9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2012 CFR

2012-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

Development of a multiplex polymerase chain reaction-sequence-specific primer method for NKG2D and NKG2F single-nucleotide polymorphism typing using isothermal multiple displacement amplification products.

PubMed

Kaewmanee, M; Phoksawat, W; Romphruk, A; Romphruk, A V; Jumnainsong, A; Leelayuwat, C

2013-06-01

Natural killer group 2 member D (NKG2D) on immune effector cells recognizes multiple stress-inducible ligands. NKG2D single-nucleotide polymorphism (SNP) haplotypes were related to the levels of cytotoxic activity of peripheral blood mononuclear cells. Indeed, these polymorphisms were also located in NKG2F. Isothermal multiple displacement amplification (IMDA) is used for whole genome amplification (WGA) that can amplify very small genomic DNA templates into microgram with whole genome coverage. This is particularly useful in the cases of limited amount of valuable DNA samples requiring multi-locus genotyping. In this study, we evaluated the quality and applicability of IMDA to genetic studies in terms of sensitivity, efficiency of IMDA re-amplification and stability of IMDA products. The smallest amount of DNA to be effectively amplified by IMDA was 200 pg yielding final DNA of approximately 16 µg within 1.5 h. IMDA could be re-amplified only once (second round of amplification), and could be kept for 5 months at 4°C and more than a year at -20°C without loosing genome coverage. The amplified products were used successfully to setup a multiplex polymerase chain reaction-sequence-specific primer for SNP typing of the NKG2D/F genes. The NKG2D/F multiplex polymerase chain reaction (PCR) contained six PCR mixtures for detecting 10 selected SNPs, including 8 NKG2D/F SNP haplotypes and 2 additional NKG2D coding SNPs. This typing procedure will be applicable in both clinical and research laboratories. Thus, our data provide useful information and limitations for utilization of genome-wide amplification using IMDA and its application for multiplex NKG2D/F typing. © 2013 John Wiley & Sons Ltd.

Nuclear TRIM25 Specifically Targets Influenza Virus Ribonucleoproteins to Block the Onset of RNA Chain Elongation.

PubMed

Meyerson, Nicholas R; Zhou, Ligang; Guo, Yusong R; Zhao, Chen; Tao, Yizhi J; Krug, Robert M; Sawyer, Sara L

2017-11-08

TRIM25 is an E3 ubiquitin ligase that activates RIG-I to promote the antiviral interferon response. The NS1 protein from all strains of influenza A virus binds TRIM25, although not all virus strains block the interferon response, suggesting alternative mechanisms for TRIM25 action. Here we present a nuclear role for TRIM25 in specifically restricting influenza A virus replication. TRIM25 inhibits viral RNA synthesis through a direct mechanism that is independent of its ubiquitin ligase activity and the interferon pathway. This activity can be inhibited by the viral NS1 protein. TRIM25 inhibition of viral RNA synthesis results from its binding to viral ribonucleoproteins (vRNPs), the structures containing individual viral RNA segments, the viral polymerase, and multiple viral nucleoproteins. TRIM25 binding does not inhibit initiation of capped-RNA-primed viral mRNA synthesis by the viral polymerase. Rather, the onset of RNA chain elongation is inhibited because TRIM25 prohibits the movement of RNA into the polymerase complex. Copyright © 2017 Elsevier Inc. All rights reserved.

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2010 CFR

2010-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2011 CFR

2011-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

Modified pseudomonas oleovorans phaC1 nucleic acids encoding bispecific polyhydroxyalkanoate polymerase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Srienc, Friedrich; Jackson, John K.; Somers, David A.

A genetically engineered Pseudomonas oleovorans phaC1 polyhydroxyalkanoate (PHA) polymerase having tailored substrate specificity is provided. The modified PHA polymerase is preferably a "bispecific" PHA polymerase capable of copolymerizing a short chain length monomer and a medium chain length monomer is provided. Methods for making the modified PHA polymerase and for making nucleic acids encoding the modified PHA polymerase are also disclosed, as are methods of producing PHA using the modified PHA polymerase. The invention further includes methods to assay for altered substrate specificity.

Mycobacterium avium restriction fragment length polymorphism-IS IS1245 and the simple double repetitive element polymerase chain reaction typing method to screen genetic diversity in Brazilian strains.

PubMed

Sequeira, Patrícia Carvalho de; Fonseca, Leila de Souza; Silva, Marlei Gomes da; Saad, Maria Helena Féres

2005-11-01

Simple double repetitive element polymerase chain reaction (MaDRE-PCR) and Pvu II-IS1245 restriction fragment length polymorphism (RFLP) typing methods were used to type 41 Mycobacterium avium isolates obtained from 14 AIDS inpatients and 10 environment and animals specimens identified among 53 mycobacteria isolated from 237 food, chicken, and pig. All environmental and animals strains showed orphan patterns by both methods. By MaDRE-PCR four patients, with multiple isolates, showed different patterns, suggesting polyclonal infection that was confirmed by RFLP in two of them. This first evaluation of MaDRE-PCR on Brazilian M. avium strains demonstrated that the method seems to be useful as simple and less expensive typing method for screening genetic diversity in M. avium strains on selected epidemiological studies, although with limitation on analysis identical patterns except for one band.

Dual phase multiplex polymerase chain reaction

DOEpatents

Pemov, Alexander [Charlottesville, VA; Bavykin, Sergei [Darien, IL

2008-10-07

Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.

DNA Sequences from Formalin-Fixed Nematodes: Integrating Molecular and Morphological Approaches to Taxonomy

PubMed Central

Thomas, W. Kelley; Vida, J. T.; Frisse, Linda M.; Mundo, Manuel; Baldwin, James G.

1997-01-01

To effectively integrate DNA sequence analysis and classical nematode taxonomy, we must be able to obtain DNA sequences from formalin-fixed specimens. Microdissected sections of nematodes were removed from specimens fixed in formalin, using standard protocols and without destroying morphological features. The fixed sections provided sufficient template for multiple polymerase chain reaction-based DNA sequence analyses. PMID:19274156

Bovine leukemia virus infection in a juvenile alpaca with multicentric lymphoma

PubMed Central

Lee, Laura C.; Scarratt, William K.; Buehring, Gertrude C.; Saunders, Geoffrey K.

2012-01-01

A 13-month-old alpaca (Vicugna pacos) was presented for mandibular masses and weight loss. Histopathology of biopsy tissue was consistent with lymphoma. The alpaca was euthanized and necropsy revealed lymphoma masses in multiple organs. Immunohistochemistry for T- and B-cell typing was inconclusive. Serology and in-situ polymerase chain reaction hybridization were positive for bovine leukemia virus. PMID:22942445

Problem-Solving Test: Real-Time Polymerase Chain Reaction

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2009-01-01

Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…

Molecular typing of Lactobacillus brevis isolates from Korean food using repetitive element-polymerase chain reaction.

PubMed

Kaur, Jasmine; Sharma, Anshul; Lee, Sulhee; Park, Young-Seo

2018-06-01

Lactobacillus brevis is a part of a large family of lactic acid bacteria that are present in cheese, sauerkraut, sourdough, silage, cow manure, feces, and the intestinal tract of humans and rats. It finds its use in food fermentation, and so is considered a "generally regarded as safe" organism. L. brevis strains are extensively used as probiotics and hence, there is a need for identifying and characterizing these strains. For identification and discrimination of the bacterial species at the subspecific level, repetitive element-polymerase chain reaction method is a reliable genomic fingerprinting tool. The objective of the present study was to characterize 13 strains of L. brevis isolated from various fermented foods using repetitive element-polymerase chain reaction. Repetitive element-polymerase chain reaction was performed using three primer sets, REP, Enterobacterial Repetitive Intergenic Consensus (ERIC), and (GTG) 5 , which produced different fingerprinting patterns that enable us to distinguish between the closely related strains. Fingerprinting patterns generated band range in between 150 and 5000 bp with REP, 200-7500 bp with ERIC, and 250-2000 bp with (GTG) 5 primers, respectively. The Jaccard's dissimilarity matrices were used to obtain dendrograms by the unweighted neighbor-joining method using genetic dissimilarities based on repetitive element-polymerase chain reaction fingerprinting data. Repetitive element-polymerase chain reaction proved to be a rapid and easy method that can produce reliable results in L. brevis species.

High-risk human papillomavirus infection involving multiple anatomic sites of the female lower genital tract: a multiplex real-time polymerase chain reaction-based study.

PubMed

Hui, Yiang; Manna, Pradip; Ou, Joyce J; Kerley, Spencer; Zhang, Cunxian; Sung, C James; Lawrence, W Dwayne; Quddus, M Ruhul

2015-09-01

High-risk human papillomavirus infection usually is seen at one anatomic site in an individual. Rarely, infection at multiple anatomic sites of the female lower genital tract in the same individual is encountered either simultaneously and/or at a later date. The current study identifies the various subtypes of high-risk human papillomavirus infection in these scenarios and analyzes the potential significance of these findings. High-risk human papillomavirus infection involving 22 anatomic sites from 7 individuals was identified after institutional review board approval. Residual paraffin-embedded tissue samples were retrieved, and all 15 high-risk human papillomavirus were identified and viral load quantified using multiplex real-time polymerase chain reaction-based method. Multiple high-risk human papillomavirus subtypes were identified in 32% of the samples and as many as 5 different subtypes of high-risk human papillomavirus infection in a single anatomic site. In general, each anatomic site has unique combination of viral subtypes, although one individual showed overlapping subtypes in the vagina, cervix, and vulvar samples. Higher viral load and rare subtypes are more frequent in younger patients and in dysplasia compared with carcinoma. Follow-up ranging from 3 to 84 months revealed persistent high-risk human papillomavirus infection in 60% of cases. Copyright © 2015 Elsevier Inc. All rights reserved.

Acute disseminated toxoplasmosis in a juvenile cheetah (Acinonyx jubatus).

PubMed

Lloyd, Christopher; Stidworthy, Mark F

2007-09-01

A juvenile cheetah (Acinonyx jubatus) died with rapidly progressive pyrexia, tachypnea, abdominal effusion, and hepatomegaly. Postmortem examination revealed lesions consistent with acute disseminated infection with Toxoplasma gondii. The presence of this organism was confirmed in multiple organs by immunohistochemistry and polymerase chain reaction. To the best of our knowledge, we propose this to be the first reported case of primary acute disseminated toxoplasmosis in a cheetah.

Identification of Bacterial Plant Pathogens Using Multilocus Polymerase Chain Reaction/Electrospray Ionization-Mass Spectrometry

DTIC Science & Technology

2008-01-01

sandii FK-53; OLF#1 Oleander; USA 1 Xylophilus ampelinus FB-1178 Grape; S. Africa 1 Xylophilus ampelinus FJ-3; 60002 Grape; S. Africa 1 1160...campestris Xanthomonas campestris Xylella fastidiosa (6 strains) Xylella fastidiosa Xylophilus ampelinus (2 strains) Xylophilus ampelinus ...Rathayibacter iranicus Rathayibacter iranicus Xylophilus ampelinus Xylophilus ampelinus a Purified DNAs from multiple bacteria were mixed at equal

Identification of the people from whom engorged Aedes aegypti took blood meals in Florida, Puerto Rico, using polymerase chain reaction-based DNA profiling.

PubMed

De Benedictis, John; Chow-Shaffer, Esther; Costero, Adriana; Clark, Gary G; Edman, John D; Scott, Thomas W

2003-04-01

We used polymerase chain reaction-based DNA profiling to construct allelic profiles for residents and visitors of 22 houses in Florida, Puerto Rico, and human DNA from blood meals in Aedes aegypti that were collected in those homes. Complete profiles were obtained for < or = 2 days after blood ingestion. Eighteen percent of the meals came from two different people. There was no evidence of meals from > or = 2 people. Eighty percent of the meal sources were identified, > 70% were taken from residents of the collection house, and > 90% were from residents of the study community. Across the community, feeding was non-random with a bias towards young adults and males. Three people accounted for 56% of the meals. Our results confirm that multiple feeding on different people is an important component in the role of Ae. aegypti in dengue virus transmission and help explain the spatial distribution of dengue cases in a previous epidemic in Florida, Puerto Rico.

The actin multigene family and livestock speciation using the polymerase chain reaction.

PubMed

Fairbrother, K S; Hopwood, A J; Lockley, A K; Bardsley, R G

1998-01-01

Actins constitute a family of highly-conserved multifunctional intracellular proteins, best known as myofibrillar components in striated muscle fibres. Most vertebrate genomes contain numerous actin genes with high sequence homology in protein coding regions but considerable variability in intron number and sizes. This genetic diversity can be utilised for livestock speciation purposes. The high sequence conservation has enabled a single pair of oligonucleotides to be used to prime the polymerase chain reaction (PCR) with DNA extracted from all animals so far studied. Multiple amplification products were obtained which on gel electrophoresis constituted characteristic species-specific 'fingerprints'. The patterns were reproducible, did not vary between individuals of the same breed or between different breeds within a species, and could be generated even from heat-processed muscle held at 120 degrees C for one hour. Given the capacity of PCR to amplify relatively short sequences in highly-degraded DNA, this approach may be suitable for authentication of processed meat products.

Amebic Liver Abscess Diagnosed by Polymerase Chain Reaction in 14 Returning Travelers

PubMed Central

Vallois, Dorothée; Epelboin, Loïc; Touafek, Feriel; Magne, Denis; Thellier, Marc; Bricaire, François; Caumes, Eric

2012-01-01

Amebic liver abscesses (ALA) are not commonly described in travelers. The ALA diagnosis is usually based on serology and Entamoeba histolytica polymerase chain reaction (PCR) is a new tool. We retrospectively reviewed all ALA cases diagnosed by PCR on the liver abscess pus aspirate of patients admitted in French hospitals between 2007 and 2011. Fourteen cases (10 male, median age 48 years) were included. The median lag time between return and onset of symptoms was 23 days (interquartile range [IQ] 18–24). All patients had an elevated cardiopulmonary resuscitation level, and 11 had leukocytosis. The ALA was multiple in five patients, localized in the right lobe in 12, and higher than 5 cm in 11. Serology was initially negative in one patient, whereas PCR was positive. There was bacterial co-infection in one patient. The outcome was good. Liver puncture allows a rapid diagnosis of ALA with PCR and helps identify the association with a bacterial dual infection. PMID:23033402

Primer-independent RNA sequencing with bacteriophage phi6 RNA polymerase and chain terminators.

PubMed

Makeyev, E V; Bamford, D H

2001-05-01

Here we propose a new general method for directly determining RNA sequence based on the use of the RNA-dependent RNA polymerase from bacteriophage phi6 and the chain terminators (RdRP sequencing). The following properties of the polymerase render it appropriate for this application: (1) the phi6 polymerase can replicate a number of single-stranded RNA templates in vitro. (2) In contrast to the primer-dependent DNA polymerases utilized in the sequencing procedure by Sanger et al. (Proc Natl Acad Sci USA, 1977, 74:5463-5467), it initiates nascent strand synthesis without a primer, starting the polymerization on the very 3'-terminus of the template. (3) The polymerase can incorporate chain-terminating nucleotide analogs into the nascent RNA chain to produce a set of base-specific termination products. Consequently, 3' proximal or even complete sequence of many target RNA molecules can be rapidly deduced without prior sequence information. The new technique proved useful for sequencing several synthetic ssRNA templates. Furthermore, using genomic segments of the bluetongue virus we show that RdRP sequencing can also be applied to naturally occurring dsRNA templates. This suggests possible uses of the method in the RNA virus research and diagnostics.

Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

DOEpatents

Cruz-Perez, Patricia; Buttner, Mark P.

2004-05-11

A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

Ureaplasma urealyticum biovar determination in women attending a family planning clinic in Guiné-Bissau, using polymerase chain reaction of the multiple-banded antigen gene.

PubMed

Domingues, D; Tavira, L Távora; Duarte, A; Sanca, A; Prieto, E; Exposto, F

2002-01-01

Although Ureaplasma urealyticum is commonly found in the genital tract of asymptomatic women, it has been suggested that only certain subgroups of this microorganism are disease associated. Vaginal specimens were collected to determine the distribution of U. urealyticum biovars and to estimate their possible association with age, absence of lactobacilli, and tetracycline resistance. Of the 94 women studied, 40 (43%) carried U. urealyticum and were biotyped by polymerase chain reaction (PCR). Twenty-nine (73%) strains presented with parvo biovar, 10 (25%) with T960 biovar, and one (2.5%) with both biovars. Parvo biovar was predominant in all age groups and appears to be more frequent in women 20-25 years of age (41%), whereas T960 was common in women 30-35 years of age (22%). In this study, U. urealyticum was not associated with changes in vaginal flora, although the inverse apparently was true for Mycoplasma hominis. However, T960 biovar was more associated with the loss of lactobacilli than was parvo biovar. The number of T960 biovar strains that presented tetracycline (40%) or multiple (100%) resistance was higher than that of parvo biovar strains (27% and 69%, respectively). Copyright 2002 Wiley-Liss, Inc.

Thermally multiplexed polymerase chain reaction.

PubMed

Phaneuf, Christopher R; Pak, Nikita; Saunders, D Curtis; Holst, Gregory L; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L; Jerris, Robert; Forest, Craig R

2015-07-01

Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously-each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel.

Measurement of messenger RNA encoding the alpha-chain, polymeric immunoglobulin receptor, and J-chain in duodenal mucosa from dogs with and without chronic diarrhea by use of quantitative real-time reverse transcription-polymerase chain reaction assays.

PubMed

Peters, Iain R; Helps, Chris R; Calvert, Emma L; Hall, Edward J; Day, Michael J

2005-01-01

To examine the difference in expression of messenger RNA (mRNA) transcripts for polymeric immunoglobulin receptor (plgR), alpha-chain, and J-chain determined by use of quantitative real-time reverse transcription-polymerase chain reaction (QRT-PCR) assays in duodenal biopsy specimens obtained from dogs with and without chronic diarrhea. Biopsy specimens of the proximal portion of the duodenum were obtained endoscopically from 39 dogs evaluated because of chronic diarrhea (12 German Shepherd Dogs and 27 non-German Shepherd Dog breeds); specimens were also obtained from a control group of 7 dogs evaluated because of other gastrointestinal tract diseases and 2 dogs that were euthanatized as a result of nongastrointestinal tract disease. Dogs were anesthetized, and multiple mucosal biopsy specimens were obtained endoscopically at the level of the caudal duodenal flexure by use of biopsy forceps; in 2 control dogs, samples were obtained from the descending duodenum within 5 minutes of euthanasia. One-step QRT-PCR was used to quantify the level of expression of transcripts for the housekeeper gene glyceraldehyde-3-phosphate dehydrogenase, plgR, alpha-chain, and J-chain in duodenal mucosal tissue. There was no significant difference in the level of expression of any transcript among non-German Shepherd Dog breeds without diarrhea (control group), non-German Shepherd Dog breeds with chronic diarrhea, and German Shepherd Dogs with chronic diarrhea. Conclusions and Clinical Relevance-Results indicated that the susceptibility of German Shepherd Dogs to chronic diarrhea is not a result of simple failure of transcription of the key genes that encode molecules involved in mucosal IgA secretion.

The use of real-time polymerase chain reaction for rapid diagnosis of skeletal tuberculosis.

PubMed

Kobayashi, Naomi; Fraser, Thomas G; Bauer, Thomas W; Joyce, Michael J; Hall, Gerri S; Tuohy, Marion J; Procop, Gary W

2006-07-01

We identified Mycobacterium tuberculosis DNA using real-time polymerase chain reaction on a specimen from an osteolytic lesion of a femoral condyle, in which the frozen section demonstrated granulomas. The process was much more rapid than is possible with culture. The rapid detection of M tuberculosis and the concomitant exclusion of granulomatous disease caused by nontuberculous mycobacteria or systemic fungi are necessary to appropriately treat skeletal tuberculosis. The detection and identification of M tuberculosis by culture may require several weeks using traditional methods. The real-time polymerase chain reaction method used has been shown to be rapid and reliable, and is able to detect and differentiate both tuberculous and nontuberculous mycobacteria. Real-time polymerase chain reaction may become a diagnostic standard for the evaluation of clinical specimens for the presence of mycobacteria; this case demonstrates the potential utility of this assay for the rapid diagnosis of skeletal tuberculosis.

Polymerase chain reaction system

DOEpatents

Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

2004-03-02

A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

In-gel multiple displacement amplification of long DNA fragments diluted to the single molecule level.

PubMed

Michikawa, Yuichi; Sugahara, Keisuke; Suga, Tomo; Ohtsuka, Yoshimi; Ishikawa, Kenichi; Ishikawa, Atsuko; Shiomi, Naoko; Shiomi, Tadahiro; Iwakawa, Mayumi; Imai, Takashi

2008-12-15

The isolation and multiple genotyping of long individual DNA fragments are needed to obtain haplotype information for diploid organisms. Limiting dilution of sample DNA followed by multiple displacement amplification is a useful technique but is restricted to short (<5 kb) DNA fragments. In the current study, a novel modification was applied to overcome these problems. A limited amount of cellular DNA was carefully released from intact cells into a mildly heated alkaline agarose solution and mixed thoroughly. The solution was then gently aliquoted and allowed to solidify while maintaining the integrity of the diluted DNA. Exogenously provided Phi29 DNA polymerase was used to perform consistent genomic amplification with random hexameric oligonucleotides within the agarose gels. Simple heat melting of the gel allowed recovery of the amplified materials in a solution of the polymerase chain reaction (PCR)-ready form. The haplotypes of seven SNPs spanning 240 kb of the DNA surrounding the human ATM gene region on chromosome 11 were determined for 10 individuals, demonstrating the feasibility of this new method.

Soil pretreatment and fast cell lysis for direct polymerase chain reaction from forest soils for terminal restriction fragment length polymorphism analysis of fungal communities

Treesearch

Fei Cheng; Lin Hou; Keith Woeste; Zhengchun Shang; Xiaobang Peng; Peng Zhao; Shuoxin Zhang

2016-01-01

Humic substances in soil DNA samples can influence the assessment of microbial diversity and community composition. Using multiple steps during or after cell lysis adds expenses, is time-consuming, and causes DNA loss. A pretreatment of soil samples and a single step DNA extraction may improve experimental results. In order to optimize a protocol for obtaining high...

DNA Polymerase III Star Requires ATP to Start Synthesis on a Primed DNA†

PubMed Central

Wickner, William; Kornberg, Arthur

1973-01-01

DNA polymerase III star replicates a ϕX174 single-stranded, circular DNA primed with a fragment of RNA. This reaction proceeds in two stages. In stage I, a complex is formed requiring DNA polymerase III star, ATP, spermidine, copolymerase III*, and RNA-primed ϕX174 single-stranded, circular DNA. The complex, isolated by gel filtration, contains ADP and inorganic phosphate (the products of a specific ATP cleavage) as well as spermidine, polymerase III star, and copolymerase III star. In stage II, the chain grows upon addition of deoxynucleoside triphosphates; ADP and inorganic phosphate are discharged and chain elongation is resistant to antibody to copolymerase III star. Thus ATP and copolymerase III star are required to initiate chain growth but not to sustain it. Images PMID:4519657

Detecting DNA methylation of the BCL2, CDKN2A and NID2 genes in urine using a nested methylation specific polymerase chain reaction assay to predict bladder cancer.

PubMed

Scher, Michael B; Elbaum, Michael B; Mogilevkin, Yakov; Hilbert, David W; Mydlo, Jack H; Sidi, A Ami; Adelson, Martin E; Mordechai, Eli; Trama, Jason P

2012-12-01

Detection of methylated DNA has been shown to be a good biomarker for bladder cancer. Bladder cancer has the highest recurrence rate of any cancer and, as such, patients are regularly monitored using invasive diagnostic techniques. As urine is easily attainable, bladder cancer is an optimal cancer to detect using DNA methylation. DNA methylation is highly specific in cancer detection. However, it is difficult to detect because of the limited amount of DNA present in the urine of patients with bladder cancer. Therefore, an improved, sensitive and noninvasive diagnostic test is needed. We developed a highly specific and sensitive nested methylation specific polymerase chain reaction assay to detect the presence of bladder cancer in small volumes of patient urine. The genes assayed for DNA methylation are BCL2, CDKN2A and NID2. The regions surrounding the DNA methylation sites were amplified in a methylation independent first round polymerase chain reaction and the amplification product from the first polymerase chain reaction was used in a real-time methylation specific polymerase chain reaction. Urine samples were collected from patients receiving treatment at Wolfson Medical Center in Holon, Israel. In a pilot clinical study using patient urine samples we were able to differentiate bladder cancer from other urogenital malignancies and nonmalignant conditions with a sensitivity of 80.9% and a specificity of 86.4%. We developed a novel methylation specific polymerase chain reaction assay for the detection and monitoring of bladder cancer using DNA extracted from patient urine. The assay may also be combined with other diagnostic tests to improve accuracy. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

Polymerase chain reaction-based detection of B-cell monoclonality in cytologic specimens.

PubMed

Chen, Y T; Mercer, G O; Chen, Y

1993-11-01

Thirty-seven cytologic cell blocks were evaluated for B-cell monoclonality by polymerase chain reaction (PCR), 16 of them cytologically positive for lymphoma, and 21 suspicious for lymphoma but morphologically nondiagnostic. Of 37 specimens, 13 (35%) showed B-cell monoclonality, including six of 16 cytologically positive samples and seven of 21 cytologically suspicious ones. Of these 13 positive samples, seven were positive using crude lysates as substrates, and six additional positive samples were identified only when DNAs were purified and concentrated. Analysis of the DNAs further revealed poor polymerase chain reaction amplifiability and low DNA yield in many samples, indicating that cell block materials are suboptimal for this assay. We concluded that B-cell monoclonality can be detected in ethanol-fixed cytologic samples, and usage of unembedded material will likely improve the sensitivity. In specimens cytologically suspicious for lymphoma, polymerase chain reaction-based identification of monoclonal B-cell population supports the diagnosis of B-cell lymphoma and is a potentially useful test in solving this diagnostic dilemma.

Lack of detection of feline leukemia and feline sarcoma viruses in diffuse iris melanomas of cats by immunohistochemistry and polymerase chain reaction.

PubMed

Cullen, Cheryl L; Haines, Deborah M; Jackson, Marion L; Grahn, Bruce H

2002-07-01

Diffuse iris melanoma was confirmed by light-microscopic examination in 10 formalin-fixed, paraffin-embedded globes from 10 cats. To determine if feline leukemia virus or a replication defective feline leukemia virus, feline sarcoma virus, was present in these anterior uveal melanomas, immunohistochemistry and polymerase chain reaction for feline leukemia virus were utilized. Immunohistochemical staining for feline leukemia virus glycoprotein 70 was performed on all 10 tumors using an avidin-biotin complex technique. The DNA was extracted from each specimen and a 166-base pair region of the feline leukemia virus long terminal repeat was targeted by polymerase chain reaction. Immunohistochemical staining for feline leukemia virus glycoprotein 70 and polymerase chain reaction amplification of a feline leukemia virus long terminal repeat region were negative in all cases. Feline leukemia virus/feline sarcoma virus was not detected in any neoplasms and therefore was unlikely to play a role in the tumorigenesis of these feline diffuse iris melanomas.

Polymerase Chain Reaction for Detection of Systemic Plant Pathogens

USDA-ARS?s Scientific Manuscript database

This chapter outlines the advances and application of the polymerase chain reaction (PCR) since its development in 1984 and its enhancements and applications to detection of viruses, viroids and phytoplasma in pome and stone fruits. PCR is probably the most rapidly and widely adopted technology eve...

Prevalence, distribution, and viral burden of all 15 high-risk human papillomavirus types in adenosquamous carcinoma of the uterine cervix: a multiplex real-time polymerase chain reaction-based study.

PubMed

Quddus, M Ruhul; Manna, Pradip; Sung, C James; Kerley, Spencer; Steinhoff, Margaret M; Lawrence, W Dwayne

2014-02-01

Human papillomavirus (HPV) 16 and 18 are the types most commonly found in cervical adenosquamous carcinoma. Multiple HPV types have been found in cervical adenocarcinoma but not in the adenosquamous variant. Type-specific detection of high-risk (HR) HPV allows the detection of co-infection by multiple HPV types and assessment of viral load per cell. Our aim was to identify and quantify all HR HPV types in cervical adenosquamous carcinoma and to correlate viral loads with prognosis-related histologic features. All 15 HR HPV types were tested for by multiplex real-time polymerase chain reaction, and standard curves were created for each type. Viral loads were determined retrospectively. Prognosis-related histologic features were correlated with specific HPV types and the viral loads. A total of 80% of the tumors examined expressed HPV. Types 16/18 were detected in 86% of these cases, whereas the remaining 14% of the positive cases were infected by other types. A single type of virus was detected in 67% of cases, 2 in 29%, and 3 in 4%. Poor prognostic features were seen in 84.6% of the tumors infected with HPV 16, 46% of those infected with HPV 18, and 100% of those infected with other types. As expected, HPV 16, HPV 18, or both were the most frequent viral types; HPV 73 was the next most frequent type. Multiple HPV types were detected in 33% of the tumors. Non-HPV 16/18 cases had low viral loads, but all of these had poor prognosis-related histologic features. Two of the three recurrent cases had multiple viral types. © 2014 Elsevier Inc. All rights reserved.

Direct detection of Streptococcus mutans in human dental plaque by polymerase chain reaction.

PubMed

Igarashi, T; Yamamoto, A; Goto, N

1996-10-01

Streptococcus mutans is an etiological agent in human dental caries. A method for the detection of S. mutans directly from human dental plaque by polymerase chain reaction has been developed. Oligonucleotide primers specific for a portion of the dextranase gene (dexA) of S. mutans Ingbritt (serotype c) were designed to amplify a 1272-bp DNA fragment by polymerase chain reaction. The present method specifically detected S. mutans (serotypes c, e and f), but none of the other mutans streptococci: S. cricetus (serotype a), S. rattus (serotype b), S. sobrinus (serotypes d and g), and S. downei (serotype h), other gram-positive bacteria (16 strains of 12 species of cocci and 18 strains of 12 species of bacilli) nor gram-negative bacteria (1 strain of 1 species of cocci and 20 strains of 18 species of bacilli). The method was capable of detecting 1 pg of the chromosomal DNA purified from S. mutans Ingbritt and as few as 12 colony-forming units of S. mutans cells. The S. mutans cells in human dental plaque were also directly detected. Seventy clinical isolates of S. mutans isolated from the dental plaque of 8 patients were all positive by the polymerase chain reaction. These results suggest that the dexA polymerase chain reaction is suitable for the specific detection and identification of S. mutans.

Modeling qRT-PCR dynamics with application to cancer biomarker quantification.

PubMed

Chervoneva, Inna; Freydin, Boris; Hyslop, Terry; Waldman, Scott A

2017-01-01

Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is widely used for molecular diagnostics and evaluating prognosis in cancer. The utility of mRNA expression biomarkers relies heavily on the accuracy and precision of quantification, which is still challenging for low abundance transcripts. The critical step for quantification is accurate estimation of efficiency needed for computing a relative qRT-PCR expression. We propose a new approach to estimating qRT-PCR efficiency based on modeling dynamics of polymerase chain reaction amplification. In contrast, only models for fluorescence intensity as a function of polymerase chain reaction cycle have been used so far for quantification. The dynamics of qRT-PCR efficiency is modeled using an ordinary differential equation model, and the fitted ordinary differential equation model is used to obtain effective polymerase chain reaction efficiency estimates needed for efficiency-adjusted quantification. The proposed new qRT-PCR efficiency estimates were used to quantify GUCY2C (Guanylate Cyclase 2C) mRNA expression in the blood of colorectal cancer patients. Time to recurrence and GUCY2C expression ratios were analyzed in a joint model for survival and longitudinal outcomes. The joint model with GUCY2C quantified using the proposed polymerase chain reaction efficiency estimates provided clinically meaningful results for association between time to recurrence and longitudinal trends in GUCY2C expression.

An investigation of genital ulcers in Jackson, Mississippi, with use of a multiplex polymerase chain reaction assay: high prevalence of chancroid and human immunodeficiency virus infection.

PubMed

Mertz, K J; Weiss, J B; Webb, R M; Levine, W C; Lewis, J S; Orle, K A; Totten, P A; Overbaugh, J; Morse, S A; Currier, M M; Fishbein, M; St Louis, M E

1998-10-01

In 1994, an apparent outbreak of atypical genital ulcers was noted by clinicians at the sexually transmitted disease clinic in Jackson, Mississippi. Of 143 patients with ulcers tested with a multiplex polymerase chain reaction (PCR) assay, 56 (39%) were positive for Haemophilus ducreyi, 44 (31%) for herpes simplex virus, and 27 (19%) for Treponema pallidum; 12 (8%) were positive for > 1 organism. Of 136 patients tested for human immunodeficiency virus (HIV) by serology, 14 (10%) were HIV-seropositive, compared with none of 200 patients without ulcers (P < .001). HIV-1 DNA was detected by PCR in ulcers of 6 (50%) of 12 HIV-positive patients. Multivariate analysis indicated that men with chancroid were significantly more likely than male patients without ulcers to report sex with a crack cocaine user, exchange of money or drugs for sex, and multiple sex partners. The strong association between genital ulcers and HIV infection in this population highlights the urgency of preventing genital ulcers in the southern United States.

Anti-pre-S responses and viral clearance in chronic hepatitis B virus infection.

PubMed

Budkowska, A; Dubreuil, P; Poynard, T; Marcellin, P; Loriot, M A; Maillard, P; Pillot, J

1992-01-01

Serial sera were collected prospectively during the clinical course of 13 HBsAg carriers with chronic liver disease and analyzed for ALT levels, pre-S1 and pre-S2 antigens and corresponding antibodies and other serological hepatitis B virus markers. In five patients, anti-pre-S1 and anti-pre-S2 antibodies became detectable in multiple serum samples, whereas in eight patients anti-pre-S was never detected or only appeared transiently during the follow-up. The first pattern was associated with normalization of ALT levels and undetectable pre-S antigens and viral DNA by the polymerase chain reaction assay at final follow-up. HBsAg clearance occurred in two of the five patients. The second pattern was one of persistence of HBsAg and pre-S antigens, associated with the presence of serum HBV DNA detectable by spot hybridization or polymerase chain reaction regardless of clinical outcome. These findings demonstrate the occurrence of anti-pre-S antibodies in chronic hepatitis B virus-induced liver disease and associate anti-pre-S appearance with the clearance of hepatitis B virus from serum.

A rapid method for the detection of foodborne pathogens by extraction of a trace amount of DNA from raw milk based on amino-modified silica-coated magnetic nanoparticles and polymerase chain reaction.

PubMed

Bai, Yalong; Song, Minghui; Cui, Yan; Shi, Chunlei; Wang, Dapeng; Paoli, George C; Shi, Xianming

2013-07-17

A method based on amino-modified silica-coated magnetic nanoparticles (ASMNPs) and polymerase chain reaction (PCR) was developed to rapidly and sensitively detect foodborne pathogens in raw milk. After optimizing parameters such as pH, temperature, and time, a trace amount of genomic DNA of pathogens could be extracted directly from complex matrices such as raw milk using ASMNPs. The magnetically separated complexes of genomic DNA and ASMNPs were directly subjected to single PCR (S-PCR) or multiplex PCR (M-PCR) to detect single or multiple pathogens from raw milk samples. Salmonella Enteritidis (Gram-negative) and Listeria monocytogenes (Gram-positive) were used as model organisms to artificially contaminate raw milk samples. After magnetic separation and S-PCR, the detection sensitivities were 8 CFU mL(-1) and 13 CFU mL(-1) respectively for these two types of pathogens. Furthermore, this method was successfully used to detect multiple pathogens (S. Enteritidis and L. monocytogenes) from artificially contaminated raw milk using M-PCR at sensitivities of 15 CFU mL(-1) and 25 CFU mL(-1), respectively. This method has great potential to rapidly and sensitively detect pathogens in raw milk or other complex food matrices. Copyright © 2013 Elsevier B.V. All rights reserved.

INTERNAL AMPLIFICATION CONTROL FOR USE IN QUANTITATIVE POLYMERASE CHAIN REACTION FECAL INDICATOR BACTERIA ASSAYS

EPA Science Inventory

Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...

Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

ERIC Educational Resources Information Center

Elkins, Kelly M.

2011-01-01

The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

USDA-ARS?s Scientific Manuscript database

Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

A METHOD TO REMOVE ENVIRONMENTAL INHIBITORS PRIOR TO THE DETECTION OF WATERBORNE ENTERIC VIRUSES BY REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION

EPA Science Inventory

A method was developed to remove environmental inhibitors from sample concentrates prior to detection of human enteric viruses using the reverse transcription-polymerase chain reaction (RT-PCR).Environmental inhibitors, concentrated along with viruses during water sample processi...

FUNGAL SPECIATION USING QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) IN PATIENTS WITH AND WITHOUT CHRONIC RHINOSINUSITIS

EPA Science Inventory

Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...

Multiple eschars in scrub typhus: a case report.

PubMed

Koraluru, Munegowda; Nandigam, Manideep; Bairy, Indira; Vidyasagar, Sudha; Varma, Muralidhar

2017-01-01

Eschar in scrub typhus aids in early diagnosis and institution of appropriate therapy; however, the eschar positivity rates vary greatly in endemic regions. Multiple eschars in scrub typhus are a rare presentation. Our patient presented with fever and multiple eschars and was empirically started on doxycycline. Nested polymerase chain reaction from all the four eschars and from EDTA blood were positive for 56-kDa type-specific antigen which is specific for Orientia tsutsugamushi The patient recovered completely after 7 days of antibiotic treatment. He was from an area where scrub typhus was not observed previously. An eschar in an acute febrile patient from the "tsutsugamushi triangle" is a valuable sign in scrub typhus diagnosis. A search for multiple eschars in scrub typhus must be made by clinicians. © The Author(s) 2016.

Angiostrongylus vasorum Causing Severe Granulomatous Hepatitis with Concurrent Multiple Acquired PSS.

PubMed

Cook, Simon; Priestnall, Simon L; Blake, Damer; Meeson, Richard L

2015-01-01

A 14 mo old female Jack Russell terrier presented with a 12 hr history of vomiting and inappetence. She was subsequently diagnosed with multiple acquired portosystemic shunts during an exploratory celiotomy. Gross and histopathological hepatic abnormalities were consistent with chronic disease, including features suggestive of portal hypertension that was potentially caused by migrating and resident Angiostrongylus vasorum larvae. Fecal analysis and polymerase chain reaction of hepatic tissue confirmed the presence of Angiostrongylus vasorum . The dog recovered clinically following empirical treatment and supportive care. A lack of parasite burden was confirmed 9 wk postdiagnosis; however, serum biochemical analysis at that time was suggestive of ongoing hepatic dysfunction.

Gemi: PCR Primers Prediction from Multiple Alignments

PubMed Central

Sobhy, Haitham; Colson, Philippe

2012-01-01

Designing primers and probes for polymerase chain reaction (PCR) is a preliminary and critical step that requires the identification of highly conserved regions in a given set of sequences. This task can be challenging if the targeted sequences display a high level of diversity, as frequently encountered in microbiologic studies. We developed Gemi, an automated, fast, and easy-to-use bioinformatics tool with a user-friendly interface to design primers and probes based on multiple aligned sequences. This tool can be used for the purpose of real-time and conventional PCR and can deal efficiently with large sets of sequences of a large size. PMID:23316117

DISCUSSION OF "DETECTION OF CRYPTOSPORIDIUM PARVUM IN SECONDARY EFFLUENTS USING A MOST PROBABLE NUMBER-POLYMERASE CHAIN REACTION ASSAY"

EPA Science Inventory

The emphasis of this paper is to show that most probable number-polymerase chain reaction (MPNPCR) assay can be used to detect Cryptosporidium parvum in WWTP effluents as an alternative to immunfluorescent assay (IFA). I am concerned, however, that the paper suggests that all WW...

Determining Annealing Temperatures for Polymerase Chain Reaction

ERIC Educational Resources Information Center

Porta, Angela R.; Enners, Edward

2012-01-01

The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

A multiplex real-time polymerase chain reaction assay differentiates between Bolbphorus damnificus and Bolbophorus type II sp

USDA-ARS?s Scientific Manuscript database

A duplex quantitative real-time polymerase chain reaction (qPCR) assay was developed to differentiate between Bolbophorus damnificus and Bolbophorus type II species cercariae. Both trematode species are prevalent throughout the commercial catfish industry,.as both infect the ram’s horn snail, Plano...

Development of sandwich-form biosensor to detect Mycobacterium tuberculosis complex in clinical sputum specimens.

PubMed

Shojaei, Taha Roodbar; Mohd Salleh, Mohamad Amran; Tabatabaei, Meisam; Ekrami, Alireza; Motallebi, Roya; Rahmani-Cherati, Tavoos; Hajalilou, Abdollah; Jorfi, Raheleh

2014-01-01

Mycobacterium tuberculosis, the causing agent of tuberculosis, comes second only after HIV on the list of infectious agents slaughtering many worldwide. Due to the limitations behind the conventional detection methods, it is therefore critical to develop new sensitive sensing systems capable of quick detection of the infectious agent. In the present study, the surface modified cadmium-telluride quantum dots and gold nanoparticles conjunct with two specific oligonucleotides against early secretory antigenic target 6 were used to develop a sandwich-form fluorescence resonance energy transfer-based biosensor to detect M. tuberculosis complex and differentiate M. tuberculosis and M. bovis Bacille Calmette-Guerin simultaneously. The sensitivity and specificity of the newly developed biosensor were 94.2% and 86.6%, respectively, while the sensitivity and specificity of polymerase chain reaction and nested polymerase chain reaction were considerably lower, 74.2%, 73.3% and 82.8%, 80%, respectively. The detection limits of the sandwich-form fluorescence resonance energy transfer-based biosensor were far lower (10 fg) than those of the polymerase chain reaction and nested polymerase chain reaction (100 fg). Although the cost of the developed nanobiosensor was slightly higher than those of the polymerase chain reaction-based techniques, its unique advantages in terms of turnaround time, higher sensitivity and specificity, as well as a 10-fold lower detection limit would clearly recommend this test as a more appropriate and cost-effective tool for large scale operations. Copyright © 2014 Elsevier Editora Ltda. All rights reserved.

Rapid Diagnosis of Infection in the Critically Ill, a Multicenter Study of Molecular Detection in Bloodstream Infections, Pneumonia, and Sterile Site Infections*

PubMed Central

Brealey, David; Libert, Nicolas; Abidi, Nour Elhouda; O’Dwyer, Michael; Zacharowski, Kai; Mikaszewska-Sokolewicz, Malgorzata; Schrenzel, Jacques; Simon, François; Wilks, Mark; Picard-Maureau, Marcus; Chalfin, Donald B.; Ecker, David J.; Sampath, Rangarajan; Singer, Mervyn

2015-01-01

Objective: Early identification of causative microorganism(s) in patients with severe infection is crucial to optimize antimicrobial use and patient survival. However, current culture-based pathogen identification is slow and unreliable such that broad-spectrum antibiotics are often used to insure coverage of all potential organisms, carrying risks of overtreatment, toxicity, and selection of multidrug-resistant bacteria. We compared the results obtained using a novel, culture-independent polymerase chain reaction/electrospray ionization-mass spectrometry technology with those obtained by standard microbiological testing and evaluated the potential clinical implications of this technique. Design: Observational study. Setting: Nine ICUs in six European countries. Patients: Patients admitted between October 2013 and June 2014 with suspected or proven bloodstream infection, pneumonia, or sterile fluid and tissue infection were considered for inclusion. Interventions: None. Measurements and Main Results: We tested 616 bloodstream infection, 185 pneumonia, and 110 sterile fluid and tissue specimens from 529 patients. From the 616 bloodstream infection samples, polymerase chain reaction/electrospray ionization-mass spectrometry identified a pathogen in 228 cases (37%) and culture in just 68 (11%). Culture was positive and polymerase chain reaction/electrospray ionization-mass spectrometry negative in 13 cases, and both were negative in 384 cases, giving polymerase chain reaction/electrospray ionization-mass spectrometry a sensitivity of 81%, specificity of 69%, and negative predictive value of 97% at 6 hours from sample acquisition. The distribution of organisms was similar with both techniques. Similar observations were made for pneumonia and sterile fluid and tissue specimens. Independent clinical analysis of results suggested that polymerase chain reaction/electrospray ionization-mass spectrometry technology could potentially have resulted in altered treatment in up to 57% of patients. Conclusions: Polymerase chain reaction/electrospray ionization-mass spectrometry provides rapid pathogen identification in critically ill patients. The ability to rule out infection within 6 hours has potential clinical and economic benefits. PMID:26327198

Comparison of Enterococcus quantitative polymerase chain reaction analysis results from midwest U.S. river samples using EPA Method 1611 and Method 1609 PCR reagents

EPA Science Inventory

The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...

Identification of Brucella spp. by using the polymerase chain reaction.

PubMed Central

Herman, L; De Ridder, H

1992-01-01

The application of two synthetic oligonucleotides as probes and as primers in the polymerase chain reaction is presented for a specific, sensitive, and quick identification of Brucella spp. The specific oligonucleotide sequences were chosen on the basis of a 16S rRNA sequence alignment between Brucella abortus and Agrobacterium tumefaciens. Images PMID:1377903

Detection of Listeria monocytogenes by using the polymerase chain reaction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bessesen, M.T.; Luo, Q.; Blaser, M.J.

1990-09-01

A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with {sup 32}P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains.

Fluorochrome-functionalized magnetic nanoparticles for high-sensitivity monitoring of the polymerase chain reaction by magnetic resonance.

PubMed

Alcantara, David; Guo, Yanyan; Yuan, Hushan; Goergen, Craig J; Chen, Howard H; Cho, Hoonsung; Sosnovik, David E; Josephson, Lee

2012-07-09

Easy to find: magnetic nanoparticles bearing fluorochromes (red) that intercalate with DNA (green) form microaggregates with DNA generated by the polymerase chain reaction (PCR). These aggregates can be detected at low cycle numbers by magnetic resonance (MR). Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

9 CFR 145.33 - Terminology and classification; flocks and products.

Code of Federal Regulations, 2010 CFR

2010-01-01

.... Such action shall not be taken until a thorough investigation has been made by the Service and the.... gallisepticum as provided in § 145.14(b), or by a polymerase chain reaction (PCR)-based procedure approved by...(b) or by a polymerase chain reaction (PCR)-based procedure approved by the Department. If fewer than...

Development of an on-site rapid real-time polymerase chain reaction system and the characterization of suitable DNA polymerases for TaqMan probe technology.

PubMed

Furutani, Shunsuke; Naruishi, Nahoko; Hagihara, Yoshihisa; Nagai, Hidenori

2016-08-01

On-site quantitative analyses of microorganisms (including viruses) by the polymerase chain reaction (PCR) system are significantly influencing medical and biological research. We have developed a remarkably rapid and portable real-time PCR system that is based on microfluidic approaches. Real-time PCR using TaqMan probes consists of a complex reaction. Therefore, in a rapid real-time PCR, the optimum DNA polymerase must be estimated by using actual real-time PCR conditions. In this study, we compared the performance of three DNA polymerases in actual PCR conditions using our rapid real-time PCR system. Although KAPA2G Fast HS DNA Polymerase has the highest enzymatic activity among them, SpeedSTAR HS DNA Polymerase exhibited better performance to rapidly increase the fluorescence signal in an actual real-time PCR using TaqMan probes. Furthermore, we achieved rapid detection of Escherichia coli in 7 min by using SpeedSTAR HS DNA Polymerase with the same sensitivity as that of a conventional thermal cycler.

Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

PubMed

Wu, Z; Nagano, I; Xu, D; Takahashi, Y

1997-03-01

Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

Evaluation of different embryonating bird eggs and cell cultures for isolation efficiency of avian influenza A virus and avian paramyxovirus serotype 1 from real-time reverse transcription polymerase chain reaction--positive

USDA-ARS?s Scientific Manuscript database

Two hundred samples collected from Anseriformes, Charadriiformes, Gruiformes, and Galliformes were assayed using real-time reverse transcriptase polymerase chain reaction (RRT-PCR) for presence of avian influenza virus and avian paramyxovirus-1. Virus isolation using embryonating chicken eggs, embr...

DATA COLLECTION CONSTRAINTS FOR THE USE OF LENGTH HETEROGENEITY POLYMERASE CHAIN REACTION (LH-PCR) AS AN INDICATOR OF STREAM SANITARY AND ECOLOGICAL CONDITION

EPA Science Inventory

This study is part of a larger project for the development of bacterial indicators of stream sanitary and ecological condition. Here we report preliminary research on the use of Length Heterogeneity Polymerase Chain Reaction (LH-PCR), which discriminates among 16S rRNA genes bas...

Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students

ERIC Educational Resources Information Center

Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary

2006-01-01

We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

Identification of the forest strain of Onchocerca volvulus using the polymerase chain reaction technique.

PubMed

Adewale, B; Mafe, M A; Oyerinde, J P O

2005-01-01

Annual mass treatment with ivermectin for 12-15 years in endemic communities is the control strategy adopted by the African Programme for Onchocerciasis Control (APOC) for the control of onchocerciasis in Nigeria. This long-term treatment necessitates the use of Polymerase Chain Reaction (PCR) for the proper identification of the Onchocerca species and strains in endemic areas and also for monitoring recrudescence of infection in areas where infection has been controlled. This study, which forms part of a larger study on transmission of onchocerciasis identifies the Onchocerca volvulus strain in Ondo state using the Polymerase Chain Reaction (PCR) technique. Deoxyribonucleic acid (DNA) was extracted from the adult worm of Onchocerca parasite using the glass bead method of extraction. The repeated sequence family present in the genome of the parasite designated as 0-150bp was amplified by the polymerase chain reaction (PCR). The amplified parasites produced significant products visible as bands in a 2% agarose gel stained with ethidium bromide. Hybridization of the PCR products with specific DNA probe identified the products as forest strain of Onchocerca volvulus. The epidemiological implication of this is that there would be more of the skin lesions and low blindness rate in the area.

Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.

PubMed

Ragheb, Suzan Mohammed; Jimenez, Luis

Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. In recent years several publications have encouraged the application of molecular techniques in the microbiological assessment of pharmaceuticals. One of these techniques is polymerase chain reaction (PCR). The successful application of PCR in the pharmaceutical industry in developing countries is governed by considerable factors and requirements. These factors include the setting up of a PCR laboratory and the choice of appropriate equipment and reagents. In addition, the presence of well-trained analysts and establishment of quality control and quality assurance programs are important requirements. The pharmaceutical firms should take into account these factors to allow better chances for regulatory acceptance and wide application of this technique. © PDA, Inc. 2014.

[The validation of kit of reagents for quantitative detection of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode].

PubMed

Sil'veĭstrova, O Iu; Domonova, É A; Shipulina, O Iu

2014-04-01

The validation of kit of reagents destined to detection and quantitative evaluation of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode was implemented. The comparison was made against international WHO standard--The first WHO international standard for human cytomegalovirus to implement measures the kit of reagents "AmpliSens CMV-screen/monitor-FL" and standard sample of enterprise DNA HCMV (The central research institute of epidemiology of Rospotrebnadzor) was applied. The fivefold dilution of international WHO standard and standard sample of enterprise were carried out in concentrations of DNA HCMV from 106 to 102. The arrangement of polymerase chain reaction and analysis of results were implemented using programed amplifier with system of detection of fluorescent signal in real-time mode "Rotor-Gene Q" ("Qiagen", Germany). In the total of three series of experiments, all stages of polymerase chain reaction study included, the coefficient of translation of quantitative evaluation of DNA HCMV from copy/ml to ME/ml equal to 0.6 was introduced for this kit of reagents.

Circulating polymerase chain reaction chips utilizing multiple-membrane activation

NASA Astrophysics Data System (ADS)

Wang, Chih-Hao; Chen, Yi-Yu; Liao, Chia-Sheng; Hsieh, Tsung-Min; Luo, Ching-Hsing; Wu, Jiunn-Jong; Lee, Huei-Huang; Lee, Gwo-Bin

2007-02-01

This paper reports a new micromachined, circulating, polymerase chain reaction (PCR) chip for nucleic acid amplification. The PCR chip is comprised of a microthermal control module and a polydimethylsiloxane (PDMS)-based microfluidic control module. The microthermal control modules are formed with three individual heating and temperature-sensing sections, each modulating a specific set temperature for denaturation, annealing and extension processes, respectively. Micro-pneumatic valves and multiple-membrane activations are used to form the microfluidic control module to transport sample fluids through three reaction regions. Compared with other PCR chips, the new chip is more compact in size, requires less time for heating and cooling processes, and has the capability to randomly adjust time ratios and cycle numbers depending on the PCR process. Experimental results showed that detection genes for two pathogens, Streptococcus pyogenes (S. pyogenes, 777 bps) and Streptococcus pneumoniae (S. pneumoniae, 273 bps), can be successfully amplified using the new circulating PCR chip. The minimum number of thermal cycles to amplify the DNA-based S. pyogenes for slab gel electrophoresis is 20 cycles with an initial concentration of 42.5 pg µl-1. Experimental data also revealed that a high reproducibility up to 98% could be achieved if the initial template concentration of the S. pyogenes was higher than 4 pg µl-1. The preliminary results of the current paper were presented at the 19th IEEE International Conference on Micro Electro Mechanical Systems (IEEE MEMS 2006), Istanbul, Turkey, 22-26 January, 2006.

Next-generation sequencing library preparation method for identification of RNA viruses on the Ion Torrent Sequencing Platform.

PubMed

Chen, Guiqian; Qiu, Yuan; Zhuang, Qingye; Wang, Suchun; Wang, Tong; Chen, Jiming; Wang, Kaicheng

2018-05-09

Next generation sequencing (NGS) is a powerful tool for the characterization, discovery, and molecular identification of RNA viruses. There were multiple NGS library preparation methods published for strand-specific RNA-seq, but some methods are not suitable for identifying and characterizing RNA viruses. In this study, we report a NGS library preparation method to identify RNA viruses using the Ion Torrent PGM platform. The NGS sequencing adapters were directly inserted into the sequencing library through reverse transcription and polymerase chain reaction, without fragmentation and ligation of nucleic acids. The results show that this method is simple to perform, able to identify multiple species of RNA viruses in clinical samples.

PCR performance of a thermostable heterodimeric archaeal DNA polymerase

PubMed Central

Killelea, Tom; Ralec, Céline; Bossé, Audrey; Henneke, Ghislaine

2014-01-01

DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR), cDNA cloning, genome sequencing, and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased performance and broadened substrate spectra. At present, there is a great demand for such enzymes in applications, e.g., forensics or paleogenomics. Current major limitations hinge on the inability of conventional PCR enzymes, such as Taq, to amplify degraded or low amounts of template DNA. Besides, a wide range of PCR inhibitors can also impede reactions of nucleic acid amplification. Here we looked at the PCR performances of the proof-reading D-type DNA polymerase from P. abyssi, Pab-polD. Fragments, 3 kilobases in length, were specifically PCR-amplified in its optimized reaction buffer. Pab-polD showed not only a greater resistance to high denaturation temperatures than Taq during cycling, but also a superior tolerance to the presence of potential inhibitors. Proficient proof-reading Pab-polD enzyme could also extend a primer containing up to two mismatches at the 3' primer termini. Overall, we found valuable biochemical properties in Pab-polD compared to the conventional Taq, which makes the enzyme ideally suited for cutting-edge PCR-applications. PMID:24847315

Integrated polymerase chain reaction/electrophoresis instrument

DOEpatents

Andresen, Brian D.

2000-01-01

A new approach and instrument for field identification of micro-organisms and DNA fragments using a small and disposable device containing integrated polymerase chain reaction (PCR) enzymatic reaction wells, attached capillary electrophoresis (CE) channels, detectors, and read-out all on/in a small hand-held package. The analysis instrument may be made inexpensively, for example, of plastic, and thus is disposable, which minimizes cross contamination and the potential for false positive identification between samples. In addition, it is designed for multiple users with individual applications. The integrated PCR/CE is manufactured by the PCR well and CE channels are "stamped" into plastic depressions where conductive coatings are made in the wells and ends of the CE microchannels to carry voltage and current to heat the PCR reaction mixtures and simultaneously draw DNA bands up the CE channels. Light is transmitted through the instrument at appropriate points and detects PCR bands and identifies DNA fragments by size (retention time) and quantifies each by the amount of light generated as each phototransistor positioned below each CE channel detects a passing band. The instrument is so compact that at least 100 PCR/CE reactions/analyses can be performed easily on one detection device.

A Blood-based Test for the Detection of ROS1 and RET Fusion Transcripts from Circulating Ribonucleic Acid Using Digital Polymerase Chain Reaction

PubMed Central

Mellert, Hestia S.; Alexander, Kristin E.; Jackson, Leisa P.; Pestano, Gary A.

2018-01-01

We have developed novel methods for the isolation and characterization of tumor-derived circulating ribonucleic acid (cRNA) for blood-based liquid biopsy. Robust detection of cRNA recovered from blood represents a solution to a critical unmet need in clinical diagnostics. The test begins with the collection of whole blood into blood collection tubes containing preservatives that stabilize cRNA. Cell-free, exosomal, and platelet-associated RNA is isolated from plasma in this test system. The cRNA is reverse transcribed to complementary DNA (cDNA) and amplified using digital polymerase chain reaction (dPCR). Samples are evaluated for both the target biomarker as well as a control gene. Test validation included limit of detection, accuracy, and robustness studies with analytic samples. The method developed as a result of these studies reproducibly detect multiple fusion variants for ROS1 (C-Ros proto-oncogene 1; 8 variants) and RET (rearranged during transfection proto-oncogene; 8 variants). The sample processing workflow has been optimized so that test results can consistently be generated within 72 hours of sample receipt. PMID:29683453

Dembo polymerase chain reaction technique for detection of bovine abortion, diarrhea, and respiratory disease complex infectious agents in potential vectors and reservoirs.

PubMed

Rahpaya, Sayed Samim; Tsuchiaka, Shinobu; Kishimoto, Mai; Oba, Mami; Katayama, Yukie; Nunomura, Yuka; Kokawa, Saki; Kimura, Takashi; Kobayashi, Atsushi; Kirino, Yumi; Okabayashi, Tamaki; Nonaka, Nariaki; Mekata, Hirohisa; Aoki, Hiroshi; Shiokawa, Mai; Umetsu, Moeko; Morita, Tatsushi; Hasebe, Ayako; Otsu, Keiko; Asai, Tetsuo; Yamaguchi, Tomohiro; Makino, Shinji; Murata, Yoshiteru; Abi, Ahmad Jan; Omatsu, Tsutomu; Mizutani, Tetsuya

2018-05-31

Bovine abortion, diarrhea, and respiratory disease complexes, caused by infectious agents, result in high and significant economic losses for the cattle industry. These pathogens are likely transmitted by various vectors and reservoirs including insects, birds, and rodents. However, experimental data supporting this possibility are scarce. We collected 117 samples and screened them for 44 bovine abortive, diarrheal, and respiratory disease complex pathogens by using Dembo polymerase chain reaction (PCR), which is based on TaqMan real-time PCR. Fifty-seven samples were positive for at least one pathogen, including bovine viral diarrhea virus, bovine enterovirus, Salmonella enterica ser. Dublin, Salmonella enterica ser. Typhimurium, and Neospora caninum ; some samples were positive for multiple pathogens. Bovine viral diarrhea virus and bovine enterovirus were the most frequently detected pathogens, especially in flies, suggesting an important role of flies in the transmission of these viruses. Additionally, we detected the N. caninum genome from a cockroach sample for the first time. Our data suggest that insects (particularly flies), birds, and rodents are potential vectors and reservoirs of abortion, diarrhea, and respiratory infectious agents, and that they may transmit more than one pathogen at the same time.

A nested multiplex polymerase chain reaction assay for the differential identification of three zooanthroponotic chlamydial strains in porcine swab samples.

PubMed

Li, Yingguo; Wang, Yu; Nie, Fuping; Xiao, Jinwen; Wang, Guoming; Yuan, Ling; Li, Zhengguo

2011-07-01

Porcine chlamydial infection is an enzootic infectious disease caused by multiple members of the family Chlamydiaceae (e.g. Chlamydophila abortus, Chlamydia suis, and Chlamydophila pneumoniae). Rapid and accurate differentiation of these pathogens is critical in the control and prevention of disease. The aim of the current study was to develop a nested multiplex polymerase chain reaction (nmPCR) assay to simultaneously detect the 3 chlamydial pathogens in clinical samples. In the first round of the nmPCR, 1 pair of family-specific primers were used to amplify the 1,100 base pair (bp) fragment of chlamydial ompA gene. In the second round of the nmPCR, 4 inner primers were designed for Ch. abortus, C. suis, and Ch. pneumoniae. Each pathogen produced a specific amplicon with a size of 340 bp, 526 bp, and 267 bp respectively. The assay was sensitive and specific for detecting target pathogens in both cell cultures and clinical specimens. The results, incorporated with the improved rapid DNA extraction protocol, suggest that the nmPCR could be a promising assay for differential identification of different chlamydial strains in pigs.

MHC Class I Chain-Related Gene A Polymorphisms and Linkage Disequilibrium with HLA-B and HLA-C Alleles in Ocular Toxoplasmosis.

PubMed

Ayo, Christiane Maria; Camargo, Ana Vitória da Silveira; Frederico, Fábio Batista; Siqueira, Rubens Camargo; Previato, Mariana; Murata, Fernando Henrique Antunes; Silveira-Carvalho, Aparecida Perpétuo; Barbosa, Amanda Pires; Brandão de Mattos, Cinara de Cássia; de Mattos, Luiz Carlos

2015-01-01

This study investigated whether polymorphisms of the MICA (major histocompatibility complex class I chain-related gene A) gene are associated with eye lesions due to Toxoplasma gondii infection in a group of immunocompetent patients from southeastern Brazil. The study enrolled 297 patients with serological diagnosis of toxoplasmosis. Participants were classified into two distinct groups after conducting fundoscopic exams according to the presence (n = 148) or absence (n = 149) of ocular scars/lesions due to toxoplasmosis. The group of patients with scars/lesions was further subdivided into two groups according to the type of the ocular manifestation observed: primary (n = 120) or recurrent (n = 28). Genotyping of the MICA and HLA alleles was performed by the polymerase chain reaction-sequence specific oligonucleotide technique (PCR-SSO; One Lambda®) and the MICA-129 polymorphism (rs1051792) was identified by nested polymerase chain reaction (PCR-RFLP). Significant associations involving MICA polymorphisms were not found. Although the MICA*002~HLA-B*35 haplotype was associated with increased risk of developing ocular toxoplasmosis (P-value = 0.04; OR = 2.20; 95% CI = 1.05-4.60), and the MICA*008~HLA-C*07 haplotype was associated with protection against the development of manifestations of ocular toxoplasmosis (P-value = 0.009; OR: 0.44; 95% CI: 0.22-0.76), these associations were not statistically significant after adjusting for multiple comparisons. MICA polymorphisms do not appear to influence the development of ocular lesions in patients diagnosed with toxoplasmosis in this study population.

MHC Class I Chain-Related Gene A Polymorphisms and Linkage Disequilibrium with HLA-B and HLA-C Alleles in Ocular Toxoplasmosis

PubMed Central

Ayo, Christiane Maria; Camargo, Ana Vitória da Silveira; Frederico, Fábio Batista; Siqueira, Rubens Camargo; Previato, Mariana; Murata, Fernando Henrique Antunes; Silveira-Carvalho, Aparecida Perpétuo; Barbosa, Amanda Pires; Brandão de Mattos, Cinara de Cássia; de Mattos, Luiz Carlos

2015-01-01

This study investigated whether polymorphisms of the MICA (major histocompatibility complex class I chain-related gene A) gene are associated with eye lesions due to Toxoplasma gondii infection in a group of immunocompetent patients from southeastern Brazil. The study enrolled 297 patients with serological diagnosis of toxoplasmosis. Participants were classified into two distinct groups after conducting fundoscopic exams according to the presence (n = 148) or absence (n = 149) of ocular scars/lesions due to toxoplasmosis. The group of patients with scars/lesions was further subdivided into two groups according to the type of the ocular manifestation observed: primary (n = 120) or recurrent (n = 28). Genotyping of the MICA and HLA alleles was performed by the polymerase chain reaction-sequence specific oligonucleotide technique (PCR-SSO; One Lambda®) and the MICA-129 polymorphism (rs1051792) was identified by nested polymerase chain reaction (PCR-RFLP). Significant associations involving MICA polymorphisms were not found. Although the MICA*002~HLA-B*35 haplotype was associated with increased risk of developing ocular toxoplasmosis (P-value = 0.04; OR = 2.20; 95% CI = 1.05–4.60), and the MICA*008~HLA-C*07 haplotype was associated with protection against the development of manifestations of ocular toxoplasmosis (P-value = 0.009; OR: 0.44; 95% CI: 0.22–0.76), these associations were not statistically significant after adjusting for multiple comparisons. MICA polymorphisms do not appear to influence the development of ocular lesions in patients diagnosed with toxoplasmosis in this study population. PMID:26672749

Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears

PubMed Central

Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

2016-01-01

This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. PMID:26556834

Identification of three randomly amplified polymorphic DNA-polymerase chain reaction markers for distinguishing Asian and North American Gypsy Moths (Lepidoptera: Lymantriidae)

Treesearch

David E. Schreiber; Karen J. Garner; James M. Slavicek

1997-01-01

Gypsy moths originating in Asia have recently been introduced into North America, making it necessary to develop markers for distinguishing the Asian strain from the established North American population. We have identified 3 randomly amplified polymorphic DNA-polymerase chain reaction generated (RAPD-PCR) markers which are specific for either Asian or North American...

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bae, Brian; Nayak, Dhananjaya; Ray, Ananya

RNA polymerase inhibitors like the CBR class that target the enzyme’s complex catalytic center are attractive leads for new antimicrobials. The catalysis by RNA polymerase involves multiple rearrangements of bridge helix, trigger loop, and active-center side chains that isomerize the triphosphate of bound NTP and two Mg 2+ ions from a preinsertion state to a reactive configuration. CBR inhibitors target a crevice between the N-terminal portion of the bridge helix and a surrounding cap region within which the bridge helix is thought to rearrange during the nucleotide addition cycle. Here, we report crystal structures of CBR inhibitor/Escherichia coli RNA polymerasemore » complexes as well as biochemical tests that establish two distinct effects of the inhibitors on the RNA polymerase catalytic site. One effect involves inhibition of trigger-loop folding via the F loop in the cap, which affects both nucleotide addition and hydrolysis of 3'-terminal dinucleotides in certain backtracked complexes. The second effect is trigger-loop independent, affects only nucleotide addition and pyrophosphorolysis, and may involve inhibition of bridge-helix movements that facilitate reactive triphosphate alignment.« less

[Import and local transmission of Haemophilus ducreyi].

PubMed

Knudsen, Troels Bygum; Sand, Carsten; Jensen, Jørgen Skov

2010-07-26

Chancroid is a sexually transmitted disease characterized by painful ulcers with a soft margin, necrotic base and purulent exudate. Previously, only sporadic, imported cases have been reported in Denmark. The bacterium is difficult to culture and novel polymerase chain reaction (PCR)-based methods for direct demonstration of bacterial DNA have facilitated rapid verification of the clinical diagnosis. We report two cases which demonstrate import and subsequent local transmission in Denmark. In both cases, the clinical diagnosis was rapidly verified by a combined PCR testing for multiple causes of venereal ulcers.

Chancroid - desperate patient makes own diagnosis.

PubMed

Barnes, P; Chauhan, M

2014-09-01

We report a case of chancroid in a white heterosexual man in the United Kingdom. This patient was seen by four separate health services over a period of five weeks with excruciatingly painful penile ulcers. Despite several negative herpes simplex virus polymerase chain reaction tests and a self-diagnosis of chancroid, he was repeatedly offered multiple courses of aciclovir. This case highlights the need for awareness of alternative diagnoses in persistent cases of genital ulcer disease. © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

Simple method for production of internal control DNA for Mycobacterium tuberculosis polymerase chain reaction assays.

PubMed Central

deWit, D; Wootton, M; Allan, B; Steyn, L

1993-01-01

A simple method for the production of internal control DNA for two well-established Mycobacterium tuberculosis polymerase chain reaction assays is described. The internal controls were produced from Mycobacterium kansasii DNA with the same primers but at a lower annealing temperature than that used in the standard assays. In both assays, therefore, the internal control DNA has the same primer-binding sequences at the target DNA. One-microgram quantities of internal control DNA which was not contaminated with target DNA could easily be produced by this method. The inclusion of the internal control in the reaction mixture did not affect the efficiency of amplification of the target DNA. The method is simple and rapid and should be adaptable to most M. tuberculosis polymerase chain reaction assays. Images PMID:8370752

An Enhanced Polymerase Chain Reaction Assay to Detect Pre- and Full Mutation Alleles of the Fragile X Mental Retardation 1 Gene

PubMed Central

Saluto, Alessandro; Brussino, Alessandro; Tassone, Flora; Arduino, Carlo; Cagnoli, Claudia; Pappi, Patrizia; Hagerman, Paul; Migone, Nicola; Brusco, Alfredo

2005-01-01

Several diagnostic strategies have been applied to the detection of FMR1 gene repeat expansions in fragile X syndrome. Here, we report a novel polymerase chain reaction-based strategy using the Expand Long Template PCR System (Roche Diagnostics, Mannheim, Germany) and the osmolyte betaine. Repeat expansions up to ∼330 CGGs in males and up to at least ∼160 CGGs in carrier women could be easily visualized on ethidium bromide agarose gels. We also demonstrated that fluorescence analysis of polymerase chain reaction products was a reliable tool to verify the presence of premutation and full mutation alleles both in males and in females. This technique, primarily designed to detect premutation alleles, can be used as a routine first screen for expanded FMR1 alleles. PMID:16258159

Blood grouping based on PCR methods and agarose gel electrophoresis.

PubMed

Sell, Ana Maria; Visentainer, Jeane Eliete Laguila

2015-01-01

The study of erythrocyte antigens continues to be an intense field of research, particularly after the development of molecular testing methods. More than 300 specificities have been described by the International Society for Blood Transfusion as belonging to 33 blood group systems. The polymerase chain reaction (PCR) is a central tool for red blood cells (RBC) genotyping. PCR and agarose gel electrophoresis are low cost, easy, and versatile in vitro methods for amplifying defined target DNA (RBC polymorphic region). Multiplex-PCR, AS-PCR (Specific Allele Polymerase Chain Reaction), and RFLP-PCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction) techniques are usually to identify RBC polymorphisms. Furthermore, it is an easy methodology to implement. This chapter describes the PCR methodology and agarose gel electrophoresis to identify the polymorphisms of the Kell, Duffy, Kidd, and MNS blood group systems.

Exploring the limits of ultrafast polymerase chain reaction using liquid for thermal heat exchange: A proof of principle

NASA Astrophysics Data System (ADS)

Maltezos, George; Johnston, Matthew; Taganov, Konstantin; Srichantaratsamee, Chutatip; Gorman, John; Baltimore, David; Chantratita, Wasun; Scherer, Axel

2010-12-01

Thermal ramp rate is a major limiting factor in using real-time polymerase chain reaction (PCR) for routine diagnostics. We explored the limits of speed by using liquid for thermal exchange rather than metal as in traditional devices, and by testing different polymerases. In a clinical setting, our system equaled or surpassed state-of-the-art devices for accuracy in amplifying DNA/RNA of avian influenza, cytomegalovirus, and human immunodeficiency virus. Using Thermococcus kodakaraensis polymerase and optimizing both electrical and chemical systems, we obtained an accurate, 35 cycle amplification of an 85-base pair fragment of E. coli O157:H7 Shiga toxin gene in as little as 94.1 s, a significant improvement over a typical 1 h PCR amplification.

[Detection of large deletions in X linked Alport syndrome using competitive multiplex fluorescence polymerase chain reaction].

PubMed

Wang, F; Zhang, Y Q; Ding, J; Yu, L X

2017-10-18

To evaluate the ability of multiplex competitive fluorescence polymerase chain reaction in detection of large deletion and duplication genotypes of X-linked Alport syndrome. Clinical diagnosis of X-linked Alport syndrome was based on either abnormal staining of type IV collagen α5 chain in the epidermal basement membrane alone or with abnormal staining of type IV collagen α5 chain in the glomerular basement membrane and Bowman's capsule/ultrastructural changes in the glomerular basement membrane typical of Alport syndrome. A total of 20 unrelated Chinese patients (13 males and 7 females) clinically diagnosed as X-linked Alport syndrome were included in the study. Their genotypes were unknown. Control subjects included a male patient with other renal disease and two patients who had large deletions in COL4A5 gene detected by multiplex ligation-dependent probe amplification. Genomic DNA was isolated from peripheral blood leukocytes in all the participants. Multiplex competitive fluorescence polymerase chain reaction was used to coamplify 53 exons of COL4A5 gene and four reference genes in a single reaction. When a deletion removed exon 1 of COL4A5 gene was identified, the same method was used to coamplify the first 4 exons of COL4A5 and COL4A6 genes, a promoter shared by COL4A5 and COL4A6 genes, and three reference genes in a single reaction. Any copy number loss suggested by this method was verified by electrophoresis of corresponding polymerase chain reaction amplified products or DNA sequencing to exclude possible DNA variations in the primer regions. Genotypes of two positive controls identified by multiplex competitive fluorescence polymerase chain reaction were consistent with those detected by multiplex ligation-dependent probe amplification. Deletions were identified in 6 of the 20 patients, including two large deletions removing the 5' part of both COL4A5 and COL4A6 genes with the breakpoint located in the second intron of COL4A6, two large deletions removing more than 30 exons of COL4A5 gene, one large deletion removing at least 1 exon of COL4A5 gene, and one small deletion involving 13 bps. No duplication was found. Our results show that multiplex competitive fluorescence polymerase chain reaction is a good alternative to classical techniques for large deletion genotyping in X-linked Alport syndrome.

Effects of Holding Time, Storage, and the Preservation of Samples on Sample Integrity for the Detection of Fecal Indicator Bacteria by Quantitative Polymerase Chain Reaction (qPCR)-based assays.

EPA Science Inventory

The purpose of this project was to answer questions related to storage of samples to be analyzed by the quantitative polymerase chain reaction (qPCR)-based assays for fecal indicator bacteria. The project was divided into two parts. The first part was to determine if filters th...

Comparison of automated BAX polymerase chain reaction and standard culture methods for detection of Listeria monocyogenes in blue crab meat (Callinectus sapidus) and blue crab processing plants

USDA-ARS?s Scientific Manuscript database

This study compared the BAX Polymerase Chain Reaction method (BAX PCR) with the Standard Culture Method (SCM) for detection of L. monocytogenes in blue crab meat and crab processing plants. The aim of this study was to address this data gap. Raw crabs, finished products and environmental sponge samp...

A novel gammaherpesvirus in a large flying fox (Pteropus vampyrus) with blepharitis.

PubMed

Paige Brock, A; Cortés-Hinojosa, Galaxia; Plummer, Caryn E; Conway, Julia A; Roff, Shannon R; Childress, April L; Wellehan, James F X

2013-05-01

A novel gammaherpesvirus was identified in a large flying fox (Pteropus vampyrus) with conjunctivitis, blepharitis, and meibomianitis by nested polymerase chain reaction and sequencing. Polymerase chain reaction amplification and sequencing of 472 base pairs of the DNA-dependent DNA polymerase gene were used to identify a novel herpesvirus. Bayesian and maximum likelihood phylogenetic analyses indicated that the virus is a member of the genus Percavirus in the subfamily Gammaherpesvirinae. Additional research is needed regarding the association of this virus with conjunctivitis and other ocular pathology. This virus may be useful as a biomarker of stress and may be a useful model of virus recrudescence in Pteropus spp.

Single-Cell Whole-Genome Amplification and Sequencing: Methodology and Applications.

PubMed

Huang, Lei; Ma, Fei; Chapman, Alec; Lu, Sijia; Xie, Xiaoliang Sunney

2015-01-01

We present a survey of single-cell whole-genome amplification (WGA) methods, including degenerate oligonucleotide-primed polymerase chain reaction (DOP-PCR), multiple displacement amplification (MDA), and multiple annealing and looping-based amplification cycles (MALBAC). The key parameters to characterize the performance of these methods are defined, including genome coverage, uniformity, reproducibility, unmappable rates, chimera rates, allele dropout rates, false positive rates for calling single-nucleotide variations, and ability to call copy-number variations. Using these parameters, we compare five commercial WGA kits by performing deep sequencing of multiple single cells. We also discuss several major applications of single-cell genomics, including studies of whole-genome de novo mutation rates, the early evolution of cancer genomes, circulating tumor cells (CTCs), meiotic recombination of germ cells, preimplantation genetic diagnosis (PGD), and preimplantation genomic screening (PGS) for in vitro-fertilized embryos.

Microfluidics-Based PCR for Fusion Transcript Detection.

PubMed

Chen, Hui

2016-01-01

The microfluidic technology allows the production of network of submillimeter-size fluidic channels and reservoirs in a variety of material systems. The microfluidic-based polymerase chain reaction (PCR) allows automated multiplexing of multiple samples and multiple assays simultaneously within a network of microfluidic channels and chambers that are co-ordinated in controlled fashion by the valves. The individual PCR reaction is performed in nanoliter volume, which allows testing on samples with limited DNA and RNA. The microfluidics devices are used in various types of PCR such as digital PCR and single molecular emulsion PCR for genotyping, gene expression, and miRNA expression. In this chapter, the use of a microfluidics-based PCR for simultaneous screening of 14 known fusion transcripts in patients with leukemia is described.

Population size estimation in Yellowstone wolves with error-prone noninvasive microsatellite genotypes.

PubMed

Creel, Scott; Spong, Goran; Sands, Jennifer L; Rotella, Jay; Zeigle, Janet; Joe, Lawrence; Murphy, Kerry M; Smith, Douglas

2003-07-01

Determining population sizes can be difficult, but is essential for conservation. By counting distinct microsatellite genotypes, DNA from noninvasive samples (hair, faeces) allows estimation of population size. Problems arise because genotypes from noninvasive samples are error-prone, but genotyping errors can be reduced by multiple polymerase chain reaction (PCR). For faecal genotypes from wolves in Yellowstone National Park, error rates varied substantially among samples, often above the 'worst-case threshold' suggested by simulation. Consequently, a substantial proportion of multilocus genotypes held one or more errors, despite multiple PCR. These genotyping errors created several genotypes per individual and caused overestimation (up to 5.5-fold) of population size. We propose a 'matching approach' to eliminate this overestimation bias.

Impact of toxigenic Clostridium difficile polymerase chain reaction testing on the clinical microbiology laboratory and inpatient epidemiology.

PubMed

Napierala, Maureen; Munson, Erik; Skonieczny, Patrice; Rodriguez, Sonia; Riederer, Nancy; Land, Gayle; Luzinski, Mary; Block, Denise; Hryciuk, Jeanne E

2013-08-01

Conversion from Clostridium difficile toxin A/B EIA to tcdB polymerase chain reaction for diagnosis of C. difficile infection (CDI) resulted in significant decreases in laboratory testing volume and largely unchanged C. difficile toxin detection rates. Decreases in healthcare-associated CDI rates (P ≤ 0.05) reflected a clinical practice benefit of this conversion. Copyright © 2013 Elsevier Inc. All rights reserved.

Optimized nested polymerase chain reaction for antemortem detection of Mycobacteria in Amazon parrots (Amazona aestiva) and orange-winged Amazons (Amazona amazonica).

PubMed

Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo

2014-03-01

The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.

Preemptive Isolation Precautions of Patients at High Risk for Methicillin-Resistant Staphylococcus aureus in Combination With Ultrarapid Polymerase Chain Reaction Screening as an Effective Tool for Infection Control.

PubMed

Hallak, Ghias; Neuner, Bruno; Schefold, Joerg C; Gorzelniak, Kerstin; Rapsch, Brigitte; Pfüller, Roland; Stengel, Dirk; Wellmann, Jürgen; Ekkernkamp, Axel; Walter, Michael

2016-12-01

This sequential nonrandomized intervention study investigated the role of preemptive isolation precautions plus ultrarapid polymerase chain reaction screening for methicillin-resistant Staphylococcus aureus (MRSA). Compared with no prophylactic isolation plus conventional microbiology MRSA screening, nosocomial MRSA colonization and total MRSA incidence per 10,000 patient days significantly decreased. Infect Control Hosp Epidemiol 2016;1489-1491.

Mycoplasma haemolamae infection in a 4-day-old cria: Support for in utero transmission by use of a polymerase chain reaction assay

PubMed Central

Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.

2006-01-01

Abstract Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic. PMID:16604978

Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears.

PubMed

Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

2016-01-01

This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. © The American Society of Tropical Medicine and Hygiene.

Clinical Characteristics and Outcomes of Hematologic Malignancy Patients With Positive Clostridium difficile Toxin Immunoassay Versus Polymerase Chain Reaction Test Results.

PubMed

Ziegler, Matthew; Landsburg, Daniel; Pegues, David; Alby, Kevin; Gilmar, Cheryl; Bink, Kristen; Gorman, Theresa; Moore, Amy; Bonhomme, Brittaney; Omorogbe, Jacqueline; Tango, Dana; Tolomeo, Pam; Han, Jennifer H

2018-04-25

In a cohort of inpatients with hematologic malignancy and positive enzyme immunoassay (EIA) or polymerase chain reaction (PCR) Clostridium difficile tests, we found that clinical characteristics and outcomes were similar between these groups. The method of testing is unlikely to predict infection in this population, and PCR-positive results should be treated with concern.Infect Control Hosp Epidemiol 2018;1-4.

Use of polymerase chain reaction in the diagnosis of toxocariasis: an experimental study.

PubMed

Rai, S K; Uga, S; Wu, Z; Takahashi, Y; Matsumura, T

1997-09-01

In this paper we report the usefulness of polymerase chain reaction technique in the diagnosis of visceral larva migrans in a mouse model. Liver samples obtained from two set of experimentally infected mice (10, 100, 1,000 and 10,000 embryonated Toxocara canis eggs per mouse) along with the eggs of T. canis, T. cati and Ascaris suum were included in this study. Polymerase chain reaction (PCR) was performed using Toxocara primers (SB12). The first PCR product electrophoresis revealed very thin positive bands or no bands in liver samples. However, on second PCR a clear-cut bands were observed. No positive band was shown by A. suum eggs. Our findings thus indicate the usefulness of PCR technic in the diagnosis of visceral larva migrans (VLM) in liver biopsy materials specifically by means of double PCR using the primer SB12.

Detection of putative oral pathogens in acute periradicular abscesses by 16S rDNA-directed polymerase chain reaction.

PubMed

Siqueira, J F; Rôças, I N; Oliveira, J C; Santos, K R

2001-03-01

A 16S rDNA-directed polymerase chain reaction method was used to assess the occurrence of four black-pigmented anaerobic rods, Treponema denticola, and Actinobacillus actinomycetemcomitans in acute periradicular abscesses. Pus was collected by aspiration from 10 cases diagnosed as acute abscesses of endodontic origin. DNA was extracted from the samples and analyzed using a polymerase chain reaction-based identification assay. The method allowed detecting black-pigmented anaerobes in 80% of the examined abscesses. Porphyromonas endodontalis was found in 70%, T. denticola in 50%, Porphyromonas gingivalis in 40%, and Prevotella intermedia in 10% of the cases. P. gingivalis was always found associated with P. endodontalis. Prevotella nigrescens and A. actinomycetemcomitans were not found in any pus sample. The high prevalence of P. endodontalis, T. denticola, and P. gingivalis suggests that they can play an important role in the etiology of acute periradicular abscesses.

Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sharma, Vinay, E-mail: winn201@gmail.com; Rajaura, Rajveer; Sharma, Preetam Kumar

An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO compositemore » for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.« less

Isolation of Separate Ureaplasma Species From Endotracheal Secretions of Twin Patients.

PubMed

Beeton, Michael L; Maxwell, Nicola C; Chalker, Victoria J; Brown, Rebecca J; Aboklaish, Ali F; Spiller, O Brad

2016-08-01

Isolation of Ureaplasma spp. from preterm neonates and the association with development of bronchopulmonary dysplasia has been previously investigated. However, few studies have contrasted the nature of infection in twins. In this article, we report that dizygotic twins (1 girl, 1 boy) born at 24 weeks gestation both yielded culturable Ureaplasma from endotracheal secretions. The samples were part of a serial blind collection cohort of ventilated premature neonates, and analysis of repeat cultures showed stable, separate infections over a period of 17 and 21 days, respectively. Immunoblot and probe-specific quantitative polymerase chain reaction analysis determined that Twin 1 was solely infected with Ureaplasma parvum (specifically, serovar 6 by gene sequencing), whereas Twin 2 was solely infected with Ureaplasma urealyticum (specifically, genotype A- serovars 2, 5, and 8 by gene sequencing). Immunoblot analysis found that the major surface antigen (multiple-banded antigen) altered relative mass for both strains during the course of infection. Quantitative polymerase chain reaction analysis of extracted endotracheal aspirates confirmed no evidence of mixed infection for either twin. Failure of sentinel ventilated preterm infants on the same ward to acquire Ureaplasma infection after the first week of birth suggests no cot-to-cot transfer of Ureaplasma infection occurred. This study demonstrated not only a contrasting clinical outcome for a set of twins infected with 2 separate species of Ureaplasma, but also the first real-time demonstration of multiple-banded antigen alteration and evolution of Ureaplasma over the course of a clinical infection. Copyright © 2016 by the American Academy of Pediatrics.

Inhibition of herpes simplex virus DNA polymerase by purine ribonucleoside monophosphates.

PubMed

Frank, K B; Cheng, Y C

1986-02-05

Purine ribonucleoside monophosphates were found to inhibit chain elongation catalyzed by herpes simplex virus (HSV) DNA polymerase when DNA template-primer concentrations were rate-limiting. Inhibition was fully competitive with DNA template-primer during chain elongation; however, DNA polymerase-associated exonuclease activity was inhibited noncompetitively with respect to DNA. Combinations of 5'-GMP and phosphonoformate were kinetically mutually exclusive in dual inhibitor studies. Pyrimidine nucleoside monophosphates and deoxynucleoside monophosphates were less inhibitory than purine riboside monophosphates. The monophosphates of 9-beta-D-arabinofuranosyladenine, Virazole (1-beta-D-ribofuranosyl-1,2,4-triazole-3-carboxamide), 9-(2-hydroxyethoxymethyl)guanine, and 9-(1,3-dihydroxy-2-propoxymethyl)guanine exerted little or no inhibition. In contrast to HSV DNA polymerase, human DNA polymerase alpha was not inhibited by purine ribonucleoside monophosphates. These studies suggest the possibility of a physiological role of purine ribonucleoside monophosphates as regulators of herpesvirus DNA synthesis and a new approach to developing selective anti-herpesvirus compounds.

Use of the polymerase chain reaction to directly detect malaria parasites in blood samples from the Venezuelan Amazon.

PubMed

Laserson, K F; Petralanda, I; Hamlin, D M; Almera, R; Fuentes, M; Carrasquel, A; Barker, R H

1994-02-01

We have examined the reproducibility, sensitivity, and specificity of detecting Plasmodium falciparum using the polymerase chain reaction (PCR) and the species-specific probe pPF14 under field conditions in the Venezuelan Amazon. Up to eight samples were field collected from each of 48 consenting Amerindians presenting with symptoms of malaria. Sample processing and analysis was performed at the Centro Amazonico para la Investigacion y Control de Enfermedades Tropicales Simon Bolivar. A total of 229 samples from 48 patients were analyzed by PCR methods using four different P. falciparum-specific probes. One P. vivax-specific probe and by conventional microscopy. Samples in which results from PCR and microscopy differed were reanalyzed at a higher sensitivity by microscopy. Results suggest that microscopy-negative, PCR-positive samples are true positives, and that microscopy-positive and PCR-negative samples are true negatives. The sensitivity of the DNA probe/PCR method was 78% and its specificity was 97%. The positive predictive value of the PCR method was 88%, and the negative predictive value was 95%. Through the analysis of multiple blood samples from each individual, the DNA probe/PCR methodology was found to have an inherent reproducibility that was highly statistically significant.

Comprehensive Panel of Real-Time TaqMan™ Polymerase Chain Reaction Assays for Detection and Absolute Quantification of Filoviruses, Arenaviruses, and New World Hantaviruses

PubMed Central

Trombley, Adrienne R.; Wachter, Leslie; Garrison, Jeffrey; Buckley-Beason, Valerie A.; Jahrling, Jordan; Hensley, Lisa E.; Schoepp, Randal J.; Norwood, David A.; Goba, Augustine; Fair, Joseph N.; Kulesh, David A.

2010-01-01

Viral hemorrhagic fever is caused by a diverse group of single-stranded, negative-sense or positive-sense RNA viruses belonging to the families Filoviridae (Ebola and Marburg), Arenaviridae (Lassa, Junin, Machupo, Sabia, and Guanarito), and Bunyaviridae (hantavirus). Disease characteristics in these families mark each with the potential to be used as a biological threat agent. Because other diseases have similar clinical symptoms, specific laboratory diagnostic tests are necessary to provide the differential diagnosis during outbreaks and for instituting acceptable quarantine procedures. We designed 48 TaqMan™-based polymerase chain reaction (PCR) assays for specific and absolute quantitative detection of multiple hemorrhagic fever viruses. Forty-six assays were determined to be virus-specific, and two were designated as pan assays for Marburg virus. The limit of detection for the assays ranged from 10 to 0.001 plaque-forming units (PFU)/PCR. Although these real-time hemorrhagic fever virus assays are qualitative (presence of target), they are also quantitative (measure a single DNA/RNA target sequence in an unknown sample and express the final results as an absolute value (e.g., viral load, PFUs, or copies/mL) on the basis of concentration of standard samples and can be used in viral load, vaccine, and antiviral drug studies. PMID:20439981

Concordance of polymerase chain reaction with human immunodeficiency virus antibody detection.

PubMed

Horsburgh, C R; Ou, C Y; Jason, J; Holmberg, S D; Lifson, A R; Moore, J L; Ward, J W; Seage, G R; Mayer, K H; Evatt, B L

1990-08-01

To evaluate the correlation of detection of human immunodeficiency virus (HIV) by polymerase chain reaction (PCR) with detection of HIV antibody, 271 simultaneous serum and peripheral blood mononuclear cell samples were examined from 242 persons whose activities placed them at increased risk for HIV infection: 142 from homosexual men, 86 from hemophilic men, and 43 from heterosexual partners of HIV-infected persons. PCR was performed using the gag region primer pair SK38/39 and the env region primer pairs SK68/69 and CO71/72. Amplified HIV DNA was detected using specific oligomer probes. Of 63 HIV antibody-positive samples, 58 (92%) had HIV DNA by PCR. Of 208 HIV antibody-negative samples, 7 (3.4%) had HIV DNA by PCR. On follow-up, 4 of the latter persons were seropositive when next tested; 2 were well and antibody- and PCR-negative; 1 had died of a stroke before retesting. Thus, PCR detects HIV in most antibody-positive persons; detection is increased by use of multiple primer pairs. PCR-positive antibody-negative specimens may indicate HIV infection in which antibody has not yet developed or may be false-positive PCR results. When PCR is discordant with HIV antibody, testing of additional specimens and clinical follow-up are necessary to assess HIV infection status.

A novel mechanism of sugar selection utilized by a human X-family DNA polymerase.

PubMed

Brown, Jessica A; Fiala, Kevin A; Fowler, Jason D; Sherrer, Shanen M; Newmister, Sean A; Duym, Wade W; Suo, Zucai

2010-01-15

During DNA synthesis, most DNA polymerases and reverse transcriptases select against ribonucleotides via a steric clash between the ribose 2'-hydroxyl group and the bulky side chain of an active-site residue. In this study, we demonstrated that human DNA polymerase lambda used a novel sugar selection mechanism to discriminate against ribonucleotides, whereby the ribose 2'-hydroxyl group was excluded mostly by a backbone segment and slightly by the side chain of Y505. Such steric clash was further demonstrated to be dependent on the size and orientation of the substituent covalently attached at the ribonucleotide C2'-position. Copyright 2009 Elsevier Ltd. All rights reserved.

A linear concatenation strategy to construct 5'-enriched amplified cDNA libraries using multiple displacement amplification.

PubMed

Gadkar, Vijay J; Filion, Martin

2013-06-01

In various experimental systems, limiting available amounts of RNA may prevent a researcher from performing large-scale analyses of gene transcripts. One way to circumvent this is to 'pre-amplify' the starting RNA/cDNA, so that sufficient amounts are available for any downstream analysis. In the present study, we report the development of a novel protocol for constructing amplified cDNA libraries using the Phi29 DNA polymerase based multiple displacement amplification (MDA) system. Using as little as 200 ng of total RNA, we developed a linear concatenation strategy to make the single-stranded cDNA template amenable for MDA. The concatenation, made possible by the template switching property of the reverse transcriptase enzyme, resulted in the amplified cDNA library with intact 5' ends. MDA generated micrograms of template, allowing large-scale polymerase chain reaction analyses or other large-scale downstream applications. As the amplified cDNA library contains intact 5' ends, it is also compatible with 5' RACE analyses of specific gene transcripts. Empirical validation of this protocol is demonstrated on a highly characterized (tomato) and an uncharacterized (corn gromwell) experimental system.

Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples.

PubMed

McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I; Cai, Hugh Y

2014-04-01

A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively.

Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples

PubMed Central

McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I.; Cai, Hugh Y.

2014-01-01

A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively. PMID:24688178

Lymphogranuloma venereum variant L2b-specific polymerase chain reaction: insertion used to close an epidemiological gap.

PubMed

Verweij, S P; Catsburg, A; Ouburg, S; Lombardi, A; Heijmans, R; Dutly, F; Frei, R; Morré, S A; Goldenberger, D

2011-11-01

The management of the ongoing lymphogranuloma venereum epidemic in industrialized Western countries caused by Chlamydia trachomatis variant L2b still needs improvements in diagnosis, therapy and prevention. We therefore developed the first rapid C. trachomatis variant L2b-specific polymerase chain reaction to circumvent laborious ompA gene sequencing. © 2011 The Authors. Clinical Microbiology and Infection © 2011 European Society of Clinical Microbiology and Infectious Diseases.

Ring test evaluation of the detection of influenza A virus in swine oral fluids by real-time, reverse transcription polymerase chain reaction (rRT-PCR) and virus isolation

USDA-ARS?s Scientific Manuscript database

The probability of detecting influenza A virus (IAV) in oral fluid (OF) specimens was calculated for each of 13 real-time, reverse transcription polymerase chain reaction (rRT-PCR) and 7 virus isolation (VI) assays. To conduct the study, OF was inoculated with H1N1 or H3N2 IAV and serially 10-fold d...

Biochemical Evaluation of the Inhibition Properties of Favipiravir and 2′-C-Methyl-Cytidine Triphosphates against Human and Mouse Norovirus RNA Polymerases

PubMed Central

Tucker, Kathryn; Lin, Xiaoyan; Kao, C. Cheng; Shaw, Ken; Tan, Hua; Symons, Julian; Behera, Ishani; Rajwanshi, Vivek K.; Dyatkina, Natalia; Wang, Guangyi; Beigelman, Leo

2015-01-01

Norovirus (NoV) is a positive-sense single-stranded RNA virus that causes acute gastroenteritis and is responsible for 200,000 deaths per year worldwide. No effective vaccine or treatment is available. Recent studies have shown that the nucleoside analogs favipiravir (T-705) and 2′-C-methyl-cytidine (2CM-C) inhibit NoV replication in vitro and in animal models, but their precise mechanism of action is unknown. We evaluated the molecular interactions between nucleoside triphosphates and NoV RNA-dependent RNA polymerase (NoVpol), the enzyme responsible for replication and transcription of NoV genomic RNA. We found that T-705 ribonucleoside triphosphate (RTP) and 2CM-C triphosphate (2CM-CTP) equally inhibited human and mouse NoVpol activities at concentrations resulting in 50% of maximum inhibition (IC50s) in the low micromolar range. 2CM-CTP inhibited the viral polymerases by competing directly with natural CTP during primer elongation, whereas T-705 RTP competed mostly with ATP and GTP at the initiation and elongation steps. Incorporation of 2CM-CTP into viral RNA blocked subsequent RNA synthesis, whereas T-705 RTP did not cause immediate chain termination of NoVpol. 2CM-CTP and T-705 RTP displayed low levels of enzyme selectivity, as they were both recognized as substrates by human mitochondrial RNA polymerase. The level of discrimination by the human enzyme was increased with a novel analog of T-705 RTP containing a 2′-C-methyl substitution. Collectively, our data suggest that 2CM-C inhibits replication of NoV by acting as a classic chain terminator, while T-705 may inhibit the virus by multiple mechanisms of action. Understanding the precise mechanism of action of anti-NoV compounds could provide a rational basis for optimizing their inhibition potencies and selectivities. PMID:26392512

Problem-Solving Test: Pyrosequencing

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2013-01-01

Terms to be familiar with before you start to solve the test: Maxam-Gilbert sequencing, Sanger sequencing, gel electrophoresis, DNA synthesis reaction, polymerase chain reaction, template, primer, DNA polymerase, deoxyribonucleoside triphosphates, orthophosphate, pyrophosphate, nucleoside monophosphates, luminescence, acid anhydride bond,…

A noninvasive, direct real-time PCR method for sex determination in multiple avian species

USGS Publications Warehouse

Brubaker, Jessica L.; Karouna-Renier, Natalie K.; Chen, Yu; Jenko, Kathryn; Sprague, Daniel T.; Henry, Paula F.P.

2011-01-01

Polymerase chain reaction (PCR)-based methods to determine the sex of birds are well established and have seen few modifications since they were first introduced in the 1990s. Although these methods allowed for sex determination in species that were previously difficult to analyse, they were not conducive to high-throughput analysis because of the laboriousness of DNA extraction and gel electrophoresis. We developed a high-throughput real-time PCR-based method for analysis of sex in birds, which uses noninvasive sample collection and avoids DNA extraction and gel electrophoresis.

Early Hits and Long-Term Consequences: Tracking the Lasting Impact of Prenatal Smoke Exposure on Telomere Length in Children

PubMed Central

McKasson, Sarah; Mabile, Emily; Dunaway, Lauren F.; Drury, Stacy S.

2013-01-01

We examined the association between telomere length and prenatal tobacco exposure (PTE) in 104 children aged 4 to 14 years. Salivary telomere length (STL) was determined from salivary DNA using quantitative polymerase chain reaction. Of the children, 18% had maternal reported PTE. Mean STL was significantly lower among children with PTE (6.4 vs 7.5, P < .05). Findings extend the literature demonstrating the negative long-term effects of PTE to include a cellular marker of aging linked to multiple negative health outcomes. PMID:23927510

Recombinase polymerase amplification: Emergence as a critical molecular technology for rapid, low-resource diagnostics.

PubMed

James, Ameh; Macdonald, Joanne

2015-01-01

Isothermal molecular diagnostics are bridging the technology gap between traditional diagnostics and polymerase chain reaction-based methods. These new techniques enable timely and accurate testing, especially in settings where there is a lack of infrastructure to support polymerase chain reaction facilities. Despite this, there is a significant lack of uptake of these technologies in developing countries where they are highly needed. Among these novel isothermal technologies, recombinase polymerase amplification (RPA) holds particular potential for use in developing countries. This rapid nucleic acid amplification approach is fast, highly sensitive and specific, and amenable to countries with a high burden of infectious diseases. Implementation of RPA technology in developing countries is critically required to assess limitations and potentials of the diagnosis of infectious disease, and may help identify impediments that prevent adoption of new molecular technologies in low resource- and low skill settings. This review focuses on approaching diagnosis of infectious disease with RPA.

Recombinase polymerase amplification-based assay to diagnose Giardia in stool samples.

PubMed

Crannell, Zachary Austin; Cabada, Miguel Mauricio; Castellanos-Gonzalez, Alejandro; Irani, Ayesha; White, Arthur Clinton; Richards-Kortum, Rebecca

2015-03-01

Giardia duodenalis is one of the most commonly identified parasites in stool samples. Although relatively easy to treat, giardiasis can be difficult to detect as it presents similar to other diarrheal diseases. Here, we present a recombinase polymerase amplification-based Giardia (RPAG) assay to detect the presence of Giardia in stool samples. The RPAG assay was characterized on the bench top using stool samples spiked with Giardia cysts where it showed a limit-of-detection nearly as low as the gold standard polymerase chain reaction assay. The RPAG assay was then tested in the highlands of Peru on 104 stool samples collected from the surrounding communities where it showed 73% sensitivity and 95% specificity against a polymerase chain reaction and microscopy composite gold standard. Further improvements in clinical sensitivity will be needed for the RPAG assay to have clinical relevance. © The American Society of Tropical Medicine and Hygiene.

Recombinase Polymerase Amplification-Based Assay to Diagnose Giardia in Stool Samples

PubMed Central

Crannell, Zachary Austin; Cabada, Miguel Mauricio; Castellanos-Gonzalez, Alejandro; Irani, Ayesha; White, Arthur Clinton; Richards-Kortum, Rebecca

2015-01-01

Giardia duodenalis is one of the most commonly identified parasites in stool samples. Although relatively easy to treat, giardiasis can be difficult to detect as it presents similar to other diarrheal diseases. Here, we present a recombinase polymerase amplification-based Giardia (RPAG) assay to detect the presence of Giardia in stool samples. The RPAG assay was characterized on the bench top using stool samples spiked with Giardia cysts where it showed a limit-of-detection nearly as low as the gold standard polymerase chain reaction assay. The RPAG assay was then tested in the highlands of Peru on 104 stool samples collected from the surrounding communities where it showed 73% sensitivity and 95% specificity against a polymerase chain reaction and microscopy composite gold standard. Further improvements in clinical sensitivity will be needed for the RPAG assay to have clinical relevance. PMID:25510713

Human immunodeficiency virus (HIV) is highly associated with giant idiopathic esophageal ulcers in acquired immunodeficiency syndrome (AIDS) patients.

PubMed

Lv, Bei; Cheng, Xin; Gao, Jackson; Zhao, Hong; Chen, Liping; Wang, Liwei; Huang, Shaoping; Fan, Zhenyu; Zhang, Renfang; Shen, Yinzhong; Li, Lei; Liu, Baochi; Qi, Tangkai; Wang, Jing; Cheng, Jilin

2016-01-01

This study aimed to determine whether the human immunodeficiency virus (HIV) exists in giant idiopathic esophageal ulcers in the patients with acquired immune deficiency syndrome (AIDS). 16 AIDS patients with a primary complaint of epigastric discomfort were examined by gastroscopy. Multiple and giant esophageal ulcers were biopsied and analyzed with pathology staining and reverse transcription-polymerase chain reaction (RT-PCR) to determine the potential pathogenic microorganisms, including HIV, cytomegalovirus (CMV) and herpes simplex viruses (HSV). HIV was detected in ulcer samples from 12 out of these 16 patients. Ulcers in 2 patients were infected with CMV and ulcers in another 2 patients were found HSV positive. No obvious cancerous pathological changes were found in these multiple giant esophageal ulcer specimens. HIV may be one of the major causative agents of multiple benign giant esophageal ulcers in AIDS patients.

Human immunodeficiency virus (HIV) is highly associated with giant idiopathic esophageal ulcers in acquired immunodeficiency syndrome (AIDS) patients

PubMed Central

Lv, Bei; Cheng, Xin; Gao, Jackson; Zhao, Hong; Chen, Liping; Wang, Liwei; Huang, Shaoping; Fan, Zhenyu; Zhang, Renfang; Shen, Yinzhong; Li, Lei; Liu, Baochi; Qi, Tangkai; Wang, Jing; Cheng, Jilin

2016-01-01

Objective: This study aimed to determine whether the human immunodeficiency virus (HIV) exists in giant idiopathic esophageal ulcers in the patients with acquired immune deficiency syndrome (AIDS). Methods: 16 AIDS patients with a primary complaint of epigastric discomfort were examined by gastroscopy. Multiple and giant esophageal ulcers were biopsied and analyzed with pathology staining and reverse transcription-polymerase chain reaction (RT-PCR) to determine the potential pathogenic microorganisms, including HIV, cytomegalovirus (CMV) and herpes simplex viruses (HSV). Results: HIV was detected in ulcer samples from 12 out of these 16 patients. Ulcers in 2 patients were infected with CMV and ulcers in another 2 patients were found HSV positive. No obvious cancerous pathological changes were found in these multiple giant esophageal ulcer specimens. Conclusion: HIV may be one of the major causative agents of multiple benign giant esophageal ulcers in AIDS patients. PMID:27830031

The use of heteroduplex analysis of polymerase chain reaction products to support the possible transmission of Legionella pneumophila from a malfunctioning automobile air conditioner.

PubMed

Pinar, Ahmet; Ramirez, Julio A; Schindler, Laura L; Miller, Richard D; Summersgill, James T

2002-03-01

Air conditioner condensates have not been previously associated with cases of Legionnaires' disease. We report the possible transmission of Legionella pneumophila serogroup 1 from a malfunctioning automobile air conditioning system's leaking water onto the floorboard of a car driven for a long distance by the patient. Heteroduplex analysis of polymerase chain reaction products was used to help establish an epidemiologic link between the water specimen and the patient.

Identification of co-infection by rotavirus and parvovirus in dogs with gastroenteritis in Mexico.

PubMed

Ortega, Ariadna Flores; Martínez-Castañeda, José Simón; Bautista-Gómez, Linda G; Muñoz, Raúl Fajardo; Hernández, Israel Quijano

This is the first report on circulating canine rotavirus in Mexico. Fifty samples from dogs with gastroenteritis were analyzed used polymerase chain reaction and reverse transcription polymerase chain reaction in order to identify parvovirus and rotavirus, respectively; 7% of dogs were infected with rotavirus exclusively, while 14% were co-infected with both rotavirus and parvovirus; clinical signs in co-infected dogs were more severe. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Detection of Trypanosoma cruzi by Polymerase Chain Reaction.

PubMed

Márquez, María Elizabeth; Concepción, Juan Luis; González-Marcano, Eglys; Mondolfi, Alberto Paniz

2016-01-01

American Trypanosomiasis (Chagas disease) is an infectious disease caused by the hemoflagellate parasite Trypanosoma cruzi which is transmitted by reduviid bugs. T. cruzi infection occurs in a broad spectrum of reservoir animals throughout North, Central, and South America and usually evolves into an asymptomatic chronic clinical stage of the disease in which diagnosis is often challenging. This chapter describes the application of polymerase chain reaction (PCR) for the detection of Trypanosoma cruzi DNA including protocols for sample preparation, DNA extraction, and target amplification methods.

Real-time polymerase chain reaction for detection of encapsulated Haemophilus influenzae using degenerate primers to target the capsule transport gene bexA.

PubMed

Law, Dennis K S; Tsang, Raymond S W

2013-05-01

A real-time polymerase chain reaction assay that uses degenerate primers and a dual-labelled probe was developed to detect the bexA gene of Haemophilus influenzae, including those belonging to non-b serotypes as well as clonal division II strains. This assay is sensitive and specific, detecting 20 copies of the gene, but negative with a variety of bacteria associated with meningitis and bacteremia or septicemia.

Geographic variation in marine turtle fibropapillomatosis

USGS Publications Warehouse

Greenblatt, R.J.; Work, Thierry M.; Dutton, P.; Sutton, C.A.; Spraker, T.R.; Casey, R.N.; Diez, C.E.; Parker, Dana C.; St. Ledger, J.; Balazs, G.H.; Casey, J.W.

2005-01-01

We document three examples of fibropapillomatosis by histology, quantitative polymerase chain reaction (qPCR), and sequence analysis from three different geographic areas. Tumors compatible in morphology with fibropapillomatosis were seen in green turtles from Puerto Rico and San Diego (California) and in a hybrid loggerhead/ hawksbill turtle from Florida Bay (Florida). Tumors were confirmed as fibropapillomas on histology, although severity of disease varied between cases. Polymerase chain reaction (PCR) analyses revealed infection with the fibropapilloma-associated turtle herpesvirus (FPTHV) in all cases, albeit at highly variable copy numbers per cell. Alignment of a portion of the polymerase gene from each fibropapilloma-associated turtle herpesvirus isolate demonstrated geographic variation in sequence. These cases illustrate geographic variation in both the pathology and the virology of fibropapillomatosis.

Geographic variation in marine turtle fibropapillomatosis.

PubMed

Greenblatt, Rebecca J; Work, Thierry M; Dutton, Peter; Sutton, Claudia A; Spraker, Terry R; Casey, Rufina N; Diez, Carlos E; Parker, Denise; St Leger, Judy; Balazs, George H; Casey, James W

2005-09-01

We document three examples of fibropapillomatosis by histology, quantitative polymerase chain reaction (qPCR), and sequence analysis from three different geographic areas. Tumors compatible in morphology with fibropapillomatosis were seen in green turtles from Puerto Rico and San Diego (California) and in a hybrid loggerhead/ hawksbill turtle from Florida Bay (Florida). Tumors were confirmed as fibropapillomas on histology, although severity of disease varied between cases. Polymerase chain reaction (PCR) analyses revealed infection with the fibropapilloma-associated turtle herpesvirus (FPTHV) in all cases, albeit at highly variable copy numbers per cell. Alignment of a portion of the polymerase gene from each fibropapilloma-associated turtle herpesvirus isolate demonstrated geographic variation in sequence. These cases illustrate geographic variation in both the pathology and the virology of fibropapillomatosis.

Multiple gastrointestinal stromal tumors in type I neurofibromatosis: a pathologic and molecular study.

PubMed

Yantiss, Rhonda K; Rosenberg, Andrew E; Sarran, Lisa; Besmer, Peter; Antonescu, Cristina R

2005-04-01

Multiple gastrointestinal stromal tumors typically occur in familial form associated with KIT receptor tyrosine kinase or platelet-derived growth factor receptor-alpha (PDGFRA) germline mutations, but may also develop in the setting of type 1 neurofibromatosis. The molecular abnormalities of gastrointestinal stromal tumors arising in neurofibromatosis have not been extensively studied. We identified three patients with type 1 neuro-fibromatosis and multiple small intestinal stromal tumors. Immunostains for CD117, CD34, desmin, actins, S-100 protein, and keratins were performed on all of the tumors. DNA was extracted from representative paraffin blocks from separate tumor nodules in each case and subjected to a nested polymerase chain reaction, using primers for KIT exons 9, 11, 13, and 17 and PDGFRA exons 12 and 18, followed by direct sequencing. The mean patient age was 56 years (range: 37-86 years, male/female ratio: 2/1). One patient had three tumors, one had five, and one had greater than 10 tumor nodules, all of which demonstrated histologic features characteristic of gastrointestinal stromal tumors and stained strongly for CD117 and CD34. One patient died of disease at 35 months, one was disease free at 12 months and one was lost to follow-up. DNA extracts from 10 gastrointestinal stromal tumors (three from each of two patients and four from one patient) were subjected to polymerase chain reactions and assessed for mutations. All of the tumors were wild type for KIT exons 9, 13, and 17 and PDGFRA exons 12 and 18. Three tumors from one patient had identical point mutations in KIT exon 11, whereas the other tumors were wild type at this locus. We conclude that, although most patients with type 1 neurofibromatosis and gastrointestinal stromal tumors do not have KIT or PDGFRA mutations, KIT germline mutations might be implicated in the pathogenesis of gastrointestinal stromal tumors in some patients.

Brief ultrasonication improves detection of biofilm-formative bacteria around a metal implant.

PubMed

Kobayashi, Naomi; Bauer, Thomas W; Tuohy, Marion J; Fujishiro, Takaaki; Procop, Gary W

2007-04-01

Biofilms are complex microenvironments produced by microorganisms on surfaces. Ultrasonication disrupts biofilms and may make the microorganism or its DNA available for detection. We determined whether ultrasonication could affect our ability to detect bacteria adherent to a metal substrate. A biofilm-formative Staphylococcus aureus strain was used for an in vitro implant infection model (biofilm-formative condition). We used quantitative culture and real time-polymerase chain reaction to determine the influence of different durations of ultrasound on bacterial adherence and viability. Sonication for 1 minute increased the yield of bacteria. Sonication longer than 5 minutes led to fewer bacterial colonies by conventional culture but not by polymerase chain reaction. This suggests short periods of sonication help release bacteria from the metal substrate by disrupting the biofilm, but longer periods of sonication lyse bacteria prohibiting their detection in microbiologic cultures. A relatively short duration of sonication may be desirable for maximizing detection of biofilm-formative bacteria around implants by culture or polymerase chain reaction.

Reverse transcription-polymerase chain reaction molecular testing of cytology specimens: Pre-analytic and analytic factors.

PubMed

Bridge, Julia A

2017-01-01

The introduction of molecular testing into cytopathology laboratory practice has expanded the types of samples considered feasible for identifying genetic alterations that play an essential role in cancer diagnosis and treatment. Reverse transcription-polymerase chain reaction (RT-PCR), a sensitive and specific technical approach for amplifying a defined segment of RNA after it has been reverse-transcribed into its DNA complement, is commonly used in clinical practice for the identification of recurrent or tumor-specific fusion gene events. Real-time RT-PCR (quantitative RT-PCR), a technical variation, also permits the quantitation of products generated during each cycle of the polymerase chain reaction process. This review addresses qualitative and quantitative pre-analytic and analytic considerations of RT-PCR as they relate to various cytologic specimens. An understanding of these aspects of genetic testing is central to attaining optimal results in the face of the challenges that cytology specimens may present. Cancer Cytopathol 2017;125:11-19. © 2016 American Cancer Society. © 2016 American Cancer Society.

Variant translocation partners of the anaplastic lymphoma kinase (ALK) gene in two cases of anaplastic large cell lymphoma, identified by inverse cDNA polymerase chain reaction.

PubMed

Takeoka, Kayo; Okumura, Atsuko; Honjo, Gen; Ohno, Hitoshi

2014-01-01

In anaplastic large cell lymphoma (ALCL), the anaplastic lymphoma kinase (ALK) gene is rearranged with diverse partners due to variant translocations/inversions. Case 1 was a 39-year-old man who developed multiple tumors in the mediastinum, psoas muscle, lung, and lymph nodes. A biopsy specimen of the inguinal node was effaced by large tumor cells expressing CD30, epithelial membrane antigen, and cytoplasmic ALK, which led to a diagnosis of ALK(+) ALCL. Case 2 was a 51-year-old man who was initially diagnosed with undifferentiated carcinoma. He developed multiple skin tumors eight years after his initial presentation, and was finally diagnosed with ALK(+) ALCL. He died of therapy-related acute myeloid leukemia. G-banding and fluorescence in situ hybridization using an ALK break-apart probe revealed the rearrangement of ALK and suggested variant translocation in both cases. We applied an inverse cDNA polymerase chain reaction (PCR) strategy to identify the partner of ALK. Nucleotide sequencing of the PCR products and a database search revealed that the sequences of ATIC in case 1 and TRAF1 in case 2 appeared to follow those of ALK. We subsequently confirmed ATIC-ALK and TRAF1-ALK fusions by reverse transcriptase PCR and nucleotide sequencing. We successfully determined the partner gene of ALK in two cases of ALK(+) ALCL. ATIC is the second most common partner of variant ALK rearrangements, while the TRAF1-ALK fusion gene was first reported in 2013, and this is the second reported case of ALK(+) ALCL carrying TRAF1-ALK.

Increases in intracellular calcium via activation of potentially multiple phospholipase C isozymes in mouse olfactory neurons

PubMed Central

Szebenyi, Steven A.; Ogura, Tatsuya; Sathyanesan, Aaron; AlMatrouk, Abdullah K.; Chang, Justin; Lin, Weihong

2014-01-01

Phospholipase C (PLC) and internal Ca2+ stores are involved in a variety of cellular functions. However, our understanding of PLC in mammalian olfactory sensory neurons (OSNs) is generally limited to its controversial role in odor transduction. Here we employed single-cell Ca2+ imaging and molecular approaches to investigate PLC-mediated Ca2+ responses and its isozyme gene transcript expression. We found that the pan-PLC activator m-3M3FBS (25 μM) induces intracellular Ca2+ increases in vast majority of isolated mouse OSNs tested. Both the response amplitude and percent responding cells depend on m-3M3FBS concentrations. In contrast, the inactive analog o-3M3FBS fails to induce Ca2+ responses. The m-3M3FBS-induced Ca2+ increase is blocked by the PLC inhibitor U73122, while its inactive analog U73433 has no effect. Removal of extracellular Ca2+ does not change significantly the m-3M3FBS-induced Ca2+ response amplitude. Additionally, in the absence of external Ca2+, we found that a subset of OSNs respond to an odorant mixture with small Ca2+ increases, which are significantly suppressed by U73122. Furthermore, using reverse transcription polymerase chain reaction and real-time quantitative polymerase chain reaction, we found that multiple PLC isozyme gene transcripts are expressed in olfactory turbinate tissue in various levels. Using RNA in situ hybridization analysis, we further show expression of β4, γ1, γ2 gene transcripts in OSNs. Taken together, our results establish that PLC isozymes are potent enzymes for mobilizing intracellular Ca2+ in mouse OSNs and provide molecular insight for PLC isozymes-mediated complex cell signaling and regulation in the peripheral olfactory epithelium. PMID:25374507

Comparison of the Diagnostic Value Between Real-Time Reverse Transcription-Polymerase Chain Reaction Assay and Histopathologic Examination in Sentinel Lymph Nodes for Patients With Gastric Carcinoma.

PubMed

Kwak, Yoonjin; Nam, Soo Kyung; Shin, Eun; Ahn, Sang-Hoon; Lee, Hee Eun; Park, Do Joong; Kim, Woo Ho; Kim, Hyung-Ho; Lee, Hye Seung

2016-05-01

Sentinel lymph node (SLN)-based diagnosis in gastric cancers has shown varied sensitivities and false-negative rates in several studies. Application of the reverse transcription-polymerase chain reaction (RT-PCR) in SLN diagnosis has recently been proposed. A total of 155 SLNs from 65 patients with cT1-2, N0 gastric cancer were examined. The histopathologic results were compared with results obtained by real-time RT-PCR for detecting molecular RNA (mRNA) of cytokeratin (CK)19, carcinoembryonic antigen (CEA), and CK20. The sensitivity and specificity of the multiple marker RT-PCR assay standardized against the results of the postoperative histological examination were 0.778 (95% confidence interval [CI], 0.577-0.914) and 0.781 (95% CI, 0.700-0.850), respectively. In comparison, the sensitivity and specificity of intraoperative diagnosis were 0.819 (95% CI, 0.619-0.937) and 1.000 (95% CI, 0.972-1.000), respectively. The positive predictive value of the multiple-marker RT-PCR assay was 0.355 (95% CI, 0.192-0.546) for predicting non-SLN metastasis, which was lower than that of intraoperative diagnosis (0.813, 95% CI, 0.544-0.960). The real-time RT-PCR assay could detect SLN metastasis in gastric cancer. However, the predictive value of the real-time RT-PCR assay was lower than that of precise histopathologic examination and did not outweigh that of our intraoperative SLN diagnosis. © American Society for Clinical Pathology, 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Mitochondrial RNA polymerase is an essential enzyme in erythrocytic stages of Plasmodium falciparum.

PubMed

Ke, Hangjun; Morrisey, Joanne M; Ganesan, Suresh M; Mather, Michael W; Vaidya, Akhil B

2012-09-01

We have shown that transgenic Plasmodium falciparum parasites expressing the yeast DHODH (dihydroorotate dehydrogenase) are independent of the mtETC (mitochondrial electron transport chain), suggesting that they might not need the mitochondrial genome (mtDNA), since it only encodes three protein subunits belonging to the mtETC and fragmentary ribosomal RNA molecules. Disrupting the mitochondrial RNA polymerase (mtRNAP), which is critical for mtDNA replication and transcription, might then cause the generation of a ρ(0) parasite line lacking mtDNA. We made multiple attempts to disrupt the mtRNAP gene by double crossover recombination methods in parasite lines expressing yDHODH either episomally or integrated in the genome, but were unable to produce the desired knockout. We verified that the mtRNAP gene was accessible to recombination by successfully integrating a triple HA tag at the 3' end via single cross-over recombination. These studies suggest that mtRNAP is essential even in mtETC-independent P. falciparum parasites. Copyright © 2012 Elsevier B.V. All rights reserved.

A rapid isothermal assay for the detection of Hop stunt viroid in hop plants (Humulus lupulus), and its application in disease surveys.

PubMed

Kappagantu, Madhu; Villamor, Dan Edward V; Bullock, Jeff M; Eastwell, Kenneth C

2017-07-01

Hop stunt disease caused by Hop stunt viroid (HSVd) is a growing threat to hop cultivation globally. HSVd spreads mainly by use of contaminated planting material and by mechanical means. Thorough testing of hop yards and removal of infected bines are critical components of efforts to control the spread of the disease. Reverse transcription-polymerase chain reaction (RT-PCR) has become the primary technique used for HSVd detection; however, sample handling and analysis are technically challenging. In this study, a robust reverse transcription-recombinase polymerase amplification (RT-RPA) assay was developed to facilitate analysis of multiple samples. The assay was optimized with all major variants of HSVd from other host species in addition to hop variants. Used in conjunction with sample collection cards, RT-RPA accommodates large sample numbers. Greenhouse and farm samples tested with RT-RPA were also tested with RT-PCR and a 100% correlation between the two techniques was found. Copyright © 2017. Published by Elsevier B.V.

Inhibiting poly(ADP-ribose) polymerase: a potential therapy against oligodendrocyte death

PubMed Central

Veto, Sara; Acs, Peter; Bauer, Jan; Lassmann, Hans; Berente, Zoltan; Setalo, Gyorgy; Borgulya, Gabor; Sumegi, Balazs; Komoly, Samuel; Gallyas, Ferenc; Illes, Zsolt

2010-01-01

Oligodendrocyte loss and demyelination are major pathological hallmarks of multiple sclerosis. In pattern III lesions, inflammation is minor in the early stages, and oligodendrocyte apoptosis prevails, which appears to be mediated at least in part through mitochondrial injury. Here, we demonstrate poly(ADP-ribose) polymerase activation and apoptosis inducing factor nuclear translocation within apoptotic oligodendrocytes in such multiple sclerosis lesions. The same morphological and molecular pathology was observed in an experimental model of primary demyelination, induced by the mitochondrial toxin cuprizone. Inhibition of poly(ADP-ribose) polymerase in this model attenuated oligodendrocyte depletion and decreased demyelination. Poly(ADP-ribose) polymerase inhibition suppressed c-Jun N-terminal kinase and p38 mitogen-activated protein kinase phosphorylation, increased the activation of the cytoprotective phosphatidylinositol-3 kinase-Akt pathway and prevented caspase-independent apoptosis inducing factor-mediated apoptosis. Our data indicate that poly(ADP-ribose) polymerase activation plays a crucial role in the pathogenesis of pattern III multiple sclerosis lesions. Since poly(ADP-ribose) polymerase inhibition was also effective in the inflammatory model of multiple sclerosis, it may target all subtypes of multiple sclerosis, either by preventing oligodendrocyte death or attenuating inflammation. PMID:20157013

Detection of Borrelia lusitaniae, Rickettsia sp. IRS3, Rickettsia monacensis, and Anaplasma phagocytophilum in Ixodes ricinus collected in Madeira Island, Portugal.

PubMed

de Carvalho, Isabel Lopes; Milhano, Natacha; Santos, Ana Sofia; Almeida, Victor; Barros, Silvia C; De Sousa, Rita; Núncio, Maria Sofia

2008-08-01

A total of 300 Ixodes ricinus ticks were tested by polymerase chain reaction (PCR) for the presence of Borrelia spp., Rickettsia spp., and Anaplasma phagocytophilum. Sequence analysis demonstrated 8 (2.7%) ticks infected with B. lusitaniae, 60 (20%) with Rickettsia spp., and 1 (0.3%) with A. phagocytophilum. Seven (2.3%) ticks were coinfected with B. lusitaniae and Rickettsia spp., 2 (0.6%) with R. monacensis, and 5 (1.7%) with Rickettsia sp. IRS3. The results of this study suggest simultaneous transmission of multiple tick-borne agents on Madeira Island, Portugal.

Mycobacteriosis in a domestic ferret (Mustela putorius furo).

PubMed

Nakata, Makoto; Miwa, Yasutsugu; Tsuboi, Masaya; Uchida, Kazuyuki

2014-05-01

A 4-year-old spayed female ferret presented with a 2-month history of anorexia, vomiting and occasional diarrhea. Abdominal ultrasonography revealed thickening of the gastric wall and enlarged abdominal lymph nodes. Biopsy samples from the thickened gastric wall, enlarged abdominal lymph nodes and liver were taken during an exploratory laparotomy. Based on the histopathological examination, mycobacterium infection was diagnosed. The bacterial species could not be identified by additional diagnostic tests of feces, including fecal smear, culture and polymerase chain reaction (PCR). The ferret was treated with prednisolone and multiple antimicrobials, including rifampicin, azithromycin and enrofloxacin, but did not improve with treatment and died 220 days after the first presentation.

Skewed X-inactivation in a tumor tissue from a female patient with leiomyomatosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kishino, T.; Jinno, Y.; Niikawa, N.

1995-07-17

Leiomyomatosis (multiple leiomyomas) is characterized by benign smooth muscle cell proliferations in the esophagus, tracheobronchial tree, and female genital tract. At least 3 genetically different hereditary leiomyomatoses have been identified. Among them, an X-linked leiomyomatosis is often associated with an Alport syndrome-like nephropathy. It has remained obscure whether the leiomyomata occur monoclonally or polyclonally. The clonality of various malignancies has been examined by analysis of X-inactivation patterns in female patients heterozygous for polymorphic alleles of X-linked genes. We examined the clonality of a leiomyoma in a female patient by a polymerase chain reaction (PCR)-based X-inactivation assay. 6 refs., 1 fig.

[Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].

PubMed

Harano, K; Harano, T; Kushida, Y; Ueda, S

1991-08-01

Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.

Screening for diverse PDGFRA or PDGFRB fusion genes is facilitated by generic quantitative reverse transcriptase polymerase chain reaction analysis

PubMed Central

Erben, Philipp; Gosenca, Darko; Müller, Martin C.; Reinhard, Jelena; Score, Joannah; del Valle, Francesco; Walz, Christoph; Mix, Jürgen; Metzgeroth, Georgia; Ernst, Thomas; Haferlach, Claudia; Cross, Nicholas C.P.; Hochhaus, Andreas; Reiter, Andreas

2010-01-01

Background Rapid identification of diverse fusion genes with involvement of PDGFRA or PDGFRB in eosinophilia-associated myeloproliferative neoplasms is essential for adequate clinical management but is complicated by the multitude and heterogeneity of partner genes and breakpoints. Design and Methods We established a generic quantitative reverse transcriptase polymerase chain reaction to detect overexpression of the 3′-regions of PDGFRA or PDGFRB as a possible indicator of an underlying fusion. Results At diagnosis, all patients with known fusion genes involving PDGFRA (n=5; 51 patients) or PDGFRB (n=5; 7 patients) showed significantly increased normalized expression levels compared to 191 patients with fusion gene-negative eosinophilia or healthy individuals (PDGFRA/ABL: 0.73 versus 0.0066 versus 0.0064, P<0.0001; PDGFRB/ABL: 196 versus 3.8 versus 5.85, P<0.0001). The sensitivity and specificity of the activation screening test were, respectively, 100% and 88.4% for PDGFRA and 100% and 94% for PDGFRB. Furthermore, significant overexpression of PDGFRB was found in a patient with an eosinophilia-associated myeloproliferative neoplasm with uninformative cytogenetics and an excellent response to imatinib. Subsequently, a new SART3-PDGFRB fusion gene was identified by 5′-rapid amplification of cDNA ends polymerase chain reaction (5′-RACE-PCR). Conclusions Quantitative reverse transcriptase polymerase chain reaction analysis is a simple and useful adjunct to standard diagnostic assays to detect clinically significant overexpression of PDGFRA and PDGFRB in eosinophilia-associated myeloproliferative neoplasms or related disorders. PMID:20107158

A sensitive detection method for MPLW515L or MPLW515K mutation in chronic myeloproliferative disorders with locked nucleic acid-modified probes and real-time polymerase chain reaction.

PubMed

Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M

2008-09-01

Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy.

Microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse-transcription polymerase chain reaction for the rapid detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens.

PubMed

Jia, Ruan; Chengjun, Sun; Heng, Chen; Chen, Zhou; Yuanqian, Li; Yongxin, Li

2015-07-01

Enterovirus 71 and Coxsackievirus A16 are the main pathogens causing hand-foot-mouth disease. In this paper, microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse transcript-polymerase chain reaction has been developed for the detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens. The specific reverse transcription-polymerase chain reaction amplicons labeled with SYBR Orange were separated by microchip capillary electrophoresis and detected by laser induced fluorescence detector within 7 min. The intraday and interday relative standard deviation of migration time for DNA Marker was in the range of 1.36-2.94 and 2.78-3.96%, respectively. The detection limits were as low as 2.06 × 10(3) copies/mL for Enterovirus 71 and 5 × 10(3) copies/mL for Coxsackievirus A16. No cross-reactivity was observed with rotavirus, astrovirus, norovirus, and adenovirus, which showed good specificity of the method. This assay was validated using 100 throat swab specimens that were detected by real-time reverse-transcript polymerase chain reaction in parallel and the two methods produced the same results. This study provided a rapid, sensitive and specific method for the detection of Enterovirus 71 and Coxsackievirus A16, which make a contribution to significant time and cost saving for the identification and treatment of patients. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Slow Joining of Newly Replicated DNA Chains in DNA Polymerase I-Deficient Escherichia coli Mutants*

PubMed Central

Okazaki, Reiji; Arisawa, Mikio; Sugino, Akio

1971-01-01

In Escherichia coli mutants deficient in DNA polymerase I, newly replicated short DNA is joined at about 10% of the rate in the wild-type strains. It is postulated that DNA polymerase I normally functions in filling gaps between the nascent short segments synthesized by the replication complex. Possible implications of the finding are discussed in relation to other abnormal properties of these mutants. PMID:4943548

Molecular diagnostics of periodontitis.

PubMed

Korona-Głowniak, Izabela; Siwiec, Radosław; Berger, Marcin; Malm, Anna; Szymańska, Jolanta

2017-01-28

The microorganisms that form dental plaque are the main cause of periodontitis. Their identification and the understanding of the complex relationships and interactions that involve these microorganisms, environmental factors and the host's health status enable improvement in diagnostics and targeted therapy in patients with periodontitis. To this end, molecular diagnostics techniques (both techniques based on the polymerase chain reaction and those involving nucleic acid analysis via hybridization) come increasingly into use. On the basis of a literature review, the following methods are presented: polymerase chain reaction (PCR), real-time polymerase chain reaction (real-time PCR), 16S rRNA-encoding gene sequencing, checkerboard and reverse-capture checkerboard hybridization, microarrays, denaturing gradient gel electrophoresis (DGGE), temperature gradient gel electrophoresis (TGGE), as well as terminal restriction fragment length polymorphism (TRFLP) and next generation sequencing (NGS). The advantages and drawbacks of each method in the examination of periopathogens are indicated. The techniques listed above allow fast detection of even small quantities of pathogen present in diagnostic material and prove particularly useful to detect microorganisms that are difficult or impossible to grow in a laboratory.

Expression and mutational analysis of Cip/Kip family in early glottic cancer.

PubMed

Kim, D-K; Lee, J H; Lee, O J; Park, C H

2015-02-01

Genetic alteration of cyclin-dependent kinase inhibitors has been associated with carcinogenesis mechanisms in various organs. This study aimed to evaluate the expression and mutational analysis of Cip/Kip family cyclin-dependent kinase inhibitors (p21CIP1/WAF1, p27KIP1 and p57KIP2) in early glottic cancer. Expressions of Cip/Kip family and p53 were determined by quantitative reverse transcription polymerase chain reaction and densitometry. For the analysis of p21 inactivation, sequence alteration was assessed using single-strand conformational polymorphism polymerase chain reaction. Additionally, the inactivation mechanism of p27 and p57 were investigated using DNA methylation analysis. Reduced expression of p27 and p57 were detected in all samples, whereas the expression of p21 was incompletely down-regulated in 6 of 11 samples. Additionally, single-strand conformational polymorphism polymerase chain reaction analysis showed the p53 mutation at exon 6. Methylation of p27 and p57 was detected by DNA methylation assay. Our results suggest that the Cip/Kip family may have a role as a molecular mechanism of carcinogenesis in early glottic cancer.

Direct and quantitative detection of HIV-1 RNA in human plasma with a branched DNA signal amplification assay.

PubMed

Urdea, M S; Wilber, J C; Yeghiazarian, T; Todd, J A; Kern, D G; Fong, S J; Besemer, D; Hoo, B; Sheridan, P J; Kokka, R

1993-11-01

To determine the relative effect of sample matrix on the quantitation of HIV RNA in plasma. Two HIV-positive specimens were diluted into five and 10 different HIV-negative plasma samples, respectively. Branched DNA signal amplification technology and reverse-transcriptase polymerase chain reaction were used to measure the viral load. In one sample the viral load by polymerase chain reaction ranged from undetectable to 1.9 x 10(5) copies/ml, and the branched DNA results ranged from 2.6 x 10(4) to 4.2 x 10(4) HIV RNA equivalent/ml. In the other sample the corresponding figures were 6.3 x 10(4) to 5.5 x 10(5) copies/ml and 5.7 x 10(4) to 7.5 x 10(4) HIV RNA equivalents/ml. In contrast to reverse-transcriptase polymerase chain reaction the branched DNA signal amplification assay does not require a separate extraction step or enzymatic amplification of the target. Therefore this measurement is less affected by the sample matrix and the signal generated is directly proportional to the viral load.

Generation of non-genomic oligonucleotide tag sequences for RNA template-specific PCR

PubMed Central

Pinto, Fernando Lopes; Svensson, Håkan; Lindblad, Peter

2006-01-01

Background In order to overcome genomic DNA contamination in transcriptional studies, reverse template-specific polymerase chain reaction, a modification of reverse transcriptase polymerase chain reaction, is used. The possibility of using tags whose sequences are not found in the genome further improves reverse specific polymerase chain reaction experiments. Given the absence of software available to produce genome suitable tags, a simple tool to fulfill such need was developed. Results The program was developed in Perl, with separate use of the basic local alignment search tool, making the tool platform independent (known to run on Windows XP and Linux). In order to test the performance of the generated tags, several molecular experiments were performed. The results show that Tagenerator is capable of generating tags with good priming properties, which will deliberately not result in PCR amplification of genomic DNA. Conclusion The program Tagenerator is capable of generating tag sequences that combine genome absence with good priming properties for RT-PCR based experiments, circumventing the effects of genomic DNA contamination in an RNA sample. PMID:16820068

Identification of carriers among individuals recruited in the typhoid registry in Malaysia using stool culture, polymerase chain reaction, and dot enzyme immunoassay as detection tools.

PubMed

Chua, Ang Lim; Aziah, Ismail; Balaram, Prabha; Bhuvanendran, Saatheeyavaane; Anthony, Amy Amilda; Mohmad, Siti Norazura; Nasir, Norhafiza M; Hassan, Haslizai; Naim, Rochman; Meran, Lila P; Hussin, Hani M; Ismail, Asma

2015-03-01

Chronic carriers of Salmonella Typhi act as reservoirs for the organism and become the agents of typhoid outbreaks in a community. In this study, chronic carriers in Kelantan, Malaysia were first identified using the culture and polymerase chain reaction method. Then, a novel serological tool, designated Typhidot-C, was evaluated in retrospect using the detected individuals as control positives. Chronic carriage positive by the culture and polymerase chain reaction method was recorded at 3.6% (4 out of 110) among individuals who previously had acute typhoid fever and a 9.4% (10 out of 106) carriage rate was observed among food handlers screened during outbreaks. The Typhidot-C assay was able to detect all these positive carriers showing its potential as a viable carrier screening tool and can be used for efficient detection of typhoid carriers in an endemic area. These findings were used to establish the first carrier registry for S Typhi carriers in Malaysia. © 2012 APJPH.

T-cell receptor V sub. alpha. and C sub. alpha. alleles associated with multiple sclerosis and myasthenia gravis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oksenberg, J.R.; Cavalli-Sforza, L.L.; Steinman, L.

1989-02-01

Polymorphic markers in genes encoding the {alpha} chain of the human T-cell receptor (TcR) have been detected by Southern blot analysis in Pss I digests. Polymorphic bands were observed at 6.3 and 2.0 kilobases (kb) with frequencies of 0.30 and 0.44, respectively, in the general population. Using the polymerase chain reaction (PCR) method, the authors amplified selected sequences derived from the full-length TcR {alpha} cDNA probe. These PcR products were used as specific probes to demonstrate that the 6.3-kb polymorphic fragment hybridizes to the variable (V)-region probe and the 2.0-kb fragment hybridizes to the constant (C)-region probe. Segregation of themore » polymorphic bands was analyzed in family studies. To look for associations between these markers and autoimmune diseases, the authors have studied the restriction fragment length polymorphism distribution of the Pss I markers in patients with multiple sclerosis, myasthenia gravis, and Graves disease. Significant differences in the frequency of the polymorphic V{sub {alpha}} and C{sub {alpha}} markers were identified between patients and healthy individuals.« less

Cutaneous lymphomatoid granulomatosis: correlation of clinical and biologic features.

PubMed

Beaty, M W; Toro, J; Sorbara, L; Stern, J B; Pittaluga, S; Raffeld, M; Wilson, W H; Jaffe, E S

2001-09-01

Lymphomatoid granulomatosis (LYG) is a rare angiocentric and angiodestructive Epstein-Barr virus-associated B-cell lymphoproliferative disorder (EBV-BLPD), varying widely from an indolent process to an aggressive large cell lymphoma. The skin is the extrapulmonary organ most commonly involved in LYG. We studied 32 skin lesions from 20 patients with known pulmonary LYG, using immunohistochemistry, in situ hybridization for EBV, and polymerase chain reaction for the presence of antigen receptor gene rearrangements (IgH and TCR) to better define both the clinicopathologic spectrum and pathogenesis of the cutaneous lesions. We describe two distinct patterns of cutaneous involvement. Multiple erythematous dermal papules and/or subcutaneous nodules, with or without ulceration, were present in 17 patients (85%). These lesions demonstrate a marked angiocentric lymphohistiocytic infiltrate, composed predominantly of CD4-positive T-cells, with a high propensity for involving the subcutaneous tissues, and exhibiting angiodestruction, necrosis, and cytologic atypia. EBV-positive B-cells were detected in the nodules from five patients; clonal immunoglobulin heavy chain gene (IgH) rearrangements were detected by polymerase chain reaction in two patients. Multiple indurated, erythematous to white plaques were present in three patients (15%). The plaque lesions were negative for EBV and clonal IgH gene rearrangements in all cases studied. The clinical course of overall disease was variable, ranging from spontaneous regression without treatment (1 of 13; 7%), resolution with chemo/immunomodulatory therapy (8 of 13; 62%), and progression (4 of 13; 31%). The clinical and histopathologic features of cutaneous LYG are extremely diverse. However, the majority (85%) of the cutaneous lesions mirrors to some extent LYG in the lung, although EBV+ cells are less frequently identified. This subset of cases shows the histopathologic triad of angiodestruction with associated necrosis, panniculitis, and in some cases atypical lymphoid cells. The commonality of the histologic features in this group suggests a common pathophysiologic basis, possibly mediated by cytokines and chemokines induced by EBV. A small percentage of the lesions (15%) presented as indurated and atrophic plaques, and EBV was not identified in the small number of cases studied. The relationship of the plaque-like lesions to LYG remains uncertain. Whereas some cases of LYG regress spontaneously, most require therapy.

Bi-parentally inherited species-specific markers identify hybridization between rainbow trout and cutthroat trout subspecies

USGS Publications Warehouse

Ostberg, C.O.; Rodriguez, R.J.

2004-01-01

Eight polymerase chain reaction primer sets amplifying bi-parentally inherited species-specific markers were developed that differentiate between rainbow trout (Oncorhynchus mykiss) and various cutthroat trout (O. clarki) subspecies. The primers were tested within known F1 and first generation hybrid backcrosses and were shown to amplify codominantly within hybrids. Heterozygous individuals also amplified a slower migrating band that was a heteroduplex, caused by the annealing of polymerase chain reaction products from both species. These primer sets have numerous advantages for native cutthroat trout conservation including statistical genetic analyses of known crosses and simple hybrid identification.

Flow-through polymerase chain reaction inside a seamless 3D helical microreactor fabricated utilizing a silicone tube and a paraffin mold.

PubMed

Wu, Wenming; Trinh, Kieu The Loan; Lee, Nae Yoon

2015-03-07

We introduce a new strategy for fabricating a seamless three-dimensional (3D) helical microreactor utilizing a silicone tube and a paraffin mold. With this method, various shapes and sizes of 3D helical microreactors were fabricated, and a complicated and laborious photolithographic process, or 3D printing, was eliminated. With dramatically enhanced portability at a significantly reduced fabrication cost, such a device can be considered to be the simplest microreactor, developed to date, for performing the flow-through polymerase chain reaction (PCR).

Polymer-based microfluidic chips for isothermal amplification of nucleic acids

NASA Astrophysics Data System (ADS)

Posmitnaya, Y. S.; Rudnitskaya, G. E.; Tupik, A. N.; Lukashenko, T. A.; Bukatin, A. C.; Evstrapov, A. A.

2017-11-01

Creation of low-cost compact devices based on microfluidic platforms for biological and medical research depends on the degree of development and enhancement of prototyping technologies. Two designs of polymer and hybrid microfluidic devices fabricated by soft lithography and intended for isothermal amplification and polymerase chain reaction are presented in this paper. The digital helicase-dependent isothermal amplification was tested in the device containing a droplet generator. Polymerase chain reaction was carried out in the hybrid microfluidic device having ten reaction chambers. A synthesized cDNA fragment of GAPDH housekeeping gene was used as a target.

[Identification of human pathogenic variola and monkeypox viruses by real-time polymerase chain reaction].

PubMed

Kostina, E V; Gavrilova, E V; Riabinin, V A; Shchelkunov, S N; Siniakov, A N

2009-01-01

A kit of specific oligonucleotide primers and hybridization probes has been proposed to detect orthopoxviruses (OPV) and to discriminate human pathogenic viruses, such as variola virus and monkey virus by real-time polymerase chain reaction (PCR). For real-time PCR, the following pairs of fluorophore and a fluorescence quencher were used: TAMRA-BHQ2 for genus-specific probes and FAM-BHQ1 for species-specific ones (variola virus, monkeypox virus, ectomelia virus). The specificity of this assay was tested on 38 strains of 6 OPV species and it was 100%.

Identification of Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss) by using polymerase chain reaction amplification and restriction analysis of the mitochondrial cytochrome b gene.

PubMed

Carrera, E; García, T; Céspedes, A; González, I; Sanz, B; Hernández, P E; Martín, R

1998-04-01

Restriction site analysis of polymerase chain reaction (PCR) products from a conserved region of the cytochrome b gene has been used for the identification of fresh and smoked samples of Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss). Digestion of the 359-bp PCR product with the endonucleases EcoRV and TaqI yielded specific banding patterns for salmon and trout. This genetic marker can be very useful for detecting fraudulent substitution of the cheaper smoked trout for the more expensive smoked salmon.

Polymerase chain reaction with phase change as intrinsic thermal control

NASA Astrophysics Data System (ADS)

Hsieh, Yi-Fan; Yonezawa, Eri; Kuo, Long-Sheng; Yeh, Shiou-Hwei; Chen, Pei-Jer; Chen, Ping-Hei

2013-04-01

This research demonstrated that without any external temperature controller, the capillary convective polymerase chain reaction (ccPCR) powered by a candle can operate with the help of phase change. The candle ccPCR system productively amplified hepatitis B virus 122 base-pairs DNA fragment. The detection sensitivity can achieve at an initial DNA concentration to 5 copies per reaction. The results also show that the candle ccPCR system can operate functionally even the ambient temperature varies from 7 °C to 45 °C. These features imply that the candle ccPCR system can provide robust medical detection services.

Building block synthesis using the polymerase chain assembly method.

PubMed

Marchand, Julie A; Peccoud, Jean

2012-01-01

De novo gene synthesis allows the creation of custom DNA molecules without the typical constraints of traditional cloning assembly: scars, restriction site incompatibility, and the quest to find all the desired parts to name a few. Moreover, with the help of computer-assisted design, the perfect DNA molecule can be created along with its matching sequence ready to download. The challenge is to build the physical DNA molecules that have been designed with the software. Although there are several DNA assembly methods, this section presents and describes a method using the polymerase chain assembly (PCA).

[Establishment of multiple regression model for virulence factors of Saccharomyces albicans by random amplified polymorphic DNA bands].

PubMed

Liu, Qi; Wu, Youcong; Yuan, Youhua; Bai, Li; Niu, Kun

2011-12-01

To research the relationship between the virulence factors of Saccharomyces albicans (S. albicans) and the random amplified polymorphic DNA (RAPD) bands of them, and establish the regression model by multiple regression analysis. Extracellular phospholipase, secreted proteinase, ability to generate germ tubes and adhere to oral mucosal cells of 92 strains of S. albicans were measured in vitro; RAPD-polymerase chain reaction (RAPD-PCR) was used to get their bands. Multiple regression for virulence factors of S. albicans and RAPD-PCR bands was established. The extracellular phospholipase activity was associated with 4 RAPD bands: 350, 450, 650 and 1 300 bp (P < 0.05); secreted proteinase activity of S. albicans was associated with 2 bands: 350 and 1 200 bp (P < 0.05); the ability of germ tube produce was associated with 2 bands: 400 and 550 bp (P < 0.05). Some RAPD bands will reflect the virulence factors of S. albicans indirectly. These bands would contain some important messages for regulation of S. albicans virulence factors.

Chitosan multiple addition enhances laccase production from Trametes versicolor.

PubMed

Adekunle, Abiodun Emmanuel; Wang, Feng; Hu, Jianhua; Ma, Anzhou; Guo, Chen; Zhuang, Guoqiang; Liu, Chun-Zhao

2015-10-01

Chitosan multiple addition strategy was developed to improve laccase production from Trametes versicolor cultures. The optimized multiple addition strategy was carried out by two-time addition of 0.1 g L(-1) chitosan to a 2-day-old culture media, with 24-h interval between the treatments. Under these conditions, laccase activity of 644.9 U l(-1) was achieved on the seventh day and laccase production was improved by 93.5 % higher than the control. Chitosan treatment increased reactive oxygen species generation and extracellular protein concentration in the treated mycelia. In contrast, the inducer inhibited the mycelia growth. The result of the quantitative reverse transcription polymerase chain reaction showed that the copy number of the laccase gene transcript increased by 16.7-fold in the treated mycelia relative to the control. This study provides insight into some of the intrinsic metabolic processes involved in the upregulation of laccase production in the presence of chitosan inducer in fungal culture.

Evaluation of immunomagnetic separation for the detection of Salmonella in surface waters by polymerase chain reaction.

PubMed

Hsu, Chao-Yu; Hsu, Bing-Mu; Chang, Tien-Yu; Hsu, Tsui-Kang; Shen, Shu-Min; Chiu, Yi-Chou; Wang, Hung-Jen; Ji, Wen-Tsai; Fan, Cheng-Wei; Chen, Jyh-Larng

2014-09-19

Salmonella spp. is associated with fecal pollution and capable of surviving for long periods in aquatic environments. Instead of the traditional, time-consuming biochemical detection, polymerase chain reaction (PCR) allows rapid identification of Salmonella directly concentrated from water samples. However, prevalence of Salmonella may be underestimated because of the vulnerability of PCR to various environmental chemicals like humic acid, compounded by the fact that various DNA polymerases have different susceptibility to humic acid. Because immunomagnetic separation (IMS) theoretically could isolate Salmonella from other microbes and facilitate removal of aquatic PCR inhibitors of different sizes, this study aims to compare the efficiency of conventional PCR combined with immunomagnetic separation (IMS) for Salmonella detection within a moderately polluted watershed. In our study, the positive rate was increased from 17.6% to 47% with nearly ten-fold improvement in the detection limit. These results suggest the sensitivity of Salmonella detection could be enhanced by IMS, particularly in low quality surface waters. Due to its effects on clearance of aquatic pollutants, IMS may be suitable for most DNA polymerases for Salmonella detection.

Identification of fragile X pre-mutation carriers in the Chinese obstetric population using a robust FMR1 polymerase chain reaction assay: implications for screening and prenatal diagnosis.

PubMed

Cheng, Y Ky; Lin, C Sw; Kwok, Y Ky; Chan, Y M; Lau, T K; Leung, T Y; Choy, K W

2017-04-01

There is significant morbidity associated with fragile X syndrome. Unfortunately, most maternal carriers are clinically silent during their reproductive years. Because of this, many experts have put forward the notion of preconception or prenatal fragile X carrier screening for females. This study aimed to determine the prevalence of fragile X syndrome pre-mutation and asymptomatic full-mutation carriers in a Chinese pregnant population, and the distribution of cytosine-guanine-guanine (CGG) repeat numbers using a robust fragile X mental retardation 1 (FMR1) polymerase chain reaction assay. This was a cross-sectional survey in prospectively recruited pregnant women from a university hospital in Hong Kong. Chinese pregnant women without a family history of fragile X syndrome were recruited between April 2013 and May 2015. A specific FMR1 polymerase chain reaction assay was performed on peripheral blood to determine the CGG repeat number of the FMR1 gene. Prenatal counselling was offered to full-mutation and pre-mutation carriers. In 2650 Chinese pregnant women, two individuals with pre-mutation alleles (0.08%, one in 1325) and one asymptomatic woman with full-mutation (0.04%, one in 2650) alleles were identified. The overall prevalence of pre-mutation and full-mutation alleles was 0.11% (1 in 883). Furthermore, 30 (1.1%) individuals with intermediate alleles were detected. In the 2617 women with normal CGG repeats, the most common CGG repeat allele was 30. The overall prevalence of pre-mutation and asymptomatic full-mutation carriers in the Chinese pregnant population was one in 883, detected by a new FMR1 polymerase chain reaction assay.

A Sensitive Detection Method for MPLW515L or MPLW515K Mutation in Chronic Myeloproliferative Disorders with Locked Nucleic Acid-Modified Probes and Real-Time Polymerase Chain Reaction

PubMed Central

Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M.

2008-01-01

Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy. PMID:18669880

No evidence of persisting measles virus in peripheral blood mononuclear cells from children with autism spectrum disorder.

PubMed

D'Souza, Yasmin; Fombonne, Eric; Ward, Brian J

2006-10-01

Despite epidemiologic evidence to the contrary, claims of an association between measles-mumps-rubella vaccination and the development of autism have persisted. Such claims are based primarily on the identification of measles virus nucleic acids in tissues and body fluids by polymerase chain reaction. We sought to determine whether measles virus nucleic acids persist in children with autism spectrum disorder compared with control children. Peripheral blood mononuclear cells were isolated from 54 children with autism spectrum disorder and 34 developmentally normal children, and up to 4 real-time polymerase chain reaction assays and 2 nested polymerase chain reaction assays were performed. These assays targeted the nucleoprotein, fusion, and hemagglutinin genes of measles virus using previously published primer pairs with detection by SYBR green I. Our own real-time assay targeted the fusion gene using novel primers and an internal fluorescent probe. Positive reactions were evaluated rigorously, and amplicons were sequenced. Finally, anti-measles antibody titers were measured by enzyme immunoassay. The real-time assays based on previously published primers gave rise to a large number of positive reactions in both autism spectrum disorder and control samples. Almost all of the positive reactions in these assays were eliminated by evaluation of melting curves and amplicon band size. The amplicons for the remaining positive reactions were cloned and sequenced. No sample from either autism spectrum disorder or control groups was found to contain nucleic acids from any measles virus gene. In the nested polymerase chain reaction and in-house assays, none of the samples yielded positive results. Furthermore, there was no difference in anti-measles antibody titers between the autism and control groups. There is no evidence of measles virus persistence in the peripheral blood mononuclear cells of children with autism spectrum disorder.

tRNAHis guanylyltransferase catalyzes a 3'-5' polymerization reaction that is distinct from G-1 addition.

PubMed

Jackman, Jane E; Phizicky, Eric M

2006-06-06

Yeast tRNA(His) guanylyltransferase, Thg1, is an essential protein that adds a single guanine to the 5' end (G(-1)) of tRNA(His). This G(-1) residue is required for aminoacylation of tRNA(His) by histidyl-tRNA synthetase, both in vitro and in vivo. The guanine nucleotide addition reaction catalyzed by Thg1 extends the polynucleotide chain in the reverse (3'-5') direction of other known polymerases, albeit by one nucleotide. Here, we show that alteration of the 3' end of the Thg1 substrate tRNA(His) unleashes an unexpected reverse polymerase activity of wild-type Thg1, resulting in the 3'-5' addition of multiple nucleotides to the tRNA, with efficiency comparable to the G(-1) addition reaction. The addition of G(-1) forms a mismatched G.A base pair at the 5' end of tRNA(His), and, with monophosphorylated tRNA substrates, it is absolutely specific for tRNA(His). By contrast, reverse polymerization forms multiple G.C or C.G base pairs, and, with preactivated tRNA species, it can initiate at positions other than -1 and is not specific for tRNA(His). Thus, wild-type Thg1 catalyzes a templated polymerization reaction acting in the reverse direction of that of canonical DNA and RNA polymerases. Surprisingly, Thg1 can also readily use dNTPs for nucleotide addition. These results suggest that 3'-5' polymerization represents either an uncharacterized role for Thg1 in RNA or DNA repair or metabolism, or it may be a remnant of an earlier catalytic strategy used in nature.

Flightless I (Drosophila) homolog facilitates chromatin accessibility of the estrogen receptor α target genes in MCF-7 breast cancer cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jeong, Kwang Won, E-mail: kwjeong@gachon.ac.kr

2014-04-04

Highlights: • H3K4me3 and Pol II binding at TFF1 promoter were reduced in FLII-depleted MCF-7 cells. • FLII is required for chromatin accessibility of the enhancer of ERalpha target genes. • Depletion of FLII causes inhibition of proliferation of MCF-7 cells. - Abstract: The coordinated activities of multiple protein complexes are essential to the remodeling of chromatin structure and for the recruitment of RNA polymerase II (Pol II) to the promoter in order to facilitate the initiation of transcription in nuclear receptor-mediated gene expression. Flightless I (Drosophila) homolog (FLII), a nuclear receptor coactivator, is associated with the SWI/SNF-chromatin remodeling complexmore » during estrogen receptor (ER)α-mediated transcription. However, the function of FLII in estrogen-induced chromatin opening has not been fully explored. Here, we show that FLII plays a critical role in establishing active histone modification marks and generating the open chromatin structure of ERα target genes. We observed that the enhancer regions of ERα target genes are heavily occupied by FLII, and histone H3K4me3 and Pol II binding induced by estrogen are decreased in FLII-depleted MCF-7 cells. Furthermore, formaldehyde-assisted isolation of regulatory elements (FAIRE)-quantitative polymerase chain reaction (qPCR) experiments showed that depletion of FLII resulted in reduced chromatin accessibility of multiple ERα target genes. These data suggest FLII as a key regulator of ERα-mediated transcription through its role in regulating chromatin accessibility for the binding of RNA Polymerase II and possibly other transcriptional coactivators.« less

Female pseudohermaphroditism with multiple caudal anomalies: Absence of Y-specific DNA sequences as pathogenetic factors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Seaver, L.H.; Grimes, J.; Erickson, R.P.

1994-05-15

46,XX female pseudohermaphrodites have been previously described with nearly complete masculinization of the external genitalia and no apparent source of testosterone. Multiple malformations of internal genital, urinary, and gastrointestinal tracts are associated. We have evaluated four such infants with female pseudohermaphroditism and multiple caudal anomalies. Three cases had apparently normal chromosome (46,XX); one had a 46,XX,del(10)(q25.3{yields}qter) chromosome constitution. The chromosome breakpoint is in the region of PAX2, a developmentally important paired box gene which is expressed in urogenital tissue. Using the polymerase chain reaction, we screened for the presence of multiple Y specific sequences, including SRY (sex determining region, Ymore » chromosome), that could explain masculinization of the external genitalia. All were negative for Y centromeric sequences, ZFY (Zinc finger Y), and SRY. Furthermore, there was no evidence for adrenal or other sources of testosterone. We suggest that the masculinization in these cases is the result of abnormal expression of genes which would normally be regulated by testosterone. 32 refs., 1 fig., 2 tabs.« less

[The detection and sequence analysis of the simian T-lymphotrophic retrovirus (STLV-1 Papio) by using the polymerase chain reaction].

PubMed

D'iachenko, A G; Dzhalagoniia, B E; Kapanadze, B I

1993-01-01

The gene amplification technique was used for detection and sequence analysis of STLV-1 Papio proviral DNA. The polymerase chain reaction was performed with a primer pair at tax region of HTLV-1, 7336-7354, sense strand, and 7516-7494, antisense strand. One microgram of DNAs isolated from LUG-4 cells and autopsies was used in a reaction volume of 50 microliters involving 30 cycles of amplifications. The reaction product was blunt-end cloned into pUC19 cut with Smal. The sequence was done with T7-polymerase using 32P-dATR as a label. Our results indicate that STLV-1 Papio provirus is actually present in the cells of a lymphoid cell line and tumor cells of lymphomatous monkeys. There are some differences between STLV-1 Papio and reported sequences of HTLV-1 and STLV-1.

Multiplexed resequencing analysis to identify rare variants in pooled DNA with barcode indexing using next-generation sequencer.

PubMed

Mitsui, Jun; Fukuda, Yoko; Azuma, Kyo; Tozaki, Hirokazu; Ishiura, Hiroyuki; Takahashi, Yuji; Goto, Jun; Tsuji, Shoji

2010-07-01

We have recently found that multiple rare variants of the glucocerebrosidase gene (GBA) confer a robust risk for Parkinson disease, supporting the 'common disease-multiple rare variants' hypothesis. To develop an efficient method of identifying rare variants in a large number of samples, we applied multiplexed resequencing using a next-generation sequencer to identification of rare variants of GBA. Sixteen sets of pooled DNAs from six pooled DNA samples were prepared. Each set of pooled DNAs was subjected to polymerase chain reaction to amplify the target gene (GBA) covering 6.5 kb, pooled into one tube with barcode indexing, and then subjected to extensive sequence analysis using the SOLiD System. Individual samples were also subjected to direct nucleotide sequence analysis. With the optimization of data processing, we were able to extract all the variants from 96 samples with acceptable rates of false-positive single-nucleotide variants.

Sarcocystis neurona encephalitis in a dog.

PubMed

Cooley, A J; Barr, B; Rejmanek, D

2007-11-01

A 1.5-year-old male Feist dog was presented to a veterinarian for reluctance to stand on the hind legs. Treatment included dexamethasone and resulted in a favorable initial response, but posterior paresis returned and progressed to recumbency, hyperesthesia, and attempts to bite the owner. The dog was euthanized. The brain was negative for rabies by fluorescent antibody analysis. Multiple foci of encephalitis were found in the cerebrum and particularly in the cerebellum. Protozoa morphologically consistent with Sarcocystis sp. were identified at sites of intense inflammation and malacia. Additionally, multiple schizonts were identified in areas without inflammation. Immunohistochemistry using both polyclonal and monoclonal antibodies specific for Sarcocystis neurona was strongly positive. No reaction to polyclonal antisera for Toxoplasma gondii or Neospora caninum was found. Polymerase chain reaction confirmed that the protozoa were S. neurona. Additional aberrant hosts for S. neurona other than horses have been identified, but S. neurona encephalitis has not been documented previously in the dog.

Novel strategies to construct complex synthetic vectors to produce DNA molecular weight standards.

PubMed

Chen, Zhe; Wu, Jianbing; Li, Xiaojuan; Ye, Chunjiang; Wenxing, He

2009-05-01

DNA molecular weight standards (DNA markers, nucleic acid ladders) are commonly used in molecular biology laboratories as references to estimate the size of various DNA samples in electrophoresis process. One method of DNA marker production is digestion of synthetic vectors harboring multiple DNA fragments of known sizes by restriction enzymes. In this article, we described three novel strategies-sequential DNA fragment ligation, screening of ligation products by polymerase chain reaction (PCR) with end primers, and "small fragment accumulation"-for constructing complex synthetic vectors and minimizing the mass differences between DNA fragments produced from restrictive digestion of synthetic vectors. The strategy could be applied to construct various complex synthetic vectors to produce any type of low-range DNA markers, usually available commercially. In addition, the strategy is useful for single-step ligation of multiple DNA fragments for construction of complex synthetic vectors and other applications in molecular biology field.

Constructing STR multiplex assays.

PubMed

Butler, John M

2005-01-01

Multiplex polymerase chain reaction (PCR) refers to the simultaneous amplification of multiple regions of deoxyribonucleic acid (DNA) using PCR. Commercial short tandem repeat (STR) assays that can coamplify as many as 16 different loci have become widely used in forensic DNA typing. This chapter will focus on some of the aspects of constructing robust STR multiplex assays, including careful design and quality control of PCR primers. Examples from the development of a cat STR 12plex and a human Y chromosome STR 20plex are used to illustrate the importance of various parts of the protocol. Primer design parameters and Internet-accessible resources are discussed, as are solutions to problems with residual dye artifacts that result from impure primers.

Identification of Prevotella in pedal osteomyelitis of a diabetic patient.

PubMed

Dominiak, Barbara J; Oxberry, William; Chen, Patrick C

2003-01-01

Osteomyelitis in a diabetic patient with a nonhealing foot ulcer, multiple medical conditions, and recurrent hospitalization for antibiotic therapy was found to be associated with gram-negative bacteria Prevotella melanginoganica and Prevotella melaninoganica hemagglutinating variant. Those organisms were identified due to the morphologically distinct features in electron microscopy and sequencing of the genes after Polymerase chain reaction amplification from the pathological material. The bacteria invaded the bone and resided in osteocyte, osteoblast, and endothelial cells. The bacteria are usually associated with periodontal plaques, causing inflammation and destruction of gingival tissue and resorption of the alveolar bone. This is the first ultrastructural and molecular study of a diabetic bone lesion with anaerobic bacterial infection.

Mycobacteriosis in a Domestic Ferret (Mustela putorius furo)

PubMed Central

NAKATA, Makoto; MIWA, Yasutsugu; TSUBOI, Masaya; UCHIDA, Kazuyuki

2014-01-01

ABSTRACT A 4-year-old spayed female ferret presented with a 2-month history of anorexia, vomiting and occasional diarrhea. Abdominal ultrasonography revealed thickening of the gastric wall and enlarged abdominal lymph nodes. Biopsy samples from the thickened gastric wall, enlarged abdominal lymph nodes and liver were taken during an exploratory laparotomy. Based on the histopathological examination, mycobacterium infection was diagnosed. The bacterial species could not be identified by additional diagnostic tests of feces, including fecal smear, culture and polymerase chain reaction (PCR). The ferret was treated with prednisolone and multiple antimicrobials, including rifampicin, azithromycin and enrofloxacin, but did not improve with treatment and died 220 days after the first presentation. PMID:24419874

Multifocal Epithelial Hyperplasia of Oral Cavity Expressing HPV 16 Gene: A Rare Entity

PubMed Central

Prabhat, M. P. V.; Raja Lakshmi, Chintamaneni; Sai Madhavi, N.; Bhavana, Sujana Mulk; Sarat, Gummadapu; Ramamohan, Kodali

2013-01-01

Focal epithelial hyperplasia is a rare contagious disease caused by human papilloma virus. Usually HPV involves either cutaneous or mucosal surfaces, whereas concomitant mucocutaneous involvement is extremely rare. We report such a unique case of multifocal epithelial hyperplasia involving multiple sites of oral cavity along with skin lesions in a 65-year-old female. We also discuss the probable multifactorial etiology and variable clinical presentations of the lesions, including evidence of HPV 16 expression, as detected by polymerase chain reaction. The present report illustrates the need for careful examination and prompt diagnosis of the disease, as it might be associated with high risk genotypes such as HPV 16 and 18. PMID:24455323

Development of melting temperature-based SYBR Green I polymerase chain reaction methods for multiplex genetically modified organism detection.

PubMed

Hernández, Marta; Rodríguez-Lázaro, David; Esteve, Teresa; Prat, Salomé; Pla, Maria

2003-12-15

Commercialization of several genetically modified crops has been approved worldwide to date. Uniplex polymerase chain reaction (PCR)-based methods to identify these different insertion events have been developed, but their use in the analysis of all commercially available genetically modified organisms (GMOs) is becoming progressively insufficient. These methods require a large number of assays to detect all possible GMOs present in the sample and thereby the development of multiplex PCR systems using combined probes and primers targeted to sequences specific to various GMOs is needed for detection of this increasing number of GMOs. Here we report on the development of a multiplex real-time PCR suitable for multiple GMO identification, based on the intercalating dye SYBR Green I and the analysis of the melting curves of the amplified products. Using this method, different amplification products specific for Maximizer 176, Bt11, MON810, and GA21 maize and for GTS 40-3-2 soybean were obtained and identified by their specific Tm. We have combined amplification of these products in a number of multiplex reactions and show the suitability of the methods for identification of GMOs with a sensitivity of 0.1% in duplex reactions. The described methods offer an economic and simple alternative to real-time PCR systems based on sequence-specific probes (i.e., TaqMan chemistry). These methods can be used as selection tests and further optimized for uniplex GMO quantification.

Multiplex reverse transcription polymerase chain reaction to study the expression of virulence and stress response genes in Staphylococcus aureus.

PubMed

Shrihari, Rohinishree Yadahalli; Singh, Negi Pradeep

2012-02-01

Staphylococcus aureus survives well in different stress conditions. The ability of this organism to adapt to various stresses is the result of a complex regulatory response, which is attributed to regulation of multiple genes. The aims of the present study were (1) to develop a multiplex PCR for the detection of genes which are involved in stress adaptation (asp23, dnaK, and groEL); alternative sigma factor (sigB) and virulence determination (entB and spa) and (2) to study the expression of these genes during stress conditions for S. aureus culture collection strains (FRI 722 and ATCC 6538) and S. aureus food isolates at mRNA level using multiplex reverse transcription polymerase chain reaction (RT-PCR). During heat shock treatment groEL, dnaK, asp23, sodA, entB, spa, and sigB genes were up regulated up to 2.58, 2.07, 2.76, 2.55, 3.55, 2.71, and 2.62- folds, respectively, whereas in acid shock treatment, sodA and groEL were up regulated; dnaK was downregulated; and entB and sigB genes were not expressed in food isolates. Multiplex PCR assay standardized in this study offers an inexpensive alternative to uniplex PCR for detection of various virulence and stress response genes. This study is relevant to rapid and accurate detection of potential pathogenic S. aureus in foods. © 2012 Institute of Food Technologists®

Multiplex Polymerase Chain Reaction for Detection of Gastrointestinal Pathogens in Migrant Workers in Qatar.

PubMed

Humphrey, John M; Ranbhise, Sanjay; Ibrahim, Emad; Al-Romaihi, Hamad E; Farag, Elmoubasher; Abu-Raddad, Laith J; Glesby, Marshall J

2016-12-07

The causes of infectious diarrhea among the migrant worker population in Qatar are not well understood. We conducted a prospective observational study to understand the demographic and clinical characteristics and infectious causes of diarrhea among migrant workers in Doha, Qatar. A total of 126 male workers presenting to the Qatar Red Crescent Worker's Health Center outpatient clinic or emergency department were studied over a 5-month period in 2015-2016. Epidemiologic surveys were administered to all subjects and the prevalence of 22 different stool pathogens was determined using multiplex polymerase chain reaction (PCR) (FilmArray ® Gastrointestinal PCR). A target pathogen was identified in 62.7% of subjects. Enteropathogenic Escherichia coli was the most prevalent pathogen and was detected in 24.6% of subjects, followed by Salmonella (22.2%), enteroaggregative E. coli (15.1%), Giardia lamblia (9.5%), and enterotoxigenic E. coli (8.7%). Multiple pathogens were identified in 49.3% of positive stool samples. In a multivariable analysis, the presence of a heart rate ≥ 90 (adjusted odds ratio [OR] = 3.7, 95% confidence interval [CI] = 1.4-10.0) and > 5 fecal leukocytes/high-power field (adjusted OR = 2.8, 95% CI = 1.2-7.0) were significant predictors of detecting an acute inflammatory pathogen by PCR. Use of multiplex PCR enabled the detection of gastrointestinal pathogens in a high proportion of cases, illustrating the utility of this diagnostic tool in epidemiologic studies of infectious diarrhea. © The American Society of Tropical Medicine and Hygiene.

Detection of Onchocerca volvulus in Skin Snips by Microscopy and Real-Time Polymerase Chain Reaction: Implications for Monitoring and Evaluation Activities.

PubMed

Thiele, Elizabeth A; Cama, Vitaliano A; Lakwo, Thomson; Mekasha, Sindeaw; Abanyie, Francisca; Sleshi, Markos; Kebede, Amha; Cantey, Paul T

2016-04-01

Microscopic evaluation of skin biopsies is the monitoring and evaluation (M and E) method currently used by multiple onchocerciasis elimination programs in Africa. However, as repeated mass drug administration suppresses microfilarial loads, the sensitivity and programmatic utility of skin snip microscopy is expected to decrease. Using a pan-filarial real-time polymerase chain reaction with melt curve analysis (qPCR-MCA), we evaluated 1) the use of a single-step molecular assay for detecting and identifying Onchocerca volvulus microfilariae in residual skin snips and 2) the sensitivity of skin snip microscopy relative to qPCR-MCA. Skin snips were collected and examined with routine microscopy in hyperendemic regions of Uganda and Ethiopia (N= 500 each) and "residual" skin snips (tissue remaining after induced microfilarial emergence) were tested with qPCR-MCA. qPCR-MCA detected Onchocerca DNA in 223 residual snips: 139 of 147 microscopy(+) and 84 among microscopy(-) snips, suggesting overall sensitivity of microscopy was 62.3% (139/223) relative to qPCR-MCA (75.6% in Uganda and 28.6% in Ethiopia). These findings demonstrate the insufficient sensitivity of skin snip microscopy for reliable programmatic monitoring. Molecular tools such as qPCR-MCA can augment sensitivity and provide diagnostic confirmation of skin biopsies and will be useful for evaluation or validation of new onchocerciasis M and E tools. © The American Society of Tropical Medicine and Hygiene.

Utilizing a polymerase chain reaction method for the detection of Toxocara canis and T. cati eggs in soil.

PubMed

Fogt-Wyrwas, R; Jarosz, W; Mizgajska-Wiktor, H

2007-03-01

A polymerase chain reaction (PCR) technique has been used for the differentiation of T. canis and T. cati eggs isolated from soil and previously identified from microscopical observations. The method, using specific primers for the identification of the two Toxocara species, was assessed in both the field and laboratory. Successful results were obtained when only a single or large numbers of eggs were recovered from 40 g soil samples. The method is sensitive, allows analysis of material independent of the stage of egg development and can be adapted for the recovery of other species of parasites from soil.

Diagnosis of feline leukaemia virus infection by semi-quantitative real-time polymerase chain reaction.

PubMed

Pinches, Mark D G; Helps, Christopher R; Gruffydd-Jones, Tim J; Egan, Kathy; Jarrett, Oswald; Tasker, Séverine

2007-02-01

In this paper the design and use of a semi-quantitative real-time polymerase chain reaction assay (RT-PCR) for feline leukaemia virus (FeLV) provirus is described. Its performance is evaluated against established methods of FeLV diagnosis, including virus isolation and enzyme-linked immunoassay (ELISA) in a population of naturally infected cats. The RT-PCR assay is found to have both a high sensitivity (0.92) and specificity (0.99) when examined by expectation maximisation methods and is also able to detect a large number of cats with low FeLV proviral loads that were negative by other conventional test methods.

Polymerase chain reaction-based detection of myc transduction in feline leukemia virus-infected cats.

PubMed

Sumi, Ryosuke; Miyake, Ariko; Endo, Taiji; Ohsato, Yoshiharu; Ngo, Minh Ha; Nishigaki, Kazuo

2018-04-01

Feline lymphomas are associated with the transduction and activation of cellular proto-oncogenes, such as c-myc, by feline leukemia virus (FeLV). We describe a polymerase chain reaction assay for detection of myc transduction usable in clinical diagnosis. The assay targets c-myc exons 2 and 3, which together result in a FeLV-specific fusion gene following c-myc transduction. When this assay was conducted on FeLV-infected feline tissues submitted for clinical diagnosis of tumors, myc transduction was detected in 14% of T-cell lymphoma/leukemias. This newly established system could become a useful diagnostic tool in veterinary medicine.

Detection of a novel human coronavirus by real-time reverse-transcription polymerase chain reaction.

PubMed

Corman, V M; Eckerle, I; Bleicker, T; Zaki, A; Landt, O; Eschbach-Bludau, M; van Boheemen, S; Gopal, R; Ballhause, M; Bestebroer, T M; Muth, D; Müller, M A; Drexler, J F; Zambon, M; Osterhaus, A D; Fouchier, R M; Drosten, C

2012-09-27

We present two real-time reverse-transcription polymerase chain reaction assays for a novel human coronavirus (CoV), targeting regions upstream of the E gene (upE) or within open reading frame (ORF)1b, respectively. Sensitivity for upE is 3.4 copies per reaction (95% confidence interval (CI): 2.5–6.9 copies) or 291 copies/mL of sample. No cross-reactivity was observed with coronaviruses OC43, NL63, 229E, SARS-CoV, nor with 92 clinical specimens containing common human respiratory viruses. We recommend using upE for screening and ORF1b for confirmation.

Illegitimate transcription: transcription of any gene in any cell type.

PubMed Central

Chelly, J; Concordet, J P; Kaplan, J C; Kahn, A

1989-01-01

Using in vitro amplification of cDNA by the polymerase chain reaction, we have detected spliced transcripts of various tissue-specific genes (genes for anti-Müllerian hormone, beta-globin, aldolase A, and factor VIIIc) in human nonspecific cells, such as fibroblasts, hepatoma cells, and lymphoblasts. In rats, erythroid- and liver-type pyruvate kinase transcripts were also detected in brain, lung, and muscle. The abundance of these "illegitimate" transcripts is very low; yet, their existence and the possibility of amplifying them by the cDNA polymerase chain reaction provide a powerful tool to analyze pathological transcripts of any tissue-specific gene by using any accessible cell. Images PMID:2495532

A Novel Mechanism of Sugar Selection Utilized by a Human X-family DNA Polymerase†

PubMed Central

Brown, Jessica A.; Fiala, Kevin A.; Fowler, Jason D.; Sherrer, Shanen M.; Newmister, Sean A.; Dyum, Wade W.; Suo, Zucai

2009-01-01

During DNA synthesis, most DNA polymerases and reverse transcriptases select against ribonucleotides via a steric clash between the ribose 2′-hydroxyl group and the bulky side chain of an active site residue. Here, we demonstrated that human DNA polymerase λ used a novel sugar selection mechanism to discriminate against ribonucleotides, whereby the ribose 2′-hydroxyl group was excluded mostly by a backbone segment and slightly by the side chain of Y505. Such a steric clash was further demonstrated to be dependent on the size and orientation of the substituent covalently attached at the ribonucleotide C2′ position. PMID:19900463

DNA extraction from coral reef sediment bacteria for the polymerase chain reaction.

PubMed

Guthrie, J N; Moriarty, D J; Blackall, L L

2000-12-15

A rapid and effective method for the direct extraction of high molecular weight amplifiable DNA from two coral reef sediments was developed. DNA was amplified by the polymerase chain reaction (PCR) using 16S rDNA specific primers. The amplicons were digested with HaeIII, HinP1I and MspI and separated using polyacrylamide gel electrophoresis and silver staining. The resulting amplified ribosomal DNA restriction analysis (ARDRA) patterns were used as a fingerprint to discern differences between the coral reef sediment samples. Results indicated that ARDRA is an effective method for determining differences within the bacterial community amongst different environmental samples.

Use of polymerase chain reaction (PCR) in the diagnosis of congenital toxoplasmosis.

PubMed

Loveridge-Easther, Cam; Yardley, Anne-Marie; Breidenstein, Brenda

2018-06-01

Congenital toxoplasmosis (CT) is a parasitic disease that causes serious fetal and neonatal harm or death. In countries that do not have antenatal screening programs, the initiation of CT treatment relies on a postnatal diagnosis. Until recently, diagnosis was based on clinical signs and immunoglobulin seropositivity, which is fraught with difficulty. In these cases, diagnosis was often delayed or treatment, which carries risk, started empirically. We highlight the use of polymerase chain reaction to diagnose a case of congenital toxoplasmosis, allowing early treatment and justifying the treatment burden. Copyright © 2018 American Association for Pediatric Ophthalmology and Strabismus. Published by Elsevier Inc. All rights reserved.

Polymerase chain reaction detection of Bartonella spp. in dogs from Spain with blood culture-negative infectious endocarditis.

PubMed

Roura, X; Santamarina, G; Tabar, M-D; Francino, O; Altet, L

2018-05-25

The presence of Bartonella spp. was detected by polymerase chain reaction (PCR) in dogs from Spain with blood culture-negative endocarditis. The aim of this study is to add information about canine infectious endocarditis in Europe. Thirty dogs with naturally occurring blood culture-negative endocarditis were examined from 2010 to 2017 at three veterinary referral hospitals, located in northwest, northeast, and southeast of Spain. It is a retrospective study. Medical records were reviewed to extract relevant data. Frozen or paraffin-embedded cardiac valve tissue and/or ethylenediamine tetraacetic acid blood samples were evaluated by PCR for the presence of Bartonella DNA. Positive results were sequenced to confirm the species. Polymerase chain reaction was positive for eight out of 30 dogs included (26.6%). Bartonella rochalimae, Bartonella vinsonii subsp. berkhoffii, and Bartonella koehlerae were detected in valve tissue or blood. Bartonella could be an important cause of blood culture-negative infectious endocarditis in dogs from Spain. The outcome for those dogs affected with Bartonella spp. was grave. Prompt empirical treatment with amoxicillin-clavulanate plus fluoroquinolones could be of value in cases of blood culture-negative endocarditis. Copyright © 2018 Elsevier B.V. All rights reserved.

[Roles of histologic examination and polymerase chain reaction in diagnosis of toxoplasmic lymphadenitis].

PubMed

Dai, Lin; Huang, Juan; Tang, Yuan; Liao, Dian-ying; Dong, Dan-dan; Xu, Gang; Li, Gan-di

2010-06-01

To study the roles of histologic examination and polymerase chain reaction in diagnosis of toxoplasmic lymphadenitis (TL). Forty-six archival cases of histologically diagnosed TL, encountered during the period from April, 1999 to September, 2009 and with the paraffin-embedded lymph node tissue blocks available, were enrolled into the study. The presence of genome fragments of Toxoplasma gondii (T. gondii) was analyzed using semi-nested polymerase chain reaction (PCR). Thirty cases of one or two histopathologic triad of TL as the controls. The positive rate of PCR in TL group was 76.1% (35/46), as compared to 10.0% (3/30) in the control group. The difference was of statistical significance. The sensitivity and specificity of the histologic triad in diagnosing TL was 92.1% (35/38) and 71.1% (27/38), respectively. The predictive value of positive and negative PCR results was 76.1% (35/46) and 90.0% (27/30). respectively. The high specificity but low sensitivity of applying the histologic triad in diagnosing TL cases may be due to the occurrence of atypical histologic pattern. The sensitivity is improved with the use of semi-nested PCR in detecting T. gondii DNA.

Development of a polymerase chain reaction applicable to rapid and sensitive detection of Clonorchis sinensis eggs in human stool samples

PubMed Central

Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo

2013-01-01

Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334

Real-Time Polymerase Chain Reaction for Detection of Schistosoma DNA in Small-Volume Urine Samples Reflects Focal Distribution of Urogenital Schistosomiasis in Primary School Girls in KwaZulu Natal, South Africa

PubMed Central

Pillay, Pavitra; Taylor, Myra; Zulu, Siphosenkosi G.; Gundersen, Svein G.; Verweij, Jaco J.; Hoekstra, Pytsje; Brienen, Eric A. T.; Kleppa, Elisabeth; Kjetland, Eyrun F.; van Lieshout, Lisette

2014-01-01

Schistosoma haematobium eggs and Schistosoma DNA levels were measured in urine samples from 708 girls recruited from 18 randomly sampled primary schools in South Africa. Microscopic analysis of two 10-mL urine subsamples collected on three consecutive days confirmed high day-to-day variation; 103 (14.5%) girls had positive results at all six examinations, and at least one positive sample was seen in 225 (31.8%) girls. Schistosoma-specific DNA, which was measured in a 200-μL urine subsample by using real-time polymerase chain reaction, was detected in 180 (25.4%) cases, and levels of DNA corresponded significantly with average urine egg excretion. In concordance with microscopic results, polymerase chain reaction results were significantly associated with history of gynecologic symptoms and confirmed highly focal distribution of urogenital schistosomiasis. Parasite-specific DNA detection has a sensitivity comparable to single urine microscopy and could be used as a standardized high-throughput procedure to assess distribution of urogenital schistosomiasis in relatively large study populations by using small sample volumes. PMID:24470560

Diagnosis of ocular toxoplasmosis by two polymerase chain reaction (PCR) examinations: qualitative multiplex and quantitative real-time.

PubMed

Sugita, Sunao; Ogawa, Manabu; Inoue, Shizu; Shimizu, Norio; Mochizuki, Manabu

2011-09-01

To establish a two-step polymerase chain reaction (PCR) diagnostic system for ocular toxoplasmosis. A total of 13 ocular fluid samples (11 aqueous humor and 2 vitreous fluid) were collected from 13 patients with clinically suspected ocular toxoplasmosis. Ten ocular samples from other uveitis patients and 20 samples from subjects without ocular inflammation were used as controls. Two polymerase chain reaction (PCR) methods, i.e., qualitative multiplex PCR and quantitative real-time PCR, were used to measure the toxoplasma genome (T. gondii B1 gene). Qualitative multiplex PCR detected T. gondii B1 gene in the ocular fluids of 11 out of 13 patients with clinically suspected ocular toxoplasmosis. In real-time PCR, we detected high copy numbers of T. gondii DNA (5.1 × 10(2)-2.1 × 10(6) copies/mL) in a total of 10 patients (10/13, 77%). Only ocular toxoplasmosis scar lesions were observed in the three real-time PCR-negative patients. PCR assay results for the samples from the two control groups were all negative. The two-step PCR examination to detect toxoplasma DNA is a useful tool for diagnosing ocular toxoplasmosis.

Cerebrospinal fluid PCR analysis and biochemistry in bodies with severe decomposition.

PubMed

Palmiere, Cristian; Vanhaebost, Jessica; Ventura, Francesco; Bonsignore, Alessandro; Bonetti, Luca Reggiani

2015-02-01

The aim of this study was to assess whether Neisseria meningitidis, Listeria monocytogenes, Streptococcus pneumoniae and Haemophilus influenzae can be identified using the polymerase chain reaction technique in the cerebrospinal fluid of severely decomposed bodies with known, noninfectious causes of death or whether postmortem changes can lead to false positive results and thus erroneous diagnostic information. Biochemical investigations, postmortem bacteriology and real-time polymerase chain reaction analysis in cerebrospinal fluid were performed in a series of medico-legal autopsies that included noninfectious causes of death with decomposition, bacterial meningitis without decomposition, bacterial meningitis with decomposition, low respiratory tract infections with decomposition and abdominal infections with decomposition. In noninfectious causes of death with decomposition, postmortem investigations failed to reveal results consistent with generalized inflammation or bacterial infections at the time of death. Real-time polymerase chain reaction analysis in cerebrospinal fluid did not identify the studied bacteria in any of these cases. The results of this study highlight the usefulness of molecular approaches in bacteriology as well as the use of alternative biological samples in postmortem biochemistry in order to obtain suitable information even in corpses with severe decompositional changes. Copyright © 2014 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

Global methylation and promoter-specific methylation of the P16, SOCS-1, E-cadherin, P73 and SHP-1 genes and their expression in patients with multiple myeloma during active disease and remission

PubMed Central

Martínez-Baños, Déborah; Sánchez-Hernández, Beatríz; Jiménez, Guadalupe; Barrera-Lumbreras, Georgina; Barrales-Benítez, Olga

2017-01-01

Tumor suppressor gene promoter CpG island methylation is a well-recognized mechanism in cancer pathogenesis, but its role in multiple myeloma (MM) is controversial. The present study investigated the methylation status and expression of P16, suppressor of cytokine signaling 1 (SOCS-1), P73, E-cadherin and Src homology region 2 domain-containing phosphatase 1 (SHP-1), as well as global methylation in patients with MM during active disease and remission. Bone marrow samples were obtained from 43 patients at the Multiple Myeloma Clinic, Instituto Nacional de Ciencias Médicas y Nutrición Salvador Zubirán (Mexico City, Mexico) during active disease and remission. Methylation-specific polymerase chain reaction and ELISA were performed on bisulfite-treated or untreated DNA to determine promoter-specific or genomic methylation, respectively. Gene expression was measured using reverse-transcription polymerase chain reaction. The results indicated that SOCS-1 methylation occurred more frequently during active disease than remission [29 vs. 3.2% (P=0.021)] and was associated with more advanced forms of the disease [international staging system (ISS) 3, 16.67% vs. ISS 1, 8.3% (P=0.037)]. SHP-1 methylation during active disease was associated with a lower probability of survival at 39-month follow up (median), 52.5 vs. 87.5% (P=0.025). The percentage of methylation was associated with active disease at remission, but this was not significant. Global hypomethylation at remission was a negative predictor factor for overall survival (OS). The results indicated that methylated P16, SOCS-1 and SHP-1 were associated with clinical variables of poor prognosis in MM, likewise the persistence of global hypomethylation at remission. The negative impact on OS of global hypomethylation at remission must be confirmed in a larger sample. Future studies are necessary to investigate whether patients with global hypermethylation at remission should receive more aggressive treatments to improve their OS. PMID:28565861

Global methylation and promoter-specific methylation of the P16, SOCS-1, E-cadherin, P73 and SHP-1 genes and their expression in patients with multiple myeloma during active disease and remission.

PubMed

Martínez-Baños, Déborah; Sánchez-Hernández, Beatríz; Jiménez, Guadalupe; Barrera-Lumbreras, Georgina; Barrales-Benítez, Olga

2017-05-01

Tumor suppressor gene promoter CpG island methylation is a well-recognized mechanism in cancer pathogenesis, but its role in multiple myeloma (MM) is controversial. The present study investigated the methylation status and expression of P16 , suppressor of cytokine signaling 1 ( SOCS-1 ), P73, E-cadherin and Src homology region 2 domain-containing phosphatase 1 ( SHP-1 ), as well as global methylation in patients with MM during active disease and remission. Bone marrow samples were obtained from 43 patients at the Multiple Myeloma Clinic, Instituto Nacional de Ciencias Médicas y Nutrición Salvador Zubirán (Mexico City, Mexico) during active disease and remission. Methylation-specific polymerase chain reaction and ELISA were performed on bisulfite-treated or untreated DNA to determine promoter-specific or genomic methylation, respectively. Gene expression was measured using reverse-transcription polymerase chain reaction. The results indicated that SOCS-1 methylation occurred more frequently during active disease than remission [29 vs. 3.2% (P=0.021)] and was associated with more advanced forms of the disease [international staging system (ISS) 3, 16.67% vs. ISS 1, 8.3% (P=0.037)]. SHP-1 methylation during active disease was associated with a lower probability of survival at 39-month follow up (median), 52.5 vs. 87.5% (P=0.025). The percentage of methylation was associated with active disease at remission, but this was not significant. Global hypomethylation at remission was a negative predictor factor for overall survival (OS). The results indicated that methylated P16 , SOCS-1 and SHP-1 were associated with clinical variables of poor prognosis in MM, likewise the persistence of global hypomethylation at remission. The negative impact on OS of global hypomethylation at remission must be confirmed in a larger sample. Future studies are necessary to investigate whether patients with global hypermethylation at remission should receive more aggressive treatments to improve their OS.

Self-powered integrated microfluidic point-of-care low-cost enabling (SIMPLE) chip

PubMed Central

Yeh, Erh-Chia; Fu, Chi-Cheng; Hu, Lucy; Thakur, Rohan; Feng, Jeffrey; Lee, Luke P.

2017-01-01

Portable, low-cost, and quantitative nucleic acid detection is desirable for point-of-care diagnostics; however, current polymerase chain reaction testing often requires time-consuming multiple steps and costly equipment. We report an integrated microfluidic diagnostic device capable of on-site quantitative nucleic acid detection directly from the blood without separate sample preparation steps. First, we prepatterned the amplification initiator [magnesium acetate (MgOAc)] on the chip to enable digital nucleic acid amplification. Second, a simplified sample preparation step is demonstrated, where the plasma is separated autonomously into 224 microwells (100 nl per well) without any hemolysis. Furthermore, self-powered microfluidic pumping without any external pumps, controllers, or power sources is accomplished by an integrated vacuum battery on the chip. This simple chip allows rapid quantitative digital nucleic acid detection directly from human blood samples (10 to 105 copies of methicillin-resistant Staphylococcus aureus DNA per microliter, ~30 min, via isothermal recombinase polymerase amplification). These autonomous, portable, lab-on-chip technologies provide promising foundations for future low-cost molecular diagnostic assays. PMID:28345028

A Model of Risk Analysis in Analytical Methodology for Biopharmaceutical Quality Control.

PubMed

Andrade, Cleyton Lage; Herrera, Miguel Angel De La O; Lemes, Elezer Monte Blanco

2018-01-01

One key quality control parameter for biopharmaceutical products is the analysis of residual cellular DNA. To determine small amounts of DNA (around 100 pg) that may be in a biologically derived drug substance, an analytical method should be sensitive, robust, reliable, and accurate. In principle, three techniques have the ability to measure residual cellular DNA: radioactive dot-blot, a type of hybridization; threshold analysis; and quantitative polymerase chain reaction. Quality risk management is a systematic process for evaluating, controlling, and reporting of risks that may affects method capabilities and supports a scientific and practical approach to decision making. This paper evaluates, by quality risk management, an alternative approach to assessing the performance risks associated with quality control methods used with biopharmaceuticals, using the tool hazard analysis and critical control points. This tool provides the possibility to find the steps in an analytical procedure with higher impact on method performance. By applying these principles to DNA analysis methods, we conclude that the radioactive dot-blot assay has the largest number of critical control points, followed by quantitative polymerase chain reaction, and threshold analysis. From the analysis of hazards (i.e., points of method failure) and the associated method procedure critical control points, we conclude that the analytical methodology with the lowest risk for performance failure for residual cellular DNA testing is quantitative polymerase chain reaction. LAY ABSTRACT: In order to mitigate the risk of adverse events by residual cellular DNA that is not completely cleared from downstream production processes, regulatory agencies have required the industry to guarantee a very low level of DNA in biologically derived pharmaceutical products. The technique historically used was radioactive blot hybridization. However, the technique is a challenging method to implement in a quality control laboratory: It is laborious, time consuming, semi-quantitative, and requires a radioisotope. Along with dot-blot hybridization, two alternatives techniques were evaluated: threshold analysis and quantitative polymerase chain reaction. Quality risk management tools were applied to compare the techniques, taking into account the uncertainties, the possibility of circumstances or future events, and their effects upon method performance. By illustrating the application of these tools with DNA methods, we provide an example of how they can be used to support a scientific and practical approach to decision making and can assess and manage method performance risk using such tools. This paper discusses, considering the principles of quality risk management, an additional approach to the development and selection of analytical quality control methods using the risk analysis tool hazard analysis and critical control points. This tool provides the possibility to find the method procedural steps with higher impact on method reliability (called critical control points). Our model concluded that the radioactive dot-blot assay has the larger number of critical control points, followed by quantitative polymerase chain reaction and threshold analysis. Quantitative polymerase chain reaction is shown to be the better alternative analytical methodology in residual cellular DNA analysis. © PDA, Inc. 2018.

[Establishment of a novel HLA genotyping method for preimplantation genetic diagnonis using multiple displacement amplification-polymerase chain reaction-sequencing based technique].

PubMed

Zhang, Yinfeng; Luo, Haining; Zhang, Yunshan

2015-12-01

To establish a novel HLA genotyping method for preimplantation genetic diagnonis (PGD) using multiple displacement amplification-polymerase chain reaction-sequencing based technique (MDA-PCR-SBT). Peripheral blood samples and 76 1PN, 2PN, 3PN discarded embryos from 9 couples were collected. The alleles of HLA-A, B, DR loci were detected from the MDA product with the PCR-SBT method. The HLA genotypes of the parental peripheral blood samples were analyzed with the same protocol. The genotypes of specific HLA region were evaluated for distinguishing the segregation of haplotypes among the family members, and primary HLA matching was performed between the embryos. The 76 embryos were subjected to MDA and 74 (97.4%) were successfully amplified. For the 34 embryos from the single blastomere group, the amplification rate was 94.1%, and for the 40 embryos in the two blastomeres group, the rate was 100%. The dropout rates for DQ allele and DR allele were 1.3% and 0, respectively. The positive rate for MDA in the single blastomere group was 100%, with the dropout rates for DQ allele and DR allele being 1.5% and 0, respectively. The positive rate of MDA for the two blastomere group was 100%, with the dropout rates for both DQ and DR alleles being 0. The recombination rate of fetal HLA was 20.2% (30/148). Due to the improper classification and abnormal fertilized embryos, the proportion of matched embryos HLA was 20.3% (15/74),which was lower than the theoretical value of 25%. PGD with HLA matching can facilitate creation of a HLA-identical donor (saviour child) for umbilical cord blood or bone marrow stem cells for its affected sibling with a genetic disease. Therefore, preimplantation HLA matching may provide a tool for couples desiring to conceive a potential donor progeny for transplantation for its sibling with a life-threatening disorder.

RAPID MONITORING BY QUANTITATIVE POLYMERASE CHAIN REACTION FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

EPA Science Inventory

Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

relA-dependent RNA polymerase activity in Escherichia coli.

PubMed Central

Ryals, J; Bremer, H

1982-01-01

Parameters relating to RNA synthesis were measured after a temperature shift from 30 to 42 degrees C, in a relA+ and relA- isogenic pair of Escherichia coli strains containing a temperature-sensitive valyl tRNA synthetase. The following results were obtained: (i) the rRNA chain growth rate increased 2-fold in both strains; (ii) newly synthesized rRNA became unstable in both strains; (iii) the stable RNA gene activity (rRNA and tRNA, measured as stable RNA synthesis rate relative to the total instantaneous rate of RNA synthesis) decreased 1.7-fold in the relA+ strain and increased 1.9-fold in the relA mutant; and (iv) the RNA polymerase activity (measured by the percentage of total RNA polymerase enzyme active in transcription an any instant) decreased from 20 to 3.6% in the relA+ strain and remained unchanged (or increased at most to 22%) in the relA mutant. It is suggested that both rRNA gene activity and the RNA polymerase activity depend on the intracellular concentration of guanosine tetraphosphate, whereas the altered chain elongation rate and stability of rRNA are temperature or amino acid starvation effects, respectively, without involvement of relA function. PMID:6174501

Development of multiplex polymerase chain reaction for detection of Ehrlichia canis, Babesia spp and Hepatozoon canis in canine blood.

PubMed

Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada

2009-01-01

A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.

Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting

USGS Publications Warehouse

Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.

2011-01-01

Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

Gonorrhoea of the sigmoid neovagina in a male-to-female transgender.

PubMed

van der Sluis, Wouter B; Bouman, Mark-Bram; Gijs, Luk; van Bodegraven, Adriaan A

2015-07-01

A 33-year-old male-to-female transgender consulted our outpatient clinic with perneovaginal bleeding during and following coitus. Four years before, she underwent a total laparoscopic sigmoid neovaginoplasty. Physical, histological and endoscopic examination revealed neither focus of active bleeding nor signs of active inflammation. A polymerase chain reaction test performed on a neovaginal swab showed gonococcal infection. Treatment consisted of 500 mg intramuscular ceftriaxone. Three weeks later, our patient reported resolution of symptoms, consistent with eradication of the infection demonstrated by a follow-up neovaginal swab polymerase chain reaction. To our knowledge, this is the first case report of gonococcal infection of the sigmoid neovagina. © The Author(s) 2014.

Method and apparatus for purifying nucleic acids and performing polymerase chain reaction assays using an immiscible fluid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Koh, Chung-Yan; Light, Yooli Kim; Piccini, Matthew Ernest

Embodiments of the present invention are directed toward devices, systems, and methods for purifying nucleic acids to conduct polymerase chain reaction (PCR) assays. In one example, a method includes generating complexes of silica beads and nucleic acids in a lysis buffer, transporting the complexes through an immiscible fluid to remove interfering compounds from the complexes, further transporting the complexes into a density medium containing components required for PCR where the nucleic acids disassociate from the silica beads, and thermocycling the contents of the density medium to achieve PCR. Signal may be detected from labeling agents in the components required formore » PCR.« less

Detection of trypanosomatid Phytomonas parasitic in plants by polymerase chain reaction amplification of small subunit ribosomal DNA.

PubMed

Teixeira, M M; Campaner, M; Camargo, E P

1994-01-01

To improve the diagnosis of Phytomonas infections in plants, we developed a polymerase chain reaction (PCR) assay using synthetic oligonucleotides complementary to conserved sequences of the 18S small subunit ribosomal (SSU) gene. From 10 ng upward of DNA of cultures of Phytomonas isolated from plants, fruits, and insects, PCR amplified an 800-bp DNA band that, after restriction analysis and probe hybridization, proved to be of 18S rDNA Phytomonas origin. PCR was also done with sap samples of tomatoes experimentally infected with Phytomonas, yielding amplified 800-bp ribosomal DNA bands before any flagellate could be detected by microscopic examination of the fruit sap.

Diagnostic exercise: chronic vomiting in a dog.

PubMed

Ellis, A E; Brown, C A; Miller, D L

2010-09-01

An approximately one-and-a-half-year-old, neutered male, mixed-breed dog was presented for a chronic history of vomiting. Profuse diarrhea was also noted during examination. An exploratory laparotomy was performed, bone chips were removed from the stomach, and a raised, circular area of gastric mucosa was biopsied. Histologically, there was severe gastric cryptosporidiosis as well as numerous spiral bacteria, consistent with Helicobacter spp. Polymerase chain reaction revealed visible bands for the 18S ribosomal RNA gene for Cryptosporidium spp. The polymerase chain reaction product was sequenced and was found to be most similar to Cryptosporidium muris. Both the gastric location and the species of Cryptosporidium are unusual in a dog.

Vertebral Osteomyelitis Caused by Helicobacter cinaedi Identified Using Broad-range Polymerase Chain Reaction with Sequencing of the Biopsied Specimen.

PubMed

Hase, Ryota; Hirooka, Takuya; Itabashi, Takashi; Endo, Yasunobu; Otsuka, Yoshihito

2018-05-15

A 65-year-old man presented with gradually exacerbating low back pain. Magnetic resonance imaging revealed vertebral osteomyelitis in the Th11-L2 vertebral bodies and discs. The patient showed negative findings on conventional cultures. Direct broad-range polymerase chain reaction (PCR) with sequencing of the biopsied specimen had the highest similarity to the 16S rRNA gene of Helicobacter cinaedi. This case suggests that direct broad-range PCR with sequencing should be considered when conventional cultures cannot identify the causative organism of vertebral osteomyelitis, and that this method may be particularly useful when the pathogen is a fastidious organism, such as H. cinaedi.

Transformation of soybean Gy3 gene into Artemisaarenaria mediated by corona discharge

NASA Astrophysics Data System (ADS)

Chao, Lu-meng; Na, Ri; Xue, Dan; Xu, Yongze; Liu, Teng

2013-03-01

In order to improve the protein content of desert plant, a method of genetic transformation mediated by corona discharge was established. Artemisia seeds were processed in corona electric field for 120 min at 12 kV, and then soaked in 0.1 SSC media that contained Soybean Gy3 gene DNA to incubate for 12 h at 26 °C. Finally the seeds were inoculated on the differentiation medium. Polymerase Chain Reaction (PCR) and Reverse Transcription Polymerase Chain Reaction (RT-PCR) detection showed that the Soybean Gy3 gene had been successfully introduced into genomic DNA of the regenerated plants of Artemisaarenaria. The study provided a new way for corona discharge in plant genetic modification.

Cerebral Toxoplasmosis Diagnosed by Nested-polymerase Chain Reaction in a Patient with Rheumatoid Arthritis.

PubMed

Matsuura, Jun; Fujii, Akihiro; Mizuta, Ikuko; Norose, Kazumi; Mizuno, Toshiki

2018-05-15

A 65-year-old woman with rheumatoid arthritis (RA) visited our hospital because of right facial sensory hypoesthesia. Cerebral toxoplasmosis was suspected on brain magnetic resonance imaging. We discontinued methotrexate for RA and started a sulfamethoxazole/trimethoprim (ST) mixture. Although ST treatment was interrupted because of adverse reactions, her prognosis was favorable. The Toxoplasma 18S rDNA gene was detected by nested-polymerase chain reaction (PCR) from blood and cerebrospinal fluid. Detecting the Toxoplasma 18S rDNA gene by nested-PCR is useful for the diagnosis and safer than a brain biopsy. In addition, the discontinuation of immunosuppressants may be recommended in patients compromised by those immunosuppressants.

Detection of coliform bacteria and Escherichia coli by multiplex polymerase chain reaction: comparison with defined substrate and plating methods for water quality monitoring.

PubMed Central

Bej, A K; McCarty, S C; Atlas, R M

1991-01-01

Multiplex polymerase chain reaction (PCR) and gene probe detection of target lacZ and uidA genes were used to detect total coliform bacteria and Escherichia coli, respectively, for determining water quality. In tests of environmental water samples, the lacZ PCR method gave results statistically equivalent to those of the plate count and defined substrate methods accepted by the U.S. Environmental Protection Agency for water quality monitoring and the uidA PCR method was more sensitive than 4-methylumbelliferyl-beta-D-glucuronide-based defined substrate tests for specific detection of E. coli. Images PMID:1768116

Nested methylation-specific polymerase chain reaction cancer detection method

DOEpatents

Belinsky, Steven A [Albuquerque, NM; Palmisano, William A [Edgewood, NM

2007-05-08

A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

Vascular endothelial growth factor and platelet-derived growth factor are potential angiogenic and metastatic factors in human breast cancer.

PubMed

Anan, K; Morisaki, T; Katano, M; Ikubo, A; Kitsuki, H; Uchiyama, A; Kuroki, S; Tanaka, M; Torisu, M

1996-03-01

Angiogenesis is a prerequisite for tumor growth and metastasis. Tumor angiogenesis may be mediated by several angiogenic factors such as vascular endothelial growth factor (VEGF), platelet-derived growth factor (PDGF), transforming growth factor-alpha, and basic fibroblast growth factor. Differential mRNA expressions of VEGF, PDGF (A chain), transforming growth factor-alpha and basic fibroblast growth factor in 32 primary invasive breast tumors were examined by reverse transcriptase-polymerase chain reaction. We analyzed relationships between mRNA expressions of these angiogenic factors and the degree of angiogenesis, tumor size, and metastasis. Quantification of angiogenesis was achieved by the immunohistochemical staining of endothelial cells with antibody to CD31. VEGF and PDGF-A mRNAs were expressed more frequently in breast tumors than in nontumor breast tissues, whereas no difference was found in expression frequency of either transforming growth factor-alpha or basic fibroblast growth factor mRNA. Vascular counts in tumors correlated with each expression frequency of VEGF and PDGF-A mRNA. PDGF-A mRNA was expressed more frequently in tumors with lymph node metastasis than in those without metastasis. Expression of VEGF and PDGF mRNAs detected by reverse transcriptase-polymerase chain reaction in breast tumors correlates with tumor-related characteristics of angiogenesis and metastatic potential. Analysis of these mRNAs by reverse transcriptase-polymerase chain reaction may be useful for assessing the biologic behavior of a breast tumor before surgical treatment.

Comparative quantification of human intestinal bacteria based on cPCR and LDR/LCR

PubMed Central

Tang, Zhou-Rui; Li, Kai; Zhou, Yu-Xun; Xiao, Zhen-Xian; Xiao, Jun-Hua; Huang, Rui; Gu, Guo-Hao

2012-01-01

AIM: To establish a multiple detection method based on comparative polymerase chain reaction (cPCR) and ligase detection reaction (LDR)/ligase chain reaction (LCR) to quantify the intestinal bacterial components. METHODS: Comparative quantification of 16S rDNAs from different intestinal bacterial components was used to quantify multiple intestinal bacteria. The 16S rDNAs of different bacteria were amplified simultaneously by cPCR. The LDR/LCR was examined to actualize the genotyping and quantification. Two beneficial (Bifidobacterium, Lactobacillus) and three conditionally pathogenic bacteria (Enterococcus, Enterobacterium and Eubacterium) were used in this detection. With cloned standard bacterial 16S rDNAs, standard curves were prepared to validate the quantitative relations between the ratio of original concentrations of two templates and the ratio of the fluorescence signals of their final ligation products. The internal controls were added to monitor the whole detection flow. The quantity ratio between two bacteria was tested. RESULTS: cPCR and LDR revealed obvious linear correlations with standard DNAs, but cPCR and LCR did not. In the sample test, the distributions of the quantity ratio between each two bacterial species were obtained. There were significant differences among these distributions in the total samples. But these distributions of quantity ratio of each two bacteria remained stable among groups divided by age or sex. CONCLUSION: The detection method in this study can be used to conduct multiple intestinal bacteria genotyping and quantification, and to monitor the human intestinal health status as well. PMID:22294830

Comparative quantification of human intestinal bacteria based on cPCR and LDR/LCR.

PubMed

Tang, Zhou-Rui; Li, Kai; Zhou, Yu-Xun; Xiao, Zhen-Xian; Xiao, Jun-Hua; Huang, Rui; Gu, Guo-Hao

2012-01-21

To establish a multiple detection method based on comparative polymerase chain reaction (cPCR) and ligase detection reaction (LDR)/ligase chain reaction (LCR) to quantify the intestinal bacterial components. Comparative quantification of 16S rDNAs from different intestinal bacterial components was used to quantify multiple intestinal bacteria. The 16S rDNAs of different bacteria were amplified simultaneously by cPCR. The LDR/LCR was examined to actualize the genotyping and quantification. Two beneficial (Bifidobacterium, Lactobacillus) and three conditionally pathogenic bacteria (Enterococcus, Enterobacterium and Eubacterium) were used in this detection. With cloned standard bacterial 16S rDNAs, standard curves were prepared to validate the quantitative relations between the ratio of original concentrations of two templates and the ratio of the fluorescence signals of their final ligation products. The internal controls were added to monitor the whole detection flow. The quantity ratio between two bacteria was tested. cPCR and LDR revealed obvious linear correlations with standard DNAs, but cPCR and LCR did not. In the sample test, the distributions of the quantity ratio between each two bacterial species were obtained. There were significant differences among these distributions in the total samples. But these distributions of quantity ratio of each two bacteria remained stable among groups divided by age or sex. The detection method in this study can be used to conduct multiple intestinal bacteria genotyping and quantification, and to monitor the human intestinal health status as well.

Comparison of Modeling Methods to Determine Liver-to-blood Inocula and Parasite Multiplication Rates During Controlled Human Malaria Infection

PubMed Central

Douglas, Alexander D.; Edwards, Nick J.; Duncan, Christopher J. A.; Thompson, Fiona M.; Sheehy, Susanne H.; O'Hara, Geraldine A.; Anagnostou, Nicholas; Walther, Michael; Webster, Daniel P.; Dunachie, Susanna J.; Porter, David W.; Andrews, Laura; Gilbert, Sarah C.; Draper, Simon J.; Hill, Adrian V. S.; Bejon, Philip

2013-01-01

Controlled human malaria infection is used to measure efficacy of candidate malaria vaccines before field studies are undertaken. Mathematical modeling using data from quantitative polymerase chain reaction (qPCR) parasitemia monitoring can discriminate between vaccine effects on the parasite's liver and blood stages. Uncertainty regarding the most appropriate modeling method hinders interpretation of such trials. We used qPCR data from 267 Plasmodium falciparum infections to compare linear, sine-wave, and normal-cumulative-density-function models. We find that the parameters estimated by these models are closely correlated, and their predictive accuracy for omitted data points was similar. We propose that future studies include the linear model. PMID:23570846

Interpretation of Negative Molecular Test Results in Patients With Suspected or Confirmed Ebola Virus Disease: Report of Two Cases.

PubMed

Edwards, Jeffrey K; Kleine, Christian; Munster, Vincent; Giuliani, Ruggero; Massaquoi, Moses; Sprecher, Armand; Chertow, Daniel S

2015-12-01

Quantitative reverse-transcription polymerase chain reaction (qRT-PCR) is the most sensitive quantitative diagnostic assay for detection of Ebola virus in multiple body fluids. Despite the strengths of this assay, we present 2 cases of Ebola virus disease (EVD) and highlight the potential for false-negative results during the early and late stages of EVD. The first case emphasizes the low negative-predictive value of qRT-PCR during incubation and the early febrile stage of EVD, and the second case emphasizes the potential for false-negative results during recovery and late neurologic complications of EVD. Careful interpretation of test results are needed to guide difficult admission and discharge decisions in suspected or confirmed EVD.

Automation of complex assays: pharmacogenetics of warfarin dosing.

PubMed

Wu, Whei-Kuo; Hujsak, Paul G; Kureshy, Fareed

2007-10-01

AutoGenomics, Inc. (Carlsbad, CA, USA) have developed a multiplex microarray assay for genotyping both VKORC1 and CYP2C9 using the INFINITI(™) Analyzer. Multiple alleles in each DNA sample are analyzed by polymerase chain reaction amplification, followed by detection primer extension using the INFINITI Analyzer. The INFINITI Analyzer performs single-nucleotide polymorphism (SNP) analysis using universal oligonucleotides immobilized on the biochip. To genotype broader ethnic groups, genomic DNA from whole blood was tested for nine SNPs for VKORC1 and six for CYP2C9 genotypes. Information related to all 15 SNPs is needed to determine dosing of population of diverse ethnic origin. The INFINITI system provides genotyping information for same day dosing of warfarin.

Giardia and Cryptosporidium species and genotypes in coyotes (Canis latrans).

PubMed

Trout, James M; Santín, Mónica; Fayer, Ronald

2006-06-01

Feces and duodenal scrapings were collected from 22 coyotes (Canis latrans) killed in managed hunts in northeastern Pennsylvania. Polymerase chain reaction (PCR) methods were used to detect Giardia and Cryptosporidium spp. PCR-amplified fragments of Giardia and Cryptosporidium spp. SSU-rRNA genes were subjected to DNA sequence analysis for species/genotype determination. Seven coyotes (32%) were positive for G. duodenalis: three assemblage C, three assemblage D, and one assemblage B. Six coyotes (27%) were positive for Cryptosporidium spp. One isolate shared 99.7% homology with C. muris, whereas five others (23%) shared 100% homology with C. canis, coyote genotype. This is the first report on multiple genotypes of Giardia spp. in coyotes and on the prevalence of Cryptosporidium spp. genotypes in coyotes.

Multiple lesions by vampire bat bites in a patient in Niterói, Brazil - Case report*

PubMed Central

Bernardes, Fred; Martins, Gustavo; Luchi, Gustavo Sabaini; Kac, Bernard Kawa; Nery, José Augusto da Costa; Azulay-Abulafia, Luna; Azulay, David Rubem

2014-01-01

Over the last few centuries, the expansion of urbanization brought bats closer to urbanized areas, increasing the risk of accidents by bat bites. The morphology of bat bites can be varied, usually having an elliptical shape, about 0.5 cm along its greatest length, and the characteristic corkscrew bite pattern. The authors present the case of a patient who was repeatedly bitten by vampire bats for two months. A polymerase chain reaction was performed in the cutaneous nerves at the base of the hair follicles which showed negativity towards the rabies virus. The authors highlight the public health importance of this case, and discuss the morphological characteristics of these hematophagous bat bites. PMID:24770518

Real-time polymerase chain reaction for diagnosing infectious mononucleosis in pediatric patients: A systematic review and meta-analysis.

PubMed

Jiang, Sha-Yi; Yang, Jing-Wei; Shao, Jing-Bo; Liao, Xue-Lian; Lu, Zheng-Hua; Jiang, Hui

2016-05-01

In this meta-analysis, we evaluated the diagnostic role of Epstein-Barr virus deoxyribonucleic acid detection and quantitation in the serum of pediatric and young adult patients with infectious mononucleosis. The primary outcome of this meta-analysis was the sensitivity and specificity of Epstein-Barr virus (EBV) deoxyribonucleic acid (DNA) detection and quantitation using polymerase chain reaction (PCR). A systematic review and meta-analysis was performed by searching for articles that were published through September 24, 2014 in the following databases: Medline, Cochrane, EMBASE, and Google Scholar. The following keywords were used for the search: "Epstein-Barr virus," "infectious mononucleosis," "children/young adults/infant/pediatric," and "polymerase chain reaction or PCR." Three were included in this analysis. We found that for detection by PCR, the pooled sensitivity for detecting EBV DNA was 77% (95%CI, 66-86%) and the pooled specificity for was 98% (95%CI, 93-100%). Our findings indicate that this PCR-based assay has high specificity and good sensitivity for detecting of EBV DNA, indicating it may useful for identifying patients with infectious mononucleosis. This assay may also be helpful to identify young athletic patients or highly physically active pediatric patients who are at risk for a splenic rupture due to acute infectious mononucleosis. © 2015 Wiley Periodicals, Inc.

Infectious agent screening in canine blood donors in the United Kingdom.

PubMed

Crawford, K; Walton, J; Lewis, D; Tasker, S; Warman, S M

2013-08-01

Transfusion of blood products is an important component of veterinary emergency medicine. Donors must be carefully selected to minimise risk of transmission of blood-borne infectious agents. This study was devised to assess the prevalence of such agents in healthy, non-travelled UK dogs screened as prospective donors. Ethylenediaminetetraacetic acid blood samples from dogs donating blood between August 2007 and January 2012 were screened by polymerase chain reaction for haemotropic mycoplasmas, Bartonella, Babesia, Leishmania, Ehrlichia and Anaplasma spp. Dogs with positive or inconclusive results underwent repeat polymerase chain reaction testing. Four of 262 dogs had positive or inconclusive results at initial screening. Repeat polymerase chain reaction testing in each dog was negative, and none of the dogs developed clinical signs of disease. The positive results on initial screening may have represented false positives from sample contamination or amplification of non-target DNA. It is also possible that dogs were infected at initial sampling but successfully cleared infection before repeat testing. The low number of positive results obtained suggests that prevalence of these agents in a population of healthy UK dogs is low and that use of blood products is unlikely to represent a significant risk of transmission of these diseases. © 2013 British Small Animal Veterinary Association.

Evaluation of revised polymerase chain reaction primers for more inclusive quantification of ammonia-oxidizing archaea and bacteria.

PubMed

Meinhardt, Kelley A; Bertagnolli, Anthony; Pannu, Manmeet W; Strand, Stuart E; Brown, Sally L; Stahl, David A

2015-04-01

Ammonia-oxidizing archaea (AOA) and bacteria (AOB) fill key roles in the nitrogen cycle. Thus, well-vetted methods for characterizing their distribution are essential for framing studies of their significance in natural and managed systems. Quantification of the gene coding for one subunit of the ammonia monooxygenase (amoA) by polymerase chain reaction is frequently employed to enumerate the two groups. However, variable amplification of sequence variants comprising this conserved genetic marker for ammonia oxidizers potentially compromises within- and between-system comparisons. We compared the performance of newly designed non-degenerate quantitative polymerase chain reaction primer sets to existing primer sets commonly used to quantify the amoA of AOA and AOB using a collection of plasmids and soil DNA samples. The new AOA primer set provided improved quantification of model mixtures of different amoA sequence variants and increased detection of amoA in DNA recovered from soils. Although both primer sets for the AOB provided similar results for many comparisons, the new primers demonstrated increased detection in environmental application. Thus, the new primer sets should provide a useful complement to primers now commonly used to characterize the environmental distribution of AOA and AOB. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

Gene transcription in sea otters (Enhydra lutris); development of a diagnostic tool for sea otter and ecosystem health

USGS Publications Warehouse

Bowen, Lizabeth; Miles, A. Keith; Murray, Michael; Haulena, Martin; Tuttle, Judy; van Bonn, William; Adams, Lance; Bodkin, James L.; Ballachey, Brenda E.; Estes, James A.; Tinker, M. Tim; Keister, Robin; Stott, Jeffrey L.

2012-01-01

Gene transcription analysis for diagnosing or monitoring wildlife health requires the ability to distinguish pathophysiological change from natural variation. Herein, we describe methodology for the development of quantitative real-time polymerase chain reaction (qPCR) assays to measure differential transcript levels of multiple immune function genes in the sea otter (Enhydra lutris); sea otter-specific qPCR primer sequences for the genes of interest are defined. We establish a ‘reference’ range of transcripts for each gene in a group of clinically healthy captive and free-ranging sea otters. The 10 genes of interest represent multiple physiological systems that play a role in immuno-modulation, inflammation, cell protection, tumour suppression, cellular stress response, xenobiotic metabolizing enzymes, antioxidant enzymes and cell–cell adhesion. The cycle threshold (CT) measures for most genes were normally distributed; the complement cytolysis inhibitor was the exception. The relative enumeration of multiple gene transcripts in simple peripheral blood samples expands the diagnostic capability currently available to assess the health of sea otters in situ and provides a better understanding of the state of their environment.

Digital PCR Quantitation of Muscle Mitochondrial DNA: Age, Fiber Type, and Mutation-Induced Changes.

PubMed

Herbst, Allen; Widjaja, Kevin; Nguy, Beatrice; Lushaj, Entela B; Moore, Timothy M; Hevener, Andrea L; McKenzie, Debbie; Aiken, Judd M; Wanagat, Jonathan

2017-10-01

Definitive quantitation of mitochondrial DNA (mtDNA) and mtDNA deletion mutation abundances would help clarify the role of mtDNA instability in aging. To more accurately quantify mtDNA, we applied the emerging technique of digital polymerase chain reaction to individual muscle fibers and muscle homogenates from aged rodents. Individual fiber mtDNA content correlated with fiber type and decreased with age. We adapted a digital polymerase chain reaction deletion assay that was accurate in mixing experiments to a mutation frequency of 0.03% and quantitated an age-induced increase in deletion frequency from rat muscle homogenates. Importantly, the deletion frequency measured in muscle homogenates strongly correlated with electron transport chain-deficient fiber abundance determined by histochemical analyses. These data clarify the temporal accumulation of mtDNA deletions that lead to electron chain-deficient fibers, a process culminating in muscle fiber loss. © The Author 2017. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Pyrosequencing-based validation of a simple cell-suspension polymerase chain reaction assay for Campylobacter... of high-processivity polymerase with novel internal amplification controls for rapid and specific detection.

USDA-ARS?s Scientific Manuscript database

Although Campylobacter is an important food-borne human pathogen, there remains a lack of molecular diagnostic assays that are simple to use, cost-effective, and provide rapid results in research, clinical, or regulatory laboratories. Of the numerous Campylobacter assays that do exist, to our knowl...

RNA Polymerase Structure, Function, Regulation, Dynamics, Fidelity, and Roles in GENE EXPRESSION | Center for Cancer Research

Cancer.gov

Multi-subunit RNA polymerases (RNAP) are ornate molecular machines that translocate on a DNA template as they generate a complementary RNA chain. RNAPs are highly conserved in evolution among eukarya, eubacteria, archaea, and some viruses. As such, multi-subunit RNAPs appear to be an irreplaceable advance in the evolution of complex life on earth. Because of their stepwise

Quantitation of Human Papillomavirus DNA in Plasma of Oropharyngeal Carcinoma Patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cao Hongbin; Banh, Alice; Kwok, Shirley

Purpose: To determine whether human papillomavirus (HPV) DNA can be detected in the plasma of patients with HPV-positive oropharyngeal carcinoma (OPC) and to monitor its temporal change during radiotherapy. Methods and Materials: We used polymerase chain reaction to detect HPV DNA in the culture media of HPV-positive SCC90 and VU147T cells and the plasma of SCC90 and HeLa tumor-bearing mice, non-tumor-bearing controls, and those with HPV-negative tumors. We used real-time quantitative polymerase chain reaction to quantify the plasma HPV DNA in 40 HPV-positive OPC, 24 HPV-negative head-and-neck cancer patients and 10 non-cancer volunteers. The tumor HPV status was confirmed bymore » p16{sup INK4a} staining and HPV16/18 polymerase chain reaction or HPV in situ hybridization. A total of 14 patients had serial plasma samples for HPV DNA quantification during radiotherapy. Results: HPV DNA was detectable in the plasma samples of SCC90- and HeLa-bearing mice but not in the controls. It was detected in 65% of the pretreatment plasma samples from HPV-positive OPC patients using E6/7 quantitative polymerase chain reaction. None of the HPV-negative head-and-neck cancer patients or non-cancer controls had detectable HPV DNA. The pretreatment plasma HPV DNA copy number correlated significantly with the nodal metabolic tumor volume (assessed using {sup 18}F-deoxyglucose positron emission tomography). The serial measurements in 14 patients showed a rapid decline in HPV DNA that had become undetectable at radiotherapy completion. In 3 patients, the HPV DNA level had increased to a discernable level at metastasis. Conclusions: Xenograft studies indicated that plasma HPV DNA is released from HPV-positive tumors. Circulating HPV DNA was detectable in most HPV-positive OPC patients. Thus, plasma HPV DNA might be a valuable tool for identifying relapse.« less

Temporal relationships between colds, upper respiratory viruses detected by polymerase chain reaction, and otitis media in young children followed through a typical cold season.

PubMed

Winther, Birgit; Alper, Cuneyt M; Mandel, Ellen M; Doyle, William J; Hendley, J Owen

2007-06-01

Otitis media is a frequent complication of a viral upper respiratory tract infection, and the reported co-incidence of those diseases increases with assay sensitivity and sampling density. We determined the incidence of otitis-media complications in young children when referenced to cold-like illnesses and to concurrent virus recovery from the nasopharynx. A total of 60 children from 24 families were followed from October 2003 through April 30, 2004, by daily parental recording of illness signs, weekly pneumatic otoscopic examinations, and periodic polymerase chain reaction assay of collected nasal fluids for common viruses. One hundred ninety-nine cold-like illnesses were observed, but a sample for virus assay was not collected concurrent with 71 episodes. Of the remainder, 73% of cold-like illnesses were temporally related to recovery of 1 or a combination of the assayed viruses, with rhinovirus predominating. For non-cold-like illness periods, 54 (18%) of 297 assays were positive for virus, and the virus frequency distribution was similar to that for cold-like illnesses. There were 93 diagnosed otitis-media episodes; 65 (70%) of these occurred during a cold-like illness. For the 79 otitis-media episodes with available nasal samples, 61 (77%) were associated with a positive virus result. In this population, the otitis-media complication rate for a cold-like illness was 33%. A cold-like illness was not a prerequisite for polymerase chain reaction detection of viruses in the nose and nasopharynx of young children. Viral detection by polymerase chain reaction in the absence of a cold-like illness is associated with complications in some subjects. Otitis media is a complication of viral infection both with and without concurrent cold-like illnesses, thus downwardly biasing coincidence estimates that use cold-based illnesses as the denominator.

No implication of Simian virus 40 in pathogenesis of malignant pleural mesothelioma in Slovenia.

PubMed

Hmeljak, Julija; Kern, Izidor; Cör, Andrej

2010-01-01

Malignant mesothelioma is predominantly caused by asbestos exposure, although the association of Simian virus 40 in its pathogenesis is currently still under debate. Simian virus 40, a DNA rhesus monkey virus with oncogenic properties, accidentally contaminated early batches of polio vaccine in the 1960s. In the 1990s, viral sequences and proteins were discovered in several human tumors, which triggered research to find a link between Simian virus 40 and human cancers, especially malignant mesothelioma. The aim of our study was to establish an effective laboratory procedure for Simian virus 40 detection and to investigate the presence of Simian virus 40 DNA and small t antigen in mesothelioma samples from Slovenian patients. Paraffin-embedded malignant pleural mesothelioma specimens from 103 Slovenian patients were collected and used for total DNA isolation and real-time polymerase chain reaction for Simian virus 40 small t and large T DNA analysis. Special attention was devoted to primer design, good laboratory practice and polymerase chain reaction contamination prevention. Polymerase chain reaction products were sequenced and BLAST aligned. One 5 microm thick paraffin section from each patient's tissue block was stained with hematoxylin and eosin for histological typing and one for immunohistochemical detection of Simian virus 40 small t antigen using a monoclonal antibody against Simian virus 40 (Pab280). SV40-expressing Wi-38 cells were used as positive control in both PCR and immunohistochemistry. In real-time polymerase chain reaction analyses, only 4 samples gave products with primer pairs amplifying small t antigen and were inconsistent and poorly reproducible. BLAST alignment showed no homology with any deposited SV40 sequences. No immunopositive staining for SV40 small t antigen was found in any of the samples. We found no evidence of SV40 presence in tissue samples from 103 Slovenian patients with malignant pleural mesothelioma. Asbestos exposure remains the main risk factor for malignant pleural mesothelioma in Slovenia.

DNA and RNA polymerase activity in a Moniliophthora perniciosa mitochondrial plasmid and self-defense against oxidative stress.

PubMed

Andrade, B S; Villela-Dias, C; Gomes, D S; Micheli, F; Góes-Neto, A

2013-06-13

Moniliophthora perniciosa (Stahel) Aime and Phillips-Mora is a hemibiotrophic basidiomycete (Agaricales, Tricholomataceae) that causes witches' broom disease in cocoa (Theobroma cacao L.). This pathogen carries a stable integrated invertron-type linear plasmid in its mitochondrial genome that encodes viral-like DNA and RNA polymerases related to fungal senescence and longevity. After culturing the fungus and obtaining its various stages of development in triplicate, we carried out total RNA extraction and subsequent complementary DNA synthesis. To analyze DNA and RNA polymerase expression levels, we performed real-time reverse transcriptase polymerase chain reaction for various fungal phases of development. Our results showed that DNA and RNA polymerase gene expression in the primordium phase of M. perniciosa is related to a potential defense mechanism against T. cacao oxidative attack.

Standardization of a two-step real-time polymerase chain reaction based method for species-specific detection of medically important Aspergillus species.

PubMed

Das, P; Pandey, P; Harishankar, A; Chandy, M; Bhattacharya, S; Chakrabarti, A

2017-01-01

Standardization of Aspergillus polymerase chain reaction (PCR) poses two technical challenges (a) standardization of DNA extraction, (b) optimization of PCR against various medically important Aspergillus species. Many cases of aspergillosis go undiagnosed because of relative insensitivity of conventional diagnostic methods such as microscopy, culture or antigen detection. The present study is an attempt to standardize real-time PCR assay for rapid sensitive and specific detection of Aspergillus DNA in EDTA whole blood. Three nucleic acid extraction protocols were compared and a two-step real-time PCR assay was developed and validated following the recommendations of the European Aspergillus PCR Initiative in our setup. In the first PCR step (pan-Aspergillus PCR), the target was 28S rDNA gene, whereas in the second step, species specific PCR the targets were beta-tubulin (for Aspergillus fumigatus, Aspergillus flavus, Aspergillus terreus), gene and calmodulin gene (for Aspergillus niger). Species specific identification of four medically important Aspergillus species, namely, A. fumigatus, A. flavus, A. niger and A. terreus were achieved by this PCR. Specificity of the PCR was tested against 34 different DNA source including bacteria, virus, yeast, other Aspergillus sp., other fungal species and for human DNA and had no false-positive reactions. The analytical sensitivity of the PCR was found to be 102 CFU/ml. The present protocol of two-step real-time PCR assays for genus- and species-specific identification for commonly isolated species in whole blood for diagnosis of invasive Aspergillus infections offers a rapid, sensitive and specific assay option and requires clinical validation at multiple centers.

Identification of blood meal sources of Lutzomyia longipalpis using polymerase chain reaction-restriction fragment length polymorphism analysis of the cytochrome B gene

PubMed Central

Soares, Vítor Yamashiro Rocha; da Silva, Jailthon Carlos; da Silva, Kleverton Ribeiro; Cruz, Maria do Socorro Pires e; Santos, Marcos Pérsio Dantas; Ribolla, Paulo Eduardo Martins; Alonso, Diego Peres; Coelho, Luiz Felipe Leomil; Costa, Dorcas Lamounier; Costa, Carlos Henrique Nery

2014-01-01

An analysis of the dietary content of haematophagous insects can provide important information about the transmission networks of certain zoonoses. The present study evaluated the potential of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis of the mitochondrial cytochrome B (cytb) gene to differentiate between vertebrate species that were identified as possible sources of sandfly meals. The complete cytb gene sequences of 11 vertebrate species available in the National Center for Biotechnology Information database were digested with Aci I, Alu I, Hae III and Rsa I restriction enzymes in silico using Restriction Mapper software. The cytb gene fragment (358 bp) was amplified from tissue samples of vertebrate species and the dietary contents of sandflies and digested with restriction enzymes. Vertebrate species presented a restriction fragment profile that differed from that of other species, with the exception of Canis familiaris and Cerdocyon thous. The 358 bp fragment was identified in 76 sandflies. Of these, 10 were evaluated using the restriction enzymes and the food sources were predicted for four: Homo sapiens (1), Bos taurus (1) and Equus caballus (2). Thus, the PCR-RFLP technique could be a potential method for identifying the food sources of arthropods. However, some points must be clarified regarding the applicability of the method, such as the extent of DNA degradation through intestinal digestion, the potential for multiple sources of blood meals and the need for greater knowledge regarding intraspecific variations in mtDNA. PMID:24821056

Poly(adenylic acid) complementary DNA real-time polymerase chain reaction in pancreatic ductal juice in patients undergoing pancreaticoduodenectomy.

PubMed

Oliveira-Cunha, Melissa; Byers, Richard J; Siriwardena, Ajith K

2010-03-01

There is a need to develop methods of early diagnosis for pancreatic cancer. Pancreatic juice is easily collected by endoscopic retrograde cholangiopancreatography and may facilitate diagnosis using molecular markers. The aim of this work was to explore the feasibility of measurement of gene expression in RNA isolated from ductal juice. Intraoperative sampling of pancreatic juice was undertaken in 27 patients undergoing pancreaticoduodenectomy for suspected tumor. Total RNA was extracted and used as template for poly(adenylic acid) (poly[A]) polymerase chain reaction (PCR) to generate a globally amplified complementary DNA pool representative of all expressed messenger RNAs. Real-time PCR was performed for trefoil factor 2 (TFF2), carboxypeptidase B1 (CPB1), and kallikrein-related peptidase 3 (KLK3) in a subset of samples; all samples were normalized for 3 reference genes (glyceraldehyde-3-phosphate dehydrogenase [GAPDH], PSMB6, and beta-2-microglobulin [B2M]). The median volume of the pancreatic juice obtained was 1245 microL (range, 50-5000 microL). The RNA integrity number ranged from 1.9 to 10. Reverse transcriptase PCR was positive for pancreas-specific genes (TFF2 and CPB1) and negative for prostatic-specific antigen in all samples. These results demonstrate that RNA analysis of pancreatic juice is feasible using a combination of poly(A) PCR and real-time PCR. In addition, the poly(A) complementary DNA generated can be probed for multiple genes and is indefinitely renewable, thereby representing a molecular block of importance for future research.

Detection of common diarrhea-causing pathogens in Northern Taiwan by multiplex polymerase chain reaction.

PubMed

Huang, Shu-Huan; Lin, Yi-Fang; Tsai, Ming-Han; Yang, Shuan; Liao, Mei-Ling; Chao, Shao-Wen; Hwang, Cheng-Cheng

2018-06-01

Conventional methods for identifying gastroenteritis pathogens are time consuming, more likely to result in a false-negative, rely on personnel with diagnostic expertise, and are dependent on the specimen status. Alternatively, molecular diagnostic methods permit the rapid, simultaneous detection of multiple pathogens with high sensitivity and specificity. The present study compared conventional methods with the Luminex xTAG Gastrointestinal Pathogen Panel (xTAG GPP) for the diagnosis of infectious gastroenteritis in northern Taiwan. From July 2015 to April 2016, 217 clinical fecal samples were collected from patients with suspected infectious gastroenteritis. All specimens were tested using conventional diagnostic techniques following physicians' orders as well as with the xTAG GPP. The multiplex polymerase chain reaction (PCR) approach detected significantly more positive samples with bacterial, viral, and/or parasitic infections as compared to conventional analysis (55.8% vs 40.1%, respectively; P < .001). Moreover, multiplex PCR could detect Escherichia coli O157, enterotoxigenic E coli, Shiga-like toxin-producing E coli, Cryptosporidium, and Giardia, which were undetectable by conventional methods. Furthermore, 48 pathogens in 23 patients (10.6%) with coinfections were identified only using the multiplex PCR approach. Of which, 82.6% were from pediatric patients. Because the detection rates using multiplex PCR are higher than conventional methods, and some pediatric pathogens could only be detected by multiplex PCR, this approach may be useful in rapidly diagnosing diarrheal disease in children and facilitating treatment initiation. Further studies are necessary to determine if multiplex PCR improves patient outcomes and reduces costs.

Detection of common diarrhea-causing pathogens in Northern Taiwan by multiplex polymerase chain reaction

PubMed Central

Huang, Shu-Huan; Lin, Yi-Fang; Tsai, Ming-Han; Yang, Shuan; Liao, Mei-Ling; Chao, Shao-Wen; Hwang, Cheng-Cheng

2018-01-01

Abstract Conventional methods for identifying gastroenteritis pathogens are time consuming, more likely to result in a false-negative, rely on personnel with diagnostic expertise, and are dependent on the specimen status. Alternatively, molecular diagnostic methods permit the rapid, simultaneous detection of multiple pathogens with high sensitivity and specificity. The present study compared conventional methods with the Luminex xTAG Gastrointestinal Pathogen Panel (xTAG GPP) for the diagnosis of infectious gastroenteritis in northern Taiwan. From July 2015 to April 2016, 217 clinical fecal samples were collected from patients with suspected infectious gastroenteritis. All specimens were tested using conventional diagnostic techniques following physicians’ orders as well as with the xTAG GPP. The multiplex polymerase chain reaction (PCR) approach detected significantly more positive samples with bacterial, viral, and/or parasitic infections as compared to conventional analysis (55.8% vs 40.1%, respectively; P < .001). Moreover, multiplex PCR could detect Escherichia coli O157, enterotoxigenic E coli, Shiga-like toxin-producing E coli, Cryptosporidium, and Giardia, which were undetectable by conventional methods. Furthermore, 48 pathogens in 23 patients (10.6%) with coinfections were identified only using the multiplex PCR approach. Of which, 82.6% were from pediatric patients. Because the detection rates using multiplex PCR are higher than conventional methods, and some pediatric pathogens could only be detected by multiplex PCR, this approach may be useful in rapidly diagnosing diarrheal disease in children and facilitating treatment initiation. Further studies are necessary to determine if multiplex PCR improves patient outcomes and reduces costs. PMID:29879060

Isolation and characterization of alternatively spliced variants of the mouse sigma1 receptor gene, Sigmar1.

PubMed

Pan, Ling; Pasternak, David A; Xu, Jin; Xu, Mingming; Lu, Zhigang; Pasternak, Gavril W; Pan, Ying-Xian

2017-01-01

The sigma1 receptor acts as a chaperone at the endoplasmic reticulum, associates with multiple proteins in various cellular systems, and involves in a number of diseases, such as addiction, pain, cancer and psychiatric disorders. The sigma1 receptor is encoded by the single copy SIGMAR1 gene. The current study identifies five alternatively spliced variants of the mouse sigma1 receptor gene using a polymerase chain reaction cloning approach. All the splice variants are generated by exon skipping or alternative 3' or 5' splicing, producing the truncated sigma1 receptor. Similar alternative splicing has been observed in the human SIGMAR1 gene based on the molecular cloning or genome sequence prediction, suggesting conservation of alternative splicing of SIGMAR1 gene. Using quantitative polymerase chain reactions, we demonstrate differential expression of several splice variants in mouse tissues and brain regions. When expressed in HEK293 cells, all the splice variants fail to bind sigma ligands, implicating that each truncated region in these splice variants is important for ligand binding. However, co-immunoprecipitation (Co-IP) study in HEK293 cells co-transfected with tagged constructs reveals that all the splice variants maintain their ability to physically associate with a mu opioid receptor (mMOR-1), providing useful information to correlate the motifs/sequences necessary for their physical association. Furthermore, a competition Co-IP study showed that all the variants can disrupt in a dose-dependent manner the dimerization of the original sigma1 receptor with mMOR-1, suggesting a potential dominant negative function and providing significant insights into their function.

Cloning and Expression Analysis of a PISTILLATA Homologous Gene from Pineapple (Ananas comosus L. Merr)

PubMed Central

Lv, Ling-Ling; Duan, Jun; Xie, Jiang-Hui; Liu, Yu-Ge; Wei, Chang-Bin; Liu, Sheng-Hui; Zhang, Jian-Xia; Sun, Guang-Ming

2012-01-01

PISTILLATA (PI)-like genes are crucial regulators of flowering in angiosperms. A homologue of PI, designated as AcPI (Genbank accession number HQ717796), was isolated from pineapple cultivar Comte de Paris by reverse transcriptase polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). The cDNA sequence of AcPI is 907 bp in length and contains an open reading frame of 594 bp, which encodes a protein of 197 amino acids. The molecular weight was 2.29 kDa and the isoelectric point was 9.28. The alignment showed that AcPI had a high identity with CsPIC2 (78.6%), AoPI (77.4%), OrcPI (75.7%) and HPI2 (72.4%). Quantitative real-time polymerase chain reaction (qRT-PCR) analyses in different tissues showed that the expression pattern of AcPI was different from the B-class genes in eudicots. AcPI was expressed in all the tissues investigated. The expression level was very low in fruit stems, bracts, leaves and sepals, high in petals and carpels, and moderate in apical meristems, flesh and stamens. The qRT-PCR analyses in different stages indicated that the expression of AcPI reached the highest level at 40 days after flower inducement, when the multiple fruit and floral organs were forming. It proved the important role of AcPI in floral organs and fruit development. The 35S::AcPI transgenic Arabidopsis plants flowered earlier and had more inflorescences or branches than wild type plants. PMID:22312303

Cloning and expression analysis of a PISTILLATA homologous gene from pineapple (Ananas comosus L. Merr).

PubMed

Lv, Ling-Ling; Duan, Jun; Xie, Jiang-Hui; Liu, Yu-Ge; Wei, Chang-Bin; Liu, Sheng-Hui; Zhang, Jian-Xia; Sun, Guang-Ming

2012-01-01

PISTILLATA (PI)-like genes are crucial regulators of flowering in angiosperms. A homologue of PI, designated as AcPI (Genbank accession number HQ717796), was isolated from pineapple cultivar Comte de Paris by reverse transcriptase polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). The cDNA sequence of AcPI is 907 bp in length and contains an open reading frame of 594 bp, which encodes a protein of 197 amino acids. The molecular weight was 2.29 kDa and the isoelectric point was 9.28. The alignment showed that AcPI had a high identity with CsPIC2 (78.6%), AoPI (77.4%), OrcPI (75.7%) and HPI2 (72.4%). Quantitative real-time polymerase chain reaction (qRT-PCR) analyses in different tissues showed that the expression pattern of AcPI was different from the B-class genes in eudicots. AcPI was expressed in all the tissues investigated. The expression level was very low in fruit stems, bracts, leaves and sepals, high in petals and carpels, and moderate in apical meristems, flesh and stamens. The qRT-PCR analyses in different stages indicated that the expression of AcPI reached the highest level at 40 days after flower inducement, when the multiple fruit and floral organs were forming. It proved the important role of AcPI in floral organs and fruit development. The 35S::AcPI transgenic Arabidopsis plants flowered earlier and had more inflorescences or branches than wild type plants.

A multiplex real-time polymerase chain reaction assay with two internal controls for the detection of Brucella species in tissues, blood, and feces from marine mammals.

PubMed

Sidor, Inga F; Dunn, J Lawrence; Tsongalis, Gregory J; Carlson, Jolene; Frasca, Salvatore

2013-01-01

Brucellosis has emerged as a disease of concern in marine mammals in the last 2 decades. Molecular detection techniques have the potential to address limitations of other methods for detecting infection with Brucella in these species. Presented herein is a real-time polymerase chain reaction (PCR) method targeting the Brucella genus-specific bcsp31 gene. The method also includes a target to a conserved region of the eukaryotic mitochondrial 16S ribosomal RNA gene to assess suitability of extracted DNA and a plasmid-based internal control to detect failure of PCR due to inhibition. This method was optimized and validated to detect Brucella spp. in multiple sample matrices, including fresh or frozen tissue, blood, and feces. The analytical limit of detection was low, with 95% amplification at 24 fg, or an estimated 7 bacterial genomic copies. When Brucella spp. were experimentally added to tissue or fecal homogenates, the assay detected an estimated 1-5 bacteria/µl. An experiment simulating tissue autolysis showed relative persistence of bacterial DNA compared to host mitochondrial DNA. When used to screen 1,658 field-collected marine mammal tissues in comparison to microbial culture, diagnostic sensitivity and specificity were 70.4% and 98.3%, respectively. In addition to amplification in fresh and frozen tissues, Brucella spp. were detected in feces and formalin-fixed, paraffin-embedded tissues from culture-positive animals. Results indicate the utility of this real-time PCR for the detection of Brucella spp. in marine species, which may have applications in surveillance or epidemiologic investigations.

Detection of a putative novel adenovirus by PCR amplification, sequencing and phylogenetic characterisation of two gene fragments from formalin-fixed paraffin-embedded tissues of a cat diagnosed with disseminated adenovirus disease.

PubMed

Lakatos, Béla; Hornyák, Ákos; Demeter, Zoltán; Forgách, Petra; Kennedy, Frances; Rusvai, Miklós

2017-12-01

Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in formalin-fixed paraffin-embedded tissue samples of a cat that had suffered from disseminated adenovirus infection. The identity of the amplified products from the hexon and DNA-dependent DNA polymerase genes was confirmed by DNA sequencing. The sequences were clearly distinguishable from corresponding hexon and polymerase sequences of other mastadenoviruses, including human adenoviruses. These results suggest the possible existence of a distinct feline adenovirus.

[Applying competitive polymerase chain reaction to the detection of hepatitis B virus DNA].

PubMed

Wang, Ling; Yang, Peng; Li, Shuang-qing; Xu, Shu-hui; Cao, Gui-qun; Zhang, Fa-qiang; Zhang, Mei-xia; Chen, Qing-ying; Xia, Qing-jie; Liu, Kai; Tang, Fang; Zhang, Yuan-zheng

2004-11-01

To reduce the rate of accidental false negative result in the HBV DNA PCR test on clinical serum samples. A competitive polymerase chain reaction (C-PCR) was used to decrease the false negative ratio. In the C-PCR, a constructed inner control DNA was added for co-amplification with the HBV target DNA. In a 20 microl C-PCR system, about 60 to 200 copies of inner control DNA could give apparent co-amplification signal band after electrophoresis on a 2% agarose gel. Five of 120 samples of clinical serum (4.2%) could not be amplified. C-PCR has the advantage of yielding information on false negative in the HBV DNA PCR assay of clinical serum samples.

Cytomegalovirus retinitis after intravitreal bevacizumab injection in an immunocompetent patient.

PubMed

Bae, So Hyun; Kim, Tae Wan; Chung, Hum; Heo, Jang Won

2013-02-01

We report a case of cytomegalovirus (CMV) retinitis after intravitreal bevacizumab injection. A 61-year-old woman with diabetic macular edema developed dense vitritis and necrotizing retinitis 3 weeks after intravitreal bevacizumab injection. A diagnostic vitrectomy was performed. The undiluted vitreous sample acquired by vitrectomy was analyzed by polymerase chain reaction and culture. Polymerase chain reaction of the vitreous was positive for CMV DNA. Other laboratory results did not show evidence of other infectious retinitis and systemic immune dysfunction. Human immunodeficiency virus antibodies were also negative. After systemic administration of ganciclovir, retinitis has resolved and there has been no recurrence of retinitis during the follow-up period of 12 months. Ophthalmologists should be aware of potential risk for CMV retinitis after intravitreal bevacizumab injection.

Detection of Listeria monocytogenes in ready-to-eat food by Step One real-time polymerase chain reaction.

PubMed

Pochop, Jaroslav; Kačániová, Miroslava; Hleba, Lukáš; Lopasovský, L'ubomír; Bobková, Alica; Zeleňáková, Lucia; Stričík, Michal

2012-01-01

The aim of this study was to follow contamination of ready-to-eat food with Listeria monocytogenes by using the Step One real time polymerase chain reaction (PCR). We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and MicroSEQ® Listeria monocytogenes Detection Kit for the real-time PCR performance. In 30 samples of ready-to-eat milk and meat products without incubation we detected strains of Listeria monocytogenes in five samples (swabs). Internal positive control (IPC) was positive in all samples. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in ready-to-eat food without incubation.

Sexing chick mRNA: A protocol based on quantitative real-time polymerase chain reaction.

PubMed

Wan, Z; Lu, Y; Rui, L; Yu, X; Li, Z

2017-03-01

The accurate identification of sex in birds is important for research on avian sex determination and differentiation. Polymerase chain reaction (PCR)-based methods have been widely applied for the molecular sexing of birds. However, these methods have used genomic DNA. Here, we present the first sexing protocol for chick mRNA based on real-time quantitative PCR. We demonstrate that this method can accurately determine sex using mRNA from chick gonads and other tissues, such as heart, liver, spleen, lung, and muscle. The strategy of this protocol also may be suitable for other species in which sex is determined by the inheritance of sex chromosomes (ZZ male and ZW female). © 2016 Poultry Science Association Inc.

Plague in a Pediatric Patient: Case Report and Use of Polymerase Chain Reaction as a Diagnostic Aid.

PubMed

Drummond, Wendi K; Nelson, Christina A; Fowler, Joe; Epson, Erin E; Mead, Paul S; Lawaczeck, Elisabeth W

2014-12-01

We report a case of bubonic plaque in a 7-year-old patient who presented with a core temperature of 107°F, seizures, vomiting, altered mental status, and septic shock. This case highlights the utility of polymerase chain reaction (PCR) as a diagnostic aid for rapid presumptive identification of Yersinia pestis as well as the importance of correlating PCR results with clinical data. We discuss the various manifestations of plague as they relate to infection control, postexposure prophylaxis, antimicrobial therapy, and treatment duration. © The Author 2014. Published by Oxford University Press on behalf of the Pediatric Infectious Diseases Society. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Reverse Transcription Quantitative Polymerase Chain Reaction for Detection of and Differentiation Between RNA and DNA of HIV-1-Based Lentiviral Vectors.

PubMed

Pavlovic, Melanie; Koehler, Nina; Anton, Martina; Dinkelmeier, Anna; Haase, Maren; Stellberger, Thorsten; Busch, Ulrich; Baiker, Armin E

2017-08-01

The purpose of the described method is the detection of and differentiation between RNA and DNA of human immunodeficiency virus (HIV)-derived lentiviral vectors (LV) in cell culture supernatants and swab samples. For the analytical surveillance of genetic engineering, operations methods for the detection of the HIV-1-based LV generations are required. Furthermore, for research issues, it is important to prove the absence of LV particles for downgrading experimental settings in terms of the biosafety level. Here, a quantitative polymerase chain reaction method targeting the long terminal repeat U5 subunit and the start sequence of the packaging signal ψ is described. Numerous controls are included in order to monitor the technical procedure.

[DIAGNOSTIC VALUE OF COMBINED USE OF COMBINED METHOD OF ENZYME IMMUNOASSAY AND POLYMERASE CHAIN REACTION TO DETECT OF INTRAUTERINE FETAL INFECTION BY PARVOVIRUS B19].

PubMed

Bondarenko, N P; Lakatosh, V P; Lakatosh, P V; Malanchuk, O B; Poladich, I V

2015-01-01

The combined method of diagnosis parvovirus infection during pregnancy by maternal serum enzyme immunoassay and deoxyribonucleic acid isolation parvovirus B19 polymerase chain reaction in amnniotic fluid and fetal cord blood newborns, can diagnose vertical transmission and anticipate a negative effect on the fetus parvovirus. Lack of maternal IgM antibodies in serum due to parvovirus seroconversion during pregnancy does not exclude the persistence of the virus in the fetus. To analyze the diagnostic value of the method for determining the LHP parvovirus B19 DNA in the amniotic fluid, umbilical cord blood of newborns to determine vertical transmission of parvovirus infection when infected mothers B19 during pregnancy.

Oligonucleotide microarray analysis of gene expression profiles followed by real-time reverse-transcriptase polymerase chain reaction assay in chronic active Epstein-Barr virus infection.

PubMed

Ito, Yoshinori; Shibata-Watanabe, Yukiko; Ushijima, Yoko; Kawada, Jun-Ichi; Nishiyama, Yukihiro; Kojima, Seiji; Kimura, Hiroshi

2008-03-01

Chronic active Epstein-Barr virus infection (CAEBV) is characterized by recurrent infectious mononucleosis-like symptoms and has high mortality and morbidity. To clarify the mechanisms of CAEBV, the gene-expression profiles of peripheral blood obtained from patients with CAEBV were investigated. Twenty genes were differentially expressed in 4 patients with CAEBV. This microarray result was verified using a real-time reverse-transcriptase polymerase chain reaction assay in a larger group of patients with CAEBV. Eventually, 3 genes were found to be significantly upregulated: guanylate binding protein 1, tumor necrosis factor-induced protein 6, and guanylate binding protein 5. These genes may be associated with the inflammatory reaction or with cell proliferation.

A case of Pitt-Hopkins syndrome with absence of hyperventilation.

PubMed

Inati, Adlette; Abbas, Hussein A; Korjian, Serge; Daaboul, Yazan; Harajeily, Mohamad; Saab, Raya

2013-12-01

Pitt-Hopkins syndrome is characterized by mental retardation, hyperventilation, and dysmorphic features due to TCF4 mutations. We report a case of Pitt-Hopkins syndrome in a 2½-year-old boy presenting with psychomotor retardation, recurrent respiratory tract infections, and dysmorphic features with absence of hyperventilation or other breathing abnormalities. Comparative genomic hybridization and quantitative real-time polymerase chain reaction were used to confirm TCF4 haploinsufficiency. Pitt-Hopkins syndrome is a rare debilitating disease that should be in the differential diagnosis of other neurodevelopmental disorders characterized by mental retardation and hypotonicity despite the absence of hyperapnea and seizures. Quantitative real-time polymerase chain reaction is another method to identify TCF4 and to confirm Pitt-Hopkins syndrome diagnosis.

Multiplex polymerase chain reaction assay for the detection of minute virus of mice and mouse parvovirus infections in laboratory mice.

PubMed

Wang, K W; Chueh, L L; Wang, M H; Huang, Y T; Fang, B H; Chang, C Y; Fang, M C; Chou, J Y; Hsieh, S C; Wan, C H

2013-04-01

Mouse parvoviruses are among the most prevalent infectious pathogens in contemporary mouse colonies. To improve the efficiency of routine screening for mouse parvovirus infections, a multiplex polymerase chain reaction (PCR) assay targeting the VP gene was developed. The assay detected minute virus of mice (MVM), mouse parvovirus (MPV) and a mouse housekeeping gene (α-actin) and was able to specifically detect MVM and MPV at levels as low as 50 copies. Co-infection with the two viruses with up to 200-fold differences in viral concentrations can easily be detected. The multiplex PCR assay developed here could be a useful tool for monitoring mouse health and the viral contamination of biological materials.

Recombinase Polymerase Amplification Compared to Real-Time Polymerase Chain Reaction Test for the Detection of Fasciola hepatica in Human Stool

PubMed Central

Cabada, Miguel M.; Malaga, Jose L.; Castellanos-Gonzalez, Alejandro; Bagwell, Kelli A.; Naeger, Patrick A.; Rogers, Hayley K.; Maharsi, Safa; Mbaka, Maryann; White, A. Clinton

2017-01-01

Fasciola hepatica is the most widely distributed trematode infection in the world. Control efforts may be hindered by the lack of diagnostic capacity especially in remote endemic areas. Polymerase chain reaction (PCR)–based methods offer high sensitivity and specificity but require expensive technology. However, the recombinase polymerase amplification (RPA) is an efficient isothermal method that eliminates the need for a thermal cycler and has a high deployment potential to resource-limited settings. We report on the characterization of RPA and PCR tests to detect Fasciola infection in clinical stool samples with low egg burdens. The sensitivity of the RPA and PCR were 87% and 66%, respectively. Both tests were 100% specific showing no cross-reactivity with trematode, cestode, or nematode parasites. In addition, RPA and PCR were able to detect 47% and 26% of infections not detected by microscopy, respectively. The RPA adapted to a lateral flow platform was more sensitive than gel-based detection of the reaction products. In conclusion, the Fasciola RPA is a highly sensitive and specific test to diagnose chronic infection using stool samples. The Fasciola RPA lateral flow has the potential for deployment to endemic areas after further characterization. PMID:27821691

Clinical update for the diagnosis and treatment of Clostridium difficile infection

PubMed Central

IV, Edward C Oldfield; III, Edward C Oldfield; Johnson, David A

2014-01-01

Clostridium difficile infection (CDI) presents a rapidly evolving challenge in the battle against hospital-acquired infections. Recent advances in CDI diagnosis and management include rapid changes in diagnostic approach with the introduction of newer tests, such as detection of glutamate dehydrogenase in stool and polymerase chain reaction to detect the gene for toxin production, which will soon revolutionize the diagnostic approach to CDI. New medications and multiple medical society guidelines have introduced changing concepts in the definitions of severity of CDI and the choice of therapeutic agents, while rapid expansion of data on the efficacy of fecal microbiota transplantation heralds a revolutionary change in the management of patients suffering multiple relapses of CDI. Through a comprehensive review of current medical literature, this article aims to offer an intensive review of the current state of CDI diagnosis, discuss the strengths and limitations of available laboratory tests, compare both current and future treatments options and offer recommendations for best practice strategies. PMID:24729930

Detection of Papillomavirus DNA in Cutaneous Squamous Cell Carcinoma and Multiple Papillomas in Captive Reptiles.

PubMed

Eleni, C; Corteggio, A; Altamura, G; Meoli, R; Cocumelli, C; Rossi, G; Friedrich, K G; Di Cerbo, P; Borzacchiello, G

2017-07-01

Papillomaviruses (PVs) are small, non-enveloped DNA viruses that cause mucocutaneous tumours including squamous cell carcinoma (SCC) in man. In animals, evidence supports a causal role for PVs in the development of cutaneous and oral SCC in some species. In reptiles, three cases of papilloma or fibropapilloma have been associated with PV infection, but no association has been reported to date with SCC. Two cases of cutaneous epithelial tumours, multiple papillomas in a spiny-tailed lizard (Uromastyx acanthinura) and SCC in a Dumeril's boa (Acrantophis dumerili), were investigated by polymerase chain reaction. PV DNA was amplified from samples of both lesions. Typical microscopical features suggestive of PV infection (e.g. the presence of koilocytes) were observed in the lesions from the spiny-tailed lizard. This is the first report of an association between PV and SCC in reptiles. Further studies are needed to better clarify the role of PVs in these species and to characterize the PV strains involved. Copyright © 2017 Elsevier Ltd. All rights reserved.

In vivo bioluminescence imaging of cell differentiation in biomaterials: a platform for scaffold development.

PubMed

Bagó, Juli R; Aguilar, Elisabeth; Alieva, Maria; Soler-Botija, Carolina; Vila, Olaia F; Claros, Silvia; Andrades, José A; Becerra, José; Rubio, Nuria; Blanco, Jerónimo

2013-03-01

In vivo testing is a mandatory last step in scaffold development. Agile longitudinal noninvasive real-time monitoring of stem cell behavior in biomaterials implanted in live animals should facilitate the development of scaffolds for tissue engineering. We report on a noninvasive bioluminescence imaging (BLI) procedure for simultaneous monitoring of changes in the expression of multiple genes to evaluate scaffold performance in vivo. Adipose tissue-derived stromal mensenchymal cells were dually labeled with Renilla red fluorescent protein and firefly green fluorescent protein chimeric reporters regulated by cytomegalovirus and tissue-specific promoters, respectively. Labeled cells were induced to differentiate in vitro and in vivo, by seeding in demineralized bone matrices (DBMs) and monitored by BLI. Imaging results were validated by RT-polymerase chain reaction and histological procedures. The proposed approach improves molecular imaging and measurement of changes in gene expression of cells implanted in live animals. This procedure, applicable to the simultaneous analysis of multiple genes from cells seeded in DBMs, should facilitate engineering of scaffolds for tissue repair.

In Vivo Bioluminescence Imaging of Cell Differentiation in Biomaterials: A Platform for Scaffold Development

PubMed Central

Bagó, Juli R.; Aguilar, Elisabeth; Alieva, Maria; Soler-Botija, Carolina; Vila, Olaia F.; Claros, Silvia; Andrades, José A.; Becerra, José; Rubio, Nuria

2013-01-01

In vivo testing is a mandatory last step in scaffold development. Agile longitudinal noninvasive real-time monitoring of stem cell behavior in biomaterials implanted in live animals should facilitate the development of scaffolds for tissue engineering. We report on a noninvasive bioluminescence imaging (BLI) procedure for simultaneous monitoring of changes in the expression of multiple genes to evaluate scaffold performance in vivo. Adipose tissue-derived stromal mensenchymal cells were dually labeled with Renilla red fluorescent protein and firefly green fluorescent protein chimeric reporters regulated by cytomegalovirus and tissue-specific promoters, respectively. Labeled cells were induced to differentiate in vitro and in vivo, by seeding in demineralized bone matrices (DBMs) and monitored by BLI. Imaging results were validated by RT-polymerase chain reaction and histological procedures. The proposed approach improves molecular imaging and measurement of changes in gene expression of cells implanted in live animals. This procedure, applicable to the simultaneous analysis of multiple genes from cells seeded in DBMs, should facilitate engineering of scaffolds for tissue repair. PMID:23013334

Detection of multiple enteric virus strains within a foodborne outbreak of gastroenteritis: an indication of the source of contamination.

PubMed Central

Gallimore, C. I.; Pipkin, C.; Shrimpton, H.; Green, A. D.; Pickford, Y.; McCartney, C.; Sutherland, G.; Brown, D. W. G.; Gray, J. J.

2005-01-01

An outbreak of acute gastroenteritis of suspected viral aetiology occurred in April 2003 in the British Royal Fleet Auxiliary ship (RFA) Argus deployed in the Northern Arabian Gulf. There were 37 cases amongst a crew of 400 personnel. Of 13 samples examined from cases amongst the crew, six enteric viruses were detected by reverse transcriptase polymerase chain reaction (RT-PCR). Five different viruses were identified including, three norovirus genotypes, a sapovirus and a rotavirus. No multiple infections were detected. A common food source was implicated in the outbreak and epidemiological analysis showed a statistically significant association with salad as the source of the outbreak, with a relative risk of 3.41 (95% confidence interval of 1.7-6.81) of eating salad on a particular date prior to the onset of symptoms. Faecal contamination of the salad at source was the most probable explanation for the diversity of viruses detected and characterized. PMID:15724709

Failure to detect genomic material of HTLV-I or HTLV-II in mononuclear cells of Italian patients with multiple sclerosis and chronic progressive myelopathy.

PubMed

Merelli, E; Sola, P; Marasca, R; Salati, R; Torelli, G

1993-01-01

To contribute to the undecided question if a retrovirus of the human T-cell lymphotropic virus (HTLV) family may be involved in the development of multiple sclerosis (MS), we investigated by the polymerase chain reaction (PCR) the presence of HTLV-I and HTLV-II sequences in the peripheral blood mononuclear cell DNAs from 30 patients affected by MS and 15 by chronic progressive myelopathy. Moreover a control group of 14 blood donors was examined. All these patients were devoid of anti-HTLV-I antibody in the serum and cerebrospinal fluid at ELISA. For the PCR, primers and probes specific for the tax region common to HTLV-I and HTLV-II, for the pol region of HTLV-I, and for the pol region of HTLV-II were used. In spite of the high sensitivity of the technique used, the three groups of subjects were negative for HTLV-I and HTLV-II genomic sequences.

Selection of internal reference genes for normalization of reverse transcription quantitative polymerase chain reaction (RT-qPCR) analysis in the rumen epithelium

USDA-ARS?s Scientific Manuscript database

The rumen is lined on the luminal side by a stratified squamous epithelium that is responsible for not only absorption, but also transport, extensive short-chain fatty acid (SCFA) metabolism and protection. Butyrate has been demonstrated to initiate the differentiation of the tissue following intro...

[THE COMPARATIVE ANALYSIS OF EFFECTIVENESS OF QUICK TESTS IN DIAGNOSTIC OF INFLUENZA AND RESPIRATORY SYNCYTIAL VIRAL INFECTION IN CHILDREN].

PubMed

Petrova, E R; Sukhovetskaia, V P; Pisareva, M M; Maiorova, V G; Sverlova, M V; Danilenko, D M; Petrova, P A; Krivitskaia, V Z; Sominina, A A

2015-11-01

The analysis was implemented concerning diagnostic parameters of commercial quick tests (immune chromatographic tests BinaxNOW Influenza A&B and BinaxNow RSV Alere, Scarborough Inc., USA) under detection of antigens of influenza virus A and respiratory syncytial virus in clinical materials. The polymerase chain reaction in real-time and isolation ofviruses in cell cultures. The analysis of naso-pharyngeal smears from 116 children demonstrated that sensitivity and specifcity of detection of influenza virus A using device mariPOC in comparison with polymerase chain reaction made up to 93.8% and 99.0% correspondingly at total concordance of results of both techniques as 98.3%. At diagnosing of respiratory syncytial virus using device mariPOC parameters made up to 77.3%, 98.9% and 862% as compared with polymerase chain reaction. The sensitivity, specificity and total concordance of results of immune chromatographic tests BinaxNOW in comparison ofpolymerase chain reaction made up to 86.7%, 100% and 96.2% correspondingly at detection of influenza virus A and 80.9%, 97.4% and 91.6% correspondingly at detection of respiratory syncytial virus. In comparison with isolation technique in cell cultures sensitivity of system mariPOC and immune chromatographic tests proved to be in 1.3-1.4 times higher at detection of influenza virus A and in 1.7-2 times higher in case of isolation of respiratory syncytial virus. There is no statistically significant differences between diagnostic parameters received for mariPOC and immune chromatographic tests at diagnosing influenza virus A and respiratory syncytial viral infection.

Comparative sequence analyses of sixteen reptilian paramyxoviruses

USGS Publications Warehouse

Ahne, W.; Batts, W.N.; Kurath, G.; Winton, J.R.

1999-01-01

Viral genomic RNA of Fer-de-Lance virus (FDLV), a paramyxovirus highly pathogenic for reptiles, was reverse transcribed and cloned. Plasmids with significant sequence similarities to the hemagglutinin-neuraminidase (HN) and polymerase (L) genes of mammalian paramyxoviruses were identified by BLAST search. Partial sequences of the FDLV genes were used to design primers for amplification by nested polymerase chain reaction (PCR) and sequencing of 518-bp L gene and 352-bp HN gene fragments from a collection of 15 previously uncharacterized reptilian paramyxoviruses. Phylogenetic analyses of the partial L and HN sequences produced similar trees in which there were two distinct subgroups of isolates that were supported with maximum bootstrap values, and several intermediate isolates. Within each subgroup the nucleotide divergence values were less than 2.5%, while the divergence between the two subgroups was 20-22%. This indicated that the two subgroups represent distinct virus species containing multiple virus strains. The five intermediate isolates had nucleotide divergence values of 11-20% and may represent additional distinct species. In addition to establishing diversity among reptilian paramyxoviruses, the phylogenetic groupings showed some correlation with geographic location, and clearly demonstrated a low level of host species-specificity within these viruses. Copyright (C) 1999 Elsevier Science B.V.

The uncoupling of catalysis and translocation in the viral RNA-dependent RNA polymerase

PubMed Central

Shu, Bo; Gong, Peng

2017-01-01

ABSTRACT The nucleotide addition cycle of nucleic acid polymerases includes 2 major events: the pre-chemistry active site closure leading to the addition of one nucleotide to the product chain; the post-chemistry translocation step moving the polymerase active site one position downstream on its template. In viral RNA-dependent RNA polymerases (RdRPs), structural and biochemical evidences suggest that these 2 events are not tightly coupled, unlike the situation observed in A-family polymerases such as the bacteriophage T7 RNA polymerase. Recently, an RdRP translocation intermediate crystal structure of enterovirus 71 shed light on how translocation may be controlled by elements within RdRP catalytic motifs, and a series of poliovirus apo RdRP crystal structures explicitly suggest that a motif B loop may assist the movement of the template strand in late stages of transcription. Implications of RdRP catalysis-translocation uncoupling and the remaining challenges to further elucidate RdRP translocation mechanism are also discussed. PMID:28277928

Development of polymerase chain reaction-based diagnostic tests for detection of Malsoor virus & adenovirus isolated from Rousettus species of bats in Maharashtra, India.

PubMed

Shete, Anita M; Yadav, Pragya; Kumar, Vimal; Nikam, Tushar; Mehershahi, Kurosh; Kokate, Prasad; Patil, Deepak; Mourya, Devendra T

2017-01-01

Bats are recognized as important reservoirs for emerging infectious disease and some unknown viral diseases. Two novel viruses, Malsoor virus (family Bunyaviridae, genus, Phlebovirus) and a novel adenovirus (AdV) (family, Adenoviridae genus, Mastadenovirus), were identified from Rousettus bats in the Maharashtra State of India. This study was done to develop and optimize real time reverse transcription - polymerase chain reaction (RT-PCR) assays for Malsoor virus and real time and nested PCR for adenovirus from Rousettus bats. For rapid and accurate screening of Malsoor virus and adenovirus a nested polymerase chain reaction and TaqMan-based real-time PCR were developed. Highly conserved region of nucleoprotein gene of phleboviruses and polymerase gene sequence from the Indian bat AdV isolate polyprotein gene were selected respectively for diagnostic assay development of Malsoor virus and AdV. Sensitivity and specificity of assays were calculated and optimized assays were used to screen bat samples. Molecular diagnostic assays were developed for screening of Malsoor virus and AdV and those were found to be specific. Based on the experiments performed with different parameters, nested PCR was found to be more sensitive than real-time PCR; however, for rapid screening, real-time PCR can be used and further nested PCR can be used for final confirmation or in those laboratories where real-time facility/expertise is not existing. This study reports the development and optimization of nested RT-PCR and a TaqMan-based real-time PCR for Malsoor virus and AdV. The diagnostic assays can be used for rapid detection of these novel viruses to understand their prevalence among bat population.

Stochastic model of template-directed elongation processes in biology.

PubMed

Schilstra, Maria J; Nehaniv, Chrystopher L

2010-10-01

We present a novel modular, stochastic model for biological template-based linear chain elongation processes. In this model, elongation complexes (ECs; DNA polymerase, RNA polymerase, or ribosomes associated with nascent chains) that span a finite number of template units step along the template, one after another, with semaphore constructs preventing overtaking. The central elongation module is readily extended with modules that represent initiation and termination processes. The model was used to explore the effect of EC span on motor velocity and dispersion, and the effect of initiation activator and repressor binding kinetics on the overall elongation dynamics. The results demonstrate that (1) motors that move smoothly are able to travel at a greater velocity and closer together than motors that move more erratically, and (2) the rate at which completed chains are released is proportional to the occupancy or vacancy of activator or repressor binding sites only when initiation or activator/repressor dissociation is slow in comparison with elongation. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

Quantitative Tetraplex Real-Time Polymerase Chain Reaction Assay with TaqMan Probes Discriminates Cattle, Buffalo, and Porcine Materials in Food Chain.

PubMed

Hossain, M A Motalib; Ali, Md Eaqub; Sultana, Sharmin; Asing; Bonny, Sharmin Quazi; Kader, Md Abdul; Rahman, M Aminur

2017-05-17

Cattle, buffalo, and porcine materials are widely adulterated, and their quantification might safeguard health, religious, economic, and social sanctity. Recently, conventional polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism (RFLP) assays have been documented but they are just suitable for identification, cannot quantify adulterations. We described here a quantitative tetraplex real-time PCR assay with TaqMan Probes to quantify contributions from cattle, buffalo, and porcine materials simultaneously. Amplicon-sizes were very short (106-, 90-, and 146-bp for cattle, buffalo, and porcine) because longer targets could be broken down, bringing serious ambiguity in molecular diagnostics. False negative detection was eliminated through an endogenous control (141-bp site of eukaryotic 18S rRNA). Analysis of 27 frankfurters and 27 meatballs reflected 84-115% target recovery at 0.1-10% adulterations. Finally, a test of 36 commercial products revealed 71% beef frankfurters, 100% meatballs, and 85% burgers contained buffalo adulteration, but no porcine was found in beef products.

Amplification of ST50 gene using dry-reagent-based polymerase chain reaction for the detection of Salmonella typhi.

PubMed

Aziah, Ismail; Ravichandran, Manickam; Ismail, Asma

2007-12-01

Conventional polymerase chain reaction (PCR) testing requires many pipetting steps and has to be transported and stored in cold chain. To overcome these limitations, we designed a ready-to-use PCR test for Salmonella typhi using PCR reagents, primers against the ST50 gene of S. typhi, a built-in internal amplification control (IAC), and gel loading dye mixed and freeze-dried in a single tube. The 2-step dry-reagent-based assay was used to amplify a 1238-bp target gene and an 810-bp IAC gene from 73 BACTEC blood culture broths (33 true positives for S. typhi and 40 true negatives for non-S. typhi). The sensitivity, specificity, positive predictive value, and negative predictive value of the PCR assay were 87.9%, 100%, 100%, and 90.9%, respectively. We suggest that this rapid 2-step PCR test could be used for the rapid diagnosis of typhoid fever.

Detection of epsilon class switching and IgE synthesis in human B cells.

PubMed

Pène, Jérôme; Guilhot, Florence; Cognet, Isabelle; Guglielmi, Paul; Guay-Giroux, Angélique; Bonnefoy, Jean-Yves; Elson, Greg C; Yssel, Hans; Gauchat, Jean-François

2006-01-01

We observed that mast cells, as other cells expressing the CD40 ligand CD154, can trigger IgE synthesis in B cells in the presence of interleukin (IL)-4. Numerous complementary techniques can be used to follow the succession of molecular events leading to IgE synthesis. This chapter will illustrate how human B cells (naïve or memory) can be purified, stored, and cultivated in medium that is permissive for IgE synthesis and stimulated with IL-4 or IL-13 and CD40 activation, the latter being induced by soluble CD154, anti-CD40 antibodies, or CD154-expressing cells. All these molecules are expressed by mast cells. The quantification of the epsilon-sterile transcript synthesis by polymerase chain reaction or Northern blot, the epsilon excision circles produced during immunoglobulin heavy chain locus rearrangement by polymerase chain reaction, and the IgE production by enzyme-linked immunosorbent assay will be described.

Error Rate Comparison during Polymerase Chain Reaction by DNA Polymerase

DOE PAGES

McInerney, Peter; Adams, Paul; Hadi, Masood Z.

2014-01-01

As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination) by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differences from study to study. We have measured the error rates for 6 DNA polymerases commonly used in PCR applications, including 3 polymerases typically used for cloning applications requiring high fidelity. Error ratemore » measurement values reported here were obtained by direct sequencing of cloned PCR products. The strategy employed here allows interrogation of error rate across a very large DNA sequence space, since 94 unique DNA targets were used as templates for PCR cloning. The six enzymes included in the study, Taq polymerase, AccuPrime-Taq High Fidelity, KOD Hot Start, cloned Pfu polymerase, Phusion Hot Start, and Pwo polymerase, we find the lowest error rates with Pfu , Phusion, and Pwo polymerases. Error rates are comparable for these 3 enzymes and are >10x lower than the error rate observed with Taq polymerase. Mutation spectra are reported, with the 3 high fidelity enzymes displaying broadly similar types of mutations. For these enzymes, transition mutations predominate, with little bias observed for type of transition.« less

Development of a rapid and sensitive one-step reverse transcription-nested polymerase chain reaction in a single tube using the droplet-polymerase chain reaction machine.

PubMed

Yamaguchi, Akemi; Matsuda, Kazuyuki; Sueki, Akane; Taira, Chiaki; Uehara, Masayuki; Saito, Yasunori; Honda, Takayuki

2015-08-25

Reverse transcription (RT)-nested polymerase chain reaction (PCR) is a time-consuming procedure because it has several handling steps and is associated with the risk of cross-contamination during each step. Therefore, a rapid and sensitive one-step RT-nested PCR was developed that could be performed in a single tube using a droplet-PCR machine. The K562 BCR-ABL mRNA-positive cell line as well as bone marrow aspirates from 5 patients with chronic myelogenous leukemia (CML) and 5 controls without CML were used. We evaluated one-step RT-nested PCR using the droplet-PCR machine. One-step RT-nested PCR performed in a single tube using the droplet-PCR machine enabled the detection of BCR-ABL mRNA within 40min, which was 10(3)-fold superior to conventional RT nested PCR using three steps in separate tubes. The sensitivity of the one-step RT-nested PCR was 0.001%, with sample reactivity comparable to that of the conventional assay. One-step RT-nested PCR was developed using the droplet-PCR machine, which enabled all reactions to be performed in a single tube accurately and rapidly and with high sensitivity. This one-step RT-nested PCR may be applicable to a wide spectrum of genetic tests in clinical laboratories. Copyright © 2015 Elsevier B.V. All rights reserved.

A screening method for the detection of the 35S promoter and the nopaline synthase terminator in genetically modified organisms in a real-time multiplex polymerase chain reaction using high-resolution melting-curve analysis.

PubMed

Akiyama, Hiroshi; Nakamura, Fumi; Yamada, Chihiro; Nakamura, Kosuke; Nakajima, Osamu; Kawakami, Hiroshi; Harikai, Naoki; Furui, Satoshi; Kitta, Kazumi; Teshima, Reiko

2009-11-01

To screen for unauthorized genetically modified organisms (GMO) in the various crops, we developed a multiplex real-time polymerase chain reaction high-resolution melting-curve analysis method for the simultaneous qualitative detection of 35S promoter sequence of cauliflower mosaic virus (35SP) and the nopaline synthase terminator (NOST) in several crops. We selected suitable primer sets for the simultaneous detection of 35SP and NOST and designed the primer set for the detection of spiked ColE1 plasmid to evaluate the validity of the polymerase chain reaction (PCR) analyses. In addition, we optimized the multiplex PCR conditions using the designed primer sets and EvaGreen as an intercalating dye. The contamination of unauthorized GMO with single copy similar to NK603 maize can be detected as low as 0.1% in a maize sample. Furthermore, we showed that the present method would be applicable in identifying GMO in various crops and foods like authorized GM soybean, authorized GM potato, the biscuit which is contaminated with GM soybeans and the rice which is contaminated with unauthorized GM rice. We consider this method to be a simple and reliable assay for screening for unauthorized GMO in crops and the processing food products.

Optimization of the elution buffer and concentration method for detecting hepatitis E virus in swine liver using a nested reverse transcription-polymerase chain reaction and real-time reverse transcription-polymerase chain reaction.

PubMed

Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun

2014-09-01

The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.

Epstein-Barr viral load before a liver transplant in children with chronic liver disease.

PubMed

Shakibazad, Nader; Honar, Naser; Dehghani, Seyed Mohsen; Alborzi, Abdolvahab

2014-12-01

Many children with chronic liver disease require a liver transplant. These patients are prone to various infections, including Epstein-Barr virus infection. This study sought to measure the Epstein-Barr viral load by polymerase chain reaction before a liver transplant. This cross-sectional study was done at the Shiraz University of Medical Sciences, Shiraz, Iran, in 2011. All patients were aged younger than 18 years with chronic liver disease and were candidates for a liver transplant at the Shiraz Nemazee Hospital Organ Transplant Center. They had been investigated regarding their demographic characteristics, underlying disease, laboratory findings, and Epstein-Barr viral load by real-time TaqMan polymerase chain reaction. Ninety-eight patients were studied and the mean age was 6.5 ± 5.9 years. Cryptogenic cirrhosis was the most-prevalent reason for liver transplant, and the death rate before a transplant was 15%. Among the study subjects, 6 had measurable Epstein-Barr viral load by polymerase chain reaction before the transplant, and 4 of them had considerably higher Epstein-Barr viral loads (more than 1000 copies/mL). With respect to the close prevalence of posttransplant lymphoproliferative disease (6%) and the high Epstein-Barr viral load in the patients before a transplant (4%), high pretransplant Epstein-Barr viral load can be considered a risk factor for posttransplant lymphoproliferative disorder.

Parvovirus B19 Infection in Children With Arterial Ischemic Stroke.

PubMed

Fullerton, Heather J; Luna, Jorge M; Wintermark, Max; Hills, Nancy K; Tokarz, Rafal; Li, Ying; Glaser, Carol; DeVeber, Gabrielle A; Lipkin, W Ian; Elkind, Mitchell S V

2017-10-01

Case-control studies suggest that acute infection transiently increases the risk of childhood arterial ischemic stroke. We hypothesized that an unbiased pathogen discovery approach utilizing MassTag-polymerase chain reaction would identify pathogens in the blood of childhood arterial ischemic stroke cases. The multicenter international VIPS study (Vascular Effects of Infection in Pediatric Stroke) enrolled arterial ischemic stroke cases, and stroke-free controls, aged 29 days through 18 years. Parental interview included questions on recent infections. In this pilot study, we used MassTag-polymerase chain reaction to test the plasma of the first 161 cases and 34 controls enrolled for a panel of 28 common bacterial and viral pathogens. Pathogen DNA was detected in no controls and 14 cases (8.7%): parvovirus B19 (n=10), herpesvirus 6 (n=2), adenovirus (n=1), and rhinovirus 6C (n=1). Parvovirus B19 infection was confirmed by serologies in all 10; infection was subclinical in 8. Four cases with parvovirus B19 had underlying congenital heart disease, whereas another 5 had a distinct arteriopathy involving a long-segment stenosis of the distal internal carotid and proximal middle cerebral arteries. Using MassTag-polymerase chain reaction, we detected parvovirus B19-a virus known to infect erythrocytes and endothelial cells-in some cases of childhood arterial ischemic stroke. This approach can generate new, testable hypotheses about childhood stroke pathogenesis. © 2017 American Heart Association, Inc.

Single cell digital polymerase chain reaction on self-priming compartmentalization chip

PubMed Central

Zhu, Qiangyuan; Qiu, Lin; Xu, Yanan; Li, Guang; Mu, Ying

2017-01-01

Single cell analysis provides a new framework for understanding biology and disease, however, an absolute quantification of single cell gene expression still faces many challenges. Microfluidic digital polymerase chain reaction (PCR) provides a unique method to absolutely quantify the single cell gene expression, but only limited devices are developed to analyze a single cell with detection variation. This paper describes a self-priming compartmentalization (SPC) microfluidic digital polymerase chain reaction chip being capable of performing single molecule amplification from single cell. The chip can be used to detect four single cells simultaneously with 85% of sample digitization. With the optimized protocol for the SPC chip, we first tested the ability, precision, and sensitivity of our SPC digital PCR chip by assessing β-actin DNA gene expression in 1, 10, 100, and 1000 cells. And the reproducibility of the SPC chip is evaluated by testing 18S rRNA of single cells with 1.6%–4.6% of coefficient of variation. At last, by detecting the lung cancer related genes, PLAU gene expression of A549 cells at the single cell level, the single cell heterogeneity was demonstrated. So, with the power-free, valve-free SPC chip, the gene copy number of single cells can be quantified absolutely with higher sensitivity, reduced labor time, and reagent. We expect that this chip will enable new studies for biology and disease. PMID:28191267

Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples

PubMed Central

Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

2015-01-01

This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449

Combined subtraction hybridization and polymerase chain reaction amplification procedure for isolation of strain-specific Rhizobium DNA sequences.

PubMed Central

Bjourson, A J; Stone, C E; Cooper, J E

1992-01-01

A novel subtraction hybridization procedure, incorporating a combination of four separation strategies, was developed to isolate unique DNA sequences from a strain of Rhizobium leguminosarum bv. trifolii. Sau3A-digested DNA from this strain, i.e., the probe strain, was ligated to a linker and hybridized in solution with an excess of pooled subtracter DNA from seven other strains of the same biovar which had been restricted, ligated to a different, biotinylated, subtracter-specific linker, and amplified by polymerase chain reaction to incorporate dUTP. Subtracter DNA and subtracter-probe hybrids were removed by phenol-chloroform extraction of a streptavidin-biotin-DNA complex. NENSORB chromatography of the sequences remaining in the aqueous layer captured biotinylated subtracter DNA which may have escaped removal by phenol-chloroform treatment. Any traces of contaminating subtracter DNA were removed by digestion with uracil DNA glycosylase. Finally, remaining sequences were amplified by polymerase chain reaction with a probe strain-specific primer, labelled with 32P, and tested for specificity in dot blot hybridizations against total genomic target DNA from each strain in the subtracter pool. Two rounds of subtraction-amplification were sufficient to remove cross-hybridizing sequences and to give a probe which hybridized only with homologous target DNA. The method is applicable to the isolation of DNA and RNA sequences from both procaryotic and eucaryotic cells. Images PMID:1637166

Performance of transport and selective media for swine Bordetella bronchiseptica recovery and it comparison to polymerase chain reaction detection

PubMed Central

Coutinho, Tania Alen; Bernardi, Mari Lourdes; de Itapema Cardoso, Marisa Ribeiro; Borowski, Sandra Maria; Moreno, Andrea Micke; de Barcellos, David Emilio Santos Neves

2009-01-01

Three comparative assays were performed seeking to improve the sensitivity of the diagnosis of Bordetella bronchiseptica infection analyzing swine nasal swabs. An initial assay compared the recovery of B. bronchiseptica from swabs simultaneously inoculated with B. bronchiseptica and some interfering bacteria, immersed into three transport formulations (Amies with charcoal, trypticase soy broth and phosphate buffer according to Soerensen supplemented with 5% of bovine fetal serum) and submitted to different temperatures (10°C and 27°C) and periods of incubation (24, 72 and 120 hours). A subsequent assay compared three selective media (MacConkey agar, modified selective medium G20G and a ceftiofur medium) for their recovery capabilities from clinical specimens. One last assay compared the polymerase chain reaction to the three selective media. In the first assay, the recovery of B. bronchiseptica from transport systems was better at 27°C and the three formulations had good performances at this temperature, but the collection of qualitative and quantitative analysis indicated the advantage of Amies medium for nasal swabs transportation. The second assay indicated that MacConkey agar and modified G20G had similar results and were superior to the ceftiofur medium. In the final assay, polymerase chain reaction presented superior capability of B. bronchiseptica detection to culture procedures. PMID:24031390

Micro-droplet Digital Polymerase Chain Reaction and Real-Time Quantitative Polymerase Chain Reaction Technologies Provide Highly Sensitive and Accurate Detection of Zika Virus.

PubMed

Hui, Yuan; Wu, Zhiming; Qin, Zhiran; Zhu, Li; Liang, Junhe; Li, Xujuan; Fu, Hanmin; Feng, Shiyu; Yu, Jianhai; He, Xiaoen; Lu, Weizhi; Xiao, Weiwei; Wu, Qinghua; Zhang, Bao; Zhao, Wei

2018-06-01

The establishment of highly sensitive diagnostic methods is critical in the early diagnosis and control of Zika virus (ZIKV) and in preventing serious neurological complications of ZIKV infection. In this study, we established micro-droplet digital polymerase chain reaction (ddPCR) and real-time quantitative PCR (RT-qPCR) protocols for the detection of ZIKV based on the amplification of the NS5 gene. For the ZIKV standard plasmid, the RT-qPCR results showed that the cycle threshold (Ct) value was linear from 10 1 to 10 8  copy/μL, with a standard curve R 2 of 0.999 and amplification efficiency of 92.203%; however, a concentration as low as 1 copy/μL could not be detected. In comparison with RT-qPCR, the ddPCR method resulted in a linear range of 10 1 -10 4  copy/μL and was able to detect concentrations as low as 1 copy/μL. Thus, for detecting ZIKV from clinical samples, RT-qPCR is a better choice for high-concentration samples (above 10 1  copy/μL), while ddPCR has excellent accuracy and sensitivity for low-concentration samples. These results indicate that the ddPCR method should be of considerable use in the early diagnosis, laboratory study, and monitoring of ZIKV.

Single cell digital polymerase chain reaction on self-priming compartmentalization chip.

PubMed

Zhu, Qiangyuan; Qiu, Lin; Xu, Yanan; Li, Guang; Mu, Ying

2017-01-01

Single cell analysis provides a new framework for understanding biology and disease, however, an absolute quantification of single cell gene expression still faces many challenges. Microfluidic digital polymerase chain reaction (PCR) provides a unique method to absolutely quantify the single cell gene expression, but only limited devices are developed to analyze a single cell with detection variation. This paper describes a self-priming compartmentalization (SPC) microfluidic digital polymerase chain reaction chip being capable of performing single molecule amplification from single cell. The chip can be used to detect four single cells simultaneously with 85% of sample digitization. With the optimized protocol for the SPC chip, we first tested the ability, precision, and sensitivity of our SPC digital PCR chip by assessing β-actin DNA gene expression in 1, 10, 100, and 1000 cells. And the reproducibility of the SPC chip is evaluated by testing 18S rRNA of single cells with 1.6%-4.6% of coefficient of variation. At last, by detecting the lung cancer related genes, PLAU gene expression of A549 cells at the single cell level, the single cell heterogeneity was demonstrated. So, with the power-free, valve-free SPC chip, the gene copy number of single cells can be quantified absolutely with higher sensitivity, reduced labor time, and reagent. We expect that this chip will enable new studies for biology and disease.

Rapid in vivo testing of drug response in multiple myeloma made possible by xenograft to turkey embryos

PubMed Central

Farnoushi, Y; Cipok, M; Kay, S; Jan, H; Ohana, A; Naparstek, E; Goldstein, R S; Deutsch, V R

2011-01-01

Background: The best current xenograft model of multiple myeloma (MM) in immune-deficient non-obese diabetic/severe-combined immunodeficient mice is costly, animal maintenance is complex and several weeks are required to establish engraftment and study drug efficacy. More practical in vivo models may reduce time and drug development cost. We recently described a rapid low-cost xenograft model of human blood malignancies in pre-immune turkey. Here, we report application of this system for studying MM growth and the preclinical assessment of anticancer therapies. Methods: Cell lines and MM patient cells were injected intravenously into embryonic veins on embryonic day 11 (E11). Engraftment of human cells in haematopoietic organs was detected by quantitative real-time polymerase chain reaction, immunohistochemistry, flow cytometry and circulating free light chain. Results: Engraftment was detected after 1 week in all embryos injected with cell lines and in 50% of those injected with patient cells. Injection of bortezomib or lenalinomide 48 h after cell injection at therapeutic levels that were not toxic to the bone marrow dramatically reduced MM engraftment. Conclusion: The turkey embryo provides a practical, xenograft system to study MM and demonstrates the utility of this model for rapid and affordable testing therapeutics in vivo. With further development, this model may enable rapid, inexpensive personalised drug screening. PMID:22045188

Non-lethal sampling for the detection of Myxobolus cerebralis in asymptomatic rainbow trout

USGS Publications Warehouse

Schill, Bane; Waldrop, Thomas; Densmore, Christine; Blazer, Vicki

1999-01-01

We have described in previous reports (Schill et al., 1998) the development of a polymerase chain reaction (PCR) amplification of 18S ribosomal RNA for the detection of Myxozoan parasites. Oligonucleotide primers were developed by multiple alignment of Myxozoan sequence information and analysis by a custom-written computer program (PRIM). Candidate pairs of primer sequences were then analyzed for specificity by BLAST (Basic Local Alignment Search Tool). From these, a set of promising primers (MYXFWD and MYXREV) was chosen for further testing. These were chosen because they should direct detection of a number of Myxozoan species (Table 1). PCR using MXYFWD and MYXREV proved to be robust and relatively free of artifact products. Further, we were able to routinely detect Myxobolus cerebralis in fish tissues (Figure 1).

Molecular detection of mixed infections with multiple dengue virus serotypes in suspected dengue samples in Tamaulipas, Mexico.

PubMed

Requena-Castro, Rocío; Reyes-López, Miguel Ángel; Rodríguez-Reyna, Rosa Eminé; Palma-Nicolás, Prisco; Bocanegra-García, Virgilio

2017-07-01

This study aimed to detect dengue virus (DENV) serotypes in serum samples obtained in Matamoros Tamaulipas, Mexico, and to determine the concordance of conventional nested reverse transcriptase polymerase chain reaction (RT-PCR) and a serological test [enzyme-linked immunosorbent assay (ELISA NS1)]. Here, we detected mixed infections consisting of four serotypes of DENV. The most prevalent serotype was DENV-1, followed by DENV-4. This is the first report of DENV-4 in our region. Mixed infections were also detected in 21.5% of samples, and the predominant coinfection consisted of DENV-1 and DENV-2. Therefore, continuous epidemiological surveillance of DENV in this area is required to predict future forms of dengue heterologous infections and the effect of this on health care.

Fast growing penis ulcer: an unusual coincidence.

PubMed

Brunasso, Alexandra Maria Giovanna; Bandelloni, Roberto; Massone, Cesare

2012-07-01

A 57-year-old man was seen with a 2-week history of progressive enlargement of an asymptomatic genital ulcer associated with bilateral inguinal lymphadenomegaly. Multiple unprotected heterosexual contacts were reported. The family doctor misdiagnosed primary syphilis with the following laboratory results: negative findings on the Venereal Disease Research Laboratory test, positive findings on the Treponema pallidum particle agglutination assay (titer 1:1280), and IgM negative on the Treponema pallidum particle agglutination assay. The patient was treated with penicillin G for the diagnosis of indeterminate latent syphilis and initially denied authorization for a skin biopsy. After 2 weeks, fast enlargement of the lesion was documented. He underwent skin biopsy, and the histopathologic examination revealed squamous cell carcinoma, and polymerase chain reaction for human papillomavirus 16 was positive. Copyright © 2012 Elsevier Inc. All rights reserved.

Acute onset of encephalomyelitis with atypical lesions associated with dual infection of Sarcocystis neurona and Toxoplasma gondii in a dog.

PubMed

Gerhold, Richard; Newman, Shelley J; Grunenwald, Caroline M; Crews, Amanda; Hodshon, Amy; Su, Chunlei

2014-10-15

A two-year-old male, neutered, basset hound-beagle mix with progressive neurological impairment was examined postmortem. Grossly, the dog had multiple raised masses on the spinal cord between nerve roots. Microscopically, the dog had protozoal myeloencephalitis. Toxoplasma gondii and Sarcocystis neurona were detected in the CNS by immunohistochemistry and polymerase chain reaction (PCR). Sarcocysts in formalin-fixed muscle were negative for Sarcocystis by PCR. Banked serum was negative for T. gondii using the modified agglutination test, suggesting an acute case of T. gondii infection or immunosuppression; however, no predisposing immunosuppressive diseases, including canine distemper, were found. To the authors' knowledge, this is the first report of dual T. gondii and S. neurona infection in a dog. Published by Elsevier B.V.

Single-Cell RT-PCR in Microfluidic Droplets with Integrated Chemical Lysis.

PubMed

Kim, Samuel C; Clark, Iain C; Shahi, Payam; Abate, Adam R

2018-01-16

Droplet microfluidics can identify and sort cells using digital reverse transcription polymerase chain reaction (RT-PCR) signals from individual cells. However, current methods require multiple microfabricated devices for enzymatic cell lysis and PCR reagent addition, making the process complex and prone to failure. Here, we describe a new approach that integrates all components into a single device. The method enables controlled exposure of isolated single cells to a high pH buffer, which lyses cells and inactivates reaction inhibitors but can be instantly neutralized with RT-PCR buffer. Using our chemical lysis approach, we distinguish individual cells' gene expression with data quality equivalent to more complex two-step workflows. Our system accepts cells and produces droplets ready for amplification, making single-cell droplet RT-PCR faster and more reliable.

The Complete Remission of Acquired Immunodeficiency Syndrome-associated Isolated Central Nervous System Lymphomatoid Granulomatosis: A Case Report and Review of the Literature.

PubMed

Kano, Yasuhiro; Kodaira, Minori; Ushiki, Atsuhito; Kosaka, Makoto; Yamada, Mitsunori; Shingu, Kunihiko; Nishihara, Hiroshi; Hanaoka, Masayuki; Sekijima, Yoshiki

2017-09-15

A 49-year-old man presented with gradually progressive aphasia one month after being diagnosed with acquired immunodeficiency syndrome (AIDS). Brain magnetic resonance imaging showed multiple brain lesions with punctate and linear enhancement. A polymerase chain reaction detected Epstein-Barr virus (EBV) in the patient's cerebrospinal fluid. A diagnosis of isolated central nervous system lymphomatoid granulomatosis (CNS-LYG) was made based on the brain biopsy findings. The complete remission of CNS-LYG was achieved by anti-retroviral therapy (ART) alone. In the present case, the development of AIDS-associated CNS-LYG was considered to have been initiated by the reactivation of EBV in the CNS under immunosuppressive conditions. The patient's condition improved with the reconstitution of the patient's immune system.

Mitochondrial DNA Depletion in Respiratory Chain-Deficient Parkinson Disease Neurons.

PubMed

Grünewald, Anne; Rygiel, Karolina A; Hepplewhite, Philippa D; Morris, Christopher M; Picard, Martin; Turnbull, Doug M

2016-03-01

To determine the extent of respiratory chain abnormalities and investigate the contribution of mtDNA to the loss of respiratory chain complexes (CI-IV) in the substantia nigra (SN) of idiopathic Parkinson disease (IPD) patients at the single-neuron level. Multiple-label immunofluorescence was applied to postmortem sections of 10 IPD patients and 10 controls to quantify the abundance of CI-IV subunits (NDUFB8 or NDUFA13, SDHA, UQCRC2, and COXI) and mitochondrial transcription factors (TFAM and TFB2M) relative to mitochondrial mass (porin and GRP75) in dopaminergic neurons. To assess the involvement of mtDNA in respiratory chain deficiency in IPD, SN neurons, isolated with laser-capture microdissection, were assayed for mtDNA deletions, copy number, and presence of transcription/replication-associated 7S DNA employing a triplex real-time polymerase chain reaction (PCR) assay. Whereas mitochondrial mass was unchanged in single SN neurons from IPD patients, we observed a significant reduction in the abundances of CI and II subunits. At the single-cell level, CI and II deficiencies were correlated in patients. The CI deficiency concomitantly occurred with low abundances of the mtDNA transcription factors TFAM and TFB2M, which also initiate transcription-primed mtDNA replication. Consistent with this, real-time PCR analysis revealed fewer transcription/replication-associated mtDNA molecules and an overall reduction in mtDNA copy number in patients. This effect was more pronounced in single IPD neurons with severe CI deficiency. Respiratory chain dysfunction in IPD neurons not only involves CI, but also extends to CII. These deficiencies are possibly a consequence of the interplay between nDNA and mtDNA-encoded factors mechanistically connected via TFAM. © 2016 The Authors. Annals of Neurology published by Wiley Periodicals, Inc. on behalf of American Neurological Association.

Sequences of heavy and light chain variable regions from four bovine immunoglobulins.

PubMed

Armour, K L; Tempest, P R; Fawcett, P H; Fernie, M L; King, S I; White, P; Taylor, G; Harris, W J

1994-12-01

Oligodeoxyribonucleotide primers based on the 5' ends of bovine IgG1/2 and lambda constant (C) region genes, together with primers encoding conserved amino acids at the N-terminus of mature variable (V) regions from other species, have been used in cDNA and polymerase chain reactions (PCRs) to amplify heavy and light chain V region cDNA from bovine heterohybridomas. The amino acid sequences of VH and V lambda from four bovine immunoglobulins of different specificities are presented.

Detection of cashew nut DNA in spiked baked goods using a real-time polymerase chain reaction method.

PubMed

Brzezinski, Jennifer L

2006-01-01

The detection of potentially allergenic foods, such as tree nuts, in food products is a major concern for the food processing industry. A real-time polymerase chain reaction (PCR) method was designed to determine the presence of cashew DNA in food products. The PCR amplifies a 67 bp fragment of the cashew 2S albumin gene, which is detected with a cashew-specific, dual-labeled TaqMan probe. This reaction will not amplify DNA derived from other tree nut species, such as almond, Brazil nut, hazelnut, and walnut, as well as 4 varieties of peanut. This assay was sensitive enough to detect 5 pg purified cashew DNA as well as cashew DNA in a spiked chocolate cookie sample containing 0.01% (100 mg/kg) cashew.

Polymerase chain reaction identification of three members of the Anopheles sundaicus (Diptera: Culicidae) complex, malaria vectors in Southeast Asia.

PubMed

Dusfour, Isabelle; Blondeau, Johanna; Harbach, Ralph E; Vythilingham, Indra; Baimai, Visut; Trung, Ho D; Sochanta, Tho; Bangs, Michael J; Manguin, Sylvie

2007-09-01

Anopheles sundaicus s.l., a major malaria vector taxon, occurs primarily along coastal areas and on islands in Southeast Asia. Our previous studies using cytochrome oxidase I, cytochrome-b, and internal transcribed spacer 2 markers discriminated three allopatric species: An. sundaicus s.s. in northern Borneo, An. epiroticus in Southeast Asia, and An. sundaicus E on Sumatra and Java, Indonesia. Morphological comparisons of three developmental stages did not reveal unique diagnostic characters that could reliably distinguish the three species. Therefore, we developed a multiplex polymerase chain reaction (PCR) assay based on two mitochondrial DNA markers to unambiguously identify them. This PCR was tested on 374 specimens from 24 different geographical populations, expanding our knowledge of the distribution of these species.

Identification of human rotavirus serotype by hybridization to polymerase chain reaction-generated probes derived from a hyperdivergent region of the gene encoding outer capsid protein VP7

DOE Office of Scientific and Technical Information (OSTI.GOV)

Flores, J.; Sears, J.; Schael, I.P.

1990-08-01

We have synthesized {sup 32}P-labeled hybridization probes from a hyperdivergent region (nucleotides 51 to 392) of the rotavirus gene encoding the VP7 glycoprotein by using the polymerase chain reaction method. Both RNA (after an initial reverse transcription step) and cloned cDNA from human rotavirus serotypes 1 through 4 could be used as templates to amplify this region. High-stringency hybridization of each of the four probes to rotavirus RNAs dotted on nylon membranes allowed the specific detection of corresponding sequences and thus permitted identification of the serotype of the strains dotted. The procedure was useful when applied to rotaviruses isolated frommore » field studies.« less

Susceptibility of Culicoides variipennis sonorensis to infection by polymerase chain reaction-detectable bluetongue virus in cattle blood.

PubMed

Tabachnick, W J; MacLachlan, N J; Thompson, L H; Hunt, G J; Patton, J F

1996-05-01

Cattle bloods containing only polymerase chain reaction (PCR)--detectable bluetongue-10 viral nucleic acid, but as determined by virus isolation techniques, not bluetongue-10 virus, were incapable of infecting intrathoracically inoculated Culicoides variipennis sonorensis. These insects also failed to transmit bluetongue-10 virus when fed on sheep. Cattle whose blood contain only PCR-detectable bluetongue viral nucleic acid, but no infectious virus, are unlikely to play a role in the epidemiology of bluetongue. The biological significance of PCR-based detection assays and their effect on animal health regulations on the international trade of livestock and livestock germplasm is discussed. Bluetongue virus infection provides a very useful model with which to study arthropod-transmitted RNA virus infections of humans and other animals.

Detection of egg drop syndrome 1976 virus by polymerase chain reaction and study of its persistence in experimentally infected layer birds.

PubMed

Kumar, N S; Kataria, J M; Koti, M; Dhama, K; Toroghi, R

2003-01-01

Polymerase chain reaction (PCR) assay was developed for the detection of Egg drop syndrome 1976 (EDS-76) virus in tissues, namely in the uterus, spleen and buffy coat. It was also used to study the persistence of the virus in tissues of experimentally infected layer birds. The PCR assay could detect as little as 10 fg of purified EDS-76 viral DNA. It also amplified the DNA of Fowl adenovirus serotypes 4 (FAV-4) and 8 (FAV-8). The virus persisted in the uterus up to day 21 post infection (p.i.). Detection of EDS-76 viral DNA in the buffy coat could be useful for studying the occurrence of the respective disease in layer bird flocks.

Detection of Clostridium botulinum type C cells in the gastrointestinal tracts of Mozambique tilapia (Oreochromis mossambicus) by polymerase chain reaction

USGS Publications Warehouse

Nol, P.; Williamson, J.L.; Rocke, T.E.; Yuill, Thomas M.

2004-01-01

We established a method of directly detecting Clostridium botulinum type C cells, while minimizing spore detection, in the intestinal contents of Mozambique tilapia (Oreochromis mossambicus). This technique involved extraction of predominantly cellular DNA from tilapia intestinal tracts and used a polymerase chain reaction assay to detect presence of type C1 toxin gene. We consistently detected C. botulinum type C cells in tilapia gastrointestinal contents at a level of 7.5×104 cells per 0.25 g material or 1.9×103 cells. This technique is useful for determining prevalence of the potentially active organisms within a given population of fish and may be adapted to other types of C. botulinum and vertebrate populations as well.

[Pea (Pisum sativum) genes, participating in symbiosis with nitrogen-fixing bacteria. III. Study of the structure of the ENOD12 early nodulin gene for various types of peas using the polymerase chain reaction (PCR)].

PubMed

Kozik, A V; Matvienko, M A; Men', A E; Zalenskiĭ, A O; Tikhonovich, I A

1992-01-01

We have determined the length of early noduline gene ENOD12 in various varieties and lines of pea (Pisum sativum) using the polymerase chain reaction (PCR). It was demonstrated that promoter regions of ENOD12A and ENOD12B genes in line 2150 (Afghanistan) are longer than these in variety "Feltham first". The disparity is 14 bp. When studying these genes in 7 different lines and varieties of pea it was found that ENOD12A gene is more variable in size than the ENOD12B gene. We showed the possibility to analyze the heritage of ENOD12 gene's alleles by using the PCR method.

Leishmania chagasi in Opossums (Didelphis albiventris) in an Urban Area Endemic for Visceral Leishmaniasis, Campo Grande, Mato Grosso do Sul, Brazil

PubMed Central

Humberg, Roberta M. P.; Oshiro, Elisa T.; Cruz, Maria do Socorro Pires e; Ribolla, Paulo E. M.; Alonso, Diego P.; Ferreira, Alda M. T.; Bonamigo, Raquel A.; Tasso, Norton; de Oliveira, Alessandra Gutierrez

2012-01-01

We investigated the occurrence of Leishmania infantum chagasi in Didelphis albiventris opossums at a wild animal rehabilitation center in the city of Campo Grande, Brazil. A total of 54 opossums were tested for L. i. chagasi infection in peripheral blood and bone marrow samples. The samples were analyzed by direct examination, culturing in a specific medium, and polymerase chain reaction–restriction fragment length polymorphism. Leishmania i. chagasi DNA was detected by polymerase chain reaction–restriction fragment length polymorphism in 11 (20.37%) animals. A total of 81.81% of positive opossums were captured in areas of known visceral leishmaniasis transmission. These results suggest a role for D. albiventris in the urban transmission of visceral leishmaniasis. PMID:22802435

Mechanistic Characterization and Molecular Modeling of Hepatitis B Virus Polymerase Resistance to Entecavir

PubMed Central

Walsh, Ann W.; Langley, David R.; Colonno, Richard J.; Tenney, Daniel J.

2010-01-01

Background Entecavir (ETV) is a deoxyguanosine analog competitive inhibitor of hepatitis B virus (HBV) polymerase that exhibits delayed chain termination of HBV DNA. A high barrier to entecavir-resistance (ETVr) is observed clinically, likely due to its potency and a requirement for multiple resistance changes to overcome suppression. Changes in the HBV polymerase reverse-transcriptase (RT) domain involve lamivudine-resistance (LVDr) substitutions in the conserved YMDD motif (M204V/I ± L180M), plus an additional ETV-specific change at residues T184, S202 or M250. These substitutions surround the putative dNTP binding site or primer grip regions of the HBV RT. Methods/Principal Findings To determine the mechanistic basis for ETVr, wildtype, lamivudine-resistant (M204V, L180M) and ETVr HBVs were studied using in vitro RT enzyme and cell culture assays, as well as molecular modeling. Resistance substitutions significantly reduced ETV incorporation and chain termination in HBV DNA and increased the ETV-TP inhibition constant (Ki) for HBV RT. Resistant HBVs exhibited impaired replication in culture and reduced enzyme activity (kcat) in vitro. Molecular modeling of the HBV RT suggested that ETVr residue T184 was adjacent to and stabilized S202 within the LVDr YMDD loop. ETVr arose through steric changes at T184 or S202 or by disruption of hydrogen-bonding between the two, both of which repositioned the loop and reduced the ETV-triphosphate (ETV-TP) binding pocket. In contrast to T184 and S202 changes, ETVr at primer grip residue M250 was observed during RNA-directed DNA synthesis only. Experimentally, M250 changes also impacted the dNTP-binding site. Modeling suggested a novel mechanism for M250 resistance, whereby repositioning of the primer-template component of the dNTP-binding site shifted the ETV-TP binding pocket. No structural data are available to confirm the HBV RT modeling, however, results were consistent with phenotypic analysis of comprehensive substitutions of each ETVr position. Conclusions Altogether, ETVr occurred through exclusion of ETV-TP from the dNTP-binding site, through different, novel mechanisms that involved lamivudine-resistance, ETV-specific substitutions, and the primer-template. PMID:20169198

Mechanistic characterization and molecular modeling of hepatitis B virus polymerase resistance to entecavir.

PubMed

Walsh, Ann W; Langley, David R; Colonno, Richard J; Tenney, Daniel J

2010-02-12

Entecavir (ETV) is a deoxyguanosine analog competitive inhibitor of hepatitis B virus (HBV) polymerase that exhibits delayed chain termination of HBV DNA. A high barrier to entecavir-resistance (ETVr) is observed clinically, likely due to its potency and a requirement for multiple resistance changes to overcome suppression. Changes in the HBV polymerase reverse-transcriptase (RT) domain involve lamivudine-resistance (LVDr) substitutions in the conserved YMDD motif (M204V/I +/- L180M), plus an additional ETV-specific change at residues T184, S202 or M250. These substitutions surround the putative dNTP binding site or primer grip regions of the HBV RT. To determine the mechanistic basis for ETVr, wildtype, lamivudine-resistant (M204V, L180M) and ETVr HBVs were studied using in vitro RT enzyme and cell culture assays, as well as molecular modeling. Resistance substitutions significantly reduced ETV incorporation and chain termination in HBV DNA and increased the ETV-TP inhibition constant (K(i)) for HBV RT. Resistant HBVs exhibited impaired replication in culture and reduced enzyme activity (k(cat)) in vitro. Molecular modeling of the HBV RT suggested that ETVr residue T184 was adjacent to and stabilized S202 within the LVDr YMDD loop. ETVr arose through steric changes at T184 or S202 or by disruption of hydrogen-bonding between the two, both of which repositioned the loop and reduced the ETV-triphosphate (ETV-TP) binding pocket. In contrast to T184 and S202 changes, ETVr at primer grip residue M250 was observed during RNA-directed DNA synthesis only. Experimentally, M250 changes also impacted the dNTP-binding site. Modeling suggested a novel mechanism for M250 resistance, whereby repositioning of the primer-template component of the dNTP-binding site shifted the ETV-TP binding pocket. No structural data are available to confirm the HBV RT modeling, however, results were consistent with phenotypic analysis of comprehensive substitutions of each ETVr position. Altogether, ETVr occurred through exclusion of ETV-TP from the dNTP-binding site, through different, novel mechanisms that involved lamivudine-resistance, ETV-specific substitutions, and the primer-template.

Comprehensive analysis of immune, extracellular matrices and pathogens profile in lung granulomatosis of unexplained etiology.

PubMed

da Costa Souza, Paola; Dondo, Patrícia Suemi; Souza, Gabriela; Lopes, Deborah; Moscardi, Marcel; de Miranda Martinho, Vinicius; de Mattos Lourenço, Rodolfo Daniel; Prieto, Tabatha; Balancin, Marcelo Luiz; Assato, Aline Kawassaki; Teodoro, Walcy Rosolia; Rodrigues, Silvia; Lima, Mariana; Castellano, Maria Vera; Coletta, Ester; Parra, Edwin Roger; Capelozzi, Vera Luiza

2018-05-01

This study analyzed the type 1 and type 2T helper (Th1/Th2) cytokines (including interleukins), immune cellular, matrix profile, and pathogens in granulomas with unexplained etiology compared to those with infectious and noninfectious etiology. Surgical lung biopsies from 108 patients were retrospectively reviewed. Histochemistry, immunohistochemistry, immunofluorescence, morphometry and polymerase chain reaction were used, respectively, to evaluate total collagen and elastin fibers, collagen I and III, immune cells, cytokines, matrix metalloproteinase-9, myofibroblasts, and multiple usual and unusual pathogens. No relevant polymerase chain reaction expression was found in unexplained granulomas. A significant difference was found between the absolute number of eosinophils, macrophages, and lymphocytes within granulomas compared to uninvolved lung tissue. Granulomas with unexplained etiology (UEG) presented increased number of eosinophils and high expression of interleukins (ILs) IL-4/IL-5 and transforming growth factor-β. In sarcoidosis, CD4/CD8 cell number was significantly higher within and outside granulomas, respectively; the opposite was detected in hypersensitivity pneumonitis. Again, a significant difference was found between the high number of myofibroblasts and matrix metalloproteinase-9 in UEG, hypersensitivity pneumonitis, and sarcoidosis compared to granulomas of tuberculosis. Granulomas of paracoccidioisis exhibited increased type I collagen and elastic fibers. Th1 immune cellular profile was similar among granulomas with unexplained, infectious, and noninfectious etiology. In contrast, modulation of Th2 and matrix remodeling was associated with more fibroelastogenesis and scarring of lung tissue in UEG compared to infectious and noninfectious. We concluded that IL-4/IL-5 and transforming growth factor-β might be used as surrogate markers of early fibrosis, reducing the need for genotyping, and promise therapeutic target in unexplained granulomas. Copyright © 2018 Elsevier Inc. All rights reserved.

Poor Prognosis Associated With Human Papillomavirus α7 Genotypes in Cervical Carcinoma Cannot Be Explained by Intrinsic Radiosensitivity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hall, John S.; Iype, Rohan; Armenoult, Lucile S.C.

2013-04-01

Purpose: To investigate the relationship between human papillomavirus (HPV) genotype and outcome after radiation therapy and intrinsic radiosensitivity. Methods and Materials: HPV genotyping was performed on cervix biopsies by polymerase chain reaction using SPF-10 broad-spectrum primers, followed by deoxyribonucleic acid enzyme immunoassay and genotyping by reverse hybridization line probe assay (LiPA{sub 25}) (version 1) (n=202). PapilloCheck and quantitative reverse transcription-polymerase chain reaction were used to genotype cervix cancer cell lines (n=16). Local progression-free survival after radiation therapy alone was assessed using log-rank and Cox proportionate hazard analyses. Intrinsic radiosensitivity was measured as surviving fraction at 2 Gy (SF2) using clonogenicmore » assays. Results: Of the 202 tumors, 107 (53.0%) were positive for HPV16, 29 (14.4%) for HPV18, 9 (4.5%) for HPV45, 23 (11.4%) for other HPV genotypes, and 22 (10.9%) were negative; 11 (5.5%) contained multiple genotypes, and 1 tumor was HPV X (0.5%). In 148 patients with outcome data, those with HPVα9-positive tumors had better local progression-free survival compared with α7 patients in univariate (P<.004) and multivariate (hazard ratio 1.54, 95% confidence interval 1.11-1.76, P=.021) analyses. There was no difference in the median SF2 of α9 and α7 cervical tumors (n=63). In the cell lines, 9 were α7 and 4 α9 positive and 3 negative. There was no difference in SF2 between α9 and α7 cell lines (n=14). Conclusion: The reduced radioresponsiveness of α7 cervical tumors is not related to intrinsic radiosensitivity.« less

Clinical application of polymerase chain reaction to diagnose Clostridium difficile in hospitalized patients with diarrhea.

PubMed

Morelli, Michael S; Rouster, Susan D; Giannella, Ralph A; Sherman, Kenneth E

2004-08-01

Clostridium difficile is a common cause of diarrhea in hospitalized patients and is associated with significant morbidity and cost. The current diagnostic standard, enzyme immunoassay (EIA), has low sensitivity, leading to duplicate testing and empiric treatment. We sought to show the usefulness and potential cost effectiveness of polymerase chain reaction (PCR) amplification of toxin B gene for diagnosis of C. difficile-induced diarrhea. A total of 148 stool samples from academic and community-based hospitals were sent for EIA testing and were evaluated prospectively for the presence of toxin B gene by PCR. Results were compared with EIA regarding sensitivity, specificity, and predictive values. Medical charts were reviewed to determine the following: (1) number of EIAs sent per admission, (2) number sent within a 24-hour time period, and (3) how caregivers practiced based on EIA results. The mean age of 130 patients was 55 years. EIA and PCR were positive in 6.8% and 13.6% of patients, respectively. EIA sensitivity was 40%, specificity was 98%, and positive and negative predictive values were 80% and 91%, respectively. The cost of the PCR was $22/sample. Empiric treatment for C. difficile was given unnecessarily in 42% of EIA-negative results. Thirty percent of patients had 3 or more EIAs sent during their hospital admission. Of patients with multiple samples sent, 57% had more than 1 sample sent in a 24-hour period. Many physicians do not conform to practice guidelines regarding recommended diagnosis and empiric treatment of C. difficile. Toxin B gene PCR represents a more sensitive and potentially cost-effective method to diagnose C. difficile-induced diarrhea than EIA and should be considered for use as an alternative diagnostic standard.

Expression characteristics of long noncoding RNA uc.322 and its effects on pancreatic islet function.

PubMed

Zhao, Xiaoqin; Rong, Can; Pan, Fenghui; Xiang, Lizhi; Wang, Xinlei; Hu, Yun

2018-06-28

Increasing evidence indicates that long noncoding RNAs (lncRNAs) perform special biological functions by regulating gene expression through multiple pathways and molecular mechanisms. The aim of this study was to explore the expression characteristics of lncRNA uc.322 in pancreatic islet cells and its effects on the secretion function of islet cells. Bioinformatics analysis was used to detect the lncRNA uc.322 sequence, location, and structural features. Expression of lncRNA uc.322 in different tissues was detected by quantitative polymerase chain reaction analyses. Quantitative polymerase chain reaction, Western blot analysis, adenosine triphosphate determination, glucose-stimulated insulin secretion, and enzyme-linked immunosorbent assay were used to evaluate the effects of lncRNA uc.322 on insulin secretion. The results showed that the full-length of lncRNA uc.322 is 224 bp and that it is highly conserved in various species. Bioinformatics analysis revealed that lncRNA uc.322 is located on chr7:122893196-122893419 (GRCH37/hg19) within the SRY-related HMG-box 6 gene exon region. Compared with other tissues, lncRNA uc.322 is highly expressed in pancreatic tissue. Upregulation of lncRNA uc.322 expression increases the insulin transcription factors pancreatic and duodenal homeobox 1 and Forkhead box O1 expression, promotes insulin secretion in the extracellular fluid of Min6 cells, and increases the adenosine triphosphate concentration. On the other hand, knockdown of lncRNA uc.322 has opposite effects on Min6 cells. Overall, this study showed that upregulation of lncRNA uc.322 in islet β-cells can increase the expression of insulin transcription factors and promote insulin secretion, and it may be a new therapeutic target for diabetes. © 2018 Wiley Periodicals, Inc.

Prevalence status and association with human papilloma virus of anal squamous proliferative lesions in a patient sample in Taiwan.

PubMed

Tsai, Tsen-Fang; Kuo, Guan-Tin; Kuo, Lu-Ting; Hsiao, Cheng-Hsiang

2008-08-01

Anal squamous proliferative lesions, including condyloma, anal high-grade squamous intraepithelial lesion (AHSIL) and squamous cell carcinoma (SCC), are associated with human papilloma virus (HPV) infection. The objectives of the study were to investigate the HPV prevalence of anal squamous proliferative lesion in Taiwan. From 1991 to 2005, 41 cases with condyloma, 12 cases with AHSIL, and 13 cases with SCC were collected. DNA was extracted from the tissue sections of these patients, and the HPV genotype was identified using polymerase chain reaction and gene chip. The integration status of HPV16 DNA was also evaluated by quantitative real-time polymerase chain reaction. Anal condyloma mainly occurred in young males, but AHSIL and anal SCC developed in older patients. In the patients with human immunodeficiency virus (HIV) infection, AHSIL developed much earlier than patients without HIV infection (36 vs. 61 years). HPV DNA was detected in all 56 patients whose specimens contained adequate DNA. High-risk HPVs (type 16, 58, etc.) were mainly detected in the AHSIL and SCC. Multiple HPV infection was found in AHSIL (4 of 12) and condyloma (11 of 34) but was rare in invasive cancer (1 of 12). Seven of 8 patients with HPV16 infection had coexistent episomal and integrated forms. HPV58 is a unique high-risk HPV prevalent in Taiwan. The integration status of HPV seems not correlated with the severity of the dysplasia. In our study, emerging HIV-positive AHSIL in recent years indicates that we should devote more efforts to promote sexual safety among the people who engaged in anal intercourse.

Kidneys From α1,3-Galactosyltransferase Knockout/Human Heme Oxygenase-1/Human A20 Transgenic Pigs Are Protected From Rejection During Ex Vivo Perfusion With Human Blood.

PubMed

Ahrens, Hellen E; Petersen, Björn; Ramackers, Wolf; Petkov, Stoyan; Herrmann, Doris; Hauschild-Quintern, Janet; Lucas-Hahn, Andrea; Hassel, Petra; Ziegler, Maren; Baars, Wiebke; Bergmann, Sabine; Schwinzer, Reinhard; Winkler, Michael; Niemann, Heiner

2015-07-01

Multiple modifications of the porcine genome are required to prevent rejection after pig-to-primate xenotransplantation. Here, we produced pigs with a knockout of the α1,3-galactosyltransferase gene (GGTA1-KO) combined with transgenic expression of the human anti-apoptotic/anti-inflammatory molecules heme oxygenase-1 and A20, and investigated their xenoprotective properties. The GGTA1-KO/human heme oxygenase-1 (hHO-1)/human A20 (hA20) transgenic pigs were produced in a stepwise approach using zinc finger nuclease vectors targeting the GGTA1 gene and a Sleeping Beauty vector coding for hA20. Two piglets were analyzed by quantitative reverse-transcription polymerase chain reaction, flow cytometry, and sequencing. The biological function of the genetic modifications was tested in a (51)Chromium release assay and by ex vivo kidney perfusions with human blood. Disruption of the GGTA1 gene by deletion of few basepairs was demonstrated in GGTA1-KO/hHO-1/hA20 transgenic pigs. The hHO-1 and hA20 mRNA expression was confirmed by quantitative reverse-transcription polymerase chain reaction. Ex vivo perfusion of 2 transgenic kidneys was feasible for the maximum experimental time of 240 minutes without symptoms of rejection. Results indicate that GGTA1-KO/hHO-1/hA20 transgenic pigs are a promising model to alleviate rejection and ischemia-reperfusion damage in porcine xenografts and could serve as a background for further genetic modifications toward the production of a donor pig that is clinically relevant for xenotransplantation.

Kidneys From α1,3-Galactosyltransferase Knockout/Human Heme Oxygenase-1/Human A20 Transgenic Pigs Are Protected From Rejection During Ex Vivo Perfusion With Human Blood

PubMed Central

Ahrens, Hellen E.; Petersen, Björn; Ramackers, Wolf; Petkov, Stoyan; Herrmann, Doris; Hauschild-Quintern, Janet; Lucas-Hahn, Andrea; Hassel, Petra; Ziegler, Maren; Baars, Wiebke; Bergmann, Sabine; Schwinzer, Reinhard; Winkler, Michael; Niemann, Heiner

2015-01-01

Background Multiple modifications of the porcine genome are required to prevent rejection after pig-to-primate xenotransplantation. Here, we produced pigs with a knockout of the α1,3-galactosyltransferase gene (GGTA1-KO) combined with transgenic expression of the human anti-apoptotic/anti-inflammatory molecules heme oxygenase-1 and A20, and investigated their xenoprotective properties. Methods The GGTA1-KO/human heme oxygenase-1 (hHO-1)/human A20 (hA20) transgenic pigs were produced in a stepwise approach using zinc finger nuclease vectors targeting the GGTA1 gene and a Sleeping Beauty vector coding for hA20. Two piglets were analyzed by quantitative reverse-transcription polymerase chain reaction, flow cytometry, and sequencing. The biological function of the genetic modifications was tested in a 51Chromium release assay and by ex vivo kidney perfusions with human blood. Results Disruption of the GGTA1 gene by deletion of few basepairs was demonstrated in GGTA1-KO/hHO-1/hA20 transgenic pigs. The hHO-1 and hA20 mRNA expression was confirmed by quantitative reverse-transcription polymerase chain reaction. Ex vivo perfusion of 2 transgenic kidneys was feasible for the maximum experimental time of 240 minutes without symptoms of rejection. Conclusions Results indicate that GGTA1-KO/hHO-1/hA20 transgenic pigs are a promising model to alleviate rejection and ischemia-reperfusion damage in porcine xenografts and could serve as a background for further genetic modifications toward the production of a donor pig that is clinically relevant for xenotransplantation. PMID:27500225

Regulator of calcineurin 1 controls growth plasticity of adult pancreas.

PubMed

Gurda, Grzegorz T; Crozier, Stephen J; Ji, Baoan; Ernst, Stephen A; Logsdon, Craig D; Rothermel, Beverly A; Williams, John A

2010-08-01

Growth of exocrine pancreas is regulated by gastrointestinal hormones, notably cholecystokinin (CCK). CCK-driven pancreatic growth requires calcineurin (CN), which activates Nuclear Factor of Activated T cells (NFATs), but the genetic underpinnings and feedback mechanisms that regulate this response are not known. Pancreatic growth was stimulated by protease inhibitor (PI)-containing chow, which induces secretion of endogenous CCK. Expression profiling of PI stimulation was performed on Affymetrix 430A chips, and CN was inhibited via FK506. Exocrine pancreas-specific overexpression of CN inhibitor Regulator of Calcineurin 1 (Rcan1) was achieved by breeding elastase-Cre(estrogen receptor [ER]) transgenics with "flox-on" Rcan1 mice. CN inhibitor FK506 blocked expression of 38 genes, as confirmed by quantitative polymerase chain reaction. The CN-dependent genes were linked to growth-related processes, whereas their promoters were enriched in NFAT and NFAT/AP1 sites. Multiple NFAT targets, including Rcan1, Rgs2, HB-EGF, Lif, and Gem, were validated by chromatin immunoprecipitation. One of these, a CN feedback inhibitor Rcan1, was induced >50 fold during 1-8 hours course of pancreatic growth and strongly inhibited (>99%) by FK506. To examine its role in pancreatic growth, we overexpressed Rcan1 in an inducible, acinar-specific fashion. Rcan1 overexpression inhibited CN-NFAT signaling, as shown using an NFAT-luciferase reporter and quantitative polymerase chain reaction. Most importantly, the increase in exocrine pancreas size, protein/DNA content, and acinar proliferation were all blocked in Rcan1 overexpressing mice. We profile adaptive pancreatic growth, identify Rcan1 as an important new feedback regulator, and firmly establish that CN-NFAT signaling is required for this response. Copyright (c) 2010 AGA Institute. Published by Elsevier Inc. All rights reserved.

Isolation and characterization of alternatively spliced variants of the mouse sigma1 receptor gene, Sigmar1

PubMed Central

Pan, Ling; Pasternak, David A.; Xu, Jin; Xu, Mingming; Lu, Zhigang; Pasternak, Gavril W.

2017-01-01

The sigma1 receptor acts as a chaperone at the endoplasmic reticulum, associates with multiple proteins in various cellular systems, and involves in a number of diseases, such as addiction, pain, cancer and psychiatric disorders. The sigma1 receptor is encoded by the single copy SIGMAR1 gene. The current study identifies five alternatively spliced variants of the mouse sigma1 receptor gene using a polymerase chain reaction cloning approach. All the splice variants are generated by exon skipping or alternative 3’ or 5’ splicing, producing the truncated sigma1 receptor. Similar alternative splicing has been observed in the human SIGMAR1 gene based on the molecular cloning or genome sequence prediction, suggesting conservation of alternative splicing of SIGMAR1 gene. Using quantitative polymerase chain reactions, we demonstrate differential expression of several splice variants in mouse tissues and brain regions. When expressed in HEK293 cells, all the splice variants fail to bind sigma ligands, implicating that each truncated region in these splice variants is important for ligand binding. However, co-immunoprecipitation (Co-IP) study in HEK293 cells co-transfected with tagged constructs reveals that all the splice variants maintain their ability to physically associate with a mu opioid receptor (mMOR-1), providing useful information to correlate the motifs/sequences necessary for their physical association. Furthermore, a competition Co-IP study showed that all the variants can disrupt in a dose-dependent manner the dimerization of the original sigma1 receptor with mMOR-1, suggesting a potential dominant negative function and providing significant insights into their function. PMID:28350844

The Frequency of c.550delA Mutation of the CANP3 Gene in the Polish LGMD2A Population.

PubMed

Dorobek, Małgorzata; Ryniewicz, Barbara; Kabzińska, Dagmara; Fidziańska, Anna; Styczyńska, Maria; Hausmanowa-Petrusewicz, Irena

2015-11-01

Limb girdle muscular dystrophy 2A (LGMD2A) is the most frequent LGMD variant in the European population, representing about 40% of LGMD. The c.550delA mutation in the CANP3 (calcium activated neutral protease 3) gene is the most commonly reported mutation in LGMD2A. Prevalence of this mutation in the Polish population has not been previously investigated. The aim of this study was to identify and estimate the frequency of the c.550delA mutation in Polish LGMD2A patients. Polymerase chain reaction-sequencing analysis, restriction fragment length polymorphism polymerase chain reaction method. We analyzed 76 families affected with LGMD and identified 62 probands with mutations in the CANP3 gene. C.550delA was the most common mutation identified, being found in 78% of the LGMD2A families. The remaining mutations observed multiple times were as follows: c.598-612del15ntd; c.2242C>T; c.418dupC; c.1356insT, listed in terms of decreasing frequency. Two novel variants in the CANP3 gene, that is, c.700G>A Gly234Arg and c.661G>A Gly221Ser were also characterized. Overall, mutations in the LGMD2A gene were estimated to be present in 81% of patients with the LGMD phenotype who were without sarcoglycans and dysferlin deficiency on immunocytochemical analysis. The frequency of the heterozygous c.550delA mutation in the healthy Polish population was estimated at 1/124. The c.550delA is the most frequent CANP3 mutation in the Polish population, thus sequencing of exon 4 of this gene could identify the majority of LGMD2A patients in Poland.

Etiology of Severe Acute Watery Diarrhea in Children in the Global Rotavirus Surveillance Network Using Quantitative Polymerase Chain Reaction

PubMed Central

Operario, Darwin J; Platts-Mills, James A; Nadan, Sandrama; Page, Nicola; Seheri, Mapaseka; Mphahlele, Jeffrey; Praharaj, Ira; Kang, Gagandeep; Araujo, Irene T; Leite, Jose Paulo G; Cowley, Daniel; Thomas, Sarah; Kirkwood, Carl D; Dennis, Francis; Armah, George; Mwenda, Jason M; Wijesinghe, Pushpa Ranjan; Rey, Gloria; Grabovac, Varja; Berejena, Chipo; Simwaka, Chibumbya J; Uwimana, Jeannine; Sherchand, Jeevan B; Thu, Hlaing Myat; Galagoda, Geethani; Bonkoungou, Isidore J O; Jagne, Sheriffo; Tsolenyanu, Enyonam; Diop, Amadou; Enweronu-Laryea, Christabel; Borbor, Sam-Aliyah; Liu, Jie; McMurry, Timothy; Lopman, Benjamin; Parashar, Umesh; Gentsch, John; Steele, A Duncan; Cohen, Adam; Serhan, Fatima; Houpt, Eric R

2017-01-01

Abstract Background The etiology of acute watery diarrhea remains poorly characterized, particularly after rotavirus vaccine introduction. Methods We performed quantitative polymerase chain reaction for multiple enteropathogens on 878 acute watery diarrheal stools sampled from 14643 episodes captured by surveillance of children <5 years of age during 2013–2014 from 16 countries. We used previously developed models of the association between pathogen quantity and diarrhea to calculate pathogen-specific weighted attributable fractions (AFs). Results Rotavirus remained the leading etiology (overall weighted AF, 40.3% [95% confidence interval {CI}, 37.6%–44.3%]), though the AF was substantially lower in the Americas (AF, 12.2 [95% CI, 8.9–15.6]), based on samples from a country with universal rotavirus vaccination. Norovirus GII (AF, 6.2 [95% CI, 2.8–9.2]), Cryptosporidium (AF, 5.8 [95% CI, 4.0–7.6]), Shigella (AF, 4.7 [95% CI, 2.8–6.9]), heat-stable enterotoxin-producing Escherichia coli (ST-ETEC) (AF, 4.2 [95% CI, 2.0–6.1]), and adenovirus 40/41 (AF, 4.2 [95% CI, 2.9–5.5]) were also important. In the Africa Region, the rotavirus AF declined from 54.8% (95% CI, 48.3%–61.5%) in rotavirus vaccine age-ineligible children to 20.0% (95% CI, 12.4%–30.4%) in age-eligible children. Conclusions Rotavirus remained the leading etiology of acute watery diarrhea despite a clear impact of rotavirus vaccine introduction. Norovirus GII, Cryptosporidium, Shigella, ST-ETEC, and adenovirus 40/41 were also important. Prospective surveillance can help identify priorities for further reducing the burden of diarrhea. PMID:28838152

Simultaneous detection of the three ilarviruses affecting stone fruit trees by nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction.

PubMed

Saade, M; Aparicio, F; Sánchez-Navarro, J A; Herranz, M C; Myrta, A; Di Terlizzi, B; Pallás, V

2000-12-01

ABSTRACT The three most economically damaging ilarviruses affecting stone fruit trees on a worldwide scale are the related Prunus necrotic ringspot virus (PNRSV), Prune dwarf virus (PDV), and Apple mosaic virus (ApMV). Nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction (RT-PCR) methodologies were developed that could detect all these viruses simultaneously. The latter technique was advantageous because it was discriminatory. For RT-PCR, a degenerate antisense primer was designed which was used in conjunction with three virus-specific sense primers. The amplification efficiencies for the detection of the three viruses in the multiplex RT-PCR reaction were identical to those obtained in the single RT-PCR reactions for individual viruses. This cocktail of primers was able to amplify sequences from all of the PNRSV, ApMV, and PDV isolates tested in five Prunus spp. hosts (almond, apricot, cherry, peach, and plum) occurring naturally in single or multiple infections. For ApMV isolates, differences in the electrophoretic mobilities of the PCR products were observed. The nucleotide sequence of the amplified products of two representative ApMV isolates was determined, and comparative analysis revealed the existence of a 28-nucleotide deletion in the sequence of isolates showing the faster electrophoretic mobility. To our knowledge, this is the first report on the simultaneous detection of three plant viruses by multiplex RT-PCR in woody hosts. This multiplex RT-PCR could be a useful time and cost saving method for indexing these three ilarviruses, which damage stone fruit tree yields, and for the analysis of mother plants in certification programs.

Using the rate of bacterial clearance determined by real-time polymerase chain reaction as a timely surrogate marker to evaluate the appropriateness of antibiotic usage in critical patients with Acinetobacter baumannii bacteremia.

PubMed

Chuang, Yu-Chung; Chang, Shan-Chwen; Wang, Wei-Kung

2012-08-01

Bacteremia caused by Acinetobacter baumannii is becoming more frequent among critically ill patients, and has been associated with high mortality and prolonged hospital stay. Multidrug resistance and delay in blood culture have been shown to be significant barriers to appropriate antibiotic treatment. Quantitative polymerase chain reaction assays were recently used to monitor bacterial loads; we hypothesized that the rate of bacterial clearance determined by quantitative polymerase chain reaction can be used as a timely surrogate marker to evaluate the appropriateness of antibiotic usage. Prospective observational study. University hospital and research laboratory. Patients with culture-proven A. baumannii bacteremia in the intensive care units were prospectively enrolled from April 2008 to February 2009. Plasmid Oxa-51/pCRII-TOPO, which contained a 431-bp fragment of the A. baumannii-specific Oxa-51 gene in a pCRII-TOPO vector, was used as the standard. Sequential bacterial DNA loads in the blood were measured by a quantitative polymerase chain reaction assay. We enrolled 51 patients with A. baumannii bacteremia, and examined 318 sequential whole blood samples. The initial mean bacterial load was 2.15 log copies/mL, and the rate of bacterial clearance was 0.088 log copies/mL/day. Multivariate linear regression using the generalized estimation equation approach revealed that the use of immunosuppressants was an independent predictor for slower bacterial clearance (coefficient, 1.116; p<.001), and appropriate antibiotic usage was an independent predictor for more rapid bacterial clearance (coefficient, -0.995; p<.001). Patients with a slower rate of bacterial clearance experienced higher in-hospital mortality (odds ratio, 2.323; p=.04) Immunosuppression and appropriate antibiotic usage were independent factors affecting the rate of clearance of A. baumannii bacteremia in critical patients. These findings highlight the importance of appropriate antibiotic usage and development of effective antibiotics against A. baumannii in an era of emerging antibiotic resistance. The rate of bacterial clearance could serve as a timely surrogate marker for evaluating the appropriateness of antibiotics.

Expression of TGF-beta1, osteonectin, and BMP-4 in mandibular distraction osteogenesis with compression stimulation: reverse transcriptase-polymerase chain reaction study and biomechanical test.

PubMed

Kim, Uk-Kyu; Park, Seong-Jin; Seong, Wook-Jin; Heo, Jun; Hwang, Dae-Seok; Kim, Yong-Deok; Shin, Sang-Hun; Kim, Gyoo-Cheon

2010-09-01

This study compared the levels of transforming growth factor-beta1 (TGF-beta1), osteonectin, and bone morphogenetic protein-4 (BMP-4) expression in regenerated bone in a rabbit mandible that had undergone conventional distraction osteogenesis (DO) with those in regenerated bone from a modified DO technique with compression stimulation. A total of 42 rabbits were used in this reverse transcriptase-polymerase chain reaction study. In the control group, distraction was performed at 1 mm/day for 8 days. In the experimental group, overdistraction was performed for 10 days, followed by a 3-day latency period and 2 days of compression to achieve the same amount of DO. Three rabbits per subgroup were killed at 0, 5, 13, 20, 27, 34, and 41 days after the initial osteotomy. The levels of TGF-beta1, osteonectin, and BMP-4 in the bone regenerates were measured by reverse transcriptase-polymerase chain reaction. A biomechanical microhardness test was also performed in 8 rabbits as a separate experiment. Reverse transcriptase-polymerase chain reaction revealed a greater level of TGF-beta1 in the experimental group immediately after applying the compression force that continued for 2 weeks. The level then decreased to that of the control group at 3 weeks. The greater level of osteonectin in the experimental group after compression than that in the control group continued for 3 weeks. In the experimental group, the level of BMP-4 increased immediately after compression. However, the level in the control group decreased. The microhardness ratio of distracted bone to normal bone on the cortex was statistically different at 0.47 in the control group and 0.80 in the experimental group (P = .049) at 55 days after osteotomy. The effectiveness of the new DO technique with compression stimulation was confirmed by the gene expression study and the biomechanical test findings. Copyright 2010 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

Polymerase chain reaction detection of Propionibacterium propionicus and Actinomyces radicidentis in primary and persistent endodontic infections.

PubMed

Siqueira, José F; Rôças, Isabela N

2003-08-01

Propionibacterium propionicus and the recently described species Actinomyces radicidentis have been isolated from infections of endodontic origin; nevertheless, the possibility exists that their actual prevalence may have been underestimated by culture. The purpose of our study was to assess the occurrence of these 2 species in different types of endodontic infections by using the sensitive 16S rDNA-based nested polymerase chain reaction approach. To detect these 2 species, nested polymerase chain reaction was performed directly in samples taken from primary endodontic infections associated with asymptomatic periradicular lesions, acute apical periodontitis, or acute periradicular abscesses and in samples from patients in whom endodontic therapy had failed. DNA was extracted from the samples and initially amplified by using universal 16S rDNA primers. In the second round of amplification, the first polymerase chain reaction products were used to detect a specific 16S rDNA fragment of either P propionicus or A radicidentis. P propionicus was detected in 6/21 (29%) root canal samples from teeth with chronic periradicular lesions, in 5/10 (50%) cases diagnosed as acute apical periodontitis, and in 7/19 (37%) pus samples aspirated from acute periradicular abscesses. Overall, this species was found in 18/50 (36%) samples taken from primary endodontic infections. Of the root canal samples obtained from root-filled teeth with chronic periradicular lesions, P propionicus was detected in 7/12 (58%) cases. A radicidentis was detected in 1/21 (5%) root canal samples from teeth with chronic periradicular lesions and in 1/10 (10%) cases of acute apical periodontitis. No pus sample yielded this species. In general, A radicidentis was detected in 2/50 (4%) samples taken from primary endodontic infections and in 1/12 (8%) root canal samples taken from patients in whom endodontic treatment had failed. P propionicus was found in a relatively large number of patients with primary and persistent endodontic infections. This strengthens the assumption that this bacterial species is an endodontic pathogen associated with different forms of periradicular diseases. In contrast, A radicidentis was only occasionally detected in the patients examined. The role played by this species in endodontic infections remains to be clarified.

Pyrosequencing-based validation of a simple cell-suspension polymerase chain reaction assay for Campylobacter with application of high-processivity polymerase and novel internal amplification controls for rapid and specific detection.

PubMed

Oakley, Brian B; Line, J Eric; Berrang, Mark E; Johnson, Jessica M; Buhr, R Jeff; Cox, Nelson A; Hiett, Kelli L; Seal, Bruce S

2012-02-01

Although Campylobacter is an important food-borne human pathogen, there remains a lack of molecular diagnostic assays that are simple to use, cost-effective, and provide rapid results in research, clinical, or regulatory laboratories. Of the numerous Campylobacter assays that do exist, to our knowledge none has been empirically tested for specificity using high-throughput sequencing. Here we demonstrate the power of next-generation sequencing to determine the specificity of a widely cited Campylobacter-specific polymerase chain reaction (PCR) assay and describe a rapid method for direct cell suspension PCR to quickly and easily screen samples for Campylobacter. We present a specific protocol which eliminates the need for time-consuming and expensive genomic DNA extractions and, using a high-processivity polymerase, demonstrate conclusive screening of samples in <1 h. Pyrosequencing results show the assay to be extremely (>99%) sensitive, and spike-back experiments demonstrated a detection threshold of <10(2) CFU mL(-1). Additionally, we present 2 newly designed broad-range bacterial primer sets targeting the 23S rRNA gene that have wide applicability as internal amplification controls. Empirical testing of putative taxon-specific assays using high-throughput sequencing is an important validation step that is now financially feasible for research, regulatory, or clinical applications. Published by Elsevier Inc.

AlignMiner: a Web-based tool for detection of divergent regions in multiple sequence alignments of conserved sequences

PubMed Central

2010-01-01

Background Multiple sequence alignments are used to study gene or protein function, phylogenetic relations, genome evolution hypotheses and even gene polymorphisms. Virtually without exception, all available tools focus on conserved segments or residues. Small divergent regions, however, are biologically important for specific quantitative polymerase chain reaction, genotyping, molecular markers and preparation of specific antibodies, and yet have received little attention. As a consequence, they must be selected empirically by the researcher. AlignMiner has been developed to fill this gap in bioinformatic analyses. Results AlignMiner is a Web-based application for detection of conserved and divergent regions in alignments of conserved sequences, focusing particularly on divergence. It accepts alignments (protein or nucleic acid) obtained using any of a variety of algorithms, which does not appear to have a significant impact on the final results. AlignMiner uses different scoring methods for assessing conserved/divergent regions, Entropy being the method that provides the highest number of regions with the greatest length, and Weighted being the most restrictive. Conserved/divergent regions can be generated either with respect to the consensus sequence or to one master sequence. The resulting data are presented in a graphical interface developed in AJAX, which provides remarkable user interaction capabilities. Users do not need to wait until execution is complete and can.even inspect their results on a different computer. Data can be downloaded onto a user disk, in standard formats. In silico and experimental proof-of-concept cases have shown that AlignMiner can be successfully used to designing specific polymerase chain reaction primers as well as potential epitopes for antibodies. Primer design is assisted by a module that deploys several oligonucleotide parameters for designing primers "on the fly". Conclusions AlignMiner can be used to reliably detect divergent regions via several scoring methods that provide different levels of selectivity. Its predictions have been verified by experimental means. Hence, it is expected that its usage will save researchers' time and ensure an objective selection of the best-possible divergent region when closely related sequences are analysed. AlignMiner is freely available at http://www.scbi.uma.es/alignminer. PMID:20525162

Detection and characterization of cry1Ac transgene construct in Bt cotton: multiple polymerase chain reaction approach.

PubMed

Singh, Chandra K; Ojha, Abhishek; Kachru, Devendra N

2007-01-01

To comply with international labeling regulations for genetically modified (GM) crops and food, and to enable proper identification of GM organisms (GMOs), effective methodologies and reliable approaches are needed. The spurious and unapproved GM planting has contributed to crop failures and commercial losses. To ensure effective and genuine GM cultivation, a methodology is needed to detect and identify the trait of interest and concurrently evaluate the structural and functional stability of the transgene insert. A multiple polymerase chain reaction (PCR) approach was developed for detection, identification, and gene stability confirmation of cry1Ac transgene construct in Bt cotton. As many as 9 samples of Bt cotton hybrid seeds comprising 3 approved Bt hybrids, MECH-12Bt, MECH-162Bt, MECH-184Bt, and a batch of 6 nonapproved Bt hybrids were tested. Initially, single standard PCR assays were run to amplify predominant GM DNA sequences (CaMV 35S promoter, nos terminator, and npt-II marker gene); a housekeeping gene, Gossypium hirsutum fiber-specific acyl carrier protein gene (acp1); a trait-specific transgene (cry1Ac); and a sequence of 7S 3' transcription terminator which specifically borders with 3' region of cry1Ac transgene cassette. The concurrent amplification of all sequences of the entire cassette was performed by 3 assays, duplex, triplex, and quadruplex multiplex PCR assays, under common assay conditions. The identity of amplicons was reconfirmed by restriction endonuclease digestion profile. The 2 distinct transgene cassettes, cry1Ac and npt-II, of the Bt cotton were amplified using the respective forward primer of promoter and reverse primer of terminator. The resultant amplicons were excised, eluted, and purified. The purified amplicons served as template for nested PCR assays. The nested PCR runs confirmed the transgene construct orientation and identity. The limit of detection as established by our assay for GM trait (cry1Ac) was 0.1%. This approach can be adopted as a standard procedure for complete molecular characterization of Bt cotton. These assays will be of interest and use to importers, breeders, research laboratories, safety regulators, and food processors for detection of cry1Ac bearing GMOs.

Generation of 2A-linked multicistronic cassettes by recombinant PCR.

PubMed

Szymczak-Workman, Andrea L; Vignali, Kate M; Vignali, Dario A A

2012-02-01

The need for reliable, multicistronic vectors for multigene delivery is at the forefront of biomedical technology. It is now possible to express multiple proteins from a single open reading frame (ORF) using 2A peptide-linked multicistronic vectors. These small sequences, when cloned between genes, allow for efficient, stoichiometric production of discrete protein products within a single vector through a novel "cleavage" event within the 2A peptide sequence. Expression of more than two genes using conventional approaches has several limitations, most notably imbalanced protein expression and large size. The use of 2A peptide sequences alleviates these concerns. They are small (18-22 amino acids) and have divergent amino-terminal sequences, which minimizes the chance for homologous recombination and allows for multiple, different 2A peptide sequences to be used within a single vector. Importantly, separation of genes placed between 2A peptide sequences is nearly 100%, which allows for stoichiometric and concordant expression of the genes, regardless of the order of placement within the vector. This protocol describes the use of recombinant polymerase chain reaction (PCR) to connect multiple 2A-linked protein sequences. The final construct is subcloned into an expression vector.

Modulating the DNA polymerase β reaction equilibrium to dissect the reverse reaction

PubMed Central

Shock, David D.; Freudenthal, Bret D.; Beard, William A.; Wilson, Samuel H.

2017-01-01

DNA polymerases catalyze efficient and high fidelity DNA synthesis. While this reaction favors nucleotide incorporation, polymerases also catalyze a reverse reaction, pyrophosphorolysis, removing the DNA primer terminus and generating deoxynucleoside triphosphates. Since pyrophosphorolysis can influence polymerase fidelity and sensitivity to chain-terminating nucleosides, we analyzed pyrophosphorolysis with human DNA polymerase β and found the reaction to be inefficient. The lack of a thio-elemental effect indicated that it was limited by a non-chemical step. Utilizing a pyrophosphate analog, where the bridging oxygen is replaced with an imido-group (PNP), increased the rate of the reverse reaction and displayed a large thio-elemental effect indicating that chemistry was now rate determining. Time-lapse crystallography with PNP captured structures consistent with a chemical equilibrium that favored the reverse reaction. These results highlight the importance of the bridging atom between the β- and γ-phosphates of the incoming nucleotide in reaction chemistry, enzyme conformational changes, and overall reaction equilibrium. PMID:28759020

A movie of the RNA polymerase nucleotide addition cycle.

PubMed

Brueckner, Florian; Ortiz, Julio; Cramer, Patrick

2009-06-01

During gene transcription, RNA polymerase (Pol) passes through repetitive cycles of adding a nucleotide to the growing mRNA chain. Here we obtained a movie of the nucleotide addition cycle by combining structural information on different functional states of the Pol II elongation complex (EC). The movie illustrates the two-step loading of the nucleoside triphosphate (NTP) substrate, closure of the active site for catalytic nucleotide incorporation, and the presumed two-step translocation of DNA and RNA, which is accompanied by coordinated conformational changes in the polymerase bridge helix and trigger loop. The movie facilitates teaching and a mechanistic analysis of transcription and can be downloaded from http://www.lmb.uni-muenchen.de/cramer/pr-materials.

Space-to-Ground: Genes in Space: 04/13/2018

NASA Image and Video Library

2018-04-12

Can the Polymerase Chain Reaction be used to study DNA alterations on the International Space Station? NASA's Space to Ground is your weekly update on what's happening aboard the International Space Station.

EPA Scientists Develop Research Methods for Studying Mold Fact Sheet

EPA Pesticide Factsheets

In 2002, U.S. Environmental Protection Agency researchers developed a DNA-based Mold Specific Quantitative Polymerase Chain Reaction method (MSQPCR) for identifying and quantifying over 100 common molds and fungi.

Polymerase chain reaction-based identification of clinically relevant Pasteurellaceae isolated from cats and dogs in Poland.

PubMed

Król, Jaroslaw; Bania, Jacek; Florek, Magdalena; Pliszczak-Król, Aleksandra; Staroniewicz, Zdzislaw

2011-05-01

A set of polymerase chain reaction (PCR) assays for identification of the most important Pasteurellaceae species encountered in cats and dogs were developed. Primers for Pasteurella multocida were designed to detect a fragment of the kmt, a gene encoding the outer-membrane protein. Primers specific to Pasteurella canis, Pasteurella dagmatis, and Pasteurella stomatis were based on the manganese-dependent superoxide dismutase gene (sodA) and those specific to [Haemophilus] haemoglobinophilus on species-specific sequences of the 16S ribosomal RNA gene. All the primers were tested on respective reference and control strains and applied to the identification of 47 canine and feline field isolates of Pasteurellaceae. The PCR assays were shown to be species specific, providing a valuable supplement to phenotypic identification of species within this group of bacteria. © 2011 The Author(s)

Biotechnical use of polymerase chain reaction for microbiological analysis of biological samples.

PubMed

Lantz, P G; Abu al-Soud, W; Knutsson, R; Hahn-Hägerdal, B; Rådström, P

2000-01-01

Since its introduction in the mid-80s, polymerase chain reaction (PCR) technology has been recognised as a rapid, sensitive and specific molecular diagnostic tool for the analysis of micro-organisms in clinical, environmental and food samples. Although this technique can be extremely effective with pure solutions of nucleic acids, it's sensitivity may be reduced dramatically when applied directly to biological samples. This review describes PCR technology as a microbial detection method, PCR inhibitors in biological samples and various sample preparation techniques that can be used to facilitate PCR detection, by either separating the micro-organisms from PCR inhibitors and/or by concentrating the micro-organisms to detectable concentrations. Parts of this review are updated and based on a doctoral thesis by Lantz [1] and on a review discussing methods to overcome PCR inhibition in foods [2].

Vanadium accelerates polymerase chain reaction and expands the applicability of forensic DNA testing.

PubMed

Kaminiwa, Junko; Honda, Katsuya; Sugano, Yukiko; Yano, Shizue; Nishi, Takeki; Sekine, Yuko

2013-05-01

Polymerase chain reaction (PCR) has been rapidly established as one of the most widely used techniques in molecular biology. Because most DNA analysis is PCR-based, the analysis of unamplifiable DNA of poor quality or low quantity is nearly impossible. However, we observed that if an appropriate concentration of vanadium chloride is added to the standard reaction mixture, the enzymatic amplification of DNA could be enhanced. Using multiplex PCR with the addition of vanadium, DNA typing was possible from even trace amounts of DNA that we were unable to amplify using normal reaction conditions. This method might be an effective tool for not only criminal investigations and ancient DNA analysis, but also for nearly all fields using DNA technology. Copyright © 2012 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

Large pathogenic expansions in the SCA2 and SCA7 genes can be detected by fluorescent repeat-primed polymerase chain reaction assay.

PubMed

Cagnoli, Claudia; Stevanin, Giovanni; Michielotto, Chiara; Gerbino Promis, Giovanni; Brussino, Alessandro; Pappi, Patrizia; Durr, Alexandra; Dragone, Elisa; Viemont, Michelle; Gellera, Cinzia; Brice, Alexis; Migone, Nicola; Brusco, Alfredo

2006-02-01

Large expansions in the SCA2 and SCA7 genes (>100 CAG repeats) have been associated with juvenile and infantile forms of cerebellar ataxias that cannot be detected using standard polymerase chain reaction (PCR). Here, we describe a successful application of the fluorescent short tandem repeat-primed PCR method for accurate identification of these expanded repeats. The test is robust, reliable, and inexpensive and can be used to screen large series of patients, although it cannot give a precise evaluation of the size of the expansion. This test may be of practical value in prenatal diagnoses offered to affected or pre-symptomatic at-risk parents, in which a very large expansion inherited from one of the parents can be missed in the fetus by standard PCR.

Large Pathogenic Expansions in the SCA2 and SCA7 Genes Can Be Detected by Fluorescent Repeat-Primed Polymerase Chain Reaction Assay

PubMed Central

Cagnoli, Claudia; Stevanin, Giovanni; Michielotto, Chiara; Gerbino Promis, Giovanni; Brussino, Alessandro; Pappi, Patrizia; Durr, Alexandra; Dragone, Elisa; Viemont, Michelle; Gellera, Cinzia; Brice, Alexis; Migone, Nicola; Brusco, Alfredo

2006-01-01

Large expansions in the SCA2 and SCA7 genes (>100 CAG repeats) have been associated with juvenile and infantile forms of cerebellar ataxias that cannot be detected using standard polymerase chain reaction (PCR). Here, we describe a successful application of the fluorescent short tandem repeat-primed PCR method for accurate identification of these expanded repeats. The test is robust, reliable, and inexpensive and can be used to screen large series of patients, although it cannot give a precise evaluation of the size of the expansion. This test may be of practical value in prenatal diagnoses offered to affected or pre-symptomatic at-risk parents, in which a very large expansion inherited from one of the parents can be missed in the fetus by standard PCR. PMID:16436644

Tuberculous otitis media: a resurgence?

PubMed

Kameswaran, M; Natarajan, K; Parthiban, M; Krishnan, P V; Raghunandhan, S

2017-09-01

Tuberculosis is a global health problem that is especially prevalent in developing countries such as India. Recently, atypical presentation has become more common and a high index of suspicion is essential. This study analysed the various presenting symptoms and signs of tuberculous otitis media and the role of diagnostic tests, with the aim of formulating criteria for the diagnosis. A total of 502 patients underwent tympanomastoidectomy over a two-year period. Microbiological and histopathological examinations and polymerase chain reaction analysis of tissue taken during tympanomastoidectomy were performed. A total of 25 patients (5 per cent) were diagnosed with tuberculous otitis media. Severe mixed hearing loss, facial palsy, labyrinthine fistula, post-aural fistula, perichondritis and extradural abscess were noted. There seems to be a resurgence in tuberculous otitis media in India. Microbiological, histopathological and polymerase chain reaction tests for tuberculosis are helpful for its diagnosis.

Fast real-time polymerase chain reaction for quantitative detection of Lactobacillus delbrueckii bacteriophages in milk.

PubMed

Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A

2008-12-01

One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.

[Polymerase chain reaction applied for detection of Toxoplasma gondii in lymph nodes].

PubMed

Liu, C; Ouyang, K; Tan, D

1998-01-01

In order to investigate the morbidity of toxoplasmic lymphadenitis, polymerase chain reaction (PCR) was used to detect DNA of Toxoplasma gondii within lymph nodes in 3 groups of 120 patients with different diseases. After extracting the DNA of each sample, PCR was employed to amplify toxoplasma DNA. The results showed that the amplification product of 210 bp was confirmed in 7 patients: 3 cases of Hodgkin's disease (HD), 2 cases of non-Hodgkin's lymphoma (NHL) and 2 cases of chronic lymphadenitis (CL). Each PCR product was then subjected to Southern blot hybridization. Besides the 7 cases proved by PCR, 1 case of CL was found positive. The positive percentages of HD, NHL and CL were 9.38% (3/32), 4.88% (2/41), and 6.38% (3/47), respectively. The total positive rate was 6.67% (8/120).

Advances in digital polymerase chain reaction (dPCR) and its emerging biomedical applications.

PubMed

Cao, Lei; Cui, Xingye; Hu, Jie; Li, Zedong; Choi, Jane Ru; Yang, Qingzhen; Lin, Min; Ying Hui, Li; Xu, Feng

2017-04-15

Since the invention of polymerase chain reaction (PCR) in 1985, PCR has played a significant role in molecular diagnostics for genetic diseases, pathogens, oncogenes and forensic identification. In the past three decades, PCR has evolved from end-point PCR, through real-time PCR, to its current version, which is the absolute quantitive digital PCR (dPCR). In this review, we first discuss the principles of all key steps of dPCR, i.e., sample dispersion, amplification, and quantification, covering commercialized apparatuses and other devices still under lab development. We highlight the advantages and disadvantages of different technologies based on these steps, and discuss the emerging biomedical applications of dPCR. Finally, we provide a glimpse of the existing challenges and future perspectives for dPCR. Copyright © 2016 Elsevier B.V. All rights reserved.

Norrie disease in a family with a manifesting female carrier.

PubMed

Sims, K B; Irvine, A R; Good, W V

1997-04-01

To show that Norrie disease can occur in a girl and to describe her ophthalmologic and genetic features. Amplification of DNA polymerase chain reaction and sequencing of asymmetric polymerase chain reaction for exon 3 were performed on the blood specimen obtained from a girl born with bilateral retinal detachments. A female child with bilateral retinal detachment who had 2 uncles in whom Norrie disease had already been diagnosed. The child had a mutation in the third exon (T776-->A; Ile 123-->Asn) identical to the mutation found in her uncles. Norrie disease can occur in girls. The most likely explanation is nonrandom or unfavorable X inactivation, although timing of development of the peripheral retina and its blood supply could render it vulnerable to effects of the mutant allele at a critical developmental phase.

Development of the polymerase chain reaction for diagnosis of chancroid.

PubMed Central

Chui, L; Albritton, W; Paster, B; Maclean, I; Marusyk, R

1993-01-01

The published nucleotide sequences of the 16S rRNA gene of Haemophilus ducreyi were used to develop primer sets and probes for the diagnosis of chancroid by polymerase chain reaction (PCR) DNA amplification. One set of broad specificity primers yielded a 303-bp PCR product from all bacteria tested. Two 16-base probes internal to this sequence were species specific for H. ducreyi when tested with 12 species of the families Pasteurellaceae and Enterobacteriaceae. The two probes in combination with the broad specificity primers were 100% sensitive with 51 strains of H. ducreyi isolated from six continents over a 15-year period. The direct detection of H. ducreyi from 100 clinical specimens by PCR showed a sensitivity of 83 to 98% and a specificity of 51 to 67%, depending on the number of amplification cycles. Images PMID:8458959

A temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

NASA Astrophysics Data System (ADS)

Bu, Minqiang; Perch-Nielsen, Ivan R.; Sørensen, Karen S.; Skov, Julia; Sun, Yi; Duong Bang, Dang; Pedersen, Michael E.; Hansen, Mikkel F.; Wolff, Anders

2013-07-01

We present a temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with an external heater and a temperature sensor. The method employs optimized temperature overshooting and undershooting steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature-dependent fluorescence signal from Rhodamine B. The method was validated with the PCR amplification of mecA gene (162 bp) from methicillin-resistant Staphylococcus aureus bacterium (MRSA), where the time for 30 cycles was reduced from 50 min (without over- and undershooting) to 20 min.

Absence of giant blood Marseille-like virus DNA detection by polymerase chain reaction in plasma from healthy US blood donors and serum from multiply transfused patients from Cameroon.

PubMed

Phan, Tung Gia; Desnues, Christelle; Switzer, William M; Djoko, Cyrille F; Schneider, Bradley S; Deng, Xutao; Delwart, Eric

2015-06-01

A new Marseilleviridae virus family member, giant blood Marseille-like (GBM) virus, was recently reported in persons from France in the serum of an infant with adenitis, in the blood of 4% of healthy blood donors, and in 9% of multiply transfused thalassemia patients. These results suggested the presence of a nucleocytoplasmic large DNA virus potentially transmissible by blood product transfusion. To investigate this possibility we tested the plasma from 113 US blood donors and 74 multiply transfused Cameroon patients for GBM viral DNA using highly sensitive polymerase chain reaction (PCR) assays. GBM DNA was not detected by nested PCR in any of these 187 human specimens. Further testing is required to confirm the occurrence of human GBM virus infections. © 2015 AABB.

Novel TaqMan real-time polymerase chain reaction assay for verifying the authenticity of meat and commercial meat products from game birds.

PubMed

Rojas, María; González, Isabel; Pavón, Miguel Angel; Pegels, Nicolette; Lago, Adriana; Hernández, Pablo E; García, Teresa; Martín, Rosario

2010-06-01

Species-specific real-time polymerase chain reaction (PCR) assays using TaqMan probes have been developed for verifying the labeling of meat and commercial meat products from game birds, including quail, pheasant, partridge, guinea fowl, pigeon, Eurasian woodcock and song thrush. The method combines the use of species-specific primers and TaqMan probes that amplify small fragments (amplicons <150 base pairs) of the mitochondrial 12S rRNA gene, and an endogenous control primer pair that amplifies a 141-bp fragment of the nuclear 18S rRNA gene from eukaryotic DNA. Analysis of experimental raw and heat-treated binary mixtures as well as of commercial meat products from the target species demonstrated the suitability of the assay for the detection of the target DNAs.

A novel polymerase chain reaction (PCR) - denaturing gradient gel electrophoresis (DGGE) for the identification of Micrococcaceae strains involved in meat fermentations. Its application to naturally fermented Italian sausages.

PubMed

Cocolin, L; Manzano, M; Aggio, D; Cantoni, C; Comi, G

2001-05-01

A new molecular method consisting of polymerase chain reaction (PCR) amplification and denaturing gradient gel electrophoresis (DGGE) of a small fragment from the 16S rRNA gene identified the Micrococcaceae strains isolated from natural fermented Italian sausages. Lactic acid bacteria, total aerobic mesophilic flora, Enterobacteriaceae and faecal enterococci were also monitored. Micrococcaceaea control strains from international collections were used to optimise the method and 90 strains, isolated from fermented sausages, were identified by biochemical tests and PCR-DGGE. No differences were observed between the methods used. The results reported in this paper prove that Staphylococcus xylosus is the main bacterium involved in fermented sausage production, representing, from the tenth day of ripening, the only Micrococcaceaea species isolated.

High-throughput amplification of mature microRNAs in uncharacterized animal models using polyadenylated RNA and stem-loop reverse transcription polymerase chain reaction.

PubMed

Biggar, Kyle K; Wu, Cheng-Wei; Storey, Kenneth B

2014-10-01

This study makes a significant advancement on a microRNA amplification technique previously used for expression analysis and sequencing in animal models without annotated mature microRNA sequences. As research progresses into the post-genomic era of microRNA prediction and analysis, the need for a rapid and cost-effective method for microRNA amplification is critical to facilitate wide-scale analysis of microRNA expression. To facilitate this requirement, we have reoptimized the design of amplification primers and introduced a polyadenylation step to allow amplification of all mature microRNAs from a single RNA sample. Importantly, this method retains the ability to sequence reverse transcription polymerase chain reaction (RT-PCR) products, validating microRNA-specific amplification. Copyright © 2014 Elsevier Inc. All rights reserved.

Real-time quantitative polymerase chain reaction methods for four genetically modified maize varieties and maize DNA content in food.

PubMed

Brodmann, Peter D; Ilg, Evelyn C; Berthoud, Hélène; Herrmann, Andre

2002-01-01

Quantitative detection methods are needed for enforcement of the recently introduced labeling threshold for genetically modified organisms (GMOs) in food ingredients. This labeling threshold, which is set to 1% in the European Union and Switzerland, must be applied to all approved GMOs. Four different varieties of maize are approved in the European Union: the insect-resistant Bt176 maize (Maximizer), Btl 1 maize, Mon810 (YieldGard) maize, and the herbicide-tolerant T25 (Liberty Link) maize. Because the labeling must be considered individually for each ingredient, a quantitation system for the endogenous maize content is needed in addition to the GMO-specific detection systems. Quantitative real-time polymerase chain reaction detection methods were developed for the 4 approved genetically modified maize varieties and for an endogenous maize (invertase) gene system.

[Development of molecular detection of food-borne pathogenic bacteria using miniaturized microfluidic devices].

PubMed

Iván, Kristóf; Maráz, Anna

2015-12-20

Detection and identification of food-borne pathogenic bacteria are key points for the assurance of microbiological food safety. Traditional culture-based methods are more and more replaced by or supplemented with nucleic acid based molecular techniques, targeting specific (preferably virulence) genes in the genomes. Internationally validated DNA amplification - most frequently real-time polymerase chain reaction - methods are applied by the food microbiological testing laboratories for routine analysis, which will result not only in shortening the time for results but they also improve the performance characteristics (e.g. sensitivity, specificity) of the methods. Beside numerous advantages of the polymerase chain reaction based techniques for routine microbiological analysis certain drawbacks have to be mentioned, such as the high cost of the equipment and reagents, as well as the risk of contamination of the laboratory environment by the polymerase chain reaction amplicons, which require construction of an isolated laboratory system. Lab-on-a-chip systems can integrate most of these laboratory processes within a miniaturized device that delivers the same specificity and reliability as the standard protocols. The benefits of miniaturized devices are: simple - often automated - use, small overall size, portability, sterility due to single use possibility. These miniaturized rapid diagnostic tests are being researched and developed at the best research centers around the globe implementing various sample preparation and molecular DNA amplification methods on-chip. In parallel, the aim of the authors' research is to develop microfluidic Lab-on-a-chip devices for the detection and identification of food-borne pathogenic bacteria.

Clinical characteristics of children with viral single- and co-infections and a petechial rash.

PubMed

Schneider, Henriette; Adams, Ortwin; Weiss, Christel; Merz, Ulrich; Schroten, Horst; Tenenbaum, Tobias

2013-05-01

Children with petechial rash are more likely to undergo invasive diagnostics, to be treated with antibiotics for potential bacterial infection and to be hospitalized. However, viruses have also been associated with petechial rash. Nonetheless, a systematic analysis of viral infections with modern available techniques as quantitative real-time polymerase chain reaction in the context of petechial rash is lacking. The purpose of this pediatric study was to prospectively uncover viral pathogens that may promote the emergence of petechiae and to analyze the correlation with the clinical characteristics and course. We conducted a prospective study in children (0 to 18 years) presenting with petechiae and signs or symptoms of infection at the emergency department between November 2009 and March 2012. In nasopharyngeal aspirates the following viruses were analyzed by quantitative real-time polymerase chain reaction: cytomegalovirus, Epstein-Barr virus, parvovirus B19, influenza A and B, parainfluenza viruses, human respiratory syncytial virus A and B, human metapneumovirus, rhinovirus, enterovirus, adenovirus, human coronavirus OC43, 229E, NL63 and human bocavirus. A viral pathogen was identified in 67% of the analyzed 58 cases with petechial rash. Virus positive patients showed a significantly higher incidence of lower respiratory tract infections. Forty-one percent were viral coinfections, which were significantly younger than virus negative patients, had a higher leukocyte count and were hospitalized for a longer time. A petechial rash is frequently associated viral single- and coinfections and can rapidly be identified via quantitative real-time polymerase chain reaction.

Prevalence of Sexually Transmitted Diseases in Asymptomatic Renal Transplant Recipients.

PubMed

Sarier, Mehmet; Sepin Ozen, Nevgun; Guler, Hicran; Duman, Ibrahim; Yüksel, Yücel; Tekin, Sabri; Yavuz, Asuman Havva; Yucetin, Levent; Erdogan Yilmaz, Mine

2018-04-04

Sexually transmitted diseases, which may be asymptomatic, have the potential to cause serious health problems in renal transplant recipients. The aim of this study was to determine the prevalence of sexually transmitted diseases in sexually active asymptomatic renal transplant patients by using real-time multiplex polymerase chain reaction assays. This prospective controlled study was conducted between November 2016 and January 2017 in our hospital. Our study group included 80 consecutive, sexually active asymptomatic patients (40 men and 40 women) who had undergone renal transplant in our hospital and who presented to our outpatient clinic for routine follow-up. We also included a control group of 80 consecutive, sexually active nontransplant patients (40 men and 40 women). All patient samples were tested for Gardnerella vaginalis and obligate anaerobes (Prevotella bivia, Porphyromonas species), Candida species, Mycoplasma hominis, Mycoplasma genitalium, Ureaplasma species, Trichomonas vaginalis, Neisseria gonorrhoeae, Chlamydia trachomatis, herpes simplex virus 1 and 2, and Cytomegalovirus by real-time multiplex polymerase chain reaction. The prevalences of infection with Gardnerella vaginalis and obligate anaerobes (P = .043), Ureaplasma species (P = .02), and Cytomegalovirus (P = .016) were found to be significantly higher in the study group versus the control group. However, there was no difference between the 2 groups regarding the prevalence of Mycoplasma infection (P = .70). Sexually transmitted diseases may occur more frequently in sexually active asymptomatic renal transplant recipients than in nontransplanted individuals. Real-time multiplex polymerase chain reaction analysis may be a suitable method for determining these pathogens.

Granulomatous herpes simplex encephalitis in an infant with multicystic encephalopathy: a distinct clinicopathologic entity?

PubMed

Schutz, Peter W; Fauth, Clarissa T; Al-Rawahi, Ghada N; Pugash, Denise; White, Valerie A; Stockler, Sylvia; Dunham, Christopher P

2014-04-01

Herpes simplex virus encephalitis can manifest as a range of clinical presentations including classic adult, neonatal, and biphasic chronic-granulomatous herpes encephalitis. We report an infant with granulomatous herpes simplex virus type 2 encephalitis with a subacute course and multicystic encephalopathy. A 2-month-old girl presented with lethargy and hypothermia. Computed tomography scan of the head showed multicystic encephalopathy and calcifications. Cerebrospinal fluid analysis by polymerase chain reaction testing for herpes simplex virus 1 and 2, enterovirus, and cytomegalovirus was negative. Normal cerebrospinal fluid interferon-α levels argued against Aicardi-Goutières syndrome. The patient died 2 weeks after presentation. At autopsy, multicystic encephalopathy was confirmed with bilateral gliosis, granulomatous inflammation with multinucleated giant cells, and calcifications. Bilateral healing necrotizing retinitis suggested a viral etiology, but retina and brain were free of viral inclusions and immunohistochemically negative for herpes simplex virus-2 and cytomegalovirus. However, polymerase chain reaction analysis showed herpes simplex virus-2 DNA in four cerebral paraffin blocks. Subsequent repeat testing of the initial cerebrospinal fluid sample using a different polymerase chain reaction assay was weakly positive for herpes simplex virus-2 DNA. Granulomatous herpes simplex virus encephalitis in infants can present with subacute course and result in multicystic encephalopathy with mineralization and minimal cerebrospinal fluid herpes simplex virus DNA load. Infectious etiologies should be carefully investigated in the differential diagnosis of multicystic encephalopathy with mineralization, in particular if multinucleated giant cells are present. Copyright © 2014 Elsevier Inc. All rights reserved.

Molecular testing for familial hypercholesterolaemia-associated mutations in a UK-based cohort: development of an NGS-based method and comparison with multiplex polymerase chain reaction and oligonucleotide arrays.

PubMed

Reiman, Anne; Pandey, Sarojini; Lloyd, Kate L; Dyer, Nigel; Khan, Mike; Crockard, Martin; Latten, Mark J; Watson, Tracey L; Cree, Ian A; Grammatopoulos, Dimitris K

2016-11-01

Background Detection of disease-associated mutations in patients with familial hypercholesterolaemia is crucial for early interventions to reduce risk of cardiovascular disease. Screening for these mutations represents a methodological challenge since more than 1200 different causal mutations in the low-density lipoprotein receptor has been identified. A number of methodological approaches have been developed for screening by clinical diagnostic laboratories. Methods Using primers targeting, the low-density lipoprotein receptor, apolipoprotein B, and proprotein convertase subtilisin/kexin type 9, we developed a novel Ion Torrent-based targeted re-sequencing method. We validated this in a West Midlands-UK small cohort of 58 patients screened in parallel with other mutation-targeting methods, such as multiplex polymerase chain reaction (Elucigene FH20), oligonucleotide arrays (Randox familial hypercholesterolaemia array) or the Illumina next-generation sequencing platform. Results In this small cohort, the next-generation sequencing method achieved excellent analytical performance characteristics and showed 100% and 89% concordance with the Randox array and the Elucigene FH20 assay. Investigation of the discrepant results identified two cases of mutation misclassification of the Elucigene FH20 multiplex polymerase chain reaction assay. A number of novel mutations not previously reported were also identified by the next-generation sequencing method. Conclusions Ion Torrent-based next-generation sequencing can deliver a suitable alternative for the molecular investigation of familial hypercholesterolaemia patients, especially when comprehensive mutation screening for rare or unknown mutations is required.

Single polysaccharide assembly protein that integrates polymerization, termination, and chain-length quality control

PubMed Central

Williams, Danielle M.; Ovchinnikova, Olga G.; Koizumi, Akihiko; Mainprize, Iain L.; Kimber, Matthew S.; Lowary, Todd L.

2017-01-01

Lipopolysaccharides (LPS) are essential outer membrane glycolipids in most gram-negative bacteria. Biosynthesis of the O-antigenic polysaccharide (OPS) component of LPS follows one of three widely distributed strategies, and similar processes are used to assemble other bacterial surface glycoconjugates. This study focuses on the ATP-binding cassette (ABC) transporter-dependent pathway, where glycans are completed on undecaprenyl diphosphate carriers at the cytosol:membrane interface, before export by the ABC transporter. We describe Raoultella terrigena WbbB, a prototype for a family of proteins that, remarkably, integrates several key activities in polysaccharide biosynthesis into a single polypeptide. WbbB contains three glycosyltransferase (GT) modules. Each of the GT102 and GT103 modules characterized here represents a previously unrecognized GT family. They form a polymerase, generating a polysaccharide of [4)-α-Rhap-(1→3)-β-GlcpNAc-(1→] repeat units. The polymer chain is terminated by a β-linked Kdo (3-deoxy-d-manno-oct-2-ulosonic acid) residue added by a third GT module belonging to the recently discovered GT99 family. The polymerase GT modules are separated from the GT99 chain terminator by a coiled-coil structure that forms a molecular ruler to determine product length. Different GT modules in the polymerase domains of other family members produce diversified OPS structures. These findings offer insight into glycan assembly mechanisms and the generation of antigenic diversity as well as potential tools for glycoengineering. PMID:28137848

Oligomerization of the E. coli Core RNA Polymerase: Formation of (α2ββ'ω)2–DNA Complexes and Regulation of the Oligomerization by Auxiliary Subunits

PubMed Central

Kansara, Seema G.; Sukhodolets, Maxim V.

2011-01-01

In this work, using multiple, dissimilar physico-chemical techniques, we demonstrate that the Escherichia coli RNA polymerase core enzyme obtained through a classic purification procedure forms stable (α2ββ'ω)2 complexes in the presence or absence of short DNA probes. Multiple control experiments indicate that this self-association is unlikely to be mediated by RNA polymerase-associated non-protein molecules. We show that the formation of (α2ββ'ω)2 complexes is subject to regulation by known RNA polymerase interactors, such as the auxiliary SWI/SNF subunit of RNA polymerase RapA, as well as NusA and σ70. We also demonstrate that the separation of the core RNA polymerase and RNA polymerase holoenzyme species during Mono Q chromatography is likely due to oligomerization of the core enzyme. We have analyzed the oligomeric state of the polymerase in the presence or absence of DNA, an aspect that was missing from previous studies. Importantly, our work demonstrates that RNA polymerase oligomerization is compatible with DNA binding. Through in vitro transcription and in vivo experiments (utilizing a RapAR599/Q602 mutant lacking transcription-stimulatory function), we demonstrate that the formation of tandem (α2ββ'ω)2–DNA complexes is likely functionally significant and beneficial for the transcriptional activity of the polymerase. Taken together, our findings suggest a novel structural aspect of the E. coli elongation complex. We hypothesize that transcription by tandem RNA polymerase complexes initiated at hypothetical bidirectional “origins of transcription” may explain recurring switches of the direction of transcription in bacterial genomes. PMID:21533049

Whole genome amplification of DNA extracted from FFPE tissues.

PubMed

Bosso, Mira; Al-Mulla, Fahd

2011-01-01

Whole genome amplification systems were developed to meet the increasing research demands on DNA resources and to avoid DNA shortage. The technology enables amplification of nanogram amounts of DNA into microgram quantities and is increasingly used in the amplification of DNA from multiple origins such as blood, fresh frozen tissue, formalin-fixed paraffin-embedded tissues, saliva, buccal swabs, bacteria, and plant and animal sources. This chapter focuses on the use of GenomePlex(®) tissue Whole Genome Amplification Kit, to amplify DNA directly from archived tissue. In addition, this chapter documents our unique experience with the utilization of GenomePlex(®) amplified DNA using several molecular techniques including metaphase Comparative Genomic Hybridization, array Comparative Genomic Hybridization, and real-time quantitative polymerase chain reaction assays. GenomePlex(®) is a registered trademark of Rubicon Genomics Incorporation.

A new protocol to detect multiple foodborne pathogens with PCR dipstick DNA chromatography after a six-hour enrichment culture in a broad-range food pathogen enrichment broth.

PubMed

Hayashi, Masahiro; Natori, Tatsuya; Kubota-Hayashi, Sayoko; Miyata, Machiko; Ohkusu, Kiyofumi; Kawamoto, Keiko; Kurazono, Hisao; Makino, Souichi; Ezaki, Takayuki

2013-01-01

A quick foodborne pathogen screening method after six-hour enrichment culture with a broad-range food pathogen enrichment broth is described. Pathogenic factors of Salmonella enterica, Shigella spp., enteroinvasive Escherichia coli, and enterohemorrhagic E. coli are amplified with a cocktail primer and rapid polymerase chain reaction (PCR), which finishes amplification in 30 min. The PCR amplicon was differentiated with a dipstick DNA chromatography assay in 5-10 min. Starting from a four- to six-hour enrichment culture, this assay was finished within 45 min. Detection sensitivity of this protocol was less than 2.5 CFU/25 g for S. enterica and 3.3 CFU/25 g for enterohemorrhagic E. coli in spiked ground meat experiments.

Sustained response to standard dose osimertinib in a patient with plasma T790M-positive leptomeningeal metastases from primary lung adenocarcinoma.

PubMed

Chan, Oscar Siu-Hong; Leung, Warren Kam-Wing; Yeung, Rebecca Mei-Wan

2017-12-01

A 44-year-old male, never smoker, suffers from stage IV adenocarcinoma of the right lung with epidermal growth factor receptor (EGFR) exon-21 L858R point mutation on initial presentation. After 23 months of treatment with gefitinib, intercalated with multiple courses of radiotherapy, leptomeningeal metastases (LMs) developed. Acquired T790M mutation was confirmed by the droplet digital polymerase chain reaction plasma EGFR test. After switching to osimertinib at the standard dose, his neurocognitive function improved clinically, coupled with sustained radiological improvement. As this clinical entity is underrepresented in clinical trials, the practicability of plasma EGFR testing and the optimal dose-response relationship of osimertinib in T790M-positive lung cancer complicated with LM deserves further exploration. © 2017 John Wiley & Sons Australia, Ltd.

DETECTION OF OPHIDIOMYCES OPHIODIICOLA IN TWO CAPTIVE BOCOURT WATER SNAKES ( SUBSESSOR BOCOURTI) AND ONE CAPTIVE PUEBLAN MILK SNAKE ( LAMPROPELTIS TRIANGULUM CAMPBELLI).

PubMed

Picquet, Pierre; Heckers, Kim O; Kolesnik, Ekaterina; Heusinger, Anton; Marschang, Rachel E

2018-03-01

Two captive Bocourt water snakes ( Subsessor bocourti) presented with chronic white skin lesions on their heads; Ophidiomyces ophiodiicola was identified by culture and polymerase chain reaction (PCR) in skin scrapings from both snakes. Histopathology performed in one Bocourt water snake revealed fungal hyphae in epidermal structures of lesions. One Pueblan milk snake ( Lampropeltis triangulum campbelli) from the same zoologic institution presented with yellow crusts and white blisters on its body, from which O. ophiodiicola was identified by culture and PCR. Two of the three snakes apparently recovered from lesions after multiple natural sheds, whereas the third snake died. This is the first report of O. ophiodiicola infection in Bocourt water snakes and in a Pueblan milk snake, as well as the first report of O. ophiodiicola in France.

The Complete Remission of Acquired Immunodeficiency Syndrome-associated Isolated Central Nervous System Lymphomatoid Granulomatosis: A Case Report and Review of the Literature

PubMed Central

Kano, Yasuhiro; Kodaira, Minori; Ushiki, Atsuhito; Kosaka, Makoto; Yamada, Mitsunori; Shingu, Kunihiko; Nishihara, Hiroshi; Hanaoka, Masayuki; Sekijima, Yoshiki

2017-01-01

A 49-year-old man presented with gradually progressive aphasia one month after being diagnosed with acquired immunodeficiency syndrome (AIDS). Brain magnetic resonance imaging showed multiple brain lesions with punctate and linear enhancement. A polymerase chain reaction detected Epstein-Barr virus (EBV) in the patient's cerebrospinal fluid. A diagnosis of isolated central nervous system lymphomatoid granulomatosis (CNS-LYG) was made based on the brain biopsy findings. The complete remission of CNS-LYG was achieved by anti-retroviral therapy (ART) alone. In the present case, the development of AIDS-associated CNS-LYG was considered to have been initiated by the reactivation of EBV in the CNS under immunosuppressive conditions. The patient's condition improved with the reconstitution of the patient's immune system. PMID:28824078

Peliosis hepatis in a dog infected with Bartonella henselae.

PubMed

Kitchell, B E; Fan, T M; Kordick, D; Breitschwerdt, E B; Wollenberg, G; Lichtensteiger, C A

2000-02-15

A 6-year-old spayed female Golden Retriever was examined because of generalized weakness and abdominal distention. Abdominal ultrasonography revealed a large quantity of peritoneal fluid. In addition, the liver appeared larger than normal and contained multiple, small, nodular masses and cyst-like structures. Abdominal exploratory surgery was performed, and 5 L of serosanguineous peritoneal fluid was removed. Gross lesions were not found in the stomach, kidneys, intestines, adrenal glands, or urinary bladder. There were diffuse cystic nodules in all liver lobes. The dog did not recover from anesthesia. A diagnosis of peliosis hepatis was made on the basis of gross and histologic appearance of the liver. A polymerase chain reaction assay revealed Bartonella henselae DNA in liver specimens. To our knowledge, this is the first report of molecular evidence of B henselae infection in a dog with peliosis hepatis.

Studies on sex-organ development. Changes in chromatin structure during spermatogenesis in maturing rooster testis as demonstrated by the initiation pattern of ribonucleic acid synthesis in vitro.

PubMed Central

Mezquita, C; Teng, C S

1978-01-01

To probe the structural change in the genome of the differentiating germ cell of the maturing rooster testis, the chromatin from nuclei at various stages of differentiation were transcribed with prokaryotic RNA polymerase from Escherichia coli or with eukaryotic RNA polymerase II from wheat germ. The transcription was performed under conditions of blockage of RNA chain reinitiation in vitro with rifampicin or rifampicin AF/013. With the E. coli enzyme, the changes in (1) the titration curve for the enzyme-chromatin interaction, (2) the number of initiation sites, (3) the rate of elongation of RNA chains, and (4) the kinetics of the formation of stable initiation complexes revealed the unmasking of DNA in elongated spermatids and the masking of DNA in spermatozoa. In both cases the stability of the DNA duplex in the initiation region for RNA synthesis greatly increased. In contrast with the E. coli enzyme, the wheat-germ RNA polymerase II was relatively inefficient at transcribing chromatin of elongated spermatids. Such behaviour can be predicted if unmasked double-stranded DNA is present in elongated spermatids. PMID:346018

Gene 1.7 of bacteriophage T7 confers sensitivity of phage growth to dideoxythymidine.

PubMed

Tran, Ngoc Q; Rezende, Lisa F; Qimron, Udi; Richardson, Charles C; Tabor, Stanley

2008-07-08

Bacteriophage T7 DNA polymerase efficiently incorporates dideoxynucleotides into DNA, resulting in chain termination. Dideoxythymidine (ddT) present in the medium at levels not toxic to Escherichia coli inhibits phage T7. We isolated 95 T7 phage mutants that were resistant to ddT. All contained a mutation in T7 gene 1.7, a nonessential gene of unknown function. When gene 1.7 was expressed from a plasmid, T7 phage resistant to ddT still arose; analysis of 36 of these mutants revealed that all had a single mutation in gene 5, which encodes T7 DNA polymerase. This mutation changes tyrosine-526 to phenylalanine, which is known to increase dramatically the ability of T7 DNA polymerase to discriminate against dideoxynucleotides. DNA synthesis in cells infected with wild-type T7 phage was inhibited by ddT, suggesting that it resulted in chain termination of DNA synthesis in the presence of gene 1.7 protein. Overexpression of gene 1.7 from a plasmid rendered E. coli cells sensitive to ddT, indicating that no other T7 proteins are required to confer sensitivity to ddT.

Bypass of lethality with mosaic mice generated by Cre-loxP-mediated recombination.

PubMed

Betz, U A; Vosshenrich, C A; Rajewsky, K; Müller, W

1996-10-01

The analysis of gene function based on the generation of mutant mice by homologous recombination in embryonic stem cells is limited if gene disruption results in embryonic lethality. Mosaic mice, which contain a certain proportion of mutant cells in all organs, allow lethality to be circumvented and the potential of mutant cells to contribute to different cell lineages to be analyzed. To generate mosaic animals, we used the bacteriophage P1-derived Cre-loxP recombination system, which allows gene alteration by Cre-mediated deletion of loxP-flanked gene segments. We generated nestin-cre transgenic mouse lines, which expressed the Cre recombinase under the control of the rat nestin promoter and its second intron enhancer. In crosses to animals carrying a loxP-flanked target gene, partial deletion of the loxP-flanked allele occurred before day 10.5 post coitum and was detectable in all adult organs examined, including germ-line cells. Using this approach, we generated mosaic mice containing cells deficient in the gamma-chain of the interleukin-2 receptor (IL-2R gamma); in these animals, the IL-2R gamma-deficient cells were underrepresented in the thymus and spleen. Because mice deficient in DNA polymerase beta die perinatally, we studied the effects of DNA polymerase beta deficiency in mosaic animals. We found that some of the mosaic polymerase beta-deficient animals were viable, but were often reduced in size and weight. The fraction of DNA polymerase beta-deficient cells in mosaic embryos decreased during embryonic development, presumably because wild-type cells had a competitive advantage. The nestin-cre transgenic mice can be used to generate mosaic animals in which target genes are mutated by Cre-mediated recombination of loxP-flanked target genes. By using mosaic animals, embryonic lethality can be bypassed and cell lineages for whose development a given target gene is critical can be identified. In the case of DNA polymerase beta, deficient cells are already selected against during embryonic development, demonstrating the general importance of this protein in multiple cell types.

Darwin Assembly: fast, efficient, multi-site bespoke mutagenesis

PubMed Central

Cozens, Christopher

2018-01-01

Abstract Engineering proteins for designer functions and biotechnological applications almost invariably requires (or at least benefits from) multiple mutations to non-contiguous residues. Several methods for multiple site-directed mutagenesis exist, but there remains a need for fast and simple methods to efficiently introduce such mutations – particularly for generating large, high quality libraries for directed evolution. Here, we present Darwin Assembly, which can deliver high quality libraries of >108 transformants, targeting multiple (>10) distal sites with minimal wild-type contamination (<0.25% of total population) and which takes a single working day from purified plasmid to library transformation. We demonstrate its efficacy with whole gene codon reassignment of chloramphenicol acetyl transferase, mutating 19 codons in a single reaction in KOD DNA polymerase and generating high quality, multiple-site libraries in T7 RNA polymerase and Tgo DNA polymerase. Darwin Assembly uses commercially available enzymes, can be readily automated, and offers a cost-effective route to highly complex and customizable library generation. PMID:29409059

In Vitro Lesion Bypass Studies of O(4)-Alkylthymidines with Human DNA Polymerase η.

PubMed

Williams, Nicole L; Wang, Pengcheng; Wu, Jiabin; Wang, Yinsheng

2016-04-18

Environmental exposure and endogenous metabolism can give rise to DNA alkylation. Among alkylated nucleosides, O(4)-alkylthymidine (O(4)-alkyldT) lesions are poorly repaired in mammalian systems and may compromise the efficiency and fidelity of cellular DNA replication. To cope with replication-stalling DNA lesions, cells are equipped with translesion synthesis DNA polymerases that are capable of bypassing various DNA lesions. In this study, we assessed human DNA polymerase η (Pol η)-mediated bypass of various O(4)-alkyldT lesions, with the alkyl group being Me, Et, nPr, iPr, nBu, iBu, (R)-sBu, or (S)-sBu, in template DNA by conducting primer extension and steady-state kinetic assays. Our primer extension assay results revealed that human Pol η, but not human polymerases κ and ι or yeast polymerase ζ, was capable of bypassing all O(4)-alkyldT lesions and extending the primer to generate full-length replication products. Data from steady-state kinetic measurements showed that Pol η preferentially misincorporated dGMP opposite O(4)-alkyldT lesions with a straight-chain alkyl group. The nucleotide misincorporation opposite most lesions with a branched-chain alkyl group was, however, not selective, where dCMP, dGMP, and dTMP were inserted at similar efficiencies opposite O(4)-iPrdT, O(4)-iBudT, and O(4)-(R)-sBudT. These results provide important knowledge about the effects of the length and structure of the alkyl group in O(4)-alkyldT lesions on the fidelity and efficiency of DNA replication mediated by human Pol η.

NMR solution structure of poliovirus uridylyated peptide linked to the genome (VPgpU)

PubMed Central

Schein, Catherine H.; Oezguen, Numan; van der Heden van Noort, Gerbrand J.; Filippov, Dmitri V.; Paul, Aniko; Kumar, Eric; Braun, Werner

2010-01-01

Picornaviruses have a 22–24 amino acid peptide, VPg, bound covalently at the 5’ end of their RNA, that is essential for replication. VPgs are uridylylated at a conserved Tyrosine to form VPgpU, the primer of RNA synthesis by the viral polymerase. This first complete structure for any uridylylated VPg, of poliovirus type 1 (PV1)-VPgpU, shows that conserved amino acids in VPg stabilize the bound UMP, with the uridine atoms involved in base pairing and chain elongation projected outward. Comparing this structure to PV1-VPg and partial structures of VPg/VPgpU from other picornaviruses suggests that enteroviral polymerases require a more stable VPg structure than does the distantly related aphthovirus, foot and mouth disease virus (FMDV). The glutamine residue at the C-terminus of PV1-VPgpU lies in back of the uridine base and may stabilize its position during chain elongation and/or contribute to base specificity. Under in vivo-like conditions with the authentic cre(2C) hairpin RNA and Mg++, 5-methylUTP cannot compete with UTP for VPg uridylyation in an in vitro uridylyation assay, but both nucleotides are equally incorporated by PV1-polymerase with Mn++ and a poly-A RNA template. This indicates the 5 position is recognized under in vivo conditions. The compact VPgpU structure docks within the active site cavity of the PV-polymerase, close to the position seen for the fragment of FMDV-VPgpU with its polymerase. This structure could aid in design of novel enterovirus inhibitors, and stabilization upon uridylylation may also be pertinent for post-translational uridylylation reactions that underlie other biological processes. PMID:20441784

Characterization of an Avipoxvirus From a Bald Eagle ( Haliaeetus leucocephalus ) Using Novel Consensus PCR Protocols for the rpo147 and DNA-Dependent DNA Polymerase Genes.

PubMed

Stephen, Alexa A; Leone, Angelique M; Toplon, David E; Archer, Linda L; Wellehan, James F X

2016-12-01

A juvenile female bald eagle ( Haliaeetus leucocephalus ) was presented with emaciation and proliferative periocular lesions. The eagle did not respond to supportive therapy and was euthanatized. Histopathologic examination of the skin lesions revealed plaques of marked epidermal hyperplasia parakeratosis, marked acanthosis and spongiosis, and eosinophilic intracytoplasmic inclusion bodies. Novel polymerase chain reaction (PCR) assays were done to amplify and sequence DNA polymerase and rpo147 genes. The 4b gene was also analyzed by a previously developed assay. Bayesian and maximum likelihood phylogenetic analyses of the obtained sequences found it to be poxvirus of the genus Avipoxvirus and clustered with other raptor isolates. Better phylogenetic resolution was found in rpo147 rather than the commonly used DNA polymerase. The novel consensus rpo147 PCR assay will create more accurate phylogenic trees and allow better insight into poxvirus history.

A Systematic Analysis of Factors Localized to Damaged Chromatin Reveals PARP-Dependent Recruitment of Transcription Factors.

PubMed

Izhar, Lior; Adamson, Britt; Ciccia, Alberto; Lewis, Jedd; Pontano-Vaites, Laura; Leng, Yumei; Liang, Anthony C; Westbrook, Thomas F; Harper, J Wade; Elledge, Stephen J

2015-06-09

Localization to sites of DNA damage is a hallmark of DNA damage response (DDR) proteins. To identify DDR factors, we screened epitope-tagged proteins for localization to sites of chromatin damaged by UV laser microirradiation and found >120 proteins that localize to damaged chromatin. These include the BAF tumor suppressor complex and the amyotrophic lateral sclerosis (ALS) candidate protein TAF15. TAF15 contains multiple domains that bind damaged chromatin in a poly-(ADP-ribose) polymerase (PARP)-dependent manner, suggesting a possible role as glue that tethers multiple PAR chains together. Many positives were transcription factors; > 70% of randomly tested transcription factors localized to sites of DNA damage, and of these, ∼90% were PARP dependent for localization. Mutational analyses showed that localization to damaged chromatin is DNA-binding-domain dependent. By examining Hoechst staining patterns at damage sites, we see evidence of chromatin decompaction that is PARP dependent. We propose that PARP-regulated chromatin remodeling at sites of damage allows transient accessibility of DNA-binding proteins. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Multicentric T-cell lymphoma associated with feline leukemia virus infection in a captive namibian cheetah (Acinonyx jubatus).

PubMed

Marker, Laurie; Munson, Linda; Basson, Peter A; Quackenbush, Sandra

2003-07-01

This case report describes a multicentric lymphoma in a 4 yr old female wildborn captive cheetah (Acinonyx jubatus) in Namibia after being housed in an enclosure adjacent to a feline leukemia virus (FeLV) infected cheetah that had previously been in contact with domestic cats. The year prior to the onset of clinical signs, the wild-born cheetah was FeLV antigen negative. The cheetah subsequently developed lymphoma, was found to be infected with FeLV, and then rapidly deteriorated and died. At necropsy, the liver, spleen, lymph nodes, and multiple other organs were extensively infiltrated with neoplastic T-lymphocytes. Feline leukemia virus DNA was identified in neoplastic lymphocytes from multiple organs by polymerase chain reaction and Southern blot analysis. Although the outcome of infection in this cheetah resembles that of FeLV infections in domestic cats, the transmission across an enclosure fence was unusual and may indicate a heightened susceptibility to infection in cheetahs. Caution should be exercised in holding and translocating cheetahs where contact could be made with FeLV-infected domestic, feral, or wild felids.

Sequence-specific "gene signatures" can be obtained by PCR with single specific primers at low stringency.

PubMed Central

Pena, S D; Barreto, G; Vago, A R; De Marco, L; Reinach, F C; Dias Neto, E; Simpson, A J

1994-01-01

Low-stringency single specific primer PCR (LSSP-PCR) is an extremely simple PCR-based technique that detects single or multiple mutations in gene-sized DNA fragments. A purified DNA fragment is subjected to PCR using high concentrations of a single specific oligonucleotide primer, large amounts of Taq polymerase, and a very low annealing temperature. Under these conditions the primer hybridizes specifically to its complementary region and nonspecifically to multiple sites within the fragment, in a sequence-dependent manner, producing a heterogeneous set of reaction products resolvable by electrophoresis. The complex banding pattern obtained is significantly altered by even a single-base change and thus constitutes a unique "gene signature." Therefore LSSP-PCR will have almost unlimited application in all fields of genetics and molecular medicine where rapid and sensitive detection of mutations and sequence variations is important. The usefulness of LSSP-PCR is illustrated by applications in the study of mutants of smooth muscle myosin light chain, analysis of a family with X-linked nephrogenic diabetes insipidus, and identity testing using human mitochondrial DNA. Images PMID:8127912

Preimplantation genetic diagnosis for Duchenne muscular dystrophy by multiple displacement amplification.

PubMed

Ren, Zi; Zeng, Hai-tao; Xu, Yan-wen; Zhuang, Guang-lun; Deng, Jie; Zhang, Cheng; Zhou, Can-quan

2009-02-01

To evaluate the use of multiple displacement amplification (MDA) in preimplantation genetic diagnosis (PGD) for female carriers with Duchenne muscular dystrophy (DMD). MDA was used to amplify a whole genome of single cells. Following the setup on single cells, the test was applied in two clinical cases of PGD. One mutant exon, six short tandem repeats (STR) markers within the dystrophin gene, and amelogenin were incorporated into singleplex polymerase chain reaction (PCR) assays on MDA products of single blastomeres. Center for reproductive medicine in First Affiliated Hospital, Sun Yat-sen University, China. Two female carriers with a duplication of exons 3-11 and a deletion of exons 47-50, respectively. The MDA of single cells and fluorescent PCR assays for PGD. The ability to analyze single blastomeres for DMD using MDA. The protocol setup previously allowed for the accurate diagnosis of each embryo. Two clinical cases resulted in a healthy girl, which was the first successful clinical application of MDA in PGD for DMD. We suggest that this protocol is reliable to increase the accuracy of the PGD for DMD.

HSV1 and 2 detection in the CSF of multiple sclerosis patients by real-time PCR.

PubMed

Koros, Christos; Ioannidis, Anastasios; Acquaviva, Tereza; Zoga, Margarita; Nikolaou, Chryssoula; Chatzipanagiotou, Stylianos; Kossyvakis, Athanassios; Anagnostouli, Maria

2014-01-01

The pathogenic role of Herpes Simplex Virus (HSV) 1 and 2 in Multiple Sclerosis (MS) still remains obscure. The aim of our study was the assessment of HSV1 and 2 DNA prevalence in the cerebrospinal fluid (CSF) of MS patients compared to patients with other neurological disorders (OND). HSV1 and HSV2 DNA detection in the CSF of patients was performed by real time polymerase chain reaction (PCR). The genome of HSV1 was present in the CSF of 4.7% of MS patients (4 out of 85), while HSV2 was not detected in any patient. In the sub-group of OND patients, HSV1 was detected in 7.9% of patients (3 out of 38) and HSV2 was detected in 5.3% of patients (2 out of 38). Our data are in accordance with a limited number of previous reports, supporting a prevalence of HSV1 genome in less than 5% of MS patients. Copyright © 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

An autopsy case of chronic active Epstein-Barr virus infection (CAEBV): distribution of central nervous system (CNS) lesions.

PubMed

Kobayashi, Zen; Tsuchiya, Kuniaki; Takahashi, Makoto; Yokota, Osamu; Sasaki, Atsushi; Bhunchet, Ekapot; Arai, Tetsuaki; Akiyama, Haruhiko; Kamoshita, Masaharu; Kotera, Minoru; Mizusawa, Hidehiro

2008-12-15

A 27-year-old Japanese man developed recurrent respiratory and central nervous system (CNS) symptoms, and hemophagocytic syndromes with a clinical course of 6 years. CT demonstrated multiple nodular lesions in the bilateral lungs, and MRI revealed multiple abnormal intensity areas in the brain and spinal cord. Cerebrospinal fluid (CSF) examination disclosed mild pleocytosis and the presence of Epstein-Barr virus (EBV)-DNA detected by polymerase chain reaction (PCR). The patient died of a hemorrhagic shock associated with a hemophagocytic syndrome. A postmortem study revealed massive hemorrhage in the abdominal cavity and iliopsoas muscles, as well as diffuse infiltration of lymphocytes and/or macrophages into the lungs, liver, kidneys, spleen, cardiac muscle, bone marrow, and CNS. The severe involvement was demonstrated in the CNS, especially in the spinal cord and brainstem. The CD3 positive cells of the brainstem were EBV-encoded RNA 1 positive. This is the first autopsy case of chronic active EBV infection (CAEBV) in which severe and extensive CNS involvement was demonstrated.

Report of Chinese family with severe dermatitis, multiple allergies and metabolic wasting syndrome caused by novel homozygous desmoglein-1 gene mutation.

PubMed

Cheng, Ruhong; Yan, Ming; Ni, Cheng; Zhang, Jia; Li, Ming; Yao, Zhirong

2016-10-01

Recently, homozygous mutations in the desmoglein-1 (DSG1) gene and heterozygous mutation in the desmoplakin (DSP) gene have been demonstrated to be associated with severe dermatitis, multiple allergies and metabolic wasting (SAM) syndrome (Mendelian Inheritance in Man no. 615508). We aim to identify the molecular basis for a Chinese pedigree of SAM syndrome. A Chinese pedigree of SAM syndrome was subjected to mutation detection in the DSG1 gene. Sequence analysis of the DSG1 gene and quantitative reverse transcriptase polymerase chain reaction analysis for gene expression of DSG1 using cDNA derived from the epidermis of patients and controls were both performed. Skin biopsies were also taken from patients for pathological study and transmission electron microscopy observation. Novel homozygous splicing mutation c.1892-1delG in the exon-intron border of the DSG1 gene has been demonstrated to be associated with SAM syndrome. We report a new family of SAM syndrome of Asian decent and expand the spectrum of mutations in the DSG1 gene. © 2016 Japanese Dermatological Association.

Pitfalls in interpretation of CT-values of RT-PCR in children with acute respiratory tract infections.

PubMed

Wishaupt, Jérôme O; Ploeg, Tjeerd van der; Smeets, Leo C; Groot, Ronald de; Versteegh, Florens G A; Hartwig, Nico G

2017-05-01

The relation between viral load and disease severity in childhood acute respiratory tract infections (ARI) is not fully understood. To assess the clinical relevance of the relation between viral load, determined by cycle threshold (CT) value of real-time reverse transcription-polymerase chain reaction assays and disease severity in children with single- and multiple viral ARI. 582 children with ARI were prospectively followed and tested for 15 viruses. Correlations were calculated between CT values and clinical parameters. In single viral ARI, statistically significant correlations were found between viral loads of Respiratory Syncytial Virus (RSV) and hospitalization and between viral loads of Human Coronavirus (HCoV) and a disease severity score. In multiple-viral ARI, statistically significant correlations between viral load and clinical parameters were found. In RSV-Rhinovirus (RV) multiple infections, a low viral load of RV was correlated with a high length of hospital stay and a high duration of extra oxygen use. The mean CT value for RV, HCoV and Parainfluenza virus was significantly lower in single- versus multiple infections. Although correlations between CT values and clinical parameters in patients with single and multiple viral infection were found, the clinical importance of these findings is limited because individual differences in host-, viral and laboratory factors complicate the interpretation of statistically significant findings. In multiple infections, viral load cannot be used to differentiate between disease causing virus and innocent bystanders. Copyright © 2017 Elsevier B.V. All rights reserved.

A Mechanistic Model for Cooperative Behavior of Co-transcribing RNA Polymerases

PubMed Central

Heberling, Tamra; Davis, Lisa; Gedeon, Jakub; Morgan, Charles; Gedeon, Tomáš

2016-01-01

In fast-transcribing prokaryotic genes, such as an rrn gene in Escherichia coli, many RNA polymerases (RNAPs) transcribe the DNA simultaneously. Active elongation of RNAPs is often interrupted by pauses, which has been observed to cause RNAP traffic jams; yet some studies indicate that elongation seems to be faster in the presence of multiple RNAPs than elongation by a single RNAP. We propose that an interaction between RNAPs via the torque produced by RNAP motion on helically twisted DNA can explain this apparent paradox. We have incorporated the torque mechanism into a stochastic model and simulated transcription both with and without torque. Simulation results illustrate that the torque causes shorter pause durations and fewer collisions between polymerases. Our results suggest that the torsional interaction of RNAPs is an important mechanism in maintaining fast transcription times, and that transcription should be viewed as a cooperative group effort by multiple polymerases. PMID:27517607

Initiation, extension, and termination of RNA synthesis by a paramyxovirus polymerase.

PubMed

Jordan, Paul C; Liu, Cheng; Raynaud, Pauline; Lo, Michael K; Spiropoulou, Christina F; Symons, Julian A; Beigelman, Leo; Deval, Jerome

2018-02-01

Paramyxoviruses represent a family of RNA viruses causing significant human diseases. These include measles virus, the most infectious virus ever reported, in addition to parainfluenza virus, and other emerging viruses. Paramyxoviruses likely share common replication machinery but their mechanisms of RNA biosynthesis activities and details of their complex polymerase structures are unknown. Mechanistic and functional details of a paramyxovirus polymerase would have sweeping implications for understanding RNA virus replication and for the development of new antiviral medicines. To study paramyxovirus polymerase structure and function, we expressed an active recombinant Nipah virus (NiV) polymerase complex assembled from the multifunctional NiV L protein bound to its phosphoprotein cofactor. NiV is an emerging highly pathogenic virus that causes severe encephalitis and has been declared a global public health concern due to its high mortality rate. Using negative-stain electron microscopy, we demonstrated NiV polymerase forms ring-like particles resembling related RNA polymerases. We identified conserved sequence elements driving recognition of the 3'-terminal genomic promoter by NiV polymerase, and leading to initiation of RNA synthesis, primer extension, and transition to elongation mode. Polyadenylation resulting from NiV polymerase stuttering provides a mechanistic basis for transcription termination. It also suggests a divergent adaptation in promoter recognition between pneumo- and paramyxoviruses. The lack of available antiviral therapy for NiV prompted us to identify the triphosphate forms of R1479 and GS-5734, two clinically relevant nucleotide analogs, as substrates and inhibitors of NiV polymerase activity by delayed chain termination. Overall, these findings provide low-resolution structural details and the mechanism of an RNA polymerase from a previously uncharacterized virus family. This work illustrates important functional differences yet remarkable similarities between the polymerases of nonsegmented negative-strand RNA viruses.

Role of disulfide bridges in archaeal family-B DNA polymerases.

PubMed

Killelea, Tom; Connolly, Bernard A

2011-06-14

The family-B DNA polymerases obtained from the order Thermococcales, for example, Pyrococcus furiosus (Pfu-Pol) are commonly used in the polymerase chain reaction (PCR) because of their high thermostability and low error rates. Most of these polymerases contain four cysteines, arranged as two disulfide bridges. With Pfu-Pol C429-C443 forms one of the disulfides (DB1) and C507-C510 (DB2) the other. Although the disulfides are well conserved in the enzymes from the hyperthermophilic Thermococcales, they are less prevalent in euryarchaeal polymerases from other orders, and tend to be only found in other hyperthermophiles. Here, we report on the effects of deleting the disulfide bridges by mutating the relevant cysteines to serines. A variety of techniques, including differential scanning calorimetry and differential scanning fluorimetry, have shown that both disulfides make a contribution to thermostability, with DB1 being more important than DB2. However, even when both disulfides are removed, sufficient thermostability remains for normal (identical to the wild type) performance in PCR and quantitative (real-time) PCR. Therefore, polymerases totally lacking cysteine are fully compatible with most PCR-based applications. This observation opens the way to further engineering of polymerases by introduction of a single cysteine followed by appropriate chemical modification. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

MAMMALIAN DNA IN PCR REAGENTS

EPA Science Inventory

Ancient DNA analysis is becoming widespread. These studies use polymerase chain reaction (PCR) to amplify minute quantities of heavily damaged template. Unusual steps are taken to achieve the sensitivity necessary to detect ancient DNA, including high- cycle PCR amplification t...

Validation of a polymerase chain reaction aided transcript titration assay (PATTY) for topoisomerase II in lung cancer samples.

PubMed

Dingemans, A M; Van Ark-Otte, J; Smit, E F; Postmus, P E; Giaccone, G

This report describes the validation of a polymerase chain reaction aided transcript titration assay (PATTY) for tumor samples. The results obtained with the PATTY were compared to those of RNase protection in a set of 7 human lung cancer cell lines and in 23 non-small cell lung cancer samples derived from resected patients. Whereas between PATTY and RNase protection assay a good correlation was observed in the cell lines (r = 0.74, p = 0.057), no correlation was observed within the tumor samples (r = 0.06, p = 0.78). This was also the case when only tumors with a high percentage of tumor cells (> 90%) were selected. Although PATTY is a valuable tool to measure mRNA expression in cell lines, our results caution the use of PATTY in human tumor samples without proper validation. The possible causes of these results are discussed.

[The development and implementation of polymerase chain reaction to detect in real-time operation mode yersinia pestis in field material].

PubMed

Afanas'ev, M V; Chipanin, E V; Shestakov, V E; Denisov, A V; Fomina, L A; Ostiak, A S; Balakhonov, S V

2013-03-01

The article presents the results of development and practical implementation of system of polymerase chain reaction testing in real-time operation mode to detect agent of plague infield material. In laboratory conditions the system demonstrated good results and hence it was applied in conditions of field laboratory of epidemiologic team during planned epizootologic examination of Gorno-Altaisk hot spot of plague. The sampling consisted of more than 1400 objects. It was demonstrated that high sensitivity and specificity is immanent to proposed system. The adaptation of the system to the real time amplifier "Smart Cycler" (Cephid, USA) having some specific technical characteristics makes it possible to consider the proposed test-system as an effective sensitive and precise instrument for screening studies in the process of regular epizootologic examinations of hot spots of plague.

Development and interlaboratory validation of quantitative polymerase chain reaction method for screening analysis of genetically modified soybeans.

PubMed

Takabatake, Reona; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

2013-01-01

A novel real-time polymerase chain reaction (PCR)-based quantitative screening method was developed for three genetically modified soybeans: RRS, A2704-12, and MON89788. The 35S promoter (P35S) of cauliflower mosaic virus is introduced into RRS and A2704-12 but not MON89788. We then designed a screening method comprised of the combination of the quantification of P35S and the event-specific quantification of MON89788. The conversion factor (Cf) required to convert the amount of a genetically modified organism (GMO) from a copy number ratio to a weight ratio was determined experimentally. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDR), respectively. The determined RSDR values for the method were less than 25% for both targets. We consider that the developed method would be suitable for the simple detection and approximate quantification of GMO.

Simultaneous detection of hemagglutinin and neuraminidase genes of novel influenza A (H7N9) by duplex real-time reverse transcription polymerase chain reaction.

PubMed

Li, Yan; Wu, Tao; Qi, Xian; Ge, Yiyue; Guo, Xiling; Wu, Bin; Yu, Huiyan; Zhu, Yefei; Shi, Zhiyang; Wang, Hua; Cui, Lunbiao; Zhou, Minghao

2013-12-01

A novel reassortant influenza A (H7N9) virus emerged recently in China. In this study, a duplex real-time reverse transcription polymerase chain reaction (rRT-PCR) assay was developed for the simultaneous detection of hemagglutinin (HA) and neuraminidase (NA) genes of H7N9 influenza viruses. The sensitivity of the assay was determined to be 10 RNA copies per reaction for both HA and NA genes. No cross-reactivity was observed with other influenza virus subtypes or respiratory tract viruses. One hundred and forty-six clinical and environmental specimens were tested and compared with reference methods and were found to be consistent. The assay is suitable for large-scale screening due to short turnaround times and high specificity, sensitivity, and reproducibility. Copyright © 2013 Elsevier B.V. All rights reserved.

Detection and genotyping of bovine diarrhea virus by reverse transcription-polymerase chain amplification of the 5' untranslated region.

PubMed

Letellier, C; Kerkhofs, P; Wellemans, G; Vanopdenbosch, E

1999-01-01

A reverse-transcription polymerase chain reaction (RT-PCR) was developed to differentiate the bovine diarrhea virus (BVDV) from other pestiviruses, and to determine the genotype of the BVDV isolates. For this purpose, primer pairs were selected in the 5' untranslated region (5'UTR). The primers BE and B2 were located in highly conserved regions and were pestivirus-specific. Two primer pairs named B3B4 and B5B6 were specific of BVDV genotypes I and II, respectively. With this technique, an amplification product of the expected size was obtained with either the B3B4 or the B5B6 primer pairs for the 107 BVDV isolates tested but not for BDV or CSFV. For some isolates that were grouped in the genotype II, sequence analysis of the PCR fragments confirmed their classification into this genotype.

Successful treatment of toxoplasmic encephalitis diagnosed early by polymerase chain reaction after allogeneic hematopoietic stem cell transplantation: two case reports and review of the literature.

PubMed

Miyagi, T; Itonaga, H; Aosai, F; Taguchi, J; Norose, K; Mochizuki, K; Fujii, H; Furumoto, A; Ohama, M; Karimata, K; Yamanoha, A; Taniguchi, H; Sato, S; Taira, N; Moriuchi, Y; Fukushima, T; Masuzaki, H; Miyazaki, Y

2015-08-01

Toxoplasmic encephalitis represents a rare, but often fatal infection after allogeneic hematopoietic stem cell transplantation. Polymerase chain reaction (PCR)-based preemptive therapy is considered promising for this disease, but is not routinely applied, especially in low seroprevalence countries including Japan. We encountered 2 cases of toxoplasmic encephalitis after transplantation that were successfully treated. The diagnosis of toxoplasmic encephalitis in these cases was confirmed by PCR testing when neurological symptoms were observed. Both patients received pyrimethamine and sulfadiazine treatments within 2 weeks of the development of neurological symptoms, and remained free of recurrence for 32 and 12 months. These results emphasized the importance of the PCR test and immediate treatment after diagnosis for the management of toxoplasmic encephalitis. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Polymerase chain reaction: A molecular diagnostic tool in periodontology

PubMed Central

Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

2016-01-01

This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822

Removal of inhibitor(s) of the polymerase chain reaction from formalin fixed, paraffin wax embedded tissues.

PubMed

An, S F; Fleming, K A

1991-11-01

A problem associated with use of the polymerase chain reaction to amplify specific DNA fragments from formalin fixed, paraffin wax embedded tissues is the not infrequent failure of amplification. One possible reason for this could be the presence of inhibitor(s), which interfere with the activity of the reaction. It has been shown that such inhibitor(s) exist when amplifying the human beta globin gene (which exists in human genomic DNA as a single copy gene) from routine clinical samples. A variety of methods to remove such inhibitor(s) were investigated. The results indicate that inhibitor(s) are removed by proteinase K digestion, followed by purification with phenol/chloroform, and centrifugation through a Centricon-30 membrane (30,000 molecular weight cut off). Other factors, including the length and concentration of the DNA sequence to be amplified, can also affect amplification.

Detection of human papillomaviruses type 16, 18 and 33 in bronchial aspirates of lung carcinoma patients by polymerase chain reaction: a study of 84 cases in Croatia.

PubMed

Branica, Bozica Vrabec; Smojver-Jezek, Silvana; Juros, Zrinka; Grgić, Sandra; Srpak, Nives; Mitrecić, Dinko; Gajović, Srećko

2010-03-01

Besides its well-known role in cervical carcinoma, HPV is also suggested to be involved in lung cancer development. A number of authors have been investigating the presence of HPV in histological materials. We used routine bronchial aspirates from 84 patients with lung carcinoma for DNA extraction and then performed polymerase chain reaction for high-risk HPV types 16, 18 and 33. The results were compared to those obtained from buccal and eyelid mucosa. Only three patients were positive for HPV in bronchial aspirates: one for HPV 16 type, one for HPV 18 type, and one for HPV 33. Our data indicated the low prevalence of HPV in patients with lung carcinomas in Croatia, therefore it seems unlikely that HPV contributes to the development of lung carcinomas in this region.

Detection of human Pneumocystis carinii by the polymerase chain reaction.

PubMed

Becker-Hapak, M; Liberator, P; Graves, D

1991-01-01

Oligonucleotide primers were prepared from a clone (B12) which has been shown to be a repetitive sequence in the rat P. carinii genome. Polymerase chain reaction was employed to amplify both rat and human P. carinii DNA. The detection limit of the assay was approximately 600 ng of total nucleic acid. Amplification products from both the rat and human isolates (ca. 780 bp) were characterized by denaturing gradient gel electrophoresis after digestion with Sau3A. No amplification products were obtained when DNA from the following potential pulmonary pathogens were used in identical reactions: Aspergillus fumigatus, Cryptococcus neoformans, Candida albicans, Mycobacterium avium-intracellulare and cytomegalovirus. In a blind study using the B12 primers, P. carinii DNA was successfully amplified in clinical samples which were positive by direct immunofluorescence assay (IFA) as well as in some specimens not identified by direct IFA.

Aspergillus vertebral osteomyelitis in chronic leukocyte leukemia patient diagnosed by a novel panfungal polymerase chain reaction method.

PubMed

Dayan, Lior; Sprecher, Hannah; Hananni, Amos; Rosenbaum, Hana; Milloul, Victor; Oren, Ilana

2007-01-01

Vertebral osteomyelitis and disciitis caused by Aspergillus spp is a rare event. Early diagnosis and early antifungal therapy are critical in improving the prognosis for these patients. The diagnosis of invasive fungal infections is, in many cases, not straightforward and requires invasive procedures so that histological examination and culture can be performed. Furthermore, current traditional microbiological tests (ie, cultures and stains) lack the sensitivity for diagnosis of invasive aspergillosis. To present a case of vertebral osteomyelitis caused by Aspergillus spp diagnosed using a novel polymerase chain reaction (PCR) assay. Case report. Aspergillus DNA was detected in DNA extracted from the necrotic bone tissue by using a "panfungal" PCR novel method. Treatment with voriconazole was started based on the diagnosis. Using this novel technique enabled us to diagnose accurately an unusual bone pathogen that requires a unique treatment.

Oligonucleotide primers, probes and molecular methods for the environmental monitoring of methanogenic archaea

PubMed Central

Narihiro, Takashi; Sekiguchi, Yuji

2011-01-01

Summary For the identification and quantification of methanogenic archaea (methanogens) in environmental samples, various oligonucleotide probes/primers targeting phylogenetic markers of methanogens, such as 16S rRNA, 16S rRNA gene and the gene for the α‐subunit of methyl coenzyme M reductase (mcrA), have been extensively developed and characterized experimentally. These oligonucleotides were designed to resolve different groups of methanogens at different taxonomic levels, and have been widely used as hybridization probes or polymerase chain reaction primers for membrane hybridization, fluorescence in situ hybridization, rRNA cleavage method, gene cloning, DNA microarray and quantitative polymerase chain reaction for studies in environmental and determinative microbiology. In this review, we present a comprehensive list of such oligonucleotide probes/primers, which enable us to determine methanogen populations in an environment quantitatively and hierarchically, with examples of the practical applications of the probes and primers. PMID:21375721

Relationship Between Ebola Virus Real-Time Quantitative Polymerase Chain Reaction-Based Threshold Cycle Value and Virus Isolation From Human Plasma.

PubMed

Spengler, Jessica R; McElroy, Anita K; Harmon, Jessica R; Ströher, Ute; Nichol, Stuart T; Spiropoulou, Christina F

2015-10-01

We performed a longitudinal analysis of plasma samples obtained from 4 patients with Ebola virus (EBOV) disease (EVD) to determine the relationship between the real-time quantitative reverse transcriptase polymerase chain reaction (qRT-PCR)-based threshold cycle (Ct) value and the presence of infectious EBOV. EBOV was not isolated from plasma samples with a Ct value of >35.5 or >12 days after onset of symptoms. EBOV was not isolated from plasma samples in which anti-EBOV nucleoprotein immunoglobulin G was detected. These data demonstrate the utility of interpreting qRT-PCR results in the context of the course of EBOV infection and associated serological responses for patient-management decisions. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.

Analysis of raw meats and fats of pigs using polymerase chain reaction for Halal authentication.

PubMed

Aida, A A; Che Man, Y B; Wong, C M V L; Raha, A R; Son, R

2005-01-01

A method for species identification from pork and lard samples using polymerase chain reaction (PCR) analysis of a conserved region in the mitochondrial (mt) cytochrome b (cyt b) gene has been developed. Genomic DNA of pork and lard were extracted using Qiagen DNeasy(®) Tissue Kits and subjected to PCR amplification targeting the mt cyt b gene. The genomic DNA from lard was found to be of good quality and produced clear PCR products on the amplification of the mt cyt b gene of approximately 360 base pairs. To distinguish between species, the amplified PCR products were cut with restriction enzyme BsaJI resulting in porcine-specific restriction fragment length polymorphisms (RFLP). The cyt b PCR-RFLP species identification assay yielded excellent results for identification of pig species. It is a potentially reliable technique for detection of pig meat and fat from other animals for Halal authentication.

Detection and differentiation of wild-type and vaccine strains of canine distemper virus by a duplex reverse transcription polymerase chain reaction

PubMed Central

Dong, X. Y.; Li, W. H.; Zhu, J. L.; Liu, W. J.; Zhao, M. Q.; Luo, Y. W.; Chen, J. D.

2015-01-01

Canine distemper virus (CDV) is the cause of canine distemper (CD) which is a severe and highly contagious disease in dogs. In the present study, a duplex reverse transcription polymerase chain reaction (RT-PCR) method was developed for the detection and differentiation of wild-type and vaccine strains of CDV. Four primers were designed to detect and discriminate the two viruses by generating 638- and 781-bp cDNA products, respectively. Furthermore, the duplex RT-PCR method was used to detect 67 field samples suspected of CD from Guangdong province in China. Results showed that, 33 samples were to be wild-type-like. The duplex RT-PCR method exhibited high specificity and sensitivity which could be used to effectively detect and differentiate wild-type and vaccine CDV, indicating its use for clinical detection and epidemiological surveillance. PMID:27175171

Identification of the five human Plasmodium species including P. knowlesi by real-time polymerase chain reaction.

PubMed

Oddoux, O; Debourgogne, A; Kantele, A; Kocken, C H; Jokiranta, T S; Vedy, S; Puyhardy, J M; Machouart, M

2011-04-01

Recently, Plasmodium knowlesi has been recognised as the fifth Plasmodium species causing malaria in humans. Hundreds of human cases infected with this originally simian Plasmodium species have been described in Asian countries and increasing numbers are reported in Europe from travellers. The growing impact of tourism and economic development in South and Southeast Asia are expected to subsequently lead to a further increase in cases both among locals and among travellers. P. knowlesi is easily misidentified in microscopy as P. malariae or P. falciparum. We developed new primers for the rapid and specific detection of this species by low-cost real-time polymerase chain reaction (PCR) and added this method to an already existing panel of primers used for the molecular identification of the other four species in one reaction. Reference laboratories should now be able to identify undisputably and rapidly P. knowlesi, as it is a potentially fatal pathogen.

Apparent polyploidization after gamma irradiation: pitfalls in the use of quantitative polymerase chain reaction (qPCR) for the estimation of mitochondrial and nuclear DNA gene copy numbers.

PubMed

Kam, Winnie W Y; Lake, Vanessa; Banos, Connie; Davies, Justin; Banati, Richard

2013-05-30

Quantitative polymerase chain reaction (qPCR) has been widely used to quantify changes in gene copy numbers after radiation exposure. Here, we show that gamma irradiation ranging from 10 to 100 Gy of cells and cell-free DNA samples significantly affects the measured qPCR yield, due to radiation-induced fragmentation of the DNA template and, therefore, introduces errors into the estimation of gene copy numbers. The radiation-induced DNA fragmentation and, thus, measured qPCR yield varies with temperature not only in living cells, but also in isolated DNA irradiated under cell-free conditions. In summary, the variability in measured qPCR yield from irradiated samples introduces a significant error into the estimation of both mitochondrial and nuclear gene copy numbers and may give spurious evidence for polyploidization.

Polymerase chain reaction assay targeting cytochrome b gene for the detection of dog meat adulteration in meatball formulation.

PubMed

Rahman, Md Mahfujur; Ali, Md Eaqub; Hamid, Sharifah Bee Abd; Mustafa, Shuhaimi; Hashim, Uda; Hanapi, Ummi Kalthum

2014-08-01

A polymerase chain reaction (PCR) assay for the assessment of dog meat adulteration in meatballs was developed. The assay selectively amplified a 100-bp region of canine mitochondrial cytochrome b gene from pure, raw, processed and mixed backgrounds. The specificity of the assay was tested against 11 animals and 3 plants species, commonly available for meatball formulation. The stability of the assay was proven under extensively autoclaving conditions that breakdown target DNA. A blind test from ready to eat chicken and beef meatballs showed that the assay can repeatedly detect 0.2% canine meat tissues under complex matrices using 0.04 ng of dog DNA extracted from differentially treated meatballs. The simplicity, stability and sensitivity of the assay suggested that it could be used in halal food industry for the authentication of canine derivatives in processed foods. Copyright © 2014 Elsevier Ltd. All rights reserved.

Peptostreptococcus micros in primary endodontic infections as detected by 16S rDNA-based polymerase chain reaction.

PubMed

Siqueira, José F; Rôças, Isabela N; Andrade, Arnaldo F B; de Uzeda, Milton

2003-02-01

A 16S rDNA-based polymerase chain reaction (PCR) method was used to detect Peptostreptococcus micros in primary root canal infections. Samples were collected from 50 teeth having carious lesions, necrotic pulps, and different forms of periradicular diseases. DNA extracted from the samples was amplified using the PCR assay, which yielded a specific fragment of P. micros 16S rDNA. P. micros was detected in 6 of 22 root canals associated with asymptomatic chronic periradicular lesions (27.3%), 2 of 8 teeth with acute apical periodontitis (25%), and 6 of 20 cases of acute periradicular abscess (30%). In general, P. micros was found in 14 of 50 cases (28%). There was no correlation between the presence of P. micros and the occurrence of symptoms. Findings suggested that P. micros can be involved in the pathogenesis of different forms of periradicular lesions.

Polymerase chain reaction technology as analytical tool in agricultural biotechnology.

PubMed

Lipp, Markus; Shillito, Raymond; Giroux, Randal; Spiegelhalter, Frank; Charlton, Stacy; Pinero, David; Song, Ping

2005-01-01

The agricultural biotechnology industry applies polymerase chain reaction (PCR) technology at numerous points in product development. Commodity and food companies as well as third-party diagnostic testing companies also rely on PCR technology for a number of purposes. The primary use of the technology is to verify the presence or absence of genetically modified (GM) material in a product or to quantify the amount of GM material present in a product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains. The document highlights the many areas to which attention must be paid in order to produce reliable test results. These include sample preparation, method validation, choice of appropriate reference materials, and biological and instrumental sources of error. The article also discusses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.

Product differentiation by analysis of DNA melting curves during the polymerase chain reaction.

PubMed

Ririe, K M; Rasmussen, R P; Wittwer, C T

1997-02-15

A microvolume fluorometer integrated with a thermal cycler was used to acquire DNA melting curves during polymerase chain reaction by fluorescence monitoring of the double-stranded DNA specific dye SYBR Green I. Plotting fluorescence as a function of temperature as the thermal cycler heats through the dissociation temperature of the product gives a DNA melting curve. The shape and position of this DNA melting curve are functions of the GC/AT ratio, length, and sequence and can be used to differentiate amplification products separated by less than 2 degrees C in melting temperature. Desired products can be distinguished from undesirable products, in many cases eliminating the need for gel electrophoresis. Analysis of melting curves can extend the dynamic range of initial template quantification when amplification is monitored with double-stranded DNA specific dyes. Complete amplification and analysis of products can be performed in less than 15 min.

Principles and applications of polymerase chain reaction in medical diagnostic fields: a review

PubMed Central

Valones, Marcela Agne Alves; Guimarães, Rafael Lima; Brandão, Lucas André Cavalcanti; de Souza, Paulo Roberto Eleutério; de Albuquerque Tavares Carvalho, Alessandra; Crovela, Sergio

2009-01-01

Recent developments in molecular methods have revolutionized the detection and characterization of microorganisms in a broad range of medical diagnostic fields, including virology, mycology, parasitology, microbiology and dentistry. Among these methods, Polymerase Chain Reaction (PCR) has generated great benefits and allowed scientific advancements. PCR is an excellent technique for the rapid detection of pathogens, including those difficult to culture. Along with conventional PCR techniques, Real-Time PCR has emerged as a technological innovation and is playing an ever-increasing role in clinical diagnostics and research laboratories. Due to its capacity to generate both qualitative and quantitative results, Real-Time PCR is considered a fast and accurate platform. The aim of the present literature review is to explore the clinical usefulness and potential of both conventional PCR and Real-Time PCR assays in diverse medical fields, addressing its main uses and advances. PMID:24031310

Bacterial Polysaccharide Co-Polymerases Share a Common Framework for Control of Polymer Length

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tocilj,A.; Munger, C.; Proteau, A.

2008-01-01

The chain length distribution of complex polysaccharides present on the bacterial surface is determined by polysaccharide co-polymerases (PCPs) anchored in the inner membrane. We report crystal structures of the periplasmic domains of three PCPs that impart substantially different chain length distributions to surface polysaccharides. Despite very low sequence similarities, they have a common protomer structure with a long central alpha-helix extending 100 Angstroms into the periplasm. The protomers self-assemble into bell-shaped oligomers of variable sizes, with a large internal cavity. Electron microscopy shows that one of the full-length PCPs has a similar organization as that observed in the crystal formore » its periplasmic domain alone. Functional studies suggest that the top of the PCP oligomers is an important region for determining polysaccharide modal length. These structures provide a detailed view of components of the bacterial polysaccharide assembly machinery.« less

Electrically controlled microvalves to integrate microchip polymerase chain reaction and capillary electrophoresis.

PubMed

Kaigala, Govind V; Hoang, Viet N; Backhouse, Christopher J

2008-07-01

Microvalves are key in realizing portable miniaturized diagnostic platforms. We present a scalable microvalve that integrates well with standard lab on a chip (LOC) implementations, yet which requires essentially no external infrastructure for its operation. This electrically controlled, phase-change microvalve is used to integrate genetic amplification and analysis via capillary electrophoresis--the basis of many diagnostics. The microvalve is actuated using a polymer (polyethylene glycol, PEG) that exhibits a large volumetric change between its solid and liquid phases. Both the phase change of the PEG and the genetic amplification via polymerase chain reaction (PCR) are thermally controlled using thin film resistive elements that are patterned using standard microfabrication methods. By contrast with many other valve technologies, these microvalves and their control interface scale down in size readily. The novelty here lies in the use of fully integrated microvalves that require only electrical connections to realize a portable and inexpensive genetic analysis platform.

Polymerase chain reaction: A molecular diagnostic tool in periodontology.

PubMed

Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

2016-01-01

This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease.

Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats

USGS Publications Warehouse

Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.

2010-01-01

A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

Effective characterization of Salmonella Enteritidis by most probable number (MPN) followed by multiplex polymerase chain reaction (PCR) methods.

PubMed

Zappelini, Lincohn; Martone-Rocha, Solange; Dropa, Milena; Matté, Maria Helena; Tiba, Monique Ribeiro; Breternitz, Bruna Suellen; Razzolini, Maria Tereza Pepe

2017-02-01

Nontyphoidal Salmonella (NTS) is a relevant pathogen involved in gastroenteritis outbreaks worldwide. In this study, we determined the capacity to combine the most probable number (MPN) and multiplex polymerase chain reaction (PCR) methods to characterize the most important Salmonella serotypes in raw sewage. A total of 499 isolates were recovered from 27 raw sewage samples and screened using two previously described multiplex PCR methods. From those, 123 isolates were selected based on PCR banding pattern-identical or similar to Salmonella Enteritidis and Salmonella Typhimurium-and submitted to conventional serotyping. Results showed that both PCR assays correctly serotyped Salmonella Enteritidis, however, they presented ambiguous results for Salmonella Typhimurium identification. These data highlight that MPN and multiplex PCR can be useful methods to describe microbial quality in raw sewage and suggest two new PCR patterns for Salmonella Enteritidis identification.

Sensitive and specific identification by polymerase chain reaction of Eimeria tenella and Eimeria maxima, important protozoan pathogens in laboratory avian facilities.

PubMed

Lee, Hyun-A; Hong, Sunhwa; Chung, Yungho; Kim, Okjin

2011-09-01

Eimeria tenella and Eimeria maxima are important pathogens causing intracellular protozoa infections in laboratory avian animals and are known to affect experimental results obtained from contaminated animals. This study aimed to find a fast, sensitive, and efficient protocol for the molecular identification of E. tenella and E. maxima in experimental samples using chickens as laboratory avian animals. DNA was extracted from fecal samples collected from chickens and polymerase chain reaction (PCR) analysis was employed to detect E. tenella and E. maxima from the extracted DNA. The target nucleic acid fragments were specifically amplified by PCR. Feces secreting E. tenella and E. maxima were detected by a positive PCR reaction. In this study, we were able to successfully detect E. tenella and E. maxima using the molecular diagnostic method of PCR. As such, we recommended PCR for monitoring E. tenella and E. maxima in laboratory avian facilities.

Allele related mutation specific-polymerase chain reaction for rapid diagnosis of Hb New York (beta 113 (G15) Val-->Glu, beta(CD113 GTG-->GAG)).

PubMed

Viprakasit, Vip; Tachavanich, Kalaya; Suwantol, Lerlugsn; Pung-Amritt, Parichat; Chinchang, Worawut; Tanphaichitr, Voravarn S

2002-08-01

Hemoglobin New York (beta 113 (G15) Val-->Glu), a beta-globin variant, was first reported in a Chinese family living in New York. Subsequently, this abnormal hemoglobin was reported in many Chinese descendants from several groups and it was also known as Hb Kaohsiung. The subtle change in alpha1beta1 contact region apart from the heme group connecting area by Val-->Glu substitution has minor changes in both the electrophoretic mobility and stability making this hemoglobin variant difficult to distinguish from Hb A using routine hemoglobin analysis. The authors described a case of heterozygosity of Hb New York diagnosed by a molecular technique and revealed a mutation in beta(CD113 GTG-->GAG). A novel Allele Related Mutation Specific-Polymerase Chain Reaction (ARMS-PCR) for rapid diagnosis of this mutation has been proposed.

Theory and applications of the polymerase chain reaction.

PubMed

Remick, D G; Kunkel, S L; Holbrook, E A; Hanson, C A

1990-04-01

The polymerase chain reaction (PCR) is a newly developed molecular biology technique that can significantly amplify DNA or RNA. The process consists of repetitive cycles of specific DNA synthesis, defined by short stretches of preselected DNA. With each cycle, there is a doubling of the final, desired DNA product such that a million-fold amplification is possible. This powerful method has numerous applications in diagnostic pathology, especially in the fields of microbiology, forensic science, and hematology. The PCR may be used to directly detect viral DNA, which may facilitate the diagnosis of acquired immune deficiency syndrome (AIDS) or other viral diseases. PCR amplification of DNA allows detection of specific sequences from extremely small samples, such as with forensic material. In hematology, PCR may help in the diagnosis of hemoglobinopathies or of neoplastic disorders by documenting chromosomal translocations. The new PCR opens exciting new avenues for diagnostic pathology using this new technology.

Capillary sample introduction of polymerase chain reaction (PCR) products separated in ultrathin slab gels.

PubMed

Bullard, K M; Hietpas, P B; Ewing, A G

1998-01-01

Polymerase chain reaction (PCR) amplified short tandem repeat (STR) samples from the HUMVWF locus have been analyzed using a unique sample introduction and separation technique. A single capillary is used to transfer samples onto an ultrathin slab gel (57 microm thin). This ultrathin nondenaturing polyacrylamide gel is used to separate the amplified fragments, and laser-induced fluorescence with ethidium bromide is used for detection. The feasibility of performing STR analysis using this system has been investigated by examining the reproducibility for repeated samples. Reproducibility is examined by comparing the migration of the 14 and 17 HUMVWF alleles on three consecutive separations on the ultrathin slab gel. Using one locus, separations match in migration time with the two alleles 42 s apart for each of the three consecutive separations. This technique shows potential to increase sample throughput in STR analysis techniques although separation resolution still needs to be improved.

International ring trial for the validation of an event-specific Golden Rice 2 quantitative real-time polymerase chain reaction method.

PubMed

Jacchia, Sara; Nardini, Elena; Bassani, Niccolò; Savini, Christian; Shim, Jung-Hyun; Trijatmiko, Kurniawan; Kreysa, Joachim; Mazzara, Marco

2015-05-27

This article describes the international validation of the quantitative real-time polymerase chain reaction (PCR) detection method for Golden Rice 2. The method consists of a taxon-specific assay amplifying a fragment of rice Phospholipase D α2 gene, and an event-specific assay designed on the 3' junction between transgenic insert and plant DNA. We validated the two assays independently, with absolute quantification, and in combination, with relative quantification, on DNA samples prepared in haploid genome equivalents. We assessed trueness, precision, efficiency, and linearity of the two assays, and the results demonstrate that both the assays independently assessed and the entire method fulfill European and international requirements for methods for genetically modified organism (GMO) testing, within the dynamic range tested. The homogeneity of the results of the collaborative trial between Europe and Asia is a good indicator of the robustness of the method.

Generation of human scFv antibody libraries: PCR amplification and assembly of light- and heavy-chain coding sequences.

PubMed

Andris-Widhopf, Jennifer; Steinberger, Peter; Fuller, Roberta; Rader, Christoph; Barbas, Carlos F

2011-09-01

The development of therapeutic antibodies for use in the treatment of human diseases has long been a goal for many researchers in the antibody field. One way to obtain these antibodies is through phage-display libraries constructed from human lymphocytes. This protocol describes the construction of human scFv (single chain antibody fragment) libraries using a short linker (GGSSRSS) or a long linker (GGSSRSSSSGGGGSGGGG). In this method, the individual rearranged heavy- and light-chain variable regions are amplified separately and are linked through a series of overlap polymerase chain reaction (PCR) steps to give the final scFv products that are used for cloning.

The Recent Emergence of Clostridium difficile Infection in Romanian Hospitals is Associated with a High Prevalence of Polymerase Chain Reaction Ribotype 027.

PubMed

Popescu, Gabriel Adrian; Serban, Roxana; Pistol, Adriana; Niculcea, Andreea; Preda, Andreea; Lemeni, Daniela; Macovei, Ioana Sabina; Tălăpan, Daniela; Rafila, Alexandru; Florea, Dragoş

2018-03-15

To investigate the epidemiology of Clostridium difficile infection in Romanian hospitals. A survey was conducted at nine hospitals throughout Romania between November 2013 and February 2014. The survey identified 393 patients with Clostridium difficile infection. The median age was 67 years (range: 2-94 years); 56% of patients were aged >65 years. The mean prevalence of Clostridium difficile infection was 5.2 cases per 10.000 patient-days. The highest prevalences were 24.9 and 20 per 10.000 patient-days in hospitals specializing in gastroenterology and infectious diseases, respectively. Clostridium difficile infections were health care-associated in 70.5% patients and community-acquired in 10.2%. The origin was not determined in 19.3%. Clostridium difficile infection was severe in 12.3% of patients, and the in-hospital all-cause mortality was 8.8%. Polymerase chain reaction ribotype 027 had the highest prevalence in all participating hospitals and represented 82.6% of the total ribotyped isolates. The minimum inhibitory concentration of moxifloxacin was >4 μg/mL for 59 of 80 tested isolates (73.8%). Of 59 isolates, 54 were highly resistant to moxifloxacin (minimum inhibitory concentration ≥32 μg/mL), and the majority were polymerase chain reaction ribotype 027 (p<0.0001). The ribotype 027 was the predominant cause of Clostridium difficile infections in Romania. In some specialized hospitals, the prevalence of Clostridium difficile infection was higher than the European mean prevalence, and this demonstrates the need for strict adherence to infection control programs.

Sustained high-throughput polymerase chain reaction diagnostics during the European epidemic of Bluetongue virus serotype 8.

PubMed

van Rijn, Piet A; Heutink, René G; Boonstra, Jan; Kramps, Hans A; van Gennip, René G P

2012-05-01

A real-time reverse transcription polymerase chain reaction assay (PCR test) based on genome segment 10 of Bluetongue virus (BTV) was developed. The PCR test consists of robotized viral RNA isolation from blood samples and an all-in-one method including initial denaturation of genomic double-stranded RNA, reverse transcription polymerase chain reaction (RT-PCR), and real-time detection and analysis. Reference strains of the 24 recognized BTV serotypes, isolates from different years, and geographic origins were detected. Other orbiviruses such as African horse sickness virus, Epizootic hemorrhagic disease virus, and Equine encephalosis virus were not detected. Experimentally infected animals were PCR positive from 2 days postinoculation, which was earlier than fever, other clinical signs, or seroconversion. The diagnostic sensitivity and specificity were very close to or even 100%. The PCR test played a key role in the detection of BTV serotype 8 in August 2006 in The Netherlands. The outbreak in a completely naive ruminant population allowed for further evaluation of the PCR test with field samples. In 2006, the correlation between enzyme-linked immunosorbent assay and PCR results was estimated to be 95%. In the following years, the PCR test was used for diagnosis of diseased animals, for testing of healthy animals for trade purposes, and for detection of BTV RNA in different species of the insect vector, Culicoides. In the autumn of 2008, BTV serotype 6 unexpectedly emerged in northwest Europe and was also detected with the PCR test developed in the current study. The performance in routine use over 5 years has been recorded and evaluated.

COLD-PCR Technologies in the Area of Personalized Medicine: Methodology and Applications.

PubMed

Mauger, Florence; How-Kit, Alexandre; Tost, Jörg

2017-06-01

Somatic mutations bear great promise for use as biomarkers for personalized medicine, but are often present only in low abundance in biological material and are therefore difficult to detect. Many assays for mutation analysis in cancer-related genes (hotspots) have been developed to improve diagnosis, prognosis, prediction of drug resistance, and monitoring of the response to treatment. Two major approaches have been developed: mutation-specific amplification methods and methods that enrich and detect mutations without prior knowledge on the exact location and identity of the mutation. CO-amplification at Lower Denaturation temperature Polymerase Chain Reaction (COLD-PCR) methods such as full-, fast-, ice- (improved and complete enrichment), enhanced-ice, and temperature-tolerant COLD-PCR make use of a critical temperature in the polymerase chain reaction to selectively denature wild-type-mutant heteroduplexes, allowing the enrichment of rare mutations. Mutations can subsequently be identified using a variety of laboratory technologies such as high-resolution melting, digital polymerase chain reaction, pyrosequencing, Sanger sequencing, or next-generation sequencing. COLD-PCR methods are sensitive, specific, and accurate if appropriately optimized and have a short time to results. A large variety of clinical samples (tumor DNA, circulating cell-free DNA, circulating cell-free fetal DNA, and circulating tumor cells) have been studied using COLD-PCR in many different applications including the detection of genetic changes in cancer and infectious diseases, non-invasive prenatal diagnosis, detection of microorganisms, or DNA methylation analysis. In this review, we describe in detail the different COLD-PCR approaches, highlighting their specificities, advantages, and inconveniences and demonstrating their use in different fields of biological and biomedical research.

An evaluation of microbial profile in halitosis with tongue coating using PCR (polymerase chain reaction)- a clinical and microbiological study.

PubMed

Kamaraj R, Dinesh; Bhushan, Kala S; K L, Vandana

2014-01-01

Medline search using key words halitosis, tongue coating, polymerase chain reaction, microbial profile did not reveal any study. Hence, the purpose of the present investigation was to assess the malodor using the organoleptic method and tanita device; to quantify odoriferous microorganisms using Polymerase Chain Reaction technique in chronic periodontitis patients. The study included 30 chronic periodontitis patients. Halitosis was detected using organoleptic assessment & tanita breath alert. Microbial analysis of Pg, Tf & Fn was done using PCR. Plaque index (PI), gingival index (GI), gingival bleeding index (GBI) were recorded. The maximum score of 3 for tongue coating was found in 60% of selected subjects. The tanita breath alert measured VSC level of score 2 in 60% of selected subjects while organoleptic score of 4 was found in 50% of subjects. The maximum mean value of 31.1±36.5 was found to be of F. nucleatum (Fn) followed by P. gingivalis (Pg) (13±13.3) & T. forsythia (Tf) (7.16±8.68) in tongue samples of selected patients. A weak positive correlation was found between VSC levels (tanita score & organoleptic score) and clinical parameters. The halitosis assessment by measuring VSC levels using organoleptic method and tanita breath alert are clinically feasible. Maximum tongue coating was found in 60% of patients. Fn was found comparatively more than the Pg & Tf. A weak positive correlation was found between VSC levels and clinical parameters such as PI, GI & GBI. Thus,the dentist/ periodontist should emphasise on tongue cleaning measures that would reduce the odoriferous microbial load.

Screening test recommendations for methicillin-resistant Staphylococcus aureus surveillance practices: A cost-minimization analysis.

PubMed

Whittington, Melanie D; Curtis, Donna J; Atherly, Adam J; Bradley, Cathy J; Lindrooth, Richard C; Campbell, Jonathan D

2017-07-01

To mitigate methicillin-resistant Staphylococcus aureus (MRSA) infections, intensive care units (ICUs) conduct surveillance through screening patients upon admission followed by adhering to isolation precautions. Two surveillance approaches commonly implemented are universal preemptive isolation and targeted isolation of only MRSA-positive patients. Decision analysis was used to calculate the total cost of universal preemptive isolation and targeted isolation. The screening test used as part of the surveillance practice was varied to identify which screening test minimized inappropriate and total costs. A probabilistic sensitivity analysis was conducted to evaluate the range of total costs resulting from variation in inputs. The total cost of the universal preemptive isolation surveillance practice was minimized when a polymerase chain reaction screening test was used ($82.51 per patient). Costs were $207.60 more per patient when a conventional culture was used due to the longer turnaround time and thus higher isolation costs. The total cost of the targeted isolation surveillance practice was minimized when chromogenic agar 24-hour testing was used ($8.54 per patient). Costs were $22.41 more per patient when polymerase chain reaction was used. For ICUs that preemptively isolate all patients, the use of a polymerase chain reaction screening test is recommended because it can minimize total costs by reducing inappropriate isolation costs. For ICUs that only isolate MRSA-positive patients, the use of chromogenic agar 24-hour testing is recommended to minimize total costs. Copyright © 2017 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

Allele-Specific Polymerase Chain Reaction for the Imatinib-Resistant KIT D816V and D816F Mutations in Mastocytosis and Acute Myelogenous Leukemia

PubMed Central

Corless, Christopher L.; Harrell, Patina; Lacouture, Mario; Bainbridge, Troy; Le, Claudia; Gatter, Ken; White, Clifton; Granter, Scott; Heinrich, Michael C.

2006-01-01

Oncogenic mutations of the receptor tyrosine kinase KIT contribute to the pathogenesis of gastrointestinal stromal tumors, systemic mastocytosis (SM), and some cases of acute myelogenous leukemia (AML). The D816V substitution in the activation loop of KIT results in relative resistance to the kinase inhibitor imatinib (Gleevec). Because this mutation occurs in 80 to 95% of adult SM, its detection has diagnostic and predictive significance. Unfortunately, the fraction of mutation-positive cells in clinical SM samples is often below the 20 to 30% threshold needed for detection by direct DNA sequencing. We have developed an allele-specific polymerase chain reaction assay using a mutation-specific primer combined with a wild-type blocking oligonucleotide that amplifies D816V at the level of 1% mutant allele in DNA extracted from formalin-fixed, paraffin-embedded tissue. There were no amplifications among 64 KIT wild-type tumors and cell lines, whereas all D816V-mutant samples (eight AML and 11 mast cell disease) were positive. Other D816 substitutions associated with resistance to imatinib in vitro are rare in SM. Among these D816F was detectable with the assay whereas D816H, D816Y, and D816G did not amplify. Nine biopsies (bone marrow, skin, or colon) with suspected SM were negative by denaturing high performance liquid chromatography and/or DNA sequencing but positive by allele-specific polymerase chain reaction. Thus, the assay may be useful in confirming the diagnosis of SM. PMID:17065430

Copy number ratios determined by two digital polymerase chain reaction systems in genetically modified grains

NASA Astrophysics Data System (ADS)

Pérez Urquiza, M.; Acatzi Silva, A. I.

2014-02-01

Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.

Molecular screening by polymerase chain reaction detects panleukopenia virus DNA in formalin-fixed hearts from cats with idiopathic cardiomyopathy and myocarditis.

PubMed

Meurs, K M; Fox, P R; Magnon, A L; Liu, S; Towbin, J A

2000-01-01

Viral myocarditis has been suggested as an etiology for cardiomyopathy in several mammalian species. Myocarditis and idiopathic cardiomyopathy have been reported in the domestic cat, although a viral etiology has not been demonstrated. Because of the continuing interest in the potential relationship between viral myocarditis and cardiomyopathy, we evaluated hearts from cats with spontaneous, idiopathic cardiomyopathy for viral genomic material within myocytes by polymerase chain reaction, and for the presence of myocarditis by light microscopy. Thirty-one (31) formalin-fixed hearts from domestic cats who died of idiopathic cardiomyopathy were randomly selected from pathology archives. Seventeen (17) formalin-fixed hearts from healthy cats were similarly selected as normal controls. The polymerase chain reaction (PCR) was used to evaluate myocardial tissue for the presence of viral genome from feline panleukopenia virus, herpes virus, calici virus, and corona virus. Hearts were examined using light microscopy for histologic evidence of myocarditis according to the Dallas criteria. Panleukopenia virus was identified by PCR in 10 of 31 cats with cardiomyopathy but in none of the controls. Neither cardiomyopathic or control cats tested positive by PCR for herpes virus, calici virus, and corona virus. Myocarditis was detected by histologic examination in 18 of 31 cardiomyopathic cats and in none of 17 control cats. Myocarditis and or feline panleukopenia virus genome was detected in felines with idiopathic hypertrophic, dilated, and restrictive cardiomyopathy, suggesting a possible role of viral infection and inflammation in the pathogenesis of cardiomyopathy in this species.

Sensitivity, specificity and comparison of three commercially available immunological tests in the diagnosis of Cryptosporidium species in animals.

PubMed

Danišová, Olga; Halánová, Monika; Valenčáková, Alexandra; Luptáková, Lenka

The study was conducted to compare the specificity of immunological diagnostic methods used for the diagnosis of Cryptosporidium species capable of causing life-threatening infection in both immunosuppressed and immunocompetent patients. For the detection of Cryptosporidium species in 79 animals with diarrhoea, we used three Copro-antigen tests: RIDASCREEN ® Cryptosporidium test, Cryptosporidium 2nd Generation (ELISA) and RIDA ® QUICK Cryptosporidium. For immunoassays we used positive and negative samples detected by means of polymerase chain reaction and validated by sequencing and nested polymerase chain reaction to confirm the presence six different species of Cryptosporidium species. Prevalence of cryptosporidiosis in the entire group determined by enzyme immunoassay, enzyme linked immunosorbent assay, immuno-chromatographic test and polymerase chain reaction was 34.17%, 27.84%, 6.33% and 27.84%, respectively. Sensitivity of animal samples with enzyme immunoassay, enzyme linked immunosorbent assay, and immuno-chromatographic test was 63.6%, 40.9% and 22.7%, resp., when questionable samples were considered positive, whereas specificity of enzyme immunoassay, enzyme linked immunosorbent assay and immuno-chromatographic test was 75.9%, 78.9% and 100%, respectively. Positive predictive values and negative predictive values were different for all the tests. These differences results are controversial and therefore reliability and reproducibility of immunoassays as the only diagnostic method is questionable. The use of various Cryptosporidium species in diagnosis based on immunological testing and different results obtained by individual tests indicate potential differences in Copro-antigens produced by individual Cryptosporidium species. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Generation of human Fab antibody libraries: PCR amplification and assembly of light- and heavy-chain coding sequences.

PubMed

Andris-Widhopf, Jennifer; Steinberger, Peter; Fuller, Roberta; Rader, Christoph; Barbas, Carlos F

2011-09-01

The development of therapeutic antibodies for use in the treatment of human diseases has long been a goal for many researchers in the antibody field. One way to obtain these antibodies is through phage-display libraries constructed from human lymphocytes. This protocol describes the construction of human Fab (fragment antigen binding) antibody libraries. In this method, the individual rearranged heavy- and light-chain variable regions are amplified separately and are linked through a series of overlap polymerase chain reaction (PCR) steps to give the final Fab products that are used for cloning.

Bypass of a psoralen DNA interstrand cross-link by DNA polymerases beta, iota, and kappa in vitro

PubMed Central

Smith, Leigh A.; Makarova, Alena V.; Samson, Laura; Thiesen, Katherine E.; Dhar, Alok; Bessho, Tadayoshi

2012-01-01

Repair of DNA inter-strand cross-links in mammalian cells involves several biochemically distinctive processes, including the release of one of the cross-linked strands and translesion DNA synthesis (TLS). In this report, we investigated in vitro TLS activity of psoralen DNA inter-strand cross-link by three DNA repair polymerases, DNA polymerase beta, kappa and iota. DNA polymerase beta is capable of bypassing a psoralen cross-link with a low efficiency. Cell extracts prepared from DNA polymerase beta knockout mouse embryonic fibroblast showed a reduced bypass activity of the psoralen cross-link and purified DNA polymerase beta restored the bypass activity. In addition, DNA polymerase iota mis-incorporated thymine across the psoralen cross-link and DNA polymerase kappa extended these mis-paired primer ends, suggesting that DNA polymerase iota may serve as an inserter and DNA polymerase kappa may play a role as an extender in the repair of psoralen DNA inter-strand cross-links. The results demonstrated here indicate that multiple DNA polymerases could participate in TLS steps in mammalian DNA inter-strand cross-link repair. PMID:23106263

Association of Progressive Multifocal Leukoencephalopathy Lesion Volume With JC Virus Polymerase Chain Reaction Results in Cerebrospinal Fluid of Natalizumab-Treated Patients With Multiple Sclerosis.

PubMed

Wijburg, Martijn T; Kleerekooper, Iris; Lissenberg-Witte, Birgit I; de Vos, Marlieke; Warnke, Clemens; Uitdehaag, Bernard M J; Barkhof, Frederik; Killestein, Joep; Wattjes, Mike P

2018-03-12

The JC virus (JCV) was named after the first patient to be described with progressive multifocal leukoencephalopathy (PML), John Cunningham. Detection of JC virus DNA in cerebrospinal fluid (CSF) by polymerase chain reaction (PCR), and of specific lesions by brain magnetic resonance imaging (MRI), are both considered essential for the diagnosis of natalizumab-associated PML (NTZ-PML) in patients with multiple sclerosis. However, strict pharmacovigilance by MRI can result in detection of patients with small lesions and undetectable JCV DNA in CSF. To investigate the association of PML lesion characteristics on MRI with both qualitative and quantitative JCV PCR results in CSF of patients with NTZ-PML. This was a retrospective, cross-sectional study conducted from January 2007 to December 2014 in patients considered to have NTZ-PML based on a set of predefined criteria. Follow-up was at least 6 months. Data of patients from the Dutch-Belgian NTZ-PML cohort and patients treated at multiple medical centers in Belgium and the Netherlands and selected for research purposes were included as a convenience sample. Brain MRI scans were analyzed for PML lesion volume, location, dissemination, and signs of inflammation. Associations of the qualitative and quantitative CSF JCV PCR results with PML MRI characteristics were calculated. Of the 73 patients screened, 56 were included (37 were women). At inclusion, 9 patients (16.1%) had undetectable JCV DNA in CSF. Patients with a positive PCR had larger total PML lesion volumes than those with undetectable JCV DNA (median volume, 22.9 mL; interquartile range, 9.2-60.4 mL vs median volume, 6.7 mL; interquartile range, 4.9-14.7 mL; P = .008), and logistic regression showed that a lower PML lesion volume significantly increased the probability for undetectable JCV DNA. There was a positive correlation between PML lesion volume and JCV copy numbers (Spearman ρ, 0.32; P = .03). Progressive multifocal leukoencephalopathy lesion volume was higher in patients with PML symptoms and in patients with more widespread lesion dissemination. No association was found between PCR results and PML lesion dissemination, signs of inflammation, or PML symptoms. Smaller NTZ-PML lesions are associated with a higher likelihood of undetectable JCV DNA in CSF. This may preclude a formal diagnosis of PML and can complicate patient treatment in patients with small MRI lesions highly suggestive of PML detected early through pharmacovigilance.

Presidential Green Chemistry Challenge: 2013 Greener Synthetic Pathways Award

EPA Pesticide Factsheets

Presidential Green Chemistry Challenge 2013 award winner, Life Technologies, developed a one-pot synthesis for polymerase chain reaction (PCR), which is a much more efficient process that prevents about 1.5 million pounds of hazardous waste a year.

A Two-State Model for the Dynamics of the Pyrophosphate Ion Release in Bacterial RNA Polymerase

PubMed Central

Da, Lin-Tai; Pardo Avila, Fátima; Wang, Dong; Huang, Xuhui

2013-01-01

The dynamics of the PPi release during the transcription elongation of bacterial RNA polymerase and its effects on the Trigger Loop (TL) opening motion are still elusive. Here, we built a Markov State Model (MSM) from extensive all-atom molecular dynamics (MD) simulations to investigate the mechanism of the PPi release. Our MSM has identified a simple two-state mechanism for the PPi release instead of a more complex four-state mechanism observed in RNA polymerase II (Pol II). We observed that the PPi release in bacterial RNA polymerase occurs at sub-microsecond timescale, which is ∼3-fold faster than that in Pol II. After escaping from the active site, the (Mg-PPi)2− group passes through a single elongated metastable region where several positively charged residues on the secondary channel provide favorable interactions. Surprisingly, we found that the PPi release is not coupled with the TL unfolding but correlates tightly with the side-chain rotation of the TL residue R1239. Our work sheds light on the dynamics underlying the transcription elongation of the bacterial RNA polymerase. PMID:23592966

Differentiation among isolates of prunus necrotic ringspot virus by transcript conformation polymorphism.

PubMed

Rosner, A; Maslenin, L; Spiegel, S

1998-09-01

A method based on differences in electrophoretic mobility of RNA transcripts made from polymerase chain reaction (PCR) products was used for differentiation among virus isolates. A T7 RNA polymerase promoter was attached to amplified prunus necrotic ringspot virus (PNRSV) sequences by PCR. The PCR products then served as a template for transcription. Single-stranded transcripts originated from different PNRSV isolates varied in electrophoretic mobility in polyacrylamide gels, presumably because of transcript conformation polymorphism (TCP). This procedure was applied for the differentiation of PNRSV isolates.

DNA polymerase preference determines PCR priming efficiency.

PubMed

Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian

2014-01-30

Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially available DNA polymerases. The results suggest that the interaction of the DNA polymerase with the primer:template junction during the initiation of DNA polymerization is very important in terms of overall amplification bias and has broader implications for both the primer design process and multiplex PCR.

A rapid assay for detection of Rose rosette virus using reverse transcription-recombinase polymerase amplification using multiple gene targets.

PubMed

Babu, Binoy; Washburn, Brian K; Miller, Steven H; Poduch, Kristina; Sarigul, Tulin; Knox, Gary W; Ochoa-Corona, Francisco M; Paret, Mathews L

2017-02-01

Rose rosette disease caused by Rose rosette virus (RRV; genus Emaravirus) is the most economically relevant disease of Knock Out ® series roses in the U.S. As there are no effective chemical control options for the disease, the most critical disease management strategies include the use of virus free clean plants for propagation and early detection and destruction of infected plants. The current diagnostic techniques for RRV including end-point reverse transcription-polymerase chain reaction (RT-PCR) and real-time PCR (RT-qPCR) are highly sensitive, but limited to diagnostic labs with the equipment and expertise; and is time consuming. To address this limitation, an isothermal reverse transcription-recombinase polymerase amplification (RT-RPA) assay based on multiple gene targets for specific detection of RRV was developed. The assay is highly specific and did not cross react with other viruses belonging to the inclusive and exclusive genus. Dilution assays using the in vitro transcripts showed that the primer sets designed (RPA-267, RPA-131, and RPA-321) are highly sensitive, consistently detecting RRV with a detection limit of 1fg/μL. Testing of the infected plants using the primer sets indicated that the virus could be detected from leaves, stems and petals of roses. The primer pair RPA-267 produced 100% positive detection of the virus from infected leaf tissues, while primer set RPA-131 produced 100% detection from stems and petals. The primer set RPA-321 produced 83%, 87.5% and 75% positive detection from leaves, petals and stem tissues, respectively. In addition, the assay has been efficiently used in the detection of RRV infecting Knock Out ® roses, collected from different states in the U.S. The assay can be completed in 20min as compared to the end-point RT-PCR assay (3-4h) and RT-qPCR (1.5h). The RT-RPA assay is reliable, rapid, highly sensitive, and can be easily used in diagnostic laboratories for detection of RRV with no need for any special equipment. Copyright © 2016 Elsevier B.V. All rights reserved.

Effective application of multiple locus variable number of tandem repeats analysis to tracing Staphylococcus aureus in food-processing environment.

PubMed

Rešková, Z; Koreňová, J; Kuchta, T

2014-04-01

A total of 256 isolates of Staphylococcus aureus were isolated from 98 samples (34 swabs and 64 food samples) obtained from small or medium meat- and cheese-processing plants in Slovakia. The strains were genotypically characterized by multiple locus variable number of tandem repeats analysis (MLVA), involving multiplex polymerase chain reaction (PCR) with subsequent separation of the amplified DNA fragments by an automated flow-through gel electrophoresis. With the panel of isolates, MLVA produced 31 profile types, which was a sufficient discrimination to facilitate the description of spatial and temporal aspects of contamination. Further data on MLVA discrimination were obtained by typing a subpanel of strains by multiple locus sequence typing (MLST). MLVA coupled to automated electrophoresis proved to be an effective, comparatively fast and inexpensive method for tracing S. aureus contamination of food-processing factories. Subspecies genotyping of microbial contaminants in food-processing factories may facilitate identification of spatial and temporal aspects of the contamination. This may help to properly manage the process hygiene. With S. aureus, multiple locus variable number of tandem repeats analysis (MLVA) proved to be an effective method for the purpose, being sufficiently discriminative, yet comparatively fast and inexpensive. The application of automated flow-through gel electrophoresis to separation of DNA fragments produced by multiplex PCR helped to improve the accuracy and speed of the method. © 2013 The Society for Applied Microbiology.

Use of Multiple Imputation to Estimate the Proportion of Respiratory Virus Detections Among Patients Hospitalized With Community-Acquired Pneumonia.

PubMed

Bozio, Catherine H; Flanders, W Dana; Finelli, Lyn; Bramley, Anna M; Reed, Carrie; Gandhi, Neel R; Vidal, Jorge E; Erdman, Dean; Levine, Min Z; Lindstrom, Stephen; Ampofo, Krow; Arnold, Sandra R; Self, Wesley H; Williams, Derek J; Grijalva, Carlos G; Anderson, Evan J; McCullers, Jonathan A; Edwards, Kathryn M; Pavia, Andrew T; Wunderink, Richard G; Jain, Seema

2018-04-01

Real-time polymerase chain reaction (PCR) on respiratory specimens and serology on paired blood specimens are used to determine the etiology of respiratory illnesses for research studies. However, convalescent serology is often not collected. We used multiple imputation to assign values for missing serology results to estimate virus-specific prevalence among pediatric and adult community-acquired pneumonia hospitalizations using data from an active population-based surveillance study. Presence of adenoviruses, human metapneumovirus, influenza viruses, parainfluenza virus types 1-3, and respiratory syncytial virus was defined by positive PCR on nasopharyngeal/oropharyngeal specimens or a 4-fold rise in paired serology. We performed multiple imputation by developing a multivariable regression model for each virus using data from patients with available serology results. We calculated absolute and relative differences in the proportion of each virus detected comparing the imputed to observed (nonimputed) results. Among 2222 children and 2259 adults, 98.8% and 99.5% had nasopharyngeal/oropharyngeal specimens and 43.2% and 37.5% had paired serum specimens, respectively. Imputed results increased viral etiology assignments by an absolute difference of 1.6%-4.4% and 0.8%-2.8% in children and adults, respectively; relative differences were 1.1-3.0 times higher. Multiple imputation can be used when serology results are missing, to refine virus-specific prevalence estimates, and these will likely increase estimates.

A New Protocol to Detect Multiple Foodborne Pathogens with PCR Dipstick DNA Chromatography after a Six-Hour Enrichment Culture in a Broad-Range Food Pathogen Enrichment Broth

PubMed Central

Hayashi, Masahiro; Natori, Tatsuya; Kubota-Hayashi, Sayoko; Miyata, Machiko; Ohkusu, Kiyofumi; Kurazono, Hisao; Makino, Souichi; Ezaki, Takayuki

2013-01-01

A quick foodborne pathogen screening method after six-hour enrichment culture with a broad-range food pathogen enrichment broth is described. Pathogenic factors of Salmonella enterica, Shigella spp., enteroinvasive Escherichia coli, and enterohemorrhagic E. coli are amplified with a cocktail primer and rapid polymerase chain reaction (PCR), which finishes amplification in 30 min. The PCR amplicon was differentiated with a dipstick DNA chromatography assay in 5–10 min. Starting from a four- to six-hour enrichment culture, this assay was finished within 45 min. Detection sensitivity of this protocol was less than 2.5 CFU/25 g for S. enterica and 3.3 CFU/25 g for enterohemorrhagic E. coli in spiked ground meat experiments. PMID:24364031

The presence of opportunistic pathogens, Legionella spp., L. pneumophila and Mycobacterium avium complex, in South Australian reuse water distribution pipelines.

PubMed

Whiley, H; Keegan, A; Fallowfield, H; Bentham, R

2015-06-01

Water reuse has become increasingly important for sustainable water management. Currently, its application is primarily constrained by the potential health risks. Presently there is limited knowledge regarding the presence and fate of opportunistic pathogens along reuse water distribution pipelines. In this study opportunistic human pathogens Legionella spp., L. pneumophila and Mycobacterium avium complex were detected using real-time polymerase chain reaction along two South Australian reuse water distribution pipelines at maximum concentrations of 10⁵, 10³ and 10⁵ copies/mL, respectively. During the summer period of sampling the concentration of all three organisms significantly increased (P < 0.05) along the pipeline, suggesting multiplication and hence viability. No seasonality in the decrease in chlorine residual along the pipelines was observed. This suggests that the combination of reduced chlorine residual and increased water temperature promoted the presence of these opportunistic pathogens.

Rapid and effective processing of blood specimens for diagnostic PCR using filter paper and Chelex-100.

PubMed Central

Polski, J M; Kimzey, S; Percival, R W; Grosso, L E

1998-01-01

AIM: To provide a more efficient method for isolating DNA from peripheral blood for use in diagnostic DNA mutation analysis. METHODS: The use of blood impregnated filter paper and Chelex-100 in DNA isolation was evaluated and compared with standard DNA isolation techniques. RESULTS: In polymerase chain reaction (PCR) based assays of five point mutations, identical results were obtained with DNA isolated routinely from peripheral blood and isolated using the filter paper and Chelex-100 method. CONCLUSION: In the clinical setting, this method provides a useful alternative to conventional DNA isolation. It is easily implemented and inexpensive, and provides sufficient, stable DNA for multiple assays. The potential for specimen contamination is reduced because most of the steps are performed in a single microcentrifuge tube. In addition, this method provides for easy storage and transport of samples from the point of acquisition. PMID:9893748

Rapid and effective processing of blood specimens for diagnostic PCR using filter paper and Chelex-100.

PubMed

Polski, J M; Kimzey, S; Percival, R W; Grosso, L E

1998-08-01

To provide a more efficient method for isolating DNA from peripheral blood for use in diagnostic DNA mutation analysis. The use of blood impregnated filter paper and Chelex-100 in DNA isolation was evaluated and compared with standard DNA isolation techniques. In polymerase chain reaction (PCR) based assays of five point mutations, identical results were obtained with DNA isolated routinely from peripheral blood and isolated using the filter paper and Chelex-100 method. In the clinical setting, this method provides a useful alternative to conventional DNA isolation. It is easily implemented and inexpensive, and provides sufficient, stable DNA for multiple assays. The potential for specimen contamination is reduced because most of the steps are performed in a single microcentrifuge tube. In addition, this method provides for easy storage and transport of samples from the point of acquisition.

Familial cleidocranial dysplasia misdiagnosed as rickets over three generations.

PubMed

Franceschi, Roberto; Maines, Evelina; Fedrizzi, Michela; Piemontese, Maria Rosaria; De Bonis, Patrizia; Agarwal, Nivedita; Bellizzi, Maria; Di Palma, Annunziata

2015-10-01

Cleidocranial dysplasia (CCD) is a rare autosomal dominant skeletal dysplasia characterized by hypoplastic clavicles, late closure of the fontanels, dental problems and other skeletal features. CCD is caused by mutations, deletions or duplications in runt-related transcription factor 2 (RUNX2), which encodes for a protein essential for osteoblast differentiation and chondrocyte maturation. We describe three familial cases of CCD, misdiagnosed as rickets over three generations. No mutations were detected on standard DNA sequencing of RUNX2, but a novel deletion was identified on quantitative polymerase chain reaction (qPCR) and multiple ligation-dependent probe amplification (MLPA). The present cases indicate that CCD could be misdiagnosed as rickets, leading to inappropriate treatment, and confirm that mutations in RUNX2 are not able to be identified on standard DNA sequencing in all CCD patients, but can be identified on qPCR and MLPA. © 2015 Japan Pediatric Society.

Mussel-Inspired Dopamine and Carbon Nanotube Leading to a Biocompatible Self-Rolling Conductive Hydrogel Film.

PubMed

Jiang, Junzi; Huang, Yong; Wang, Yitian; Xu, Hui; Xing, Malcolm; Zhong, Wen

2017-08-18

We report a novel self-rolling, conductive, and biocompatible multiwall carbon nanotube (MWCNT)-dopamine-polyethylene glycol (PEG) hydrogel film. The gel can self-fold into a thin tube when it is transferred from a glass slide to an aqueous environment, regardless of the concentrations of the MWCNT. The film presents a highly organized pattern, which results from the self-assembly of hydrophilic dopamine and hydrophobic carbon nanotubes. By exploring the biomedical potential, we found that MWCNT-included rolled film is nontoxic and can promote cell growth. For further functional verification by qPCR (quantitative polymerase chain reaction), bone marrow derived mesenchymal cells present higher levels of osteogenic differentiations in response to a higher concentration of CNTs. The results suggest that the self-rolling, conductive CNT-dopamine-PEG hydrogel could have multiple potentials, including biomedical usage and as a conductive biosensor.

Novel Hantavirus in the Flat-Skulled Shrew (Sorex roboratus)

PubMed Central

Kang, Hae Ji; Arai, Satoru; Hope, Andrew G.; Cook, Joseph A.

2010-01-01

Abstract Genetically distinct hantaviruses have been identified recently in multiple species of shrews (Order Soricomorpha, Family Soricidae) in Eurasia and North America. To corroborate decades-old reports of hantaviral antigens in shrews from Russia, archival liver and lung tissues from 4 Siberian large-toothed shrews (Sorex daphaenodon), 5 Eurasian least shrews (Sorex minutissimus), 12 flat-skulled shrews (Sorex roboratus), and 18 tundra shrews (Sorex tundrensis), captured in the Sakha Republic in northeastern Siberia during July and August 2006, were analyzed for hantavirus RNA by reverse transcription–polymerase chain reaction. A novel hantavirus, named Kenkeme virus, was detected in a flat-skulled shrew. Sequence analysis of the full-length S and partial M and L segments indicated that Kenkeme virus was genetically and phylogenetically distinct from Seewis virus harbored by the Eurasian common shrew (Sorex araneus), as well as all other rodent-, soricid-, and talpid-borne hantaviruses. PMID:20426682

Cutaneous sarcoids in captive African lions associated with feline sarcoid-associated papillomavirus infection.

PubMed

Orbell, G M B; Young, S; Munday, J S

2011-11-01

Solitary and multiple cutaneous and mucocutaneous masses were identified in 5 of 24 captive African lions (Panthera leo) over a 6-month-period. All masses were surgically excised, and all were histologically similar to equine and feline sarcoids. DNA was extracted from formalin-fixed, paraffin-embedded tissue. Polymerase chain reaction amplified DNA sequences that had been previously detected in feline sarcoids and clinically normal bovine skin. All lions had been fed a diet that included bovine carcasses that had not been skinned. Since the cessation of feeding bovine carcasses with cutaneous lesions, no additional skin lesions have been observed within any of the lions. Herein is described the clinical, gross, and histopathological findings of sarcoids in 5 captive lions. As the causative papillomavirus most likely has a bovine definitive host, it is hypothesized that the lions were exposed to the virus by feeding on bovine carcasses with skin still attached.

MYCOBACTERIUM GENAVENSE IN AN AFRICAN PENGUIN (SPHENISCUS DEMERSUS).

PubMed

Krause, Kristian J; Reavill, Drury; Weldy, Scott H; Bradway, Daniel S

2015-12-01

A 19-yr-old female African penguin (Spheniscus demersus) presented with labored breathing and anorexia. Radiographs revealed soft-tissue density lesions in the left lung fields and fluid in the right. The penguin died during the night. Postmortem examination demonstrated multiple granulomas in the lungs and air sacs. The right coelom was filled with opaque fluid. Histopathology of the lung, liver, kidney, and spleen identified Mycobacterium as a primary disease etiology. Large numbers of acid fast-positive, rod-shaped bacteria were recognized on tissue staining. Mycobacterium genavense was detected by polymerase chain reaction (PCR) using primers specific for the species. Further confirmation of M. genavense was accomplished using PCR with universal Mycobacterium spp. primers followed by sequencing of the amplicon obtained. To our knowledge, this is the first reported case of mycobacteriosis-and specifically M. genavense -in an African penguin. This case also demonstrates the similarities of presentation between the more commonly suspected and encountered aspergillosis and mycobacteriosis.

Atypical mycobacteria infection in an immunocompromised patient.

PubMed

Berger, Emily; Batra, Priya; Ralston, Jonathan; Sanchez, Miguel R; Franks, Andrew G

2010-11-15

A 61-year-old woman with systemic lupus erythematosus and Sjögren syndrome presented with a two-month history of symptomatic nodules on the buttocks and thighs that progressed to involve the dorsal aspects of the hands. On examination, infiltrative papules, nodules, and plaques were present in these regions. Biopsy specimens demonstrated granulomatous inflammation and acid-fast bacilli with the use of a Fite stain, although a culture and polymerase chain reaction analysis were negative. The patient continues to improve on long-term clarithromycin therapy. Atypical mycobacterial infections are becoming more common, especially in immunocompromised patients. Antimicrobial therapy, either with a single agent or multiple agents, often is prolonged. A high index of suspicion is warranted in immunocompromised patients, which includes those with connective-tissue diseases that are active or that require immunosuppression. In these patients, the differential diagnosis includes infectious as well as inflammatory, reactive, or neoplastic processes.

Mining microarrays for metabolic meaning: nutritional regulation of hypothalamic gene expression.

PubMed

Mobbs, Charles V; Yen, Kelvin; Mastaitis, Jason; Nguyen, Ha; Watson, Elizabeth; Wurmbach, Elisa; Sealfon, Stuart C; Brooks, Andrew; Salton, Stephen R J

2004-06-01

DNA microarray analysis has been used to investigate relative changes in the level of gene expression in the CNS, including changes that are associated with disease, injury, psychiatric disorders, drug exposure or withdrawal, and memory formation. We have used oligonucleotide microarrays to identify hypothalamic genes that respond to nutritional manipulation. In addition to commonly used microarray analysis based on criteria such as fold-regulation, we have also found that simply carrying out multiple t tests then sorting by P value constitutes a highly reliable method to detect true regulation, as assessed by real-time polymerase chain reaction (PCR), even for relatively low abundance genes or relatively low magnitude of regulation. Such analyses directly suggested novel mechanisms that mediate effects of nutritional state on neuroendocrine function and are being used to identify regulated gene products that may elucidate the metabolic pathology of obese ob/ob, lean Vgf-/Vgf-, and other models with profound metabolic impairments.

Searching for Helicobacter pylori and Chlamydia pneumoniae in primary endodontic infections.

PubMed

Rôças, Isabela N; Siqueira, José F

2012-04-01

The purpose of this study was to search samples from primary endodontic infections for the presence of two common human bacterial pathogens - Helicobacter pylori and Chlamydia pneumoniae. Genomic DNA isolated from samples taken from 25 root canals of teeth with asymptomatic (chronic) apical periodontitis and 25 aspirates from acute apical abscess was initially amplified by the multiple displacement amplification approach and then used as template in species-specific polymerase chain reaction (PCR) for detection of H. pylori and C. pneumoniae. All clinical samples were positive for the presence of bacterial DNA. However, no clinical sample was positive for either H. pylori or C. pneumoniae. Neither H. pylori nor C. pneumoniae were found in samples from primary endodontic infections. These findings suggest that these species are not candidate endodontic pathogens and that the necrotic root canal does not serve as a reservoir for these human pathogens in healthy patients.

Field Analysis of Microbial Contamination Using Three Molecular Methods in Parallel

NASA Technical Reports Server (NTRS)

Morris, H.; Stimpson, E.; Schenk, A.; Kish, A.; Damon, M.; Monaco, L.; Wainwright, N.; Steele, A.

2010-01-01

Advanced technologies with the capability of detecting microbial contamination remain an integral tool for the next stage of space agency proposed exploration missions. To maintain a clean, operational spacecraft environment with minimal potential for forward contamination, such technology is a necessity, particularly, the ability to analyze samples near the point of collection and in real-time both for conducting biological scientific experiments and for performing routine monitoring operations. Multiple molecular methods for detecting microbial contamination are available, but many are either too large or not validated for use on spacecraft. Two methods, the adenosine- triphosphate (ATP) and Limulus Amebocyte Lysate (LAL) assays have been approved by the NASA Planetary Protection Office for the assessment of microbial contamination on spacecraft surfaces. We present the first parallel field analysis of microbial contamination pre- and post-cleaning using these two methods as well as universal primer-based polymerase chain reaction (PCR).

Ultrasensitive electrochemical DNA detection based on dual amplification of circular strand-displacement polymerase reaction and hybridization chain reaction.

PubMed

Wang, Cui; Zhou, Hui; Zhu, Wenping; Li, Hongbo; Jiang, Jianhui; Shen, Guoli; Yu, Ruqin

2013-09-15

We developed a novel electrochemical strategy for ultrasensitive DNA detection using a dual amplification strategy based on the circular strand-displacement polymerase reaction (CSDPR) and the hybridization chain reaction (HCR). In this assay, hybridization of hairpin-shaped capture DNA to target DNA resulted in a conformational change of the capture DNA with a concomitant exposure of its stem. The primer was then hybridized with the exposed stem and triggered a polymerization reaction, allowing a cyclic reaction comprising release of target DNA, hybridization of target with remaining capture DNA, polymerization initiated by the primer. Furthermore, the free part of the primer propagated a chain reaction of hybridization events between two DNA hairpin probes with biotin labels, enabling an electrochemical reading using the streptavidin-alkaline phosphatase. The proposed biosensor showed to have very high sensitivity and selectivity with a dynamic response range through 10fM to 1nM, and the detect limit was as low as 8fM. The proposed strategy could have the potential for molecular diagnostics in complex biological systems. Copyright © 2013 Elsevier B.V. All rights reserved.

An efficient in planta transformation of Jatropha curcas (L.) and multiplication of transformed plants through in vivo grafting.

PubMed

Jaganath, Balusamy; Subramanyam, Kondeti; Mayavan, Subramanian; Karthik, Sivabalan; Elayaraja, Dhandapani; Udayakumar, Rajangam; Manickavasagam, Markandan; Ganapathi, Andy

2014-05-01

An efficient and reproducible Agrobacterium-mediated in planta transformation was developed in Jatropha curcas. The various factors affecting J. curcas in planta transformation were optimized, including decapitation, Agrobacterium strain, pin-pricking, vacuum infiltration duration and vacuum pressure. Simple vegetative in vivo cleft grafting method was adopted in the multiplication of transformants without the aid of tissue culture. Among the various parameters evaluated, decapitated plants on pin-pricking and vacuum infiltrated at 250 mmHg for 3 min with the Agrobacterium strain EHA 105 harbouring the binary vector pGA 492 was proved to be efficient in all terms with a transformation efficiency of 62.66%. Transgene integration was evinced by the GUS histochemical analysis, and the GUS positive plants were subjected to grafting. Putatively transformed J. curcas served as "Scion" and the wild type J. curcas plant severed as "Stock". There was no occurrence of graft rejection and the plants were then confirmed by GUS histochemical analysis, polymerase chain reaction (PCR) and Southern hybridization. Genetic stability of the grafted plants was evaluated by using randomly amplified polymorphic DNA (RAPD), marker which showed 100% genetic stability between mother and grafted plants. Thus, an efficient in planta transformation and grafting based multiplication of J. curcas was established.

Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

DOEpatents

Gardner, Shea N; Mariella, Jr., Raymond P; Christian, Allen T; Young, Jennifer A; Clague, David S

2013-06-25

A method of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths.

DIFFERENTIATING HUMAN FROM ANIMAL ISOLATES OF CRYPTOSPORIDIUM PARVUM

EPA Science Inventory

We analyzed 9s Cryptosporidium parvum isolates from humans and animals by a polymerase chain reaction/restriction fragment length polymorphism method based on the thrombospondin-related anonymous protein 2 gene sequence. Used as a molecular marker, this method can differentiate ...

QUALITY ASSURANCE FOR PCR

EPA Science Inventory

The U.S. Environmental Protection Agency (EPA) held a workshop in January 2003 on the detection of viruses in water using polymerase chain reaction (PCR)-based methods. Speakers were asked to address a series of specific questions, including whether a single standard method coul...

Convectively driven PCR thermal-cycling

DOEpatents

Benett, William J.; Richards, James B.; Milanovich, Fred P.

2003-07-01

A polymerase chain reaction system provides an upper temperature zone and a lower temperature zone in a fluid sample. Channels set up convection cells in the fluid sample and move the fluid sample repeatedly through the upper and lower temperature zone creating thermal cycling.

A Technical Approach to Marking Explosives, Propellants, and Precursor Chemicals

DTIC Science & Technology

1998-08-01

polymerase chain reaction (PCR) methods whereby small strands are cut and analyzed under specified temperature mediated enzymatic /molecular reactions (4...such as these are often overlooked. Several other companies have been investigating other methods including immunoassay techniques, microencapsulated

Evaluation of Four RNA Extraction Methods for Gene Expression Analyses of Cryptosporidium parvum and Toxoplasma gondii Oocys

EPA Science Inventory

Cryptosporidium spp. and Toxoplasma gondii are important coccidian parasites that have caused waterborne and foodborne disease outbreaks worldwide. Techniques like subtractive hybridization, microarrays, and quantitative reverse transcriptase real-time polymerase chain reaction (...

ANIMAL DNA IN PCR REAGENTS PLAGUES ANCIENT DNA RESEARCH

EPA Science Inventory

Ancient DNA analysis is becoming widespread. These studies use polymerase chain reaction (PCR) to amplify minute quantities of heavily damaged template. Unusual steps are taken to achieve the sensitivity necessary to detect ancient DNA, including high-cycle PCR amplification targ...

DETECTION OF PATHOGENS IN DRINKING WATER (SEER 2)

EPA Science Inventory

Project investigators developed a polymerase chain reaction (PCR)-based technique to detect E. coli 0157:H7 cells in environmental samples using previously reported PCR primers for the specific detection of genes involved in biosynthesis of 0157 polysacchari...

Enhancing the specificity of polymerase chain reaction by graphene oxide through surface modification: zwitterionic polymer is superior to other polymers with different charges.

PubMed

Zhong, Yong; Huang, Lihong; Zhang, Zhisen; Xiong, Yunjing; Sun, Liping; Weng, Jian

Graphene oxides (GOs) with different surface characteristics, such as size, reduction degree and charge, are prepared, and their effects on the specificity of polymerase chain reaction (PCR) are investigated. In this study, we demonstrate that GO with a large size and high reduction degree is superior to small and nonreduced GO in enhancing the specificity of PCR. Negatively charged polyacrylic acid (PAA), positively charged polyacrylamide (PAM), neutral polyethylene glycol (PEG) and zwitterionic polymer poly(sulfobetaine) (pSB) are used to modify GO. The PCR specificity-enhancing ability increases in the following order: GO-PAA < GO-PAM < GO-PEG < GO-pSB. Thus, zwitterionic polymer-modified GO is superior to other GO derivatives with different charges in enhancing the specificity of PCR. GO derivatives are also successfully used to enhance the specificity of PCR for the amplification of human mitochondrial DNA using blood genomic DNA as template. Molecular dynamics simulations and molecular docking are performed to elucidate the interaction between the polymers and Pfu DNA polymerase. Our data demonstrate that the size, reduction degree and surface charge of GO affect the specificity of PCR. Based on our results, zwitterionic polymer-modified GO may be used as an efficient additive for enhancing the specificity of PCR.

Biochemical behavior of N-oxidized cytosine and adenine bases in DNA polymerase-mediated primer extension reactions

PubMed Central

Tsunoda, Hirosuke; Kudo, Tomomi; Masaki, Yoshiaki; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo

2011-01-01

To clarify the biochemical behavior of 2′-deoxyribonucleoside 5′-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (Co) and adenine N-oxide (Ao), we examined their base recognition ability in DNA duplex formation using melting temperature (Tm) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the Tm values of modified DNA–DNA duplexes incorporating 2′-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo−) and Vent (exo−) suggested that Co and Ao selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo−) toward Ao on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator. PMID:21300642

Biochemical behavior of N-oxidized cytosine and adenine bases in DNA polymerase-mediated primer extension reactions.

PubMed

Tsunoda, Hirosuke; Kudo, Tomomi; Masaki, Yoshiaki; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo

2011-04-01

To clarify the biochemical behavior of 2'-deoxyribonucleoside 5'-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (C(o)) and adenine N-oxide (A(o)), we examined their base recognition ability in DNA duplex formation using melting temperature (T(m)) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the T(m) values of modified DNA-DNA duplexes incorporating 2'-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo(-)) and Vent (exo(-)) suggested that C(o) and A(o) selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo(-)) toward A(o) on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator.

The cellular level of O-antigen polymerase Wzy determines chain length regulation by WzzB and WzzpHS-2 in Shigella flexneri 2a.

PubMed

Carter, Javier A; Jiménez, Juan C; Zaldívar, Mercedes; Alvarez, Sergio A; Marolda, Cristina L; Valvano, Miguel A; Contreras, Inés

2009-10-01

The lipopolysaccharide O antigen of Shigella flexneri 2a has two preferred chain lengths, a short (S-OAg) composed of an average of 17 repeated units and a very long (VL-OAg) of about 90 repeated units. These chain length distributions are controlled by the chromosomally encoded WzzB and the plasmid-encoded Wzz(pHS-2) proteins, respectively. In this study, genes wzzB, wzz(pHS-2) and wzy (encoding the O-antigen polymerase) were cloned under the control of arabinose- and rhamnose-inducible promoters to investigate the effect of varying their relative expression levels on O antigen polysaccharide chain length distribution. Controlled expression of the chain length regulators wzzB and wzz(pHS-2) revealed a dose-dependent production of each modal length. Increase in one mode resulted in a parallel decrease in the other, indicating that chain length regulators compete to control the degree of O antigen polymerization. Also, when expression of the wzy gene is low, S-OAg but not VL-OAg is produced. Production of VL-OAg requires high induction levels of wzy. Thus, the level of expression of wzy is critical in determining O antigen modal distribution. Western blot analyses of membrane proteins showed comparable high levels of the WzzB and Wzz(pHS-2) proteins, but very low levels of Wzy. In vivo cross-linking experiments and immunoprecipitation of membrane proteins did not detect any direct interaction between Wzy and WzzB, suggesting the possibility that these two proteins may not interact physically but rather by other means such as via translocated O antigen precursors.

Risks and burden of viral respiratory tract infections in patients with multiple myeloma in the era of immunomodulatory drugs and bortezomib: experience at an Australian Cancer Hospital.

PubMed

Teh, Benjamin W; Worth, Leon J; Harrison, Simon J; Thursky, Karin A; Slavin, Monica A

2015-07-01

Infections are a leading cause of morbidity and mortality in patients with multiple myeloma. The epidemiology, risk factors and outcomes of viral respiratory tract infections (vRTI) are not well described in patients with multiple myeloma managed with novel agents, the current standard of care. Patients with myeloma from 2009 to 2012 who tested positive on respiratory virus multiplex polymerase chain reaction had clinical, radiological and microbiological records reviewed. The Fourth European Conference on Infections in Leukaemia (ECIL-4) definitions of RTI were applied. Univariate and multivariate regression analysis of risk factors was performed using vRTI as the evaluable outcome. Of 330 patients, 75 (22.7%) tested positive for a total of 100 vRTI episodes. All patients received thalidomide, lenalidomide or bortezomib in combination with myeloma therapies (median of three treatment regimens). vRTI occurred most commonly in patients with progressive disease, and receipt of more than three lines of myeloma therapy was associated with an increased risk of vRTI (p < 0.01). Amongst key respiratory pathogens, influenza was associated with the highest hospital admission rate (66.7%), ICU admission rate (41.6%) and mortality (33.3%) whilst RSV was associated with prolonged hospital stay. Patients with multiple myeloma and advanced disease managed with multiple lines of therapy are at risk for vRTI, and targeted interventions for prevention/treatment are required.

Cellular RNA-dependent RNA polymerase involved in posttranscriptional gene silencing has two distinct activity modes.

PubMed

Makeyev, Eugene V; Bamford, Dennis H

2002-12-01

Recent genetic data suggest that proteins homologous to a plant RNA-dependent RNA polymerase (RdRP) play a central role in posttranscriptional gene silencing (PTGS) in many organisms. We show here that purified recombinant protein QDE-1, a genetic component of PTGS ("quelling") in the fungus Neurospora crassa, possesses RNA polymerase activity in vitro. The full-length enzyme and its enzymatically active C-terminal fragment perform two different reactions on single-stranded RNA templates, synthesizing either extensive RNA chains that form template-length duplexes or approximately 9-21-mer complementary RNA oligonucleotides scattered along the entire template. QDE-1 supports both de novo and primer-dependent initiation mechanisms. These results suggest that several distinct activities of cell-encoded RdRPs can be employed for efficient PTGS in vivo.

Detection of Entamoeba histolytica by Recombinase Polymerase Amplification

PubMed Central

Nair, Gayatri; Rebolledo, Mauricio; White, A. Clinton; Crannell, Zachary; Richards-Kortum, R. Rebecca; Pinilla, A. Elizabeth; Ramírez, Juan David; López, M. Consuelo; Castellanos-Gonzalez, Alejandro

2015-01-01

Amebiasis is an important cause of diarrheal disease worldwide and has been associated with childhood malnutrition. Traditional microscopy approaches are neither sensitive nor specific for Entamoeba histolytica. Antigen assays are more specific, but many cases are missed unless tested by molecular methods. Although polymerase chain reaction (PCR) is effective, the need for sophisticated, expensive equipment, infrastructure, and trained personnel limits its usefulness, especially in the resource-limited, endemic areas. Here, we report development of a recombinase polymerase amplification (RPA) method to detect E. histolytica specifically. Using visual detection by lateral flow (LF), the test was highly sensitive and specific and could be performed without additional equipment. The availability of this inexpensive, sensitive, and field-applicable diagnostic test could facilitate rapid diagnosis and treatment of amebiasis in endemic regions. PMID:26123960

Design principles of a microtubule polymerase

PubMed Central

Geyer, Elisabeth A; Miller, Matthew P; Brautigam, Chad A; Biggins, Sue

2018-01-01

Stu2/XMAP215 microtubule polymerases use multiple tubulin-binding TOG domains and a lattice-binding basic region to processively promote faster elongation. How the domain composition and organization of these proteins dictate polymerase activity, end localization, and processivity is unknown. We show that polymerase activity does not require different kinds of TOGs, nor are there strict requirements for how the TOGs are linked. We identify an unexpected antagonism between the tubulin-binding TOGs and the lattice-binding basic region: lattice binding by the basic region is weak when at least two TOGs engage tubulins, strong when TOGs are empty. End-localization of Stu2 requires unpolymerized tubulin, at least two TOGs, and polymerase competence. We propose a ‘ratcheting’ model for processivity: transfer of tubulin from TOGs to the lattice activates the basic region, retaining the polymerase at the end for subsequent rounds of tubulin binding and incorporation. These results clarify design principles of the polymerase. PMID:29897335

Bacillus subtilis DNA polymerases, PolC and DnaE, are required for both leading and lagging strand synthesis in SPP1 origin-dependent DNA replication

PubMed Central

Seco, Elena M.

2017-01-01

Abstract Firmicutes have two distinct replicative DNA polymerases, the PolC leading strand polymerase, and PolC and DnaE synthesizing the lagging strand. We have reconstituted in vitro Bacillus subtilis bacteriophage SPP1 θ-type DNA replication, which initiates unidirectionally at oriL. With this system we show that DnaE is not only restricted to lagging strand synthesis as previously suggested. DnaG primase and DnaE polymerase are required for initiation of DNA replication on both strands. DnaE and DnaG synthesize in concert a hybrid RNA/DNA ‘initiation primer’ on both leading and lagging strands at the SPP1 oriL region, as it does the eukaryotic Pol α complex. DnaE, as a RNA-primed DNA polymerase, extends this initial primer in a reaction modulated by DnaG and one single-strand binding protein (SSB, SsbA or G36P), and hands off the initiation primer to PolC, a DNA-primed DNA polymerase. Then, PolC, stimulated by DnaG and the SSBs, performs the bulk of DNA chain elongation at both leading and lagging strands. Overall, these modulations by the SSBs and DnaG may contribute to the mechanism of polymerase switch at Firmicutes replisomes. PMID:28575448

Detection of Genetically Modified Food: Has Your Food Been Genetically Modified?

ERIC Educational Resources Information Center

Brandner, Diana L.

2002-01-01

Explains the benefits and risks of genetically-modified foods and describes methods for genetically modifying food. Presents a laboratory experiment using a polymerase chain reaction (PCR) test to detect foreign DNA in genetically-modified food. (Contains 18 references.) (YDS)

Microsatellite primers for red drum (Sciaenops ocellatus)

USDA-ARS?s Scientific Manuscript database

In this note, we document polymerase-chain-reaction (PCR) primer pairs for 101, nuclear-encoded microsatellites designed and developed from a red drum (Sciaenops ocellatus) genomic library. The 101 microsatellites (Genbank Accession Numbers EU015882-EU015982) were amplified successfully and used to...

A SIMPLE MULTIPLEX POLYMERASE CHAIN REACTION ASSAY FOR THE IDENTIFICATION OF FOUR ENVIRONMENTALLY RELEVANT FUNGAL CONTAMINANTS

EPA Science Inventory

Historically, identification of filamentous fungal (mold) species has been based on morphological characteristics, both macroscopic and microscopic. These methods have proven to be time consuming and inaccurate, necessitating the development of identification protocols that are ...

Comparison of EPA Method 1615 RT-qPCR Assays in Standard and Kit Format

EPA Science Inventory

EPA Method 1615 contains protocols for measuring enterovirus and norovirus by reverse transcription quantitative polymerase chain reaction. A commercial kit based upon these protocols was designed and compared to the method's standard approach. Reagent grade, secondary effluent, ...

Detection of Strawberry Viruses in Egypt

USDA-ARS?s Scientific Manuscript database

As part of a USAID-MERC funded project, ‘Disease-indexing and mass propagation of superior strawberry cultivars’, an effort was made to evaluate the virus status of strawberries in Egypt. Diagnostic reverse transcription-polymerase chain reaction (RT-PCR) tests for Strawberry mottle, Strawberry cri...

USE OF TAQMAN TO ENUMERATE ENTEROCOCCUS FAECALIS IN WATER

EPA Science Inventory

The Polymerase Chain Reaction (PCR) has become a useful tool in the detection of microorganisms. However, conventional PCR is somewhat time-consuming considering that additional steps (e.g., gel electrophoresis and gene sequencing) are required to confirm the presence of the tar...

MATERIALS SUPPORTING THE NEW RECREATIONAL WATER QUALITY CRITERIA FOR PATHOGENS

EPA Science Inventory

EPA is developing new, rapid methods for monitoring water quality at beaches to determine adequacy of water quality for swimming. The methods being developed rely upon quantitive polymerase chain reaction technology. They will permit real time decisions regarding beach closures...

77 FR 71191 - 2012 Recreational Water Quality Criteria

Federal Register 2010, 2011, 2012, 2013, 2014

2012-11-29

... Criteria AGENCY: Environmental Protection Agency (EPA). ACTION: Notice of availability of the 2012... for beach monitoring, quantitative polymerase chain reaction (qPCR), for the detection of enterococci... managing recreational waters, such as predictive modeling; the EPA is providing a beach action value for...

78 FR 25274 - Findings of Research Misconduct

Federal Register 2010, 2011, 2012, 2013, 2014

2013-04-30

... AGENCY: Office of the Secretary, HHS. ACTION: Notice. SUMMARY: Notice is hereby given that the Office of Research Integrity (ORI) has taken final action in the following case: Matthew Poore, Advanced Liquid Logic... that Respondent knowingly and intentionally falsified reverse transcription-polymerase chain reaction...

Thermodynamics of Oligonucleotide Duplex Melting

ERIC Educational Resources Information Center

Schreiber-Gosche, Sherrie; Edwards, Robert A.

2009-01-01

Melting temperatures of oligonucleotides are useful for a number of molecular biology applications, such as the polymerase chain reaction (PCR). Although melting temperatures are often calculated with simplistic empirical equations, application of thermodynamics provides more accurate melting temperatures and an opportunity for students to apply…

Pertussis outbreak, southeastern Minnesota, 2012.

PubMed

Theofiles, Alexander G; Cunningham, Scott A; Chia, Nicholas; Jeraldo, Patricio R; Quest, Daniel J; Mandrekar, Jayawant N; Patel, Robin

2014-10-01

To describe clinical and laboratory findings from the 2012 southeastern Minnesota pertussis outbreak. Patients were selected for 2 parts of the study. In the first part, nasopharyngeal swabs from a convenience sample of 265 unique patients were used for both the clinician-requested polymerase chain reaction (PCR) test and culture. B pertussis isolates were tested for macrolide susceptibility and typed using whole genome sequencing and pulsed-field gel electrophoresis. Pertactin gene sequences were analyzed to identify pertactin-deficient B pertussis. In the second part, all patients seen at Mayo Clinic in Rochester, Minnesota, who had PCR results positive for Bordetella pertussis or Bordetella parapertussis between January 1, 2012, and December 31, 2012, were analyzed for patient demographic features and vaccination records. One hundred sixty patients had results positive for B pertussis, and 21 patients had results positive for B parapertussis. Among the 265 swabs cultured, B pertussis was detected by both culture and PCR in 11. One swab was positive for B pertussis by culture alone, and 13 were positive by PCR alone. Polymerase chain reaction detected B pertussis more frequently than did culture (P=.001). No macrolide resistance was detected. All 12 isolates tested had an altered pertactin gene, including 9 with a signal sequence deletion, 2 with insertion sequence disruptions, and 1 with a premature stop codon. Nine and 3 isolates were pertactin types prn1 and prn2, respectively. Whole genome sequencing and pulsed-field gel electrophoresis detected the presence of multiple B pertussis strains. The mean age of patients with pertussis was younger than that of those without pertussis (15.6 and 25.5 years, respectively; P=.002). Compared with those whose test results were negative for B pertussis, fewer patients with positive results had received whole-cell pertussis vaccine (P=.02). In the subgroup who had received acellular vaccine exclusively, the time since the most recent pertussis vaccination in those with results positive for B pertussis was longer than that in those with negative results (1363 vs 1010 days; P=.004). The 2012 pertussis outbreak in southeastern Minnesota included multiple strains of B pertussis, all putatively lacking pertactin. Our findings may indicate decreased efficacy of (and waning immunity from) acellular vaccines as contributors to the outbreak. Copyright © 2014 Mayo Foundation for Medical Education and Research. Published by Elsevier Inc. All rights reserved.

Factors influencing polymerase chain reaction outcomes in patients with clinically suspected ocular tuberculosis.

PubMed

Balne, Praveen Kumar; Modi, Rohit Ramesh; Choudhury, Nuzhat; Mohan, Neha; Barik, Manas Ranjan; Padhi, Tapas Ranjan; Sharma, Savitri; Panigrahi, Satya Ranjan; Basu, Soumyava

2014-03-25

Polymerase chain reaction (PCR) assay can be a useful method for definitive diagnosis in paucibacillary infections such as ocular tuberculosis (TB). In this study, we have evaluated factors affecting PCR outcomes in patients with clinically suspected ocular TB. Patients with clinically suspected ocular TB were investigated by PCR of aqueous or vitreous samples. Three control groups were also tested: group 1 included culture-proven non-tuberculous endophthalmitis, group 2 culture-negative non-tuberculous endophthalmitis, and group 3 patients undergoing surgery for uncomplicated cataract. PCR targeted one or more of following targets: IS6110, MPB64, and protein b genes of Mycobacterium tuberculosis complex. Multiple regression analysis (5% level of significance) was done to evaluate the associations between positive PCR outcome and laterality of disease, tuberculin skin test (TST)/interferon-gamma release assay (IGRA), chest radiography, and type of sample (aqueous or vitreous). The main outcome measures were positive PCR by one or more gene targets, and factors influencing positive PCR outcomes. All 114 samples were tested for MPB64, 110 for protein b, and 88 for IS6110. MPB64 was positive in 70.2% (n = 80) of tested samples, protein b in 40.0% (n = 44), and IS6110 in only 9.1% (n = 8). DNA sequencing of amplicons from four randomly chosen PCR reactions showed homology for M. tuberculosis complex. Of the 80 PCR-positive patients, 71 completed a full course of antitubercular therapy, of which 65 patients (91.5%) had complete resolution of inflammation at final follow-up. Among controls, 12.5% (3 out of 24) in group 1 and 18.7% (6 out of 32) in group 2 also tested positive by PCR. No PCR-positive outcome was observed in control group 3 (n = 25). Multiple regression analysis revealed significant association of positive PCR outcome with bilateral presentation, but not with a positive TST/IGRA, chest radiography, or type of sample (aqueous/vitreous) used. Careful selection of gene targets can yield high PCR positivity in clinically suspected ocular TB. Bilateral disease presentation but not any evidence of latent systemic TB influences PCR outcomes. False-positive results may be seen in ocular inflammation unrelated to ocular TB.

Presence of infectious agents and co-infections in diarrheic dogs determined with a real-time polymerase chain reaction-based panel.

PubMed

Gizzi, Aline Baumann da Rocha; Oliveira, Simone Tostes; Leutenegger, Christian M; Estrada, Marko; Kozemjakin, Denise Adamczyk; Stedile, Rafael; Marcondes, Mary; Biondo, Alexander Welker

2014-01-16

Infectious diarrhea can be caused by bacteria, viruses, or protozoan organisms, or a combination of these. The identification of co-infections in dogs is important to determine the prognosis and to plan strategies for their treatment and prophylaxis. Although many pathogens have been individually detected with real-time polymerase chain reaction (PCR), a comprehensive panel of agents that cause diarrhea in privately owned dogs has not yet been established. The objective of this study was to use a real-time PCR diarrhea panel to survey the frequencies of pathogens and co-infections in owned dogs attended in a veterinary hospital with and without diarrhea, as well the frequency in different countries. Feces samples were tested for canine distemper virus, canine coronavirus, canine parvovirus type 2 (CPV-2), Clostridium perfringens alpha toxin (CPA), Cryptosporidium spp., Giardia spp., and Salmonella spp. using molecular techniques. In total, 104 diarrheic and 43 control dogs that were presented consecutively at a major private veterinary hospital were included in the study. Overall, 71/104 (68.3%) dogs with diarrhea were positive for at least one pathogen: a single infection in 39/71 dogs (54.9%) and co-infections in 32/71 dogs (45.1%), including 21/32 dogs (65.6%) with dual, 5/32 (15.6%) with triple, and 6/32 (18.8%) with quadruple infections. In the control group, 13/43 (30.2%) dogs were positive, all with single infections only. The most prevalent pathogens in the diarrheic dogs were CPA (40/104 dogs, 38.5%), CPV-2 (36/104 dogs, 34.6%), and Giardia spp. (14/104 dogs, 13.5%). CPV-2 was the most prevalent pathogen in the dual co-infections, associated with CPA, Cryptosporidium spp., or Giardia spp. No statistical difference (P = 0.8374) was observed in the duration of diarrhea or the number of deaths (P = 0.5722) in the presence or absence of single or co-infections. Diarrheic dogs showed a higher prevalence of pathogen infections than the controls. Whereas the healthy dogs had only single infections, about half the diarrheic dogs had co-infections. Therefore, multiple pathogens should be investigated in dogs presenting with diarrhea. The effects of multiple pathogens on the disease outcomes remain unclear because the rate of death and the duration of diarrhea did not seem to be affected by these factors.

Genetic traits of avascular necrosis of the femoral head analyzed by array comparative genomic hybridization and real-time polymerase chain reaction.

PubMed

Hwang, Jung-Taek; Baik, Seung-Ho; Choi, Jin-Soo; Lee, Kweon-Haeng; Rhee, Seung-Koo

2011-01-03

In an attempt to observe the genetic traits of avascular necrosis of the femoral head, we analyzed the genomic alterations in blood samples of 18 patients with avascular necrosis of the femoral head (9 idiopathic and 9 alcoholic cases) using the array comparative genomic hybridization method and real-time polymerase chain reaction. Several candidate genes were identified that may induce avascular necrosis of the femoral head, and we investigated their role in the pathomechanism of osteonecrosis of bone. The frequency of each candidate gene over all the categories of avascular necrosis of the femoral head was also calculated by real-time polymerase chain reaction. The highest frequency specific genes in each category were FLJ40296, CYP27C1, and CTDP1. FLJ40296 and CYP27C1 had the highest frequency (55.6%) in the idiopathic category. FLJ40296 had a high frequency (44.4%) in the alcoholic category, but CYP27C1 had a relatively low frequency (33.3%) in the alcoholic category. However, CTDP1 showed a significantly high frequency (55.6%) in the alcoholic category and a low frequency (22.2%) in the idiopathic category. Although we statistically analyzed the frequency of each gene with Fisher's exact test, we could not prove statistical significance due to the small number of samples. Further studies are needed with larger sample numbers. If the causal genes of avascular necrosis of the femoral head are found, they may be used for early detection, prognosis prediction, and genomic treatment of avascular necrosis of the femoral head in the future. Copyright 2011, SLACK Incorporated.

Implications of Measurement Assay Type in Design of HIV Experiments.

PubMed

Cannon, LaMont; Jagarapu, Aditya; Vargas-Garcia, Cesar A; Piovoso, Michael J; Zurakowski, Ryan

2017-12-01

Time series measurements of circular viral episome (2-LTR) concentrations enable indirect quantification of persistent low-level Human Immunodeficiency Virus (HIV) replication in patients on Integrase-Inhibitor intensified Combined Antiretroviral Therapy (cART). In order to determine the magnitude of these low level infection events, blood has to be drawn from a patients at a frequency and volume that is strictly regulated by the Institutional Review Board (IRB). Once the blood is drawn, the 2-LTR concentration is determined by quantifying the amount of HIV DNA present in the sample via a PCR (Polymerase Chain Reaction) assay. Real time quantitative Polymerase Chain Reaction (qPCR) is a widely used method of performing PCR; however, a newer droplet digital Polymerase Chain Reaction (ddPCR) method has been shown to provide more accurate quantification of DNA. Using a validated model of HIV viral replication, this paper demonstrates the importance of considering DNA quantification assay type when optimizing experiment design conditions. Experiments are optimized using a Genetic Algorithm (GA) to locate a family of suboptimal sample schedules which yield the highest fitness. Fitness is defined as the expected information gained in the experiment, measured by the Kullback-Leibler Divergence (KLD) between the prior and posterior distributions of the model parameters. We compare the information content of the optimized schedules to uniform schedules as well as two clinical schedules implemented by researchers at UCSF and the University of Melbourne. This work shows that there is a significantly greater gain information in experiments using a ddPCR assay vs. a qPCR assay and that certain experiment design considerations should be taken when using either assay.

Mutations blocking side chain assembly, polymerization, or transport of a Wzy-dependent Streptococcus pneumoniae capsule are lethal in the absence of suppressor mutations and can affect polymer transfer to the cell wall.

PubMed

Xayarath, Bobbi; Yother, Janet

2007-05-01

Extracellular polysaccharides of many bacteria are synthesized by the Wzy polymerase-dependent mechanism, where long-chain polymers are assembled from undecaprenyl-phosphate-linked repeat units on the outer face of the cytoplasmic membrane. In gram-positive bacteria, Wzy-dependent capsules remain largely cell associated via membrane and peptidoglycan linkages. Like many Wzy-dependent capsules, the Streptococcus pneumoniae serotype 2 capsule is branched. In this study, we found that deletions of cps2K, cps2J, or cps2H, which encode a UDP-glucose dehydrogenase necessary for side chain synthesis, the putative Wzx transporter (flippase), and the putative Wzy polymerase, respectively, were obtained only in the presence of suppressor mutations. Most of the suppressor mutations were in cps2E, which encodes the initiating glycosyltransferase for capsule synthesis. The cps2K mutants containing the suppressor mutations produced low levels of high-molecular-weight polymer that was detected only in membrane fractions. cps2K-repaired mutants exhibited only modest increases in capsule production due to the effect of the secondary mutation, but capsule was detectable in both membrane and cell wall fractions. Lethality of the cps2K, cps2J, and cps2H mutations was likely due to sequestration of undecaprenyl-phosphate in the capsule pathway and either preclusion of its turnover for utilization in essential pathways or destabilization of the membrane due to an accumulation of lipid-linked intermediates. The results demonstrate that proper polymer assembly requires not only a functional transporter and polymerase but also complete repeat units. A central role for the initiating glycosyltransferase in controlling capsule synthesis is also suggested.

Diagnosing leprosy: revisiting the role of the slit-skin smear with critical analysis of the applicability of polymerase chain reaction in diagnosis.

PubMed

Banerjee, Surajita; Biswas, Nibir; Kanti Das, Nilay; Sil, Amrita; Ghosh, Pramit; Hasanoor Raja, Abu Hena; Dasgupta, Sarbani; Kanti Datta, Pijush; Bhattacharya, Basudev

2011-12-01

Diagnosing leprosy is challenging, especially in early-stage cases, and the need for a sensitive diagnostic tool is urgent. Polymerase chain reaction (PCR) holds promise as a simple and sensitive diagnostic tool, but its usefulness in the Indian context requires further evaluation. Slit-skin smear (SSS) remains the conventional method of leprosy detection. Hence, this study was undertaken to evaluate and compare the diagnostic efficacy of PCR versus that of SSS. Punch biopsy of skin and SSS were obtained from the active margins of lesions. Cases were clinically grouped according to whether they were multibacillary (MB) or paucibacillary (PB) and classified into tuberculoid (TT), borderline tuberculoid (BT), borderline lepromatous (BL), lepromatous (LL), histoid, and indeterminate groups after clinicopathological correlation. DNA was extracted from biopsy specimens, and multiplex PCR was carried out incorporating primers intended for the amplification of a specific 372-bp fragment of a repetitive sequence of Mycobacterium leprae DNA. Among 164 patients, PCR was positive in 82.3%. The sensitivity of PCR was significantly greater (P < 0.0001) than that of SSS in both the MB (85.9% vs. 59.8%) and PB (75.4% vs. 1.8%) subgroups; the difference in sensitivity in the PB subgroup is remarkable. Positivity by PCR and SSS was found in 100% of LL and histoid leprosy, but PCR had significantly greater (P < 0.0001) positivity in BT leprosy and was of definite increased value in indeterminate and TT leprosy. Polymerase chain reaction had higher sensitivity compared with SSS, especially in diagnostically challenging and PB cases. Thus, the use of this costly but sensitive tool should be restricted to this subgroup, because SSS is sufficiently sensitive in the diagnosis of LL and histoid leprosy. © 2011 The International Society of Dermatology.

Differentiation of human-induced pluripotent stem cells into insulin-producing clusters.

PubMed

Shaer, Anahita; Azarpira, Negar; Vahdati, Akbar; Karimi, Mohammad Hosein; Shariati, Mehrdad

2015-02-01

In diabetes mellitus type 1, beta cells are mostly destroyed; while in diabetes mellitus type 2, beta cells are reduced by 40% to 60%. We hope that soon, stem cells can be used in diabetes therapy via pancreatic beta cell replacement. Induced pluripotent stem cells are a kind of stem cell taken from an adult somatic cell by "stimulating" certain genes. These induced pluripotent stem cells may be a promising source of cell therapy. This study sought to produce isletlike clusters of insulin-producing cells taken from induced pluripotent stem cells. A human-induced pluripotent stem cell line was induced into isletlike clusters via a 4-step protocol, by adding insulin, transferrin, and selenium (ITS), N2, B27, fibroblast growth factor, and nicotinamide. During differentiation, expression of pancreatic β-cell genes was evaluated by reverse transcriptase-polymerase chain reaction; the morphologic changes of induced pluripotent stem cells toward isletlike clusters were observed by a light microscope. Dithizone staining was used to stain these isletlike clusters. Insulin produced by these clusters was evaluated by radio immunosorbent assay, and the secretion capacity was analyzed with a glucose challenge test. Differentiation was evaluated by analyzing the morphology, dithizone staining, real-time quantitative polymerase chain reaction, and immunocytochemistry. Gene expression of insulin, glucagon, PDX1, NGN3, PAX4, PAX6, NKX6.1, KIR6.2, and GLUT2 were documented by analyzing real-time quantitative polymerase chain reaction. Dithizone-stained cellular clusters were observed after 23 days. The isletlike clusters significantly produced insulin. The isletlike clusters could increase insulin secretion after a glucose challenge test. This work provides a model for studying the differentiation of human-induced pluripotent stem cells to insulin-producing cells.

An insight into the isolation, enumeration, and molecular detection of Listeria monocytogenes in food

PubMed Central

Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han

2015-01-01

Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are chances for the development of new techniques for the detection and identification of foodborne with improved features. PMID:26579116

Antibiotic resistance and molecular typing among cockle (Anadara granosa) strains of Vibrio parahaemolyticus by polymerase chain reaction (PCR)-based analysis.

PubMed

Sahilah, A M; Laila, R A S; Sallehuddin, H Mohd; Osman, H; Aminah, A; Ahmad Azuhairi, A

2014-02-01

Genomic DNA of Vibrio parahaemolyticus were characterized by antibiotic resistance, enterobacterial repetitive intergenic consensus-polymerase chain reaction (ERIC-PCR) and random amplified polymorphic DNA-polymerase chain reaction (RAPD-PCR) analysis. These isolates originated from 3 distantly locations of Selangor, Negeri Sembilan and Melaka (East coastal areas), Malaysia. A total of 44 (n = 44) of tentatively V. parahaemolyticus were also examined for the presence of toxR, tdh and trh gene. Of 44 isolates, 37 were positive towards toxR gene; while, none were positive to tdh and trh gene. Antibiotic resistance analysis showed the V. parahaemolyticus isolates were highly resistant to bacitracin (92%, 34/37) and penicillin (89%, 33/37) followed by resistance towards ampicillin (68%, 25/37), cefuroxime (38%, 14/37), amikacin (6%, 2/37) and ceftazidime (14%, 5/37). None of the V. parahaemolyticus isolates were resistant towards chloramphenicol, ciprofloxacin, ceftriaxone, enrofloxacin, norfloxacin, streptomycin and vancomycin. Antibiogram patterns exhibited, 9 patterns and phenotypically less heterogenous when compared to PCR-based techniques using ERIC- and RAPD-PCR. The results of the ERIC- and RAPD-PCR were analyzed using GelCompare software. ERIC-PCR with primers ERIC1R and ERIC2 discriminated the V. parahaemolyticus isolates into 6 clusters and 21 single isolates at a similarity level of 80%. While, RAPD-PCR with primer Gen8 discriminated the V. parahaemolyticus isolates into 11 clusters and 10 single isolates and Gen9 into 8 clusters and 16 single isolates at the same similarity level examined. Results in the presence study demonstrated combination of phenotypically and genotypically methods show a wide heterogeneity among cockle isolates of V. parahaemolyticus.

Fatal hemorrhagic fever caused by West Nile virus in the United States.

PubMed

Paddock, Christopher D; Nicholson, William L; Bhatnagar, Julu; Goldsmith, Cynthia S; Greer, Patricia W; Hayes, Edward B; Risko, Joseph A; Henderson, Corey; Blackmore, Carina G; Lanciotti, Robert S; Campbell, Grant L; Zaki, Sherif R

2006-06-01

Most West Nile virus (WNV) infections in humans are asymptomatic; severe disease occurs in relatively few patients and typically manifests as encephalitis, meningitis, or acute flaccid paralysis. A few cases of life-threatening disease with diffuse hemorrhagic manifestations have been reported in Africa; however, this clinical presentation has not been documented for any of the >16,700 cases of WNV disease reported in the United States during 1999-2004. We describe a case of fulminant WNV infection in a 59-year-old Florida man who died following a brief illness that resembled hemorrhagic disease caused by Rickettsia reckettsii, dengue virus or yellow fever virus. Traditional and contemporary diagnostic assays, including culture isolation, electron microscopic examination, reverse-transcriptase polymerase chain reaction amplification, and immunohistochemical stains, were used to confirm systemic WNV infection in the patient. WNV was isolated in a cell culture from a skin biopsy specimen obtained from the patient shortly prior to death. Electron microscopic examination identified the isolate as a flavivirus, and reverse-transcriptase polymerase chain reaction amplified specific WNV sequences from the isolate and patient tissue. Quantitative polymerase chain reaction identified approximately 1x10(7) viral copies/mL in the patient's serum. WNV antigens were detected by immunohistochemical stains in intravascular mononuclear cells and endothelium in skin, lung, liver, kidney, spleen, bone marrow, and central nervous system; no viral antigens were identified in neurons or glial cells of the central nervous system. Although hemorrhagic disease is a rare manifestation of WNV infection, the findings provided by this report may offer new insights regarding the clinical spectrum and pathogenesis of WNV disease in humans.

A Degradome-Based Polymerase Chain Reaction to Resolve the Potential of Environmental Samples for 2,4-Dichlorophenol Biodegradation.

PubMed

Ibrahim, Eslam S; Kashef, Mona T; Essam, Tamer M; Ramadan, Mohammed A

2017-12-01

A clean way to overcome environmental pollution is biodegradation. In this perspective, at the intersection of biodegradation and metagenomics, the degradome is defined as the totality of genes related to the biodegradation of a certain compound. It includes the genetic elements from both culturable and uncultured microorganisms. The possibility of assessing the biodegradation potential of an environmental samples, using a degradome-based polymerase chain reaction, was explored. 2,4-Dichlorophenol (2,4-DCP) was chosen as a model and the use of tfdB gene as a biodegradation marker was confirmed by bioinformatics study of TfdB protein. Five primer pairs were designed for the detection of different tfdB gene families. A total of 16 environmental samples were collected from Egyptian agricultural soils and wastewaters and tested for the presence of 2,4-DCP. The biodegradation capacity of 2,4-DCP was determined, for all isolated consortia, to reach up to 350 mg/l. Metagenomic DNA was extracted directly from the soil samples while successive 2,4-DCP-degrading microbial communities were enriched, with increasing concentrations of 2,4-DCP, then their DNA was extracted. The extracted DNA was tested for the distribution of the tfdB gene using a degradome-based polymerase chain reaction. tfdB-1 and tfdB-2 were detected in 5 and 9 samples, respectively. However, the co-existence of both genes was detected only in five samples. All tfdB positive samples were capable of 2,4-DCP degradation. The developed approach of assessing the potential of different environments for degrading 2,4-DCP was successfully measured in terms of accuracy (81.25%) and specificity (100%).

Expression of Connexin 43 in Synovial Tissue of Patients With Rheumatoid Arthritis

PubMed Central

MATSUKI, Tomohiro; TSUCHIDA, Shinji; TERAUCHI, Ryu; ODA, Ryo; FUJIWARA, Hiroyoshi; MAZDA, Osam; KUBO, Toshikazu

2016-01-01

Objectives This study aims to identify the distribution and expression level of connexin 43 (Cx43) in synovial tissue in patients with rheumatoid arthritis (RA). Patients and methods The expression of Cx43 in synovial tissue from eight patients with RA (2 males, 6 females; mean age 59.5±2.7 years; range 52 to 71 years), five patients with osteoarthritis (2 males, 3 females; mean age 68.4±2.7 years; range 61 to 81 years), and one normal female subject (mean age 61 year) was analyzed by quantitative reverse transcriptase polymerase chain reaction and immunohistochemistry of tissue sections. Induction of Cx43 following stimulation of human RA synovial fibroblasts with tumor necrosis factor-alpha (TNF-a) cultures was examined by quantitative reverse transcriptase polymerase chain reaction. The effect of small interfering ribonucleic acid targeting Cx43 (siCx43) on the expression of TNF-a and interleukin-6 was examined using quantitative reverse transcriptase polymerase chain reaction and enzyme-linked immunosorbent assays. Results Connexin 43 was highly expressed in RA synovial tissue, which also expressed TNF-a, but was expressed lower in osteoarthritis and normal synovial tissue. Expression of Cx43 was markedly up-regulated in RA synovial fibroblasts after stimulation with TNF-a. The over-expression of pro- inflammatory cytokines was suppressed by transfection of siCx43. Conclusion This study shows that Cx43 is expressed in RA synovial tissue and that its expression is induced by stimulation with TNF-a. The expression of the pro-inflammatory cytokines was inhibited by transfection of siCx43. Cx43 may be a novel marker of inflammation in RA synovial tissue. PMID:29900991

Molecular analysis and association with clinical and laboratory manifestations in children with sickle cell anemia

PubMed Central

Camilo-Araújo, Roberta Faria; Amancio, Olga Maria Silverio; Figueiredo, Maria Stella; Cabanãs-Pedro, Ana Carolina; Braga, Josefina Aparecida Pellegrini

2014-01-01

Objectives To analyze the frequency of βS-globin haplotypes and alpha-thalassemia, and their influence on clinical manifestations and the hematological profile of children with sickle cell anemia. Method The frequency of βS-globin haplotypes and alpha-thalassemia and any association with clinical and laboratorial manifestations were determined in 117 sickle cell anemia children aged 3–71 months. The confirmation of hemoglobin SS and determination of the haplotypes were achieved by polymerase chain reaction-restriction fragment length polymorphism, and alpha-thalassemia genotyping was by multiplex polymerase chain reaction (single-tube multiplex-polymerase chain reaction). Results The genotype distribution of haplotypes was 43 (36.7%) Central African Republic/Benin, 41 (35.0%) Central African Republic/Central African Republic, 20 (17.0%) Rare/atypical, and 13 (11.1%) Benin/Benin. The frequency of the α3.7 deletion was 1.71% as homozygous (−α3.7/−α3.7) and 11.9% as heterozygous (−α3.7/αα). The only significant association in respect to haplotypes was related to the mean corpuscular volume. The presence of alpha-thalassemia was significantly associated to decreases in mean corpuscular volume, mean corpuscular hemoglobin and reticulocyte count and to an increase in the red blood cell count. There were no significant associations of βS-globin haplotypes and alpha-thalassemia with clinical manifestations. Conclusions In the study population, the frequency of alpha-thalassemia was similar to published data in Brazil with the Central African Republic haplotype being the most common, followed by the Benin haplotype. βS-globin haplotypes and interaction between alpha-thalassemia and sickle cell anemia did not influence fetal hemoglobin concentrations or the number of clinical manifestations. PMID:25305165

An Evaluation of Microbial Profile in Halitosis with Tongue Coating Using PCR (Polymerase Chain Reaction)- A Clinical and Microbiological Study

PubMed Central

Kamaraj R., Dinesh; Bhushan, Kala S.; K.L., Vandana

2014-01-01

Background: Medline search using key words halitosis, tongue coating, polymerase chain reaction, microbial profile did not reveal any study. Hence, the purpose of the present investigation was to assess the malodor using the organoleptic method and tanita device; to quantify odoriferous microorganisms using Polymerase Chain Reaction technique in chronic periodontitis patients. Materials and Methods: The study included 30 chronic periodontitis patients. Halitosis was detected using organoleptic assessment & tanita breath alert. Microbial analysis of Pg, Tf & Fn was done using PCR. Plaque index (PI), gingival index (GI), gingival bleeding index (GBI) were recorded. Result: The maximum score of 3 for tongue coating was found in 60% of selected subjects. The tanita breath alert measured VSC level of score 2 in 60% of selected subjects while organoleptic score of 4 was found in 50% of subjects. The maximum mean value of 31.1±36.5 was found to be of F. nucleatum (Fn) followed by P. gingivalis (Pg) (13±13.3) & T. forsythia (Tf) (7.16±8.68) in tongue samples of selected patients. A weak positive correlation was found between VSC levels (tanita score & organoleptic score) and clinical parameters. Conclusion: The halitosis assessment by measuring VSC levels using organoleptic method and tanita breath alert are clinically feasible. Maximum tongue coating was found in 60% of patients. Fn was found comparatively more than the Pg & Tf. A weak positive correlation was found between VSC levels and clinical parameters such as PI, GI & GBI. Thus,the dentist/ periodontist should emphasise on tongue cleaning measures that would reduce the odoriferous microbial load. PMID:24596791

An insight into the isolation, enumeration, and molecular detection of Listeria monocytogenes in food.

PubMed

Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han

2015-01-01

Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are chances for the development of new techniques for the detection and identification of foodborne with improved features.

Development of a Novel, Rapid Multiplex Polymerase Chain Reaction Assay for the Detection and Differentiation of Salmonella enterica Serovars Enteritidis and Typhimurium Using Ultra-Fast Convection Polymerase Chain Reaction.

PubMed

Kim, Tae-Hoon; Hwang, Hyun Jin; Kim, Jeong Hee

2017-10-01

Salmonella enterica serovars Enteritidis and Typhimurium are the most common causative agents of human nontyphoidal salmonellosis. The rapid detection and timely treatment of salmonellosis are important to increase the curative ratio and prevent spreading of the disease. In this study, we developed a rapid multiplex convection polymerase chain reaction (PCR) method to detect Salmonella spp. and differentiate Salmonella Enteritidis and Salmonella Typhimurium. We used the invA gene for Salmonella spp. detection. Salmonella Enteritidis-specific primers and Salmonella Typhimurium-specific primers were designed using the insertion element (IE) and spy genes, respectively. The primer set for Salmonella spp. detection clearly detected both Salmonella Enteritidis and Salmonella Typhimurium after a 21-min amplification reaction. Serovar-specific primer sets for Salmonella Enteritidis and Salmonella Typhimurium specifically detected each target species in a 21-min amplification reaction. We were able to detect Salmonella spp. at a single copy level in the singleplex mode. The limits of detection for Salmonella Enteritidis and Salmonella Typhimurium were 30 copies in both the singleplex and multiplex modes. The PCR run time could be reduced to 10.5 min/15 cycles. The multiplex convection PCR method developed in this study could detect the Salmonella spp. Salmonella Enteritidis and Salmonella Typhimurium in artificially contaminated milk with as few as 10 0 colony-forming unit/mL after 4-h enrichment. The PCR assay developed in this study provides a rapid, specific, and sensitive method for the detection of Salmonella spp. and the differentiation of Salmonella Enteritidis and Salmonella Typhimurium.

First report of Toxoplasma gondii sporulated oocysts and Giardia duodenalis in commercial green-lipped mussels (Perna canaliculus) in New Zealand.

PubMed

Coupe, Alicia; Howe, Laryssa; Burrows, Elizabeth; Sine, Abigail; Pita, Anthony; Velathanthiri, Niluka; Vallée, Emilie; Hayman, David; Shapiro, Karen; Roe, Wendi D

2018-05-01

Pollution of marine ecosystems with the protozoan parasites Toxoplasma gondii, Cryptosporidium spp. and Giardia duodenalis can be studied using bivalve shellfish as biosentinels. Although evidence suggests that these parasites are present in New Zealand coastal waters, the extent of protozoal pollution has not been investigated. This study used optimised molecular methods to detect the presence of Cryptosporidium spp., G. duodenalis and T. gondii in commercially sourced green-lipped mussel (Perna canaliculus), an endemic species found throughout coastal New Zealand. A nested polymerase chain reaction was validated for detection of T. gondii DNA and applied to 104 commercially sourced mussels. Thirteen mussels were positive for T. gondii DNA with an estimated true prevalence of 16.4% using Bayesian statistics, and the presence of T. gondii in mussels was significantly associated with collection during the summer compared with that in the winter (P = 0.003). Consumption of contaminated shellfish may also pose a health risk for humans and marine wildlife. As only sporulated T. gondii oocysts can be infectious, a reverse transcriptase-polymerase chain reaction was used to confirm presence of a sporozoite-specific marker (SporoSAG), detected in four mussels. G. duodenalis assemblage B, known to be pathogenic in humans, was also discovered in 1% mussels, tested by polymerase chain reaction (n = 90). Cryptosporidium spp. was not detected in the sampled mussel haemolymph. Results suggest that New Zealand may have high levels of coastal contamination with T. gondii, particularly in summer months, and that naturally exposed mussels can ingest and retain sporulated oocysts, further establishing shellfish consumption as a health concern.

Transcription elongation. Heterogeneous tracking of RNA polymerase and its biological implications.

PubMed

Imashimizu, Masahiko; Shimamoto, Nobuo; Oshima, Taku; Kashlev, Mikhail

2014-01-01

Regulation of transcription elongation via pausing of RNA polymerase has multiple physiological roles. The pausing mechanism depends on the sequence heterogeneity of the DNA being transcribed, as well as on certain interactions of polymerase with specific DNA sequences. In order to describe the mechanism of regulation, we introduce the concept of heterogeneity into the previously proposed alternative models of elongation, power stroke and Brownian ratchet. We also discuss molecular origins and physiological significances of the heterogeneity.

Mammalian proliferating cell nuclear antigen stimulates the processivity of two wheat embryo DNA polymerases.

PubMed Central

Laquel, P; Litvak, S; Castroviejo, M

1993-01-01

Multiple DNA polymerases have been described in all organisms studied to date. Their specific functions are not easy to determine, except when powerful genetic and/or biochemical tools are available. However, the processivity of a DNA polymerase could reflect the physiological role of the enzyme. In this study, analogies between plant and animal DNA polymerases have been investigated by analyzing the size of the products synthesized by wheat DNA polymerases A, B, CI, and CII as a measure of their processivity. Thus, incubations have been carried out with poly(dA)-oligo(dT) as a template-primer under varying assay conditions. In the presence of MgCl2, DNA polymerase A was highly processive, whereas DNA polymerases B, CI, and CII synthesized much shorter products. With MnCl2 instead of MgCl2, DNA polymerase A was highly processive, DNA polymerases B and CII were moderately processive, and DNA polymerase CI remained strictly distributive. The effect of calf thymus proliferating cell nuclear antigen (PCNA) on wheat polymerases was studied as described for animal DNA polymerases. The high processivity of DNA polymerase A was PCNA independent, whereas both enzyme activity and processivity of wheat DNA polymerases B and CII were significantly stimulated by PCNA. On the other hand, DNA polymerase CI was not stimulated by PCNA and, like animal DNA polymerase beta, was distributive in all cases. From these results, we propose that wheat DNA polymerase A could correspond to a DNA polymerase alpha, DNA polymerases B and CII could correspond to the delta-like enzyme, and DNA polymerase CI could correspond to DNA polymerase beta. PMID:7906418