being expressed at high levels and in the correct subcellular compartment. Surprisingly this did not result in correction of glycosaminoglycan turnover as measured by accumulation of 35S in metabolically labelled cells. We demonstrate that this is apparently caused by an induced reduction of the activities of other lysosomal sulphatases, presumably due to competition for a sulphatase-specific processing mechanism by the over-expressed 4-sulphatase. The level of steroid sulphatase, which is a microsomal sulphatase, was also reduced. Infection of skin fibroblasts from a second, clinically mildly affected, MPS VI patient with the same virus also resulted in no significant change in the level of glycosaminoglycan storage. However, in this case the cause of the observed phenomenon was less clear. These results are of obvious practical importance when considering gene therapy for a sulphatase deficiency such as MPS VI and also provide possible new avenues for exploration of the processes involved in sulphatase synthesis and genetically determined multiple sulphatase deficiency. PMID:8379921

  20. NGF-induction of the metalloproteinase-transin/stromelysin in PC12 cells: involvement of multiple protein kinases.

    PubMed

    Machida, C M; Scott, J D; Ciment, G

    1991-09-01

    In previous work, we found that nerve growth factor (NGF) induced expression of the mRNA transcript encoding the metalloproteinase transin/stromelysin in PC12 cells. Transin was found, moreover, to be a "late" gene product whose expression correlated with neurites extension. In this study, various aspects of the NGF intracellular signaling pathway in PC12 cells are investigated. We show that the protein kinase inhibitor staurosporine, but not various other kinase inhibitors, specifically blocked the NGF induction of transin. Preliminary characterization of this staurosporine-sensitive kinase suggest that it does not correspond to a tyrosine kinase, nor various serine kinases, and that it is involved both at the transcriptional and posttranscriptional levels of transin gene regulation. In contrast to these effects of staurosporine, various activators of protein kinases C and A augmented the NGF induction of transin. Similar effects of these kinase inhibitors and activators were also observed with the expression of various immediate-early genes that have been proposed to mediate the transcriptional effects of NGF, including c-fos and c-jun. These data suggest, therefore, that the NGF induction of transin mRNA expression involves multiple protein kinases acting at a number of postreceptor regulatory steps in the NGF signaling pathway.

  1. Choristoneura fumiferana multiple nucleopolyhedrovirus LEF-3-P143 complex can complement DNA replication and budded virus in an AcMNPV LEF-3-P143 double knockout bacmid.

    PubMed

    Yu, Mei; Carstens, Eric B

    2012-02-01

    Transient replication assays using Autographa californica multiple nucleopolyhedrovirus (AcMNPV) and Choristoneura fumiferana multiple nucleopolyhedrovirus (CfMNPV) genes suggested that the interactions between P143, the viral helicase and LEF-3, a ssDNA-binding protein, may represent virus species specificity determinants. P143 and LEF-3 are essential for DNA replication in these assays and together with IE-1, the major immediate-early transcription factor, may be part of the viral replisome. In the current report, a lef-3/p143 double-knockout AcMNPV bacmid was constructed that was defective for viral DNA replication and late gene expression. When the homologous lef-3/p143 CfMNPV genes were introduced into this double-knockout bacmid, DNA replication was restored but the level of replication was lower, budded virus production was delayed, and the yields were reduced from those in an AcMNPV-rescue bacmid. These results suggest that to maximize virus replication, baculovirus replisome assembly and function requires protein-protein interactions between P143 and LEF-3, and other viral proteins.

  2. Creating Multiple Processes from Multiple Intelligences.

    ERIC Educational Resources Information Center

    Wolffe, Robert; Robinson, Helja; Grant, Jean Marie

    1998-01-01

    Howard Gardner's multiple-intelligences theory stresses that all humans possess the various intelligences (linguistic, logical-mathematical, spatial, bodily-kinesthetic, musical, interpersonal, intrapersonal, and naturalist) to differing degrees, and most people can attain adequate competency levels. This article provides a sample checklist for…

  3. On Multiple Questions and Multiple WH Fronting.

    ERIC Educational Resources Information Center

    Rudin, Catherine

    An analysis of languages with multiple fronting of WH words (who, what, whom, etc.) looks in detail at Polish, Serbo-Croatian, Czech, Bulgarian (Slavic languages), and Romanian (a Romance language). In spite of their superficial similarity, the Slavic and East European languages that normally put all WH words at the beginning of clauses fall into…

  4. Complications of multiple myeloma.

    PubMed

    Bladé, Joan; Rosiñol, Laura

    2007-12-01

    Multiple myeloma, also known as myeloma or plasma cell myeloma, is a progressive hematologic disease. Complications of multiple myeloma include renal insufficiency, hematologic complications (anemia, bone marrow failure, bleeding disorders), infections, bone complications (pathologic fractures, spinal cord compression, hyercalcemia), and neurologic complications (spinal cord and nerve root compression, intracranial plasmacytomas, leptomeningeal involvement, among others). This article reviews these various complications connected to multiple myeloma, examining their various causes and possible treatment.

  5. Multiple Instance Fuzzy Inference

    DTIC Science & Technology

    2015-12-02

    INFERENCE A novel fuzzy learning framework that employs fuzzy inference to solve the problem of multiple instance learning (MIL) is presented. The...fuzzy learning framework that employs fuzzy inference to solve the problem of multiple instance learning (MIL) is presented. The framework introduces a...or learned from data. In multiple instance problems, the training data is ambiguously labeled. Instances are grouped into bags, labels of bags are

  6. Multiple alcohol dehydrogenases but no functional acetaldehyde dehydrogenase causing excessive acetaldehyde production from ethanol by oral streptococci.

    PubMed

    Pavlova, Sylvia I; Jin, Ling; Gasparovich, Stephen R; Tao, Lin

    2013-07-01

    Ethanol consumption and poor oral hygiene are risk factors for oral and oesophageal cancers. Although oral streptococci have been found to produce excessive acetaldehyde from ethanol, little is known about the mechanism by which this carcinogen is produced. By screening 52 strains of diverse oral streptococcal species, we identified Streptococcus gordonii V2016 that produced the most acetaldehyde from ethanol. We then constructed gene deletion mutants in this strain and analysed them for alcohol and acetaldehyde dehydrogenases by zymograms. The results showed that S. gordonii V2016 expressed three primary alcohol dehydrogenases, AdhA, AdhB and AdhE, which all oxidize ethanol to acetaldehyde, but their preferred substrates were 1-propanol, 1-butanol and ethanol, respectively. Two additional dehydrogenases, S-AdhA and TdhA, were identified with specificities to the secondary alcohol 2-propanol and threonine, respectively, but not to ethanol. S. gordonii V2016 did not show a detectable acetaldehyde dehydrogenase even though its adhE gene encodes a putative bifunctional acetaldehyde/alcohol dehydrogenase. Mutants with adhE deletion showed greater tolerance to ethanol in comparison with the wild-type and mutant with adhA or adhB deletion, indicating that AdhE is the major alcohol dehydrogenase in S. gordonii. Analysis of 19 additional strains of S. gordonii, S. mitis, S. oralis, S. salivarius and S. sanguinis showed expressions of up to three alcohol dehydrogenases, but none showed detectable acetaldehyde dehydrogenase, except one strain that showed a novel ALDH. Therefore, expression of multiple alcohol dehydrogenases but no functional acetaldehyde dehydrogenase may contribute to excessive production of acetaldehyde from ethanol by certain oral streptococci.

  7. Lethal multiple pterygium syndrome

    PubMed Central

    Joshi, Tulika; Noor, Nazia Nagori; Kural, Moolraj; Tripathi, Amita

    2016-01-01

    The multiple pterygium syndrome is consist of wide range of fetal malformations which have a genetic linkage. A defect in embryonic acetylcholine receptor which can be inherited as autosomal recessive, autosomal dominant, or X-linked fashion is the cause of this syndrome. We present a sporadic case of lethal multiple pterygium syndrome. PMID:27843868

  8. Multiple Frequency Parametric Sonar

    DTIC Science & Technology

    2015-09-28

    300003 1 MULTIPLE FREQUENCY PARAMETRIC SONAR STATEMENT OF GOVERNMENT INTEREST [0001] The invention described herein may be manufactured and...beams. However, the multiple nonlinear interactions are not taken advantage of in order to generate additional efficiencies, bandwidth, and SNR...array. [0050] It will be understood that many additional changes in details, materials , steps, and arrangements of parts which have been described

  9. Multiple density layered insulator

    DOEpatents

    Alger, Terry W.

    1994-01-01

    A multiple density layered insulator for use with a laser is disclosed wh provides at least two different insulation materials for a laser discharge tube, where the two insulation materials have different thermoconductivities. The multiple layer insulation materials provide for improved thermoconductivity capability for improved laser operation.

  10. Assessing Children's Multiplicative Thinking

    ERIC Educational Resources Information Center

    Hurst, Chris; Hurrell, Derek

    2016-01-01

    Multiplicative thinking is a "big idea" of mathematics that underpins much of the mathematics learned beyond the early primary school years. This paper reports on a current study that utilises an interview tool and a written quiz to gather data about children's multiplicative thinking. The development of the tools and some of the…

  11. Multiple density layered insulator

    DOEpatents

    Alger, T.W.

    1994-09-06

    A multiple density layered insulator for use with a laser is disclosed which provides at least two different insulation materials for a laser discharge tube, where the two insulation materials have different thermoconductivities. The multiple layer insulation materials provide for improved thermoconductivity capability for improved laser operation. 4 figs.

  12. Applying Multiple Intelligences

    ERIC Educational Resources Information Center

    Christodoulou, Joanna A.

    2009-01-01

    The ideas of multiple intelligences introduced by Howard Gardner of Harvard University more than 25 years ago have taken form in many ways, both in schools and in other sometimes-surprising settings. The silver anniversary of Gardner's learning theory provides an opportunity to reflect on the ways multiple intelligences theory has taken form and…

  13. Orchestrating Multiple Intelligences

    ERIC Educational Resources Information Center

    Moran, Seana; Kornhaber, Mindy; Gardner, Howard

    2006-01-01

    Education policymakers often go astray when they attempt to integrate multiple intelligences theory into schools, according to the originator of the theory, Howard Gardner, and his colleagues. The greatest potential of a multiple intelligences approach to education grows from the concept of a profile of intelligences. Each learner's intelligence…

  14. Constraining Multiple Grammars

    ERIC Educational Resources Information Center

    Hopp, Holger

    2014-01-01

    This article offers the author's commentary on the Multiple Grammars (MG) language acquisition theory proposed by Luiz Amaral and Tom Roeper in the present issue. Multiple Grammars advances the claim that optionality is a constitutive characteristic of any one grammar, with interlanguage grammars being perhaps the clearest examples of a…

  15. Reference genes for quantitative gene expression studies in multiple avian species.

    PubMed

    Olias, Philipp; Adam, Iris; Meyer, Anne; Scharff, Constance; Gruber, Achim D

    2014-01-01

    Quantitative real-time PCR (qPCR) rapidly and reliably quantifies gene expression levels across different experimental conditions. Selection of suitable reference genes is essential for meaningful normalization and thus correct interpretation of data. In recent years, an increasing number of avian species other than the chicken has been investigated molecularly, highlighting the need for an experimentally validated pan-avian primer set for reference genes. Here we report testing a set for 14 candidate reference genes (18S, ABL, GAPDH, GUSB, HMBS, HPRT, PGK1, RPL13, RPL19, RPS7, SDHA, TFRC, VIM, YWHAZ) on different tissues of the mallard (Anas platyrhynchos), domestic chicken (Gallus gallus domesticus), common crane (Grus grus), white-tailed eagle (Haliaeetus albicilla), domestic turkey (Meleagris gallopavo f. domestica), cockatiel (Nymphicus hollandicus), Humboldt penguin (Sphenicus humboldti), ostrich (Struthio camelus) and zebra finch (Taeniopygia guttata), spanning a broad range of the phylogenetic tree of birds. Primer pairs for six to 11 genes were successfully established for each of the nine species. As a proof of principle, we analyzed expression levels of 10 candidate reference genes as well as FOXP2 and the immediate early genes, EGR1 and CFOS, known to be rapidly induced by singing in the avian basal ganglia. We extracted RNA from microbiopsies of the striatal song nucleus Area X of adult male zebra finches after they had sang or remained silent. Using three different statistical algorithms, we identified five genes (18S, PGK1, RPS7, TFRC, YWHAZ) that were stably expressed within each group and also between the singing and silent conditions, establishing them as suitable reference genes. In conclusion, the newly developed pan-avian primer set allows accurate normalization and quantification of gene expression levels in multiple avian species.

  16. Elk-1 a transcription factor with multiple facets in the brain.

    PubMed

    Besnard, Antoine; Galan-Rodriguez, Beatriz; Vanhoutte, Peter; Caboche, Jocelyne

    2011-01-01

    The ternary complex factor (TCF) Elk-1 is a transcription factor that regulates immediate early gene (IEG) expression via the serum response element (SRE) DNA consensus site. Elk-1 is associated with a dimer of serum response factor (SRF) at the SRE site, and its phosphorylation occurs at specific residues in response to mitogen-activated protein kinases (MAPKs), including c-Jun-N terminal kinase (JNK), p38/MAPK, and extracellular-signal regulated kinase (ERK). This phosphorylation event is critical for triggering SRE-dependent transcription. Although MAPKs are fundamental actors for the instatement and maintenance of memory, and much investigation of their downstream signaling partners have been conducted, no data yet clearly implicate Elk-1 in these processes. This is partly due to the complexity of Elk-1 sub-cellular localization, and hence functions, within neurons. Elk-1 is present in its resting state in the cytoplasm, where it colocalizes with mitochondrial proteins or microtubules. In this particular sub-cellular compartment, overexpression of Elk-1 is toxic for neuronal cells. When phosphorylated by the MAPK/ERK, Elk-1 translocates to the nucleus where it is implicated in regulating chromatin remodeling, SRE-dependent transcription, and neuronal differentiation. Another post-translational modification is the conjugation to SUMO (Small Ubiquitin-like MOdifier), which relocalizes Elk-1 in the cytoplasm. Thus, Elk-1 plays a dual role in neuronal functions: pro-apoptotic within the cytoplasm, and pro-differentiation within the nucleus. To address the role of Elk-1 in the brain, one must be aware of its multiple facets, and design molecular tools that will shut down Elk-1 expression, trafficking, or activation, in specific neuronal compartments. We summarize in this review the known molecular functions of Elk-1, its regulation in neuronal cells, and present evidence of its possible implication in model systems of synaptic plasticity, learning, but also in

  17. Multiple scattering technique lidar

    NASA Technical Reports Server (NTRS)

    Bissonnette, Luc R.

    1992-01-01

    The Bernouilli-Ricatti equation is based on the single scattering description of the lidar backscatter return. In practice, especially in low visibility conditions, the effects of multiple scattering can be significant. Instead of considering these multiple scattering effects as a nuisance, we propose here to use them to help resolve the problems of having to assume a backscatter-to-extinction relation and specifying a boundary value for a position far remote from the lidar station. To this end, we have built a four-field-of-view lidar receiver to measure the multiple scattering contributions. The system has been described in a number of publications that also discuss preliminary results illustrating the multiple scattering effects for various environmental conditions. Reported here are recent advances made in the development of a method of inverting the multiple scattering data for the determination of the aerosol scattering coefficient.

  18. Group 2 coronaviruses prevent immediate early interferon induction by protection of viral RNA from host cell recognition

    SciTech Connect

    Versteeg, Gijs A.; Bredenbeek, Peter J.; Worm, Sjoerd H.E. van den; Spaan, Willy J.M. . E-mail: w.j.m.spaan@lumc.nl

    2007-04-25

    Many viruses encode antagonists to prevent interferon (IFN) induction. Infection of fibroblasts with the murine hepatitis coronavirus (MHV) and SARS-coronavirus (SARS-CoV) did not result in nuclear translocation of interferon-regulatory factor 3 (IRF3), a key transcription factor involved in IFN induction, and induction of IFN mRNA transcription. Furthermore, MHV and SARS-CoV infection could not prevent IFN induction by poly (I:C) or Sendai virus, suggesting that these CoVs do not inactivate IRF3-mediated transcription regulation, but apparently prevent detection of replicative RNA by cellular sensory molecules. Our data indicate that shielding of viral RNA to host cell sensors might be the main general mechanism for coronaviruses to prevent IFN induction.

  19. Effects of aging and walnut diet on DNA methylation and expression of immediate-early genes in critical brain regions

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Emerging evidence indicates a direct link between age-associated changes in epigenetic mechanisms and onset of neurodegenerative diseases, and that these genomic modulations are directly affected by the diet. Diets deficient in folate, choline and methionine, or the trace elements zinc and selenium,...

  20. Aging and walnut-rich diet supplementation affects the expression of immediate-early genes in critical brain regions

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Emerging evidence indicates a direct link between age-associated changes in epigenetic mechanisms and onset of neurodegenerative diseases, and that these genomic modulations are directly affected by diet. Diets deficient in folate, choline and methionine, or the trace elements zinc and selenium, are...

  1. Multiple frame cluster tracking

    NASA Astrophysics Data System (ADS)

    Gadaleta, Sabino; Klusman, Mike; Poore, Aubrey; Slocumb, Benjamin J.

    2002-08-01

    Tracking large number of closely spaced objects is a challenging problem for any tracking system. In missile defense systems, countermeasures in the form of debris, chaff, spent fuel, and balloons can overwhelm tracking systems that track only individual objects. Thus, tracking these groups or clusters of objects followed by transitions to individual object tracking (if and when individual objects separate from the groups) is a necessary capability for a robust and real-time tracking system. The objectives of this paper are to describe the group tracking problem in the context of multiple frame target tracking and to formulate a general assignment problem for the multiple frame cluster/group tracking problem. The proposed approach forms multiple clustering hypotheses on each frame of data and base individual frame clustering decisions on the information from multiple frames of data in much the same way that MFA or MHT work for individual object tracking. The formulation of the assignment problem for resolved object tracking and candidate clustering methods for use in multiple frame cluster tracking are briefly reviewed. Then, three different formulations are presented for the combination of multiple clustering hypotheses on each frame of data and the multiple frame assignments of clusters between frames.

  2. Multiple intracranial enterogenous cysts.

    PubMed Central

    Walls, T J; Purohit, D P; Aji, W S; Schofield, I S; Barwick, D D

    1986-01-01

    The case of a 40-year-old woman with increasing ataxia is described. Although the clinical presentation and evoked response studies raised the possibility of multiple sclerosis, further investigation revealed multiple cystic intracranial lesions. Surgical excision of one of the lesions relieved the patient's symptoms. Histological examination revealed that this was an enterogenous cyst. Although single cysts of this type have rarely been reported occurring in the posterior cranial fossa, the occurrence of multiple lesions, some in the supratentorial compartment, appears to be unique. Images PMID:3701354

  3. Multiple Myeloma and Diabetes

    PubMed Central

    Issa, Zeinab A.; Zantout, Mira S.; Azar, Sami T.

    2011-01-01

    Multiple myeloma is a malignant plasma cell disorder that accounts for approximately 10% of all hematologic cancers. It is characterized by accumulation of clonal plasma cells, predominantly in the bone marrow. The prevalence of type 2 diabetes is increasing; therefore, it is expected that there will be an increase in the diagnosis of multiple myeloma with concomitant diabetes mellitus. The treatment of multiple myeloma and diabetes mellitus is multifaceted. The coexistence of the two conditions in a patient forms a major challenge for physicians. PMID:22363889

  4. Vision and multiple sclerosis.

    PubMed

    Hickman, Simon J; Raoof, Naz; McLean, Rebecca J; Gottlob, Irene

    2014-01-01

    Multiple sclerosis can affect vision in many ways, including optic neuritis, chronic optic neuropathy, retrochiasmal visual field defects, higher order cortical processing, double vision, nystagmus and also by related ocular conditions such as uveitis. There are also side effects from recently introduced multiple sclerosis treatments that can affect vision. This review will discuss all these aspects and how they come together to cause visual symptoms. It will then focus on practical aspects of how to recognise when there is a vision problem in a multiple sclerosis patient and on what treatments are available to improve vision.

  5. Multiple vitamin overdose

    MedlinePlus

    ... ingredient in a multiple vitamin supplement can be toxic in large amounts, but the most serious risk ... chap 9. Velez LI, O'Connell EJ. Heavy metals. In: Marx JA, Hockberger RS, Walls RM, eds. ...

  6. The Multiplicative Situation

    ERIC Educational Resources Information Center

    Hurst, Chris

    2015-01-01

    The relationships between three critical elements, and the associated mathematical language, to assist students to make the critical transition from additive to multiplicative thinking are examined in this article by Chris Hurst.

  7. Taking multiple medicines safely

    MedlinePlus

    ... medlineplus.gov/ency/patientinstructions/000883.htm Taking multiple medicines safely To use the sharing features on this ... directed. Why you may Need More Than one Medicine You may take more than one medicine to ...

  8. Pomalidomide for Multiple Myeloma

    Cancer.gov

    A summary of results from a phase III trial that compared the combination of pomalidomide (Pomalyst®) and low-dose dexamethasone versus high-dose dexamethasone alone in patients with multiple myeloma that has progressed despite other treatments.

  9. Multiple shell fusion targets

    DOEpatents

    Lindl, J.D.; Bangerter, R.O.

    1975-10-31

    Multiple shell fusion targets for use with electron beam and ion beam implosion systems are described. The multiple shell targets are of the low-power type and use a separate relatively low Z, low density ablator at large radius for the outer shell, which reduces the focusing and power requirements of the implosion system while maintaining reasonable aspect ratios. The targets use a high Z, high density pusher shell placed at a much smaller radius in order to obtain an aspect ratio small enough to protect against fluid instability. Velocity multiplication between these shells further lowers the power requirements. Careful tuning of the power profile and intershell density results in a low entropy implosion which allows breakeven at low powers. For example, with ion beams as a power source, breakeven at 10-20 Terrawatts with 10 MeV alpha particles for imploding a multiple shell target can be accomplished.

  10. What Is Multiple Myeloma?

    MedlinePlus

    ... Multiple myeloma is a cancer formed by malignant plasma cells. Normal plasma cells are found in the bone marrow and ... to an infection, they mature and change into plasma cells. Plasma cells make the antibodies (also called ...

  11. Multiple Myeloma Symptoms

    MedlinePlus

    ... Investors Our Model Testimonials Investor Resources Investor Spotlight Financials Estate Planning Investor Services MMRF EVENTS MMRF Events Team for Cures Signature Events Independent Events Featured Supporters Spirit of Hope Honorees Education ... Partners Careers ABOUT MULTIPLE MYELOMA What ...

  12. Understanding Multiplication of Fractions.

    ERIC Educational Resources Information Center

    Sweetland, Robert D.

    1984-01-01

    Discussed the use of Cuisenaire rods in teaching the multiplication of fractions. Considers whole number times proper fraction, proper fraction multiplied by proper fraction, mixed number times proper fraction, and mixed fraction multiplied by mixed fractions. (JN)

  13. Mobile multiple access study

    NASA Technical Reports Server (NTRS)

    1977-01-01

    Multiple access techniques (FDMA, CDMA, TDMA) for the mobile user and attempts to identify the current best technique are discussed. Traffic loading is considered as well as voice and data modulation and spacecraft and system design. Emphasis is placed on developing mobile terminal cost estimates for the selected design. In addition, design examples are presented for the alternative techniques of multiple access in order to compare with the selected technique.

  14. Multiple pterygium syndrome.

    PubMed Central

    Penchaszadeh, V B; Salszberg, B

    1981-01-01

    The multiple pterygium syndrome is a rare autosomal recessive condition characterised by arthrogryposis multiplex congenita, pterygia of the neck, fingers, and antecubital, popliteal, and intercrural areas, growth retardation, and facial, vertebral, and genital anomalies. We present two unrelated patients of 17 and 6 years of age, respectively, affected with this condition. We describe the natural history of their disorder since birth and review the spectrum of phenotypic variation of the multiple pterygium syndrome in 25 published cases. Images PMID:7334504

  15. Multiple Indicators, Multiple Causes Measurement Error Models

    PubMed Central

    Tekwe, Carmen D.; Carter, Randy L.; Cullings, Harry M.; Carroll, Raymond J.

    2014-01-01

    Multiple Indicators, Multiple Causes Models (MIMIC) are often employed by researchers studying the effects of an unobservable latent variable on a set of outcomes, when causes of the latent variable are observed. There are times however when the causes of the latent variable are not observed because measurements of the causal variable are contaminated by measurement error. The objectives of this paper are: (1) to develop a novel model by extending the classical linear MIMIC model to allow both Berkson and classical measurement errors, defining the MIMIC measurement error (MIMIC ME) model, (2) to develop likelihood based estimation methods for the MIMIC ME model, (3) to apply the newly defined MIMIC ME model to atomic bomb survivor data to study the impact of dyslipidemia and radiation dose on the physical manifestations of dyslipidemia. As a by-product of our work, we also obtain a data-driven estimate of the variance of the classical measurement error associated with an estimate of the amount of radiation dose received by atomic bomb survivors at the time of their exposure. PMID:24962535

  16. Multiple stage multiple filter hydrate store

    DOEpatents

    Bjorkman, H.K. Jr.

    1983-05-31

    An improved hydrate store for a metal halogen battery system is disclosed which employs a multiple stage, multiple filter means for separating the halogen hydrate from the liquid used in forming the hydrate. The filter means is constructed in the form of three separate sections which combine to substantially cover the interior surface of the store container. Exit conduit means is provided in association with the filter means for transmitting liquid passing through the filter means to a hydrate former subsystem. The hydrate former subsystem combines the halogen gas generated during the charging of the battery system with the liquid to form the hydrate in association with the store. Relief valve means is interposed in the exit conduit means for controlling the operation of the separate sections of the filter means, such that the liquid flow through the exit conduit means from each of the separate sections is controlled in a predetermined sequence. The three separate sections of the filter means operate in three discrete stages to provide a substantially uniform liquid flow to the hydrate former subsystem during the charging of the battery system. The separation of the liquid from the hydrate causes an increase in the density of the hydrate by concentrating the hydrate along the filter means. 7 figs.

  17. Multiple indicators, multiple causes measurement error models

    DOE PAGES

    Tekwe, Carmen D.; Carter, Randy L.; Cullings, Harry M.; ...

    2014-06-25

    Multiple indicators, multiple causes (MIMIC) models are often employed by researchers studying the effects of an unobservable latent variable on a set of outcomes, when causes of the latent variable are observed. There are times, however, when the causes of the latent variable are not observed because measurements of the causal variable are contaminated by measurement error. The objectives of this study are as follows: (i) to develop a novel model by extending the classical linear MIMIC model to allow both Berkson and classical measurement errors, defining the MIMIC measurement error (MIMIC ME) model; (ii) to develop likelihood-based estimation methodsmore » for the MIMIC ME model; and (iii) to apply the newly defined MIMIC ME model to atomic bomb survivor data to study the impact of dyslipidemia and radiation dose on the physical manifestations of dyslipidemia. Finally, as a by-product of our work, we also obtain a data-driven estimate of the variance of the classical measurement error associated with an estimate of the amount of radiation dose received by atomic bomb survivors at the time of their exposure.« less

  18. Multiple stage multiple filter hydrate store

    DOEpatents

    Bjorkman, Jr., Harry K.

    1983-05-31

    An improved hydrate store for a metal halogen battery system is disclosed which employs a multiple stage, multiple filter means or separating the halogen hydrate from the liquid used in forming the hydrate. The filter means is constructed in the form of three separate sections which combine to substantially cover the interior surface of the store container. Exit conduit means is provided in association with the filter means for transmitting liquid passing through the filter means to a hydrate former subsystem. The hydrate former subsystem combines the halogen gas generated during the charging of the battery system with the liquid to form the hydrate in association with the store. Relief valve means is interposed in the exit conduit means for controlling the operation of the separate sections of the filter means, such that the liquid flow through the exit conduit means from each of the separate sections is controlled in a predetermined sequence. The three separate sections of the filter means operate in three discrete stages to provide a substantially uniform liquid flow to the hydrate former subsystem during the charging of the battery system. The separation of the liquid from the hydrate causes an increase in the density of the hydrate by concentrating the hydrate along the filter means.

  19. Multiple indicators, multiple causes measurement error models

    SciTech Connect

    Tekwe, Carmen D.; Carter, Randy L.; Cullings, Harry M.; Carroll, Raymond J.

    2014-06-25

    Multiple indicators, multiple causes (MIMIC) models are often employed by researchers studying the effects of an unobservable latent variable on a set of outcomes, when causes of the latent variable are observed. There are times, however, when the causes of the latent variable are not observed because measurements of the causal variable are contaminated by measurement error. The objectives of this study are as follows: (i) to develop a novel model by extending the classical linear MIMIC model to allow both Berkson and classical measurement errors, defining the MIMIC measurement error (MIMIC ME) model; (ii) to develop likelihood-based estimation methods for the MIMIC ME model; and (iii) to apply the newly defined MIMIC ME model to atomic bomb survivor data to study the impact of dyslipidemia and radiation dose on the physical manifestations of dyslipidemia. Finally, as a by-product of our work, we also obtain a data-driven estimate of the variance of the classical measurement error associated with an estimate of the amount of radiation dose received by atomic bomb survivors at the time of their exposure.

  20. Trousseau's syndrome: multiple definitions and multiple mechanisms

    PubMed Central

    2007-01-01

    In 1865, Armand Trousseau noted that unexpected or migratory thrombophlebitis could be a forewarning of an occult visceral malignancy. An analysis by Sack and colleagues in 1977 extended the term Trousseau's syndrome to include chronic disseminated intravascular coagulopathy associated with microangiopathy, verrucous endocarditis, and arterial emboli in patients with cancer, often occurring with mucin-positive carcinomas. In recent times the term has been ascribed to various clinical situations, ranging all the way from these classic descriptions to any kind of coagulopathy occurring in the setting of any kind of malignancy. These multiple definitions of Trousseau's syndrome are partly the consequence of multiple pathophysiologic mechanisms that apparently contribute to the hypercoagulability associated with cancer. Even the classic syndrome probably represents a spectrum of disorders, ranging from exaggerated fluid-phased thrombosis dependent on prothrombotic agents such as tissue factor to a platelet- and endotheliumum-based selectin-dependent microangiopathy associated with mucin-producing carcinomas, along with thrombin and fibrin production. Also considered here are recent hypotheses about genetic pathways within tumor cells that might trigger these thrombotic phenomena, and the reasons why therapy with heparins of various kinds remain the preferred treatment, probably because of their salutary actions on several of the proposed pathologic mechanisms. PMID:17496204

  1. The role of the PI3K-Akt signal transduction pathway in Autographa californica multiple nucleopolyhedrovirus infection of Spodoptera frugiperda cells

    SciTech Connect

    Xiao Wei; Yang Yi; Weng Qingbei; Lin Tiehao; Yuan Meijin; Yang Kai; Pang Yi

    2009-08-15

    Many viruses activate the phosphatidylinositol 3-kinase (PI3K)-Akt signaling pathway, thereby modulating diverse downstream signaling pathways associated with antiapoptosis, proliferation, cell cycling, protein synthesis and glucose metabolism, in order to augment their replication. To date, the role of the PI3K-Akt pathway in Baculovirus replication has not been defined. In the present study, we demonstrate that infection of Sf9 cells with Autographa californica multiple nucleopolyhedrovirus (AcMNPV) elevated cellular Akt phosphorylation at 1 h post-infection. The maximum Akt phosphorylation occurred at 6 h post-infection and remained unchanged until 18 h post-infection. The PI3K-specific inhibitor, LY294002, suppressed Akt phosphorylation in a dose-dependent manner, suggesting that AcMNPV-induced Akt phosphorylation is PI3K-dependent. The inhibition of PI3K-Akt activation by LY294002 significantly reduced the viral yield, including a reduction in budded viruses and occlusion bodies. The virus production was reduced only when the inhibitor was added within 24 h of infection, implying that activation of PI3K occurred early in infection. Correspondingly, both viral DNA replication and late (VP39) and very late (POLH) viral protein expression were impaired by LY294002 treatment; LY294002 had no effect on immediate-early (IE1) and early-late (GP64) protein expression. These results demonstrate that the PI3K-Akt pathway is required for efficient Baculovirus replication.

  2. Use of Multiple Correlation Analysis and Multiple Regression Analysis.

    ERIC Educational Resources Information Center

    Huberty, Carl J.; Petoskey, Martha D.

    1999-01-01

    Distinguishes between multiple correlation and multiple regression analysis. Illustrates suggested information reporting methods and reviews the use of regression methods when dealing with problems of missing data. (SK)

  3. Enhancing multiple disciplinary teamwork.

    PubMed

    Weaver, Terri E

    2008-01-01

    Multiple disciplinary research provides an opportunity to bring together investigators across disciplines to provide new views and develop innovative approaches to important questions. Through this shared experience, novel paradigms are formed, original frameworks are developed, and new language is generated. Integral to the successful construction of effective cross-disciplinary teams is the recognition of antecedent factors that affect the development of the team such as intrapersonal, social, physical environmental, organizational, and institutional influences. Team functioning is enhanced with well-developed behavioral, affective, interpersonal, and intellectual processes. Outcomes of effective multiple disciplinary research teams include novel ideas, integrative models, new training programs, institutional change, and innovative policies that can also influence the degree to which antecedents and processes contribute to team performance. Ongoing evaluation of team functioning and achievement of designated outcomes ensures the continued development of the multiple disciplinary team and confirmation of this approach as important to the advancement of science.

  4. Outcomes in patients with multiple myeloma with TP53 deletion after autologous hematopoietic stem cell transplant.

    PubMed

    Gaballa, Sameh; Saliba, Rima M; Srour, Samer; Lu, Gary; Brammer, Jonathan E; Shah, Nina; Bashir, Qaiser; Patel, Krina; Bock, Fabian; Parmar, Simrit; Hosing, Chitra; Popat, Uday; Delgado, Ruby; Rondon, Gabriela; Shah, Jatin J; Manasanch, Elisabet E; Orlowski, Robert Z; Champlin, Richard; Qazilbash, Muzaffar H

    2016-10-01

    TP53 gene deletion is associated with poor outcomes in multiple myeloma (MM). We report the outcomes of patients with MM with and without TP53 deletion who underwent immunomodulatory drug (IMiD) and/or proteasome inhibitor (PI) induction followed by autologous hematopoietic stem cell transplant (auto-HCT). We identified 34 patients with MM and TP53 deletion who underwent IMiD and/or PI induction followed by auto-HCT at our institution during 2008-2014. We compared their outcomes with those of control patients (n = 111) with MM without TP53 deletion. Median age at auto-HCT was 59 years in the TP53-deletion group and 58 years in the control group (P = 0.4). Twenty-one patients (62%) with TP53 deletion and 69 controls (62%) achieved at least partial remission before auto-HCT (P = 0.97). Twenty-three patients (68%) with TP53 deletion and 47 controls (42%) had relapsed disease at auto-HCT (P = 0.01). Median progression-free survival was 8 months for patients with TP53 deletion and 28 months for controls (P < 0.001). Median overall survival was 21 months for patients with TP53 deletion and 56 months for controls (P < 0.001). On multivariate analysis of both groups, TP53 deletion (hazard ratio 3.4, 95% confidence interval 1.9-5.8, P < 0.001) and relapsed disease at auto-HCT (hazard ratio 2.0, 95% confidence interval 1.2-3.4, P = 0.008) were associated with a higher risk of earlier progression. In MM patients treated with PI and/or IMiD drugs, and auto-HCT, TP53 deletion and relapsed disease at the time of auto-HCT are independent predictors of progression. Novel approaches should be evaluated in this high-risk population. Am. J. Hematol. 91:E442-E447, 2016. © 2016 Wiley Periodicals, Inc.

  5. Multiple sort flow cytometer

    DOEpatents

    Engh, G. van den; Esposito, R.J.

    1996-01-09

    A flow cytometer utilizes multiple lasers for excitation and respective fluorescence of identified dyes bonded to specific cells or events to identify and verify multiple events to be sorted from a sheath flow and droplet stream. Once identified, verified and timed in the sheath flow, each event is independently tagged upon separation from the flow by an electrical charge of +60, +120, or +180 volts and passed through oppositely charged deflection plates with ground planes to yield a focused six way deflection of at least six events in a narrow plane. 8 figs.

  6. Neutron multiplicity analysis tool

    SciTech Connect

    Stewart, Scott L

    2010-01-01

    I describe the capabilities of the EXCOM (EXcel based COincidence and Multiplicity) calculation tool which is used to analyze experimental data or simulated neutron multiplicity data. The input to the program is the count-rate data (including the multiplicity distribution) for a measurement, the isotopic composition of the sample and relevant dates. The program carries out deadtime correction and background subtraction and then performs a number of analyses. These are: passive calibration curve, known alpha and multiplicity analysis. The latter is done with both the point model and with the weighted point model. In the current application EXCOM carries out the rapid analysis of Monte Carlo calculated quantities and allows the user to determine the magnitude of sample perturbations that lead to systematic errors. Neutron multiplicity counting is an assay method used in the analysis of plutonium for safeguards applications. It is widely used in nuclear material accountancy by international (IAEA) and national inspectors. The method uses the measurement of the correlations in a pulse train to extract information on the spontaneous fission rate in the presence of neutrons from ({alpha},n) reactions and induced fission. The measurement is relatively simple to perform and gives results very quickly ({le} 1 hour). By contrast, destructive analysis techniques are extremely costly and time consuming (several days). By improving the achievable accuracy of neutron multiplicity counting, a nondestructive analysis technique, it could be possible to reduce the use of destructive analysis measurements required in safeguards applications. The accuracy of a neutron multiplicity measurement can be affected by a number of variables such as density, isotopic composition, chemical composition and moisture in the material. In order to determine the magnitude of these effects on the measured plutonium mass a calculational tool, EXCOM, has been produced using VBA within Excel. This

  7. [Multiple intracranial arteriovenous malformation].

    PubMed

    Gelabert-González, Miguel; Santin-Amo, José María; Román-Pena, Paula; Vázquez Herrero, Fernando

    2015-01-01

    Multiple cerebral arteriovenous malformations (AVMs) are thought to be exceedingly rare lesions and have usually been reported as single cases. The incidence of multiple cerebral AVMs in major series ranges from 0.3% to 9% and, in the majority of cases, these malformations are associated with other vascular anomalies of the brain or soft tissues. We report a 62-year-old woman that presented with a left temporal haemorrhage. Angiography showed 3 AVMs located in the left temporal lobe, left cerebellar hemisphere and right temporal lobe. The lesions were treated with radiosurgery.

  8. Multiple Endocrine Neoplasia Syndromes

    PubMed Central

    Pont, Allan

    1980-01-01

    The multiple endocrine neoplasia (MEN) syndromes consist of three distinct disease entities. They have in common adenomatous, carcinomatous or hyperplastic involvement of a variety of endocrine glands, and an autosomal dominant inheritance. MEN I includes hyperparathyroidism, islet cell and pituitary tumors. The components of MEN IIa are hyperparathyroidism, medullary thyroid carcinoma and pheochromocytoma. MEN IIb includes multiple neuromas, medullary thyroid carcinoma and pheochromocytoma. Effective tests are available for the early detection of components of the syndromes in potentially affected patients. Screening can lead to therapeutic intervention before clinical sequelae ensue. PMID:6247851

  9. Multiple sort flow cytometer

    DOEpatents

    Van den Engh, Ger; Esposito, Richard J.

    1996-01-01

    A flow cytometer utilizes multiple lasers for excitation and respective fluorescence of identified dyes bonded to specific cells or events to identify and verify multiple events to be sorted from a sheath flow and droplet stream. Once identified, verified and timed in the sheath flow, each event is independently tagged upon separation from the flow by an electrical charge of +60, +120, or +180 volts and passed through oppositely charged deflection plates with ground planes to yield a focused six way deflection of at least six events in a narrow plane.

  10. Multiple Docking Adapter Illustration

    NASA Technical Reports Server (NTRS)

    1972-01-01

    This cutaway drawing details the major characteristics of the Skylab Multiple Docking Adapter (MDA). The MDA, built under the direction of the Marshall Space Flight Center, housed the control units for the Apollo Telescope Mount (ATM), Earth Resources Experiment Package (EREP), and Zero-Gravity Materials Processing Facility, and provided a docking port for the Apollo Command Module (CM).

  11. A Multiple Intelligence Approach.

    ERIC Educational Resources Information Center

    Nuzzi, Ronald

    1997-01-01

    Describes multiple intelligence instruction (MII), based on the theory that humans possess seven intelligences: visual, musical, logical-mathematical, intrapersonal, interpersonal, linguistic, and bodily-kinesthetic. Argues that current methods of assessment are deficit-based and, therefore, not helpful in assessing MII students. Describes an…

  12. Universality of particle multiplicities

    NASA Astrophysics Data System (ADS)

    Goulianos, K.

    1994-09-01

    We discuss the scaling properties and universality aspects of the rapidity and multiplicity distributions of particles produced in high energy hadronic and e(+)e(-) interactions. This paper is based on material presented in three lectures on pomeron phenomenology, which included a review of traditional soft pomeron physics and selected topics on hard diffraction processes probing the structure function of the pomeron.

  13. Multiple personality disorder.

    PubMed

    Salama, A A

    1995-02-01

    This paper presents a description of Multiple Personality Disorder--its development, etiology, and presentation. The paper stresses the criteria for diagnosis that can help professionals to identify individuals at an early stage. An overview of treatment approaches and indications for hospitalization, length of treatment, and goals are also explained.

  14. Hyperamylasaemia in multiple myeloma.

    PubMed

    Bloemendal, H J; Lobatto, S

    1996-07-01

    A 71-year-old woman, known to have multiple myeloma, was admitted because of fever, abdominal pain and hyperamylasaemia and hyperamylasuria. She was diagnosed as having acute pancreatitis. Because the diagnosis could not be confirmed, and serum lipase was normal, it appeared that this patient had developed an amylase-producing myeloma lesion in the pelvis.

  15. Multiple organ dysfunction syndrome.

    PubMed

    Parke, A L; Liu, P T; Parke, D V

    2003-01-01

    Multiple organ dysfunction syndrome, including acute respiratory distress syndrome (ARDS) and renal failure, is described, its clinical features outlined, its origins in tissue oxidative stress following severe infections, surgical trauma, ionizing radiation, high-dosage drugs and chemicals, severe hemorrhage, etc., are defined, and its prevention and treatment prescribed.

  16. Caring for Multiples

    MedlinePlus

    ... in online discussions, meet other NICU families. Mothering Multiples: Breastfeeding and Caring for Twins or More, by Karen Kerkhoff Gromada (La Leche League International, 1999). Mothers of Super Twins (MOST) A support network of families who have or are expecting triplets, ...

  17. Preparing for Multiple Births

    MedlinePlus

    ... lives. Preparing for Childbirth Getting ready for a multiple birth may seem overwhelming, and concerns about pre-term labor can be additional burdens for you to bear. The best reassurance is knowing that you have a network of support around you: capable doctors, a caring ...

  18. Multiple Grammars and MOGUL

    ERIC Educational Resources Information Center

    Truscott, John

    2014-01-01

    Optionality is a central phenomenon in second language acquisition (SLA), for which any adequate theory must account. Amaral and Roeper (this issue; henceforth A&R) offer an appealing approach to it, using Roeper's Multiple Grammars Theory, which was created with first language in mind but which extends very naturally to SLA. They include…

  19. Assessing Multiple Intelligences.

    ERIC Educational Resources Information Center

    Martin, William C.

    This paper explains Howard Gardner's Theory of Multiple Intelligences (MI) and discusses questions raised about MI theory in regard to validity, assessment, and implications for instructional activities. MI theory asserts that human cognitive competence is best described in terms of a set of abilities, talents, and mental skills that each child…

  20. Multiple gap photovoltaic device

    DOEpatents

    Dalal, Vikram L.

    1981-01-01

    A multiple gap photovoltaic device having a transparent electrical contact adjacent a first cell which in turn is adjacent a second cell on an opaque electrical contact, includes utilizing an amorphous semiconductor as the first cell and a crystalline semiconductor as the second cell.

  1. Automatic multiple applicator electrophoresis

    NASA Technical Reports Server (NTRS)

    Grunbaum, B. W.

    1977-01-01

    Easy-to-use, economical device permits electrophoresis on all known supporting media. System includes automatic multiple-sample applicator, sample holder, and electrophoresis apparatus. System has potential applicability to fields of taxonomy, immunology, and genetics. Apparatus is also used for electrofocusing.

  2. Multiple Primary Cancer Monograph

    Cancer.gov

    To identify groups of cancer survivors that are at increased risk for multiple primary cancers, investigators led an effort to provide the first comprehensive population-based analysis of the risk of subsequent cancer in the U.S., resulting in a monograph.

  3. Multiple sclerosis and pregnancy.

    PubMed

    Popescu, C D

    2014-01-01

    Multiple sclerosis is one of the main reasons for invalidation of young adults of both sexes. The disease is more common in women than in men. The illness begins most frequently in patients between the ages of 20 and 40 years, which is also the most fertile period for women. MS is an immune-mediated disease with chronic evolution marked by exacerbations and remissions that amplify the degree of disability. The most common clinical picture is the one with relapse and remission whose evolution is greatly improved after immunomodulatory treatment. We have revised the literature together with the data from the national multiple sclerosis society and the cases that are in the National Programme of Multiple Sclerosis, mainly the ones that are assigned to the regional center of Iaşi, at the Neurology Clinic inside the Clinical Rehabilitation Hospital Iaşi. Pregnancy is quite frequent in female patients with MS. Certain risks are present during pregnancy, birth and breastfeeding and certain protocols must be applied, such as interrupting the immunomodulatory treatment before the conception. Child delivery must be closely monitored and it must take into consideration the dysfunction that the patient has and be adapted to the existing deficits. There are some methods that may be used during delivery for female patients with multiple sclerosis in order to make this process smooth and reduce the risk of postpartum complications. Multiple sclerosis is an invalidating disease, with a high prevalence in women. Pregnancy in patients with MS is not such a natural phenomenon as in a healthy female and it requires a multidisciplinary team in order to ensure the safety of both the mother and the newborn.

  4. Small Multiples with Gaps.

    PubMed

    Meulemans, Wouter; Dykes, Jason; Slingsby, Aidan; Turkay, Cagatay; Wood, Jo

    2017-01-01

    Small multiples enable comparison by providing different views of a single data set in a dense and aligned manner. A common frame defines each view, which varies based upon values of a conditioning variable. An increasingly popular use of this technique is to project two-dimensional locations into a gridded space (e.g. grid maps), using the underlying distribution both as the conditioning variable and to determine the grid layout. Using whitespace in this layout has the potential to carry information, especially in a geographic context. Yet, the effects of doing so on the spatial properties of the original units are not understood. We explore the design space offered by such small multiples with gaps. We do so by constructing a comprehensive suite of metrics that capture properties of the layout used to arrange the small multiples for comparison (e.g. compactness and alignment) and the preservation of the original data (e.g. distance, topology and shape). We study these metrics in geographic data sets with varying properties and numbers of gaps. We use simulated annealing to optimize for each metric and measure the effects on the others. To explore these effects systematically, we take a new approach, developing a system to visualize this design space using a set of interactive matrices. We find that adding small amounts of whitespace to small multiple arrays improves some of the characteristics of 2D layouts, such as shape, distance and direction. This comes at the cost of other metrics, such as the retention of topology. Effects vary according to the input maps, with degree of variation in size of input regions found to be a factor. Optima exist for particular metrics in many cases, but at different amounts of whitespace for different maps. We suggest multiple metrics be used in optimized layouts, finding topology to be a primary factor in existing manually-crafted solutions, followed by a trade-off between shape and displacement. But the rich range of possible

  5. Multiple zeros of polynomials

    NASA Technical Reports Server (NTRS)

    Wood, C. A.

    1974-01-01

    For polynomials of higher degree, iterative numerical methods must be used. Four iterative methods are presented for approximating the zeros of a polynomial using a digital computer. Newton's method and Muller's method are two well known iterative methods which are presented. They extract the zeros of a polynomial by generating a sequence of approximations converging to each zero. However, both of these methods are very unstable when used on a polynomial which has multiple zeros. That is, either they fail to converge to some or all of the zeros, or they converge to very bad approximations of the polynomial's zeros. This material introduces two new methods, the greatest common divisor (G.C.D.) method and the repeated greatest common divisor (repeated G.C.D.) method, which are superior methods for numerically approximating the zeros of a polynomial having multiple zeros. These methods were programmed in FORTRAN 4 and comparisons in time and accuracy are given.

  6. Portable multiplicity counter

    DOEpatents

    Newell, Matthew R.; Jones, David Carl

    2009-09-01

    A portable multiplicity counter has signal input circuitry, processing circuitry and a user/computer interface disposed in a housing. The processing circuitry, which can comprise a microcontroller integrated circuit operably coupled to shift register circuitry implemented in a field programmable gate array, is configured to be operable via the user/computer interface to count input signal pluses receivable at said signal input circuitry and record time correlations thereof in a total counting mode, coincidence counting mode and/or a multiplicity counting mode. The user/computer interface can be for example an LCD display/keypad and/or a USB interface. The counter can include a battery pack for powering the counter and low/high voltage power supplies for biasing external detectors so that the counter can be configured as a hand-held device for counting neutron events.

  7. Universality of particle multiplicities

    SciTech Connect

    Goulianos, K. |

    1994-09-01

    We discuss the scaling properties and universality aspects of the rapidity and multiplicity distributions of particles produced in high energy hadronic and e{sup +}e{sup {minus}} interactions. This paper is based on material presented in three lectures on pomeron phenomenology, which included a review of traditional soft pomeron physics and selected topics on hard diffraction processes probing the structure function of the pomeron.

  8. Multiple muons in MACRO

    NASA Technical Reports Server (NTRS)

    Heinz, R.

    1985-01-01

    An analysis of the multiple muon events in the Monopole Astrophysics and Cosmic Ray Observatory detector was conducted to determine the cosmic ray composition. Particular emphasis is placed on the interesting primary cosmic ray energy region above 2000 TeV/nucleus. An extensive study of muon production in cosmic ray showers has been done. Results were used to parameterize the characteristics of muon penetration into the Earth to the location of a detector.

  9. [Multiple primary pulmonary carcinomas].

    PubMed

    Guitart, A C; Gómez, G; Estrada, G; Rodríguez, C; León, C; Cornudella, R

    1991-02-01

    Three cases of multiple simultaneous primary lung carcinomas are presented, in which diagnosis was established by post-surgery pathological exam. In all three cases, chest X-ray showed pulmonary masses suggestive or clinical malignancy, and pre-surgery pathological diagnosis or squamous lung carcinoma. During thoracotomy or in the resected segment, a second lesion we confirmed which made resection necessary being this second lesion classified as lung adenocarcinoma.

  10. Multiple myeloma: current perspectives.

    PubMed

    Slovak, Marilyn L

    2011-12-01

    Multiple myeloma (MM) is a malignancy of terminally differentiated plasma cells characterized by complex genetic aberrations and heterogeneous outcomes. Over the past 25 years, cytogenetic analysis has played a key role in the diagnosis and management of MM. This article reviews the conventional cytogenetics, molecular cytogenetics, and genomic diagnostics of MM and highlights a few recent clinical trials that demonstrate the impact of genetic risk stratification on the treatment of this plasma cell malignancy.

  11. Multiple log potash assay

    NASA Astrophysics Data System (ADS)

    Hill, D. G.

    1993-10-01

    A five-mineral multiple-log potash assay technique has been successfully applied to evaluate potash-rich intervals in evaporite sequences. The technique is able to distinguish economic potash minerals from non-economic potash minerals and from other non-potash radioactive minerals. It can be applied on location, using a programmable calculator or microcomputer, providing near real-time logs of potash mineral concentrations. Log assay values show good agreement with core wet chemistry analyses.

  12. Multiple Core Galaxies

    NASA Technical Reports Server (NTRS)

    Miller, R.H.; Morrison, David (Technical Monitor)

    1994-01-01

    Nuclei of galaxies often show complicated density structures and perplexing kinematic signatures. In the past we have reported numerical experiments indicating a natural tendency for galaxies to show nuclei offset with respect to nearby isophotes and for the nucleus to have a radial velocity different from the galaxy's systemic velocity. Other experiments show normal mode oscillations in galaxies with large amplitudes. These oscillations do not damp appreciably over a Hubble time. The common thread running through all these is that galaxies often show evidence of ringing, bouncing, or sloshing around in unexpected ways, even though they have not been disturbed by any external event. Recent observational evidence shows yet another phenomenon indicating the dynamical complexity of central regions of galaxies: multiple cores (M31, Markarian 315 and 463 for example). These systems can hardly be static. We noted long-lived multiple core systems in galaxies in numerical experiments some years ago, and we have more recently followed up with a series of experiments on multiple core galaxies, starting with two cores. The relevant parameters are the energy in the orbiting clumps, their relative.masses, the (local) strength of the potential well representing the parent galaxy, and the number of cores. We have studied the dependence of the merger rates and the nature of the final merger product on these parameters. Individual cores survive much longer in stronger background potentials. Cores can survive for a substantial fraction of a Hubble time if they travel on reasonable orbits.

  13. Multiple protein structure alignment.

    PubMed Central

    Taylor, W. R.; Flores, T. P.; Orengo, C. A.

    1994-01-01

    A method was developed to compare protein structures and to combine them into a multiple structure consensus. Previous methods of multiple structure comparison have only concatenated pairwise alignments or produced a consensus structure by averaging coordinate sets. The current method is a fusion of the fast structure comparison program SSAP and the multiple sequence alignment program MULTAL. As in MULTAL, structures are progressively combined, producing intermediate consensus structures that are compared directly to each other and all remaining single structures. This leads to a hierarchic "condensation," continually evaluated in the light of the emerging conserved core regions. Following the SSAP approach, all interatomic vectors were retained with well-conserved regions distinguished by coherent vector bundles (the structural equivalent of a conserved sequence position). Each bundle of vectors is summarized by a resultant, whereas vector coherence is captured in an error term, which is the only distinction between conserved and variable positions. Resultant vectors are used directly in the comparison, which is weighted by their error values, giving greater importance to the matching of conserved positions. The resultant vectors and their errors can also be used directly in molecular modeling. Applications of the method were assessed by the quality of the resulting sequence alignments, phylogenetic tree construction, and databank scanning with the consensus. Visual assessment of the structural superpositions and consensus structure for various well-characterized families confirmed that the consensus had identified a reasonable core. PMID:7849601

  14. Effects of Early or Overexpression of the Autographa californica Multiple Nucleopolyhedrovirus orf94 (ODV-e25) on Virus Replication.

    PubMed

    Luo, Xiao-Chun; Wang, Shan-Shan; Zhang, Jie; Qian, Duo-Duo; Wang, Si-Min; Li, Lu-Lin

    2013-01-01

    odv-e25(e25) is one of the core genes of baculoviruses. To investigate how it functions in the replication cycle of a baculovirus, a number of Autographa californica multiple nucleopolyhedrovirus recombinants with e25 under control of the promoter of immediate early gene ie1, or the promoter of the very late hyperexpressed gene p10, were constructed using a bacmid system, and the effects of early expression or overexpression of e25 on replication of the virus were evaluated. Microscopy and titration assays demonstrated that bacmids with e25 under control of ie1 promoter were unable to produce budded viruses; and that the recombinant viruses with e25 under control of p10 promoter generated budded virus normally, but formation of occlusion bodies were dramatically reduced and delayed in the infected cells. Electron microscopy showed that there were no mature virions or intact nucleocapsids present in the cells transfected with a recombinant bacmid with e25 under control of ie1 promoter. Quantitative real-time PCR analysis demonstrated that alteration of the e25 promoter did not affect viral DNA synthesis. The reporter gene expression from the promoter of the major capsid protein gene vp39 was reduced 63% by early expression of e25. Confocal microscopy revealed that E25 was predominantly localized in nuclei by 24 hours post infection with wild-type virus, but it remained in the cytoplasm in the cells transfected with a recombinant bacmid with e25 under control of the ie1 promoter, suggesting that the transport of E25 into nuclei was regulated in a specific and strict time dependent manner.

  15. Multiple Sparse Representations Classification

    PubMed Central

    Plenge, Esben; Klein, Stefan S.; Niessen, Wiro J.; Meijering, Erik

    2015-01-01

    Sparse representations classification (SRC) is a powerful technique for pixelwise classification of images and it is increasingly being used for a wide variety of image analysis tasks. The method uses sparse representation and learned redundant dictionaries to classify image pixels. In this empirical study we propose to further leverage the redundancy of the learned dictionaries to achieve a more accurate classifier. In conventional SRC, each image pixel is associated with a small patch surrounding it. Using these patches, a dictionary is trained for each class in a supervised fashion. Commonly, redundant/overcomplete dictionaries are trained and image patches are sparsely represented by a linear combination of only a few of the dictionary elements. Given a set of trained dictionaries, a new patch is sparse coded using each of them, and subsequently assigned to the class whose dictionary yields the minimum residual energy. We propose a generalization of this scheme. The method, which we call multiple sparse representations classification (mSRC), is based on the observation that an overcomplete, class specific dictionary is capable of generating multiple accurate and independent estimates of a patch belonging to the class. So instead of finding a single sparse representation of a patch for each dictionary, we find multiple, and the corresponding residual energies provides an enhanced statistic which is used to improve classification. We demonstrate the efficacy of mSRC for three example applications: pixelwise classification of texture images, lumen segmentation in carotid artery magnetic resonance imaging (MRI), and bifurcation point detection in carotid artery MRI. We compare our method with conventional SRC, K-nearest neighbor, and support vector machine classifiers. The results show that mSRC outperforms SRC and the other reference methods. In addition, we present an extensive evaluation of the effect of the main mSRC parameters: patch size, dictionary size, and

  16. Multiple pulmonary rheumatoid nodules.

    PubMed

    Sargin, Gokhan; Senturk, Taskin

    2015-01-01

    We present a case of 45-year-old female patient with the diagnosis of seropositive rheumatoid arthritis, who was admitted to our rheumatology department with exacerbation of the disease. The patient's disease activity score (DAS 28) was 6.9. Physical examination revealed changes in the lung auscultation as a rough breathing sound at the middle and lower lobe of the right lung. Chest X-ray revealed multiple nodular densities in both lungs. Lung biopsy was performed for the diagnosis and revealed necrotizing granulomas with central fibrinoid necrosis surrounded by epithelioid cells. Such a histopathological picture is typical for rheumatoid nodules. Finally the patient was treated with rituximab, with significant improvement.

  17. Multiple personality disorder.

    PubMed

    Piper, A

    1994-05-01

    Five aspects of the diagnosis and treatment of multiple personality disorder (MPD) were examined. The following five conclusions were made: the contemporary diagnostic criteria are vague and overinclusive; the recent alleged increase in prevalence of the disorder is almost certainly artefactual; legal proceedings involving MPD patients raise disturbing questions about personal responsibility; there is little literature support for the theory that MPD results from childhood trauma; and many of the techniques used to diagnose and treat the condition reinforce its symptoms. A careful revision of diagnostic criteria for the disorder is recommended.

  18. Ambulation and multiple sclerosis.

    PubMed

    Motl, Robert W

    2013-05-01

    Walking impairment is a common consequence of multiple sclerosis (MS) that can result in substantial limitations of daily activities and compromised quality of life. Walking impairment is often monitored as an indicator of disease and neurologic disability progression. The worsening of walking performance while undertaking a cognitive task underscores the role of nonmotor impairments in ambulation limitations. Walking impairment has ubiquitous and life-altering consequences, underscoring the importance of continued efforts to identify approaches to prevent and forestall this event, and to restore walking ability in persons with MS.

  19. Multiple Sclerosis: An Update.

    PubMed

    Faguy, Kathryn

    2016-05-01

    Multiple sclerosis (MS) is the most common disabling neurologic condition in young adults and imposes high financial and quality of life costs on patients, their families, and society. Yet, developments in the battle against MS include new treatments to slow its progression and updated diagnostic criteria that can accelerate diagnosis and effective treatment. This article offers a review and update on the disease, focusing on risk factors and possible causes, symptoms, forms of MS, diagnostic criteria and tools, and the expanding array of approved treatments. It also reports on the skyrocketing cost of MS drugs, misdiagnosis, and special patient populations with MS.

  20. Multiple sulfatase deficiency.

    PubMed

    Soong, B W; Casamassima, A C; Fink, J K; Constantopoulos, G; Horwitz, A L

    1988-08-01

    Multiple sulfatase deficiency is an inherited disorder characterized by a deficiency of several sulfatases and the accumulation of sulfatides, glycosaminoglycans, sphingolipids, and steroid sulfates in tissues and body fluids. The clinical manifestations represent the summation of two diseases: late infantile metachromatic leukodystrophy and mucopolysaccharidosis. We present a 9-year-old girl with a phenotype similar to a mucopolysaccharidosis: short stature, microcephaly, and mild facial dysmorphism, along with dysphagia, retinal degeneration, developmental arrest, and ataxia. We discuss the importance of measuring the sulfatase activities in the leukocytes, and the instability of sulfatases in the cultured skin fibroblasts.

  1. Factorial Invariance in Multiple Populations: A Multiple Testing Procedure

    ERIC Educational Resources Information Center

    Raykov, Tenko; Marcoulides, George A.; Millsap, Roger E.

    2013-01-01

    A multiple testing method for examining factorial invariance for latent constructs evaluated by multiple indicators in distinct populations is outlined. The procedure is based on the false discovery rate concept and multiple individual restriction tests and resolves general limitations of a popular factorial invariance testing approach. The…

  2. Smoldering Multiple Myeloma

    PubMed Central

    Gao, Minjie; Yang, Guang; Kong, Yuanyuan; Wu, Xiaosong; Shi, Jumei

    2015-01-01

    Smoldering multiple myeloma (SMM) is an asymptomatic precursor stage of multiple myeloma (MM) characterized by clonal bone marrow plasma cells (BMPC) ≥ 10% and/or M protein level ≥ 30 g/L in the absence of end organ damage. It represents an intermediate stage between monoclonal gammopathy of undetermined significance (MGUS) and symptomatic MM. The risk of progression to symptomatic MM is not uniform, and several parameters have been reported to predict the risk of progression. These include the level of M protein and the percentage of BMPC, the proportion of immunophenotypically aberrant plasma cells, and the presence of immunoparesis, free light-chain (FLC) ratio, peripheral blood plasma cells (PBPC), pattern of serum M protein evolution, abnormal magnetic resonance imaging (MRI), cytogenetic abnormalities, IgA isotype, and Bence Jones proteinuria. So far treatment is still not recommended for SMM, because several trials suggested that patients with SMM do not benefit from early treatment. However, the Mateos et al. trial showed a survival benefit after early treatment with lenalidomide plus dexamethasone in patients with high-risk SMM. This trial has prompted a reevaluation of early treatment in an asymptomatic patient population. PMID:26000300

  3. Multiple capillary biochemical analyzer

    DOEpatents

    Dovichi, Norman J.; Zhang, Jian Z.

    1995-01-01

    A multiple capillary analyzer allows detection of light from multiple capillaries with a reduced number of interfaces through which light must pass in detecting light emitted from a sample being analyzed, using a modified sheath flow cuvette. A linear or rectangular array of capillaries is introduced into a rectangular flow chamber. Sheath fluid draws individual sample streams through the cuvette. The capillaries are closely and evenly spaced and held by a transparent retainer in a fixed position in relation to an optical detection system. Collimated sample excitation radiation is applied simultaneously across the ends of the capillaries in the retainer. Light emitted from the excited sample is detected by the optical detection system. The retainer is provided by a transparent chamber having inward slanting end walls. The capillaries are wedged into the chamber. One sideways dimension of the chamber is equal to the diameter of the capillaries and one end to end dimension varies from, at the top of the chamber, slightly greater than the sum of the diameters of the capillaries to, at the bottom of the chamber, slightly smaller than the sum of the diameters of the capillaries. The optical system utilizes optic fibres to deliver light to individual photodetectors, one for each capillary tube. A filter or wavelength division demultiplexer may be used for isolating fluorescence at particular bands.

  4. Albumin and multiple sclerosis.

    PubMed

    LeVine, Steven M

    2016-04-12

    Leakage of the blood-brain barrier (BBB) is a common pathological feature in multiple sclerosis (MS). Following a breach of the BBB, albumin, the most abundant protein in plasma, gains access to CNS tissue where it is exposed to an inflammatory milieu and tissue damage, e.g., demyelination. Once in the CNS, albumin can participate in protective mechanisms. For example, due to its high concentration and molecular properties, albumin becomes a target for oxidation and nitration reactions. Furthermore, albumin binds metals and heme thereby limiting their ability to produce reactive oxygen and reactive nitrogen species. Albumin also has the potential to worsen disease. Similar to pathogenic processes that occur during epilepsy, extravasated albumin could induce the expression of proinflammatory cytokines and affect the ability of astrocytes to maintain potassium homeostasis thereby possibly making neurons more vulnerable to glutamate exicitotoxicity, which is thought to be a pathogenic mechanism in MS. The albumin quotient, albumin in cerebrospinal fluid (CSF)/albumin in serum, is used as a measure of blood-CSF barrier dysfunction in MS, but it may be inaccurate since albumin levels in the CSF can be influenced by multiple factors including: 1) albumin becomes proteolytically cleaved during disease, 2) extravasated albumin is taken up by macrophages, microglia, and astrocytes, and 3) the location of BBB damage affects the entry of extravasated albumin into ventricular CSF. A discussion of the roles that albumin performs during MS is put forth.

  5. Multiple organ dysfunction syndrome.

    PubMed Central

    Murray, M. J.; Coursin, D. B.

    1993-01-01

    The multiple organ dysfunction syndrome (MODS), though newly described, has manifested itself in intensive care unit (ICU) patients for several decades. As the name implies, it is a syndrome in which more than one organ system fails. Failure of these multiple organ systems may or may not be related to the initial injury or disease process for which the patient was admitted to the ICU. MODS is the leading cause of morbidity and mortality in current ICU practice. While the pathophysiology of MODS is not completely known, much evidence indicates that, during the initial injury which precipitates ICU admission, a chain of events is initiated which results in activation of several endogenous metabolic pathways. These pathways release compounds which, in and of themselves, are usually cytoprotective. However, an over exuberant activation of these endogenous systems results in an inflammatory response which can lead to development of failure in distant organs. As these organs fail, they activate and propagate the systemic inflammatory response. No therapy has proven entirely efficacious at modulating this inflammatory response and the incidence and severity of MODS. In current ICU practice, treatment is focused on prevention and treating individual organ dysfunction as it develops. With increased understanding of the pathophysiology of MODS therapy will come newer modalities which inhibit or interfere with the propagation of the endogenous systemic inflammatory response. These newer therapies hold great promise and already some are undergoing clinical investigation. PMID:7825351

  6. Multiple capillary biochemical analyzer

    DOEpatents

    Dovichi, N.J.; Zhang, J.Z.

    1995-08-08

    A multiple capillary analyzer allows detection of light from multiple capillaries with a reduced number of interfaces through which light must pass in detecting light emitted from a sample being analyzed, using a modified sheath flow cuvette. A linear or rectangular array of capillaries is introduced into a rectangular flow chamber. Sheath fluid draws individual sample streams through the cuvette. The capillaries are closely and evenly spaced and held by a transparent retainer in a fixed position in relation to an optical detection system. Collimated sample excitation radiation is applied simultaneously across the ends of the capillaries in the retainer. Light emitted from the excited sample is detected by the optical detection system. The retainer is provided by a transparent chamber having inward slanting end walls. The capillaries are wedged into the chamber. One sideways dimension of the chamber is equal to the diameter of the capillaries and one end to end dimension varies from, at the top of the chamber, slightly greater than the sum of the diameters of the capillaries to, at the bottom of the chamber, slightly smaller than the sum of the diameters of the capillaries. The optical system utilizes optic fibers to deliver light to individual photodetectors, one for each capillary tube. A filter or wavelength division demultiplexer may be used for isolating fluorescence at particular bands. 21 figs.

  7. [Multiple organ dysfunction syndrome].

    PubMed

    Cuenca Solanas, M

    1999-01-01

    Multiple organ dysfunction syndrome (MODS) is a clinical situation that has been described as a result of the rapid progress and advances that have been made in recent decades in the physiology, diagnosis, and therapeutic support of critically ill patients. In 1991, in view of the confusing terminology used to characterize processes coursing with systemic inflammatory response syndrome (SIRS), a consensus conference was held. A series of basic definitions were established and the term "multiple organ failure" was replace by MODS. In response to outside aggression, the organism tries to defend itself with two mechanisms: a non-specific humoral and cellular response called inflammation, and a specific antigenic response that modifies the genetic codes of cells of the defense system and constitutes an immunological response. At present it is thought that the inflammatory response is activated (SIRS) in response to an uncontrolled aggression, but an antiinflammatory response syndrome (ARS) exists as well. An exaggerated SIRS can lead to MODS. MODS usually debuts with pulmonary dysfunction. If the aggression persists, cardiovascular, renal, hepatic, coagulation, central nervous system, gastrointestinal metabolism, neuroendocrine and musculoskeletal failure follow. A series of causes often trigger this syndrome and certain factors favor it. Prevention of these causes and factors in fundamental for controlling the occurrence of MODS. At present, there is no clear treatment for MODS, although numerous studies designed to block the release of certain proinflammatory mediators or to neutralize antiinflammatory responses are being carried out.

  8. Multiple Representations of Buoyancy

    NASA Astrophysics Data System (ADS)

    Oliviera, Jessica; Weglarz, Meredith; Vesenka, James

    2009-10-01

    For many students the concept of buoyancy falls under a category that can be loosely described as ``knowing it when they see it.'' Unfortunately some of the misconceptions this generates are that ``objects float because they are light'' and ``objects float because they are full of air'' [1]. Those these can some times be true, these descriptions are vague at best, and frequently can be wrong. Part of these misconceptions may stem from incomplete immersion of the object in the fluid and the vector nature of forces. We describe a demonstration/lab activity to help students make sense about relationship between the tension on and weight of an object immersed in water. The activity is in rich in multiple representations, graphical, diagrammatical as well as mathematical. A simple four question multiple choice pre/post test survey has been developed to evaluate the effectiveness of the lab activity.[4pt] [1] Bruce Harlan ``Diving Science'', www.stmatthewsschool.com/deep/pdfs/Diving%20Science.pdf

  9. Smoldering multiple myeloma.

    PubMed

    Rajkumar, S Vincent; Landgren, Ola; Mateos, María-Victoria

    2015-05-14

    Smoldering multiple myeloma (SMM) is an asymptomatic clonal plasma cell disorder. SMM is distinguished from monoclonal gammopathy of undetermined significance by a much higher risk of progression to multiple myeloma (MM). There have been major advances in the diagnosis, prognosis, and management of SMM in the last few years. These include a revised disease definition, identification of several new prognostic factors, a classification based on underlying cytogenetic changes, and new treatment options. Importantly, a subset of patients previously considered SMM is now reclassified as MM on the basis of biomarkers identifying patients with an ≥80% risk of progression within 2 years. SMM has assumed greater significance on the basis of recent trials showing that early therapy can be potentially beneficial to patients. As a result, there is a need to accurately diagnose and risk-stratify patients with SMM, including routine incorporation of modern imaging and laboratory techniques. In this review, we outline current concepts in diagnosis and risk stratification of SMM, and provide specific recommendations on the management of SMM.

  10. Multiple symbol differential detection

    NASA Technical Reports Server (NTRS)

    Divsalar, Dariush (Inventor); Simon, Marvin K. (Inventor)

    1991-01-01

    A differential detection technique for multiple phase shift keying (MPSK) signals is provided which uses a multiple symbol observation interval on the basis of which a joint decision is made regarding the phase of the received symbols. In accordance with the invention, a first difference phase is created between first and second received symbols. Next, the first difference phase is correlated with the possible values thereof to provide a first plurality of intermediate output signals. A second difference phase is next created between second and third received symbols. The second difference phase is correlated with plural possible values thereof to provide a second plurality of intermediate output signals. Next, a third difference phase is created between the first and third symbols. The third difference phase is correlated with plural possible values thereof to provide a third plurality of intermediate output signals. Each of the first plurality of intermediate outputs are combined with each of the second plurality of intermediate outputs and each of the third plurality of intermediate outputs to provide a plurality of possible output values. Finally, a joint decision is made by choosing from the plurality of possible output values the value which represents the best combined correlation of the first, second and third difference values with the possible values thereof.

  11. Smoldering multiple myeloma

    PubMed Central

    Landgren, Ola; Mateos, María-Victoria

    2015-01-01

    Smoldering multiple myeloma (SMM) is an asymptomatic clonal plasma cell disorder. SMM is distinguished from monoclonal gammopathy of undetermined significance by a much higher risk of progression to multiple myeloma (MM). There have been major advances in the diagnosis, prognosis, and management of SMM in the last few years. These include a revised disease definition, identification of several new prognostic factors, a classification based on underlying cytogenetic changes, and new treatment options. Importantly, a subset of patients previously considered SMM is now reclassified as MM on the basis of biomarkers identifying patients with an ≥80% risk of progression within 2 years. SMM has assumed greater significance on the basis of recent trials showing that early therapy can be potentially beneficial to patients. As a result, there is a need to accurately diagnose and risk-stratify patients with SMM, including routine incorporation of modern imaging and laboratory techniques. In this review, we outline current concepts in diagnosis and risk stratification of SMM, and provide specific recommendations on the management of SMM. PMID:25838344

  12. Management of multiple sclerosis.

    PubMed

    Perrin Ross, Amy

    2013-11-01

    Patients with multiple sclerosis (MS), a disease of the central nervous system that disrupts signals within the brain and also the signals between the brain and body, will likely experience symptoms that may negatively impact their quality of life (QOL). Due to the complexity of MS and its disease burden, multidisciplinary management that combines pharmacologic and nonpharmacologic strategies with patient education is necessary. Diagnosing relapses of MS in clinical practice can be difficult due to the multiple subtypes of MS, variations of symptomatology, and pseudo-relapses. Managing relapses also presents its own set of challenges, for example, evaluating if treatment is appropriate and determining which agent would be most effective for a patient if treatment is recommended. Patient education is essential for achieving optimal outcomes for patients with MS and improving patient QOL, and should increase awareness of: (1) the disease itself and its progression; (2) the signs and symptoms of MS; (3) current treatment strategies and plan of care; (4) the recognition and management of relapses; (5) the value of treatment adherence and impact of nonadherence; and (6) hope for the future. The management of active MS may be further complicated by the complex variety of pharmacotherapeutic options, and in some instances, by having to switch between agents and drug classes. Newer agents in development (eg, alemtuzumab, ocrelizumab, laquinimod) offer the opportunity to expand the therapeutic armamentarium, although further long-term data are required to evaluate any safety concerns associated with newer agents.

  13. Input Multiplicities in Process Control.

    ERIC Educational Resources Information Center

    Koppel, Lowell B.

    1983-01-01

    Describes research investigating potential effect of input multiplicity on multivariable chemical process control systems. Several simple processes are shown to exhibit the possibility of theoretical developments on input multiplicity and closely related phenomena are discussed. (JN)

  14. Multiple personality disorder following childbirth.

    PubMed

    O'Dwyer, J M; Friedman, T

    1993-06-01

    A case of multiple personality disorder is described as a coping mechanism protecting the patient from the abuse to which she was subjected throughout her life. The multiple personalities became more prominent following the birth of a severely handicapped child.

  15. Genetics Home Reference: multiple sclerosis

    MedlinePlus

    ... Facebook Share on Twitter Your Guide to Understanding Genetic Conditions Search MENU Toggle navigation Home Page Search ... Conditions Genes Chromosomes & mtDNA Resources Help Me Understand Genetics Home Health Conditions multiple sclerosis multiple sclerosis Enable ...

  16. Lattice Multiplication: Old and New.

    ERIC Educational Resources Information Center

    Givan, Betty; Karr, Rosemary

    1988-01-01

    The author presents two examples of lattice multiplication followed by a computer algorithm to perform this multiplication. The algorithm is given in psuedocode but could easily be given in Pascal. (PK)

  17. Targeted Gene Deletion Demonstrates that Cell Adhesion MoleculeICAM-4 is Critical for Erythroblastic Island Formation

    SciTech Connect

    Lee, Gloria; Lo, Annie; Short, Sarah A.; Mankelow, Tosti J.; Spring, Frances; Parsons, Stephen F.; Mohandas, Narla; Anstee, David J.; Chasis, Joel Anne

    2006-02-15

    Erythroid progenitors differentiate in erythroblastic islands, bone marrow niches composed of erythroblasts surrounding a central macrophage. Evidence suggests that within islands adhesive interactions regulate erythropoiesis and apoptosis. We are exploring whether erythroid intercellular adhesion molecule-4 (ICAM-4), animmunoglobulin superfamily member, participates in island formation. Earlier, we identified alpha V integrins as ICAM-4 counter receptors. Since macrophages express alpha V, ICAM-4 potentially mediates island attachments. To test this, we generated ICAM-4 knockout mice and developed quantitative, live cell techniques for harvesting intact islands and for reforming islands in vitro. We observed a 47 percent decrease in islands reconstituted from ICAM-4 null marrow compared to wild type. We also found a striking decrease in islands formed in vivo in knockout mice. Further, peptides that block ICAM-4 alpha V adhesion produced a 53-57 percent decrease in reconstituted islands, strongly suggesting that ICAM-4 binding to macrophage alpha V functions in island integrity. Importantly, we documented that alpha V integrin is expressed in macrophages isolated from erythro blastic islands. Collectively, these data provide convincing evidence that ICAM-4 is critical in erythroblastic island formation via ICAM-4/alpha V adhesion and also demonstrate that the novel experimental strategies we developed will be valuable in exploring molecular mechanisms of erythroblastic island formation and their functional role in regulating erythropoiesis.

  18. IL1RAPL1 gene deletion as a cause of X-linked intellectual disability and dysmorphic features.

    PubMed

    Youngs, Erin L; Henkhaus, Rebecca; Hellings, Jessica A; Butler, Merlin G

    2012-01-01

    Intellectual disability affects approximately 2% of the population with males outnumbering females due to involvement of over 300 genes on the X chromosome. The most common form of X-linked intellectual disability (XLID) is fragile X syndrome. We report a family with an apparent XLID pattern with the proband, his mother and maternal half brother having an Xp21.3 deletion detected with chromosomal microarray analysis involving the interleukin 1 receptor accessory protein-like 1 (IL1RAPL1) gene. IL1RAPL1 is highly expressed in the postnatal brain, specifically hippocampus suggesting a specialized role in memory and learning abilities. The proband presented with intellectual disability, a broad face, prominent and wide nasal root, ptosis, a wide philtrum and a small mouth. XLID due to involvement of the IL1RAPL1 gene has been reported to cause nonsyndromic XLID. We report a new family with XLID due to partial deletion of IL1RAPL1, summarize reported literature and describe similar phenotypic similarities among the affected individuals in this family and those reported in the literature proposing that deletion of IL1RAPL1 may cause syndromic XLID. Additional reports are needed to further characterize whether syndromic features are related to disturbances of this gene.

  19. CD36 gene deletion reduces fat preference and intake but not post-oral fat conditioning in mice.

    PubMed

    Sclafani, A; Ackroff, K; Abumrad, N A

    2007-11-01

    Several findings suggest the existence of a "fatty" taste, and the CD36 fatty acid translocase is a candidate taste receptor. The present study compared fat preference and acceptance in CD36 knockout (KO) and wild-type (WT) mice using nutritive (triglyceride and fatty acid) and nonnutritive (Sefa Soyate oil) emulsions. In two-bottle tests (24 h/day) naive KO mice, unlike WT mice, displayed little or no preference for dilute soybean oil, linoleic acid, or Sefa Soyate emulsions. At high concentrations (2.5-20%), KO mice developed significant soybean oil preferences, although they consumed less oil than WT mice. The postoral actions of fat likely conditioned these preferences. KO mice, like WT mice, learned to prefer a flavored solution paired with intragastric soybean oil infusions. These findings support CD36 mediation of a gustatory component to fat preference but demonstrate that it is not essential for fat-conditioned flavor preferences. The finding that oil-naive KO mice failed to prefer a nonnutritive oil, assumed to provide texture rather than taste cues, requires explanation. Finally, CD36 deletion decreased fat consumption and enhanced the ability of the mice to compensate for the calories provided by their optional fat intake.

  20. Double gene deletion reveals the lack of cooperation between claudin 11 and claudin 14 tight junction proteins

    PubMed Central

    Elkouby-Naor, Liron; Abassi, Zaid; Lagziel, Ayala; Gow, Alexander; Ben-Yosef, Tamar

    2010-01-01

    Summary Members of the claudin family of proteins are the main components of tight junctions (TJs), the major selective barrier of the paracellular pathway between epithelial cells. Selectivity and specificity of TJ strands are determined by the type of claudins present. It is thus important to understand the cooperation between different claudins in various tissues. To study the possible cooperation between claudin 11 and claudin 14 we generated claudin11/claudin 14 double deficient mice. These mice exhibit a combination of the phenotypes found in each of the singly deficient mutants, including deafness, neurological deficits and male sterility. In the kidney we found that these two claudins have distinct and partially overlapping expression patterns. Claudin 11 is located in both the proximal and the distal convoluted tubules, while claudin 14 is located in both the thin descending and the thick ascending limbs of the loop of Henle, as well as in the proximal convoluted tubules. Although daily urinary excretion of Mg++, and to a lesser extent of Ca++, tended to be higher in claudin11/claudin 14 double mutants, these changes did not reach statistical significance comparing to wt animals. These findings suggest that under normal conditions co-deletion of claudin11 and claudin 14 does not affect kidney function or ion balance. Our data demonstrate that despite the importance of each of these claudins, there is probably no functional cooperation between them. Generation of additional mouse models in which different claudins are abolished will provide further insight into the complex interactions between claudin proteins in various physiological systems. PMID:18663477

  1. Virulence Associated Genes-Deleted Salmonella Montevideo Is Attenuated, Highly Immunogenic and Confers Protection against Virulent Challenge in Chickens

    PubMed Central

    Lalsiamthara, Jonathan; Lee, John H.

    2016-01-01

    To construct a novel live vaccine against Salmonella enterica serovar Montevideo (SM) infection in chickens, two important bacterial regulatory genes, lon and cpxR, which are associated with invasion and virulence, were deleted from the wild type SM genome. Attenuated strains, JOL1625 (Δlon), JOL1597 (ΔcpxR), and JOL1599 (ΔlonΔcpxR) were thereby generated. Observations with scanning electron microscopy suggested that JOL1625 and JOL1599 cells showed increased ruffled surface which may be related to abundant extracellular polysaccharide (EPS) production. JOL1597 depicted milder ruffled surface but showed increased surface corrugation. ConA affinity-based fluorometric quantification and fluorescence microscopy revealed significant increases in EPS production in JOL1625 and JOL1599. Four weeks old chickens were used for safety and immunological studies. The mutants were not observed in feces beyond day 3 nor in spleen and cecum beyond day 7, whereas wild type SM was detected for at least 2 weeks in spleen and cecum. JOL1599 was further evaluated as a vaccine candidate. Chickens immunized with JOL1599 showed strong humoral responses, as indicated by systemic IgG and secretory IgA levels, as well as strong cell-mediated immune response, as indicated by increased lymphocyte proliferation. JOL1599-immunized groups also showed significant degree of protection against wild type challenge. Our results indicate that Δlon- and/or ΔcpxR-deleted SM exhibited EPS-enhanced immunogenicity and attenuation via reduced bacterial cell intracellular replication, conferred increased protection, and possess safety qualities favorable for effective vaccine development against virulent SM infections. PMID:27785128

  2. A ‘suicide’ CRISPR-Cas9 system to promote gene deletion and restoration by electroporation in Cryptococcus neoformans

    PubMed Central

    Wang, Yu; Wei, Dongsheng; Zhu, Xiangyang; Pan, Jiao; Zhang, Ping; Huo, Liang; Zhu, Xudong

    2016-01-01

    Loss-of-function mutagenesis is an important tool used to characterize gene functions, and the CRISPR-Cas9 system is a powerful method for performing targeted mutagenesis in organisms that present low recombination frequencies, such as the serotype D strains of Cryptococcus neoformans. However, when the CRISPR-Cas9 system persists in the host cells, off-target effects and Cas9 cytotoxicity may occur, which might block subsequent genetic manipulation. Here, we report a method of spontaneously eliminating the CRISPR-Cas9 system without impairing its robust editing function. We successfully expressed single guide RNA under the driver of an endogenous U6 promoter and the human codon-optimized Cas9 endonuclease with an ACT1 promoter. This system can effectively generate an indel mutation and efficiently perform targeted gene disruption via homology-directed repair by electroporation in yeast. We then demonstrated the spontaneous elimination of the system via a cis arrangement of the CRISPR-Cas9 expression cassettes to the recombination construct. After a system-mediated double crossover, the CRISPR-Cas9 cassettes were cleaved and degraded, which was validated by Southern blotting. This ‘suicide’ CRISPR-Cas9 system enables the validation of gene functions by subsequent complementation and has the potential to minimize off-target effects. Thus, this technique has the potential for use in functional genomics studies of C. neoformans. PMID:27503169

  3. Strong dominance of functional alleles over gene deletions in both intensely growing and deeply starved yeast cells.

    PubMed

    Marek, A; Korona, R

    2016-09-01

    Previous studies with diploid yeast have shown that the deletion of one allele at a single locus typically has little impact on fitness under conditions promoting fast growth. Here, we confirm and quantify this finding. The strong dominance of functional over nonfunctional alleles is predicted by the metabolic control theory which assumes that the cell is a system of metabolic fluxes and that the total metabolic rate is equivalent to fitness. To test whether these requirements are critical, we tested dominance under conditions of long-term starvation when metabolism is low and thus the metabolic activities of proteins are likely inadequate or imbalanced. More fundamentally, the central assumption of the model, that high metabolic rate translates into high fitness, appears implausible. Contrary to these conjectures, we found that the mean rate of survival of starving heterozygotes was affected only slightly more than was the mean rate of growth under good conditions. Under none of the two treatments the central prediction of the model, that fitness of heterozygous strains is higher for the enzymatic proteins than for nonenzymatic ones, was confirmed. Our data add to growing uncertainty whether the metabolic control theory is sufficient to explain the remarkable ubiquity of strong genetic dominance.

  4. A Self-deleting Cre-lox-ermAM Cassette, CHESHIRE, for marker-less gene deletion in Streptococcus pneumoniae

    PubMed Central

    Weng, Liming; Biswas, Indranil; Morrison, Donald A.

    2009-01-01

    Although targeted mutagenesis of Streptococcus pneumoniae is readily accomplished with the aid of natural genetic transformation and chimeric donor DNA constructs assembled in vitro, the drug resistance markers often employed for selection of recombinant products can themselves be undesirable by-products of the genetic manipulation. A new cassette carrying the erythromycin-resistance marker ermAM is described that can be used as a temporary marker for selection of desired recombinants. The cassette may subsequently be removed at will by virtue of an embedded fucose-regulated Cre recombinase gene and terminal lox66 and lox71 Cre recognition sites, with retention of 34 bp from the cassette as an inert residual double-mutant lox72 site. PMID:19850089

  5. Aquaporin-4 regulates extracellular space volume dynamics during high-frequency synaptic stimulation: a gene deletion study in mouse hippocampus.

    PubMed

    Haj-Yasein, Nadia Nabil; Jensen, Vidar; Østby, Ivar; Omholt, Stig W; Voipio, Juha; Kaila, Kai; Ottersen, Ole P; Hvalby, Øivind; Nagelhus, Erlend A

    2012-05-01

    Little is known about the physiological roles of aquaporin-4 (AQP4) in the central nervous system. AQP4 water channels are concentrated in endfeet membranes of astrocytes but also localize to the fine astrocytic processes that abut central synapses. Based on its pattern of expression, we predicted that AQP4 could be involved in controlling water fluxes and changes in extracellular space (ECS) volume that are associated with activation of excitatory pathways. Here, we show that deletion of Aqp4 accentuated the shrinkage of the ECS that occurred in the mouse hippocampal CA1 region during activation of Schaffer collateral/commissural fibers. This effect was found in the stratum radiatum (where perisynaptic astrocytic processes abound) but not in the pyramidal cell layer (where astrocytic processes constitute but a minor volume fraction). For both genotypes the ECS shrinkage was most pronounced in the pyramidal cell layer. Our data attribute a physiological role to AQP4 and indicate that this water channel regulates extracellular volume dynamics in the mammalian brain.

  6. Correlations between long inverted repeat (LIR) features, deletion size and distance from breakpoint in human gross gene deletions

    PubMed Central

    Aygun, Nevim

    2015-01-01

    Long inverted repeats (LIRs) have been shown to induce genomic deletions in yeast. In this study, LIRs were investigated within ±10 kb spanning each breakpoint from 109 human gross deletions, using Inverted Repeat Finder (IRF) software. LIR number was significantly higher at the breakpoint regions, than in control segments (P < 0.001). In addition, it was found that strong correlation between 5′ and 3′ LIR numbers, suggesting contribution to DNA sequence evolution (r = 0.85, P < 0.001). 138 LIR features at ±3 kb breakpoints in 89 (81%) of 109 gross deletions were evaluated. Significant correlations were found between distance from breakpoint and loop length (r = −0.18, P < 0.05) and stem length (r = −0.18, P < 0.05), suggesting DNA strands are potentially broken in locations closer to bigger LIRs. In addition, bigger loops cause larger deletions (r = 0.19, P < 0.05). Moreover, loop length (r = 0.29, P < 0.02) and identity between stem copies (r = 0.30, P < 0.05) of 3′ LIRs were more important in larger deletions. Consequently, DNA breaks may form via LIR-induced cruciform structure during replication. DNA ends may be later repaired by non-homologous end-joining (NHEJ), with following deletion. PMID:25657065

  7. Hereditary fructose intolerance: functional study of two novel ALDOB natural variants and characterization of a partial gene deletion.

    PubMed

    Esposito, Gabriella; Imperato, Maria Rosaria; Ieno, Luigi; Sorvillo, Rosa; Benigno, Vincenzo; Parenti, Giancarlo; Parini, Rossella; Vitagliano, Luigi; Zagari, Adriana; Salvatore, Francesco

    2010-12-01

    Hereditary fructose intolerance (HFI) is an autosomal recessive metabolic disease caused by impaired functioning of human liver aldolase (ALDOB). At least 54 subtle/point mutations and only two large intragenic deletions have been found in the ALDOB gene. Here we report two novel ALDOB variants (p.R46W and p.Y343H) and an intragenic deletion that we found in patients with suspected HFI. The residual catalytic activity of the recombinant p.R46W and p.Y343H variants toward F1P was particularly altered. We also characterized a large intragenic deletion that we found in six unrelated patients. This is the first report of six unrelated patients sharing the same ALDOB deletion, thus indicating a founder effect for this allele in our geographic area. Because this deletion involves ALDOB exon 5, it can mimic worldwide common pathogenic genotypes, that is, homozygous p.A150P and p.A175D. Finally, the identification of only one ALDOB mutation in symptomatic patients suggests that HFI symptoms can, albeit rarely, appear also in heterozygotes. Therefore, an excessive and continuous fructose dietary intake may have deleterious effects even in apparently asymptomatic HFI carriers.

  8. Discoidin domain receptor 2 germline gene deletion leads to altered heart structure and function in the mouse.

    PubMed

    Cowling, Randy T; Yeo, Seon Ju; Kim, In Jai; Park, Joong Il; Gu, Yusu; Dalton, Nancy D; Peterson, Kirk L; Greenberg, Barry H

    2014-09-01

    Discoidin domain receptor 2 (DDR2) is a fibrillar collagen receptor that is expressed in mesenchymal cells throughout the body. In the heart, DDR2 is selectively expressed on cardiac fibroblasts. We generated a germline DDR2 knockout mouse and used this mouse to examine the role of DDR2 deletion on heart structure and function. Echocardiographic measurements from null mice were consistent with those from a smaller heart, with reduced left ventricular chamber dimensions and little change in wall thickness. Fractional shortening appeared normal. Left ventricular pressure measurements revealed mild inotropic and lusitropic abnormalities that were accentuated by dobutamine infusion. Both body and heart weights from 10-wk-old male mice were ~20% smaller in null mice. The reduced heart size was not simply due to reduced body weight, since cardiomyocyte lengths were atypically shorter in null mice. Although normalized cardiac collagen mass (assayed by hydroxyproline content) was not different in null mice, the collagen area fraction was statistically higher, suggesting a reduced collagen density from altered collagen deposition and cross-linking. Cultured cardiac fibroblasts from null mice deposited collagen at a slower rate than wild-type littermates, possibly due to the expression of lower prolyl 4-hydroxylase α-isoform 1 enzyme levels. We conclude that genetic deletion of the DDR2 collagen receptor alters cardiac fibroblast function. The resulting perturbations in collagen deposition can influence the structure and function of mature cardiomyocytes.

  9. α2δ-1 Gene Deletion Affects Somatosensory Neuron Function and Delays Mechanical Hypersensitivity in Response to Peripheral Nerve Damage

    PubMed Central

    Patel, Ryan; Bauer, Claudia S.; Nieto-Rostro, Manuela; Margas, Wojciech; Ferron, Laurent; Chaggar, Kanchan; Crews, Kasumi; Ramirez, Juan D.; Bennett, David L. H.; Schwartz, Arnold; Dickenson, Anthony H.

    2013-01-01

    The α2δ-1 subunit of voltage-gated calcium channels is upregulated after sensory nerve injury and is also the therapeutic target of gabapentinoid drugs. It is therefore likely to play a key role in the development of neuropathic pain. In this study, we have examined mice in which α2δ-1 gene expression is disrupted, to determine whether α2δ-1 is involved in various modalities of nociception, and for the development of behavioral hypersensitivity after partial sciatic nerve ligation (PSNL). We find that naive α2δ-1−/− mice show a marked behavioral deficit in mechanical and cold sensitivity, but no change in thermal nociception threshold. The lower mechanical sensitivity is mirrored by a reduced in vivo electrophysiological response of dorsal horn wide dynamic range neurons. The CaV2.2 level is reduced in brain and spinal cord synaptosomes from α2δ-1−/− mice, and α2δ-1−/− DRG neurons exhibit lower calcium channel current density. Furthermore, a significantly smaller number of DRG neurons respond to the TRPM8 agonist menthol. After PSNL, α2δ-1−/− mice show delayed mechanical hypersensitivity, which only develops at 11 d after surgery, whereas in wild-type littermates it is maximal at the earliest time point measured (3 d). There is no compensatory upregulation of α2δ-2 or α2δ-3 after PSNL in α2δ-1−/− mice, and other transcripts, including neuropeptide Y and activating transcription factor-3, are upregulated normally. Furthermore, the ability of pregabalin to alleviate mechanical hypersensitivity is lost in PSNL α2δ-1−/− mice. Thus, α2δ-1 is essential for rapid development of mechanical hypersensitivity in a nerve injury model of neuropathic pain. PMID:24133248

  10. EZH2 expression in gliomas: Correlation with CDKN2A gene deletion/ p16 loss and MIB-1 proliferation index.

    PubMed

    Purkait, Suvendu; Sharma, Vikas; Jha, Prerana; Sharma, Mehar Chand; Suri, Vaishali; Suri, Ashish; Sharma, B S; Sarkar, Chitra

    2015-10-01

    Enhancer of zeste homolog 2 (EZH2) mediated down-regulation of CDKN2A/p16 has been observed in cell lines as well as in a few carcinomas. However, there is no study correlating EZH2 expression with CDKN2A/p16 status in gliomas. Hence, the present study was conducted to evaluate EZH2 expression in astrocytic and oligodendroglial tumors and correlate with CDKN2A/p16 status as well as MIB-1 labeling index (LI). Gliomas of all grades (n = 118) were studied using immunohistochemistry to assess EZH2, p16 and MIB-1 LI and fluorescence in situ hybrization to evaluate CDKN2A gene status. EZH2 expression and CDKN2A homozygous deletion (HD) were both significantly more frequent in high-grade gliomas (HGG). Further, strong EZH2 expression (LI ≥ 25%) was significantly more common in HGGs without CDKN2A HD (48.7%; 19/39) as compared to cases with deletion (15.8%; 3/19). Loss of p16 expression was noted in 100% and 51.3% of CDKN2A deleted and non-deleted tumors, respectively. Notably, 80% (16/20) of the CDKN2A non-deleted HGGs with p16 loss had strong EZH2 expression, in contrast to only 15.8% (3/19) in the deleted group. Loss of p16 expression significantly correlated with MIB-1 LI, irrespective of EZH2 status. Thus, this study shows that EZH2 expression correlates with tumor grade in both astrocytic and oligodendroglial tumors and hence can be used as a diagnostic marker to differentiate between low and HGGs. Further, this is the first report demonstrating an inverse correlation of strong EZH2 expression with CDKN2A HD in HGGs. Loss of p16 protein expression is mostly attributable to CDKN2A HD and correlates significantly with MIB-1 LI. Notably, our study for the first time suggests a possible epigenetic mechanism of p16 loss in CDKN2A non-deleted HGGs mediated by strong EZH2 expression. A hypothetical model for control of proliferative activity in low versus HGGs is therefore proposed.

  11. Entire CAPN3 gene deletion in a patient with limb-girdle muscular dystrophy type 2A.

    PubMed

    Jaka, Oihane; Azpitarte, Margarita; Paisán-Ruiz, Coro; Zulaika, Miren; Casas-Fraile, Leire; Sanz, Raúl; Trevisiol, Nathalie; Levy, Nicolas; Bartoli, Marc; Krahn, Martin; López de Munain, Adolfo; Sáenz, Amets

    2014-09-01

    Limb-girdle muscular dystrophy type 2A (LGMD2A) due to mutations in the CAPN3 gene is one of the most common of autosomal recessive limb-girdle muscular dystrophies. We describe a patient who had a typical LGMD2A phenotype and posterior compartment involvement on MRI. Different genetic analyses were performed, including microarray analysis. There was an apparently homozygous mutation in exon 24, c.2465G>T, p.(*822Leuext62*), and a lack of correlation in the disease segregation analyses. This suggested the presence of a genomic rearrangement. In fact, a heterozygous deletion of the entire CAPN3 gene was found. This novel deletion comprised the terminal region of the GANC gene and the entire CAPN3 gene. This finding points out the need to reconsider and adapt our current strategy of molecular diagnosis in order to detect these types of genomic rearrangements that escape standard mutation screening procedures.

  12. Unexpected effects of gene deletion on mercury interactions with the methylation-deficient mutant hgcAB

    SciTech Connect

    Lin, Hui; Hurt, Jr., Richard Ashley; Johs, Alexander; Parks, Jerry M; Morrell-Falvey, Jennifer L; Liang, Liyuan; Elias, Dwayne A; Gu, Baohua

    2014-01-01

    The hgcA and hgcB gene pair is essential for mercury (Hg) methylation by certain anaerobic bacteria,1 but little is known about how deletion of hgcAB affects cell surface interactions and intracellular uptake of Hg. Here, we compare hgcAB mutants with the wild-type (WT) strains of both Geobacter sulfurreducens PCA and Desulfovibrio desulfuricans ND132 and observe differences in Hg redox transformations, adsorption, and uptake in laboratory incubation studies. In both strains, deletion of hgcAB increased the reduction of Hg(II) but decreased the oxidation of Hg(0) under anaerobic conditions. The measured cellular thiol content in hgcAB mutants was lower than the WT, accounting for decreased adsorption and uptake of Hg. Despite the lack of methylation activity, Hg uptake by the hgcAB continued, albeit at a slower rate than the WT. These findings demonstrate that deletion of the hgcAB gene not only eliminates Hg methylation but also alters cell physiology, resulting in changes to Hg redox reactions, sorption, and uptake by cells.

  13. CONSTRUCTION AND CHARACTERIZATION OF PTA GENE DELETED MUTANT OF C CLOSTRIDIUM TYROBUTYRICUM FOR BUTYRIC ACID FERMENTATION. (R829479C016)

    EPA Science Inventory

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  14. The chromosomal arrangement of human alpha-like globin genes: sequence homology and alpha-globin gene deletions.

    PubMed

    Lauer, J; Shen, C K; Maniatis, T

    1980-05-01

    We report the isolation of a cluster of four alpha-like globin genes from a bacteriophage lambda library of human DNA (Lawn et al., 1978). Analysis of the cloned DNA confirms the linkage arrangement of the two adult alpha-globin genes (alpha 1 and alpha 2) previously derived from genomic blotting experiments (Orkin, 1978) and identifies two additional closely linked alpha-like genes. The nucleotide sequence of a portion of each of these alpha-like genes was determined. One of these sequences is tentatively identified as an embryonic zeta-globin gene (zeta 1) by comparison with structural data derived from purified zeta-globin protein (J. Clegg, personal communication), while the other sequence cannot be matched with any known alpha-like polypeptide sequence (we designate this sequence phi alpha 1). Localization of the four alpha-like sequences on a restriction map of the gene cluster indicates that the genes have the same transcriptional orientation and are arranged in the order 5'-zeta 1-phi alpha 1-alpha 2-alpha 1-3'. Genomic blotting experiments identified a second, nonallelic zeta-like globin gene (phi 2) located 10-12 kb 5' to the cloned zeta-globin gene. Comparison of the locations of restriction sites within alpha 1 and alpha 2 and heteroduplex studies reveal extensive sequence homology within and flanking the two genes. The homologous sequences, which are interrupted by two blocks of nonhomology, span a region of approximately 4 kb. This extensive sequence homology between two genes which are thought to be the products of an ancient duplication event suggests the existence of a mechanism for sequence matching during evolution. One consequence of this arrangement of homologous sequences is the occurrence of two types of deletions in recombinant phage DNA during propagation in E. coli. The locations and sizes of the two types of deletions are indistinguishable from those of the two types of deletions associated with alpha-thalassemia 2 (Embury et al., 1979; Orkin et al., 1979; S. Embury et al., manuscript submitted). This information strongly suggests that the genetic disease is a consequence of unequal crossing over between homologous sequences within and/or surrounding the two adult alpha-globin genes.

  15. Isolation and Culture of Adult Intestinal, Gastric, and Liver Organoids for Cre-recombinase-Mediated Gene Deletion.

    PubMed

    Flanagan, Dustin J; Schwab, Renate H M; Tran, Bang M; Phesse, Toby J; Vincan, Elizabeth

    2016-10-05

    The discovery of Lgr5 as a marker of adult stem cells meant that stem cell populations could be purified and studied in isolation. Importantly, when cultured under the appropriate conditions these stem cells form organoids in tissue culture that retain many features of the tissue of origin. The organoid cultures are accessible to genetic and biochemical manipulation, bridging the gap between in vivo mouse models and conventional tissue culture. Here we describe robust protocols to establish organoids from gastrointestinal tissues (stomach, intestine, liver) and Cre-recombinase mediated gene manipulation in vitro.

  16. Circulating IGF-1 and its role in cancer: lessons from the IGF-1 gene deletion (LID) mouse.

    PubMed

    Yakar, Shoshana; Pennisi, Patricia; Zhao, Hong; Zhang, Yang; LeRoith, Derek

    2004-01-01

    Recent epidemiological studies have suggested a statistical connection between serum IGF-1 levels in the upper quartile of the normal range and the relative risk of developing certain cancers. Our studies have focused on mouse models where circulating IGF-1 levels are reduced, while tissue expression of IGF-1 is normal. These mice show a lower risk for the development of colon and breast cancers and metastases when compared with control mice, and lend support to the hypothesis that circulating IGF-1 may be linked to cancer cell growth.

  17. Targeted proteome analysis of single-gene deletion strains of Saccharomyces cerevisiae lacking enzymes in the central carbon metabolism

    PubMed Central

    Kinoshita, Syohei; Nishino, Shunsuke; Tomita, Atsumi; Shimizu, Hiroshi

    2017-01-01

    Central carbon metabolism is controlled by modulating the protein abundance profiles of enzymes that maintain the essential systems in living organisms. In this study, metabolic adaptation mechanisms in the model organism Saccharomyces cerevisiae were investigated by direct determination of enzyme abundance levels in 30 wild type and mutant strains. We performed a targeted proteome analysis using S. cerevisiae strains that lack genes encoding the enzymes responsible for central carbon metabolism. Our analysis revealed that at least 30% of the observed variations in enzyme abundance levels could be explained by global regulatory mechanisms. A enzyme-enzyme co-abundance analysis revealed that the abundances of enzyme proteins involved in the trehalose metabolism and glycolysis changed in a coordinated manner under the control of the transcription factors for global regulation. The remaining variations were derived from local mechanisms such as a mutant-specific increase in the abundances of remote enzymes. The proteome data also suggested that, although the functional compensation of the deficient enzyme was attained by using more resources for protein biosynthesis, available resources for the biosynthesis of the enzymes responsible for central metabolism were not abundant in S. cerevisiae cells. These results showed that global and local regulation of enzyme abundance levels shape central carbon metabolism in S. cerevisiae by using a limited resource for protein biosynthesis. PMID:28241048

  18. Analysis of GzmbCre as a Model System for Gene Deletion in the Natural Killer Cell Lineage.

    PubMed

    Xu, Yiying; Evaristo, Cesar; Alegre, Maria-Luisa; Gurbuxani, Sandeep; Kee, Barbara L

    2015-01-01

    The analysis of gene function in mature and activated natural killer cells has been hampered by the lack of model systems for Cre-mediated recombination in these cells. Here we have investigated the utility of GzmbCre for recombination of loxp sequences in these cells predicated on the observation that Gzmb mRNA is highly expressed in mature and activated natural killer cells. Using two different reporter strains we determined that gene function could be investigated in mature natural killer cells after GzmbCre mediated recombination in vitro in conditions that lead to natural killer cell activation such as in the cytokine combination of interleukin 2 and interleukin 12. We demonstrated the utility of this model by creating GzmbCre;Rosa26IKKbca mice in which Cre-mediated recombination resulted in expression of constitutively active IKKβ, which results in activation of the NFκB transcription factor. In vivo and in vitro activation of IKKβ in natural killer cells revealed that constitutive activation of this pathway leads to natural killer cell hyper-activation and altered morphology. As a caveat to the use of GzmbCre we found that this transgene can lead to recombination in all hematopoietic cells the extent of which varies with the particular loxp flanked allele under investigation. We conclude that GzmbCre can be used under some conditions to investigate gene function in mature and activated natural killer cells.

  19. α2δ-1 gene deletion affects somatosensory neuron function and delays mechanical hypersensitivity in response to peripheral nerve damage.

    PubMed

    Patel, Ryan; Bauer, Claudia S; Nieto-Rostro, Manuela; Margas, Wojciech; Ferron, Laurent; Chaggar, Kanchan; Crews, Kasumi; Ramirez, Juan D; Bennett, David L H; Schwartz, Arnold; Dickenson, Anthony H; Dolphin, Annette C

    2013-10-16

    The α2δ-1 subunit of voltage-gated calcium channels is upregulated after sensory nerve injury and is also the therapeutic target of gabapentinoid drugs. It is therefore likely to play a key role in the development of neuropathic pain. In this study, we have examined mice in which α2δ-1 gene expression is disrupted, to determine whether α2δ-1 is involved in various modalities of nociception, and for the development of behavioral hypersensitivity after partial sciatic nerve ligation (PSNL). We find that naive α2δ-1(-/-) mice show a marked behavioral deficit in mechanical and cold sensitivity, but no change in thermal nociception threshold. The lower mechanical sensitivity is mirrored by a reduced in vivo electrophysiological response of dorsal horn wide dynamic range neurons. The CaV2.2 level is reduced in brain and spinal cord synaptosomes from α2δ-1(-/-) mice, and α2δ-1(-/-) DRG neurons exhibit lower calcium channel current density. Furthermore, a significantly smaller number of DRG neurons respond to the TRPM8 agonist menthol. After PSNL, α2δ-1(-/-) mice show delayed mechanical hypersensitivity, which only develops at 11 d after surgery, whereas in wild-type littermates it is maximal at the earliest time point measured (3 d). There is no compensatory upregulation of α2δ-2 or α2δ-3 after PSNL in α2δ-1(-/-) mice, and other transcripts, including neuropeptide Y and activating transcription factor-3, are upregulated normally. Furthermore, the ability of pregabalin to alleviate mechanical hypersensitivity is lost in PSNL α2δ-1(-/-) mice. Thus, α2δ-1 is essential for rapid development of mechanical hypersensitivity in a nerve injury model of neuropathic pain.

  20. What Happens After Treatment for Multiple Myeloma?

    MedlinePlus

    ... After Treatment What Happens After Treatment for Multiple Myeloma? For most people, multiple myeloma never goes away ... for Multiple Myeloma Stops Working More In Multiple Myeloma About Multiple Myeloma Causes, Risk Factors, and Prevention ...

  1. Can Multiple Myeloma Be Found Early?

    MedlinePlus

    ... Myeloma Early Detection, Diagnosis, and Staging Can Multiple Myeloma Be Found Early? It’s difficult to diagnose multiple ... Your Doctor About Multiple Myeloma? More In Multiple Myeloma About Multiple Myeloma Causes, Risk Factors, and Prevention ...

  2. Sesterterpene ophiobolin biosynthesis involving multiple gene clusters in Aspergillus ustus

    PubMed Central

    Chai, Hangzhen; Yin, Ru; Liu, Yongfeng; Meng, Huiying; Zhou, Xianqiang; Zhou, Guolin; Bi, Xupeng; Yang, Xue; Zhu, Tonghan; Zhu, Weiming; Deng, Zixin; Hong, Kui

    2016-01-01

    Terpenoids are the most diverse and abundant natural products among which sesterterpenes account for less than 2%, with very few reports on their biosynthesis. Ophiobolins are tricyclic 5–8–5 ring sesterterpenes with potential pharmaceutical application. Aspergillus ustus 094102 from mangrove rizhosphere produces ophiobolin and other terpenes. We obtained five gene cluster knockout mutants, with altered ophiobolin yield using genome sequencing and in silico analysis, combined with in vivo genetic manipulation. Involvement of the five gene clusters in ophiobolin synthesis was confirmed by investigation of the five key terpene synthesis relevant enzymes in each gene cluster, either by gene deletion and complementation or in vitro verification of protein function. The results demonstrate that ophiobolin skeleton biosynthesis involves five gene clusters, which are responsible for C15, C20, C25, and C30 terpenoid biosynthesis. PMID:27273151

  3. Mixed Mode Matrix Multiplication

    SciTech Connect

    Meng-Shiou Wu; Srinivas Aluru; Ricky A. Kendall

    2004-09-30

    In modern clustering environments where the memory hierarchy has many layers (distributed memory, shared memory layer, cache,...), an important question is how to fully utilize all available resources and identify the most dominant layer in certain computations. When combining algorithms on all layers together, what would be the best method to get the best performance out of all the resources we have? Mixed mode programming model that uses thread programming on the shared memory layer and message passing programming on the distributed memory layer is a method that many researchers are using to utilize the memory resources. In this paper, they take an algorithmic approach that uses matrix multiplication as a tool to show how cache algorithms affect the performance of both shared memory and distributed memory algorithms. They show that with good underlying cache algorithm, overall performance is stable. When underlying cache algorithm is bad, superlinear speedup may occur, and an increasing number of threads may also improve performance.

  4. [Pediatric multiple trauma].

    PubMed

    Auner, B; Marzi, I

    2014-05-01

    Multiple trauma in children is rare so that even large trauma centers will only treat a small number of cases. Nevertheless, accidents are the most common cause of death in childhood whereby the causes are mostly traffic accidents and falls. Head trauma is the most common form of injury and the degree of severity is mostly decisive for the prognosis. Knowledge on possible causes of injury and injury patterns as well as consideration of anatomical and physiological characteristics are of great importance for treatment. The differences compared to adults are greater the younger the child is. Decompression and stopping bleeding are the main priorities before surgical fracture stabilization. The treatment of a severely injured child should be carried out by an interdisciplinary team in an approved trauma center with expertise in pediatrics. An inadequate primary assessment involves a high risk of early mortality. On the other hand children have a better prognosis than adults with comparable injuries.

  5. Multiple suicide attempts.

    PubMed

    Tuckman, J; Youngman, W F; Kreizman, G

    1968-04-01

    A sample of 157 persons who attempted suicide from 2 to 6 times was compared with a sample of 1,045 single attempted suicides on a number of personal and social characteristics and other factors related to the act itself. Suicide death rates, obtained through a follow-up of both groups for a year following the last attempt, were also compared. It is concluded (1) that the two groups are essentially similar in their general characteristics and in their risk of suicide and (2) that, among multiples, little change occurs from first to second attempt. However, it is pointed out that both groups are at considerably higher risk of suicide than those who have not made attempts.

  6. [Pomalidomide for multiple myeloma].

    PubMed

    Fouquet, G; Macro, M; Decaux, O; Fohrer, C; Guidez, S; Demarquette, H; Le Grand, C; Prodhomme, C; Renaud, L; Bories, C; Herbaux, C; Karlin, L; Roussel, M; Benboubker, L; Hulin, C; Arnulf, B; Leleu, X

    2015-09-01

    Once characterized by a very poor outcome, multiple myeloma (MM) now has a significantly prolonged survival, with major improvements allowed by the use of "novel agents": proteasome inhibitors (first-in-class bortezomib) and immunomodulatory compounds (IMiDs; first-in-class thalidomide and lenalidomide). However, the vast majority - if not all - of patients with MM ultimately end up being refractory to all existing drugs, including these efficient novel agents. There is a clear unmet medical need in this situation, which warrants the development of the next generation of proteasome inhibitors and IMiDs, as well as new drug classes. This review focuses on pomalidomide, the next generation IMiD, recently approved by the US FDA and the EMA for patients with relapsed or refractory MM who have received at least two prior therapies, including lenalidomide and bortezomib, and have demonstrated disease progression on their last therapy.

  7. Tremor in multiple sclerosis

    PubMed Central

    Mostert, Jop; Heersema, Dorothea; De Keyser, Jacques

    2007-01-01

    Tremor is estimated to occur in about 25 to 60 percent of patients with multiple sclerosis (MS). This symptom, which can be severely disabling and embarrassing for patients, is difficult to manage. Isoniazid in high doses, carbamazepine, propranolol and gluthetimide have been reported to provide some relief, but published evidence of effectiveness is very limited. Most trials were of small size and of short duration. Cannabinoids appear ineffective. Tremor reduction can be obtained with stereotactic thalamotomy or thalamic stimulation. However, the studies were small and information on long-term functional outcome is scarce. Physiotherapy, tremor reducing orthoses, and limb cooling can achieve some functional improvement. Tremor in MS remains a significant challenge and unmet need, requiring further basic and clinical research. PMID:17318714

  8. Multiple layer insulation cover

    DOEpatents

    Farrell, James J.; Donohoe, Anthony J.

    1981-11-03

    A multiple layer insulation cover for preventing heat loss in, for example, a greenhouse, is disclosed. The cover is comprised of spaced layers of thin foil covered fabric separated from each other by air spaces. The spacing is accomplished by the inflation of spaced air bladders which are integrally formed in the cover and to which the layers of the cover are secured. The bladders are inflated after the cover has been deployed in its intended use to separate the layers of the foil material. The sizes of the material layers are selected to compensate for sagging across the width of the cover so that the desired spacing is uniformly maintained when the cover has been deployed. The bladders are deflated as the cover is stored thereby expediting the storage process and reducing the amount of storage space required.

  9. Vaccines in Multiple Sclerosis.

    PubMed

    Williamson, Eric M L; Chahin, Salim; Berger, Joseph R

    2016-04-01

    Vaccinations help prevent communicable disease. To be valuable, a vaccine's ability to prevent disease must exceed the risk of adverse effects from administration. Many vaccines present no risk of infection as they are comprised of killed or non-infectious components while other vaccines consist of live attenuated microorganisms which carry a potential risk of infection-particularly, in patients with compromised immunity. There are several unique considerations with respect to vaccination in the multiple sclerosis (MS) population. First, there has been concern that vaccination may trigger or aggravate the disease. Second, disease-modifying therapies (DMTs) employed in the treatment of MS may increase the risk of infectious complications from vaccines or alter their efficacy. Lastly, in some cases, vaccination strategies may be part of the treatment paradigm in attempts to avoid complications of therapy.

  10. Swamp Works- Multiple Projects

    NASA Technical Reports Server (NTRS)

    Carelli, Jonathan M.; Schuler, Jason M.; Chandler, Meredith L.

    2013-01-01

    My Surface Systems internship over the summer 2013 session covered a broad range of projects that utilized multiple fields of engineering and technology. This internship included a project to create a command center for a 120 ton regolith bin, for the design and assembly of a blast shield to add further protection for the Surface Systems engineers, for the design and assembly of a portable four monitor hyper wall strip that could extend as large as needed, research and programming a nano drill that could be utilized on a next generation robot or rover, and social media tasks including the making of videos, posting to social networking websites and creation of a new outreach program to help spread the word about the Swamp Works laboratory.

  11. MULTIPLE GALAXY COLLISIONS

    NASA Technical Reports Server (NTRS)

    2002-01-01

    Here is a sampling of 15 ultraluminous infrared galaxies viewed by NASA's Hubble Space Telescope. Hubble's sharp vision reveals more complexity within these galaxies, which astronomers are interpreting as evidence of a multiple-galaxy pileup. These images, taken by the Wide Field and Planetary Camera 2, are part of a three-year study of 123 galaxies within 3 billion light-years of Earth. The study was conducted in 1996, 1997, and 1999. False colors were assigned to these photos to enhance fine details within these coalescing galaxies. Credits: NASA, Kirk Borne (Raytheon and NASA Goddard Space Flight Center, Greenbelt, Md.), Luis Colina (Instituto de Fisica de Cantabria, Spain), and Howard Bushouse and Ray Lucas (Space Telescope Science Institute, Baltimore, Md.)

  12. MULTIPLE SPARK GAP SWITCH

    DOEpatents

    Schofield, A.E.

    1958-07-22

    A multiple spark gap switch of unique construction is described which will permit controlled, simultaneous discharge of several capacitors into a load. The switch construction includes a disc electrode with a plurality of protuberances of generally convex shape on one surface. A firing electrode is insulatingly supponted In each of the electrode protuberances and extends substantially to the apex thereof. Individual electrodes are disposed on an insulating plate parallel with the disc electrode to form a number of spark gaps with the protuberances. These electrodes are each connected to a separate charged capacitor and when a voltage ls applied simultaneously between the trigger electrodes and the dlsc electrode, each spark gap fires to connect its capacitor to the disc electrode and a subsequent load.

  13. Functional Connectivity of Multiple Brain Regions Required for the Consolidation of Social Recognition Memory.

    PubMed

    Tanimizu, Toshiyuki; Kenney, Justin W; Okano, Emiko; Kadoma, Kazune; Frankland, Paul W; Kida, Satoshi

    2017-04-12

    Social recognition memory is an essential and basic component of social behavior that is used to discriminate familiar and novel animals/humans. Previous studies have shown the importance of several brain regions for social recognition memories; however, the mechanisms underlying the consolidation of social recognition memory at the molecular and anatomic levels remain unknown. Here, we show a brain network necessary for the generation of social recognition memory in mice. A mouse genetic study showed that cAMP-responsive element-binding protein (CREB)-mediated transcription is required for the formation of social recognition memory. Importantly, significant inductions of the CREB target immediate-early genes c-fos and Arc were observed in the hippocampus (CA1 and CA3 regions), medial prefrontal cortex (mPFC), anterior cingulate cortex (ACC), and amygdala (basolateral region) when social recognition memory was generated. Pharmacological experiments using a microinfusion of the protein synthesis inhibitor anisomycin showed that protein synthesis in these brain regions is required for the consolidation of social recognition memory. These findings suggested that social recognition memory is consolidated through the activation of CREB-mediated gene expression in the hippocampus/mPFC/ACC/amygdala. Network analyses suggested that these four brain regions show functional connectivity with other brain regions and, more importantly, that the hippocampus functions as a hub to integrate brain networks and generate social recognition memory, whereas the ACC and amygdala are important for coordinating brain activity when social interaction is initiated by connecting with other brain regions. We have found that a brain network composed of the hippocampus/mPFC/ACC/amygdala is required for the consolidation of social recognition memory.SIGNIFICANCE STATEMENT Here, we identify brain networks composed of multiple brain regions for the consolidation of social recognition memory. We

  14. Multiple stage railgun

    DOEpatents

    Hawke, Ronald S.; Scudder, Jonathan K.; Aaland, Kristian

    1982-01-01

    A multiple stage magnetic railgun accelerator (10) for accelerating a projectile (15) by movement of a plasma arc (13) along the rails (11,12). The railgun (10) is divided into a plurality of successive rail stages (10a-n) which are sequentially energized by separate energy sources (14a-n) as the projectile (15) moves through the bore (17) of the railgun (10). Propagation of energy from an energized rail stage back towards the breech end (29) of the railgun (10) can be prevented by connection of the energy sources (14a-n) to the rails (11,12) through isolation diodes (34a-n). Propagation of energy from an energized rail stage back towards the breech end of the railgun can also be prevented by dividing the rails (11,12) into electrically isolated rail sections (11a-n, 12a-n). In such case means (55a-n) are used to extinguish the arc at the end of each energized stage and a fuse (31) or laser device (61) is used to initiate a new plasma arc in the next energized rail stage.

  15. [Smoking and multiple sclerosis].

    PubMed

    Arruti, Maialen; Castillo-Triviño, Tamara; Egüés, Nerea; Olascoaga, Javier

    2015-02-16

    Introduccion. La esclerosis multiple (EM) es una enfermedad autoinmune de etiologia compleja, hoy por hoy desconocida, en la que factores geneticos y ambientales determinan la susceptibilidad. En los ultimos años, el efecto del tabaco ha sido uno de los factores ambientales que ha emergido en la EM, y se ha asociado tanto a un aumento de la susceptibilidad como a un aumento de la progresion. Objetivo. Revisar la evidencia actual sobre el papel del tabaco en la EM. Desarrollo. Se incluye una actualizacion de los estudios publicados que han analizado distintos aspectos del tabaco en la EM: vias patogenicas implicadas, asociacion del tabaco y riesgo de EM, interaccion con otros factores de riesgo y efecto del tabaco en el curso de la enfermedad. Conclusiones. Los estudios observacionales demuestran que el tabaquismo incrementa de forma significativa el riesgo de EM (odds ratio ~ 1,5) y es un factor de riesgo independiente. Sin embargo, la EM es una enfermedad compleja y el aumento de riesgo por el tabaco puede diferir en funcion de la interaccion con otros factores geneticos y ambientales. El papel del tabaco como factor de progresion es mas controvertido, con resultados contradictorios y estudios de gran variabilidad, lo que dificulta establecer una conclusion firme. Los mecanismos por los que el tabaquismo modifica el riesgo y posiblemente la progresion de la enfermedad no son aun conocidos.

  16. Fatigue and multiple sclerosis.

    PubMed

    Béthoux, F

    2006-07-01

    Even if the definition and pathophysiology of fatigue in multiple sclerosis (MS) are still debated, and despite the scarcity of objective markers correlated with the subjective sensation of fatigue, a review of the literature shows the importance of its detection and management, and allows one to propose therapeutic strategies. Fatigue is not only the most frequently reported symptom in MS, but also a frequent source of activity and participation limitations, psychological distress, and impairment of quality of life. Its management, which must be initiated early, is based on a comprehensive evaluation of its characteristics and consequences (sometimes with the use of scales such as the Fatigue Severity Scale and the Modified Fatigue Impact Scale), and on the identification of many potential contributing factors (psychological disorders, sleep disturbances, pain, infections and other comorbidities, medications, and deconditioning). Rehabilitative interventions are essential to the treatment of fatigue. Beyond the traditional energy conservation strategies and cooling techniques, several randomized controlled studies have demonstrated the positive impact of aerobic exercise. Medications are partially beneficial, and with the exception of amantadine, their efficacy has not been confirmed by randomized double-blind trials.

  17. Isothermal Multiple Displacement Amplification

    PubMed Central

    Luthra, Rajyalakshmi; Medeiros, L. Jeffrey

    2004-01-01

    Isothermal multiple strand displacement amplification (IMDA) of the whole human genome is a promising method for procuring abundant DNA from valuable and often limited clinical specimens. However, whether DNA generated by this method is of high quality and a faithful replication of the DNA in the original specimen, allowing for subsequent molecular diagnostic testing, requires verification. In this study, we evaluated the suitability of IMDA-generated DNA (IMDA-DNA) for detecting antigen receptor gene rearrangements, chromosomal translocations, and gene mutations using Southern blot analysis, polymerase chain reaction (PCR) methods, or sequencing methods in 28 lymphoma and leukemia clinical specimens. Molecular testing before and after whole genome amplification of these specimens using the IMDA technique showed concordance in 27 of 28 (96%) specimens. Analysis of IMDA-DNA by Southern blot analysis detected restriction fragments >12 kilobases long. No amplification bias was observed at all loci tested demonstrating that this method can be useful in generating large amounts of unbiased, high molecular weight DNA from limited clinical specimens. PMID:15269301

  18. Multiple Myeloma: An Update

    PubMed Central

    Al-Farsi, Khalil

    2013-01-01

    Multiple myeloma is a rare, largely incurable malignant disease of plasma cells. Patients usually present with hypercalcemia, renal insufficiency, anemia and/or lytic bony lesions along with a monoclonal protein in the serum and/or urine in addition to an increase in the number of clonal plasma cells in the bone marrow. Patients with myeloma live on an average for five to seven years, with their survival dependent on the presence or absence of different prognostic markers. Treatment of younger fit patients is with induction therapy consisting of steroids with one or more novel anti-myeloma agents followed by high dose melphalan and autologous stem cell transplantation, while older and less fit patients are treated with melphalan-based combination chemotherapy. Supportive care is of paramount importance and includes the use of bisphosphonates, prophylactic antibiotics, thrombosis prophylaxis and the use of hematopoietic growth factors along with the treatment of complications of disease and its therapy. As more progress is being made and deeper responses are being attained, the disease might turn into a potentially curable one in the near future. PMID:23386937

  19. Progressive multiple sclerosis

    PubMed Central

    Ontaneda, Daniel; Fox, Robert J.

    2015-01-01

    Purpose to Review To highlight the pathological features and clinical aspects of progressive multiple sclerosis (PMS). To highlight results of clinical trial experience to date and review ongoing clinical trials and perspective new treatment options. Explain the challenges of clinical trial design in PMS. Recent Findings MS has been identified as a chronic immune mediated disease, and the progressive phase of the disease appears to have significant neurodegenerative mechanisms. The classification of the course of PMS has been re-organized into categories of active vs. inactive inflammatory disease and the presence vs. absence of gradual disease progression. This differentiation allows clearer conceptualization of PMS and possibly even more efficient recruitment of PMS subjects into clinical trials. Clinical trial experience to date in PMS has been negative with anti-inflammatory medications used in relapsing MS. Simvastatin was recently tested in a phase II trial and showed a 43% reduction on annualized atrophy progression in secondary progressive MS. Ongoing PMS trials are currently being conducted with the phosphodiesterase inhibitor ibudilast, S1P modulator siponimod, and anti-B-cell therapy ocrelizumab. Several efforts for development of outcome measures in PMS are ongoing. Summary PMS represents a significant challenge, as the pathogenesis of the disease is not well understood, no validated outcome metrics have been established, and clinical trial experience to date has been disappointing. Advances in the understanding of the disease and lessons learned in previous clinical trials are paving the way for successful development of disease modifying agents for this disease. PMID:25887766

  20. MULTIPLE SHAFT TOOL HEAD

    DOEpatents

    Colbert, H.P.

    1962-10-23

    An improved tool head arrangement is designed for the automatic expanding of a plurality of ferruled tubes simultaneously. A plurality of output shafts of a multiple spindle drill head are driven in unison by a hydraulic motor. A plurality of tube expanders are respectively coupled to the shafts through individual power train arrangements. The axial or thrust force required for the rolling operation is provided by a double acting hydraulic cylinder having a hollow through shaft with the shaft cooperating with an internally rotatable splined shaft slidably coupled to a coupling rigidly attached to the respectlve output shaft of the drill head, thereby transmitting rotary motion and axial thrust simultaneously to the tube expander. A hydraulic power unit supplies power to each of the double acting cylinders through respective two-position, four-way valves, under control of respective solenoids for each of the cylinders. The solenoids are in turn selectively controlled by a tool selection control unit which in turn is controlled by signals received from a programmed, coded tape from a tape reader. The number of expanders that are extended in a rolling operation, which may be up to 42 expanders, is determined by a predetermined program of operations depending upon the arrangement of the ferruled tubes to be expanded in the tube bundle. The tape reader also supplies dimensional information to a machine tool servo control unit for imparting selected, horizontal and/or vertical movement to the tool head assembly. (AEC)

  1. Multiple valence superatoms.

    PubMed

    Reveles, J U; Khanna, S N; Roach, P J; Castleman, A W

    2006-12-05

    We recently demonstrated that, in gas phase clusters containing aluminum and iodine atoms, an Al(13) cluster behaves like a halogen atom, whereas an Al(14) cluster exhibits properties analogous to an alkaline earth atom. These observations, together with our findings that Al(13)(-) is inert like a rare gas atom, have reinforced the idea that chosen clusters can exhibit chemical behaviors reminiscent of atoms in the periodic table, offering the exciting prospect of a new dimension of the periodic table formed by cluster elements, called superatoms. As the behavior of clusters can be controlled by size and composition, the superatoms offer the potential to create unique compounds with tailored properties. In this article, we provide evidence of an additional class of superatoms, namely Al(7)(-), that exhibit multiple valences, like some of the elements in the periodic table, and hence have the potential to form stable compounds when combined with other atoms. These findings support the contention that there should be no limitation in finding clusters, which mimic virtually all members of the periodic table.

  2. [Diet and multiple sclerosis].

    PubMed

    Pozuelo-Moyano, Beatriz; Benito-León, Julián

    2014-05-16

    Introduccion. El tipo de dieta se ha relacionado con el proceso inflamatorio que forma parte de la esclerosis multiple (EM). En los ultimos años, distintas lineas de investigacion han generado una gran cantidad de conocimiento sobre la participacion de la dieta en la patogenesis de la EM. Objetivo. Elucidar de modo critico las evidencias que relacionan distintos tipos de dietas y alimentos con la EM. Desarrollo. Se incluye una actualizacion de los estudios publicados mas significativos que han analizado el papel de la dieta en la patogenesis y en el tratamiento de la EM. Para explorar la asociacion entre la dieta y el riesgo de EM se ha revisado la evidencia disponible hasta el momento, pasando por estudios observacionales hasta terminar con estudios de intervencion. Conclusiones. Se necesita mas investigacion sobre la nutricion como factor de riesgo, ya que podria tener relacion con la enfermedad, y el control de esta podria llevar a una disminucion significativa de la incidencia o progresion de la patologia.

  3. Multiple sclerosis and behavior.

    PubMed

    Pinkston, James B; Kablinger, Anita; Alekseeva, Nadejda

    2007-01-01

    Multiple sclerosis (MS) is one of the most frequently seen neurological causes of progressive disability in early to middle adulthood. The disease is variable in its presentation and course, affects roughly 100-300 per 100,000 persons within the United States alone, and is slightly more common among females than males. MS places substantial burdens on patients, families, and caregivers. It negatively affects cognitive abilities and psychiatric functioning, and can add a notably deleterious effect on a patient's quality of life. This chapter reviews the recent literature on the behavioral manifestations of MS. Cognitive domains discussed include executive functioning, processing speed, attention, learning and memory, language functioning, and visual spatial processing. Some attention will also be paid to differential diagnosis and the cognitive effects of treatment. Psychiatric manifestations are also discussed, including symptoms of depression, bipolar disorder, euphoria, pathological laughter and crying, and psychosis, as well as maladaptive personality traits. Finally, the chapter concludes with a discussion of the effects of MS on quality of life including such areas as fatigue, sexual dysfunction, pain, employment, and cognitive functioning.

  4. Multiple trellis coded modulation

    NASA Technical Reports Server (NTRS)

    Simon, Marvin K. (Inventor); Divsalar, Dariush (Inventor)

    1990-01-01

    A technique for designing trellis codes to minimize bit error performance for a fading channel. The invention provides a criteria which may be used in the design of such codes which is significantly different from that used for average white Gaussian noise channels. The method of multiple trellis coded modulation of the present invention comprises the steps of: (a) coding b bits of input data into s intermediate outputs; (b) grouping said s intermediate outputs into k groups of s.sub.i intermediate outputs each where the summation of all s.sub.i,s is equal to s and k is equal to at least 2; (c) mapping each of said k groups of intermediate outputs into one of a plurality of symbols in accordance with a plurality of modulation schemes, one for each group such that the first group is mapped in accordance with a first modulation scheme and the second group is mapped in accordance with a second modulation scheme; and (d) outputting each of said symbols to provide k output symbols for each b bits of input data.

  5. Rituximab in multiple sclerosis

    PubMed Central

    Svenningsson, Rasmus; Alping, Peter; Novakova, Lenka; Björck, Anna; Fink, Katharina; Islam-Jakobsson, Protik; Malmeström, Clas; Axelsson, Markus; Vågberg, Mattias; Sundström, Peter; Lycke, Jan; Piehl, Fredrik; Svenningsson, Anders

    2016-01-01

    Objective: To investigate the safety and efficacy of rituximab in multiple sclerosis (MS). Methods: In this retrospective uncontrolled observational multicenter study, off-label rituximab-treated patients with MS were identified through the Swedish MS register. Outcome data were collected from the MS register and medical charts. Adverse events (AEs) grades 2–5 according to the Common Terminology Criteria for Adverse Events were recorded. Results: A total of 822 rituximab-treated patients with MS were identified: 557 relapsing-remitting MS (RRMS), 198 secondary progressive MS (SPMS), and 67 primary progressive MS (PPMS). At baseline, 26.2% had contrast-enhancing lesions (CELs). Patients were treated with 500 or 1,000 mg rituximab IV every 6–12 months, during a mean 21.8 (SD 14.3) months. During treatment, the annualized relapse rates were 0.044 (RRMS), 0.038 (SPMS), and 0.015 (PPMS), and 4.6% of patients displayed CELs. Median Expanded Disability Status Scale remained unchanged in RRMS (p = 0.42) and increased by 0.5 and 1.0 in SPMS and PPMS, respectively (p = 0.10 and 0.25). Infusion-related AEs occurred during 7.8% of infusions and most were mild. A total of 89 AEs grades ≥2 (of which 76 infections) were recorded in 72 patients. No case of progressive multifocal leukoencephalopathy was detected. Conclusions: This is the largest cohort of patients with MS treated with rituximab reported so far. The safety, clinical, and MRI findings in this heterogeneous real-world cohort treated with different doses of rituximab were similar to those reported in previous randomized controlled trials on B-cell depletion therapy in MS. Classification of evidence: This study provides Class IV evidence that for patients with MS, rituximab is safe and effective. PMID:27760868

  6. Swamp Works- Multiple Projects

    NASA Technical Reports Server (NTRS)

    Carelli, Jonathan M.

    2013-01-01

    My Surface Systems internship over the summer 2013 session covered a broad range of projects that ranged multiple aspects and fields of engineering and technology. This internship included a project to create a command center for a 120 ton regolith bin, a design and build for a blast shield to add further protection for the Surface Systems engineers, a design for a portable four monitor hyper wall that can extend as large as needed, research and programming a nano drill for a next generation robot, and social media tasks including the making of videos, posting to social networking websites and implementation of a new weekly outreach program to help spread the word about the Swamp Works laboratory. The objectives for the command center were to create a central computer controlled area for the still in production lunar regolith bin. It needed to be easy to use and the operating systems had to be Linux. The objectives for the hyper wall were to build a mobile transport of monitors that could potentially attach to one another. It needed to be light but sturdy, and have the ability to last. The objectives for the blast shield included a robust design that could withstand a small equipment malfunction, while also being convenient for use. The objectives for the nano-drill included the research and implementation of programming for vertical and horizontal movement. The hyper wall and blasts shield project were designed by me in the Pro/Engineer/Creo2 software. Each project required a meeting with the Swamp Works engineers and was declared successful.

  7. Multiple sclerosis update.

    PubMed

    Markowitz, Clyde E

    2013-11-01

    Multiple sclerosis (MS) is a chronic but incurable disease of the central nervous system (CNS) that is often diagnosed in the second or third decade of life. It is more common among women than men, significantly impairs patient quality of life, and is associated with substantial costs to patients, healthcare systems, and society. Of the approximately 2.3 million individuals worldwide that have MS, more than 400,000 reside in the United States. Although the etiology of MS is not completely understood, a great deal of evidence suggests a complex relationship between environmental and genetic factors. The pathophysiology of MS involves an aberrant attack by the host immune system on oligodendrocytes, which synthesize and maintain myelin sheaths in the CNS. There are 4 identified disease courses in MS, and approximately 85% of people with MS present with relapsing-remitting MS, which is characterized by discrete acute attacks followed by periods of remission. Signs and symptoms of MS are dependent on the demyelinated area(s) of the CNS and often involve sensory disturbances, limb weakness, fatigue, and increased body temperature. The criteria for a diagnosis of MS include evidence of damage in at least 2 separate areas of the CNS, evidence that the damage occurred at different time points, and the ruling out of other possible diagnoses. Diseasemodifying drugs (DMDs) that reduce the frequency of relapses, development of brain lesions, and progression of disability are the standard of care for relapsing forms of MS, and the use of DMDs should be initiated as early as possible.

  8. Multiple epiphyseal dysplasia

    PubMed Central

    2009-01-01

    Background Multiple epiphyseal dysplasia (MED) is a common genetically and clinically heterogeneous skeletal dysplasia characterized by early-onset osteoarthritis, mainly in the hip and knee, and mild-to-moderate short stature. Here we report on a 6-generation MED family with 17 affected members. Method The clinical and radiographic data on the 12 affected members still living were scrutinized. A structured inquiry comprising state of health and MED-related symptoms since birth up to the present time and the osteoarthritis outcome (KOOS) questionnaire were sent to all living family members with MED. The 5 known gene loci for autosomal dominant MED were analyzed for linkage, using fluorescence-labeled microsatellite markers. Linkage was ascertained with markers close to the COL9A2 gene, which was analyzed for mutations by sequencing. Results We identified an exon 3 donor splice mutation in the COL9A2 gene in all affected family members. Clinical, radiographic, and questionnaire data from affected family members suggested that MED caused by COL9A2 mutations starts in early childhood with knee pain accompanied by delayed ossification of femoral epiphyses. The disease then either stabilizes during puberty or progresses with additional joints becoming affected; joint surgery might be necessary. The progression of the disease also affects muscles, with increasing atrophy, resulting in muscle fatigue and pain. Muscular atrophy has not been reported earlier in cases with COL9A2 mutations. Interpretation In a patient with clinically suspected or verified MED, it is important to perform DNA-based analysis to identify a possible disease-causing mutation. This information can be used to carry out genetic risk assessment of other family members and to achieve an early and correct diagnosis in the children. PMID:19995321

  9. [Future challenges in multiple sclerosis].

    PubMed

    Fernández, Óscar

    2014-12-01

    Multiple sclerosis occurs in genetically susceptible individuals, in whom an unknown environmental factor triggers an immune response, giving rise to a chronic and disabling autoimmune disease. Currently, significant progress is being made in our knowledge of the frequency and distribution of multiple sclerosis and its risk factors, genetics, pathology, pathogenesis, diagnostic and prognostic markers, and treatment. This has radically changed patients' and clinicians' expectations of multiple sclerosis and has raised hope that there will soon be a way to control the disease.

  10. Multiplicative Thinking: Much More than Knowing Multiplication Facts and Procedures

    ERIC Educational Resources Information Center

    Hurst, Chris; Hurrell, Derek

    2016-01-01

    Multiplicative thinking is accepted as a "big idea" of mathematics that underpins important mathematical concepts such as fraction understanding, proportional reasoning, and algebraic thinking. It is characterised by understandings such as the multiplicative relationship between places in the number system, basic and extended number…

  11. Genetics Home Reference: multiple endocrine neoplasia

    MedlinePlus

    ... Multiple endocrine neoplasia, type 4 Genomics Education Programme (UK): Multiple Endocrine Neoplasia type 1 Genomics Education Programme (UK): Multiple Endocrine Neoplasia type 2A MalaCards: multiple endocrine ...

  12. Chaotic communication scheme with multiplication

    NASA Astrophysics Data System (ADS)

    Bobreshov, A. M.; Karavaev, A. A.

    2007-05-01

    A new scheme of data transmission with nonlinear admixing is described, in which the two mutually inverse operations (multiplication and division) ensure multiplicative mixing of the informative and chaotic signals that provides a potentially higher degree of security. A special feature of the proposed scheme is the absence of limitations (related to the division by zero) imposed on the types of informative signals.

  13. The problem with multiple robots

    NASA Technical Reports Server (NTRS)

    Huber, Marcus J.; Kenny, Patrick G.

    1994-01-01

    The issues that can arise in research associated with multiple, robotic agents are discussed. Two particular multi-robot projects are presented as examples. This paper was written in the hope that it might ease the transition from single to multiple robot research.

  14. Multiple Intelligences Centers and Projects.

    ERIC Educational Resources Information Center

    Chapman, Carolyn; Freeman, Lynn

    Based upon Gardner's theory of multiple intelligences, this book guides elementary school teachers through the process of using classroom learning centers and projects by providing choices for students. The guide is divided into two sections, providing the theoretical background and information on how to develop multiple intelligences learning…

  15. Folklore and the Multiple Intelligences.

    ERIC Educational Resources Information Center

    Koehnecke, Dianne Swenson

    1995-01-01

    Explores using Howard Gardner's multiple intelligences for folklore analysis. States that when listening to folktales, linguistic intelligence was used, as opposed to drawing pictures of the stories, which used spatial intelligence. Provides some ideas on how to bring folklore studies and the use of multiple intelligences into the classroom. (PA)

  16. Symptomatic therapy in multiple sclerosis

    PubMed Central

    Frohman, Teresa C.; Castro, Wanda; Shah, Anjali; Courtney, Ardith; Ortstadt, Jeffrey; Davis, Scott L.; Logan, Diana; Abraham, Thomas; Abraham, Jaspreet; Remington, Gina; Treadaway, Katherine; Graves, Donna; Hart, John; Stuve, Olaf; Lemack, Gary; Greenberg, Benjamin; Frohman, Elliot M.

    2011-01-01

    Multiple sclerosis is the most common disabling neurological disease of young adults. The ability to impact the quality of life of patients with multiple sclerosis should not only incorporate therapies that are disease modifying, but should also include a course of action for the global multidisciplinary management focused on quality of life and functional capabilities. PMID:21694806

  17. Adult Multiple Intelligences and Math.

    ERIC Educational Resources Information Center

    Costanzo, Meg Ryback

    In the Adult Multiple Intelligences (AMI) study, 10 teachers of adults from the northeastern region of the United States explored for 18 months the ways that multiple intelligences (MI) theory could support instruction and assessment in various adult learning contexts. The results of this research were published in a book by Julie Viens called MI…

  18. Multiple Intelligences for Differentiated Learning

    ERIC Educational Resources Information Center

    Williams, R. Bruce

    2007-01-01

    There is an intricate literacy to Gardner's multiple intelligences theory that unlocks key entry points for differentiated learning. Using a well-articulated framework, rich with graphic representations, Williams provides a comprehensive discussion of multiple intelligences. He moves the teacher and students from curiosity, to confidence, to…

  19. Multiplication Fact Fluency Using Doubles

    ERIC Educational Resources Information Center

    Flowers, Judith M.; Rubenstein, Rheta N.

    2010-01-01

    Not knowing multiplication facts creates a gap in a student's mathematics development and undermines confidence and disposition toward further mathematical learning. Learning multiplication facts is a first step in proportional reasoning, "the capstone of elementary arithmetic and the gateway to higher mathematics" (NRC 2001, p. 242). Proportional…

  20. Rickettsial Antibodies in Multiple Sclerosis

    PubMed Central

    Field, E. J.; Chambers, Mavis

    1970-01-01

    The serum of subjects with multiple sclerosis or other degenerative neurological diseases and that of normal controls does not differ significantly in its content of antibodies to several rickettsial antigens. There is no evidence for a rickettsial aetiology of multiple sclerosis, and no grounds for an extended clinical trial of Le Gac's full method of treatment with antibiotics. PMID:4983591

  1. Bent Bonds and Multiple Bonds.

    ERIC Educational Resources Information Center

    Robinson, Edward A.; Gillespie, Ronald J.

    1980-01-01

    Considers carbon-carbon multiple bonds in terms of Pauling's bent bond model, which allows direct calculation of double and triple bonds from the length of a CC single bond. Lengths of these multiple bonds are estimated from direct measurements on "bent-bond" models constructed of plastic tubing and standard kits. (CS)

  2. Electroconvulsive Therapy in Multiple Sclerosis.

    PubMed

    Steen, Katie; Narang, Puneet; Lippmann, Steven

    2015-01-01

    We performed a literature search regarding the safety and efficacy of electroconvulsive therapy in patients with multiple sclerosis and comorbid psychiatric symptoms. Literature review was conducted via PubMed databases. Of the cases we reviewed, most subjects with multiple sclerosis reported significant psychiatric symptom relief, with only a handful reporting neurologic deterioration. There was some evidence that active white matter lesions may be predictive of neurologic deterioration when electroconvulsive therapy is used in patients with multiple sclerosis. A brief description of the pathophysiology and effects of depression in patients with multiple sclerosis is also provided. Although no clinical recommendations or meaningful conclusions can be drawn without further investigation, the literature suggests that electroconvulsive therapy for treatment of psychiatric illnesses in patients with multiple sclerosis is safe and efficacious.

  3. Epidemiology of multiple sclerosis.

    PubMed

    Leray, E; Moreau, T; Fromont, A; Edan, G

    2016-01-01

    Multiple sclerosis (MS) is the most frequently seen demyelinating disease, with a prevalence that varies considerably, from high levels in North America and Europe (>100/100,000 inhabitants) to low rates in Eastern Asia and sub-Saharan Africa (2/100,000 population). Knowledge of the geographical distribution of the disease and its survival data, and a better understanding of the natural history of the disease, have improved our understanding of the respective roles of endogenous and exogenous causes of MS. Concerning mortality, in a large French cohort of 27,603 patients, there was no difference between MS patients and controls in the first 20 years of the disease, although life expectancy was reduced by 6-7 years in MS patients. In 2004, the prevalence of MS in France was 94.7/100,000 population, according to data from the French National Health Insurance Agency for Salaried Workers (Caisse nationale d'assurance maladie des travailleurs Salariés [CNAM-TS]), which insures 87% of the French population. This prevalence was higher in the North and East of France. In several countries, including France, the gender ratio for MS incidence (women/men) went from 2/1 to 3/1 from the 1950s to the 2000s, but only for the relapsing-remitting form. As for risk factors of MS, the most pertinent environmental factors are infection with Epstein-Barr virus (EBV), especially if it arises after childhood and is symptomatic. The role of smoking in MS risk has been confirmed, but is modest. In contrast, vaccines, stress, traumatic events and allergies have not been identified as risk factors, while the involvement of vitamin D has yet to be confirmed. From a genetic point of view, the association between HLA-DRB1*15:01 and a high risk of MS has been known for decades. More recently, immunogenetic markers have been identified (IL2RA, IL7RA) and, in particular thanks to studies of genome-wide associations, more than 100 genetic variants have been reported. Most of these are involved in

  4. Multiple Model Methods for Cost Function Based Multiple Hypothesis Trackers

    DTIC Science & Technology

    2006-03-01

    MHT’s Gaussian mixture with Multiple Model Adaptive Estimators (MMAEs) or Interacting Multiple Model (IMM) estimators, and replacing the elemental...Kalman Filtering . . . . . . . . . . . . . . . . . . . . . . . . . 2-2 2.3.1 Dynamics Design Models . . . . . . . . . . . . . . . 2-3 2.3.2 Propagation ...Track Life of Various Merging and Pruning Algorithms . . 2-30 3.1. Constant Velocity Truth Model Driven by White Gaussian Noise . . 3-3 3.2. Constant

  5. Autonomic dysfunction in multiple sclerosis.

    PubMed

    Racosta, Juan Manuel; Kimpinski, Kurt; Morrow, Sarah Anne; Kremenchutzky, Marcelo

    2015-12-01

    Autonomic dysfunction is a prevalent and significant cause of disability among patients with multiple sclerosis. Autonomic dysfunction in multiple sclerosis is usually explained by lesions within central nervous system regions responsible for autonomic regulation, but novel evidence suggests that other factors may be involved as well. Additionally, the interactions between the autonomic nervous system and the immune system have generated increased interest about the role of autonomic dysfunction in the pathogenesis of multiple sclerosis. In this paper we analyze systematically the most relevant signs and symptoms of autonomic dysfunction in MS, considering separately their potential causes and implications.

  6. On Multiple-Layered Vortices

    NASA Technical Reports Server (NTRS)

    Rossow, Vernon J.

    2011-01-01

    As part of an ongoing effort to find ways to make vortex flow fields decompose more quickly, photographs and observations are presented of vortex flow fields that indicate the presence of multiple layers of fluid rotating about a common axis. A survey of the literature indicates that multiple-layered vortices form in waterspouts, tornadoes and lift-generated vortices of aircraft. An explanation for the appearance of multiple-layered structures in vortices is suggested. The observations and data presented are intended to improve the understanding of the formation and persistence of vortex flow fields.

  7. Chronic hypothermia in multiple sclerosis.

    PubMed Central

    Sullivan, F; Hutchinson, M; Bahandeka, S; Moore, R E

    1987-01-01

    Two patients with clinically definite multiple sclerosis presented with acute hypothermia and on recovery were found to be chronically hypothermic. Thermoregulatory studies indicated a central, hypothalamic defect which is presumed to be due to a plaque of demyelination. PMID:3612161

  8. Multiplicities in high energy interactions

    SciTech Connect

    Derrick, M.

    1985-05-13

    This paper reviews the data on multiplicities in high energy interactions. Results from e/sup +/e/sup -/ annihilation, from neutrino interactions, and from hadronic collisions, both diffractive and nondiffractive, are compared and contrasted. The energy dependence of the mean charged multiplicity, , as well as the rapidity density at Y = 0 are presented. For hadronic collisions, the data on neutral pion production shows a strong correlation with . The heavy particle fractions increase with ..sqrt..s up to the highest energies. The charged particle multiplicity distributions for each type of reaction show a scaling behavior when expressed in terms of the mean. Attempts to understand this behavior, which was first predicted by Koba, Nielsen, and Olesen, are discussed. The multiplicity correlations and the energy variation of the shape of the KNO scaling distribution provide important constraints on models. Some extrapolations to the energies of the Superconducting Super Collider are made. 51 refs., 27 figs.

  9. Twins, Triplets, and Other Multiples

    MedlinePlus

    ... complications Pregnancy loss Know your pregnancy rights Getting ready for baby Childbirth and ... Twins, triplets, and other multiples If you are pregnant with more than one baby, you are far from alone. In the ...

  10. Multiple Thymoma with Myasthenia Gravis

    PubMed Central

    Seo, Dong Hyun; Cho, Sukki

    2017-01-01

    The actual incidence of multiple thymoma is unknown and rarely reported because it remains controversial whether the cases represent a disease of multicentric origin or a disease resulting from intrathymic metastasis. In this case, a patient underwent total thymectomy for multiple thymoma with myasthenia gravis via bilateral video-assisted thoracic surgery. A well-encapsulated multinodular cystic mass, measuring 57 mm×50 mm×22 mm in the right lobe of the thymus, and a well-encapsulated mass, measuring 32 mm×15 mm×14 mm in the left lobe, were found. Both tumors were type B2 thymoma. Few cases of multiple thymoma with myasthenia gravis have ever been reported in the literature. We report a case of synchronous multiple thymoma associated with myasthenia gravis. PMID:28180109

  11. Multiple Regression and Its Discontents

    ERIC Educational Resources Information Center

    Snell, Joel C.; Marsh, Mitchell

    2012-01-01

    Multiple regression is part of a larger statistical strategy originated by Gauss. The authors raise questions about the theory and suggest some changes that would make room for Mandelbrot and Serendipity.

  12. Genetics Home Reference: multiple myeloma

    MedlinePlus

    ... in these genes may interfere with proper control (regulation) of cell growth and division (proliferation), resulting in ... Plasma Cell Neoplasms Including Multiple Myeloma NCI Surveillance, Epidemiology, and End Results Program Educational Resources (5 links) ...

  13. Hereditary multiple exostoses and schizophrenia.

    PubMed

    Gòmez-Bernal, Germán

    2008-05-01

    I report a case of a patient who suffered schizophrenia and multiple exostoses and argue the possible role of EXT gene and nearly chromosomal loci in further genetic investigations related to schizophrenia.

  14. Humanizing Outgroups Through Multiple Categorization

    PubMed Central

    Prati, Francesca; Crisp, Richard J.; Meleady, Rose; Rubini, Monica

    2016-01-01

    In three studies, we examined the impact of multiple categorization on intergroup dehumanization. Study 1 showed that perceiving members of a rival university along multiple versus simple categorical dimensions enhanced the tendency to attribute human traits to this group. Study 2 showed that multiple versus simple categorization of immigrants increased the attribution of uniquely human emotions to them. This effect was explained by the sequential mediation of increased individuation of the outgroup and reduced outgroup threat. Study 3 replicated this sequential mediation model and introduced a novel way of measuring humanization in which participants generated attributes corresponding to the outgroup in a free response format. Participants generated more uniquely human traits in the multiple versus simple categorization conditions. We discuss the theoretical implications of these findings and consider their role in informing and improving efforts to ameliorate contemporary forms of intergroup discrimination. PMID:26984016

  15. Multiple oncocytomas and renal carcinoma

    SciTech Connect

    Velasquez, G.; Glass, T.A.; D'Souza, V.J.; Formanek, A.G.

    1984-01-01

    Renal oncocytoma, although rare, is being diagnosed more frequently, and criteria to differentiate it from other tumors have been described. Multiple oncocytomas have been reported, but an association between multiple oncocytomas and renal carcinoma in the same kidney has not been described. The authors report a case with two oncocytomas and a renal carcinoma in the right kidney as well as a right adrenal adenoma.

  16. Criteria for performing multiple dosimetry

    SciTech Connect

    Berger, C.D.; Gupta, V.P.; Pryor, K.H.

    1995-10-01

    When radiation fields vary spatially as a result of job- or location-specific conditions, the use of more than one dosimeter may be necessary for a variety of radiation protection purposes. This paper contains a methodology for when and how to use multiple dosimeters under conditions incident to routine activities in the presence of ionizing radiation. It also describes a methodology for determining the effective dose equivalent when the use of multiple dosimeters has been deemed necessary by radiation protection professionals.

  17. The INEL beryllium multiplication experiment

    SciTech Connect

    Smith, J.R.; King, J.J.

    1991-03-01

    The experiment to measure the multiplication of 14-MeV neutrons in bulk beryllium has been completed. The experiment consists of determining the ratio of {sup 56}Mn activities induced in a large manganese bath by a central 14-MeV neutron source, with and without a beryllium sample surrounding the source. In the manganese bath method a neutron source is placed at the center of a totally-absorbing aqueous solution of MnSo{sub 4}. The capture of neutrons by Mn produces a {sup 56}Mn activity proportional to the emission rate of the source. As applied to the measurement of the multiplication of 14- MeV neutrons in bulk beryllium, the neutron source is a tritium target placed at the end of the drift tube of a small deuteron accelerator. Surrounding the source is a sample chamber. When the sample chamber is empty, the neutrons go directly to the surrounding MnSO{sub 4} solution, and produce a {sup 56}Mn activity proportional to the neutron emission rate. When the chamber contains a beryllium sample, the neutrons first enter the beryllium and multiply through the (n,2n) process. Neutrons escaping from the beryllium enter the bath and produce a {sup 56}Mn activity proportional to the neutron emission rate multiplied by the effective value of the multiplication in bulk beryllium. The ratio of the activities with and without the sample present is proportional to the multiplication value. Detailed calculations of the multiplication and all the systematic effects were made with the Monte Carlo program MCNP, utilizing both the Young and Stewart and the ENDF/B-VI evaluations for beryllium. Both data sets produce multiplication values that are in excellent agreement with the measurements for both raw and corrected values of the multiplication. We conclude that there is not real discrepancy between experimental and calculated values for the multiplication of neutrons in bulk beryllium. 12 figs., 11 tabs., 18 refs.

  18. [Current therapy of multiple sclerosis].

    PubMed

    Antonio García Merino, J

    2014-12-01

    Since the introduction of interferon beta 1 b for the treatment of multiple sclerosis, there has been a progressive increase in the number of drugs available for this disease. Currently, 11 drugs have been approved in Spain, and their indications depend on specific clinical characteristics. The present article reviews these indications and also discusses other medications without official approval that have also been used in multiple sclerosis.

  19. A multiple armature railgun launcher

    NASA Astrophysics Data System (ADS)

    Challita, Antonios; Maas, Brian L.; Bauer, David P.; Heyse, Mark

    1993-01-01

    Railgun launchers with multiple armatures, which can distribute the accelerating force on the projectile, supply each armature with gun current for acceleration through its own set of rails. Test results are reported which confirm the feasibility of this concept; it is shown that the control of current distribution to multiple armatures is possible. Attention is given to gun behavior for the case of high length/diameter projectiles.

  20. Multiple phases of protien gels

    NASA Astrophysics Data System (ADS)

    Annaka, Masahiko; Tanaka, Toyoichi

    1994-03-01

    A multiple phase transition was observed in gels made by covalently cross-linking proteins in either native or denatured state. The enzymatic activity of the gels prepared from native α-chymotrypsin was determined for each of the multiple phases. The reversibility of the swelling degrees and the enzymatic reaction rates upon phase transition suggests that the protein is at a free energy minimum and thus in a phase.

  1. Therapeutics for multiple sclerosis symptoms.

    PubMed

    Ben-Zacharia, Aliza Bitton

    2011-01-01

    Symptoms management in multiple sclerosis is an integral part of its care. Accurate assessment and addressing the different symptoms provides increased quality of life among patients with multiple sclerosis. Multiple sclerosis symptoms may be identified as primary, secondary, or tertiary symptoms. Primary symptoms, such as weakness, sensory loss, and ataxia, are directly related to demyelination and axonal loss. Secondary symptoms, such as urinary tract infections as a result of urinary retention, are a result of the primary symptoms. Tertiary symptoms, such as reactive depression or social isolation, are a result of the social and psychological consequences of the disease. Common multiple sclerosis symptoms include fatigue and weakness; decreased balance, spasticity and gait problems; depression and cognitive issues; bladder, bowel, and sexual deficits; visual and sensory loss; and neuropathic pain. Less-common symptoms include dysarthria and dysphagia, vertigo, and tremors. Rare symptoms in multiple sclerosis include seizures, hearing loss, and paralysis. Symptom management includes nonpharmacological methods, such as rehabilitation and psychosocial support, and pharmacological methods, ie, medications and surgical procedures. The keys to symptom management are awareness, knowledge, and coordination of care. Symptoms have to be recognized and management needs to be individualized. Multiple sclerosis therapeutics include nonpharmacological strategies that consist of lifestyle modifications, rehabilitation, social support, counseling, and pharmacological agents or surgical procedures. The goal is vigilant management to improve quality of life and promote realistic expectations and hope.

  2. Performance of Multiple Pulse Multiple Delay Modulated UWB Signals in a Multiple Access Indoor Wireless Channel

    SciTech Connect

    Nekoogar, F

    2003-06-12

    In this paper, the performance of a two user UWB multiple access (UWB-MA) system based on multiple-pulse multiple-delay (MPMD) modulation scheme in an indoor wireless channel is evaluated by computer simulations. The indoor multipath propagation channel model used in this study is based on the modified statistical Saleh-Valenzuela model proposed by Foerester and Li from Intel. The simulation results indicate that the multipath performance of MPMD modulated signals in a multiple access system outperforms the nonmultipath case as the number of autocorrelation function (ACF) sampling points increases for each user. This is an unusual but important result, since MPMD receiver exploits multipath phenomenon in indoor wireless channels to increase the BER performance, hence the transmission rate in a UWB-MA system.

  3. Telerobotic management system: coordinating multiple human operators with multiple robots

    NASA Astrophysics Data System (ADS)

    King, Jamie W.; Pretty, Raymond; Brothers, Brendan; Gosine, Raymond G.

    2003-09-01

    This paper describes an application called the Tele-robotic management system (TMS) for coordinating multiple operators with multiple robots for applications such as underground mining. TMS utilizes several graphical interfaces to allow the user to define a partially ordered plan for multiple robots. This plan is then converted to a Petri net for execution and monitoring. TMS uses a distributed framework to allow robots and operators to easily integrate with the applications. This framework allows robots and operators to join the network and advertise their capabilities through services. TMS then decides whether tasks should be dispatched to a robot or a remote operator based on the services offered by the robots and operators.

  4. Convergence characteristics of the multiple input, multiple output LMS algorithm

    NASA Technical Reports Server (NTRS)

    Snyder, Scott D.; Hansen, Colin H.; Clark, Robert L.

    1992-01-01

    The convergence characteristics of the multiple input, multiple output LMS algorithm, as applied to active noise and vibration control systems, are examined. The mean square error during the convergence process, as well as the final converged value, are examined analytically and in computer simulation. It is shown that the ratio of number of error sensors to number of control sources has a significant influence upon both the converging and converged value of the mean square error. Other active control system variables, such as the inherent time delays and structural/acoustic transfer functions, are also shown to have a significant influence upon the convergence process.

  5. Pyrochemical neutron multiplicity counter design

    SciTech Connect

    Langner, D.G.; Ensslin, N.; Krick, M.S.

    1990-01-01

    Pyrochemical process materials are difficult to measure using conventional neutron counting methods because of significant self- multiplication and variable ({alpha},n) reaction rates. Multiplicity counters measure the first three moments of the neutron multiplicity distribution and thus make it possible to determine sample mass even when multiplication and ({alpha},n) rate are unknown. A new multiplicity counter suitable for inplant measurement of pyrochemical process materials has been designed using Monte Carlo simulations. The goals were to produce a counter that has high neutron detection efficiency, low die-away time, a flat spatial efficiency profile, and is insensitive to the neutron energy spectrum. Monte Carlo calculations were performed for several prototype models consisting of four rings of 71-cm active length {sup 3}He tubes in a polyethylene body. The cadmium-lined sample well is 25 cm in diameter to accommodate a wide variety of inplant sample containers. The counter can be free-standing or in-line without mechanical modification. The calculations were performed to determine the above design criteria for several configurations of tube spacing, cadmium liners, and sample height. Calculations were also performed for distributed sample sources to understand the integrated effects of variable neutron spectra on the counter. 5 refs., 8 figs., 1 tab.

  6. Maintenance therapy in multiple myeloma

    PubMed Central

    Mewawalla, Prerna; Chilkulwar, Abhishek

    2016-01-01

    Despite recent advances, multiple myeloma remains an incurable disease. Induction therapy followed by autologous transplantation has become the standard of care. The idea of maintenance therapy in multiple myeloma is not new. Starting with chemotherapy in 1975, to interferon in 1998, to novel agents recently, a multitude of agents have been explored in patients with multiple myeloma. In spite of the novel agents, multiple myeloma continues to be an incurable disease with the progression-free survival after autologous transplant rarely exceeding 3 years. The goal of using maintenance therapy has been to improve the outcomes following autologous transplantation by increasing the progression-free survival, deepening remissions and perhaps increasing overall survival. It has been shown that patients with a stringent complete response (CR) have a better outcome [Kapoor et al. 2013]. It is becoming increasingly common to check minimal residual disease (MRD) as a means of assessing depth of response. It has also been shown that patients with no MRD have not only a better progression-free survival but also a better overall survival compared with patients who are MRD positive. This makes it even more important to find agents for maintenance therapy, which can further deepen and maintain responses. Here, we present a comprehensive review of the agents studied as maintenance for multiple myeloma and their efficacy, both in terms of overall survival, progression-free survival and toxicity. PMID:28203343

  7. Multiple personality: self-rape.

    PubMed

    Beer, D; Beer, J; Beer, J

    1994-12-01

    Multiple personality disorder is the classification given a person for whom two or more distinct personalities are diagnosed. The personalities can be different and vary in character from aggressive to submissive (victimized). The victim alters can be abused and abuse or mutilate self to relieve anxiety or guilt (deserving punishment) or to exert control. Alters may provide a means of expressing anger or other feelings. Aggression towards the body may be sexually oriented, so one may ask whether aggression could make self-rape possible. If so, such expression of self-injuries may be observed in a person with multiple personality as when one alter may injure another. Clinical case material is presented on this concept for a woman who had been formally diagnosed with multiple personality disorder.

  8. Multiple Imputation Strategies for Multiple Group Structural Equation Models

    ERIC Educational Resources Information Center

    Enders, Craig K.; Gottschall, Amanda C.

    2011-01-01

    Although structural equation modeling software packages use maximum likelihood estimation by default, there are situations where one might prefer to use multiple imputation to handle missing data rather than maximum likelihood estimation (e.g., when incorporating auxiliary variables). The selection of variables is one of the nuances associated…

  9. Multiple order common path spectrometer

    NASA Technical Reports Server (NTRS)

    Newbury, Amy B. (Inventor)

    2010-01-01

    The present invention relates to a dispersive spectrometer. The spectrometer allows detection of multiple orders of light on a single focal plane array by splitting the orders spatially using a dichroic assembly. A conventional dispersion mechanism such as a defraction grating disperses the light spectrally. As a result, multiple wavelength orders can be imaged on a single focal plane array of limited spectral extent, doubling (or more) the number of spectral channels as compared to a conventional spectrometer. In addition, this is achieved in a common path device.

  10. [Current description of multiple sclerosis].

    PubMed

    Río, Jordi; Montalbán, Xavier

    2014-12-01

    Multiple sclerosis is a multifocal demyelinating disease leading to progressive neurodegeneration caused by an autoimmune response in genetically predisposed individuals. In the last few years, the knowledge and management of this disease has been revolutionized by a series of findings. The present article reviews pathological features of the disease, in which cortical involvement is increasingly implicated, and aspects related to novel pathogenic mechanisms, such as the role of the microbiota in the genesis of multiple sclerosis, as well as recent contributions from the fields of epidemiology and genetics. Also reviewed are the latest diagnostic criteria, which currently allow a much earlier diagnosis, with clear therapeutic implications.

  11. Multiple Sclerosis and its Management

    PubMed Central

    Weinshenker, Brian

    1992-01-01

    Multiple sclerosis, the most common disabling disease of the central nervous system affecting young adults, is diagnosed primarily from a history of typical relapsing and remitting white matter symptoms supported by objective signs. Multiple sclerosis may present in more insidious ways or may be mimicked by other diseases, which seemingly satisfy the diagnostic criteria of dissemination in time and space. Patients need psychological support to deal with an uncertain future. A multidisciplinary team approach can best manage both acute temporary disability and, often later, progressive physical and occasionally mental disability. ImagesFigures 1-3 PMID:21221279

  12. Evoked potentials in multiple sclerosis.

    PubMed

    Kraft, George H

    2013-11-01

    Before the development of magnetic resonance imaging (MRI), evoked potentials (EPs)-visual evoked potentials, somatosensory evoked potentials, and brain stem auditory evoked responses-were commonly used to determine a second site of disease in patients being evaluated for possible multiple sclerosis (MS). The identification of an area of the central nervous system showing abnormal conduction was used to supplement the abnormal signs identified on the physical examination-thus identifying the "multiple" in MS. This article is a brief overview of additional ways in which central nervous system (CNS) physiology-as measured by EPs-can still contribute value in the management of MS in the era of MRIs.

  13. Multiplicative calculus and its applications

    NASA Astrophysics Data System (ADS)

    Bashirov, Agamirza E.; Kurpinar, Emine Misirli; Özyapici, Ali

    2008-01-01

    Two operations, differentiation and integration, are basic in calculus and analysis. In fact, they are the infinitesimal versions of the subtraction and addition operations on numbers, respectively. In the period from 1967 till 1970 Michael Grossman and Robert Katz gave definitions of a new kind of derivative and integral, moving the roles of subtraction and addition to division and multiplication, and thus established a new calculus, called multiplicative calculus. In the present paper our aim is to bring up this calculus to the attention of researchers and demonstrate its usefulness.

  14. Body composition in multiple sclerosis

    PubMed Central

    Dionyssiotis, Y

    2013-01-01

    Multiple sclerosis affects central nervous system leading to disability. Among other complications the deterioration of body composition is usually neglected and increases the risk for diseases such as coronary heart disease, non-insulin dependent diabetes mellitus, lipid abnormalities and bone loss leading to fractures in this population. Body mass index values, the effect of spasticity, the increased number of drugs used and the relationship between skeletal muscle and bone which interacts with impaired motor function leading to body composition alterations in multiple sclerosis are reviewed. PMID:23935336

  15. Multiple McNemar tests.

    PubMed

    Westfall, Peter H; Troendle, James F; Pennello, Gene

    2010-12-01

    Methods for performing multiple tests of paired proportions are described. A broadly applicable method using McNemar's exact test and the exact distributions of all test statistics is developed; the method controls the familywise error rate in the strong sense under minimal assumptions. A closed form (not simulation-based) algorithm for carrying out the method is provided. A bootstrap alternative is developed to account for correlation structures. Operating characteristics of these and other methods are evaluated via a simulation study. Applications to multiple comparisons of predictive models for disease classification and to postmarket surveillance of adverse events are given.

  16. Development of a Multimorbidity Illness Perceptions Scale (MULTIPleS)

    PubMed Central

    Gibbons, Chris J.; Kenning, Cassandra; Coventry, Peter A.; Bee, Penny; Bundy, Christine; Fisher, Louise; Bower, Peter

    2013-01-01

    Background Illness perceptions are beliefs about the cause, nature and management of illness, which enable patients to make sense of their conditions. These perceptions can predict adjustment and quality of life in patients with single conditions. However, multimorbidity (i.e. patients with multiple long-term conditions) is increasingly prevalent and a key challenge for future health care delivery. The objective of this research was to develop a valid and reliable measure of illness perceptions for multimorbid patients. Methods Candidate items were derived from previous qualitative research with multimorbid patients. Questionnaires were posted to 1500 patients with two or more exemplar long-term conditions (depression, diabetes, osteoarthritis, coronary heart disease and chronic obstructive pulmonary disease). Data were analysed using factor analysis and Rasch analysis. Rasch analysis is a modern psychometric technique for deriving unidimensional and intervally-scaled questionnaires. Results Questionnaires from 490 eligible patients (32.6% response) were returned. Exploratory factor analysis revealed five potential subscales ‘Emotional representations’, ‘Treatment burden’, ‘Prioritising conditions’, ‘Causal links’ and ‘Activity limitations’. Rasch analysis led to further item reduction and the generation of a summary scale comprising of items from all scales. All scales were unidimensional and free from differential item functioning or local independence of items. All scales were reliable, but for each subscale there were a number of patients who scored at the floor of the scale. Conclusions The MULTIPleS measure consists of five individual subscales and a 22-item summary scale that measures the perceived impact of multimorbidity. All scales showed good fit to the Rasch model and preliminary evidence of reliability and validity. A number of patients scored at floor of each subscale, which may reflect variation in the perception of multimorbidity

  17. Dephosphorylation-induced ubiquitination and degradation of FMRP in dendrites: a role in immediate early mGluR-stimulated translation

    PubMed Central

    Nalavadi, Vijayalaxmi C.; Muddashetty, Ravi S.; Gross, Christina; Bassell, Gary J.

    2012-01-01

    Fragile X Syndrome is caused by the loss of FMRP, which represses and reversibly regulates the translation of a subset of mRNAs in dendrites. Protein synthesis can be rapidly stimulated by mGluR-induced and PP2A-mediated dephosphorylation of FMRP, which is coupled to the dissociation of FMRP and target mRNAs from miRISC complexes. Here, we report the rapid ubiquitination and UPS mediated degradation of FMRP in dendrites upon DHPG stimulation in cultured rat neurons. Using inhibitors to PP2A and FMRP phosphomutants, degradation of FMRP was observed to depend on its prior dephosphorylation. Translational induction of an FMRP target, PSD-95 mRNA, required both PP2A and UPS. Thus, control of FMRP levels at the synapse by dephosphorylation-induced and UPS mediated degradation provides a mode to regulate protein synthesis. PMID:22357842

  18. Connective tissue growth factor: a cysteine-rich mitogen secreted by human vascular endothelial cells is related to the SRC-induced immediate early gene product CEF-10

    PubMed Central

    1991-01-01

    Human umbilical vein endothelial (HUVE) cells have been previously reported to express the genes for the A and B chains of PDGF and to secrete PDGF-related factors into culture media. Antihuman PDGF IgG affinity chromatography was used to purify PDGF-related activity from HUVE cell-conditioned media. Immunoblot analysis of the affinity- purified proteins with anti-PDGF IgG and antibodies specific for the A or B chain peptides of PDGF combined with chemotactic and mitogenic assays revealed that the major PDGF immunorelated molecule secreted by HUVE cells is a monomer of approximately 36-38 kD and that less than 10% of the purified biologically active molecules are PDGF A or B chain peptides. Screening of an HUVE cell cDNA library in the expression vector lambda gtl 1 with the anti-PDGF antibody resulted in the cloning and sequencing of a cDNA with an open reading frame encoding a 38-kD cysteine-rich secreted protein which we show to be the major PDGF- related mitogen secreted by human vascular endothelial cells. The protein has a 45% overall homology to the translation product of the v- src-induced CEF-10 mRNA from chick embryo fibroblasts. We have termed this new mitogen connective tissue growth factor. PMID:1654338

  19. Striatal patch compartment lesions alter methamphetamine-induced behavior and immediate early gene expression in the striatum, substantia nigra and frontal cortex.

    PubMed

    Murray, Ryan C; Gilbert, Yamiece E; Logan, Anna S; Hebbard, John C; Horner, Kristen A

    2014-07-01

    Methamphetamine (METH) induces stereotypy, which is characterized as inflexible, repetitive behavior. Enhanced activation of the patch compartment of the striatum has been correlated with stereotypy, suggesting that stereotypy may be related to preferential activation of this region. However, the specific contribution of the patch compartment to METH-induced stereotypy is not clear. To elucidate the involvement of the patch compartment to the development of METH-induced stereotypy, we determined if destruction of this sub-region altered METH-induced behaviors. Animals were bilaterally infused in the striatum with the neurotoxin dermorphin-saporin (DERM-SAP; 17 ng/μl) to specifically ablate the neurons of the patch compartment. Eight days later, animals were treated with METH (7.5 mg/kg), placed in activity chambers, observed for 2 h and killed. DERM-SAP pretreatment significantly reduced the number and total area of mu-labeled patches in the striatum. DERM-SAP pretreatment significantly reduced the intensity of METH-induced stereotypy and the spatial immobility typically observed with METH-induced stereotypy. In support of this observation, DERM-SAP pretreatment also significantly increased locomotor activity in METH-treated animals. In the striatum, DERM-SAP pretreatment attenuated METH-induced c-Fos expression in the patch compartment, while enhancing METH-induced c-Fos expression in the matrix compartment. DERM-SAP pretreatment followed by METH administration augmented c-Fos expression in the SNpc and reduced METH-induced c-Fos expression in the SNpr. In the medial prefrontal, but not sensorimotor cortex, c-Fos and zif/268 expression was increased following METH treatment in animals pre-treated with DERM-SAP. These data indicate that the patch compartment is necessary for the expression of repetitive behaviors and suggests that alterations in activity in the basal ganglia may contribute to this phenomenon.

  20. Dynamic Shifts in Corticostriatal Expression Patterns of the Immediate Early Genes "Homer 1a" and "Zif268" during Early and Late Phases of Instrumental Training

    ERIC Educational Resources Information Center

    Kelley, Ann E.; Hernandez, Pepe J.; Schiltz, Craig A.

    2006-01-01

    Adaptive motor actions require prior knowledge of instrumental contingencies. With practice, these actions can become highly automatic in nature. However, the molecular and anatomical substrates mediating these related forms of learning are not understood. In the present study, we used in situ hybridization to measure the mRNA levels of two…