Sample records for multiple single nucleotide

  1. Infectious mononucleosis-linked HLA class I single nucleotide polymorphism is associated with multiple sclerosis.

    PubMed

    Jafari, Naghmeh; Broer, Linda; Hoppenbrouwers, Ilse A; van Duijn, Cornelia M; Hintzen, Rogier Q

    2010-11-01

    Multiple sclerosis is a presumed autoimmune disease associated with genetic and environmental risk factors such as infectious mononucleosis. Recent research has shown infectious mononucleosis to be associated with a specific HLA class I polymorphism. Our aim was to test if the infectious mononucleosis-linked HLA class I single nucleotide polymorphism (rs6457110) is also associated with multiple sclerosis. Genotyping of the HLA-A single nucleotide polymorphism rs6457110 using TaqMan was performed in 591 multiple sclerosis cases and 600 controls. The association of multiple sclerosis with the HLA-A single nucleotide polymorphism was tested using logistic regression adjusted for age, sex and HLA-DRB1*1501. HLA-A minor allele (A) is associated with multiple sclerosis (OR = 0.68; p = 4.08 × 10( -5)). After stratification for HLA-DRB1*1501 risk allele (T) carrier we showed a significant OR of 0.70 (p = 0.003) for HLA-A. HLA class I single nucleotide polymorphism rs6457110 is associated with infectious mononucleosis and multiple sclerosis, independent of the major class II allele, supporting the hypothesis that shared genetics may contribute to the association between infectious mononucleosis and multiple sclerosis.

  2. Allelic imbalance of multiple sclerosis susceptibility genes IKZF3 and IQGAP1 in human peripheral blood.

    PubMed

    Keshari, Pankaj K; Harbo, Hanne F; Myhr, Kjell-Morten; Aarseth, Jan H; Bos, Steffan D; Berge, Tone

    2016-04-14

    Multiple sclerosis is a chronic inflammatory, demyelinating disease of the central nervous system. Recent genome-wide studies have revealed more than 110 single nucleotide polymorphisms as associated with susceptibility to multiple sclerosis, but their functional contribution to disease development is mostly unknown. Consistent allelic imbalance was observed for rs907091 in IKZF3 and rs11609 in IQGAP1, which are in strong linkage disequilibrium with the multiple sclerosis associated single nucleotide polymorphisms rs12946510 and rs8042861, respectively. Using multiple sclerosis patients and healthy controls heterozygous for rs907091 and rs11609, we showed that the multiple sclerosis risk alleles at IKZF3 and IQGAP1 are expressed at higher levels as compared to the protective allele. Furthermore, individuals homozygous for the multiple sclerosis risk allele at IQGAP1 had a significantly higher total expression of IQGAP1 compared to individuals homozygous for the protective allele. Our data indicate a possible regulatory role for the multiple sclerosis-associated IKZF3 and IQGAP1 variants. We suggest that such cis-acting mechanisms may contribute to the multiple sclerosis association of single nucleotide polymorphisms at IKZF3 and IQGAP1.

  3. Electrical detection and quantification of single and mixed DNA nucleotides in suspension

    NASA Astrophysics Data System (ADS)

    Ahmad, Mahmoud Al; Panicker, Neena G.; Rizvi, Tahir A.; Mustafa, Farah

    2016-09-01

    High speed sequential identification of the building blocks of DNA, (deoxyribonucleotides or nucleotides for short) without labeling or processing in long reads of DNA is the need of the hour. This can be accomplished through exploiting their unique electrical properties. In this study, the four different types of nucleotides that constitute a DNA molecule were suspended in a buffer followed by performing several types of electrical measurements. These electrical parameters were then used to quantify the suspended DNA nucleotides. Thus, we present a purely electrical counting scheme based on the semiconductor theory that allows one to determine the number of nucleotides in a solution by measuring their capacitance-voltage dependency. The nucleotide count was observed to be similar to the multiplication of the corresponding dopant concentration and debye volume after de-embedding the buffer contribution. The presented approach allows for a fast and label-free quantification of single and mixed nucleotides in a solution.

  4. The association of single-nucleotide polymorphisms in the oxytocin receptor and G protein-coupled receptor kinase 6 (GRK6) genes with oxytocin dosing requirements and labor outcomes.

    PubMed

    Grotegut, Chad A; Ngan, Emily; Garrett, Melanie E; Miranda, Marie Lynn; Ashley-Koch, Allison E; Swamy, Geeta K

    2017-09-01

    Oxytocin is a potent uterotonic agent that is widely used for induction and augmentation of labor. Oxytocin has a narrow therapeutic index and the optimal dosing for any individual woman varies widely. The objective of this study was to determine whether genetic variation in the oxytocin receptor (OXTR) or in the gene encoding G protein-coupled receptor kinase 6 (GRK6), which regulates desensitization of the oxytocin receptor, could explain variation in oxytocin dosing and labor outcomes among women being induced near term. Pregnant women with a singleton gestation residing in Durham County, NC, were prospectively enrolled as part of the Healthy Pregnancy, Healthy Baby cohort study. Those women undergoing an induction of labor at 36 weeks or greater were genotyped for 18 haplotype-tagging single-nucleotide polymorphisms in OXTR and 7 haplotype-tagging single-nucleotide polymorphisms in GRK6 using TaqMan assays. Linear regression was used to examine the relationship between maternal genotype and maximal oxytocin infusion rate, total oxytocin dose received, and duration of labor. Logistic regression was used to test for the association of maternal genotype with mode of delivery. For each outcome, backward selection techniques were utilized to control for important confounding variables and additive genetic models were used. Race/ethnicity was included in all models because of differences in allele frequencies across populations, and Bonferroni correction for multiple testing was used. DNA was available from 482 women undergoing induction of labor at 36 weeks or greater. Eighteen haplotype-tagging single-nucleotide polymorphisms within OXTR and 7 haplotype-tagging single-nucleotide polymorphisms within GRK6 were examined. Five single-nucleotide polymorphisms in OXTR showed nominal significance with maximal infusion rate of oxytocin, and two single-nucleotide polymorphisms in OXTR were associated with total oxytocin dose received. One single-nucleotide polymorphism in OXTR and two single-nucleotide polymorphisms in GRK6 were associated with duration of labor, one of which met the multiple testing threshold (P = .0014, rs2731664 [GRK6], mean duration of labor, 17.7 hours vs 20.2 hours vs 23.5 hours for AA, AC, and CC genotypes, respectively). Three single-nucleotide polymorphisms, two in OXTR and one in GRK6, showed nominal significance with mode of delivery. Genetic variation in OXTR and GRK6 is associated with the amount of oxytocin required as well as the duration of labor and risk for cesarean delivery among women undergoing induction of labor near term. With further research, pharmacogenomic approaches may potentially be utilized to develop personalized treatment to improve safety and efficacy outcomes among women undergoing induction of labor. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Decreased necrotizing fasciitis capacity caused by a single nucleotide mutation that alters a multiple gene virulence axis

    PubMed Central

    Olsen, Randall J.; Sitkiewicz, Izabela; Ayeras, Ara A.; Gonulal, Vedia E.; Cantu, Concepcion; Beres, Stephen B.; Green, Nicole M.; Lei, Benfang; Humbird, Tammy; Greaver, Jamieson; Chang, Ellen; Ragasa, Willie P.; Montgomery, Charles A.; Cartwright, Joiner; McGeer, Allison; Low, Donald E.; Whitney, Adeline R.; Cagle, Philip T.; Blasdel, Terry L.; DeLeo, Frank R.; Musser, James M.

    2010-01-01

    Single-nucleotide changes are the most common cause of natural genetic variation among members of the same species, but there is remarkably little information bearing on how they alter bacterial virulence. We recently discovered a single-nucleotide mutation in the group A Streptococcus genome that is epidemiologically associated with decreased human necrotizing fasciitis (“flesh-eating disease”). Working from this clinical observation, we find that wild-type mtsR function is required for group A Streptococcus to cause necrotizing fasciitis in mice and nonhuman primates. Expression microarray analysis revealed that mtsR inactivation results in overexpression of PrsA, a chaperonin involved in posttranslational maturation of SpeB, an extracellular cysteine protease. Isogenic mutant strains that overexpress prsA or lack speB had decreased secreted protease activity in vivo and recapitulated the necrotizing fasciitis-negative phenotype of the ΔmtsR mutant strain in mice and monkeys. mtsR inactivation results in increased PrsA expression, which in turn causes decreased SpeB secreted protease activity and reduced necrotizing fasciitis capacity. Thus, a naturally occurring single-nucleotide mutation dramatically alters virulence by dysregulating a multiple gene virulence axis. Our discovery has broad implications for the confluence of population genomics and molecular pathogenesis research. PMID:20080771

  6. Decreased necrotizing fasciitis capacity caused by a single nucleotide mutation that alters a multiple gene virulence axis.

    PubMed

    Olsen, Randall J; Sitkiewicz, Izabela; Ayeras, Ara A; Gonulal, Vedia E; Cantu, Concepcion; Beres, Stephen B; Green, Nicole M; Lei, Benfang; Humbird, Tammy; Greaver, Jamieson; Chang, Ellen; Ragasa, Willie P; Montgomery, Charles A; Cartwright, Joiner; McGeer, Allison; Low, Donald E; Whitney, Adeline R; Cagle, Philip T; Blasdel, Terry L; DeLeo, Frank R; Musser, James M

    2010-01-12

    Single-nucleotide changes are the most common cause of natural genetic variation among members of the same species, but there is remarkably little information bearing on how they alter bacterial virulence. We recently discovered a single-nucleotide mutation in the group A Streptococcus genome that is epidemiologically associated with decreased human necrotizing fasciitis ("flesh-eating disease"). Working from this clinical observation, we find that wild-type mtsR function is required for group A Streptococcus to cause necrotizing fasciitis in mice and nonhuman primates. Expression microarray analysis revealed that mtsR inactivation results in overexpression of PrsA, a chaperonin involved in posttranslational maturation of SpeB, an extracellular cysteine protease. Isogenic mutant strains that overexpress prsA or lack speB had decreased secreted protease activity in vivo and recapitulated the necrotizing fasciitis-negative phenotype of the DeltamtsR mutant strain in mice and monkeys. mtsR inactivation results in increased PrsA expression, which in turn causes decreased SpeB secreted protease activity and reduced necrotizing fasciitis capacity. Thus, a naturally occurring single-nucleotide mutation dramatically alters virulence by dysregulating a multiple gene virulence axis. Our discovery has broad implications for the confluence of population genomics and molecular pathogenesis research.

  7. WEB-server for search of a periodicity in amino acid and nucleotide sequences

    NASA Astrophysics Data System (ADS)

    E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

    2017-12-01

    A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

  8. Single nucleotide polymorphisms in multiple sclerosis: disease susceptibility and treatment response biomarkers.

    PubMed

    Pravica, Vera; Popadic, Dusan; Savic, Emina; Markovic, Milos; Drulovic, Jelena; Mostarica-Stojkovic, Marija

    2012-04-01

    Multiple sclerosis (MS) is a chronic inflammatory demyelinating and neurodegenerative disease of the central nervous system characterized by unpredictable and variable clinical course. Etiology of MS involves both genetic and environmental factors. New technologies identified genetic polymorphisms associated with MS susceptibility among which immunologically relevant genes are significantly overrepresented. Although individual genes contribute only a small part to MS susceptibility, they might be used as biomarkers, thus helping to identify accurate diagnosis, predict clinical disease course and response to therapy. This review focuses on recent progress in research on MS genetics with special emphasis on the possibility to use single nucleotide polymorphism of candidate genes as biomarkers of susceptibility to disease and response to therapy.

  9. SNPGenie: estimating evolutionary parameters to detect natural selection using pooled next-generation sequencing data.

    PubMed

    Nelson, Chase W; Moncla, Louise H; Hughes, Austin L

    2015-11-15

    New applications of next-generation sequencing technologies use pools of DNA from multiple individuals to estimate population genetic parameters. However, no publicly available tools exist to analyse single-nucleotide polymorphism (SNP) calling results directly for evolutionary parameters important in detecting natural selection, including nucleotide diversity and gene diversity. We have developed SNPGenie to fill this gap. The user submits a FASTA reference sequence(s), a Gene Transfer Format (.GTF) file with CDS information and a SNP report(s) in an increasing selection of formats. The program estimates nucleotide diversity, distance from the reference and gene diversity. Sites are flagged for multiple overlapping reading frames, and are categorized by polymorphism type: nonsynonymous, synonymous, or ambiguous. The results allow single nucleotide, single codon, sliding window, whole gene and whole genome/population analyses that aid in the detection of positive and purifying natural selection in the source population. SNPGenie version 1.2 is a Perl program with no additional dependencies. It is free, open-source, and available for download at https://github.com/hugheslab/snpgenie. nelsoncw@email.sc.edu or austin@biol.sc.edu Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  10. Contribution of 20 single nucleotide polymorphisms of 13 genes to dyslipidemia associated with antiretroviral therapy.

    PubMed

    Arnedo, Mireia; Taffé, Patrick; Sahli, Roland; Furrer, Hansjakob; Hirschel, Bernard; Elzi, Luigia; Weber, Rainer; Vernazza, Pietro; Bernasconi, Enos; Darioli, Roger; Bergmann, Sven; Beckmann, Jacques S; Telenti, Amalio; Tarr, Philip E

    2007-09-01

    HIV-1 infected individuals have an increased cardiovascular risk which is partially mediated by dyslipidemia. Single nucleotide polymorphisms in multiple genes involved in lipid transport and metabolism are presumed to modulate the risk of dyslipidemia in response to antiretroviral therapy. The contribution to dyslipidemia of 20 selected single nucleotide polymorphisms of 13 genes reported in the literature to be associated with plasma lipid levels (ABCA1, ADRB2, APOA5, APOC3, APOE, CETP, LIPC, LIPG, LPL, MDR1, MTP, SCARB1, and TNF) was assessed by longitudinally modeling more than 4400 plasma lipid determinations in 438 antiretroviral therapy-treated participants during a median period of 4.8 years. An exploratory genetic score was tested that takes into account the cumulative contribution of multiple gene variants to plasma lipids. Variants of ABCA1, APOA5, APOC3, APOE, and CETP contributed to plasma triglyceride levels, particularly in the setting of ritonavir-containing antiretroviral therapy. Variants of APOA5 and CETP contributed to high-density lipoprotein-cholesterol levels. Variants of CETP and LIPG contributed to non-high-density lipoprotein-cholesterol levels, a finding not reported previously. Sustained hypertriglyceridemia and low high-density lipoprotein-cholesterol during the study period was significantly associated with the genetic score. Single nucleotide polymorphisms of ABCA1, APOA5, APOC3, APOE, and CETP contribute to plasma triglyceride and high-density lipoprotein-cholesterol levels during antiretroviral therapy exposure. Genetic profiling may contribute to the identification of patients at risk for antiretroviral therapy-related dyslipidemia.

  11. Institutional Protocol to Manage Consanguinity Detected by Genetic Testing in Pregnancy in a Minor

    PubMed Central

    Chen, Laura P.; Beck, Anita E.; Tsuchiya, Karen D.; Chow, Penny M.; Mirzaa, Ghayda M.; Wiester, Rebecca T.

    2015-01-01

    Single-nucleotide polymorphism arrays and other types of genetic tests have the potential to detect first-degree consanguinity and uncover parental rape in cases of minor teenage pregnancy. We present 2 cases in which genetic testing identified parental rape of a minor teenager. In case 1, single-nucleotide polymorphism array in a patient with multiple developmental abnormalities demonstrated multiple long stretches of homozygosity, revealing parental rape of a teenage mother. In case 2, a vague maternal sexual assault history and diagnosis of Pompe disease by direct gene sequencing identified parental rape of a minor. Given the medical, legal, and ethical implications of such revelations, a protocol was developed at our institution to manage consanguinity identified via genetic testing. PMID:25687148

  12. Prediction of peripheral neuropathy in multiple myeloma patients receiving bortezomib and thalidomide: a genetic study based on a single nucleotide polymorphism array.

    PubMed

    García-Sanz, Ramón; Corchete, Luis Antonio; Alcoceba, Miguel; Chillon, María Carmen; Jiménez, Cristina; Prieto, Isabel; García-Álvarez, María; Puig, Noemi; Rapado, Immaculada; Barrio, Santiago; Oriol, Albert; Blanchard, María Jesús; de la Rubia, Javier; Martínez, Rafael; Lahuerta, Juan José; González Díaz, Marcos; Mateos, María Victoria; San Miguel, Jesús Fernando; Martínez-López, Joaquín; Sarasquete, María Eugenia

    2017-12-01

    Bortezomib- and thalidomide-based therapies have significantly contributed to improved survival of multiple myeloma (MM) patients. However, treatment-induced peripheral neuropathy (TiPN) is a common adverse event associated with them. Risk factors for TiPN in MM patients include advanced age, prior neuropathy, and other drugs, but there are conflicting results about the role of genetics in predicting the risk of TiPN. Thus, we carried out a genome-wide association study based on more than 300 000 exome single nucleotide polymorphisms in 172 MM patients receiving therapy involving bortezomib and thalidomide. We compared patients developing and not developing TiPN under similar treatment conditions (GEM05MAS65, NCT00443235). The highest-ranking single nucleotide polymorphism was rs45443101, located in the PLCG2 gene, but no significant differences were found after multiple comparison correction (adjusted P = .1708). Prediction analyses, cytoband enrichment, and pathway analyses were also performed, but none yielded any significant findings. A copy number approach was also explored, but this gave no significant results either. In summary, our study did not find a consistent genetic component associated with TiPN under bortezomib and thalidomide therapies that could be used for prediction, which makes clinical judgment essential in the practical management of MM treatment. Copyright © 2016 John Wiley & Sons, Ltd.

  13. Bitterness of the Non-nutritive Sweetener Acesulfame Potassium Varies With Polymorphisms in TAS2R9 and TAS2R31

    PubMed Central

    2013-01-01

    Demand for nonnutritive sweeteners continues to increase due to their ability to provide desirable sweetness with minimal calories. Acesulfame potassium and saccharin are well-studied nonnutritive sweeteners commonly found in food products. Some individuals report aversive sensations from these sweeteners, such as bitter and metallic side tastes. Recent advances in molecular genetics have provided insight into the cause of perceptual differences across people. For example, common alleles for the genes TAS2R9 and TAS2R38 explain variable response to the bitter drugs ofloxacin in vitro and propylthiouracil in vivo. Here, we wanted to determine whether differences in the bitterness of acesulfame potassium could be predicted by common polymorphisms (genetic variants) in bitter taste receptor genes (TAS2Rs). We genotyped participants (n = 108) for putatively functional single nucleotide polymorphisms in 5 TAS2Rs and asked them to rate the bitterness of 25 mM acesulfame potassium on a general labeled magnitude scale. Consistent with prior reports, we found 2 single nucleotide polymorphisms in TAS2R31 were associated with acesulfame potassium bitterness. However, TAS2R9 alleles also predicted additional variation in acesulfame potassium bitterness. Conversely, single nucleotide polymorphisms in TAS2R4, TAS2R38, and near TAS2R16 were not significant predictors. Using 1 single nucleotide polymorphism each from TAS2R9 and TAS2R31, we modeled the simultaneous influence of these single nucleotide polymorphisms on acesulfame potassium bitterness; together, these 2 single nucleotide polymorphisms explained 13.4% of the variance in perceived bitterness. These data suggest multiple polymorphisms within TAS2Rs contribute to the ability to perceive the bitterness from acesulfame potassium. PMID:23599216

  14. Theory of single-molecule controlled rotation experiments, predictions, tests, and comparison with stalling experiments in F1-ATPase.

    PubMed

    Volkán-Kacsó, Sándor; Marcus, Rudolph A

    2016-10-25

    A recently proposed chemomechanical group transfer theory of rotary biomolecular motors is applied to treat single-molecule controlled rotation experiments. In these experiments, single-molecule fluorescence is used to measure the binding and release rate constants of nucleotides by monitoring the occupancy of binding sites. It is shown how missed events of nucleotide binding and release in these experiments can be corrected using theory, with F 1 -ATP synthase as an example. The missed events are significant when the reverse rate is very fast. Using the theory the actual rate constants in the controlled rotation experiments and the corrections are predicted from independent data, including other single-molecule rotation and ensemble biochemical experiments. The effective torsional elastic constant is found to depend on the binding/releasing nucleotide, and it is smaller for ADP than for ATP. There is a good agreement, with no adjustable parameters, between the theoretical and experimental results of controlled rotation experiments and stalling experiments, for the range of angles where the data overlap. This agreement is perhaps all the more surprising because it occurs even though the binding and release of fluorescent nucleotides is monitored at single-site occupancy concentrations, whereas the stalling and free rotation experiments have multiple-site occupancy.

  15. Yeast ribonuclease III uses a network of multiple hydrogen bonds for RNA binding and cleavage.

    PubMed

    Lavoie, Mathieu; Abou Elela, Sherif

    2008-08-19

    Members of the bacterial RNase III family recognize a variety of short structured RNAs with few common features. It is not clear how this group of enzymes supports high cleavage fidelity while maintaining a broad base of substrates. Here we show that the yeast orthologue of RNase III (Rnt1p) uses a network of 2'-OH-dependent interactions to recognize substrates with different structures. We designed a series of bipartite substrates permitting the distinction between binding and cleavage defects. Each substrate was engineered to carry a single or multiple 2'- O-methyl or 2'-fluoro ribonucleotide substitutions to prevent the formation of hydrogen bonds with a specific nucleotide or group of nucleotides. Interestingly, introduction of 2'- O-methyl ribonucleotides near the cleavage site increased the rate of catalysis, indicating that 2'-OH are not required for cleavage. Substitution of nucleotides in known Rnt1p binding site with 2'- O-methyl ribonucleotides inhibited cleavage while single 2'-fluoro ribonucleotide substitutions did not. This indicates that while no single 2'-OH is essential for Rnt1p cleavage, small changes in the substrate structure are not tolerated. Strikingly, several nucleotide substitutions greatly increased the substrate dissociation constant with little or no effect on the Michaelis-Menten constant or rate of catalysis. Together, the results indicate that Rnt1p uses a network of nucleotide interactions to identify its substrate and support two distinct modes of binding. One mode is primarily mediated by the dsRNA binding domain and leads to the formation of stable RNA/protein complex, while the other requires the presence of the nuclease and N-terminal domains and leads to RNA cleavage.

  16. Selection and Management of DNA Markers for Use in Genomic Evaluation

    USDA-ARS?s Scientific Manuscript database

    A database was constructed to store genotypes for 50,972 single-nucleotide polymorphisms (SNP) from the Illumina BovineSNP50 BeadChip for over 30,000 animals. The database allows storage of multiple samples per animal and stores all SNP genotypes for a sample in a single row. An indicator specifies ...

  17. Detecting and Analyzing Genetic Recombination Using RDP4.

    PubMed

    Martin, Darren P; Murrell, Ben; Khoosal, Arjun; Muhire, Brejnev

    2017-01-01

    Recombination between nucleotide sequences is a major process influencing the evolution of most species on Earth. The evolutionary value of recombination has been widely debated and so too has its influence on evolutionary analysis methods that assume nucleotide sequences replicate without recombining. When nucleic acids recombine, the evolution of the daughter or recombinant molecule cannot be accurately described by a single phylogeny. This simple fact can seriously undermine the accuracy of any phylogenetics-based analytical approach which assumes that the evolutionary history of a set of recombining sequences can be adequately described by a single phylogenetic tree. There are presently a large number of available methods and associated computer programs for analyzing and characterizing recombination in various classes of nucleotide sequence datasets. Here we examine the use of some of these methods to derive and test recombination hypotheses using multiple sequence alignments.

  18. Single Locked Nucleic Acid-Enhanced Nanopore Genetic Discrimination of Pathogenic Serotypes and Cancer Driver Mutations.

    PubMed

    Tian, Kai; Chen, Xiaowei; Luan, Binquan; Singh, Prashant; Yang, Zhiyu; Gates, Kent S; Lin, Mengshi; Mustapha, Azlin; Gu, Li-Qun

    2018-05-22

    Accurate and rapid detection of single-nucleotide polymorphism (SNP) in pathogenic mutants is crucial for many fields such as food safety regulation and disease diagnostics. Current detection methods involve laborious sample preparations and expensive characterizations. Here, we investigated a single locked nucleic acid (LNA) approach, facilitated by a nanopore single-molecule sensor, to accurately determine SNPs for detection of Shiga toxin producing Escherichia coli (STEC) serotype O157:H7, and cancer-derived EGFR L858R and KRAS G12D driver mutations. Current LNA applications that require incorporation and optimization of multiple LNA nucleotides. But we found that in the nanopore system, a single LNA introduced in the probe is sufficient to enhance the SNP discrimination capability by over 10-fold, allowing accurate detection of the pathogenic mutant DNA mixed in a large amount of the wild-type DNA. Importantly, the molecular mechanistic study suggests that such a significant improvement is due to the effect of the single-LNA that both stabilizes the fully matched base-pair and destabilizes the mismatched base-pair. This sensitive method, with a simplified, low cost, easy-to-operate LNA design, could be generalized for various applications that need rapid and accurate identification of single-nucleotide variations.

  19. Single-Cell Whole-Genome Amplification and Sequencing: Methodology and Applications.

    PubMed

    Huang, Lei; Ma, Fei; Chapman, Alec; Lu, Sijia; Xie, Xiaoliang Sunney

    2015-01-01

    We present a survey of single-cell whole-genome amplification (WGA) methods, including degenerate oligonucleotide-primed polymerase chain reaction (DOP-PCR), multiple displacement amplification (MDA), and multiple annealing and looping-based amplification cycles (MALBAC). The key parameters to characterize the performance of these methods are defined, including genome coverage, uniformity, reproducibility, unmappable rates, chimera rates, allele dropout rates, false positive rates for calling single-nucleotide variations, and ability to call copy-number variations. Using these parameters, we compare five commercial WGA kits by performing deep sequencing of multiple single cells. We also discuss several major applications of single-cell genomics, including studies of whole-genome de novo mutation rates, the early evolution of cancer genomes, circulating tumor cells (CTCs), meiotic recombination of germ cells, preimplantation genetic diagnosis (PGD), and preimplantation genomic screening (PGS) for in vitro-fertilized embryos.

  20. Genetic characterization of Measles Viruses in China, 2004

    PubMed Central

    Zhang, Yan; Ji, Yixin; Jiang, Xiaohong; Xu, Songtao; Zhu, Zhen; Zheng, Lei; He, Jilan; Ling, Hua; Wang, Yan; Liu, Yang; Du, Wen; Yang, Xuelei; Mao, Naiying; Xu, Wenbo

    2008-01-01

    Genetic characterization of wild-type measles virus was studied using nucleotide sequencing of the C-terminal region of the N protein gene and phylogenetic analysis on 59 isolates from 16 provinces of China in 2004. The results showed that all of the isolates belonged to genotype H1. 51 isolates were belonged to cluster 1 and 8 isolates were cluster 2 and Viruses from both clusters were distributed throughout China without distinct geographic pattern. The nucleotide sequence and predicted amino acid homologies of the 59 H1 strains were 96.5%–100% and 95.7%–100%, respectively. The report showed that the transmission pattern of genotype H1 viruses in China in 2004 was consistent with ongoing endemic transmission of multiple lineages of a single, endemic genotype. Multiple transmission pathways leaded to multiple lineages within endemic genotype. PMID:18928575

  1. Labeled Nucleoside Triphosphates with Reversibly Terminating Aminoalkoxyl Groups

    PubMed Central

    Hutter, Daniel; Kim, Myong-Jung; Karalkar, Nilesh; Leal, Nicole A.; Chen, Fei; Guggenheim, Evan; Visalakshi, Visa; Olejnik, Jerzy; Gordon, Steven; Benner, Steven A.

    2013-01-01

    Nucleoside triphosphates having a 3′-ONH2 blocking group have been prepared with and without fluorescent tags on their nucleobases. DNA polymerases were identified that accepted these, adding a single nucleotide to the 3′-end of a primer in a template-directed extension reaction that then stops. Nitrite chemistry was developed to cleave the 3′-ONH2 group under mild conditions to allow continued primer extension. Extension-cleavage-extension cycles in solution were demonstrated with untagged nucleotides and mixtures of tagged and untagged nucleotides. Multiple extension-cleavage-extension cycles were demonstrated on an Intelligent Bio-Systems Sequencer, showing the potential of the 3′-ONH2 blocking group in “next generation sequencing”. PMID:21128174

  2. Reciprocal uniparental disomy in yeast.

    PubMed

    Andersen, Sabrina L; Petes, Thomas D

    2012-06-19

    In the diploid cells of most organisms, including humans, each chromosome is usually distinguishable from its partner homolog by multiple single-nucleotide polymorphisms. One common type of genetic alteration observed in tumor cells is uniparental disomy (UPD), in which a pair of homologous chromosomes are derived from a single parent, resulting in loss of heterozygosity for all single-nucleotide polymorphisms while maintaining diploidy. Somatic UPD events are usually explained as reflecting two consecutive nondisjunction events. Here we report a previously undescribed mode of chromosome segregation in Saccharomyces cerevisiae in which one cell division produces daughter cells with reciprocal UPD for the same pair of chromosomes without an aneuploid intermediate. One pair of sister chromatids is segregated into one daughter cell and the other pair is segregated into the other daughter cell, mimicking a meiotic chromosome segregation pattern. We term this process "reciprocal uniparental disomy."

  3. CGDSNPdb: a database resource for error-checked and imputed mouse SNPs.

    PubMed

    Hutchins, Lucie N; Ding, Yueming; Szatkiewicz, Jin P; Von Smith, Randy; Yang, Hyuna; de Villena, Fernando Pardo-Manuel; Churchill, Gary A; Graber, Joel H

    2010-07-06

    The Center for Genome Dynamics Single Nucleotide Polymorphism Database (CGDSNPdb) is an open-source value-added database with more than nine million mouse single nucleotide polymorphisms (SNPs), drawn from multiple sources, with genotypes assigned to multiple inbred strains of laboratory mice. All SNPs are checked for accuracy and annotated for properties specific to the SNP as well as those implied by changes to overlapping protein-coding genes. CGDSNPdb serves as the primary interface to two unique data sets, the 'imputed genotype resource' in which a Hidden Markov Model was used to assess local haplotypes and the most probable base assignment at several million genomic loci in tens of strains of mice, and the Affymetrix Mouse Diversity Genotyping Array, a high density microarray with over 600,000 SNPs and over 900,000 invariant genomic probes. CGDSNPdb is accessible online through either a web-based query tool or a MySQL public login. Database URL: http://cgd.jax.org/cgdsnpdb/

  4. An omnibus test for family-based association studies with multiple SNPs and multiple phenotypes.

    PubMed

    Lasky-Su, Jessica; Murphy, Amy; McQueen, Matthew B; Weiss, Scott; Lange, Christoph

    2010-06-01

    We propose an omnibus family-based association test (MFBAT) that can be applied to multiple markers and multiple phenotypes and that has only one degree of freedom. The proposed test statistic extends current FBAT methodology to incorporate multiple markers as well as multiple phenotypes. Using simulation studies, power estimates for the proposed methodology are compared with the standard methodologies. On the basis of these simulations, we find that MFBAT substantially outperforms other methods, including haplotypic approaches and doing multiple tests with single single-nucleotide polymorphisms (SNPs) and single phenotypes. The practical relevance of the approach is illustrated by an application to asthma in which SNP/phenotype combinations are identified and reach overall significance that would not have been identified using other approaches. This methodology is directly applicable to cases in which there are multiple SNPs, such as candidate gene studies, cases in which there are multiple phenotypes, such as expression data, and cases in which there are multiple phenotypes and genotypes, such as genome-wide association studies that incorporate expression profiles as phenotypes. This program is available in the PBAT analysis package.

  5. An innovative SNP genotyping method adapting to multiple platforms and throughputs

    USDA-ARS?s Scientific Manuscript database

    Single nucleotide polymorphisms (SNPs) are highly abundant, distributed throughout the genome in various species, and therefore they are widely used as genetic markers. However, the usefulness of this genetic tool relies heavily on the availability of user-friendly SNP genotyping methods. We have d...

  6. Optimal design of low-density SNP arrays for genomic prediction: algorithm and applications

    USDA-ARS?s Scientific Manuscript database

    Low-density (LD) single nucleotide polymorphism (SNP) arrays provide a cost-effective solution for genomic prediction and selection, but algorithms and computational tools are needed for their optimal design. A multiple-objective, local optimization (MOLO) algorithm was developed for design of optim...

  7. Microsatellite Imputation for parental verification from SNP across multiple Bos taurus and indicus breeds

    USDA-ARS?s Scientific Manuscript database

    Microsatellite markers (MS) have traditionally been used for parental verification and are still the international standard in spite of their higher cost, error rate, and turnaround time compared with Single Nucleotide Polymorphisms (SNP)-based assays. Despite domestic and international demands fro...

  8. Pooled genome wide association detects association upstream of FCRL3 with Graves' disease.

    PubMed

    Khong, Jwu Jin; Burdon, Kathryn P; Lu, Yi; Laurie, Kate; Leonardos, Lefta; Baird, Paul N; Sahebjada, Srujana; Walsh, John P; Gajdatsy, Adam; Ebeling, Peter R; Hamblin, Peter Shane; Wong, Rosemary; Forehan, Simon P; Fourlanos, Spiros; Roberts, Anthony P; Doogue, Matthew; Selva, Dinesh; Montgomery, Grant W; Macgregor, Stuart; Craig, Jamie E

    2016-11-18

    Graves' disease is an autoimmune thyroid disease of complex inheritance. Multiple genetic susceptibility loci are thought to be involved in Graves' disease and it is therefore likely that these can be identified by genome wide association studies. This study aimed to determine if a genome wide association study, using a pooling methodology, could detect genomic loci associated with Graves' disease. Nineteen of the top ranking single nucleotide polymorphisms including HLA-DQA1 and C6orf10, were clustered within the Major Histo-compatibility Complex region on chromosome 6p21, with rs1613056 reaching genome wide significance (p = 5 × 10 -8 ). Technical validation of top ranking non-Major Histo-compatablity complex single nucleotide polymorphisms with individual genotyping in the discovery cohort revealed four single nucleotide polymorphisms with p ≤ 10 -4 . Rs17676303 on chromosome 1q23.1, located upstream of FCRL3, showed evidence of association with Graves' disease across the discovery, replication and combined cohorts. A second single nucleotide polymorphism rs9644119 downstream of DPYSL2 showed some evidence of association supported by finding in the replication cohort that warrants further study. Pooled genome wide association study identified a genetic variant upstream of FCRL3 as a susceptibility locus for Graves' disease in addition to those identified in the Major Histo-compatibility Complex. A second locus downstream of DPYSL2 is potentially a novel genetic variant in Graves' disease that requires further confirmation.

  9. Digynic triploidy: utility and challenges of noninvasive prenatal testing

    PubMed Central

    Fleischer, Julie; Shenoy, Archana; Goetzinger, Katherine; Cottrell, Catherine E; Baldridge, Dustin; White, Frances V; Shinawi, Marwan

    2015-01-01

    Key Clinical Message Low fraction fetal DNA in noninvasive prenatal testing in the context of fetal growth restriction and multiple congenital anomalies should alert medical professionals to the possibility of digynic triploidy. Single-nucleotide polymorphism microarray can detect the parental origin of triploidy and explain its mechanism. PMID:26185638

  10. The origin of multiple clones in the parthenogenetic lizard species Darevskia rostombekowi.

    PubMed

    Ryskov, Alexey P; Osipov, Fedor A; Omelchenko, Andrey V; Semyenova, Seraphima K; Girnyk, Anastasiya E; Korchagin, Vitaly I; Vergun, Andrey A; Murphy, Robert W

    2017-01-01

    The all-female Caucasian rock lizard Darevskia rostombekowi and other unisexual species of this genus reproduce normally via true parthenogenesis. Typically, diploid parthenogenetic reptiles exhibit some amount of clonal diversity. However, allozyme data from D. rostombekowi have suggested that this species consists of a single clone. Herein, we test this hypothesis by evaluating variation at three variable microsatellite loci for 42 specimens of D. rostombekowi from four populations in Armenia. Analyses based on single nucleotide polymorphisms of each locus reveal five genotypes or presumptive clones in this species. All individuals are heterozygous at the loci. The major clone occurs in 24 individuals and involves three populations. Four rare clones involve one or several individuals from one or two populations. Most variation owes to parent-specific single nucleotide polymorphisms, which occur as heterozygotes. This result fails to reject the hypothesis of a single hybridization founder event that resulted in the initial formation of one major clone. The other clones appear to have originated via post-formation microsatellite mutations of the major clone.

  11. Makeup of the genetic correlation between milk production traits using genome-wide single nucleotide polymorphism information.

    PubMed

    van Binsbergen, R; Veerkamp, R F; Calus, M P L

    2012-04-01

    The correlated responses between traits may differ depending on the makeup of genetic covariances, and may differ from the predictions of polygenic covariances. Therefore, the objective of the present study was to investigate the makeup of the genetic covariances between the well-studied traits: milk yield, fat yield, protein yield, and their percentages in more detail. Phenotypic records of 1,737 heifers of research farms in 4 different countries were used after homogenizing and adjusting for management effects. All cows had a genotype for 37,590 single nucleotide polymorphisms (SNP). A bayesian stochastic search variable selection model was used to estimate the SNP effects for each trait. About 0.5 to 1.0% of the SNP had a significant effect on 1 or more traits; however, the SNP without a significant effect explained most of the genetic variances and covariances of the traits. Single nucleotide polymorphism correlations differed from the polygenic correlations, but only 10 regions were found with an effect on multiple traits; in 1 of these regions the DGAT1 gene was previously reported with an effect on multiple traits. This region explained up to 41% of the variances of 4 traits and explained a major part of the correlation between fat yield and fat percentage and contributes to asymmetry in correlated response between fat yield and fat percentage. Overall, for the traits in this study, the infinitesimal model is expected to be sufficient for the estimation of the variances and covariances. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  12. The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing.

    PubMed

    Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P; Panitz, Frank; Bendixen, Christian; Nielsen, Rasmus; Willerslev, Eske

    2007-02-14

    The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform) has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR) reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources. We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences). Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis. We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%). Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of comparative genomics, complete mitochondrial analyses, population genetics, and phylogenetics.

  13. Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

    PubMed

    Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

    2012-05-01

    The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

  14. Single nucleotide polymorphism discovery via genotyping by sequencing to assess population genetic structure and recurrent polyploidization in Andropogon gerardii.

    PubMed

    McAllister, Christine A; Miller, Allison J

    2016-07-01

    Autopolyploidy, genome duplication within a single lineage, can result in multiple cytotypes within a species. Geographic distributions of cytotypes may reflect the evolutionary history of autopolyploid formation and subsequent population dynamics including stochastic (drift) and deterministic (differential selection among cytotypes) processes. Here, we used a population genomic approach to investigate whether autopolyploidy occurred once or multiple times in Andropogon gerardii, a widespread, North American grass with two predominant cytotypes. Genotyping by sequencing was used to identify single nucleotide polymorphisms (SNPs) in individuals collected from across the geographic range of A. gerardii. Two independent approaches to SNP calling were used: the reference-free UNEAK pipeline and a reference-guided approach based on the sequenced Sorghum bicolor genome. SNPs generated using these pipelines were analyzed independently with genetic distance and clustering. Analyses of the two SNP data sets showed very similar patterns of population-level clustering of A. gerardii individuals: a cluster of A. gerardii individuals from the southern Plains, a northern Plains cluster, and a western cluster. Groupings of individuals corresponded to geographic localities regardless of cytotype: 6x and 9x individuals from the same geographic area clustered together. SNPs generated using reference-guided and reference-free pipelines in A. gerardii yielded unique subsets of genomic data. Both data sets suggest that the 9x cytotype in A. gerardii likely evolved multiple times from 6x progenitors across the range of the species. Genomic approaches like GBS and diverse bioinformatics pipelines used here facilitate evolutionary analyses of complex systems with multiple ploidy levels. © 2016 Botanical Society of America.

  15. Imputation of microsatellite alleles from dense SNP genotypes for parentage verification across multiple Bos taurus and Bos indicus breeds

    USDA-ARS?s Scientific Manuscript database

    Microsatellite markers (MS) have traditionally been used for parental verification and are still the international standard in spite of their higher cost, error rate, and turnaround time compared with Single Nucleotide Polymorphisms (SNP) -based assays. Despite domestic and international demands fr...

  16. Determination of Metastatic Potential in Breast Tumors by Global Molecular Characterization Using Multiple Modalities

    DTIC Science & Technology

    2010-10-01

    5 Results ...to disease prognosis and in determining the course of treatment for the patient (2) . Breast cancer is a highly heterogeneous and complex disease...progression is a challenge. Introduction of high density single nucleotide polymorphism (SNP) genotyping arrays has helped not only for whole genome

  17. SEAN: SNP prediction and display program utilizing EST sequence clusters.

    PubMed

    Huntley, Derek; Baldo, Angela; Johri, Saurabh; Sergot, Marek

    2006-02-15

    SEAN is an application that predicts single nucleotide polymorphisms (SNPs) using multiple sequence alignments produced from expressed sequence tag (EST) clusters. The algorithm uses rules of sequence identity and SNP abundance to determine the quality of the prediction. A Java viewer is provided to display the EST alignments and predicted SNPs.

  18. ADOMA: A Command Line Tool to Modify ClustalW Multiple Alignment Output.

    PubMed

    Zaal, Dionne; Nota, Benjamin

    2016-01-01

    We present ADOMA, a command line tool that produces alternative outputs from ClustalW multiple alignments of nucleotide or protein sequences. ADOMA can simplify the output of alignments by showing only the different residues between sequences, which is often desirable when only small differences such as single nucleotide polymorphisms are present (e.g., between different alleles). Another feature of ADOMA is that it can enhance the ClustalW output by coloring the residues in the alignment. This tool is easily integrated into automated Linux pipelines for next-generation sequencing data analysis, and may be useful for researchers in a broad range of scientific disciplines including evolutionary biology and biomedical sciences. The source code is freely available at https://sourceforge. net/projects/adoma/. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. An ImmunoChip study of multiple sclerosis risk in African Americans

    PubMed Central

    Isobe, Noriko; Madireddy, Lohith; Khankhanian, Pouya; Matsushita, Takuya; Caillier, Stacy J.; Moré, Jayaji M.; Gourraud, Pierre-Antoine; McCauley, Jacob L.; Beecham, Ashley H.; Piccio, Laura; Herbert, Joseph; Khan, Omar; Cohen, Jeffrey; Stone, Lael; Santaniello, Adam; Cree, Bruce A. C.; Onengut-Gumuscu, Suna; Rich, Stephen S.; Hauser, Stephen L.; Sawcer, Stephen

    2015-01-01

    The aims of this study were: (i) to determine to what degree multiple sclerosis-associated loci discovered in European populations also influence susceptibility in African Americans; (ii) to assess the extent to which the unique linkage disequilibrium patterns in African Americans can contribute to localizing the functionally relevant regions or genes; and (iii) to search for novel African American multiple sclerosis-associated loci. Using the ImmunoChip custom array we genotyped 803 African American cases with multiple sclerosis and 1516 African American control subjects at 130 135 autosomal single nucleotide polymorphisms. We conducted association analysis with rigorous adjustments for population stratification and admixture. Of the 110 non-major histocompatibility complex multiple sclerosis-associated variants identified in Europeans, 96 passed stringent quality control in our African American data set and of these, >70% (69) showed over-representation of the same allele amongst cases, including 21 with nominally significant evidence for association (one-tailed test P < 0.05). At a further eight loci we found nominally significant association with an alternate correlated risk-tagging single nucleotide polymorphism from the same region. Outside the regions known to be associated in Europeans, we found seven potentially associated novel candidate multiple sclerosis variants (P < 10−4), one of which (rs2702180) also showed nominally significant evidence for association (one-tailed test P = 0.034) in an independent second cohort of 620 African American cases and 1565 control subjects. However, none of these novel associations reached genome-wide significance (combined P = 6.3 × 10−5). Our data demonstrate substantial overlap between African American and European multiple sclerosis variants, indicating common genetic contributions to multiple sclerosis risk. PMID:25818868

  20. An ImmunoChip study of multiple sclerosis risk in African Americans.

    PubMed

    Isobe, Noriko; Madireddy, Lohith; Khankhanian, Pouya; Matsushita, Takuya; Caillier, Stacy J; Moré, Jayaji M; Gourraud, Pierre-Antoine; McCauley, Jacob L; Beecham, Ashley H; Piccio, Laura; Herbert, Joseph; Khan, Omar; Cohen, Jeffrey; Stone, Lael; Santaniello, Adam; Cree, Bruce A C; Onengut-Gumuscu, Suna; Rich, Stephen S; Hauser, Stephen L; Sawcer, Stephen; Oksenberg, Jorge R

    2015-06-01

    The aims of this study were: (i) to determine to what degree multiple sclerosis-associated loci discovered in European populations also influence susceptibility in African Americans; (ii) to assess the extent to which the unique linkage disequilibrium patterns in African Americans can contribute to localizing the functionally relevant regions or genes; and (iii) to search for novel African American multiple sclerosis-associated loci. Using the ImmunoChip custom array we genotyped 803 African American cases with multiple sclerosis and 1516 African American control subjects at 130 135 autosomal single nucleotide polymorphisms. We conducted association analysis with rigorous adjustments for population stratification and admixture. Of the 110 non-major histocompatibility complex multiple sclerosis-associated variants identified in Europeans, 96 passed stringent quality control in our African American data set and of these, >70% (69) showed over-representation of the same allele amongst cases, including 21 with nominally significant evidence for association (one-tailed test P < 0.05). At a further eight loci we found nominally significant association with an alternate correlated risk-tagging single nucleotide polymorphism from the same region. Outside the regions known to be associated in Europeans, we found seven potentially associated novel candidate multiple sclerosis variants (P < 10(-4)), one of which (rs2702180) also showed nominally significant evidence for association (one-tailed test P = 0.034) in an independent second cohort of 620 African American cases and 1565 control subjects. However, none of these novel associations reached genome-wide significance (combined P = 6.3 × 10(-5)). Our data demonstrate substantial overlap between African American and European multiple sclerosis variants, indicating common genetic contributions to multiple sclerosis risk. © The Author (2015). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  1. Generalization of Associations of Kidney-Related Genetic Loci to American Indians

    PubMed Central

    Haack, Karin; Almasy, Laura; Laston, Sandra; Lee, Elisa T.; Best, Lyle G.; Fabsitz, Richard R.; MacCluer, Jean W.; Howard, Barbara V.; Umans, Jason G.; Cole, Shelley A.

    2014-01-01

    Summary Background and objectives CKD disproportionally affects American Indians, who similar to other populations, show genetic susceptibility to kidney outcomes. Recent studies have identified several loci associated with kidney traits, but their relevance in American Indians is unknown. Design, setting, participants, & measurements This study used data from a large, family-based genetic study of American Indians (the Strong Heart Family Study), which includes 94 multigenerational families enrolled from communities located in Oklahoma, the Dakotas, and Arizona. Individuals were recruited from the Strong Heart Study, a population-based study of cardiovascular disease in American Indians. This study selected 25 single nucleotide polymorphisms in 23 loci identified from recently published kidney-related genome-wide association studies in individuals of European ancestry to evaluate their associations with kidney function (estimated GFR; individuals 18 years or older, up to 3282 individuals) and albuminuria (urinary albumin to creatinine ratio; n=3552) in the Strong Heart Family Study. This study also examined the association of single nucleotide polymorphisms in the APOL1 region with estimated GFR in 1121 Strong Heart Family Study participants. GFR was estimated using the abbreviated Modification of Diet in Renal Disease Equation. Additive genetic models adjusted for age and sex were used. Results This study identified significant associations of single nucleotide polymorphisms with estimated GFR in or nearby PRKAG2, SLC6A13, UBE2Q2, PIP5K1B, and WDR72 (P<2.1 × 10-3 to account for multiple testing). Single nucleotide polymorphisms in these loci explained 2.2% of the estimated GFR total variance and 2.9% of its heritability. An intronic variant of BCAS3 was significantly associated with urinary albumin to creatinine ratio. APOL1 single nucleotide polymorphisms were not associated with estimated GFR in a single variant test or haplotype analyses, and the at-risk variants identified in individuals with African ancestry were not detected in DNA sequencing of American Indians. Conclusion This study extends the genetic associations of loci affecting kidney function to American Indians, a population at high risk of kidney disease, and provides additional support for a potential biologic relevance of these loci across ancestries. PMID:24311711

  2. Single nucleotide polymorphism-specific regulation of matrix metalloproteinase-9 by multiple miRNAs targeting the coding exon

    PubMed Central

    Duellman, Tyler; Warren, Christopher; Yang, Jay

    2014-01-01

    Microribonucleic acids (miRNAs) work with exquisite specificity and are able to distinguish a target from a non-target based on a single nucleotide mismatch in the core nucleotide domain. We questioned whether miRNA regulation of gene expression could occur in a single nucleotide polymorphism (SNP)-specific manner, manifesting as a post-transcriptional control of expression of genetic polymorphisms. In our recent study of the functional consequences of matrix metalloproteinase (MMP)-9 SNPs, we discovered that expression of a coding exon SNP in the pro-domain of the protein resulted in a profound decrease in the secreted protein. This missense SNP results in the N38S amino acid change and a loss of an N-glycosylation site. A systematic study demonstrated that the loss of secreted protein was due not to the loss of an N-glycosylation site, but rather an SNP-specific targeting by miR-671-3p and miR-657. Bioinformatics analysis identified 41 SNP-specific miRNA targeting MMP-9 SNPs, mostly in the coding exon and an extension of the analysis to chromosome 20, where the MMP-9 gene is located, suggesting that SNP-specific miRNAs targeting the coding exon are prevalent. This selective post-transcriptional regulation of a target messenger RNA harboring genetic polymorphisms by miRNAs offers an SNP-dependent post-transcriptional regulatory mechanism, allowing for polymorphic-specific differential gene regulation. PMID:24627221

  3. Differential effects of chromosome 9p21 variation on subphenotypes of intracranial aneurysm: site distribution.

    PubMed

    Nakaoka, Hirofumi; Takahashi, Tomoko; Akiyama, Koichi; Cui, Tailin; Tajima, Atsushi; Krischek, Boris; Kasuya, Hidetoshi; Hata, Akira; Inoue, Ituro

    2010-08-01

    Recently, a genome-wide association study identified associations between single nucleotide polymorphisms on chromosome 9p21 and risk of harboring intracranial aneurysm (IA). Aneurysm characteristics or subphenotypes of IAs, such as history of subarachnoid hemorrhage, presence of multiple IAs and location of IAs, are clinically important. We investigated whether the association between 9p21 variation and risk of IA varied among these subphenotypes. We conducted a case-control study of 981 cases and 699 controls in Japanese. Four single nucleotide polymorphisms tagging the 9p21 risk locus were genotyped. The OR and 95% CI were estimated using logistic regression analyses. Among the 4 single nucleotide polymorphisms, rs1333040 showed the strongest evidence of association with IA (P=1.5x10(-6); per allele OR, 1.43; 95% CI, 1.24-1.66). None of the patient characteristics (gender, age, smoking, and hypertension) was a significant confounder or effect modifier of the association. Subgroup analyses of IA subphenotypes showed that among the most common sites of IAs, the association was strongest for IAs of the posterior communicating artery (OR, 1.69; 95% CI, 1.26-2.26) and not significant for IAs in the anterior communicating artery (OR, 1.22; 95% CI, 0.96-1.57). When dichotomizing IA sites, the association was stronger for IAs of the posterior circulation-posterior communicating artery group (OR, 1.73; 95% CI, 1.32-2.26) vs the anterior circulation group (OR, 1.28; 95% CI, 1.07-1.53). Heterogeneity in these ORs was significant (P=0.032). The associations did not vary when stratifying by history of subarachnoid hemorrhage (OR, 1.42; 95% CI, 1.18-1.71 for ruptured IA; OR, 1.27; 95% CI, 1.00-1.62 for unruptured IA) or by multiplicity of IA (OR, 1.57; 95% CI, 1.21-2.03 for multiple IAs; OR, 1.36; 95% CI, 1.15-1.61 for single IA). Our results suggest that genetic influence on formation may vary between IA subphenotypes.

  4. Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

    PubMed

    Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

    2017-11-28

    Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

  5. Defining the mRNA recognition signature of a bacterial toxin protein

    DOE PAGES

    Schureck, Marc A.; Dunkle, Jack A.; Maehigashi, Tatsuya; ...

    2015-10-27

    Bacteria contain multiple type II toxins that selectively degrade mRNAs bound to the ribosome to regulate translation and growth and facilitate survival during the stringent response. Ribosome-dependent toxins recognize a variety of three-nucleotide codons within the aminoacyl (A) site, but how these endonucleases achieve substrate specificity remains poorly understood. In this paper, we identify the critical features for how the host inhibition of growth B (HigB) toxin recognizes each of the three A-site nucleotides for cleavage. X-ray crystal structures of HigB bound to two different codons on the ribosome illustrate how HigB uses a microbial RNase-like nucleotide recognition loop tomore » recognize either cytosine or adenosine at the second A-site position. Strikingly, a single HigB residue and 16S rRNA residue C1054 form an adenosine-specific pocket at the third A-site nucleotide, in contrast to how tRNAs decode mRNA. Finally, our results demonstrate that the most important determinant for mRNA cleavage by ribosome-dependent toxins is interaction with the third A-site nucleotide.« less

  6. Defining the mRNA recognition signature of a bacterial toxin protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schureck, Marc A.; Dunkle, Jack A.; Maehigashi, Tatsuya

    Bacteria contain multiple type II toxins that selectively degrade mRNAs bound to the ribosome to regulate translation and growth and facilitate survival during the stringent response. Ribosome-dependent toxins recognize a variety of three-nucleotide codons within the aminoacyl (A) site, but how these endonucleases achieve substrate specificity remains poorly understood. In this paper, we identify the critical features for how the host inhibition of growth B (HigB) toxin recognizes each of the three A-site nucleotides for cleavage. X-ray crystal structures of HigB bound to two different codons on the ribosome illustrate how HigB uses a microbial RNase-like nucleotide recognition loop tomore » recognize either cytosine or adenosine at the second A-site position. Strikingly, a single HigB residue and 16S rRNA residue C1054 form an adenosine-specific pocket at the third A-site nucleotide, in contrast to how tRNAs decode mRNA. Finally, our results demonstrate that the most important determinant for mRNA cleavage by ribosome-dependent toxins is interaction with the third A-site nucleotide.« less

  7. Genome amplification of single sperm using multiple displacement amplification.

    PubMed

    Jiang, Zhengwen; Zhang, Xingqi; Deka, Ranjan; Jin, Li

    2005-06-07

    Sperm typing is an effective way to study recombination rate on a fine scale in regions of interest. There are two strategies for the amplification of single meiotic recombinants: repulsion-phase allele-specific PCR and whole genome amplification (WGA). The former can selectively amplify single recombinant molecules from a batch of sperm but is not scalable for high-throughput operation. Currently, primer extension pre-amplification is the only method used in WGA of single sperm, whereas it has limited capacity to produce high-coverage products enough for the analysis of local recombination rate in multiple large regions. Here, we applied for the first time a recently developed WGA method, multiple displacement amplification (MDA), to amplify single sperm DNA, and demonstrated its great potential for producing high-yield and high-coverage products. In a 50 mul reaction, 76 or 93% of loci can be amplified at least 2500- or 250-fold, respectively, from single sperm DNA, and second-round MDA can further offer >200-fold amplification. The MDA products are usable for a variety of genetic applications, including sequencing and microsatellite marker and single nucleotide polymorphism (SNP) analysis. The use of MDA in single sperm amplification may open a new era for studies on local recombination rates.

  8. Identification and validation of single nucleotide polymorphic markers linked to Ug99 stem rust resistance in spring wheat

    USDA-ARS?s Scientific Manuscript database

    Wheat stem rust (Puccinia graminis f. sp. tritici Eriks. and E. Henn.) is one of the most destructive diseases world-wide. Races belonging to Ug99 (or TTKSK) continue to cause crop losses in East Africa and threaten global wheat production. Developing and deploying wheat varieties with multiple race...

  9. Exploring genetic variants predisposing to diabetes mellitus and their association with indicators of socioeconomic status.

    PubMed

    Schmidt, Börge; Dragano, Nico; Scherag, André; Pechlivanis, Sonali; Hoffmann, Per; Nöthen, Markus M; Erbel, Raimund; Jöckel, Karl-Heinz; Moebus, Susanne

    2014-06-16

    The relevance of disease-related genetic variants for the explanation of social inequalities in complex diseases is unclear and empirical analyses are largely missing. The aim of our study was to examine whether genetic variants predisposing to diabetes mellitus are associated with socioeconomic status in a population-based cohort. We genotyped 11 selected diabetes-related single nucleotide polymorphisms in 4655 participants (age 45-75 years) of the Heinz Nixdorf Recall study. Diabetes status was self-reported or defined by blood glucose levels. Education, income and paternal occupation were assessed as indicators of socioeconomic status. Multiple regression analyses were used to examine the association of socioeconomic status and diabetes by estimating sex-specific and age-adjusted prevalence ratios and their corresponding 95%-confidence intervals. To explore the relationship between individual single nucleotide polymorphisms and socioeconomic status sex- and age-adjusted odds ratios were computed. We adjusted the alpha-level for multiple testing of 11 single nucleotide polymorphisms using Bonferroni's method (α(BF) ~ 0.005). In addition, we explored the association of a genetic risk score with socioeconomic status. Social inequalities in diabetes were observed for all indicators of socioeconomic status. However, there were no significant associations between individual diabetes-related risk alleles and socioeconomic status with odds ratios ranging from 0.87 to 1.23. Similarly, the genetic risk score analysis revealed no evidence for an association. Our data provide no evidence for an association between 11 diabetes-related risk alleles and different indicators of socioeconomic status in a population-based cohort, suggesting that the explored genetic variants do not contribute to health inequalities in diabetes.

  10. A Novel Center Star Multiple Sequence Alignment Algorithm Based on Affine Gap Penalty and K-Band

    NASA Astrophysics Data System (ADS)

    Zou, Quan; Shan, Xiao; Jiang, Yi

    Multiple sequence alignment is one of the most important topics in computational biology, but it cannot deal with the large data so far. As the development of copy-number variant(CNV) and Single Nucleotide Polymorphisms(SNP) research, many researchers want to align numbers of similar sequences for detecting CNV and SNP. In this paper, we propose a novel multiple sequence alignment algorithm based on affine gap penalty and k-band. It can align more quickly and accurately, that will be helpful for mining CNV and SNP. Experiments prove the performance of our algorithm.

  11. Association of α-, β-, and γ-Synuclein With Diffuse Lewy Body Disease

    PubMed Central

    Nishioka, Kenya; Wider, Christian; Vilariño-Güell, Carles; Soto-Ortolaza, Alexandra I.; Lincoln, Sarah J.; Kachergus, Jennifer M.; Jasinska-Myga, Barbara; Ross, Owen A.; Rajput, Alex; Robinson, Christopher A.; Ferman, Tanis J.; Wszolek, Zbigniew K.; Dickson, Dennis W.; Farrer, Matthew J.

    2016-01-01

    Objective To determine the association of the genes that encode α-, β-, and γ-synuclein (SNCA, SNCB, and SNCG, respectively) with diffuse Lewy body disease (DLBD). Design Case-control study. Subjects A total of 172 patients with DLBD consistent with a clinical diagnosis of Parkinson disease dementia/dementia with Lewy bodies and 350 clinically and 97 pathologically normal controls. Interventions Sequencing of SNCA, SNCB, and SNCG and genotyping of single-nucleotide polymorphisms performed on an Applied Biosystems capillary sequencer and a Sequenom MassArray pLEX platform, respectively. Associations were determined using χ2 or Fisher exact tests. Results Initial sequencing studies of the coding regions of each gene in 89 patients with DLBD did not detect any pathogenic substitutions. Nevertheless, genotyping of known polymorphic variability in sequence-conserved regions detected several single-nucleotide polymorphisms in the SNCA and SNCG genes that were significantly associated with disease (P=.05 to <.001). Significant association was also observed for 3 single-nucleotide polymorphisms located in SNCB when comparing DLBD cases and pathologically confirmed normal controls (P=.03-.01); however, this association was not significant for the clinical controls alone or the combined clinical and pathological controls (P>.05). After correction for multiple testing, only 1 single-nucleotide polymorphism in SNCG (rs3750823) remained significant in all of the analyses (P=.05-.009). Conclusion These findings suggest that variants in all 3 members of the synuclein gene family, particularly SNCA and SNCG, affect the risk of developing DLBD and warrant further investigation in larger, pathologically defined data sets as well as clinically diagnosed Parkinson disease/dementia with Lewy bodies case-control series. PMID:20697047

  12. Analysis of Genome-Wide Association Studies with Multiple Outcomes Using Penalization

    PubMed Central

    Liu, Jin; Huang, Jian; Ma, Shuangge

    2012-01-01

    Genome-wide association studies have been extensively conducted, searching for markers for biologically meaningful outcomes and phenotypes. Penalization methods have been adopted in the analysis of the joint effects of a large number of SNPs (single nucleotide polymorphisms) and marker identification. This study is partly motivated by the analysis of heterogeneous stock mice dataset, in which multiple correlated phenotypes and a large number of SNPs are available. Existing penalization methods designed to analyze a single response variable cannot accommodate the correlation among multiple response variables. With multiple response variables sharing the same set of markers, joint modeling is first employed to accommodate the correlation. The group Lasso approach is adopted to select markers associated with all the outcome variables. An efficient computational algorithm is developed. Simulation study and analysis of the heterogeneous stock mice dataset show that the proposed method can outperform existing penalization methods. PMID:23272092

  13. Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing.

    PubMed

    Conway, Tyrrell; Creecy, James P; Maddox, Scott M; Grissom, Joe E; Conkle, Trevor L; Shadid, Tyler M; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada; Wanner, Barry L

    2014-07-08

    We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. Importance: We precisely mapped the 5' and 3' ends of RNA transcripts across the E. coli K-12 genome by using a single-nucleotide analytical approach. Our resulting high-resolution transcriptome maps show that ca. one-third of E. coli operons are complex, with internal promoters and terminators generating multiple transcription units and allowing differential gene expression within these operons. We discovered extensive antisense transcription that results from more than 500 operons, which fully overlap or extensively overlap adjacent divergent or convergent operons. The genomic regions corresponding to these antisense transcripts are highly conserved in E. coli (including Shigella species), although it remains to be proven whether or not they are functional. Our observations of features unearthed by single-nucleotide transcriptome mapping suggest that deeper layers of transcriptional regulation in bacteria are likely to be revealed in the future. Copyright © 2014 Conway et al.

  14. Multiplexed resequencing analysis to identify rare variants in pooled DNA with barcode indexing using next-generation sequencer.

    PubMed

    Mitsui, Jun; Fukuda, Yoko; Azuma, Kyo; Tozaki, Hirokazu; Ishiura, Hiroyuki; Takahashi, Yuji; Goto, Jun; Tsuji, Shoji

    2010-07-01

    We have recently found that multiple rare variants of the glucocerebrosidase gene (GBA) confer a robust risk for Parkinson disease, supporting the 'common disease-multiple rare variants' hypothesis. To develop an efficient method of identifying rare variants in a large number of samples, we applied multiplexed resequencing using a next-generation sequencer to identification of rare variants of GBA. Sixteen sets of pooled DNAs from six pooled DNA samples were prepared. Each set of pooled DNAs was subjected to polymerase chain reaction to amplify the target gene (GBA) covering 6.5 kb, pooled into one tube with barcode indexing, and then subjected to extensive sequence analysis using the SOLiD System. Individual samples were also subjected to direct nucleotide sequence analysis. With the optimization of data processing, we were able to extract all the variants from 96 samples with acceptable rates of false-positive single-nucleotide variants.

  15. Single Color Multiplexed ddPCR Copy Number Measurements and Single Nucleotide Variant Genotyping.

    PubMed

    Wood-Bouwens, Christina M; Ji, Hanlee P

    2018-01-01

    Droplet digital PCR (ddPCR) allows for accurate quantification of genetic events such as copy number variation and single nucleotide variants. Probe-based assays represent the current "gold-standard" for detection and quantification of these genetic events. Here, we introduce a cost-effective single color ddPCR assay that allows for single genome resolution quantification of copy number and single nucleotide variation.

  16. No Association between Oxytocin Receptor (OXTR) Gene Polymorphisms and Experimentally Elicited Social Preferences

    PubMed Central

    Apicella, Coren L.; Cesarini, David; Johannesson, Magnus; Dawes, Christopher T.; Lichtenstein, Paul; Wallace, Björn; Beauchamp, Jonathan; Westberg, Lars

    2010-01-01

    Background Oxytocin (OXT) has been implicated in a suite of complex social behaviors including observed choices in economic laboratory experiments. However, actual studies of associations between oxytocin receptor (OXTR) gene variants and experimentally elicited social preferences are rare. Methodology/Principal Findings We test hypotheses of associations between social preferences, as measured by behavior in two economic games, and 9 single nucleotide polymorphisms (SNPs) of the OXTR gene in a sample of Swedish twins (n = 684). Two standard economic games, the dictator game and the trust game, both involving real monetary consequences, were used to elicit such preferences. After correction for multiple hypothesis testing, we found no significant associations between any of the 9 single nucleotide polymorphisms (SNPs) and behavior in either of the games. Conclusion We were unable to replicate the most significant association reported in previous research between the amount donated in a dictator game and an OXTR genetic variant. PMID:20585395

  17. No association between oxytocin receptor (OXTR) gene polymorphisms and experimentally elicited social preferences.

    PubMed

    Apicella, Coren L; Cesarini, David; Johannesson, Magnus; Dawes, Christopher T; Lichtenstein, Paul; Wallace, Björn; Beauchamp, Jonathan; Westberg, Lars

    2010-06-16

    Oxytocin (OXT) has been implicated in a suite of complex social behaviors including observed choices in economic laboratory experiments. However, actual studies of associations between oxytocin receptor (OXTR) gene variants and experimentally elicited social preferences are rare. We test hypotheses of associations between social preferences, as measured by behavior in two economic games, and 9 single nucleotide polymorphisms (SNPs) of the OXTR gene in a sample of Swedish twins (n = 684). Two standard economic games, the dictator game and the trust game, both involving real monetary consequences, were used to elicit such preferences. After correction for multiple hypothesis testing, we found no significant associations between any of the 9 single nucleotide polymorphisms (SNPs) and behavior in either of the games. We were unable to replicate the most significant association reported in previous research between the amount donated in a dictator game and an OXTR genetic variant.

  18. Pre-Steady-State Kinetic Analysis of Single-Nucleotide Incorporation by DNA Polymerases

    PubMed Central

    Su, Yan; Guengerich, F. Peter

    2016-01-01

    Pre-steady-state kinetic analysis is a powerful and widely used method to obtain multiple kinetic parameters. This protocol provides a step-by-step procedure for pre-steady-state kinetic analysis of single-nucleotide incorporation by a DNA polymerase. It describes the experimental details of DNA substrate annealing, reaction mixture preparation, handling of the RQF-3 rapid quench-flow instrument, denaturing polyacrylamide DNA gel preparation, electrophoresis, quantitation, and data analysis. The core and unique part of this protocol is the rationale for preparation of the reaction mixture (the ratio of the polymerase to the DNA substrate) and methods for conducting pre-steady-state assays on an RQF-3 rapid quench-flow instrument, as well as data interpretation after analysis. In addition, the methods for the DNA substrate annealing and DNA polyacrylamide gel preparation, electrophoresis, quantitation and analysis are suitable for use in other studies. PMID:27248785

  19. Single nucleotide polymorphisms associated with coronary heart disease predict incident ischemic stroke in the atherosclerosis risk in communities study.

    PubMed

    Morrison, Alanna C; Bare, Lance A; Luke, May M; Pankow, James S; Mosley, Thomas H; Devlin, James J; Willerson, James T; Boerwinkle, Eric

    2008-01-01

    Ischemic stroke and coronary heart disease (CHD) may share genetic factors contributing to a common etiology. This study investigates whether 51 single nucleotide polymorphisms (SNPs) associated with CHD in multiple antecedent studies are associated with incident ischemic stroke in the Atherosclerosis Risk in Communities (ARIC) study. From the multiethnic ARIC cohort of 14,215 individuals, 495 validated ischemic strokes were identified. Cox proportional hazards models, adjusted for age and gender, identified three SNPs in Whites and two SNPs in Blacks associated with incident stroke (p

  20. Conformational rearrangements in the transmembrane domain of CNGA1 channels revealed by single-molecule force spectroscopy

    NASA Astrophysics Data System (ADS)

    Maity, Sourav; Mazzolini, Monica; Arcangeletti, Manuel; Valbuena, Alejandro; Fabris, Paolo; Lazzarino, Marco; Torre, Vincent

    2015-05-01

    Cyclic nucleotide-gated (CNG) channels are activated by binding of cyclic nucleotides. Although structural studies have identified the channel pore and selectivity filter, conformation changes associated with gating remain poorly understood. Here we combine single-molecule force spectroscopy (SMFS) with mutagenesis, bioinformatics and electrophysiology to study conformational changes associated with gating. By expressing functional channels with SMFS fingerprints in Xenopus laevis oocytes, we were able to investigate gating of CNGA1 in a physiological-like membrane. Force spectra determined that the S4 transmembrane domain is mechanically coupled to S5 in the closed state, but S3 in the open state. We also show there are multiple pathways for the unfolding of the transmembrane domains, probably caused by a different degree of α-helix folding. This approach demonstrates that CNG transmembrane domains have dynamic structure and establishes SMFS as a tool for probing conformational change in ion channels.

  1. Sequence polymorphism data of the hypervariable regions of mitochondrial DNA in the Yadav population of Haryana.

    PubMed

    Verma, Kapil; Sharma, Sapna; Sharma, Arun; Dalal, Jyoti; Bhardwaj, Tapeshwar

    2018-06-01

    Genetic variations among humans occur both within and among populations and range from single nucleotide changes to multiple-nucleotide variants. These multiple-nucleotide variants are useful for studying the relationships among individuals or various population groups. The study of human genetic variations can help scientists understand how different population groups are biologically related to one another. Sequence analysis of hypervariable regions of human mitochondrial DNA (mtDNA) has been successfully used for the genetic characterization of different population groups for forensic purposes. It is well established that different ethnic or population groups differ significantly in their mtDNA distributions. In the last decade, very little research has been conducted on mtDNA variations in the Indian population, although such data would be useful for elucidating the history of human population expansion across the world. Moreover, forensic studies on mtDNA variations in the Indian subcontinent are also scarce, particularly in the northern part of India. In this report, variations in the hypervariable regions of mtDNA were analyzed in the Yadav population of Haryana. Different molecular diversity indices were computed. Further, the obtained haplotypes were classified into different haplogroups and the phylogenetic relationship between different haplogroups was inferred.

  2. Multiple-strand displacement and identification of single nucleotide polymorphisms as markers of genotypic variation of Pasteuria penetrans biotypes infecting root-knot nematodes.

    PubMed

    Nong, Guang; Chow, Virginia; Schmidt, Liesbeth M; Dickson, Don W; Preston, James F

    2007-08-01

    Pasteuria species are endospore-forming obligate bacterial parasites of soil-inhabiting nematodes and water-inhabiting cladocerans, e.g. water fleas, and are closely related to Bacillus spp. by 16S rRNA gene sequence. As naturally occurring bacteria, biotypes of Pasteuria penetrans are attractive candidates for the biocontrol of various Meloidogyne spp. (root-knot nematodes). Failure to culture these bacteria outside their hosts has prevented isolation of genomic DNA in quantities sufficient for identification of genes associated with host recognition and virulence. We have applied multiple-strand displacement amplification (MDA) to generate DNA for comparative genomics of biotypes exhibiting different host preferences. Using the genome of Bacillus subtilis as a paradigm, MDA allowed quantitative detection and sequencing of 12 marker genes from 2000 cells. Meloidogyne spp. infected with P. penetrans P20 or B4 contained single nucleotide polymorphisms (SNPs) in the spoIIAB gene that did not change the amino acid sequence, or that substituted amino acids with similar chemical properties. Individual nematodes infected with P. penetrans P20 or B4 contained SNPs in the spoIIAB gene sequenced in MDA-generated products. Detection of SNPs in the spoIIAB gene in a nematode indicates infection by more than one genotype, supporting the need to sequence genomes of Pasteuria spp. derived from single spore isolates.

  3. Joint Identification of Genetic Variants for Physical Activity in Korean Population

    PubMed Central

    Kim, Jayoun; Kim, Jaehee; Min, Haesook; Oh, Sohee; Kim, Yeonjung; Lee, Andy H.; Park, Taesung

    2014-01-01

    There has been limited research on genome-wide association with physical activity (PA). This study ascertained genetic associations between PA and 344,893 single nucleotide polymorphism (SNP) markers in 8842 Korean samples. PA data were obtained from a validated questionnaire that included information on PA intensity and duration. Metabolic equivalent of tasks were calculated to estimate the total daily PA level for each individual. In addition to single- and multiple-SNP association tests, a pathway enrichment analysis was performed to identify the biological significance of SNP markers. Although no significant SNP was found at genome-wide significance level via single-SNP association tests, 59 genetic variants mapped to 76 genes were identified via a multiple SNP approach using a bootstrap selection stability measure. Pathway analysis for these 59 variants showed that maturity onset diabetes of the young (MODY) was enriched. Joint identification of SNPs could enable the identification of multiple SNPs with good predictive power for PA and a pathway enriched for PA. PMID:25026172

  4. Multiple testing and power calculations in genetic association studies.

    PubMed

    So, Hon-Cheong; Sham, Pak C

    2011-01-01

    Modern genetic association studies typically involve multiple single-nucleotide polymorphisms (SNPs) and/or multiple genes. With the development of high-throughput genotyping technologies and the reduction in genotyping cost, investigators can now assay up to a million SNPs for direct or indirect association with disease phenotypes. In addition, some studies involve multiple disease or related phenotypes and use multiple methods of statistical analysis. The combination of multiple genetic loci, multiple phenotypes, and multiple methods of evaluating associations between genotype and phenotype means that modern genetic studies often involve the testing of an enormous number of hypotheses. When multiple hypothesis tests are performed in a study, there is a risk of inflation of the type I error rate (i.e., the chance of falsely claiming an association when there is none). Several methods for multiple-testing correction are in popular use, and they all have strengths and weaknesses. Because no single method is universally adopted or always appropriate, it is important to understand the principles, strengths, and weaknesses of the methods so that they can be applied appropriately in practice. In this article, we review the three principle methods for multiple-testing correction and provide guidance for calculating statistical power.

  5. A single nucleotide mutation in Nppc is associated with a long bone abnormality in lbab mice.

    PubMed

    Jiao, Yan; Yan, Jian; Jiao, Feng; Yang, Hongbin; Donahue, Leah Rae; Li, Xinmin; Roe, Bruce A; Stuart, John; Gu, Weikuan

    2007-04-17

    The long bone abnormality (lbab) mouse is a new autosomal recessive mutant characterized by overall smaller body size with proportionate dwarfing of all organs and shorter long bones. Previous linkage analysis has located the lbab mutation on chromosome 1 between the markers D1Mit9 and D1Mit488. A genome-based positional approach was used to identify a mutation associated with lbab disease. A total of 122 genes and expressed sequence tags at the lbab region were screened for possible mutation by using genomic DNA from lbabl/lbab, lbab/+, and +/+ B6 mice and high throughput temperature gradient capillary electrophoresis. A sequence difference was identified in one of the amplicons of gene Nppc between lbab/lbab and +/+ mice. One-step reverse transcriptase polymerase chain reaction was performed to validate the difference of Nppc in different types of mice at the mRNA level. The mutation of Nppc was unique in lbab/lbab mice among multiple mouse inbred strains. The mutation of Nppc is co-segregated with lbab disease in 200 progenies produced from heterozygous lbab/+ parents. A single nucleotide mutation of Nppc is associated with dwarfism in lbab/lbab mice. Current genome information and technology allow us to efficiently identify single nucleotide mutations from roughly mapped disease loci. The lbab mouse is a useful model for hereditary human achondroplasia.

  6. A single nucleotide mutation in Nppc is associated with a long bone abnormality in lbab mice

    PubMed Central

    Jiao, Yan; Yan, Jian; Jiao, Feng; Yang, HongBin; Donahue, Leah Rae; Li, Xinmin; Roe, Bruce A; Stuart, John; Gu, Weikuan

    2007-01-01

    Background The long bone abnormality (lbab) mouse is a new autosomal recessive mutant characterized by overall smaller body size with proportionate dwarfing of all organs and shorter long bones. Previous linkage analysis has located the lbab mutation on chromosome 1 between the markers D1Mit9 and D1Mit488. Results A genome-based positional approach was used to identify a mutation associated with lbab disease. A total of 122 genes and expressed sequence tags at the lbab region were screened for possible mutation by using genomic DNA from lbabl/lbab, lbab/+, and +/+ B6 mice and high throughput temperature gradient capillary electrophoresis. A sequence difference was identified in one of the amplicons of gene Nppc between lbab/lbab and +/+ mice. One-step reverse transcriptase polymerase chain reaction was performed to validate the difference of Nppc in different types of mice at the mRNA level. The mutation of Nppc was unique in lbab/lbab mice among multiple mouse inbred strains. The mutation of Nppc is co-segregated with lbab disease in 200 progenies produced from heterozygous lbab/+ parents. Conclusion A single nucleotide mutation of Nppc is associated with dwarfism in lbab/lbab mice. Current genome information and technology allow us to efficiently identify single nucleotide mutations from roughly mapped disease loci. The lbab mouse is a useful model for hereditary human achondroplasia. PMID:17439653

  7. Associations between single nucleotide polymorphisms in multiple candidate genes and body weight in rabbits

    PubMed Central

    El-Sabrout, Karim; Aggag, Sarah A.

    2017-01-01

    Aim: In this study, we examined parts of six growth genes (growth hormone [GH], melanocortin 4 receptor [MC4R], growth hormone receptor [GHR], phosphorglycerate mutase [PGAM], myostatin [MSTN], and fibroblast growth factor [FGF]) as specific primers for two rabbit lines (V-line, Alexandria) using nucleotide sequence analysis, to investigate association between detecting single nucleotide polymorphism (SNP) of these genes and body weight (BW) at market. Materials and Methods: Each line kits were grouped into high and low weight rabbits to identify DNA markers useful for association studies with high BW. DNA from blood samples of each group was extracted to amplify the six growth genes. SNP technique was used to study the associate polymorphism in the six growth genes and marketing BW (at 63 days) in the two rabbit lines. The purified polymerase chain reaction products were sequenced in those had the highest and lowest BW in each line. Results: Alignment of sequence data from each group revealed the following SNPs: At nucleotide 23 (A-C) and nucleotide 35 (T-G) in MC4R gene (sense mutation) of Alexandria and V-line high BW. Furthermore, we detected the following SNPs variation between the two lines: A SNP (T-C) at nucleotide 27 was identified by MC4R gene (sense mutation) and another one (A-C) at nucleotide 14 was identified by GHR gene (nonsense mutation) of Alexandria line. The results of individual BW at market (63 days) indicated that Alexandria rabbits had significantly higher BW compared with V-line rabbits. MC4R polymorphism showed significant association with high BW in rabbits. Conclusion: The results of polymorphism demonstrate the possibility to detect an association between BW in rabbits and the efficiency of the used primers to predict through the genetic specificity using the SNP of MC4R. PMID:28246458

  8. Fluorescence In situ Hybridization: Cell-Based Genetic Diagnostic and Research Applications.

    PubMed

    Cui, Chenghua; Shu, Wei; Li, Peining

    2016-01-01

    Fluorescence in situ hybridization (FISH) is a macromolecule recognition technology based on the complementary nature of DNA or DNA/RNA double strands. Selected DNA strands incorporated with fluorophore-coupled nucleotides can be used as probes to hybridize onto the complementary sequences in tested cells and tissues and then visualized through a fluorescence microscope or an imaging system. This technology was initially developed as a physical mapping tool to delineate genes within chromosomes. Its high analytical resolution to a single gene level and high sensitivity and specificity enabled an immediate application for genetic diagnosis of constitutional common aneuploidies, microdeletion/microduplication syndromes, and subtelomeric rearrangements. FISH tests using panels of gene-specific probes for somatic recurrent losses, gains, and translocations have been routinely applied for hematologic and solid tumors and are one of the fastest-growing areas in cancer diagnosis. FISH has also been used to detect infectious microbias and parasites like malaria in human blood cells. Recent advances in FISH technology involve various methods for improving probe labeling efficiency and the use of super resolution imaging systems for direct visualization of intra-nuclear chromosomal organization and profiling of RNA transcription in single cells. Cas9-mediated FISH (CASFISH) allowed in situ labeling of repetitive sequences and single-copy sequences without the disruption of nuclear genomic organization in fixed or living cells. Using oligopaint-FISH and super-resolution imaging enabled in situ visualization of chromosome haplotypes from differentially specified single-nucleotide polymorphism loci. Single molecule RNA FISH (smRNA-FISH) using combinatorial labeling or sequential barcoding by multiple round of hybridization were applied to measure mRNA expression of multiple genes within single cells. Research applications of these single molecule single cells DNA and RNA FISH techniques have visualized intra-nuclear genomic structure and sub-cellular transcriptional dynamics of many genes and revealed their functions in various biological processes.

  9. Association between Single Nucleotide Polymorphisms of the Major Histocompatibility Complex Class II Gene and Newcastle Disease Virus Titre and Body Weight in Leung Hang Khao Chickens

    PubMed Central

    Molee, A.; Kongroi, K.; Kuadsantia, P.; Poompramun, C.; Likitdecharote, B.

    2016-01-01

    The aim of the present study was to investigate the effect of single nucleotide polymorphisms in the major histocompatibility complex (MHC) class II gene on resistance to Newcastle disease virus and body weight of the Thai indigenous chicken, Leung Hang Khao (Gallus gallus domesticus). Blood samples were collected for single nucleotide polymorphism analysis from 485 chickens. Polymerase chain reaction sequencing was used to classify single nucleotide polymorphisms of class II MHC. Body weights were measured at the ages of 3, 4, 5, and 7 months. Titres of Newcastle disease virus at 2 weeks to 7 months were determined and the correlation between body weight and titre was analysed. The association between single nucleotide polymorphisms and body weight and titre were analysed by a generalized linear model. Seven single nucleotide polymorphisms were identified: C125T, A126T, C209G, C242T, A243T, C244T, and A254T. Significant correlations between log titre and body weight were found at 2 and 4 weeks. Associations between single nucleotide polymorphisms and titre were found for C209G and A254T, and between all single nucleotide polymorphisms (except A243T) and body weight. The results showed that class II MHC is associated with both titre of Newcastle disease virus and body weight in Leung Hang Khao chickens. This is of concern because improved growth traits are the main goal of breeding selection. Moreover, the results suggested that MHC has a pleiotropic effect on the titre and growth performance. This mechanism should be investigated in a future study. PMID:26732325

  10. An analytical framework for whole-genome sequence association studies and its implications for autism spectrum disorder.

    PubMed

    Werling, Donna M; Brand, Harrison; An, Joon-Yong; Stone, Matthew R; Zhu, Lingxue; Glessner, Joseph T; Collins, Ryan L; Dong, Shan; Layer, Ryan M; Markenscoff-Papadimitriou, Eirene; Farrell, Andrew; Schwartz, Grace B; Wang, Harold Z; Currall, Benjamin B; Zhao, Xuefang; Dea, Jeanselle; Duhn, Clif; Erdman, Carolyn A; Gilson, Michael C; Yadav, Rachita; Handsaker, Robert E; Kashin, Seva; Klei, Lambertus; Mandell, Jeffrey D; Nowakowski, Tomasz J; Liu, Yuwen; Pochareddy, Sirisha; Smith, Louw; Walker, Michael F; Waterman, Matthew J; He, Xin; Kriegstein, Arnold R; Rubenstein, John L; Sestan, Nenad; McCarroll, Steven A; Neale, Benjamin M; Coon, Hilary; Willsey, A Jeremy; Buxbaum, Joseph D; Daly, Mark J; State, Matthew W; Quinlan, Aaron R; Marth, Gabor T; Roeder, Kathryn; Devlin, Bernie; Talkowski, Michael E; Sanders, Stephan J

    2018-05-01

    Genomic association studies of common or rare protein-coding variation have established robust statistical approaches to account for multiple testing. Here we present a comparable framework to evaluate rare and de novo noncoding single-nucleotide variants, insertion/deletions, and all classes of structural variation from whole-genome sequencing (WGS). Integrating genomic annotations at the level of nucleotides, genes, and regulatory regions, we define 51,801 annotation categories. Analyses of 519 autism spectrum disorder families did not identify association with any categories after correction for 4,123 effective tests. Without appropriate correction, biologically plausible associations are observed in both cases and controls. Despite excluding previously identified gene-disrupting mutations, coding regions still exhibited the strongest associations. Thus, in autism, the contribution of de novo noncoding variation is probably modest in comparison to that of de novo coding variants. Robust results from future WGS studies will require large cohorts and comprehensive analytical strategies that consider the substantial multiple-testing burden.

  11. Genomic Changes Associated with Reproductive and Migratory Ecotypes in Sockeye Salmon (Oncorhynchus nerka)

    PubMed Central

    Veale, Andrew J.

    2017-01-01

    Mechanisms underlying adaptive evolution can best be explored using paired populations displaying similar phenotypic divergence, illuminating the genomic changes associated with specific life history traits. Here, we used paired migratory [anadromous vs. resident (kokanee)] and reproductive [shore- vs. stream-spawning] ecotypes of sockeye salmon (Oncorhynchus nerka) sampled from seven lakes and two rivers spanning three catchments (Columbia, Fraser, and Skeena) in British Columbia, Canada to investigate the patterns and processes underlying their divergence. Restriction-site associated DNA sequencing was used to genotype this sampling at 7,347 single nucleotide polymorphisms, 334 of which were identified as outlier loci and candidates for divergent selection within at least one ecotype comparison. Sixty-eight of these outliers were present in two or more comparisons, with 33 detected across multiple catchments. Of particular note, one locus was detected as the most significant outlier between shore and stream-spawning ecotypes in multiple comparisons and across catchments (Columbia, Fraser, and Snake). We also detected several genomic islands of divergence, some shared among comparisons, potentially showing linked signals of differential selection. The single nucleotide polymorphisms and genomic regions identified in our study offer a range of mechanistic hypotheses associated with the genetic basis of O. nerka life history variation and provide novel tools for informing fisheries management. PMID:29045601

  12. Genome-wide single-nucleotide polymorphism arrays demonstrate high fidelity of multiple displacement-based whole-genome amplification.

    PubMed

    Tzvetkov, Mladen V; Becker, Christian; Kulle, Bettina; Nürnberg, Peter; Brockmöller, Jürgen; Wojnowski, Leszek

    2005-02-01

    Whole-genome DNA amplification by multiple displacement (MD-WGA) is a promising tool to obtain sufficient DNA amounts from samples of limited quantity. Using Affymetrix' GeneChip Human Mapping 10K Arrays, we investigated the accuracy and allele amplification bias in DNA samples subjected to MD-WGA. We observed an excellent concordance (99.95%) between single-nucleotide polymorphisms (SNPs) called both in the nonamplified and the corresponding amplified DNA. This concordance was only 0.01% lower than the intra-assay reproducibility of the genotyping technique used. However, MD-WGA failed to amplify an estimated 7% of polymorphic loci. Due to the algorithm used to call genotypes, this was detected only for heterozygous loci. We achieved a 4.3-fold reduction of noncalled SNPs by combining the results from two independent MD-WGA reactions. This indicated that inter-reaction variations rather than specific chromosomal loci reduced the efficiency of MD-WGA. Consistently, we detected no regions of reduced amplification, with the exception of several SNPs located near chromosomal ends. Altogether, despite a substantial loss of polymorphic sites, MD-WGA appears to be the current method of choice to amplify genomic DNA for array-based SNP analyses. The number of nonamplified loci can be substantially reduced by amplifying each DNA sample in duplicate.

  13. Polymorphism of the renalase gene in gestational diabetes mellitus.

    PubMed

    Fatima, Syeda Sadia; Jamil, Zehra; Alam, Faiza; Malik, Hajira Zafar; Madhani, Sarosh Irfan; Ahmad, Muhammad Saad; Shabbir, Tayyab; Rehmani, Muhammed Noman; Rabbani, Amna

    2017-01-01

    Renalase is considered as a novel candidate gene for type 2 diabetes. In this study, we aimed to investigate the relationship of serum renalase and two single nucleotide polymorphisms with gestational diabetes mellitus. One hundred and ninety-eight normotensive pregnant females (n = 99 gestational diabetes mellitus; n = 99 euglycemic pregnant controls) were classified according to the International Association of the Diabetes and Pregnancy Study criteria. Fasting and 2-h post glucose load blood levels and anthropometric assessment was performed. Serum renalase was measured using enzyme-linked immunosorbent assay, whereas DNA samples were genotyped for renalase single nucleotide polymorphisms rs2576178 and rs10887800 using Polymerase chain reaction-Restriction fragment length polymorphism method. In an age-matched case control study, no difference was observed in the serum levels of renalase (p > 0.05). The variant rs10887800 showed an association with gestational diabetes mellitus and remained significant after multiple adjustments (p < 0.05), whereas rs2576178 showed weak association (p = 0.030) that was lost after multiple adjustments (p = 0.09). We inferred a modest association of the rs10887800 polymorphism with gestational diabetes. Although gestational diabetes mellitus is self-reversible, yet presence of this minor G allele might predispose to metabolic syndrome phenotypes in near the future.

  14. Genetic Factors Influencing Coagulation Factor XIII B-Subunit Contribute to Risk of Ischemic Stroke.

    PubMed

    Hanscombe, Ken B; Traylor, Matthew; Hysi, Pirro G; Bevan, Stephen; Dichgans, Martin; Rothwell, Peter M; Worrall, Bradford B; Seshadri, Sudha; Sudlow, Cathie; Williams, Frances M K; Markus, Hugh S; Lewis, Cathryn M

    2015-08-01

    Abnormal coagulation has been implicated in the pathogenesis of ischemic stroke, but how this association is mediated and whether it differs between ischemic stroke subtypes is unknown. We determined the shared genetic risk between 14 coagulation factors and ischemic stroke and its subtypes. Using genome-wide association study results for 14 coagulation factors from the population-based TwinsUK sample (N≈2000 for each factor), meta-analysis results from the METASTROKE consortium ischemic stroke genome-wide association study (12 389 cases, 62 004 controls), and genotype data for 9520 individuals from the WTCCC2 ischemic stroke study (3548 cases, 5972 controls-the largest METASTROKE subsample), we explored shared genetic risk for coagulation and stroke. We performed three analyses: (1) a test for excess concordance (or discordance) in single nucleotide polymorphism effect direction across coagulation and stroke, (2) an estimation of the joint effect of multiple coagulation-associated single nucleotide polymorphisms in stroke, and (3) an evaluation of common genetic risk between coagulation and stroke. One coagulation factor, factor XIII subunit B (FXIIIB), showed consistent effects in the concordance analysis, the estimation of polygenic risk, and the validation with genotype data, with associations specific to the cardioembolic stroke subtype. Effect directions for FXIIIB-associated single nucleotide polymorphisms were significantly discordant with cardioembolic disease (smallest P=5.7×10(-04)); the joint effect of FXIIIB-associated single nucleotide polymorphisms was significantly predictive of ischemic stroke (smallest P=1.8×10(-04)) and the cardioembolic subtype (smallest P=1.7×10(-04)). We found substantial negative genetic covariation between FXIIIB and ischemic stroke (rG=-0.71, P=0.01) and the cardioembolic subtype (rG=-0.80, P=0.03). Genetic markers associated with low FXIIIB levels increase risk of ischemic stroke cardioembolic subtype. © 2015 The Authors.

  15. Association of functional polymorphisms of the transforming growth factor B1 gene with survival and graft-versus-host disease after unrelated donor hematopoietic stem cell transplantation

    PubMed Central

    Berro, Mariano; Mayor, Neema P.; Maldonado-Torres, Hazael; Cooke, Louise; Kusminsky, Gustavo; Marsh, Steven G.E.; Madrigal, J. Alejandro; Shaw, Bronwen E.

    2010-01-01

    Background Many genetic factors play major roles in the outcome of hematopoietic stem cell transplants from unrelated donors. Transforming growth factor β1 is a member of a highly pleiotrophic family of growth factors involved in the regulation of numerous immunomodulatory processes. Design and Methods We investigated the impact of single nucleotide polymorphisms at codons 10 and 25 of TGFB1, the gene encoding for transforming growth factor β1, on outcomes in 427 mye-loablative-conditioned transplanted patients. In addition, transforming growth factor β1 plasma levels were measured in 263 patients and 327 donors. Results Patients homozygous for the single nucleotide polymorphism at codon 10 had increased non-relapse mortality (at 3 years: 46.8% versus 29.4%, P=0.014) and reduced overall survival (at 5 years 29.3% versus 42.2%, P=0.013); the differences remained statistically significant in multivariate analysis. Donor genotype alone had no impact, although multiple single nucleotide polymorphisms within the pair were significantly associated with higher non-relapse mortality (at 3 years: 44% versus 29%, P=0.021) and decreased overall survival (at 5 years: 33.8% versus 41.9%, P=0.033). In the 10/10 HLA matched transplants (n=280), recipients of non-wild type grafts tended to have a higher incidence of acute graft-versus-host disease grades II-IV (P=0.052). In multivariate analysis, when analyzed with patients’ genotype, the incidences of both overall and grades II-IV acute graft-versus-host disease were increased (P=0.025 and P=0.009, respectively) in non-wild-type pairs. Conclusions We conclude that increasing numbers of single nucleotide polymorphisms in codon 10 of TGFB1 in patients and donors are associated with a worse outcome following hematopoietic stem cell transplantation from unrelated donors. PMID:19713222

  16. OligArch: A software tool to allow artificially expanded genetic information systems (AEGIS) to guide the autonomous self-assembly of long DNA constructs from multiple DNA single strands.

    PubMed

    Bradley, Kevin M; Benner, Steven A

    2014-01-01

    Synthetic biologists wishing to self-assemble large DNA (L-DNA) constructs from small DNA fragments made by automated synthesis need fragments that hybridize predictably. Such predictability is difficult to obtain with nucleotides built from just the four standard nucleotides. Natural DNA's peculiar combination of strong and weak G:C and A:T pairs, the context-dependence of the strengths of those pairs, unimolecular strand folding that competes with desired interstrand hybridization, and non-Watson-Crick interactions available to standard DNA, all contribute to this unpredictability. In principle, adding extra nucleotides to the genetic alphabet can improve the predictability and reliability of autonomous DNA self-assembly, simply by increasing the information density of oligonucleotide sequences. These extra nucleotides are now available as parts of artificially expanded genetic information systems (AEGIS), and tools are now available to generate entirely standard DNA from AEGIS DNA during PCR amplification. Here, we describe the OligArch (for "oligonucleotide architecting") software, an application that permits synthetic biologists to engineer optimally self-assembling DNA constructs from both six- and eight-letter AEGIS alphabets. This software has been used to design oligonucleotides that self-assemble to form complete genes from 20 or more single-stranded synthetic oligonucleotides. OligArch is therefore a key element of a scalable and integrated infrastructure for the rapid and designed engineering of biology.

  17. Functional analysis of regulatory single-nucleotide polymorphisms.

    PubMed

    Pampín, Sandra; Rodríguez-Rey, José C

    2007-04-01

    The identification of regulatory polymorphisms has become a key problem in human genetics. In the past few years there has been a conceptual change in the way in which regulatory single-nucleotide polymorphisms are studied. We revise the new approaches and discuss how gene expression studies can contribute to a better knowledge of the genetics of common diseases. New techniques for the association of single-nucleotide polymorphisms with changes in gene expression have been recently developed. This, together with a more comprehensive use of the old in-vitro methods, has produced a great amount of genetic information. When added to current databases, it will help to design better tools for the detection of regulatory single-nucleotide polymorphisms. The identification of functional regulatory single-nucleotide polymorphisms cannot be done by the simple inspection of DNA sequence. In-vivo techniques, based on primer-extension, and the more recently developed 'haploChIP' allow the association of gene variants to changes in gene expression. Gene expression analysis by conventional in-vitro techniques is the only way to identify the functional consequences of regulatory single-nucleotide polymorphisms. The amount of information produced in the last few years will help to refine the tools for the future analysis of regulatory gene variants.

  18. Developing single nucleotide polymorphism (SNP) markers from transcriptome sequences for identification of longan (Dimocarpus longan) germplasm

    PubMed Central

    Wang, Boyi; Tan, Hua-Wei; Fang, Wanping; Meinhardt, Lyndel W; Mischke, Sue; Matsumoto, Tracie; Zhang, Dapeng

    2015-01-01

    Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in 50 longan germplasm accessions, including cultivated varieties and wild germplasm; and designated 25 SNP markers that unambiguously identified all tested longan varieties with high statistical rigor (P<0.0001). Multiple trees from the same clone were verified and off-type trees were identified. Diversity analysis revealed genetic relationships among analyzed accessions. Cultivated varieties differed significantly from wild populations (Fst=0.300; P<0.001), demonstrating untapped genetic diversity for germplasm conservation and utilization. Within cultivated varieties, apparent differences between varieties from China and those from Thailand and Hawaii indicated geographic patterns of genetic differentiation. These SNP markers provide a powerful tool to manage longan genetic resources and breeding, with accurate and efficient genotype identification. PMID:26504559

  19. Typing and comparative genome analysis of Brucella melitensis isolated from Lebanon.

    PubMed

    Abou Zaki, Natalia; Salloum, Tamara; Osman, Marwan; Rafei, Rayane; Hamze, Monzer; Tokajian, Sima

    2017-10-16

    Brucella melitensis is the main causative agent of the zoonotic disease brucellosis. This study aimed at typing and characterizing genetic variation in 33 Brucella isolates recovered from patients in Lebanon. Bruce-ladder multiplex PCR and PCR-RFLP of omp31, omp2a and omp2b were performed. Sixteen representative isolates were chosen for draft-genome sequencing and analyzed to determine variations in virulence, resistance, genomic islands, prophages and insertion sequences. Comparative whole-genome single nucleotide polymorphism analysis was also performed. The isolates were confirmed to be B. melitensis. Genome analysis revealed multiple virulence determinants and efflux pumps. Genome comparisons and single nucleotide polymorphisms divided the isolates based on geographical distribution but revealed high levels of similarity between the strains. Sequence divergence in B. melitensis was mainly due to lateral gene transfer of mobile elements. This is the first report of an in-depth genomic characterization of B. melitensis in Lebanon. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  20. Genetic diversity revealed by single nucleotide polymorphism markers in a worldwide germplasm collection of durum wheat.

    PubMed

    Ren, Jing; Sun, Daokun; Chen, Liang; You, Frank M; Wang, Jirui; Peng, Yunliang; Nevo, Eviatar; Sun, Dongfa; Luo, Ming-Cheng; Peng, Junhua

    2013-03-28

    Evaluation of genetic diversity and genetic structure in crops has important implications for plant breeding programs and the conservation of genetic resources. Newly developed single nucleotide polymorphism (SNP) markers are effective in detecting genetic diversity. In the present study, a worldwide durum wheat collection consisting of 150 accessions was used. Genetic diversity and genetic structure were investigated using 946 polymorphic SNP markers covering the whole genome of tetraploid wheat. Genetic structure was greatly impacted by multiple factors, such as environmental conditions, breeding methods reflected by release periods of varieties, and gene flows via human activities. A loss of genetic diversity was observed from landraces and old cultivars to the modern cultivars released during periods of the Early Green Revolution, but an increase in cultivars released during the Post Green Revolution. Furthermore, a comparative analysis of genetic diversity among the 10 mega ecogeographical regions indicated that South America, North America, and Europe possessed the richest genetic variability, while the Middle East showed moderate levels of genetic diversity.

  1. MultiGeMS: detection of SNVs from multiple samples using model selection on high-throughput sequencing data.

    PubMed

    Murillo, Gabriel H; You, Na; Su, Xiaoquan; Cui, Wei; Reilly, Muredach P; Li, Mingyao; Ning, Kang; Cui, Xinping

    2016-05-15

    Single nucleotide variant (SNV) detection procedures are being utilized as never before to analyze the recent abundance of high-throughput DNA sequencing data, both on single and multiple sample datasets. Building on previously published work with the single sample SNV caller genotype model selection (GeMS), a multiple sample version of GeMS (MultiGeMS) is introduced. Unlike other popular multiple sample SNV callers, the MultiGeMS statistical model accounts for enzymatic substitution sequencing errors. It also addresses the multiple testing problem endemic to multiple sample SNV calling and utilizes high performance computing (HPC) techniques. A simulation study demonstrates that MultiGeMS ranks highest in precision among a selection of popular multiple sample SNV callers, while showing exceptional recall in calling common SNVs. Further, both simulation studies and real data analyses indicate that MultiGeMS is robust to low-quality data. We also demonstrate that accounting for enzymatic substitution sequencing errors not only improves SNV call precision at low mapping quality regions, but also improves recall at reference allele-dominated sites with high mapping quality. The MultiGeMS package can be downloaded from https://github.com/cui-lab/multigems xinping.cui@ucr.edu Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  2. Relationship Between Some Single-nucleotide Polymorphism and Response to Hydroxyurea Therapy in Iranian Patients With β-Thalassemia Intermedia.

    PubMed

    Karimi, Mehran; Zarei, Tahereh; Haghpanah, Sezaneh; Moghadam, Mohamad; Ebrahimi, Ahmad; Rezaei, Narges; Heidari, Ghazaleh; Vazin, Afsaneh; Khavari, Maryam; Miri, Hamid R

    2017-05-01

    To evaluate the possible relationship between hydroxyurea (HU) response and some single-nucleotide polymorphism (SNP) in patients affected by β-thalassemia intermedia. In this cross-sectional study, 100 β-thalassemia intermedia patients who were taking HU with a dose of 8 to 15 mg/kg body weight per day for a period of at least 6 months were randomly selected between February 2013 and October 2014 in southern Iran. HU response was defined based on decrease or cessation of the blood transfusion need and evaluation of Hb level. In univariate analysis, from all evaluated SNPs, only rs10837814 SNP of olfactory receptors (ORs) OR51B2 showed a significant association with HU response (P=0.038) and from laboratory characteristics, only nucleated red blood cells showed significant associations (116%±183%) in good responders versus (264%±286%) in poor responders (P=0.045). In multiple logistic regression, neither laboratory variables nor different SNPs, showed significant association with HU response. Three novel nucleotide variations (-665 [A→C], -1301 [T→G],-1199 delA) in OR51B2 gene were found in good responders. None of the evaluated SNPs in our study showed significant association with HU response. Further larger studies and evaluation of other genes are suggested.

  3. Minireview: Signal Bias, Allosterism, and Polymorphic Variation at the GLP-1R: Implications for Drug Discovery

    PubMed Central

    Koole, Cassandra; Savage, Emilia E.; Christopoulos, Arthur; Miller, Laurence J.

    2013-01-01

    The glucagon-like peptide-1 receptor (GLP-1R) controls the physiological responses to the incretin hormone glucagon-like peptide-1 and is a major therapeutic target for the treatment of type 2 diabetes, owing to the broad range of effects that are mediated upon its activation. These include the promotion of glucose-dependent insulin secretion, increased insulin biosynthesis, preservation of β-cell mass, improved peripheral insulin action, and promotion of weight loss. Regulation of GLP-1R function is complex, with multiple endogenous and exogenous peptides that interact with the receptor that result in the activation of numerous downstream signaling cascades. The current understanding of GLP-1R signaling and regulation is limited, with the desired spectrum of signaling required for the ideal therapeutic outcome still to be determined. In addition, there are several single-nucleotide polymorphisms (used in this review as defining a natural change of single nucleotide in the receptor sequence; clinically, this is viewed as a single-nucleotide polymorphism only if the frequency of the mutation occurs in 1% or more of the population) distributed within the coding sequence of the receptor protein that have the potential to produce differential responses for distinct ligands. In this review, we discuss the current understanding of GLP-1R function, in particular highlighting recent advances in the field on ligand-directed signal bias, allosteric modulation, and probe dependence and the implications of these behaviors for drug discovery and development. PMID:23864649

  4. Multiple primary tumors of the upper aerodigestive tract: is there a role for constitutional mutations in the p53 gene?

    PubMed

    Gallo, O; Sardi, I; Pepe, G; Franchi, A; Attanasio, M; Giusti, B; Bocciolini, C; Abbate, R

    1999-07-19

    Head-and-neck cancer (HNC) patients have a high risk of developing second primary tumors of the upper aerodigestive tract, the main cause of death. Although the roles of tobacco and diet in multiple head-and-neck carcinogenesis have been thoroughly investigated, little is known about individual genetic susceptibility factors involved in this process. Genomic instability, reflecting the propensity and the susceptibility of the genome to acquire multiple alterations, could be considered a driving force behind multiple carcinogenesis. Mutation of the p53 tumor-suppressor gene has been proposed to play an important role in this process. Therefore, we evaluated the incidence of inherited p53 germ-line alteration(s) in a population of 24 consecutive HNC patients and their first-degree relatives affected by multiple malignancies as well as the occurrence of p53 somatic acquired mutation(s) in 16 cancers, including first and second primaries from 5 HNCs of the same group. Mutations in exons 4-11 of the p53 gene were investigated using SSCP-PCR analysis and DNA sequencing. Analysis was extended to the peripheral blood and cancer biopsies available from first-degree relatives of cancer-prone families with p53 germ-line mutations. p53 germ-line mutations were identified in the peripheral blood and corresponding cancers of 3 HNC patients who had multiple malignancies. The only missense mutation detected was mapped in exon 6; it is a GTG to GAG substitution with an amino acid change from Val to Glu at codon 197. The remaining 2 p53 germ-line mutations were single-nucleotide substitutions without amino acid change in exon 6 (codon 213, CGA to CGG) and in exon 8 (codon 295, CCT to CCC), respectively. These mutations were found in HNC patients with a family history of cancer. Abnormal expression of wild-type p53 protein in normal and pathological tissues from patients with the same sense single-nucleotide substitutions was detected by immuno-histochemistry.

  5. Detecting associated single-nucleotide polymorphisms on the X chromosome in case control genome-wide association studies.

    PubMed

    Chen, Zhongxue; Ng, Hon Keung Tony; Li, Jing; Liu, Qingzhong; Huang, Hanwen

    2017-04-01

    In the past decade, hundreds of genome-wide association studies have been conducted to detect the significant single-nucleotide polymorphisms that are associated with certain diseases. However, most of the data from the X chromosome were not analyzed and only a few significant associated single-nucleotide polymorphisms from the X chromosome have been identified from genome-wide association studies. This is mainly due to the lack of powerful statistical tests. In this paper, we propose a novel statistical approach that combines the information of single-nucleotide polymorphisms on the X chromosome from both males and females in an efficient way. The proposed approach avoids the need of making strong assumptions about the underlying genetic models. Our proposed statistical test is a robust method that only makes the assumption that the risk allele is the same for both females and males if the single-nucleotide polymorphism is associated with the disease for both genders. Through simulation study and a real data application, we show that the proposed procedure is robust and have excellent performance compared to existing methods. We expect that many more associated single-nucleotide polymorphisms on the X chromosome will be identified if the proposed approach is applied to current available genome-wide association studies data.

  6. Genome-wide divergence and linkage disequilibrium analyses for Capsicum baccatum revealed by genome-anchored single nucleotide polymorphisms

    USDA-ARS?s Scientific Manuscript database

    Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to show the distribution of these 2 important incompatible cultivated pepper species. Estimated mean nucleotide...

  7. A survey of endogenous retrovirus (ERV) sequences in the vicinity of multiple sclerosis (MS)-associated single nucleotide polymorphisms (SNPs).

    PubMed

    Brütting, Christine; Emmer, Alexander; Kornhuber, Malte; Staege, Martin S

    2016-08-01

    Although multiple sclerosis (MS) is one of the most common central nervous system diseases in young adults, little is known about its etiology. Several human endogenous retroviruses (ERVs) are considered to play a role in MS. We are interested in which ERVs can be identified in the vicinity of MS associated genetic marker to find potential initiators of MS. We analysed the chromosomal regions surrounding 58 single nucleotide polymorphisms (SNPs) that are associated with MS identified in one of the last major genome wide association studies. We scanned these regions for putative endogenous retrovirus sequences with large open reading frames (ORFs). We observed that more retrovirus-related putative ORFs exist in the relatively close vicinity of SNP marker indices in multiple sclerosis compared to control SNPs. We found very high homologies to HERV-K, HCML-ARV, XMRV, Galidia ERV, HERV-H/env62 and XMRV-like mouse endogenous retrovirus mERV-XL. The associated genes (CYP27B1, CD6, CD58, MPV17L2, IL12RB1, CXCR5, PTGER4, TAGAP, TYK2, ICAM3, CD86, GALC, GPR65 as well as the HLA DRB1*1501) are mainly involved in the immune system, but also in vitamin D regulation. The most frequently detected ERV sequences are related to the multiple sclerosis-associated retrovirus, the human immunodeficiency virus 1, HERV-K, and the Simian foamy virus. Our data shows that there is a relation between MS associated SNPs and the number of retroviral elements compared to control. Our data identifies new ERV sequences that have not been associated with MS, so far.

  8. Genetic polymorphisms in ESR1 and ESR2 genes, and risk of hypospadias in a multiethnic study population.

    PubMed

    Choudhry, Shweta; Baskin, Laurence S; Lammer, Edward J; Witte, John S; Dasgupta, Sudeshna; Ma, Chen; Surampalli, Abhilasha; Shen, Joel; Shaw, Gary M; Carmichael, Suzan L

    2015-05-01

    Estrogenic endocrine disruptors acting via estrogen receptors α (ESR1) and β (ESR2) have been implicated in the etiology of hypospadias, a common congenital malformation of the male external genitalia. We determined the association of single nucleotide polymorphisms in ESR1 and ESR2 genes with hypospadias in a racially/ethnically diverse study population of California births. We investigated the relationship between hypospadias and 108 ESR1 and 36 ESR2 single nucleotide polymorphisms in 647 cases and 877 population based nonmalformed controls among infants born in selected California counties from 1990 to 2003. Subgroup analyses were performed by race/ethnicity (nonHispanic white and Hispanic subjects) and by hypospadias severity (mild to moderate and severe). Odds ratios for 33 of the 108 ESR1 single nucleotide polymorphisms had p values less than 0.05 (p = 0.05 to 0.007) for risk of hypospadias. However, none of the 36 ESR2 single nucleotide polymorphisms was significantly associated. In stratified analyses the association results were consistent by disease severity but different sets of single nucleotide polymorphisms were significantly associated with hypospadias in nonHispanic white and Hispanic subjects. Due to high linkage disequilibrium across the single nucleotide polymorphisms, haplotype analyses were conducted and identified 6 haplotype blocks in ESR1 gene that had haplotypes significantly associated with an increased risk of hypospadias (OR 1.3 to 1.8, p = 0.04 to 0.00001). Similar to single nucleotide polymorphism analysis, different ESR1 haplotypes were associated with risk of hypospadias in nonHispanic white and Hispanic subjects. No significant haplotype association was observed for ESR2. The data provide evidence that ESR1 single nucleotide polymorphisms and haplotypes influence the risk of hypospadias in white and Hispanic subjects, and warrant further examination in other study populations. Copyright © 2015 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  9. Novel applications of array comparative genomic hybridization in molecular diagnostics.

    PubMed

    Cheung, Sau W; Bi, Weimin

    2018-05-31

    In 2004, the implementation of array comparative genomic hybridization (array comparative genome hybridization [CGH]) into clinical practice marked a new milestone for genetic diagnosis. Array CGH and single-nucleotide polymorphism (SNP) arrays enable genome-wide detection of copy number changes in a high resolution, and therefore microarray has been recognized as the first-tier test for patients with intellectual disability or multiple congenital anomalies, and has also been applied prenatally for detection of clinically relevant copy number variations in the fetus. Area covered: In this review, the authors summarize the evolution of array CGH technology from their diagnostic laboratory, highlighting exonic SNP arrays developed in the past decade which detect small intragenic copy number changes as well as large DNA segments for the region of heterozygosity. The applications of array CGH to human diseases with different modes of inheritance with the emphasis on autosomal recessive disorders are discussed. Expert commentary: An exonic array is a powerful and most efficient clinical tool in detecting genome wide small copy number variants in both dominant and recessive disorders. However, whole-genome sequencing may become the single integrated platform for detection of copy number changes, single-nucleotide changes as well as balanced chromosomal rearrangements in the near future.

  10. Genotypic distribution of single nucleotide polymorphisms in oral cancer: global scene.

    PubMed

    Multani, Shaleen; Saranath, Dhananjaya

    2016-11-01

    Globocan 2012 reports the global oral cancer incidence of 300,373 new oral cancer cases annually, contributing to 2.1 % of the world cancer burden. The major well-established risk factors for oral cancer include tobacco, betel/areca nut, alcohol and high-risk oncogenic human papilloma virus (HPV) 16/18. However, only 5-10 % of individuals with high-risk lifestyle develop oral cancer. Thus, genomic variants in individuals represented as single nucleotide polymorphisms (SNPs) influence susceptibility to oral cancer. With a view to understanding the role of genomic variants in oral cancer, we reviewed SNPs in case-control studies with a minimum of 100 cases and 100 controls. PubMed and HuGE navigator search engines were used to obtain data published from 1990 to 2015, which identified 67 articles investigating the role of SNPs in oral cancer. Single publications reported 93 SNPs in 55 genes, with 34 SNPs associated with a risk of oral cancer. Meta-analysis of data in multiple studies defined nine SNPs associated with a risk of oral cancer. The genes were associated with critical functions deregulated in cancers, including cell proliferation, immune function, inflammation, transcription, DNA repair and xenobiotic metabolism.

  11. Compositions and methods for detecting single nucleotide polymorphisms

    DOEpatents

    Yeh, Hsin-Chih; Werner, James; Martinez, Jennifer S.

    2016-11-22

    Described herein are nucleic acid based probes and methods for discriminating and detecting single nucleotide variants in nucleic acid molecules (e.g., DNA). The methods include use of a pair of probes can be used to detect and identify polymorphisms, for example single nucleotide polymorphism in DNA. The pair of probes emit a different fluorescent wavelength of light depending on the association and alignment of the probes when hybridized to a target nucleic acid molecule. Each pair of probes is capable of discriminating at least two different nucleic acid molecules that differ by at least a single nucleotide difference. The methods can probes can be used, for example, for detection of DNA polymorphisms that are indicative of a particular disease or condition.

  12. Dynamic variable selection in SNP genotype autocalling from APEX microarray data.

    PubMed

    Podder, Mohua; Welch, William J; Zamar, Ruben H; Tebbutt, Scott J

    2006-11-30

    Single nucleotide polymorphisms (SNPs) are DNA sequence variations, occurring when a single nucleotide--adenine (A), thymine (T), cytosine (C) or guanine (G)--is altered. Arguably, SNPs account for more than 90% of human genetic variation. Our laboratory has developed a highly redundant SNP genotyping assay consisting of multiple probes with signals from multiple channels for a single SNP, based on arrayed primer extension (APEX). This mini-sequencing method is a powerful combination of a highly parallel microarray with distinctive Sanger-based dideoxy terminator sequencing chemistry. Using this microarray platform, our current genotype calling system (known as SNP Chart) is capable of calling single SNP genotypes by manual inspection of the APEX data, which is time-consuming and exposed to user subjectivity bias. Using a set of 32 Coriell DNA samples plus three negative PCR controls as a training data set, we have developed a fully-automated genotyping algorithm based on simple linear discriminant analysis (LDA) using dynamic variable selection. The algorithm combines separate analyses based on the multiple probe sets to give a final posterior probability for each candidate genotype. We have tested our algorithm on a completely independent data set of 270 DNA samples, with validated genotypes, from patients admitted to the intensive care unit (ICU) of St. Paul's Hospital (plus one negative PCR control sample). Our method achieves a concordance rate of 98.9% with a 99.6% call rate for a set of 96 SNPs. By adjusting the threshold value for the final posterior probability of the called genotype, the call rate reduces to 94.9% with a higher concordance rate of 99.6%. We also reversed the two independent data sets in their training and testing roles, achieving a concordance rate up to 99.8%. The strength of this APEX chemistry-based platform is its unique redundancy having multiple probes for a single SNP. Our model-based genotype calling algorithm captures the redundancy in the system considering all the underlying probe features of a particular SNP, automatically down-weighting any 'bad data' corresponding to image artifacts on the microarray slide or failure of a specific chemistry. In this regard, our method is able to automatically select the probes which work well and reduce the effect of other so-called bad performing probes in a sample-specific manner, for any number of SNPs.

  13. Lack of Association Between Toll-like Receptor 2 Polymorphisms (R753Q and A-16934T) and Atopic Dermatitis in Children from Thrace Region of Turkey

    PubMed Central

    Can, Ceren; Yazıcıoğlu, Mehtap; Gürkan, Hakan; Tozkır, Hilmi; Görgülü, Adnan; Süt, Necdet Hilmi

    2017-01-01

    Background: Atopic dermatitis is the most common chronic inflammatory skin disease. A complex interaction of both genetic and environmental factors is thought to contribute to the disease. Aims: To evaluate whether single nucleotide polymorphisms in the TLR2 gene c.2258C>T (R753Q) (rs5743708) and TLR2 c.-148+1614T>A (A-16934T) (rs4696480) (NM_0032643) are associated with atopic dermatitis in Turkish children. Study Design: Case-control study. Methods: The study was conducted on 70 Turkish children with atopic dermatitis aged 0.5-18 years. The clinical severity of atopic dermatitis was evaluated by the severity scoring of atopic dermatitis index. Serum total IgE levels, specific IgE antibodies to inhalant and food allergens were measured in both atopic dermatitis patients and controls, skin prick tests were done on 70 children with atopic dermatitis. Genotyping for TLR2 (R753Q and A-16934T) single nucleotide polymorphisms was performed in both atopic dermatitis patients and controls. Results: Cytosine-cytosine and cytosin-thymine genotype frequencies of the TLR2 R753Q single nucleotide polymorphism in the atopic dermatitis group were determined as being 98.6% and 1.4%, cytosine allele frequency for TLR2 R753Q single nucleotide polymorphism was determined as 99.29% and the thymine allele frequency was 0.71%, thymine-thymine, thymine-adenine, and adenine-adenine genotype frequencies of the TLR2 A-16934T single nucleotide polymorphism were 24.3%, 44.3%, and 31.4%. The thymine allele frequency for the TLR2 A-16934T single nucleotide polymorphism in the atopic dermatitis group was 46.43%, and the adenine allele frequency was 53.57%, respectively. There was not statistically significant difference between the groups for all investigated polymorphisms (p>0.05). For all single nucleotide polymorphisms studied, allelic distribution was analogous among atopic dermatitis patients and controls, and no significant statistical difference was observed. No homozygous carriers of the TLR2 R753Q single nucleotide polymorphism were found in the atopic dermatitis and control groups. Conclusion: The TLR2 (R753Q and A-16934T) single nucleotide polymorphisms are not associated with atopic dermatitis in a group of Turkish patients. PMID:28443596

  14. Lack of Association Between Toll-like Receptor 2 Polymorphisms (R753Q and A-16934T) and Atopic Dermatitis in Children from Thrace Region of Turkey.

    PubMed

    Can, Ceren; Yazıcıoğlu, Mehtap; Gürkan, Hakan; Tozkır, Hilmi; Görgülü, Adnan; Süt, Necdet Hilmi

    2017-05-05

    Atopic dermatitis is the most common chronic inflammatory skin disease. A complex interaction of both genetic and environmental factors is thought to contribute to the disease. To evaluate whether single nucleotide polymorphisms in the TLR2 gene c.2258C>T (R753Q) (rs5743708) and TLR2 c.-148+1614T>A (A-16934T) (rs4696480) (NM_0032643) are associated with atopic dermatitis in Turkish children. Case-control study. The study was conducted on 70 Turkish children with atopic dermatitis aged 0.5-18 years. The clinical severity of atopic dermatitis was evaluated by the severity scoring of atopic dermatitis index. Serum total IgE levels, specific IgE antibodies to inhalant and food allergens were measured in both atopic dermatitis patients and controls, skin prick tests were done on 70 children with atopic dermatitis. Genotyping for TLR2 (R753Q and A-16934T) single nucleotide polymorphisms was performed in both atopic dermatitis patients and controls. Cytosine-cytosine and cytosin-thymine genotype frequencies of the TLR2 R753Q single nucleotide polymorphism in the atopic dermatitis group were determined as being 98.6% and 1.4%, cytosine allele frequency for TLR2 R753Q single nucleotide polymorphism was determined as 99.29% and the thymine allele frequency was 0.71%, thymine-thymine, thymine-adenine, and adenine-adenine genotype frequencies of the TLR2 A-16934T single nucleotide polymorphism were 24.3%, 44.3%, and 31.4%. The thymine allele frequency for the TLR2 A-16934T single nucleotide polymorphism in the atopic dermatitis group was 46.43%, and the adenine allele frequency was 53.57%, respectively. There was not statistically significant difference between the groups for all investigated polymorphisms (p>0.05). For all single nucleotide polymorphisms studied, allelic distribution was analogous among atopic dermatitis patients and controls, and no significant statistical difference was observed. No homozygous carriers of the TLR2 R753Q single nucleotide polymorphism were found in the atopic dermatitis and control groups. The TLR2 (R753Q and A-16934T) single nucleotide polymorphisms are not associated with atopic dermatitis in a group of Turkish patients.

  15. A Parallel Independent Component Analysis Approach to Investigate Genomic Influence on Brain Function

    PubMed Central

    Liu, Jingyu; Demirci, Oguz; Calhoun, Vince D.

    2009-01-01

    Relationships between genomic data and functional brain images are of great interest but require new analysis approaches to integrate the high-dimensional data types. This letter presents an extension of a technique called parallel independent component analysis (paraICA), which enables the joint analysis of multiple modalities including interconnections between them. We extend our earlier work by allowing for multiple interconnections and by providing important overfitting controls. Performance was assessed by simulations under different conditions, and indicated reliable results can be extracted by properly balancing overfitting and underfitting. An application to functional magnetic resonance images and single nucleotide polymorphism array produced interesting findings. PMID:19834575

  16. A Parallel Independent Component Analysis Approach to Investigate Genomic Influence on Brain Function.

    PubMed

    Liu, Jingyu; Demirci, Oguz; Calhoun, Vince D

    2008-01-01

    Relationships between genomic data and functional brain images are of great interest but require new analysis approaches to integrate the high-dimensional data types. This letter presents an extension of a technique called parallel independent component analysis (paraICA), which enables the joint analysis of multiple modalities including interconnections between them. We extend our earlier work by allowing for multiple interconnections and by providing important overfitting controls. Performance was assessed by simulations under different conditions, and indicated reliable results can be extracted by properly balancing overfitting and underfitting. An application to functional magnetic resonance images and single nucleotide polymorphism array produced interesting findings.

  17. Improved prediction of biochemical recurrence after radical prostatectomy by genetic polymorphisms.

    PubMed

    Morote, Juan; Del Amo, Jokin; Borque, Angel; Ars, Elisabet; Hernández, Carlos; Herranz, Felipe; Arruza, Antonio; Llarena, Roberto; Planas, Jacques; Viso, María J; Palou, Joan; Raventós, Carles X; Tejedor, Diego; Artieda, Marta; Simón, Laureano; Martínez, Antonio; Rioja, Luis A

    2010-08-01

    Single nucleotide polymorphisms are inherited genetic variations that can predispose or protect individuals against clinical events. We hypothesized that single nucleotide polymorphism profiling may improve the prediction of biochemical recurrence after radical prostatectomy. We performed a retrospective, multi-institutional study of 703 patients treated with radical prostatectomy for clinically localized prostate cancer who had at least 5 years of followup after surgery. All patients were genotyped for 83 prostate cancer related single nucleotide polymorphisms using a low density oligonucleotide microarray. Baseline clinicopathological variables and single nucleotide polymorphisms were analyzed to predict biochemical recurrence within 5 years using stepwise logistic regression. Discrimination was measured by ROC curve AUC, specificity, sensitivity, predictive values, net reclassification improvement and integrated discrimination index. The overall biochemical recurrence rate was 35%. The model with the best fit combined 8 covariates, including the 5 clinicopathological variables prostate specific antigen, Gleason score, pathological stage, lymph node involvement and margin status, and 3 single nucleotide polymorphisms at the KLK2, SULT1A1 and TLR4 genes. Model predictive power was defined by 80% positive predictive value, 74% negative predictive value and an AUC of 0.78. The model based on clinicopathological variables plus single nucleotide polymorphisms showed significant improvement over the model without single nucleotide polymorphisms, as indicated by 23.3% net reclassification improvement (p = 0.003), integrated discrimination index (p <0.001) and likelihood ratio test (p <0.001). Internal validation proved model robustness (bootstrap corrected AUC 0.78, range 0.74 to 0.82). The calibration plot showed close agreement between biochemical recurrence observed and predicted probabilities. Predicting biochemical recurrence after radical prostatectomy based on clinicopathological data can be significantly improved by including patient genetic information. Copyright (c) 2010 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  18. [Meta-analysis on relationship between single nucleotide polymorphism of rs2231142 in ABCG2 gene and gout in East Asian population].

    PubMed

    Wu, Lei; He, Yao; Zhang, Di

    2015-11-01

    To systematically evaluate the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout in East Asian population. The literature retrieval was conducted by using English databases (Medline, EMbase), Chinese databases (CNKI, Vip, Wanfang, SinaMed) and others to collect the published papers on the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout by the end of December 2014. Meta-analysis was performed with software Stata 12.0. Nine studies were included. There were significant associations between increased risk of gout and single nucleotide polymorphism of rs2231142, the combined OR was 2.04 (95%CI: 1.82-2.28) for A allele and C allele, 1.97 (95%CI: 1.57-2.48) for CA and CC, 3.71 (95%CI: 3.07-4.47) for AA and CC. Sex and region specific subgroup analysis showed less heterogeneity. There is significant association between gout and single nucleotide polymorphism of rs2231142 in East Asian population, and A allele is a high risk gene for gout.

  19. CNTNAP2 Is Significantly Associated With Speech Sound Disorder in the Chinese Han Population.

    PubMed

    Zhao, Yun-Jing; Wang, Yue-Ping; Yang, Wen-Zhu; Sun, Hong-Wei; Ma, Hong-Wei; Zhao, Ya-Ru

    2015-11-01

    Speech sound disorder is the most common communication disorder. Some investigations support the possibility that the CNTNAP2 gene might be involved in the pathogenesis of speech-related diseases. To investigate single-nucleotide polymorphisms in the CNTNAP2 gene, 300 unrelated speech sound disorder patients and 200 normal controls were included in the study. Five single-nucleotide polymorphisms were amplified and directly sequenced. Significant differences were found in the genotype (P = .0003) and allele (P = .0056) frequencies of rs2538976 between patients and controls. The excess frequency of the A allele in the patient group remained significant after Bonferroni correction (P = .0280). A significant haplotype association with rs2710102T/+rs17236239A/+2538976A/+2710117A (P = 4.10e-006) was identified. A neighboring single-nucleotide polymorphism, rs10608123, was found in complete linkage disequilibrium with rs2538976, and the genotypes exactly corresponded to each other. The authors propose that these CNTNAP2 variants increase the susceptibility to speech sound disorder. The single-nucleotide polymorphisms rs10608123 and rs2538976 may merge into one single-nucleotide polymorphism. © The Author(s) 2015.

  20. Real-Time PCR Typing of Escherichia coli Based on Multiple Single Nucleotide Polymorphisms--a Convenient and Rapid Method.

    PubMed

    Lager, Malin; Mernelius, Sara; Löfgren, Sture; Söderman, Jan

    2016-01-01

    Healthcare-associated infections caused by Escherichia coli and antibiotic resistance due to extended-spectrum beta-lactamase (ESBL) production constitute a threat against patient safety. To identify, track, and control outbreaks and to detect emerging virulent clones, typing tools of sufficient discriminatory power that generate reproducible and unambiguous data are needed. A probe based real-time PCR method targeting multiple single nucleotide polymorphisms (SNP) was developed. The method was based on the multi locus sequence typing scheme of Institute Pasteur and by adaptation of previously described typing assays. An 8 SNP-panel that reached a Simpson's diversity index of 0.95 was established, based on analysis of sporadic E. coli cases (ESBL n = 27 and non-ESBL n = 53). This multi-SNP assay was used to identify the sequence type 131 (ST131) complex according to the Achtman's multi locus sequence typing scheme. However, it did not fully discriminate within the complex but provided a diagnostic signature that outperformed a previously described detection assay. Pulsed-field gel electrophoresis typing of isolates from a presumed outbreak (n = 22) identified two outbreaks (ST127 and ST131) and three different non-outbreak-related isolates. Multi-SNP typing generated congruent data except for one non-outbreak-related ST131 isolate. We consider multi-SNP real-time PCR typing an accessible primary generic E. coli typing tool for rapid and uniform type identification.

  1. Genomic Changes Associated with Reproductive and Migratory Ecotypes in Sockeye Salmon (Oncorhynchus nerka).

    PubMed

    Veale, Andrew J; Russello, Michael A

    2017-10-01

    Mechanisms underlying adaptive evolution can best be explored using paired populations displaying similar phenotypic divergence, illuminating the genomic changes associated with specific life history traits. Here, we used paired migratory [anadromous vs. resident (kokanee)] and reproductive [shore- vs. stream-spawning] ecotypes of sockeye salmon (Oncorhynchus nerka) sampled from seven lakes and two rivers spanning three catchments (Columbia, Fraser, and Skeena) in British Columbia, Canada to investigate the patterns and processes underlying their divergence. Restriction-site associated DNA sequencing was used to genotype this sampling at 7,347 single nucleotide polymorphisms, 334 of which were identified as outlier loci and candidates for divergent selection within at least one ecotype comparison. Sixty-eight of these outliers were present in two or more comparisons, with 33 detected across multiple catchments. Of particular note, one locus was detected as the most significant outlier between shore and stream-spawning ecotypes in multiple comparisons and across catchments (Columbia, Fraser, and Snake). We also detected several genomic islands of divergence, some shared among comparisons, potentially showing linked signals of differential selection. The single nucleotide polymorphisms and genomic regions identified in our study offer a range of mechanistic hypotheses associated with the genetic basis of O. nerka life history variation and provide novel tools for informing fisheries management. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  2. Development of a single-tube loop-mediated isothermal amplification assay for detection of four pathogens of bacterial meningitis.

    PubMed

    Huy, Nguyen Tien; Hang, Le Thi Thuy; Boamah, Daniel; Lan, Nguyen Thi Phuong; Van Thanh, Phan; Watanabe, Kiwao; Huong, Vu Thi Thu; Kikuchi, Mihoko; Ariyoshi, Koya; Morita, Kouichi; Hirayama, Kenji

    2012-12-01

    Several loop-mediated isothermal amplification (LAMP) assays have been developed to detect common causative pathogens of bacterial meningitis (BM). However, no LAMP assay is reported to detect Streptococcus agalactiae and Streptococcus suis, which are also among common pathogens of BM. Moreover, it is laborious and expensive by performing multiple reactions for each sample to detect bacterial pathogen. Thus, we aimed to design and develop a single-tube LAMP assay capable of detecting multiple bacterial species, based on the nucleotide sequences of the 16S rRNA genes of the bacteria. The nucleotide sequences of the 16S rRNA genes of main pathogens involved in BM were aligned to identify conserved regions, which were further used to design broad range specific LAMP assay primers. We successfully designed a set of broad range specific LAMP assay primers for simultaneous detection of four species including Staphylococcus aureus, Streptococcus pneumoniae, S. suis and S. agalactiae. The broad range LAMP assay was highly specific without cross-reactivity with other bacteria including Haemophilus influenzae, Neisseria meningitidis and Escherichia coli. The sensitivity of our LAMP assay was 100-1000 times higher compared with the conventional PCR assay. The bacterial species could be identified after digestion of the LAMP products with restriction endonuclease DdeI and HaeIII. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  3. SNPitty: An Intuitive Web Application for Interactive B-Allele Frequency and Copy Number Visualization of Next-Generation Sequencing Data.

    PubMed

    van Riet, Job; Krol, Niels M G; Atmodimedjo, Peggy N; Brosens, Erwin; van IJcken, Wilfred F J; Jansen, Maurice P H M; Martens, John W M; Looijenga, Leendert H; Jenster, Guido; Dubbink, Hendrikus J; Dinjens, Winand N M; van de Werken, Harmen J G

    2018-03-01

    Exploration and visualization of next-generation sequencing data are crucial for clinical diagnostics. Software allowing simultaneous visualization of multiple regions of interest coupled with dynamic heuristic filtering of genetic aberrations is, however, lacking. Therefore, the authors developed the web application SNPitty that allows interactive visualization and interrogation of variant call format files by using B-allele frequencies of single-nucleotide polymorphisms and single-nucleotide variants, coverage metrics, and copy numbers analysis results. SNPitty displays variant alleles and allelic imbalances with a focus on loss of heterozygosity and copy number variation using genome-wide heterozygous markers and somatic mutations. In addition, SNPitty is capable of generating predefined reports that summarize and highlight disease-specific targets of interest. SNPitty was validated for diagnostic interpretation of somatic events by showcasing a serial dilution series of glioma tissue. Additionally, SNPitty is demonstrated in four cancer-related scenarios encountered in daily clinical practice and on whole-exome sequencing data of peripheral blood from a Down syndrome patient. SNPitty allows detection of loss of heterozygosity, chromosomal and gene amplifications, homozygous or heterozygous deletions, somatic mutations, or any combination thereof in regions or genes of interest. Furthermore, SNPitty can be used to distinguish molecular relationships between multiple tumors from a single patient. On the basis of these data, the authors demonstrate that SNPitty is robust and user friendly in a wide range of diagnostic scenarios. Copyright © 2018 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  4. Single-Nucleotide Polymorphisms Associated with Skin Naphthyl–Keratin Adduct Levels in Workers Exposed to Naphthalene

    PubMed Central

    Jiang, Rong; French, John E.; Stober, Vandy P.; Kang-Sickel, Juei-Chuan C.; Zou, Fei

    2012-01-01

    Background: Individual genetic variation that results in differences in systemic response to xenobiotic exposure is not accounted for as a predictor of outcome in current exposure assessment models. Objective: We developed a strategy to investigate individual differences in single-nucleotide polymorphisms (SNPs) as genetic markers associated with naphthyl–keratin adduct (NKA) levels measured in the skin of workers exposed to naphthalene. Methods: The SNP-association analysis was conducted in PLINK using candidate-gene analysis and genome-wide analysis. We identified significant SNP–NKA associations and investigated the potential impact of these SNPs along with personal and workplace factors on NKA levels using a multiple linear regression model and the Pratt index. Results: In candidate-gene analysis, a SNP (rs4852279) located near the CYP26B1 gene contributed to the 2-naphthyl–keratin adduct (2NKA) level. In the multiple linear regression model, the SNP rs4852279, dermal exposure, exposure time, task replacing foam, age, and ethnicity all were significant predictors of 2NKA level. In genome-wide analysis, no single SNP reached genome-wide significance for NKA levels (all p ≥ 1.05 × 10–5). Pathway and network analyses of SNPs associated with NKA levels were predicted to be involved in the regulation of cellular processes and homeostasis. Conclusions: These results provide evidence that a quantitative biomarker can be used as an intermediate phenotype when investigating the association between genetic markers and exposure–dose relationship in a small, well-characterized exposed worker population. PMID:22391508

  5. Cacao single-nucleotide polymorphism (SNP) markers: A discovery strategy to identify SNPs for genotyping, genetic mapping and genome wide association studies (GWAS)

    USDA-ARS?s Scientific Manuscript database

    Single-nucleotide polymorphisms (SNPs) are the most common genetic markers in Theobroma cacao, occurring approximately once in every 200 nucleotides. SNPs, like microsatellites, are co-dominant and PCR-based, but they have several advantages over microsatellites. They are unambiguous, so that a SN...

  6. Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

    DOEpatents

    McCutchen-Maloney, Sandra L.

    2002-01-01

    DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

  7. The chlorophyll-deficient golden leaf mutation in cucumber is due to a single nucleotide substitution in CsChlI for magnesium chelatase I subunit.

    PubMed

    Gao, Meiling; Hu, Liangliang; Li, Yuhong; Weng, Yiqun

    2016-10-01

    The cucumber chlorophyll-deficient golden leaf mutation is due to a single nucleotide substitution in the CsChlI gene for magnesium chelatase I subunit which plays important roles in the chlorophyll biosynthesis pathway. The Mg-chelatase catalyzes the insertion of Mg(2+) into the protoporphyrin IX in the chlorophyll biosynthesis pathway, which is a protein complex encompassing three subunits CHLI, CHLD, and CHLH. Chlorophyll-deficient mutations in genes encoding the three subunits have played important roles in understanding the structure, function and regulation of this important enzyme. In an EMS mutagenesis population, we identified a chlorophyll-deficient mutant C528 with golden leaf color throughout its development which was viable and able to set fruits and seeds. Segregation analysis in multiple populations indicated that this leaf color mutation was recessively inherited and the green color showed complete dominance over golden color. Map-based cloning identified CsChlI as the candidate gene for this mutation which encoded the CHLI subunit of cucumber Mg-chelatase. The 1757-bp CsChlI gene had three exons and a single nucleotide change (G to A) in its third exon resulted in an amino acid substitution (G269R) and the golden leaf color in C528. This mutation occurred in the highly conserved nucleotide-binding domain of the CHLI protein in which chlorophyll-deficient mutations have been frequently identified. The mutant phenotype, CsChlI expression pattern and the mutated residue in the CHLI protein suggested the mutant allele in C528 is unique among mutations identified so far in different species. This golden leaf mutant not only has its potential in cucumber breeding, but also provides a useful tool in understanding the CHLI function and its regulation in the chlorophyll biosynthesis pathway as well as chloroplast development.

  8. Sequence-Based Prioritization of Nonsynonymous Single-Nucleotide Polymorphisms for the Study of Disease Mutations

    PubMed Central

    Jiang, Rui ; Yang, Hua ; Zhou, Linqi ; Kuo, C.-C. Jay ; Sun, Fengzhu ; Chen, Ting 

    2007-01-01

    The increasing demand for the identification of genetic variation responsible for common diseases has translated into a need for sophisticated methods for effectively prioritizing mutations occurring in disease-associated genetic regions. In this article, we prioritize candidate nonsynonymous single-nucleotide polymorphisms (nsSNPs) through a bioinformatics approach that takes advantages of a set of improved numeric features derived from protein-sequence information and a new statistical learning model called “multiple selection rule voting” (MSRV). The sequence-based features can maximize the scope of applications of our approach, and the MSRV model can capture subtle characteristics of individual mutations. Systematic validation of the approach demonstrates that this approach is capable of prioritizing causal mutations for both simple monogenic diseases and complex polygenic diseases. Further studies of familial Alzheimer diseases and diabetes show that the approach can enrich mutations underlying these polygenic diseases among the top of candidate mutations. Application of this approach to unclassified mutations suggests that there are 10 suspicious mutations likely to cause diseases, and there is strong support for this in the literature. PMID:17668383

  9. Origins and Domestication of Cultivated Banana Inferred from Chloroplast and Nuclear Genes

    PubMed Central

    Zhang, Cui; Wang, Xin-Feng; Shi, Feng-Xue; Chen, Wen-Na; Ge, Xue-Jun

    2013-01-01

    Background Cultivated bananas are large, vegetatively-propagated members of the genus Musa. More than 1,000 cultivars are grown worldwide and they are major economic and food resources in numerous developing countries. It has been suggested that cultivated bananas originated from the islands of Southeast Asia (ISEA) and have been developed through complex geodomestication pathways. However, the maternal and parental donors of most cultivars are unknown, and the pattern of nucleotide diversity in domesticated banana has not been fully resolved. Methodology/Principal Findings We studied the genetics of 16 cultivated and 18 wild Musa accessions using two single-copy nuclear (granule-bound starch synthase I, GBSS I, also known as Waxy, and alcohol dehydrogenase 1, Adh1) and two chloroplast (maturase K, matK, and the trnL-F gene cluster) genes. The results of phylogenetic analyses showed that all A-genome haplotypes of cultivated bananas were grouped together with those of ISEA subspecies of M. acuminata (A-genome). Similarly, the B- and S-genome haplotypes of cultivated bananas clustered with the wild species M. balbisiana (B-genome) and M. schizocarpa (S-genome), respectively. Notably, it has been shown that distinct haplotypes of each cultivar (A-genome group) were nested together to different ISEA subspecies M. acuminata. Analyses of nucleotide polymorphism in the Waxy and Adh1 genes revealed that, in comparison to the wild relatives, cultivated banana exhibited slightly lower nucleotide diversity both across all sites and specifically at silent sites. However, dramatically reduced nucleotide diversity was found at nonsynonymous sites for cultivated bananas. Conclusions/Significance Our study not only confirmed the origin of cultivated banana as arising from multiple intra- and inter-specific hybridization events, but also showed that cultivated banana may have not suffered a severe genetic bottleneck during the domestication process. Importantly, our findings suggested that multiple maternal origins and a reduction in nucleotide diversity at nonsynonymous sites are general attributes of cultivated bananas. PMID:24260405

  10. Feasibility of mesenchymal stem cell culture expansion for a phase I clinical trial in multiple sclerosis.

    PubMed

    Planchon, Sarah M; Lingas, Karen T; Reese Koç, Jane; Hooper, Brittney M; Maitra, Basabi; Fox, Robert M; Imrey, Peter B; Drake, Kylie M; Aldred, Micheala A; Lazarus, Hillard M; Cohen, Jeffrey A

    2018-01-01

    Multiple sclerosis is an inflammatory, neurodegenerative disease of the central nervous system for which therapeutic mesenchymal stem cell transplantation is under study. Published experience of culture-expanding multiple sclerosis patients' mesenchymal stem cells for clinical trials is limited. To determine the feasibility of culture-expanding multiple sclerosis patients' mesenchymal stem cells for clinical use. In a phase I trial, autologous, bone marrow-derived mesenchymal stem cells were isolated from 25 trial participants with multiple sclerosis and eight matched controls, and culture-expanded to a target single dose of 1-2 × 10 6 cells/kg. Viability, cell product identity and sterility were assessed prior to infusion. Cytogenetic stability was assessed by single nucleotide polymorphism analysis of mesenchymal stem cells from 18 multiple sclerosis patients and five controls. One patient failed screening. Mesenchymal stem cell culture expansion was successful for 24 of 25 multiple sclerosis patients and six of eight controls. The target dose was achieved in 16-62 days, requiring two to three cell passages. Growth rate and culture success did not correlate with demographic or multiple sclerosis disease characteristics. Cytogenetic studies identified changes on one chromosome of one control (4.3%) after extended time in culture. Culture expansion of mesenchymal stem cells from multiple sclerosis patients as donors is feasible. However, culture time should be minimized for cell products designated for therapeutic administration.

  11. tRNAHis guanylyltransferase catalyzes a 3'-5' polymerization reaction that is distinct from G-1 addition.

    PubMed

    Jackman, Jane E; Phizicky, Eric M

    2006-06-06

    Yeast tRNA(His) guanylyltransferase, Thg1, is an essential protein that adds a single guanine to the 5' end (G(-1)) of tRNA(His). This G(-1) residue is required for aminoacylation of tRNA(His) by histidyl-tRNA synthetase, both in vitro and in vivo. The guanine nucleotide addition reaction catalyzed by Thg1 extends the polynucleotide chain in the reverse (3'-5') direction of other known polymerases, albeit by one nucleotide. Here, we show that alteration of the 3' end of the Thg1 substrate tRNA(His) unleashes an unexpected reverse polymerase activity of wild-type Thg1, resulting in the 3'-5' addition of multiple nucleotides to the tRNA, with efficiency comparable to the G(-1) addition reaction. The addition of G(-1) forms a mismatched G.A base pair at the 5' end of tRNA(His), and, with monophosphorylated tRNA substrates, it is absolutely specific for tRNA(His). By contrast, reverse polymerization forms multiple G.C or C.G base pairs, and, with preactivated tRNA species, it can initiate at positions other than -1 and is not specific for tRNA(His). Thus, wild-type Thg1 catalyzes a templated polymerization reaction acting in the reverse direction of that of canonical DNA and RNA polymerases. Surprisingly, Thg1 can also readily use dNTPs for nucleotide addition. These results suggest that 3'-5' polymerization represents either an uncharacterized role for Thg1 in RNA or DNA repair or metabolism, or it may be a remnant of an earlier catalytic strategy used in nature.

  12. Molecular Diagnostics in Transfusion Medicine: In Capillary, on a Chip, in Silico, or in Flight?

    PubMed Central

    Garritsen, Henk S.P.; Xiu-Cheng Fan, Alex; Lenz, Daniela; Hannig, Horst; Yan Zhong, Xiao; Geffers, Robert; Lindenmaier, Werner; Dittmar, Kurt E.J.; Wörmann, Bernhard

    2009-01-01

    Summary Serology, defined as antibody-based diagnostics, has been regarded as the diagnostic gold standard in transfusion medicine. Nowadays however the impact of molecular diagnostics in transfusion medicine is rapidly growing. Molecular diagnostics can improve tissue typing (HLA typing), increase safety of blood products (NAT testing of infectious diseases), and enable blood group typing in difficult situations (after transfusion of blood products or prenatal non-invasive RhD typing). Most of the molecular testing involves the determination of the presence of single nucleotide polymorphisms (SNPs). Antigens (e.g. blood group antigens) mostly result from single nucleotide differences in critical positions. However, most blood group systems cannot be determined by looking at a single SNP. To identify members of a blood group system a number of critical SNPs have to be taken into account. The platforms which are currently used to perform molecular diagnostics are mostly gel-based, requiring time-consuming multiple manual steps. To implement molecular methods in transfusion medicine in the future the development of higher-throughput SNP genotyping non-gel-based platforms which allow a rapid, cost-effective screening are essential. Because of its potential for automation, high throughput and cost effectiveness the special focus of this paper is a relative new technique: SNP genotyping by MALDI-TOF MS analysis. PMID:21113259

  13. AXM mutagenesis: an efficient means for the production of libraries for directed evolution of proteins.

    PubMed

    Holland, Erika G; Buhr, Diane L; Acca, Felicity E; Alderman, Dawn; Bovat, Kristin; Busygina, Valeria; Kay, Brian K; Weiner, Michael P; Kiss, Margaret M

    2013-08-30

    Affinity maturation is an important part of the recombinant antibody development process. There are several well-established approaches for generating libraries of mutated antibody genes for affinity maturation, but these approaches are generally too laborious or expensive to allow high-throughput, parallel processing of multiple antibodies. Here, we describe a scalable approach that enables the generation of libraries with greater than 10(8) clones from a single Escherichia coli transformation. In our method, a mutated DNA fragment is produced using PCR conditions that promote nucleotide misincorporation into newly synthesized DNA. In the PCR reaction, one of the primers contains at least three phosphorothioate linkages at its 5' end, and treatment of the PCR product with a 5' to 3' exonuclease is used to preferentially remove the strand synthesized with the non-modified primer, resulting in a single-stranded DNA fragment. This fragment then serves as a megaprimer to prime DNA synthesis on a uracilated, circular, single-stranded template in a Kunkel-like mutagenesis reaction that biases nucleotide base-changes between the megaprimer and uracilated DNA sequence in favor of the in vitro synthesized megaprimer. This method eliminates the inefficient subcloning steps that are normally required for the construction of affinity maturation libraries from randomly mutagenized antibody genes. Copyright © 2013. Published by Elsevier B.V.

  14. Interferon regulatory factor 5 (IRF5) gene variants are associated with multiple sclerosis in three distinct populations

    PubMed Central

    Kristjansdottir, G; Sandling, J K; Bonetti, A; Roos, I M; Milani, L; Wang, C; Gustafsdottir, S M; Sigurdsson, S; Lundmark, A; Tienari, P J; Koivisto, K; Elovaara, I; Pirttilä, T; Reunanen, M; Peltonen, L; Saarela, J; Hillert, J; Olsson, T; Landegren, U; Alcina, A; Fernández, O; Leyva, L; Guerrero, M; Lucas, M; Izquierdo, G; Matesanz, F; Syvänen, A-C

    2008-01-01

    Background: IRF5 is a transcription factor involved both in the type I interferon and the toll-like receptor signalling pathways. Previously, IRF5 has been found to be associated with systemic lupus erythematosus, rheumatoid arthritis and inflammatory bowel diseases. Here we investigated whether polymorphisms in the IRF5 gene would be associated with yet another disease with features of autoimmunity, multiple sclerosis (MS). Methods: We genotyped nine single nucleotide polymorphisms and one insertion-deletion polymorphism in the IRF5 gene in a collection of 2337 patients with MS and 2813 controls from three populations: two case–control cohorts from Spain and Sweden, and a set of MS trio families from Finland. Results: Two single nucleotide polymorphism (SNPs) (rs4728142, rs3807306), and a 5 bp insertion-deletion polymorphism located in the promoter and first intron of the IRF5 gene, showed association signals with values of p<0.001 when the data from all cohorts were combined. The predisposing alleles were present on the same common haplotype in all populations. Using electrophoretic mobility shift assays we observed allele specific differences in protein binding for the SNP rs4728142 and the 5 bp indel, and by a proximity ligation assay we demonstrated increased binding of the transcription factor SP1 to the risk allele of the 5 bp indel. Conclusion: These findings add IRF5 to the short list of genes shown to be associated with MS in more than one population. Our study adds to the evidence that there might be genes or pathways that are common in multiple autoimmune diseases, and that the type I interferon system is likely to be involved in the development of these diseases. PMID:18285424

  15. Multiplex Droplet Digital PCR Quantification of Recurrent Somatic Mutations in Diffuse Large B-Cell and Follicular Lymphoma.

    PubMed

    Alcaide, Miguel; Yu, Stephen; Bushell, Kevin; Fornika, Daniel; Nielsen, Julie S; Nelson, Brad H; Mann, Koren K; Assouline, Sarit; Johnson, Nathalie A; Morin, Ryan D

    2016-09-01

    A plethora of options to detect mutations in tumor-derived DNA currently exist but each suffers limitations in analytical sensitivity, cost, or scalability. Droplet digital PCR (ddPCR) is an appealing technology for detecting the presence of specific mutations based on a priori knowledge and can be applied to tumor biopsies, including formalin-fixed paraffin embedded (FFPE) tissues. More recently, ddPCR has gained popularity in its utility in quantifying circulating tumor DNA. We have developed a suite of novel ddPCR assays for detecting recurrent mutations that are prevalent in common B-cell non-Hodgkin lymphomas (NHLs), including diffuse large B-cell lymphoma, follicular lymphoma, and lymphoplasmacytic lymphoma. These assays allowed the differentiation and counting of mutant and wild-type molecules using one single hydrolysis probe. We also implemented multiplexing that allowed the simultaneous detection of distinct mutations and an "inverted" ddPCR assay design, based on employing probes matching wild-type alleles, capable of detecting the presence of multiple single nucleotide polymorphisms. The assays successfully detected and quantified somatic mutations commonly affecting enhancer of zeste 2 polycomb repressive complex 2 subunit (EZH2) (Y641) and signal transducer and activator of transcription 6 (STAT6) (D419) hotspots in fresh tumor, FFPE, and liquid biopsies. The "inverted" ddPCR approach effectively reported any single nucleotide variant affecting either of these 2 hotspots as well. Finally, we could effectively multiplex hydrolysis probes targeting 2 additional lymphoma-related hotspots: myeloid differentiation primary response 88 (MYD88; L265P) and cyclin D3 (CCND3; I290R). Our suite of ddPCR assays provides sufficient analytical sensitivity and specificity for either the invasive or noninvasive detection of multiple recurrent somatic mutations in B-cell NHLs. © 2016 American Association for Clinical Chemistry.

  16. Base-By-Base: single nucleotide-level analysis of whole viral genome alignments.

    PubMed

    Brodie, Ryan; Smith, Alex J; Roper, Rachel L; Tcherepanov, Vasily; Upton, Chris

    2004-07-14

    With ever increasing numbers of closely related virus genomes being sequenced, it has become desirable to be able to compare two genomes at a level more detailed than gene content because two strains of an organism may share the same set of predicted genes but still differ in their pathogenicity profiles. For example, detailed comparison of multiple isolates of the smallpox virus genome (each approximately 200 kb, with 200 genes) is not feasible without new bioinformatics tools. A software package, Base-By-Base, has been developed that provides visualization tools to enable researchers to 1) rapidly identify and correct alignment errors in large, multiple genome alignments; and 2) generate tabular and graphical output of differences between the genomes at the nucleotide level. Base-By-Base uses detailed annotation information about the aligned genomes and can list each predicted gene with nucleotide differences, display whether variations occur within promoter regions or coding regions and whether these changes result in amino acid substitutions. Base-By-Base can connect to our mySQL database (Virus Orthologous Clusters; VOCs) to retrieve detailed annotation information about the aligned genomes or use information from text files. Base-By-Base enables users to quickly and easily compare large viral genomes; it highlights small differences that may be responsible for important phenotypic differences such as virulence. It is available via the Internet using Java Web Start and runs on Macintosh, PC and Linux operating systems with the Java 1.4 virtual machine.

  17. Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

    PubMed

    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

    2015-10-01

    The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

  18. Novel single nucleotide polymorphism associations with colorectal cancer on chromosome 8q24 in African and European Americans

    PubMed Central

    Kupfer, Sonia S.; Torres, Jada Benn; Hooker, Stanley; Anderson, Jeffrey R.; Skol, Andrew D.; Ellis, Nathan A.; Kittles, Rick A.

    2009-01-01

    Regions on chromosome 8q24 harbor susceptibility alleles for multiple cancers including colorectal (region 3) and prostate cancer (regions 1–4). The objectives of the present study were (i) to test whether single-nucleotide polymorphisms (SNPs) in region 4 are associated with colorectal cancer (CRC) in European or African Americans; (ii) to test whether 8q24 SNPs previously shown to be associated with colorectal and prostate cancer also show association in our multiethnic series and (iii) to test for association between 100 ancestry informative markers (AIMs) and CRC in both the African American and European American cohorts. In total, we genotyped nine markers on 8q24 and 100 unlinked AIMs in 569 CRC cases and 439 controls (490 European Americans and 518 African Americans) obtained retrospectively from a hospital-based sample. We found rs7008482 in 8q24 region 4 to be significantly associated with CRC in European Americans (P = 0.03). Also in region 4, we found that a second SNP, rs16900305, trended toward association with CRC in African Americans. The rs6983267 in region 3, previously implicated in CRC risk, trended toward association with disease in European Americans but not in African Americans. Finally, none of the 100 AIMs tested for association reached statistical significance after correction for multiple hypothesis testing. In summary, these results are evidence that 8q24 region 4 contains novel CRC-associated alleles in European and African Americans. PMID:19520795

  19. Sniffing out significant “Pee values”: genome wide association study of asparagus anosmia

    PubMed Central

    Markt, Sarah C; Nuttall, Elizabeth; Turman, Constance; Sinnott, Jennifer; Rimm, Eric B; Ecsedy, Ethan; Unger, Robert H; Fall, Katja; Finn, Stephen; Jensen, Majken K; Rider, Jennifer R; Kraft, Peter

    2016-01-01

    Objective To determine the inherited factors associated with the ability to smell asparagus metabolites in urine. Design Genome wide association study. Setting Nurses’ Health Study and Health Professionals Follow-up Study cohorts. Participants 6909 men and women of European-American descent with available genetic data from genome wide association studies. Main outcome measure Participants were characterized as asparagus smellers if they strongly agreed with the prompt “after eating asparagus, you notice a strong characteristic odor in your urine,” and anosmic if otherwise. We calculated per-allele estimates of asparagus anosmia for about nine million single nucleotide polymorphisms using logistic regression. P values <5×10-8 were considered as genome wide significant. Results 58.0% of men (n=1449/2500) and 61.5% of women (n=2712/4409) had anosmia. 871 single nucleotide polymorphisms reached genome wide significance for asparagus anosmia, all in a region on chromosome 1 (1q44: 248139851-248595299) containing multiple genes in the olfactory receptor 2 (OR2) family. Conditional analyses revealed three independent markers associated with asparagus anosmia: rs13373863, rs71538191, and rs6689553. Conclusion A large proportion of people have asparagus anosmia. Genetic variation near multiple olfactory receptor genes is associated with the ability of an individual to smell the metabolites of asparagus in urine. Future replication studies are necessary before considering targeted therapies to help anosmic people discover what they are missing. PMID:27965198

  20. Examining the role of common genetic variants on alcohol, tobacco, cannabis, and illicit drug dependence

    PubMed Central

    Palmer, RHC; Brick, L; Nugent, NR; Bidwell, LC; McGeary, JE; Knopik, VS; Keller, MC

    2014-01-01

    Background and Aims Twin and family studies suggest that genetic influences are shared across substances of abuse. However, despite evidence of heritability, genome-wide association and candidate gene studies have indicated numerous markers of limited effects, suggesting that much of the heritability remains missing. We estimated (1) the aggregate effect of common single nucleotide polymorphisms (SNPs) on multiple indicators of comorbid drug problems that are typically employed across community and population-based samples, and (2) the genetic covariance across these measures. Participants 2596 unrelated subjects from the “Study of Addiction: Genetics and Environment” provided information on alcohol, tobacco, cocaine, cannabis, and other illicit substance dependence. Phenotypic measures included: (1) a factor score based on DSM-IV drug dependence diagnoses (DD), (2) a factor score based on problem use (PU; i.e., 1+ DSM-IV symptoms), and (3) dependence vulnerability (DV; a ratio of DSM-IV symptoms to the number of substances used). Findings Univariate and bivariate Genome-wide complex trait analyses of this selected sample indicated that common SNPs explained 25-36% of the variance across measures, with DD and DV having the largest effects [h2SNP (CI)=0.36 (0.11-0.62) and 0.33(0.07-0.58), respectively; PU = 0.25 (-0.01-0.51)]. Genetic effects were shared across the three phenotypic measures of comorbid drug problems (rSNP; rDD-PU = 0.92 (0.76-1.00), rDD-DV = 0.97 (0.87-1.00), and rPU-DV = 0.96 (0.82-1.00)). Conclusion At least 20% of the variance in the generalized vulnerability to substance dependence is attributable to common single nucleotide polymorphisms. The additive effect of common single nucleotide polymorphisms is shared across important indicators of comorbid drug problems. PMID:25424661

  1. Statistical inference for Hardy-Weinberg proportions in the presence of missing genotype information.

    PubMed

    Graffelman, Jan; Sánchez, Milagros; Cook, Samantha; Moreno, Victor

    2013-01-01

    In genetic association studies, tests for Hardy-Weinberg proportions are often employed as a quality control checking procedure. Missing genotypes are typically discarded prior to testing. In this paper we show that inference for Hardy-Weinberg proportions can be biased when missing values are discarded. We propose to use multiple imputation of missing values in order to improve inference for Hardy-Weinberg proportions. For imputation we employ a multinomial logit model that uses information from allele intensities and/or neighbouring markers. Analysis of an empirical data set of single nucleotide polymorphisms possibly related to colon cancer reveals that missing genotypes are not missing completely at random. Deviation from Hardy-Weinberg proportions is mostly due to a lack of heterozygotes. Inbreeding coefficients estimated by multiple imputation of the missings are typically lowered with respect to inbreeding coefficients estimated by discarding the missings. Accounting for missings by multiple imputation qualitatively changed the results of 10 to 17% of the statistical tests performed. Estimates of inbreeding coefficients obtained by multiple imputation showed high correlation with estimates obtained by single imputation using an external reference panel. Our conclusion is that imputation of missing data leads to improved statistical inference for Hardy-Weinberg proportions.

  2. PCR/LDR/capillary electrophoresis for detection of single-nucleotide differences between fetal and maternal DNA in maternal plasma.

    PubMed

    Yi, Ping; Chen, Zhuqin; Zhao, Yan; Guo, Jianxin; Fu, Huabin; Zhou, Yuanguo; Yu, Lili; Li, Li

    2009-03-01

    The discovery of fetal DNA in maternal plasma has opened up an approach for noninvasive diagnosis. We have now assessed the possibility of detecting single-nucleotide differences between fetal and maternal DNA in maternal plasma by polymerase chain reaction (PCR)/ligase detection reaction((LDR)/capillary electrophoresis. PCR/LDR/capillary electrophoresis was applied to detect the genotype of c.454-397T>gene (ESR1) from experimental DNA models of maternal plasma at different sensitivity levels and 13 maternal plasma samples.alphaC in estrogen receptor. (1) Our results demonstrated that the technique could discriminate low abundance single-nucleotide mutation with a mutant/normal allele ratio up to 1:10 000. (2) Examination of ESR1 c.454-397T>C genotypes by using the method of restriction fragment length analysis was performed in 25 pregnant women, of whom 13 pregnant women had homozygous genotypes. The c.454-397T>C genotypes of paternally inherited fetal DNA in maternal plasma of these 13 women were detected by PCR/LDR/capillary electrophoresis, which were accordant with the results of umbilical cord blood. PCR/LDR/capillary electrophoresis has very high sensitivity to distinguish low abundance single nucleotide differences and can discriminate point mutations and single-nucleotide polymorphisms(SNPs) of paternally inherited fetal DNA in maternal plasma.

  3. A 2-Stage Genome-Wide Association Study to Identify Single Nucleotide Polymorphisms Associated With Development of Erectile Dysfunction Following Radiation Therapy for Prostate Cancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kerns, Sarah L.; Departments of Pathology and Genetics, Albert Einstein College of Medicine, Bronx, New York; Stock, Richard

    2013-01-01

    Purpose: To identify single nucleotide polymorphisms (SNPs) associated with development of erectile dysfunction (ED) among prostate cancer patients treated with radiation therapy. Methods and Materials: A 2-stage genome-wide association study was performed. Patients were split randomly into a stage I discovery cohort (132 cases, 103 controls) and a stage II replication cohort (128 cases, 102 controls). The discovery cohort was genotyped using Affymetrix 6.0 genome-wide arrays. The 940 top ranking SNPs selected from the discovery cohort were genotyped in the replication cohort using Illumina iSelect custom SNP arrays. Results: Twelve SNPs identified in the discovery cohort and validated in themore » replication cohort were associated with development of ED following radiation therapy (Fisher combined P values 2.1 Multiplication-Sign 10{sup -5} to 6.2 Multiplication-Sign 10{sup -4}). Notably, these 12 SNPs lie in or near genes involved in erectile function or other normal cellular functions (adhesion and signaling) rather than DNA damage repair. In a multivariable model including nongenetic risk factors, the odds ratios for these SNPs ranged from 1.6 to 5.6 in the pooled cohort. There was a striking relationship between the cumulative number of SNP risk alleles an individual possessed and ED status (Sommers' D P value = 1.7 Multiplication-Sign 10{sup -29}). A 1-allele increase in cumulative SNP score increased the odds for developing ED by a factor of 2.2 (P value = 2.1 Multiplication-Sign 10{sup -19}). The cumulative SNP score model had a sensitivity of 84% and specificity of 75% for prediction of developing ED at the radiation therapy planning stage. Conclusions: This genome-wide association study identified a set of SNPs that are associated with development of ED following radiation therapy. These candidate genetic predictors warrant more definitive validation in an independent cohort.« less

  4. Competing targets of microRNA-608 affect anxiety and hypertension

    PubMed Central

    Hanin, Geula; Shenhar-Tsarfaty, Shani; Yayon, Nadav; Hoe, Yau Yin; Bennett, Estelle R.; Sklan, Ella H.; Rao, Dabeeru. C.; Rankinen, Tuomo; Bouchard, Claude; Geifman-Shochat, Susana; Shifman, Sagiv; Greenberg, David S.; Soreq, Hermona

    2014-01-01

    MicroRNAs (miRNAs) can repress multiple targets, but how a single de-balanced interaction affects others remained unclear. We found that changing a single miRNA–target interaction can simultaneously affect multiple other miRNA–target interactions and modify physiological phenotype. We show that miR-608 targets acetylcholinesterase (AChE) and demonstrate weakened miR-608 interaction with the rs17228616 AChE allele having a single-nucleotide polymorphism (SNP) in the 3′-untranslated region (3′UTR). In cultured cells, this weakened interaction potentiated miR-608-mediated suppression of other targets, including CDC42 and interleukin-6 (IL6). Postmortem human cortices homozygote for the minor rs17228616 allele showed AChE elevation and CDC42/IL6 decreases compared with major allele homozygotes. Additionally, minor allele heterozygote and homozygote subjects showed reduced cortisol and elevated blood pressure, predicting risk of anxiety and hypertension. Parallel suppression of the conserved brain CDC42 activity by intracerebroventricular ML141 injection caused acute anxiety in mice. We demonstrate that SNPs in miRNA-binding regions could cause expanded downstream effects changing important biological pathways. PMID:24722204

  5. Aspergillus and Penicillium identification using DNA sequences: Barcode or MLST?

    USDA-ARS?s Scientific Manuscript database

    Current methods in DNA technology can detect single nucleotide polymorphisms with measurable accuracy using several different approaches appropriate for different uses. If there are even single nucleotide differences that are invariant markers of the species, we can accomplish identification through...

  6. Ultraviolet Shadowing of RNA Can Cause Significant Chemical Damage in Seconds

    PubMed Central

    Kladwang, Wipapat; Hum, Justine; Das, Rhiju

    2012-01-01

    Chemical purity of RNA samples is important for high-precision studies of RNA folding and catalytic behavior, but photodamage accrued during ultraviolet (UV) shadowing steps of sample preparation can reduce this purity. Here, we report the quantitation of UV-induced damage by using reverse transcription and single-nucleotide-resolution capillary electrophoresis. We found photolesions in a dozen natural and artificial RNAs; across multiple sequence contexts, dominantly at but not limited to pyrimidine doublets; and from multiple lamps recommended for UV shadowing. Irradiation time-courses revealed detectable damage within a few seconds of exposure for 254 nm lamps held at a distance of 5 to 10 cm from 0.5-mm thickness gels. Under these conditions, 200-nucleotide RNAs subjected to 20 seconds of UV shadowing incurred damage to 16-27% of molecules; and, due to a ‘skin effect’, the molecule-by-molecule distribution of lesions gave 4-fold higher variance than a Poisson distribution. Thicker gels, longer wavelength lamps, and shorter exposure times reduced but did not eliminate damage. These results suggest that RNA biophysical studies should report precautions taken to avoid artifactual heterogeneity from UV shadowing. PMID:22816040

  7. Nucleotide cleaving agents and method

    DOEpatents

    Que, Jr., Lawrence; Hanson, Richard S.; Schnaith, Leah M. T.

    2000-01-01

    The present invention provides a unique series of nucleotide cleaving agents and a method for cleaving a nucleotide sequence, whether single-stranded or double-stranded DNA or RNA, using and a cationic metal complex having at least one polydentate ligand to cleave the nucleotide sequence phosphate backbone to yield a hydroxyl end and a phosphate end.

  8. Clinical Relevance of Multiple Single-Nucleotide Polymorphisms in Pneumocystis jirovecii Pneumonia: Development of a Multiplex PCR-Single-Base-Extension Methodology▿

    PubMed Central

    Esteves, F.; Gaspar, J.; De Sousa, B.; Antunes, F.; Mansinho, K.; Matos, O.

    2011-01-01

    Pneumocystis jirovecii pneumonia (PcP) is a major cause of respiratory illness in patients with AIDS. The identification of multiple single-nucleotide polymorphisms (SNPs) at three distinct P. jirovecii loci encoding dihydrofolate reductase (DHFR), mitochondrial large-subunit rRNA (mtLSU rRNA), and superoxide dismutase (SOD) was achieved using multiplex-PCR (MPCR) followed by direct sequencing and two single-base extension (SBE) techniques. Four SNPs (DHFR312, mt85, SOD215, and SOD110), correlated previously with parameters of disease, were amplified and genotyped simultaneously. The concordance of results between the standard sequencing technique (direct sequencing) and SBE analysis was 96.9% for the acrylamide gel electrophoresis and 98.4% for the capillary electrophoresis. The cross-genetic analysis established several statistical associations among the SNPs studied: mt85C-SOD110T, SOD110T-SOD215C, and SOD110C-SOD215T. These results were confirmed by cluster analysis. Data showed that among the isolates with low to moderate parasite burden, the highest percentages of DHFR312C, mt85C, SOD110T, and SOD215C were detected, whereas for high parasite burden cases the highest frequencies were observed among isolates with DHFR312T, mt85T, SOD110C, and SOD215T. The polymorphisms studied were shown to be suitable genetic targets potentially correlated with PcP clinical data that can be used as predictors of outcome in further studies to help clinical decision-making in the management of PcP. The MPCR/SBE protocol described for the first time in the present study was shown to be a rapid, highly accurate method for genotyping P. jirovecii SNPs encoded by different loci that could be used for epidemiological studies and as an additional procedure for the prognostic classification and diagnosis of PcP. PMID:21389160

  9. Clinical relevance of multiple single-nucleotide polymorphisms in Pneumocystis jirovecii Pneumonia: development of a multiplex PCR-single-base-extension methodology.

    PubMed

    Esteves, F; Gaspar, J; De Sousa, B; Antunes, F; Mansinho, K; Matos, O

    2011-05-01

    Pneumocystis jirovecii pneumonia (PcP) is a major cause of respiratory illness in patients with AIDS. The identification of multiple single-nucleotide polymorphisms (SNPs) at three distinct P. jirovecii loci encoding dihydrofolate reductase (DHFR), mitochondrial large-subunit rRNA (mtLSU rRNA), and superoxide dismutase (SOD) was achieved using multiplex-PCR (MPCR) followed by direct sequencing and two single-base extension (SBE) techniques. Four SNPs (DHFR312, mt85, SOD215, and SOD110), correlated previously with parameters of disease, were amplified and genotyped simultaneously. The concordance of results between the standard sequencing technique (direct sequencing) and SBE analysis was 96.9% for the acrylamide gel electrophoresis and 98.4% for the capillary electrophoresis. The cross-genetic analysis established several statistical associations among the SNPs studied: mt85C-SOD110T, SOD110T-SOD215C, and SOD110C-SOD215T. These results were confirmed by cluster analysis. Data showed that among the isolates with low to moderate parasite burden, the highest percentages of DHFR312C, mt85C, SOD110T, and SOD215C were detected, whereas for high parasite burden cases the highest frequencies were observed among isolates with DHFR312T, mt85T, SOD110C, and SOD215T. The polymorphisms studied were shown to be suitable genetic targets potentially correlated with PcP clinical data that can be used as predictors of outcome in further studies to help clinical decision-making in the management of PcP. The MPCR/SBE protocol described for the first time in the present study was shown to be a rapid, highly accurate method for genotyping P. jirovecii SNPs encoded by different loci that could be used for epidemiological studies and as an additional procedure for the prognostic classification and diagnosis of PcP.

  10. Genetic analysis of glucosinolate variability in broccoli florets using genome-anchored single nucleotide polymorphisms.

    PubMed

    Brown, Allan F; Yousef, Gad G; Reid, Robert W; Chebrolu, Kranthi K; Thomas, Aswathy; Krueger, Christopher; Jeffery, Elizabeth; Jackson, Eric; Juvik, John A

    2015-07-01

    The identification of genetic factors influencing the accumulation of individual glucosinolates in broccoli florets provides novel insight into the regulation of glucosinolate levels in Brassica vegetables and will accelerate the development of vegetables with glucosinolate profiles tailored to promote human health. Quantitative trait loci analysis of glucosinolate (GSL) variability was conducted with a B. oleracea (broccoli) mapping population, saturated with single nucleotide polymorphism markers from a high-density array designed for rapeseed (Brassica napus). In 4 years of analysis, 14 QTLs were associated with the accumulation of aliphatic, indolic, or aromatic GSLs in floret tissue. The accumulation of 3-carbon aliphatic GSLs (2-propenyl and 3-methylsulfinylpropyl) was primarily associated with a single QTL on C05, but common regulation of 4-carbon aliphatic GSLs was not observed. A single locus on C09, associated with up to 40 % of the phenotypic variability of 2-hydroxy-3-butenyl GSL over multiple years, was not associated with the variability of precursor compounds. Similarly, QTLs on C02, C04, and C09 were associated with 4-methylsulfinylbutyl GSL concentration over multiple years but were not significantly associated with downstream compounds. Genome-specific SNP markers were used to identify candidate genes that co-localized to marker intervals and previously sequenced Brassica oleracea BAC clones containing known GSL genes (GSL-ALK, GSL-PRO, and GSL-ELONG) were aligned to the genomic sequence, providing support that at least three of our 14 QTLs likely correspond to previously identified GSL loci. The results demonstrate that previously identified loci do not fully explain GSL variation in broccoli. The identification of additional genetic factors influencing the accumulation of GSL in broccoli florets provides novel insight into the regulation of GSL levels in Brassicaceae and will accelerate development of vegetables with modified or enhanced GSL profiles.

  11. An Engineered Kinetic Amplification Mechanism for Single Nucleotide Variant Discrimination by DNA Hybridization Probes.

    PubMed

    Chen, Sherry Xi; Seelig, Georg

    2016-04-20

    Even a single-nucleotide difference between the sequences of two otherwise identical biological nucleic acids can have dramatic functional consequences. Here, we use model-guided reaction pathway engineering to quantitatively improve the performance of selective hybridization probes in recognizing single nucleotide variants (SNVs). Specifically, we build a detection system that combines discrimination by competition with DNA strand displacement-based catalytic amplification. We show, both mathematically and experimentally, that the single nucleotide selectivity of such a system in binding to single-stranded DNA and RNA is quadratically better than discrimination due to competitive hybridization alone. As an additional benefit the integrated circuit inherits the property of amplification and provides at least 10-fold better sensitivity than standard hybridization probes. Moreover, we demonstrate how the detection mechanism can be tuned such that the detection reaction is agnostic to the position of the SNV within the target sequence. in contrast, prior strand displacement-based probes designed for kinetic discrimination are highly sensitive to position effects. We apply our system to reliably discriminate between different members of the let-7 microRNA family that differ in only a single base position. Our results demonstrate the power of systematic reaction network design to quantitatively improve biotechnology.

  12. Association of single nucleotide polymorphism in CD28(C/T-I3 + 17) and CD40 (C/T-1) genes with the Graves' disease.

    PubMed

    Mustafa, Saima; Fatima, Hira; Fatima, Sadia; Khosa, Tafheem; Akbar, Atif; Shaikh, Rehan Sadiq; Iqbal, Furhan

    2018-01-01

    To find out a correlation between the single nucleotide polymorphisms in cluster of differentiation 28 and cluster of differentiation 40 genes with Graves' disease, if any. This case-control study was conducted at the Multan Institute of Nuclear Medicine and Radiotherapy, Multan, Pakistan, and comprised blood samples of Graves' disease patients and controls. Various risk factors were also correlated either with the genotype at each single-nucleotide polymorphism or with various combinations of genotypes studied during present investigation. Of the 160 samples, there were 80(50%) each from patients and controls. Risk factor analysis revealed that gender (p=0.008), marital status (p<0.001), education (p<0.001), smoking (p<0.001), tri-iodothyronine (P <0.001), thyroxin (p<0.001) and thyroid-stimulating hormone (p<0.000) levels in blood were associated with Graves' disease. Both single-nucleotide polymorphisms in both genes were not associated with Graves' disease, either individually or in any combined form.

  13. Systematic assessment of the performance of whole-genome amplification for SNP/CNV detection and β-thalassemia genotyping.

    PubMed

    He, Fei; Zhou, Wanjun; Cai, Ren; Yan, Tizhen; Xu, Xiangmin

    2018-04-01

    In this study, we aimed to assess the performance of two whole-genome amplification methods, multiple displacement amplification (MDA), and multiple annealing and looping-based amplification cycle (MALBAC), for β-thalassemia genotyping and single-nucleotide polymorphism (SNP)/copy-number variant (CNV) detection using two DNA sequencing assays. We collected peripheral blood, cell lines, and discarded embryos, and carried out MALBAC and MDA on single-cell and five-cell samples. We detected and statistically analyzed differences in the amplification efficiency, positive predictive value, sensitivity, allele dropout (ADO) rate, SNPs, and CV values between the two methods. Through Sanger sequencing at the single-cell and five-cell levels, we showed that both the amplification rate and ADO rate of MDA were better than those using MALBAC, and the sensitivity and positive predictive value obtained from MDA were higher than those from MALBAC for β-thalassemia genotyping. Using next-generation sequencing (NGS) at the single-cell level, we confirmed that MDA has better properties than MALBAC for SNP detection. However, MALBAC was more stable and homogeneous than MDA using low-depth NGS at the single-cell level for CNV detection. We conclude that MALBAC is the better option for CNV detection, while MDA is better suited for SNV detection.

  14. Identification and Characterization of Novel Variations in Platelet G-Protein Coupled Receptor (GPCR) Genes in Patients Historically Diagnosed with Type 1 von Willebrand Disease.

    PubMed

    Stockley, Jacqueline; Nisar, Shaista P; Leo, Vincenzo C; Sabi, Essa; Cunningham, Margaret R; Eikenboom, Jeroen C; Lethagen, Stefan; Schneppenheim, Reinhard; Goodeve, Anne C; Watson, Steve P; Mundell, Stuart J; Daly, Martina E

    2015-01-01

    The clinical expression of type 1 von Willebrand disease may be modified by co-inheritance of other mild bleeding diatheses. We previously showed that mutations in the platelet P2Y12 ADP receptor gene (P2RY12) could contribute to the bleeding phenotype in patients with type 1 von Willebrand disease. Here we investigated whether variations in platelet G protein-coupled receptor genes other than P2RY12 also contributed to the bleeding phenotype. Platelet G protein-coupled receptor genes P2RY1, F2R, F2RL3, TBXA2R and PTGIR were sequenced in 146 index cases with type 1 von Willebrand disease and the potential effects of identified single nucleotide variations were assessed using in silico methods and heterologous expression analysis. Seven heterozygous single nucleotide variations were identified in 8 index cases. Two single nucleotide variations were detected in F2R; a novel c.-67G>C transversion which reduced F2R transcriptional activity and a rare c.1063C>T transition predicting a p.L355F substitution which did not interfere with PAR1 expression or signalling. Two synonymous single nucleotide variations were identified in F2RL3 (c.402C>G, p.A134 =; c.1029 G>C p.V343 =), both of which introduced less commonly used codons and were predicted to be deleterious, though neither of them affected PAR4 receptor expression. A third single nucleotide variation in F2RL3 (c.65 C>A; p.T22N) was co-inherited with a synonymous single nucleotide variation in TBXA2R (c.6680 C>T, p.S218 =). Expression and signalling of the p.T22N PAR4 variant was similar to wild-type, while the TBXA2R variation introduced a cryptic splice site that was predicted to cause premature termination of protein translation. The enrichment of single nucleotide variations in G protein-coupled receptor genes among type 1 von Willebrand disease patients supports the view of type 1 von Willebrand disease as a polygenic disorder.

  15. Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array

    PubMed Central

    Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue

    2016-01-01

    DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

  16. Reenacting the birth of an intron

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hellsten, Uffe; Aspden, Julie L.; Rio, Donald C.

    2011-07-01

    An intron is an extended genomic feature whose function requires multiple constrained positions - donor and acceptor splice sites, a branch point, a polypyrimidine tract and suitable splicing enhancers - that may be distributed over hundreds or thousands of nucleotides. New introns are therefore unlikely to emerge by incremental accumulation of functional sub-elements. Here we demonstrate that a functional intron can be created de novo in a single step by a segmental genomic duplication. This experiment recapitulates in vivo the birth of an intron that arose in the ancestral jawed vertebrate lineage nearly half a billion years ago.

  17. Single-nucleotide polymorphism-gene intermixed networking reveals co-linkers connected to multiple gene expression phenotypes

    PubMed Central

    Gong, Bin-Sheng; Zhang, Qing-Pu; Zhang, Guang-Mei; Zhang, Shao-Jun; Zhang, Wei; Lv, Hong-Chao; Zhang, Fan; Lv, Sa-Li; Li, Chuan-Xing; Rao, Shao-Qi; Li, Xia

    2007-01-01

    Gene expression profiles and single-nucleotide polymorphism (SNP) profiles are modern data for genetic analysis. It is possible to use the two types of information to analyze the relationships among genes by some genetical genomics approaches. In this study, gene expression profiles were used as expression traits. And relationships among the genes, which were co-linked to a common SNP(s), were identified by integrating the two types of information. Further research on the co-expressions among the co-linked genes was carried out after the gene-SNP relationships were established using the Haseman-Elston sib-pair regression. The results showed that the co-expressions among the co-linked genes were significantly higher if the number of connections between the genes and a SNP(s) was more than six. Then, the genes were interconnected via one or more SNP co-linkers to construct a gene-SNP intermixed network. The genes sharing more SNPs tended to have a stronger correlation. Finally, a gene-gene network was constructed with their intensities of relationships (the number of SNP co-linkers shared) as the weights for the edges. PMID:18466544

  18. Tertiary network in mammalian mitochondrial tRNAAsp revealed by solution probing and phylogeny

    PubMed Central

    Messmer, Marie; Pütz, Joern; Suzuki, Takeo; Suzuki, Tsutomu; Sauter, Claude; Sissler, Marie; Catherine, Florentz

    2009-01-01

    Primary and secondary structures of mammalian mitochondrial (mt) tRNAs are divergent from canonical tRNA structures due to highly skewed nucleotide content and large size variability of D- and T-loops. The nonconservation of nucleotides involved in the expected network of tertiary interactions calls into question the rules governing a functional L-shaped three-dimensional (3D) structure. Here, we report the solution structure of human mt-tRNAAsp in its native post-transcriptionally modified form and as an in vitro transcript. Probing performed with nuclease S1, ribonuclease V1, dimethylsulfate, diethylpyrocarbonate and lead, revealed several secondary structures for the in vitro transcribed mt-tRNAAsp including predominantly the cloverleaf. On the contrary, the native tRNAAsp folds into a single cloverleaf structure, highlighting the contribution of the four newly identified post-transcriptional modifications to correct folding. Reactivities of nucleotides and phosphodiester bonds in the native tRNA favor existence of a full set of six classical tertiary interactions between the D-domain and the variable region, forming the core of the 3D structure. Reactivities of D- and T-loop nucleotides support an absence of interactions between these domains. According to multiple sequence alignments and search for conservation of Leontis–Westhof interactions, the tertiary network core building rules apply to all tRNAAsp from mammalian mitochondria. PMID:19767615

  19. Detecting Single-Nucleotides by Tunneling Current Measurements at Sub-MHz Temporal Resolution.

    PubMed

    Morikawa, Takanori; Yokota, Kazumichi; Tanimoto, Sachie; Tsutsui, Makusu; Taniguchi, Masateru

    2017-04-18

    Label-free detection of single-nucleotides was performed by fast tunneling current measurements in a polar solvent at 1 MHz sampling rate using SiO₂-protected Au nanoprobes. Short current spikes were observed, suggestive of trapping/detrapping of individual nucleotides between the nanoelectrodes. The fall and rise features of the electrical signatures indicated signal retardation by capacitance effects with a time constant of about 10 microseconds. The high temporal resolution revealed current fluctuations, reflecting the molecular conformation degrees of freedom in the electrode gap. The method presented in this work may enable direct characterizations of dynamic changes in single-molecule conformations in an electrode gap in liquid.

  20. [Single nucleotide polymorphism and its application in allogeneic hematopoietic stem cell transplantation--review].

    PubMed

    Li, Su-Xia

    2004-12-01

    Single nucleotide polymorphism (SNP) is the third genetic marker after restriction fragment length polymorphism (RFLP) and short tandem repeat. It represents the most density genetic variability in the human genome and has been widely used in gene location, cloning, and research of heredity variation, as well as parenthood identification in forensic medicine. As steady heredity polymorphism, single nucleotide polymorphism is becoming the focus of attention in monitoring chimerism and minimal residual disease in the patients after allogeneic hematopoietic stem cell transplantation. The article reviews SNP heredity characterization, analysis techniques and its applications in allogeneic stem cell transplantation and other fields.

  1. Combined use of a new SNP-based assay and multilocus SSR markers to assess genetic diversity of Xylella fastidiosa subsp. pauca infecting citrus and coffee plants.

    PubMed

    Montes-Borrego, Miguel; Lopes, Joao R S; Jiménez-Díaz, Rafael M; Landa, Blanca B

    2015-03-01

    Two haplotypes of Xylella fastidiosa subsp. pauca (Xfp) that correlated with their host of origin were identified in a collection of 90 isolates infecting citrus and coffee plants in Brazil, based on a single-nucleotide polymorphism in the gyrB sequence. A new single-nucleotide primer extension (SNuPE) protocol was designed for rapid identification of Xfp according to the host source. The protocol proved to be robust for the prediction of the Xfp host source in blind tests using DNA from cultures of the bacterium, infected plants, and insect vectors allowed to feed on Xfp-infected citrus plants. AMOVA and STRUCTURE analyses of microsatellite data separated most Xfp populations on the basis of their host source, indicating that they were genetically distinct. The combined use of the SNaPshot protocol and three previously developed multilocus SSR markers showed that two haplotypes and distinct isolates of Xfp infect citrus and coffee in Brazil and that multiple, genetically different isolates can be present in a single orchard or infect a single tree. This combined approach will be very useful in studies of the epidemiology of Xfp-induced diseases, host specificity of bacterial genotypes, the occurrence of Xfp host jumping, vector feeding habits, etc., in economically important cultivated plants or weed host reservoirs of Xfp in Brazil and elsewhere. Copyright© by the Spanish Society for Microbiology and Institute for Catalan Studies.

  2. A new single-nucleotide polymorphism database for rainbow trout generated through whole genome re-sequencing

    USDA-ARS?s Scientific Manuscript database

    Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

  3. Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array

    USDA-ARS?s Scientific Manuscript database

    High-density single nucleotide polymorphism (SNP) genotyping chips are a powerful tool for studying genomic patterns of diversity, inferring ancestral relationships among individuals in populations and studying marker-trait associations in mapping experiments. We developed a genotyping array includ...

  4. Novel high-speed droplet-allele specific-polymerase chain reaction: application in the rapid genotyping of single nucleotide polymorphisms.

    PubMed

    Taira, Chiaki; Matsuda, Kazuyuki; Yamaguchi, Akemi; Sueki, Akane; Koeda, Hiroshi; Takagi, Fumio; Kobayashi, Yukihiro; Sugano, Mitsutoshi; Honda, Takayuki

    2013-09-23

    Single nucleotide alterations such as single nucleotide polymorphisms (SNP) and single nucleotide mutations are associated with responses to drugs and predisposition to several diseases, and they contribute to the pathogenesis of malignancies. We developed a rapid genotyping assay based on the allele-specific polymerase chain reaction (AS-PCR) with our droplet-PCR machine (droplet-AS-PCR). Using 8 SNP loci, we evaluated the specificity and sensitivity of droplet-AS-PCR. Buccal cells were pretreated with proteinase K and subjected directly to the droplet-AS-PCR without DNA extraction. The genotypes determined using the droplet-AS-PCR were then compared with those obtained by direct sequencing. Specific PCR amplifications for the 8 SNP loci were detected, and the detection limit of the droplet-AS-PCR was found to be 0.1-5.0% by dilution experiments. Droplet-AS-PCR provided specific amplification when using buccal cells, and all the genotypes determined within 9 min were consistent with those obtained by direct sequencing. Our novel droplet-AS-PCR assay enabled high-speed amplification retaining specificity and sensitivity and provided ultra-rapid genotyping. Crude samples such as buccal cells were available for the droplet-AS-PCR assay, resulting in the reduction of the total analysis time. Droplet-AS-PCR may therefore be useful for genotyping or the detection of single nucleotide alterations. Copyright © 2013 Elsevier B.V. All rights reserved.

  5. Identification of Critical Residues for the Tight Binding of Both Correct and Incorrect Nucleotides to Human DNA Polymerase λ

    PubMed Central

    Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai

    2010-01-01

    DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705

  6. Genome-wide association study of fertility traits in dairy cattle using high-density single nucleotide polymorphism marker panels

    USDA-ARS?s Scientific Manuscript database

    Unfavorable genetic correlations between production and fertility traits are well documented. Genetic selection for fertility traits is slow, however, due to low heritabilities. Identification of single nucleotide polymorphisms (SNP) involved in reproduction could improve reliability of genomic esti...

  7. Discovery, Validation and Characterization of 1039 Cattle Single Nucleotide Polymorphisms

    USDA-ARS?s Scientific Manuscript database

    We identified approximately 13000 putative single nucleotide polymorphisms (SNPs) by comparison of repeat-masked BAC-end sequences from the cattle RPCI-42 BAC library with whole-genome shotgun contigs of cattle genome assembly Btau 1.0. Genotyping of a subset of these SNPs was performed on a panel ...

  8. High-throughput single nucleotide polymorphism genotyping for breeding applications in rice using the BeadXpress platform

    USDA-ARS?s Scientific Manuscript database

    Multiplexed single nucleotide polymorphism (SNP) markers have the potential to increase the speed and cost-effectiveness of genotyping, provided that an optimal SNP density is used for each application. To test the efficiency of multiplexed SNP genotyping for diversity, mapping and breeding applicat...

  9. Developing Single Nucleotide Polymorphism (SNP) markers from transcriptome sequences for the identification of longan (Dimocarpus longan) germplasm

    USDA-ARS?s Scientific Manuscript database

    Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in...

  10. Informativeness of single nucleotide polymorphisms and relationships among onion populations from important world production regions

    USDA-ARS?s Scientific Manuscript database

    Single nucleotide polymorphisms (SNPs) were genotyped using a high-density array and DNAs from individual plants from important onion populations from major production regions world-wide and the likely progenitor of onion, Allium vavilovii. Genotypes at 1226 SNPs were used to estimate genetic relati...

  11. Relationships among calpastatin single nucleotide polymorphisms, calpastatin expression and tenderness in pork longissimus

    USDA-ARS?s Scientific Manuscript database

    Genome scans in the pig have identified a region on chromosome 2 (SSC2) associated with tenderness. Calpastatin is a likely positional candidate gene in this region because of its inhibitory role in the calpain system that is involved in postmortem tenderization. Novel single nucleotide polymorphism...

  12. Lineage and genogroup-defining single nucleotide polymorphisms of Escherichia coli 0157:H7

    USDA-ARS?s Scientific Manuscript database

    Escherichia coli O157:H7 is a zoonotic human pathogen for which cattle are an important reservoir host. Using both previously published and new sequencing data, a 48-locus single nucleotide polymorphism (SNP) based typing panel was developed that redundantly identified eleven genogroups that span ...

  13. A new single-nucleotide polymorphisms database for rainbow trout generated through whole genome resequencing of selected samples

    USDA-ARS?s Scientific Manuscript database

    Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

  14. Single 23S rRNA mutations at the ribosomal peptidyl transferase centre confer resistance to valnemulin and other antibiotics in Mycobacterium smegmatis by perturbation of the drug binding pocket.

    PubMed

    Long, Katherine S; Poehlsgaard, Jacob; Hansen, Lykke H; Hobbie, Sven N; Böttger, Erik C; Vester, Birte

    2009-03-01

    Tiamulin and valnemulin target the peptidyl transferase centre (PTC) on the bacterial ribosome. They are used in veterinary medicine to treat infections caused by a variety of bacterial pathogens, including the intestinal spirochetes Brachyspira spp. Mutations in ribosomal protein L3 and 23S rRNA have previously been associated with tiamulin resistance in Brachyspira spp. isolates, but as multiple mutations were isolated together, the roles of the individual mutations are unclear. In this work, individual 23S rRNA mutations associated with pleuromutilin resistance at positions 2055, 2447, 2504 and 2572 (Escherichia coli numbering) are introduced into a Mycobacterium smegmatis strain with a single rRNA operon. The single mutations each confer a significant and similar degree of valnemulin resistance and those at 2447 and 2504 also confer cross-resistance to other antibiotics that bind to the PTC in M. smegmatis. Antibiotic footprinting experiments on mutant ribosomes show that the introduced mutations cause structural perturbations at the PTC and reduced binding of pleuromutilin antibiotics. This work underscores the fact that mutations at nucleotides distant from the pleuromutilin binding site can confer the same level of valnemulin resistance as those at nucleotides abutting the bound drug, and suggests that the former function indirectly by altering local structure and flexibility at the drug binding pocket.

  15. Homogeneous real-time detection of single-nucleotide polymorphisms by strand displacement amplification on the BD ProbeTec ET system.

    PubMed

    Wang, Sha-Sha; Thornton, Keith; Kuhn, Andrew M; Nadeau, James G; Hellyer, Tobin J

    2003-10-01

    The BD ProbeTec ET System is based on isothermal strand displacement amplification (SDA) of target nucleic acid coupled with homogeneous real-time detection using fluorescent probes. We have developed a novel, rapid method using this platform that incorporates a universal detection format for identification of single-nucleotide polymorphisms (SNPs) and other genotypic variations. The system uses a common pair of fluorescent Detector Probes in conjunction with unlabeled allele-specific Adapter Primers and a universal buffer chemistry to permit analysis of multiple SNP loci under generic assay conditions. We used Detector Probes labeled with different dyes to facilitate differentiation of two alternative alleles in a single reaction with no postamplification manipulation. We analyzed six SNPs within the human beta(2)-adrenergic receptor (beta(2)AR) gene, using whole blood, buccal swabs, and urine samples, and compared results with those obtained by DNA sequencing. Unprocessed whole blood was successfully genotyped with as little as 0.1-1 micro L of sample per reaction. All six beta(2)AR assays were able to accommodate >/==" BORDER="0">20 micro L of unprocessed whole blood. For the 14 individuals tested, genotypes determined with the six beta(2)AR assays agreed with DNA sequencing results. SDA-based allelic differentiation on the BD ProbeTec ET System can detect SNPs rapidly, using whole blood, buccal swabs, or urine.

  16. MPRAnator: a web-based tool for the design of massively parallel reporter assay experiments

    PubMed Central

    Georgakopoulos-Soares, Ilias; Jain, Naman; Gray, Jesse M; Hemberg, Martin

    2017-01-01

    Motivation: With the rapid advances in DNA synthesis and sequencing technologies and the continuing decline in the associated costs, high-throughput experiments can be performed to investigate the regulatory role of thousands of oligonucleotide sequences simultaneously. Nevertheless, designing high-throughput reporter assay experiments such as massively parallel reporter assays (MPRAs) and similar methods remains challenging. Results: We introduce MPRAnator, a set of tools that facilitate rapid design of MPRA experiments. With MPRA Motif design, a set of variables provides fine control of how motifs are placed into sequences, thereby allowing the investigation of the rules that govern transcription factor (TF) occupancy. MPRA single-nucleotide polymorphism design can be used to systematically examine the functional effects of single or combinations of single-nucleotide polymorphisms at regulatory sequences. Finally, the Transmutation tool allows for the design of negative controls by permitting scrambling, reversing, complementing or introducing multiple random mutations in the input sequences or motifs. Availability and implementation: MPRAnator tool set is implemented in Python, Perl and Javascript and is freely available at www.genomegeek.com and www.sanger.ac.uk/science/tools/mpranator. The source code is available on www.github.com/hemberg-lab/MPRAnator/ under the MIT license. The REST API allows programmatic access to MPRAnator using simple URLs. Contact: igs@sanger.ac.uk or mh26@sanger.ac.uk Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27605100

  17. MPRAnator: a web-based tool for the design of massively parallel reporter assay experiments.

    PubMed

    Georgakopoulos-Soares, Ilias; Jain, Naman; Gray, Jesse M; Hemberg, Martin

    2017-01-01

    With the rapid advances in DNA synthesis and sequencing technologies and the continuing decline in the associated costs, high-throughput experiments can be performed to investigate the regulatory role of thousands of oligonucleotide sequences simultaneously. Nevertheless, designing high-throughput reporter assay experiments such as massively parallel reporter assays (MPRAs) and similar methods remains challenging. We introduce MPRAnator, a set of tools that facilitate rapid design of MPRA experiments. With MPRA Motif design, a set of variables provides fine control of how motifs are placed into sequences, thereby allowing the investigation of the rules that govern transcription factor (TF) occupancy. MPRA single-nucleotide polymorphism design can be used to systematically examine the functional effects of single or combinations of single-nucleotide polymorphisms at regulatory sequences. Finally, the Transmutation tool allows for the design of negative controls by permitting scrambling, reversing, complementing or introducing multiple random mutations in the input sequences or motifs. MPRAnator tool set is implemented in Python, Perl and Javascript and is freely available at www.genomegeek.com and www.sanger.ac.uk/science/tools/mpranator The source code is available on www.github.com/hemberg-lab/MPRAnator/ under the MIT license. The REST API allows programmatic access to MPRAnator using simple URLs. igs@sanger.ac.uk or mh26@sanger.ac.ukSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press.

  18. Unraveling Haplotype Diversity of the Apical Membrane Antigen-1 Gene in Plasmodium falciparum Populations in Thailand

    PubMed Central

    Lumkul, Lalita; Sawaswong, Vorthon; Simpalipan, Phumin; Kaewthamasorn, Morakot; Harnyuttanakorn, Pongchai; Pattaradilokrat, Sittiporn

    2018-01-01

    Development of an effective vaccine is critically needed for the prevention of malaria. One of the key antigens for malaria vaccines is the apical membrane antigen 1 (AMA-1) of the human malaria parasite Plasmodium falciparum, the surface protein for erythrocyte invasion of the parasite. The gene encoding AMA-1 has been sequenced from populations of P. falciparum worldwide, but the haplotype diversity of the gene in P. falciparum populations in the Greater Mekong Subregion (GMS), including Thailand, remains to be characterized. In the present study, the AMA-1 gene was PCR amplified and sequenced from the genomic DNA of 65 P. falciparum isolates from 5 endemic areas in Thailand. The nearly full-length 1,848 nucleotide sequence of AMA-1 was subjected to molecular analyses, including nucleotide sequence diversity, haplotype diversity and deduced amino acid sequence diversity and neutrality tests. Phylogenetic analysis and pairwise population differentiation (Fst indices) were performed to infer the population structure. The analyses identified 60 single nucleotide polymorphic loci, predominately located in domain I of AMA-1. A total of 31 unique AMA-1 haplotypes were identified, which included 11 novel ones. The phylogenetic tree of the AMA-1 haplotypes revealed multiple clades of AMA-1, each of which contained parasites of multiple geographical origins, consistent with the Fst indices indicating genetic homogeneity or gene flow among geographically distinct populations of P. falciparum in Thailand’s borders with Myanmar, Laos and Cambodia. In summary, the study revealed novel haplotypes and population structure needed for the further advancement of AMA-1-based malaria vaccines in the GMS. PMID:29742870

  19. A novel MALDI–TOF based methodology for genotyping single nucleotide polymorphisms

    PubMed Central

    Blondal, Thorarinn; Waage, Benedikt G.; Smarason, Sigurdur V.; Jonsson, Frosti; Fjalldal, Sigridur B.; Stefansson, Kari; Gulcher, Jeffery; Smith, Albert V.

    2003-01-01

    A new MALDI–TOF based detection assay was developed for analysis of single nucleotide polymorphisms (SNPs). It is a significant modification on the classic three-step minisequencing method, which includes a polymerase chain reaction (PCR), removal of excess nucleotides and primers, followed by primer extension in the presence of dideoxynucleotides using modified thermostable DNA polymerase. The key feature of this novel assay is reliance upon deoxynucleotide mixes, lacking one of the nucleotides at the polymorphic position. During primer extension in the presence of depleted nucleotide mixes, standard thermostable DNA polymerases dissociate from the template at positions requiring a depleted nucleotide; this principal was harnessed to create a genotyping assay. The assay design requires a primer- extension primer having its 3′-end one nucleotide upstream from the interrogated site. The assay further utilizes the same DNA polymerase in both PCR and the primer extension step. This not only simplifies the assay but also greatly reduces the cost per genotype compared to minisequencing methodology. We demonstrate accurate genotyping using this methodology for two SNPs run in both singleplex and duplex reactions. We term this assay nucleotide depletion genotyping (NUDGE). Nucleotide depletion genotyping could be extended to other genotyping assays based on primer extension such as detection by gel or capillary electrophoresis. PMID:14654708

  20. Biological nanopore MspA for DNA sequencing

    NASA Astrophysics Data System (ADS)

    Manrao, Elizabeth A.

    Unlocking the information hidden in the human genome provides insight into the inner workings of complex biological systems and can be used to greatly improve health-care. In order to allow for widespread sequencing, new technologies are required that provide fast and inexpensive readings of DNA. Nanopore sequencing is a third generation DNA sequencing technology that is currently being developed to fulfill this need. In nanopore sequencing, a voltage is applied across a small pore in an electrolyte solution and the resulting ionic current is recorded. When DNA passes through the channel, the ionic current is partially blocked. If the DNA bases uniquely modulate the ionic current flowing through the channel, the time trace of the current can be related to the sequence of DNA passing through the pore. There are two main challenges to realizing nanopore sequencing: identifying a pore with sensitivity to single nucleotides and controlling the translocation of DNA through the pore so that the small single nucleotide current signatures are distinguishable from background noise. In this dissertation, I explore the use of Mycobacterium smegmatis porin A (MspA) for nanopore sequencing. In order to determine MspA's sensitivity to single nucleotides, DNA strands of various compositions are held in the pore as the resulting ionic current is measured. DNA is immobilized in MspA by attaching it to a large molecule which acts as an anchor. This technique confirms the single nucleotide resolution of the pore and additionally shows that MspA is sensitive to epigenetic modifications and single nucleotide polymorphisms. The forces from the electric field within MspA, the effective charge of nucleotides, and elasticity of DNA are estimated using a Freely Jointed Chain model of single stranded DNA. These results offer insight into the interactions of DNA within the pore. With the nucleotide sensitivity of MspA confirmed, a method is introduced to controllably pass DNA through the pore. Using a DNA polymerase, DNA strands are stepped through MspA one nucleotide at a time. The steps are observable as distinct levels on the ionic-current time-trace and are related to the DNA sequence. These experiments overcome the two fundamental challenges to realizing MspA nanopore sequencing and pave the way to the development of a commercial technology.

  1. Sniffing out significant "Pee values": genome wide association study of asparagus anosmia.

    PubMed

    Markt, Sarah C; Nuttall, Elizabeth; Turman, Constance; Sinnott, Jennifer; Rimm, Eric B; Ecsedy, Ethan; Unger, Robert H; Fall, Katja; Finn, Stephen; Jensen, Majken K; Rider, Jennifer R; Kraft, Peter; Mucci, Lorelei A

    2016-12-13

     To determine the inherited factors associated with the ability to smell asparagus metabolites in urine.  Genome wide association study.  Nurses' Health Study and Health Professionals Follow-up Study cohorts.  6909 men and women of European-American descent with available genetic data from genome wide association studies.  Participants were characterized as asparagus smellers if they strongly agreed with the prompt "after eating asparagus, you notice a strong characteristic odor in your urine," and anosmic if otherwise. We calculated per-allele estimates of asparagus anosmia for about nine million single nucleotide polymorphisms using logistic regression. P values <5×10 -8 were considered as genome wide significant.  58.0% of men (n=1449/2500) and 61.5% of women (n=2712/4409) had anosmia. 871 single nucleotide polymorphisms reached genome wide significance for asparagus anosmia, all in a region on chromosome 1 (1q44: 248139851-248595299) containing multiple genes in the olfactory receptor 2 (OR2) family. Conditional analyses revealed three independent markers associated with asparagus anosmia: rs13373863, rs71538191, and rs6689553.  A large proportion of people have asparagus anosmia. Genetic variation near multiple olfactory receptor genes is associated with the ability of an individual to smell the metabolites of asparagus in urine. Future replication studies are necessary before considering targeted therapies to help anosmic people discover what they are missing. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  2. Wavelet-based identification of DNA focal genomic aberrations from single nucleotide polymorphism arrays

    PubMed Central

    2011-01-01

    Background Copy number aberrations (CNAs) are an important molecular signature in cancer initiation, development, and progression. However, these aberrations span a wide range of chromosomes, making it hard to distinguish cancer related genes from other genes that are not closely related to cancer but are located in broadly aberrant regions. With the current availability of high-resolution data sets such as single nucleotide polymorphism (SNP) microarrays, it has become an important issue to develop a computational method to detect driving genes related to cancer development located in the focal regions of CNAs. Results In this study, we introduce a novel method referred to as the wavelet-based identification of focal genomic aberrations (WIFA). The use of the wavelet analysis, because it is a multi-resolution approach, makes it possible to effectively identify focal genomic aberrations in broadly aberrant regions. The proposed method integrates multiple cancer samples so that it enables the detection of the consistent aberrations across multiple samples. We then apply this method to glioblastoma multiforme and lung cancer data sets from the SNP microarray platform. Through this process, we confirm the ability to detect previously known cancer related genes from both cancer types with high accuracy. Also, the application of this approach to a lung cancer data set identifies focal amplification regions that contain known oncogenes, though these regions are not reported using a recent CNAs detecting algorithm GISTIC: SMAD7 (chr18q21.1) and FGF10 (chr5p12). Conclusions Our results suggest that WIFA can be used to reveal cancer related genes in various cancer data sets. PMID:21569311

  3. Variation of Cats under Domestication: Genetic Assignment of Domestic Cats to Breeds and Worldwide Random Bred Populations

    PubMed Central

    Kurushima, J. D.; Lipinski, M. J.; Gandolfi, B.; Froenicke, L.; Grahn, J. C.; Grahn, R. A.; Lyons, L. A.

    2012-01-01

    Summary Both cat breeders and the lay public have interests in the origins of their pets, not only in the genetic identity of the purebred individuals, but also the historical origins of common household cats. The cat fancy is a relatively new institution with over 85% of its 40–50 breeds arising only in the past 75 years, primarily through selection on single-gene aesthetic traits. The short, yet intense cat breed history poses a significant challenge to the development of a genetic marker-based breed identification strategy. Using different breed assignment strategies and methods, 477 cats representing 29 fancy breeds were analysed with 38 short tandem repeats, 148 intergenic and five phenotypic single nucleotide polymorphisms. Results suggest the frequentist method of Paetkau (accuracy single nucleotide polymorphisms = 0.78, short tandem repeats = 0.88) surpasses the Bayesian method of Rannala and Mountain (single nucleotide polymorphisms = 0.56, short tandem repeats = 0.83) for accurate assignment of individuals to the correct breed. Additionally, a post-assignment verification step with the five phenotypic single nucleotide polymorphisms accurately identified between 0.31 and 0.58 of the mis-assigned individuals raising the sensitivity of assignment with the frequentist method to 0.89 and 0.92 single nucleotide polymorphisms and short tandem repeats respectively. This study provides a novel multi-step assignment strategy and suggests that, despite their short breed history and breed family groupings, a majority of cats can be assigned to their proper breed or population of origin, i.e. race. PMID:23171373

  4. Formation of template-switching artifacts by linear amplification.

    PubMed

    Chakravarti, Dhrubajyoti; Mailander, Paula C

    2008-07-01

    Linear amplification is a method of synthesizing single-stranded DNA from either a single-stranded DNA or one strand of a double-stranded DNA. In this protocol, molecules of a single primer DNA are extended by multiple rounds of DNA synthesis at high temperature using thermostable DNA polymerases. Although linear amplification generates the intended full-length single-stranded product, it is more efficient over single-stranded templates than double-stranded templates. We analyzed linear amplification over single- or double-stranded mouse H-ras DNA (exon 1-2 region). The single-stranded H-ras template yielded only the intended product. However, when the double-stranded template was used, additional artifact products were observed. Increasing the concentration of the double-stranded template produced relatively higher amounts of these artifact products. One of the artifact DNA bands could be mapped and analyzed by sequencing. It contained three template-switching products. These DNAs were formed by incomplete DNA strand extension over the template strand, followed by switching to the complementary strand at a specific Ade nucleotide within a putative hairpin sequence, from which DNA synthesis continued over the complementary strand.

  5. Imputation of single nucleotide polymorhpism genotypes of Hereford cattle: reference panel size, family relationship and population structure

    USDA-ARS?s Scientific Manuscript database

    The objective of this study is to investigate single nucleotide polymorphism (SNP) genotypes imputation of Hereford cattle. Purebred Herefords were from two sources, Line 1 Hereford (N=240) and representatives of Industry Herefords (N=311). Using different reference panels of 62 and 494 males with 1...

  6. A resource of single-nucleotide polymorphisms for rainbow trout generated by restriction-site associated DNA sequencing of doubled haploids

    USDA-ARS?s Scientific Manuscript database

    Salmonid genomes are considered to be in a pseudo-tetraploid state as a result of an evolutionarily recent genome duplication event. This situation complicates single nucleotide polymorphism (SNP) discovery in rainbow trout as many putative SNPs are actually paralogous sequence variants (PSVs) and ...

  7. Single nucleotide polymorphisms in candidate genes associated with fertilizing ability of sperm and subsequent embryonic development in cattle

    USDA-ARS?s Scientific Manuscript database

    Fertilization and development of the preimplantation embryo is under genetic control. The goal of the current study was to test 434 single nucleotide polymorphisms (SNPs) for association with genetic variation in fertilization and early embryonic development. The approach was to produce embryos from...

  8. Prospects for inferring pairwise relationships with single nucleotide polymorphisms

    Treesearch

    Jeffery C. Glaubitz; O. Eugene, Jr. Rhodes; J. Andrew DeWoody

    2003-01-01

    An extraordinarily large number of single nucleotide polymorphisms (SNPs) are now available in humans as well as in other model organisms. Technological advancements may soon make it feasible to assay hundreds of SNPs in virtually any organism of interest. One potential application of SNPs is the determination of pairwise genetic relationships in populations without...

  9. Short communication: Relationship of call rate and accuracy of single nucleotide polymorphism genotypes in dairy cattle

    USDA-ARS?s Scientific Manuscript database

    Call rate has been used as a measure of quality on both a single nucleotide polymorphism (SNP) and animal basis since SNP genotypes were first used in genomic evaluation of dairy cattle. The genotyping laboratories perform initial quality control screening and genotypes that fail are usually exclude...

  10. Single nucleotide polymorphisms generated by genotyping by sequencing to characterize genome-wide diversity, linkage disequilibrium, and selective sweeps in cultivated watermelon

    USDA-ARS?s Scientific Manuscript database

    Large datasets containing single nucleotide polymorphisms (SNPs) are used to analyze genome-wide diversity in a robust collection of cultivars from representative accessions, across the world. The extent of linkage disequilibrium (LD) within a population determines the number of markers required fo...

  11. Lack of Association Between Polymorphisms in Dopa Decarboxylase and Dopamine Receptor-1 Genes With Childhood Autism in Chinese Han Population.

    PubMed

    Yu, Hong; Liu, Jun; Yang, Aiping; Yang, Guohui; Yang, Wenjun; Lei, Heyue; Quan, Jianjun; Zhang, Zengyu

    2016-04-01

    Genetic factors play an important role in childhood autism. This study is to determine the association of single-nucleotide polymorphisms in dopa decarboxylase (DDC) and dopamine receptor-1 (DRD1) genes with childhood autism, in a Chinese Han population. A total of 211 autistic children and 250 age- and gender-matched healthy controls were recruited. The severity of disease was determined by Children Autism Rating Scale scores. TaqMan Probe by real-time polymerase chain reaction was used to determine genotypes and allele frequencies of single-nucleotide polymorphism rs6592961 in DDC and rs251937 in DRD1. Case-control and case-only studies were respectively performed, to determine the contribution of both single-nucleotide polymorphisms to the predisposition of disease and its severity. Our results showed that there was no significant association of the genotypes and allele frequencies of both single-nucleotide polymorphisms concerning childhood autism and its severity. More studies with larger samples are needed to corroborate their predicting roles. © The Author(s) 2015.

  12. Single-molecule comparison of DNA Pol I activity with native and analog nucleotides

    NASA Astrophysics Data System (ADS)

    Gul, Osman; Olsen, Tivoli; Choi, Yongki; Corso, Brad; Weiss, Gregory; Collins, Philip

    2014-03-01

    DNA polymerases are critical enzymes for DNA replication, and because of their complex catalytic cycle they are excellent targets for investigation by single-molecule experimental techniques. Recently, we studied the Klenow fragment (KF) of DNA polymerase I using a label-free, electronic technique involving single KF molecules attached to carbon nanotube transistors. The electronic technique allowed long-duration monitoring of a single KF molecule while processing thousands of template strands. Processivity of up to 42 nucleotide bases was directly observed, and statistical analysis of the recordings determined key kinetic parameters for the enzyme's open and closed conformations. Subsequently, we have used the same technique to compare the incorporation of canonical nucleotides like dATP to analogs like 1-thio-2'-dATP. The analog had almost no affect on duration of the closed conformation, during which the nucleotide is incorporated. On the other hand, the analog increased the rate-limiting duration of the open conformation by almost 40%. We propose that the thiolated analog interferes with KF's recognition and binding, two key steps that determine its ensemble turnover rate.

  13. Transcript-specific, single-nucleotide polymorphism discovery and linkage analysis in hexaploid bread wheat (Triticum aestivum L.).

    PubMed

    Allen, Alexandra M; Barker, Gary L A; Berry, Simon T; Coghill, Jane A; Gwilliam, Rhian; Kirby, Susan; Robinson, Phil; Brenchley, Rachel C; D'Amore, Rosalinda; McKenzie, Neil; Waite, Darren; Hall, Anthony; Bevan, Michael; Hall, Neil; Edwards, Keith J

    2011-12-01

    Food security is a global concern and substantial yield increases in cereal crops are required to feed the growing world population. Wheat is one of the three most important crops for human and livestock feed. However, the complexity of the genome coupled with a decline in genetic diversity within modern elite cultivars has hindered the application of marker-assisted selection (MAS) in breeding programmes. A crucial step in the successful application of MAS in breeding programmes is the development of cheap and easy to use molecular markers, such as single-nucleotide polymorphisms. To mine selected elite wheat germplasm for intervarietal single-nucleotide polymorphisms, we have used expressed sequence tags derived from public sequencing programmes and next-generation sequencing of normalized wheat complementary DNA libraries, in combination with a novel sequence alignment and assembly approach. Here, we describe the development and validation of a panel of 1114 single-nucleotide polymorphisms in hexaploid bread wheat using competitive allele-specific polymerase chain reaction genotyping technology. We report the genotyping results of these markers on 23 wheat varieties, selected to represent a broad cross-section of wheat germplasm including a number of elite UK varieties. Finally, we show that, using relatively simple technology, it is possible to rapidly generate a linkage map containing several hundred single-nucleotide polymorphism markers in the doubled haploid mapping population of Avalon × Cadenza. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

  14. TPH-2 Polymorphisms Interact with Early Life Stress to Influence Response to Treatment with Antidepressant Drugs.

    PubMed

    Xu, Zhi; Reynolds, Gavin P; Yuan, Yonggui; Shi, Yanyan; Pu, Mengjia; Zhang, Zhijun

    2016-11-01

    Variation in genes implicated in monoamine neurotransmission may interact with environmental factors to influence antidepressant response. We aimed to determine how a range of single nucleotide polymorphisms in monoaminergic genes influence this response to treatment and how they interact with childhood trauma and recent life stress in a Chinese sample. An initial study of monoaminergic coding region single nucleotide polymorphisms identified significant associations of TPH2 and HTR1B single nucleotide polymorphisms with treatment response that showed interactions with childhood and recent life stress, respectively (Xu et al., 2012). A total of 47 further single nucleotide polymorphisms in 17 candidate monoaminergic genes were genotyped in 281 Chinese Han patients with major depressive disorder. Response to 6 weeks' antidepressant treatment was determined by change in the 17-item Hamilton Depression Rating Scale score, and previous stressful events were evaluated by the Life Events Scale and Childhood Trauma Questionnaire-Short Form. Three TPH2 single nucleotide polymorphisms (rs11178998, rs7963717, and rs2171363) were significantly associated with antidepressant response in this Chinese sample, as was a haplotype in TPH2 (rs2171363 and rs1487278). One of these, rs2171363, showed a significant interaction with childhood adversity in its association with antidepressant response. These findings provide further evidence that variation in TPH2 is associated with antidepressant response and may also interact with childhood trauma to influence outcome of antidepressant treatment. © The Author 2016. Published by Oxford University Press on behalf of CINP.

  15. TPH-2 Polymorphisms Interact with Early Life Stress to Influence Response to Treatment with Antidepressant Drugs

    PubMed Central

    Reynolds, Gavin P.; Yuan, Yonggui; Shi, Yanyan; Pu, Mengjia; Zhang, Zhijun

    2016-01-01

    Background: Variation in genes implicated in monoamine neurotransmission may interact with environmental factors to influence antidepressant response. We aimed to determine how a range of single nucleotide polymorphisms in monoaminergic genes influence this response to treatment and how they interact with childhood trauma and recent life stress in a Chinese sample. An initial study of monoaminergic coding region single nucleotide polymorphisms identified significant associations of TPH2 and HTR1B single nucleotide polymorphisms with treatment response that showed interactions with childhood and recent life stress, respectively (Xu et al., 2012). Methods: A total of 47 further single nucleotide polymorphisms in 17 candidate monoaminergic genes were genotyped in 281 Chinese Han patients with major depressive disorder. Response to 6 weeks’ antidepressant treatment was determined by change in the 17-item Hamilton Depression Rating Scale score, and previous stressful events were evaluated by the Life Events Scale and Childhood Trauma Questionnaire-Short Form. Results: Three TPH2 single nucleotide polymorphisms (rs11178998, rs7963717, and rs2171363) were significantly associated with antidepressant response in this Chinese sample, as was a haplotype in TPH2 (rs2171363 and rs1487278). One of these, rs2171363, showed a significant interaction with childhood adversity in its association with antidepressant response. Conclusions: These findings provide further evidence that variation in TPH2 is associated with antidepressant response and may also interact with childhood trauma to influence outcome of antidepressant treatment. PMID:27521242

  16. Robust high-performance nanoliter-volume single-cell multiple displacement amplification on planar substrates.

    PubMed

    Leung, Kaston; Klaus, Anders; Lin, Bill K; Laks, Emma; Biele, Justina; Lai, Daniel; Bashashati, Ali; Huang, Yi-Fei; Aniba, Radhouane; Moksa, Michelle; Steif, Adi; Mes-Masson, Anne-Marie; Hirst, Martin; Shah, Sohrab P; Aparicio, Samuel; Hansen, Carl L

    2016-07-26

    The genomes of large numbers of single cells must be sequenced to further understanding of the biological significance of genomic heterogeneity in complex systems. Whole genome amplification (WGA) of single cells is generally the first step in such studies, but is prone to nonuniformity that can compromise genomic measurement accuracy. Despite recent advances, robust performance in high-throughput single-cell WGA remains elusive. Here, we introduce droplet multiple displacement amplification (MDA), a method that uses commercially available liquid dispensing to perform high-throughput single-cell MDA in nanoliter volumes. The performance of droplet MDA is characterized using a large dataset of 129 normal diploid cells, and is shown to exceed previously reported single-cell WGA methods in amplification uniformity, genome coverage, and/or robustness. We achieve up to 80% coverage of a single-cell genome at 5× sequencing depth, and demonstrate excellent single-nucleotide variant (SNV) detection using targeted sequencing of droplet MDA product to achieve a median allelic dropout of 15%, and using whole genome sequencing to achieve false and true positive rates of 9.66 × 10(-6) and 68.8%, respectively, in a G1-phase cell. We further show that droplet MDA allows for the detection of copy number variants (CNVs) as small as 30 kb in single cells of an ovarian cancer cell line and as small as 9 Mb in two high-grade serous ovarian cancer samples using only 0.02× depth. Droplet MDA provides an accessible and scalable method for performing robust and accurate CNV and SNV measurements on large numbers of single cells.

  17. Multiple conformations are a conserved and regulatory feature of the RB1 5′ UTR

    PubMed Central

    Kutchko, Katrina M.; Sanders, Wes; Ziehr, Ben; Phillips, Gabriela; Solem, Amanda; Halvorsen, Matthew; Weeks, Kevin M.; Moorman, Nathaniel

    2015-01-01

    Folding to a well-defined conformation is essential for the function of structured ribonucleic acids (RNAs) like the ribosome and tRNA. Structured elements in the untranslated regions (UTRs) of specific messenger RNAs (mRNAs) are known to control expression. The importance of unstructured regions adopting multiple conformations, however, is still poorly understood. High-resolution SHAPE-directed Boltzmann suboptimal sampling of the Homo sapiens Retinoblastoma 1 (RB1) 5′ UTR yields three distinct conformations compatible with the experimental data. Private single nucleotide variants (SNVs) identified in two patients with retinoblastoma each collapse the structural ensemble to a single but distinct well-defined conformation. The RB1 5′ UTRs from Bos taurus (cow) and Trichechus manatus latirostris (manatee) are divergent in sequence from H. sapiens (human) yet maintain structural compatibility with high-probability base pairs. SHAPE chemical probing of the cow and manatee RB1 5′ UTRs reveals that they also adopt multiple conformations. Luciferase reporter assays reveal that 5′ UTR mutations alter RB1 expression. In a traditional model of disease, causative SNVs disrupt a key structural element in the RNA. For the subset of patients with heritable retinoblastoma-associated SNVs in the RB1 5′ UTR, the absence of multiple structures is likely causative of the cancer. Our data therefore suggest that selective pressure will favor multiple conformations in eukaryotic UTRs to regulate expression. PMID:25999316

  18. A Multi-Trait, Meta-analysis for Detecting Pleiotropic Polymorphisms for Stature, Fatness and Reproduction in Beef Cattle

    PubMed Central

    Bolormaa, Sunduimijid; Pryce, Jennie E.; Reverter, Antonio; Zhang, Yuandan; Barendse, William; Kemper, Kathryn; Tier, Bruce; Savin, Keith; Hayes, Ben J.; Goddard, Michael E.

    2014-01-01

    Polymorphisms that affect complex traits or quantitative trait loci (QTL) often affect multiple traits. We describe two novel methods (1) for finding single nucleotide polymorphisms (SNPs) significantly associated with one or more traits using a multi-trait, meta-analysis, and (2) for distinguishing between a single pleiotropic QTL and multiple linked QTL. The meta-analysis uses the effect of each SNP on each of n traits, estimated in single trait genome wide association studies (GWAS). These effects are expressed as a vector of signed t-values (t) and the error covariance matrix of these t values is approximated by the correlation matrix of t-values among the traits calculated across the SNP (V). Consequently, t'V−1t is approximately distributed as a chi-squared with n degrees of freedom. An attractive feature of the meta-analysis is that it uses estimated effects of SNPs from single trait GWAS, so it can be applied to published data where individual records are not available. We demonstrate that the multi-trait method can be used to increase the power (numbers of SNPs validated in an independent population) of GWAS in a beef cattle data set including 10,191 animals genotyped for 729,068 SNPs with 32 traits recorded, including growth and reproduction traits. We can distinguish between a single pleiotropic QTL and multiple linked QTL because multiple SNPs tagging the same QTL show the same pattern of effects across traits. We confirm this finding by demonstrating that when one SNP is included in the statistical model the other SNPs have a non-significant effect. In the beef cattle data set, cluster analysis yielded four groups of QTL with similar patterns of effects across traits within a group. A linear index was used to validate SNPs having effects on multiple traits and to identify additional SNPs belonging to these four groups. PMID:24675618

  19. Single nucleotide polymorphism (SNP) discovery in duplicated genomes: intron-primed exon-crossing (IPEC) as a strategy for avoiding amplification of duplicated loci in Atlantic salmon (Salmo salar) and other salmonid fishes

    PubMed Central

    Ryynänen, Heikki J; Primmer, Craig R

    2006-01-01

    Background Single nucleotide polymorphisms (SNPs) represent the most abundant type of DNA variation in the vertebrate genome, and their applications as genetic markers in numerous studies of molecular ecology and conservation of natural populations are emerging. Recent large-scale sequencing projects in several fish species have provided a vast amount of data in public databases, which can be utilized in novel SNP discovery in salmonids. However, the suggested duplicated nature of the salmonid genome may hamper SNP characterization if the primers designed in conserved gene regions amplify multiple loci. Results Here we introduce a new intron-primed exon-crossing (IPEC) method in an attempt to overcome this duplication problem, and also evaluate different priming methods for SNP discovery in Atlantic salmon (Salmo salar) and other salmonids. A total of 69 loci with differing priming strategies were screened in S. salar, and 27 of these produced ~13 kb of high-quality sequence data consisting of 19 SNPs or indels (one per 680 bp). The SNP frequency and the overall nucleotide diversity (3.99 × 10-4) in S. salar was lower than reported in a majority of other organisms, which may suggest a relative young population history for Atlantic salmon. A subset of primers used in cross-species analyses revealed considerable variation in the SNP frequencies and nucleotide diversities in other salmonids. Conclusion Sequencing success was significantly higher with the new IPEC primers; thus the total number of loci to screen in order to identify one potential polymorphic site was six times less with this new strategy. Given that duplication may hamper SNP discovery in some species, the IPEC method reported here is an alternative way of identifying novel polymorphisms in such cases. PMID:16872523

  20. Rapid identification of genes controlling virulence and immunity in malaria parasites

    PubMed Central

    Xangsayarath, Phonepadith; Tang, Jianxia; Yahata, Kazuhide; Zoungrana, Augustin; Mitaka, Hayato; Acharjee, Arita; Datta, Partha P.; Hunt, Paul; Carter, Richard; Kaneko, Osamu; Mustonen, Ville; Pain, Arnab

    2017-01-01

    Identifying the genetic determinants of phenotypes that impact disease severity is of fundamental importance for the design of new interventions against malaria. Here we present a rapid genome-wide approach capable of identifying multiple genetic drivers of medically relevant phenotypes within malaria parasites via a single experiment at single gene or allele resolution. In a proof of principle study, we found that a previously undescribed single nucleotide polymorphism in the binding domain of the erythrocyte binding like protein (EBL) conferred a dramatic change in red blood cell invasion in mutant rodent malaria parasites Plasmodium yoelii. In the same experiment, we implicated merozoite surface protein 1 (MSP1) and other polymorphic proteins, as the major targets of strain-specific immunity. Using allelic replacement, we provide functional validation of the substitution in the EBL gene controlling the growth rate in the blood stages of the parasites. PMID:28704525

  1. A silent allele in the locus D5S818 contained within the PowerPlex®21 PCR Amplification Kit.

    PubMed

    Chen, Ling; Tai, Yunchun; Qiu, Pingming; Du, Weian; Liu, Chao

    2015-11-01

    Three paternity tests cases were found with a single locus mismatch at the locus D5S818 with PowerPlex®21 PCR Amplification Kit (Promega). Forward and reverse primers were redesigned to type the samples again and to evaluate if there were alleles dropped out. The results showed the existence of a silent allele 12 in all the three families, due to a point mutation that changed cytosine to adenine at 90 nucleotides upstream from the 5' end of the AGAT repeat sequences in all the six individuals. A single locus mismatch due to a silent allele may occur in any locus using any kit. Therefore, we recommend using multiple kits to confirm the results in paternity testing cases with mismatches, especially when there is a single locus mismatch with homozygote involved. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  2. Single Nucleotide Polymorphisms Predict Symptom Severity of Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Jiao, Yun; Chen, Rong; Ke, Xiaoyan; Cheng, Lu; Chu, Kangkang; Lu, Zuhong; Herskovits, Edward H.

    2012-01-01

    Autism is widely believed to be a heterogeneous disorder; diagnosis is currently based solely on clinical criteria, although genetic, as well as environmental, influences are thought to be prominent factors in the etiology of most forms of autism. Our goal is to determine whether a predictive model based on single-nucleotide polymorphisms (SNPs)…

  3. Single nucleotide polymorphisms in uracil-processing genes, intake of one-carbon nutrients and breast cancer risk

    USDA-ARS?s Scientific Manuscript database

    Background/Objectives: The misincorporation of uracil into DNA leads to genomic instability. In a previous study, some of us identified four common single nucleotide polymorphisms (SNPs) in uracil-processing genes (rs2029166 and rs7296239 in SMUG1, rs34259 in UNG and rs4775748 in DUT) that were asso...

  4. Single nucleotide polymorphisms in common bean: their discovery and genotyping using a multiplex detection system

    USDA-ARS?s Scientific Manuscript database

    Single-nucleotide Polymorphism (SNP) markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean comparing sequences from coding and non-coding regions obtained from Genbank and genomic DNA and to compare sequencing resu...

  5. Single nucleotide polymorphisms in specific candidate genes are associated with phenotypic differences in days open for first lactation in Holstein cows

    USDA-ARS?s Scientific Manuscript database

    Previously, a candidate gene approach identified 51 single nucleotide polymorphisms (SNP) associated with genetic merit for reproductive traits and 26 associated with genetic merit for production in dairy bulls. We evaluated association of the 77 SNPs with days open (DO) for first lactation in a pop...

  6. An integrated genetic linkage map of watermelon and genetic diversity based on single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers

    USDA-ARS?s Scientific Manuscript database

    Watermelon (Citrullus lanatus var. lanatus) is an important vegetable fruit throughout the world. A high number of single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers should provide large coverage of the watermelon genome and high phylogenetic resolution of germplasm acces...

  7. Identification and characterization of single nucleotide polymorphisms (SNPs) in Culex theileri (Diptera: Culicidae).

    PubMed

    Demirci, Berna; Lee, Yoosook; Lanzaro, Gregory C; Alten, Bulent

    2012-05-01

    Culex theileri Theobald (Diptera: Culicidae) is one of the most common mosquito species in northeastern Turkey and serves as a vector for various zoonotic diseases including West Nile virus. Although there have been some studies on the ecology of Cx. theileri, very little genetic data has been made available. We successfully sequenced 11 gene fragments from Cx. theileri specimens collected from the northeastern part of Turkey. On average, we found a Single nucleotide polymorphism every 45 bp. Transitions outnumbered transversions, at a ratio of 2:1. This is the first report of genetic polymorphisms in Cx. theileri and Single nucleotide polymorphism discovered from this study can be used to investigate population structure and gene-environmental interactions.

  8. Distinctive features of single nucleotide alterations in induced pluripotent stem cells with different types of DNA repair deficiency disorders

    PubMed Central

    Okamura, Kohji; Sakaguchi, Hironari; Sakamoto-Abutani, Rie; Nakanishi, Mahito; Nishimura, Ken; Yamazaki-Inoue, Mayu; Ohtaka, Manami; Periasamy, Vaiyapuri Subbarayan; Alshatwi, Ali Abdullah; Higuchi, Akon; Hanaoka, Kazunori; Nakabayashi, Kazuhiko; Takada, Shuji; Hata, Kenichiro; Toyoda, Masashi; Umezawa, Akihiro

    2016-01-01

    Disease-specific induced pluripotent stem cells (iPSCs) have been used as a model to analyze pathogenesis of disease. In this study, we generated iPSCs derived from a fibroblastic cell line of xeroderma pigmentosum (XP) group A (XPA-iPSCs), a rare autosomal recessive hereditary disease in which patients develop skin cancer in the areas of skin exposed to sunlight. XPA-iPSCs exhibited hypersensitivity to ultraviolet exposure and accumulation of single-nucleotide substitutions when compared with ataxia telangiectasia-derived iPSCs that were established in a previous study. However, XPA-iPSCs did not show any chromosomal instability in vitro, i.e. intact chromosomes were maintained. The results were mutually compensating for examining two major sources of mutations, nucleotide excision repair deficiency and double-strand break repair deficiency. Like XP patients, XPA-iPSCs accumulated single-nucleotide substitutions that are associated with malignant melanoma, a manifestation of XP. These results indicate that XPA-iPSCs may serve a monitoring tool (analogous to the Ames test but using mammalian cells) to measure single-nucleotide alterations, and may be a good model to clarify pathogenesis of XP. In addition, XPA-iPSCs may allow us to facilitate development of drugs that delay genetic alteration and decrease hypersensitivity to ultraviolet for therapeutic applications. PMID:27197874

  9. Shared additive genetic influences on DSM-IV criteria for alcohol dependence in subjects of European ancestry.

    PubMed

    Palmer, Rohan H C; McGeary, John E; Heath, Andrew C; Keller, Matthew C; Brick, Leslie A; Knopik, Valerie S

    2015-12-01

    Genetic studies of alcohol dependence (AD) have identified several candidate loci and genes, but most observed effects are small and difficult to reproduce. A plausible explanation for inconsistent findings may be a violation of the assumption that genetic factors contributing to each of the seven DSM-IV criteria point to a single underlying dimension of risk. Given that recent twin studies suggest that the genetic architecture of AD is complex and probably involves multiple discrete genetic factors, the current study employed common single nucleotide polymorphisms in two multivariate genetic models to examine the assumption that the genetic risk underlying DSM-IV AD is unitary. AD symptoms and genome-wide single nucleotide polymorphism (SNP) data from 2596 individuals of European descent from the Study of Addiction: Genetics and Environment were analyzed using genomic-relatedness-matrix restricted maximum likelihood. DSM-IV AD symptom covariance was described using two multivariate genetic factor models. Common SNPs explained 30% (standard error=0.136, P=0.012) of the variance in AD diagnosis. Additive genetic effects varied across AD symptoms. The common pathway model approach suggested that symptoms could be described by a single latent variable that had a SNP heritability of 31% (0.130, P=0.008). Similarly, the exploratory genetic factor model approach suggested that the genetic variance/covariance across symptoms could be represented by a single genetic factor that accounted for at least 60% of the genetic variance in any one symptom. Additive genetic effects on DSM-IV alcohol dependence criteria overlap. The assumption of common genetic effects across alcohol dependence symptoms appears to be a valid assumption. © 2015 Society for the Study of Addiction.

  10. Single-cell sequencing deciphers a convergent evolution of copy number alterations from primary to circulating tumor cells.

    PubMed

    Gao, Yan; Ni, Xiaohui; Guo, Hua; Su, Zhe; Ba, Yi; Tong, Zhongsheng; Guo, Zhi; Yao, Xin; Chen, Xixi; Yin, Jian; Yan, Zhao; Guo, Lin; Liu, Ying; Bai, Fan; Xie, X Sunney; Zhang, Ning

    2017-08-01

    Copy number alteration (CNA) is a major contributor to genome instability, a hallmark of cancer. Here, we studied genomic alterations in single primary tumor cells and circulating tumor cells (CTCs) from the same patient. Single-nucleotide variants (SNVs) in single cells from both samples occurred sporadically, whereas CNAs among primary tumor cells emerged accumulatively rather than abruptly, converging toward the CNA in CTCs. Focal CNAs affecting the MYC gene and the PTEN gene were observed only in a minor portion of primary tumor cells but were present in all CTCs, suggesting a strong selection toward metastasis. Single-cell structural variant (SV) analyses revealed a two-step mechanism, a complex rearrangement followed by gene amplification, for the simultaneous formation of anomalous CNAs in multiple chromosome regions. Integrative CNA analyses of 97 CTCs from 23 patients confirmed the convergence of CNAs and revealed single, concurrent, and mutually exclusive CNAs that could be the driving events in cancer metastasis. © 2017 Gao et al.; Published by Cold Spring Harbor Laboratory Press.

  11. High-throughput discovery of rare human nucleotide polymorphisms by Ecotilling

    PubMed Central

    Till, Bradley J.; Zerr, Troy; Bowers, Elisabeth; Greene, Elizabeth A.; Comai, Luca; Henikoff, Steven

    2006-01-01

    Human individuals differ from one another at only ∼0.1% of nucleotide positions, but these single nucleotide differences account for most heritable phenotypic variation. Large-scale efforts to discover and genotype human variation have been limited to common polymorphisms. However, these efforts overlook rare nucleotide changes that may contribute to phenotypic diversity and genetic disorders, including cancer. Thus, there is an increasing need for high-throughput methods to robustly detect rare nucleotide differences. Toward this end, we have adapted the mismatch discovery method known as Ecotilling for the discovery of human single nucleotide polymorphisms. To increase throughput and reduce costs, we developed a universal primer strategy and implemented algorithms for automated band detection. Ecotilling was validated by screening 90 human DNA samples for nucleotide changes in 5 gene targets and by comparing results to public resequencing data. To increase throughput for discovery of rare alleles, we pooled samples 8-fold and found Ecotilling to be efficient relative to resequencing, with a false negative rate of 5% and a false discovery rate of 4%. We identified 28 new rare alleles, including some that are predicted to damage protein function. The detection of rare damaging mutations has implications for models of human disease. PMID:16893952

  12. Minute virus of mice (MVM) mRNAs predominantly polyadenylate at a single site.

    PubMed

    Clemens, K E; Pintel, D

    1987-10-01

    The polyadenylation sites for MVM(p) and MVM(i) mRNAs were determined by a quantitative hybridization-S1 protection assay. mRNAs produced by MVM(p) both early and late in infection of mouse A9 fibroblasts, and by MVM(p) and MVM(i) late in infection of human NB324K cells, polyadenylate predominantly at a single site, at nucleotide 4908 +/- 2 for MVM(p) and 4843 +/- 2 for MVM(i), shortly downstream of the final AATAAA in each viral genome. These results demonstrate that although the right-hand end of MVM has multiple AATAAA signals, and MVM(p) and MVM(i) vary significantly within this region, 3' end processing of viral mRNAs is not a prevalent mechanism for the regulation of MVM gene expression.

  13. Molecular epidemiology of measles viruses in China, 1995–2003

    PubMed Central

    Zhang, Yan; Zhu, Zhen; Rota, Paul A; Jiang, Xiaohong; Hu, Jiayu; Wang, Jianguo; Tang, Wei; Zhang, Zhenying; Li, Congyong; Wang, Changyin; Wang, Tongzhan; Zheng, Lei; Tian, Hong; Ling, Hua; Zhao, Chunfang; Ma, Yan; Lin, Chunyan; He, Jilan; Tian, Jiang; Ma, Yan; Li, Ping; Guan, Ronghui; He, Weikuan; Zhou, Jianhui; Liu, Guiyan; Zhang, Hong; Yan, Xinge; Yang, Xuelei; Zhang, Jinlin; Lu, Yiyu; Zhou, Shunde; Ba, Zhuoma; Liu, Wei; Yang , Xiuhui; Ma, Yujie; Liang, Yong; Li, Yeqiang; Ji, Yixin; Featherstone, David; Bellini, William J; Xu, Songtao; Liang, Guodong; Xu, Wenbo

    2007-01-01

    This report describes the genetic characterization of 297 wild-type measles viruses that were isolated in 24 provinces of China between 1995 and 2003. Phylogenetic analysis of the N gene sequences showed that all of the isolates belonged to genotype H1 except 3 isolates, which were genotype A. The nucleotide sequence and predicted amino acid homologies of the 294-genotype H1 strains were 94.7%–100% and 93.3%–100%, respectively. The genotype H1 isolates were divided into 2 clusters, which differed by approximately 2.9% at the nucleotide level. Viruses from both clusters were distributed throughout China with no apparent geographic restriction and multiple co-circulating lineages were present in many provinces. Even though other measles genotypes have been detected in countries that border China, this report shows that genotype H1 is widely distributed throughout the country and that China has a single, endemic genotype. This important baseline data will help to monitor the progress of measles control in China. PMID:17280609

  14. Detection of 549 new HLA alleles in potential stem cell donors from the United States, Poland and Germany.

    PubMed

    Hernández-Frederick, C J; Cereb, N; Giani, A S; Ruppel, J; Maraszek, A; Pingel, J; Sauter, J; Schmidt, A H; Yang, S Y

    2016-01-01

    We characterized 549 new human leukocyte antigen (HLA) class I and class II alleles found in newly registered stem cell donors as a result of high-throughput HLA typing. New alleles include 101 HLA-A, 132 HLA-B, 105 HLA-C, 2 HLA-DRB1, 89 HLA-DQB1 and 120 HLA-DPB1 alleles. Mainly, new alleles comprised single nucleotide variations when compared with homologous sequences. We identified nonsynonymous nucleotide mutations in 70.7% of all new alleles, synonymous variations in 26.4% and nonsense substitutions in 2.9% (null alleles). Some new alleles (55, 10.0%) were found multiple times, HLA-DPB1 alleles being the most frequent among these. Furthermore, as several new alleles were identified in individuals from ethnic minority groups, the relevance of recruiting donors belonging to such groups and the importance of ethnicity data collection in donor centers and registries is highlighted. © 2015 The Authors. HLA published by John Wiley & Sons Ltd.

  15. Multiple Locus Variable-Number Tandem-Repeat and Single-Nucleotide Polymorphism-Based Brucella Typing Reveals Multiple Lineages in Brucella melitensis Currently Endemic in China.

    PubMed

    Sun, Mingjun; Jing, Zhigang; Di, Dongdong; Yan, Hao; Zhang, Zhicheng; Xu, Quangang; Zhang, Xiyue; Wang, Xun; Ni, Bo; Sun, Xiangxiang; Yan, Chengxu; Yang, Zhen; Tian, Lili; Li, Jinping; Fan, Weixing

    2017-01-01

    Brucellosis is a worldwide zoonotic disease caused by Brucella spp. In China, brucellosis is recognized as a reemerging disease mainly caused by Brucella melitensis specie. To better understand the currently endemic B. melitensis strains in China, three Brucella genotyping methods were applied to 110 B. melitensis strains obtained in past several years. By MLVA genotyping, five MLVA-8 genotypes were identified, among which genotypes 42 (1-5-3-13-2-2-3-2) was recognized as the predominant genotype, while genotype 63 (1-5-3-13-2-3-3-2) and a novel genotype of 1-5-3-13-2-4-3-2 were second frequently observed. MLVA-16 discerned a total of 57 MLVA-16 genotypes among these Brucella strains, with 41 genotypes being firstly detected and the other 16 genotypes being previously reported. By BruMLSA21 typing, six sequence types (STs) were identified, among them ST8 is the most frequently seen in China while the other five STs were firstly detected and designated as ST137, ST138, ST139, ST140, and ST141 by international multilocus sequence typing database. Whole-genome sequence (WGS)-single-nucleotide polymorphism (SNP)-based typing and phylogenetic analysis resolved Chinese B. melitensis strains into five clusters, reflecting the existence of multiple lineages among these Chinese B. melitensis strains. In phylogeny, Chinese lineages are more closely related to strains collected from East Mediterranean and Middle East countries, such as Turkey, Kuwait, and Iraq. In the next few years, MLVA typing will certainly remain an important epidemiological tool for Brucella infection analysis, as it displays a high discriminatory ability and achieves result largely in agreement with WGS-SNP-based typing. However, WGS-SNP-based typing is found to be the most powerful and reliable method in discerning Brucella strains and will be popular used in the future.

  16. Development of a multiplex polymerase chain reaction-sequence-specific primer method for NKG2D and NKG2F single-nucleotide polymorphism typing using isothermal multiple displacement amplification products.

    PubMed

    Kaewmanee, M; Phoksawat, W; Romphruk, A; Romphruk, A V; Jumnainsong, A; Leelayuwat, C

    2013-06-01

    Natural killer group 2 member D (NKG2D) on immune effector cells recognizes multiple stress-inducible ligands. NKG2D single-nucleotide polymorphism (SNP) haplotypes were related to the levels of cytotoxic activity of peripheral blood mononuclear cells. Indeed, these polymorphisms were also located in NKG2F. Isothermal multiple displacement amplification (IMDA) is used for whole genome amplification (WGA) that can amplify very small genomic DNA templates into microgram with whole genome coverage. This is particularly useful in the cases of limited amount of valuable DNA samples requiring multi-locus genotyping. In this study, we evaluated the quality and applicability of IMDA to genetic studies in terms of sensitivity, efficiency of IMDA re-amplification and stability of IMDA products. The smallest amount of DNA to be effectively amplified by IMDA was 200 pg yielding final DNA of approximately 16 µg within 1.5 h. IMDA could be re-amplified only once (second round of amplification), and could be kept for 5 months at 4°C and more than a year at -20°C without loosing genome coverage. The amplified products were used successfully to setup a multiplex polymerase chain reaction-sequence-specific primer for SNP typing of the NKG2D/F genes. The NKG2D/F multiplex polymerase chain reaction (PCR) contained six PCR mixtures for detecting 10 selected SNPs, including 8 NKG2D/F SNP haplotypes and 2 additional NKG2D coding SNPs. This typing procedure will be applicable in both clinical and research laboratories. Thus, our data provide useful information and limitations for utilization of genome-wide amplification using IMDA and its application for multiplex NKG2D/F typing. © 2013 John Wiley & Sons Ltd.

  17. A new class of homogeneous nucleic acid probes based on specific displacement hybridization

    PubMed Central

    Li, Qingge; Luan, Guoyan; Guo, Qiuping; Liang, Jixuan

    2002-01-01

    We have developed a new class of probes for homogeneous nucleic acid detection based on the proposed displacement hybridization. Our probes consist of two complementary oligodeoxyribonucleotides of different length labeled with a fluorophore and a quencher in close proximity in the duplex. The probes on their own are quenched, but they become fluorescent upon displacement hybridization with the target. These probes display complete discrimination between a perfectly matched target and single nucleotide mismatch targets. A comparison of double-stranded probes with corresponding linear probes confirms that the presence of the complementary strand significantly enhances their specificity. Using four such probes labeled with different color fluorophores, each designed to recognize a different target, we have demonstrated that multiple targets can be distinguished in the same solution, even if they differ from one another by as little as a single nucleotide. Double-stranded probes were used in real-time nucleic acid amplifications as either probes or as primers. In addition to its extreme specificity and flexibility, the new class of probes is simple to design and synthesize, has low cost and high sensitivity and is accessible to a wide range of labels. This class of probes should find applications in a variety of areas wherever high specificity of nucleic acid hybridization is relevant. PMID:11788731

  18. Investigation of Genetic Variants Associated with Alzheimer Disease in Parkinson Disease Cognition.

    PubMed

    Barrett, Matthew J; Koeppel, Alexander F; Flanigan, Joseph L; Turner, Stephen D; Worrall, Bradford B

    2016-01-01

    Meta-analysis of genome-wide association studies have implicated multiple single nucleotide polymorphisms (SNPs) and associated genes with Alzheimer disease. The role of these SNPs in cognitive impairment in Parkinson disease (PD) remains incompletely evaluated. The objective of this study was to test alleles associated with risk of Alzheimer disease for association with cognitive impairment in Parkinson disease (PD). Two datasets with PD subjects accessed through the NIH database of Genotypes and Phenotypes contained both single nucleotide polymorphism (SNP) arrays and mini-mental state exam (MMSE) scores. Genetic data underwent rigorous quality control and we selected SNPs for genes associated with AD other than APOE. We constructed logistic regression and ordinal regression models, adjusted for sex, age at MMSE, and duration of PD, to assess the association between selected SNPs and MMSE score. In one dataset, PICALM rs3851179 was associated with cognitive impairment (MMSE <  24) in PD subjects > 70 years old (OR = 2.3; adjusted p-value = 0.017; n = 250) but not in PD subjects ≤ 70 years old. Our finding suggests that PICALM rs3851179 could contribute to cognitive impairment in older patients with PD. It is important that future studies consider the interaction of age and genetic risk factors in the development of cognitive impairment in PD.

  19. Initial evidence that polymorphisms in neurotransmitter-regulating genes contribute to being born small for gestational age

    PubMed Central

    Morgan, Angharad R.; Thompson, John M.D.; Waldie, Karen E.; Cornforth, Christine M.; Turic, Darko; Sonuga-Barke, Edmund J.S.; Lam, Wen-Jiun; Ferguson, Lynnette R.; Mitchell, Edwin A.

    2012-01-01

    Being born small for gestational age (SGA) is a putative risk factor for the development of later cognitive and psychiatric health problems. While the inter-uterine environment has been shown to play an important role in predicting birth weight, little is known about the genetic factors that might be important. Here we test the hypothesis that neurotransmitter-regulating genes implicated in psychiatric disorders previously shown to be associated with SGA (such as attention-deficit hyperactivity disorder) are themselves predictive of SGA. DNA was collected from 227 SGA and 319 appropriate for gestational age children taking part in the Auckland Birthweight Collaborative Study. Candidate single nucleotide polymorphisms in genes regulating activity within dopamine, serotonin, glutamate and gamma-aminobutyric acid pathways were genotyped. Multiple regression analysis, controlling for potentially confounding factors, supported nominally significant associations between SGA and single nucleotide polymorphisms in COMT, HTR2A, SLC1A1 and SLC6A1. This is the first evidence that genes implicated in psychiatric disorders previously linked to SGA status themselves predict SGA. This highlights the possibility that the link between SGA and psychiatric disorders such as attention-deficit hyperactivity disorder may in part be genetically determined – that SGA marks pre-existing genetic risk for later problems. PMID:27625810

  20. MIDAS: software for analysis and visualisation of interallelic disequilibrium between multiallelic markers

    PubMed Central

    Gaunt, Tom R; Rodriguez, Santiago; Zapata, Carlos; Day, Ian NM

    2006-01-01

    Background Various software tools are available for the display of pairwise linkage disequilibrium across multiple single nucleotide polymorphisms. The HapMap project also presents these graphics within their website. However, these approaches are limited in their use of data from multiallelic markers and provide limited information in a graphical form. Results We have developed a software package (MIDAS – Multiallelic Interallelic Disequilibrium Analysis Software) for the estimation and graphical display of interallelic linkage disequilibrium. Linkage disequilibrium is analysed for each allelic combination (of one allele from each of two loci), between all pairwise combinations of any type of multiallelic loci in a contig (or any set) of many loci (including single nucleotide polymorphisms, microsatellites, minisatellites and haplotypes). Data are presented graphically in a novel and informative way, and can also be exported in tabular form for other analyses. This approach facilitates visualisation of patterns of linkage disequilibrium across genomic regions, analysis of the relationships between different alleles of multiallelic markers and inferences about patterns of evolution and selection. Conclusion MIDAS is a linkage disequilibrium analysis program with a comprehensive graphical user interface providing novel views of patterns of linkage disequilibrium between all types of multiallelic and biallelic markers. Availability Available from and PMID:16643648

  1. A dynamic sandwich assay on magnetic beads for selective detection of single-nucleotide mutations at room temperature.

    PubMed

    Wang, Junxiu; Xiong, Guoliang; Ma, Liang; Wang, Shihui; Zhou, Xu; Wang, Lei; Xiao, Lehui; Su, Xin; Yu, Changyuan

    2017-08-15

    Single-nucleotide mutation (SNM) has proven to be associated with a variety of human diseases. Development of reliable methods for the detection of SNM is crucial for molecular diagnosis and personalized medicine. The sandwich assays are widely used tools for detecting nucleic acid biomarkers due to their low cost and rapid signaling. However, the poor hybridization specificity of signal probe at room temperature hampers the discrimination of mutant and wild type. Here, we demonstrate a dynamic sandwich assay on magnetic beads for SNM detection based on the transient binding between signal probe and target. By taking the advantage of mismatch sensitive thermodynamics of transient DNA binding, the dynamic sandwich assay exhibits high discrimination factor for mutant with a broad range of salt concentration at room temperature. The beads used in this assay serve as a tool for separation, and might be helpful to enhance SNM selectivity. Flexible design of signal probe and facile magnetic separation allow multiple-mode downstream analysis including colorimetric detection and isothermal amplification. With this method, BRAF mutations in the genomic DNA extracted from cancer cell lines were tested, allowing sensitive detection of SNM at very low abundances (0.1-0.5% mutant/wild type). Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Molecular Characterization of the Lipid Genome-Wide Association Study Signal on Chromosome 18q11.2 Implicates HNF4A-Mediated Regulation of the TMEM241 Gene.

    PubMed

    Rodríguez, Alejandra; Gonzalez, Luis; Ko, Arthur; Alvarez, Marcus; Miao, Zong; Bhagat, Yash; Nikkola, Elina; Cruz-Bautista, Ivette; Arellano-Campos, Olimpia; Muñoz-Hernández, Linda L; Ordóñez-Sánchez, Maria-Luisa; Rodriguez-Guillen, Rosario; Mohlke, Karen L; Laakso, Markku; Tusie-Luna, Teresa; Aguilar-Salinas, Carlos A; Pajukanta, Päivi

    2016-07-01

    We recently identified a locus on chromosome 18q11.2 for high serum triglycerides in Mexicans. We hypothesize that the lead genome-wide association study single-nucleotide polymorphism rs9949617, or its linkage disequilibrium proxies, regulates 1 of the 5 genes in the triglyceride-associated region. We performed a linkage disequilibrium analysis and found 9 additional variants in linkage disequilibrium (r(2)>0.7) with the lead single-nucleotide polymorphism. To select the variants for functional analyses, we annotated the 10 variants using DNase I hypersensitive sites, transcription factor and chromatin states and identified rs17259126 as the lead candidate variant for functional in vitro validation. Using luciferase transcriptional reporter assay in liver HepG2 cells, we found that the G allele exhibits a significantly lower effect on transcription (P<0.05). The electrophoretic mobility shift and ChIPqPCR (chromatin immunoprecipitation coupled with quantitative polymerase chain reaction) assays confirmed that the minor G allele of rs17259126 disrupts an hepatocyte nuclear factor 4 α-binding site. To find the regional candidate gene, we performed a local expression quantitative trait locus analysis and found that rs17259126 and its linkage disequilibrium proxies alter expression of the regional transmembrane protein 241 (TMEM241) gene in 795 adipose RNAs from the Metabolic Syndrome In Men (METSIM) cohort (P=6.11×10(-07)-5.80×10(-04)). These results were replicated in expression profiles of TMEM241 from the Multiple Tissue Human Expression Resource (MuTHER; n=856). The Mexican genome-wide association study signal for high serum triglycerides on chromosome 18q11.2 harbors a regulatory single-nucleotide polymorphism, rs17259126, which disrupts normal hepatocyte nuclear factor 4 α binding and decreases the expression of the regional TMEM241 gene. Our data suggest that decreased transcript levels of TMEM241 contribute to increased triglyceride levels in Mexicans. © 2016 American Heart Association, Inc.

  3. Can Non-HLA Single Nucleotide Polymorphisms Help Stratify Risk in TrialNet Relatives at Risk for Type 1 Diabetes?

    PubMed

    Steck, Andrea K; Xu, Ping; Geyer, Susan; Redondo, Maria J; Antinozzi, Peter; Wentworth, John M; Sosenko, Jay; Onengut-Gumuscu, Suna; Chen, Wei-Min; Rich, Stephen S; Pugliese, Alberto

    2017-08-01

    Genome-wide association studies identified >50 type 1 diabetes (T1D) associated non-human leukocyte antigens (non-HLA) loci. The purpose of this study was to assess the contribution of non-HLA single nucleotide polymorphisms (SNPs) to risk of disease progression. The TrialNet Pathway to Prevention Study follows relatives of T1D patients for development of autoantibodies (Abs) and T1D. Using the Immunochip, we analyzed 53 diabetes-associated, non-HLA SNPs in 1016 Ab-positive, at-risk non-Hispanic white relatives. Effect of SNPs on the development of multiple Abs and T1D. Cox proportional analyses included all substantial non-HLA SNPs, HLA genotypes, relationship to proband, sex, age at initial screening, initial Ab type, and number. Factors involved in progression from single to multiple Abs included age at screening, relationship to proband, HLA genotypes, and rs3087243 (cytotoxic T lymphocyte antigen-4). Significant factors for diabetes progression included age at screening, Ab number, HLA genotypes, rs6476839 [GLIS family zinc finger 3 (GLIS3)], and rs3184504 [SH2B adaptor protein 3 (SH2B3)]. When glucose area under the curve (AUC) was included, factors involved in disease progression included glucose AUC, age at screening, Ab number, relationship to proband, HLA genotypes, rs6476839 (GLIS3), and rs7221109 (CCR7). In stratified analyses by age, glucose AUC, age at screening, sibling, HLA genotypes, rs6476839 (GLIS3), and rs4900384 (C14orf64) were significantly associated with progression to diabetes in participants <12 years old, whereas glucose AUC, sibling, rs3184504 (SH2B3), and rs4900384 (C14orf64) were significant in those ≥12. In conclusion, we identified five non-HLA SNPs associated with increased risk of progression from Ab positivity to disease that may improve risk stratification for prevention trials. Copyright © 2017 by the Endocrine Society

  4. Substitution scanning identifies a novel, catalytically active ibrutinib-resistant BTK cysteine 481 to threonine (C481T) variant

    PubMed Central

    Hamasy, A; Wang, Q; Blomberg, K E M; Mohammad, D K; Yu, L; Vihinen, M; Berglöf, A; Smith, C I E

    2017-01-01

    Irreversible Bruton tyrosine kinase (BTK) inhibitors, ibrutinib and acalabrutinib have demonstrated remarkable clinical responses in multiple B-cell malignancies. Acquired resistance has been identified in a sub-population of patients in which mutations affecting BTK predominantly substitute cysteine 481 in the kinase domain for catalytically active serine, thereby ablating covalent binding of inhibitors. Activating substitutions in the BTK substrate phospholipase Cγ2 (PLCγ2) instead confers resistance independent of BTK. Herein, we generated all six possible amino acid substitutions due to single nucleotide alterations for the cysteine 481 codon, in addition to threonine, requiring two nucleotide substitutions, and performed functional analysis. Replacement by arginine, phenylalanine, tryptophan or tyrosine completely inactivated the catalytic activity, whereas substitution with glycine caused severe impairment. BTK with threonine replacement was catalytically active, similar to substitution with serine. We identify three potential ibrutinib resistance scenarios for cysteine 481 replacement: (1) Serine, being catalytically active and therefore predominating among patients. (2) Threonine, also being catalytically active, but predicted to be scarce, because two nucleotide changes are needed. (3) As BTK variants replaced with other residues are catalytically inactive, they presumably need compensatory mutations, therefore being very scarce. Glycine and tryptophan variants were not yet reported but likely also provide resistance. PMID:27282255

  5. Nucleotide variability in the 5-enolpyruvylshikimate-3-phosphate synthase gene from Eleusine indica (L.) Gaertn.

    PubMed

    Chong, J L; Wickneswari, R; Ismail, B S; Salmijah, S

    2008-02-01

    This study reports the results of the partial DNA sequence analysis of the 5-enolpyruvyl-shikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant (R) and glyphosate-susceptible (S) biotypes of Eleusine indica (L.) Gaertn from Peninsular Malaysia. Sequencing results revealed point mutation at nucleotide position 875 in the R biotypes of Bidor, Chaah and Temerloh. In the Chaah R population, substitution of cytosine (C) to adenine (A) resulted in the change of threonine (Thr106) to proline (Pro106) and from C to thymidine (T) in the Bidor R population, leading to serine (Ser106) from Pro106. As for the Temerloh R, C was substituted by T resulting in the change of Pro106 to Ser106. A new mutation previously undetected in the Temerloh R was revealed with C being substituted with A, resulting in the change of Pro106 to Thr106 indicating multiple founding events rather than to the spread of a single resistant allele. There was no point mutation recorded at nucleotide position 875 previously demonstrated to play a pivotal role in conferring glyphosate resistance to E. indica for the Lenggeng, Kuala Selangor, Melaka R populations. Thus, there may be another resistance mechanism yet undiscovered in the resistant Lenggeng, Kuala Selangor and Melaka populations.

  6. The Single Nucleotide Polymorphism Consortium

    NASA Technical Reports Server (NTRS)

    Morgan, Michael

    2003-01-01

    I want to discuss both the Single Nucleotide Polymorphism (SNP) Consortium and the Human Genome Project. I am afraid most of my presentation will be thin on law and possibly too high on rhetoric. Having been engaged in a personal and direct way with these issues as a trained scientist, I find it quite difficult to be always as objective as I ought to be.

  7. Analysis of single nucleotide polymorphisms in case-control studies.

    PubMed

    Li, Yonghong; Shiffman, Dov; Oberbauer, Rainer

    2011-01-01

    Single nucleotide polymorphisms (SNPs) are the most common type of genetic variants in the human genome. SNPs are known to modify susceptibility to complex diseases. We describe and discuss methods used to identify SNPs associated with disease in case-control studies. An outline on study population selection, sample collection and genotyping platforms is presented, complemented by SNP selection, data preprocessing and analysis.

  8. A lateral flow biosensor for detection of single nucleotide polymorphism by circular strand displacement reaction.

    PubMed

    Xiao, Zhuo; Lie, Puchang; Fang, Zhiyuan; Yu, Luxin; Chen, Junhua; Liu, Jie; Ge, Chenchen; Zhou, Xuemeng; Zeng, Lingwen

    2012-09-04

    A lateral flow biosensor for detection of single nucleotide polymorphism based on circular strand displacement reaction (CSDPR) has been developed. Taking advantage of high fidelity of T4 DNA ligase, signal amplification by CSDPR, and the optical properties of gold nanoparticles, this assay has reached a detection limit of 0.01 fM.

  9. A Laboratory Exercise for Genotyping Two Human Single Nucleotide Polymorphisms

    ERIC Educational Resources Information Center

    Fernando, James; Carlson, Bradley; LeBard, Timothy; McCarthy, Michael; Umali, Finianne; Ashton, Bryce; Rose, Ferrill F., Jr.

    2016-01-01

    The dramatic decrease in the cost of sequencing a human genome is leading to an era in which a wide range of students will benefit from having an understanding of human genetic variation. Since over 90% of sequence variation between humans is in the form of single nucleotide polymorphisms (SNPs), a laboratory exercise has been devised in order to…

  10. The effects of single nucleotide polymorphisms (SNPs) of calpastatin (CAST) gene on meat tenderness of yak.

    USDA-ARS?s Scientific Manuscript database

    The association of single nucleotide polymorphisms (SNPs) of calpastatin (CAST) gene with shear force of 2.54 cm steaks from M. longissimus dorsi from Gannan yaks (Bos grunniens, n=181) was studied. Yaks were harvested at 2, 3, and 4 yr of age (n=51, 59, and 71, respectively), and samples of each ya...

  11. Single nucleotide polymorphism analysis reveals heterogeneity within a seedling tree population of a polyembryonic mango cultivar.

    PubMed

    Winterhagen, Patrick; Wünsche, Jens-Norbert

    2016-05-01

    Within a polyembryonic mango seedling tree population, the genetic background of individuals should be identical because vigorous plants for cultivation are expected to develop from nucellar embryos representing maternal clones. Due to the fact that the mango cultivar 'Hôi' is assigned to the polyembryonic ecotype, an intra-cultivar variability of ethylene receptor genes was unexpected. Ethylene receptors in plants are conserved, but the number of receptors or receptor isoforms is variable regarding different plant species. However, it is shown here that the ethylene receptor MiETR1 is present in various isoforms within the mango cultivar 'Hôi'. The investigation of single nucleotide polymorphisms revealed that different MiETR1 isoforms can not be discriminated simply by individual single nucleotide exchanges but by the specific arrangement of single nucleotide polymorphisms at certain positions in the exons of MiETR1. Furthermore, an MiETR1 isoform devoid of introns in the genomic sequence was identified. The investigation demonstrates some limitations of high resolution melting and ScreenClust analysis and points out the necessity of sequencing to identify individual isoforms and to determine the variability within the tree population.

  12. High Genetic Diversity Revealed by Variable-Number Tandem Repeat Genotyping and Analysis of hsp65 Gene Polymorphism in a Large Collection of “Mycobacterium canettii” Strains Indicates that the M. tuberculosis Complex Is a Recently Emerged Clone of “M. canettii”

    PubMed Central

    Fabre, Michel; Koeck, Jean-Louis; Le Flèche, Philippe; Simon, Fabrice; Hervé, Vincent; Vergnaud, Gilles; Pourcel, Christine

    2004-01-01

    We have analyzed, using complementary molecular methods, the diversity of 43 strains of “Mycobacterium canettii” originating from the Republic of Djibouti, on the Horn of Africa, from 1998 to 2003. Genotyping by multiple-locus variable-number tandem repeat analysis shows that all the strains belong to a single but very distant group when compared to strains of the Mycobacterium tuberculosis complex (MTBC). Thirty-one strains cluster into one large group with little variability and five strains form another group, whereas the other seven are more diverged. In total, 14 genotypes are observed. The DR locus analysis reveals additional variability, some strains being devoid of a direct repeat locus and others having unique spacers. The hsp65 gene polymorphism was investigated by restriction enzyme analysis and sequencing of PCR amplicons. Four new single nucleotide polymorphisms were discovered. One strain was characterized by three nucleotide changes in 441 bp, creating new restriction enzyme polymorphisms. As no sequence variability was found for hsp65 in the whole MTBC, and as a single point mutation separates M. tuberculosis from the closest “M. canettii” strains, this diversity within “M. canettii” subspecies strongly suggests that it is the most probable source species of the MTBC rather than just another branch of the MTBC. PMID:15243089

  13. Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA.

    PubMed

    Khodakov, Dmitriy A; Khodakova, Anastasia S; Huang, David M; Linacre, Adrian; Ellis, Amanda V

    2015-03-04

    Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within double-stranded DNA generated from real-life human mitochondrial DNA samples. Aside from the potential diagnostic value, the current study represents an additional way to control the strand displacement reaction rate without altering other reaction parameters and provides new insights into the influence of single nucleotide substitutions on 3- and 4-way branch migration efficiency and kinetics.

  14. Single nucleotide polymorphism analysis using different colored dye dimer probes

    NASA Astrophysics Data System (ADS)

    Marmé, Nicole; Friedrich, Achim; Denapaite, Dalia; Hakenbeck, Regine; Knemeyer, Jens-Peter

    2006-09-01

    Fluorescence quenching by dye dimer formation has been utilized to develop hairpin-structured DNA probes for the detection of a single nucleotide polymorphism (SNP) in the penicillin target gene pbp2x, which is implicated in the penicillin resistance of Streptococcus pneumoniae. We designed two specific DNA probes for the identification of the pbp2x genes from a penicillin susceptible strain R6 and a resistant strain Streptococcus mitis 661 using green-fluorescent tetramethylrhodamine (TMR) and red-fluorescent DY-636, respectively. Hybridization of each of the probes to its respective target DNA sequence opened the DNA hairpin probes, consequently breaking the nonfluorescent dye dimers into fluorescent species. This hybridization of the target with the hairpin probe achieved single nucleotide specific detection at nanomolar concentrations via increased fluorescence.

  15. A ruler protein in a complex for antiviral defense determines the length of small interfering CRISPR RNAs.

    PubMed

    Hatoum-Aslan, Asma; Samai, Poulami; Maniv, Inbal; Jiang, Wenyan; Marraffini, Luciano A

    2013-09-27

    Small RNAs undergo maturation events that precisely determine the length and structure required for their function. CRISPRs (clustered regularly interspaced short palindromic repeats) encode small RNAs (crRNAs) that together with CRISPR-associated (cas) genes constitute a sequence-specific prokaryotic immune system for anti-viral and anti-plasmid defense. crRNAs are subject to multiple processing events during their biogenesis, and little is known about the mechanism of the final maturation step. We show that in the Staphylococcus epidermidis type III CRISPR-Cas system, mature crRNAs are measured in a Cas10·Csm ribonucleoprotein complex to yield discrete lengths that differ by 6-nucleotide increments. We looked for mutants that impact this crRNA size pattern and found that an alanine substitution of a conserved aspartate residue of Csm3 eliminates the 6-nucleotide increments in the length of crRNAs. In vitro, recombinant Csm3 binds RNA molecules at multiple sites, producing gel-shift patterns that suggest that each protein binds 6 nucleotides of substrate. In vivo, changes in the levels of Csm3 modulate the crRNA size distribution without disrupting the 6-nucleotide periodicity. Our data support a model in which multiple Csm3 molecules within the Cas10·Csm complex bind the crRNA with a 6-nucleotide periodicity to function as a ruler that measures the extent of crRNA maturation.

  16. Genomic patterns of nucleotide diversity in divergent populations of U.S. weedy rice

    PubMed Central

    2010-01-01

    Background Weedy rice (red rice), a conspecific weed of cultivated rice (Oryza sativa L.), is a significant problem throughout the world and an emerging threat in regions where it was previously absent. Despite belonging to the same species complex as domesticated rice and its wild relatives, the evolutionary origins of weedy rice remain unclear. We use genome-wide patterns of single nucleotide polymorphism (SNP) variation in a broad geographic sample of weedy, domesticated, and wild Oryza samples to infer the origin and demographic processes influencing U.S. weedy rice evolution. Results We find greater population structure than has been previously reported for U.S. weedy rice, and that the multiple, genetically divergent populations have separate origins. The two main U.S. weedy rice populations share genetic backgrounds with cultivated O. sativa varietal groups not grown commercially in the U.S., suggesting weed origins from domesticated ancestors. Hybridization between weedy groups and between weedy rice and local crops has also led to the evolution of distinct U.S. weedy rice populations. Demographic simulations indicate differences among the main weedy groups in the impact of bottlenecks on their establishment in the U.S., and in the timing of divergence from their cultivated relatives. Conclusions Unlike prior research, we did not find unambiguous evidence for U.S. weedy rice originating via hybridization between cultivated and wild Oryza species. Our results demonstrate the potential for weedy life-histories to evolve directly from within domesticated lineages. The diverse origins of U.S. weedy rice populations demonstrate the multiplicity of evolutionary forces that can influence the emergence of weeds from a single species complex. PMID:20550656

  17. Novel functional polymorphism in IGF-1 gene associated with multiple sclerosis: A new insight to MS.

    PubMed

    Shahbazi, Majid; Abdolmohammadi, Reza; Ebadi, Hamid; Farazmandfar, Touraj

    2017-04-01

    Interactions between several genes and environment may play a role in susceptibility to multiple sclerosis (MS). The IGF-1 plays a key role in proliferation, maintenance and survival of nerve cells. Therefore, we hypothesized that IGF-1 may be a target for prediction and control MS. We aimed to analysis IGF-1 gene promoter sequence, to investigate the effect of the single nucleotide variants on IGF-1 expression and its association with MS. We enrolled 339 MS patients and 431 healthy controls. A specific region in IGF-1 gene promoter was investigated by SSCP analysis. All samples were genotyped by SSP-PCR. In-vitro and in-vivo IGF-1 production was measured by ELISA assay. IGF-1 expression in PBMCs was measured using real-time PCR. We identified a T to C single nucleotide substitution at position -1089 and a C to T at position -383 from transcription start site in the IGF-1 gene promoter. There was a significant association between MS and genotypes IGF-1(-383) C/T (p=0.001) and IGF-1(-383) C/C (p<0.001). There was also a significant association between IGF-1(-383) allele C and MS (p=0.001). In-vitro and in-vivo IGF-1 level showed that IGF-1 production in samples with genotype IGF-1(-383) C/C significantly was less than T/T (p=0.004) but not T/C (p=0.220). According to IGF-1 roles in CNS and our results, this study suggests that low IGF-1 level may be associated with susceptibility to MS. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. The relationship between methylenetetrahydrofolate reductase polymorphism and hematological malignancy.

    PubMed

    Jiang, Ni; Zhu, Xishan; Zhang, Hongmei; Wang, Xiaoli; Zhou, Xinna; Gu, Jiezhun; Chen, Baoan; Ren, Jun

    2014-01-01

    Methylenetetrahydrofolate reductase (MTHFR) is the key enzyme for folate metabolism. Previous studies suggest a relationship between its single nucleotide polymorphisms (SNP) of C677T and A1298C with a variety of tumor susceptibility including hematological malignancy. SNP frequency distribution in different ethnic populations might lead to differences in disease susceptibility. There has been little research in Chinese people on the MTHFR SNP with the susceptibility of the hematological malignancy. Therefore, this study investigated the relationship between MTHFR SNPs and hematological malignancy in Jiangsu province in China. Gene microarray was used to detect MTHFR C677T and A1298C single nucleotide polymorphism loci on 157 healthy controls and 127 patients from Jiangsu province with hematological malignancies (30 with multiple myeloma, 28 with non-Hodgkin's lymphoma, 22 with acute lymphoblastic leukemia, 40 with acute myeloid leukemia, and seven with chronic myeloid leukemia). The allele frequency of 677T was 41.3% in patients and 33.1% in controls, showed significant difference (chi2 = 4.08, p = 0.043); 677TT genotype with a high susceptibility to hematological malignancy (OR 1.96, 95% CI 1.01 - 4.45, p = 0.041). In subgroup analyses, the genotypes 677TT and 1298CC were associated with significantly increased multiple myeloma risk (TT vs. CC: OR 8.92, 95% CI 1.06 - 75.24, p = 0.006; CC vs. AA: OR = 4.80, 95% CI 1.56 - 14.73, p = 0.044). No associations were found between polymorphisms and susceptibilities to acute lymphoblastic leukemia, acute myeloid leukemia, or non-Hodgkin's lymphoma. MTHFRC677T polymorphisms influence the risk of hematological malignancy among the population in Jiangsu province. Both MTHFR 677TT and MTHFR 1298CC genotypes increase susceptibility to myeloid leukemia.

  19. Pharmacogenetic study of the impact of ABCB1 single-nucleotide polymorphisms on lenalidomide treatment outcomes in patients with multiple myeloma: results from a phase IV observational study and subsequent phase II clinical trial.

    PubMed

    Jakobsen Falk, Ingrid; Lund, Johan; Gréen, Henrik; Gruber, Astrid; Alici, Evren; Lauri, Birgitta; Blimark, Cecilie; Mellqvist, Ulf-Henrik; Swedin, Agneta; Forsberg, Karin; Carlsson, Conny; Hardling, Mats; Ahlberg, Lucia; Lotfi, Kourosh; Nahi, Hareth

    2018-01-01

    Despite therapeutic advances, patients with multiple myeloma (MM) continue to experience disease relapse and treatment resistance. The gene ABCB1 encodes the drug transporter P-glycoprotein, which confers resistance through drug extrusion across the cell membrane. Lenalidomide (Len) is excreted mainly via the kidneys, and, given the expression of P-gp in the renal tubuli, single-nucleotide polymorphisms (SNPs) in the ABCB1 gene may influence Len plasma concentrations and, subsequently, the outcome of treatment. We, therefore, investigated the influence of ABCB1 genetic variants on Len treatment outcomes and adverse events (AEs). Ninety patients with relapsed or refractory MM, who received the second-line Len plus dexamethasone in the Rev II trial, were genotyped for the ABCB1 SNPs 1199G>A (Ser400Asn, rs2229109), 1236C>T (silent, rs1128503), 2677G>T/A (Ala893Ser, rs2032582), and 3435C>T (silent, rs1045642) using pyrosequencing, and correlations to response parameters, outcomes, and AEs were investigated. No significant associations were found between genotype and either best response rates or hematological AEs, and 1236C>T, 2677G>T or 3435C>T genotypes had no impact on survival. There was a trend towards increased time to progression (TTP) in patients carrying the 1199A variant, and a significant difference in TTP between genotypes in patients with standard-risk cytogenetics. Our findings show a limited influence of ABCB1 genotype on lenalidomide treatment efficacy and safety. The results suggest that 1199G>A may be a marker of TTP following Len treatment in standard-risk patients; however, larger studies are needed to validate and clarify the relationship.

  20. Association of single nucleotide polymorphisms in a glutamate receptor gene (GRM8) with theta power of event-related oscillations and alcohol dependence.

    PubMed

    Chen, Andrew C H; Tang, Yongqiang; Rangaswamy, Madhavi; Wang, Jen C; Almasy, Laura; Foroud, Tatiana; Edenberg, Howard J; Hesselbrock, Victor; Nurnberger, John; Kuperman, Samuel; O'Connor, Sean J; Schuckit, Marc A; Bauer, Lance O; Tischfield, Jay; Rice, John P; Bierut, Laura; Goate, Alison; Porjesz, Bernice

    2009-04-05

    Evidence suggests the P3 amplitude of the event-related potential and its underlying superimposed event-related oscillations (EROs), primarily in the theta (4-5 Hz) and delta (1-3 Hz) frequencies, as endophenotypes for the risk of alcoholism and other disinhibitory disorders. Major neurochemical substrates contributing to theta and delta rhythms and P3 involve strong GABAergic, cholinergic and glutamatergic system interactions. The aim of this study was to test the potential associations between single nucleotide polymorphisms (SNPs) in glutamate receptor genes and ERO quantitative traits. GRM8 was selected because it maps at chromosome 7q31.3-q32.1 under the peak region where we previously identified significant linkage (peak LOD = 3.5) using a genome-wide linkage scan of the same phenotype (event-related theta band for the target visual stimuli). Neural activities recorded from scalp electrodes during a visual oddball task in which rare target elicited P3s were analyzed in a subset of the Collaborative Study on the Genetics of Alcoholism (COGA) sample comprising 1,049 Caucasian subjects from 209 families (with 472 DSM-IV alcohol dependent individuals). The family-based association test (FBAT) detected significant association (P < 0.05) with multiple SNPs in the GRM8 gene and event-related theta power to target visual stimuli, and also with alcohol dependence, even after correction for multiple comparisons by false discovery rate (FDR). Our results suggest that variation in GRM8 may be involved in modulating event-related theta oscillations during information processing and also in vulnerability to alcoholism. These findings underscore the utility of electrophysiology and the endophenotype approach in the genetic study of psychiatric disorders. (c) 2008 Wiley-Liss, Inc.

  1. Whole genome sequencing discriminates hepatocellular carcinoma with intrahepatic metastasis from multi-centric tumors.

    PubMed

    Furuta, Mayuko; Ueno, Masaki; Fujimoto, Akihiro; Hayami, Shinya; Yasukawa, Satoru; Kojima, Fumiyoshi; Arihiro, Koji; Kawakami, Yoshiiku; Wardell, Christopher P; Shiraishi, Yuichi; Tanaka, Hiroko; Nakano, Kaoru; Maejima, Kazuhiro; Sasaki-Oku, Aya; Tokunaga, Naoki; Boroevich, Keith A; Abe, Tetsuo; Aikata, Hiroshi; Ohdan, Hideki; Gotoh, Kunihito; Kubo, Michiaki; Tsunoda, Tatsuhiko; Miyano, Satoru; Chayama, Kazuaki; Yamaue, Hiroki; Nakagawa, Hidewaki

    2017-02-01

    Patients with hepatocellular carcinoma (HCC) have a high-risk of multi-centric (MC) tumor occurrence due to a strong carcinogenic background in the liver. In addition, they have a high risk of intrahepatic metastasis (IM). Liver tumors withIM or MC are profoundly different in their development and clinical outcome. However, clinically or pathologically discriminating between IM and MC can be challenging. This study investigated whether IM or MC could be diagnosed at the molecular level. We performed whole genome and RNA sequencing analyses of 49 tumors including two extra-hepatic metastases, and one nodule-in-nodule tumor from 23 HCC patients. Sequencing-based molecular diagnosis using somatic single nucleotide variation information showed higher sensitivity compared to previous techniques due to the inclusion of a larger number of mutation events. This proved useful in cases, which showed inconsistent clinical diagnoses. In addition, whole genome sequencing offered advantages in profiling of other genetic alterations, such as structural variations, copy number alterations, and variant allele frequencies, and helped to confirm the IM/MCdiagnosis. Divergent alterations between IM tumors with sorafenib treatment, long time-intervals, or tumor-in-tumor nodules indicated high intra-tumor heterogeneity, evolution, and clonal switching of liver cancers. It is important to analyze the differences between IM tumors, in addition to IM/MC diagnosis, before selecting a therapeutic strategy for multiple tumors in the liver. Whole genome sequencing of multiple liver tumors enabled the accuratediagnosis ofmulti-centric occurrence and intrahepatic metastasis using somatic single nucleotide variation information. In addition, genetic discrepancies between tumors help us to understand the physical changes during recurrence and cancer spread. Copyright © 2016 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

  2. Intracellular nucleotide and nucleotide sugar contents of cultured CHO cells determined by a fast, sensitive, and high-resolution ion-pair RP-HPLC.

    PubMed

    Kochanowski, N; Blanchard, F; Cacan, R; Chirat, F; Guedon, E; Marc, A; Goergen, J-L

    2006-01-15

    Analysis of intracellular nucleotide and nucleotide sugar contents is essential in studying protein glycosylation of mammalian cells. Nucleotides and nucleotide sugars are the donor substrates of glycosyltransferases, and nucleotides are involved in cellular energy metabolism and its regulation. A sensitive and reproducible ion-pair reverse-phase high-performance liquid chromatography (RP-HPLC) method has been developed, allowing the direct and simultaneous detection and quantification of some essential nucleotides and nucleotide sugars. After a perchloric acid extraction, 13 molecules (8 nucleotides and 5 nucleotide sugars) were separated, including activated sugars such as UDP-glucose, UDP-galactose, GDP-mannose, UDP-N-acetylglucosamine, and UDP-N-acetylgalactosamine. To validate the analytical parameters, the reproducibility, linearity of calibration curves, detection limits, and recovery were evaluated for standard mixtures and cell extracts. The developed method is capable of resolving picomolar quantities of nucleotides and nucleotide sugars in a single chromatographic run. The HPLC method was then applied to quantify intracellular levels of nucleotides and nucleotide sugars of Chinese hamster ovary (CHO) cells cultivated in a bioreactor batch process. Evolutions of the titers of nucleotides and nucleotide sugars during the batch process are discussed.

  3. Genome-Wide Divergence and Linkage Disequilibrium Analyses for Capsicum baccatum Revealed by Genome-Anchored Single Nucleotide Polymorphisms

    PubMed Central

    Nimmakayala, Padma; Abburi, Venkata L.; Saminathan, Thangasamy; Almeida, Aldo; Davenport, Brittany; Davidson, Joshua; Reddy, C. V. Chandra Mohan; Hankins, Gerald; Ebert, Andreas; Choi, Doil; Stommel, John; Reddy, Umesh K.

    2016-01-01

    Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to characterize population structure and species domestication of these two important incompatible cultivated pepper species. Estimated mean nucleotide diversity (π) and Tajima's D across various chromosomes revealed biased distribution toward negative values on all chromosomes (except for chromosome 4) in cultivated C. baccatum, indicating a population bottleneck during domestication of C. baccatum. In contrast, C. annuum chromosomes showed positive π and Tajima's D on all chromosomes except chromosome 8, which may be because of domestication at multiple sites contributing to wider genetic diversity. For C. baccatum, 13,129 SNPs were available, with minor allele frequency (MAF) ≥0.05; PCA of the SNPs revealed 283 C. baccatum accessions grouped into 3 distinct clusters, for strong population structure. The fixation index (FST) between domesticated C. annuum and C. baccatum was 0.78, which indicates genome-wide divergence. We conducted extensive linkage disequilibrium (LD) analysis of C. baccatum var. pendulum cultivars on all adjacent SNP pairs within a chromosome to identify regions of high and low LD interspersed with a genome-wide average LD block size of 99.1 kb. We characterized 1742 haplotypes containing 4420 SNPs (range 9–2 SNPs per haplotype). Genome-wide association study (GWAS) of peduncle length, a trait that differentiates wild and domesticated C. baccatum types, revealed 36 significantly associated genome-wide SNPs. Population structure, identity by state (IBS) and LD patterns across the genome will be of potential use for future GWAS of economically important traits in C. baccatum peppers. PMID:27857720

  4. Genome-Wide Divergence and Linkage Disequilibrium Analyses for Capsicum baccatum Revealed by Genome-Anchored Single Nucleotide Polymorphisms.

    PubMed

    Nimmakayala, Padma; Abburi, Venkata L; Saminathan, Thangasamy; Almeida, Aldo; Davenport, Brittany; Davidson, Joshua; Reddy, C V Chandra Mohan; Hankins, Gerald; Ebert, Andreas; Choi, Doil; Stommel, John; Reddy, Umesh K

    2016-01-01

    Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to characterize population structure and species domestication of these two important incompatible cultivated pepper species. Estimated mean nucleotide diversity (π) and Tajima's D across various chromosomes revealed biased distribution toward negative values on all chromosomes (except for chromosome 4) in cultivated C. baccatum , indicating a population bottleneck during domestication of C. baccatum . In contrast, C. annuum chromosomes showed positive π and Tajima's D on all chromosomes except chromosome 8, which may be because of domestication at multiple sites contributing to wider genetic diversity. For C. baccatum , 13,129 SNPs were available, with minor allele frequency (MAF) ≥0.05; PCA of the SNPs revealed 283 C. baccatum accessions grouped into 3 distinct clusters, for strong population structure. The fixation index ( F ST ) between domesticated C. annuum and C. baccatum was 0.78, which indicates genome-wide divergence. We conducted extensive linkage disequilibrium (LD) analysis of C. baccatum var. pendulum cultivars on all adjacent SNP pairs within a chromosome to identify regions of high and low LD interspersed with a genome-wide average LD block size of 99.1 kb. We characterized 1742 haplotypes containing 4420 SNPs (range 9-2 SNPs per haplotype). Genome-wide association study (GWAS) of peduncle length, a trait that differentiates wild and domesticated C. baccatum types, revealed 36 significantly associated genome-wide SNPs. Population structure, identity by state (IBS) and LD patterns across the genome will be of potential use for future GWAS of economically important traits in C. baccatum peppers.

  5. Reduced representation approaches to interrogate genome diversity in large repetitive plant genomes.

    PubMed

    Hirsch, Cory D; Evans, Joseph; Buell, C Robin; Hirsch, Candice N

    2014-07-01

    Technology and software improvements in the last decade now provide methodologies to access the genome sequence of not only a single accession, but also multiple accessions of plant species. This provides a means to interrogate species diversity at the genome level. Ample diversity among accessions in a collection of species can be found, including single-nucleotide polymorphisms, insertions and deletions, copy number variation and presence/absence variation. For species with small, non-repetitive rich genomes, re-sequencing of query accessions is robust, highly informative, and economically feasible. However, for species with moderate to large sized repetitive-rich genomes, technical and economic barriers prevent en masse genome re-sequencing of accessions. Multiple approaches to access a focused subset of loci in species with larger genomes have been developed, including reduced representation sequencing, exome capture and transcriptome sequencing. Collectively, these approaches have enabled interrogation of diversity on a genome scale for large plant genomes, including crop species important to worldwide food security. © The Author 2014. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  6. MACARON: A python framework to identify and re-annotate multi-base affected codons in whole genome/exome sequence data.

    PubMed

    Khan, Waqasuddin; Saripella, Ganapathi Varma-; Ludwig, Thomas; Cuppens, Tania; Thibord, Florian; Génin, Emmanuelle; Deleuze, Jean-Francois; Trégouët, David-Alexandre

    2018-05-03

    Predicted deleteriousness of coding variants is a frequently used criterion to filter out variants detected in next-generation sequencing projects and to select candidates impacting on the risk of human diseases. Most available dedicated tools implement a base-to-base annotation approach that could be biased in presence of several variants in the same genetic codon. We here proposed the MACARON program that, from a standard VCF file, identifies, re-annotates and predicts the amino acid change resulting from multiple single nucleotide variants (SNVs) within the same genetic codon. Applied to the whole exome dataset of 573 individuals, MACARON identifies 114 situations where multiple SNVs within a genetic codon induce an amino acid change that is different from those predicted by standard single SNV annotation tool. Such events are not uncommon and deserve to be studied in sequencing projects with inconclusive findings. MACARON is written in python with codes available on the GENMED website (www.genmed.fr). david-alexandre.tregouet@inserm.fr. Supplementary data are available at Bioinformatics online.

  7. Gender and single nucleotide polymorphisms in MTHFR, BHMT, SPTLC1, CRBP2R, and SCARB1 are significant predictors of plasma homocysteine normalized by RBC folate in healthy adults.

    USDA-ARS?s Scientific Manuscript database

    Using linear regression models, we studied the main and two-way interaction effects of the predictor variables gender, age, BMI, and 64 folate/vitamin B-12/homocysteine/lipid/cholesterol-related single nucleotide polymorphisms (SNP) on log-transformed plasma homocysteine normalized by red blood cell...

  8. Brief Report: Glutamate Transporter Gene ("SLC1A1") Single Nucleotide Polymorphism (rs301430) and Repetitive Behaviors and Anxiety in Children with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Gadow, Kenneth D.; Roohi, Jasmin; DeVincent, Carla J.; Kirsch, Sarah; Hatchwell, Eli

    2010-01-01

    Investigated association of single nucleotide polymorphism (SNP) rs301430 in glutamate transporter gene ("SLC1A1") with severity of repetitive behaviors (obsessive-compulsive behaviors, tics) and anxiety in children with autism spectrum disorder (ASD). Mothers and/or teachers completed a validated DSM-IV-referenced rating scale for 67 children…

  9. Effect of increasing the number of single-nucleotide polymorphisms from 60,000 to 85,000 in genomic evaluation of Holsteins

    USDA-ARS?s Scientific Manuscript database

    The periodic need to restock reagent pools for genotyping chips provides an opportunity to increase the number of single-nucleotide polymorphisms (SNP) on a chip at no increase in cost. A high-density chip with >140,000 SNP has been developed by GeneSeek Inc. (Lincoln, NE) to increase accuracy of ge...

  10. Development of single-nucleotide polymorphism markers for Bromus tectorum (Poaceae) from a partially sequenced transcriptome

    Treesearch

    Keith R. Merrill; Craig E. Coleman; Susan E. Meyer; Elizabeth A. Leger; Katherine A. Collins

    2016-01-01

    Premise of the study: Bromus tectorum (Poaceae) is an annual grass species that is invasive in many areas of the world but most especially in the U.S. Intermountain West. Single-nucleotide polymorphism (SNP) markers were developed for use in investigating the geospatial and ecological diversity of B. tectorum in the Intermountain West to better understand the...

  11. A Comprehensive Experiment for Molecular Biology: Determination of Single Nucleotide Polymorphism in Human REV3 Gene Using PCR-RFLP

    ERIC Educational Resources Information Center

    Zhang, Xu; Shao, Meng; Gao, Lu; Zhao, Yuanyuan; Sun, Zixuan; Zhou, Liping; Yan, Yongmin; Shao, Qixiang; Xu, Wenrong; Qian, Hui

    2017-01-01

    Laboratory exercise is helpful for medical students to understand the basic principles of molecular biology and to learn about the practical applications of molecular biology. We have designed a lab course on molecular biology about the determination of single nucleotide polymorphism (SNP) in human REV3 gene, the product of which is a subunit of…

  12. Antibiotic Resistance and Single-Nucleotide Polymorphism Cluster Grouping Type in a Multinational Sample of Resistant Mycobacterium tuberculosis Isolates▿

    PubMed Central

    Brimacombe, M.; Hazbon, M.; Motiwala, A. S.; Alland, D.

    2007-01-01

    A single-nucleotide polymorphism-based cluster grouping (SCG) classification system for Mycobacterium tuberculosis was used to examine antibiotic resistance type and resistance mutations in relationship to specific evolutionary lineages. Drug resistance and resistance mutations were seen across all SCGs. SCG-2 had higher proportions of katG codon 315 mutations and resistance to four drugs. PMID:17846140

  13. Immune complex-mediated autoimmunity in a patient With Smith-Magenis syndrome (del 17p11.2).

    PubMed

    Yang, Jianying; Chandrasekharappa, Settara C; Vilboux, Thierry; Smith, Ann C M; Peterson, Erik J

    2014-08-01

    Smith-Magenis syndrome (SMS) is a sporadic congenital disorder involving multiple organ systems caused by chromosome 17p11.2 deletions. Smith-Magenis syndrome features craniofacial and skeletal anomalies, cognitive impairment, and neurobehavioral abnormalities. In addition, some SMS patients may exhibit hypogammaglobulinemia. We report the first case of SMS-associated autoimmunity in a woman who presented with adult onset of multiple autoimmune disorders, including systemic lupus erythematosus, antiphospholipid antibody syndrome, and autoimmune hepatitis. Molecular analysis using single-nucleotide polymorphism array confirmed a de novo 3.8-Mb deletion (breakpoints, chr17: 16,660,721-20,417,975), resulting in haploinsufficiency for TACI (transmembrane activator and CAML interactor). Our data are consistent with potential loss of function for the BAFF (B cell-activating factor) receptor TACI as a contributing factor to human autoimmune phenomena.

  14. Screening for SNPs with Allele-Specific Methylation based on Next-Generation Sequencing Data.

    PubMed

    Hu, Bo; Ji, Yuan; Xu, Yaomin; Ting, Angela H

    2013-05-01

    Allele-specific methylation (ASM) has long been studied but mainly documented in the context of genomic imprinting and X chromosome inactivation. Taking advantage of the next-generation sequencing technology, we conduct a high-throughput sequencing experiment with four prostate cell lines to survey the whole genome and identify single nucleotide polymorphisms (SNPs) with ASM. A Bayesian approach is proposed to model the counts of short reads for each SNP conditional on its genotypes of multiple subjects, leading to a posterior probability of ASM. We flag SNPs with high posterior probabilities of ASM by accounting for multiple comparisons based on posterior false discovery rates. Applying the Bayesian approach to the in-house prostate cell line data, we identify 269 SNPs as candidates of ASM. A simulation study is carried out to demonstrate the quantitative performance of the proposed approach.

  15. Design and characterization of a nanopore-coupled polymerase for single-molecule DNA sequencing by synthesis on an electrode array

    PubMed Central

    Stranges, P. Benjamin; Palla, Mirkó; Kalachikov, Sergey; Nivala, Jeff; Dorwart, Michael; Trans, Andrew; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Tao, Chuanjuan; Morozova, Irina; Li, Zengmin; Shi, Shundi; Aberra, Aman; Arnold, Cleoma; Yang, Alexander; Aguirre, Anne; Harada, Eric T.; Korenblum, Daniel; Pollard, James; Bhat, Ashwini; Gremyachinskiy, Dmitriy; Bibillo, Arek; Chen, Roger; Davis, Randy; Russo, James J.; Fuller, Carl W.; Roever, Stefan; Ju, Jingyue; Church, George M.

    2016-01-01

    Scalable, high-throughput DNA sequencing is a prerequisite for precision medicine and biomedical research. Recently, we presented a nanopore-based sequencing-by-synthesis (Nanopore-SBS) approach, which used a set of nucleotides with polymer tags that allow discrimination of the nucleotides in a biological nanopore. Here, we designed and covalently coupled a DNA polymerase to an α-hemolysin (αHL) heptamer using the SpyCatcher/SpyTag conjugation approach. These porin–polymerase conjugates were inserted into lipid bilayers on a complementary metal oxide semiconductor (CMOS)-based electrode array for high-throughput electrical recording of DNA synthesis. The designed nanopore construct successfully detected the capture of tagged nucleotides complementary to a DNA base on a provided template. We measured over 200 tagged-nucleotide signals for each of the four bases and developed a classification method to uniquely distinguish them from each other and background signals. The probability of falsely identifying a background event as a true capture event was less than 1.2%. In the presence of all four tagged nucleotides, we observed sequential additions in real time during polymerase-catalyzed DNA synthesis. Single-polymerase coupling to a nanopore, in combination with the Nanopore-SBS approach, can provide the foundation for a low-cost, single-molecule, electronic DNA-sequencing platform. PMID:27729524

  16. Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.

    PubMed

    Black, W C; Gorrochotegui-Escalante, N; Duteau, N M

    2006-03-01

    Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.

  17. Single-Cell Sequencing for Drug Discovery and Drug Development.

    PubMed

    Wu, Hongjin; Wang, Charles; Wu, Shixiu

    2017-01-01

    Next-generation sequencing (NGS), particularly single-cell sequencing, has revolutionized the scale and scope of genomic and biomedical research. Recent technological advances in NGS and singlecell studies have made the deep whole-genome (DNA-seq), whole epigenome and whole-transcriptome sequencing (RNA-seq) at single-cell level feasible. NGS at the single-cell level expands our view of genome, epigenome and transcriptome and allows the genome, epigenome and transcriptome of any organism to be explored without a priori assumptions and with unprecedented throughput. And it does so with single-nucleotide resolution. NGS is also a very powerful tool for drug discovery and drug development. In this review, we describe the current state of single-cell sequencing techniques, which can provide a new, more powerful and precise approach for analyzing effects of drugs on treated cells and tissues. Our review discusses single-cell whole genome/exome sequencing (scWGS/scWES), single-cell transcriptome sequencing (scRNA-seq), single-cell bisulfite sequencing (scBS), and multiple omics of single-cell sequencing. We also highlight the advantages and challenges of each of these approaches. Finally, we describe, elaborate and speculate the potential applications of single-cell sequencing for drug discovery and drug development. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  18. Detection of Strand Cleavage And Oxidation Damage Using Model DNA Molecules Captured in a Nanoscale Pore

    NASA Technical Reports Server (NTRS)

    Vercoutere, W.; Solbrig, A.; DeGuzman, V.; Deamer, D.; Akeson, M.

    2003-01-01

    We use a biological nano-scale pore to distinguish among individual DNA hairpins that differ by a single site of oxidation or a nick in the sugar-phosphate backbone. In earlier work we showed that the protein ion channel alpha-hemolysin can be used as a detector to distinguish single-stranded from double-stranded DNA, single base pair and single nucleotide differences. This resolution is in part a result of sensitivity to structural changes that influence the molecular dynamics of nucleotides within DNA. The strand cleavage products we examined here included a 5-base-pair (5-bp) hairpin with a 5-prime five-nucleotide overhang, and a complementary five-nucleotide oligomer. These produced predictable shoulder-spike and rapid near-full blockade signatures, respectively. When combined, strand annealing was monitored in real time. The residual current level dropped to a lower discrete level in the shoulder-spike blockade signatures, and the duration lengthened. However, these blockade signatures had a shorter duration than the unmodified l0bp hairpin. To test the pore sensitivity to nucleotide oxidation, we examined a 9-bp hairpin with a terminal 8-oxo-deoxyguanosine (8-oxo-dG), or a penultimate 8-oxo-dG. Each produced blockade signatures that differed from the otherwise identical control 9bp hairpins. This study showed that DNA structure is modified sufficiently by strand cleavage or oxidation damage at a single site to alter in a predictable manner the ionic current blockade signatures produced. This technique improves the ability to assess damage to DNA, and can provide a simple means to help characterize the risks of radiation exposure. It may also provide a method to test radiation protection.

  19. Identification of rs7350481 at chromosome 11q23.3 as a novel susceptibility locus for metabolic syndrome in Japanese individuals by an exome-wide association study.

    PubMed

    Yamada, Yoshiji; Sakuma, Jun; Takeuchi, Ichiro; Yasukochi, Yoshiki; Kato, Kimihiko; Oguri, Mitsutoshi; Fujimaki, Tetsuo; Horibe, Hideki; Muramatsu, Masaaki; Sawabe, Motoji; Fujiwara, Yoshinori; Taniguchi, Yu; Obuchi, Shuichi; Kawai, Hisashi; Shinkai, Shoji; Mori, Seijiro; Arai, Tomio; Tanaka, Masashi

    2017-06-13

    We have performed exome-wide association studies to identify genetic variants that influence body mass index or confer susceptibility to obesity or metabolic syndrome in Japanese. The exome-wide association study for body mass index included 12,890 subjects, and those for obesity and metabolic syndrome included 12,968 subjects (3954 individuals with obesity, 9014 controls) and 6817 subjects (3998 individuals with MetS, 2819 controls), respectively. Exome-wide association studies were performed with Illumina HumanExome-12 DNA Analysis BeadChip or Infinium Exome-24 BeadChip arrays. The relation of genotypes of single nucleotide polymorphisms to body mass index was examined by linear regression analysis, and that of allele frequencies of single nucleotide polymorphisms to obesity or metabolic syndrome was evaluated with Fisher's exact test. The exome-wide association studies identified six, 11, and 40 single nucleotide polymorphisms as being significantly associated with body mass index, obesity (P <1.21 × 10-6), or metabolic syndrome (P <1.20 × 10-6), respectively. Subsequent multivariable logistic regression analysis with adjustment for age and sex revealed that three and five single nucleotide polymorphisms were related (P < 0.05) to obesity or metabolic syndrome, respectively, with one of these latter polymorphisms-rs7350481 (C/T) at chromosome 11q23.3-also being significantly (P < 3.13 × 10-4) associated with metabolic syndrome. The polymorphism rs7350481 may thus be a novel susceptibility locus for metabolic syndrome in Japanese. In addition, single nucleotide polymorphisms in three genes (CROT, TSC1, RIN3) and at four loci (ANKK1, ZNF804B, CSRNP3, 17p11.2) were implicated as candidate determinants of obesity and metabolic syndrome, respectively.

  20. Meta-analysis of the relationship between single nucleotide polymorphism of IL-10-1082G/A and rheumatic heart disease.

    PubMed

    Dai, Weiran; Ye, Ziliang; Lu, Haili; Su, Qiang; Li, Hui; Li, Lang

    2018-02-23

    The results showed that there was a certain correlation between the single nucleotide polymorphism of IL-10-1082G/A and rheumatic heart disease, but there was no systematic study to verify this conclusion. Systematic review of the association between single nucleotide polymorphism of IL-10-1082G/A locus and rheumatic heart disease. Computer retrieval PubMed, EMbase, Cochrane Library, CBM, CNKI, VIP and Data WanFang, the retrieval time limit from inception to June 2017. A case control study of single nucleotide polymorphisms and rheumatic heart disease in patients with rheumatic heart disease in the IL-10-1082G/A was collected. Two researchers independently screened the literature, extracted data and evaluated the risk of bias in the study, and using RevMan5.3 software for data analysis. A total of 3 case control studies were included, including 318 patients with rheumatic heart disease and 502 controls. Meta-analysis showed that there was no correlation between IL-10-1082G/A gene polymorphism and rheumatic heart disease [AA+AG VS GG: OR = 0.62, 95% CI (0.28, 1.39), P = 0.25; AA VS AG+GG: OR = 0.73, 95% CI (0.54, 1.00), P = 0.05; AA VS GG: OR = 0.70, 95% CI(0.47, 1.05), P = 0.08; AG VS GG: OR = 0.65, 95% CI (0.22, 1.92), P = 0.43; A VS G: OR = 0.87, 95% CI (0.71, 1.06), P = 0.17]. When AA is a recessive gene, the single nucleotide polymorphism of IL-10-1082G/A is associated with the presence of rheumatic heart disease. Due to the limitations of the quantity and quality of the included literatures, the further research results were still needed.

  1. OmpF, a nucleotide-sensing nanoprobe, computational evaluation of single channel activities

    NASA Astrophysics Data System (ADS)

    Abdolvahab, R. H.; Mobasheri, H.; Nikouee, A.; Ejtehadi, M. R.

    2016-09-01

    The results of highthroughput practical single channel experiments should be formulated and validated by signal analysis approaches to increase the recognition precision of translocating molecules. For this purpose, the activities of the single nano-pore forming protein, OmpF, in the presence of nucleotides were recorded in real time by the voltage clamp technique and used as a means for nucleotide recognition. The results were analyzed based on the permutation entropy of current Time Series (TS), fractality, autocorrelation, structure function, spectral density, and peak fraction to recognize each nucleotide, based on its signature effect on the conductance, gating frequency and voltage sensitivity of channel at different concentrations and membrane potentials. The amplitude and frequency of ion current fluctuation increased in the presence of Adenine more than Cytosine and Thymine in milli-molar (0.5 mM) concentrations. The variance of the current TS at various applied voltages showed a non-monotonic trend whose initial increasing slope in the presence of Thymine changed to a decreasing one in the second phase and was different from that of Adenine and Cytosine; e.g., by increasing the voltage from 40 to 140 mV in the 0.5 mM concentration of Adenine or Cytosine, the variance decreased by one third while for the case of Thymine it was doubled. Moreover, according to the structure function of TS, the fractality of current TS differed as a function of varying membrane potentials (pd) and nucleotide concentrations. Accordingly, the calculated permutation entropy of the TS, validated the biophysical approach defined for the recognition of different nucleotides at various concentrations, pd's and polarities. Thus, the promising outcomes of the combined experimental and theoretical methodologies presented here can be implemented as a complementary means in pore-based nucleotide recognition approaches.

  2. Fine-mapping identifies multiple prostate cancer risk loci at 5p15, one of which associates with TERT expression

    PubMed Central

    Kote-Jarai, Zsofia; Saunders, Edward J.; Leongamornlert, Daniel A.; Tymrakiewicz, Malgorzata; Dadaev, Tokhir; Jugurnauth-Little, Sarah; Ross-Adams, Helen; Al Olama, Ali Amin; Benlloch, Sara; Halim, Silvia; Russel, Roslin; Dunning, Alison M.; Luccarini, Craig; Dennis, Joe; Neal, David E.; Hamdy, Freddie C.; Donovan, Jenny L.; Muir, Ken; Giles, Graham G.; Severi, Gianluca; Wiklund, Fredrik; Gronberg, Henrik; Haiman, Christopher A.; Schumacher, Fredrick; Henderson, Brian E.; Le Marchand, Loic; Lindstrom, Sara; Kraft, Peter; Hunter, David J.; Gapstur, Susan; Chanock, Stephen; Berndt, Sonja I.; Albanes, Demetrius; Andriole, Gerald; Schleutker, Johanna; Weischer, Maren; Canzian, Federico; Riboli, Elio; Key, Tim J.; Travis, Ruth C.; Campa, Daniele; Ingles, Sue A.; John, Esther M.; Hayes, Richard B.; Pharoah, Paul; Khaw, Kay-Tee; Stanford, Janet L.; Ostrander, Elaine A.; Signorello, Lisa B.; Thibodeau, Stephen N.; Schaid, Dan; Maier, Christiane; Vogel, Walther; Kibel, Adam S.; Cybulski, Cezary; Lubinski, Jan; Cannon-Albright, Lisa; Brenner, Hermann; Park, Jong Y.; Kaneva, Radka; Batra, Jyotsna; Spurdle, Amanda; Clements, Judith A.; Teixeira, Manuel R.; Govindasami, Koveela; Guy, Michelle; Wilkinson, Rosemary A.; Sawyer, Emma J.; Morgan, Angela; Dicks, Ed; Baynes, Caroline; Conroy, Don; Bojesen, Stig E.; Kaaks, Rudolf; Vincent, Daniel; Bacot, François; Tessier, Daniel C.; Easton, Douglas F.; Eeles, Rosalind A.

    2013-01-01

    Associations between single nucleotide polymorphisms (SNPs) at 5p15 and multiple cancer types have been reported. We have previously shown evidence for a strong association between prostate cancer (PrCa) risk and rs2242652 at 5p15, intronic in the telomerase reverse transcriptase (TERT) gene that encodes TERT. To comprehensively evaluate the association between genetic variation across this region and PrCa, we performed a fine-mapping analysis by genotyping 134 SNPs using a custom Illumina iSelect array or Sequenom MassArray iPlex, followed by imputation of 1094 SNPs in 22 301 PrCa cases and 22 320 controls in The PRACTICAL consortium. Multiple stepwise logistic regression analysis identified four signals in the promoter or intronic regions of TERT that independently associated with PrCa risk. Gene expression analysis of normal prostate tissue showed evidence that SNPs within one of these regions also associated with TERT expression, providing a potential mechanism for predisposition to disease. PMID:23535824

  3. Single-Molecule Counting of Point Mutations by Transient DNA Binding

    NASA Astrophysics Data System (ADS)

    Su, Xin; Li, Lidan; Wang, Shanshan; Hao, Dandan; Wang, Lei; Yu, Changyuan

    2017-03-01

    High-confidence detection of point mutations is important for disease diagnosis and clinical practice. Hybridization probes are extensively used, but are hindered by their poor single-nucleotide selectivity. Shortening the length of DNA hybridization probes weakens the stability of the probe-target duplex, leading to transient binding between complementary sequences. The kinetics of probe-target binding events are highly dependent on the number of complementary base pairs. Here, we present a single-molecule assay for point mutation detection based on transient DNA binding and use of total internal reflection fluorescence microscopy. Statistical analysis of single-molecule kinetics enabled us to effectively discriminate between wild type DNA sequences and single-nucleotide variants at the single-molecule level. A higher single-nucleotide discrimination is achieved than in our previous work by optimizing the assay conditions, which is guided by statistical modeling of kinetics with a gamma distribution. The KRAS c.34 A mutation can be clearly differentiated from the wild type sequence (KRAS c.34 G) at a relative abundance as low as 0.01% mutant to WT. To demonstrate the feasibility of this method for analysis of clinically relevant biological samples, we used this technology to detect mutations in single-stranded DNA generated from asymmetric RT-PCR of mRNA from two cancer cell lines.

  4. Elastic-net regularization approaches for genome-wide association studies of rheumatoid arthritis.

    PubMed

    Cho, Seoae; Kim, Haseong; Oh, Sohee; Kim, Kyunga; Park, Taesung

    2009-12-15

    The current trend in genome-wide association studies is to identify regions where the true disease-causing genes may lie by evaluating thousands of single-nucleotide polymorphisms (SNPs) across the whole genome. However, many challenges exist in detecting disease-causing genes among the thousands of SNPs. Examples include multicollinearity and multiple testing issues, especially when a large number of correlated SNPs are simultaneously tested. Multicollinearity can often occur when predictor variables in a multiple regression model are highly correlated, and can cause imprecise estimation of association. In this study, we propose a simple stepwise procedure that identifies disease-causing SNPs simultaneously by employing elastic-net regularization, a variable selection method that allows one to address multicollinearity. At Step 1, the single-marker association analysis was conducted to screen SNPs. At Step 2, the multiple-marker association was scanned based on the elastic-net regularization. The proposed approach was applied to the rheumatoid arthritis (RA) case-control data set of Genetic Analysis Workshop 16. While the selected SNPs at the screening step are located mostly on chromosome 6, the elastic-net approach identified putative RA-related SNPs on other chromosomes in an increased proportion. For some of those putative RA-related SNPs, we identified the interactions with sex, a well known factor affecting RA susceptibility.

  5. Next-generation sequencing reveals cryptic mtDNA diversity of Plasmodium relictum in the Hawaiian Islands

    USGS Publications Warehouse

    Jarvi, S.I.; Farias, M.E.; Lapointe, D.A.; Belcaid, M.; Atkinson, C.T.

    2013-01-01

    Next-generation 454 sequencing techniques were used to re-examine diversity of mitochondrial cytochrome b lineages of avian malaria (Plasmodium relictum) in Hawaii. We document a minimum of 23 variant lineages of the parasite based on single nucleotide transitional changes, in addition to the previously reported single lineage (GRW4). A new, publicly available portal (Integroomer) was developed for initial parsing of 454 datasets. Mean variant prevalence and frequency was higher in low elevation Hawaii Amakihi (Hemignathus virens) with Avipoxvirus-like lesions (P = 0·001), suggesting that the variants may be biologically distinct. By contrast, variant prevalence and frequency did not differ significantly among mid-elevation Apapane (Himatione sanguinea) with or without lesions (P = 0·691). The low frequency and the lack of detection of variants independent of GRW4 suggest that multiple independent introductions of P. relictum to Hawaii are unlikely. Multiple variants may have been introduced in heteroplasmy with GRW4 or exist within the tandem repeat structure of the mitochondrial genome. The discovery of multiple mitochondrial lineages of P. relictum in Hawaii provides a measure of genetic diversity within a geographically isolated population of this parasite and suggests the origins and evolution of parasite diversity may be more complicated than previously recognized.

  6. Next-generation sequencing reveals cryptic mtDNA diversity of Plasmodium relictum in the Hawaiian Islands.

    PubMed

    Jarvi, S I; Farias, M E; Lapointe, D A; Belcaid, M; Atkinson, C T

    2013-12-01

    Next-generation 454 sequencing techniques were used to re-examine diversity of mitochondrial cytochrome b lineages of avian malaria (Plasmodium relictum) in Hawaii. We document a minimum of 23 variant lineages of the parasite based on single nucleotide transitional changes, in addition to the previously reported single lineage (GRW4). A new, publicly available portal (Integroomer) was developed for initial parsing of 454 datasets. Mean variant prevalence and frequency was higher in low elevation Hawaii Amakihi (Hemignathus virens) with Avipoxvirus-like lesions (P = 0·001), suggesting that the variants may be biologically distinct. By contrast, variant prevalence and frequency did not differ significantly among mid-elevation Apapane (Himatione sanguinea) with or without lesions (P = 0·691). The low frequency and the lack of detection of variants independent of GRW4 suggest that multiple independent introductions of P. relictum to Hawaii are unlikely. Multiple variants may have been introduced in heteroplasmy with GRW4 or exist within the tandem repeat structure of the mitochondrial genome. The discovery of multiple mitochondrial lineages of P. relictum in Hawaii provides a measure of genetic diversity within a geographically isolated population of this parasite and suggests the origins and evolution of parasite diversity may be more complicated than previously recognized.

  7. Methods and kits for nucleic acid analysis using fluorescence resonance energy transfer

    DOEpatents

    Kwok, Pui-Yan; Chen, Xiangning

    1999-01-01

    A method for detecting the presence of a target nucleotide or sequence of nucleotides in a nucleic acid is disclosed. The method is comprised of forming an oligonucleotide labeled with two fluorophores on the nucleic acid target site. The doubly labeled oligonucleotide is formed by addition of a singly labeled dideoxynucleoside triphosphate to a singly labeled polynucleotide or by ligation of two singly labeled polynucleotides. Detection of fluorescence resonance energy transfer upon denaturation indicates the presence of the target. Kits are also provided. The method is particularly applicable to genotyping.

  8. Who's your daddy? Using RADseq to explore survival and paternity in the clownfish, Amphiprion clarkii.

    NASA Astrophysics Data System (ADS)

    Stuart, M. R.; Pinsky, M. L.

    2016-02-01

    The ability to use DNA to identify individuals and their offspring has begun to revolutionize marine ecology. However, genetic mark-recapture and parentage studies typically require large numbers of individuals and associated high genotyping costs. Here, we describe a rapid and relatively low-cost protocol for genotyping non-model organisms at thousands of Single Nucleotide Polymorphisms (SNPs) using massively parallel sequencing. We apply the approach to a population of yellowtail clownfish, Amphiprion clarkii, to detect genetic mark-recaptures and parent-offspring relationships. We test multiple bioinformatic approaches and describe how this method could be applied to a wide variety of marine organisms.

  9. Single nucleotide polymorphisms in CETP, SLC46A1, SLC19A1, CD36, BCOM1, APOA5, and ABCA1 are significant predictors of plasma HDL in healthy adults

    USDA-ARS?s Scientific Manuscript database

    In a marker-trait association study we estimated the statistical significance of 65 single nucleotide polymorphisms (SNP) in 23 candidate genes on HDL levels of two independent Caucasian populations. Each population consisted of men and women and their HDL levels were adjusted for gender and body we...

  10. Rhabdomyolysis After Out-of-Water Exercise in an Elite Adolescent Water Polo Player Carrying the IL-6 174C Allele Single-Nucleotide Polymorphism.

    PubMed

    Eliakim, Alon; Ben Zaken, Sigal; Meckel, Yoav; Yamin, Chen; Dror, Nitzan; Nemet, Dan

    2015-12-01

    We present an adolescent elite water polo player who despite a genetic predisposition to develop exercise-induced severe muscle damage due to carrying the IL-6 174C allele single-nucleotide polymorphism, developed acute rhabdomyolysis only after a vigorous out-of-water training, suggesting that water polo training may be more suitable for genetically predisposed athletes.

  11. Genetic variants associated with the root system architecture of oilseed rape (Brassica napus L.) under contrasting phosphate supply.

    PubMed

    Wang, Xiaohua; Chen, Yanling; Thomas, Catherine L; Ding, Guangda; Xu, Ping; Shi, Dexu; Grandke, Fabian; Jin, Kemo; Cai, Hongmei; Xu, Fangsen; Yi, Bin; Broadley, Martin R; Shi, Lei

    2017-08-01

    Breeding crops with ideal root system architecture for efficient absorption of phosphorus is an important strategy to reduce the use of phosphate fertilizers. To investigate genetic variants leading to changes in root system architecture, 405 oilseed rape cultivars were genotyped with a 60K Brassica Infinium SNP array in low and high P environments. A total of 285 single-nucleotide polymorphisms were associated with root system architecture traits at varying phosphorus levels. Nine single-nucleotide polymorphisms corroborate a previous linkage analysis of root system architecture quantitative trait loci in the BnaTNDH population. One peak single-nucleotide polymorphism region on A3 was associated with all root system architecture traits and co-localized with a quantitative trait locus for primary root length at low phosphorus. Two more single-nucleotide polymorphism peaks on A5 for root dry weight at low phosphorus were detected in both growth systems and co-localized with a quantitative trait locus for the same trait. The candidate genes identified on A3 form a haplotype 'BnA3Hap', that will be important for understanding the phosphorus/root system interaction and for the incorporation into Brassica napus breeding programs. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  12. The clinical application of single-sperm-based SNP haplotyping for PGD of osteogenesis imperfecta.

    PubMed

    Chen, Linjun; Diao, Zhenyu; Xu, Zhipeng; Zhou, Jianjun; Yan, Guijun; Sun, Haixiang

    2018-05-15

    Osteogenesis imperfecta (OI) is a genetically heterogeneous disorder, presenting either autosomal dominant, autosomal recessive or X-linked inheritance patterns. The majority of OI cases are autosomal dominant and are caused by heterozygous mutations in either the COL1A1 or COL1A2 gene. In these dominant disorders, allele dropout (ADO) can lead to misdiagnosis in preimplantation genetic diagnosis (PGD). Polymorphic markers linked to the mutated genes have been used to establish haplotypes for identifying ADO and ensuring the accuracy of PGD. However, the haplotype of male patients cannot be determined without data from affected relatives. Here, we developed a method for single-sperm-based single-nucleotide polymorphism (SNP) haplotyping via next-generation sequencing (NGS) for the PGD of OI. After NGS, 10 informative polymorphic SNP markers located upstream and downstream of the COL1A1 gene and its pathogenic mutation site were linked to individual alleles in a single sperm from an affected male. After haplotyping, a normal blastocyst was transferred to the uterus for a subsequent frozen embryo transfer cycle. The accuracy of PGD was confirmed by amniocentesis at 19 weeks of gestation. A healthy infant weighing 4,250 g was born via vaginal delivery at the 40th week of gestation. Single-sperm-based SNP haplotyping can be applied for PGD of any monogenic disorders or de novo mutations in males in whom the haplotype of paternal mutations cannot be determined due to a lack of affected relatives. ADO: allele dropout; DI: dentinogenesis imperfect; ESHRE: European Society of Human Reproduction and Embryology; FET: frozen embryo transfer; gDNA: genomic DNA; ICSI: intracytoplasmic sperm injection; IVF: in vitro fertilization; MDA: multiple displacement amplification; NGS: next-generation sequencing; OI: osteogenesis imperfect; PBS: phosphate buffer saline; PCR: polymerase chain reaction; PGD: preimplantation genetic diagnosis; SNP: single-nucleotide polymorphism; STR: short tandem repeat; TE: trophectoderm; WGA: whole-genome amplification.

  13. A Ruler Protein in a Complex for Antiviral Defense Determines the Length of Small Interfering CRISPR RNAs

    PubMed Central

    Hatoum-Aslan, Asma; Samai, Poulami; Maniv, Inbal; Jiang, Wenyan; Marraffini, Luciano A.

    2013-01-01

    Small RNAs undergo maturation events that precisely determine the length and structure required for their function. CRISPRs (clustered regularly interspaced short palindromic repeats) encode small RNAs (crRNAs) that together with CRISPR-associated (cas) genes constitute a sequence-specific prokaryotic immune system for anti-viral and anti-plasmid defense. crRNAs are subject to multiple processing events during their biogenesis, and little is known about the mechanism of the final maturation step. We show that in the Staphylococcus epidermidis type III CRISPR-Cas system, mature crRNAs are measured in a Cas10·Csm ribonucleoprotein complex to yield discrete lengths that differ by 6-nucleotide increments. We looked for mutants that impact this crRNA size pattern and found that an alanine substitution of a conserved aspartate residue of Csm3 eliminates the 6-nucleotide increments in the length of crRNAs. In vitro, recombinant Csm3 binds RNA molecules at multiple sites, producing gel-shift patterns that suggest that each protein binds 6 nucleotides of substrate. In vivo, changes in the levels of Csm3 modulate the crRNA size distribution without disrupting the 6-nucleotide periodicity. Our data support a model in which multiple Csm3 molecules within the Cas10·Csm complex bind the crRNA with a 6-nucleotide periodicity to function as a ruler that measures the extent of crRNA maturation. PMID:23935102

  14. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    PubMed

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit.

  15. Association of Cytokine Candidate Genes with Severity of Pain and Co-Occurring Symptoms in Breast Cancer Patients Receiving Chemotherapy

    DTIC Science & Technology

    2013-10-01

    identify common genetic variations (i.e., single nucleotide polymorphisms [ SNPs ] and haplotypes) in cytokine genes, as well demographic, clinical, and...Center. The purpose of the proposed project is to identify common genetic variations (i.e., single nucleotide polymorphisms [ SNPs ] and haplotypes) in...research team continues to meet monthly to discuss progress with regards to recruitment, enrollment, and data collection. Training in Genetics In year

  16. Single-cell analysis of intercellular heteroplasmy of mtDNA in Leber hereditary optic neuropathy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kobayashi, Y.; Sharpe, H.; Brown, N.

    1994-07-01

    The authors have investigated the distribution of mutant mtDNA molecules in single cells from a patient with Leber hereditary optic neuropathy (LHON). LHON is a maternally inherited disease that is characterized by a sudden-onset bilateral loss of central vision, which typically occurs in early adulthood. More than 50% of all LHON patients carry an mtDNA mutation at nucleotide position 11778. This nucleotide change converts a highly conserved arginine residue to histidine at codon 340 in the NADH-ubiquinone oxidoreductase subunit 4 (ND4) gene of mtDNA. In the present study, the authors used PCR amplification of mtDNA from lymphocytes to investigate mtDNAmore » heteroplasmy at the single-cell level in a LHON patient. They found that most cells were either homoplasmic normal or homoplasmic mutant at nucleotide position 11778. Some (16%) cells contained both mutant and normal mtDNA.« less

  17. Variation in the γ-glutamyltransferase 1 gene and risk of chronic pancreatitis.

    PubMed

    Brand, Harrison; Diergaarde, Brenda; O'Connell, Michael R; Whitcomb, David C; Brand, Randall E

    2013-07-01

    Individuals with chronic pancreatitis are at increased risk for pancreatic cancer. We hypothesized that genetic variation in the γ-glutamyltransferase 1 (GGT1) gene, which was recently reported associated with pancreatic cancer risk in a genome-wide association study, is also associated with risk of chronic pancreatitis. Associations between common polymorphisms in GGT1 and chronic pancreatitis were evaluated using data and samples from the North American Pancreatitis Study 2. Patients (n = 496) and control subjects (n = 465) were genotyped for 4 single-nucleotide polymorphisms: rs4820599, rs2017869, rs8135987, and rs5751901. Odds ratios (ORs) and corresponding 95% confidence intervals (95% CI) for chronic pancreatitis risk were calculated using multiple logistic regression models. Interactions with cigarette smoking and alcohol use were explored. Single-nucleotide polymorphisms rs8135987 and rs4820599 were both statistically significantly associated with risk of chronic pancreatitis; compared with common allele homozygotes, individuals with at least 1 minor allele were at increased risk (rs8135987: OR, 1.36; 95% CI, 1.03-1.80 [P(trend) = 0.01]; rs4820599: OR, 1.39; 95% CI, 1.04-1.84 [P(trend) = 0.0]; adjusted for age, sex, race, smoking status, and alcohol use). No significant interactions with cigarette smoking and alcohol use were observed. Our results suggest that common variation in the GGT1 gene may also affect risk of chronic pancreatitis.

  18. Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array

    PubMed Central

    Wang, Shichen; Wong, Debbie; Forrest, Kerrie; Allen, Alexandra; Chao, Shiaoman; Huang, Bevan E; Maccaferri, Marco; Salvi, Silvio; Milner, Sara G; Cattivelli, Luigi; Mastrangelo, Anna M; Whan, Alex; Stephen, Stuart; Barker, Gary; Wieseke, Ralf; Plieske, Joerg; International Wheat Genome Sequencing Consortium; Lillemo, Morten; Mather, Diane; Appels, Rudi; Dolferus, Rudy; Brown-Guedira, Gina; Korol, Abraham; Akhunova, Alina R; Feuillet, Catherine; Salse, Jerome; Morgante, Michele; Pozniak, Curtis; Luo, Ming-Cheng; Dvorak, Jan; Morell, Matthew; Dubcovsky, Jorge; Ganal, Martin; Tuberosa, Roberto; Lawley, Cindy; Mikoulitch, Ivan; Cavanagh, Colin; Edwards, Keith J; Hayden, Matthew; Akhunov, Eduard

    2014-01-01

    High-density single nucleotide polymorphism (SNP) genotyping arrays are a powerful tool for studying genomic patterns of diversity, inferring ancestral relationships between individuals in populations and studying marker–trait associations in mapping experiments. We developed a genotyping array including about 90 000 gene-associated SNPs and used it to characterize genetic variation in allohexaploid and allotetraploid wheat populations. The array includes a significant fraction of common genome-wide distributed SNPs that are represented in populations of diverse geographical origin. We used density-based spatial clustering algorithms to enable high-throughput genotype calling in complex data sets obtained for polyploid wheat. We show that these model-free clustering algorithms provide accurate genotype calling in the presence of multiple clusters including clusters with low signal intensity resulting from significant sequence divergence at the target SNP site or gene deletions. Assays that detect low-intensity clusters can provide insight into the distribution of presence–absence variation (PAV) in wheat populations. A total of 46 977 SNPs from the wheat 90K array were genetically mapped using a combination of eight mapping populations. The developed array and cluster identification algorithms provide an opportunity to infer detailed haplotype structure in polyploid wheat and will serve as an invaluable resource for diversity studies and investigating the genetic basis of trait variation in wheat. PMID:24646323

  19. Multiple thrombophilic single nucleotide polymorphisms lack a significant effect on outcomes in fresh IVF cycles: an analysis of 1717 patients.

    PubMed

    Patounakis, George; Bergh, Eric; Forman, Eric J; Tao, Xin; Lonczak, Agnieszka; Franasiak, Jason M; Treff, Nathan; Scott, Richard T

    2016-01-01

    The aim of the study is to determine if thrombophilic single nucleotide polymorphisms (SNPs) affect outcomes in fresh in vitro fertilization (IVF) cycles in a large general infertility population. A prospective cohort analysis was performed at a university-affiliated private IVF center of female patients undergoing fresh non-donor IVF cycles. The effect of the following thrombophilic SNPs on IVF outcomes were explored: factor V (Leiden and H1299R), prothrombin (G20210A), factor XIII (V34L), β-fibrinogen (-455G → A), plasminogen activator inhibitor-1 (4G/5G), human platelet antigen-1 (a/b9L33P), and methylenetetrahydrofolate reductase (C677T and A1298C). The main outcome measures included positive pregnancy test, clinical pregnancy, embryo implantation, live birth, and pregnancy loss. Patients (1717) were enrolled in the study, and a total of 4169 embryos were transferred. There were no statistically significant differences in positive pregnancy test, clinical pregnancy, embryo implantation, live birth, or pregnancy loss in the analysis of 1717 patients attempting their first cycle of IVF. Receiver operator characteristics and logistic regression analyses showed that outcomes cannot be predicted by the cumulative number of thrombophilic mutations present in the patient. Individual and cumulative thrombophilic SNPs do not affect IVF outcomes. Therefore, initial screening for these SNPs is not indicated.

  20. Genetic variants in PNPLA3 and risk of non-alcoholic fatty liver disease in a Han Chinese population.

    PubMed

    Peng, Xian-E; Wu, Yun-Li; Lin, Shao-Wei; Lu, Qing-Qing; Hu, Zhi-Jian; Lin, Xu

    2012-01-01

    We investigated the possible association between genetic variants in the Patatin like phospholipase-3 (PNPLA3) gene and nonalcoholic fatty liver disease (NAFLD) in a Han Chinese population. We evaluated twelve tagging single-nucleotide polymorphisms (tSNPs) of the PNPLA3 gene in a frequency matched case-control study from Fuzhou city of China (553 cases, 553 controls). In the multivariate logistic regression analysis, the rs738409 GG or GC, and rs139051 TT genotypes were found to be associated with increased risk of NAFLD, and a significant trend of increased risk with increasing numbers of risk genotype was observed in the cumulative effect analysis of these single nucleotide polymorphisms. Furthermore, haplotype association analysis showed that, compared with the most common haplotype, the CAAGAATGCGTG and CGAAGGTGTCCG haplotypes conferred a statistically significant increased risk for NAFLD, while the CGGGAACCCGCG haplotype decreased the risk of NAFLD. Moreover, rs738409 C>G appeared to have a multiplicative joint effect with tea drinking (P<0.005) and an additive joint effect with obesity (Interaction contrast ratio (ICR) = 2.31, 95% CI: 0.7-8.86), hypertriglyceridemia (ICR = 3.07, 95% CI: 0.98-5.09) or hypertension (ICR = 1.74, 95% CI: 0.52-3.12). Our data suggests that PNPLA3 genetic polymorphisms might influence the susceptibility to NAFLD development independently or jointly in Han Chinese.

  1. Single nucleotide polymorphisms in obesity-related genes and the risk of esophageal cancers.

    PubMed

    Doecke, James D; Zhao, Zhen Zhen; Stark, Mitchell S; Green, Adèle C; Hayward, Nicholas K; Montgomery, Grant W; Webb, Penelope M; Whiteman, David C

    2008-04-01

    Rates of adenocarcinoma of the esophagus (EAC) and esophagogastric junction (EGJAC) have been rising rapidly in recent decades, in contrast to the declining rates of esophageal squamous cell carcinomas (ESCC). Obesity is a major risk factor for both EAC and EGJAC, but not ESCC, and there is speculation that obesity promotes adenocarcinoma development through endocrine and related pathways. We therefore compared the prevalence of 12 single nucleotide polymorphisms (SNPs) in nine candidate genes previously implicated in obesity pathways (LEP, LEPR, ADIPOQ, POMC, PPARalpha, PPARgamma, RXRgamma, GHRL, and INSIG2) in a large Australian case-control study comprising DNA samples from 260 EAC cases, 301 EGJAC cases, 213 ESCC cases, and 1,352 population controls. No SNPs were associated with EGJAC or ESCC. Although several SNPs seemed to be associated with EAC on crude analysis [ADIPOQ (rs1501299), LEP (5'-untranslated region), PPARgamma (H447H), and GHRL (M72L)], effect sizes were modest and none of the associations was significant after correcting for multiple comparisons. Further, we found no consistent evidence that any of the genotypes were associated with risk of EAC or EGJAC within strata of body mass index (<25.0 kg/m(2), 25.0-29.9 kg/m(2), >30 kg/m(2)). In conclusion, our data suggest that these SNPs do not play a major role in esophageal carcinogenesis.

  2. Prenatal detection of fetal triploidy from cell-free DNA testing in maternal blood.

    PubMed

    Nicolaides, Kypros H; Syngelaki, Argyro; del Mar Gil, Maria; Quezada, Maria Soledad; Zinevich, Yana

    2014-01-01

    To investigate potential performance of cell-free DNA (cfDNA) testing in maternal blood in detecting fetal triploidy. Plasma and buffy coat samples obtained at 11-13 weeks' gestation from singleton pregnancies with diandric triploidy (n=4), digynic triploidy (n=4), euploid fetuses (n=48) were sent to Natera, Inc. (San Carlos, Calif., USA) for cfDNA testing. Multiplex polymerase chain reaction amplification of cfDNA followed by sequencing of single nucleotide polymorphic loci covering chromosomes 13, 18, 21, X, and Y was performed. Sequencing data were analyzed using the NATUS algorithm which identifies copy number for each of the five chromosomes. cfDNA testing provided a result in 44 (91.7%) of the 48 euploid cases and correctly predicted the fetal sex and the presence of two copies each of chromosome 21, 18 and 13. In diandric triploidy, cfDNA testing identified multiple paternal haplotypes (indicating fetal trisomy 21, trisomy 18 and trisomy 13) suggesting the presence of either triploidy or dizygotic twins. In digynic triploidy the fetal fraction corrected for maternal weight and gestational age was below the 0.5th percentile. cfDNA testing by targeted sequencing and allelic ratio analysis of single nucleotide polymorphisms covering chromosomes 21, 18, 13, X, and Y can detect diandric triploidy and raise the suspicion of digynic triploidy. © 2013 S. Karger AG, Basel.

  3. Phylogenetic Characteristics of Anthrax Outbreaks in Liaoning Province, China, 2001-2015.

    PubMed

    Mao, Lingling; Zhang, Enmin; Wang, Zijiang; Li, Yan; Zhou, Hang; Liu, Xuesheng; Zhang, Huijuan; Cai, Hong; Liang, Xudong; Sun, Yingwei; Zhang, Zhikai; Li, Wei; Yao, Wenqing; Wei, Jianchun

    2016-01-01

    Anthrax is a continuous threat in China, especially in rural regions. In July 2015, an anthrax outbreak occurred in Xifeng County, Liaoning Province. A total of 10 cutaneous anthrax cases were reported, with 210 people under medical observation. In this study, the general characteristics of human anthrax outbreak occurred in Liaoning Province were described, and all cases were caused by butchering and contacting sick animal. Meanwhile, the phylogenetic relationship between outbreak-related isolates/samples of the year 2015 and previous Bacillus anthracis strains was analyzed by means of canonical single nucleotide polymorphisms (canSNP), multiple-locus variable-number tandem repeat analysis (MLVA) with 15 markers and single-nucleotide repeats (SNR) analysis. There are two canSNP subgroups found in Liaoning, A.Br.001/002 and A.Br.Ames, and a total of six MLVA 15 genotypes and five SNR genotypes were observed. The strain collected from anthrax outbreak in Xifeng County in 2015 was classified as A.Br.001/002 subgroup and identified as MLVA15-29 genotype, with same SNR profile (CL10: 17, CL12: 15, CL33: 29, and CL35: 13). So we conclude that the same clone of B.anthracis caused the anthrax outbreak in Xifeng County in 2015, and this clone is different to previous isolates. Strengthening public health education in China is one of the most important measures to prevent and control anthrax.

  4. Further Evidence of the Association of the Diacylglycerol Kinase Kappa (DGKK) Gene With Hypospadias.

    PubMed

    Hozyasz, Kamil Konrad; Mostowska, Adrianna; Kowal, Andrzej; Mydlak, Dariusz; Tsibulski, Alexander; Jagodzinski, Pawel P

    2018-02-18

    Hypospadias is a common developmental anomaly of the male external genitalia. In previous studies conducted on West European, Californian, and Han Chinese populations the relationship between polymorphic variants of the diacylglycerol kinase kappa (DGKK) gene and hypospadias have been reported. The aim was to study the possible associations between polymorphic variants of the DGKK gene and hypospadias using an independent sample of the Polish population. Ten single nucleotide polymorphisms in DGKK, which were reported to have an impact on the risk of hypospadias in other populations, were genotyped using high-resolution melting curve analysis in a group of 166 boys with isolated anterior (66%) and middle (34%) forms of hypospadias and 285 properly matched controls without congenital anomalies. Two DGKK variants rs11091748 and rs12171755 were associated with increased risk of hypospadias in the Polish population. These results were statistically significant, even after applying the Bonferroni correction for multiple comparisons (P < .005). All the tested nucleotide variants were involved in haplotype combinations associated with hypospadias. The global p-values for haplotypes comprising of rs4143304-rs11091748, rs11091748-rs17328236, rs1934179-rs4554617, rs1934183-rs1934179-rs4554617 and rs12171755-rs1934183-rs1934179-rs4554617 were statistically significant, even after the permutation test correction. Our study provides strong evidence of an association between DGKK nucleotide variants, haplotypes and hypospadias susceptibility.

  5. From milk to diet: feed recognition for milk authenticity.

    PubMed

    Ponzoni, E; Gianì, S; Mastromauro, F; Breviario, D

    2009-11-01

    The presence of plastidial DNA fragments of plant origin in animal milk samples has been confirmed. An experimental plan was arranged with 4 groups of goats, each provided with a different monophytic diet: 3 fresh forages (oats, ryegrass, and X-triticosecale) and one 2-wk-old silage (X-triticosecale). Feed-derived rubisco (ribulose bisphosphate carboxylase, rbcL) DNA fragments were detected in 100% of the analyzed goat milk samples, and the nucleotide sequence of the PCR-amplified fragments was found to be 100% identical to the corresponding fragments amplified from the plant species consumed in the diet. Two additional chloroplast-based molecular markers were used to set up an assay for distinctiveness, conveniently based on a simple PCR. In one case, differences in single nucleotides occurring within the gene encoding for plant maturase K (matK) were exploited. In the other, plant species recognition was based on the difference in the length of the intron present within the transfer RNA leucine (trnL) gene. The presence of plastidial plant DNA, ascertained by the PCR-based amplification of the rbcL fragment, was also assessed in raw cow milk samples collected directly from stock farms or taken from milk sold on the commercial market. In this case, the nucleotide sequence of the amplified DNA fragments reflected the multiple forages present in the diet fed to the animals.

  6. An integrated pipeline of open source software adapted for multi-CPU architectures: use in the large-scale identification of single nucleotide polymorphisms.

    PubMed

    Jayashree, B; Hanspal, Manindra S; Srinivasan, Rajgopal; Vigneshwaran, R; Varshney, Rajeev K; Spurthi, N; Eshwar, K; Ramesh, N; Chandra, S; Hoisington, David A

    2007-01-01

    The large amounts of EST sequence data available from a single species of an organism as well as for several species within a genus provide an easy source of identification of intra- and interspecies single nucleotide polymorphisms (SNPs). In the case of model organisms, the data available are numerous, given the degree of redundancy in the deposited EST data. There are several available bioinformatics tools that can be used to mine this data; however, using them requires a certain level of expertise: the tools have to be used sequentially with accompanying format conversion and steps like clustering and assembly of sequences become time-intensive jobs even for moderately sized datasets. We report here a pipeline of open source software extended to run on multiple CPU architectures that can be used to mine large EST datasets for SNPs and identify restriction sites for assaying the SNPs so that cost-effective CAPS assays can be developed for SNP genotyping in genetics and breeding applications. At the International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), the pipeline has been implemented to run on a Paracel high-performance system consisting of four dual AMD Opteron processors running Linux with MPICH. The pipeline can be accessed through user-friendly web interfaces at http://hpc.icrisat.cgiar.org/PBSWeb and is available on request for academic use. We have validated the developed pipeline by mining chickpea ESTs for interspecies SNPs, development of CAPS assays for SNP genotyping, and confirmation of restriction digestion pattern at the sequence level.

  7. Efficient selection of tagging single-nucleotide polymorphisms in multiple populations.

    PubMed

    Howie, Bryan N; Carlson, Christopher S; Rieder, Mark J; Nickerson, Deborah A

    2006-08-01

    Common genetic polymorphism may explain a portion of the heritable risk for common diseases, so considerable effort has been devoted to finding and typing common single-nucleotide polymorphisms (SNPs) in the human genome. Many SNPs show correlated genotypes, or linkage disequilibrium (LD), suggesting that only a subset of all SNPs (known as tagging SNPs, or tagSNPs) need to be genotyped for disease association studies. Based on the genetic differences that exist among human populations, most tagSNP sets are defined in a single population and applied only in populations that are closely related. To improve the efficiency of multi-population analyses, we have developed an algorithm called MultiPop-TagSelect that finds a near-minimal union of population-specific tagSNP sets across an arbitrary number of populations. We present this approach as an extension of LD-select, a tagSNP selection method that uses a greedy algorithm to group SNPs into bins based on their pairwise association patterns, although the MultiPop-TagSelect algorithm could be used with any SNP tagging approach that allows choices between nearly equivalent SNPs. We evaluate the algorithm by considering tagSNP selection in candidate-gene resequencing data and lower density whole-chromosome data. Our analysis reveals that an exhaustive search is often intractable, while the developed algorithm can quickly and reliably find near-optimal solutions even for difficult tagSNP selection problems. Using populations of African, Asian, and European ancestry, we also show that an optimal multi-population set of tagSNPs can be substantially smaller (up to 44%) than a typical set obtained through independent or sequential selection.

  8. Reconstructing population histories from single nucleotide polymorphism data.

    PubMed

    Sirén, Jukka; Marttinen, Pekka; Corander, Jukka

    2011-01-01

    Population genetics encompasses a strong theoretical and applied research tradition on the multiple demographic processes that shape genetic variation present within a species. When several distinct populations exist in the current generation, it is often natural to consider the pattern of their divergence from a single ancestral population in terms of a binary tree structure. Inference about such population histories based on molecular data has been an intensive research topic in the recent years. The most common approach uses coalescent theory to model genealogies of individuals sampled from the current populations. Such methods are able to compare several different evolutionary scenarios and to estimate demographic parameters. However, their major limitation is the enormous computational complexity associated with the indirect modeling of the demographies, which limits the application to small data sets. Here, we propose a novel Bayesian method for inferring population histories from unlinked single nucleotide polymorphisms, which is applicable also to data sets harboring large numbers of individuals from distinct populations. We use an approximation to the neutral Wright-Fisher diffusion to model random fluctuations in allele frequencies. The population histories are modeled as binary rooted trees that represent the historical order of divergence of the different populations. A combination of analytical, numerical, and Monte Carlo integration techniques are utilized for the inferences. A particularly important feature of our approach is that it provides intuitive measures of statistical uncertainty related with the estimates computed, which may be entirely lacking for the alternative methods in this context. The potential of our approach is illustrated by analyses of both simulated and real data sets.

  9. Single Endemic Genotype of Measles Virus Continuously Circulating in China for at Least 16 Years

    PubMed Central

    Wang, Huiling; Zhu, Zhen; Ji, Yixin; Liu, Chunyu; Zhang, Xiaojie; Sun, Liwei; Zhou, Jianhui; Lu, Peishan; Hu, Ying; Feng, Daxing; Zhang, Zhenying; Wang, Changyin; Fang, Xueqiang; Zheng, Huanying; Liu, Leng; Sun, Xiaodong; Tang, Wei; Wang, Yan; Liu, Yan; Gao, Hui; Tian, Hong; Ma, Jiangtao; Gu, Suyi; Wang, Shuang; Feng, Yan; Bo, Fang; Liu, Jianfeng; Si, Yuan; Zhou, Shujie; Ma, Yuyan; Wu, Shengwei; Zhou, Shunde; Li, Fangcai; Ding, Zhengrong; Yang, Zhaohui; Rota, Paul A.; Featherstone, David; Jee, Youngmee; Bellini, William J.; Xu, Wenbo

    2012-01-01

    The incidence of measles in China from 1991 to 2008 was reviewed, and the nucleotide sequences from 1507 measles viruses (MeV) isolated during 1993 to 2008 were phylogenetically analyzed. The results showed that measles epidemics peaked approximately every 3 to 5 years with the range of measles cases detected between 56,850 and 140,048 per year. The Chinese MeV strains represented three genotypes; 1501 H1, 1 H2 and 5 A. Genotype H1 was the predominant genotype throughout China continuously circulating for at least 16 years. Genotype H1 sequences could be divided into two distinct clusters, H1a and H1b. A 4.2% average nucleotide divergence was found between the H1a and H1b clusters, and the nucleotide sequence and predicted amino acid homologies of H1a viruses were 92.3%–100% and 84.7%–100%, H1b were 97.1%–100% and 95.3%–100%, respectively. Viruses from both clusters were distributed throughout China with no apparent geographic restriction and multiple co-circulating lineages were present in many provinces. Cluster H1a and H1b viruses were co-circulating during 1993 to 2005, while no H1b viruses were detected after 2005 and the transmission of that cluster has presumably been interrupted. Analysis of the nucleotide and predicted amino acid changes in the N proteins of H1a and H1b viruses showed no evidence of selective pressure. This study investigated the genotype and cluster distribution of MeV in China over a 16-year period to establish a genetic baseline before MeV elimination in Western Pacific Region (WPR). Continuous and extensive MeV surveillance and the ability to quickly identify imported cases of measles will become more critical as measles elimination goals are achieved in China in the near future. This is the first report that a single endemic genotype of measles virus has been found to be continuously circulating in one country for at least 16 years. PMID:22532829

  10. Catalytic analysis of APOBEC3G involving real-time NMR spectroscopy reveals nucleic acid determinants for deamination.

    PubMed

    Kamba, Keisuke; Nagata, Takashi; Katahira, Masato

    2015-01-01

    APOBEC3G (A3G) is a single-stranded DNA-specific cytidine deaminase that preferentially converts cytidine to uridine at the third position of triplet cytosine (CCC) hotspots. A3G restricts the infectivity of viruses, such as HIV-1, by targeting CCC hotspots scattered through minus DNA strands, reverse-transcribed from genomic RNA. Previously, we developed a real-time NMR method and elucidated the origin of the 3'→5' polarity of deamination of DNA by the C-terminal domain of A3G (CD2), which is a phenomenon by which a hotspot located closer to the 5'-end is deaminated more effectively than one less close to the 5'-end, through quantitative analysis involving nonspecific binding to and sliding along DNA. In the present study we applied the real-time NMR method to analyze the catalytic activity of CD2 toward DNA oligonucleotides containing a nucleotide analog at a single or multiple positions. Analyses revealed the importance of the sugar and base moieties throughout the consecutive 5 nucleotides, the CCC hotspot being positioned at the center. It was also shown that the sugar or base moieties of the nucleotides outside this 5 nucleotide recognition sequence are also relevant as to CD2's activity. Analyses involving DNA oligonucleotides having two CCC hotspots linked by a long sequence of either deoxyribonucleotides, ribonucleotides or abasic deoxyribonucleotides suggested that the phosphate backbone is required for CD2 to slide along the DNA strand and to exert the 3'→5' polarity. Examination of the effects of different salt concentrations on the 3'→5' polarity indicated that the higher the salt concentration, the less prominent the 3'→5' polarity. This is most likely the result of alleviation of sliding due to a decrease in the affinity of CD2 with the phosphate backbone at high salt concentrations. We also investigated the reactivity of substrates containing 5-methylcytidine (5mC) or 5-hydroxymethylcytidine, and found that A3G exhibited low activity toward 5mC.

  11. Single endemic genotype of measles virus continuously circulating in China for at least 16 years.

    PubMed

    Zhang, Yan; Xu, Songtao; Wang, Huiling; Zhu, Zhen; Ji, Yixin; Liu, Chunyu; Zhang, Xiaojie; Sun, Liwei; Zhou, Jianhui; Lu, Peishan; Hu, Ying; Feng, Daxing; Zhang, Zhenying; Wang, Changyin; Fang, Xueqiang; Zheng, Huanying; Liu, Leng; Sun, Xiaodong; Tang, Wei; Wang, Yan; Liu, Yan; Gao, Hui; Tian, Hong; Ma, Jiangtao; Gu, Suyi; Wang, Shuang; Feng, Yan; Bo, Fang; Liu, Jianfeng; Si, Yuan; Zhou, Shujie; Ma, Yuyan; Wu, Shengwei; Zhou, Shunde; Li, Fangcai; Ding, Zhengrong; Yang, Zhaohui; Rota, Paul A; Featherstone, David; Jee, Youngmee; Bellini, William J; Xu, Wenbo

    2012-01-01

    The incidence of measles in China from 1991 to 2008 was reviewed, and the nucleotide sequences from 1507 measles viruses (MeV) isolated during 1993 to 2008 were phylogenetically analyzed. The results showed that measles epidemics peaked approximately every 3 to 5 years with the range of measles cases detected between 56,850 and 140,048 per year. The Chinese MeV strains represented three genotypes; 1501 H1, 1 H2 and 5 A. Genotype H1 was the predominant genotype throughout China continuously circulating for at least 16 years. Genotype H1 sequences could be divided into two distinct clusters, H1a and H1b. A 4.2% average nucleotide divergence was found between the H1a and H1b clusters, and the nucleotide sequence and predicted amino acid homologies of H1a viruses were 92.3%-100% and 84.7%-100%, H1b were 97.1%-100% and 95.3%-100%, respectively. Viruses from both clusters were distributed throughout China with no apparent geographic restriction and multiple co-circulating lineages were present in many provinces. Cluster H1a and H1b viruses were co-circulating during 1993 to 2005, while no H1b viruses were detected after 2005 and the transmission of that cluster has presumably been interrupted. Analysis of the nucleotide and predicted amino acid changes in the N proteins of H1a and H1b viruses showed no evidence of selective pressure. This study investigated the genotype and cluster distribution of MeV in China over a 16-year period to establish a genetic baseline before MeV elimination in Western Pacific Region (WPR). Continuous and extensive MeV surveillance and the ability to quickly identify imported cases of measles will become more critical as measles elimination goals are achieved in China in the near future. This is the first report that a single endemic genotype of measles virus has been found to be continuously circulating in one country for at least 16 years.

  12. Multiplexed droplet single-cell RNA-sequencing using natural genetic variation.

    PubMed

    Kang, Hyun Min; Subramaniam, Meena; Targ, Sasha; Nguyen, Michelle; Maliskova, Lenka; McCarthy, Elizabeth; Wan, Eunice; Wong, Simon; Byrnes, Lauren; Lanata, Cristina M; Gate, Rachel E; Mostafavi, Sara; Marson, Alexander; Zaitlen, Noah; Criswell, Lindsey A; Ye, Chun Jimmie

    2018-01-01

    Droplet single-cell RNA-sequencing (dscRNA-seq) has enabled rapid, massively parallel profiling of transcriptomes. However, assessing differential expression across multiple individuals has been hampered by inefficient sample processing and technical batch effects. Here we describe a computational tool, demuxlet, that harnesses natural genetic variation to determine the sample identity of each droplet containing a single cell (singlet) and detect droplets containing two cells (doublets). These capabilities enable multiplexed dscRNA-seq experiments in which cells from unrelated individuals are pooled and captured at higher throughput than in standard workflows. Using simulated data, we show that 50 single-nucleotide polymorphisms (SNPs) per cell are sufficient to assign 97% of singlets and identify 92% of doublets in pools of up to 64 individuals. Given genotyping data for each of eight pooled samples, demuxlet correctly recovers the sample identity of >99% of singlets and identifies doublets at rates consistent with previous estimates. We apply demuxlet to assess cell-type-specific changes in gene expression in 8 pooled lupus patient samples treated with interferon (IFN)-β and perform eQTL analysis on 23 pooled samples.

  13. Genetic architecture of plant stress resistance: multi-trait genome-wide association mapping.

    PubMed

    Thoen, Manus P M; Davila Olivas, Nelson H; Kloth, Karen J; Coolen, Silvia; Huang, Ping-Ping; Aarts, Mark G M; Bac-Molenaar, Johanna A; Bakker, Jaap; Bouwmeester, Harro J; Broekgaarden, Colette; Bucher, Johan; Busscher-Lange, Jacqueline; Cheng, Xi; Fradin, Emilie F; Jongsma, Maarten A; Julkowska, Magdalena M; Keurentjes, Joost J B; Ligterink, Wilco; Pieterse, Corné M J; Ruyter-Spira, Carolien; Smant, Geert; Testerink, Christa; Usadel, Björn; van Loon, Joop J A; van Pelt, Johan A; van Schaik, Casper C; van Wees, Saskia C M; Visser, Richard G F; Voorrips, Roeland; Vosman, Ben; Vreugdenhil, Dick; Warmerdam, Sonja; Wiegers, Gerrie L; van Heerwaarden, Joost; Kruijer, Willem; van Eeuwijk, Fred A; Dicke, Marcel

    2017-02-01

    Plants are exposed to combinations of various biotic and abiotic stresses, but stress responses are usually investigated for single stresses only. Here, we investigated the genetic architecture underlying plant responses to 11 single stresses and several of their combinations by phenotyping 350 Arabidopsis thaliana accessions. A set of 214 000 single nucleotide polymorphisms (SNPs) was screened for marker-trait associations in genome-wide association (GWA) analyses using tailored multi-trait mixed models. Stress responses that share phytohormonal signaling pathways also share genetic architecture underlying these responses. After removing the effects of general robustness, for the 30 most significant SNPs, average quantitative trait locus (QTL) effect sizes were larger for dual stresses than for single stresses. Plants appear to deploy broad-spectrum defensive mechanisms influencing multiple traits in response to combined stresses. Association analyses identified QTLs with contrasting and with similar responses to biotic vs abiotic stresses, and below-ground vs above-ground stresses. Our approach allowed for an unprecedented comprehensive genetic analysis of how plants deal with a wide spectrum of stress conditions. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

  14. The α‐synuclein gene in multiple system atrophy

    PubMed Central

    Ozawa, T; Healy, D G; Abou‐Sleiman, P M; Ahmadi, K R; Quinn, N; Lees, A J; Shaw, K; Wullner, U; Berciano, J; Moller, J C; Kamm, C; Burk, K; Josephs, K A; Barone, P; Tolosa, E; Goldstein, D B; Wenning, G; Geser, F; Holton, J L; Gasser, T; Revesz, T; Wood, N W

    2006-01-01

    Background The formation of α‐synuclein aggregates may be a critical event in the pathogenesis of multiple system atrophy (MSA). However, the role of this gene in the aetiology of MSA is unknown and untested. Method The linkage disequilibrium (LD) structure of the α‐synuclein gene was established and LD patterns were used to identify a set of tagging single nucleotide polymorphisms (SNPs) that represent 95% of the haplotype diversity across the entire gene. The effect of polymorphisms on the pathological expression of MSA in pathologically confirmed cases was also evaluated. Results and conclusion In 253 Gilman probable or definite MSA patients, 457 possible, probable, and definite MSA cases and 1472 controls, a frequency difference for the individual tagging SNPs or tag‐defined haplotypes was not detected. No effect was observed of polymorphisms on the pathological expression of MSA in pathologically confirmed cases. PMID:16543523

  15. Pathway-based analyses.

    PubMed

    Kent, Jack W

    2016-02-03

    New technologies for acquisition of genomic data, while offering unprecedented opportunities for genetic discovery, also impose severe burdens of interpretation and penalties for multiple testing. The Pathway-based Analyses Group of the Genetic Analysis Workshop 19 (GAW19) sought reduction of multiple-testing burden through various approaches to aggregation of highdimensional data in pathways informed by prior biological knowledge. Experimental methods testedincluded the use of "synthetic pathways" (random sets of genes) to estimate power and false-positive error rate of methods applied to simulated data; data reduction via independent components analysis, single-nucleotide polymorphism (SNP)-SNP interaction, and use of gene sets to estimate genetic similarity; and general assessment of the efficacy of prior biological knowledge to reduce the dimensionality of complex genomic data. The work of this group explored several promising approaches to managing high-dimensional data, with the caveat that these methods are necessarily constrained by the quality of external bioinformatic annotation.

  16. SORL1 variants and risk of late-onset Alzheimer's disease.

    PubMed

    Li, Yonghong; Rowland, Charles; Catanese, Joseph; Morris, John; Lovestone, Simon; O'Donovan, Michael C; Goate, Alison; Owen, Michael; Williams, Julie; Grupe, Andrew

    2008-02-01

    A recent study reported significant association of late-onset Alzheimer's disease (LOAD) with multiple single nucleotide polymorphisms (SNPs) and haplotypes in SORL1, a neuronal sortilin-related receptor protein known to be involved in the trafficking and processing of amyloid precursor protein. Here we attempted to validate this finding in three large, well characterized case-control series. Approximately 2000 samples from the three series were individually genotyped for 12 SNPs, including the 10 reported significant SNPs and 2 that constitute the reported significant haplotypes. A total of 25 allelic and haplotypic association tests were performed. One SNP rs2070045 was marginally replicated in the three sample sets combined (nominal P=0.035); however, this result does not remain significant when accounting for multiple comparisons. Further validation in other sample sets will be required to assess the true effects of SORL1 variants in LOAD.

  17. Diseases Associated with Defective Responses to DNA Damage

    PubMed Central

    O’Driscoll, Mark

    2012-01-01

    Within the last decade, multiple novel congenital human disorders have been described with genetic defects in known and/or novel components of several well-known DNA repair and damage response pathways. Examples include disorders of impaired nucleotide excision repair, DNA double-strand and single-strand break repair, as well as compromised DNA damage-induced signal transduction including phosphorylation and ubiquitination. These conditions further reinforce the importance of multiple genome stability pathways for health and development in humans. Furthermore, these conditions inform our knowledge of the biology of the mechanics of genome stability and in some cases provide potential routes to help exploit these pathways therapeutically. Here, I will review a selection of these exciting findings from the perspective of the disorders themselves, describing how they were identified, how genotype informs phenotype, and how these defects contribute to our growing understanding of genome stability pathways. PMID:23209155

  18. Screening for SNPs with Allele-Specific Methylation based on Next-Generation Sequencing Data

    PubMed Central

    Hu, Bo; Xu, Yaomin

    2013-01-01

    Allele-specific methylation (ASM) has long been studied but mainly documented in the context of genomic imprinting and X chromosome inactivation. Taking advantage of the next-generation sequencing technology, we conduct a high-throughput sequencing experiment with four prostate cell lines to survey the whole genome and identify single nucleotide polymorphisms (SNPs) with ASM. A Bayesian approach is proposed to model the counts of short reads for each SNP conditional on its genotypes of multiple subjects, leading to a posterior probability of ASM. We flag SNPs with high posterior probabilities of ASM by accounting for multiple comparisons based on posterior false discovery rates. Applying the Bayesian approach to the in-house prostate cell line data, we identify 269 SNPs as candidates of ASM. A simulation study is carried out to demonstrate the quantitative performance of the proposed approach. PMID:23710259

  19. Electron attachment to DNA single strands: gas phase and aqueous solution.

    PubMed

    Gu, Jiande; Xie, Yaoming; Schaefer, Henry F

    2007-01-01

    The 2'-deoxyguanosine-3',5'-diphosphate, 2'-deoxyadenosine-3',5'-diphosphate, 2'-deoxycytidine-3',5'-diphosphate and 2'-deoxythymidine-3',5'-diphosphate systems are the smallest units of a DNA single strand. Exploring these comprehensive subunits with reliable density functional methods enables one to approach reasonable predictions of the properties of DNA single strands. With these models, DNA single strands are found to have a strong tendency to capture low-energy electrons. The vertical attachment energies (VEAs) predicted for 3',5'-dTDP (0.17 eV) and 3',5'-dGDP (0.14 eV) indicate that both the thymine-rich and the guanine-rich DNA single strands have the ability to capture electrons. The adiabatic electron affinities (AEAs) of the nucleotides considered here range from 0.22 to 0.52 eV and follow the order 3',5'-dTDP > 3',5'-dCDP > 3',5'-dGDP > 3',5'-dADP. A substantial increase in the AEA is observed compared to that of the corresponding nucleic acid bases and the corresponding nucleosides. Furthermore, aqueous solution simulations dramatically increase the electron attracting properties of the DNA single strands. The present investigation illustrates that in the gas phase, the excess electron is situated both on the nucleobase and on the phosphate moiety for DNA single strands. However, the distribution of the extra negative charge is uneven. The attached electron favors the base moiety for the pyrimidine, while it prefers the 3'-phosphate subunit for the purine DNA single strands. In contrast, the attached electron is tightly bound to the base fragment for the cytidine, thymidine and adenosine nucleotides, while it almost exclusively resides in the vicinity of the 3'-phosphate group for the guanosine nucleotides due to the solvent effects. The comparatively low vertical detachment energies (VDEs) predicted for 3',5'-dADP(-) (0.26 eV) and 3',5'-dGDP(-) (0.32 eV) indicate that electron detachment might compete with reactions having high activation barriers such as glycosidic bond breakage. However, the radical anions of the pyrimidine nucleotides with high VDE are expected to be electronically stable. Thus the base-centered radical anions of the pyrimidine nucleotides might be the possible intermediates for DNA single-strand breakage.

  20. ChIP-nexus: a novel ChIP-exo protocol for improved detection of in vivo transcription factor binding footprints

    PubMed Central

    He, Qiye; Johnston, Jeff; Zeitlinger, Julia

    2014-01-01

    Understanding how eukaryotic enhancers are bound and regulated by specific combinations of transcription factors is still a major challenge. To better map transcription factor binding genome-wide at nucleotide resolution in vivo, we have developed a robust ChIP-exo protocol called ChIP experiments with nucleotide resolution through exonuclease, unique barcode and single ligation (ChIP-nexus), which utilizes an efficient DNA self-circularization step during library preparation. Application of ChIP-nexus to four proteins—human TBP and Drosophila NFkB, Twist and Max— demonstrates that it outperforms existing ChIP protocols in resolution and specificity, pinpoints relevant binding sites within enhancers containing multiple binding motifs and allows the analysis of in vivo binding specificities. Notably, we show that Max frequently interacts with DNA sequences next to its motif, and that this binding pattern correlates with local DNA sequence features such as DNA shape. ChIP-nexus will be broadly applicable to studying in vivo transcription factor binding specificity and its relationship to cis-regulatory changes in humans and model organisms. PMID:25751057

  1. Genetic risk profiling and gene signature modeling to predict risk of complications after IPAA.

    PubMed

    Sehgal, Rishabh; Berg, Arthur; Polinski, Joseph I; Hegarty, John P; Lin, Zhenwu; McKenna, Kevin J; Stewart, David B; Poritz, Lisa S; Koltun, Walter A

    2012-03-01

    Severe pouchitis and Crohn's disease-like complications are 2 adverse postoperative complications that confound the success of the IPAA in patients with ulcerative colitis. To date, approximately 83 single nucleotide polymorphisms within 55 genes have been associated with IBD. The aim of this study was to identify single-nucleotide polymorphisms that correlate with complications after IPAA that could be utilized in a gene signature fashion to predict postoperative complications and aid in preoperative surgical decision making. One hundred forty-two IPAA patients were retrospectively classified as "asymptomatic" (n = 104, defined as no Crohn's disease-like complications or severe pouchitis for at least 2 years after IPAA) and compared with a "severe pouchitis" group (n = 12, ≥ 4 episodes pouchitis per year for 2 years including the need for long-term therapy to maintain remission) and a "Crohn's disease-like" group (n = 26, presence of fistulae, pouch inlet stricture, proximal small-bowel disease, or pouch granulomata, occurring at least 6 months after surgery). Genotyping for 83 single-nucleotide polymorphisms previously associated with Crohn's disease and/or ulcerative colitis was performed on a customized Illumina genotyping platform. The top 2 single-nucleotide polymorphisms statistically identified as being independently associated with each of Crohn's disease-like and severe pouchitis were used in a multivariate logistic regression model. These single-nucleotide polymorphisms were then used to create probability equations to predict overall chance of a positive or negative outcome for that complication. The top 2 single-nucleotide polymorphisms for Crohn's disease-like complications were in the 10q21 locus and the gene for PTGER4 (p = 0.006 and 0.007), whereas for severe pouchitis it was NOD2 and TNFSF15 (p = 0.003 and 0.011). Probability equations suggested that the risk of these 2 complications greatly increased with increasing number of risk alleles, going as high as 92% for severe pouchitis and 65% for Crohn's disease-like complications. In this IPAA patient cohort, mutations in the 10q21 locus and the PTGER4 gene were associated with Crohn's disease-like complications, whereas mutations in NOD2 and TNFSF15 correlated with severe pouchitis. Preoperative genetic analysis and use of such gene signatures hold promise for improved preoperative surgical patient selection to minimize these IPAA complications.

  2. Pre-steady-state Kinetic Analysis of a Family D DNA Polymerase from Thermococcus sp. 9°N Reveals Mechanisms for Archaeal Genomic Replication and Maintenance*

    PubMed Central

    Schermerhorn, Kelly M.; Gardner, Andrew F.

    2015-01-01

    Family D DNA polymerases (polDs) have been implicated as the major replicative polymerase in archaea, excluding the Crenarchaeota branch, and bear little sequence homology to other DNA polymerase families. Here we report a detailed kinetic analysis of nucleotide incorporation and exonuclease activity for a Family D DNA polymerase from Thermococcus sp. 9°N. Pre-steady-state single-turnover nucleotide incorporation assays were performed to obtain the kinetic parameters, kpol and Kd, for correct nucleotide incorporation, incorrect nucleotide incorporation, and ribonucleotide incorporation by exonuclease-deficient polD. Correct nucleotide incorporation kinetics revealed a relatively slow maximal rate of polymerization (kpol ∼2.5 s−1) and especially tight nucleotide binding (Kd(dNTP) ∼1.7 μm), compared with DNA polymerases from Families A, B, C, X, and Y. Furthermore, pre-steady-state nucleotide incorporation assays revealed that polD prevents the incorporation of incorrect nucleotides and ribonucleotides primarily through reduced nucleotide binding affinity. Pre-steady-state single-turnover assays on wild-type 9°N polD were used to examine 3′-5′ exonuclease hydrolysis activity in the presence of Mg2+ and Mn2+. Interestingly, substituting Mn2+ for Mg2+ accelerated hydrolysis rates >40-fold (kexo ≥110 s−1 versus ≥2.5 s−1). Preference for Mn2+ over Mg2+ in exonuclease hydrolysis activity is a property unique to the polD family. The kinetic assays performed in this work provide critical insight into the mechanisms that polD employs to accurately and efficiently replicate the archaeal genome. Furthermore, despite the unique properties of polD, this work suggests that a conserved polymerase kinetic pathway is present in all known DNA polymerase families. PMID:26160179

  3. Comprehensive thermodynamic analysis of 3′ double-nucleotide overhangs neighboring Watson–Crick terminal base pairs

    PubMed Central

    O'Toole, Amanda S.; Miller, Stacy; Haines, Nathan; Zink, M. Coleen; Serra, Martin J.

    2006-01-01

    Thermodynamic parameters are reported for duplex formation of 48 self-complementary RNA duplexes containing Watson–Crick terminal base pairs (GC, AU and UA) with all 16 possible 3′ double-nucleotide overhangs; mimicking the structures of short interfering RNAs (siRNA) and microRNAs (miRNA). Based on nearest-neighbor analysis, the addition of a second dangling nucleotide to a single 3′ dangling nucleotide increases stability of duplex formation up to 0.8 kcal/mol in a sequence dependent manner. Results from this study in conjunction with data from a previous study [A. S. O'Toole, S. Miller and M. J. Serra (2005) RNA, 11, 512.] allows for the development of a refined nearest-neighbor model to predict the influence of 3′ double-nucleotide overhangs on the stability of duplex formation. The model improves the prediction of free energy and melting temperature when tested against five oligomers with various core duplex sequences. Phylogenetic analysis of naturally occurring miRNAs was performed to support our results. Selection of the effector miR strand of the mature miRNA duplex appears to be dependent upon the identity of the 3′ double-nucleotide overhang. Thermodynamic parameters for 3′ single terminal overhangs adjacent to a UA pair are also presented. PMID:16820533

  4. Multiple cis-acting elements involved in up-regulation of a cytochrome P450 gene conferring resistance to deltamethrin in smal brown planthopper, Laodelphax striatellus (Fallén).

    PubMed

    Pu, Jian; Sun, Haina; Wang, Jinda; Wu, Min; Wang, Kangxu; Denholm, Ian; Han, Zhaojun

    2016-11-01

    As well as arising from single point mutations in binding sites or detoxifying enzymes, it is likely that insecticide resistance mechanisms are frequently controlled by multiple genetic factors, resulting in resistance being inherited as a quantitative trait. However, empirical evidence for this is still rare. Here we analyse the causes of up-regulation of CYP6FU1, a monoxygenase implicated in resistance to deltamethrin in the rice pest Laodelphax striatellus. The 5'-flanking region of this gene was cloned and sequenced from individuals of a susceptible and a resistant strain. A luminescent reporter assay was used to evaluate different 5'-flanking regions and their fragments for promoter activity. Mutations enhancing promoter activity in various fragments were characterized, singly and in combination, by site mutation recovery. Nucleotide diversity in flanking sequences was greatly reduced in deltamethrin-resistant insects compared to susceptible ones. Phylogenetic sequence analysis found that CYP6FU1 had five different types of 5'-flanking region. All five types were present in a susceptible strain but only a single type showing the highest promoter activity was present in a resistant strain. Four cis-acting elements were identified whose influence on up-regulation was much more pronounced in combination than when present singly. Of these, two were new transcription factor (TF) binding sites produced by mutations, another one was also a new TF binding site alternated from an existing one, and the fourth was a unique transcription start site. These results demonstrate that multiple cis-acting elements are involved in up-regulating CYP6FU1 to generate a resistance phenotype. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Genome-scale engineering of Saccharomyces cerevisiae with single-nucleotide precision.

    PubMed

    Bao, Zehua; HamediRad, Mohammad; Xue, Pu; Xiao, Han; Tasan, Ipek; Chao, Ran; Liang, Jing; Zhao, Huimin

    2018-07-01

    We developed a CRISPR-Cas9- and homology-directed-repair-assisted genome-scale engineering method named CHAnGE that can rapidly output tens of thousands of specific genetic variants in yeast. More than 98% of target sequences were efficiently edited with an average frequency of 82%. We validate the single-nucleotide resolution genome-editing capability of this technology by creating a genome-wide gene disruption collection and apply our method to improve tolerance to growth inhibitors.

  6. Genetic Diversity among Bacillus anthracis Soil Isolates at Fine Geographic Scales

    PubMed Central

    Bader, Douglas E.

    2012-01-01

    Environmental samples were collected from carcass sites during and after anthrax outbreaks in 2000 and 2001 in the bison (Bison bison) population within Wood Buffalo National Park and the Hook Lake Region north of Wood Buffalo National Park. Bacillus anthracis spores were isolated from these samples and confirmed using phenotypic characterization and real-time PCR. Confirmed B. anthracis isolates were typed using multiple-locus variable-number tandem repeat analysis (MLVA15) and single-nucleotide-repeat analysis (SNRA). B. anthracis isolates split into two clades based on MLVA15, while SNRA allowed some isolates between carcass sites to be distinguished from each other. SNRA polymorphisms were also present within a single carcass site. Some isolates from different carcass sites having the same SNRA type had divergent MLVA types; this finding leads to questions about hierarchical typing methods and the robustness of the fine-scale typing of Bacillus anthracis. PMID:22773624

  7. Single cytidine units-templated syntheses of multi-colored water-soluble Au nanoclusters.

    PubMed

    Jiang, Hui; Zhang, Yuanyuan; Wang, Xuemei

    2014-09-07

    Ultra-small metallic nanoparticles, or so-called "nanoclusters" (NCs), have attracted considerable interest due to their unique optical properties that are different from both larger nanoparticles and single atoms. To prepare high-quality NCs, the stabilizing agent plays an essential role. In this work, we have revealed and validated that cytidine and its nucleotides (cytidine 5'-monophosphate or cytidine 5'-triphosphate) can act as efficient stabilizers for syntheses of multicolored Au NCs. Interestingly, Au NCs with blue, green and yellow fluorescence emissions are simultaneously obtained using various pH environments or reaction times. The transmission electron microscopy verifies that the size of Au NCs ranges from 1.5 to 3 nm. The X-ray photoelectron spectroscopy confirms that only Au (0) species are present in NCs. Generally, the facile preparation of multicolored Au NCs that are stabilized by cytidine units provides access to promising candidates for multiple biolabeling applications.

  8. Detection limit of intragenic deletions with targeted array comparative genomic hybridization

    PubMed Central

    2013-01-01

    Background Pathogenic mutations range from single nucleotide changes to deletions or duplications that encompass a single exon to several genes. The use of gene-centric high-density array comparative genomic hybridization (aCGH) has revolutionized the detection of intragenic copy number variations. We implemented an exon-centric design of high-resolution aCGH to detect single- and multi-exon deletions and duplications in a large set of genes using the OGT 60 K and 180 K arrays. Here we describe the molecular characterization and breakpoint mapping of deletions at the smaller end of the detectable range in several genes using aCGH. Results The method initially implemented to detect single to multiple exon deletions, was able to detect deletions much smaller than anticipated. The selected deletions we describe vary in size, ranging from over 2 kb to as small as 12 base pairs. The smallest of these deletions are only detectable after careful manual review during data analysis. Suspected deletions smaller than the detection size for which the method was optimized, were rigorously followed up and confirmed with PCR-based investigations to uncover the true detection size limit of intragenic deletions with this technology. False-positive deletion calls often demonstrated single nucleotide changes or an insertion causing lower hybridization of probes demonstrating the sensitivity of aCGH. Conclusions With optimizing aCGH design and careful review process, aCGH can uncover intragenic deletions as small as dozen bases. These data provide insight that will help optimize probe coverage in array design and illustrate the true assay sensitivity. Mapping of the breakpoints confirms smaller deletions and contributes to the understanding of the mechanism behind these events. Our knowledge of the mutation spectra of several genes can be expected to change as previously unrecognized intragenic deletions are uncovered. PMID:24304607

  9. Discriminating a Single Nucleotide Difference for Enhanced miRNA Detection Using Tunable Graphene and Oligonucleotide Nanodevices.

    PubMed

    Robertson, Neil M; Hizir, Mustafa Salih; Balcioglu, Mustafa; Wang, Rui; Yavuz, Mustafa Selman; Yumak, Hasan; Ozturk, Birol; Sheng, Jia; Yigit, Mehmet V

    2015-09-15

    In this study we have reported our efforts to address some of the challenges in the detection of miRNAs using water-soluble graphene oxide and DNA nanoassemblies. Purposefully inserting mismatches at specific positions in our DNA (probe) strands shows increasing specificity against our target miRNA, miR-10b, over miR-10a which varies by only a single nucleotide. This increased specificity came at a loss of signal intensity within the system, but we demonstrated that this could be addressed with the use of DNase I, an endonuclease capable of cleaving the DNA strands of the RNA/DNA heteroduplex and recycling the RNA target to hybridize to another probe strand. As we previously demonstrated, this enzymatic signal also comes with an inherent activity of the enzyme on the surface-adsorbed probe strands. To remove this activity of DNase I and the steady nonspecific increase in the fluorescence signal without compromising the recovered signal, we attached a thermoresponsive PEGMA polymer (poly(ethylene glycol) methyl ether methacrylate) to nGO. This smart polymer is able to shield the probes adsorbed on the nGO surface from the DNase I activity and is capable of tuning the detection capacity of the nGO nanoassembly with a thermoswitch at 39 °C. By utilizing probes with multiple mismatches, DNase I cleavage of the DNA probe strands, and the attachment of PEGMA polymers to graphene oxide to block undesired DNase I activity, we were able to detect miR-10b from liquid biopsy mimics and breast cancer cell lines. Overall we have reported our efforts to improve the specificity, increase the sensitivity, and eliminate the undesired enzymatic activity of DNase I on surface-adsorbed probes for miR-10b detection using water-soluble graphene nanodevices. Even though we have demonstrated only the discrimination of miR-10b from miR-10a, our approach can be extended to other short RNA molecules which differ by a single nucleotide.

  10. Culture adaptation of malaria parasites selects for convergent loss-of-function mutants.

    PubMed

    Claessens, Antoine; Affara, Muna; Assefa, Samuel A; Kwiatkowski, Dominic P; Conway, David J

    2017-01-24

    Cultured human pathogens may differ significantly from source populations. To investigate the genetic basis of laboratory adaptation in malaria parasites, clinical Plasmodium falciparum isolates were sampled from patients and cultured in vitro for up to three months. Genome sequence analysis was performed on multiple culture time point samples from six monoclonal isolates, and single nucleotide polymorphism (SNP) variants emerging over time were detected. Out of a total of five positively selected SNPs, four represented nonsense mutations resulting in stop codons, three of these in a single ApiAP2 transcription factor gene, and one in SRPK1. To survey further for nonsense mutants associated with culture, genome sequences of eleven long-term laboratory-adapted parasite strains were examined, revealing four independently acquired nonsense mutations in two other ApiAP2 genes, and five in Epac. No mutants of these genes exist in a large database of parasite sequences from uncultured clinical samples. This implicates putative master regulator genes in which multiple independent stop codon mutations have convergently led to culture adaptation, affecting most laboratory lines of P. falciparum. Understanding the adaptive processes should guide development of experimental models, which could include targeted gene disruption to adapt fastidious malaria parasite species to culture.

  11. Stable Gene Targeting in Human Cells Using Single-Strand Oligonucleotides with Modified Bases

    PubMed Central

    Rios, Xavier; Briggs, Adrian W.; Christodoulou, Danos; Gorham, Josh M.; Seidman, Jonathan G.; Church, George M.

    2012-01-01

    Recent advances allow multiplexed genome engineering in E. coli, employing easily designed oligonucleotides to edit multiple loci simultaneously. A similar technology in human cells would greatly expedite functional genomics, both by enhancing our ability to test how individual variants such as single nucleotide polymorphisms (SNPs) are related to specific phenotypes, and potentially allowing simultaneous mutation of multiple loci. However, oligo-mediated targeting of human cells is currently limited by low targeting efficiencies and low survival of modified cells. Using a HeLa-based EGFP-rescue reporter system we show that use of modified base analogs can increase targeting efficiency, in part by avoiding the mismatch repair machinery. We investigate the effects of oligonucleotide toxicity and find a strong correlation between the number of phosphorothioate bonds and toxicity. Stably EGFP-corrected cells were generated at a frequency of ~0.05% with an optimized oligonucleotide design combining modified bases and reduced number of phosphorothioate bonds. We provide evidence from comparative RNA-seq analysis suggesting cellular immunity induced by the oligonucleotides might contribute to the low viability of oligo-corrected cells. Further optimization of this method should allow rapid and scalable genome engineering in human cells. PMID:22615794

  12. Genotyping of the Alzheimer's Disease Genome-Wide Association Study Index Single Nucleotide Polymorphisms in the Brains for Dementia Research Cohort.

    PubMed

    Brookes, Keeley J; McConnell, George; Williams, Kirsty; Chaudhury, Sultan; Madhan, Gaganjit; Patel, Tulsi; Turley, Christopher; Guetta-Baranes, Tamar; Bras, Jose; Guerreiro, Rita; Hardy, John; Francis, Paul T; Morgan, Kevin

    2018-06-08

    The Brains for Dementia Research project is a recently established longitudinal cohort which aims to provide brain tissue for research purposes from neuropathologically defined samples. Here we present the findings from our analysis on the 19 established GWAS index SNPs for Alzheimer's disease, in order to demonstrate if the BDR sample also displays association to these variants. A highly significant association of the APOEɛ4 allele was identified (p = 3.99×10-12). Association tests for the 19 GWAS SNPs found that although no SNPs survive multiple testing, nominal significant findings were detected and concordance with the Lambert et al. GWAS meta-analysis was observed.

  13. Analysis of in vivo correction of defined mismatches in the DNA mismatch repair mutants msh2, msh3 and msh6 of Saccharomyces cerevisiae.

    PubMed

    Lühr, B; Scheller, J; Meyer, P; Kramer, W

    1998-02-01

    We have analysed the correction of defined mismatches in wild-type and msh2, msh3, msh6 and msh3 msh6 mutants of Saccharomyces cerevisiae in two different yeast strain backgrounds by transformation with plasmid heteroduplex DNA constructs. Ten different base/base mismatches, two single-nucleotide loops and a 38-nucleotide loop were tested. Repair of all types of mismatches was severely impaired in msh2 and msh3 msh6 mutants. In msh6 mutants, repair efficiency of most base/base mismatches was reduced to a similar extent as in msh3 msh6 double mutants. G/T and A/C mismatches, however, displayed residual repair in msh6 mutants in one strain background, implying a role for Msh3p in recognition of base/base mismatches. Furthermore, the efficiency of repair of base/base mismatches was considerably reduced in msh3 mutants in one strain background, indicating a requirement for MSH3 for fully efficient mismatch correction. Also the efficiency of repair of the 38-nucleotide loop was reduced in msh3 mutants, and to a lesser extent in msh6 mutants. The single-nucleotide loop with an unpaired A was less efficiently repaired in msh3 mutants and that with an unpaired T was less efficiently corrected in msh6 mutants, indicating non-redundant functions for the two proteins in the recognition of single-nucleotide loops.

  14. Manipulation of oligonucleotides immobilized on solid supports - DNA computations on surfaces

    NASA Astrophysics Data System (ADS)

    Liu, Qinghua

    The manipulation of DNA oligonucleotides immobilized on various solid supports has been studied intensively, especially in the area of surface hybridization. Recently, surface-based biotechnology has been applied to the area of molecular computing. These surface-based methods have advantages with regard to ease of handling, facile purification, and less interference when compared to solution methodologies. This dissertation describes the investigation of molecular approaches to DNA computing. The feasibility of encoding a bit (0 or 1) of information for DNA-based computations at the single nucleotide level was studied, particularly with regard to the efficiency and specificity of hybridization discrimination. Both gold and glass surfaces, with addressed arrays of 32 oligonucleotides, were employed with similar hybridization results. Although single-base discrimination may be achieved in the system, it is at the cost of a severe decrease in the efficiency of hybridization to perfectly matched sequences. This compromises the utility of single nucleotide encoding for DNA computing applications in the absence of some additional mechanism for increasing specificity. Several methods are suggested including a multiple-base encoding strategy. The multiple-base encoding strategy was employed to develop a prototype DNA computer. The approach was demonstrated by solving a small example of the Satisfiability (SAT) problem, an NP-complete problem in Boolean logic. 16 distinct DNA oligonucleotides, encoding all candidate solutions to the 4-variable-4-clause-3-SAT problem, were immobilized on a gold surface in the non-addressed format. Four cycles of MARK (hybridization), DESTROY (enzymatic destruction) and UNMARK (denaturation) were performed, which identified and eliminated members of the set which were not solutions to the problem. Determination of the answer was accomplished in the READOUT (sequence identification) operation by PCR amplification of the remaining molecules and hybridization to an addressed array. Four answers were determined and the S/N ratio between correct and incorrect solutions ranged from 10 to 777, making discrimination between correct and incorrect solutions to the problem straightforward. Additionally, studies of enzymatic manipulations of DNA molecules on surfaces suggested the use of E. coli Exonuclease I (Exo I) and perhaps EarI in the DESTROY operation.

  15. Single cytidine units-templated syntheses of multi-colored water-soluble Au nanoclusters

    NASA Astrophysics Data System (ADS)

    Jiang, Hui; Zhang, Yuanyuan; Wang, Xuemei

    2014-08-01

    Ultra-small metallic nanoparticles, or so-called ``nanoclusters'' (NCs), have attracted considerable interest due to their unique optical properties that are different from both larger nanoparticles and single atoms. To prepare high-quality NCs, the stabilizing agent plays an essential role. In this work, we have revealed and validated that cytidine and its nucleotides (cytidine 5'-monophosphate or cytidine 5'-triphosphate) can act as efficient stabilizers for syntheses of multicolored Au NCs. Interestingly, Au NCs with blue, green and yellow fluorescence emissions are simultaneously obtained using various pH environments or reaction times. The transmission electron microscopy verifies that the size of Au NCs ranges from 1.5 to 3 nm. The X-ray photoelectron spectroscopy confirms that only Au (0) species are present in NCs. Generally, the facile preparation of multicolored Au NCs that are stabilized by cytidine units provides access to promising candidates for multiple biolabeling applications.Ultra-small metallic nanoparticles, or so-called ``nanoclusters'' (NCs), have attracted considerable interest due to their unique optical properties that are different from both larger nanoparticles and single atoms. To prepare high-quality NCs, the stabilizing agent plays an essential role. In this work, we have revealed and validated that cytidine and its nucleotides (cytidine 5'-monophosphate or cytidine 5'-triphosphate) can act as efficient stabilizers for syntheses of multicolored Au NCs. Interestingly, Au NCs with blue, green and yellow fluorescence emissions are simultaneously obtained using various pH environments or reaction times. The transmission electron microscopy verifies that the size of Au NCs ranges from 1.5 to 3 nm. The X-ray photoelectron spectroscopy confirms that only Au (0) species are present in NCs. Generally, the facile preparation of multicolored Au NCs that are stabilized by cytidine units provides access to promising candidates for multiple biolabeling applications. Electronic supplementary information (ESI) available: The feed amount for preparation of Au NCs, photophysical properties of Au NCs, the FL spectra under different pH and reaction time, and XPS results are included. See DOI: 10.1039/c4nr02180k

  16. Demonstration of Protein-Based Human Identification Using the Hair Shaft Proteome

    PubMed Central

    Leppert, Tami; Anex, Deon S.; Hilmer, Jonathan K.; Matsunami, Nori; Baird, Lisa; Stevens, Jeffery; Parsawar, Krishna; Durbin-Johnson, Blythe P.; Rocke, David M.; Nelson, Chad; Fairbanks, Daniel J.; Wilson, Andrew S.; Rice, Robert H.; Woodward, Scott R.; Bothner, Brian; Hart, Bradley R.; Leppert, Mark

    2016-01-01

    Human identification from biological material is largely dependent on the ability to characterize genetic polymorphisms in DNA. Unfortunately, DNA can degrade in the environment, sometimes below the level at which it can be amplified by PCR. Protein however is chemically more robust than DNA and can persist for longer periods. Protein also contains genetic variation in the form of single amino acid polymorphisms. These can be used to infer the status of non-synonymous single nucleotide polymorphism alleles. To demonstrate this, we used mass spectrometry-based shotgun proteomics to characterize hair shaft proteins in 66 European-American subjects. A total of 596 single nucleotide polymorphism alleles were correctly imputed in 32 loci from 22 genes of subjects’ DNA and directly validated using Sanger sequencing. Estimates of the probability of resulting individual non-synonymous single nucleotide polymorphism allelic profiles in the European population, using the product rule, resulted in a maximum power of discrimination of 1 in 12,500. Imputed non-synonymous single nucleotide polymorphism profiles from European–American subjects were considerably less frequent in the African population (maximum likelihood ratio = 11,000). The converse was true for hair shafts collected from an additional 10 subjects with African ancestry, where some profiles were more frequent in the African population. Genetically variant peptides were also identified in hair shaft datasets from six archaeological skeletal remains (up to 260 years old). This study demonstrates that quantifiable measures of identity discrimination and biogeographic background can be obtained from detecting genetically variant peptides in hair shaft protein, including hair from bioarchaeological contexts. PMID:27603779

  17. Recombination-dependent replication and gene conversion homogenize repeat sequences and diversify plastid genome structure.

    PubMed

    Ruhlman, Tracey A; Zhang, Jin; Blazier, John C; Sabir, Jamal S M; Jansen, Robert K

    2017-04-01

    There is a misinterpretation in the literature regarding the variable orientation of the small single copy region of plastid genomes (plastomes). The common phenomenon of small and large single copy inversion, hypothesized to occur through intramolecular recombination between inverted repeats (IR) in a circular, single unit-genome, in fact, more likely occurs through recombination-dependent replication (RDR) of linear plastome templates. If RDR can be primed through both intra- and intermolecular recombination, then this mechanism could not only create inversion isomers of so-called single copy regions, but also an array of alternative sequence arrangements. We used Illumina paired-end and PacBio single-molecule real-time (SMRT) sequences to characterize repeat structure in the plastome of Monsonia emarginata (Geraniaceae). We used OrgConv and inspected nucleotide alignments to infer ancestral nucleotides and identify gene conversion among repeats and mapped long (>1 kb) SMRT reads against the unit-genome assembly to identify alternative sequence arrangements. Although M. emarginata lacks the canonical IR, we found that large repeats (>1 kilobase; kb) represent ∼22% of the plastome nucleotide content. Among the largest repeats (>2 kb), we identified GC-biased gene conversion and mapping filtered, long SMRT reads to the M. emarginata unit-genome assembly revealed alternative, substoichiometric sequence arrangements. We offer a model based on RDR and gene conversion between long repeated sequences in the M. emarginata plastome and provide support that both intra-and intermolecular recombination between large repeats, particularly in repeat-rich plastomes, varies unit-genome structure while homogenizing the nucleotide sequence of repeats. © 2017 Botanical Society of America.

  18. Sequence of a cDNA encoding pancreatic preprosomatostatin-22.

    PubMed Central

    Magazin, M; Minth, C D; Funckes, C L; Deschenes, R; Tavianini, M A; Dixon, J E

    1982-01-01

    We report the nucleotide sequence of a precursor to somatostatin that upon proteolytic processing may give rise to a hormone of 22 amino acids. The nucleotide sequence of a cDNA from the channel catfish (Ictalurus punctatus) encodes a precursor to somatostatin that is 105 amino acids (Mr, 11,500). The cDNA coding for somatostatin-22 consists of 36 nucleotides in the 5' untranslated region, 315 nucleotides that code for the precursor to somatostatin-22, 269 nucleotides at the 3' untranslated region, and a variable length of poly(A). The putative preprohormone contains a sequence of hydrophobic amino acids at the amino terminus that has the properties of a "signal" peptide. A connecting sequence of approximately 57 amino acids is followed by a single Arg-Arg sequence, which immediately precedes the hormone. Somatostatin-22 is homologous to somatostatin-14 in 7 of the 14 amino acids, including the Phe-Trp-Lys sequence. Hybridization selection of mRNA, followed by its translation in a wheat germ cell-free system, resulted in the synthesis of a single polypeptide having a molecular weight of approximately 10,000 as estimated on Na-DodSO4/polyacrylamide gels. Images PMID:6127673

  19. Simultaneous determination of nucleotide sugars with ion-pair reversed-phase HPLC.

    PubMed

    Nakajima, Kazuki; Kitazume, Shinobu; Angata, Takashi; Fujinawa, Reiko; Ohtsubo, Kazuaki; Miyoshi, Eiji; Taniguchi, Naoyuki

    2010-07-01

    Nucleotide sugars are important in determining cell surface glycoprotein glycosylation, which can modulate cellular properties such as growth and arrest. We have developed a conventional HPLC method for simultaneous determination of nucleotide sugars. A mixture of nucleotide sugars (CMP-NeuAc, UDP-Gal, UDP-Glc, UDP-GalNAc, UDP-GlcNAc, GDP-Man, GDP-Fuc and UDP-GlcUA) and relevant nucleotides were perfectly separated in an optimized ion-pair reversed-phase mode using Inertsil ODS-4 and ODS-3 columns. The newly developed method enabled us to determine the nucleotide sugars in cellular extracts from 1 x 10(6) cells in a single run. We applied this method to characterize nucleotide sugar levels in breast and pancreatic cancer cell lines and revealed that the abundance of UDP-GlcNAc, UDP-GalNAc, UDP-GlcUA and GDP-Fuc were a cell-type-specific feature. To determine the physiological significance of changes in nucleotide sugar levels, we analyzed their changes by glucose deprivation and found that the determination of nucleotide sugar levels provided us with valuable information with respect to studying the overview of cellular glycosylation status.

  20. Adolescent idiopathic scoliosis and the single-nucleotide polymorphism of the growth hormone receptor and IGF-1 genes.

    PubMed

    Yang, Yong; Wu, Zhihong; Zhao, Taimao; Wang, Hai; Zhao, Dong; Zhang, Jianguo; Wang, Yipeng; Ding, Yaozhong; Qiu, Guixing

    2009-06-01

    The etiology of adolescent idiopathic scoliosis is undetermined despite years of research. A number of hypotheses have been postulated to explain its development, including growth abnormalities. The irregular expression of growth hormone and insulin-like growth factor-1 (IGF-1) may disturb hormone metabolism, result in a gross asymmetry, and promote the progress of adolescent idiopathic scoliosis. Initial association studies in complex diseases have demonstrated the power of candidate gene association. Prior to our study, 1 study in this field had a negative result. A replicable study is vital for reliability. To determine the relationship of growth hormone receptor and IGF-1 genes with adolescent idiopathic scoliosis, a population-based association study was performed. Single nucleotide polymorphisms with potential function were selected from candidate genes and a distribution analysis was performed. A conclusion was made confirming the insufficiency of an association between adolescent idiopathic scoliosis and the single-nucleotide polymorphism of the growth hormone receptor and IGF-1 genes in Han Chinese.

  1. A single splice site mutation in human-specific ARHGAP11B causes basal progenitor amplification

    PubMed Central

    Florio, Marta; Namba, Takashi; Pääbo, Svante; Hiller, Michael; Huttner, Wieland B.

    2016-01-01

    The gene ARHGAP11B promotes basal progenitor amplification and is implicated in neocortex expansion. It arose on the human evolutionary lineage by partial duplication of ARHGAP11A, which encodes a Rho guanosine triphosphatase–activating protein (RhoGAP). However, a lack of 55 nucleotides in ARHGAP11B mRNA leads to loss of RhoGAP activity by GAP domain truncation and addition of a human-specific carboxy-terminal amino acid sequence. We show that these 55 nucleotides are deleted by mRNA splicing due to a single C→G substitution that creates a novel splice donor site. We reconstructed an ancestral ARHGAP11B complementary DNA without this substitution. Ancestral ARHGAP11B exhibits RhoGAP activity but has no ability to increase basal progenitors during neocortex development. Hence, a single nucleotide substitution underlies the specific properties of ARHGAP11B that likely contributed to the evolutionary expansion of the human neocortex. PMID:27957544

  2. Failure of replicating the association between hippocampal volume and 3 single-nucleotide polymorphisms identified from the European genome-wide association study in Asian populations.

    PubMed

    Li, Ming; Ohi, Kazutaka; Chen, Chunhui; He, Qinghua; Liu, Jie-Wei; Chen, Chuansheng; Luo, Xiong-Jian; Dong, Qi; Hashimoto, Ryota; Su, Bing

    2014-12-01

    Hippocampal volume is a key brain structure for learning ability and memory process, and hippocampal atrophy is a recognized biological marker of Alzheimer's disease. However, the genetic bases of hippocampal volume are still unclear although it is a heritable trait. Genome-wide association studies (GWASs) on hippocampal volume have implicated several significantly associated genetic variants in Europeans. Here, to test the contributions of these GWASs identified genetic variants to hippocampal volume in different ethnic populations, we screened the GWAS-identified candidate single-nucleotide polymorphisms in 3 independent healthy Asian brain imaging samples (a total of 990 subjects). The results showed that none of these single-nucleotide polymorphisms were associated with hippocampal volume in either individual or combined Asian samples. The replication results suggested a complexity of genetic architecture for hippocampal volume and potential genetic heterogeneity between different ethnic populations. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. Detecting Single-Nucleotide Substitutions Induced by Genome Editing.

    PubMed

    Miyaoka, Yuichiro; Chan, Amanda H; Conklin, Bruce R

    2016-08-01

    The detection of genome editing is critical in evaluating genome-editing tools or conditions, but it is not an easy task to detect genome-editing events-especially single-nucleotide substitutions-without a surrogate marker. Here we introduce a procedure that significantly contributes to the advancement of genome-editing technologies. It uses droplet digital polymerase chain reaction (ddPCR) and allele-specific hydrolysis probes to detect single-nucleotide substitutions generated by genome editing (via homology-directed repair, or HDR). HDR events that introduce substitutions using donor DNA are generally infrequent, even with genome-editing tools, and the outcome is only one base pair difference in 3 billion base pairs of the human genome. This task is particularly difficult in induced pluripotent stem (iPS) cells, in which editing events can be very rare. Therefore, the technological advances described here have implications for therapeutic genome editing and experimental approaches to disease modeling with iPS cells. © 2016 Cold Spring Harbor Laboratory Press.

  4. Association of genetic variations in the serotonin and dopamine systems with aggressive behavior in the Chinese adolescent population: Single- and multiple-risk genetic variants.

    PubMed

    Chang, Hongjuan; Yan, Qiuge; Tang, Lina; Huang, Juan; Ma, Yuqiao; Ye, Xiaozhou; Wu, Chunxia; Wu, Linguo; Yu, Yizhen

    2018-01-01

    Genetic predisposition is an important factor leading to aggressive behavior. However, the relationship between genetic polymorphisms and aggressive behavior has not been elucidated. We identified candidate genes located in the dopaminergic and serotonin system (DRD3, DRD4, and FEV) that had been previously reported to be associated with aggressive behavior. We investigated 14 tag single-nucleotide polymorphisms (SNPs) using a multi-analytic strategy combining logistic regression (LR) and classification and regression tree (CART) to explore higher-order interactions between these SNPs and aggressive behavior in 318 patients and 558 controls. Both LR and CART analyses suggested that the rs16859448 polymorphism is the strongest individual factor associated with aggressive behavior risk. In CART analysis, individuals carrying the combined genotypes of rs16859448TT/GT-rs11246228CT/TT-rs3773679TT had the highest risk, while rs16859448GG-rs2134655CT had the lowest risk (OR = 5.25, 95% CI: 2.53-10.86). This study adds to the growing evidence on the association of single- and multiple-risk variants in DRD3, DRD4, and FEV with aggressive behavior in Chinese adolescents. However, the aggressive behavior scale used to diagnose aggression in this study did not account for comorbid conditions; therefore, further studies are needed to confirm our observations. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Structure of the human gene encoding the protein repair L-isoaspartyl (D-aspartyl) O-methyltransferase.

    PubMed

    DeVry, C G; Tsai, W; Clarke, S

    1996-11-15

    The protein L-isoaspartyl/D-aspartyl O-methyltransferase (EC 2.1.1.77) catalyzes the first step in the repair of proteins damaged in the aging process by isomerization or racemization reactions at aspartyl and asparaginyl residues. A single gene has been localized to human chromosome 6 and multiple transcripts arising through alternative splicing have been identified. Restriction enzyme mapping, subcloning, and DNA sequence analysis of three overlapping clones from a human genomic library in bacteriophage P1 indicate that the gene spans approximately 60 kb and is composed of 8 exons interrupted by 7 introns. Analysis of intron/exon splice junctions reveals that all of the donor and acceptor splice sites are in agreement with the mammalian consensus splicing sequence. Determination of transcription initiation sites by primer extension analysis of poly(A)+ mRNA from human brain identifies multiple start sites, with a major site 159 nucleotides upstream from the ATG start codon. Sequence analysis of the 5'-untranslated region demonstrates several potential cis-acting DNA elements including SP1, ETF, AP1, AP2, ARE, XRE, CREB, MED-1, and half-palindromic ERE motifs. The promoter of this methyltransferase gene lacks an identifiable TATA box but is characterized by a CpG island which begins approximately 723 nucleotides upstream of the major transcriptional start site and extends through exon 1 and into the first intron. These features are characteristic of housekeeping genes and are consistent with the wide tissue distribution observed for this methyltransferase activity.

  6. Predicted stem-loop structures and variation in nucleotide sequence of 3' noncoding regions among animal calicivirus genomes.

    PubMed

    Seal, B S; Neill, J D; Ridpath, J F

    1994-07-01

    Caliciviruses are nonenveloped with a polyadenylated genome of approximately 7.6 kb and a single capsid protein. The "RNA Fold" computer program was used to analyze 3'-terminal noncoding sequences of five feline calicivirus (FCV), rabbit hemorrhagic disease virus (RHDV), and two San Miguel sea lion virus (SMSV) isolates. The FCV 3'-terminal sequences are 40-46 nucleotides in length and 72-91% similar. The FCV sequences were predicted to contain two possible duplex structures and one stem-loop structure with free energies of -2.1 to -18.2 kcal/mole. The RHDV genomic 3'-terminal RNA sequences are 54 nucleotides in length and share 49% sequence similarity to homologous regions of the FCV genome. The RHDV sequence was predicted to form two duplex structures in the 3'-terminal noncoding region with a single stem-loop structure, resembling that of FCV. In contrast, the SMSV 1 and 4 genomic 3'-terminal noncoding sequences were 185 and 182 nucleotides in length, respectively. Ten possible duplex structures were predicted with an average structural free energy of -35 kcal/mole. Sequence similarity between the two SMSV isolates was 75%. Furthermore, extensive cloverleaflike structures are predicted in the 3' noncoding region of the SMSV genome, in contrast to the predicted single stem-loop structures of FCV or RHDV.

  7. Base Preferences in Non-Templated Nucleotide Incorporation by MMLV-Derived Reverse Transcriptases

    PubMed Central

    Zajac, Pawel; Islam, Saiful; Hochgerner, Hannah; Lönnerberg, Peter; Linnarsson, Sten

    2013-01-01

    Reverse transcriptases derived from Moloney Murine Leukemia Virus (MMLV) have an intrinsic terminal transferase activity, which causes the addition of a few non-templated nucleotides at the 3´ end of cDNA, with a preference for cytosine. This mechanism can be exploited to make the reverse transcriptase switch template from the RNA molecule to a secondary oligonucleotide during first-strand cDNA synthesis, and thereby to introduce arbitrary barcode or adaptor sequences in the cDNA. Because the mechanism is relatively efficient and occurs in a single reaction, it has recently found use in several protocols for single-cell RNA sequencing. However, the base preference of the terminal transferase activity is not known in detail, which may lead to inefficiencies in template switching when starting from tiny amounts of mRNA. Here, we used fully degenerate oligos to determine the exact base preference at the template switching site up to a distance of ten nucleotides. We found a strong preference for guanosine at the first non-templated nucleotide, with a greatly reduced bias at progressively more distant positions. Based on this result, and a number of careful optimizations, we report conditions for efficient template switching for cDNA amplification from single cells. PMID:24392002

  8. Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data.

    PubMed

    Dunn, Joshua G; Weissman, Jonathan S

    2016-11-22

    Next-generation sequencing (NGS) informs many biological questions with unprecedented depth and nucleotide resolution. These assays have created a need for analytical tools that enable users to manipulate data nucleotide-by-nucleotide robustly and easily. Furthermore, because many NGS assays encode information jointly within multiple properties of read alignments - for example, in ribosome profiling, the locations of ribosomes are jointly encoded in alignment coordinates and length - analytical tools are often required to extract the biological meaning from the alignments before analysis. Many assay-specific pipelines exist for this purpose, but there remains a need for user-friendly, generalized, nucleotide-resolution tools that are not limited to specific experimental regimes or analytical workflows. Plastid is a Python library designed specifically for nucleotide-resolution analysis of genomics and NGS data. As such, Plastid is designed to extract assay-specific information from read alignments while retaining generality and extensibility to novel NGS assays. Plastid represents NGS and other biological data as arrays of values associated with genomic or transcriptomic positions, and contains configurable tools to convert data from a variety of sources to such arrays. Plastid also includes numerous tools to manipulate even discontinuous genomic features, such as spliced transcripts, with nucleotide precision. Plastid automatically handles conversion between genomic and feature-centric coordinates, accounting for splicing and strand, freeing users of burdensome accounting. Finally, Plastid's data models use consistent and familiar biological idioms, enabling even beginners to develop sophisticated analytical workflows with minimal effort. Plastid is a versatile toolkit that has been used to analyze data from multiple NGS assays, including RNA-seq, ribosome profiling, and DMS-seq. It forms the genomic engine of our ORF annotation tool, ORF-RATER, and is readily adapted to novel NGS assays. Examples, tutorials, and extensive documentation can be found at https://plastid.readthedocs.io .

  9. A Polymorphism in the Retinol Binding Protein 4 Gene is Not Associated with Gestational Diabetes Mellitus in Several Different Ethnic Groups

    PubMed Central

    Urschitz, Johann; Sultan, Omar; Ward, Kenneth

    2011-01-01

    Objective Various Asian and Pacifific Islander groups have higher prevalence rates of type 2 diabetes and gestational diabetes. This increased incidence is likely to include genetic factors. Single nucleotide polymorphisms in the retinol binding protein 4 gene have been linked to the occurrence of type 2 diabetes. Hypothesizing a link between retinol binding protein 4 and gestational diabetes, we performed a candidate gene study to look for an association between an important retinol binding protein gene polymorphism (rs3758539) and gestational diabetes. Study Design Blood was collected from Caucasian, Asian, and Pacific Islander women diagnosed with gestational diabetes and from ethnically matched non-diabetic controls. DNA was extracted and real time PCR technology (TaqMan, Applied Biosystems) used to screen for the rs3758539 single nucleotide polymorphism located 5′ of exon 1 of the retinol binding protein 4 gene. Results Genotype and allele frequencies in the controls and gestational diabetes cases were tested using chi-square contingency tests. Genotype frequencies were in Hardy-Weinberg equilibrium. There was no association between the rs3758539 retinol binding protein 4 single nucleotide polymorphism and gestational diabetes in the Caucasian, Filipino, or Pacific Islander groups. Conclusion Interestingly, the rs3758539 retinol binding protein 4 single nucleotide polymorphism was not found to be associated with gestational diabetes. The absence of association suggests that gestational and type 2 diabetes may have more divergent molecular pathophysiology than previously suspected. PMID:21886308

  10. Association of glutathione S-transferase pi isoform single-nucleotide polymorphisms with exudative age-related macular degeneration in a Chinese population.

    PubMed

    Gu, Hong; Sun, Erdan; Cui, Lei; Yang, Xiufen; Lim, Apiradee; Xu, Jun; Snellingen, Torkel; Liu, Xipu; Wang, Ningli; Liu, Ningpu

    2012-10-01

    To investigate the association between single-nucleotide polymorphisms in the pi isoform of glutathione S-transferase (GSTP1) gene and the risk of exudative age-related macular degeneration (AMD) in a Chinese case-control cohort. A total of 131 Chinese patients with exudative AMD and 138 control individuals were recruited. Genomic DNA was extracted from venous blood leukocytes. Two common nonsynonymous single-nucleotide polymorphisms in GSTP1 (rs1695 and rs1138272) were genotyped by polymerase chain reaction followed by allele-specific restriction enzyme digestion and direct sequencing. Significant association with exudative AMD was detected for single-nucleotide polymorphism, rs1695 (P = 0.019). The risk G allele frequencies were 21.8% in AMD patients and 12.7% in control subjects (P = 0.007). Compared with the wild-type AA genotype, odds ratio for the risk of AMD was 1.91 (95% confidence interval, 1.09-3.35) for the heterozygous AG genotype and 2.52 (95% confidence interval, 0.6-10.61) for the homozygous GG genotype. In contrast, rs1138272 was not associated with exudative AMD (P = 1.00). The risk G allele frequencies of rs1138272 were 0.4% in AMD patients and 0.4% in control subjects (P = 1.00). Our data suggest that the GSTP1 variant rs1695 moderately increases the risk of exudative AMD. The variant rs1138272 was rare and was not associated with exudative AMD in this Chinese cohort.

  11. Electron attachment to DNA single strands: gas phase and aqueous solution

    PubMed Central

    Gu, Jiande; Xie, Yaoming; Schaefer, Henry F.

    2007-01-01

    The 2′-deoxyguanosine-3′,5′-diphosphate, 2′-deoxyadenosine-3′,5′-diphosphate, 2′-deoxycytidine-3′,5′-diphosphate and 2′-deoxythymidine-3′,5′-diphosphate systems are the smallest units of a DNA single strand. Exploring these comprehensive subunits with reliable density functional methods enables one to approach reasonable predictions of the properties of DNA single strands. With these models, DNA single strands are found to have a strong tendency to capture low-energy electrons. The vertical attachment energies (VEAs) predicted for 3′,5′-dTDP (0.17 eV) and 3′,5′-dGDP (0.14 eV) indicate that both the thymine-rich and the guanine-rich DNA single strands have the ability to capture electrons. The adiabatic electron affinities (AEAs) of the nucleotides considered here range from 0.22 to 0.52 eV and follow the order 3′,5′-dTDP > 3′,5′-dCDP > 3′,5′-dGDP > 3′,5′-dADP. A substantial increase in the AEA is observed compared to that of the corresponding nucleic acid bases and the corresponding nucleosides. Furthermore, aqueous solution simulations dramatically increase the electron attracting properties of the DNA single strands. The present investigation illustrates that in the gas phase, the excess electron is situated both on the nucleobase and on the phosphate moiety for DNA single strands. However, the distribution of the extra negative charge is uneven. The attached electron favors the base moiety for the pyrimidine, while it prefers the 3′-phosphate subunit for the purine DNA single strands. In contrast, the attached electron is tightly bound to the base fragment for the cytidine, thymidine and adenosine nucleotides, while it almost exclusively resides in the vicinity of the 3′-phosphate group for the guanosine nucleotides due to the solvent effects. The comparatively low vertical detachment energies (VDEs) predicted for 3′,5′-dADP− (0.26 eV) and 3′,5′-dGDP− (0.32 eV) indicate that electron detachment might compete with reactions having high activation barriers such as glycosidic bond breakage. However, the radical anions of the pyrimidine nucleotides with high VDE are expected to be electronically stable. Thus the base-centered radical anions of the pyrimidine nucleotides might be the possible intermediates for DNA single-strand breakage. PMID:17660189

  12. Characterization of a splicing mutation in group A xeroderma pigmentosum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Satokata, Ichiro; Tanaka, Kiyoji; Miura, Naoyuki

    1990-12-01

    The molecular basis of group A xeroderma pigmentosum (WP) was investigated by comparison of the nucleotide sequences of multiple clones of the XP group A complementing gene (XPAC) from a patient with group A XP with that of a normal gene. The clones showed a G {r arrow} C substitution at the 3{prime} splice acceptor site of intron 3, which altered the obligatory AG acceptor dinucleotide to AC. Nucleotide sequencing of cDNAs amplified by the polymerase chain reaction revealed that this single base substitution abolishes the canonical 3{prime} splice site, thus creating two abnormally spliced mRNA forms. The larger formmore » is identical with normal mRNA except for a dinucleotide deletion at the 5{prime} end of exon 4. This deletion results in a frameshift with premature translation termination in exon 4. The smaller form has a deletion of the entire exon 3 and the dinucleotide at the 5{prime} end of exon 4. The result of a transfection study provided additional evidence that this single base substitution is the disease-causing mutation. This single base substitution creates a new cleavage site for the restriction nuclease AlwNI. Analysis of AlwNI restriction fragment length polymorphism showed a high frequency of this mutation in Japanese patients with group A XP: 16 of 21 unrelated Japanese patients were homozygous and 4 were heterozygous for this mutation. However, 11 Caucasians and 2 Blacks with group A XP did not have this mutant allele. The polymorphic AlwNI restriction fragments are concluded to be useful for diagnosis of group A XP in Japanese subjects, including prenatal cases and carriers.« less

  13. SiNoPsis: Single Nucleotide Polymorphisms selection and promoter profiling.

    PubMed

    Boloc, Daniel; Rodríguez, Natalia; Gassó, Patricia; Abril, Josep F; Bernardo, Miquel; Lafuente, Amalia; Mas, Sergi

    2017-09-14

    The selection of a Single Nucleotide Polymorphism (SNP) using bibliographic methods can be a very time-consuming task. Moreover, a SNP selected in this way may not be easily visualized in its genomic context by a standard user hoping to correlate it with other valuable information. Here we propose a web form built on top of Circos that can assist SNP-centred screening, based on their location in the genome and the regulatory modules they can disrupt. Its use may allow researchers to prioritize SNPs in genotyping and disease studies. SiNoPsis is bundled as a web portal. It focuses on the different structures involved in the genomic expression of a gene, especially those found in the core promoter upstream region. These structures include transcription factor binding sites (for promoter and enhancer signals), histones, and promoter flanking regions. Additionally, the tool provides eQTL and linkage disequilibrium (LD) properties for a given SNP query, yielding further clues about other indirectly associated SNPs. Possible disruptions of the aforementioned structures affecting gene transcription are reported using multiple resource databases. SiNoPsis has a simple user-friendly interface, which allows single queries by gene symbol, genomic coordinates, Ensembl gene identifiers, RefSeq transcript identifiers and SNPs. It is the only portal providing useful SNP selection based on regulatory modules and LD with functional variants in both textual and graphic modes (by properly defining the arguments and parameters needed to run Circos). SiNoPsis is freely available at https://compgen.bio.ub.edu/SiNoPsis /. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  14. Genetic variation in Pythium myriotylum based on SNP typing and development of a PCR-RFLP detection of isolates recovered from Pythium soft rot ginger.

    PubMed

    Le, D P; Smith, M K; Aitken, E A B

    2017-10-01

    Pythium myriotylum is responsible for severe losses in both capsicum and ginger crops in Australia under different regimes. Intraspecific genomic variation within the pathogen might explain the differences in aggressiveness and pathogenicity on diverse hosts. In this study, whole genome data of four P. myriotylum isolates recovered from three hosts and one Pythium zingiberis isolate were derived and analysed for sequence diversity based on single nucleotide polymorphisms (SNPs). A higher number of true and unique SNPs occurred in P. myriotylum isolates obtained from ginger with symptoms of Pythium soft rot (PSR) in Australia compared to other P. myriotylum isolates. Overall, SNPs were discovered more in the mitochondrial genome than those in the nuclear genome. Among the SNPs, a single substitution from the cytosine (C) to the thymine (T) in the partially sequenced CoxII gene of 14 representatives of PSR P. myriotylum isolates was within a restriction site of HinP1I enzyme which was used in the PCR-RFLP for detection and identification of the isolates without sequencing. The PCR-RFLP was also sensitive to detect PSR P. myriotylum strains from artificially infected ginger without the need for isolation for pure cultures. This is the first study of intraspecific variants of Pythium myriotylum isolates recovered from different hosts and origins based on single nucleotide polymorphism (SNP) genotyping of multiple genes. The SNPs discovered provide valuable makers for detection and identification of P. myriotylum strains initially isolated from Pythium soft rot (PSR) ginger by using PCR-RFLP of the CoxII locus. The PCR-RFLP was also sensitive to detect P. myriotylum directly from PSR ginger sampled from pot trials without the need of isolation for pure cultures. © 2017 The Society for Applied Microbiology.

  15. Genome-Wide Association of the Laboratory-Based Nicotine Metabolite Ratio in Three Ancestries.

    PubMed

    Baurley, James W; Edlund, Christopher K; Pardamean, Carissa I; Conti, David V; Krasnow, Ruth; Javitz, Harold S; Hops, Hyman; Swan, Gary E; Benowitz, Neal L; Bergen, Andrew W

    2016-09-01

    Metabolic enzyme variation and other patient and environmental characteristics influence smoking behaviors, treatment success, and risk of related disease. Population-specific variation in metabolic genes contributes to challenges in developing and optimizing pharmacogenetic interventions. We applied a custom genome-wide genotyping array for addiction research (Smokescreen), to three laboratory-based studies of nicotine metabolism with oral or venous administration of labeled nicotine and cotinine, to model nicotine metabolism in multiple populations. The trans-3'-hydroxycotinine/cotinine ratio, the nicotine metabolite ratio (NMR), was the nicotine metabolism measure analyzed. Three hundred twelve individuals of self-identified European, African, and Asian American ancestry were genotyped and included in ancestry-specific genome-wide association scans (GWAS) and a meta-GWAS analysis of the NMR. We modeled natural-log transformed NMR with covariates: principal components of genetic ancestry, age, sex, body mass index, and smoking status. African and Asian American NMRs were statistically significantly (P values ≤ 5E-5) lower than European American NMRs. Meta-GWAS analysis identified 36 genome-wide significant variants over a 43 kilobase pair region at CYP2A6 with minimum P = 2.46E-18 at rs12459249, proximal to CYP2A6. Additional minima were located in intron 4 (rs56113850, P = 6.61E-18) and in the CYP2A6-CYP2A7 intergenic region (rs34226463, P = 1.45E-12). Most (34/36) genome-wide significant variants suggested reduced CYP2A6 activity; functional mechanisms were identified and tested in knowledge-bases. Conditional analysis resulted in intergenic variants of possible interest (P values < 5E-5). This meta-GWAS of the NMR identifies CYP2A6 variants, replicates the top-ranked single nucleotide polymorphism from a recent Finnish meta-GWAS of the NMR, identifies functional mechanisms, and provides pan-continental population biomarkers for nicotine metabolism. This multiple ancestry meta-GWAS of the laboratory study-based NMR provides novel evidence and replication for genome-wide association of CYP2A6 single nucleotide and insertion-deletion polymorphisms. We identify three regions of genome-wide significance: proximal, intronic, and distal to CYP2A6. We replicate the top-ranking single nucleotide polymorphism from a recent GWAS of the NMR in Finnish smokers, identify a functional mechanism for this intronic variant from in silico analyses of RNA-seq data that is consistent with CYP2A6 expression measured in postmortem lung and liver, and provide additional support for the intergenic region between CYP2A6 and CYP2A7. © The Author 2016. Published by Oxford University Press on behalf of the Society for Research on Nicotine and Tobacco.

  16. Genome-Wide Association of the Laboratory-Based Nicotine Metabolite Ratio in Three Ancestries

    PubMed Central

    Baurley, James W.; Edlund, Christopher K.; Pardamean, Carissa I.; Conti, David V.; Krasnow, Ruth; Javitz, Harold S.; Hops, Hyman; Swan, Gary E.; Benowitz, Neal L.

    2016-01-01

    Introduction: Metabolic enzyme variation and other patient and environmental characteristics influence smoking behaviors, treatment success, and risk of related disease. Population-specific variation in metabolic genes contributes to challenges in developing and optimizing pharmacogenetic interventions. We applied a custom genome-wide genotyping array for addiction research (Smokescreen), to three laboratory-based studies of nicotine metabolism with oral or venous administration of labeled nicotine and cotinine, to model nicotine metabolism in multiple populations. The trans-3′-hydroxycotinine/cotinine ratio, the nicotine metabolite ratio (NMR), was the nicotine metabolism measure analyzed. Methods: Three hundred twelve individuals of self-identified European, African, and Asian American ancestry were genotyped and included in ancestry-specific genome-wide association scans (GWAS) and a meta-GWAS analysis of the NMR. We modeled natural-log transformed NMR with covariates: principal components of genetic ancestry, age, sex, body mass index, and smoking status. Results: African and Asian American NMRs were statistically significantly (P values ≤ 5E-5) lower than European American NMRs. Meta-GWAS analysis identified 36 genome-wide significant variants over a 43 kilobase pair region at CYP2A6 with minimum P = 2.46E-18 at rs12459249, proximal to CYP2A6. Additional minima were located in intron 4 (rs56113850, P = 6.61E-18) and in the CYP2A6-CYP2A7 intergenic region (rs34226463, P = 1.45E-12). Most (34/36) genome-wide significant variants suggested reduced CYP2A6 activity; functional mechanisms were identified and tested in knowledge-bases. Conditional analysis resulted in intergenic variants of possible interest (P values < 5E-5). Conclusions: This meta-GWAS of the NMR identifies CYP2A6 variants, replicates the top-ranked single nucleotide polymorphism from a recent Finnish meta-GWAS of the NMR, identifies functional mechanisms, and provides pan-continental population biomarkers for nicotine metabolism. Implications: This multiple ancestry meta-GWAS of the laboratory study-based NMR provides novel evidence and replication for genome-wide association of CYP2A6 single nucleotide and insertion–deletion polymorphisms. We identify three regions of genome-wide significance: proximal, intronic, and distal to CYP2A6. We replicate the top-ranking single nucleotide polymorphism from a recent GWAS of the NMR in Finnish smokers, identify a functional mechanism for this intronic variant from in silico analyses of RNA-seq data that is consistent with CYP2A6 expression measured in postmortem lung and liver, and provide additional support for the intergenic region between CYP2A6 and CYP2A7. PMID:27113016

  17. Associations between single nucleotide polymorphisms in folate uptake and metabolizing genes with blood folate, homocysteine and DNA uracil concentrations

    USDA-ARS?s Scientific Manuscript database

    Background: Folate is an essential nutrient which supports nucleotide synthesis and biological methylation reactions. Diminished folate status results in chromosome breakage and is associated with several diseases including colorectal cancer. Folate status is also inversely related to plasma homocys...

  18. Identification of Splice Variants, Targeted MicroRNAs and Functional Single Nucleotide Polymorphisms of the BOLA-DQA2 Gene in Dairy Cattle

    PubMed Central

    Hou, Qinlei; Huang, Jinming; Ju, Zhihua; Li, Qiuling; Li, Liming; Wang, Changfa; Sun, Tao; Wang, Lingling; Hou, Minghai

    2012-01-01

    Major histocompatibility complex, class II, DQ alpha 2, also named BOLA-DQA2, belongs to the Bovine Leukocyte Antigen (BOLA) class II genes which are involved in the immune response. To explore the variability of the BOLA-DQA2 gene and resistance to mastitis in cows, the splice variants (SV), targeted microRNAs (miRNAs), and single nucleotide polymorphisms (SNPs) were identified in this study. A new SV (BOLA-DQA2-SV1) lacking part of exon 3 (195 bp) and two 3′-untranslated regions (UTR) (52 bp+167 bp) of the BOLA-DQA2 gene was found in the healthy and mastitis-infected mammary gland tissues. Four of 13 new SNPs and multiple nucleotide polymorphisms resulted in amino acid changes in the protein and SNP (c. +1283 C>T) may affect the binding to the seed sequence of bta-miR-2318. Further, we detected the relative expressions of two BOLA-DQA2 transcripts and five candidated microRNAs binding to the 3′-UTR of two transcripts in the mammary gland tissues in dairy cattle by using the quantitative real-time polymerase chain reaction. The result showed that expression of the BOLA-DQA2-SV1 mRNA was significantly upregulated 2.67-fold (p<0.05) in mastitis-infected mammary tissues (n=5) compared with the healthy mammary gland mammary tissues (n=5). Except for bta-miR-1777a, miRNA expression (bta-miR-296, miR-2430, and miR-671) was upregulated 1.75 to 2.59-fold (p<0.05), whereas miR-2318 was downregulated in the mastitis cows. Our findings reveal that BOLA-DQA2-SV1 may play an important role in the mastitis resistance in dairy cattle. Whether the SNPs affect the structure of the BOLA-DQA2 gene or association with mastitis resistance is unknown and warrants further investigation. PMID:22084936

  19. The two single nucleotide polymorphisms in the H37/RBM5 tumour suppressor gene at 3p21.3 correlated with different subtypes of non-small cell lung cancers

    PubMed Central

    Oh, Juliana J.; Koegel, Ashley; Phan, Diana T.; Razfar, Ali; Slamon, Dennis J.

    2007-01-01

    Summary Allele loss and genetic alteration in chromosome 3p, particularly in 3p21.3 region, are the most frequent and the earliest genomic abnormalities found in lung cancer. Multiple 3p21.3 genes exhibit various degrees of tumour suppression activity suggesting that 3p21.3 genes may function as an integrated tumour suppressor region through their diverse biological activities. We have previously demonstrated growth inhibitory effects and tumour suppression mechanism of the H37/RBM5 gene which is one of the 19 genes residing in the 370kb minimal overlap region at 3p21.3. In the current study, in an attempt to find, if any, mutations in the H37 coding region in lung cancer cells, we compared nucleotide sequences of the entire H37 gene in tumour vs. adjacent normal tissues from 17 non-small cell lung cancer (NSCLC) patients. No mutations were detected, instead, we found the two silent single nucleotide polymorphisms (SNPs), C1138T and C2185T, within the coding region of the H37 gene. In addition, we found that specific allele types at these SNP positions are correlated with different histological subtypes of NSCLC; tumours containing heterozygous alleles (C+T) at these SNP positions are more likely to be associated with adenocarcinoma (AC) whereas homozygous alleles (either C or T) are associated with squamous cell carcinoma (SCC) (p=0.0098). We postulate that, these two silent polymorphisms may be in linkage disequilibrium (LD) with a disease causative allele in the 3p21.3 tumour suppressor region which is packed with a large number of important genes affecting lung cancer development. In addition, because of prevalent loss of heterozygosity (LOH) detected at 3p21.3 which precedes lung cancer initiation, these SNPs may be developed into a marker screening for the high risk individuals. PMID:17606309

  20. Analyses of single nucleotide polymorphisms in selected nutrient-sensitive genes in weight-regain prevention: the DIOGENES study.

    PubMed

    Larsen, Lesli H; Angquist, Lars; Vimaleswaran, Karani S; Hager, Jörg; Viguerie, Nathalie; Loos, Ruth J F; Handjieva-Darlenska, Teodora; Jebb, Susan A; Kunesova, Marie; Larsen, Thomas M; Martinez, J Alfredo; Papadaki, Angeliki; Pfeiffer, Andreas F H; van Baak, Marleen A; Sørensen, Thorkild Ia; Holst, Claus; Langin, Dominique; Astrup, Arne; Saris, Wim H M

    2012-05-01

    Differences in the interindividual response to dietary intervention could be modified by genetic variation in nutrient-sensitive genes. This study examined single nucleotide polymorphisms (SNPs) in presumed nutrient-sensitive candidate genes for obesity and obesity-related diseases for main and dietary interaction effects on weight, waist circumference, and fat mass regain over 6 mo. In total, 742 participants who had lost ≥ 8% of their initial body weight were randomly assigned to follow 1 of 5 different ad libitum diets with different glycemic indexes and contents of dietary protein. The SNP main and SNP-diet interaction effects were analyzed by using linear regression models, corrected for multiple testing by using Bonferroni correction and evaluated by using quantile-quantile (Q-Q) plots. After correction for multiple testing, none of the SNPs were significantly associated with weight, waist circumference, or fat mass regain. Q-Q plots showed that ALOX5AP rs4769873 showed a higher observed than predicted P value for the association with less waist circumference regain over 6 mo (-3.1 cm/allele; 95% CI: -4.6, -1.6; P/Bonferroni-corrected P = 0.000039/0.076), independently of diet. Additional associations were identified by using Q-Q plots for SNPs in ALOX5AP, TNF, and KCNJ11 for main effects; in LPL and TUB for glycemic index interaction effects on waist circumference regain; in GHRL, CCK, MLXIPL, and LEPR on weight; in PPARC1A, PCK2, ALOX5AP, PYY, and ADRB3 on waist circumference; and in PPARD, FABP1, PLAUR, and LPIN1 on fat mass regain for dietary protein interaction. The observed effects of SNP-diet interactions on weight, waist, and fat mass regain suggest that genetic variation in nutrient-sensitive genes can modify the response to diet. This trial was registered at clinicaltrials.gov as NCT00390637.

  1. Association study of two functional single nucleotide polymorphisms of neuropeptide y gene with multiple sclerosis.

    PubMed

    Mohammadi, Seyed Mahdi; Shirvani Farsani, Zeinab; Dosti, Rozita; Sahraian, Mohammad Ali; Behmanesh, Mehrdad

    2016-12-01

    Multiple sclerosis (MS) is an autoimmune disease of the central nervous system characterized by brain inflammation, demyelination and axonal loss. Neuropeptide Y (NPY) has a critical role in the maintenance of homeostasis in the immune system and coping of stress condition. In the current study we analyzed 188 patients suffering from MS and 204 unrelated healthy controls for two functional single nucleotide polymorphisms (SNPs), NPY 20T>C (rs16139) and NPY -485T>C (rs16147) using PCR-RFLP and Mismatch PCR-RFLP methods. Our results demonstrated that homozygocity in the minor allele for NPY -485T>C polymorphism is associated with the MS risk in patients in compare with healthy controls (CC vs. TT, P=0.033; CC vs. TT+TC, P=0.02). In addition, by comparison with allele T, the frequency of NPY -485C allele was higher in cases than in control subjects and present increased risk of MS, but statistically significant was borderline (P=0.053). The stratification for disease progression revealed a significant difference in the allelic and genotypic distribution between subgroups of MS and controls. The frequency of the CC genotype and C allele was higher in the primary progressive MS patients when compared with control group (CC vs. TT, P=0.019; CC vs. TT+TC, P=0.008; C vs. T, P=0.022). In addition, the frequency of CC genotype was higher in the relapsing remitting MS patients when compared with control group (CC vs. TT, P=0.034; CC vs. TT+TC, P=0.016). Haplotype analysis demonstrated that the haplotype 3 (CT) is more common in RR MS (P=0.041), and PP MS (P=0.031) than control group. In conclusion, the obtained results demonstrate the probable role of NPY SNPs in susceptibility to MS within the Iranian population. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. NDR1 modulates the UV-induced DNA-damage checkpoint and nucleotide excision repair

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Park, Jeong-Min; Choi, Ji Ye; Yi, Joo Mi

    2015-06-05

    Nucleotide excision repair (NER) is the sole mechanism of UV-induced DNA lesion repair in mammals. A single round of NER requires multiple components including seven core NER factors, xeroderma pigmentosum A–G (XPA–XPG), and many auxiliary effector proteins including ATR serine/threonine kinase. The XPA protein helps to verify DNA damage and thus plays a rate-limiting role in NER. Hence, the regulation of XPA is important for the entire NER kinetic. We found that NDR1, a novel XPA-interacting protein, modulates NER by modulating the UV-induced DNA-damage checkpoint. In quiescent cells, NDR1 localized mainly in the cytoplasm. After UV irradiation, NDR1 accumulated inmore » the nucleus. The siRNA knockdown of NDR1 delayed the repair of UV-induced cyclobutane pyrimidine dimers in both normal cells and cancer cells. It did not, however, alter the expression levels or the chromatin association levels of the core NER factors following UV irradiation. Instead, the NDR1-depleted cells displayed reduced activity of ATR for some set of its substrates including CHK1 and p53, suggesting that NDR1 modulates NER indirectly via the ATR pathway. - Highlights: • NDR1 is a novel XPA-interacting protein. • NDR1 accumulates in the nucleus in response to UV irradiation. • NDR1 modulates NER (nucleotide excision repair) by modulating the UV-induced DNA-damage checkpoint response.« less

  3. Association Genetics of Wood Physical Traits in the Conifer White Spruce and Relationships With Gene Expression

    PubMed Central

    Beaulieu, Jean; Doerksen, Trevor; Boyle, Brian; Clément, Sébastien; Deslauriers, Marie; Beauseigle, Stéphanie; Blais, Sylvie; Poulin, Pier-Luc; Lenz, Patrick; Caron, Sébastien; Rigault, Philippe; Bicho, Paul; Bousquet, Jean; MacKay, John

    2011-01-01

    Marker-assisted selection holds promise for highly influencing tree breeding, especially for wood traits, by considerably reducing breeding cycles and increasing selection accuracy. In this study, we used a candidate gene approach to test for associations between 944 single-nucleotide polymorphism markers from 549 candidate genes and 25 wood quality traits in white spruce. A mixed-linear model approach, including a weak but nonsignificant population structure, was implemented for each marker–trait combination. Relatedness among individuals was controlled using a kinship matrix estimated either from the known half-sib structure or from the markers. Both additive and dominance effect models were tested. Between 8 and 21 single-nucleotide polymorphisms (SNPs) were found to be significantly associated (P ≤ 0.01) with each of earlywood, latewood, or total wood traits. After controlling for multiple testing (Q ≤ 0.10), 13 SNPs were still significant across as many genes belonging to different families, each accounting for between 3 and 5% of the phenotypic variance in 10 wood characters. Transcript accumulation was determined for genes containing SNPs associated with these traits. Significantly different transcript levels (P ≤ 0.05) were found among the SNP genotypes of a 1-aminocyclopropane-1-carboxylate oxidase, a β-tonoplast intrinsic protein, and a long-chain acyl-CoA synthetase 9. These results should contribute toward the development of efficient marker-assisted selection in an economically important tree species. PMID:21385726

  4. Genetic Variants in PNPLA3 and Risk of Non-Alcoholic Fatty Liver Disease in a Han Chinese Population

    PubMed Central

    Lin, Shao-Wei; Lu, Qing-Qing; Hu, Zhi-Jian; Lin, Xu

    2012-01-01

    We investigated the possible association between genetic variants in the Patatin like phospholipase-3 (PNPLA3) gene and nonalcoholic fatty liver disease (NAFLD) in a Han Chinese population. We evaluated twelve tagging single-nucleotide polymorphisms (tSNPs) of the PNPLA3 gene in a frequency matched case–control study from Fuzhou city of China (553 cases, 553 controls). In the multivariate logistic regression analysis, the rs738409 GG or GC, and rs139051 TT genotypes were found to be associated with increased risk of NAFLD, and a significant trend of increased risk with increasing numbers of risk genotype was observed in the cumulative effect analysis of these single nucleotide polymorphisms. Furthermore, haplotype association analysis showed that, compared with the most common haplotype, the CAAGAATGCGTG and CGAAGGTGTCCG haplotypes conferred a statistically significant increased risk for NAFLD, while the CGGGAACCCGCG haplotype decreased the risk of NAFLD. Moreover, rs738409 C>G appeared to have a multiplicative joint effect with tea drinking (P<0.005) and an additive joint effect with obesity (Interaction contrast ratio (ICR) = 2.31, 95% CI: 0.7–8.86), hypertriglyceridemia (ICR = 3.07, 95% CI: 0.98–5.09) or hypertension (ICR = 1.74, 95% CI: 0.52–3.12). Our data suggests that PNPLA3 genetic polymorphisms might influence the susceptibility to NAFLD development independently or jointly in Han Chinese. PMID:23226254

  5. Identification of relevant single-nucleotide polymorphisms in Pneumocystis jirovecii: relationship with clinical data.

    PubMed

    Esteves, F; Gaspar, J; Marques, T; Leite, R; Antunes, F; Mansinho, K; Matos, O

    2010-07-01

    Pneumocystis jirovecii is a poorly understood pathogen that causes opportunistic pneumonia (Pneumocystis pneumonia (PcP)) in patients with AIDS. The present study was aimed at correlating genetic differences in P. jirovecii isolates and clinical patient data. A description of genetic diversity in P. jirovecii isolates from human immunodeficiency virus-positive patients, based on the identification of multiple single-nucleotide polymorphisms (SNPs) at five distinct loci encoding mitochondrial large-subunit rRNA (mtLSU rRNA), cytochrome b (CYB), superoxide dismutase (SOD), dihydrofolate reductase (DHFR), and dihydropteroate synthase (DHPS), was achieved using PCR with DNA sequencing and restriction fragment length polymorphism analysis. The statistical analysis revealed several interesting correlations among the four most relevant SNPs (mt85, SOD110, SOD215, and DHFR312) and specific clinical parameters: mt85C was associated with undiagnosed or atypical PcP episodes and favourable follow-up; SOD215C was associated with favourable follow-up; and DHFR312T was associated with PcP cases presenting moderate to high parasite burdens. The genotypes mt85C/SOD215C and SOD110T/SOD215C were found to be associated with less virulent P. jirovecii infections, whereas the genotype SOD110T/SOD215T was found to be related to more virulent PcP episodes. The present work demonstrated that potential P. jirovecii haplotypes may be related to the clinical data and outcome of PcP.

  6. Genetic polymorphisms and the risk of stroke after cardiac surgery.

    PubMed

    Grocott, Hilary P; White, William D; Morris, Richard W; Podgoreanu, Mihai V; Mathew, Joseph P; Nielsen, Dahlia M; Schwinn, Debra A; Newman, Mark F

    2005-09-01

    Stroke represents a significant cause of morbidity and mortality after cardiac surgery. Although the risk of stroke varies according to both patient and procedural factors, the impact of genetic variants on stroke risk is not well understood. Therefore, we tested the hypothesis that specific genetic polymorphisms are associated with an increased risk of stroke after cardiac surgery. Patients undergoing cardiac surgery utilizing cardiopulmonary bypass surgery were studied. DNA was isolated from preoperative blood and analyzed for 26 different single-nucleotide polymorphisms. Multivariable logistic regression modeling was used to determine the association of clinical and genetic characteristics with stroke. Permutation analysis was used to adjust for multiple comparisons inherent in genetic association studies. A total of 1635 patients experiencing 28 strokes (1.7%) were included in the final genetic model. The combination of the 2 minor alleles of C-reactive protein (CRP; 3'UTR 1846C/T) and interleukin-6 (IL-6; -174G/C) polymorphisms, occurring in 583 (35.7%) patients, was significantly associated with stroke (odds ratio, 3.3; 95% CI, 1.4 to 8.1; P=0.0023). In a multivariable logistic model adjusting for age, the CRP and IL-6 single-nucleotide polymorphism combination remained significantly associated with stroke (P=0.0020). We demonstrate that common genetic variants of CRP (3'UTR 1846C/T) and IL-6 (-174G/C) are significantly associated with the risk of stroke after cardiac surgery, suggesting a pivotal role of inflammation in post-cardiac surgery stroke.

  7. Association of candidate genes with drought tolerance traits in diverse perennial ryegrass accessions

    PubMed Central

    Jiang, Yiwei

    2013-01-01

    Drought is a major environmental stress limiting growth of perennial grasses in temperate regions. Plant drought tolerance is a complex trait that is controlled by multiple genes. Candidate gene association mapping provides a powerful tool for dissection of complex traits. Candidate gene association mapping of drought tolerance traits was conducted in 192 diverse perennial ryegrass (Lolium perenne L.) accessions from 43 countries. The panel showed significant variations in leaf wilting, leaf water content, canopy and air temperature difference, and chlorophyll fluorescence under well-watered and drought conditions across six environments. Analysis of 109 simple sequence repeat markers revealed five population structures in the mapping panel. A total of 2520 expression-based sequence readings were obtained for a set of candidate genes involved in antioxidant metabolism, dehydration, water movement across membranes, and signal transduction, from which 346 single nucleotide polymorphisms were identified. Significant associations were identified between a putative LpLEA3 encoding late embryogenesis abundant group 3 protein and a putative LpFeSOD encoding iron superoxide dismutase and leaf water content, as well as between a putative LpCyt Cu-ZnSOD encoding cytosolic copper-zinc superoxide dismutase and chlorophyll fluorescence under drought conditions. Four of these identified significantly associated single nucleotide polymorphisms from these three genes were also translated to amino acid substitutions in different genotypes. These results indicate that allelic variation in these genes may affect whole-plant response to drought stress in perennial ryegrass. PMID:23386684

  8. Multiple single nucleotide polymorphism analysis and association of specific genotypes in FHIT, SAMD4A, and ANKRD17 in Indian patients with oral cancer.

    PubMed

    D'Souza, Wendy; Pradhan, Sultan; Saranath, Dhananjaya

    2017-08-01

    Oral cancer has a high incidence primarily because of tobacco chewing habits. However, a small proportion of habitués develop oral cancer, implying a role for genomic variants in its susceptibility. Thirteen single nucleotide polymorphisms (SNPs) in an Indian cohort comprising patients with oral cancer (n = 500) and healthy controls (n = 500) were genotyped using allelic discrimination real-time polymerase chain reaction (PCR). Prevalence of SNPs rs11130760, rs1957358, rs2306058, rs4883543, rs12637722, rs1457115, rs2353292, rs709821, rs2194861, rs4789378, rs3827538, rs2667552, and rs2886093 was determined in the Indian cohort. A significant association of rs11130760 GG (odds ratio [OR] 1.41; 95% confidence interval [CI] 1.08-1.84) and rs1957358 TT (OR 1.44; 95% CI 1.10-1.90) indicated increased risk; whereas rs1957358 TC (OR 0.67; 95% CI 0.53-0.87) and rs2306058 CT (OR 0.72; 95% CI 0.56-0.93) reflected decreased risk. The SNP rs11130760 wild-type (WT) allele G indicated an increased risk for oral cancer (OR 1.38; 95% CI 1.09-1.73), whereas SNP allele T indicated a decreased risk (OR 0.73; 95% CI 0.58-0.92) for oral cancer. Our study identified SNPs with susceptibility to oral cancer in high-risk populations. © 2017 Wiley Periodicals, Inc.

  9. Validation of PDE9A Gene Identified in GWAS Showing Strong Association with Milk Production Traits in Chinese Holstein.

    PubMed

    Yang, Shao-Hua; Bi, Xiao-Jun; Xie, Yan; Li, Cong; Zhang, Sheng-Li; Zhang, Qin; Sun, Dong-Xiao

    2015-11-05

    Phosphodiesterase9A (PDE9A) is a cyclic guanosine monophosphate (cGMP)-specific enzyme widely expressed among the tissues, which is important in activating cGMP-dependent signaling pathways. In our previous genome-wide association study, a single nucleotide polymorphism (SNP) (BTA-55340-no-rs(b)) located in the intron 14 of PDE9A, was found to be significantly associated with protein yield. In addition, we found that PDE9A was highly expressed in mammary gland by analyzing its mRNA expression in different tissues. The objectives of this study were to identify genetic polymorphisms of PDE9A and to determine the effects of these variants on milk production traits in dairy cattle. DNA sequencing identified 11 single nucleotide polymorphisms (SNPs) and six SNPs in 5' regulatory region were genotyped to test for the subsequent association analyses. After Bonferroni correction for multiple testing, all these identified SNPs were statistically significant for one or more milk production traits (p < 0.0001~0.0077). Interestingly, haplotype-based association analysis revealed similar effects on milk production traits (p < 0.01). In follow-up RNA expression analyses, two SNPs (c.-1376 G>A, c.-724 A>G) were involved in the regulation of gene expression. Consequently, our findings provide confirmatory evidences for associations of PDE9A variants with milk production traits and these identified SNPs may serve as genetic markers to accelerate Chinese Holstein breeding program.

  10. A panel of 130 autosomal single-nucleotide polymorphisms for ancestry assignment in five Asian populations and in Caucasians.

    PubMed

    Hwa, Hsiao-Lin; Lin, Chih-Peng; Huang, Tsun-Ying; Kuo, Po-Hsiu; Hsieh, Wei-Hsin; Lin, Chun-Yen; Yin, Hsiang-I; Tseng, Li-Hui; Lee, James Chun-I

    2017-06-01

    Ancestry informative single-nucleotide polymorphism (AISNP) panels for differentiating between East and Southeast Asian populations are scarce. This study aimed to identify AISNPs for ancestry assignment of five East and Southeast Asian populations, and Caucasians. We analyzed 145 autosomal SNPs of the 627 DNA samples from individuals of six populations (234 Taiwanese Han, 91 Filipinos, 79 Indonesians, 60 Thais, 71 Vietnamese, and 92 Caucasians) using arrays. The multiple logistic regression model and a multi-tier approach were used for ancestry classification. We observed that 130 AISNPs were effective for classifying the ethnic origins with fair accuracy. Among the 130 AISNPs, 122 were useful for stratification between these five Asian populations and 64 were effective for differentiating between Caucasians and these Asian populations. For differentiation between Caucasians and Asians, an accuracy rate of 100% was achieved in these 627 subjects with 50 optimal AISNPs among the 64 effective SNPs. For classification of the five Asian populations, the accuracy rates of ancestry inference using 20 to 57 SNPs for each of the two Asian populations ranged from 74.1% to 100%. Another 14 degraded DNA samples with incomplete profiling were analyzed, and the ancestry of 12 (85.7%) of those subjects was accurately assigned. We developed a 130-AISNP panel for ethnic origin differentiation between the five East and Southeast Asian populations and Caucasians. This AISNP set may be helpful for individual ancestral assignment of these populations in forensic casework.

  11. Analysis of the whole mitochondrial genome: translation of the Ion Torrent Personal Genome Machine system to the diagnostic bench?

    PubMed

    Seneca, Sara; Vancampenhout, Kim; Van Coster, Rudy; Smet, Joél; Lissens, Willy; Vanlander, Arnaud; De Paepe, Boel; Jonckheere, An; Stouffs, Katrien; De Meirleir, Linda

    2015-01-01

    Next-generation sequencing (NGS), an innovative sequencing technology that enables the successful analysis of numerous gene sequences in a massive parallel sequencing approach, has revolutionized the field of molecular biology. Although NGS was introduced in a rather recent past, the technology has already demonstrated its potential and effectiveness in many research projects, and is now on the verge of being introduced into the diagnostic setting of routine laboratories to delineate the molecular basis of genetic disease in undiagnosed patient samples. We tested a benchtop device on retrospective genomic DNA (gDNA) samples of controls and patients with a clinical suspicion of a mitochondrial DNA disorder. This Ion Torrent Personal Genome Machine platform is a high-throughput sequencer with a fast turnaround time and reasonable running costs. We challenged the chemistry and technology with the analysis and processing of a mutational spectrum composed of samples with single-nucleotide substitutions, indels (insertions and deletions) and large single or multiple deletions, occasionally in heteroplasmy. The output data were compared with previously obtained conventional dideoxy sequencing results and the mitochondrial revised Cambridge Reference Sequence (rCRS). We were able to identify the majority of all nucleotide alterations, but three false-negative results were also encountered in the data set. At the same time, the poor performance of the PGM instrument in regions associated with homopolymeric stretches generated many false-positive miscalls demanding additional manual curation of the data.

  12. Genetic source tracking of an anthrax outbreak in Shaanxi province, China.

    PubMed

    Liu, Dong-Li; Wei, Jian-Chun; Chen, Qiu-Lan; Guo, Xue-Jun; Zhang, En-Min; He, Li; Liang, Xu-Dong; Ma, Guo-Zhu; Zhou, Ti-Cao; Yin, Wen-Wu; Liu, Wei; Liu, Kai; Shi, Yi; Ji, Jian-Jun; Zhang, Hui-Juan; Ma, Lin; Zhang, Fa-Xin; Zhang, Zhi-Kai; Zhou, Hang; Yu, Hong-Jie; Kan, Biao; Xu, Jian-Guo; Liu, Feng; Li, Wei

    2017-01-17

    Anthrax is an acute zoonotic infectious disease caused by the bacterium known as Bacillus anthracis. From 26 July to 8 August 2015, an outbreak with 20 suspected cutaneous anthrax cases was reported in Ganquan County, Shaanxi province in China. The genetic source tracking analysis of the anthrax outbreak was performed by molecular epidemiological methods in this study. Three molecular typing methods, namely canonical single nucleotide polymorphisms (canSNP), multiple-locus variable-number tandem repeat analysis (MLVA), and single nucleotide repeat (SNR) analysis, were used to investigate the possible source of transmission and identify the genetic relationship among the strains isolated from human cases and diseased animals during the outbreak. Five strains isolated from diseased mules were clustered together with patients' isolates using canSNP typing and MLVA. The causative B. anthracis lineages in this outbreak belonged to the A.Br.001/002 canSNP subgroup and the MLVA15-31 genotype (the 31 genotype in MLVA15 scheme). Because nine isolates from another four provinces in China were clustered together with outbreak-related strains by the canSNP (A.Br.001/002 subgroup) and MLVA15 method (MLVA15-31 genotype), still another SNR analysis (CL10, CL12, CL33, and CL35) was used to source track the outbreak, and the results suggesting that these patients in the anthrax outbreak were probably infected by the same pathogen clone. It was deduced that the anthrax outbreak occurred in Shaanxi province, China in 2015 was a local occurrence.

  13. Universal digital high-resolution melt: a novel approach to broad-based profiling of heterogeneous biological samples.

    PubMed

    Fraley, Stephanie I; Hardick, Justin; Masek, Billie J; Jo Masek, Billie; Athamanolap, Pornpat; Rothman, Richard E; Gaydos, Charlotte A; Carroll, Karen C; Wakefield, Teresa; Wang, Tza-Huei; Yang, Samuel

    2013-10-01

    Comprehensive profiling of nucleic acids in genetically heterogeneous samples is important for clinical and basic research applications. Universal digital high-resolution melt (U-dHRM) is a new approach to broad-based PCR diagnostics and profiling technologies that can overcome issues of poor sensitivity due to contaminating nucleic acids and poor specificity due to primer or probe hybridization inaccuracies for single nucleotide variations. The U-dHRM approach uses broad-based primers or ligated adapter sequences to universally amplify all nucleic acid molecules in a heterogeneous sample, which have been partitioned, as in digital PCR. Extensive assay optimization enables direct sequence identification by algorithm-based matching of melt curve shape and Tm to a database of known sequence-specific melt curves. We show that single-molecule detection and single nucleotide sensitivity is possible. The feasibility and utility of U-dHRM is demonstrated through detection of bacteria associated with polymicrobial blood infection and microRNAs (miRNAs) associated with host response to infection. U-dHRM using broad-based 16S rRNA gene primers demonstrates universal single cell detection of bacterial pathogens, even in the presence of larger amounts of contaminating bacteria; U-dHRM using universally adapted Lethal-7 miRNAs in a heterogeneous mixture showcases the single copy sensitivity and single nucleotide specificity of this approach.

  14. Field Synopsis and Re-analysis of Systematic Meta-analyses of Genetic Association Studies in Multiple Sclerosis: a Bayesian Approach.

    PubMed

    Park, Jae Hyon; Kim, Joo Hi; Jo, Kye Eun; Na, Se Whan; Eisenhut, Michael; Kronbichler, Andreas; Lee, Keum Hwa; Shin, Jae Il

    2018-07-01

    To provide an up-to-date summary of multiple sclerosis-susceptible gene variants and assess the noteworthiness in hopes of finding true associations, we investigated the results of 44 meta-analyses on gene variants and multiple sclerosis published through December 2016. Out of 70 statistically significant genotype associations, roughly a fifth (21%) of the comparisons showed noteworthy false-positive rate probability (FPRP) at a statistical power to detect an OR of 1.5 and at a prior probability of 10 -6 assumed for a random single nucleotide polymorphism. These associations (IRF8/rs17445836, STAT3/rs744166, HLA/rs4959093, HLA/rs2647046, HLA/rs7382297, HLA/rs17421624, HLA/rs2517646, HLA/rs9261491, HLA/rs2857439, HLA/rs16896944, HLA/rs3132671, HLA/rs2857435, HLA/rs9261471, HLA/rs2523393, HLA-DRB1/rs3135388, RGS1/rs2760524, PTGER4/rs9292777) also showed a noteworthy Bayesian false discovery probability (BFDP) and one additional association (CD24 rs8734/rs52812045) was also noteworthy via BFDP computation. Herein, we have identified several noteworthy biomarkers of multiple sclerosis susceptibility. We hope these data are used to study multiple sclerosis genetics and inform future screening programs.

  15. 3'-End labeling of nucleic acids by a polymerase ribozyme.

    PubMed

    Samanta, Biswajit; Horning, David P; Joyce, Gerald F

    2018-06-13

    A polymerase ribozyme can be used to label the 3' end of RNA or DNA molecules by incorporating a variety of functionalized nucleotide analogs. Guided by a complementary template, the ribozyme adds a single nucleotide that may contain a fluorophore, biotin, azide or alkyne moiety, thus enabling the detection and/or capture of selectively labeled materials. Employing a variety of commercially available nucleotide analogs, efficient labeling was demonstrated for model RNAs and DNAs, human microRNAs and natural tRNA.

  16. Feasibility of a workflow for the molecular characterization of single cells by next generation sequencing.

    PubMed

    Salvianti, Francesca; Rotunno, Giada; Galardi, Francesca; De Luca, Francesca; Pestrin, Marta; Vannucchi, Alessandro Maria; Di Leo, Angelo; Pazzagli, Mario; Pinzani, Pamela

    2015-09-01

    The purpose of the study was to explore the feasibility of a protocol for the isolation and molecular characterization of single circulating tumor cells (CTCs) from cancer patients using a single-cell next generation sequencing (NGS) approach. To reach this goal we used as a model an artificial sample obtained by spiking a breast cancer cell line (MDA-MB-231) into the blood of a healthy donor. Tumor cells were enriched and enumerated by CellSearch(®) and subsequently isolated by DEPArray™ to obtain single or pooled pure samples to be submitted to the analysis of the mutational status of multiple genes involved in cancer. Upon whole genome amplification, samples were analysed by NGS on the Ion Torrent PGM™ system (Life Technologies) using the Ion AmpliSeq™ Cancer Hotspot Panel v2 (Life Technologies), designed to investigate genomic "hot spot" regions of 50 oncogenes and tumor suppressor genes. We successfully sequenced five single cells, a pool of 5 cells and DNA from a cellular pellet of the same cell line with a mean depth of the sequencing reaction ranging from 1581 to 3479 reads. We found 27 sequence variants in 18 genes, 15 of which already reported in the COSMIC or dbSNP databases. We confirmed the presence of two somatic mutations, in the BRAF and TP53 gene, which had been already reported for this cells line, but also found new mutations and single nucleotide polymorphisms. Three variants were common to all the analysed samples, while 18 were present only in a single cell suggesting a high heterogeneity within the same cell line. This paper presents an optimized workflow for the molecular characterization of multiple genes in single cells by NGS. The described pipeline can be easily transferred to the study of single CTCs from oncologic patients.

  17. Efficiency and Fidelity of Human DNA Polymerases λ and β during Gap-Filling DNA Synthesis

    PubMed Central

    Brown, Jessica A.; Pack, Lindsey R.; Sanman, Laura E.; Suo, Zucai

    2010-01-01

    The base excision repair (BER) pathway coordinates the replacement of 1 to 10 nucleotides at sites of single-base lesions. This process generates DNA substrates with various gap sizes which can alter the catalytic efficiency and fidelity of a DNA polymerase during gap-filling DNA synthesis. Here, we quantitatively determined the substrate specificity and base substitution fidelity of human DNA polymerase λ (Pol λ), an enzyme proposed to support the known BER DNA polymerase β (Pol β), as it filled 1- to 10-nucleotide gaps at 1-nucleotide intervals. Pol λ incorporated a correct nucleotide with relatively high efficiency until the gap size exceeded 9 nucleotides. Unlike Pol λ, Pol β did not have an absolute threshold on gap size as the catalytic efficiency for a correct dNTP gradually decreased as the gap size increased from 2 to 10 nucleotides and then recovered for non-gapped DNA. Surprisingly, an increase in gap size resulted in lower polymerase fidelity for Pol λ, and this downregulation of fidelity was controlled by its non-enzymatic N-terminal domains. Overall, Pol λ was up to 160-fold more error-prone than Pol β, thereby suggesting Pol λ would be more mutagenic during long gap-filling DNA synthesis. In addition, dCTP was the preferred misincorporation for Pol λ and its N-terminal domain truncation mutants. This nucleotide preference was shown to be dependent upon the identity of the adjacent 5′-template base. Our results suggested that both Pol λ and Pol β would catalyze nucleotide incorporation with the highest combination of efficiency and accuracy when the DNA substrate contains a single-nucleotide gap. Thus, Pol λ, like Pol β, is better suited to catalyze gap-filling DNA synthesis during short-patch BER in vivo, although, Pol λ may play a role in long-patch BER. PMID:20961817

  18. New insights into the phylogenetics and population structure of the prairie falcon (Falco mexicanus)

    USGS Publications Warehouse

    Doyle, Jacqueline M.; Bell, Douglas A.; Bloom, Peter H.; Emmons, Gavin; Fesnock, Amy; Katzner, Todd; LePre, Larry; Leonard, Kolbe; SanMiguel, Phillip; Westerman, Rick; DeWoody, J. Andrew

    2018-01-01

    BackgroundManagement requires a robust understanding of between- and within-species genetic variability, however such data are still lacking in many species. For example, although multiple population genetics studies of the peregrine falcon (Falco peregrinus) have been conducted, no similar studies have been done of the closely-related prairie falcon (F. mexicanus) and it is unclear how much genetic variation and population structure exists across the species’ range. Furthermore, the phylogenetic relationship of F. mexicanus relative to other falcon species is contested. We utilized a genomics approach (i.e., genome sequencing and assembly followed by single nucleotide polymorphism genotyping) to rapidly address these gaps in knowledge.ResultsWe sequenced the genome of a single female prairie falcon and generated a 1.17 Gb (gigabases) draft genome assembly. We generated maximum likelihood phylogenetic trees using complete mitochondrial genomes as well as nuclear protein-coding genes. This process provided evidence that F. mexicanus is an outgroup to the clade that includes the peregrine falcon and members of the subgenus Hierofalco. We annotated > 16,000 genes and almost 600,000 high-quality single nucleotide polymorphisms (SNPs) in the nuclear genome, providing the raw material for a SNP assay design featuring > 140 gene-associated markers and a molecular-sexing marker. We subsequently genotyped ~ 100 individuals from California (including the San Francisco East Bay Area, Pinnacles National Park and the Mojave Desert) and Idaho (Snake River Birds of Prey National Conservation Area). We tested for population structure and found evidence that individuals sampled in California and Idaho represent a single panmictic population.ConclusionsOur study illustrates how genomic resources can rapidly shed light on genetic variability in understudied species and resolve phylogenetic relationships. Furthermore, we found evidence of a single, randomly mating population of prairie falcons across our sampling locations. Prairie falcons are highly mobile and relatively rare long-distance dispersal events may promote gene flow throughout the range. As such, California’s prairie falcons might be managed as a single population, indicating that management actions undertaken to benefit the species at the local level have the potential to influence the species as a whole.

  19. Examination of association to autism of common genetic variationin genes related to dopamine.

    PubMed

    Anderson, B M; Schnetz-Boutaud, N; Bartlett, J; Wright, H H; Abramson, R K; Cuccaro, M L; Gilbert, J R; Pericak-Vance, M A; Haines, J L

    2008-12-01

    Autism is a severe neurodevelopmental disorder characterized by a triad of complications. Autistic individuals display significant disturbances in language and reciprocal social interactions, combined with repetitive and stereotypic behaviors. Prevalence studies suggest that autism is more common than originally believed, with recent estimates citing a rate of one in 150. Although multiple genetic linkage and association studies have yielded multiple suggestive genes or chromosomal regions, a specific risk locus has yet to be identified and widely confirmed. Because many etiologies have been suggested for this complex syndrome, we hypothesize that one of the difficulties in identifying autism genes is that multiple genetic variants may be required to significantly increase the risk of developing autism. Thus, we took the alternative approach of examining 14 prominent dopamine pathway candidate genes for detailed study by genotyping 28 single nucleotide polymorphisms. Although we did observe a nominally significant association for rs2239535 (P=0.008) on chromosome 20, single-locus analysis did not reveal any results as significant after correction for multiple comparisons. No significant interaction was identified when Multifactor Dimensionality Reduction was employed to test specifically for multilocus effects. Although genome-wide linkage scans in autism have provided support for linkage to various loci along the dopamine pathway, our study does not provide strong evidence of linkage or association to any specific gene or combination of genes within the pathway. These results demonstrate that common genetic variation within the tested genes located within this pathway at most play a minor to moderate role in overall autism pathogenesis.

  20. High density DNA microarrays: algorithms and biomedical applications.

    PubMed

    Liu, Wei-Min

    2004-08-01

    DNA microarrays are devices capable of detecting the identity and abundance of numerous DNA or RNA segments in samples. They are used for analyzing gene expressions, identifying genetic markers and detecting mutations on a genomic scale. The fundamental chemical mechanism of DNA microarrays is the hybridization between probes and targets due to the hydrogen bonds of nucleotide base pairing. Since the cross hybridization is inevitable, and probes or targets may form undesirable secondary or tertiary structures, the microarray data contain noise and depend on experimental conditions. It is crucial to apply proper statistical algorithms to obtain useful signals from noisy data. After we obtained the signals of a large amount of probes, we need to derive the biomedical information such as the existence of a transcript in a cell, the difference of expression levels of a gene in multiple samples, and the type of a genetic marker. Furthermore, after the expression levels of thousands of genes or the genotypes of thousands of single nucleotide polymorphisms are determined, it is usually important to find a small number of genes or markers that are related to a disease, individual reactions to drugs, or other phenotypes. All these applications need careful data analyses and reliable algorithms.

  1. Extension of the COG and arCOG databases by amino acid and nucleotide sequences

    PubMed Central

    Meereis, Florian; Kaufmann, Michael

    2008-01-01

    Background The current versions of the COG and arCOG databases, both excellent frameworks for studies in comparative and functional genomics, do not contain the nucleotide sequences corresponding to their protein or protein domain entries. Results Using sequence information obtained from GenBank flat files covering the completely sequenced genomes of the COG and arCOG databases, we constructed NUCOCOG (nucleotide sequences containing COG databases) as an extended version including all nucleotide sequences and in addition the amino acid sequences originally utilized to construct the current COG and arCOG databases. We make available three comprehensive single XML files containing the complete databases including all sequence information. In addition, we provide a web interface as a utility suitable to browse the NUCOCOG database for sequence retrieval. The database is accessible at . Conclusion NUCOCOG offers the possibility to analyze any sequence related property in the context of the COG and arCOG framework simply by using script languages such as PERL applied to a large but single XML document. PMID:19014535

  2. TryTransDB: A web-based resource for transport proteins in Trypanosomatidae.

    PubMed

    Sonar, Krushna; Kabra, Ritika; Singh, Shailza

    2018-03-12

    TryTransDB is a web-based resource that stores transport protein data which can be retrieved using a standalone BLAST tool. We have attempted to create an integrated database that can be a one-stop shop for the researchers working with transport proteins of Trypanosomatidae family. TryTransDB (Trypanosomatidae Transport Protein Database) is a web based comprehensive resource that can fire a BLAST search against most of the transport protein sequences (protein and nucleotide) from Trypanosomatidae family organisms. This web resource further allows to compute a phylogenetic tree by performing multiple sequence alignment (MSA) using CLUSTALW suite embedded in it. Also, cross-linking to other databases helps in gathering more information for a certain transport protein in a single website.

  3. Automation of complex assays: pharmacogenetics of warfarin dosing.

    PubMed

    Wu, Whei-Kuo; Hujsak, Paul G; Kureshy, Fareed

    2007-10-01

    AutoGenomics, Inc. (Carlsbad, CA, USA) have developed a multiplex microarray assay for genotyping both VKORC1 and CYP2C9 using the INFINITI(™) Analyzer. Multiple alleles in each DNA sample are analyzed by polymerase chain reaction amplification, followed by detection primer extension using the INFINITI Analyzer. The INFINITI Analyzer performs single-nucleotide polymorphism (SNP) analysis using universal oligonucleotides immobilized on the biochip. To genotype broader ethnic groups, genomic DNA from whole blood was tested for nine SNPs for VKORC1 and six for CYP2C9 genotypes. Information related to all 15 SNPs is needed to determine dosing of population of diverse ethnic origin. The INFINITI system provides genotyping information for same day dosing of warfarin.

  4. Obesity-Related Genomic Loci Are Associated with Type 2 Diabetes in a Han Chinese Population

    PubMed Central

    Zhao, Qi; He, Jiang; Chen, Li; Zhao, Zhigang; Li, Qiang; Ge, Jiapu; Chen, Gang; Guo, Xiaohui; Lu, Juming; Weng, Jianping; Jia, Weiping; Ji, Linong; Xiao, Jianzhong; Shan, Zhongyan; Liu, Jie; Tian, Haoming; Ji, Qiuhe; Zhu, Dalong; Zhou, Zhiguang; Shan, Guangliang; Yang, Wenying

    2014-01-01

    Background and Aims Obesity is a well-known risk factor for type 2 diabetes. Genome-wide association studies have identified a number of genetic loci associated with obesity. The aim of this study is to examine the contribution of obesity-related genomic loci to type 2 diabetes in a Chinese population. Methods We successfully genotyped 18 obesity-related single nucleotide polymorphisms among 5338 type 2 diabetic patients and 4663 controls. Both individual and joint effects of these single nucleotide polymorphisms on type 2 diabetes and quantitative glycemic traits (assessing β-cell function and insulin resistance) were analyzed using logistic and linear regression models, respectively. Results Two single nucleotide polymorphisms near MC4R and GNPDA2 genes were significantly associated with type 2 diabetes before adjusting for body mass index and waist circumference (OR (95% CI) = 1.14 (1.06, 1.22) for the A allele of rs12970134, P = 4.75×10−4; OR (95% CI) = 1.10 (1.03, 1.17) for the G allele of rs10938397, P = 4.54×10−3). When body mass index and waist circumference were further adjusted, the association of MC4R with type 2 diabetes remained significant (P = 1.81×10−2) and that of GNPDA2 was attenuated (P = 1.26×10−1), suggesting the effect of the locus including GNPDA2 on type 2 diabetes may be mediated through obesity. Single nucleotide polymorphism rs2260000 within BAT2 was significantly associated with type 2 diabetes after adjusting for body mass index and waist circumference (P = 1.04×10−2). In addition, four single nucleotide polymorphisms (near or within SEC16B, BDNF, MAF and PRL genes) showed significant associations with quantitative glycemic traits in controls even after adjusting for body mass index and waist circumference (all P values<0.05). Conclusions This study indicates that obesity-related genomic loci were associated with type 2 diabetes and glycemic traits in the Han Chinese population. PMID:25093408

  5. SRD5A1 and SRD5A2 are associated with treatment for benign prostatic hyperplasia with the combination of 5α-reductase inhibitors and α-adrenergic receptor antagonists.

    PubMed

    Gu, Xin; Na, Rong; Huang, Tao; Wang, Li; Tao, Sha; Tian, Lu; Chen, Zhuo; Jiao, Yang; Kang, Jian; Zheng, Siqun; Xu, Jianfeng; Sun, Jielin; Qi, Jun

    2013-08-01

    Common treatments for benign prostatic hyperplasia include 5α-reductase inhibitors and α-adrenergic receptor antagonists. However, these treatments can only partially decrease the risk of benign prostatic hyperplasia progression. SRD5A1 and SRD5A2 are 5α-reductase inhibitor targets. We investigated the association between drug efficacy and single nucleotide polymorphisms in the SRD5A1 and SRD5A2 genes in a Chinese population. We genotyped 11 tagging single nucleotide polymorphisms in the SRD5A1 and SRD5A2 genes in a total of 426 benign prostatic hyperplasia cases and 1,008 controls from Xinhua Hospital, Shanghai, People's Republic of China. Cases were treated with type II 5α-reductase inhibitors and α-adrenergic receptor antagonists. We tested the association of tagging single nucleotide polymorphisms with benign prostatic hyperplasia risk/progression, clinical characteristics at baseline, including the I-PSS (International Prostate Symptom Score) and total prostate volume, and changes in clinical characteristics after treatment. The 11 tagging single nucleotide polymorphisms were not significantly associated with benign prostatic hyperplasia risk or progression (each p >0.05). In the SRD5A1 gene rs6884552 and rs3797177 were significantly associated with baseline I-PSS (p = 0.04 and 0.003, respectively). In the SRD5A2 gene rs523349 (V89L) and rs9332975 were significantly associated with baseline total prostate volume (p = 0.01 and 0.001, respectively). In SRD5A1 rs166050 was significantly associated with the posttreatment change in total prostate volume (p = 0.04). In SRD5A2 rs523349 and rs612224 were significantly associated with the posttreatment I-PSS change (p = 0.03 and 0.009, respectively). SRD5A1 and SRD5A2 single nucleotide polymorphisms are significantly associated with the clinical characteristics of benign prostatic hyperplasia and the efficacy of benign prostatic hyperplasia treatment. Copyright © 2013 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  6. FALDO: a semantic standard for describing the location of nucleotide and protein feature annotation.

    PubMed

    Bolleman, Jerven T; Mungall, Christopher J; Strozzi, Francesco; Baran, Joachim; Dumontier, Michel; Bonnal, Raoul J P; Buels, Robert; Hoehndorf, Robert; Fujisawa, Takatomo; Katayama, Toshiaki; Cock, Peter J A

    2016-06-13

    Nucleotide and protein sequence feature annotations are essential to understand biology on the genomic, transcriptomic, and proteomic level. Using Semantic Web technologies to query biological annotations, there was no standard that described this potentially complex location information as subject-predicate-object triples. We have developed an ontology, the Feature Annotation Location Description Ontology (FALDO), to describe the positions of annotated features on linear and circular sequences. FALDO can be used to describe nucleotide features in sequence records, protein annotations, and glycan binding sites, among other features in coordinate systems of the aforementioned "omics" areas. Using the same data format to represent sequence positions that are independent of file formats allows us to integrate sequence data from multiple sources and data types. The genome browser JBrowse is used to demonstrate accessing multiple SPARQL endpoints to display genomic feature annotations, as well as protein annotations from UniProt mapped to genomic locations. Our ontology allows users to uniformly describe - and potentially merge - sequence annotations from multiple sources. Data sources using FALDO can prospectively be retrieved using federalised SPARQL queries against public SPARQL endpoints and/or local private triple stores.

  7. FALDO: a semantic standard for describing the location of nucleotide and protein feature annotation

    DOE PAGES

    Bolleman, Jerven T.; Mungall, Christopher J.; Strozzi, Francesco; ...

    2016-06-13

    Nucleotide and protein sequence feature annotations are essential to understand biology on the genomic, transcriptomic, and proteomic level. Using Semantic Web technologies to query biological annotations, there was no standard that described this potentially complex location information as subject-predicate-object triples. In this paper, we have developed an ontology, the Feature Annotation Location Description Ontology (FALDO), to describe the positions of annotated features on linear and circular sequences. FALDO can be used to describe nucleotide features in sequence records, protein annotations, and glycan binding sites, among other features in coordinate systems of the aforementioned “omics” areas. Using the same data formatmore » to represent sequence positions that are independent of file formats allows us to integrate sequence data from multiple sources and data types. The genome browser JBrowse is used to demonstrate accessing multiple SPARQL endpoints to display genomic feature annotations, as well as protein annotations from UniProt mapped to genomic locations. Our ontology allows users to uniformly describe – and potentially merge – sequence annotations from multiple sources. Finally, data sources using FALDO can prospectively be retrieved using federalised SPARQL queries against public SPARQL endpoints and/or local private triple stores.« less

  8. FALDO: a semantic standard for describing the location of nucleotide and protein feature annotation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bolleman, Jerven T.; Mungall, Christopher J.; Strozzi, Francesco

    Nucleotide and protein sequence feature annotations are essential to understand biology on the genomic, transcriptomic, and proteomic level. Using Semantic Web technologies to query biological annotations, there was no standard that described this potentially complex location information as subject-predicate-object triples. In this paper, we have developed an ontology, the Feature Annotation Location Description Ontology (FALDO), to describe the positions of annotated features on linear and circular sequences. FALDO can be used to describe nucleotide features in sequence records, protein annotations, and glycan binding sites, among other features in coordinate systems of the aforementioned “omics” areas. Using the same data formatmore » to represent sequence positions that are independent of file formats allows us to integrate sequence data from multiple sources and data types. The genome browser JBrowse is used to demonstrate accessing multiple SPARQL endpoints to display genomic feature annotations, as well as protein annotations from UniProt mapped to genomic locations. Our ontology allows users to uniformly describe – and potentially merge – sequence annotations from multiple sources. Finally, data sources using FALDO can prospectively be retrieved using federalised SPARQL queries against public SPARQL endpoints and/or local private triple stores.« less

  9. Clinical evaluation, biochemistry and genetic polymorphism analysis for the diagnosis of lactose intolerance in a population from northeastern Brazil.

    PubMed

    Ponte, Paulo Roberto Lins; de Medeiros, Pedro Henrique Quintela Soares; Havt, Alexandre; Caetano, Joselany Afio; Cid, David A C; Prata, Mara de Moura Gondim; Soares, Alberto Melo; Guerrant, Richard L; Mychaleckyj, Josyf; Lima, Aldo Ângelo Moreira

    2016-02-01

    This work aimed to evaluate and correlate symptoms, biochemical blood test results and single nucleotide polymorphisms for lactose intolerance diagnosis. A cross-sectional study was conducted in Fortaleza, Ceará, Brazil, with a total of 119 patients, 54 of whom were lactose intolerant. Clinical evaluation and biochemical blood tests were conducted after lactose ingestion and blood samples were collected for genotyping evaluation. In particular, the single nucleotide polymorphisms C>T-13910 and G>A-22018 were analyzed by restriction fragment length polymorphism/polymerase chain reaction and validated by DNA sequencing. Lactose-intolerant patients presented with more symptoms of flatulence (81.4%), bloating (68.5%), borborygmus (59.3%) and diarrhea (46.3%) compared with non-lactose-intolerant patients (p<0.05). We observed a significant association between the presence of the alleles T-13910 and A-22018 and the lactose-tolerant phenotype (p<0.05). After evaluation of the biochemical blood test results for lactose, we found that the most effective cutoff for glucose levels obtained for lactose malabsorbers was <15 mg/dL, presenting an area under the receiver operating characteristic curve greater than 80.3%, with satisfactory values for sensitivity and specificity. These data corroborate the association of these single nucleotide polymorphisms (C>T-13910 and G>A-22018) with lactose tolerance in this population and suggest clinical management for patients with lactose intolerance that considers single nucleotide polymorphism detection and a change in the biochemical blood test cutoff from <25 mg/dL to <15 mg/dL.

  10. 17q25 Locus Is Associated With White Matter Hyperintensity Volume in Ischemic Stroke, But Not With Lacunar Stroke Status

    PubMed Central

    Adib-Samii, Poneh; Rost, Natalia; Traylor, Matthew; Devan, William; Biffi, Alessandro; Lanfranconi, Silvia; Fitzpatrick, Kaitlin; Bevan, Steve; Kanakis, Allison; Valant, Valerie; Gschwendtner, Andreas; Malik, Rainer; Richie, Alexa; Gamble, Dale; Segal, Helen; Parati, Eugenio A.; Ciusani, Emilio; Holliday, Elizabeth G.; Maguire, Jane; Wardlaw, Joanna; Worrall, Bradford; Bis, Joshua; Wiggins, Kerri L.; Longstreth, Will; Kittner, Steve J.; Cheng, Yu-Ching; Mosley, Thomas; Falcone, Guido J.; Furie, Karen L.; Leiva-Salinas, Carlos; Lau, Benison C.; Khan, Muhammed Saleem; Sharma, Pankaj; Fornage, Myriam; Mitchell, Braxton D.; Psaty, Bruce M.; Sudlow, Cathie; Levi, Christopher; Boncoraglio, Giorgio B.; Rothwell, Peter M.; Meschia, James; Dichgans, Martin; Rosand, Jonathan; Markus, Hugh S.

    2013-01-01

    Background and Purpose Recently, a novel locus at 17q25 was associated with white matter hyperintensities (WMH) on MRI in stroke-free individuals. We aimed to replicate the association with WMH volume (WMHV) in patients with ischemic stroke. If the association acts by promoting a small vessel arteriopathy, it might be expected to also associate with lacunar stroke. Methods We quantified WMH on MRI in the stroke-free hemisphere of 2588 ischemic stroke cases. Association between WMHV and 6 single-nucleotide polymorphisms at chromosome 17q25 was assessed by linear regression. These single-nucleotide polymorphisms were also investigated for association with lacunar stroke in 1854 cases and 51 939 stroke-free controls from METASTROKE. Meta-analyses with previous reports and a genetic risk score approach were applied to identify other novel WMHV risk variants and uncover shared genetic contributions to WMHV in community participants without stroke and ischemic stroke. Results Single-nucleotide polymorphisms at 17q25 were associated with WMHV in ischemic stroke, the most significant being rs9894383 (P=0.0006). In contrast, there was no association between any single-nucleotide polymorphism and lacunar stroke. A genetic risk score analysis revealed further genetic components to WMHV shared between community participants without stroke and ischemic stroke. Conclusions This study provides support for an association between the 17q25 locus and WMH. In contrast, it is not associated with lacunar stroke, suggesting that the association does not act by promoting small-vessel arteriopathy or the same arteriopathy responsible for lacunar infarction. PMID:23674528

  11. Association of Nitric Oxide Synthase and Matrix Metalloprotease Single Nucleotide Polymorphisms with Preeclampsia and Its Complications

    PubMed Central

    Leonardo, Daniela P.; Albuquerque, Dulcinéia M.; Lanaro, Carolina; Baptista, Letícia C.; Cecatti, José G.; Surita, Fernanda G.; Parpinelli, Mary A.; Costa, Fernando F.; Franco-Penteado, Carla F.; Fertrin, Kleber Y.; Costa, Maria Laura

    2015-01-01

    Background Preeclampsia is one of the leading causes of maternal and neonatal morbidity and mortality in the world, but its appearance is still unpredictable and its pathophysiology has not been entirely elucidated. Genetic studies have associated single nucleotide polymorphisms in genes encoding nitric oxide synthase and matrix metalloproteases with preeclampsia, but the results are largely inconclusive across different populations. Objectives To investigate the association of single nucleotide polymorphisms (SNPs) in NOS3 (G894T, T-786C, and a variable number of tandem repetitions VNTR in intron 4), MMP2 (C-1306T), and MMP9 (C-1562T) genes with preeclampsia in patients from Southeastern Brazil. Methods This prospective case-control study enrolled 77 women with preeclampsia and 266 control pregnant women. Clinical data were collected to assess risk factors and the presence of severe complications, such as eclampsia and HELLP (hemolysis, elevated liver enzymes, and low platelets) syndrome. Results We found a significant association between the single nucleotide polymorphism NOS3 T-786C and preeclampsia, independently from age, height, weight, or the other SNPs studied, and no association was found with the other polymorphisms. Age and history of preeclampsia were also identified as risk factors. The presence of at least one polymorphic allele for NOS3 T-786C was also associated with the occurrence of eclampsia or HELLP syndrome among preeclamptic women. Conclusions Our data support that the NOS3 T-786C SNP is associated with preeclampsia and the severity of its complications. PMID:26317342

  12. Clinical evaluation, biochemistry and genetic polymorphism analysis for the diagnosis of lactose intolerance in a population from northeastern Brazil

    PubMed Central

    Ponte, Paulo Roberto Lins; de Medeiros, Pedro Henrique Quintela Soares; Havt, Alexandre; Caetano, Joselany Afio; Cid, David A C; de Moura Gondim Prata, Mara; Soares, Alberto Melo; Guerrant, Richard L; Mychaleckyj, Josyf; Lima, Aldo Ângelo Moreira

    2016-01-01

    OBJECTIVE: This work aimed to evaluate and correlate symptoms, biochemical blood test results and single nucleotide polymorphisms for lactose intolerance diagnosis. METHOD: A cross-sectional study was conducted in Fortaleza, Ceará, Brazil, with a total of 119 patients, 54 of whom were lactose intolerant. Clinical evaluation and biochemical blood tests were conducted after lactose ingestion and blood samples were collected for genotyping evaluation. In particular, the single nucleotide polymorphisms C>T-13910 and G>A-22018 were analyzed by restriction fragment length polymorphism/polymerase chain reaction and validated by DNA sequencing. RESULTS: Lactose-intolerant patients presented with more symptoms of flatulence (81.4%), bloating (68.5%), borborygmus (59.3%) and diarrhea (46.3%) compared with non-lactose-intolerant patients (p<0.05). We observed a significant association between the presence of the alleles T-13910 and A-22018 and the lactose-tolerant phenotype (p<0.05). After evaluation of the biochemical blood test results for lactose, we found that the most effective cutoff for glucose levels obtained for lactose malabsorbers was <15 mg/dL, presenting an area under the receiver operating characteristic curve greater than 80.3%, with satisfactory values for sensitivity and specificity. CONCLUSIONS: These data corroborate the association of these single nucleotide polymorphisms (C>T-13910 and G>A-22018) with lactose tolerance in this population and suggest clinical management for patients with lactose intolerance that considers single nucleotide polymorphism detection and a change in the biochemical blood test cutoff from <25 mg/dL to <15 mg/dL. PMID:26934237

  13. Genome-wide SNP data suggest complex ancestry of sympatric North Pacific killer whale ecotypes.

    PubMed

    Foote, A D; Morin, P A

    2016-11-01

    Three ecotypes of killer whale occur in partial sympatry in the North Pacific. Individuals assortatively mate within the same ecotype, resulting in correlated ecological and genetic differentiation. A key question is whether this pattern of evolutionary divergence is an example of incipient sympatric speciation from a single panmictic ancestral population, or whether sympatry could have resulted from multiple colonisations of the North Pacific and secondary contact between ecotypes. Here, we infer multilocus coalescent trees from >1000 nuclear single-nucleotide polymorphisms (SNPs) and find evidence of incomplete lineage sorting so that the genealogies of SNPs do not all conform to a single topology. To disentangle whether uncertainty in the phylogenetic inference of the relationships among ecotypes could also result from ancestral admixture events we reconstructed the relationship among the ecotypes as an admixture graph and estimated f 4 -statistics using TreeMix. The results were consistent with episodes of admixture between two of the North Pacific ecotypes and the two outgroups (populations from the Southern Ocean and the North Atlantic). Gene flow may have occurred via unsampled 'ghost' populations rather than directly between the populations sampled here. Our results indicate that because of ancestral admixture events and incomplete lineage sorting, a single bifurcating tree does not fully describe the relationship among these populations. The data are therefore most consistent with the genomic variation among North Pacific killer whale ecotypes resulting from multiple colonisation events, and secondary contact may have facilitated evolutionary divergence. Thus, the present-day populations of North Pacific killer whale ecotypes have a complex ancestry, confounding the tree-based inference of ancestral geography.

  14. Short double-stranded RNAs with an overhanging 5' ppp-nucleotide, as found in arenavirus genomes, act as RIG-I decoys.

    PubMed

    Marq, Jean-Baptiste; Hausmann, Stéphane; Veillard, Nicolas; Kolakofsky, Daniel; Garcin, Dominique

    2011-02-25

    Arenavirus RNA genomes are initiated by a "prime and realign" mechanism, such that the initiating GTP is found as a single unpaired (overhanging) nucleotide when the complementary genome ends anneal to form double-stranded (ds) RNA panhandle structures. dsRNAs modeled on these structures do not induce interferon (IFN), as opposed to blunt-ended (5' ppp)dsRNA. This study examines whether these viral structures can also act as decoys, by trapping RIG-I in inactive dsRNA complexes. We examined the ability of various dsRNAs to activate the RIG-I ATPase (presumably a measure of helicase translocation on dsRNA) relative to their ability to induce IFN. We found that there is no simple relationship between these two properties, as if RIG-I can translocate on short dsRNAs without inducing IFN. Moreover, we found that (5' ppp)dsRNAs with a single unpaired 5' ppp-nucleotide can in fact competitively inhibit the ability of blunt-ended (5' ppp)dsRNAs to induce IFN when co-transfected into cells and that this inhibition is strongly dependent on the presence of the 5' ppp. In contrast, (5' ppp)dsRNAs with a single unpaired 5' ppp-nucleotide does not inhibit poly(I-C)-induced IFN activation, which is independent of the presence of a 5' ppp group.

  15. Four Linked Genes Participate in Controlling Sporulation Efficiency in Budding Yeast

    PubMed Central

    Ben-Ari, Giora; Zenvirth, Drora; Sherman, Amir; David, Lior; Klutstein, Michael; Lavi, Uri; Hillel, Jossi; Simchen, Giora

    2006-01-01

    Quantitative traits are conditioned by several genetic determinants. Since such genes influence many important complex traits in various organisms, the identification of quantitative trait loci (QTLs) is of major interest, but still encounters serious difficulties. We detected four linked genes within one QTL, which participate in controlling sporulation efficiency in Saccharomyces cerevisiae. Following the identification of single nucleotide polymorphisms by comparing the sequences of 145 genes between the parental strains SK1 and S288c, we analyzed the segregating progeny of the cross between them. Through reciprocal hemizygosity analysis, four genes, RAS2, PMS1, SWS2, and FKH2, located in a region of 60 kilobases on Chromosome 14, were found to be associated with sporulation efficiency. Three of the four “high” sporulation alleles are derived from the “low” sporulating strain. Two of these sporulation-related genes were verified through allele replacements. For RAS2, the causative variation was suggested to be a single nucleotide difference in the upstream region of the gene. This quantitative trait nucleotide accounts for sporulation variability among a set of ten closely related winery yeast strains. Our results provide a detailed view of genetic complexity in one “QTL region” that controls a quantitative trait and reports a single nucleotide polymorphism-trait association in wild strains. Moreover, these findings have implications on QTL identification in higher eukaryotes. PMID:17112318

  16. SNPassoc: an R package to perform whole genome association studies.

    PubMed

    González, Juan R; Armengol, Lluís; Solé, Xavier; Guinó, Elisabet; Mercader, Josep M; Estivill, Xavier; Moreno, Víctor

    2007-03-01

    The popularization of large-scale genotyping projects has led to the widespread adoption of genetic association studies as the tool of choice in the search for single nucleotide polymorphisms (SNPs) underlying susceptibility to complex diseases. Although the analysis of individual SNPs is a relatively trivial task, when the number is large and multiple genetic models need to be explored it becomes necessary a tool to automate the analyses. In order to address this issue, we developed SNPassoc, an R package to carry out most common analyses in whole genome association studies. These analyses include descriptive statistics and exploratory analysis of missing values, calculation of Hardy-Weinberg equilibrium, analysis of association based on generalized linear models (either for quantitative or binary traits), and analysis of multiple SNPs (haplotype and epistasis analysis). Package SNPassoc is available at CRAN from http://cran.r-project.org. A tutorial is available on Bioinformatics online and in http://davinci.crg.es/estivill_lab/snpassoc.

  17. [Phenotypic and genetic analysis of a patient presented with Tietz/Waardenburg type II a syndrome].

    PubMed

    Wang, Huanhuan; Tang, Lifang; Zhang, Jingmin; Hu, Qin; Chen, Yingwei; Xiao, Bing

    2015-08-01

    To determine the genetic cause for a patient featuring decreased pigmentation of the skin and iris, hearing loss and multiple congenital anomalies. Routine chromosomal banding was performed to analyze the karyotype of the patient and his parents. Single nucleotide polymorphism array (SNP array) was employed to identify cryptic chromosome aberrations, and quantitative real-time PCR was used to confirm the results. Karyotype analysis has revealed no obvious anomaly for the patient and his parents. SNP array analysis of the patient has demonstrated a 3.9 Mb deletion encompassing 3p13p14.1, which caused loss of entire MITF gene. The deletion was confirmed by quantitative real-time PCR. Clinical features of the patient have included severe bilateral hearing loss, decreased pigmentation of the skin and iris and multiple congenital anomalies. The patient, carrying a 3p13p14.1 deletion, has features of Tietz syndrome/Waardenburg syndrome type IIa. This case may provide additional data for the study of genotype-phenotype correlation of this disease.

  18. Advantages and limitations of multiple-trait genomic prediction for Fusarium head blight severity in hybrid wheat (Triticum aestivum L.).

    PubMed

    Schulthess, Albert W; Zhao, Yusheng; Longin, C Friedrich H; Reif, Jochen C

    2018-03-01

    Predictabilities for wheat hybrids less related to the estimation set were improved by shifting from single- to multiple-trait genomic prediction of Fusarium head blight severity. Breeding for improved Fusarium head blight resistance (FHBr) of wheat is a very laborious and expensive task. FHBr complexity is mainly due to its highly polygenic nature and because FHB severity (FHBs) is greatly influenced by the environment. Associated traits plant height and heading date may provide additional information related to FHBr, but this is ignored in single-trait genomic prediction (STGP). The aim of our study was to explore the benefits in predictabilities of multiple-trait genomic prediction (MTGP) over STGP of target trait FHBs in a population of 1604 wheat hybrids using information on 17,372 single nucleotide polymorphism markers along with indicator traits plant height and heading date. The additive inheritance of FHBs allowed accurate hybrid performance predictions using information on general combining abilities or average performance of both parents without the need of markers. Information on molecular markers and indicator trait(s) improved FHBs predictabilities for hybrids less related to the estimation set. Indicator traits must be observed on the predicted individuals to benefit from MTGP. Magnitudes of genetic and phenotypic correlations along with improvements in predictabilities made plant height a better indicator trait for FHBs than heading date. Thus, MTGP having only plant height as indicator trait already maximized FHBs predictabilities. Provided a good indicator trait was available, MTGP could reduce the impacts of genotype environment [Formula: see text] interaction on STGP for hybrids less related to the estimation set.

  19. Genetics of Oxidative Stress in Obesity

    PubMed Central

    Rupérez, Azahara I.; Gil, Angel; Aguilera, Concepción M.

    2014-01-01

    Obesity is a multifactorial disease characterized by the excessive accumulation of fat in adipose tissue and peripheral organs. Its derived metabolic complications are mediated by the associated oxidative stress, inflammation and hypoxia. Oxidative stress is due to the excessive production of reactive oxygen species or diminished antioxidant defenses. Genetic variants, such as single nucleotide polymorphisms in antioxidant defense system genes, could alter the efficacy of these enzymes and, ultimately, the risk of obesity; thus, studies investigating the role of genetic variations in genes related to oxidative stress could be useful for better understanding the etiology of obesity and its metabolic complications. The lack of existing literature reviews in this field encouraged us to gather the findings from studies focusing on the impact of single nucleotide polymorphisms in antioxidant enzymes, oxidative stress-producing systems and transcription factor genes concerning their association with obesity risk and its phenotypes. In the future, the characterization of these single nucleotide polymorphisms (SNPs) in obese patients could contribute to the development of controlled antioxidant therapies potentially beneficial for the treatment of obesity-derived metabolic complications. PMID:24562334

  20. Genetics of oxidative stress in obesity.

    PubMed

    Rupérez, Azahara I; Gil, Angel; Aguilera, Concepción M

    2014-02-20

    Obesity is a multifactorial disease characterized by the excessive accumulation of fat in adipose tissue and peripheral organs. Its derived metabolic complications are mediated by the associated oxidative stress, inflammation and hypoxia. Oxidative stress is due to the excessive production of reactive oxygen species or diminished antioxidant defenses. Genetic variants, such as single nucleotide polymorphisms in antioxidant defense system genes, could alter the efficacy of these enzymes and, ultimately, the risk of obesity; thus, studies investigating the role of genetic variations in genes related to oxidative stress could be useful for better understanding the etiology of obesity and its metabolic complications. The lack of existing literature reviews in this field encouraged us to gather the findings from studies focusing on the impact of single nucleotide polymorphisms in antioxidant enzymes, oxidative stress-producing systems and transcription factor genes concerning their association with obesity risk and its phenotypes. In the future, the characterization of these single nucleotide polymorphisms (SNPs) in obese patients could contribute to the development of controlled antioxidant therapies potentially beneficial for the treatment of obesity-derived metabolic complications.

  1. A graphene-based platform for single nucleotide polymorphism (SNP) genotyping.

    PubMed

    Liu, Meng; Zhao, Huimin; Chen, Shuo; Yu, Hongtao; Zhang, Yaobin; Quan, Xie

    2011-06-15

    A facile, rapid, stable and sensitive approach for fluorescent detection of single nucleotide polymorphism (SNP) is designed based on DNA ligase reaction and π-stacking between the graphene and the nucleotide bases. In the presence of perfectly matched DNA, DNA ligase can catalyze the linkage of fluorescein amidite-labeled single-stranded DNA (ssDNA) and a phosphorylated ssDNA, and thus the formation of a stable duplex in high yield. However, the catalytic reaction cannot effectively carry out with one-base mismatched DNA target. In this case, we add graphene to the system in order to produce different quenching signals due to its different adsorption affinity for ssDNA and double-stranded DNA. Taking advantage of the unique surface property of graphene and the high discriminability of DNA ligase, the proposed protocol exhibits good performance in SNP genotyping. The results indicate that it is possible to accurately determine SNP with frequency as low as 2.6% within 40 min. Furthermore, the presented flexible strategy facilitates the development of other biosensing applications in the future. Copyright © 2011 Elsevier B.V. All rights reserved.

  2. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.

    PubMed

    Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B

    2017-09-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  3. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions

    NASA Astrophysics Data System (ADS)

    Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.

    2017-09-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  4. Analysis of transitions at two-fold redundant sites in mammalian genomes. Transition redundant approach-to-equilibrium (TREx) distance metrics

    PubMed Central

    Li, Tang; Chamberlin, Stephen G; Caraco, M Daniel; Liberles, David A; Gaucher, Eric A; Benner, Steven A

    2006-01-01

    Background The exchange of nucleotides at synonymous sites in a gene encoding a protein is believed to have little impact on the fitness of a host organism. This should be especially true for synonymous transitions, where a pyrimidine nucleotide is replaced by another pyrimidine, or a purine is replaced by another purine. This suggests that transition redundant exchange (TREx) processes at the third position of conserved two-fold codon systems might offer the best approximation for a neutral molecular clock, serving to examine, within coding regions, theories that require neutrality, determine whether transition rate constants differ within genes in a single lineage, and correlate dates of events recorded in genomes with dates in the geological and paleontological records. To date, TREx analysis of the yeast genome has recognized correlated duplications that established a new metabolic strategies in fungi, and supported analyses of functional change in aromatases in pigs. TREx dating has limitations, however. Multiple transitions at synonymous sites may cause equilibration and loss of information. Further, to be useful to correlate events in the genomic record, different genes within a genome must suffer transitions at similar rates. Results A formalism to analyze divergence at two fold redundant codon systems is presented. This formalism exploits two-state approach-to-equilibrium kinetics from chemistry. This formalism captures, in a single equation, the possibility of multiple substitutions at individual sites, avoiding any need to "correct" for these. The formalism also connects specific rate constants for transitions to specific approximations in an underlying evolutionary model, including assumptions that transition rate constants are invariant at different sites, in different genes, in different lineages, and at different times. Therefore, the formalism supports analyses that evaluate these approximations. Transitions at synonymous sites within two-fold redundant coding systems were examined in the mouse, rat, and human genomes. The key metric (f2), the fraction of those sites that holds the same nucleotide, was measured for putative ortholog pairs. A transition redundant exchange (TREx) distance was calculated from f2 for these pairs. Pyrimidine-pyrimidine transitions at these sites occur approximately 14% faster than purine-purine transitions in various lineages. Transition rate constants were similar in different genes within the same lineages; within a set of orthologs, the f2 distribution is only modest overdispersed. No correlation between disparity and overdispersion is observed. In rodents, evidence was found for greater conservation of TREx sites in genes on the X chromosome, accounting for a small part of the overdispersion, however. Conclusion The TREx metric is useful to analyze the history of transition rate constants within these mammals over the past 100 million years. The TREx metric estimates the extent to which silent nucleotide substitutions accumulate in different genes, on different chromosomes, with different compositions, in different lineages, and at different times. PMID:16545144

  5. A challenge to the striking genotypic heterogeneity of retinitis pigmentosa: a better understanding of the pathophysiology using the newest genetic strategies

    PubMed Central

    Sorrentino, F S; Gallenga, C E; Bonifazzi, C; Perri, P

    2016-01-01

    Retinitis pigmentosa (RP) is a group of inherited retinal disorders characterized by a complex association between tremendous genotypic multiplicity and great phenotypic heterogeneity. The severity of the clinical manifestation depends on penetrance and expressivity of the disease-gene. Also, various interactions between gene expression and environmental factors have been hypothesized. More than 250 genes with ~4500 causative mutations have been reported to be involved in different RP-related mechanisms. Nowadays, not more than the 50% of RPs are attributable to identified genes, whereas the rest of molecular defects are still undetectable, especially in populations where few genetic screenings have been performed. Therefore, new genetic strategies can be a remarkably useful tool to aid clinical diagnosis, potentially modifying treatment options, and family counseling. Genome-wide analytical techniques (array comparative genomic hybridization and single-nucleotide polymorphism genotyping) and DNA sequencing strategies (arrayed primer extension, Sanger sequencing, and ultra high-throughput sequencing) are successfully used to early make molecular diagnosis detecting single or multiple mutations in the huge heterogeneity of RPs. To date, further research needs to be carried out to better investigate the genotype/phenotype correlation, putting together genetic and clinical findings to provide detailed information concerning the risk of RP development and novel effective treatments. PMID:27564722

  6. Estimating Animal Abundance in Ground Beef Batches Assayed with Molecular Markers

    PubMed Central

    Hu, Xin-Sheng; Simila, Janika; Platz, Sindey Schueler; Moore, Stephen S.; Plastow, Graham; Meghen, Ciaran N.

    2012-01-01

    Estimating animal abundance in industrial scale batches of ground meat is important for mapping meat products through the manufacturing process and for effectively tracing the finished product during a food safety recall. The processing of ground beef involves a potentially large number of animals from diverse sources in a single product batch, which produces a high heterogeneity in capture probability. In order to estimate animal abundance through DNA profiling of ground beef constituents, two parameter-based statistical models were developed for incidence data. Simulations were applied to evaluate the maximum likelihood estimate (MLE) of a joint likelihood function from multiple surveys, showing superiority in the presence of high capture heterogeneity with small sample sizes, or comparable estimation in the presence of low capture heterogeneity with a large sample size when compared to other existing models. Our model employs the full information on the pattern of the capture-recapture frequencies from multiple samples. We applied the proposed models to estimate animal abundance in six manufacturing beef batches, genotyped using 30 single nucleotide polymorphism (SNP) markers, from a large scale beef grinding facility. Results show that between 411∼1367 animals were present in six manufacturing beef batches. These estimates are informative as a reference for improving recall processes and tracing finished meat products back to source. PMID:22479559

  7. Quantum-Sequencing: Fast electronic single DNA molecule sequencing

    NASA Astrophysics Data System (ADS)

    Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

    2014-03-01

    A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

  8. Conformational Smear Characterization and Binning of Single-Molecule Conductance Measurements for Enhanced Molecular Recognition.

    PubMed

    Korshoj, Lee E; Afsari, Sepideh; Chatterjee, Anushree; Nagpal, Prashant

    2017-11-01

    Electronic conduction or charge transport through single molecules depends primarily on molecular structure and anchoring groups and forms the basis for a wide range of studies from molecular electronics to DNA sequencing. Several high-throughput nanoelectronic methods such as mechanical break junctions, nanopores, conductive atomic force microscopy, scanning tunneling break junctions, and static nanoscale electrodes are often used for measuring single-molecule conductance. In these measurements, "smearing" due to conformational changes and other entropic factors leads to large variances in the observed molecular conductance, especially in individual measurements. Here, we show a method for characterizing smear in single-molecule conductance measurements and demonstrate how binning measurements according to smear can significantly enhance the use of individual conductance measurements for molecular recognition. Using quantum point contact measurements on single nucleotides within DNA macromolecules, we demonstrate that the distance over which molecular junctions are maintained is a measure of smear, and the resulting variance in unbiased single measurements depends on this smear parameter. Our ability to identify individual DNA nucleotides at 20× coverage increases from 81.3% accuracy without smear analysis to 93.9% with smear characterization and binning (SCRIB). Furthermore, merely 7 conductance measurements (7× coverage) are needed to achieve 97.8% accuracy for DNA nucleotide recognition when only low molecular smear measurements are used, which represents a significant improvement over contemporary sequencing methods. These results have important implications in a broad range of molecular electronics applications from designing robust molecular switches to nanoelectronic DNA sequencing.

  9. Translational genomics for abiotic stress in sorghum: transcriptional profiling and validation of SNP markers between germplasm with differential cold tolerance

    USDA-ARS?s Scientific Manuscript database

    One focus of the Sorghum Translational Genomics Lab (part of sorghum CRIS, PSGD, CSRL, USDA-ARS, Lubbock TX) is to utilize nucleotide variation between sorghum germplasm such as those derived from RNA seq for translation and validation of Single Nucleotide Polymorphism (SNP) into easy access DNA m...

  10. A genetic variation map for chicken with 2.8 million single nucleotide polymorphisms

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wong, G K; Hillier, L; Brandstrom, M

    2005-02-20

    We describe a genetic variation map for the chicken genome containing 2.8 million single nucleotide polymorphisms (SNPs), based on a comparison of the sequences of 3 domestic chickens (broiler, layer, Silkie) to their wild ancestor Red Jungle Fowl (RJF). Subsequent experiments indicate that at least 90% are true SNPs, and at least 70% are common SNPs that segregate in many domestic breeds. Mean nucleotide diversity is about 5 SNP/kb for almost every possible comparison between RJF and domestic lines, between two different domestic lines, and within domestic lines--contrary to the idea that domestic animals are highly inbred relative to theirmore » wild ancestors. In fact, most of the SNPs originated prior to domestication, and there is little to no evidence of selective sweeps for adaptive alleles on length scales of greater than 100 kb.« less

  11. A Lateral Flow Biosensor for the Detection of Single Nucleotide Polymorphisms.

    PubMed

    Zeng, Lingwen; Xiao, Zhuo

    2017-01-01

    A lateral flow biosensor (LFB) is introduced for the detection of single nucleotide polymorphisms (SNPs). The assay is composed of two steps: circular strand displacement reaction and lateral flow biosensor detection. In step 1, the nucleotide at SNP site is recognized by T4 DNA ligase and the signal is amplified by strand displacement DNA polymerase, which can be accomplished at a constant temperature. In step 2, the reaction product of step 1 is detected by a lateral flow biosensor, which is a rapid and cost effective tool for nuclei acid detection. Comparing with conventional methods, it requires no complicated machines. It is suitable for the use of point of care diagnostics. Therefore, this simple, cost effective, robust, and promising LFB detection method of SNP has great potential for the detection of genetic diseases, personalized medicine, cancer related mutations, and drug-resistant mutations of infectious agents.

  12. Genotyping of ancient Mycobacterium tuberculosis strains reveals historic genetic diversity.

    PubMed

    Müller, Romy; Roberts, Charlotte A; Brown, Terence A

    2014-04-22

    The evolutionary history of the Mycobacterium tuberculosis complex (MTBC) has previously been studied by analysis of sequence diversity in extant strains, but not addressed by direct examination of strain genotypes in archaeological remains. Here, we use ancient DNA sequencing to type 11 single nucleotide polymorphisms and two large sequence polymorphisms in the MTBC strains present in 10 archaeological samples from skeletons from Britain and Europe dating to the second-nineteenth centuries AD. The results enable us to assign the strains to groupings and lineages recognized in the extant MTBC. We show that at least during the eighteenth-nineteenth centuries AD, strains of M. tuberculosis belonging to different genetic groups were present in Britain at the same time, possibly even at a single location, and we present evidence for a mixed infection in at least one individual. Our study shows that ancient DNA typing applied to multiple samples can provide sufficiently detailed information to contribute to both archaeological and evolutionary knowledge of the history of tuberculosis.

  13. Estrogen Receptor 1 ( ESR1) Gene Polymorphisms and Obesity Phenotypes in a Population of Young Adults.

    PubMed

    Correa-Rodríguez, María; Schmidt-RioValle, Jacqueline; González-Jiménez, Emilio; Rueda-Medina, Blanca

    2017-06-01

    Obesity is considered an increasingly serious health problem determined by multiple genetic and environmental factors. Estrogens have been found to play a major role in body weight and adiposity regulation through estrogen receptor 1 ( ESR1). The aim of this study was to determine whether genotype and haplotype frequencies of ESR1 polymorphisms are associated with body composition measures in a population of 572 young adults. A lack of significant association between genotypes of ESR1 gene polymorphisms and obesity phenotypes was seen after adjustment for confounding factors. Linkage disequilibrium (LD) analysis identified a single LD block for the ESR1 gene including PvuII and XbaI single-nucleotide polymorphisms (SNPs) (pairwise r 2 = .66). None of the haplotypes identified revealed statistically significant associations with any of the obesity phenotypes. Our results suggest that polymorphisms of the ESR1 gene do not contribute significantly to the genetic risk for obesity phenotypes in a population of young Caucasian adults.

  14. Mapping DNA polymerase errors by single-molecule sequencing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, David F.; Lu, Jenny; Chang, Seungwoo

    Genomic integrity is compromised by DNA polymerase replication errors, which occur in a sequence-dependent manner across the genome. Accurate and complete quantification of a DNA polymerase's error spectrum is challenging because errors are rare and difficult to detect. We report a high-throughput sequencing assay to map in vitro DNA replication errors at the single-molecule level. Unlike previous methods, our assay is able to rapidly detect a large number of polymerase errors at base resolution over any template substrate without quantification bias. To overcome the high error rate of high-throughput sequencing, our assay uses a barcoding strategy in which each replicationmore » product is tagged with a unique nucleotide sequence before amplification. Here, this allows multiple sequencing reads of the same product to be compared so that sequencing errors can be found and removed. We demonstrate the ability of our assay to characterize the average error rate, error hotspots and lesion bypass fidelity of several DNA polymerases.« less

  15. A LDR-PCR approach for multiplex polymorphisms genotyping of severely degraded DNA with fragment sizes <100 bp.

    PubMed

    Zhang, Zhen; Wang, Bao-Jie; Guan, Hong-Yu; Pang, Hao; Xuan, Jin-Feng

    2009-11-01

    Reducing amplicon sizes has become a major strategy for analyzing degraded DNA typical of forensic samples. However, amplicon sizes in current mini-short tandem repeat-polymerase chain reaction (PCR) and mini-sequencing assays are still not suitable for analysis of severely degraded DNA. In this study, we present a multiplex typing method that couples ligase detection reaction with PCR that can be used to identify single nucleotide polymorphisms and small-scale insertion/deletions in a sample of severely fragmented DNA. This method adopts thermostable ligation for allele discrimination and subsequent PCR for signal enhancement. In this study, four polymorphic loci were used to assess the ability of this technique to discriminate alleles in an artificially degraded sample of DNA with fragment sizes <100 bp. Our results showed clear allelic discrimination of single or multiple loci, suggesting that this method might aid in the analysis of extremely degraded samples in which allelic drop out of larger fragments is observed.

  16. Detection of Multiple Parallel Transmission Outbreak of Streptococcus suis Human Infection by Use of Genome Epidemiology, China, 2005

    PubMed Central

    Du, Pengcheng; Zheng, Han; Zhou, Jieping; Lan, Ruiting; Ye, Changyun; Jing, Huaiqi; Jin, Dong; Cui, Zhigang; Bai, Xuemei; Liang, Jianming; Liu, Jiantao; Xu, Lei; Zhang, Wen; Chen, Chen

    2017-01-01

    Streptococcus suis sequence type 7 emerged and caused 2 of the largest human infection outbreaks in China in 1998 and 2005. To determine the major risk factors and source of the infections, we analyzed whole genomes of 95 outbreak-associated isolates, identified 160 single nucleotide polymorphisms, and classified them into 6 clades. Molecular clock analysis revealed that clade 1 (responsible for the 1998 outbreak) emerged in October 1997. Clades 2–6 (responsible for the 2005 outbreak) emerged separately during February 2002–August 2004. A total of 41 lineages of S. suis emerged by the end of 2004 and rapidly expanded to 68 genome types through single base mutations when the outbreak occurred in June 2005. We identified 32 identical isolates and classified them into 8 groups, which were distributed in a large geographic area with no transmission link. These findings suggest that persons were infected in parallel in respective geographic sites. PMID:27997331

  17. Polymorphism at the merozoite surface protein-3alpha locus of Plasmodium vivax: global and local diversity.

    PubMed

    Bruce, M C; Galinski, M R; Barnwell, J W; Snounou, G; Day, K P

    1999-10-01

    Allelic diversity at the Plasmodium vivax merozoite surface protein-3alpha (PvMsp-3alpha) locus was investigated using a combined polymerase chain reaction/restriction fragment length polymorphism (PCR/RFLP) protocol. Symptomatic patient isolates from global geographic origins showed a high level of polymorphism at the nucleotide level. These samples were used to validate the sensitivity, specificity, and reproducibility of the PCR/RFLP method. It was then used to investigate PvMsp3alpha diversity in field samples from children living in a single village in a malaria-endemic region of Papua New Guinea, with the aim of assessing the usefulness of this locus as an epidemiologic marker of P. vivax infections. Eleven PvMsp-3alpha alleles were distinguishable in 16 samples with single infections, revealing extensive parasite polymorphism within this restricted area. Multiple infections were easily detected and accounted for 5 (23%) of 22 positive samples. Pairs of samples from individual children provided preliminary evidence for high turnover of P. vivax populations.

  18. Mechanisms for RNA capture by ssDNA viruses: grand theft RNA.

    PubMed

    Stedman, Kenneth

    2013-06-01

    Viruses contain three common types of packaged genomes; double-stranded DNA (dsDNA), RNA (mostly single and occasionally double stranded) and single-stranded DNA (ssDNA). There are relatively straightforward explanations for the prevalence of viruses with dsDNA and RNA genomes, but the evolutionary basis for the apparent success of ssDNA viruses is less clear. The recent discovery of four ssDNA virus genomes that appear to have been formed by recombination between co-infecting RNA and ssDNA viruses, together with the high mutation rate of ssDNA viruses provide possible explanations. RNA-DNA recombination allows ssDNA viruses to access much broader sequence space than through nucleotide substitution and DNA-DNA recombination alone. Multiple non-exclusive mechanisms, all due to the unique replication of ssDNA viruses, are proposed for this unusual RNA capture. RNA capture provides an explanation for the evolutionary success of the ssDNA viruses and may help elucidate the mystery of integrated RNA viruses in viral and cellular DNA genomes.

  19. Mapping DNA polymerase errors by single-molecule sequencing

    DOE PAGES

    Lee, David F.; Lu, Jenny; Chang, Seungwoo; ...

    2016-05-16

    Genomic integrity is compromised by DNA polymerase replication errors, which occur in a sequence-dependent manner across the genome. Accurate and complete quantification of a DNA polymerase's error spectrum is challenging because errors are rare and difficult to detect. We report a high-throughput sequencing assay to map in vitro DNA replication errors at the single-molecule level. Unlike previous methods, our assay is able to rapidly detect a large number of polymerase errors at base resolution over any template substrate without quantification bias. To overcome the high error rate of high-throughput sequencing, our assay uses a barcoding strategy in which each replicationmore » product is tagged with a unique nucleotide sequence before amplification. Here, this allows multiple sequencing reads of the same product to be compared so that sequencing errors can be found and removed. We demonstrate the ability of our assay to characterize the average error rate, error hotspots and lesion bypass fidelity of several DNA polymerases.« less

  20. Detecting and Removing Ascertainment Bias in Microsatellites from the HGDP-CEPH Panel

    PubMed Central

    Eriksson, Anders; Manica, Andrea

    2011-01-01

    Although ascertainment bias in single nucleotide polymorphisms is a well-known problem, it is generally accepted that microsatellites have mutation rates too high for bias to be a concern. Here, we analyze in detail the large set of microsatellites typed for the Human Genetic Diversity Panel (HGDP)-CEPH panel. We develop a novel framework based on rarefaction to compare heterozygosity across markers with different mutation rates. We find that, whereas di- and tri-nucleotides show similar patterns of within- and between-population heterozygosity, tetra-nucleotides are inconsistent with the other two motifs. In addition, di- and tri-nucleotides are consistent with 16 unbiased tetra-nucleotide markers, whereas the HPGP-CEPH tetra-nucleotides are significantly different. This discrepancy is due to the HGDP-CEPH tetra-nucleotides being too homogeneous across Eurasia, even after their slower mutation rate is taken into account by rarefying the other markers. The most likely explanation for this pattern is ascertainment bias. We strongly advocate the exclusion of tetra-nucleotides from future population genetics analysis of this dataset, and we argue that other microsatellite datasets should be investigated for the presence of bias using the approach outlined in this article. PMID:22384358

  1. Microarray study of single nucleotide polymorphisms and expression of ATP-binding cassette genes in breast tumors

    NASA Astrophysics Data System (ADS)

    Tsyganov, M. M.; Ibragimova, M. K.; Karabut, I. V.; Freydin, M. B.; Choinzonov, E. L.; Litvyakov, N. V.

    2015-11-01

    Our previous research establishes that changes of expression of the ATP-binding cassette genes family is connected with the neoadjuvant chemotherapy effect. However, the mechanism of regulation of resistance gene expression remains unclear. As many researchers believe, single nucleotide polymorphisms can be involved in this process. Thereupon, microarray analysis is used to study polymorphisms in ATP-binding cassette genes. It is thus found that MDR gene expression is connected with 5 polymorphisms, i.e. rs241432, rs241429, rs241430, rs3784867, rs59409230, which participate in the regulation of expression of own genes.

  2. Trichomonas vaginalis Metronidazole Resistance Is Associated with Single Nucleotide Polymorphisms in the Nitroreductase Genes ntr4Tv and ntr6Tv

    PubMed Central

    Paulish-Miller, Teresa E.; Augostini, Peter; Schuyler, Jessica A.; Smith, William L.; Mordechai, Eli; Adelson, Martin E.; Gygax, Scott E.; Secor, William E.

    2014-01-01

    Metronidazole resistance in the sexually transmitted parasite Trichomonas vaginalis is a problematic public health issue. We have identified single nucleotide polymorphisms (SNPs) in two nitroreductase genes (ntr4Tv and ntr6Tv) associated with resistance. These SNPs were associated with one of two distinct T. vaginalis populations identified by multilocus sequence typing, yet one SNP (ntr6Tv A238T), which results in a premature stop codon, was associated with resistance independent of population structure and may be of diagnostic value. PMID:24550324

  3. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    PubMed

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  4. Modular Organization of Residue-Level Contacts Shapes the Selection Pressure on Individual Amino Acid Sites of Ribosomal Proteins.

    PubMed

    Mallik, Saurav; Kundu, Sudip

    2017-04-01

    Understanding the molecular evolution of macromolecular complexes in the light of their structure, assembly, and stability is of central importance. Here, we address how the modular organization of native molecular contacts shapes the selection pressure on individual residue sites of ribosomal complexes. The bacterial ribosomal complex is represented as a residue contact network where nodes represent amino acid/nucleotide residues and edges represent their van der Waals interactions. We find statistically overrepresented native amino acid-nucleotide contacts (OaantC, one amino acid contacts one or multiple nucleotides, internucleotide contacts are disregarded). Contact number is defined as the number of nucleotides contacted. Involvement of individual amino acids in OaantCs with smaller contact numbers is more random, whereas only a few amino acids significantly contribute to OaantCs with higher contact numbers. An investigation of structure, stability, and assembly of bacterial ribosome depicts the involvement of these OaantCs in diverse biophysical interactions stabilizing the complex, including high-affinity protein-RNA contacts, interprotein cooperativity, intersubunit bridge, packing of multiple ribosomal RNA domains, etc. Amino acid-nucleotide constituents of OaantCs with higher contact numbers are generally associated with significantly slower substitution rates compared with that of OaantCs with smaller contact numbers. This evolutionary rate heterogeneity emerges from the strong purifying selection pressure that conserves the respective amino acid physicochemical properties relevant to the stabilizing interaction with OaantC nucleotides. An analysis of relative molecular orientations of OaantC residues and their interaction energetics provides the biophysical ground of purifying selection conserving OaantC amino acid physicochemical properties. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  5. CNG and HCN channels: two peas, one pod.

    PubMed

    Craven, Kimberley B; Zagotta, William N

    2006-01-01

    Cyclic nucleotide-activated ion channels play a fundamental role in a variety of physiological processes. By opening in response to intracellular cyclic nucleotides, they translate changes in concentrations of signaling molecules to changes in membrane potential. These channels belong to two families: the cyclic nucleotide-gated (CNG) channels and the hyperpolarization-activated cyclic nucleotide-modulated (HCN) channels. The two families exhibit high sequence similarity and belong to the superfamily of voltage-gated potassium channels. Whereas HCN channels are activated by voltage and CNG channels are virtually voltage independent, both channels are activated by cyclic nucleotide binding. Furthermore, the channels are thought to have similar channel structures, leading to similar mechanisms of activation by cyclic nucleotides. However, although these channels are structurally and behaviorally similar, they have evolved to perform distinct physiological functions. This review describes the physiological roles and biophysical behavior of CNG and HCN channels. We focus on how similarities in structure and activation mechanisms result in common biophysical models, allowing CNG and HCN channels to be viewed as a single genre.

  6. Structure of a eukaryotic cyclic nucleotide-gated channel

    PubMed Central

    Li, Minghui; Zhou, Xiaoyuan; Wang, Shu; Michailidis, Ioannis; Gong, Ye; Su, Deyuan; Li, Huan; Li, Xueming; Yang, Jian

    2018-01-01

    Summary Cyclic nucleotide-gated (CNG) channels are essential for vision and olfaction. They belong to the voltage-gated ion channel superfamily but their activities are controlled by intracellular cyclic nucleotides instead of transmembrane voltage. Here we report a 3.5 Å-resolution single-particle electron cryomicroscopy structure of a CNG channel from C. elegans in the cGMP-bound open state. The channel has an unusual voltage-sensor-like domain (VSLD), accounting for its deficient voltage dependence. A C-terminal linker connecting S6 and the cyclic nucleotide-binding domain interacts directly with both the VSLD and pore domain, forming a gating ring that couples conformational changes triggered by cyclic nucleotide binding to the gate. The selectivity filter is lined by the carboxylate side chains of a functionally important glutamate and three rings of backbone carbonyls. This structure provides a new framework for understanding mechanisms of ion permeation, gating and channelopathy of CNG channels and cyclic nucleotide modulation of related channels. PMID:28099415

  7. Aquaporin-4 polymorphisms and brain/body weight ratio in sudden infant death syndrome (SIDS).

    PubMed

    Studer, Jacqueline; Bartsch, Christine; Haas, Cordula

    2014-07-01

    Failure in the regulation of homeostatic water balance in the brain is associated with severe cerebral edema and increased brain weights and may also play an important role in the pathogenesis of sudden infant death syndrome (SIDS). We genotyped three single-nucleotide polymorphisms in the aquaporin-4 water channel-encoding gene (AQP4), which were previously shown to be associated with (i) SIDS in Norwegian infants (rs2075575), (ii) severe brain edema (rs9951307), and (iii) increased brain water permeability (rs3906956). We also determined whether the brain/body weight ratio is increased in SIDS infants compared with sex- and age-matched controls. Genotyping of the three AQP4 single-nucleotide polymorphisms was performed in 160 Caucasian SIDS infants and 181 healthy Swiss adults using a single-base extension method. Brain and body weights were measured during autopsy in 157 SIDS and 59 non-SIDS infants. No differences were detected in the allelic frequencies of the three AQP4 single-nucleotide polymorphisms between SIDS and adult controls. The brain/body weight ratio was similarly distributed in SIDS and non-SIDS infants. Variations in the AQP4 gene seem of limited significance as predisposing factors in Caucasian SIDS infants. Increased brain weights may only become evident in conjunction with environmental or other genetic risk factors.

  8. Single nucleotide editing without DNA cleavage using CRISPR/Cas9-deaminase in the sea urchin embryo.

    PubMed

    Shevidi, Saba; Uchida, Alicia; Schudrowitz, Natalie; Wessel, Gary M; Yajima, Mamiko

    2017-12-01

    A single base pair mutation in the genome can result in many congenital disorders in humans. The recent gene editing approach using CRISPR/Cas9 has rapidly become a powerful tool to replicate or repair such mutations in the genome. These approaches rely on cleaving DNA, while presenting unexpected risks. In this study, we demonstrate a modified CRISPR/Cas9 system fused to cytosine deaminase (Cas9-DA), which induces a single nucleotide conversion in the genome. Cas9-DA was introduced into sea urchin eggs with sgRNAs targeted for SpAlx1, SpDsh, or SpPks, each of which is critical for skeletogenesis, embryonic axis formation, or pigment formation, respectively. We found that both Cas9 and Cas9-DA edit the genome, and cause predicted phenotypic changes at a similar efficiency. Cas9, however, resulted in significant deletions in the genome centered on the gRNA target sequence, whereas Cas9-DA resulted in single or double nucleotide editing of C to T conversions within the gRNA target sequence. These results suggest that the Cas9-DA approach may be useful for manipulating gene activity with decreased risks of genomic aberrations. Developmental Dynamics 246:1036-1046, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  9. Evaluating fossil calibrations for dating phylogenies in light of rates of molecular evolution: a comparison of three approaches.

    PubMed

    Lukoschek, Vimoksalehi; Scott Keogh, J; Avise, John C

    2012-01-01

    Evolutionary and biogeographic studies increasingly rely on calibrated molecular clocks to date key events. Although there has been significant recent progress in development of the techniques used for molecular dating, many issues remain. In particular, controversies abound over the appropriate use and placement of fossils for calibrating molecular clocks. Several methods have been proposed for evaluating candidate fossils; however, few studies have compared the results obtained by different approaches. Moreover, no previous study has incorporated the effects of nucleotide saturation from different data types in the evaluation of candidate fossils. In order to address these issues, we compared three approaches for evaluating fossil calibrations: the single-fossil cross-validation method of Near, Meylan, and Shaffer (2005. Assessing concordance of fossil calibration points in molecular clock studies: an example using turtles. Am. Nat. 165:137-146), the empirical fossil coverage method of Marshall (2008. A simple method for bracketing absolute divergence times on molecular phylogenies using multiple fossil calibration points. Am. Nat. 171:726-742), and the Bayesian multicalibration method of Sanders and Lee (2007. Evaluating molecular clock calibrations using Bayesian analyses with soft and hard bounds. Biol. Lett. 3:275-279) and explicitly incorporate the effects of data type (nuclear vs. mitochondrial DNA) for identifying the most reliable or congruent fossil calibrations. We used advanced (Caenophidian) snakes as a case study; however, our results are applicable to any taxonomic group with multiple candidate fossils, provided appropriate taxon sampling and sufficient molecular sequence data are available. We found that data type strongly influenced which fossil calibrations were identified as outliers, regardless of which method was used. Despite the use of complex partitioned models of sequence evolution and multiple calibrations throughout the tree, saturation severely compressed basal branch lengths obtained from mitochondrial DNA compared with nuclear DNA. The effects of mitochondrial saturation were not ameliorated by analyzing a combined nuclear and mitochondrial data set. Although removing the third codon positions from the mitochondrial coding regions did not ameliorate saturation effects in the single-fossil cross-validations, it did in the Bayesian multicalibration analyses. Saturation significantly influenced the fossils that were selected as most reliable for all three methods evaluated. Our findings highlight the need to critically evaluate the fossils selected by data with different rates of nucleotide substitution and how data with different evolutionary rates affect the results of each method for evaluating fossils. Our empirical evaluation demonstrates that the advantages of using multiple independent fossil calibrations significantly outweigh any disadvantages.

  10. Single Marker and Haplotype-Based Association Analysis of Semolina and Pasta Colour in Elite Durum Wheat Breeding Lines Using a High-Density Consensus Map.

    PubMed

    N'Diaye, Amidou; Haile, Jemanesh K; Cory, Aron T; Clarke, Fran R; Clarke, John M; Knox, Ron E; Pozniak, Curtis J

    2017-01-01

    Association mapping is usually performed by testing the correlation between a single marker and phenotypes. However, because patterns of variation within genomes are inherited as blocks, clustering markers into haplotypes for genome-wide scans could be a worthwhile approach to improve statistical power to detect associations. The availability of high-density molecular data allows the possibility to assess the potential of both approaches to identify marker-trait associations in durum wheat. In the present study, we used single marker- and haplotype-based approaches to identify loci associated with semolina and pasta colour in durum wheat, the main objective being to evaluate the potential benefits of haplotype-based analysis for identifying quantitative trait loci. One hundred sixty-nine durum lines were genotyped using the Illumina 90K Infinium iSelect assay, and 12,234 polymorphic single nucleotide polymorphism (SNP) markers were generated and used to assess the population structure and the linkage disequilibrium (LD) patterns. A total of 8,581 SNPs previously localized to a high-density consensus map were clustered into 406 haplotype blocks based on the average LD distance of 5.3 cM. Combining multiple SNPs into haplotype blocks increased the average polymorphism information content (PIC) from 0.27 per SNP to 0.50 per haplotype. The haplotype-based analysis identified 12 loci associated with grain pigment colour traits, including the five loci identified by the single marker-based analysis. Furthermore, the haplotype-based analysis resulted in an increase of the phenotypic variance explained (50.4% on average) and the allelic effect (33.7% on average) when compared to single marker analysis. The presence of multiple allelic combinations within each haplotype locus offers potential for screening the most favorable haplotype series and may facilitate marker-assisted selection of grain pigment colour in durum wheat. These results suggest a benefit of haplotype-based analysis over single marker analysis to detect loci associated with colour traits in durum wheat.

  11. African-American mitochondrial DNAs often match mtDNAs found in multiple African ethnic groups

    PubMed Central

    Ely, Bert; Wilson, Jamie Lee; Jackson, Fatimah; Jackson, Bruce A

    2006-01-01

    Background Mitochondrial DNA (mtDNA) haplotypes have become popular tools for tracing maternal ancestry, and several companies offer this service to the general public. Numerous studies have demonstrated that human mtDNA haplotypes can be used with confidence to identify the continent where the haplotype originated. Ideally, mtDNA haplotypes could also be used to identify a particular country or ethnic group from which the maternal ancestor emanated. However, the geographic distribution of mtDNA haplotypes is greatly influenced by the movement of both individuals and population groups. Consequently, common mtDNA haplotypes are shared among multiple ethnic groups. We have studied the distribution of mtDNA haplotypes among West African ethnic groups to determine how often mtDNA haplotypes can be used to reconnect Americans of African descent to a country or ethnic group of a maternal African ancestor. The nucleotide sequence of the mtDNA hypervariable segment I (HVS-I) usually provides sufficient information to assign a particular mtDNA to the proper haplogroup, and it contains most of the variation that is available to distinguish a particular mtDNA haplotype from closely related haplotypes. In this study, samples of general African-American and specific Gullah/Geechee HVS-I haplotypes were compared with two databases of HVS-I haplotypes from sub-Saharan Africa, and the incidence of perfect matches recorded for each sample. Results When two independent African-American samples were analyzed, more than half of the sampled HVS-I mtDNA haplotypes exactly matched common haplotypes that were shared among multiple African ethnic groups. Another 40% did not match any sequence in the database, and fewer than 10% were an exact match to a sequence from a single African ethnic group. Differences in the regional distribution of haplotypes were observed in the African database, and the African-American haplotypes were more likely to match haplotypes found in ethnic groups from West or West Central Africa than those found in eastern or southern Africa. Fewer than 14% of the African-American mtDNA sequences matched sequences from only West Africa or only West Central Africa. Conclusion Our database of sub-Saharan mtDNA sequences includes the most common haplotypes that are shared among ethnic groups from multiple regions of Africa. These common haplotypes have been found in half of all sub-Saharan Africans. More than 60% of the remaining haplotypes differ from the common haplotypes at a single nucleotide position in the HVS-I region, and they are likely to occur at varying frequencies within sub-Saharan Africa. However, the finding that 40% of the African-American mtDNAs analyzed had no match in the database indicates that only a small fraction of the total number of African haplotypes has been identified. In addition, the finding that fewer than 10% of African-American mtDNAs matched mtDNA sequences from a single African region suggests that few African Americans might be able to trace their mtDNA lineages to a particular region of Africa, and even fewer will be able to trace their mtDNA to a single ethnic group. However, no firm conclusions should be made until a much larger database is available. It is clear, however, that when identical mtDNA haplotypes are shared among many ethnic groups from different parts of Africa, it is impossible to determine which single ethnic group was the source of a particular maternal ancestor based on the mtDNA sequence. PMID:17038170

  12. Computed Energetics of Nucleotides in Spatial Ribozyme Structures: An Accurate Identification of Functional Regions from Structure

    PubMed Central

    Torshin, Ivan Y.

    2004-01-01

    Ribozymes are functionally diverse RNA molecules with intrinsic catalytic activity. Multiple structural and biochemical studies are required to establish which nucleotide bases are involved in the catalysis. The relative energetic properties of the nucleotide bases have been analyzed in a set of the known ribozyme structures. It was found that many of the known catalytic nucleotides can be identified using only the structure without any additional biochemical data. The results of the calculations compare well with the available biochemical data on RNA stability. Extensive in silico mutagenesis suggests that most of the nucleotides in ribozymes stabilize the RNA. The calculations show that relative contribution of the catalytic bases to RNA stability observably differs from contributions of the noncatalytic bases. Distinction between the concepts of “relative stability” and “mutational stability” is suggested. As results of prediction for several models of ribozymes appear to be in agreement with the published data on the potential active site regions, the method can potentially be used for prediction of functional nucleotides from nucleic sequence. PMID:15105962

  13. Genome-wide patterns of recombination, linkage disequilibrium and nucleotide diversity from pooled resequencing and single nucleotide polymorphism genotyping unlock the evolutionary history of Eucalyptus grandis.

    PubMed

    Silva-Junior, Orzenil B; Grattapaglia, Dario

    2015-11-01

    We used high-density single nucleotide polymorphism (SNP) data and whole-genome pooled resequencing to examine the landscape of population recombination (ρ) and nucleotide diversity (ϴw ), assess the extent of linkage disequilibrium (r(2) ) and build the highest density linkage maps for Eucalyptus. At the genome-wide level, linkage disequilibrium (LD) decayed within c. 4-6 kb, slower than previously reported from candidate gene studies, but showing considerable variation from absence to complete LD up to 50 kb. A sharp decrease in the estimate of ρ was seen when going from short to genome-wide inter-SNP distances, highlighting the dependence of this parameter on the scale of observation adopted. Recombination was correlated with nucleotide diversity, gene density and distance from the centromere, with hotspots of recombination enriched for genes involved in chemical reactions and pathways of the normal metabolic processes. The high nucleotide diversity (ϴw = 0.022) of E. grandis revealed that mutation is more important than recombination in shaping its genomic diversity (ρ/ϴw = 0.645). Chromosome-wide ancestral recombination graphs allowed us to date the split of E. grandis (1.7-4.8 million yr ago) and identify a scenario for the recent demographic history of the species. Our results have considerable practical importance to Genome Wide Association Studies (GWAS), while indicating bright prospects for genomic prediction of complex phenotypes in eucalypt breeding. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  14. Kernel Machine SNP-set Testing under Multiple Candidate Kernels

    PubMed Central

    Wu, Michael C.; Maity, Arnab; Lee, Seunggeun; Simmons, Elizabeth M.; Harmon, Quaker E.; Lin, Xinyi; Engel, Stephanie M.; Molldrem, Jeffrey J.; Armistead, Paul M.

    2013-01-01

    Joint testing for the cumulative effect of multiple single nucleotide polymorphisms grouped on the basis of prior biological knowledge has become a popular and powerful strategy for the analysis of large scale genetic association studies. The kernel machine (KM) testing framework is a useful approach that has been proposed for testing associations between multiple genetic variants and many different types of complex traits by comparing pairwise similarity in phenotype between subjects to pairwise similarity in genotype, with similarity in genotype defined via a kernel function. An advantage of the KM framework is its flexibility: choosing different kernel functions allows for different assumptions concerning the underlying model and can allow for improved power. In practice, it is difficult to know which kernel to use a priori since this depends on the unknown underlying trait architecture and selecting the kernel which gives the lowest p-value can lead to inflated type I error. Therefore, we propose practical strategies for KM testing when multiple candidate kernels are present based on constructing composite kernels and based on efficient perturbation procedures. We demonstrate through simulations and real data applications that the procedures protect the type I error rate and can lead to substantially improved power over poor choices of kernels and only modest differences in power versus using the best candidate kernel. PMID:23471868

  15. The Association of CD81 Polymorphisms with Alloimmunization in Sickle Cell Disease

    PubMed Central

    Tatari-Calderone, Zohreh; Tamouza, Ryad; Le Bouder, Gama P.; Dewan, Ramita; Luban, Naomi L. C.; Lasserre, Jacqueline; Maury, Jacqueline; Lionnet, François; Krishnamoorthy, Rajagopal; Girot, Robert

    2013-01-01

    The goal of the present work was to identify the candidate genetic markers predictive of alloimmunization in sickle cell disease (SCD). Red blood cell (RBC) transfusion is indicated for acute treatment, prevention, and abrogation of some complications of SCD. A well-known consequence of multiple RBC transfusions is alloimmunization. Given that a subset of SCD patients develop multiple RBC allo-/autoantibodies, while others do not in a similar multiple transfusional setting, we investigated a possible genetic basis for alloimmunization. Biomarker(s) which predicts (predict) susceptibility to alloimmunization could identify patients at risk before the onset of a transfusion program and thus may have important implications for clinical management. In addition, such markers could shed light on the mechanism(s) underlying alloimmunization. We genotyped 27 single nucleotide polymorphisms (SNPs) in the CD81, CHRNA10, and ARHG genes in two groups of SCD patients. One group (35) of patients developed alloantibodies, and another (40) had no alloantibodies despite having received multiple transfusions. Two SNPs in the CD81 gene, that encodes molecule involved in the signal modulation of B lymphocytes, show a strong association with alloimmunization. If confirmed in prospective studies with larger cohorts, the two SNPs identified in this retrospective study could serve as predictive biomarkers for alloimmunization. PMID:23762099

  16. The nucleotide sequence and genome organization of Plasmopara halstedii virus.

    PubMed

    Heller-Dohmen, Marion; Göpfert, Jens C; Pfannstiel, Jens; Spring, Otmar

    2011-03-17

    Only very few viruses of Oomycetes have been studied in detail. Isometric virions were found in different isolates of the oomycete Plasmopara halstedii, the downy mildew pathogen of sunflower. However, complete nucleotide sequences and data on the genome organization were lacking. Viral RNA of different P. halstedii isolates was subjected to nucleotide sequencing and analysis of the viral genome. The N-terminal sequence of the viral coat protein was determined using Top-Down MALDI-TOF analysis. The complete nucleotide sequences of both single-stranded RNA segments (RNA1 and RNA2) were established. RNA1 consisted of 2793 nucleotides (nt) exclusive its 3' poly(A) tract and a single open-reading frame (ORF1) of 2745 nt. ORF1 was framed by a 5' untranslated region (5' UTR) of 18 nt and a 3' untranslated region (3' UTR) of 30 nt. ORF1 contained motifs of RNA-dependent RNA polymerases (RdRp) and showed similarities to RdRp of Scleropthora macrospora virus A (SmV A) and viruses within the Nodaviridae family. RNA2 consisted of 1526 nt exclusive its 3' poly(A) tract and a second ORF (ORF2) of 1128 nt. ORF2 coded for the single viral coat protein (CP) and was framed by a 5' UTR of 164 nt and a 3' UTR of 234 nt. The deduced amino acid sequence of ORF2 was verified by nano-LC-ESI-MS/MS experiments. Top-Down MALDI-TOF analysis revealed the N-terminal sequence of the CP. The N-terminal sequence represented a region within ORF2 suggesting a proteolytic processing of the CP in vivo. The CP showed similarities to CP of SmV A and viruses within the Tombusviridae family. Fragments of RNA1 (ca. 1.9 kb) and RNA2 (ca. 1.4 kb) were used to analyze the nucleotide sequence variation of virions in different P. halstedii isolates. Viral sequence variation was 0.3% or less regardless of their host's pathotypes, the geographical origin and the sensitivity towards the fungicide metalaxyl. The results showed the presence of a single and new virus type in different P. halstedii isolates. Insignificant viral sequence variation indicated that the virus did not account for differences in pathogenicity of the oomycete P. halstedii.

  17. DAMGO binding to mouse brain membranes: influence of salts, guanine nucleotides, substance P, and substance P fragments.

    PubMed

    Krumins, S A; Kim, D C; Igwe, O J; Larson, A A

    1993-01-01

    Substance P (SP) appears to mediate many processes of the central nervous system, including pain. This report deals with modulation of opioid binding in the mouse brain by SP and SP fragments, as well as by salts and guanine nucleotides. Binding studies of the selective mu opioid receptor agonist [D-Ala2, MePhe4,Gly(ol)5]enkephalin (DAMGO) to mouse brain membrane preparations demonstrated that guanine nucleotide modulation of DAMGO binding affinity was modified by SP. However, SP had little or no influence on inhibition of DAMGO binding induced by salts, such as MgCl2, CaCl2, or NaCl. By replacing GTP with GppNHp, SP (0.1 nM) produced multiple affinity forms of the DAMGO receptor, while at a higher concentration (10 nM), SP lost its influence on DAMGO binding. Furthermore, 0.1 nM SP changed DAMGO binding parameters in a medium containing NaCl, CaCl2, and GppNHp such that the high- and low-affinity conformations of the receptor converted to a single site following the addition of SP to the incubation medium. While the C-terminal SP fragment SP(5-11) was without effect, the N-terminal SP fragments SP(1-9) and SP(1-7) appeared to imitate SP in modifying GppNHp-modulated DAMGO binding. These results suggest that SP functions as a modulator of opioid binding at the mu receptor and it appears that the N-terminus of SP plays a role in the modulatory process.

  18. An Outbreak of Respiratory Tularemia Caused by Diverse Clones of Francisella tularensis

    PubMed Central

    Johansson, Anders; Lärkeryd, Adrian; Widerström, Micael; Mörtberg, Sara; Myrtännäs, Kerstin; Öhrman, Caroline; Birdsell, Dawn; Keim, Paul; Wagner, David M.; Forsman, Mats; Larsson, Pär

    2014-01-01

    Background. The bacterium Francisella tularensis is recognized for its virulence, infectivity, genetic homogeneity, and potential as a bioterrorism agent. Outbreaks of respiratory tularemia, caused by inhalation of this bacterium, are poorly understood. Such outbreaks are exceedingly rare, and F. tularensis is seldom recovered from clinical specimens. Methods. A localized outbreak of tularemia in Sweden was investigated. Sixty-seven humans contracted laboratory-verified respiratory tularemia. F. tularensis subspecies holarctica was isolated from the blood or pleural fluid of 10 individuals from July to September 2010. Using whole-genome sequencing and analysis of single-nucleotide polymorphisms (SNPs), outbreak isolates were compared with 110 archived global isolates. Results. There were 757 SNPs among the genomes of the 10 outbreak isolates and the 25 most closely related archival isolates (all from Sweden/Finland). Whole genomes of outbreak isolates were >99.9% similar at the nucleotide level and clustered into 3 distinct genetic clades. Unexpectedly, high-sequence similarity grouped some outbreak and archival isolates that originated from patients from different geographic regions and up to 10 years apart. Outbreak and archival genomes frequently differed by only 1–3 of 1 585 229 examined nucleotides. Conclusions. The outbreak was caused by diverse clones of F. tularensis that occurred concomitantly, were widespread, and apparently persisted in the environment. Multiple independent acquisitions of F. tularensis from the environment over a short time period suggest that natural outbreaks of respiratory tularemia are triggered by environmental cues. The findings additionally caution against interpreting genome sequence identity for this pathogen as proof of a direct epidemiological link. PMID:25097081

  19. Uncovering drug-responsive regulatory elements

    PubMed Central

    Luizon, Marcelo R; Ahituv, Nadav

    2015-01-01

    Nucleotide changes in gene regulatory elements can have a major effect on interindividual differences in drug response. For example, by reviewing all published pharmacogenomic genome-wide association studies, we show here that 96.4% of the associated single nucleotide polymorphisms reside in noncoding regions. We discuss how sequencing technologies are improving our ability to identify drug response-associated regulatory elements genome-wide and to annotate nucleotide variants within them. We highlight specific examples of how nucleotide changes in these elements can affect drug response and illustrate the techniques used to find them and functionally characterize them. Finally, we also discuss challenges in the field of drug-responsive regulatory elements that need to be considered in order to translate these findings into the clinic. PMID:26555224

  20. Implications of the plastid genome sequence of typha (typhaceae, poales) for understanding genome evolution in poaceae.

    PubMed

    Guisinger, Mary M; Chumley, Timothy W; Kuehl, Jennifer V; Boore, Jeffrey L; Jansen, Robert K

    2010-02-01

    Plastid genomes of the grasses (Poaceae) are unusual in their organization and rates of sequence evolution. There has been a recent surge in the availability of grass plastid genome sequences, but a comprehensive comparative analysis of genome evolution has not been performed that includes any related families in the Poales. We report on the plastid genome of Typha latifolia, the first non-grass Poales sequenced to date, and we present comparisons of genome organization and sequence evolution within Poales. Our results confirm that grass plastid genomes exhibit acceleration in both genomic rearrangements and nucleotide substitutions. Poaceae have multiple structural rearrangements, including three inversions, three genes losses (accD, ycf1, ycf2), intron losses in two genes (clpP, rpoC1), and expansion of the inverted repeat (IR) into both large and small single-copy regions. These rearrangements are restricted to the Poaceae, and IR expansion into the small single-copy region correlates with the phylogeny of the family. Comparisons of 73 protein-coding genes for 47 angiosperms including nine Poaceae genera confirm that the branch leading to Poaceae has significantly accelerated rates of change relative to other monocots and angiosperms. Furthermore, rates of sequence evolution within grasses are lower, indicating a deceleration during diversification of the family. Overall there is a strong correlation between accelerated rates of genomic rearrangements and nucleotide substitutions in Poaceae, a phenomenon that has been noted recently throughout angiosperms. The cause of the correlation is unknown, but faulty DNA repair has been suggested in other systems including bacterial and animal mitochondrial genomes.

  1. Sequence Variation of the tRNALeu Intron as a Marker for Genetic Diversity and Specificity of Symbiotic Cyanobacteria in Some Lichens

    PubMed Central

    Paulsrud, Per; Lindblad, Peter

    1998-01-01

    We examined the genetic diversity of Nostoc symbionts in some lichens by using the tRNALeu (UAA) intron as a genetic marker. The nucleotide sequence was analyzed in the context of the secondary structure of the transcribed intron. Cyanobacterial tRNALeu (UAA) introns were specifically amplified from freshly collected lichen samples without previous DNA extraction. The lichen species used in the present study were Nephroma arcticum, Peltigera aphthosa, P. membranacea, and P. canina. Introns with different sizes around 300 bp were consistently obtained. Multiple clones from single PCRs were screened by using their single-stranded conformational polymorphism pattern, and the nucleotide sequence was determined. No evidence for sample heterogenity was found. This implies that the symbiont in situ is not a diverse community of cyanobionts but, rather, one Nostoc strain. Furthermore, each lichen thallus contained only one intron type, indicating that each thallus is colonized only once or that there is a high degree of specificity. The same cyanobacterial intron sequence was also found in samples of one lichen species from different localities. In a phylogenetic analysis, the cyanobacterial lichen sequences grouped together with the sequences from two free-living Nostoc strains. The size differences in the intron were due to insertions and deletions in highly variable regions. The sequence data were used in discussions concerning specificity and biology of the lichen symbiosis. It is concluded that the tRNALeu (UAA) intron can be of great value when examining cyanobacterial diversity. PMID:9435083

  2. Single Nucleotide Polymorphisms in the TP53 Region and Susceptibility to Invasive Epithelial Ovarian Cancer

    PubMed Central

    Schildkraut, Joellen M.; Goode, Ellen L; Clyde, Merlise A.; Iversen, Edwin S.; Moorman, Patricia G.; Berchuck, Andrew; Marks, Jeffrey R.; Lissowska, Jolanta; Brinton, Louise; Peplonska, Beata; Cunningham, Julie M.; Vierkant, Robert A.; Rider, David N.; Chenevix-Trench, Georgia; Webb, Penelope M.; Beesley, Jonathan; Chen, Xiaoqing; Phelan, Catherine; Sutphen, Rebecca; Sellers, Thomas A.; Pearce, Leigh; Wu, Anna H.; Van Den Berg, David; Conti, David; Elund, Christopher K.; Anderson, Rebecca; Goodman, Marc T.; Lurie, Galina; Carney, Michael E.; Thompson, Pamela J.; Gayther, Simon A.; Ramus, Susan J.; Jacobs, Ian; Kjaer, Susanne Krüger; Hogdall, Estrid; Blaakaer, Jan; Hogdall, Claus; Easton, Douglas F.; Song, Honglin; Pharoah, Paul D.P.; Whittemore, Alice S.; McGuire, Valerie; Quaye, Lydia; Anton-Culver, Hoda; Ziogas, Argyrios; Terry, Kathryn L.; Cramer, Daniel W.; Hankinson, Susan E.; Tworoger, Shelley S.; Calingaert, Brian; Chanock, Stephen; Sherman, Mark; Garcia-Closason, Montserrat

    2009-01-01

    The p53 protein is critical for multiple cellular functions including cell growth and DNA repair. We assessed whether polymorphisms in the region encoding TP53 were associated with risk of invasive ovarian cancer. The study population includes a total of 5,206 invasive ovarian cancer cases (2,829 of which were serous) and 8,790 controls from 13 case-control or nested case-control studies participating in the Ovarian Cancer Association Consortium (OCAC). Three of the studies performed independent discovery investigations involving genotyping of up to 23 single nucleotide polymorphisms (SNPs) in the TP53 region. Significant findings from this discovery phase were followed up for replication in the other OCAC studies. Mixed effects logistic regression was used to generate posterior median per allele odds ratios (ORs), 95% probability intervals (PIs) and Bayes factors (BFs) for genotype associations. Five SNPs showed significant associations with risk in one or more of the discovery investigations and were followed up by OCAC. Mixed effects analysis confirmed associations with serous invasive cancers for two correlated (r2 = 0.62) SNPs: rs2287498 (median per allele OR = 1.30; 95% PI = 1.07-1.57) and rs12951053 (median per allele OR = 1.19; 95% PI = 1.01 - 1.38). Analyses of other histological subtypes suggested similar associations with endometrioid but not with mucinous or clear cell cancers. This large study provides statistical evidence for a small increase in risk of ovarian cancer associated with common variants in the TP53 region. PMID:19276375

  3. Increased genomic prediction accuracy in wheat breeding through spatial adjustment of field trial data.

    PubMed

    Lado, Bettina; Matus, Ivan; Rodríguez, Alejandra; Inostroza, Luis; Poland, Jesse; Belzile, François; del Pozo, Alejandro; Quincke, Martín; Castro, Marina; von Zitzewitz, Jarislav

    2013-12-09

    In crop breeding, the interest of predicting the performance of candidate cultivars in the field has increased due to recent advances in molecular breeding technologies. However, the complexity of the wheat genome presents some challenges for applying new technologies in molecular marker identification with next-generation sequencing. We applied genotyping-by-sequencing, a recently developed method to identify single-nucleotide polymorphisms, in the genomes of 384 wheat (Triticum aestivum) genotypes that were field tested under three different water regimes in Mediterranean climatic conditions: rain-fed only, mild water stress, and fully irrigated. We identified 102,324 single-nucleotide polymorphisms in these genotypes, and the phenotypic data were used to train and test genomic selection models intended to predict yield, thousand-kernel weight, number of kernels per spike, and heading date. Phenotypic data showed marked spatial variation. Therefore, different models were tested to correct the trends observed in the field. A mixed-model using moving-means as a covariate was found to best fit the data. When we applied the genomic selection models, the accuracy of predicted traits increased with spatial adjustment. Multiple genomic selection models were tested, and a Gaussian kernel model was determined to give the highest accuracy. The best predictions between environments were obtained when data from different years were used to train the model. Our results confirm that genotyping-by-sequencing is an effective tool to obtain genome-wide information for crops with complex genomes, that these data are efficient for predicting traits, and that correction of spatial variation is a crucial ingredient to increase prediction accuracy in genomic selection models.

  4. Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria.

    PubMed

    Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung

    2017-01-01

    Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association.

  5. Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria

    PubMed Central

    Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung

    2017-01-01

    Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association. PMID:28158221

  6. Multiple SNPs in Intron 41 of Thyroglobulin Gene Are Associated with Autoimmune Thyroid Disease in the Japanese Population

    PubMed Central

    Ban, Yoshiyuki; Tozaki, Teruaki; Taniyama, Matsuo; Skrabanek, Luce; Nakano, Yasuko; Ban, Yoshio; Hirano, Tsutomu

    2012-01-01

    Background The etiology of the autoimmune thyroid diseases (AITDs), Graves' disease (GD) and Hashimoto's thyroiditis (HT), is largely unknown. However, genetic susceptibility is believed to play a major role. Two whole genome scans from Japan and from the US identified a locus on chromosome 8q24 that showed evidence for linkage with AITD and HT. Recent studies have demonstrated an association between thyroglobulin (Tg) polymorphisms and AITD in Caucasians, suggesting that Tg is a susceptibility gene on 8q24. Objectives The objective of the study was to refine Tg association with AITD, by analyzing a panel of 25 SNPs across an extended 260 kb region of the Tg. Methods We studied 458 Japanese AITD patients (287 GD and 171 HT patients) and 221 matched Japanese control subjects in association studies. Case-control association studies were performed using 25 Tg single nucleotide polymorphisms (SNPs) chosen from a database of the Single Nucleotide Polymorphism Database (dbSNP). Haplotype analysis was undertaken using the computer program SNPAlyze version 7.0. Principal Findings and Conclusions In total, 5 SNPs revealed association with GD (P<0.05), with the strongest SNP associations at rs2256366 (P = 0.002) and rs2687836 (P = 0.0077), both located in intron 41 of the Tg gene. Because of the strong LD between these two strongest associated variants, we performed the haplotype analysis, and identified a major protective haplotype for GD (P = 0.001).These results suggested that the Tg gene is involved in susceptibility for GD and AITD in the Japanese. PMID:22662162

  7. Association of Sun Exposure, Skin Colour and Body Mass Index with Vitamin D Status in Individuals Who Are Morbidly Obese.

    PubMed

    Dix, Clare F; Bauer, Judith D; Martin, Ian; Rochester, Sharon; Duarte Romero, Briony; Prins, Johannes B; Wright, Olivia R L

    2017-10-04

    Vitamin D deficiency is a common issue, particularly in obese populations, and is tested by assessing serum 25(OH)D concentrations. This study aimed to identify factors that contribute to the vitamin D status in fifty morbidly obese individuals recruited prior to bariatric surgery. Data collected included serum 25(OH)D concentrations, dietary and supplement intake of vitamin D, sun exposure measures, skin colour via spectrophotometry, and genotype analysis of several single nucleotide polymorphisms in the vitamin D metabolism pathway. Results showed a significant correlation between serum 25(OH)D concentrations and age, and serum 25(OH)D and ITAC score (natural skin colour). Natural skin colour accounted for 13.5% of variation in serum 25(OH)D, with every 10° increase in ITAC score (i.e., lighter skin) leading to a 9 nmol/L decrease in serum 25(OH)D. Multiple linear regression using age, ITAC score, and average UV index in the three months prior to testing, significantly predicted serum 25(OH)D concentrations ( R ² = 29.7%). Single nucleotide polymorphisms for all vitamin D genes tested, showed lower serum 25(OH)D for those with the rare genotype compared to the common genotype; this was most pronounced for fok1 and rs4588 , where those with the rare genotype were insufficient (<50 nmol/L), and those with the common genotype were sufficient (≥50 nmol/L). Assessing vitamin D status in individuals with morbid obesity requires testing of 25(OH)D, but potential risk factors for this population include natural skin colour and age.

  8. Sudden infant death syndrome (SIDS) and polymorphisms in Monoamine oxidase A gene (MAOA): a revisit.

    PubMed

    Groß, Maximilian; Bajanowski, Thomas; Vennemann, Mechtild; Poetsch, Micaela

    2014-01-01

    Literature describes multiple possible links between genetic variations in the neuroadrenergic system and the occurrence of sudden infant death syndrome. The X-chromosomal Monoamine oxidase A (MAOA) is one of the genes with regulatory activity in the noradrenergic and serotonergic neuronal systems and a polymorphism of the promoter which affects the activity of this gene has been proclaimed to contribute significantly to the prevalence of sudden infant death syndrome (SIDS) in three studies from 2009, 2012 and 2013. However, these studies described different significant correlations regarding gender or age of children. Since several studies, suggesting associations between genetic variations and SIDS, were disproved by follow-up analysis, this study was conducted to take a closer look at the MAOA gene and its polymorphisms. The functional MAOA promoter length polymorphism was investigated in 261 SIDS cases and 93 control subjects. Moreover, the allele distribution of 12 coding and non-coding single nucleotide polymorphisms (SNPs) of the MAOA gene was examined in 285 SIDS cases and 93 controls by a minisequencing technique. In contrast to prior studies with fewer individuals, no significant correlations between the occurrence of SIDS and the frequency of allele variants of the promoter polymorphism could be demonstrated, even including the results from the abovementioned previous studies. Regarding the SNPs, three statistically significant associations were observed which had not been described before. This study clearly disproves interactions between MAOA promoter polymorphisms and SIDS, even if variations in single nucleotide polymorphisms of MAOA should be subjected to further analysis to clarify their impact on SIDS.

  9. Common rs5918 (PlA1/A2) polymorphism in the ITGB3 gene and risk of coronary artery disease

    PubMed Central

    Heidari, Mohammad Mehdi; Soheilyfar, Sorour

    2016-01-01

    Introduction The T to C transition at nucleotide 1565 of the human glycoprotein IIIa (ITGB3) gene represents a genetic polymorphism (PlA1/A2) that can influence both platelet activation and aggregation and that has been associated with many types of disease. Here, we present a newly designed multiplex tetra-primer amplification refractory mutation system – polymerase chain reaction (T-ARMS-PCR) for genotyping a single nucleotide polymorphism (SNP) (dbSNP ID: rs5918) in the human ITGB3 gene. Material and methods We set up T-ARMS-PCR for the rs5918 SNP in a single-step PCR and the results were validated by the PCR-RFLP method in 132 coronary artery disease (CAD) patients and 122 unrelated healthy individuals. Results Full accordance was found for genotype determination by the PCR-RFLP method. The multiple logistic regression analysis showed a significant association of the rs5918 polymorphism and CAD according to dominant and recessive models (dominant model OR: 2.40, 95% CI: 1.33–4.35; p = 0.003, recessive model OR: 4.71, 95% CI: 1.32–16.80; p = 0.0067). Conclusions Our T-ARMS-PCR in comparison with RFLP and allele-specific PCR is more advantageous because this PCR method allows the evaluation of both the wild type and the mutant allele in the same tube. Our results suggest that the rs5918 (PlA1/A2) polymorphism in the ITGB3 gene may contribute to the susceptibility of sporadic Iranian coronary artery disease (CAD) patients. PMID:28905013

  10. Financial and Psychological Risk Attitudes Associated with Two Single Nucleotide Polymorphisms in the Nicotine Receptor (CHRNA4) Gene

    PubMed Central

    Roe, Brian E.; Tilley, Michael R.; Gu, Howard H.; Beversdorf, David Q.; Sadee, Wolfgang; Haab, Timothy C.; Papp, Audrey C.

    2009-01-01

    With recent advances in understanding of the neuroscience of risk taking, attention is now turning to genetic factors that may contribute to individual heterogeneity in risk attitudes. In this paper we test for genetic associations with risk attitude measures derived from both the psychology and economics literature. To develop a long-term prospective study, we first evaluate both types of risk attitudes and find that the economic and psychological measures are poorly correlated, suggesting that different genetic factors may underlie human response to risk faced in different behavioral domains. We then examine polymorphisms in a spectrum of candidate genes that affect neurotransmitter systems influencing dopamine regulation or are thought to be associated with risk attitudes or impulsive disorders. Analysis of the genotyping data identified two single nucleotide polymorphisms (SNPs) in the gene encoding the alpha 4 nicotine receptor (CHRNA4, rs4603829 and rs4522666) that are significantly associated with harm avoidance, a risk attitude measurement drawn from the psychology literature. Novelty seeking, another risk attitude measure from the psychology literature, is associated with several COMT (catechol-O-methyl transferase) SNPs while economic risk attitude measures are associated with several VMAT2 (vesicular monoamine transporter) SNPs, but the significance of these associations did not withstand statistical adjustment for multiple testing and requires larger cohorts. These exploratory results provide a starting point for understanding the genetic basis of risk attitudes by considering the range of methods available for measuring risk attitudes and by searching beyond the traditional direct focus on dopamine and serotonin receptor and transporter genes. PMID:19693267

  11. Associations between Common Variants in Iron-Related Genes with Haematological Traits in Populations of African Ancestry.

    PubMed

    Gichohi-Wainaina, Wanjiku N; Tanaka, Toshiko; Towers, G Wayne; Verhoef, Hans; Veenemans, Jacobien; Talsma, Elise F; Harryvan, Jan; Boekschoten, Mark V; Feskens, Edith J; Melse-Boonstra, Alida

    2016-01-01

    Large genome-wide association (GWA) studies of European ancestry individuals have identified multiple genetic variants influencing iron status. Studies on the generalizability of these associations to African ancestry populations have been limited. These studies are important given interethnic differences in iron status and the disproportionate burden of iron deficiency among African ancestry populations. We tested the associations of 20 previously identified iron status-associated single nucleotide polymorphisms (SNPs) in 628 Kenyans, 609 Tanzanians, 608 South Africans and 228 African Americans. In each study, we examined the associations present between 20 SNPs with ferritin and haemoglobin, adjusting for age, sex and CRP levels. In the meta analysis including all 4 African ancestry cohorts, we replicated previously reported associations with lowered haemoglobin concentrations for rs2413450 (β = -0.19, P = 0.02) and rs4820268 (β = -0.16, P = 0.04) in TMPRSS6. An association with increased ferritin concentrations was also confirmed for rs1867504 in TF (β = 1.04, P = <0.0001) in the meta analysis including the African cohorts only. In all meta analyses, we only replicated 4 of the 20 single nucleotide polymorphisms reported to be associated with iron status in large GWA studies of European ancestry individuals. While there is now evidence for the associations of a number of genetic variants with iron status in both European and African ancestry populations, the considerable lack of concordance highlights the importance of continued ancestry-specific studies to elucidate the genetic underpinnings of iron status in ethnically diverse populations.

  12. Associations between Common Variants in Iron-Related Genes with Haematological Traits in Populations of African Ancestry

    PubMed Central

    Tanaka, Toshiko; Towers, G. Wayne; Verhoef, Hans; Veenemans, Jacobien; Talsma, Elise F.; Harryvan, Jan; Boekschoten, Mark V.; Feskens, Edith J.; Melse-Boonstra, Alida

    2016-01-01

    Background Large genome-wide association (GWA) studies of European ancestry individuals have identified multiple genetic variants influencing iron status. Studies on the generalizability of these associations to African ancestry populations have been limited. These studies are important given interethnic differences in iron status and the disproportionate burden of iron deficiency among African ancestry populations. Methods We tested the associations of 20 previously identified iron status-associated single nucleotide polymorphisms (SNPs) in 628 Kenyans, 609 Tanzanians, 608 South Africans and 228 African Americans. In each study, we examined the associations present between 20 SNPs with ferritin and haemoglobin, adjusting for age, sex and CRP levels. Results In the meta analysis including all 4 African ancestry cohorts, we replicated previously reported associations with lowered haemoglobin concentrations for rs2413450 (β = -0.19, P = 0.02) and rs4820268 (β = -0.16, P = 0.04) in TMPRSS6. An association with increased ferritin concentrations was also confirmed for rs1867504 in TF (β = 1.04, P = <0.0001) in the meta analysis including the African cohorts only. Conclusions In all meta analyses, we only replicated 4 of the 20 single nucleotide polymorphisms reported to be associated with iron status in large GWA studies of European ancestry individuals. While there is now evidence for the associations of a number of genetic variants with iron status in both European and African ancestry populations, the considerable lack of concordance highlights the importance of continued ancestry-specific studies to elucidate the genetic underpinnings of iron status in ethnically diverse populations. PMID:27332551

  13. Demonstration of protein-based human identification using the hair shaft proteome [Protein-based human identification: A proof of concept using the hair shaft proteome

    DOE PAGES

    Parker, Glendon J.; Leppert, Tami; Anex, Deon S.; ...

    2016-09-07

    Human identification from biological material is largely dependent on the ability to characterize genetic polymorphisms in DNA. Unfortunately, DNA can degrade in the environment, sometimes below the level at which it can be amplified by PCR. Protein however is chemically more robust than DNA and can persist for longer periods. Protein also contains genetic variation in the form of single amino acid polymorphisms. These can be used to infer the status of non-synonymous single nucleotide polymorphism alleles. To demonstrate this, we used mass spectrometry-based shotgun proteomics to characterize hair shaft proteins in 66 European-American subjects. A total of 596 singlemore » nucleotide polymorphism alleles were correctly imputed in 32 loci from 22 genes of subjects’ DNA and directly validated using Sanger sequencing. Estimates of the probability of resulting individual non-synonymous single nucleotide polymorphism allelic profiles in the European population, using the product rule, resulted in a maximum power of discrimination of 1 in 12,500. Imputed non-synonymous single nucleotide polymorphism profiles from European–American subjects were considerably less frequent in the African population (maximum likelihood ratio = 11,000). The converse was true for hair shafts collected from an additional 10 subjects with African ancestry, where some profiles were more frequent in the African population. Genetically variant peptides were also identified in hair shaft datasets from six archaeological skeletal remains (up to 260 years old). Furthermore, this study demonstrates that quantifiable measures of identity discrimination and biogeographic background can be obtained from detecting genetically variant peptides in hair shaft protein, including hair from bioarchaeological contexts.« less

  14. Refactoring the Genetic Code for Increased Evolvability

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pines, Gur; Winkler, James D.; Pines, Assaf

    ABSTRACT The standard genetic code is robust to mutations during transcription and translation. Point mutations are likely to be synonymous or to preserve the chemical properties of the original amino acid. Saturation mutagenesis experiments suggest that in some cases the best-performing mutant requires replacement of more than a single nucleotide within a codon. These replacements are essentially inaccessible to common error-based laboratory engineering techniques that alter a single nucleotide per mutation event, due to the extreme rarity of adjacent mutations. In this theoretical study, we suggest a radical reordering of the genetic code that maximizes the mutagenic potential of singlemore » nucleotide replacements. We explore several possible genetic codes that allow a greater degree of accessibility to the mutational landscape and may result in a hyperevolvable organism that could serve as an ideal platform for directed evolution experiments. We then conclude by evaluating the challenges of constructing such recoded organisms and their potential applications within the field of synthetic biology. IMPORTANCE The conservative nature of the genetic code prevents bioengineers from efficiently accessing the full mutational landscape of a gene via common error-prone methods. Here, we present two computational approaches to generate alternative genetic codes with increased accessibility. These new codes allow mutational transitions to a larger pool of amino acids and with a greater extent of chemical differences, based on a single nucleotide replacement within the codon, thus increasing evolvability both at the single-gene and at the genome levels. Given the widespread use of these techniques for strain and protein improvement, along with more fundamental evolutionary biology questions, the use of recoded organisms that maximize evolvability should significantly improve the efficiency of directed evolution, library generation, and fitness maximization.« less

  15. Demonstration of protein-based human identification using the hair shaft proteome [Protein-based human identification: A proof of concept using the hair shaft proteome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Parker, Glendon J.; Leppert, Tami; Anex, Deon S.

    Human identification from biological material is largely dependent on the ability to characterize genetic polymorphisms in DNA. Unfortunately, DNA can degrade in the environment, sometimes below the level at which it can be amplified by PCR. Protein however is chemically more robust than DNA and can persist for longer periods. Protein also contains genetic variation in the form of single amino acid polymorphisms. These can be used to infer the status of non-synonymous single nucleotide polymorphism alleles. To demonstrate this, we used mass spectrometry-based shotgun proteomics to characterize hair shaft proteins in 66 European-American subjects. A total of 596 singlemore » nucleotide polymorphism alleles were correctly imputed in 32 loci from 22 genes of subjects’ DNA and directly validated using Sanger sequencing. Estimates of the probability of resulting individual non-synonymous single nucleotide polymorphism allelic profiles in the European population, using the product rule, resulted in a maximum power of discrimination of 1 in 12,500. Imputed non-synonymous single nucleotide polymorphism profiles from European–American subjects were considerably less frequent in the African population (maximum likelihood ratio = 11,000). The converse was true for hair shafts collected from an additional 10 subjects with African ancestry, where some profiles were more frequent in the African population. Genetically variant peptides were also identified in hair shaft datasets from six archaeological skeletal remains (up to 260 years old). Furthermore, this study demonstrates that quantifiable measures of identity discrimination and biogeographic background can be obtained from detecting genetically variant peptides in hair shaft protein, including hair from bioarchaeological contexts.« less

  16. Refactoring the Genetic Code for Increased Evolvability

    DOE PAGES

    Pines, Gur; Winkler, James D.; Pines, Assaf; ...

    2017-11-14

    ABSTRACT The standard genetic code is robust to mutations during transcription and translation. Point mutations are likely to be synonymous or to preserve the chemical properties of the original amino acid. Saturation mutagenesis experiments suggest that in some cases the best-performing mutant requires replacement of more than a single nucleotide within a codon. These replacements are essentially inaccessible to common error-based laboratory engineering techniques that alter a single nucleotide per mutation event, due to the extreme rarity of adjacent mutations. In this theoretical study, we suggest a radical reordering of the genetic code that maximizes the mutagenic potential of singlemore » nucleotide replacements. We explore several possible genetic codes that allow a greater degree of accessibility to the mutational landscape and may result in a hyperevolvable organism that could serve as an ideal platform for directed evolution experiments. We then conclude by evaluating the challenges of constructing such recoded organisms and their potential applications within the field of synthetic biology. IMPORTANCE The conservative nature of the genetic code prevents bioengineers from efficiently accessing the full mutational landscape of a gene via common error-prone methods. Here, we present two computational approaches to generate alternative genetic codes with increased accessibility. These new codes allow mutational transitions to a larger pool of amino acids and with a greater extent of chemical differences, based on a single nucleotide replacement within the codon, thus increasing evolvability both at the single-gene and at the genome levels. Given the widespread use of these techniques for strain and protein improvement, along with more fundamental evolutionary biology questions, the use of recoded organisms that maximize evolvability should significantly improve the efficiency of directed evolution, library generation, and fitness maximization.« less

  17. Transient state kinetics of transcription elongation by T7 RNA polymerase.

    PubMed

    Anand, Vasanti Subramanian; Patel, Smita S

    2006-11-24

    The single subunit DNA-dependent RNA polymerase (RNAP) from bacteriophage T7 catalyzes both promoter-dependent transcription initiation and promoter-independent elongation. Using a promoter-free substrate, we have dissected the kinetic pathway of single nucleotide incorporation during elongation. We show that T7 RNAP undergoes a slow conformational change (0.01-0.03 s(-1)) to form an elongation competent complex with the promoter-free substrate (dissociation constant (Kd) of 96 nM). The complex binds to a correct NTP (Kd of 80 microM) and incorporates the nucleoside monophosphate (NMP) into RNA primer very efficiently (220 s(-1) at 25 degrees C). An overall free energy change (-5.5 kcal/mol) and internal free energy change (-3.7 kcal/mol) of single NMP incorporation was calculated from the measured equilibrium constants. In the presence of inorganic pyrophosphate (PPi), the elongation complex catalyzes the reverse pyrophosphorolysis reaction at a maximum rate of 0.8 s(-1) with PPi Kd of 1.2 mM. Several experiments were designed to investigate the rate-limiting step in the pathway of single nucleotide addition. Acid-quench and pulse-chase kinetics indicated that an isomerization step before chemistry is rate-limiting. The very similar rate constants of sequential incorporation of two nucleotides indicated that the steps after chemistry are fast. Based on available data, we propose that the preinsertion to insertion isomerization of NTP observed in the crystallographic studies of T7 RNAP is a likely candidate for the rate-limiting step. The studies here provide a kinetic framework to investigate structure-function and fidelity of RNA synthesis and to further explore the role of the conformational change in nucleotide selection during RNA synthesis.

  18. European multiple sclerosis risk variants in the south Asian population.

    PubMed

    Pandit, Lekha; Ban, Maria; Beecham, Ashley Harris; McCauley, Jacob L; Sawcer, Stephen; D'Cunha, Anitha; Malli, Chaitra; Malik, Omar

    2016-10-01

    In less than a decade, genomewide association studies have identified over 100 single-nucleotide variants that are associated with increased risk of developing multiple sclerosis. However, since these studies have focused almost exclusively on European populations, it is unclear what role these variants might play in determining risk in other ethnic groups. To assess the effects of European multiple sclerosis-associated risk variants in the south Asian population. Using a combination of chip-based genotyping and next-generation sequencing, we have assessed 109 European-associated variants in a total of 270 cases and 555 controls from the south Asian population. We found that two-thirds of the tested variants (72/109) showed over representation of the European risk allele in south Asian cases (p < 0.0003). In the rest of the Immunochip array, the most associated variant was rs7318477 which maps close to TNFSF13B, the gene for the B-cell-related protein BAFF. Our data indicate substantial overlap in genetic risk architecture between Europeans and south Asians and suggest that the aetiology of the disease may be largely independent of ethnicity. © The Author(s), 2016.

  19. Pervasive sharing of genetic effects in autoimmune disease.

    PubMed

    Cotsapas, Chris; Voight, Benjamin F; Rossin, Elizabeth; Lage, Kasper; Neale, Benjamin M; Wallace, Chris; Abecasis, Gonçalo R; Barrett, Jeffrey C; Behrens, Timothy; Cho, Judy; De Jager, Philip L; Elder, James T; Graham, Robert R; Gregersen, Peter; Klareskog, Lars; Siminovitch, Katherine A; van Heel, David A; Wijmenga, Cisca; Worthington, Jane; Todd, John A; Hafler, David A; Rich, Stephen S; Daly, Mark J

    2011-08-01

    Genome-wide association (GWA) studies have identified numerous, replicable, genetic associations between common single nucleotide polymorphisms (SNPs) and risk of common autoimmune and inflammatory (immune-mediated) diseases, some of which are shared between two diseases. Along with epidemiological and clinical evidence, this suggests that some genetic risk factors may be shared across diseases-as is the case with alleles in the Major Histocompatibility Locus. In this work we evaluate the extent of this sharing for 107 immune disease-risk SNPs in seven diseases: celiac disease, Crohn's disease, multiple sclerosis, psoriasis, rheumatoid arthritis, systemic lupus erythematosus, and type 1 diabetes. We have developed a novel statistic for Cross Phenotype Meta-Analysis (CPMA) which detects association of a SNP to multiple, but not necessarily all, phenotypes. With it, we find evidence that 47/107 (44%) immune-mediated disease risk SNPs are associated to multiple-but not all-immune-mediated diseases (SNP-wise P(CPMA)<0.01). We also show that distinct groups of interacting proteins are encoded near SNPs which predispose to the same subsets of diseases; we propose these as the mechanistic basis of shared disease risk. We are thus able to leverage genetic data across diseases to construct biological hypotheses about the underlying mechanism of pathogenesis.

  20. Candida kantuleensis sp. nov., a d-xylose-fermenting yeast species isolated from peat in a tropical peat swamp forest.

    PubMed

    Nitiyon, Sukanya; Khunnamwong, Pannida; Lertwattanasakul, Noppon; Limtong, Savitree

    2018-05-24

    Three strains (DMKU-XE11 T , DMKU-XE15 and DMKU-XE20) representing a single novel anamorphic and d-xylose-fermenting yeast species were obtained from three peat samples collected from Khan Thulee peat swamp forest in Surat Thani province, Thailand. The strains differed from each other by one to two nucleotide substitutions in the sequences of the D1/D2 region of the large subunit (LSU) rRNA gene and zero to one nucleotide substitution in the internal transcribed spacer (ITS) region. Phylogenetic analysis based on the combined sequences of the ITS and the D1/D2 regions showed that the three strains represented a single Candida species that was distinct from the other related species in the Lodderomyces/Candida albicans clade. The three strains form a subclade with the other Candida species including Candida sanyaensis, Candida tropicalis and Candida sojae. C. sanyaensis was the most closely related species, with 2.1-2.4 % nucleotide substitutions in the D1/D2 region of the LSU rRNA gene, and 3.8-4.0 % nucleotide substitutions in the ITS region. The three strains (DMKU-XE11 T , DMKU-XE15 and DMKU-XE20) were assigned as a single novel species, which was named Candida kantuleensis sp. nov. The type strain is DMKU-XE11 T (=CBS 15219 T =TBRC 7764 T ). The MycoBank number for C. kantuleensis sp. nov. is MB 824179.

  1. IL-TIF/IL-22: genomic organization and mapping of the human and mouse genes.

    PubMed

    Dumoutier, L; Van Roost, E; Ameye, G; Michaux, L; Renauld, J C

    2000-12-01

    IL-TIF is a new cytokine originally identified as a gene induced by IL-9 in murine T lymphocytes, and showing 22% amino acid identity with IL-10. Here, we report the sequence and organization of the mouse and human IL-TIF genes, which both consist of 6 exons spreading over approximately 6 Kb. The IL-TIF gene is a single copy gene in humans, and is located on chromosome 12q15, at 90 Kb from the IFN gamma gene, and at 27 Kb from the AK155 gene, which codes for another IL-10-related cytokine. In the mouse, the IL-TIF gene is located on chromosome 10, also in the same region as the IFN gamma gene. Although it is a single copy gene in BALB/c and DBA/2 mice, the IL-TIF gene is duplicated in other strains such as C57Bl/6, FVB and 129. The two copies, which show 98% nucleotide identity in the coding region, were named IL-TIF alpha and IL-TIF beta. Beside single nucleotide variations, they differ by a 658 nucleotide deletion in IL-TIF beta, including the first non-coding exon and 603 nucleotides from the promoter. A DNA fragment corresponding to this deletion was sufficient to confer IL-9-regulated expression of a luciferase reporter plasmid, suggesting that the IL-TIF beta gene is either differentially regulated, or not expressed at all.

  2. Evaluation of targeted exome sequencing for 28 protein-based blood group systems, including the homologous gene systems, for blood group genotyping.

    PubMed

    Schoeman, Elizna M; Lopez, Genghis H; McGowan, Eunike C; Millard, Glenda M; O'Brien, Helen; Roulis, Eileen V; Liew, Yew-Wah; Martin, Jacqueline R; McGrath, Kelli A; Powley, Tanya; Flower, Robert L; Hyland, Catherine A

    2017-04-01

    Blood group single nucleotide polymorphism genotyping probes for a limited range of polymorphisms. This study investigated whether massively parallel sequencing (also known as next-generation sequencing), with a targeted exome strategy, provides an extended blood group genotype and the extent to which massively parallel sequencing correctly genotypes in homologous gene systems, such as RH and MNS. Donor samples (n = 28) that were extensively phenotyped and genotyped using single nucleotide polymorphism typing, were analyzed using the TruSight One Sequencing Panel and MiSeq platform. Genes for 28 protein-based blood group systems, GATA1, and KLF1 were analyzed. Copy number variation analysis was used to characterize complex structural variants in the GYPC and RH systems. The average sequencing depth per target region was 66.2 ± 39.8. Each sample harbored on average 43 ± 9 variants, of which 10 ± 3 were used for genotyping. For the 28 samples, massively parallel sequencing variant sequences correctly matched expected sequences based on single nucleotide polymorphism genotyping data. Copy number variation analysis defined the Rh C/c alleles and complex RHD hybrids. Hybrid RHD*D-CE-D variants were correctly identified, but copy number variation analysis did not confidently distinguish between D and CE exon deletion versus rearrangement. The targeted exome sequencing strategy employed extended the range of blood group genotypes detected compared with single nucleotide polymorphism typing. This single-test format included detection of complex MNS hybrid cases and, with copy number variation analysis, defined RH hybrid genes along with the RHCE*C allele hitherto difficult to resolve by variant detection. The approach is economical compared with whole-genome sequencing and is suitable for a red blood cell reference laboratory setting. © 2017 AABB.

  3. CoMet: a workflow using contig coverage and composition for binning a metagenomic sample with high precision.

    PubMed

    Herath, Damayanthi; Tang, Sen-Lin; Tandon, Kshitij; Ackland, David; Halgamuge, Saman Kumara

    2017-12-28

    In metagenomics, the separation of nucleotide sequences belonging to an individual or closely matched populations is termed binning. Binning helps the evaluation of underlying microbial population structure as well as the recovery of individual genomes from a sample of uncultivable microbial organisms. Both supervised and unsupervised learning methods have been employed in binning; however, characterizing a metagenomic sample containing multiple strains remains a significant challenge. In this study, we designed and implemented a new workflow, Coverage and composition based binning of Metagenomes (CoMet), for binning contigs in a single metagenomic sample. CoMet utilizes coverage values and the compositional features of metagenomic contigs. The binning strategy in CoMet includes the initial grouping of contigs in guanine-cytosine (GC) content-coverage space and refinement of bins in tetranucleotide frequencies space in a purely unsupervised manner. With CoMet, the clustering algorithm DBSCAN is employed for binning contigs. The performances of CoMet were compared against four existing approaches for binning a single metagenomic sample, including MaxBin, Metawatt, MyCC (default) and MyCC (coverage) using multiple datasets including a sample comprised of multiple strains. Binning methods based on both compositional features and coverages of contigs had higher performances than the method which is based only on compositional features of contigs. CoMet yielded higher or comparable precision in comparison to the existing binning methods on benchmark datasets of varying complexities. MyCC (coverage) had the highest ranking score in F1-score. However, the performances of CoMet were higher than MyCC (coverage) on the dataset containing multiple strains. Furthermore, CoMet recovered contigs of more species and was 18 - 39% higher in precision than the compared existing methods in discriminating species from the sample of multiple strains. CoMet resulted in higher precision than MyCC (default) and MyCC (coverage) on a real metagenome. The approach proposed with CoMet for binning contigs, improves the precision of binning while characterizing more species in a single metagenomic sample and in a sample containing multiple strains. The F1-scores obtained from different binning strategies vary with different datasets; however, CoMet yields the highest F1-score with a sample comprised of multiple strains.

  4. PREMIX: PRivacy-preserving EstiMation of Individual admiXture.

    PubMed

    Chen, Feng; Dow, Michelle; Ding, Sijie; Lu, Yao; Jiang, Xiaoqian; Tang, Hua; Wang, Shuang

    2016-01-01

    In this paper we proposed a framework: PRivacy-preserving EstiMation of Individual admiXture (PREMIX) using Intel software guard extensions (SGX). SGX is a suite of software and hardware architectures to enable efficient and secure computation over confidential data. PREMIX enables multiple sites to securely collaborate on estimating individual admixture within a secure enclave inside Intel SGX. We implemented a feature selection module to identify most discriminative Single Nucleotide Polymorphism (SNP) based on informativeness and an Expectation Maximization (EM)-based Maximum Likelihood estimator to identify the individual admixture. Experimental results based on both simulation and 1000 genome data demonstrated the efficiency and accuracy of the proposed framework. PREMIX ensures a high level of security as all operations on sensitive genomic data are conducted within a secure enclave using SGX.

  5. Complex Patterns of Local Adaptation in Teosinte

    PubMed Central

    Pyhäjärvi, Tanja; Hufford, Matthew B.; Mezmouk, Sofiane; Ross-Ibarra, Jeffrey

    2013-01-01

    Populations of widely distributed species encounter and must adapt to local environmental conditions. However, comprehensive characterization of the genetic basis of adaptation is demanding, requiring genome-wide genotype data, multiple sampled populations, and an understanding of population structure and potential selection pressures. Here, we used single-nucleotide polymorphism genotyping and data on numerous environmental variables to describe the genetic basis of local adaptation in 21 populations of teosinte, the wild ancestor of maize. We found complex hierarchical genetic structure created by altitude, dispersal events, and admixture among subspecies, which complicated identification of locally beneficial alleles. Patterns of linkage disequilibrium revealed four large putative inversion polymorphisms showing clinal patterns of frequency. Population differentiation and environmental correlations suggest that both inversions and intergenic polymorphisms are involved in local adaptation. PMID:23902747

  6. Binding and Translocation of Termination Factor Rho Studied at the Single-Molecule Level

    PubMed Central

    Koslover, Daniel J.; Fazal, Furqan M.; Mooney, Rachel A.; Landick, Robert; Block, Steven M.

    2012-01-01

    Rho termination factor is an essential hexameric helicase responsible for terminating 20–50% of all mRNA synthesis in E. coli. We used single- molecule force spectroscopy to investigate Rho-RNA binding interactions at the Rho- utilization (rut) site of the ? tR1 terminator. Our results are consistent with Rho complexes adopting two states, one that binds 57 ±2 nucleotides of RNA across all six of the Rho primary binding sites, and another that binds 85 ±2 nucleotides at the six primary sites plus a single secondary site situated at the center of the hexamer. The single-molecule data serve to establish that Rho translocates 5′-to-3′ towards RNA polymerase (RNAP) by a tethered-tracking mechanism, looping out the intervening RNA between the rut site and RNAP. These findings lead to a general model for Rho binding and translocation, and establish a novel experimental approach that should facilitate additional single- molecule studies of RNA-binding proteins. PMID:22885804

  7. [The joint applications of DNA chips and single nucleotide polymorphisms in forensic science].

    PubMed

    Bai, Peng; Tian, Li; Zhou, Xue-ping

    2005-05-01

    DNA chip technology, being a new high-technology, shows its vigorous life and rapid growth. Single Nucleotide Polymorphisms (SNPs) is the most common diversity in the human genome. It provides suitable genetic markers which play a key role in disease linkage study, pharmacogenomics, forensic medicine, population evolution and immigration study. Their advantage such as being analyzed with DNA chips technology, is predicted to play an important role in the field of forensic medicine, especially in paternity test and individual identification. This report mainly reviews the characteristics of DNA chip and SNPs, and their joint applications in the practice of forensic medicine.

  8. Testing for genetic association taking into account phenotypic information of relatives.

    PubMed

    Uh, Hae-Won; Wijk, Henk Jan van der; Houwing-Duistermaat, Jeanine J

    2009-12-15

    We investigated efficient case-control association analysis using family data. The outcome of interest was coronary heart disease. We employed existing and new methods that take into account the correlations among related individuals to obtain the proper type I error rates. The methods considered for autosomal single-nucleotide polymorphisms were: 1) generalized estimating equations-based methods, 2) variance-modified Cochran-Armitage (MCA) trend test incorporating kinship coefficients, and 3) genotypic modified quasi-likelihood score test. Additionally, for X-linked single-nucleotide polymorphisms we proposed a two-degrees-of-freedom test. Performance of these methods was tested using Framingham Heart Study 500 k array data.

  9. Simultaneous genotyping of single-nucleotide polymorphisms in alcoholism-related genes using duplex and triplex allele-specific PCR with two-step thermal cycles.

    PubMed

    Shirasu, Naoto; Kuroki, Masahide

    2014-01-01

    We developed a time- and cost-effective multiplex allele-specific polymerase chain reaction (AS-PCR) method based on the two-step PCR thermal cycles for genotyping single-nucleotide polymorphisms in three alcoholism-related genes: alcohol dehydrogenase 1B, aldehyde dehydrogenase 2 and μ-opioid receptor. Applying MightyAmp(®) DNA polymerase with optimized AS-primers and PCR conditions enabled us to achieve effective and selective amplification of the target alleles from alkaline lysates of a human hair root, and simultaneously to determine the genotypes within less than 1.5 h using minimal lab equipment.

  10. Gene-gene, gene-environment, gene-nutrient interactions and single nucleotide polymorphisms of inflammatory cytokines.

    PubMed

    Nadeem, Amina; Mumtaz, Sadaf; Naveed, Abdul Khaliq; Aslam, Muhammad; Siddiqui, Arif; Lodhi, Ghulam Mustafa; Ahmad, Tausif

    2015-05-15

    Inflammation plays a significant role in the etiology of type 2 diabetes mellitus (T2DM). The rise in the pro-inflammatory cytokines is the essential step in glucotoxicity and lipotoxicity induced mitochondrial injury, oxidative stress and beta cell apoptosis in T2DM. Among the recognized markers are interleukin (IL)-6, IL-1, IL-10, IL-18, tissue necrosis factor-alpha (TNF-α), C-reactive protein, resistin, adiponectin, tissue plasminogen activator, fibrinogen and heptoglobins. Diabetes mellitus has firm genetic and very strong environmental influence; exhibiting a polygenic mode of inheritance. Many single nucleotide polymorphisms (SNPs) in various genes including those of pro and anti-inflammatory cytokines have been reported as a risk for T2DM. Not all the SNPs have been confirmed by unifying results in different studies and wide variations have been reported in various ethnic groups. The inter-ethnic variations can be explained by the fact that gene expression may be regulated by gene-gene, gene-environment and gene-nutrient interactions. This review highlights the impact of these interactions on determining the role of single nucleotide polymorphism of IL-6, TNF-α, resistin and adiponectin in pathogenesis of T2DM.

  11. Discovery, genotyping and characterization of structural variation and novel sequence at single nucleotide resolution from de novo genome assemblies on a population scale.

    PubMed

    Liu, Siyang; Huang, Shujia; Rao, Junhua; Ye, Weijian; Krogh, Anders; Wang, Jun

    2015-01-01

    Comprehensive recognition of genomic variation in one individual is important for understanding disease and developing personalized medication and treatment. Many tools based on DNA re-sequencing exist for identification of single nucleotide polymorphisms, small insertions and deletions (indels) as well as large deletions. However, these approaches consistently display a substantial bias against the recovery of complex structural variants and novel sequence in individual genomes and do not provide interpretation information such as the annotation of ancestral state and formation mechanism. We present a novel approach implemented in a single software package, AsmVar, to discover, genotype and characterize different forms of structural variation and novel sequence from population-scale de novo genome assemblies up to nucleotide resolution. Application of AsmVar to several human de novo genome assemblies captures a wide spectrum of structural variants and novel sequences present in the human population in high sensitivity and specificity. Our method provides a direct solution for investigating structural variants and novel sequences from de novo genome assemblies, facilitating the construction of population-scale pan-genomes. Our study also highlights the usefulness of the de novo assembly strategy for definition of genome structure.

  12. Maximization of Markers Linked in Coupling for Tetraploid Potatoes via Monoparental Haploids

    PubMed Central

    Bartkiewicz, Annette M.; Chilla, Friederike; Terefe-Ayana, Diro; Lübeck, Jens; Strahwald, Josef; Tacke, Eckhard; Hofferbert, Hans-Reinhard; Linde, Marcus; Debener, Thomas

    2018-01-01

    Haploid potato populations derived from a single tetraploid donor constitute an efficient strategy to analyze markers segregating from a single donor genotype. Analysis of marker segregation in populations derived from crosses between polysomic tetraploids is complicated by a maximum of eight segregating alleles, multiple dosages of the markers and problems related to linkage analysis of marker segregation in repulsion. Here, we present data on two monoparental haploid populations generated by prickle pollination of two tetraploid cultivars with Solanum phureja and genotyped with the 12.8 k SolCAP single nucleotide polymorphism (SNP) array. We show that in a population of monoparental haploids, the number of biallelic SNP markers segregating in linkage to loci from the tetraploid donor genotype is much larger than in putative crosses of this genotype to a diverse selection of 125 tetraploid cultivars. Although this strategy is more laborious than conventional breeding, the generation of haploid progeny for efficient marker analysis is straightforward if morphological markers and flow cytometry are utilized to select true haploid progeny. The level of introgressed fragments from S. phureja, the haploid inducer, is very low, supporting its suitability for genetic analysis. Mapping with single-dose markers allowed the analysis of quantitative trait loci (QTL) for four phenotypic traits. PMID:29868076

  13. Formation of tamoxifen-DNA adducts in multiple organs of adult female cynomolgus monkeys dosed with tamoxifen for 30 days.

    PubMed

    Schild, Laura J; Divi, Rao L; Beland, Frederick A; Churchwell, Mona I; Doerge, Daniel R; Gamboa da Costa, Gonçalo; Marques, M Matilde; Poirier, Miriam C

    2003-09-15

    The use of the antiestrogen tamoxifen (TAM) is associated with an increase in endometrial cancer. TAM-induced endometrial carcinogenesis may proceed through a genotoxin-mediated pathway, although the detection of endometrial TAM-DNA adducts in exposed women is still controversial. In this study, a monkey model has been used to investigate the question of TAM-DNA adduct formation in primates. Two methods have been used to determine TAM-DNA adducts: a TAM-DNA chemiluminescence immunoassay (TAM-DNA CIA), using an antiserum that has specificity for (E)-alpha-(deoxyguanosin-N(2)-yl)-tamoxifen (dG-TAM) and (E)-alpha-(deoxyguanosin-N(2)-yl)-N-desmethyltamoxifen (dG-desmethyl-TAM) and electrospray ionization tandem mass spectrometry (ES-MS/MS) coupled with on-line sample preparation and high-performance liquid chromatography (HPLC). Mature (19 year old) cynomolgus monkeys were given either vehicle control (n = 1) or TAM (n = 3) twice daily for a total dose of 2 mg of TAM/kg body weight (bw)/day for 30 days by naso-gastric intubation. Tissues were harvested, and DNA was isolated from uterus, ovary, liver, brain cortex, and kidney. By TAM-DNA CIA, values for uterine TAM-DNA adducts in two monkeys were 0.9 and 1.7 adducts/10(8) nucleotides, whereas values for ovarian TAM-DNA adducts in the same animals were 0.4 and 0.5 adducts/10(8) nucleotides. Liver, brain cortex, and kidney DNA samples from the three exposed monkeys had TAM-DNA levels of 2.1-4.2 adducts/10(8) nucleotides, 0.4-5.0 adducts/10(8) nucleotides, and 0.7-2.1 adducts/10(8) nucleotides, respectively. By HPLC-ES-MS/MS, the levels of TAM-DNA adducts detected in all tissues were comparable with those observed by TAM-DNA CIA. Thus, values for uterine TAM-DNA adducts ranged from 0.5 to 1.4 adducts/10(8) nucleotides, whereas values for ovarian TAM-DNA adducts, measurable in two monkeys, were 0.2 and 0.3 adducts/10(8) nucleotides. Liver DNA contained the highest TAM-DNA adduct levels (7.0-11.1 adducts/10(8) nucleotides), whereas brain cortex DNA contained lower adduct levels (0.6-4.8 adducts/10(8) nucleotides) and the lowest levels were measured in the kidney (0.2-0.4 adducts/10(8) nucleotides). This study indicates that cynomolgus monkeys are capable of metabolizing TAM to genotoxic intermediates that form TAM-DNA adducts in multiple tissues.

  14. Genome-wide SNP data suggest complex ancestry of sympatric North Pacific killer whale ecotypes

    PubMed Central

    Foote, A D; Morin, P A

    2016-01-01

    Three ecotypes of killer whale occur in partial sympatry in the North Pacific. Individuals assortatively mate within the same ecotype, resulting in correlated ecological and genetic differentiation. A key question is whether this pattern of evolutionary divergence is an example of incipient sympatric speciation from a single panmictic ancestral population, or whether sympatry could have resulted from multiple colonisations of the North Pacific and secondary contact between ecotypes. Here, we infer multilocus coalescent trees from >1000 nuclear single-nucleotide polymorphisms (SNPs) and find evidence of incomplete lineage sorting so that the genealogies of SNPs do not all conform to a single topology. To disentangle whether uncertainty in the phylogenetic inference of the relationships among ecotypes could also result from ancestral admixture events we reconstructed the relationship among the ecotypes as an admixture graph and estimated f4-statistics using TreeMix. The results were consistent with episodes of admixture between two of the North Pacific ecotypes and the two outgroups (populations from the Southern Ocean and the North Atlantic). Gene flow may have occurred via unsampled ‘ghost' populations rather than directly between the populations sampled here. Our results indicate that because of ancestral admixture events and incomplete lineage sorting, a single bifurcating tree does not fully describe the relationship among these populations. The data are therefore most consistent with the genomic variation among North Pacific killer whale ecotypes resulting from multiple colonisation events, and secondary contact may have facilitated evolutionary divergence. Thus, the present-day populations of North Pacific killer whale ecotypes have a complex ancestry, confounding the tree-based inference of ancestral geography. PMID:27485668

  15. Reconstructing Native American population history.

    PubMed

    Reich, David; Patterson, Nick; Campbell, Desmond; Tandon, Arti; Mazieres, Stéphane; Ray, Nicolas; Parra, Maria V; Rojas, Winston; Duque, Constanza; Mesa, Natalia; García, Luis F; Triana, Omar; Blair, Silvia; Maestre, Amanda; Dib, Juan C; Bravi, Claudio M; Bailliet, Graciela; Corach, Daniel; Hünemeier, Tábita; Bortolini, Maria Cátira; Salzano, Francisco M; Petzl-Erler, María Luiza; Acuña-Alonzo, Victor; Aguilar-Salinas, Carlos; Canizales-Quinteros, Samuel; Tusié-Luna, Teresa; Riba, Laura; Rodríguez-Cruz, Maricela; Lopez-Alarcón, Mardia; Coral-Vazquez, Ramón; Canto-Cetina, Thelma; Silva-Zolezzi, Irma; Fernandez-Lopez, Juan Carlos; Contreras, Alejandra V; Jimenez-Sanchez, Gerardo; Gómez-Vázquez, Maria José; Molina, Julio; Carracedo, Angel; Salas, Antonio; Gallo, Carla; Poletti, Giovanni; Witonsky, David B; Alkorta-Aranburu, Gorka; Sukernik, Rem I; Osipova, Ludmila; Fedorova, Sardana A; Vasquez, René; Villena, Mercedes; Moreau, Claudia; Barrantes, Ramiro; Pauls, David; Excoffier, Laurent; Bedoya, Gabriel; Rothhammer, Francisco; Dugoujon, Jean-Michel; Larrouy, Georges; Klitz, William; Labuda, Damian; Kidd, Judith; Kidd, Kenneth; Di Rienzo, Anna; Freimer, Nelson B; Price, Alkes L; Ruiz-Linares, Andrés

    2012-08-16

    The peopling of the Americas has been the subject of extensive genetic, archaeological and linguistic research; however, central questions remain unresolved. One contentious issue is whether the settlement occurred by means of a single migration or multiple streams of migration from Siberia. The pattern of dispersals within the Americas is also poorly understood. To address these questions at a higher resolution than was previously possible, we assembled data from 52 Native American and 17 Siberian groups genotyped at 364,470 single nucleotide polymorphisms. Here we show that Native Americans descend from at least three streams of Asian gene flow. Most descend entirely from a single ancestral population that we call 'First American'. However, speakers of Eskimo-Aleut languages from the Arctic inherit almost half their ancestry from a second stream of Asian gene flow, and the Na-Dene-speaking Chipewyan from Canada inherit roughly one-tenth of their ancestry from a third stream. We show that the initial peopling followed a southward expansion facilitated by the coast, with sequential population splits and little gene flow after divergence, especially in South America. A major exception is in Chibchan speakers on both sides of the Panama isthmus, who have ancestry from both North and South America.

  16. Molecular cardiology and genetics in the 21st century--a primer.

    PubMed

    Roberts, Robert; Gollob, Michael

    2006-10-01

    The terminology and technology of molecular genetics and recombinant DNA have become an essential part of academic cardiology and will soon be applied at the bedside. The treatise includes a brief summary of the essentials of the DNA molecule, the more common techniques, and their application to genetics and molecular cardiology. It is written to be understood by physicians, scientists, and paramedical personnel who would not necessarily have a background in molecular biology. Inherent in the DNA molecule are three properties fundamental to all of the diagnostic and therapeutic applications, namely, the ability of DNA to separate into single strands, recombine (annealment or hybridization), and the presence of the negative charge enables DNA fragments to be separated easily by electrophoresis. Genetic linkage analysis of a family with an inherited disease enables one to identify the gene without knowing its protein product. Over 50 diseases in cardiology due to single-gene disorders have been identified and multiple mutations have been detected. The new therapeutic frontier will be stem cells and nuclear transfer. Identification of genes responsible for coronary artery disease made possible by genome-wide single nucleotide polymorphism (SNP) mapping techniques paves the way for personalized medicine.

  17. Using of methods of speckle optics for Chlamydia trachomatis typing

    NASA Astrophysics Data System (ADS)

    Ulyanov, Sergey S.; Zaytsev, Sergey S.; Ulianova, Onega V.; Saltykov, Yury V.; Feodorova, Valentina A.

    2017-03-01

    Specific method of transformation of nucleotide of gene into speckle pattern is suggested. Reference speckle pattern of omp1 gene of typical wild strains of Chlamydia trachomatis of genovars D, E, F, G, J and K and Chlamydia psittaci as well is generated. Perspectives of proposed technique in the gene identification and detection of natural genetic mutations as single nucleotide polymorphism (SNP) are demonstrated.

  18. High-resolution genetic map for understanding the effect of genome-wide recombination rate, selection sweep and linkage disequilibrium on nucleotide diversity in watermelon

    USDA-ARS?s Scientific Manuscript database

    Genotyping by sequencing (GBS) technology was used to identify a set of 9,933 single nucleotide polymorphism (SNP) markers for constructing a high-resolution genetic map of 1,087 cM for watermelon. The genome-wide variation of recombination rate (GWRR) across the map was evaluated and a positive co...

  19. Genetic diversity among isolates of Autographa californica multiple nucleopolyhedrovirus

    USDA-ARS?s Scientific Manuscript database

    Our knowledge of genetic variation at the nucleotide sequence level of Autographa californica multiple nucleopolyhedrovirus (AcMNPV; Baculoviridae: Alphabaculovirus) derives from complete genome sequences of the C6 clonal isolate of AcMNPV and the R1 and CL3 clonal isolates of AcMNPV variants Rachip...

  20. Bellerophon: A program to detect chimeric sequences in multiple sequence alignments

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Huber, Thomas; Faulkner, Geoffrey; Hugenholtz, Philip

    2003-12-23

    Bellerophon is a program for detecting chimeric sequences in multiple sequence datasets by an adaption of partial treeing analysis. Bellerophon was specifically developed to detect 16S rRNA gene chimeras in PCR-clone libraries of environmental samples but can be applied to other nucleotide sequence alignments.

  1. Apolipoprotein E genotyping by multiplex tetra-primer amplification refractory mutation system PCR in single reaction tube.

    PubMed

    Yang, Young Geun; Kim, Jong Yeol; Park, Su Jeong; Kim, Suhng Wook; Jeon, Ok-Hee; Kim, Doo-Sik

    2007-08-31

    Apolipoprotein E (APOE) plays a critical role in lipoprotein metabolism by binding to both low-density lipoprotein and APOE receptors. The APOE gene has three allelic forms, epsilon2, epsilon3, and epsilon4, which encode different isoforms of the APOE protein. In this study, we have developed a new genotyping method for APOE. Our multiplex tetra-primer amplification refractory mutation system (multiplex T-ARMS) polymerase chain reaction (PCR) was performed in a single reaction tube with six primers consisting of two common primers and two specific primers for each of two single nucleotide polymorphism (SNP) sites. We obtained definitive electropherograms that showed three (epsilon2/epsilon2, epsilon3/epsilon3, and epsilon4/epsilon4), four (epsilon2/epsilon3 and epsilon3/epsilon4), and five (epsilon2/epsilon4) amplicons by multiplex T-ARMS PCR in a single reaction tube. Multiplex T-ARMS PCR for APOE genotyping is a simple and accurate method that requires only a single PCR reaction, without any another treatments or expensive instrumentation, to simultaneously identify two sites of single nucleotide polymorphisms.

  2. 2'-Bispyrene-modified 2'-O-methyl RNA probes as useful tools for the detection of RNA: synthesis, fluorescent properties, and duplex stability.

    PubMed

    Krasheninina, Olga A; Novopashina, Darya S; Lomzov, Alexander A; Venyaminova, Alya G

    2014-09-05

    The synthesis and properties two series of new 2'-O-methyl RNA probes, each containing a single insertion of a 2'-bispyrenylmethylphosphorodiamidate derivative of a nucleotide (U, C, A, and G), are described. As demonstrated by UV melting studies, the probes form stable complexes with model RNAs and DNAs. Significant increases (up to 21-fold) in pyrene excimer fluorescence intensity were observed upon binding of most of the probes with complementary RNAs, but not with DNAs. The fluorescence spectra are independent of the nature of the modified nucleotides. The nucleotides on the 5'-side of the modified nucleotide have no effect on the fluorescence spectra, whereas the natures of the two nucleotides on the 3'-side are important: CC, CG, and UC dinucleotide units on the 3'-side of the modified nucleotide provide the maximum increases in excimer fluorescence intensity. This study suggests that these 2'-bispyrene-labeled 2'-O-methyl RNA probes might be useful tools for detection of RNAs. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Rate-determining Step of Flap Endonuclease 1 (FEN1) Reflects a Kinetic Bias against Long Flaps and Trinucleotide Repeat Sequences.

    PubMed

    Tarantino, Mary E; Bilotti, Katharina; Huang, Ji; Delaney, Sarah

    2015-08-21

    Flap endonuclease 1 (FEN1) is a structure-specific nuclease responsible for removing 5'-flaps formed during Okazaki fragment maturation and long patch base excision repair. In this work, we use rapid quench flow techniques to examine the rates of 5'-flap removal on DNA substrates of varying length and sequence. Of particular interest are flaps containing trinucleotide repeats (TNR), which have been proposed to affect FEN1 activity and cause genetic instability. We report that FEN1 processes substrates containing flaps of 30 nucleotides or fewer at comparable single-turnover rates. However, for flaps longer than 30 nucleotides, FEN1 kinetically discriminates substrates based on flap length and flap sequence. In particular, FEN1 removes flaps containing TNR sequences at a rate slower than mixed sequence flaps of the same length. Furthermore, multiple-turnover kinetic analysis reveals that the rate-determining step of FEN1 switches as a function of flap length from product release to chemistry (or a step prior to chemistry). These results provide a kinetic perspective on the role of FEN1 in DNA replication and repair and contribute to our understanding of FEN1 in mediating genetic instability of TNR sequences. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. Evolutionarily diverse determinants of meiotic DNA break and recombination landscapes across the genome

    PubMed Central

    Fowler, Kyle R.; Sasaki, Mariko; Milman, Neta

    2014-01-01

    Fission yeast Rec12 (Spo11 homolog) initiates meiotic recombination by forming developmentally programmed DNA double-strand breaks (DSBs). DSB distributions influence patterns of heredity and genome evolution, but the basis of the highly nonrandom choice of Rec12 cleavage sites is poorly understood, largely because available maps are of relatively low resolution and sensitivity. Here, we determined DSBs genome-wide at near-nucleotide resolution by sequencing the oligonucleotides attached to Rec12 following DNA cleavage. The single oligonucleotide size class allowed us to deeply sample all break events. We find strong evidence across the genome for differential DSB repair accounting for crossover invariance (constant cM/kb in spite of DSB hotspots). Surprisingly, about half of all crossovers occur in regions where DSBs occur at low frequency and are widely dispersed in location from cell to cell. These previously undetected, low-level DSBs thus play an outsized and crucial role in meiosis. We further find that the influence of underlying nucleotide sequence and chromosomal architecture differs in multiple ways from that in budding yeast. DSBs are not strongly restricted to nucleosome-depleted regions, as they are in budding yeast, but are nevertheless spatially influenced by chromatin structure. Our analyses demonstrate that evolutionarily fluid factors contribute to crossover initiation and regulation. PMID:25024163

  5. Single nucleotide resolution RNA-seq uncovers new regulatory mechanisms in the opportunistic pathogen Streptococcus agalactiae.

    PubMed

    Rosinski-Chupin, Isabelle; Sauvage, Elisabeth; Sismeiro, Odile; Villain, Adrien; Da Cunha, Violette; Caliot, Marie-Elise; Dillies, Marie-Agnès; Trieu-Cuot, Patrick; Bouloc, Philippe; Lartigue, Marie-Frédérique; Glaser, Philippe

    2015-05-30

    Streptococcus agalactiae, or Group B Streptococcus, is a leading cause of neonatal infections and an increasing cause of infections in adults with underlying diseases. In an effort to reconstruct the transcriptional networks involved in S. agalactiae physiology and pathogenesis, we performed an extensive and robust characterization of its transcriptome through a combination of differential RNA-sequencing in eight different growth conditions or genetic backgrounds and strand-specific RNA-sequencing. Our study identified 1,210 transcription start sites (TSSs) and 655 transcript ends as well as 39 riboswitches and cis-regulatory regions, 39 cis-antisense non-coding RNAs and 47 small RNAs potentially acting in trans. Among these putative regulatory RNAs, ten were differentially expressed in response to an acid stress and two riboswitches sensed directly or indirectly the pH modification. Strikingly, 15% of the TSSs identified were associated with the incorporation of pseudo-templated nucleotides, showing that reiterative transcription is a pervasive process in S. agalactiae. In particular, 40% of the TSSs upstream genes involved in nucleotide metabolism show reiterative transcription potentially regulating gene expression, as exemplified for pyrG and thyA encoding the CTP synthase and the thymidylate synthase respectively. This comprehensive map of the transcriptome at the single nucleotide resolution led to the discovery of new regulatory mechanisms in S. agalactiae. It also provides the basis for in depth analyses of transcriptional networks in S. agalactiae and of the regulatory role of reiterative transcription following variations of intra-cellular nucleotide pools.

  6. Probing Gαi1 Protein Activation at Single Amino Acid Resolution

    PubMed Central

    Sun, Dawei; Maeda, Shoji; Matkovic, Milos; Mendieta, Sandro; Mayer, Daniel; Dawson, Roger; Schertler, Gebhard F.X.; Madan Babu, M.; Veprintsev, Dmitry B.

    2016-01-01

    We present comprehensive single amino acid resolution maps of the residues stabilising the human Gαi1 subunit in nucleotide- and receptor-bound states. We generated these maps by measuring the effects of alanine mutations on the stability of Gαi1 and of the rhodopsin-Gαi1 complex. We identified stabilization clusters in the GTPase and helical domains responsible for structural integrity and the conformational changes associated with activation. In activation cluster I, helices α1 and α5 pack against strands β1-3 to stabilize the nucleotide-bound states. In the receptor-bound state, these interactions are replaced by interactions between α5 and strands β4-6. Key residues in this cluster are Y320, crucial for the stabilization of the receptor-bound state, and F336, which stabilizes nucleotide-bound states. Destabilization of helix α1, caused by rearrangement of this activation cluster, leads to the weakening of the inter-domain interface and release of GDP. PMID:26258638

  7. Parsimony and Model-Based Analyses of Indels in Avian Nuclear Genes Reveal Congruent and Incongruent Phylogenetic Signals

    PubMed Central

    Yuri, Tamaki; Kimball, Rebecca T.; Harshman, John; Bowie, Rauri C. K.; Braun, Michael J.; Chojnowski, Jena L.; Han, Kin-Lan; Hackett, Shannon J.; Huddleston, Christopher J.; Moore, William S.; Reddy, Sushma; Sheldon, Frederick H.; Steadman, David W.; Witt, Christopher C.; Braun, Edward L.

    2013-01-01

    Insertion/deletion (indel) mutations, which are represented by gaps in multiple sequence alignments, have been used to examine phylogenetic hypotheses for some time. However, most analyses combine gap data with the nucleotide sequences in which they are embedded, probably because most phylogenetic datasets include few gap characters. Here, we report analyses of 12,030 gap characters from an alignment of avian nuclear genes using maximum parsimony (MP) and a simple maximum likelihood (ML) framework. Both trees were similar, and they exhibited almost all of the strongly supported relationships in the nucleotide tree, although neither gap tree supported many relationships that have proven difficult to recover in previous studies. Moreover, independent lines of evidence typically corroborated the nucleotide topology instead of the gap topology when they disagreed, although the number of conflicting nodes with high bootstrap support was limited. Filtering to remove short indels did not substantially reduce homoplasy or reduce conflict. Combined analyses of nucleotides and gaps resulted in the nucleotide topology, but with increased support, suggesting that gap data may prove most useful when analyzed in combination with nucleotide substitutions. PMID:24832669

  8. Genomewide predictions from maize single-cross data.

    PubMed

    Massman, Jon M; Gordillo, Andres; Lorenzana, Robenzon E; Bernardo, Rex

    2013-01-01

    Maize (Zea mays L.) breeders evaluate many single-cross hybrids each year in multiple environments. Our objective was to determine the usefulness of genomewide predictions, based on marker effects from maize single-cross data, for identifying the best untested single crosses and the best inbreds within a biparental cross. We considered 479 experimental maize single crosses between 59 Iowa Stiff Stalk Synthetic (BSSS) inbreds and 44 non-BSSS inbreds. The single crosses were evaluated in multilocation experiments from 2001 to 2009 and the BSSS and non-BSSS inbreds had genotypic data for 669 single nucleotide polymorphism (SNP) markers. Single-cross performance was predicted by a previous best linear unbiased prediction (BLUP) approach that utilized marker-based relatedness and information on relatives, and from genomewide marker effects calculated by ridge-regression BLUP (RR-BLUP). With BLUP, the mean prediction accuracy (r(MG)) of single-cross performance was 0.87 for grain yield, 0.90 for grain moisture, 0.69 for stalk lodging, and 0.84 for root lodging. The BLUP and RR-BLUP models did not lead to r(MG) values that differed significantly. We then used the RR-BLUP model, developed from single-cross data, to predict the performance of testcrosses within 14 biparental populations. The r(MG) values within each testcross population were generally low and were often negative. These results were obtained despite the above-average level of linkage disequilibrium, i.e., r(2) between adjacent markers of 0.35 in the BSSS inbreds and 0.26 in the non-BSSS inbreds. Overall, our results suggested that genomewide marker effects estimated from maize single crosses are not advantageous (cofmpared with BLUP) for predicting single-cross performance and have erratic usefulness for predicting testcross performance within a biparental cross.

  9. Genetic variants associated with severe retinopathy of prematurity in extremely low birth weight infants.

    PubMed

    Hartnett, M Elizabeth; Morrison, Margaux A; Smith, Silvia; Yanovitch, Tammy L; Young, Terri L; Colaizy, Tarah; Momany, Allison; Dagle, John; Carlo, Waldemar A; Clark, Erin A S; Page, Grier; Murray, Jeff; DeAngelis, Margaret M; Cotten, C Michael

    2014-08-12

    To determine genetic variants associated with severe retinopathy of prematurity (ROP) in a candidate gene cohort study of US preterm infants. Preterm infants in the discovery cohort were enrolled through the Eunice Kennedy Shriver National Institute of Child Health and Human Development Neonatal Research Network, and those in the replication cohort were from the University of Iowa. All infants were phenotyped for ROP severity. Because of differences in the durations of enrollment between cohorts, severe ROP was defined as threshold disease in the discovery cohort and as threshold disease or type 1 ROP in the replication cohort. Whole genome amplified DNA from stored blood spot samples from the Neonatal Research Network biorepository was genotyped using an Illumina GoldenGate platform for candidate gene single nucleotide polymorphisms (SNPs) involving angiogenic, developmental, inflammatory, and oxidative pathways. Three analyses were performed to determine significant epidemiologic variables and SNPs associated with levels of ROP severity. Analyses controlled for multiple comparisons, ancestral eigenvalues, family relatedness, and significant epidemiologic variables. Single nucleotide polymorphisms significantly associated with ROP severity from the discovery cohort were analyzed in the replication cohort and in meta-analysis. Eight hundred seventeen infants in the discovery cohort and 543 in the replication cohort were analyzed. Severe ROP occurred in 126 infants in the discovery and in 14 in the replication cohort. In both cohorts, ventilation days and seizure occurrence were associated with severe ROP. After controlling for significant factors and multiple comparisons, two intronic SNPs in the gene BDNF (rs7934165 and rs2049046, P < 3.1 × 10(-5)) were associated with severe ROP in the discovery cohort and were not associated with severe ROP in the replication cohort. However, when the cohorts were analyzed together in an exploratory meta-analysis, rs7934165 increased in associated significance with severe ROP (P = 2.9 × 10(-7)). Variants in BDNF encoding brain-derived neurotrophic factor were associated with severe ROP in a large candidate gene study of infants with threshold ROP. Copyright 2014 The Association for Research in Vision and Ophthalmology, Inc.

  10. Application of a Combination of a Knowledge-Based Algorithm and 2-Stage Screening to Hypothesis-Free Genomic Data on Irinotecan-Treated Patients for Identification of a Candidate Single Nucleotide Polymorphism Related to an Adverse Effect

    PubMed Central

    Takahashi, Hiro; Sai, Kimie; Saito, Yoshiro; Kaniwa, Nahoko; Matsumura, Yasuhiro; Hamaguchi, Tetsuya; Shimada, Yasuhiro; Ohtsu, Atsushi; Yoshino, Takayuki; Doi, Toshihiko; Okuda, Haruhiro; Ichinohe, Risa; Takahashi, Anna; Doi, Ayano; Odaka, Yoko; Okuyama, Misuzu; Saijo, Nagahiro; Sawada, Jun-ichi; Sakamoto, Hiromi; Yoshida, Teruhiko

    2014-01-01

    Interindividual variation in a drug response among patients is known to cause serious problems in medicine. Genomic information has been proposed as the basis for “personalized” health care. The genome-wide association study (GWAS) is a powerful technique for examining single nucleotide polymorphisms (SNPs) and their relationship with drug response variation; however, when using only GWAS, it often happens that no useful SNPs are identified due to multiple testing problems. Therefore, in a previous study, we proposed a combined method consisting of a knowledge-based algorithm, 2 stages of screening, and a permutation test for identifying SNPs. In the present study, we applied this method to a pharmacogenomics study where 109,365 SNPs were genotyped using Illumina Human-1 BeadChip in 168 cancer patients treated with irinotecan chemotherapy. We identified the SNP rs9351963 in potassium voltage-gated channel subfamily KQT member 5 (KCNQ5) as a candidate factor related to incidence of irinotecan-induced diarrhea. The p value for rs9351963 was 3.31×10−5 in Fisher's exact test and 0.0289 in the permutation test (when multiple testing problems were corrected). Additionally, rs9351963 was clearly superior to the clinical parameters and the model involving rs9351963 showed sensitivity of 77.8% and specificity of 57.6% in the evaluation by means of logistic regression. Recent studies showed that KCNQ4 and KCNQ5 genes encode members of the M channel expressed in gastrointestinal smooth muscle and suggested that these genes are associated with irritable bowel syndrome and similar peristalsis diseases. These results suggest that rs9351963 in KCNQ5 is a possible predictive factor of incidence of diarrhea in cancer patients treated with irinotecan chemotherapy and for selecting chemotherapy regimens, such as irinotecan alone or a combination of irinotecan with a KCNQ5 opener. Nonetheless, clinical importance of rs9351963 should be further elucidated. PMID:25127363

  11. Application of a combination of a knowledge-based algorithm and 2-stage screening to hypothesis-free genomic data on irinotecan-treated patients for identification of a candidate single nucleotide polymorphism related to an adverse effect.

    PubMed

    Takahashi, Hiro; Sai, Kimie; Saito, Yoshiro; Kaniwa, Nahoko; Matsumura, Yasuhiro; Hamaguchi, Tetsuya; Shimada, Yasuhiro; Ohtsu, Atsushi; Yoshino, Takayuki; Doi, Toshihiko; Okuda, Haruhiro; Ichinohe, Risa; Takahashi, Anna; Doi, Ayano; Odaka, Yoko; Okuyama, Misuzu; Saijo, Nagahiro; Sawada, Jun-ichi; Sakamoto, Hiromi; Yoshida, Teruhiko

    2014-01-01

    Interindividual variation in a drug response among patients is known to cause serious problems in medicine. Genomic information has been proposed as the basis for "personalized" health care. The genome-wide association study (GWAS) is a powerful technique for examining single nucleotide polymorphisms (SNPs) and their relationship with drug response variation; however, when using only GWAS, it often happens that no useful SNPs are identified due to multiple testing problems. Therefore, in a previous study, we proposed a combined method consisting of a knowledge-based algorithm, 2 stages of screening, and a permutation test for identifying SNPs. In the present study, we applied this method to a pharmacogenomics study where 109,365 SNPs were genotyped using Illumina Human-1 BeadChip in 168 cancer patients treated with irinotecan chemotherapy. We identified the SNP rs9351963 in potassium voltage-gated channel subfamily KQT member 5 (KCNQ5) as a candidate factor related to incidence of irinotecan-induced diarrhea. The p value for rs9351963 was 3.31×10-5 in Fisher's exact test and 0.0289 in the permutation test (when multiple testing problems were corrected). Additionally, rs9351963 was clearly superior to the clinical parameters and the model involving rs9351963 showed sensitivity of 77.8% and specificity of 57.6% in the evaluation by means of logistic regression. Recent studies showed that KCNQ4 and KCNQ5 genes encode members of the M channel expressed in gastrointestinal smooth muscle and suggested that these genes are associated with irritable bowel syndrome and similar peristalsis diseases. These results suggest that rs9351963 in KCNQ5 is a possible predictive factor of incidence of diarrhea in cancer patients treated with irinotecan chemotherapy and for selecting chemotherapy regimens, such as irinotecan alone or a combination of irinotecan with a KCNQ5 opener. Nonetheless, clinical importance of rs9351963 should be further elucidated.

  12. Multi-environment QTL analysis of grain morphology traits and fine mapping of a kernel-width QTL in Zheng58 × SK maize population.

    PubMed

    Raihan, Mohammad Sharif; Liu, Jie; Huang, Juan; Guo, Huan; Pan, Qingchun; Yan, Jianbing

    2016-08-01

    Sixteen major QTLs regulating maize kernel traits were mapped in multiple environments and one of them, qKW - 9.2 , was restricted to 630 Kb, harboring 28 putative gene models. To elucidate the genetic basis of kernel traits, a quantitative trait locus (QTL) analysis was conducted in a maize recombinant inbred line population derived from a cross between two diverse parents Zheng58 and SK, evaluated across eight environments. Construction of a high-density linkage map was based on 13,703 single-nucleotide polymorphism markers, covering 1860.9 cM of the whole genome. In total, 18, 26, 23, and 19 QTLs for kernel length, width, thickness, and 100-kernel weight, respectively, were detected on the basis of a single-environment analysis, and each QTL explained 3.2-23.7 % of the phenotypic variance. Sixteen major QTLs, which could explain greater than 10 % of the phenotypic variation, were mapped in multiple environments, implying that kernel traits might be controlled by many minor and multiple major QTLs. The major QTL qKW-9.2 with physical confidence interval of 1.68 Mbp, affecting kernel width, was then selected for fine mapping using heterogeneous inbred families. At final, the location of the underlying gene was narrowed down to 630 Kb, harboring 28 putative candidate-gene models. This information will enhance molecular breeding for kernel traits and simultaneously assist the gene cloning underlying this QTL, helping to reveal the genetic basis of kernel development in maize.

  13. Methods to Increase the Sensitivity of High Resolution Melting Single Nucleotide Polymorphism Genotyping in Malaria.

    PubMed

    Daniels, Rachel; Hamilton, Elizabeth J; Durfee, Katelyn; Ndiaye, Daouda; Wirth, Dyann F; Hartl, Daniel L; Volkman, Sarah K

    2015-11-10

    Despite decades of eradication efforts, malaria remains a global burden. Recent renewed interest in regional elimination and global eradication has been accompanied by increased genomic information about Plasmodium parasite species responsible for malaria, including characteristics of geographical populations as well as variations associated with reduced susceptibility to anti-malarial drugs. One common genetic variation, single-nucleotide polymorphisms (SNPs), offers attractive targets for parasite genotyping. These markers are useful not only for tracking drug resistance markers but also for tracking parasite populations using markers not under drug or other selective pressures. SNP genotyping methods offer the ability to track drug resistance as well as to fingerprint individual parasites for population surveillance, particularly in response to malaria control efforts in regions nearing elimination status. While informative SNPs have been identified that are agnostic to specific genotyping technologies, high-resolution melting (HRM) analysis is particularly suited to field-based studies. Compared to standard fluorescent-probe based methods that require individual SNPs in a single labeled probe and offer at best 10% sensitivity to detect SNPs in samples that contain multiple genomes (polygenomic), HRM offers 2-5% sensitivity. Modifications to HRM, such as blocked probes and asymmetric primer concentrations as well as optimization of amplification annealing temperatures to bias PCR towards amplification of the minor allele, further increase the sensitivity of HRM. While the sensitivity improvement depends on the specific assay, we have increased detection sensitivities to less than 1% of the minor allele. In regions approaching malaria eradication, early detection of emerging or imported drug resistance is essential for prompt response. Similarly, the ability to detect polygenomic infections and differentiate imported parasite types from cryptic local reservoirs can inform control programs. This manuscript describes modifications to high resolution melting technology that further increase its sensitivity to identify polygenomic infections in patient samples.

  14. Single-Molecule Methods for Nucleotide Excision Repair: Building a System to Watch Repair in Real Time.

    PubMed

    Kong, Muwen; Beckwitt, Emily C; Springall, Luke; Kad, Neil M; Van Houten, Bennett

    2017-01-01

    Single-molecule approaches to solving biophysical problems are powerful tools that allow static and dynamic real-time observations of specific molecular interactions of interest in the absence of ensemble-averaging effects. Here, we provide detailed protocols for building an experimental system that employs atomic force microscopy and a single-molecule DNA tightrope assay based on oblique angle illumination fluorescence microscopy. Together with approaches for engineering site-specific lesions into DNA substrates, these complementary biophysical techniques are well suited for investigating protein-DNA interactions that involve target-specific DNA-binding proteins, such as those engaged in a variety of DNA repair pathways. In this chapter, we demonstrate the utility of the platform by applying these techniques in the studies of proteins participating in nucleotide excision repair. © 2017 Elsevier Inc. All rights reserved.

  15. Phosphotyrosine-mediated LAT assembly on membranes drives kinetic bifurcation in recruitment dynamics of the Ras activator SOS

    DOE PAGES

    Huang, William Y. C.; Yan, Qingrong; Lin, Wan-Chen; ...

    2016-07-01

    The assembly of cell surface receptors with downstream signaling molecules is a commonly occurring theme in multiple signaling systems. However, little is known about how these assemblies modulate reaction kinetics and the ultimate propagation of signals. Here, we reconstitute phosphotyrosine-mediated assembly of extended linker for the activation of T cells (LAT):growth factor receptor-bound protein 2 (Grb2):Son of Sevenless (SOS) networks, derived from the T-cell receptor signaling system, on supported membranes. Single-molecule dwell time distributions reveal two, well-differentiated kinetic species for both Grb2 and SOS on the LAT assemblies. The majority fraction of membrane-recruited Grb2 and SOS both exhibit fast kineticsmore » and single exponential dwell time distributions, with average dwell times of hundreds of milliseconds. The minor fraction exhibits much slower kinetics, extending the dwell times to tens of seconds. Considering this result in the context of the multistep process by which the Ras GEF (guanine nucleotide exchange factor) activity of SOS is activated indicates that kinetic stabilization from the LAT assembly may be important. This kinetic proofreading effect would additionally serve as a stochastic noise filter by reducing the relative probability of spontaneous SOS activation in the absence of receptor triggering. In conclusion, the generality of receptor-mediated assembly suggests that such effects may play a role in multiple receptor proximal signaling processes.« less

  16. The separation between the 5'-3' ends in long RNA molecules is short and nearly constant.

    PubMed

    Leija-Martínez, Nehemías; Casas-Flores, Sergio; Cadena-Nava, Rubén D; Roca, Joan A; Mendez-Cabañas, José A; Gomez, Eduardo; Ruiz-Garcia, Jaime

    2014-12-16

    RNA molecules play different roles in coding, decoding and gene expression regulation. Such roles are often associated to the RNA secondary or tertiary structures. The folding dynamics lead to multiple secondary structures of long RNA molecules, since an RNA molecule might fold into multiple distinct native states. Despite an ensemble of different structures, it has been theoretically proposed that the separation between the 5' and 3' ends of long single-stranded RNA molecules (ssRNA) remains constant, independent of their base content and length. Here, we present the first experimental measurements of the end-to-end separation in long ssRNA molecules. To determine this separation, we use single molecule Fluorescence Resonance Energy Transfer of fluorescently end-labeled ssRNA molecules ranging from 500 to 5500 nucleotides in length, obtained from two viruses and a fungus. We found that the end-to-end separation is indeed short, within 5-9 nm. It is remarkable that the separation of the ends of all RNA molecules studied remains small and similar, despite the origin, length and differences in their secondary structure. This implies that the ssRNA molecules are 'effectively circularized' something that might be a general feature of RNAs, and could result in fine-tuning for translation and gene expression regulation. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Phosphotyrosine-mediated LAT assembly on membranes drives kinetic bifurcation in recruitment dynamics of the Ras activator SOS

    PubMed Central

    Huang, William Y. C.; Yan, Qingrong; Lin, Wan-Chen; Chung, Jean K.; Hansen, Scott D.; Christensen, Sune M.; Tu, Hsiung-Lin; Kuriyan, John; Groves, Jay T.

    2016-01-01

    The assembly of cell surface receptors with downstream signaling molecules is a commonly occurring theme in multiple signaling systems. However, little is known about how these assemblies modulate reaction kinetics and the ultimate propagation of signals. Here, we reconstitute phosphotyrosine-mediated assembly of extended linker for the activation of T cells (LAT):growth factor receptor-bound protein 2 (Grb2):Son of Sevenless (SOS) networks, derived from the T-cell receptor signaling system, on supported membranes. Single-molecule dwell time distributions reveal two, well-differentiated kinetic species for both Grb2 and SOS on the LAT assemblies. The majority fraction of membrane-recruited Grb2 and SOS both exhibit fast kinetics and single exponential dwell time distributions, with average dwell times of hundreds of milliseconds. The minor fraction exhibits much slower kinetics, extending the dwell times to tens of seconds. Considering this result in the context of the multistep process by which the Ras GEF (guanine nucleotide exchange factor) activity of SOS is activated indicates that kinetic stabilization from the LAT assembly may be important. This kinetic proofreading effect would additionally serve as a stochastic noise filter by reducing the relative probability of spontaneous SOS activation in the absence of receptor triggering. The generality of receptor-mediated assembly suggests that such effects may play a role in multiple receptor proximal signaling processes. PMID:27370798

  18. Phosphotyrosine-mediated LAT assembly on membranes drives kinetic bifurcation in recruitment dynamics of the Ras activator SOS.

    PubMed

    Huang, William Y C; Yan, Qingrong; Lin, Wan-Chen; Chung, Jean K; Hansen, Scott D; Christensen, Sune M; Tu, Hsiung-Lin; Kuriyan, John; Groves, Jay T

    2016-07-19

    The assembly of cell surface receptors with downstream signaling molecules is a commonly occurring theme in multiple signaling systems. However, little is known about how these assemblies modulate reaction kinetics and the ultimate propagation of signals. Here, we reconstitute phosphotyrosine-mediated assembly of extended linker for the activation of T cells (LAT):growth factor receptor-bound protein 2 (Grb2):Son of Sevenless (SOS) networks, derived from the T-cell receptor signaling system, on supported membranes. Single-molecule dwell time distributions reveal two, well-differentiated kinetic species for both Grb2 and SOS on the LAT assemblies. The majority fraction of membrane-recruited Grb2 and SOS both exhibit fast kinetics and single exponential dwell time distributions, with average dwell times of hundreds of milliseconds. The minor fraction exhibits much slower kinetics, extending the dwell times to tens of seconds. Considering this result in the context of the multistep process by which the Ras GEF (guanine nucleotide exchange factor) activity of SOS is activated indicates that kinetic stabilization from the LAT assembly may be important. This kinetic proofreading effect would additionally serve as a stochastic noise filter by reducing the relative probability of spontaneous SOS activation in the absence of receptor triggering. The generality of receptor-mediated assembly suggests that such effects may play a role in multiple receptor proximal signaling processes.

  19. Identification of Genomic Regions and the Isoamylase Gene for Reduced Grain Chalkiness in Rice

    PubMed Central

    Sun, Wenqian; Zhou, Qiaoling; Yao, Yue; Qiu, Xianjin; Xie, Kun; Yu, Sibin

    2015-01-01

    Grain chalkiness is an important grain quality related to starch granules in the endosperm. A high percentage of grain chalkiness is a major problem because it diminishes grain quality in rice. Here, we report quantitative trait loci identification for grain chalkiness using high-throughput single nucleotide polymorphism genotyping of a chromosomal segment substitution line population in which each line carried one or a few introduced japonica cultivar Nipponbare segments in the genetic background of the indica cultivar ZS97. Ten quantitative trait loci regions were commonly identified for the percentage of grain chalkiness and the degree of endosperm chalkiness. The allelic effects at nine of these quantitative trait loci reduced grain chalkiness. Furthermore, a quantitative trait locus (qPGC8-2) on chromosome 8 was validated in a chromosomal segment substitution line–derived segregation population, and had a stable effect on chalkiness in a multiple-environment evaluation of the near-isogenic lines. Residing on the qPGC8-2 region, the isoamylase gene (ISA1) was preferentially expressed in the endosperm and revealed some nucleotide polymorphisms between two varieties, Nipponbare and ZS97. Transgenic lines with suppression of ISA1 by RNA interference produced grains with 20% more chalkiness than the control. The results support that the gene may underlie qPGC8-2 for grain chalkiness. The multiple-environment trials of the near-isogenic lines also show that combination of the favorable alleles such as the ISA1 gene for low chalkiness and the GS3 gene for long grains considerably improved grain quality of ZS97, which proves useful for grain quality improvement in rice breeding programs. PMID:25790260

  20. Genomic Surveillance Elucidates Persistent Wild Poliovirus Transmission During 2013-2015 in Major Reservoir Areas of Pakistan.

    PubMed

    Alam, Muhammad Masroor; Sharif, Salmaan; Shaukat, Shahzad; Angez, Mehar; Khurshid, Adnan; Rehman, Lubna; Zaidi, Syed Sohail Zahoor

    2016-01-15

    Despite tremendous efforts in the fight against polio, Pakistan bears the highest proportion of poliomyelitis cases among the 3 endemic countries including Afghanistan and Nigeria. Apart from insecurity and inaccessibility challenges, the substantial shift of unimmunized children from North Waziristan due to recent military operations was presumed to favor the widespread poliovirus infection in Pakistan. To better understand the current epidemiological situation, we analyzed the virologic data of wild poliovirus type 1 (WPV1) strains detected in Pakistan during 2013-2015. Five genetic clusters (A-E) were identified with at least 5% nucleotide divergence in the viral protein 1 (VP1) coding region. Peshawar, Quetta, and Karachi were found to be the major endemic foci where multiple discrete genetic lineages of WPV1 were detected. Phylogenetic analysis suggests that wild poliovirus strains from endemic regions were genetically distant (with 5%-15% VP1 nucleotide divergence) from those detected in North Waziristan cases, excluding the possibility of a recent progenitor of WPV1 instigating single-source transmission across the country. Orphan lineages detected in Rawalpindi, Lahore, Hyderabad, Sukkur, and Jacobabad revealed silent transmission and the need for vigilant surveillance. Sustenance of analogous genetic lineages over a period of 3 years highlights multiple unimmunized foci present to maintain viral genetic diversity. Our findings are inconsistent with the hypothesis that impoverished populations from North Waziristan serve as a possible determinant of widespread poliomyelitis infection in Pakistan and further emphasize the need to scale-up clinical and environmental surveillance as well as immunization activities. © The Author 2015. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

  1. Disentangling the complex evolutionary history of the Western Palearctic blue tits (Cyanistes spp.) - phylogenomic analyses suggest radiation by multiple colonization events and subsequent isolation.

    PubMed

    Stervander, Martin; Illera, Juan Carlos; Kvist, Laura; Barbosa, Pedro; Keehnen, Naomi P; Pruisscher, Peter; Bensch, Staffan; Hansson, Bengt

    2015-05-01

    Isolated islands and their often unique biota continue to play key roles for understanding the importance of drift, genetic variation and adaptation in the process of population differentiation and speciation. One island system that has inspired and intrigued evolutionary biologists is the blue tit complex (Cyanistes spp.) in Europe and Africa, in particular the complex evolutionary history of the multiple genetically distinct taxa of the Canary Islands. Understanding Afrocanarian colonization events is of particular importance because of recent unconventional suggestions that these island populations acted as source of the widespread population in mainland Africa. We investigated the relationship between mainland and island blue tits using a combination of Sanger sequencing at a population level (20 loci; 12 500 nucleotides) and next-generation sequencing of single population representatives (>3 200 000 nucleotides), analysed in coalescence and phylogenetic frameworks. We found (i) that Afrocanarian blue tits are monophyletic and represent four major clades, (ii) that the blue tit complex has a continental origin and that the Canary Islands were colonized three times, (iii) that all island populations have low genetic variation, indicating low long-term effective population sizes and (iv) that populations on La Palma and in Libya represent relicts of an ancestral North African population. Further, demographic reconstructions revealed (v) that the Canary Islands, conforming to traditional views, hold sink populations, which have not served as source for back colonization of the African mainland. Our study demonstrates the importance of complete taxon sampling and an extensive multimarker study design to obtain robust phylogeographical inferences. © 2015 John Wiley & Sons Ltd.

  2. Genomic diversity of the human intestinal parasite Entamoeba histolytica

    PubMed Central

    2012-01-01

    Background Entamoeba histolytica is a significant cause of disease worldwide. However, little is known about the genetic diversity of the parasite. We re-sequenced the genomes of ten laboratory cultured lines of the eukaryotic pathogen Entamoeba histolytica in order to develop a picture of genetic diversity across the genome. Results The extreme nucleotide composition bias and repetitiveness of the E. histolytica genome provide a challenge for short-read mapping, yet we were able to define putative single nucleotide polymorphisms in a large portion of the genome. The results suggest a rather low level of single nucleotide diversity, although genes and gene families with putative roles in virulence are among the more polymorphic genes. We did observe large differences in coverage depth among genes, indicating differences in gene copy number between genomes. We found evidence indicating that recombination has occurred in the history of the sequenced genomes, suggesting that E. histolytica may reproduce sexually. Conclusions E. histolytica displays a relatively low level of nucleotide diversity across its genome. However, large differences in gene family content and gene copy number are seen among the sequenced genomes. The pattern of polymorphism indicates that E. histolytica reproduces sexually, or has done so in the past, which has previously been suggested but not proven. PMID:22630046

  3. Assessment of primer/template mismatch effects on real-time PCR amplification of target taxa for GMO quantification.

    PubMed

    Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc

    2009-10-28

    GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree.

  4. Molecular characterization of the vitamin D receptor (VDR) gene in Holstein cows.

    PubMed

    Ali, Mayar O; El-Adl, Mohamed A; Ibrahim, Hussam M M; Elseedy, Youssef Y; Rizk, Mohamed A; El-Khodery, Sabry A

    2018-06-01

    Vitamin D plays a vital role in calcium homeostasis, growth, and immunoregulation. Because little is known about the vitamin D receptor (VDR) gene in cattle, the aim of the present investigation was to present the molecular characterization of exons 5 and 6 of the VDR gene in Holstein cows. DNA extraction, genomic sequencing, phylogenetic analysis, synteny mapping and single nucleotide gene polymorphism analysis of the VDR gene were performed to assess blood samples collected from 50 clinically healthy Holstein cows. The results revealed the presence of a 450-base pair (bp) nucleotide sequence that resembled exons 5 and 6 with intron 5 enclosed between these exons. Sequence alignment and phylogenetic analysis revealed a close relationship between the sequenced VDR region and that found in Hereford cattle. A close association between this region and the corresponding region in small ruminants was also documented. Moreover, a single nucleotide polymorphism (SNP) that caused the replacement of a glutamate with an arginine in the deduced amino acid sequence was detected at position 7 of exon 5. In conclusion, Holstein and Hereford cattle differ with respect to exon 5 of the VDR gene. Phylogenetic analysis of the VDR gene based on nucleotide sequence produced different results from prior analyses based on amino acid sequence. Copyright © 2018 Elsevier Ltd. All rights reserved.

  5. The Structural Basis for Allosteric Inhibition of a Threonine-sensitive Aspartokinase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Xuying; Pavlovsky, Alexander G.; Viola, Ronald E.

    2008-10-08

    The commitment step to the aspartate pathway of amino acid biosynthesis is the phosphorylation of aspartic acid catalyzed by aspartokinase (AK). Most microorganisms and plants have multiple forms of this enzyme, and many of these isofunctional enzymes are subject to feedback regulation by the end products of the pathway. However, the archeal species Methanococcus jannaschii has only a single, monofunctional form of AK. The substrate l-aspartate binds to this recombinant enzyme in two different orientations, providing the first structural evidence supporting the relaxed regiospecificity previously observed with several alternative substrates of Escherichia coli AK. Binding of the nucleotide substrate triggersmore » significant domain movements that result in a more compact quaternary structure. In contrast, the highly cooperative binding of the allosteric regulator l-threonine to multiple sites on this dimer of dimers leads to an open enzyme structure. A comparison of these structures supports a mechanism for allosteric regulation in which the domain movements induced by threonine binding causes displacement of the substrates from the enzyme, resulting in a relaxed, inactive conformation.« less

  6. Switching of the positive feedback for RAS activation by a concerted function of SOS membrane association domains.

    PubMed

    Nakamura, Yuki; Hibino, Kayo; Yanagida, Toshio; Sako, Yasushi

    2016-01-01

    Son of sevenless (SOS) is a guanine nucleotide exchange factor that regulates cell behavior by activating the small GTPase RAS. Recent in vitro studies have suggested that an interaction between SOS and the GTP-bound active form of RAS generates a positive feedback loop that propagates RAS activation. However, it remains unclear how the multiple domains of SOS contribute to the regulation of the feedback loop in living cells. Here, we observed single molecules of SOS in living cells to analyze the kinetics and dynamics of SOS behavior. The results indicate that the histone fold and Grb2-binding domains of SOS concertedly produce an intermediate state of SOS on the cell surface. The fraction of the intermediated state was reduced in positive feedback mutants, suggesting that the feedback loop functions during the intermediate state. Translocation of RAF, recognizing the active form of RAS, to the cell surface was almost abolished in the positive feedback mutants. Thus, the concerted functions of multiple membrane-associating domains of SOS governed the positive feedback loop, which is crucial for cell fate decision regulated by RAS.

  7. Genetic variation and biological activity of isolates of lymantria dispar multiple nucleopolyhedrovirus from north america, europe, and asia

    USDA-ARS?s Scientific Manuscript database

    Little is known about genetic variation of Lymantria dispar multiple nucleopolyhedrovirus (LdMNPV; Baculoviridae: Alphabaculovirus) at the nucleotide sequence level. To obtain a more comprehensive view of genetic diversity among isolates of LdMNPV, partial sequences of the lef-8 gene were generated...

  8. DRoP: a water analysis program identifies Ras-GTP-specific pathway of communication between membrane-interacting regions and the active site.

    PubMed

    Kearney, Bradley M; Johnson, Christian W; Roberts, Daniel M; Swartz, Paul; Mattos, Carla

    2014-02-06

    Ras GTPase mediates several cellular signal transduction pathways and is found mutated in a large number of cancers. It is active in the GTP-bound state, where it interacts with effector proteins, and at rest in the GDP-bound state. The catalytic domain is tethered to the membrane, with which it interacts in a nucleotide-dependent manner. Here we present the program Detection of Related Solvent Positions (DRoP) for crystallographic water analysis on protein surfaces and use it to study Ras. DRoP reads and superimposes multiple Protein Data Bank coordinates, transfers symmetry-related water molecules to the position closest to the protein surface, and ranks the waters according to how well conserved and tightly clustered they are in the set of structures. Coloring according to this rank allows visualization of the results. The effector-binding region of Ras is hydrated with highly conserved water molecules at the interface between the P-loop, switch I, and switch II, as well as at the Raf-RBD binding pocket. Furthermore, we discovered a new conserved water-mediated H-bonding network present in Ras-GTP, but not in Ras-GDP, that links the nucleotide sensor residues R161 and R164 on helix 5 to the active site. The double mutant RasN85A/N86A, where the final link between helix 5 and the nucleotide is not possible, is a severely impaired enzyme, while the single mutant RasN86A, with partial connection to the active site, has a wild-type hydrolysis rate. DRoP was instrumental in determining the water-mediated connectivity networks that link two lobes of the catalytic domain in Ras. Copyright © 2013 Elsevier Ltd. All rights reserved.

  9. An outbreak of respiratory tularemia caused by diverse clones of Francisella tularensis.

    PubMed

    Johansson, Anders; Lärkeryd, Adrian; Widerström, Micael; Mörtberg, Sara; Myrtännäs, Kerstin; Ohrman, Caroline; Birdsell, Dawn; Keim, Paul; Wagner, David M; Forsman, Mats; Larsson, Pär

    2014-12-01

    The bacterium Francisella tularensis is recognized for its virulence, infectivity, genetic homogeneity, and potential as a bioterrorism agent. Outbreaks of respiratory tularemia, caused by inhalation of this bacterium, are poorly understood. Such outbreaks are exceedingly rare, and F. tularensis is seldom recovered from clinical specimens. A localized outbreak of tularemia in Sweden was investigated. Sixty-seven humans contracted laboratory-verified respiratory tularemia. F. tularensis subspecies holarctica was isolated from the blood or pleural fluid of 10 individuals from July to September 2010. Using whole-genome sequencing and analysis of single-nucleotide polymorphisms (SNPs), outbreak isolates were compared with 110 archived global isolates. There were 757 SNPs among the genomes of the 10 outbreak isolates and the 25 most closely related archival isolates (all from Sweden/Finland). Whole genomes of outbreak isolates were >99.9% similar at the nucleotide level and clustered into 3 distinct genetic clades. Unexpectedly, high-sequence similarity grouped some outbreak and archival isolates that originated from patients from different geographic regions and up to 10 years apart. Outbreak and archival genomes frequently differed by only 1-3 of 1 585 229 examined nucleotides. The outbreak was caused by diverse clones of F. tularensis that occurred concomitantly, were widespread, and apparently persisted in the environment. Multiple independent acquisitions of F. tularensis from the environment over a short time period suggest that natural outbreaks of respiratory tularemia are triggered by environmental cues. The findings additionally caution against interpreting genome sequence identity for this pathogen as proof of a direct epidemiological link. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  10. N-acetyltransferase single nucleotide polymorphisms: Emerging concepts serve as a paradigm for understanding complexities of personalized medicine

    PubMed Central

    Hein, David W.

    2009-01-01

    Arylamine N-acetyltransferase 1 (NAT1) and 2 (NAT2) exhibit single nucleotide polymorphisms (SNPs) in human populations that modify drug and carcinogen metabolism. This paper updates the identity, location, and functional effects of these SNPs and then follows with emerging concepts for understanding why pharmacogenetic findings may not be replicated consistently. Using this paradigm as an example, laboratory-based mechanistic analyses can reveal complexities such that genetic polymorphisms become biologically and medically relevant when confounding factors are more fully understood and considered. As medical care moves to a more personalized approach, the implications of these confounding factors will be important in understanding the complexities of personalized medicine. PMID:19379125

  11. Mycobacterium leprae: genes, pseudogenes and genetic diversity

    PubMed Central

    Singh, Pushpendra; Cole, Stewart T

    2011-01-01

    Leprosy, which has afflicted human populations for millenia, results from infection with Mycobacterium leprae, an unculturable pathogen with an exceptionally long generation time. Considerable insight into the biology and drug resistance of the leprosy bacillus has been obtained from genomics. M. leprae has undergone reductive evolution and pseudogenes now occupy half of its genome. Comparative genomics of four different strains revealed remarkable conservation of the genome (99.995% identity) yet uncovered 215 polymorphic sites, mainly single nucleotide polymorphisms, and a handful of new pseudogenes. Mapping these polymorphisms in a large panel of strains defined 16 single nucleotide polymorphism-subtypes that showed strong geographical associations and helped retrace the evolution of M. leprae. PMID:21162636

  12. Annotate-it: a Swiss-knife approach to annotation, analysis and interpretation of single nucleotide variation in human disease

    PubMed Central

    2012-01-01

    The increasing size and complexity of exome/genome sequencing data requires new tools for clinical geneticists to discover disease-causing variants. Bottlenecks in identifying the causative variation include poor cross-sample querying, constantly changing functional annotation and not considering existing knowledge concerning the phenotype. We describe a methodology that facilitates exploration of patient sequencing data towards identification of causal variants under different genetic hypotheses. Annotate-it facilitates handling, analysis and interpretation of high-throughput single nucleotide variant data. We demonstrate our strategy using three case studies. Annotate-it is freely available and test data are accessible to all users at http://www.annotate-it.org. PMID:23013645

  13. Fixed-Gap Tunnel Junction for Reading DNA Nucleotides

    PubMed Central

    2015-01-01

    Previous measurements of the electronic conductance of DNA nucleotides or amino acids have used tunnel junctions in which the gap is mechanically adjusted, such as scanning tunneling microscopes or mechanically controllable break junctions. Fixed-junction devices have, at best, detected the passage of whole DNA molecules without yielding chemical information. Here, we report on a layered tunnel junction in which the tunnel gap is defined by a dielectric layer, deposited by atomic layer deposition. Reactive ion etching is used to drill a hole through the layers so that the tunnel junction can be exposed to molecules in solution. When the metal electrodes are functionalized with recognition molecules that capture DNA nucleotides via hydrogen bonds, the identities of the individual nucleotides are revealed by characteristic features of the fluctuating tunnel current associated with single-molecule binding events. PMID:25380505

  14. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes

    PubMed Central

    Kondo, Jiro; Westhof, Eric

    2011-01-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

  15. Noncoding somatic and inherited single-nucleotide variants converge to promote ESR1 expression in breast cancer.

    PubMed

    Bailey, Swneke D; Desai, Kinjal; Kron, Ken J; Mazrooei, Parisa; Sinnott-Armstrong, Nicholas A; Treloar, Aislinn E; Dowar, Mark; Thu, Kelsie L; Cescon, David W; Silvester, Jennifer; Yang, S Y Cindy; Wu, Xue; Pezo, Rossanna C; Haibe-Kains, Benjamin; Mak, Tak W; Bedard, Philippe L; Pugh, Trevor J; Sallari, Richard C; Lupien, Mathieu

    2016-10-01

    Sustained expression of the estrogen receptor-α (ESR1) drives two-thirds of breast cancer and defines the ESR1-positive subtype. ESR1 engages enhancers upon estrogen stimulation to establish an oncogenic expression program. Somatic copy number alterations involving the ESR1 gene occur in approximately 1% of ESR1-positive breast cancers, suggesting that other mechanisms underlie the persistent expression of ESR1. We report significant enrichment of somatic mutations within the set of regulatory elements (SRE) regulating ESR1 in 7% of ESR1-positive breast cancers. These mutations regulate ESR1 expression by modulating transcription factor binding to the DNA. The SRE includes a recurrently mutated enhancer whose activity is also affected by rs9383590, a functional inherited single-nucleotide variant (SNV) that accounts for several breast cancer risk-associated loci. Our work highlights the importance of considering the combinatorial activity of regulatory elements as a single unit to delineate the impact of noncoding genetic alterations on single genes in cancer.

  16. Genetics of recurrent early-onset major depression (GenRED): significant linkage on chromosome 15q25-q26 after fine mapping with single nucleotide polymorphism markers.

    PubMed

    Levinson, Douglas F; Evgrafov, Oleg V; Knowles, James A; Potash, James B; Weissman, Myrna M; Scheftner, William A; Depaulo, J Raymond; Crowe, Raymond R; Murphy-Eberenz, Kathleen; Marta, Diana H; McInnis, Melvin G; Adams, Philip; Gladis, Madeline; Miller, Erin B; Thomas, Jo; Holmans, Peter

    2007-02-01

    The authors studied a dense map of single nucleotide polymorphism (SNP) DNA markers on chromosome 15q25-q26 to maximize the informativeness of genetic linkage analyses in a region where they previously reported suggestive evidence for linkage of recurrent early-onset major depressive disorder. In 631 European-ancestry families with multiple cases of recurrent early-onset major depressive disorder, 88 SNPs were genotyped, and multipoint allele-sharing linkage analyses were carried out. Marker-marker linkage disequilibrium was minimized, and a simulation study with founder haplotypes from these families suggested that linkage scores were not inflated by linkage disequilibrium. The dense SNP map increased the information content of the analysis from around 0.7 to over 0.9. The maximum evidence for linkage was the Z likelihood ratio score statistic of Kong and Cox (Z(LR))=4.69 at 109.8 cM. The exact p value was below the genomewide significance threshold. By contrast, in the genome scan with microsatellite markers at 9 cM spacing, the maximum Z(LR) for European-ancestry families was 3.43 (106.53 cM). It was estimated that the linked locus or loci in this region might account for a 20% or less populationwide increase in risk to siblings of cases. This region has produced modestly positive evidence for linkage to depression and related traits in other studies. These results suggest that DNA sequence variations in one or more genes in the 15q25-q26 region can increase susceptibility to major depression and that efforts are warranted to identify these genes.

  17. Heritability, linkage, and genetic associations of exercise treadmill test responses.

    PubMed

    Ingelsson, Erik; Larson, Martin G; Vasan, Ramachandran S; O'Donnell, Christopher J; Yin, Xiaoyan; Hirschhorn, Joel N; Newton-Cheh, Christopher; Drake, Jared A; Musone, Stacey L; Heard-Costa, Nancy L; Benjamin, Emelia J; Levy, Daniel; Atwood, Larry D; Wang, Thomas J; Kathiresan, Sekar

    2007-06-12

    The blood pressure (BP) and heart rate responses to exercise treadmill testing predict incidence of cardiovascular disease, but the genetic determinants of hemodynamic and chronotropic responses to exercise are largely unknown. We assessed systolic BP, diastolic BP, and heart rate during the second stage of the Bruce protocol and at the third minute of recovery in 2982 Framingham Offspring participants (mean age 43 years; 53% women). With use of residuals from multivariable models adjusted for clinical correlates of exercise treadmill testing responses, we estimated the heritability (variance-components methods), genetic linkage (multipoint quantitative trait analyses), and association with 235 single-nucleotide polymorphisms in 14 candidate genes selected a priori from neurohormonal pathways for their potential role in exercise treadmill testing responses. Heritability estimates for heart rate during exercise and during recovery were 0.32 and 0.34, respectively. Heritability estimates for BP variables during exercise were 0.25 and 0.26 (systolic and diastolic BP) and during recovery, 0.16 and 0.13 (systolic and diastolic BP), respectively. Suggestive linkage was found for systolic BP during recovery from exercise (locus 1q43-44, log-of-the-odds score 2.59) and diastolic BP during recovery from exercise (locus 4p15.3, log-of-the-odds score 2.37). Among 235 single-nucleotide polymorphisms tested for association with exercise treadmill testing responses, the minimum nominal probability value was 0.003, which was nonsignificant after adjustment for multiple testing. Hemodynamic and chronotropic responses to exercise are heritable and demonstrate suggestive linkage to select loci. Genetic mapping with newer approaches such as genome-wide association may yield novel insights into the physiological responses to exercise.

  18. Integrating multiple genomic data to predict disease-causing nonsynonymous single nucleotide variants in exome sequencing studies.

    PubMed

    Wu, Jiaxin; Li, Yanda; Jiang, Rui

    2014-03-01

    Exome sequencing has been widely used in detecting pathogenic nonsynonymous single nucleotide variants (SNVs) for human inherited diseases. However, traditional statistical genetics methods are ineffective in analyzing exome sequencing data, due to such facts as the large number of sequenced variants, the presence of non-negligible fraction of pathogenic rare variants or de novo mutations, and the limited size of affected and normal populations. Indeed, prevalent applications of exome sequencing have been appealing for an effective computational method for identifying causative nonsynonymous SNVs from a large number of sequenced variants. Here, we propose a bioinformatics approach called SPRING (Snv PRioritization via the INtegration of Genomic data) for identifying pathogenic nonsynonymous SNVs for a given query disease. Based on six functional effect scores calculated by existing methods (SIFT, PolyPhen2, LRT, MutationTaster, GERP and PhyloP) and five association scores derived from a variety of genomic data sources (gene ontology, protein-protein interactions, protein sequences, protein domain annotations and gene pathway annotations), SPRING calculates the statistical significance that an SNV is causative for a query disease and hence provides a means of prioritizing candidate SNVs. With a series of comprehensive validation experiments, we demonstrate that SPRING is valid for diseases whose genetic bases are either partly known or completely unknown and effective for diseases with a variety of inheritance styles. In applications of our method to real exome sequencing data sets, we show the capability of SPRING in detecting causative de novo mutations for autism, epileptic encephalopathies and intellectual disability. We further provide an online service, the standalone software and genome-wide predictions of causative SNVs for 5,080 diseases at http://bioinfo.au.tsinghua.edu.cn/spring.

  19. Large-scale mass spectrometric detection of variant peptides resulting from non-synonymous nucleotide differences

    PubMed Central

    Sheynkman, Gloria M.; Shortreed, Michael R.; Frey, Brian L.; Scalf, Mark; Smith, Lloyd M.

    2013-01-01

    Each individual carries thousands of non-synonymous single nucleotide variants (nsSNVs) in their genome, each corresponding to a single amino acid polymorphism (SAP) in the encoded proteins. It is important to be able to directly detect and quantify these variations at the protein level in order to study post-transcriptional regulation, differential allelic expression, and other important biological processes. However, such variant peptides are not generally detected in standard proteomic analyses, due to their absence from the generic databases that are employed for mass spectrometry searching. Here, we extend previous work that demonstrated the use of customized SAP databases constructed from sample-matched RNA-Seq data. We collected deep coverage RNA-Seq data from the Jurkat cell line, compiled the set of nsSNVs that are expressed, used this information to construct a customized SAP database, and searched it against deep coverage shotgun MS data obtained from the same sample. This approach enabled detection of 421 SAP peptides mapping to 395 nsSNVs. We compared these peptides to peptides identified from a large generic search database containing all known nsSNVs (dbSNP) and found that more than 70% of the SAP peptides from this dbSNP-derived search were not supported by the RNA-Seq data, and thus are likely false positives. Next, we increased the SAP coverage from the RNA-Seq derived database by utilizing multiple protease digestions, thereby increasing variant detection to 695 SAP peptides mapping to 504 nsSNV sites. These detected SAP peptides corresponded to moderate to high abundance transcripts (30+ transcripts per million, TPM). The SAP peptides included 192 allelic pairs; the relative expression levels of the two alleles were evaluated for 51 of those pairs, and found to be comparable in all cases. PMID:24175627

  20. Single Nucleotide Polymorphism in Gene Encoding Transcription Factor Prep1 Is Associated with HIV-1-Associated Dementia

    PubMed Central

    van Manen, Daniëlle; Bunnik, Evelien M.; van Sighem, Ard I.; Sieberer, Margit; Boeser-Nunnink, Brigitte; de Wolf, Frank; Schuitemaker, Hanneke; Portegies, Peter; Kootstra, Neeltje A.; van 't Wout, Angélique B.

    2012-01-01

    Background Infection with HIV-1 may result in severe cognitive and motor impairment, referred to as HIV-1-associated dementia (HAD). While its prevalence has dropped significantly in the era of combination antiretroviral therapy, milder neurocognitive disorders persist with a high prevalence. To identify additional therapeutic targets for treating HIV-associated neurocognitive disorders, several candidate gene polymorphisms have been evaluated, but few have been replicated across multiple studies. Methods We here tested 7 candidate gene polymorphisms for association with HAD in a case-control study consisting of 86 HAD cases and 246 non-HAD AIDS patients as controls. Since infected monocytes and macrophages are thought to play an important role in the infection of the brain, 5 recently identified single nucleotide polymorphisms (SNPs) affecting HIV-1 replication in macrophages in vitro were also tested. Results The CCR5 wt/Δ32 genotype was only associated with HAD in individuals who developed AIDS prior to 1991, in agreement with the observed fading effect of this genotype on viral load set point. A significant difference in genotype distribution among all cases and controls irrespective of year of AIDS diagnosis was found only for a SNP in candidate gene PREP1 (p = 1.2×10−5). Prep1 has recently been identified as a transcription factor preferentially binding the −2,518 G allele in the promoter of the gene encoding MCP-1, a protein with a well established role in the etiology of HAD. Conclusion These results support previous findings suggesting an important role for MCP-1 in the onset of HIV-1-associated neurocognitive disorders. PMID:22347417

  1. Increased Genomic Prediction Accuracy in Wheat Breeding Through Spatial Adjustment of Field Trial Data

    PubMed Central

    Lado, Bettina; Matus, Ivan; Rodríguez, Alejandra; Inostroza, Luis; Poland, Jesse; Belzile, François; del Pozo, Alejandro; Quincke, Martín; Castro, Marina; von Zitzewitz, Jarislav

    2013-01-01

    In crop breeding, the interest of predicting the performance of candidate cultivars in the field has increased due to recent advances in molecular breeding technologies. However, the complexity of the wheat genome presents some challenges for applying new technologies in molecular marker identification with next-generation sequencing. We applied genotyping-by-sequencing, a recently developed method to identify single-nucleotide polymorphisms, in the genomes of 384 wheat (Triticum aestivum) genotypes that were field tested under three different water regimes in Mediterranean climatic conditions: rain-fed only, mild water stress, and fully irrigated. We identified 102,324 single-nucleotide polymorphisms in these genotypes, and the phenotypic data were used to train and test genomic selection models intended to predict yield, thousand-kernel weight, number of kernels per spike, and heading date. Phenotypic data showed marked spatial variation. Therefore, different models were tested to correct the trends observed in the field. A mixed-model using moving-means as a covariate was found to best fit the data. When we applied the genomic selection models, the accuracy of predicted traits increased with spatial adjustment. Multiple genomic selection models were tested, and a Gaussian kernel model was determined to give the highest accuracy. The best predictions between environments were obtained when data from different years were used to train the model. Our results confirm that genotyping-by-sequencing is an effective tool to obtain genome-wide information for crops with complex genomes, that these data are efficient for predicting traits, and that correction of spatial variation is a crucial ingredient to increase prediction accuracy in genomic selection models. PMID:24082033

  2. MYH9 genetic variants associated with glomerular disease: what is the role for genetic testing?

    PubMed

    Kopp, Jeffrey B; Winkler, Cheryl A; Nelson, George W

    2010-07-01

    Genetic variation in MYH9, encoding nonmuscle myosin IIA heavy chain, has been associated recently with increased risk for kidney disease. Previously, MYH9 missense mutations have been shown to cause the autosomal-dominant MYH9 (ADM9) spectrum, characterized by large platelets, leukocyte Döhle bodies, and, variably, sensorineural deafness, cataracts, and glomerulopathy. Genetic testing is indicated for familial and sporadic cases that fit this spectrum. By contrast, the MYH9 kidney risk variant is characterized by multiple intronic single nucleotide polymorphisms, but the causative variant has not been identified. Disease associations include human immunodeficiency virus-associated collapsing glomerulopathy, focal segmental glomerulosclerosis, hypertension-attributed end-stage kidney disease, and diabetes-attributed end-stage kidney disease. One plausible hypothesis is that the MYH9 kidney risk variant confers a fragile podocyte phenotype. In the case of hypertension-attributed kidney disease, it remains unclear if the hypertension is a contributing cause or a consequence of glomerular injury. The MYH9 kidney risk variant is strikingly more common among individuals of African descent, but only some will develop clinical kidney disease in their lifetime. Thus, it is likely that additional genes and/or environmental factors interact with the MYH9 kidney risk variant to trigger glomerular injury. A preliminary genetic risk stratification scheme, using two single nucleotide polymorphisms, may estimate lifetime risk for kidney disease. Nevertheless, at present, no role has been established for genetic testing as part of personalized medicine, but testing should be considered in clinical studies of glomerular diseases among populations of African descent. Such studies will address critical questions pertaining to MYH9-associated kidney disease, including mechanism, course, and response to therapy. Published by Elsevier Inc.

  3. Inverse correlation between HPSE gene single nucleotide polymorphisms and heparanase expression: possibility of multiple levels of heparanase regulation

    PubMed Central

    Ostrovsky, Olga; Korostishevsky, Michael; Shafat, Itay; Mayorov, Margarita; Ilan, Neta; Vlodavsky, Israel; Nagler, Arnon

    2009-01-01

    Heparanase is an endo-β-glucuronidase that specifically cleaves the saccharide chains of heparan sulfate proteoglycans. Heparanase plays important roles in processes such as angiogenesis, tumor metastasis, tissue repair and remodeling, inflammation and autoimmunity. Genetic variations of the heparanase gene (HPSE) have been associated with heparanase transcription level. The present study was undertaken to identify haplotype or single nucleotide polymorphisms (SNPs) genotype combinations that correlate with heparanase expression both at the mRNA and protein levels. For this purpose, 11 HPSE gene SNPs were genotyped among 108 healthy individuals. Five out of the eleven polymorphisms revealed an association between the SNPs and heparanase expression. SNP rs4693608 exhibited a strong evidence of association. Analysis of haplotypes distribution revealed that the combination of two SNPs (rs4693608 and rs4364254) disclosed the most significant result. This approach allowed segregation of possible genotype combinations to three groups that correlate with low (LR: GG-CC, GG-CT, GG-TT, GA-CC), intermediate (MR: GA-CT, GA-TT) and high (HR: AA-TT, AA-CT) heparanase expression. Unexpectedly, LR genotype combinations were associated with low mRNA expressions level and high heparanase concentration in plasma, while HR genotype combinations were associated with high expression of mRNA and low plasma protein level. Because the main site of activity of secreted active heparanase is the extracellular matrix and cell surface, the origin and functional significance of plasma heparanase remain to be investigated. The current study indicates that rs4693608 and rs4364254 SNPs are involved in the regulation of heparanase expression and provides the basis for further studies on the association between HPSE gene SNPs and disease outcome. PMID:19406828

  4. Polygenic risk score in postmortem diagnosed sporadic early-onset Alzheimer's disease.

    PubMed

    Chaudhury, Sultan; Patel, Tulsi; Barber, Imelda S; Guetta-Baranes, Tamar; Brookes, Keeley J; Chappell, Sally; Turton, James; Guerreiro, Rita; Bras, Jose; Hernandez, Dena; Singleton, Andrew; Hardy, John; Mann, David; Morgan, Kevin

    2018-02-01

    Sporadic early-onset Alzheimer's disease (sEOAD) exhibits the symptoms of late-onset Alzheimer's disease but lacks the familial aspect of the early-onset familial form. The genetics of Alzheimer's disease (AD) identifies APOEε4 to be the greatest risk factor; however, it is a complex disease involving both environmental risk factors and multiple genetic loci. Polygenic risk scores (PRSs) accumulate the total risk of a phenotype in an individual based on variants present in their genome. We determined whether sEOAD cases had a higher PRS compared to controls. A cohort of sEOAD cases was genotyped on the NeuroX array, and PRSs were generated using PRSice. The target data set consisted of 408 sEOAD cases and 436 controls. The base data set was collated by the International Genomics of Alzheimer's Project consortium, with association data from 17,008 late-onset Alzheimer's disease cases and 37,154 controls, which can be used for identifying sEOAD cases due to having shared phenotype. PRSs were generated using all common single nucleotide polymorphisms between the base and target data set, PRS were also generated using only single nucleotide polymorphisms within a 500 kb region surrounding the APOE gene. Sex and number of APOE ε2 or ε4 alleles were used as variables for logistic regression and combined with PRS. The results show that PRS is higher on average in sEOAD cases than controls, although there is still overlap among the whole cohort. Predictive ability of identifying cases and controls using PRSice was calculated with 72.9% accuracy, greater than the APOE locus alone (65.2%). Predictive ability was further improved with logistic regression, identifying cases and controls with 75.5% accuracy. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. A single nucleotide polymorphism in the FADS1/FADS2 gene is associated with plasma lipid profiles in two genetically similar Asian ethnic groups with distinctive differences in lifestyle.

    PubMed

    Nakayama, Kazuhiro; Bayasgalan, Tumenbayer; Tazoe, Fumiko; Yanagisawa, Yoshiko; Gotoh, Takaya; Yamanaka, Kazuhiro; Ogawa, Ayumi; Munkhtulga, Lkhagvasuren; Chimedregze, Ulziiburen; Kagawa, Yasuo; Ishibashi, Shun; Iwamoto, Sadahiko

    2010-06-01

    Recent genome-wide association studies (GWASs) showed that single nucleotide polymorphisms (SNPs) in FADS1/FADS2 were associated with plasma lipid concentrations in populations with European ancestry. We investigated the associations between the SNPs in FADS1/FADS2 and plasma concentrations of triglycerides, high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C) in two Asian groups, i.e., Japanese and Mongolians. The genotype of rs174547 (T/C), found to be associated with triglyceride and HDL-C concentrations in the GWAS, was determined in 21,004 Japanese and 1,203 Mongolian individuals. Genotype-phenotype association was assessed by using multiple linear regression models, assuming an additive model of inheritance. The copy number of the rs174547 C allele was significantly associated with increased triglyceride levels (P = 1.5 x 10(-6)) and decreased HDL-C levels (P = 0.03) in the Japanese population. On the other hand, in the Mongolian population, the rs174547 C allele copy number was strongly associated with decreased LDL-C levels (P = 2.6 x 10(-6)), but was not associated with triglyceride and HDL-C levels. The linkage disequilibrium pattern and haplotype structures of SNPs around the FADS1/FADS2 locus showed no marked dissimilarity between Japanese and Mongolian individuals. The present data indicate that the FADS1/FADS2 locus can be added to the growing list of loci involved in polygenic dyslipidemia in Asians. Furthermore, the variable effects of FADS1/FADS2 on plasma lipid profiles in Asians may result from differences in the dietary intake of polyunsaturated fatty acids, which serve as substrates for enzymes encoded by FADS1/FADS2.

  6. Single-nucleotide polymorphisms of MMP2 in MMP/TIMP pathways associated with the risk of alcohol-induced osteonecrosis of the femoral head in Chinese males: A case-control study.

    PubMed

    Yu, Yan; Xie, Zhilan; Wang, Jihan; Chen, Chu; Du, Shuli; Chen, Peng; Li, Bin; Jin, Tianbo; Zhao, Heping

    2016-12-01

    The proportion of alcohol-induced osteonecrosis of the femoral head (ONFH) in all ONFH patients was 30.7%, with males prevailing among the ONFH patients in mainland China (70.1%). Matrix metalloproteinase 2 (MMP2), a member of the MMP gene family, encodes the enzyme MMP2, which can promote osteoclast migration, attachment, and bone matrix degradation. In this case-control study, we aimed to investigate the association between MMP2 and the alcohol-induced ONFH in Chinese males.In total, 299 patients with alcohol-induced ONFH and 396 healthy controls were recruited for a case-control association study. Five single-nucleotide polymorphisms within the MMP2 locus were genotyped and examined for their correlation with the risk of alcohol-induced ONFH and treatment response using Pearson χ test and unconditional logistic regression analysis. We identified 3 risk alleles for carriers: the allele "T" of rs243849 increased the risk of alcohol-induced ONFH in the allele model, the log-additive model without adjustment, and the log-additive model with adjustment for age. Conversely, the genotypes "CC" in rs7201 and "CC" in rs243832 decreased the risk of alcohol-induced ONFH, as revealed by the recessive model. After the Bonferroni multiple adjustment, no significant association was found. Furthermore, the haplotype analysis showed that the "TT" haplotype of MMP2 was more frequent among patients with alcohol-induced ONFH by unconditional logistic regression analysis adjusted for age.In conclusion, there may be an association between MMP2 and the risk of alcohol-induced ONFH in North-Chinese males. However, studies on larger populations are needed to confirm this hypothesis; these data may provide a theoretical foundation for future studies.

  7. A Multiomics Approach to Identify Genes Associated with Childhood Asthma Risk and Morbidity.

    PubMed

    Forno, Erick; Wang, Ting; Yan, Qi; Brehm, John; Acosta-Perez, Edna; Colon-Semidey, Angel; Alvarez, Maria; Boutaoui, Nadia; Cloutier, Michelle M; Alcorn, John F; Canino, Glorisa; Chen, Wei; Celedón, Juan C

    2017-10-01

    Childhood asthma is a complex disease. In this study, we aim to identify genes associated with childhood asthma through a multiomics "vertical" approach that integrates multiple analytical steps using linear and logistic regression models. In a case-control study of childhood asthma in Puerto Ricans (n = 1,127), we used adjusted linear or logistic regression models to evaluate associations between several analytical steps of omics data, including genome-wide (GW) genotype data, GW methylation, GW expression profiling, cytokine levels, asthma-intermediate phenotypes, and asthma status. At each point, only the top genes/single-nucleotide polymorphisms/probes/cytokines were carried forward for subsequent analysis. In step 1, asthma modified the gene expression-protein level association for 1,645 genes; pathway analysis showed an enrichment of these genes in the cytokine signaling system (n = 269 genes). In steps 2-3, expression levels of 40 genes were associated with intermediate phenotypes (asthma onset age, forced expiratory volume in 1 second, exacerbations, eosinophil counts, and skin test reactivity); of those, methylation of seven genes was also associated with asthma. Of these seven candidate genes, IL5RA was also significant in analytical steps 4-8. We then measured plasma IL-5 receptor α levels, which were associated with asthma age of onset and moderate-severe exacerbations. In addition, in silico database analysis showed that several of our identified IL5RA single-nucleotide polymorphisms are associated with transcription factors related to asthma and atopy. This approach integrates several analytical steps and is able to identify biologically relevant asthma-related genes, such as IL5RA. It differs from other methods that rely on complex statistical models with various assumptions.

  8. Effects of IL1B single nucleotide polymorphisms on depressive and anxiety symptoms are determined by severity and type of life stress.

    PubMed

    Kovacs, David; Eszlari, Nora; Petschner, Peter; Pap, Dorottya; Vas, Szilvia; Kovacs, Peter; Gonda, Xenia; Juhasz, Gabriella; Bagdy, Gyorgy

    2016-08-01

    Interleukin-1β is one of the main mediators in the cross-talk between the immune system and the central nervous system. Higher interleukin-1β levels are found in mood spectrum disorders, and the stress-induced expression rate of the interleukin-1β gene (IL1B) is altered by polymorphisms in the region. Therefore we examined the effects of rs16944 and rs1143643 single nucleotide polymorphisms (SNPs) within the IL1B gene on depressive and anxiety symptoms, as measured by the Brief Symptom Inventory, in a Hungarian population sample of 1053 persons. Distal and proximal environmental stress factors were also included in our analysis, namely childhood adversity and recent negative life-events. We found that rs16944 minor (A) allele specifically interacted with childhood adversity increasing depressive and anxiety symptoms, while rs1143643's minor (A) allele showed protective effect against depressive symptoms after recent life stress. The genetic main effects of the two SNPs were not significant in the main analysis, but the interaction effects remained significant after correction for multiple testing. In addition, the effect of rs16944 A allele was reversed in a subsample with low-exposure to life stress, suggesting a protective effect against depressive symptoms, in the post hoc analysis. In summary, both of the two IL1B SNPs showed specific environmental stressor-dependent effects on mood disorder symptoms. We also demonstrated that the presence of exposure to childhood adversity changed the direction of the rs16944 effect on depression phenotype. Therefore our results suggest that it is advisable to include environmental factors in genetic association studies when examining the effect of the IL1B gene. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  9. Kaposi's Sarcoma-Associated Herpesvirus MicroRNA Single-Nucleotide Polymorphisms Identified in Clinical Samples Can Affect MicroRNA Processing, Level of Expression, and Silencing Activity

    PubMed Central

    Han, Soo-Jin; Marshall, Vickie; Barsov, Eugene; Quiñones, Octavio; Ray, Alex; Labo, Nazzarena; Trivett, Matthew; Ott, David; Renne, Rolf

    2013-01-01

    Kaposi's sarcoma-associated herpesvirus (KSHV) encodes 12 pre-microRNAs that can produce 25 KSHV mature microRNAs. We previously reported single-nucleotide polymorphisms (SNPs) in KSHV-encoded pre-microRNA and mature microRNA sequences from clinical samples (V. Marshall et al., J. Infect. Dis., 195:645–659, 2007). To determine whether microRNA SNPs affect pre-microRNA processing and, ultimately, mature microRNA expression levels, we performed a detailed comparative analysis of (i) mature microRNA expression levels, (ii) in vitro Drosha/Dicer processing, and (iii) RNA-induced silencing complex-dependent targeting of wild-type (wt) and variant microRNA genes. Expression of pairs of wt and variant pre-microRNAs from retroviral vectors and measurement of KSHV mature microRNA expression by real-time reverse transcription-PCR (RT-PCR) revealed differential expression levels that correlated with the presence of specific sequence polymorphisms. Measurement of KSHV mature microRNA expression in a panel of primary effusion lymphoma cell lines by real-time RT-PCR recapitulated some observed expression differences but suggested a more complex relationship between sequence differences and expression of mature microRNA. Furthermore, in vitro maturation assays demonstrated significant SNP-associated changes in Drosha/DGCR8 and/or Dicer processing. These data demonstrate that SNPs within KSHV-encoded pre-microRNAs are associated with differential microRNA expression levels. Given the multiple reports on the involvement of microRNAs in cancer, the biological significance of these phenotypic and genotypic variants merits further studies in patients with KSHV-associated malignancies. PMID:24006441

  10. Three Substrains of the Cyanobacterium Anabaena sp. Strain PCC 7120 Display Divergence in Genomic Sequences and hetC Function.

    PubMed

    Wang, Yali; Gao, Yuan; Li, Chao; Gao, Hong; Zhang, Cheng-Cai; Xu, Xudong

    2018-07-01

    Anabaena sp. strain PCC 7120 is a model strain for molecular studies of cell differentiation and patterning in heterocyst-forming cyanobacteria. Subtle differences in heterocyst development have been noticed in different laboratories working on the same organism. In this study, 360 mutations, including single nucleotide polymorphisms (SNPs), small insertion/deletions (indels; 1 to 3 bp), fragment deletions, and transpositions, were identified in the genomes of three substrains. Heterogeneous/heterozygous bases were also identified due to the polyploidy nature of the genome and the multicellular morphology but could be completely segregated when plated after filament fragmentation by sonication. hetC is a gene upregulated in developing cells during heterocyst formation in Anabaena sp. strain PCC 7120 and found in approximately half of other heterocyst-forming cyanobacteria. Inactivation of hetC in 3 substrains of Anabaena sp. PCC 7120 led to different phenotypes: the formation of heterocysts, differentiating cells that keep dividing, or the presence of both heterocysts and dividing differentiating cells. The expression of P hetZ - gfp in these hetC mutants also showed different patterns of green fluorescent protein (GFP) fluorescence. Thus, the function of hetC is influenced by the genomic background and epistasis and constitutes an example of evolution under way. IMPORTANCE Our knowledge about the molecular genetics of heterocyst formation, an important cell differentiation process for global N 2 fixation, is mostly based on studies with Anabaena sp. strain PCC 7120. Here, we show that rapid microevolution is under way in this strain, leading to phenotypic variations for certain genes related to heterocyst development, such as hetC This study provides an example for ongoing microevolution, marked by multiple heterogeneous/heterozygous single nucleotide polymorphisms (SNPs), in a multicellular multicopy-genome microorganism. Copyright © 2018 American Society for Microbiology.

  11. A novel approach to exploring potential interactions among single-nucleotide polymorphisms of inflammation genes in gliomagenesis: an exploratory case-only study.

    PubMed

    Amirian, E Susan; Scheurer, Michael E; Liu, Yanhong; D'Amelio, Anthony M; Houlston, Richard S; Etzel, Carol J; Shete, Sanjay; Swerdlow, Anthony J; Schoemaker, Minouk J; McKinney, Patricia A; Fleming, Sarah J; Muir, Kenneth R; Lophatananon, Artitaya; Bondy, Melissa L

    2011-08-01

    Despite extensive research on the topic, glioma etiology remains largely unknown. Exploration of potential interactions between single-nucleotide polymorphisms (SNP) of immune genes is a promising new area of glioma research. The case-only study design is a powerful and efficient design for exploring possible multiplicative interactions between factors that are independent of one another. The purpose of our study was to use this exploratory design to identify potential pair wise SNP-SNP interactions from genes involved in several different immune-related pathways for investigation in future studies. The study population consisted of two case groups: 1,224 histologic confirmed, non-Hispanic white glioma cases from the United States and a validation population of 634 glioma cases from the United Kingdom. Polytomous logistic regression, in which one SNP was coded as the outcome and the other SNP was included as the exposure, was utilized to calculate the ORs of the likelihood of cases simultaneously having the variant alleles of two different SNPs. Potential interactions were examined only between SNPs located in different genes or chromosomes. Using this data mining strategy, we found 396 significant SNP-SNP interactions among polymorphisms of immune-related genes that were present in both the U.S. and U.K. study populations. This exploratory study was conducted for the purpose of hypothesis generation, and thus has provided several new hypotheses that can be tested using traditional case-control study designs to obtain estimates of risk. This is the first study, to our knowledge, to take this novel approach to identifying SNP-SNP interactions relevant to glioma etiology. ©2011 AACR.

  12. Systematic, genome-wide, sex-specific linkage of cardiovascular traits in French Canadians.

    PubMed

    Seda, Ondrej; Tremblay, Johanne; Gaudet, Daniel; Brunelle, Pierre-Luc; Gurau, Alexandru; Merlo, Ettore; Pilote, Louise; Orlov, Sergei N; Boulva, Francis; Petrovich, Milan; Kotchen, Theodore A; Cowley, Allen W; Hamet, Pavel

    2008-04-01

    The sexual dimorphism of cardiovascular traits, as well as susceptibility to a variety of related diseases, has long been recognized, yet their sex-specific genomic determinants are largely unknown. We systematically assessed the sex-specific heritability and linkage of 539 hemodynamic, metabolic, anthropometric, and humoral traits in 120 French-Canadian families from the Saguenay-Lac-St-Jean region of Quebec, Canada. We performed multipoint linkage analysis using microsatellite markers followed by peak-wide linkage scan based on Affymetrix Human Mapping 50K Array Xba240 single nucleotide polymorphism genotypes in 3 settings, including the entire sample and then separately in men and women. Nearly one half of the traits were age and sex independent, one quarter were both age and sex dependent, and one eighth were exclusively age or sex dependent. Sex-specific phenotypes are most frequent in heart rate and blood pressure categories, whereas sex- and age-independent determinants are predominant among humoral and biochemical parameters. Twenty sex-specific loci passing multiple testing criteria were corroborated by 2-point single nucleotide polymorphism linkage. Several resting systolic blood pressure measurements showed significant genotype-by-sex interaction, eg, male-specific locus at chromosome 12 (male-female logarithm of odds difference: 4.16; interaction P=0.0002), which was undetectable in the entire population, even after adjustment for sex. Detailed interrogation of this locus revealed a 220-kb block overlapping parts of TAO-kinase 3 and SUDS3 genes. In summary, a large number of complex cardiovascular traits display significant sexual dimorphism, for which we have demonstrated genomic determinants at the haplotype level. Many of these would have been missed in a traditional, sex-adjusted setting.

  13. Translating natural genetic variation to gene expression in a computational model of the Drosophila gap gene regulatory network

    PubMed Central

    Kozlov, Konstantin N.; Kulakovskiy, Ivan V.; Zubair, Asif; Marjoram, Paul; Lawrie, David S.; Nuzhdin, Sergey V.; Samsonova, Maria G.

    2017-01-01

    Annotating the genotype-phenotype relationship, and developing a proper quantitative description of the relationship, requires understanding the impact of natural genomic variation on gene expression. We apply a sequence-level model of gap gene expression in the early development of Drosophila to analyze single nucleotide polymorphisms (SNPs) in a panel of natural sequenced D. melanogaster lines. Using a thermodynamic modeling framework, we provide both analytical and computational descriptions of how single-nucleotide variants affect gene expression. The analysis reveals that the sequence variants increase (decrease) gene expression if located within binding sites of repressors (activators). We show that the sign of SNP influence (activation or repression) may change in time and space and elucidate the origin of this change in specific examples. The thermodynamic modeling approach predicts non-local and non-linear effects arising from SNPs, and combinations of SNPs, in individual fly genotypes. Simulation of individual fly genotypes using our model reveals that this non-linearity reduces to almost additive inputs from multiple SNPs. Further, we see signatures of the action of purifying selection in the gap gene regulatory regions. To infer the specific targets of purifying selection, we analyze the patterns of polymorphism in the data at two phenotypic levels: the strengths of binding and expression. We find that combinations of SNPs show evidence of being under selective pressure, while individual SNPs do not. The model predicts that SNPs appear to accumulate in the genotypes of the natural population in a way biased towards small increases in activating action on the expression pattern. Taken together, these results provide a systems-level view of how genetic variation translates to the level of gene regulatory networks via combinatorial SNP effects. PMID:28898266

  14. Genotype Analysis of Bacillus anthracis Strains Circulating in Bangladesh.

    PubMed

    Rume, Farzana Islam; Affuso, Alessia; Serrecchia, Luigina; Rondinone, Valeria; Manzulli, Viviana; Campese, Emanuele; Di Taranto, Pietro; Biswas, Paritosh Kumar; Ahsan, Chowdhury Rafiqul; Yasmin, Mahmuda; Fasanella, Antonio; Hugh-Jones, Martin

    2016-01-01

    In Bangladesh, anthrax, caused by the bacterium Bacillus anthracis, is considered an endemic disease affecting ruminants with sporadic zoonotic occurrences in humans. Due to the lack of knowledge about risks from an incorrect removal of infected carcasses, the disease is not properly monitored, and because of the socio-economic conditions, the situation is under-reported and under-diagnosed. For sensitive species, anthrax represents a fatal outcome with sudden death and sometimes bleeding from natural orifices. The most common source of infection for ruminants is ingestion of spores during grazing in contaminated pastures or through grass and water contaminated with anthrax spores. Domestic cattle, sheep and goats can also become infected through contaminated bone meal (used as feed) originating from anthrax-infected carcasses. The present investigation was conducted to isolate B. anthracis organisms from 169 samples (73 soil, 1 tissue, 4 bone and 91 bone meal samples) collected from 12 different districts of Bangladesh. The sampling was carried out from 2012 to 2015. Twelve samples resulted positive for B. anthracis. Biomolecular analyses were conducted starting from the Canonical Single Nucleotide Polymorphism (CanSNP) to analyze the phylogenetic origin of strains. The analysis of genotype, obtained through the Multiple Locus Variable Number Tandem Repeat Analysis (MLVA) with the analysis of 15 Variable Number Tandem Repeats (VNTR), demonstrated four different genotypes: two of them were previously identified in the district of Sirajganj. The sub-genotyping, conducted with Single Nucleotide Repeats analysis, revealed the presence of eight subgenotypes. The data of the present study concluded that there was no observed correlation between imported cattle feed and anthrax occurrence in Bangladesh and that the remarkable genetic variations of B. anthracis were found in the soil of numerous outbreaks in this country.

  15. Allopregnanolone levels and depressive symptoms during pregnancy in relation to single nucleotide polymorphisms in the allopregnanolone synthesis pathway.

    PubMed

    Hellgren, Charlotte; Comasco, Erika; Skalkidou, Alkistis; Sundström-Poromaa, Inger

    2017-08-01

    Allopregnanolone, a neurosteroid whose levels rise throughout gestation, putatively stabilizes antenatal mood. The present study aimed to investigate associations of plasma allopregnanolone to antenatal depressive symptoms, as well as to genetic and obstetric factors. Allopregnanolone plasma levels from 284 pregnant women were measured around gestational week 18. Haplotype tag single nucleotide polymorphisms in the aldo-keto reductase family 1, members C2 and C4 (AKR1C2, AKR1C4), and steroid 5 alpha-reductase 1 and 2 (SRD5A1, and SRD5A2) genes were genotyped in a larger sample of pregnant women (n=1351). The Edinburgh Postnatal Depression Scale (EPDS) was administered via web-questionnaires in gestational weeks 17 and 32. Demographic and obstetric data was retrieved from web-questionnaires and medical records. There was no association between allopregnanolone levels and depressive symptoms. Furthermore, no associations between allopregnanolone level and synthesis pathway genotypes were found after accounting for multiple comparisons. However, exploratory analyses suggested that the women who were homozygous for the minor allele of the AKR1C2 polymorphism rs1937863 had nominally lower allopregnanolone levels and lower depression scores in gestational week 17, but also the highest increase in depression scores between week 17 and 32. Additionally, higher body mass index was associated with lower allopregnanolone levels. The results do not support second trimester plasma allopregnanolone as a mood stabilizing factor. However, we speculate that AKR1C2 variation may alter the susceptibility to depressive symptoms through effects on central allopregnanolone synthesis. Another implication of this study is that the relationship between neuroactive steroids and obesity in pregnancy deserves to be investigated. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  16. No association between TERT-CLPTM1L single nucleotide polymorphism rs401681 and mean telomere length or cancer risk.

    PubMed

    Pooley, Karen A; Tyrer, Jonathan; Shah, Mitul; Driver, Kristy E; Leyland, Jean; Brown, Judith; Audley, Tina; McGuffog, Lesley; Ponder, Bruce A J; Pharoah, Paul D P; Easton, Douglas F; Dunning, Alison M

    2010-07-01

    A recent study reported genetic variants in the TERT-CLPTM1L locus that were associated with mean telomere length, and with risk of multiple cancers. We evaluated the association between single nucleotide polymorphism (SNP) rs401681 (C > T) and mean telomere length, using quantitative real-time PCR, in blood-extracted DNA collected from 11,314 cancer-free participants from the Sisters in Breast Screening study, the Melanoma and Pigmented Lesions Evaluative Study melanoma family study, and the SEARCH Breast, Colorectal, Melanoma studies. We also examined the relationship between rs401618 genotype and susceptibility to breast cancer (6,800 cases and 6,608 controls), colorectal cancer (2,259 cases and 2,181 controls), and melanoma (787 cases and 999 controls). The "per T allele" change in mean telomere length (DeltaCt), adjusted for age, study plate, gender, and family was 0.001 [95% confidence intervals (CI), 0.01-0.02; P trend = 0.61]. The "per T allele" odds ratio for each cancer was 1.01 for breast cancer (95% CI, 0.96-1.06; P trend = 0.64), 1.02 for colorectal cancer (95% CI, 0.94-1.11; P trend = 0.66), and 0.99 for melanoma (95% CI, 0.84-1.15; P trend = 0.87). We found no evidence that this SNP was associated with mean telomere length, or with risk of breast cancer, colorectal cancer, or melanoma. Our results indicate that the observed associations between rs401681 and several cancer types might be weaker than previously described. The lack of an association in our study between this SNP and mean telomere length suggests that any association with cancer risk at this locus is not mediated through TERT.

  17. What can time-frequency and phase coherence measures tell us about the genetic basis of P3 amplitude?

    PubMed Central

    McGue, Matt; Iacono, William G.

    2017-01-01

    In a recent comprehensive investigation, we largely failed to identify significant genetic markers associated with P3 amplitude or to corroborate previous associations between P3 and specific single nucleotide polymorphisms (SNPs) or genes. In the present study we extended this line of investigation to examine time-frequency (TF) activity and intertrial phase coherence (ITPC) in the P3 time window, both of which are associated with P3 amplitude. Previous genome-wide research has reported associations between P3-related theta and delta activity and individual genetic variants. A large, population-based sample of 4211 subjects, comprising male and female adolescent twins and their parents, was genotyped for 527,828 single nucleotide polymorphisms (SNPs), from which over six million SNPs were accurately imputed. Heritability estimates were greater for TF energy than ITPC, whether based on biometric models or the combined influence of all measured SNPs (derived from genome-wide complex trait analysis). The magnitude of overlap in the specific SNPs associated with delta energy and ITPC and P3 amplitude was significant. A genome-wide analysis of all SNPs, accompanied by an analysis of approximately 17,600 genes, indicated a region of chromosome 2 around TEKT4 that was significantly associated with theta ITPC. Analysis of candidate SNPs and genes previously reported to be associated with P3 or related phenotypes yielded one association surviving correction for multiple tests: between theta energy and CRHR1. However, we did not obtain significant associations for SNPs implicated in previous genome-wide studies of TF measures. Identifying specific genetic variants associated with P3 amplitude remains a challenge. PMID:27871913

  18. Association of Sun Exposure, Skin Colour and Body Mass Index with Vitamin D Status in Individuals Who Are Morbidly Obese

    PubMed Central

    Bauer, Judith D.; Martin, Ian; Rochester, Sharon; Duarte Romero, Briony; Prins, Johannes B.; Wright, Olivia R. L.

    2017-01-01

    Vitamin D deficiency is a common issue, particularly in obese populations, and is tested by assessing serum 25(OH)D concentrations. This study aimed to identify factors that contribute to the vitamin D status in fifty morbidly obese individuals recruited prior to bariatric surgery. Data collected included serum 25(OH)D concentrations, dietary and supplement intake of vitamin D, sun exposure measures, skin colour via spectrophotometry, and genotype analysis of several single nucleotide polymorphisms in the vitamin D metabolism pathway. Results showed a significant correlation between serum 25(OH)D concentrations and age, and serum 25(OH)D and ITAC score (natural skin colour). Natural skin colour accounted for 13.5% of variation in serum 25(OH)D, with every 10° increase in ITAC score (i.e., lighter skin) leading to a 9 nmol/L decrease in serum 25(OH)D. Multiple linear regression using age, ITAC score, and average UV index in the three months prior to testing, significantly predicted serum 25(OH)D concentrations (R2 = 29.7%). Single nucleotide polymorphisms for all vitamin D genes tested, showed lower serum 25(OH)D for those with the rare genotype compared to the common genotype; this was most pronounced for fok1 and rs4588, where those with the rare genotype were insufficient (<50 nmol/L), and those with the common genotype were sufficient (≥50 nmol/L). Assessing vitamin D status in individuals with morbid obesity requires testing of 25(OH)D, but potential risk factors for this population include natural skin colour and age. PMID:28976930

  19. Evaluation of Candidate Genes for Cholinesterase Activity in Farmworkers Exposed to Organophosphorus Pesticides: Association of Single Nucleotide Polymorphisms in BCHE

    PubMed Central

    Howard, Timothy D.; Hsu, Fang-Chi; Grzywacz, Joseph G.; Chen, Haiying; Quandt, Sara A.; Vallejos, Quirina M.; Whalley, Lara E.; Cui, Wei; Padilla, Stephanie; Arcury, Thomas A.

    2010-01-01

    Background Organophosphate pesticides act as cholinesterase inhibitors. For those with agricultural exposure to these chemicals, risk of potential exposure-related health effects may be modified by genetic variability in cholinesterase metabolism. Cholinesterase activity is a useful, indirect measurement of pesticide exposure, especially in high-risk individuals such as farmworkers. To understand fully the links between pesticide exposure and potential human disease, analyses must be able to consider genetic variability in pesticide metabolism. Objectives We studied participants in the Community Participatory Approach to Measuring Farmworker Pesticide Exposure (PACE3) study to determine whether cholinesterase levels are associated with single-nucleotide polymorphisms (SNPs) involved in pesticide metabolism. Methods Cholinesterase levels were measured from blood samples taken from 287 PACE3 participants at up to four time points during the 2007 growing season. We performed association tests of cholinesterase levels and 256 SNPs in 30 candidate genes potentially involved in pesticide metabolism. A false discovery rate (FDR) p-value was used to account for multiple testing. Results Thirty-five SNPs were associated (unadjusted p < 0.05) based on at least one of the genetic models tested (general, additive, dominant, and recessive). The strongest evidence of association with cholinesterase levels was observed with two SNPs, rs2668207 and rs2048493, in the butyrylcholinesterase (BCHE) gene (FDR adjusted p = 0.15 for both; unadjusted p = 0.00098 and 0.00068, respectively). In participants with at least one minor allele, cholinesterase levels were lower by 4.3–9.5% at all time points, consistent with an effect that is independent of pesticide exposure. Conclusions Common genetic variation in the BCHE gene may contribute to subtle changes in cholinesterase levels. PMID:20529763

  20. Genotype Analysis of Bacillus anthracis Strains Circulating in Bangladesh

    PubMed Central

    Rume, Farzana Islam; Affuso, Alessia; Serrecchia, Luigina; Rondinone, Valeria; Manzulli, Viviana; Campese, Emanuele; Di Taranto, Pietro; Biswas, Paritosh Kumar; Ahsan, Chowdhury Rafiqul; Yasmin, Mahmuda; Fasanella, Antonio; Hugh-Jones, Martin

    2016-01-01

    In Bangladesh, anthrax, caused by the bacterium Bacillus anthracis, is considered an endemic disease affecting ruminants with sporadic zoonotic occurrences in humans. Due to the lack of knowledge about risks from an incorrect removal of infected carcasses, the disease is not properly monitored, and because of the socio-economic conditions, the situation is under-reported and under-diagnosed. For sensitive species, anthrax represents a fatal outcome with sudden death and sometimes bleeding from natural orifices. The most common source of infection for ruminants is ingestion of spores during grazing in contaminated pastures or through grass and water contaminated with anthrax spores. Domestic cattle, sheep and goats can also become infected through contaminated bone meal (used as feed) originating from anthrax-infected carcasses. The present investigation was conducted to isolate B. anthracis organisms from 169 samples (73 soil, 1 tissue, 4 bone and 91 bone meal samples) collected from 12 different districts of Bangladesh. The sampling was carried out from 2012 to 2015. Twelve samples resulted positive for B. anthracis. Biomolecular analyses were conducted starting from the Canonical Single Nucleotide Polymorphism (CanSNP) to analyze the phylogenetic origin of strains. The analysis of genotype, obtained through the Multiple Locus Variable Number Tandem Repeat Analysis (MLVA) with the analysis of 15 Variable Number Tandem Repeats (VNTR), demonstrated four different genotypes: two of them were previously identified in the district of Sirajganj. The sub-genotyping, conducted with Single Nucleotide Repeats analysis, revealed the presence of eight subgenotypes. The data of the present study concluded that there was no observed correlation between imported cattle feed and anthrax occurrence in Bangladesh and that the remarkable genetic variations of B. anthracis were found in the soil of numerous outbreaks in this country. PMID:27082248

Top