An immunity-based anomaly detection system with sensor agents.
Okamoto, Takeshi; Ishida, Yoshiteru
2009-01-01
This paper proposes an immunity-based anomaly detection system with sensor agents based on the specificity and diversity of the immune system. Each agent is specialized to react to the behavior of a specific user. Multiple diverse agents decide whether the behavior is normal or abnormal. Conventional systems have used only a single sensor to detect anomalies, while the immunity-based system makes use of multiple sensors, which leads to improvements in detection accuracy. In addition, we propose an evaluation framework for the anomaly detection system, which is capable of evaluating the differences in detection accuracy between internal and external anomalies. This paper focuses on anomaly detection in user's command sequences on UNIX-like systems. In experiments, the immunity-based system outperformed some of the best conventional systems.
The Potential of Nano-Vehicle Mediated Therapy in Vasculitis and Multiple Sclerosis.
In't Veld, R Huis; Da Silva, C G; Kaijzel, E L; Chan, A B; Cruz, L J
2017-01-01
The induction of immune tolerance towards self-antigens presents as a viable future strategy in the treatment of auto-immune diseases, including vasculitis and multiple sclerosis (MS). As specific targets are currently lacking for vasculitis due to incomplete understanding of the pathologies underlying this disease, current treatment options are based on modalities that induce general immune suppression. However, many immune suppressants used in the clinic are known to display wide biodistribution and are thus often accompanied by several adverse effects. Nano-vehicles (NVs) possess the ability to overcome such limitations by enabling more specific delivery of their content through modifications with targeting moieties. In this review, we describe the latest insights in the pathology of vasculitis that may function as potential targets for NV carrier systems, allowing more specific delivery of currently used immune suppressants. In addition, we describe the existing strategies to induce artificial immune tolerance and explore the feasibility of inducing regulatory T cell (Treg) mediated tolerance for MS, possibly mediated by NVs. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Neuro-immune interactions at barrier surfaces
Veiga-Fernandes, Henrique; Mucida, Daniel
2016-01-01
Multidirectional interactions between the nervous and immune systems have been documented in homeostasis and pathologies ranging from multiple sclerosis to autism, and from leukemia to acute and chronic inflammation. Recent studies have addressed this crosstalk using cell-specific targeting, novel sequencing, imaging and analytical tools, shedding light on unappreciated mechanisms of neuro-immune regulation. This review focuses on neuro-immune interactions at barrier surfaces, mostly the gut, but also including the skin and the airways, areas densely populated by neurons and immune cells that constantly sense and adapt to tissue-specific environmental challenges. PMID:27153494
Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A
2015-10-01
The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.
USDA-ARS?s Scientific Manuscript database
Avian coccidiosis is caused by multiple species of the apicomplexan protozoan, Eimeria, and is one of the most economically devastating enteric diseases for the poultry industry worldwide. Host immunity to Eimeria infection, however, is relatively species-specific. The ability to immunize chickens a...
Human Neoplasms Elicit Multiple Specific Immune Responses in the Autologous Host
NASA Astrophysics Data System (ADS)
Sahin, Ugur; Tureci, Ozlem; Schmitt, Holger; Cochlovius, Bjorn; Johannes, Thomas; Schmits, Rudolf; Stenner, Frank; Luo, Guorong; Schobert, Ingrid; Pfreundschuh, Michael
1995-12-01
Expression of cDNA libraries from human melanoma, renal cancer, astrocytoma, and Hodgkin disease in Escherichia coli and screening for clones reactive with high-titer IgG antibodies in autologous patient serum lead to the discovery of at least four antigens with a restricted expression pattern in each tumor. Besides antigens known to elicit T-cell responses, such as MAGE-1 and tyrosinase, numerous additional antigens that were overexpressed or specifically expressed in tumors of the same type were identified. Sequence analyses suggest that many of these molecules, besides being the target of a specific immune response, might be of relevance for tumor growth. Antibodies to a given antigen were usually confined to patients with the same tumor type. The unexpected frequency of human tumor antigens, which can be readily defined at the molecular level by the serological analysis of autologous tumor cDNA expression cloning, indicates that human neoplasms elicit multiple specific immune responses in the autologous host and provides diagnostic and therapeutic approaches to human cancer.
Qendro, Veneta; Bugos, Grace A; Lundgren, Debbie H; Glynn, John; Han, May H; Han, David K
2017-03-01
In order to gain mechanistic insights into multiple sclerosis (MS) pathogenesis, we utilized a multi-dimensional approach to test the hypothesis that mutations in myelin proteins lead to immune activation and central nervous system autoimmunity in MS. Mass spectrometry-based proteomic analysis of human MS brain lesions revealed seven unique mutations of PLP1; a key myelin protein that is known to be destroyed in MS. Surprisingly, in-depth genomic analysis of two MS patients at the genomic DNA and mRNA confirmed mutated PLP1 in RNA, but not in the genomic DNA. Quantification of wild type and mutant PLP RNA levels by qPCR further validated the presence of mutant PLP RNA in the MS patients. To seek evidence linking mutations in abundant myelin proteins and immune-mediated destruction of myelin, specific immune response against mutant PLP1 in MS patients was examined. Thus, we have designed paired, wild type and mutant peptide microarrays, and examined antibody response to multiple mutated PLP1 in sera from MS patients. Consistent with the idea of different patients exhibiting unique mutation profiles, we found that 13 out of 20 MS patients showed antibody responses against specific but not against all the mutant-PLP1 peptides. Interestingly, we found mutant PLP-directed antibody response against specific mutant peptides in the sera of pre-MS controls. The results from integrative proteomic, genomic, and immune analyses reveal a possible mechanism of mutation-driven pathogenesis in human MS. The study also highlights the need for integrative genomic and proteomic analyses for uncovering pathogenic mechanisms of human diseases. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Bearoff, Frank; del Rio, Roxana; Case, Laure K.; Dragon, Julie A.; Nguyen-Vu, Trang; Lin, Chin-Yo; Blankenhorn, Elizabeth P.; Teuscher, Cory; Krementsov, Dimitry N.
2016-01-01
Regulation of gene expression in immune cells is known to be under genetic control, and likely contributes to susceptibility to autoimmune diseases, such as multiple sclerosis (MS). How this occurs in concert across multiple immune cell types is poorly understood. Using a mouse model that harnesses the genetic diversity of wild-derived mice, more accurately reflecting genetically diverse human populations, we provide an extensive characterization of the genetic regulation of gene expression in five different naïve immune cell types relevant to MS. The immune cell transcriptome is shown to be under profound genetic control, exhibiting diverse patterns: global, cell-specific, and sex-specific. Bioinformatic analysis of the genetically-controlled transcript networks reveals reduced cell type-specificity and inflammatory activity in wild-derived PWD/PhJ mice, compared with the conventional laboratory strain C57BL/6J. Additionally, candidate MS-GWAS genes were significantly enriched among transcripts overrepresented in C57BL/6J cells compared to PWD. These expression level differences correlate with robust differences in susceptibility to experimental autoimmune encephalomyelitis, the principal model of MS, and skewing of the encephalitogenic T cell responses. Taken together, our results provide functional insights into the genetic regulation of the immune transcriptome, and shed light on how this in turn contributes to susceptibility to autoimmune disease. PMID:27653816
Gleditsch, Dorothy D; Shornick, Laurie P; Van Steenwinckel, Juliette; Gressens, Pierre; Weisert, Ryan P; Koenig, Joyce M
2014-07-01
Chorioamnionitis, an inflammatory gestational disorder, commonly precedes preterm delivery. Preterm infants may be at particular risk for inflammation-related morbidity related to infection, although the pathogenic mechanisms are unclear. We hypothesized that maternal inflammation modulates immune programming to drive postnatal inflammatory processes. We used a novel combined murine model to treat late gestation dams with low-dose lipopolysaccharide (LPS) and to secondarily challenge exposed neonates or weanlings with Sendai virus (SeV) lung infection. Multiple organs were analyzed to characterize age-specific postnatal immune and inflammatory responses. Maternal LPS treatment enhanced innate immune populations in the lungs, livers, and/or spleens of exposed neonates or weanlings. Secondary lung SeV infection variably affected neutrophil, macrophage, and dendritic cell proportions in multiple organs of exposed pups. Neonatal lung infection induced brain interleukin (IL)-4 expression, although this response was muted in LPS-exposed pups. Adaptive immune cells, including lung, lymph node, and thymic lymphocytes and lung CD4 cells expressing FoxP3, interferon (IFN)-γ, or IL-17, were variably prominent in LPS-exposed pups. Maternal inflammation modifies postnatal immunity and augments systemic inflammatory responses to viral lung infection in an age-specific manner. We speculate that inflammatory modulation of the developing immune system contributes to chronic morbidity and mortality in preterm infants.
Immune Tolerance in Multiple Sclerosis
Goverman, Joan M.
2011-01-01
Summary Multiple sclerosis is believed to be mediated by T cells specific for myelin antigens that circulate harmlessly in the periphery of healthy individuals until they are erroneously by an environmental stimulus. Upon activation, the T cells enter the central nervous system and orchestrate an immune response against myelin. To understand the initial steps in the pathogenesis of multiple sclerosis, it is important to identify the mechanisms that maintain T-cell tolerance to myelin antigens and to understand how some myelin-specific T cells escape tolerance and what conditions lead to their activation. Central tolerance strongly shapes the peripheral repertoire of myelin-specific T cells, as most myelin-specific T cells are eliminated by clonal deletion in the thymus. Self-reactive T cells that escape central tolerance are generally capable only of low-avidity interactions with antigen-presenting cells. Despite the low avidity of these interactions, peripheral tolerance mechanisms are required to prevent spontaneous autoimmunity. Multiple peripheral tolerance mechanisms for myelin-specific T cells have been indentified, the most important of which appears to be regulatory T cells. While most studies have focused on CD4+ myelin-specific T cells, interesting differences in tolerance mechanisms and the conditions that abrogate these mechanisms have recently been described for CD8+ myelin-specific T cells. PMID:21488900
Ubiquitination as an efficient molecular strategy employed in salmonella infection
USDA-ARS?s Scientific Manuscript database
The ubiquitin modification has various functions in the host innate immune system in response to the bacterial infection. To counteract the host immunity, Salmonella can specifically target ubiquitin pathways by its effector proteins. In this review, we describe the multiple facets of ubiquitin func...
USDA-ARS?s Scientific Manuscript database
The immune response to the highly acute foot-and-mouth disease virus (FMDV) is routinely reported as a measure of serum antibody. However, a critical effector function of immune responses combating viral infection of mammals is the cytotoxic T lymphocyte (CTL) response, mediated by virus specific ...
Submission of nucleotide sequence eimeria tenella elongation factor 1-alpha to genBank database
USDA-ARS?s Scientific Manuscript database
Avian coccidiosis is caused by multiple species of the apicomplexan protozoan, Eimeria, and is one of the most economically devastating enteric diseases for the poultry industry worldwide. Host immunity to Eimeria infection, however, is relatively species-specific. The ability to immunize chickens a...
Blyth, Emily; Clancy, Leighton; Simms, Renee; Gaundar, Shivashni; O'Connell, Philip; Micklethwaite, Kenneth; Gottlieb, David J
2011-11-27
BK virus (BKV) infection causes hemorrhagic cystitis posthemopoietic stem-cell transplant and graft loss in renal transplant recipients. Reactivation occurs in up to 60% of patients in both groups. Treatment-related cellular immunosuppression is a major contributor to the development of BKV-related disease, but the targets of the immune response are not well characterized. Immunotherapy by adoptive transfer of cellular effectors has been shown to be effective in controlling and preventing some virus-related diseases in transplant recipients, particularly Epstein-Barr virus and cytomegalovirus. Infusion of BKV-specific T cells may potentially reconstitute functional BKV immunity and reduce clinical complications of BKV infection. BKV-specific T cells for clinical use in adoptive immunotherapy were generated using monocyte-derived dendritic cells pulsed with overlapping peptide mixes spanning the five BKV proteins VP1, VP2, VP3, large T antigen, and small T antigen. Phenotypic and functional characteristics of the cells were investigated as well as their antigen specificity. Expanded CD4(+) and CD8(+) cells responded to restimulation with BKV peptides principally from VP1, large T, or small T antigens; produced multiple cytokines; and showed cytotoxic activity against antigen-coated targets. Possible clinical uses for BKV-specific T cells generated using this method include immune reconstitution posthemopoietic stem-cell transplantation or prophylaxis and treatment of immune deficiency in renal transplant recipients, fulfilling the need for effective therapy for BKV-related hemorrhagic cystitis and renal dysfunction.
Grover, Ajay; McLean, Jennifer L; Troudt, JoLynn M; Foster, Chad; Izzo, Linda; Creissen, Elisabeth; MacDonald, Elisabeth; Troy, Amber; Izzo, Angelo A
2016-05-27
The use of novel vaccine delivery systems allows for the manipulation of the adaptive immune systems through the use of molecular adjuvants that target specific innate pathways. Such strategies have been used extensively for vaccines against cancer and multiple pathogens such as Mycobacterium tuberculosis. In the current study we used heat killed non-pathogenic recombinant Saccharomyces cerevisiae expressing M. tuberculosis antigen Rv1886c (fbpB, mpt59, Ag85B) as a delivery system in conjunction with its ability to stimulate innate immunity to determine its ability to induce immunity. We established that the recombinant yeast induced activated antigen specific T cells are capable of reducing the mycobacterial burden. Inoculation of the recombinant yeast after vaccination with BCG resulted in a systemic alteration of the phenotype of the immune response although this was not reflected in an increase in the reduction of the mycobacterial burden. Taken together the data suggest that heat killed yeast can induce multiple cytokines required for induction of protective immunity and can function as a vehicle for delivery of M. tuberculosis antigens in a vaccine formulation. In addition, while it can enhance the effector memory response induced by BCG, it had little effect on central memory responses. Copyright © 2016 Elsevier Ltd. All rights reserved.
PPAR-γ in innate and adaptive lung immunity.
Nobs, Samuel Philip; Kopf, Manfred
2018-05-16
The transcription factor PPAR-γ (peroxisome proliferator-activated receptor-γ) is a key regulator of lung immunity exhibiting multiple cell type specific roles in controlling development and function of the lung immune system. It is strictly required for the generation of alveolar macrophages by controlling differentiation of fetal lung monocyte precursors. Furthermore, it plays an important role in lung allergic inflammation by licensing lung dendritic cell t helper 2 (Th2) priming capacity as well as acting as a master transcription factor for pathogenic Th2 cells. Due to this plethora of functions and its involvement in multiple pulmonary diseases including asthma and pulmonary alveolar proteinosis, understanding the role of PPAR-γ in lung immunity is an important subject of ongoing research. ©2018 Society for Leukocyte Biology.
Infections in MS: An innate immunity perspective.
Hänninen, A
2017-11-01
Multiple sclerosis is a multifaceted inflammatory-autoimmune disease, which shows remarkable heterogeneity in its clinical presentation, disease progression and in tissue lesions in the CNS. Focal lesions in white matter consist of immune effector cells, antibodies, and complement deposits in varying combinations, suggesting that immune mechanisms related to CNS pathology are multiple. Although adaptive immunity to myelin antigens is essential in MS pathogenesis, innate immune mechanisms are likely involved in its initiation and perpetuation. One key question is if recognition of infectious agents and microbial products by innate immune mechanisms impacts on MS and if so, how and where? This short review aims at conceptualizing how interactions between microbes and innate immune mechanisms could contribute to MS pathogenesis. Consideration is given to initiation of local inflammation and to myelin-specific immune responses, and how innate immunity and microbes may contribute to these. Recent advances in our understanding of lymphatic drainage of CNS, its immune surveillance and effects of gut microbiota and obesity on systemic endotoxin levels and T-cell priming may open new perspectives to understanding the roles that infectious agents and microbes may have in MS. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Novel Strategies for Immunotherapy in Multiple Myeloma: Previous Experience and Future Directions
Danylesko, Ivetta; Beider, Katia; Shimoni, Avichai; Nagler, Arnon
2012-01-01
Multiple myeloma (MM) is a life-threatening haematological malignancy for which standard therapy is inadequate. Autologous stem cell transplantation is a relatively effective treatment, but residual malignant sites may cause relapse. Allogeneic transplantation may result in durable responses due to antitumour immunity mediated by donor lymphocytes. However, morbidity and mortality related to graft-versus-host disease remain a challenge. Recent advances in understanding the interaction between the immune system of the patient and the malignant cells are influencing the design of clinically more efficient study protocols for MM. Cellular immunotherapy using specific antigen-presenting cells (APCs), to overcome aspects of immune incompetence in MM patients, has received great attention, and numerous clinical trials have evaluated the potential for dendritic cell (DC) vaccines as a novel immunotherapeutic approach. This paper will summarize the data investigating aspects of immunity concerning MM, immunotherapy for patients with MM, and strategies, on the way, to target the plasma cell more selectively. We also include the MM antigens and their specific antibodies that are of potential use for MM humoral immunotherapy, because they have demonstrated the most promising preclinical results. PMID:22649466
Amelioration of ongoing experimental autoimmune encephalomyelitis with fluoxetine.
Bhat, Roopa; Mahapatra, Sidharth; Axtell, Robert C; Steinman, Lawrence
2017-12-15
In patients with multiple sclerosis, the selective serotonin reuptake inhibitor, fluoxetine, resulted in less acute disease activity. We tested the immune modulating effects of fluoxetine in a mouse model of multiple sclerosis, i.e. experimental autoimmune encephalomyelitis (EAE). We show that fluoxetine delayed the onset of disease and reduced clinical paralysis in mice with established disease. Fluoxetine had abrogating effects on proliferation of immune cells and inflammatory cytokine production by both antigen-presenting cells and T cells. Specifically, in CD 4 T cells, fluoxetine increased Fas-induced apoptosis. We conclude that fluoxetine possesses immune-modulating effects resulting in the amelioration of symptoms in EAE. Copyright © 2017 Elsevier B.V. All rights reserved.
Genser, Bernd; Fischer, Joachim E; Figueiredo, Camila A; Alcântara-Neves, Neuza; Barreto, Mauricio L; Cooper, Philip J; Amorim, Leila D; Saemann, Marcus D; Weichhart, Thomas; Rodrigues, Laura C
2016-05-20
Immunologists often measure several correlated immunological markers, such as concentrations of different cytokines produced by different immune cells and/or measured under different conditions, to draw insights from complex immunological mechanisms. Although there have been recent methodological efforts to improve the statistical analysis of immunological data, a framework is still needed for the simultaneous analysis of multiple, often correlated, immune markers. This framework would allow the immunologists' hypotheses about the underlying biological mechanisms to be integrated. We present an analytical approach for statistical analysis of correlated immune markers, such as those commonly collected in modern immuno-epidemiological studies. We demonstrate i) how to deal with interdependencies among multiple measurements of the same immune marker, ii) how to analyse association patterns among different markers, iii) how to aggregate different measures and/or markers to immunological summary scores, iv) how to model the inter-relationships among these scores, and v) how to use these scores in epidemiological association analyses. We illustrate the application of our approach to multiple cytokine measurements from 818 children enrolled in a large immuno-epidemiological study (SCAALA Salvador), which aimed to quantify the major immunological mechanisms underlying atopic diseases or asthma. We demonstrate how to aggregate systematically the information captured in multiple cytokine measurements to immunological summary scores aimed at reflecting the presumed underlying immunological mechanisms (Th1/Th2 balance and immune regulatory network). We show how these aggregated immune scores can be used as predictors in regression models with outcomes of immunological studies (e.g. specific IgE) and compare the results to those obtained by a traditional multivariate regression approach. The proposed analytical approach may be especially useful to quantify complex immune responses in immuno-epidemiological studies, where investigators examine the relationship among epidemiological patterns, immune response, and disease outcomes.
Co-inhibitory immune checkpoints in head and neck squamous cell carcinoma.
Deng, W-W; Wu, L; Sun, Z-J
2018-03-01
The upregulation of co-inhibitory immune checkpoints hampers the immune response toward tumor cells and facilitates the tumor cells ability to evade immunosurveillance. Specific inhibitory immune checkpoint delivers inhibitory signals to T cells using multiple mechanisms. More in-depth understanding of the co-inhibitory immune checkpoints could be exploited for head and neck squamous cell carcinoma (HNSCC) treatment. In this review, we summarize the expression and the mechanism of partial co-inhibitory immune checkpoint signals and discuss targeting co-inhibitory immune checkpoints as an immunotherapeutic target for cancer therapy. This review may provide a better understanding of the co-inhibitory immune checkpoints and could promote applications of immunotherapy. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd. All rights reserved.
Hickey, DK; Patel, MV; Fahey, JV; Wira, CR
2011-01-01
This review examines the multiple levels of pre-existing immunity in the upper and lower female reproductive tract. In addition, we highlight the need for further research of innate and adaptive immune protection of mucosal surfaces in the female reproductive tract. Innate mechanisms include the mucus lining, a tight epithelial barrier and the secretion of antimicrobial peptides and cytokines by epithelial and innate immune cells. Stimulation of the innate immune system also serves to bridge the adaptive arm resulting in the generation of pathogen-specific humoral and cell-mediated immunity. Less understood are the multiple components that act in a coordinated way to provide a network of ongoing protection. Innate and adaptive immunity in the human female reproductive tract are influenced by the stage of menstrual cycle and are directly regulated by the sex steroid hormones, progesterone and estradiol. Furthermore, the effect of hormones on immunity is mediated both directly on immune and epithelial cells and indirectly by stimulating growth factor secretion from stromal cells. The goal of this review is to focus on the diverse aspects of the innate and adaptive immune systems that contribute to a unique network of protection throughout the female reproductive tract. PMID:21353708
Ihara, Sozaburo; Hirata, Yoshihiro; Koike, Kazuhiko
2017-07-01
Inflammatory bowel disease (IBD) is defined as chronic intestinal inflammation, and includes ulcerative colitis and Crohn's disease. Multiple factors are involved in the pathogenesis of IBD, and the condition is characterized by aberrant mucosal immune reactions to intestinal microbes in genetically susceptible hosts. Transforming growth factor-β (TGF-β) is an immune-suppressive cytokine produced by many cell types and activated by integrins. Active TGF-β binds to its receptor and regulates mucosal immune reactions through the TGF-β signaling pathway. Dysregulated TGF-β signaling is observed in the intestines of IBD patients. TGF-β signal impairment in specific cell types, such as T-cells and dendritic cells, results in spontaneous colitis in mouse models. In addition, specific intestinal microbes contribute to immune homeostasis by modulating TGF-β production. In this review, we describe the role of TGF-β in intestinal immunity, focusing on immune cells, epithelium, and intestinal microbes. In addition, we present potential therapeutic strategies for IBD that target TGF-β.
Chauchet, Xavier; Hannani, Dalil; Djebali, Sophia; Laurin, David; Polack, Benoit; Marvel, Jacqueline; Buffat, Laurent; Toussaint, Bertrand; Le Gouëllec, Audrey
2016-01-01
Live-attenuated bacterial vectors for antigens delivery have aroused growing interest in the field of cancer immunotherapy. Their potency to stimulate innate immunity and to promote intracellular antigen delivery into antigen-presenting cells could be exploited to elicit a strong and specific cellular immune response against tumor cells. We previously described genetically-modified and attenuated Pseudomonas aeruginosa vectors able to deliver in vivo protein antigens into antigen-presenting cells, through Type 3 secretion system of the bacteria. Using this approach, we managed to protect immunized mice against aggressive B16 melanoma development in both a prophylactic and therapeutic setting. In this study, we further investigated the antigen-specific CD8+ T cell response, in terms of phenotypic and functional aspects, obtained after immunizations with a killed but metabolically active P. aeruginosa attenuated vector. We demonstrated that P. aeruginosa vaccine induces a highly functional pool of antigen-specific CD8+ T cell able to infiltrate the tumor. Furthermore, multiple immunizations allowed the development of a long-lasting immune response, represented by a pool of predominantly effector memory cells which protected mice against late tumor challenge. Overall, killed but metabolically active P. aeruginosa vector is a safe and promising approach for active and specific antitumor immunotherapy. PMID:28035332
Innate immune activity conditions the effect of regulatory variants upon monocyte gene expression.
Fairfax, Benjamin P; Humburg, Peter; Makino, Seiko; Naranbhai, Vivek; Wong, Daniel; Lau, Evelyn; Jostins, Luke; Plant, Katharine; Andrews, Robert; McGee, Chris; Knight, Julian C
2014-03-07
To systematically investigate the impact of immune stimulation upon regulatory variant activity, we exposed primary monocytes from 432 healthy Europeans to interferon-γ (IFN-γ) or differing durations of lipopolysaccharide and mapped expression quantitative trait loci (eQTLs). More than half of cis-eQTLs identified, involving hundreds of genes and associated pathways, are detected specifically in stimulated monocytes. Induced innate immune activity reveals multiple master regulatory trans-eQTLs including the major histocompatibility complex (MHC), coding variants altering enzyme and receptor function, an IFN-β cytokine network showing temporal specificity, and an interferon regulatory factor 2 (IRF2) transcription factor-modulated network. Induced eQTL are significantly enriched for genome-wide association study loci, identifying context-specific associations to putative causal genes including CARD9, ATM, and IRF8. Thus, applying pathophysiologically relevant immune stimuli assists resolution of functional genetic variants.
NASA Astrophysics Data System (ADS)
Popov, Dmitri; Maliev, Slava
Introduction: Combined Acute Radiation Syndromes (CARS) are extremely severe injuries. Combination of Radiation and Thermal factors induce development of the acute pathologi-cal processes in irradiated mammals: systemic inflammatory response syndrome (SIRS), toxic multiple organ injury (TMOI), toxic multiple organ dysfunction syndromes (TMOD), toxic multiple organ failure (TMOF). Also, high doses of Radiation and Thermal injury induce for-mation of following Toxin groups: A. Specific Radiation Toxins; B. Specific Thermal Toxins; C. Nonspecific Histiogenic Pro-inflammatory and Inflammatory Toxins (NHIT). Specific Radi-ation Toxins (SRT) include four major group of Toxins: Cerebrovascular Radiation Toxins (Cv RT), Cardiovascular Radiation Toxins (Cr RT), Gastrointestinal Radiation Toxins (Gi RT), and Hematopoietic Radiation Toxins (Hp RT). CvRT, Cr RT, Gi RT groups of toxins are defined as Neurotoxins and Hp RT group is defined as Hematotoxins. Specific Thermal Toxins (STT) were isolated from the burned skin (Voul S., Colker I. 1972). The group of Nonspecific Histio-genic Inflammatory Toxins (NHIT) includes high amount of tissue toxins which are peptides with medium molecular weight. This group of polypeptides can be a significant factor as a part of developing of the general inflammation reaction. However, NHIT toxins can't induce many reactions and changes which are specific for radiation. Specific Radiation Toxins (SRT) can induce specific processes and reactions such as clonogenic cell death -programmed apoptotic necrosis. Although besides high doses of radiation, other forms of cell death such as Pyroptosis or Oncosis should be considered. We postulate that NHIT toxins are similar for high doses of radiation and thermal injury. Specific Radiation Toxins (SRT) are induced by high doses of radiation. Specific Thermal Toxins (STT) toxins which formation is induced by a Thermal Factor are different from SRT. Administration of STT toxins or NHIT toxins (IV or IM) to healthy mammals induces development of lymphocytosis, leukocytosis, trombocytosis, and ac-tivation of blood coagulation cascade. Administration of SRT (IV or IM) to radiation naive animals induces leukopeina, thrombopenia, lymphopenia as a result of clonogenic programmed cell death. Blood coagulation cascade suppression is registered. Materials and Methods: Cows, horses, rabbits, rats, mice were used for different stages of our experiments. Animals were quarantined at laboratory conditions for three weeks prior to experimentation. Isolation of the SRT was provided from the central lymphatic duct of irradiated cows. Immunization of horses and rabbits to obtain Antiradiation Antibodies (Specific Antiradiation Antidote -SAR) was provided. Animals: cows, mice, rats were irradiated in the VSRI (Kazan), Academy of Vet-erinary Medicine (Moscow), Scientific Research Institute of Radiobiology (Gomel), Scientific Research Nuclear Center (Dubna). Equipment for gamma-irradiation: " Pyma", "Panorama" -Co gamma radiation source. Irradiation was performed by different doses corresponding to induction of severe forms of the Acute Radiation Syndromes (ARS). Mice and rats were re-ceiving the combined radiation and thermal injury. Model of the thermal injury: Burns -10% of total body surface. Third grade of burns was used as a model. Thermal Injury was given after irradiation. Preparations of Antiradiation Vaccine -contained a toxoid form of Radiation Toxins were used for immune-prophylaxis. Preparations of Antiradiation Antidote IgG con-tained antibodies to Radiation Toxins was used for immune-therapy. Scheme of experiments: I. Control: Group A. Animals with the ARS not received any treatment. Group B. Animals with the thermal injury not received any treatment. Group C. Animals with combined forms of the ARS not received any treatment. II. Specific Immune-prophylaxis with Antiradiation Vaccine (AV): Group D. Animals undergone immune-prophylaxis by AV. Irradiation was provided 24 days after vaccination. Group E. Animals undergone immune-prophylaxis by AV. Thermal injury was provided 24 days after vaccination. Group F. Animals undergone vaccination by AV and with combined injury. Irradiation was provided 24 days after vaccination. Thermal injury was provided immediately after irradiation. III. Specific Immune-therapy with Antiradiation Antidote IgG (AA IgG): Group G. Animals with ARS undergone immune-therapy by AA IgG. Group H. Animals with the thermal injury undergone immune-therapy by AA IgG. Group I. Animals with the combined radiation thermal injury undergone treatment by AA IgG. Results: The Lethality Doses (LD) 100/30 of radiation caused 100 % mortality rate in next 30 days after irradiation with development of different forms of the ARS in all groups. The thermal injury induced the third degree burns with area of dry necrosis in Group B. Mortality rate in this group with thermal injury without treatment was almost 100 % within next 30 days. Lethality rate at Combined Radiation and Thermal injury without any treatment in group C was 100 % within next 30 days. Immune-prophylaxis by the specific AV was most effective for animals with the ARS and survival rate was up to 70 %. Although, immune-therapy by the specific AA IgG demonstrated less effectiveness and demonstrated survival rate 50%-60% in different groups of irradiated animals. For animals with the thermal injury only, immune-therapy by the AV and immune-prophylaxis by AA IgG were significantly ineffective and the survival rate had not exceeded 15 %. Results of specific immune-therapy and immune-prophylaxis provided at combined radiation thermal injury (CRTI) had demonstrated 30% of survival rate. Conclusion: Effects of Different Biological Response to specific immune-prophylaxis with AV and specific immune-therapy with AA IgG had demonstrated effective radio-protection for irradiated ani-mals with different forms of the ARS. The recovery phases demonstrated a shorter period of reconvalescence. Effects of the specific immune-prophylaxis by the AV and immune-therapy by AA IgG provided for animals with thermal and combined injury were less effective although use-ful. However,Immune-prophylaxis and Immune-therapy by the Specific Immune-modifiers used at combined and Thermal injury demonstrated a prolonged life time after immune-prophylaxis. Demarcation zone of burns and necrotic tissues rejection were more expressed after immune-therapy. Additional specific Immune-prophylaxis with the Thermal Injury Toxins and Specific Immune-therapy with the specific anti-thermal injury antibodies (serum of IgG preparation) can significantly improve results of therapy of thermal and combined injury.
Mucosal immunology of HIV infection.
Xu, Huanbin; Wang, Xiaolei; Veazey, Ronald S
2013-07-01
Recent advances in the immunology, pathogenesis, and prevention of human immunodeficiency virus (HIV) infection continue to reveal clues to the mechanisms involved in the progressive immunodeficiency attributed to infection, but more importantly have shed light on the correlates of immunity to infection and disease progression. HIV selectively infects, eliminates, and/or dysregulates several key cells of the human immune system, thwarting multiple arms of the host immune response, and inflicting severe damage to mucosal barriers, resulting in tissue infiltration of 'symbiotic' intestinal bacteria and viruses that essentially become opportunistic infections promoting systemic immune activation. This leads to activation and recruitment or more target cells for perpetuating HIV infection, resulting in persistent, high-level viral replication in lymphoid tissues, rapid evolution of resistant strains, and continued evasion of immune responses. However, vaccine studies and studies of spontaneous controllers are finally providing correlates of immunity from protection and disease progression, including virus-specific CD4(+) T-cell responses, binding anti-bodies, innate immune responses, and generation of antibodies with potent antibody-dependent cell-mediated cytotoxicity activity. Emerging correlates of immunity indicate that prevention of HIV infection may be possible through effective vaccine strategies that protect and stimulate key regulatory cells and immune responses in susceptible hosts. Furthermore, immune therapies specifically directed toward boosting specific aspects of the immune system may eventually lead to a cure for HIV-infected patients. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Mucosal Immunology of HIV Infection
Xu, Huanbin; Wang, Xiaolei; Veazey, Ronald S.
2013-01-01
Summary Recent advances in the immunology, pathogenesis, and prevention of human immunodeficiency virus (HIV) infection continue to reveal clues to the mechanisms involved in the progressive immunodeficiency attributed to infection but more importantly have shed light on the correlates of immunity to infection and disease progression. HIV selectively infects, eliminates, and/or dysregulates several key cells of the human immune system, thwarting multiple arms of the host immune response, and inflicting severe damage to mucosal barriers, resulting in tissue infiltration of ‘symbiotic’ intestinal bacteria and viruses that essentially become opportunistic infections promoting systemic immune activation. This leads to activation and recruitment or more target cells for perpetuating HIV infection, resulting in persistent, high level viral replication in lymphoid tissues, rapid evolution of resistant strains, and continued evasion of immune responses. However, vaccine studies and studies of spontaneous controllers are finally providing correlates of immunity from protection and disease progression, including virus-specific CD4+ T-cell responses, binding antibodies, innate immune responses, and generation of antibodies with potent antibody-dependent cell-mediated cytotoxicity activity. Emerging correlates of immunity indicate that prevention of HIV infection may be possible through effective vaccine strategies that protect and stimulate key regulatory cells and immune responses in susceptible hosts. Further, immune therapies specifically directed towards boosting specific aspects of the immune system may eventually lead to a cure for HIV-infected patients. PMID:23772612
Querec, Troy; Bennouna, Soumaya; Alkan, Sefik; Laouar, Yasmina; Gorden, Keith; Flavell, Richard; Akira, Shizuo; Ahmed, Rafi; Pulendran, Bali
2006-02-20
The live attenuated yellow fever vaccine 17D (YF-17D) is one of the most effective vaccines available, with a 65-yr history of use in >400 million people globally. Despite this efficacy, there is presently no information about the immunological mechanisms by which YF-17D acts. Here, we present data that suggest that YF-17D activates multiple Toll-like receptors (TLRs) on dendritic cells (DCs) to elicit a broad spectrum of innate and adaptive immune responses. Specifically, YF-17D activates multiple DC subsets via TLRs 2, 7, 8, and 9 to elicit the proinflammatory cytokines interleukin (IL)-12p40, IL-6, and interferon-alpha. Interestingly, the resulting adaptive immune responses are characterized by a mixed T helper cell (Th)1/Th2 cytokine profile and antigen-specific CD8+ T cells. Furthermore, distinct TLRs appear to differentially control the Th1/Th2 balance; thus, whilst MyD88-deficient mice show a profound impairment of Th1 cytokines, TLR2-deficient mice show greatly enhanced Th1 and Tc1 responses to YF-17D. Together, these data enhance our understanding of the molecular mechanism of action of YF-17D, and highlight the potential of vaccination strategies that use combinations of different TLR ligands to stimulate polyvalent immune responses.
Murphy, Sean C.; Kas, Arnold; Stone, Brad C.; Bevan, Michael J.
2013-01-01
Development of an antimalarial subunit vaccine inducing protective cytotoxic T lymphocyte (CTL)-mediated immunity could pave the way for malaria eradication. Experimental immunization with sporozoites induces this type of protective response, but the extremely large number of proteins expressed by Plasmodium parasites has so far prohibited the identification of sufficient discrete T-cell antigens to develop subunit vaccines that produce sterile immunity. Here, using mice singly immunized with Plasmodium yoelii sporozoites and high-throughput screening, we identified a unique CTL response against the parasite ribosomal L3 protein. Unlike CTL responses to the circumsporozoite protein (CSP), the population of L3-specific CTLs was not expanded by multiple sporozoite immunizations. CSP is abundant in the sporozoite itself, whereas L3 expression does not increase until the liver stage. The response induced by a single immunization with sporozoites reduces the parasite load in the liver so greatly during subsequent immunizations that L3-specific responses are only generated during the primary exposure. Functional L3-specific CTLs can, however, be expanded by heterologous prime-boost regimens. Thus, although repeat sporozoite immunization expands responses to preformed antigens like CSP that are present in the sporozoite itself, this immunization strategy may not expand CTLs targeting parasite proteins that are synthesized later. Heterologous strategies may be needed to increase CTL responses across the entire spectrum of Plasmodium liver-stage proteins. PMID:23530242
Phage idiotype vaccination: first phase I/II clinical trial in patients with multiple myeloma
2014-01-01
Background Multiple myeloma is characterized by clonal expansion of B cells producing monoclonal immunoglobulins or fragments thereof, which can be detected in the serum and/or urine and are ideal target antigens for patient-specific immunotherapies. Methods Using phage particles as immunological carriers, we employed a novel chemically linked idiotype vaccine in a clinical phase I/II trial including 15 patients with advanced multiple myeloma. Vaccines composed of purified paraproteins linked to phage were manufactured successfully for each patient. Patients received six intradermal immunizations with phage idiotype vaccines in three different dose groups. Results Phage idiotype was well tolerated by all study participants. A subset of patients (80% in the middle dose group) displayed a clinical response indicated by decrease or stabilization of paraprotein levels. Patients exhibiting a clinical response to phage vaccines also raised idiotype-specific immunoglobulins. Induction of a cellular immune response was demonstrated by a cytotoxicity assay and delayed type hypersensitivity tests. Conclusion We present a simple, time- and cost-efficient phage idiotype vaccination strategy, which represents a safe and feasible patient-specific therapy for patients with advanced multiple myeloma and produced promising anti-tumor activity in a subset of patients. PMID:24885819
T regulatory cells in contact hypersensitivity.
Cavani, Andrea
2008-08-01
The review summarizes the recent investigations focused on T regulatory cells in hapten diseases. Multiple mechanisms ensure tolerance to small chemicals penetrating the skin. Among these, specific T regulatory cells play a major role in controlling harmful immune responses to environmental antigens. Most of the T regulatory cells involved in this process belongs to the CD4 subset and suppress hapten-specific immune response through the release of IL-10 and through direct interaction with effector T cells, blocking their function. Methods for in-vitro and in-vivo expansion of specific T regulatory cells may represent an innovative approach for the cure of contact hypersensitivity.
USDA-ARS?s Scientific Manuscript database
Autofluorescence and non-specific immunofluorescent labeling are common challenges associated with immunofluorescence experiments. Autofluorescence typically demonstrates a broad emission spectrum, increasing the potential for overlap with experiments that utilize multiple fluorophores. During immun...
Host Immune Response to Influenza A Virus Infection.
Chen, Xiaoyong; Liu, Shasha; Goraya, Mohsan Ullah; Maarouf, Mohamed; Huang, Shile; Chen, Ji-Long
2018-01-01
Influenza A viruses (IAVs) are contagious pathogens responsible for severe respiratory infection in humans and animals worldwide. Upon detection of IAV infection, host immune system aims to defend against and clear the viral infection. Innate immune system is comprised of physical barriers (mucus and collectins), various phagocytic cells, group of cytokines, interferons (IFNs), and IFN-stimulated genes, which provide first line of defense against IAV infection. The adaptive immunity is mediated by B cells and T cells, characterized with antigen-specific memory cells, capturing and neutralizing the pathogen. The humoral immune response functions through hemagglutinin-specific circulating antibodies to neutralize IAV. In addition, antibodies can bind to the surface of infected cells and induce antibody-dependent cell-mediated cytotoxicity or complement activation. Although there are neutralizing antibodies against the virus, cellular immunity also plays a crucial role in the fight against IAVs. On the other hand, IAVs have developed multiple strategies to escape from host immune surveillance for successful replication. In this review, we discuss how immune system, especially innate immune system and critical molecules are involved in the antiviral defense against IAVs. In addition, we highlight how IAVs antagonize different immune responses to achieve a successful infection.
Tullila, Antti; Nevanen, Tarja K
2017-05-31
Phage display technology provides a powerful tool for the development of novel recombinant antibodies. In this work, we optimized and streamlined the recombinant antibody discovery process for haptens as an example. A multi-immunization approach was used in order to avoid the need for construction of multiple antibody libraries. Selection methods were developed to utilize the full potential of the recombinant antibody library by applying four different elution conditions simultaneously. High-throughput immunoassays were used to analyse the binding properties of the individual antibody clones. Different carrier proteins were used in the immunization, selection, and screening phases to avoid enrichment of the antibodies for the carrier protein epitopes. Novel recombinant antibodies against mycophenolic acid and ochratoxin A, with affinities up to 39 nM and 34 nM, respectively, were isolated from a multi-immunized fragment antigen-binding (Fab) library.
Tullila, Antti; Nevanen, Tarja K.
2017-01-01
Phage display technology provides a powerful tool for the development of novel recombinant antibodies. In this work, we optimized and streamlined the recombinant antibody discovery process for haptens as an example. A multi-immunization approach was used in order to avoid the need for construction of multiple antibody libraries. Selection methods were developed to utilize the full potential of the recombinant antibody library by applying four different elution conditions simultaneously. High-throughput immunoassays were used to analyse the binding properties of the individual antibody clones. Different carrier proteins were used in the immunization, selection, and screening phases to avoid enrichment of the antibodies for the carrier protein epitopes. Novel recombinant antibodies against mycophenolic acid and ochratoxin A, with affinities up to 39 nM and 34 nM, respectively, were isolated from a multi-immunized fragment antigen-binding (Fab) library. PMID:28561803
Durham, David P; Poolman, Eric M; Ibuka, Yoko; Townsend, Jeffrey P; Galvani, Alison P
2012-10-01
The degree of cross-immunity between human papillomavirus (HPV) types is fundamental both to the epidemiological dynamics of HPV and to the impact of HPV vaccination. Epidemiological data on HPV infections has been repeatedly interpreted as inconsistent with cross-immunity. We reevaluate the epidemiological data using a model to determine the odds ratios of multiple to single infections expected in the presence or absence of cross-immunity. We simulate a virtual longitudinal survey to determine the effect cross-immunity has on the prevalence of multiple infections. We calibrate our model to epidemiological data and estimate the extent of type replacement following vaccination against specific HPV types. We find that cross-immunity can produce odds ratios of infection comparable with epidemiological observations. We show that the sample sizes underlying existing surveys have been insufficient to identify even intense cross-immunity. We also find that the removal of HPV type 16, type 18, and types 6 and 11 would increase the prevalence of nontargeted types by 50%, 29%, and 183%, respectively. Cross-immunity between HPV types is consistent with epidemiological data, contrary to previous interpretations. Cross-immunity may cause significant type replacement following vaccination, and therefore should be considered in future vaccine studies and epidemiological models.
Multiple Vaccinations: Friend or Foe
Church, Sarah E.; Jensen, Shawn M.; Twitty, Chris; Bahjat, Keith; Hu, Hong-Ming; Urba, Walter J.; Fox, Bernard A.
2013-01-01
Few immunotherapists would accept the concept of a single vaccination inducing a therapeutic anti-cancer immune response in a patient with advanced cancer. But what is the evidence to support the “more-is-better” approach of multiple vaccinations? Since we are unaware of trials comparing the effect of a single vaccine versus multiple vaccinations on patient outcome, we considered that an anti-cancer immune response might provide a surrogate measure of the effectiveness of vaccination strategies. Since few large trials include immunological monitoring, the majority of information is gleaned from smaller trials in which an evaluation of immune responses to vaccine or tumor, before and at one or more times following the first vaccine was performed. In some studies there is convincing evidence that repeated administration of a specific vaccine can augment the immune response to antigens contained in the vaccine. In other settings multiple vaccinations can significantly reduce the immune response to one or more targets. Results from three large adjuvant vaccine studies support the potential detrimental effect of multiple vaccinations as clinical outcomes in the control arms were significantly better than that for treatment groups. Recent research has provided insights into mechanisms that are likely responsible for the reduced responses in the studies noted above, but supporting evidence from clinical specimens is generally lacking. Interpretation of these results is further complicated by the possibility that the dominant immune response may evolve to recognize epitopes not present in the vaccine. Nonetheless, the FDA-approval of the first therapeutic cancer vaccine and recent developments from preclinical models and clinical trials provide a substantial basis for optimism and a critical evaluation of cancer vaccine strategies. PMID:21952289
Lohan, Paul; Treacy, Oliver; Griffin, Matthew D.; Ritter, Thomas; Ryan, Aideen E.
2017-01-01
Mesenchymal stromal cells (MSC) have been used to treat a broad range of disease indications such as acute and chronic inflammatory disorders, autoimmune diseases, and transplant rejection due to their potent immunosuppressive/anti-inflammatory properties. The breadth of their usage is due in no small part to the vast quantity of published studies showing their ability to modulate multiple immune cell types of both the innate and adaptive immune response. While patient-derived (autologous) MSC may be the safer choice in terms of avoiding unwanted immune responses, factors including donor comorbidities may preclude these cells from use. In these situations, allogeneic MSC derived from genetically unrelated individuals must be used. While allogeneic MSC were initially believed to be immune-privileged, substantial evidence now exists to prove otherwise with multiple studies documenting specific cellular and humoral immune responses against donor antigens following administration of these cells. In this article, we will review recent published studies using non-manipulated, inflammatory molecule-activated (licensed) and differentiated allogeneic MSC, as well as MSC extracellular vesicles focusing on the immune responses to these cells and whether or not such responses have an impact on allogeneic MSC-mediated safety and efficacy. PMID:29225601
Weiss, Yvonne; Forêt, Sylvain; Hayward, David C; Ainsworth, Tracy; King, Rob; Ball, Eldon E; Miller, David J
2013-06-14
As a step towards understanding coral immunity we present the first whole transcriptome analysis of the acute responses of Acropora millepora to challenge with the bacterial cell wall derivative MDP and the viral mimic poly I:C, defined immunogens provoking distinct but well characterised responses in higher animals. These experiments reveal similarities with the responses both of arthropods and mammals, as well as coral-specific effects. The most surprising finding was that MDP specifically induced three members of the GiMAP gene family, which has been implicated in immunity in mammals but is absent from Drosophila and Caenorhabditis. Like their mammalian homologs, GiMAP genes are arranged in a tandem cluster in the coral genome. A phylogenomic survey of this gene family implies ancient origins, multiple independent losses and lineage-specific expansions during animal evolution. Whilst functional convergence cannot be ruled out, GiMAP expression in corals may reflect an ancestral role in immunity, perhaps in phagolysosomal processing.
Vaccines against advanced melanoma.
Blanchard, Tatiana; Srivastava, Pramod K; Duan, Fei
2013-01-01
Research shows that cancers are recognized by the immune system but that the immune recognition of tumors does not uniformly result in tumor rejection or regression. Quantitating the success or failure of the immune system in tumor elimination is difficult because we do not really know the total numbers of encounters of the immune system with the tumors. Regardless of that important issue, recognition of the tumor by the immune system implicitly contains the idea of the tumor antigen, which is what is actually recognized. We review the molecular identity of all forms of tumor antigens (antigens with specific mutations, cancer-testis antigens, differentiation antigens, over-expressed antigens) and discuss the use of these multiple forms of antigens in experimental immunotherapy of mouse and human melanoma. These efforts have been uniformly unsuccessful; however, the approaches that have not worked or have somewhat worked have been the source of many new insights into melanoma immunology. From a critical review of the various approaches to vaccine therapy we conclude that individual cancer-specific mutations are truly the only sources of cancer-specific antigens, and therefore, the most attractive targets for immunotherapy. Published by Elsevier Inc.
Leukemia cell-rhabdovirus vaccine: personalized immunotherapy for acute lymphoblastic leukemia.
Conrad, David P; Tsang, Jovian; Maclean, Meaghan; Diallo, Jean-Simon; Le Boeuf, Fabrice; Lemay, Chantal G; Falls, Theresa J; Parato, Kelley A; Bell, John C; Atkins, Harold L
2013-07-15
Acute lymphoblastic leukemia (ALL) remains incurable in most adults. It has been difficult to provide effective immunotherapy to improve outcomes for the majority of patients. Rhabdoviruses induce strong antiviral immune responses. We hypothesized that mice administered ex vivo rhabdovirus-infected ALL cells [immunotherapy by leukemia-oncotropic virus (iLOV)] would develop robust antileukemic immune responses capable of controlling ALL. Viral protein production, replication, and cytopathy were measured in human and murine ALL cells exposed to attenuated rhabdovirus. Survival following injection of graded amounts of ALL cells was compared between cohorts of mice administered γ-irradiated rhabdovirus-infected ALL cells (iLOV) or multiple control vaccines to determine key immunotherapeutic components and characteristics. Host immune requirements were assessed in immunodeficient and bone marrow-transplanted mice or by adoptive splenocyte transfer from immunized donors. Antileukemic immune memory was ascertained by second leukemic challenge in long-term survivors. Human and murine ALL cells were infected and killed by rhabdovirus; this produced a potent antileukemia vaccine. iLOV protected mice from otherwise lethal ALL by developing durable leukemia-specific immune-mediated responses (P < 0.0001), which required an intact CTL compartment. Preexisting antiviral immunity augmented iLOV potency. Splenocytes from iLOV-vaccinated donors protected 60% of naïve recipients from ALL challenge (P = 0.0001). Injecting leukemia cells activated by, or concurrent with, multiple Toll-like receptor agonists could not reproduce the protective effect of iLOV. Similarly, injecting uninfected irradiated viable, apoptotic, or necrotic leukemia cells with/without concurrent rhabdovirus administration was ineffective. Rhabdovirus-infected leukemia cells can be used to produce a vaccine that induces robust specific immunity against aggressive leukemia.
Tadesse, Tefera; Getachew, Kinde; Assefa, Tersit; Ababu, Yohannes; Simireta, Tesfaye; Birhanu, Zewdie; Hailemichael, Yohannes
2017-01-01
Introduction While the routine childhood immunization program might be affected by several factors, its identification using qualitative evidence of caretakers is generally minimal. This article explores the various factors and misperceptions of routine childhood immunization service uptake in Ethiopia and provides possible recommendations to mitigate them. Methods In this study, we used a qualitative multiple case study design collecting primary data from 63 focus group discussions (FGDs) conducted with a purposefully selected sample of children's caretakers (n = 630). Results According to the results of this study, the use of routine childhood immunization is dependent on four major factors: caretakers' behavior, family characteristics, information and communication and immunization service system. In addition, the participants had some misperceptions about routine childhood immunization. For example, immunization should be taken when the child gets sick and a single dose vaccine is enough for a child. These factors and misperceptions are complex and sometimes context-specific and vary between categories of caretakers. Conclusion Our interpretations suggest that no single factor affects immunization service uptake alone in a unique way. Rather, it is the synergy among the factors that has a collective influence on the childhood immunization system. Therefore, intervention efforts should target these multiple factors simultaneously. Importantly, this study recommends improving the quality of existing childhood immunization services and building awareness among caretakers as crucial components. PMID:29675124
Influence of interleukin 12 on p53 peptide vaccination against established Meth A sarcoma.
Noguchi, Y; Richards, E C; Chen, Y T; Old, L J
1995-01-01
BALB/c murine sarcoma Meth A is known to have three missense point mutations in p53. We previously reported that a nonamer peptide containing the codon 234 mutational product (designated 234CM) elicited 234CM-specific cytotoxic T cells and that immunization with 234CM in adjuvant before tumor challenge inhibited Meth A growth. Because interleukin 12 (IL-12) has been shown to have antitumor activity against established tumors and immuno-modulatory activities, we analyzed its effect on p53 peptide immunization and Meth A growth. Multiple injections of IL-12 alone (4 times a week for 2 weeks) caused regression of established Meth A sarcoma, and this effect was dose dependent. IL-12 treatment prior to Meth A challenge had little or no antitumor activity. To evaluate the effect of IL-12 on the generation of 234CM-specific cytotoxic T lymphocytes, spleen cells from BALB/c mice immunized with 234CM in adjuvant and injected with various doses of IL-12 were sensitized with 234CM in vitro. Multiple injections of 1 ng of IL-12 induced the highest cytotoxicity against target cells pulsed with 234CM. Higher doses of IL-12 suppressed 234CM-specific cytotoxic T-cell generation. Mice immunized with 234CM in QS-21 adjuvant and treated with 1 ng of IL-12 rejected established Meth A sarcoma. Mice comparably treated with 1 ng of IL-12 but immunized with 234CW peptide (the wild-type counterpart to 234CM) in QS-21 or with QS-21 alone showed progressive tumor growth. PMID:7892250
Hartman, Zachary C.; Osada, Takuya; Glass, Oliver; Yang, Xiao Y.; Lei, Gang-jun; Lyerly, H. Kim; Clay, Timothy M.
2010-01-01
Although critical for initiating and regulating immune responses, the therapeutic use of individual cytokines as anti-cancer immunotherapeutic agents has achieved only modest clinical success. Consequently, many current strategies have focused on the use of specific immunotherapeutic agonists that engage individual receptors of innate immune networks, such as the Toll Like-Receptor (TLR) system, each resulting in specific patterns of gene expression, cytokine production and inflammatory outcome. However, these immunotherapeutics are constrained by variable cellular TLR expression and responsiveness to particular TLR agonists, as well as the specific cellular context of different tumors. We hypothesized that overexpression of MyD88, a pivotal regulator of multiple TLR signaling pathways, could circumvent these constraints and mimic coordinated TLR signaling across all cell types in a ligand independent fashion. To explore this hypothesis, we generated an adenoviral vector expressing MyD88 and demonstrate that Ad-MyD88 infection elicits extensive Th1-specific transcriptional and secreted cytokine signatures in all murine and human cell types tested in vitro and in vivo. Importantly, in vivo intratumoral injection of Ad-MyD88 into established tumor masses enhanced adaptive immune responses and inhibited local tumor immunosuppression, resulting in significantly inhibited local and systemic growth of multiple tumor types. Finally, Ad-MyD88 infection of primary human dendritic cells, tumor associated fibroblasts, and colorectal carcinoma cells elicited significant Th1-type cytokine responses, resulting in enhanced tumor cell lysis and expansion of human tumor antigen-specific T-cells. Thus, Ad-MyD88 initiated robust anti-tumor activity in established murine tumor microenvironments and in human contexts, suggesting its potential effectiveness as a clinical immunotherapeutic strategy. PMID:20823152
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Lingshu; Shi, Wei; Chappell, James D.
ABSTRACT Middle East respiratory syndrome coronavirus (MERS-CoV) causes a highly lethal pulmonary infection with ~35% mortality. The potential for a future pandemic originating from animal reservoirs or health care-associated events is a major public health concern. There are no vaccines or therapeutic agents currently available for MERS-CoV. Using a probe-based single B cell cloning strategy, we have identified and characterized multiple neutralizing monoclonal antibodies (MAbs) specifically binding to the receptor-binding domain (RBD) or S1 (non-RBD) regions from a convalescent MERS-CoV-infected patient and from immunized rhesus macaques. RBD-specific MAbs tended to have greater neutralizing potency than non-RBD S1-specific MAbs. Six RBD-specificmore » and five S1-specific MAbs could be sorted into four RBD and three non-RBD distinct binding patterns, based on competition assays, mapping neutralization escape variants, and structural analysis. We determined cocrystal structures for two MAbs targeting the RBD from different angles and show they can bind the RBD only in the “out” position. We then showed that selected RBD-specific, non-RBD S1-specific, and S2-specific MAbs given prophylactically prevented MERS-CoV replication in lungs and protected mice from lethal challenge. Importantly, combining RBD- and non-RBD MAbs delayed the emergence of escape mutations in a cell-based virus escape assay. These studies identify MAbs targeting different antigenic sites on S that will be useful for defining mechanisms of MERS-CoV neutralization and for developing more effective interventions to prevent or treat MERS-CoV infections. IMPORTANCEMERS-CoV causes a highly lethal respiratory infection for which no vaccines or antiviral therapeutic options are currently available. Based on continuing exposure from established reservoirs in dromedary camels and bats, transmission of MERS-CoV into humans and future outbreaks are expected. Using structurally defined probes for the MERS-CoV spike glycoprotein (S), the target for neutralizing antibodies, single B cells were sorted from a convalescent human and immunized nonhuman primates (NHPs). MAbs produced from paired immunoglobulin gene sequences were mapped to multiple epitopes within and outside the receptor-binding domain (RBD) and protected against lethal MERS infection in a murine model following passive immunization. Importantly, combining MAbs targeting distinct epitopes prevented viral neutralization escape from RBD-directed MAbs. These data suggest that antibody responses to multiple domains on CoV spike protein may improve immunity and will guide future vaccine and therapeutic development efforts.« less
Nucleic acid-induced antiviral immunity in invertebrates: an evolutionary perspective.
Wang, Pei-Hui; Weng, Shao-Ping; He, Jian-Guo
2015-02-01
Nucleic acids derived from viral pathogens are typical pathogen associated molecular patterns (PAMPs). In mammals, the recognition of viral nucleic acids by pattern recognition receptors (PRRs), which include Toll-like receptors (TLRs) and retinoic acid-inducible gene (RIG)-I-like receptors (RLRs), induces the release of inflammatory cytokines and type I interferons (IFNs) through the activation of nuclear factor κB (NF-κB) and interferon regulatory factor (IRF) 3/7 pathways, triggering the host antiviral state. However, whether nucleic acids can induce similar antiviral immunity in invertebrates remains ambiguous. Several studies have reported that nucleic acid mimics, especially dsRNA mimic poly(I:C), can strongly induce non-specific antiviral immune responses in insects, shrimp, and oyster. This behavior shows multiple similarities to the hallmarks of mammalian IFN responses. In this review, we highlight the current understanding of nucleic acid-induced antiviral immunity in invertebrates. We also discuss the potential recognition and regulatory mechanisms that confer non-specific antiviral immunity on invertebrate hosts. Copyright © 2014 Elsevier Ltd. All rights reserved.
Zhuang, Shufei; Kelo, Lisha; Nardi, James B; Kanost, Michael R
2008-01-01
The cell-mediated responses of the insect innate immune system-phagocytosis, nodulation, encapsulation-involve multiple cell adhesion molecules of hemocyte surfaces. A hemocyte-specific (HS) integrin and a member of the immunoglobulin (Ig) superfamily (neuroglian) are involved in the encapsulation response of hemocytes in Manduca sexta. In addition, two new integrin alpha (alpha) subunits have been found on these hemocytes. The alpha2 subunit is mainly expressed in epidermis and Malphigian tubules, whereas the alpha3 subunit is primarily expressed on hemocytes and fat body cells. Of the three known alpha subunits, the alpha1 subunit found in HS integrin is the predominant subunit of hemocytes. Cell adhesion assays indicate that alpha2 belongs to the integrin family with RGD-binding motifs, confirming the phylogenetic analysis of alpha subunits based on the amino-acid sequence alignment of different alpha subunits. Double-stranded RNAs (dsRNAs) targeting each of these three integrin alpha subunits not only specifically decreased transcript expression of each alpha subunit in hemocytes, but also abolished the cell-mediated encapsulation response of hemocytes to foreign surfaces. The individual alpha subunits of M. sexta integrins, like their integrin counterparts in mammalian immune systems, have critical, individual roles in cell-substrate and cell-cell interactions during immune responses.
Schmid-Hempel, Paul
2008-01-01
The discussion of host–parasite interactions, and of parasite virulence more specifically, has so far, with a few exceptions, not focused much attention on the accumulating evidence that immune evasion by parasites is not only almost universal but also often linked to pathogenesis, i.e. the appearance of virulence. Now, the immune evasion hypothesis offers a deeper insight into the evolution of virulence than previous hypotheses. Sensitivity analysis for parasite fitness and life-history theory shows promise to generate a more general evolutionary theory of virulence by including a major element, immune evasion to prevent parasite clearance from the host. Also, the study of dose–response relationships and multiple infections should be particularly illuminating to understand the evolution of virulence. Taking into account immune evasion brings immunological processes to the core of understanding the evolution of parasite virulence and for a range of related issues such as dose, host specificity or immunopathology. The aim of this review is to highlight the mechanism underlying immune evasion and to discuss possible consequences for the evolutionary ecology analysis of host–parasite interactions. PMID:18930879
Neuman-Lee, Lorin; Terletzky, Patricia; Atwood, Todd C.; Gese, Eric; Smith, Geoffrey; Greenfield, Sydney; Pettit, John; French, Susannah
2017-01-01
Assessing the health and condition of animals in their natural environment can be problematic. Many physiological metrics, including immunity, are highly influenced by specific context and recent events to which researchers may be unaware. Thus, using a multifaceted physiological approach and a context-specific analysis encompassing multiple time scales can be highly informative. Ecoimmunological tools in particular can provide important indications to the health of animals in the wild. We collected blood and hair samples from free-ranging polar bears (Ursus maritimus) in the southern Beaufort Sea and examined the influence of sex, age, and reproductive status on metrics of immunity, stress, and body condition during 2013–2015. We examined metrics of innate immunity (bactericidal ability and lysis) and stress (hair cortisol, reactive oxygen species, and oxidative barrier), in relation to indices of body condition considered to be short term (urea to creatinine ratio; UC ratio) and long term (storage energy and body mass index). We found the factors of sex, age, and reproductive status of the bear were critical for interpreting different physiological metrics. Additionally, the metrics of body condition were important predictors for stress indicators. Finally, many of these metrics differed between years, illustrating the need to examine populations on a longer time scale. Taken together, this study demonstrates the complex relationship between multiple facets of physiology and how interpretation requires us to examine individuals within a specific context.
Bolton, Diane L; Santra, Sampa; Swett-Tapia, Cindy; Custers, Jerome; Song, Kaimei; Balachandran, Harikrishnan; Mach, Linh; Naim, Hussein; Kozlowski, Pamela A; Lifton, Michelle; Goudsmit, Jaap; Letvin, Norman; Roederer, Mario; Radošević, Katarina
2012-09-07
Licensed live attenuated virus vaccines capable of expressing transgenes from other pathogens have the potential to reduce the number of childhood immunizations by eliciting robust immunity to multiple pathogens simultaneously. Recombinant attenuated measles virus (rMV) derived from the Edmonston Zagreb vaccine strain was engineered to express simian immunodeficiency virus (SIV) Gag protein for the purpose of evaluating the immunogenicity of rMV as a vaccine vector in rhesus macaques. rMV-Gag immunization alone elicited robust measles-specific humoral and cellular responses, but failed to elicit transgene (Gag)-specific immune responses, following aerosol or intratracheal/intramuscular delivery. However, when administered as a priming vaccine to a heterologous boost with recombinant adenovirus serotype 5 expressing the same transgene, rMV-Gag significantly enhanced Gag-specific T lymphocyte responses following rAd5 immunization. Gag-specific humoral responses were not enhanced, however, which may be due to either the transgene or the vector. Cellular response priming by rMV against the transgene was highly effective even when using a suboptimal dose of rAd5 for the boost. These data demonstrate feasibility of using rMV as a priming component of heterologous prime-boost vaccine regimens for pathogens requiring strong cellular responses. Copyright © 2012 Elsevier Ltd. All rights reserved.
Fogg, Mark; Murphy, John R.; Lorch, Jochen; Posner, Marshall; Wang, Fred
2013-01-01
Epstein–Barr virus (EBV) is associated with multiple malignancies including nasopharyngeal carcinoma (NPC). In nasopharynx cancer, CD8+ T cells specific for EBV Nuclear Antigen-1 (EBNA-1) and Latent Membrane Protein 2 (LMP2) are important components of anti-tumor immunity since both are consistently expressed in NPC. We have previously shown that EBNA-1-specific CD8+ T cell responses were suppressed in NPC patients compared to healthy controls. We now find that CD8+ T cell responses specific for LMP2 are also abnormal in NPC patients, and both EBNA-1- and LMP2-specific responses are suppressed by regulatory T cells (Treg). EBNA-1 and LMP2-specific CD8+ T cell responses, as well as immune control of EBV-infected cells in vitro, could be restored by the depletion of Tregs and by use of a clinically approved drug targeting Tregs. Thus, in vivo modulation of Tregs may be an effective means of enhancing these anti-tumor immune responses in NPC patients. PMID:23601786
Novel Therapeutic Strategies for Solid Tumor Based on Body's Intrinsic Antitumor Immune System.
Duan, Haifeng
2018-05-22
The accumulation of mutated somatic cells due to the incompetency of body's immune system may lead to tumor onset. Therefore, enhancing the ability of the system to eliminate such cells should be the core of tumor therapy. The intrinsic antitumor immunity is triggered by tumor-specific antigens (TSA) or TSA-sensitized dendritic cells (DC). Once initiated, specific anti-tumor antibodies are produced and tumor-specific killer immune cells, including cytotoxic T lymphocytes (CTL), NK cells, and macrophages, are raised or induced. Several strategies may enhance antitumor action of immune system, such as supplying tumor-targeted antibody, activating T cells, enhancing the activity and tumor recognition of NK cells, promoting tumor-targeted phagocytosis of macrophages, and eliminating the immunosuppressive myeloid-derived suppressor cells (MDSCs) and Treg cells. Apart from the immune system, the removal of tumor burden still needs to be assisted by drugs, surgery or radiation. And the body's internal environment and tumor microenvironment should be improved to recover immune cell function and prevent tumor growth. Multiple microenvironment modulatory therapies may be applied, including addressing hypoxia and oxidative stress, correcting metabolic disorders, and controlling chronic inflammation. Finally, to cure tumor and prevent tumor recurrence, repairing or supporting therapy that consist of tissue repair and nutritional supplement should be applied properly. © 2018 The Author(s). Published by S. Karger AG, Basel.
Peters, James E.; Lyons, Paul A.; Lee, James C.; Richard, Arianne C.; Fortune, Mary D.; Newcombe, Paul J.; Richardson, Sylvia; Smith, Kenneth G. C.
2016-01-01
Genome-wide association studies (GWAS) have transformed our understanding of the genetics of complex traits such as autoimmune diseases, but how risk variants contribute to pathogenesis remains largely unknown. Identifying genetic variants that affect gene expression (expression quantitative trait loci, or eQTLs) is crucial to addressing this. eQTLs vary between tissues and following in vitro cellular activation, but have not been examined in the context of human inflammatory diseases. We performed eQTL mapping in five primary immune cell types from patients with active inflammatory bowel disease (n = 91), anti-neutrophil cytoplasmic antibody-associated vasculitis (n = 46) and healthy controls (n = 43), revealing eQTLs present only in the context of active inflammatory disease. Moreover, we show that following treatment a proportion of these eQTLs disappear. Through joint analysis of expression data from multiple cell types, we reveal that previous estimates of eQTL immune cell-type specificity are likely to have been exaggerated. Finally, by analysing gene expression data from multiple cell types, we find eQTLs not previously identified by database mining at 34 inflammatory bowel disease-associated loci. In summary, this parallel eQTL analysis in multiple leucocyte subsets from patients with active disease provides new insights into the genetic basis of immune-mediated diseases. PMID:27015630
Antigen-Specific Antibody Glycosylation Is Regulated via Vaccination.
Mahan, Alison E; Jennewein, Madeleine F; Suscovich, Todd; Dionne, Kendall; Tedesco, Jacquelynne; Chung, Amy W; Streeck, Hendrik; Pau, Maria; Schuitemaker, Hanneke; Francis, Don; Fast, Patricia; Laufer, Dagna; Walker, Bruce D; Baden, Lindsey; Barouch, Dan H; Alter, Galit
2016-03-01
Antibody effector functions, such as antibody-dependent cellular cytotoxicity, complement deposition, and antibody-dependent phagocytosis, play a critical role in immunity against multiple pathogens, particularly in the absence of neutralizing activity. Two modifications to the IgG constant domain (Fc domain) regulate antibody functionality: changes in antibody subclass and changes in a single N-linked glycan located in the CH2 domain of the IgG Fc. Together, these modifications provide a specific set of instructions to the innate immune system to direct the elimination of antibody-bound antigens. While it is clear that subclass selection is actively regulated during the course of natural infection, it is unclear whether antibody glycosylation can be tuned, in a signal-specific or pathogen-specific manner. Here, we show that antibody glycosylation is determined in an antigen- and pathogen-specific manner during HIV infection. Moreover, while dramatic differences exist in bulk IgG glycosylation among individuals in distinct geographical locations, immunization is able to overcome these differences and elicit antigen-specific antibodies with similar antibody glycosylation patterns. Additionally, distinct vaccine regimens induced different antigen-specific IgG glycosylation profiles, suggesting that antibody glycosylation is not only programmable but can be manipulated via the delivery of distinct inflammatory signals during B cell priming. These data strongly suggest that the immune system naturally drives antibody glycosylation in an antigen-specific manner and highlights a promising means by which next-generation therapeutics and vaccines can harness the antiviral activity of the innate immune system via directed alterations in antibody glycosylation in vivo. .
USDA-ARS?s Scientific Manuscript database
Autofluorescence and non-specific immunofluorescent labeling are common challenges associated with immunofluorescence experiments. Autofluorescence typically demonstrates a broad emission spectrum, increasing the potential for overlap with experiments that utilize multiple fluorophores. During immun...
Innate cell communication kick-starts pathogen-specific immunity
Rivera, Amariliz; Siracusa, Mark C.; Yap, George S.; Gause, William C.
2016-01-01
Innate cells are responsible for the rapid recognition of infection and mediate essential mechanisms of pathogen elimination, and also facilitate adaptive immune responses. We review here the numerous intricate interactions among innate cells that initiate protective immunity. The efficient eradication of pathogens depends on the coordinated actions of multiple cells, including innate cells and epithelial cells. Rather than acting as isolated effector cells, innate cells are in constant communication with other responding cells of the immune system, locally and distally. These interactions are critically important for the efficient control of primary infections as well for the development of ‘trained’ innate cells that facilitate the rapid elimination of homologous or heterologous infections. PMID:27002843
Dead cell phagocytosis and innate immune checkpoint
Yoon, Kyoung Wan
2017-01-01
The human body loses several billions of cells daily. When cells die in vivo, the corpse of each dead cell is immediately cleared. Specifically, dead cells are efficiently recognized and cleared by multiple types of neighboring phagocytes. Early research on cell death focused more on molecular mechanisms of cell death regulation while the cellular corpses were merely considered cellular debris. However, it has come to light that various biological stimuli following cell death are important for immune regulation. Clearance of normal dead cells occurs silently in immune tolerance. Exogenous or mutated antigens of malignant or infected cells can initiate adaptive immunity, thereby inducing immunogenicity by adjuvant signals. Several pathogens and cancer cells have strategies to limit the adjuvant signals and escape immune surveillance. In this review, we present an overview of the mechanisms of dead cell clearance and its immune regulations. PMID:28768566
Dasari, Vijayendra; Smith, Corey; Schuessler, Andrea; Zhong, Jie; Khanna, Rajiv
2014-01-01
Recent studies have suggested that a successful subunit human cytomegalovirus (CMV) vaccine requires improved formulation to generate broad-based anti-viral immunity following immunization. Here we report the development of a non-live protein-based vaccine strategy for CMV based on a polyepitope protein and CMV glycoprotein B (gB) adjuvanted with TLR4 and/or TLR9 agonists. The polyepitope protein includes contiguous multiple MHC class I-restricted epitopes with an aim to induce CD8+ T cell immunity, while gB is an important target for CD4+ T cell immunity and neutralizing antibodies. Optimal immunogenicity of this bivalent non-live protein vaccine formulation was dependent upon the co-administration of both the TLR4 and TLR9 agonist, which was associated with the activation of innate immune signatures and the influx of different DC subsets including plasmacytoid DCs and migratory CD8-DEC205+CD103-CD326- langerin-negative dermal DCs into the draining lymph nodes. Furthermore these professional antigen presenting cells also expressed IL-6, IL-12p70, TNFα, and IFNα which play a crucial role in the activation of adaptive immunity. In summary, this study provides a novel platform technology in which broad-based anti-CMV immune responses upon vaccination can be maximized by co-delivery of viral antigens and TLR4 and 9 agonists which induce activation of innate immune signatures and promote potent antigen acquisition and cross-presentation by multiple DC subsets. PMID:24463331
Mast cell: an emerging partner in immune interaction.
Gri, Giorgia; Frossi, Barbara; D'Inca, Federica; Danelli, Luca; Betto, Elena; Mion, Francesca; Sibilano, Riccardo; Pucillo, Carlo
2012-01-01
Mast cells (MCs) are currently recognized as effector cells in many settings of the immune response, including host defense, immune regulation, allergy, chronic inflammation, and autoimmune diseases. MC pleiotropic functions reflect their ability to secrete a wide spectrum of preformed or newly synthesized biologically active products with pro-inflammatory, anti-inflammatory and/or immunosuppressive properties, in response to multiple signals. Moreover, the modulation of MC effector phenotypes relies on the interaction of a wide variety of membrane molecules involved in cell-cell or cell-extracellular-matrix interaction. The delivery of co-stimulatory signals allows MC to specifically communicate with immune cells belonging to both innate and acquired immunity, as well as with non-immune tissue-specific cell types. This article reviews and discusses the evidence that MC membrane-expressed molecules play a central role in regulating MC priming and activation and in the modulation of innate and adaptive immune response not only against host injury, but also in peripheral tolerance and tumor-surveillance or -escape. The complex expression of MC surface molecules may be regarded as a measure of connectivity, with altered patterns of cell-cell interaction representing functionally distinct MC states. We will focalize our attention on roles and functions of recently discovered molecules involved in the cross-talk of MCs with other immune partners.
Mast Cell: An Emerging Partner in Immune Interaction
Gri, Giorgia; Frossi, Barbara; D’Inca, Federica; Danelli, Luca; Betto, Elena; Mion, Francesca; Sibilano, Riccardo; Pucillo, Carlo
2012-01-01
Mast cells (MCs) are currently recognized as effector cells in many settings of the immune response, including host defense, immune regulation, allergy, chronic inflammation, and autoimmune diseases. MC pleiotropic functions reflect their ability to secrete a wide spectrum of preformed or newly synthesized biologically active products with pro-inflammatory, anti-inflammatory and/or immunosuppressive properties, in response to multiple signals. Moreover, the modulation of MC effector phenotypes relies on the interaction of a wide variety of membrane molecules involved in cell–cell or cell-extracellular-matrix interaction. The delivery of co-stimulatory signals allows MC to specifically communicate with immune cells belonging to both innate and acquired immunity, as well as with non-immune tissue-specific cell types. This article reviews and discusses the evidence that MC membrane-expressed molecules play a central role in regulating MC priming and activation and in the modulation of innate and adaptive immune response not only against host injury, but also in peripheral tolerance and tumor-surveillance or -escape. The complex expression of MC surface molecules may be regarded as a measure of connectivity, with altered patterns of cell–cell interaction representing functionally distinct MC states. We will focalize our attention on roles and functions of recently discovered molecules involved in the cross-talk of MCs with other immune partners. PMID:22654879
Metabolic regulation of inflammation.
Gaber, Timo; Strehl, Cindy; Buttgereit, Frank
2017-05-01
Immune cells constantly patrol the body via the bloodstream and migrate into multiple tissues where they face variable and sometimes demanding environmental conditions. Nutrient and oxygen availability can vary during homeostasis, and especially during the course of an immune response, creating a demand for immune cells that are highly metabolically dynamic. As an evolutionary response, immune cells have developed different metabolic programmes to supply them with cellular energy and biomolecules, enabling them to cope with changing and challenging metabolic conditions. In the past 5 years, it has become clear that cellular metabolism affects immune cell function and differentiation, and that disease-specific metabolic configurations might provide an explanation for the dysfunctional immune responses seen in rheumatic diseases. This Review outlines the metabolic challenges faced by immune cells in states of homeostasis and inflammation, as well as the variety of metabolic configurations utilized by immune cells during differentiation and activation. Changes in cellular metabolism that contribute towards the dysfunctional immune responses seen in rheumatic diseases are also briefly discussed.
Quispe Calla, Nirk E.; Pavelko, Stephen D.; Cherpes, Thomas L.
2016-01-01
While ascension of Chlamydia trachomatis into the upper genital tract of women can cause pelvic inflammatory disease and Fallopian tube damage, most infections elicit no symptoms or overt upper genital tract pathology. Consistent with this asymptomatic clinical presentation, genital C. trachomatis infection of women generates robust TH2 immunity. As an animal model that modeled this response would be invaluable for delineating bacterial pathogenesis and human host defenses, herein we explored if pathogen-specific TH2 immunity is similarly elicited by intravaginal (ivag) infection of mice with oculogenital C. trachomatis serovars. Analogous to clinical infection, ascension of primary C. trachomatis infection into the mouse upper genital tract produced no obvious tissue damage. Clearance of ivag challenge infection was mediated by interferon (IFN)-γ-producing CD4+ T cells, while IFN-γ signaling blockade concomitant with a single ivag challenge promoted tissue damage by enhancing Chlamydia-specific TH17 immunity. Likewise, IFN-γ and IL-17 signaling blockade or CD4+ T cell depletion eliminated the genital pathology produced in untreated controls by multiple ivag challenge infections. Conversely, we were unable to detect formation of pathogen-specific TH2 immunity in C. trachomatis-infected mice. Together, our work revealed C. trachomatis infection of mice generates TH1 and TH17 immune responses that promote pathogen clearance and immunopathological tissue damage. Absence of Chlamydia-specific TH2 immunity in these mice newly highlights the need to identify experimental models of C. trachomatis genital infection that more closely recapitulate the human host response. PMID:27606424
RNA-Seq Reveals an Integrated Immune Response in Nucleated Erythrocytes
Morera, Davinia; Roher, Nerea; Ribas, Laia; Balasch, Joan Carles; Doñate, Carmen; Callol, Agnes; Boltaña, Sebastian; Roberts, Steven; Goetz, Giles; Goetz, Frederick W.; MacKenzie, Simon A.
2011-01-01
Background Throughout the primary literature and within textbooks, the erythrocyte has been tacitly accepted to have maintained a unique physiological role; namely gas transport and exchange. In non-mammalian vertebrates, nucleated erythrocytes are present in circulation throughout the life cycle and a fragmented series of observations in mammals support a potential role in non-respiratory biological processes. We hypothesised that nucleated erythrocytes could actively participate via ligand-induced transcriptional re-programming in the immune response. Methodology/Principal Findings Nucleated erythrocytes from both fish and birds express and regulate specific pattern recognition receptor (PRR) mRNAs and, thus, are capable of specific pathogen associated molecular pattern (PAMP) detection that is central to the innate immune response. In vitro challenge with diverse PAMPs led to de novo specific mRNA synthesis of both receptors and response factors including interferon-alpha (IFNα) that exhibit a stimulus-specific polysomal shift supporting active translation. RNA-Seq analysis of the PAMP (Poly (I∶C), polyinosinic∶polycytidylic acid)-erythrocyte response uncovered diverse cohorts of differentially expressed mRNA transcripts related to multiple physiological systems including the endocrine, reproductive and immune. Moreover, erythrocyte-derived conditioned mediums induced a type-1 interferon response in macrophages thus supporting an integrative role for the erythrocytes in the immune response. Conclusions/Significance We demonstrate that nucleated erythrocytes in non-mammalian vertebrates spanning significant phylogenetic distance participate in the immune response. RNA-Seq studies highlight a mRNA repertoire that suggests a previously unrecognized integrative role for the erythrocytes in other physiological systems. PMID:22046430
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fogg, Mark; Murphy, John R.; Lorch, Jochen
Epstein–Barr virus (EBV) is associated with multiple malignancies including nasopharyngeal carcinoma (NPC). In nasopharynx cancer, CD8+ T cells specific for EBV Nuclear Antigen-1 (EBNA-1) and Latent Membrane Protein 2 (LMP2) are important components of anti-tumor immunity since both are consistently expressed in NPC. We have previously shown that EBNA-1-specific CD8+ T cell responses were suppressed in NPC patients compared to healthy controls. We now find that CD8+ T cell responses specific for LMP2 are also abnormal in NPC patients, and both EBNA-1- and LMP2-specific responses are suppressed by regulatory T cells (Treg). EBNA-1 and LMP2-specific CD8+ T cell responses, asmore » well as immune control of EBV-infected cells in vitro, could be restored by the depletion of Tregs and by use of a clinically approved drug targeting Tregs. Thus, in vivo modulation of Tregs may be an effective means of enhancing these anti-tumor immune responses in NPC patients. - Highlights: • Viral proteins are tumor antigens in Epstein–Barr virus associated Nasopharyngeal Carcinoma. • CD8+ T cell responses against EBV proteins EBNA-1 and LMP2 are suppressed in NPC patients. • T regulatory cells are responsible for suppressing EBV immunity in NPC patients. • Depletion of Tregs with Ontak can rescue EBV-specific CD8+ T cell responses in NPC patients. • This clinically approved drug may be effective for enhancing anti-tumor immunity in NPC patients.« less
The Split Virus Influenza Vaccine rapidly activates immune cells through Fcγ receptors.
O'Gorman, William E; Huang, Huang; Wei, Yu-Ling; Davis, Kara L; Leipold, Michael D; Bendall, Sean C; Kidd, Brian A; Dekker, Cornelia L; Maecker, Holden T; Chien, Yueh-Hsiu; Davis, Mark M
2014-10-14
Seasonal influenza vaccination is one of the most common medical procedures and yet the extent to which it activates the immune system beyond inducing antibody production is not well understood. In the United States, the most prevalent formulations of the vaccine consist of degraded or "split" viral particles distributed without any adjuvants. Based on previous reports we sought to determine whether the split influenza vaccine activates innate immune receptors-specifically Toll-like receptors. High-dimensional proteomic profiling of human whole-blood using Cytometry by Time-of-Flight (CyTOF) was used to compare signaling pathway activation and cytokine production between the split influenza vaccine and a prototypical TLR response ex vivo. This analysis revealed that the split vaccine rapidly and potently activates multiple immune cell types but yields a proteomic signature quite distinct from TLR activation. Importantly, vaccine induced activity was dependent upon the presence of human sera indicating that a serum factor was necessary for vaccine-dependent immune activation. We found this serum factor to be human antibodies specific for influenza proteins and therefore immediate immune activation by the split vaccine is immune-complex dependent. These studies demonstrate that influenza virus "splitting" inactivates any potential adjuvants endogenous to influenza, such as RNA, but in previously exposed individuals can elicit a potent immune response by facilitating the rapid formation of immune complexes. Copyright © 2014 Elsevier Ltd. All rights reserved.
Experimental evolution of insect immune memory versus pathogen resistance.
Khan, Imroze; Prakash, Arun; Agashe, Deepa
2017-12-20
Under strong pathogen pressure, insects often evolve resistance to infection. Many insects are also protected via immune memory (immune priming), whereby sublethal exposure to a pathogen enhances survival after secondary infection. Theory predicts that immune memory should evolve when the pathogen is highly virulent, or when pathogen exposure is relatively rare. However, there are no empirical tests of these hypotheses, and the adaptive benefits of immune memory relative to direct resistance against a pathogen are poorly understood. To determine the selective pressures and ecological conditions that shape immune evolution, we imposed strong pathogen selection on flour beetle ( Tribolium castaneum ) populations, infecting them with Bacillus thuringiensis (Bt) for 11 generations. Populations injected first with heat-killed and then live Bt evolved high basal resistance against multiple Bt strains. By contrast, populations injected only with a high dose of live Bt evolved a less effective but strain-specific priming response. Control populations injected with heat-killed Bt did not evolve priming; and in the ancestor, priming was effective only against a low Bt dose. Intriguingly, one replicate population first evolved priming and subsequently evolved basal resistance, suggesting the potential for dynamic evolution of different immune strategies. Our work is the first report showing that pathogens can select for rapid modulation of insect priming ability, allowing hosts to evolve divergent immune strategies (generalized resistance versus specific immune memory) with potentially distinct mechanisms. © 2017 The Author(s).
Lendvai, Nikoletta; Gnjatic, Sacha; Ritter, Erika; Mangone, Michael; Austin, Wayne; Reyner, Karina; Jayabalan, David; Niesvizky, Ruben; Jagannath, Sundar; Bhardwaj, Nina; Chen-Kiang, Selina; Old, Lloyd J.
2010-01-01
The type I melanoma antigen gene (MAGE) proteins CT7 (MAGE-C1) and MAGE-A3 are commonly expressed in multiple myeloma (MM), and their expression correlates with increased plasma cell proliferation and poor clinical outcome. They belong to the cancer-testis antigen (CTAg) group of tumor-associated proteins, some of which elicit spontaneous immune responses in cancer patients. CT7 and MAGE-A3 are promising antigenic targets for therapeutic tumor vaccines in myeloma; therefore, it is critical to determine if they are immunogenic in MM patients. We analyzed cellular and humoral immune responses against CTAgs in patients with plasma cell dyscrasias: MM, monoclonal gammopathy of undetermined significance (MGUS), and Waldenström's macroglobulinemia (WM). Bone marrow lymphocytes from two of four untreated MM patients exhibited CT7-specific cellular immune responses as measured by an autologous cellular immunity assay, the first such immune response to CT7 to be reported in cancer patients. Sera from 24 patients were screened by ELISA for humoral immune responses to CTAgs. Two patients with MM demonstrated positive titers, one for MAGE-A1 and the other for SSX1. These data demonstrate that CTAgs, particularly CT7, are immunogenic in MM patients and merit further exploration as targets of immunological therapy in MM. PMID:20108890
Lendvai, Nikoletta; Gnjatic, Sacha; Ritter, Erika; Mangone, Michael; Austin, Wayne; Reyner, Karina; Jayabalan, David; Niesvizky, Ruben; Jagannath, Sundar; Bhardwaj, Nina; Chen-Kiang, Selina; Old, Lloyd J; Cho, Hearn Jay
2010-01-29
The type I melanoma antigen gene (MAGE) proteins CT7 (MAGE-C1) and MAGE-A3 are commonly expressed in multiple myeloma (MM), and their expression correlates with increased plasma cell proliferation and poor clinical outcome. They belong to the cancer-testis antigen (CTAg) group of tumor-associated proteins, some of which elicit spontaneous immune responses in cancer patients. CT7 and MAGE-A3 are promising antigenic targets for therapeutic tumor vaccines in myeloma; therefore, it is critical to determine if they are immunogenic in MM patients. We analyzed cellular and humoral immune responses against CTAgs in patients with plasma cell dyscrasias: MM, monoclonal gammopathy of undetermined significance (MGUS), and Waldenström's macroglobulinemia (WM). Bone marrow lymphocytes from two of four untreated MM patients exhibited CT7-specific cellular immune responses as measured by an autologous cellular immunity assay, the first such immune response to CT7 to be reported in cancer patients. Sera from 24 patients were screened by ELISA for humoral immune responses to CTAgs. Two patients with MM demonstrated positive titers, one for MAGE-A1 and the other for SSX1. These data demonstrate that CTAgs, particularly CT7, are immunogenic in MM patients and merit further exploration as targets of immunological therapy in MM.
Cytokine networking of innate immunity cells: a potential target of therapy.
Striz, Ilja; Brabcova, Eva; Kolesar, Libor; Sekerkova, Alena
2014-05-01
Innate immune cells, particularly macrophages and epithelial cells, play a key role in multiple layers of immune responses. Alarmins and pro-inflammatory cytokines from the IL (interleukin)-1 and TNF (tumour necrosis factor) families initiate the cascade of events by inducing chemokine release from bystander cells and by the up-regulation of adhesion molecules required for transendothelial trafficking of immune cells. Furthermore, innate cytokines produced by dendritic cells, macrophages, epithelial cells and innate lymphoid cells seem to play a critical role in polarization of helper T-cell cytokine profiles into specific subsets of Th1/Th2/Th17 effector cells or regulatory T-cells. Lastly, the innate immune system down-regulates effector mechanisms and restores homoeostasis in injured tissue via cytokines from the IL-10 and TGF (transforming growth factor) families mainly released from macrophages, preferentially the M2 subset, which have a capacity to induce regulatory T-cells, inhibit the production of pro-inflammatory cytokines and induce healing of the tissue by regulating extracellular matrix protein deposition and angiogenesis. Cytokines produced by innate immune cells represent an attractive target for therapeutic intervention, and multiple molecules are currently being tested clinically in patients with inflammatory bowel disease, rheumatoid arthritis, systemic diseases, autoinflammatory syndromes, fibrosing processes or malignancies. In addition to the already widely used blockers of TNFα and the tested inhibitors of IL-1 and IL-6, multiple therapeutic molecules are currently in clinical trials targeting TNF-related molecules [APRIL (a proliferation-inducing ligand) and BAFF (B-cell-activating factor belonging to the TNF family)], chemokine receptors, IL-17, TGFβ and other cytokines.
Andrews, Chasity D.; Huh, Myung-Sook; Patton, Kathryn; Higgins, Debbie; Van Nest, Gary; Ott, Gary; Lee, Kyung-Dall
2013-01-01
Immunostimulatory sequences (ISS) are short DNA sequences containing unmethylated CpG dimers that have multiple effects on the host immune system, including the ability to stimulate antigen-specific cytotoxic T lymphocytes (CTLs) and drive Th1-type immune responses. Listeriolysin O (LLO)-containing pH-sensitive liposomes have been shown to efficiently deliver macromolecules to the cytosol of APCs and efficiently stimulate CTLs. We hypothesized that encapsulating ISS-oligodeoxyribonucleotides (ODNs) in this delivery system would enhance the cell-mediated immune response and skew Th1-type responses in protein antigen-based vaccination utilizing LLO-liposomes. In vitro studies indicated that co-encapsulation of ISS in LLO-liposomes engendered activation of the NF-κB pathway while maintaining the efficient cytosolic delivery of antigen mediated by the co-encapsulated LLO. Antigen-specific CTL responses monitored by using the model antigen ovalbumin (OVA) in mice were enhanced when mice were immunized with OVA and ISS-ODN-containing LLO-liposomes compared with those immunized with either OVA-containing LLO-liposomes or OVA-ISS conjugates. The enhanced immune responses were of the Th1-type as monitored by the robust OVA-specific IgG2a induction and the OVA CD8 peptide-stimulated IFN-γ secretion. Our study suggests that including ISS-ODN in LLO-containing pH-sensitive liposomes yields a vaccine delivery system that enhances the cell-mediated immune response and skews this response toward the Th1-type. PMID:22376145
Dead cell phagocytosis and innate immune checkpoint.
Yoon, Kyoung Wan
2017-10-01
The human body loses several billions of cells daily. When cells die in vivo, the corpse of each dead cell is immediately cleared. Specifically, dead cells are efficiently recognized and cleared by multiple types of neighboring phagocytes. Early research on cell death focused more on molecular mechanisms of cell death regulation while the cellular corpses were merely considered cellular debris. However, it has come to light that various biological stimuli following cell death are important for immune regulation. Clearance of normal dead cells occurs silently in immune tolerance. Exogenous or mutated antigens of malignant or infected cells can initiate adaptive immunity, thereby inducing immunogenicity by adjuvant signals. Several pathogens and cancer cells have strategies to limit the adjuvant signals and escape immune surveillance. In this review, we present an overview of the mechanisms of dead cell clearance and its immune regulations. [BMB Reports 2017; 50(10): 496-503].
Innate Immune Signaling Activated by MDR Bacteria in the Airway
Parker, Dane; Ahn, Danielle; Cohen, Taylor; Prince, Alice
2015-01-01
Health care-associated bacterial pneumonias due to multiple-drug resistant (MDR) pathogens are an important public health problem and are major causes of morbidity and mortality worldwide. In addition to antimicrobial resistance, these organisms have adapted to the milieu of the human airway and have acquired resistance to the innate immune clearance mechanisms that normally prevent pneumonia. Given the limited efficacy of antibiotics, bacterial clearance from the airway requires an effective immune response. Understanding how specific airway pathogens initiate and regulate innate immune signaling, and whether this response is excessive, leading to host-induced pathology may guide future immunomodulatory therapy. We will focus on three of the most important causes of health care-associated pneumonia, Staphylococcus aureus, Pseudomonas aeruginosa, and Klebsiella pneumoniae, and review the mechanisms through which an inappropriate or damaging innate immune response is stimulated, as well as describe how airway pathogens cause persistent infection by evading immune activation. PMID:26582515
The Ad5 [E1-, E2b-]-based vector: a new and versatile gene delivery platform
NASA Astrophysics Data System (ADS)
Jones, Frank R.; Gabitzsch, Elizabeth S.; Balint, Joseph P.
2015-05-01
Based upon advances in gene sequencing and construction, it is now possible to identify specific genes or sequences thereof for gene delivery applications. Recombinant adenovirus serotype-5 (Ad5) viral vectors have been utilized in the settings of gene therapy, vaccination, and immunotherapy but have encountered clinical challenges because they are recognized as foreign entities to the host. This recognition leads to an immunologic clearance of the vector that contains the inserted gene of interest and prevents effective immunization(s). We have reported on a new Ad5-based viral vector technology that can be utilized as an immunization modality to induce immune responses even in the presence of Ad5 vector immunity. We have reported successful immunization and immunotherapy results to infectious diseases and cancers. This improved recombinant viral platform (Ad5 [E1-, E2b-]) can now be utilized in the development of multiple vaccines and immunotherapies.
Miller, Yury I.; Choi, Soo-Ho; Wiesner, Philipp; Fang, Longhou; Harkewicz, Richard; Hartvigsen, Karsten; Boullier, Agnès; Gonen, Ayelet; Diehl, Cody J.; Que, Xuchu; Montano, Erica; Shaw, Peter X.; Tsimikas, Sotirios; Binder, Christoph J.; Witztum, Joseph L.
2010-01-01
Oxidation reactions are vital parts of metabolism and signal transduction. However, they also produce reactive oxygen species, which damage lipids, proteins and DNA, generating “oxidation-specific” epitopes. In this review, we will discuss the hypothesis that such common oxidation-specific epitopes are a major target of innate immunity, recognized by a variety of “pattern recognition receptors” (PRRs). By analogy with microbial “pathogen associated molecular patterns” (PAMPs), we postulate that host-derived, oxidation-specific epitopes can be considered to represent “danger (or damage) associated molecular patterns” (DAMPs). We also argue that oxidation-specific epitopes present on apoptotic cells and their cellular debris provided the primary evolutionary pressure for the selection of such PRRs. Further, because many PAMPs on microbes share molecular identity and/or mimicry with oxidation-specific epitopes, such PAMPs provided a strong secondary selecting pressure for the same set of oxidation-specific PRRs as well. Because lipid peroxidation is ubiquitous and a major component of the inflammatory state associated with atherosclerosis, the understanding that oxidation-specific epitopes are DAMPs, and thus the target of multiple arcs of innate immunity, provides novel insights into the pathogenesis of atherosclerosis. As examples, we show that both cellular and soluble PRRs, such as CD36, toll-like receptor-4, natural antibodies, and CRP recognize common oxidation-specific DAMPs, such as oxidized phospholipids and oxidized cholesteryl esters, and mediate a variety of immune responses, from expression of proinflammatory genes to excessive intracellular lipoprotein accumulation to atheroprotective humoral immunity. These insights may lead to improved understanding of inflammation and atherogenesis and suggest new approaches to diagnosis and therapy. PMID:21252151
DOE Office of Scientific and Technical Information (OSTI.GOV)
Caulada-Benedetti, Z.; Al-Zamel, F.; Sher, A.
1991-03-01
Mice immunized against Schistosoma mansoni by a single percutaneous exposure to radiation-attenuated parasite larvae demonstrate partial resistance to challenge infection that has been shown to correlate with development of cell-mediated immunity, whereas mice hyperimmunized by multiple exposure to attenuated larvae produce antibodies capable of transferring partial protection to naive recipients. Measurement of Ag-specific lymphokine responses in these animals suggested that the difference in resistance mechanisms may be due to the differential induction of Th subset response by the two immunization protocols. Thus, upon Ag stimulation, singly immunized mice predominantly demonstrated responses associated with Th1 reactivity, including IL-2 and IFN-gamma production,more » whereas multiply immunized animals showed increased IL-5, IL-4, and IgG1 antibody production associated with enhanced Th2 response. These responses demonstrated some degree of organ compartmentalization, with splenocytes demonstrating higher Th1-related lymphokine production and cells from draining lymph nodes showing stronger proliferation and Th2 type reactivity. However, hyperimmunized mice also continued to demonstrate substantial Th1-associated immune reactivity. Moreover, in vivo Ag challenge elicited activated larvacidal macrophages in hyperimmunized animals. These observations indicate that protective cell-mediated mechanisms associated with induction of CD4+ Th1 cell reactivity predominate in singly vaccinated mice. Further vaccination stimulates Th2 responses, such as enhanced IgG1 production, that may also contribute to protective immunity.« less
Advances in personalized cancer immunotherapy.
Kakimi, Kazuhiro; Karasaki, Takahiro; Matsushita, Hirokazu; Sugie, Tomoharu
2017-01-01
There are currently three major approaches to T cell-based cancer immunotherapy, namely, active vaccination, adoptive cell transfer therapy and immune checkpoint blockade. Recently, this latter approach has demonstrated remarkable clinical benefits, putting cancer immunotherapy under the spotlight. Better understanding of the dynamics of anti-tumor immune responses (the "Cancer-Immunity Cycle") is crucial for the further development of this form of treatment. Tumors employ multiple strategies to escape from anti-tumor immunity, some of which result from the selection of cancer cells with immunosuppressive activity by the process of cancer immunoediting. Apart from this selective process, anti-tumor immune responses can also be inhibited in multiple different ways which vary from patient to patient. This implies that cancer immunotherapy must be personalized to (1) identify the rate-limiting steps in any given patient, (2) identify and combine strategies to overcome these hurdles, and (3) proceed with the next round of the "Cancer-Immunity Cycle". Cancer cells have genetic alterations which can provide the immune system with targets by which to recognize and eradicate the tumor. Mutated proteins expressed exclusively in cancer cells and recognizable by the immune system are known as neoantigens. The development of next-generation sequencing technology has made it possible to determine the genetic landscape of human cancer and facilitated the utilization of genomic information to identify such candidate neoantigens in individual cancers. Future immunotherapies will need to be personalized in terms of the identification of both patient-specific immunosuppressive mechanisms and target neoantigens.
Varn, Frederick S.; Tafe, Laura J.; Amos, Christopher I.; Cheng, Chao
2018-01-01
ABSTRACT Non-small cell lung cancer is one of the leading causes of cancer-related death in the world. Lung adenocarcinoma, the most common type of non-small cell lung cancer, has been well characterized as having a dense lymphocytic infiltrate, suggesting that the immune system plays an active role in shaping this cancer's growth and development. Despite these findings, our understanding of how this infiltrate affects patient prognosis and its association with lung adenocarcinoma-specific clinical factors remains limited. To address these questions, we inferred the infiltration level of six distinct immune cell types from a series of four lung adenocarcinoma gene expression datasets. We found that naive B cell, CD8+ T cell, and myeloid cell-derived expression signals of immune infiltration were significantly predictive of patient survival in multiple independent datasets, with B cell and CD8+ T cell infiltration associated with prolonged prognosis and myeloid cell infiltration associated with shorter survival. These associations remained significant even after accounting for additional clinical variables. Patients stratified by smoking status exhibited decreased CD8+ T cell infiltration and altered prognostic associations, suggesting potential immunosuppressive mechanisms in smokers. Survival analyses accounting for immune checkpoint gene expression and cellular immune infiltrate indicated checkpoint protein-specific modulatory effects on CD8+ T cell and B cell function that may be associated with patient sensitivity to immunotherapy. Together, these analyses identified reproducible associations that can be used to better characterize the role of immune infiltration in lung adenocarcinoma and demonstrate the utility in using computational approaches to systematically characterize tissue-specific tumor-immune interactions. PMID:29872556
Protective Cellular Immunity Against Influenza Virus Induced by Plasmid Inoculation of Newborn Mice
Bot, Adrian; Bot, Simona; García-Sastre, Adolfo
1998-01-01
Neonate organisms display an intrinsic disability to mount effective immune responses to infectious agents or conventional vaccines. Whereas low. doses of antigens trigger a suboptimal response, higher doses are frequently associated with tolerance induction. We investigated the ability of a plasmid-expressing nucleoprotein of influenza virus to prime a specific cellular immune response when administered to newborn mice. We found that persistent exposure to antigen following plasmid inoculation of neonates leads to a vigorous priming of specific CTLs rather than tolerance induction. The CTLs were cross-reactive against multiple strains of type A influenza viruses and produced IFNγ but no IL-4. The immunity triggered by plasmid inoculation of neonates was protective in terms of pulmonary virus clearance as well as survival rate following lethal challenge with influenza virus. Whereas the persistence of the plasmid at the site of injection was readily demonstrable in adult mice at 3 months after inoculation, mice immunized as newborns displayed no plasmid at 3 months and very little at 1 month after injection. Thus, DNA-based immunization of neonates may prove an effective and safe vaccination strategy for induction of cellular immunity against microbes that cause serious infectious diseases in the early period of life. PMID:9851359
Llosa, Nicolas J.; Cruise, Michael; Tam, Ada; Wick, Elizabeth C.; Hechenbleikner, Elizabeth M.; Taube, Janis M.; Blosser, Lee; Fan, Hongni; Wang, Hao; Luber, Brandon; Zhang, Ming; Papadopoulos, Nickolas; Kinzler, Kenneth W.; Vogelstein, Bert; Sears, Cynthia L.; Anders, Robert A.; Pardoll, Drew M.; Housseau, Franck
2014-01-01
We examined the immune microenvironment of primary colorectal cancer (CRC) using immunohistochemistry, laser capture microdissection/qRT-PCR, flow cytometry and functional analysis of tumor infiltrating lymphocytes. A subset of CRC displayed high infiltration with activated CD8+ CTL as well as activated Th1 cells characterized by IFN-γ production and the Th1 transcription factor Tbet. Parallel analysis of tumor genotypes revealed that virtually all of the tumors with this active Th1/CTL microenvironment had defects in mismatch repair, as evidenced by microsatellite instability (MSI). Counterbalancing this active Th1/CTL microenvironment, MSI tumors selectively demonstrated highly up-regulated expression of multiple immune checkpoints, including five – PD-1, PD-L1, CTLA-4, LAG-3 and IDO – currently being targeted clinically with inhibitors. These findings link tumor genotype with the immune microenvironment, and explain why MSI tumors are not naturally eliminated despite a hostile Th1/CTL microenvironment. They further suggest that blockade of specific checkpoints may be selectively efficacious in the MSI subset of CRC. PMID:25358689
Th9 cells: differentiation and disease
Kaplan, Mark H.
2014-01-01
Summary CD4+ T-helper cells regulate immunity and inflammation through the acquisition of potential to secrete specific cytokines. The acquisition of cytokine-secreting potential, in a process termed T-helper cell differentiation, is a response to multiple environmental signals including the cytokine milieu. The most recently defined subset of T-helper cells are termed Th9 and are identified by the potent production of interleukin-9 (IL-9). Given the pleiotropic functions of IL-9, Th9 cells might be involved in pathogen immunity and immune-mediated disease. In this review, I focus on recent developments in understanding the signals that promote Th9 differentiation, the transcription factors that regulate IL-9 expression, and finally the potential roles for Th9 cells in immunity in vivo. PMID:23405898
Gorse, Geoffrey J; Newman, Mark J; deCamp, Allan; Hay, Christine Mhorag; De Rosa, Stephen C; Noonan, Elizabeth; Livingston, Brian D; Fuchs, Jonathan D; Kalams, Spyros A; Cassis-Ghavami, Farah L
2012-05-01
We evaluated a DNA plasmid-vectored vaccine and a recombinant modified vaccinia virus Ankara vaccine (MVA-mBN32), each encoding cytotoxic and helper T-lymphocyte epitopes of human immunodeficiency virus type 1 (HIV-1) in a randomized, double-blinded, placebo-controlled trial in 36 HIV-1-uninfected adults using a heterologous prime-boost schedule. HIV-1-specific cellular immune responses, measured as interleukin-2 and/or gamma interferon production, were induced in 1 (4%) of 28 subjects after the first MVA-mBN32 immunization and in 3 (12%) of 25 subjects after the second MVA-mBN32 immunization. Among these responders, polyfunctional T-cell responses, including the production of tumor necrosis factor alpha and perforin, were detected. Vaccinia virus-specific antibodies were induced to the MVA vector in 27 (93%) of 29 and 26 (93%) of 28 subjects after the first and second immunizations with MVA-mBN32. These peptide-based vaccines were safe but were ineffective at inducing HIV-1-specific immune responses and induced much weaker responses than MVA vaccines expressing the entire open reading frames of HIV-1 proteins.
Khattar, Sunil K; Palaniyandi, Senthilkumar; Samal, Sweety; LaBranche, Celia C; Montefiori, David C; Zhu, Xiaoping; Samal, Siba K
2015-01-01
The combination of multiple HIV antigens in a vaccine can broaden antiviral immune responses. In this study, we used NDV vaccine strain LaSota to generate rNDV (rLaSota/optGag) expressing human codon optimized p55 Gag protein of HIV-1. We examined the effect of co-immunization of rLaSota/optGag with rNDVs expressing different forms of Env protein gp160, gp120, gp140L [a version of gp140 that lacked cytoplasmic tail and contained complete membrane-proximal external region (MPER)] and gp140S (a version of gp140 that lacked cytoplasmic tail and distal half of MPER) on magnitude and breadth of humoral, mucosal and cellular immune responses in guinea pigs and mice. Our results showed that inclusion of rLaSota/optGag with rNDVs expressing different forms of Env HIV Gag did not affect the Env-specific humoral and mucosal immune responses in guinea pigs and that the potent immune responses generated against Env persisted for at least 13 weeks post immunization. The highest Env-specific humoral and mucosal immune responses were observed with gp140S+optGag group. The neutralizing antibody responses against HIV strains BaL.26 and MN.3 induced by gp140S+optGag and gp160+optGag were higher than those elicited by other groups. Inclusion of Gag with gp160, gp140S and gp140L enhanced the level of Env-specific IFN-γ-producing CD8+ T cells in mice. Inclusion of Gag with gp160 and gp140L also resulted in increased Env-specific CD4+ T cells. The level of Gag-specific CD8+ and CD4+ T cells was also enhanced in mice immunized with Gag along with gp140S and gp120. These results indicate lack of antigen interference in a vaccine containing rNDVs expressing Env and Gag proteins. PMID:25695657
Evaluation of a DLA-79 allele associated with multiple immune-mediated diseases in dogs.
Friedenberg, Steven G; Buhrman, Greg; Chdid, Lhoucine; Olby, Natasha J; Olivry, Thierry; Guillaumin, Julien; O'Toole, Theresa; Goggs, Robert; Kennedy, Lorna J; Rose, Robert B; Meurs, Kathryn M
2016-03-01
Immune-mediated diseases are common and life-threatening disorders in dogs. Many canine immune-mediated diseases have strong breed predispositions and are believed to be inherited. However, the genetic mutations that cause these diseases are mostly unknown. As many immune-mediated diseases in humans share polymorphisms among a common set of genes, we conducted a candidate gene study of 15 of these genes across four immune-mediated diseases (immune-mediated hemolytic anemia, immune-mediated thrombocytopenia, immune-mediated polyarthritis (IMPA), and atopic dermatitis) in 195 affected and 206 unaffected dogs to assess whether causative or predictive polymorphisms might exist in similar genes in dogs. We demonstrate a strong association (Fisher's exact p = 0.0004 for allelic association, p = 0.0035 for genotypic association) between two polymorphic positions (10 bp apart) in exon 2 of one allele in DLA-79, DLA-79*001:02, and multiple immune-mediated diseases. The frequency of this allele was significantly higher in dogs with immune-mediated disease than in control dogs (0.21 vs. 0.12) and ranged from 0.28 in dogs with IMPA to 0.15 in dogs with atopic dermatitis. This allele has two non-synonymous substitutions (compared with the reference allele, DLA-79*001:01), resulting in F33L and N37D amino acid changes. These mutations occur in the peptide-binding pocket of the protein, and based upon our computational modeling studies, are likely to affect critical interactions with the peptide N-terminus. Further studies are warranted to confirm these findings more broadly and to determine the specific mechanism by which the identified variants alter canine immune system function.
Zhang, Congdang; Wang, Yi; Ma, Shuzhi; Li, Leike; Chen, Liyun; Yan, Huimin; Peng, Tao
2016-06-01
Human enterovirus 71 (EV-A71), a major agent of hand, foot, and mouth disease, has become an important public health issue in recent years. No effective antiviral or vaccines against EV-A71 infection are currently available. EV-A71 infection intrudes bodies through the gastric mucosal surface and it is necessary to enhance mucosal immune response to protect children from these pathogens. Recently, the majority of EV-A71 vaccine candidates have been developed for parenteral immunization. However, parenteral vaccine candidates often induce poor mucosal responses. On the other hand, oral vaccines could induce effective mucosal and systemic immunity, and could be easily and safely administered. Thus, proper oral vaccines have attached more interest compared with parenteral vaccine. In this study, the major immunogenic capsid protein of EV-A71 was displayed on the surface of Saccharomyces cerevisiae. Oral immunization of mice with surface-displayed VP1 S. cerevisiae induced systemic humoral and mucosal immune responses, including virus-neutralizing titers, VP1-specific antibody, and the induction of Th1 immune responses in the spleen. Furthermore, oral immunization of mother mice with surface-displayed VP1 S. cerevisiae conferred protection to neonatal mice against the lethal EV-A71 infection. Furthermore, we observed that multiple boost immunization as well as higher immunization dosage could induce higher EV-A71-specific immune response. Our results demonstrated that surface-displayed VP1 S. cerevisiae could be used as potential oral vaccine against EV-A71 infection.
Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J.; Shih, J. Wai-Kuo
2017-01-01
Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-γ-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biasedpathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-γ demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins. PMID:18675871
Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J; Shih, J Wai-Kuo
2008-10-09
Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-gamma-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biased pathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-gamma demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins.
Oscherwitz, Jon; Feldman, Daniel; Yu, Fen; Cease, Kemp B
2015-01-09
Anthrax represents a formidable bioterrorism threat for which new, optimized vaccines are required. We previously demonstrated that epitope-focused multiple antigenic peptides or a recombinant protein in Freund's adjuvant can elicit Ab against the loop neutralizing determinant (LND), a cryptic linear neutralizing epitope in the 2ß2-2ß3 loop of protective antigen from Bacillus anthracis, which mediated protection of rabbits from inhalation challenge with B. anthracis Ames strain. However, demonstration of efficacy using human-use adjuvants is required before proceeding with further development of an LND vaccine for testing in non-human primates and humans. To optimize the LND immunogen, we first evaluated the protective efficacy and immune correlates associated with immunization of rabbits with mixtures containing two molecular variants of multiple antigenic peptides in Freunds adjuvant, termed BT-LND(2) and TB-LND(2). TB-LND(2) was then further evaluated for protective efficacy in rabbits employing human-use adjuvants. Immunization of rabbits with TB-LND(2) in human-use adjuvants elicited protection from Ames strain spore challenge which was statistically indistinguishable from that elicited through immunization with protective antigen. All TB-LND(2) rabbits with any detectable serum neutralization prior to challenge were protected from aerosolized spore exposure. Remarkably, rabbits immunized with TB-LND(2) in Alhydrogel/CpG had significant anamnestic increases in post-challenge LND-specific Ab and neutralization titers despite little evidence of spore germination in these rabbits. An LND-specific epitope-focused vaccine may complement PA-based vaccines and may represent a complementary stand-alone vaccine for anthrax. Copyright © 2014 Elsevier Ltd. All rights reserved.
Arru, Giannina; Sechi, Elia; Mariotto, Sara; Farinazzo, Alessia; Mancinelli, Chiara; Alberti, Daniela; Ferrari, Sergio; Gajofatto, Alberto; Capra, Ruggero; Monaco, Salvatore; Deiana, Giovanni A; Caggiu, Elisa; Mameli, Giuseppe; Sechi, Leonardo A; Sechi, Gian Pietro
2017-01-01
A specific humoral immune response against HERV-W envelope surface (env-su) glycoprotein antigens has been reported in serum of patients with multiple sclerosis (MS). However, it has not been evaluated to date in patients with neuromyelitis optica spectrum disorder (NMOSD). The objective of this paper is to investigate whether antibody (Ab) response against HERV-W env-su antigenic peptides differs between NMOSD and MS. Serum samples were collected from 36 patients with NMOSD, 36 patients with MS and 36 healthy control individuals (HCs). An indirect ELISA was set up to detect specific Abs against HERV-W env-su peptides. Our data showed that two antigenic peptides, particularly HERV-Wenv 93-108 and HERV-Wenv 248-262, were statistically significantly present only in serum of MS compared to NMOSD and HCs. Thus, the specific humoral immune response against HERV-W env-su glycoprotein antigens found in MS is widely missing in NMOSD. Increased circulating serum levels of these HERV-W Abs may be suitable as additional biomarkers to better differentiate MS from NMOSD.
Staphylococcus aureus innate immune evasion is lineage-specific: a bioinfomatics study.
McCarthy, Alex J; Lindsay, Jodi A
2013-10-01
Staphylococcus aureus is a major human pathogen, and is targeted by the host innate immune system. In response, S. aureus genomes encode dozens of secreted proteins that inhibit complement, chemotaxis and neutrophil activation resulting in successful evasion of innate immune responses. These proteins include immune evasion cluster proteins (IEC; Chp, Sak, Scn), staphylococcal superantigen-like proteins (SSLs), phenol soluble modulins (PSMs) and several leukocidins. Biochemical studies have indicated that genetic variants of these proteins can have unique functions. To ascertain the scale of genetic variation in secreted immune evasion proteins, whole genome sequences of 88 S. aureus isolates, representing 25 clonal complex (CC) lineages, in the public domain were analysed across 43 genes encoding 38 secreted innate immune evasion protein complexes. Twenty-three genes were variable, with between 2 and 15 variants, and the variants had lineage-specific distributions. They include genes encoding Eap, Ecb, Efb, Flipr/Flipr-like, Hla, Hld, Hlg, Sbi, Scin-B/C and 13 SSLs. Most of these protein complexes inhibit complement, chemotaxis and neutrophil activation suggesting that isolates from each S. aureus lineage respond to the innate immune system differently. In contrast, protein complexes that lyse neutrophils (LukSF-PVL, LukMF, LukED and PSMs) were highly conserved, but can be carried on mobile genetic elements (MGEs). MGEs also encode proteins with narrow host-specificities arguing that their acquisition has important roles in host/environmental adaptation. In conclusion, this data suggests that each lineage of S. aureus evades host immune responses differently, and that isolates can adapt to new host environments by acquiring MGEs and the immune evasion protein complexes that they encode. Cocktail therapeutics that targets multiple variant proteins may be the most appropriate strategy for controlling S. aureus infections. Copyright © 2013 Elsevier B.V. All rights reserved.
Neonatal Immunization: Rationale, Current State, and Future Prospects.
Whittaker, Elizabeth; Goldblatt, David; McIntyre, Peter; Levy, Ofer
2018-01-01
Infections take their greatest toll in early life necessitating robust approaches to protect the very young. Here, we review the rationale, current state, and future research directions for one such approach: neonatal immunization. Challenges to neonatal immunization include natural concern about safety as well as a distinct neonatal immune system that is generally polarized against Th1 responses to many stimuli such that some vaccines that are effective in adults are not in newborns. Nevertheless, neonatal immunization could result in high-population penetration as birth is a reliable point of healthcare contact, and offers an opportunity for early protection of the young, including preterm newborns who are deficient in maternal antibodies. Despite distinct immunity and reduced responses to some vaccines, several vaccines have proven safe and effective at birth. While some vaccines such as polysaccharide vaccines have little effectiveness at birth, hepatitis B vaccine can prime at birth and requires multiple doses to achieve protection, whereas the live-attenuated Bacille Calmette-Guérin (BCG), may offer single shot protection, potentially in part via heterologous ("non-specific") beneficial effects. Additional vaccines have been studied at birth including those directed against pertussis, pneumococcus, Haemophilus influenza type B and rotavirus providing important lessons. Current areas of research in neonatal vaccinology include characterization of early life immune ontogeny, heterogeneity in and heterologous effects of BCG vaccine formulations, applying systems biology and systems serology, in vitro platforms that model age-specific human immunity and discovery and development of novel age-specific adjuvantation systems. These approaches may inform, de-risk, and accelerate development of novel vaccines for use in early life. Key stakeholders, including the general public, should be engaged in assessing the opportunities and challenges inherent to neonatal immunization.
Human influenza viruses and CD8(+) T cell responses.
Grant, Emma J; Quiñones-Parra, Sergio M; Clemens, E Bridie; Kedzierska, Katherine
2016-02-01
Influenza A viruses (IAVs) cause significant morbidity and mortality worldwide, despite new strain-specific vaccines being available annually. As IAV-specific CD8(+) T cells promote viral control in the absence of neutralizing antibodies, and can mediate cross-reactive immunity toward distinct IAVs to drive rapid recovery from both mild and severe influenza disease, there is great interest in developing a universal T cell vaccine. However, despite detailed studies in mouse models of influenza virus infection, there is still a paucity of data on human epitope-specific CD8(+) T cell responses to IAVs. This review focuses on our current understanding of human CD8(+) T cell immunity against distinct IAVs and discusses the possibility of achieving a CD8(+) T cell mediated-vaccine that protects against multiple, distinct IAV strains across diverse human populations. We also review the importance of CD8(+) T cell immunity in individuals highly susceptible to severe influenza infection, including those hospitalised with influenza, the elderly and Indigenous populations. Copyright © 2016 Elsevier B.V. All rights reserved.
Plant-bacterial pathogen interactions mediated by type III effectors.
Feng, Feng; Zhou, Jian-Min
2012-08-01
Effectors secreted by the bacterial type III system play a central role in the interaction between Gram-negative bacterial pathogens and their host plants. Recent advances in the effector studies have helped cementing several key concepts concerning bacterial pathogenesis, plant immunity, and plant-pathogen co-evolution. Type III effectors use a variety of biochemical mechanisms to target specific host proteins or DNA for pathogenesis. The identifications of their host targets led to the identification of novel components of plant innate immune system. Key modules of plant immune signaling pathways such as immune receptor complexes and MAPK cascades have emerged as a major battle ground for host-pathogen adaptation. These modules are attacked by multiple type III effectors, and some components of these modules have evolved to actively sense the effectors and trigger immunity. Copyright © 2012 Elsevier Ltd. All rights reserved.
Identification of variant-specific surface proteins in Giardia muris trophozoites.
Ropolo, Andrea S; Saura, Alicia; Carranza, Pedro G; Lujan, Hugo D
2005-08-01
Giardia lamblia undergoes antigenic variation, a process that might allow the parasite to evade the host's immune response and adapt to different environments. Here we show that Giardia muris, a related species that naturally infects rodents, possesses multiple variant-specific surface proteins (VSPs) and expresses VSPs on its surface, suggesting that it undergoes antigenic variation similar to that of G. lamblia.
HLA-G peptide preferences change in transformed cells: impact on the binding motif.
Celik, Alexander A; Simper, Gwendolin S; Hiemisch, Wiebke; Blasczyk, Rainer; Bade-Döding, Christina
2018-03-30
HLA-G is known for its strictly restricted tissue distribution. HLA-G expression could be detected in immune privileged organs and many tumor entities such as leukemia, multiple myeloma, and non-Hodgkin and Hodgkin's lymphoma. This functional variability from mediation of immune tolerance to facilitation of tumor immune evasion strategies might translate to a differential NK cell inhibition between immune-privileged organs and tumor cells. The biophysical invariability of the HLA-G heavy chain and its contrary diversity in immunity implicates a strong influence of the bound peptides on the pHLA-G structure. The aim was to determine if HLA-G displays a tissue-specific peptide repertoire. Therefore, using soluble sHLA-G technology, we analyzed the K562 and HDLM-2 peptide repertoires. Although both cell lines possess a comparable proteome and recruit HLA-G-restricted peptides through the same peptide-loading pathway, the peptide features appear to be cell specific. HDLM-2 derived HLA-G peptides are anchored by an Arg at p1 and K562-derived peptides are anchored by a Lys. At p2, no anchor motif could be determined while peptides were anchored at pΩ with a Leu and showed an auxiliary anchor motif Pro at p3. To appreciate if the peptide anchor alterations are due to a cell-specific differential peptidome, we performed analysis of peptide availability within the different cell types. Yet, the comparison of the cell-specific proteome and HLA-G-restricted ligandome clearly demonstrates a tissue-specific peptide selection by HLA-G molecules. This exclusive and unexpected observation suggests an exquisite immune function of HLA-G.
Complex Immune Correlates of Protection in HIV-1 Vaccine Efficacy Trials
Tomaras, Georgia D.; Plotkin, Stanley A.
2016-01-01
Summary Development of an efficacious HIV-1 vaccine is a major priority for improving human health worldwide. Vaccine mediated protection against human pathogens can be achieved through elicitation of protective innate, humoral, and cellular responses. Identification of specific immune responses responsible for pathogen protection enables vaccine development and provides insights into host defenses against pathogens and the immunological mechanisms that most effectively fight infection. Defining immunological correlates of transmission risk in preclinical and clinical HIV-1 vaccine trials has moved the HIV-1 vaccine development field forward and directed new candidate vaccine development. Immune correlate studies are providing novel hypotheses about immunological mechanisms that may be responsible for preventing HIV-1 acquisition. Recent results from HIV-1 immune correlates work has demonstrated that there are multiple types of immune responses that together, comprise an immune correlate—thus implicating polyfunctional immune control of HIV-1 transmission. An in depth understanding of these complex immunological mechanisms of protection against HIV-1 will accelerate the development of an efficacious HIV-1 vaccine. PMID:28133811
Orekhov, Alexander N.; Bobryshev, Yuri V.; Sobenin, Igor A.; Melnichenko, Alexandra A.; Chistiakov, Dimitry A.
2014-01-01
In atherosclerosis; blood low-density lipoproteins (LDL) are subjected to multiple enzymatic and non-enzymatic modifications that increase their atherogenicity and induce immunogenicity. Modified LDL are capable of inducing vascular inflammation through activation of innate immunity; thus, contributing to the progression of atherogenesis. The immunogenicity of modified LDL results in induction of self-antibodies specific to a certain type of modified LDL. The antibodies react with modified LDL forming circulating immune complexes. Circulating immune complexes exhibit prominent immunomodulatory properties that influence atherosclerotic inflammation. Compared to freely circulating modified LDL; modified LDL associated with the immune complexes have a more robust atherogenic and proinflammatory potential. Various lipid components of the immune complexes may serve not only as diagnostic but also as essential predictive markers of cardiovascular events in atherosclerosis. Accumulating evidence indicates that LDL-containing immune complexes can also serve as biomarker for macrovascular disease in type 1 diabetes. PMID:25050779
Bruton's Tyrosine Kinase: An Emerging Key Player in Innate Immunity.
Weber, Alexander N R; Bittner, Zsofia; Liu, Xiao; Dang, Truong-Minh; Radsak, Markus Philipp; Brunner, Cornelia
2017-01-01
Bruton's tyrosine kinase (BTK) was initially discovered as a critical mediator of B cell receptor signaling in the development and functioning of adaptive immunity. Growing evidence also suggests multiple roles for BTK in mononuclear cells of the innate immune system, especially in dendritic cells and macrophages. For example, BTK has been shown to function in Toll-like receptor-mediated recognition of infectious agents, cellular maturation and recruitment processes, and Fc receptor signaling. Most recently, BTK was additionally identified as a direct regulator of a key innate inflammatory machinery, the NLRP3 inflammasome. BTK has thus attracted interest not only for gaining a more thorough basic understanding of the human innate immune system but also as a target to therapeutically modulate innate immunity. We here review the latest developments on the role of BTK in mononuclear innate immune cells in mouse versus man, with specific emphasis on the sensing of infectious agents and the induction of inflammation. Therapeutic implications for modulating innate immunity and critical open questions are also discussed.
Sudjarwo, Sri Agus; Eraiko, Koerniasari; Sudjarwo, Giftania Wardani; Koerniasari
2017-01-01
The aim of this study was to characterize of chicken egg yolk immunoglobulins (IgYs) specific as immunotherapy to Mycobacterium tuberculosis complex (MTBC) infection. Lohmann laying hens were immunized intramuscularly with antigenic of MTBC. Egg yolk was separated from egg white, and IgY antibody was then purified by multiple polyethylene glycols 6000 extraction and ammonium sulfate purification steps. The IgY anti-MTBC concentration in egg yolk increased at 2 weeks and it reached a maximum at 4 weeks after immunization. After 6 weeks, the levels of IgY anti-MTBC decreased gradually. The antibody of MTBC was detected and produces a specific line of precipitation in agar gel precipitation test beginning the week 2 after the first immunization. Analysis of results obtained with ELISA showed a significant increase in the MTBC specific antibodies after 2 weeks and reached a plateau at 4 weeks from the booster immunization. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis revealed the IgY preparation to be pure and dissociated into protein bands with molecular weights of 112, 78, 69, 49, and 28 kDa and Western blot analysis shown the presence of anti-MTBC IgY in egg yolks, with molecular weights of approximately 78 kDa. These results suggested that egg yolk could be a practical strategy in large-scale production of specific anti-MTBC IgY for immunotherapy of TBC. PMID:28795022
Sudjarwo, Sri Agus; Eraiko, Koerniasari; Sudjarwo, Giftania Wardani; Koerniasari
2017-01-01
The aim of this study was to characterize of chicken egg yolk immunoglobulins (IgYs) specific as immunotherapy to Mycobacterium tuberculosis complex (MTBC) infection. Lohmann laying hens were immunized intramuscularly with antigenic of MTBC. Egg yolk was separated from egg white, and IgY antibody was then purified by multiple polyethylene glycols 6000 extraction and ammonium sulfate purification steps. The IgY anti-MTBC concentration in egg yolk increased at 2 weeks and it reached a maximum at 4 weeks after immunization. After 6 weeks, the levels of IgY anti-MTBC decreased gradually. The antibody of MTBC was detected and produces a specific line of precipitation in agar gel precipitation test beginning the week 2 after the first immunization. Analysis of results obtained with ELISA showed a significant increase in the MTBC specific antibodies after 2 weeks and reached a plateau at 4 weeks from the booster immunization. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis revealed the IgY preparation to be pure and dissociated into protein bands with molecular weights of 112, 78, 69, 49, and 28 kDa and Western blot analysis shown the presence of anti-MTBC IgY in egg yolks, with molecular weights of approximately 78 kDa. These results suggested that egg yolk could be a practical strategy in large-scale production of specific anti-MTBC IgY for immunotherapy of TBC.
Immunologic Endocrine Disorders
Michels, Aaron W.; Eisenbarth, George S.
2010-01-01
Autoimmunity affects multiple glands in the endocrine system. Animal models and human studies highlight the importance of alleles in HLA (human leukocyte antigen)-like molecules determining tissue specific targeting that with the loss of tolerance leads to organ specific autoimmunity. Disorders such as type 1A diabetes, Grave's disease, Hashimoto's thyroiditis, Addison's disease, and many others result from autoimmune mediated tissue destruction. Each of these disorders can be divided into stages beginning with genetic susceptibility, environmental triggers, active autoimmunity, and finally metabolic derangements with overt symptoms of disease. With an increased understanding of the immunogenetics and immunopathogenesis of endocrine autoimmune disorders, immunotherapies are becoming prevalent, especially in type 1A diabetes. Immunotherapies are being used more in multiple subspecialty fields to halt disease progression. While therapies for autoimmune disorders stop the progress of an immune response, immunomodulatory therapies for cancer and chronic infections can also provoke an unwanted immune response. As a result, there are now iatrogenic autoimmune disorders arising from the treatment of chronic viral infections and malignancies. PMID:20176260
A humoral immune response confers protection against Haemophilus ducreyi infection.
Cole, Leah E; Toffer, Kristen L; Fulcher, Robert A; San Mateo, Lani R; Orndorff, Paul E; Kawula, Thomas H
2003-12-01
Haemophilus ducreyi is the etiologic agent of the sexually transmitted genital ulcer disease chancroid. Neither naturally occurring chancroid nor experimental infection with H. ducreyi results in protective immunity. Likewise, a single inoculation of H. ducreyi does not protect pigs against subsequent infection. Accordingly, we used the swine model of chancroid infection to examine the impact of multiple inoculations on a host's immune response. After three successive inoculations with H. ducreyi, pigs developed a modestly protective immune response evidenced by the decreased recovery of viable bacteria from lesions. All lesions biopsied 2 days after the first and second inoculations contained viable H. ducreyi cells, yet only 55% of the lesions biopsied 2 days after the third inoculation did. Nearly 90% of the lesions biopsied 7 days after the first inoculation contained viable H. ducreyi cells, but this percentage dropped to only 16% after the third inoculation. Between the first and third inoculations, the average recovery of CFU from lesions decreased approximately 100-fold. The reduced recovery of bacteria corresponded directly with a fivefold increase in H. ducreyi-specific antibody titers and the emergence of bactericidal activity. These immune sera were protective when administered to naïve pigs prior to challenge with H. ducreyi. These data suggest that pigs mount an effective humoral immune response to H. ducreyi after multiple exposures to the organism.
Memory T cells maintain protracted protection against malaria.
Krzych, Urszula; Zarling, Stasya; Pichugin, Alexander
2014-10-01
Immunologic memory is one of the cardinal features of antigen-specific immune responses, and the persistence of memory cells contributes to prophylactic immunizations against infectious agents. Adequately maintained memory T and B cell pools assure a fast, effective and specific response against re-infections. However, many aspects of immunologic memory are still poorly understood, particularly immunologic memory inducible by parasites, for example, Plasmodium spp., the causative agents of malaria. For example, memory responses to Plasmodium antigens amongst residents of malaria endemic areas appear to be either inadequately developed or maintained, because persons who survive episodes of childhood malaria remain vulnerable to intermittent malaria infections. By contrast, multiple exposures of humans and laboratory rodents to radiation-attenuated Plasmodium sporozoites (γ-spz) induce sterile and long-lasting protection against experimental sporozoite challenge. Multifactorial immune mechanisms maintain this protracted and sterile protection. While the presence of memory CD4 T cell subsets has been associated with lasting protection in humans exposed to multiple bites from Anopheles mosquitoes infected with attenuated Plasmodium falciparum, memory CD8 T cells maintain protection induced with Plasmodium yoelii and Plasmodium berghei γ-spz in murine models. In this review, we discuss our observations that show memory CD8 T cells specific for antigens expressed by P. berghei liver stage parasites as an indispensable component for the maintenance of protracted protective immunity against experimental malaria infection; moreover, the provision of an Ag-depot assures a quick recall of memory T cells as IFN-γ-producing effector CD8 T cells and IL-4- producing CD4 T cells that collaborate with B cells for an effective antibody response. Published by Elsevier B.V.
Plant targets for Pseudomonas syringae type III effectors: virulence targets or guarded decoys?
Block, Anna; Alfano, James R
2011-02-01
The phytopathogenic bacterium Pseudomonas syringae can suppress both pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI) and effector-triggered immunity (ETI) by the injection of type III effector (T3E) proteins into host cells. T3Es achieve immune suppression using a variety of strategies including interference with immune receptor signaling, blocking RNA pathways and vesicle trafficking, and altering organelle function. T3Es can be recognized indirectly by resistance proteins monitoring specific T3E targets resulting in ETI. It is presently unclear whether the monitored targets represent bona fide virulence targets or guarded decoys. Extensive overlap between PTI and ETI signaling suggests that T3Es may suppress both pathways through common targets and by possessing multiple activities. Copyright © 2010 Elsevier Ltd. All rights reserved.
Identification of Variant-Specific Surface Proteins in Giardia muris Trophozoites
Ropolo, Andrea S.; Saura, Alicia; Carranza, Pedro G.; Lujan, Hugo D.
2005-01-01
Giardia lamblia undergoes antigenic variation, a process that might allow the parasite to evade the host's immune response and adapt to different environments. Here we show that Giardia muris, a related species that naturally infects rodents, possesses multiple variant-specific surface proteins (VSPs) and expresses VSPs on its surface, suggesting that it undergoes antigenic variation similar to that of G. lamblia. PMID:16041041
Modulation by Melatonin of the Pathogenesis of Inflammatory Autoimmune Diseases
Lin, Gu-Jiun; Huang, Shing-Hwa; Chen, Shyi-Jou; Wang, Chih-Hung; Chang, Deh-Ming; Sytwu, Huey-Kang
2013-01-01
Melatonin is the major secretory product of the pineal gland during the night and has multiple activities including the regulation of circadian and seasonal rhythms, and antioxidant and anti-inflammatory effects. It also possesses the ability to modulate immune responses by regulation of the T helper 1/2 balance and cytokine production. Autoimmune diseases, which result from the activation of immune cells by autoantigens released from normal tissues, affect around 5% of the population. Activation of autoantigen-specific immune cells leads to subsequent damage of target tissues by these activated cells. Melatonin therapy has been investigated in several animal models of autoimmune disease, where it has a beneficial effect in a number of models excepting rheumatoid arthritis, and has been evaluated in clinical autoimmune diseases including rheumatoid arthritis and ulcerative colitis. This review summarizes and highlights the role and the modulatory effects of melatonin in several inflammatory autoimmune diseases including multiple sclerosis, systemic lupus erythematosus, rheumatoid arthritis, type 1 diabetes mellitus, and inflammatory bowel disease. PMID:23727938
Louveau, Antoine; Mesquita, Sandro Da; Kipnis, Jonathan
2016-01-01
Summary Lymphatic vasculature drains interstitial fluids, which contain the tissue’s waste products and ensures immune surveillance of the tissues, allowing immune-cell recirculation. Until recently the central nervous system (CNS) was considered to be devoid of a conventional lymphatic vasculature. The recent discovery in the meninges of a lymphatic network that drains the CNS calls into question classic models for the drainage of macromolecules and immune cells from the CNS. In the context of neurological disorders, the presence of a lymphatic system draining the CNS potentially offers a new player and a new avenue for therapy. In this review, we will attempt to integrate the known primary functions of the tissue lymphatic vasculature that exists in peripheral organs with the proposed function of meningeal lymphatic vessels in neurological disorders, specifically multiple sclerosis and Alzheimer’s disease. We propose that these (and potentially other) neurological afflictions can be viewed as diseases with neuro-lympho-vascular component and should be therapeutically targeted as such. PMID:27608759
Biology and Mucosal Immunity to Myxozoans
Gómez, Daniela; Bartholomew, Jerri; Sunyer, J. Oriol
2014-01-01
Myxozoans are among the most abundant parasites in nature. Their life cycles involve two hosts: an invertebrate, usually an annelid, and a vertebrate, usually a fish. They affect fish species in their natural habitats but also constitute a menace for fish aquaculture. Using different strategies they are able to parasitize and cause damage in multiple organs, including mucosal tissues, which they use also as portals of entry. In fish, the main mucosal sites include the intestine, skin and gills. Recently the finding of a specific mucosal immunoglobulin in teleost (IgT), analogous to mammalian IgA, and the capacity of fish to develop a specific mucosal immune response against different pathogens, has highlighted the importance of studying immune responses at mucosal sites. In this review, we describe the major biological characteristics of myxozoan parasites and present the data available regarding immune responses for species that infect mucosal sites. As models for mucosal immunity we review the responses to Enteromyxum spp. and Ceratomyxa shasta, both of which parasitize the intestine. The immune response at the skin and gills is also described, as these mucosal tissues are used by myxozoans as attaching surfaces and portal of entry, and some species also parasitize these sites. Finally, the development of immunoprophylactic strategies is discussed. PMID:23994774
Methods for Posttranslational Induction of Polyreactivity of Antibodies.
Lecerf, Maxime; Jarossay, Annaelle; Kaveri, Srinivas V; Lacroix-Desmazes, Sébastien; Dimitrov, Jordan D
2017-01-01
An antibody molecule that recognizes multiple unrelated antigens is defined as polyreactive. Polyreactivity is an intrinsic characteristic of immune repertoires. Degenerated antigen binding diversifies the repertoire of specificities, thus contributing to immune defense and immune regulation. Immune repertoire contains also a fraction of immunoglobulins, which acquire polyreactivity only following contact with various protein-destabilizing or pro-oxidative substances. Posttranslational induction of the antibody polyreactivity may have important repercussion for laboratory practice, as well as in cases of pathological conditions accompanied by liberation of large quantities of pro-oxidative substances such as heme, labile iron, or reactive oxygen species. Antibodies with induced polyreactivity have been demonstrated to exert pathogen neutralization and immune regulatory potential in inflammatory conditions, suggesting that this phenomenon may be exploited for design of therapeutic strategies. In this article, we provide description of the basic procedures for uncovering of the cryptic polyreactivity of antibodies by heme, ferrous ions, and acid pH solution.
[Dermatologic toxicities of immune checkpoint inhibitors].
Sibaud, V; Boulinguez, S; Pagès, C; Riffaud, L; Lamant, L; Chira, C; Boyrie, S; Vigarios, E; Tournier, E; Meyer, N
2018-05-01
The development of immune checkpoint inhibitors (monoclonal antibodies targeting PD-1/PD-L1 or CTLA-4) represents a significant advance in the treatment of multiple cancers. Given their particular mechanism of action, which involves triggering CD4+/CD8+ T-cell activation and proliferation, they are associated with a specific safety profile. Their adverse events are primarily immune-related, and can affect practically all organs. In this context, dermatological toxicity is the most common, though it mostly remains mild to moderate and does not require discontinuation of treatment. More than a third of patients are faced with cutaneous adverse events, usually in the form of a maculopapular rash, pruritus or vitiligo (only in patients treated for melanoma). Much more specific dermatologic disorders, however, may occur such as lichenoid reactions, induced psoriasis, sarcoidosis, auto-immune diseases (bullous pemphigoid, dermatomyositis, alopecia areata), acne-like rash, xerostomia, etc. Rigorous dermatological evaluation is thus mandatory in the case of atypical, persistent/recurrent or severe lesions. In this article, we review the incidence and spectrum of dermatologic adverse events reported with immune checkpoint inhibitors. Finally, a management algorithm is proposed. Copyright © 2018. Published by Elsevier Masson SAS.
Hancock, David G; Shklovskaya, Elena; Guy, Thomas V; Falsafi, Reza; Fjell, Chris D; Ritchie, William; Hancock, Robert E W; Fazekas de St Groth, Barbara
2014-01-01
Dendritic cells (DCs) are critical for regulating CD4 and CD8 T cell immunity, controlling Th1, Th2, and Th17 commitment, generating inducible Tregs, and mediating tolerance. It is believed that distinct DC subsets have evolved to control these different immune outcomes. However, how DC subsets mount different responses to inflammatory and/or tolerogenic signals in order to accomplish their divergent functions remains unclear. Lipopolysaccharide (LPS) provides an excellent model for investigating responses in closely related splenic DC subsets, as all subsets express the LPS receptor TLR4 and respond to LPS in vitro. However, previous studies of the LPS-induced DC transcriptome have been performed only on mixed DC populations. Moreover, comparisons of the in vivo response of two closely related DC subsets to LPS stimulation have not been reported in the literature to date. We compared the transcriptomes of murine splenic CD8 and CD11b DC subsets after in vivo LPS stimulation, using RNA-Seq and systems biology approaches. We identified subset-specific gene signatures, which included multiple functional immune mediators unique to each subset. To explain the observed subset-specific differences, we used a network analysis approach. While both DC subsets used a conserved set of transcription factors and major signalling pathways, the subsets showed differential regulation of sets of genes that 'fine-tune' the network Hubs expressed in common. We propose a model in which signalling through common pathway components is 'fine-tuned' by transcriptional control of subset-specific modulators, thus allowing for distinct functional outcomes in closely related DC subsets. We extend this analysis to comparable datasets from the literature and confirm that our model can account for cell subset-specific responses to LPS stimulation in multiple subpopulations in mouse and man.
Balancing Immune Protection and Immune Pathology by CD8+ T-Cell Responses to Influenza Infection
Duan, Susu; Thomas, Paul G.
2016-01-01
Influenza A virus (IAV) is a significant human pathogen causing annual epidemics and periodic pandemics. CD8+ cytotoxic T lymphocyte (CTL)-mediated immunity contributes to the clearance of virus-infected cells, and CTL immunity targeting the conserved internal proteins of IAVs is a key protection mechanism when neutralizing antibodies are absent during heterosubtypic IAV infection. However, CTL infiltration into the airways, its cytotoxicity, and the effects of produced proinflammatory cytokines can cause severe lung tissue injury, thereby contributing to immunopathology. Studies have discovered complicated and exquisite stimulatory and inhibitory mechanisms that regulate CTL magnitude and effector activities during IAV infection. Here, we review the state of knowledge on the roles of IAV-specific CTLs in immune protection and immunopathology during IAV infection in animal models, highlighting the key findings of various requirements and constraints regulating the balance of immune protection and pathology involved in CTL immunity. We also discuss the evidence of cross-reactive CTL immunity as a positive correlate of cross-subtype protection during secondary IAV infection in both animal and human studies. We argue that the effects of CTL immunity on protection and immunopathology depend on multiple layers of host and viral factors, including complex host mechanisms to regulate CTL magnitude and effector activity, the pathogenic nature of the IAV, the innate response milieu, and the host historical immune context of influenza infection. Future efforts are needed to further understand these key host and viral factors, especially to differentiate those that constrain optimally effective CTL antiviral immunity from those necessary to restrain CTL-mediated non-specific immunopathology in the various contexts of IAV infection, in order to develop better vaccination and therapeutic strategies for modifying protective CTL immunity. PMID:26904022
Palmer, Clovis S; Palchaudhuri, Riya; Albargy, Hassan; Abdel-Mohsen, Mohamed; Crowe, Suzanne M
2018-01-01
An emerging paradigm in immunology suggests that metabolic reprogramming and immune cell activation and functions are intricately linked. Viral infections, such as HIV infection, as well as cancer force immune cells to undergo major metabolic challenges. Cells must divert energy resources in order to mount an effective immune response. However, the fact that immune cells adopt specific metabolic programs to provide host defense against intracellular pathogens and how this metabolic shift impacts immune cell functions and the natural course of diseases have only recently been appreciated. A clearer insight into how these processes are inter-related will affect our understanding of several fundamental aspects of HIV persistence. Even in patients with long-term use of anti-retroviral therapies, HIV infection persists and continues to cause chronic immune activation and inflammation, ongoing and cumulative damage to multiple organs systems, and a reduction in life expectancy. HIV-associated fundamental changes to the metabolic machinery of the immune system can promote a state of "inflammaging", a chronic, low-grade inflammation with specific immune changes that characterize aging, and can also contribute to the persistence of HIV in its reservoirs. In this commentary, we will bring into focus evolving concepts on how HIV modulates the metabolic machinery of immune cells in order to persist in reservoirs and how metabolic reprogramming facilitates a chronic state of inflammation that underlies the development of age-related comorbidities. We will discuss how immunometabolism is facilitating the changing paradigms in HIV cure research and outline the novel therapeutic opportunities for preventing inflammaging and premature development of age-related conditions in HIV + individuals.
A key requirement for CD300f in innate immune responses of eosinophils in colitis.
Moshkovits, I; Reichman, H; Karo-Atar, D; Rozenberg, P; Zigmond, E; Haberman, Y; Ben Baruch-Morgenstern, N; Lampinen, M; Carlson, M; Itan, M; Denson, L A; Varol, C; Munitz, A
2017-01-01
Eosinophils are traditionally studied in the context of type 2 immune responses. However, recent studies highlight key innate immune functions for eosinophils especially in colonic inflammation. Surprisingly, molecular pathways regulating innate immune activities of eosinophil are largely unknown. We have recently shown that the CD300f is highly expressed by colonic eosinophils. Nonetheless, the role of CD300f in governing innate immune eosinophil activities is ill-defined. RNA sequencing of 162 pediatric Crohn's disease patients revealed upregulation of multiple Cd300 family members, which correlated with the presence of severe ulcerations and inflammation. Increased expression of CD300 family receptors was also observed in active ulcerative colitis (UC) and in mice following induction of experimental colitis. Specifically, the expression of CD300f was dynamically regulated in monocytes and eosinophils. Dextran sodium sulfate (DSS)-treated Cd300f -/- mice exhibit attenuated disease activity and histopathology in comparison with DSS-treated wild type (WT). Decreased disease activity in Cd300f -/- mice was accompanied with reduced inflammatory cell infiltration and nearly abolished production of pro-inflammatory cytokines. Monocyte depletion and chimeric bone marrow transfer experiments revealed a cell-specific requirement for CD300f in innate immune activation of eosinophils. Collectively, we uncover a new pathway regulating innate immune activities of eosinophils, a finding with significant implications in eosinophil-associated gastrointestinal diseases.
Recognition of bacterial plant pathogens: local, systemic and transgenerational immunity.
Henry, Elizabeth; Yadeta, Koste A; Coaker, Gitta
2013-09-01
Bacterial pathogens can cause multiple plant diseases and plants rely on their innate immune system to recognize and actively respond to these microbes. The plant innate immune system comprises extracellular pattern recognition receptors that recognize conserved microbial patterns and intracellular nucleotide binding leucine-rich repeat (NLR) proteins that recognize specific bacterial effectors delivered into host cells. Plants lack the adaptive immune branch present in animals, but still afford flexibility to pathogen attack through systemic and transgenerational resistance. Here, we focus on current research in plant immune responses against bacterial pathogens. Recent studies shed light onto the activation and inactivation of pattern recognition receptors and systemic acquired resistance. New research has also uncovered additional layers of complexity surrounding NLR immune receptor activation, cooperation and sub-cellular localizations. Taken together, these recent advances bring us closer to understanding the web of molecular interactions responsible for coordinating defense responses and ultimately resistance. © 2013 The Authors. New Phytologist © 2013 New Phytologist Trust.
Göbel, Kerstin; Pankratz, Susann; Asaridou, Chloi-Magdalini; Herrmann, Alexander M.; Bittner, Stefan; Merker, Monika; Ruck, Tobias; Glumm, Sarah; Langhauser, Friederike; Kraft, Peter; Krug, Thorsten F.; Breuer, Johanna; Herold, Martin; Gross, Catharina C.; Beckmann, Denise; Korb-Pap, Adelheid; Schuhmann, Michael K.; Kuerten, Stefanie; Mitroulis, Ioannis; Ruppert, Clemens; Nolte, Marc W.; Panousis, Con; Klotz, Luisa; Kehrel, Beate; Korn, Thomas; Langer, Harald F.; Pap, Thomas; Nieswandt, Bernhard; Wiendl, Heinz; Chavakis, Triantafyllos; Kleinschnitz, Christoph; Meuth, Sven G.
2016-01-01
Aberrant immune responses represent the underlying cause of central nervous system (CNS) autoimmunity, including multiple sclerosis (MS). Recent evidence implicated the crosstalk between coagulation and immunity in CNS autoimmunity. Here we identify coagulation factor XII (FXII), the initiator of the intrinsic coagulation cascade and the kallikrein–kinin system, as a specific immune cell modulator. High levels of FXII activity are present in the plasma of MS patients during relapse. Deficiency or pharmacologic blockade of FXII renders mice less susceptible to experimental autoimmune encephalomyelitis (a model of MS) and is accompanied by reduced numbers of interleukin-17A-producing T cells. Immune activation by FXII is mediated by dendritic cells in a CD87-dependent manner and involves alterations in intracellular cyclic AMP formation. Our study demonstrates that a member of the plasmatic coagulation cascade is a key mediator of autoimmunity. FXII inhibition may provide a strategy to combat MS and other immune-related disorders. PMID:27188843
Regulation of obesity-related insulin resistance with gut anti-inflammatory agents.
Luck, Helen; Tsai, Sue; Chung, Jason; Clemente-Casares, Xavier; Ghazarian, Magar; Revelo, Xavier S; Lei, Helena; Luk, Cynthia T; Shi, Sally Yu; Surendra, Anuradha; Copeland, Julia K; Ahn, Jennifer; Prescott, David; Rasmussen, Brittany A; Chng, Melissa Hui Yen; Engleman, Edgar G; Girardin, Stephen E; Lam, Tony K T; Croitoru, Kenneth; Dunn, Shannon; Philpott, Dana J; Guttman, David S; Woo, Minna; Winer, Shawn; Winer, Daniel A
2015-04-07
Obesity has reached epidemic proportions, but little is known about its influence on the intestinal immune system. Here we show that the gut immune system is altered during high-fat diet (HFD) feeding and is a functional regulator of obesity-related insulin resistance (IR) that can be exploited therapeutically. Obesity induces a chronic phenotypic pro-inflammatory shift in bowel lamina propria immune cell populations. Reduction of the gut immune system, using beta7 integrin-deficient mice (Beta7(null)), decreases HFD-induced IR. Treatment of wild-type HFD C57BL/6 mice with the local gut anti-inflammatory, 5-aminosalicyclic acid (5-ASA), reverses bowel inflammation and improves metabolic parameters. These beneficial effects are dependent on adaptive and gut immunity and are associated with reduced gut permeability and endotoxemia, decreased visceral adipose tissue inflammation, and improved antigen-specific tolerance to luminal antigens. Thus, the mucosal immune system affects multiple pathways associated with systemic IR and represents a novel therapeutic target in this disease. Copyright © 2015 Elsevier Inc. All rights reserved.
Kennedy, Richard B.; Ovsyannikova, Inna G.; Haralambieva, Iana H.; Lambert, Nathaniel D.; Pankratz, V. Shane; Poland, Gregory A.
2014-01-01
Rubella virus causes a relatively benign disease in most cases, although infection during pregnancy can result in serious birth defects. An effective vaccine has been available since the early 1970s and outbreaks typically do not occur among highly vaccinated (≥2 doses) populations. Nevertheless, considerable inter-individual variation in immune response to rubella immunization does exist, with single dose seroconversion rates ~95%. Understanding the mechanisms behind this variability may provide important insights into rubella immunity. In the current study, we examined associations between single nucleotide polymorphisms (SNPs) in selected cytokine, cytokine receptor, and innate/antiviral genes and immune responses following rubella vaccination in order to understand genetic influences on vaccine response. Our approach consisted of a discovery cohort of 887 subjects ages 11–22 at the time of enrollment and a replication cohort of 542 older adolescents and young adults (ages 18–40). Our data indicate that SNPs near the butyrophilin genes (BTN3A3/BTN2A1) and cytokine receptors (IL10RB/IFNAR1) are associated with variations in IFNγ secretion and that multiple SNPs in the PVR gene, as well as SNPs located in the ADAR gene, exhibit significant associations with rubella virus-specific IL-6 secretion. This information may be useful, not only in furthering our understanding immune responses to rubella vaccine, but also in identifying key pathways for targeted adjuvant use to boost immunity in those with weak or absent immunity following vaccination. PMID:25098560
Kennedy, Richard B; Ovsyannikova, Inna G; Haralambieva, Iana H; Lambert, Nathaniel D; Pankratz, V Shane; Poland, Gregory A
2014-11-01
Rubella virus causes a relatively benign disease in most cases, although infection during pregnancy can result in serious birth defects. An effective vaccine has been available since the early 1970s and outbreaks typically do not occur among highly vaccinated (≥2 doses) populations. Nevertheless, considerable inter-individual variation in immune response to rubella immunization does exist, with single-dose seroconversion rates ~95 %. Understanding the mechanisms behind this variability may provide important insights into rubella immunity. In the current study, we examined associations between single nucleotide polymorphisms (SNPs) in selected cytokine, cytokine receptor, and innate/antiviral genes and immune responses following rubella vaccination in order to understand genetic influences on vaccine response. Our approach consisted of a discovery cohort of 887 subjects aged 11-22 at the time of enrollment and a replication cohort of 542 older adolescents and young adults (age 18-40). Our data indicate that SNPs near the butyrophilin genes (BTN3A3/BTN2A1) and cytokine receptors (IL10RB/IFNAR1) are associated with variations in IFNγ secretion and that multiple SNPs in the PVR gene, as well as SNPs located in the ADAR gene, exhibit significant associations with rubella virus-specific IL-6 secretion. This information may be useful, not only in furthering our understanding immune responses to rubella vaccine, but also in identifying key pathways for targeted adjuvant use to boost immunity in those with weak or absent immunity following vaccination.
Current multiple sclerosis treatments have improved our understanding of MS autoimmune pathogenesis.
Martin, Roland; Sospedra, Mireia; Rosito, Maria; Engelhardt, Britta
2016-09-01
Multiple sclerosis (MS) is the most common inflammatory disorder of the central nervous system (CNS) in young adults. When MS is not treated, it leads to irreversible and severe disability. The etiology of MS and its pathogenesis are not fully understood. The recent discovery that MS-associated genetic variants code for molecules related to the function of specific immune cell subsets is consistent with the concept of MS as a prototypic, T-cell-mediated autoimmune disease targeting the CNS. While the therapeutic efficacy of the currently available immunomodulatory therapies further strengthen this concept, differences observed in responses to MS treatment as well as additional clinical and imaging observations have also shown that the autoimmune pathogenesis underlying MS is much more complex than previously thought. There is therefore an unmet need for continued detailed phenotypic and functional analysis of disease-relevant adaptive immune cells and tissues directly derived from MS patients to unravel the immune etiology of MS in its entire complexity. In this review, we will discuss the currently available MS treatment options and approved drugs, including how they have contributed to the understanding of the immune pathology of this autoimmune disease. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Fonseca, Adriana Barbosa de Lima; Simon, Marise do Vale; Cazzaniga, Rodrigo Anselmo; de Moura, Tatiana Rodrigues; de Almeida, Roque Pacheco; Duthie, Malcolm S; Reed, Steven G; de Jesus, Amelia Ribeiro
2017-02-06
Leprosy is a chronic infectious disease caused by Mycobacterium leprae. According to official reports from 121 countries across five WHO regions, there were 213 899 newly diagnosed cases in 2014. Although leprosy affects the skin and peripheral nerves, it can present across a spectrum of clinical and histopathological forms that are strongly influenced by the immune response of the infected individuals. These forms comprise the extremes of tuberculoid leprosy (TT), with a M. leprae-specific Th1, but also a Th17, response that limits M. leprae multiplication, through to lepromatous leprosy (LL), with M. leprae-specific Th2 and T regulatory responses that do not control M. leprae replication but rather allow bacterial dissemination. The interpolar borderline clinical forms present with similar, but less extreme, immune biases. Acute inflammatory episodes, known as leprosy reactions, are complications that may occur before, during or after treatment, and cause further neurological damages that can cause irreversible chronic disabilities. This review discusses the innate and adaptive immune responses, and their interactions, that are known to affect pathogenesis and influence the clinical outcome of leprosy.
Maternal Milk T Cells Drive Development of Transgenerational Th1 Immunity in Offspring Thymus.
Ghosh, Mrinal K; Nguyen, Virginia; Muller, H Konrad; Walker, Ameae M
2016-09-15
Using multiple murine foster-nursing protocols, thereby eliminating placental transfer and allowing a distinction between dam- and pup-derived cells, we show that foster nursing by an immunized dam results in development of CD8(+) T cells in nonimmunized foster pups that are specific for Ags against which the foster dam was immunized (Mycobacterium tuberculosis or Candida albicans). We have dubbed this process "maternal educational immunity" to distinguish it from passive cellular immunity. Of the variety of maternal immune cells present in milk, only T cells were detected in pup tissues. Maternal T cells, a substantial percentage of which were CD4(+)MHC class II(+), accumulated in the pup thymus and spleen during the nursing period. Further analysis of maternal cells in the pup thymus showed that a proportion was positive for maternal immunogen-specific MHC class II tetramers. To determine the outcome of Ag presentation in the thymus, the maternal or foster pup origin of immunogen-responding CD8(+) cells in foster pup spleens was assessed. Whereas ∼10% were maternally derived in the first few weeks after weaning, all immunogen-responding CD8(+) T cells were pup derived by 12 wk of age. Pup-derived immunogen-responsive CD8(+) cells persisted until at least 1 y of age. Passive cellular immunity is well accepted and has been demonstrated in the human population. In this study, we show an arguably more important role for transferred immune cells: the direction of offspring T cell development. Harnessing maternal educational immunity through prepregnancy immunization programs has potential for improvement of infant immunity. Copyright © 2016 by The American Association of Immunologists, Inc.
'Order from disorder sprung': recognition and regulation in the immune system
NASA Astrophysics Data System (ADS)
Mak, Tak W.
2003-06-01
Milton's epic poem Paradise lost supplies a colourful metaphor for the immune system and its responses to pathogens. With the role of Satan played by pathogens seeking to destroy the paradise of human health, GOD intervenes and imposes order out of chaos. In this context, GOD means 'generation of diversity': the capacity of the innate and specific immune responses to recognize and eliminate a universe of pathogens. Thus, the immune system can be thought of as an entity that self-assembles the elements required to combat bodily invasion and injury. In so doing, it brings to bear the power of specific recognition: the ability to distinguish self from non-self, and the threatening from the benign. This ability to define and protect self is evolutionarily very old. Self-recognition and biochemical and barrier defences can be detected in primitive organisms, and elements of these mechanisms are built upon in an orderly way to establish the mammalian immune system. Innate immune responses depend on the use of a limited number of germline-encoded receptors to recognize conserved molecular patterns that occur on the surfaces of a broad range of pathogens. The B and T lymphocytes of the specific immune response use complex gene-rearrangement machinery to generate a diversity of antigen receptors capable of recognizing any pathogen in the universe. Binding to receptors on both innate and specific immune-system cells triggers intricate intracellular signalling pathways that lead to new gene transcription and effector-cell activation. And yet, regulation is imposed on these responses so that Paradise is not lost to the turning of the immune system onto self-tissues, the spectre of autoimmunity. Lymphocyte activation requires multiple signals and intercellular interactions. Mechanisms exist to establish tolerance to self by the selection and elimination of cells recognizing self-antigens. Immune system cell populations are reduced by programmed cell death once the pathogen threat is resolved. Once Paradise has been regained, memory cells remain in the body to sharply reduce the impact of a second exposure to a pathogen. Vaccination programs take advantage of this capacity of the human immune system for immunological memory, sparing millions the suffering associated with disease scourges. Thus does the order of the immune response spring from the disorder of pathogen attacks, and thus is Paradise preserved.
'Order from disorder sprung': recognition and regulation in the immune system.
Mak, Tak W
2003-06-15
Milton's epic poem Paradise lost supplies a colourful metaphor for the immune system and its responses to pathogens. With the role of Satan played by pathogens seeking to destroy the paradise of human health, GOD intervenes and imposes order out of chaos. In this context, GOD means 'generation of diversity': the capacity of the innate and specific immune responses to recognize and eliminate a universe of pathogens. Thus, the immune system can be thought of as an entity that self-assembles the elements required to combat bodily invasion and injury. In so doing, it brings to bear the power of specific recognition: the ability to distinguish self from non-self, and the threatening from the benign. This ability to define and protect self is evolutionarily very old. Self-recognition and biochemical and barrier defences can be detected in primitive organisms, and elements of these mechanisms are built upon in an orderly way to establish the mammalian immune system. Innate immune responses depend on the use of a limited number of germline-encoded receptors to recognize conserved molecular patterns that occur on the surfaces of a broad range of pathogens. The B and T lymphocytes of the specific immune response use complex gene-rearrangement machinery to generate a diversity of antigen receptors capable of recognizing any pathogen in the universe. Binding to receptors on both innate and specific immune-system cells triggers intricate intracellular signalling pathways that lead to new gene transcription and effector-cell activation. And yet, regulation is imposed on these responses so that Paradise is not lost to the turning of the immune system onto self-tissues, the spectre of autoimmunity. Lymphocyte activation requires multiple signals and intercellular interactions. Mechanisms exist to establish tolerance to self by the selection and elimination of cells recognizing self-antigens. Immune system cell populations are reduced by programmed cell death once the pathogen threat is resolved. Once Paradise has been regained, memory cells remain in the body to sharply reduce the impact of a second exposure to a pathogen. Vaccination programs take advantage of this capacity of the human immune system for immunological memory, sparing millions the suffering associated with disease scourges. Thus does the order of the immune response spring from the disorder of pathogen attacks, and thus is Paradise preserved.
Bonin, Serena; Zanotta, Nunzia; Sartori, Arianna; Bratina, Alessio; Manganotti, Paolo; Trevisan, Giusto; Comar, Manola
2018-02-01
Cerebrospinal fluid (CSF) analysis in patients with particular neurologic disorders is a powerful tool to evaluate specific central nervous system inflammatory markers for diagnostic needs, because CSF represents the specific immune micro-environment to the central nervous system. CSF samples from 49 patients with multiple sclerosis (MS), chronic inflammatory demyelinating polyneuropathy (CIDP), and non-inflammatory neurologic disorders (NIND) as controls were submitted to protein expression profiles of 47 inflammatory biomarkers by multiplex Luminex bead assay to investigate possible differences in the inflammatory process for MS and CIDP. Our results showed differences in CSF cytokine levels in MS and CIDP; in particular, IL12 (p40) was significantly highly expressed in MS in comparison with CIDP and NIND, while SDF-1α and SCGF-β were significantly highly expressed in CIDP cohort when compared to MS and NIND. IL-9, IL-13, and IL-17 had higher expression levels in NIND if compared with the other groups. Our study showed that, despite some common pathogenic mechanisms, central and peripheral nervous system demyelinating diseases, such as MS and CIDP, differ in some specific inflammatory soluble proteins in CSF, underlining differences in the immune response involved in those autoimmune diseases.
Yersinia pestis targets neutrophils via complement receptor 3
Merritt, Peter M.; Nero, Thomas; Bohman, Lesley; Felek, Suleyman; Krukonis, Eric S.; Marketon, Melanie M.
2015-01-01
Yersinia species display a tropism for lymphoid tissues during infection, and the bacteria select innate immune cells for delivery of cytotoxic effectors by the type III secretion system. Yet the mechanism for target cell selection remains a mystery. Here we investigate the interaction of Yersinia pestis with murine splenocytes to identify factors that participate in the targeting process. We find that interactions with primary immune cells rely on multiple factors. First, the bacterial adhesin Ail is required for efficient targeting of neutrophils in vivo. However, Ail does not appear to directly mediate binding to a specific cell type. Instead, we find that host serum factors direct Y. pestis to specific innate immune cells, particularly neutrophils. Importantly, specificity towards neutrophils was increased in the absence of bacterial adhesins due to reduced targeting of other cell types, but this phenotype was only visible in the presence of mouse serum. Addition of antibodies against complement receptor 3 and CD14 blocked target cell selection, suggesting that a combination of host factors participate in steering bacteria toward neutrophils during plague infection. PMID:25359083
Immunotherapy with myeloid cells for tolerance induction
Rodriguez-García, Mercedes; Boros, Peter; Bromberg, Jonathan S.; Ochando, Jordi C.
2013-01-01
Purpose of review Understanding the interplay between myeloid dendritic cells and T cells under tolerogenic conditions, and whether their interactions induce the development of antigen-specific regulatory T cells (Tregs) is critical to uncover the mechanisms involved in the induction of indefinite allograft survival. Recent findings Myeloid dendritic cell–T-cell interactions are seminal events that determine the outcome of the immune response, and multiple in-vitro protocols suggest the generation of tolerogenic myeloid dendritic cells that modulate T-cell responses, and determine the outcome of the immune response to an allograft following adoptive transfer. We believe that identifying specific conditions that lead to the generation of tolerogenic myeloid dendritic cells and Tregs are critical for the manipulation the immune response towards the development of transplantation tolerance. Summary We summarize recent findings regarding specific culture conditions that generate tolerogenic myeloid dendritic cells that induce T-cell hyporesponsiveness and Treg development, and represents a novel immunotherapeutic approach to promote the induction of indefinite graft survival prolongation. The interpretations presented here illustrate that different mechanisms govern the generation tolerogenic myeloid dendritic cells, and we discuss the concomitant therapeutic implications. PMID:20616727
NASA Technical Reports Server (NTRS)
Knisley, Keith A.; Rodkey, L. Scott
1988-01-01
Serum was collected from rabbits at 2-day intervals following a single injection with tetanus toxoid or at weekly intervals following multiple injections with Micrococcus lysodeikticus cell walls. These sera were analyzed for the presence of individual clonotypes of specific antitetanus or antimicrococcal antibodies by isoelectric focusing in immobilized pH gradients with added carrier ampholytes followed by affinity immunoblotting. The affinity immunoblots obtained clearly defined both the rapid disappearance and late appearance of distinct subsets of antibody clonotypes during the response. These data demonstrate the application of affinity immunoblotting combined with immobilized pH gradients for detecting the subtle changes in specific antibody clonotype patterns which occur during an immune response.
Impaired humoral immunity and tolerance in K14-VEGFR-3-Ig mice that lack dermal lymphatic drainage
Thomas, Susan N.; Rutkowski, Joseph M.; Pasquier, Miriella; Kuan, Emma L.; Alitalo, Kari; Randolph, Gwendalyn J.; Swartz, Melody A.
2012-01-01
Lymphatic vessels transport interstitial fluid, soluble antigen, and immune cells from peripheral tissues to lymph nodes (LNs), yet the contribution of peripheral lymphatic drainage to adaptive immunity remains poorly understood. We examined immune responses to dermal vaccination and contact hypersensitivity (CHS) challenge in K14-VEGFR-3-Ig mice, which lack dermal lymphatic capillaries and experience markedly depressed transport of solutes and dendritic cells from the skin to draining LNs. In response to dermal immunization, K14-VEGFR-3-Ig mice produced lower antibody titers. In contrast, although delayed, T cell responses were robust after 21 days, including high levels of antigen-specific CD8+ T cells and production of IFN-γ, IL-4 and IL-10 upon restimulation. T cell-mediated CHS responses were strong in K14-VEGFR-3-Ig mice, but importantly, their ability to induce CHS tolerance in the skin was impaired. Additionally, one-year-old mice displayed multiple signs of autoimmunity. These data suggest that lymphatic drainage plays more important roles in regulating humoral immunity and peripheral tolerance than in effector T cell immunity. PMID:22844119
Zilkha-Falb, Rina; Yosef-Hemo, Reut; Cohen, Lydia; Ben-Nun, Avraham
2011-01-01
Antigen-induced peripheral tolerance is potentially one of the most efficient and specific therapeutic approaches for autoimmune diseases. Although highly effective in animal models, antigen-based strategies have not yet been translated into practicable human therapy, and several clinical trials using a single antigen or peptidic-epitope in multiple sclerosis (MS) yielded disappointing results. In these clinical trials, however, the apparent complexity and dynamics of the pathogenic autoimmunity associated with MS, which result from the multiplicity of potential target antigens and “epitope spread”, have not been sufficiently considered. Thus, targeting pathogenic T-cells reactive against a single antigen/epitope is unlikely to be sufficient; to be effective, immunospecific therapy to MS should logically neutralize concomitantly T-cells reactive against as many major target antigens/epitopes as possible. We investigated such “multi-epitope-targeting” approach in murine experimental autoimmune encephalomyelitis (EAE) associated with a single (“classical”) or multiple (“complex”) anti-myelin autoreactivities, using cocktail of different encephalitogenic peptides vis-a-vis artificial multi-epitope-protein (designated Y-MSPc) encompassing rationally selected MS-relevant epitopes of five major myelin antigens, as “multi-epitope-targeting” agents. Y-MSPc was superior to peptide(s) in concomitantly downregulating pathogenic T-cells reactive against multiple myelin antigens/epitopes, via inducing more effective, longer lasting peripheral regulatory mechanisms (cytokine shift, anergy, and Foxp3+ CTLA4+ regulatory T-cells). Y-MSPc was also consistently more effective than the disease-inducing single peptide or peptide cocktail, not only in suppressing the development of “classical” or “complex EAE” or ameliorating ongoing disease, but most importantly, in reversing chronic EAE. Overall, our data emphasize that a “multi-epitope-targeting” strategy is required for effective immune-specific therapy of organ-specific autoimmune diseases associated with complex and dynamic pathogenic autoimmunity, such as MS; our data further demonstrate that the “multi-epitope-targeting” approach to therapy is optimized through specifically designed multi-epitope-proteins, rather than myelin peptide cocktails, as “multi-epitope-targeting” agents. Such artificial multi-epitope proteins can be tailored to other organ-specific autoimmune diseases. PMID:22140475
Chuan, Yap P; Rivera-Hernandez, Tania; Wibowo, Nani; Connors, Natalie K; Wu, Yang; Hughes, Fiona K; Lua, Linda H L; Middelberg, Anton P J
2013-09-01
Modularization of a peptide antigen for presentation on a microbially synthesized murine polyomavirus (MuPyV) virus-like particle (VLP) offers a new alternative for rapid and low-cost vaccine delivery at a global scale. In this approach, heterologous modules containing peptide antigenic elements are fused to and displayed on the VLP carrier, allowing enhancement of peptide immunogenicity via ordered and densely repeated presentation of the modules. This study addresses two key engineering questions pertaining to this platform, exploring the effects of (i) pre-existing carrier-specific immunity on modular VLP vaccine effectiveness and (ii) increase in the antigenic element number per VLP on peptide-specific immune response. These effects were studied in a mouse model and with modular MuPyV VLPs presenting a group A streptococcus (GAS) peptide antigen, J8i. The data presented here demonstrate that immunization with a modular VLP could induce high levels of J8i-specific antibodies despite a strong pre-existing anti-carrier immune response. Doubling of the J8i antigenic element number per VLP did not enhance J8i immunogenicity at a constant peptide dose. However, the strategy, when used in conjunction with increased VLP dose, could effectively increase the peptide dose up to 10-fold, leading to a significantly higher J8i-specific antibody titer. This study further supports feasibility of the MuPyV modular VLP vaccine platform by showing that, in the absence of adjuvant, modularized GAS antigenic peptide at a dose as low as 150 ng was sufficient to raise a high level of peptide-specific IgGs indicative of bactericidal activity. Copyright © 2013 Wiley Periodicals, Inc.
Engineering vaccines and niches for immune modulation.
Purwada, Alberto; Roy, Krishnendu; Singh, Ankur
2014-04-01
Controlled modulation of immune response, especially the balance between immunostimulatory and immunosuppressive responses, is critical for a variety of clinical applications, including immunotherapies against cancer and infectious diseases, treatment of autoimmune disorders, transplant surgeries, regenerative medicine, prosthetic implants, etc. Our ability to precisely modify both innate and adaptive immune responses could provide new therapeutic directions in a variety of diseases. In the context of vaccines and immunotherapies, the interplay between antigen-presenting cells (e.g. dendritic cells and macrophages), B cells, T helper and killer subtypes, and regulatory T- and B-cell responses is critical for generating effective immunity against cancer, infectious diseases and autoimmune diseases. In recent years, immunoengineering has emerged as a new field that uses quantitative engineering tools to understand molecular-, cellular- and system-level interactions of the immune system and to develop design-driven approaches to control and modulate immune responses. Biomaterials are an integral part of this engineering toolbox and can exploit the intrinsic biological and mechanical cues of the immune system to directly modulate and train immune cells and direct their response to a particular phenotype. A large body of literature exists on strategies to evade or suppress the immune response in implants, transplantation and regenerative medicine. This review specifically focuses on the use of biomaterials for immunostimulation and controlled modulation, especially in the context of vaccines and immunotherapies against cancer, infectious diseases and autoimmune disorders. Bioengineering smart systems that can simultaneously deliver multiple bioactive agents in a controlled manner or can work as a niche for in situ priming and modulation of the immune system could significantly enhance the efficacy of next-generation immunotherapeutics. In this review, we describe our perspective on the important design aspects for the development of biomaterials that can actively modulate immune responses by stimulating receptor complexes and cells, and delivering multiple immunomodulatory biomolecules. Copyright © 2013 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.
Oscherwitz, Jon; Yu, Fen; Cease, Kemp B
2010-09-15
The current vaccines for anthrax in the United States and United Kingdom are efficacious in the two most accepted animal models of inhalation anthrax, nonhuman primates and rabbits, but require extensive immunization protocols. We previously demonstrated that a linear determinant in domain 2 of Bacillus anthracis protective Ag (PA) is a potentially important target for an epitope-specific vaccine for anthrax, as Abs specific for this site, referred to as the loop-neutralizing determinant (LND), neutralize lethal toxin in vitro, yet are virtually absent in PA-immunized rabbits. In this study, we evaluated the immunogenicity and protective efficacy in rabbits of multiple antigenic peptides (MAPs) consisting of aa 304-319 from the LND of PA colinearly synthesized at the C terminus (T-B MAP) or N terminus (B-T MAP) with a heterologous T cell epitope from Plasmodium falciparum. Immunogenicity studies demonstrated that both MAPs elicited toxin-neutralizing Ab in rabbits. To evaluate the MAPs as potential anthrax vaccines, we immunized groups of rabbits (n = 7) with each MAP in Freund's adjuvant and then exposed all rabbits to a 200-LD(50) challenge with aerosolized spores of B. anthracis Ames strain. All seven rabbits immunized with the B-T MAP and 89% (six of seven) of rabbits immunized with the T-B MAP survived the spore challenge. Corollary studies with reference sera from human vaccinees immunized with rPA or anthrax vaccine absorbed and nonhuman primates immunized with PA revealed no detectable Ab with specificity for the LND. We conclude that a synthetic peptide vaccine targeting the LND would be a potentially efficacious vaccine for anthrax.
How do immune cells support and shape the brain in health, disease, and aging?
Schwartz, Michal; Kipnis, Jonathan; Rivest, Serge; Prat, Alexandre
2013-11-06
For decades, several axioms have prevailed with respect to the relationships between the CNS and circulating immune cells. Specifically, immune cell entry was largely considered to be pathological or to mark the beginning of pathology within the brain. Moreover, local inflammation associated with neurodegenerative diseases such Alzheimer's disease or amyotrophic lateral sclerosis, were considered similar in their etiology to inflammatory diseases, such as remitting relapsing-multiple sclerosis. The ensuing confusion reflected a lack of awareness that the etiology of the disease as well as the origin of the immune cells determines the nature of the inflammatory response, and that inflammation resolution is an active cellular process. The last two decades have seen a revolution in these prevailing dogmas, with a significant contribution made by the authors. Microglia and infiltrating monocyte-derived macrophages are now known to be functionally distinct and of separate origin. Innate and adaptive immune cells are now known to have protective/healing properties in the CNS, as long as their activity is regulated, and their recruitment is well controlled; their role is appreciated in maintenance of brain plasticity in health, aging, and chronic neurodevelopmental and neurodegenerative diseases. Moreover, it is now understood that the barriers of the brain are not uniform in their interactions with the circulating immune cells. The implications of these new findings to the basic understanding of CNS repair processes, brain aging, and a wide spectrum of CNS disorders, including acute injuries, Rett syndrome, Alzheimer's disease, and multiple sclerosis, will be discussed.
Local and systemic tumor immune dynamics
NASA Astrophysics Data System (ADS)
Enderling, Heiko
Tumor-associated antigens, stress proteins, and danger-associated molecular patterns are endogenous immune adjuvants that can both initiate and continually stimulate an immune response against a tumor. In retaliation, tumors can hijack intrinsic immune regulatory programs that are intended to prevent autoimmune disease, thereby facilitating continued growth despite the activated antitumor immune response. In metastatic disease, this ongoing tumor-immune battle occurs at each site. Adding an additional layer of complexity, T cells activated at one tumor site can cycle through the blood circulation system and extravasate in a different anatomic location to surveil a distant metastasis. We propose a mathematical modeling framework that incorporates the trafficking of activated T cells between metastatic sites. We extend an ordinary differential equation model of tumor-immune system interactions to multiple metastatic sites. Immune cells are activated in response to tumor burden and tumor cell death, and are recruited from tumor sites elsewhere in the body. A model of T cell trafficking throughout the circulatory system can inform the tumor-immune interaction model about the systemic distribution and arrival of T cells at specific tumor sites. Model simulations suggest that metastases not only contribute to immune surveillance, but also that this contribution varies between metastatic sites. Such information may ultimately help harness the synergy of focal therapy with the immune system to control metastatic disease.
Ascough, Stephanie; Ingram, Rebecca J.; Chu, Karen K.; Reynolds, Catherine J.; Musson, Julie A.; Doganay, Mehmet; Metan, Gökhan; Ozkul, Yusuf; Baillie, Les; Sriskandan, Shiranee; Moore, Stephen J.; Gallagher, Theresa B.; Dyson, Hugh; Williamson, E. Diane; Robinson, John H.; Maillere, Bernard; Boyton, Rosemary J.; Altmann, Daniel M.
2014-01-01
Bacillus anthracis produces a binary toxin composed of protective antigen (PA) and one of two subunits, lethal factor (LF) or edema factor (EF). Most studies have concentrated on induction of toxin-specific antibodies as the correlate of protective immunity, in contrast to which understanding of cellular immunity to these toxins and its impact on infection is limited. We characterized CD4+ T cell immunity to LF in a panel of humanized HLA-DR and DQ transgenic mice and in naturally exposed patients. As the variation in antigen presentation governed by HLA polymorphism has a major impact on protective immunity to specific epitopes, we examined relative binding affinities of LF peptides to purified HLA class II molecules, identifying those regions likely to be of broad applicability to human immune studies through their ability to bind multiple alleles. Transgenics differing only in their expression of human HLA class II alleles showed a marked hierarchy of immunity to LF. Immunogenicity in HLA transgenics was primarily restricted to epitopes from domains II and IV of LF and promiscuous, dominant epitopes, common to all HLA types, were identified in domain II. The relevance of this model was further demonstrated by the fact that a number of the immunodominant epitopes identified in mice were recognized by T cells from humans previously infected with cutaneous anthrax and from vaccinated individuals. The ability of the identified epitopes to confer protective immunity was demonstrated by lethal anthrax challenge of HLA transgenic mice immunized with a peptide subunit vaccine comprising the immunodominant epitopes that we identified. PMID:24788397
Au, Bryan C; Lee, Chyan-Jang; Lopez-Perez, Orlay; Foltz, Warren; Felizardo, Tania C; Wang, James C M; Huang, Ju; Fan, Xin; Madden, Melissa; Goldstein, Alyssa; Jaffray, David A; Moloo, Badru; McCart, J Andrea; Medin, Jeffrey A
2016-02-19
Anti-cancer immunotherapy is emerging from a nadir and demonstrating tangible benefits to patients. A variety of approaches are now employed. We are invoking antigen (Ag)-specific responses through direct injections of recombinant lentivectors (LVs) that encode sequences for tumor-associated antigens into multiple lymph nodes to optimize immune presentation/stimulation. Here we first demonstrate the effectiveness and antigen-specificity of this approach in mice challenged with prostate-specific antigen (PSA)-expressing tumor cells. Next we tested the safety and efficacy of this approach in two cohorts of rhesus macaques as a prelude to a clinical trial application. Our vector encodes the cDNA for rhesus macaque PSA and a rhesus macaque cell surface marker to facilitate vector titering and tracking. We utilized two independent injection schemas demarcated by the timing of LV administration. In both cohorts we observed marked tissue-specific responses as measured by clinical evaluations and magnetic resonance imaging of the prostate gland. Tissue-specific responses were sustained for up to six months-the end-point of the study. Control animals immunized against an irrelevant Ag were unaffected. We did not observe vector spread in test or control animals or perturbations of systemic immune parameters. This approach thus offers an "off-the-shelf" anti-cancer vaccine that could be made at large scale and injected into patients-even on an out-patient basis.
Geisbert, Joan B; Shedlock, Devon J; Xu, Ling; Lamoreaux, Laurie; Custers, Jerome H. H. V; Popernack, Paul M; Yang, Zhi-Yong; Pau, Maria G; Roederer, Mario; Koup, Richard A; Goudsmit, Jaap; Jahrling, Peter B; Nabel, Gary J
2006-01-01
Background Ebola virus causes a hemorrhagic fever syndrome that is associated with high mortality in humans. In the absence of effective therapies for Ebola virus infection, the development of a vaccine becomes an important strategy to contain outbreaks. Immunization with DNA and/or replication-defective adenoviral vectors (rAd) encoding the Ebola glycoprotein (GP) and nucleoprotein (NP) has been previously shown to confer specific protective immunity in nonhuman primates. GP can exert cytopathic effects on transfected cells in vitro, and multiple GP forms have been identified in nature, raising the question of which would be optimal for a human vaccine. Methods and Findings To address this question, we have explored the efficacy of mutant GPs from multiple Ebola virus strains with reduced in vitro cytopathicity and analyzed their protective effects in the primate challenge model, with or without NP. Deletion of the GP transmembrane domain eliminated in vitro cytopathicity but reduced its protective efficacy by at least one order of magnitude. In contrast, a point mutation was identified that abolished this cytopathicity but retained immunogenicity and conferred immune protection in the absence of NP. The minimal effective rAd dose was established at 1010 particles, two logs lower than that used previously. Conclusions Expression of specific GPs alone vectored by rAd are sufficient to confer protection against lethal challenge in a relevant nonhuman primate model. Elimination of NP from the vaccine and dose reductions to 1010 rAd particles do not diminish protection and simplify the vaccine, providing the basis for selection of a human vaccine candidate. PMID:16683867
Immunosurveillance and therapy of multiple myeloma are CD226 dependent
Guillerey, Camille; Ferrari de Andrade, Lucas; Vuckovic, Slavica; Miles, Kim; Ngiow, Shin Foong; Yong, Michelle C.R.; Teng, Michele W.L.; Colonna, Marco; Ritchie, David S.; Chesi, Martha; Bergsagel, P. Leif; Hill, Geoffrey R.; Smyth, Mark J.; Martinet, Ludovic
2015-01-01
Multiple myeloma (MM) is an age-dependent hematological malignancy. Evaluation of immune interactions that drive MM relies on in vitro experiments that do not reflect the complex cellular stroma involved in MM pathogenesis. Here we used Vk*MYC transgenic mice, which spontaneously develop MM, and demonstrated that the immune system plays a critical role in the control of MM progression and the response to treatment. We monitored Vk*MYC mice that had been crossed with Cd226 mutant mice over a period of 3 years and found that CD226 limits spontaneous MM development. The CD226-dependent anti-myeloma immune response against transplanted Vk*MYC MM cells was mediated both by NK and CD8+ T cells through perforin and IFN-γ pathways. Moreover, CD226 expression was required for optimal antimyeloma efficacy of cyclophosphamide (CTX) and bortezomib (Btz), which are both standardly used to manage MM in patients. Activation of costimulatory receptor CD137 with mAb (4-1BB) exerted strong antimyeloma activity, while inhibition of coinhibitory receptors PD-1 and CTLA-4 had no effect. Taken together, the results of this study provide in vivo evidence that CD226 is important for MM immunosurveillance and indicate that specific immune components should be targeted for optimal MM treatment efficacy. As progressive immunosuppression associates with MM development, strategies aimed to increase immune functions may have important therapeutic implications in MM. PMID:25893601
Morris, Gerwyn; Stubbs, Brendon; Köhler, Cristiano A; Walder, Ken; Slyepchenko, Anastasiya; Berk, Michael; Carvalho, André F
2018-04-04
Sleep and circadian abnormalities are prevalent and burdensome manifestations of diverse neuro-immune diseases, and may aggravate the course of several neuropsychiatric disorders. The underlying pathophysiology of sleep abnormalities across neuropsychiatric disorders remains unclear, and may involve the inter-play of several clinical variables and mechanistic pathways. In this review, we propose a heuristic framework in which reciprocal interactions of immune, oxidative and nitrosative stress, and mitochondrial pathways may drive sleep abnormalities across potentially neuroprogressive disorders. Specifically, it is proposed that systemic inflammation may activate microglial cells and astrocytes in brain regions involved in sleep and circadian regulation. Activated glial cells may secrete pro-inflammatory cytokines (for example, interleukin-1 beta and tumour necrosis factor alpha), nitric oxide and gliotransmitters, which may influence the expression of key circadian regulators (e.g., the Circadian Locomotor Output Cycles Kaput (CLOCK) gene). Furthermore, sleep disruption may further aggravate oxidative and nitrosative, peripheral immune activation, and (neuro) inflammation across these disorders in a vicious pathophysiological loop. This review will focus on chronic fatigue syndrome, bipolar disorder, and multiple sclerosis as exemplars of neuro-immune disorders. We conclude that novel therapeutic targets exploring immune and oxidative & nitrosative pathways (p.e. melatonin and molecular hydrogen) hold promise in alleviating sleep and circadian dysfunction in these disorders. Copyright © 2018 Elsevier Ltd. All rights reserved.
Overexpression of the Cytokine BAFF and Autoimmunity Risk.
Steri, Maristella; Orrù, Valeria; Idda, M Laura; Pitzalis, Maristella; Pala, Mauro; Zara, Ilenia; Sidore, Carlo; Faà, Valeria; Floris, Matteo; Deiana, Manila; Asunis, Isadora; Porcu, Eleonora; Mulas, Antonella; Piras, Maria G; Lobina, Monia; Lai, Sandra; Marongiu, Mara; Serra, Valentina; Marongiu, Michele; Sole, Gabriella; Busonero, Fabio; Maschio, Andrea; Cusano, Roberto; Cuccuru, Gianmauro; Deidda, Francesca; Poddie, Fausto; Farina, Gabriele; Dei, Mariano; Virdis, Francesca; Olla, Stefania; Satta, Maria A; Pani, Mario; Delitala, Alessandro; Cocco, Eleonora; Frau, Jessica; Coghe, Giancarlo; Lorefice, Lorena; Fenu, Giuseppe; Ferrigno, Paola; Ban, Maria; Barizzone, Nadia; Leone, Maurizio; Guerini, Franca R; Piga, Matteo; Firinu, Davide; Kockum, Ingrid; Lima Bomfim, Izaura; Olsson, Tomas; Alfredsson, Lars; Suarez, Ana; Carreira, Patricia E; Castillo-Palma, Maria J; Marcus, Joseph H; Congia, Mauro; Angius, Andrea; Melis, Maurizio; Gonzalez, Antonio; Alarcón Riquelme, Marta E; da Silva, Berta M; Marchini, Maurizio; Danieli, Maria G; Del Giacco, Stefano; Mathieu, Alessandro; Pani, Antonello; Montgomery, Stephen B; Rosati, Giulio; Hillert, Jan; Sawcer, Stephen; D'Alfonso, Sandra; Todd, John A; Novembre, John; Abecasis, Gonçalo R; Whalen, Michael B; Marrosu, Maria G; Meloni, Alessandra; Sanna, Serena; Gorospe, Myriam; Schlessinger, David; Fiorillo, Edoardo; Zoledziewska, Magdalena; Cucca, Francesco
2017-04-27
Genomewide association studies of autoimmune diseases have mapped hundreds of susceptibility regions in the genome. However, only for a few association signals has the causal gene been identified, and for even fewer have the causal variant and underlying mechanism been defined. Coincident associations of DNA variants affecting both the risk of autoimmune disease and quantitative immune variables provide an informative route to explore disease mechanisms and drug-targetable pathways. Using case-control samples from Sardinia, Italy, we performed a genomewide association study in multiple sclerosis followed by TNFSF13B locus-specific association testing in systemic lupus erythematosus (SLE). Extensive phenotyping of quantitative immune variables, sequence-based fine mapping, cross-population and cross-phenotype analyses, and gene-expression studies were used to identify the causal variant and elucidate its mechanism of action. Signatures of positive selection were also investigated. A variant in TNFSF13B, encoding the cytokine and drug target B-cell activating factor (BAFF), was associated with multiple sclerosis as well as SLE. The disease-risk allele was also associated with up-regulated humoral immunity through increased levels of soluble BAFF, B lymphocytes, and immunoglobulins. The causal variant was identified: an insertion-deletion variant, GCTGT→A (in which A is the risk allele), yielded a shorter transcript that escaped microRNA inhibition and increased production of soluble BAFF, which in turn up-regulated humoral immunity. Population genetic signatures indicated that this autoimmunity variant has been evolutionarily advantageous, most likely by augmenting resistance to malaria. A TNFSF13B variant was associated with multiple sclerosis and SLE, and its effects were clarified at the population, cellular, and molecular levels. (Funded by the Italian Foundation for Multiple Sclerosis and others.).
Carey, John B; Vrdoljak, Anto; O'Mahony, Conor; Hill, Adrian V S; Draper, Simon J; Moore, Anne C
2014-08-21
Substantial effort has been placed in developing efficacious recombinant attenuated adenovirus-based vaccines. However induction of immunity to the vector is a significant obstacle to its repeated use. Here we demonstrate that skin-based delivery of an adenovirus-based malaria vaccine, HAdV5-PyMSP1₄₂, to mice using silicon microneedles induces equivalent or enhanced antibody responses to the encoded antigen, however it results in decreased anti-vector responses, compared to intradermal delivery. Microneedle-mediated vaccine priming and resultant induction of low anti-vector antibody titres permitted repeated use of the same adenovirus vaccine vector. This resulted in significantly increased antigen-specific antibody responses in these mice compared to ID-treated mice. Boosting with a heterologous vaccine; MVA-PyMSP1₄₂ also resulted in significantly greater antibody responses in mice primed with HAdV5-PyMSP1₄₂ using MN compared to the ID route. The highest protection against blood-stage malaria challenge was observed when a heterologous route of immunization (MN/ID) was used. Therefore, microneedle-mediated immunization has potential to both overcome some of the logistic obstacles surrounding needle-and-syringe-based immunization as well as to facilitate the repeated use of the same adenovirus vaccine thereby potentially reducing manufacturing costs of multiple vaccines. This could have important benefits in the clinical ease of use of adenovirus-based immunization strategies.
Carey, John B.; Vrdoljak, Anto; O'Mahony, Conor; Hill, Adrian V. S.; Draper, Simon J.; Moore, Anne C.
2014-01-01
Substantial effort has been placed in developing efficacious recombinant attenuated adenovirus-based vaccines. However induction of immunity to the vector is a significant obstacle to its repeated use. Here we demonstrate that skin-based delivery of an adenovirus-based malaria vaccine, HAdV5-PyMSP142, to mice using silicon microneedles induces equivalent or enhanced antibody responses to the encoded antigen, however it results in decreased anti-vector responses, compared to intradermal delivery. Microneedle-mediated vaccine priming and resultant induction of low anti-vector antibody titres permitted repeated use of the same adenovirus vaccine vector. This resulted in significantly increased antigen-specific antibody responses in these mice compared to ID-treated mice. Boosting with a heterologous vaccine; MVA-PyMSP142 also resulted in significantly greater antibody responses in mice primed with HAdV5-PyMSP142 using MN compared to the ID route. The highest protection against blood-stage malaria challenge was observed when a heterologous route of immunization (MN/ID) was used. Therefore, microneedle-mediated immunization has potential to both overcome some of the logistic obstacles surrounding needle-and-syringe-based immunization as well as to facilitate the repeated use of the same adenovirus vaccine thereby potentially reducing manufacturing costs of multiple vaccines. This could have important benefits in the clinical ease of use of adenovirus-based immunization strategies. PMID:25142082
Jeffery, Nick D.; Barker, Andrew K.; Alcott, Cody J.; Levine, Jon M.; Meren, Ilyssa; Wengert, Jane; Jergens, Albert E.; Suchodolski, Jan S.
2017-01-01
Meningoencephalomyelitis of unknown origin (MUO) is a common, naturally-occurring, clinical disease of pet dogs. It is an immune-mediated condition that has many similarities with experimental autoimmune encephalitis (EAE) in rodents and so investigation of its pathogenesis may aid in understanding factors that contribute to development of multiple sclerosis in people. Gut microbiota are known to modulate immune responses that influence susceptibility to immune-mediated brain disease. In this study we aimed to compare abundance of specific constituents of the fecal microbiota, namely Faecalibacterium prausnitzii and Prevotellaceae, between dogs diagnosed with MUO and matched controls. Fecal samples were obtained from 20 dogs diagnosed with MUO and 20 control dogs matched for breed, age and gender. Bacterial abundance was measured using qPCR and 16S rRNA sequencing. We found that Prevotellaceae were significantly less abundant in cases compared with controls (p = 0.003) but there was no difference in abundance of F.prausnitzii. There was no evidence of other differences in gut microbiota between groups. These data, derived from this naturally-occurring canine clinical model, provide strong corroborative evidence that high abundance of Prevotellaceae in the gut is associated with reduced risk for developing immune-mediated brain disease. PMID:28125651
Mucosal and systemic adjuvant activity of alphavirus replicon particles
NASA Astrophysics Data System (ADS)
Thompson, Joseph M.; Whitmore, Alan C.; Konopka, Jennifer L.; Collier, Martha L.; Richmond, Erin M. B.; Davis, Nancy L.; Staats, Herman F.; Johnston, Robert E.
2006-03-01
Vaccination represents the most effective control measure in the fight against infectious diseases. Local mucosal immune responses are critical for protection from, and resolution of, infection by numerous mucosal pathogens. Antigen processing across mucosal surfaces is the natural route by which mucosal immunity is generated, as peripheral antigen delivery typically fails to induce mucosal immune responses. However, we demonstrate in this article that mucosal immune responses are evident at multiple mucosal surfaces after parenteral delivery of Venezuelan equine encephalitis virus replicon particles (VRP). Moreover, coinoculation of null VRP (not expressing any transgene) with inactivated influenza virions, or ovalbumin, resulted in a significant increase in antigen-specific systemic IgG and fecal IgA antibodies, compared with antigen alone. Pretreatment of VRP with UV light largely abrogated this adjuvant effect. These results demonstrate that alphavirus replicon particles possess intrinsic systemic and mucosal adjuvant activity and suggest that VRP RNA replication is the trigger for this activity. We feel that these observations and the continued experimentation they stimulate will ultimately define the specific components of an alternative pathway for the induction of mucosal immunity, and if the activity is evident in humans, will enable new possibilities for safe and inexpensive subunit and inactivated vaccines. vaccine vector | Venezuelan equine encephalitis virus | viral immunology | RNA virus
Jeffery, Nick D; Barker, Andrew K; Alcott, Cody J; Levine, Jon M; Meren, Ilyssa; Wengert, Jane; Jergens, Albert E; Suchodolski, Jan S
2017-01-01
Meningoencephalomyelitis of unknown origin (MUO) is a common, naturally-occurring, clinical disease of pet dogs. It is an immune-mediated condition that has many similarities with experimental autoimmune encephalitis (EAE) in rodents and so investigation of its pathogenesis may aid in understanding factors that contribute to development of multiple sclerosis in people. Gut microbiota are known to modulate immune responses that influence susceptibility to immune-mediated brain disease. In this study we aimed to compare abundance of specific constituents of the fecal microbiota, namely Faecalibacterium prausnitzii and Prevotellaceae, between dogs diagnosed with MUO and matched controls. Fecal samples were obtained from 20 dogs diagnosed with MUO and 20 control dogs matched for breed, age and gender. Bacterial abundance was measured using qPCR and 16S rRNA sequencing. We found that Prevotellaceae were significantly less abundant in cases compared with controls (p = 0.003) but there was no difference in abundance of F.prausnitzii. There was no evidence of other differences in gut microbiota between groups. These data, derived from this naturally-occurring canine clinical model, provide strong corroborative evidence that high abundance of Prevotellaceae in the gut is associated with reduced risk for developing immune-mediated brain disease.
Stress-Related Immune Markers in Depression: Implications for Treatment
Hughes, Martina M.; Connor, Thomas J.
2016-01-01
Major depression is a serious psychiatric disorder; however, the precise biological basis of depression still remains elusive. A large body of evidence implicates a dysregulated endocrine and inflammatory response system in the pathogenesis of depression. Despite this, given the heterogeneity of depression, not all depressed patients exhibit dysregulation of the inflammatory and endocrine systems. Evidence suggests that inflammation is associated with depression in certain subgroups of patients and that those who have experienced stressful life events such as childhood trauma or bereavement may be at greater risk of developing depression. Consequently, prolonged exposure to stress is thought to be a key trigger for the onset of a depressive episode. This review assesses the relationship between stress and the immune system, with a particular interest in the mechanisms by which stress impacts immune function, and how altered immune functioning, in turn, may lead to a feed forward cascade of multiple systems dysregulation and the subsequent manifestation of depressive symptomology. The identification of stress-related immune markers and potential avenues for advances in therapeutic intervention is vital. Changes in specific biological markers may be used to characterize or differentiate depressive subtypes or specific symptoms and may predict treatment response, in turn facilitating a more effective, targeted, and fast-acting approach to treatment. PMID:26775294
Cancer Immunotherapy and Breaking Immune Tolerance-New Approaches to an Old Challenge
Makkouk, Amani; Weiner, George
2014-01-01
Cancer immunotherapy has proven to be challenging as it depends on overcoming multiple mechanisms that mediate immune tolerance to self-antigens. A growing understanding of immune tolerance has been the foundation for new approaches to cancer immunotherapy. Adoptive transfer of immune effectors such as antitumor monoclonal antibodies and Chimeric Antigen Receptor T cells bypasses many of the mechanisms involved in immune tolerance by allowing for expansion of tumor specific effectors ex vivo. Vaccination with whole tumor cells, protein, peptide, or dendritic cells has proven challenging, yet may be more useful when combined with other cancer immunotherapeutic strategies. Immunomodulatory approaches to cancer immunotherapy include treatment with agents that enhance and maintain T cell activation. Recent advances in the use of checkpoint blockade to block negative signals and so maintain the antitumor response are particularly exciting. With our growing knowledge of immune tolerance and ways to overcome it, combination treatments are being developed, tested and have particular promise. One example is in situ immunization that is designed to break tolerance within the tumor microenvironment. Progress in all these areas is continuing based on clear evidence that cancer immunotherapy designed to overcome immune tolerance can be useful for a growing number of cancer patients. PMID:25524899
Bae, Chungyun; Kim, Su-min; Lee, Dong Ju; Choi, Doil
2013-01-01
Proteases regulate a large number of biological processes in plants, such as metabolism, physiology, growth, and defense. In this study, we carried out virus-induced gene silencing assays with pepper cDNA clones to elucidate the biological roles of protease superfamilies. A total of 153 representative protease genes from pepper cDNA were selected and cloned into a Tobacco rattle virus-ligation independent cloning vector in a loss-of-function study. Silencing of 61 proteases resulted in altered phenotypes, such as the inhibition of shoot growth, abnormal leaf shape, leaf color change, and lethality. Furthermore, the silencing experiments revealed that multiple proteases play a role in cell death and immune response against avirulent and virulent pathogens. Among these 153 proteases, 34 modulated the hypersensitive cell death response caused by infection with an avirulent pathogen, and 16 proteases affected disease symptom development caused by a virulent pathogen. Specifically, we provide experimental evidence for the roles of multiple protease genes in plant development and immune defense following pathogen infection. With these results, we created a broad sketch of each protease function. This information will provide basic information for further understanding the roles of the protease superfamily in plant growth, development, and defense. PMID:23696830
Protein carriers of conjugate vaccines
Pichichero, Michael E
2013-01-01
The immunogenicity of polysaccharides as human vaccines was enhanced by coupling to protein carriers. Conjugation transformed the T cell-independent polysaccharide vaccines of the past to T cell-dependent antigenic vaccines that were much more immunogenic and launched a renaissance in vaccinology. This review discusses the conjugate vaccines for prevention of infections caused by Hemophilus influenzae type b, Streptococcus pneumoniae, and Neisseria meningitidis. Specifically, the characteristics of the proteins used in the construction of the vaccines including CRM, tetanus toxoid, diphtheria toxoid, Neisseria meningitidis outer membrane complex, and Hemophilus influenzae protein D are discussed. The studies that established differences among and key features of conjugate vaccines including immunologic memory induction, reduction of nasopharyngeal colonization and herd immunity, and antibody avidity and avidity maturation are presented. Studies of dose, schedule, response to boosters, of single protein carriers with single and multiple polysaccharides, of multiple protein carriers with multiple polysaccharides and conjugate vaccines administered concurrently with other vaccines are discussed along with undesirable consequences of conjugate vaccines. The clear benefits of conjugate vaccines in improving the protective responses of the immature immune systems of young infants and the senescent immune systems of the elderly have been made clear and opened the way to development of additional vaccines using this technology for future vaccine products. PMID:23955057
Karan, Dev
2017-10-13
We previously developed and characterized an adenoviral-based prostate cancer vaccine for simultaneous targeting of prostate-specific antigen (PSA) and prostate stem cell antigen (PSCA). We also demonstrated that immunization of mice with the bivalent vaccine (Ad 5 -PSA+PSCA) inhibited the growth of established prostate tumors. However, there are multiple challenges hindering the success of immunological therapies in the clinic. One of the prime concerns has been to overcome the immunological tolerance and maintenance of long-term effector T cells. In this study, we further characterized the use of the bivalent vaccine (Ad 5 -PSA+PSCA) in a transgenic mouse model expressing human PSA in the mouse prostate. We demonstrated the expression of PSA analyzed at the mRNA level (by RT-PCR) and protein level (by immunohistochemistry) in the prostate lobes harvested from the PSA-transgenic (PSA-Tg) mice. We established that the administration of the bivalent vaccine in surgifoam to the PSA-Tg mice induces strong PSA-specific effector CD8 + T cells as measured by IFN-γ secretion and in vitro cytotoxic T-cell assay. Furthermore, the use of surgifoam with Ad 5 -PSA+PSCA vaccine allows multiple boosting vaccinations with a significant increase in antigen-specific CD8 + T cells. These observations suggest that the formulation of the bivalent prostate cancer vaccine (Ad 5 -PSA+PSCA) with surgifoam bypasses the neutralizing antibody response, thus allowing multiple boosting. This formulation is also helpful for inducing an antigen-specific immune response in the presence of self-antigen, and maintains long-term effector CD8 + T cells. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.
Adams, R A; Schachtrup, C; Davalos, D; Tsigelny, I; Akassoglou, K
2007-01-01
The blood protein fibrinogen as a ligand for integrin and non-integrin receptors functions as the molecular nexus of coagulation, inflammation and immunity. Studies in animal models and in human disease have demonstrated that extravascular fibrinogen that is deposited in tissues upon vascular rupture is not merely a marker, but a mediator of diseases with an inflammatory component, such as rheumatoid arthritis, multiple sclerosis, sepsis, myocardial infarction and bacterial infection. The present article focuses on the recent discoveries of specific cellular targets and receptors for fibrinogen within tissues that have extended the role of fibrinogen from a coagulation factor to a regulator of inflammation and immunity. Fibrinogen has the potential for selective drug targeting that would target its proinflammatory properties without affecting its beneficial effects in hemostasis, since it interacts with different receptors to mediate blood coagulation and inflammation. Strategies to target receptors for fibrinogen and fibrin within the tissue microenvironment could reveal selective and disease-specific agents for therapeutic intervention in a variety of human diseases associated with fibrin deposition.
Transduction of a Foreign Histocompatibility Gene into the Arterial Wall Induces Vasculitis
NASA Astrophysics Data System (ADS)
Nabel, Elizabeth G.; Plautz, Gregory; Nabel, Gary J.
1992-06-01
Autoimmune vasculitis represents a disease characterized by focal inflammation within arteries at multiple sites in the vasculature. Therapeutic interventions in this disease are empirical and often unsuccessful, and the mechanisms of immune injury are not well-defined. The direct transfer of recombinant genes and their expression in the arterial wall provides an opportunity to explore the pathogenesis and treatment of vascular disease. In this report, an animal model for vasculitis has been developed. Inflammation has been elicited by direct gene transfer of a foreign class I major histocompatibility complex gene, HLA-B7, to specific sites in porcine arteries. Transfer and expression of this recombinant gene was confirmed by a polymerase chain reaction and immunohistochemistry, and cytolytic T cells specific for HLA-B7 were detected. These findings demonstrate that expression of a recombinant gene in the vessel wall can induce a focal immune response and suggest that vessel damage induced by cell-mediated immune injury can initiate vasculitis.
Arévalo-Herrera, Myriam; Solarte, Yezid; Marin, Catherin; Santos, Mariana; Castellanos, Jenniffer; Beier, John C; Valencia, Sócrates Herrera
2016-01-01
Malaria is a vector-borne disease that is considered to be one of the most serious public health problems due to its high global mortality and morbidity rates. Although multiple strategies for controlling malaria have been used, many have had limited impact due to the appearance and rapid dissemination of mosquito resistance to insecticides, parasite resistance to multiple antimalarial drug, and the lack of sustainability. Individuals in endemic areas that have been permanently exposed to the parasite develop specific immune responses capable of diminishing parasite burden and the clinical manifestations of the disease, including blocking of parasite transmission to the mosquito vector. This is referred to as transmission blocking (TB) immunity (TBI) and is mediated by specific antibodies and other factors ingested during the blood meal that inhibit parasite development in the mosquito. These antibodies recognize proteins expressed on either gametocytes or parasite stages that develop in the mosquito midgut and are considered to be potential malaria vaccine candidates. Although these candidates, collectively called TB vaccines (TBV), would not directly stop malaria from infecting individuals, but would stop transmission from infected person to non-infected person. Here, we review the progress that has been achieved in TBI studies and the development of TBV and we highlight their potential usefulness in areas of low endemicity such as Latin America. PMID:21881775
Engineering Molecular Immunity Against Plant Viruses.
Zaidi, Syed Shan-E-Ali; Tashkandi, Manal; Mahfouz, Magdy M
2017-01-01
Genomic engineering has been used to precisely alter eukaryotic genomes at the single-base level for targeted gene editing, replacement, fusion, and mutagenesis, and plant viruses such as Tobacco rattle virus have been developed into efficient vectors for delivering genome-engineering reagents. In addition to altering the host genome, these methods can target pathogens to engineer molecular immunity. Indeed, recent studies have shown that clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) systems that target the genomes of DNA viruses can interfere with viral activity and limit viral symptoms in planta, demonstrating the utility of this system for engineering molecular immunity in plants. CRISPR/Cas9 can efficiently target single and multiple viral infections and confer plant immunity. Here, we discuss the use of site-specific nucleases to engineer molecular immunity against DNA and RNA viruses in plants. We also explore how to address the potential challenges encountered when producing plants with engineered resistance to single and mixed viral infections. © 2017 Elsevier Inc. All rights reserved.
Noonan, Kimberly A.; Huff, Carol A.; Davis, Janice; Lemas, M. Victor; Fiorino, Susan; Bitzan, Jeffrey; Ferguson, Anna; Emerling, Amy; Luznik, Leo; Matsui, William; Powell, Jonathan; Fuchs, Ephraim; Rosner, Gary L.; Epstein, Caroline; Rudraraju, Lakshmi; Ambinder, Richard F.; Jones, Richard J.; Pardoll, Drew; Borrello, Ivan
2015-01-01
Successful adoptive T cell therapy (ACT) requires the ability to activate tumor-specific T cells with the ability to traffic to the tumor site and effectively kill their target as well as persist over time. We hypothesized that ACT using marrow-infiltrating lymphocytes (MILs) in multiple myeloma (MM) could impart greater antitumor immunity in that they were obtained from the tumor microenvironment. We describe the results from the first clinical trial using MILs in MM. Twenty-five patients with either newly diagnosed or relapsed disease had their MILs harvested, activated and expanded, and subsequently infused on the third day after myeloablative therapy. Cells were obtained and adequately expanded in all patients with anti-CD3/CD28 beads plus interleukin-2, and a median of 9.5 × 108 MILs were infused. Factors indicative of response to MIL ACT included (i) the presence of measurable myeloma-specific activity of the ex vivo expanded product, (ii) low endogenous bone marrow T cell interferon-γ production at baseline, (iii) a CD8+ central memory phenotype at baseline, and (iv) the generation and persistence of myeloma-specific immunity in the bone marrow at 1 year after ACT. Achieving at least a 90% reduction in disease burden significantly increased the progression-free survival (25.1 months versus 11.8 months; P = 0.01). This study demonstrates the feasibility and efficacy of MILs as a form of ACT with applicability across many hematologic malignancies and possibly solid tumors infiltrating the bone marrow. PMID:25995224
The role of extracellular vesicles when innate meets adaptive.
Groot Kormelink, Tom; Mol, Sanne; de Jong, Esther C; Wauben, Marca H M
2018-04-03
Innate immune cells are recognized for their rapid and critical contribution to the body's first line of defense against invading pathogens and harmful agents. These actions can be further amplified by specific adaptive immune responses adapted to the activating stimulus. Recently, the awareness has grown that virtually all innate immune cells, i.e., mast cells, neutrophils, macrophages, eosinophils, basophils, and NK cells, are able to communicate with dendritic cells (DCs) and/or T and B cells, and thereby significantly contribute to the orchestration of adaptive immune responses. The means of communication that are thus far primarily associated with this function are cell-cell contacts and the release of a broad range of soluble mediators. Moreover, the possible contribution of innate immune cell-derived extracellular vesicles (EVs) to the modulation of adaptive immunity will be outlined in this review. EVs are submicron particles composed of a lipid bilayer, proteins, and nucleic acids released by cells in a regulated fashion. EVs are involved in intercellular communication between multiple cell types, including those of the immune system. A good understanding of the mechanisms by which innate immune cell-derived EVs influence adaptive immune responses, or vice versa, may reveal novel insights in the regulation of the immune system and can open up new possibilities for EVs (or their components) in controlling immune responses, either as a therapy, target, or as an adjuvant in future immune modulating treatments.
Neonatal Immunization: Rationale, Current State, and Future Prospects
Whittaker, Elizabeth; Goldblatt, David; McIntyre, Peter; Levy, Ofer
2018-01-01
Infections take their greatest toll in early life necessitating robust approaches to protect the very young. Here, we review the rationale, current state, and future research directions for one such approach: neonatal immunization. Challenges to neonatal immunization include natural concern about safety as well as a distinct neonatal immune system that is generally polarized against Th1 responses to many stimuli such that some vaccines that are effective in adults are not in newborns. Nevertheless, neonatal immunization could result in high-population penetration as birth is a reliable point of healthcare contact, and offers an opportunity for early protection of the young, including preterm newborns who are deficient in maternal antibodies. Despite distinct immunity and reduced responses to some vaccines, several vaccines have proven safe and effective at birth. While some vaccines such as polysaccharide vaccines have little effectiveness at birth, hepatitis B vaccine can prime at birth and requires multiple doses to achieve protection, whereas the live-attenuated Bacille Calmette–Guérin (BCG), may offer single shot protection, potentially in part via heterologous (“non-specific”) beneficial effects. Additional vaccines have been studied at birth including those directed against pertussis, pneumococcus, Haemophilus influenza type B and rotavirus providing important lessons. Current areas of research in neonatal vaccinology include characterization of early life immune ontogeny, heterogeneity in and heterologous effects of BCG vaccine formulations, applying systems biology and systems serology, in vitro platforms that model age-specific human immunity and discovery and development of novel age-specific adjuvantation systems. These approaches may inform, de-risk, and accelerate development of novel vaccines for use in early life. Key stakeholders, including the general public, should be engaged in assessing the opportunities and challenges inherent to neonatal immunization. PMID:29670610
Sunyer, Oriol J.
2016-01-01
Fishes (i.e., teleost fishes) are the largest group of vertebrates. Although their immune system is based on the fundamental receptors, pathways, and cell types found in all groups of vertebrates, fishes show a diversity of particular features that challenge some classical concepts of immunology. In this chapter, we discuss the particularities of fish immune repertoires from a comparative perspective. We examine how allelic exclusion can be achieved when multiple Ig loci are present, how isotypic diversity and functional specificity impact clonal complexity, how loss of the MHC class II molecules affects the cooperation between T and B cells, and how deep sequencing technologies bring new insights about somatic hypermutation in the absence of germinal centers. The unique coexistence of two distinct B-cell lineages respectively specialized in systemic and mucosal responses is also discussed. Finally, we try to show that the diverse adaptations of immune repertoires in teleosts can help in understanding how somatic adaptive mechanisms of immunity evolved in parallel in different lineages across vertebrates. PMID:26537384
MicroRNA regulation of immune events at conception.
Robertson, Sarah A; Zhang, Bihong; Chan, Honyueng; Sharkey, David J; Barry, Simon C; Fullston, Tod; Schjenken, John E
2017-09-01
The reproductive tract environment at conception programs the developmental trajectory of the embryo, sets the course of pregnancy, and impacts offspring phenotype and health. Despite the fundamental importance of this stage of reproduction, the rate-limiting regulatory mechanisms operating locally to control fertility and fecundity are incompletely understood. Emerging studies highlight roles for microRNAs (miRNAs) in regulating reproductive and developmental processes and in modulating the quality and strength of the female immune response. Since endometrial receptivity and robust placentation require specific adaptation of the immune response, we hypothesize that miRNAs participate in establishing pregnancy through effects on key gene networks in immune cells. Our recent studies investigated miRNAs that are induced in the peri-conception environment, focusing on miRNAs that have immune-regulatory roles-particularly miR-223, miR-155, and miR-146a. Genetic mouse models deficient in individual miRNAs are proving informative in defining roles for these miRNAs in the generation and stabilization of regulatory T cells (Treg cells) that confer adaptive immune tolerance. Overlapping and redundant functions between miRNAs that target multiple genes, combined with multiple miRNAs targeting individual genes, indicate complex and sensitive regulatory networks. Although to date most data on miRNA regulation of reproductive events are from mice, conserved functions of miRNAs across species imply similar biological pathways operate in all mammals. Understanding the regulation and roles of miRNAs in the peri-conception immune response will advance our knowledge of how environmental determinants act at conception, and could have practical applications for animal breeding as well as human fertility. © 2017 Wiley Periodicals, Inc.
Regulation of cancer immune escape: The roles of miRNAs in immune checkpoint proteins.
Yang, Qin; Cao, Wenjie; Wang, Zi; Zhang, Bin; Liu, Jing
2018-09-01
Immune checkpoint proteins (ICPs) are regulators of immune system. The ICP dysregulation silences the host immune response to cancer-specific antigens, contributing to the occurrence and progress of various cancers. MiRNAs are regulatory molecules and function in mRNA silencing and post-transcriptional regulation of gene expression. MiRNAs that modulate the immunity via ICPs have received increasing attention. Many studies have shown that the expressions of ICPs are directly or indirectly repressed by miRNAs in multiple types of cancers. MiRNAs are also subject to regulation by ICPs. In this review, recent studies of the relationship between miRNAs and ICPs (including the PD-1, PD-L1, CTLA-4, ICOS, B7-1, B7-2, B7-H2, B7-H3, CD27, CD70, CD40, and CD40L) in cancer immune escape are comprehensively discussed, which provide critical detailed mechanistic insights into the functions of the miRNA-ICP axes and their effects on immune escape, and will be beneficial for the potential applications of immune checkpoint therapy and miRNA-based guidance for personalized medicine as well as for predicting the prognosis. Copyright © 2018 Elsevier B.V. All rights reserved.
Wise, Megan C.; Hutnick, Natalie A.; Pollara, Justin; Myles, Devin J. F.; Williams, Constance; Yan, Jian; LaBranche, Celia C.; Khan, Amir S.; Sardesai, Niranjan Y.; Montefiori, David; Barnett, Susan W.; Zolla-Pazner, Susan; Ferrari, Guido
2015-01-01
ABSTRACT The search for an efficacious human immunodeficiency virus type 1 (HIV-1) vaccine remains a pressing need. The moderate success of the RV144 Thai clinical vaccine trial suggested that vaccine-induced HIV-1-specific antibodies can reduce the risk of HIV-1 infection. We have made several improvements to the DNA platform and have previously shown that improved DNA vaccines alone are capable of inducing both binding and neutralizing antibodies in small-animal models. In this study, we explored how an improved DNA prime and recombinant protein boost would impact HIV-specific vaccine immunogenicity in rhesus macaques (RhM). After DNA immunization with either a single HIV Env consensus sequence or multiple constructs expressing HIV subtype-specific Env consensus sequences, we detected both CD4+ and CD8+ T-cell responses to all vaccine immunogens. These T-cell responses were further increased after protein boosting to levels exceeding those of DNA-only or protein-only immunization. In addition, we observed antibodies that exhibited robust cross-clade binding and neutralizing and antibody-dependent cellular cytotoxicity (ADCC) activity after immunization with the DNA prime-protein boost regimen, with the multiple-Env formulation inducing a more robust and broader response than the single-Env formulation. The magnitude and functionality of these responses emphasize the strong priming effect improved DNA immunogens can induce, which are further expanded upon protein boost. These results support further study of an improved synthetic DNA prime together with a protein boost for enhancing anti-HIV immune responses. IMPORTANCE Even with effective antiretroviral drugs, HIV remains an enormous global health burden. Vaccine development has been problematic in part due to the high degree of diversity and poor immunogenicity of the HIV Env protein. Studies suggest that a relevant HIV vaccine will likely need to induce broad cellular and humoral responses from a simple vaccine regimen due to the resource-limited setting in which the HIV pandemic is most rampant. DNA vaccination lends itself well to increasing the amount of diversity included in a vaccine due to the ease of manufacturing multiple plasmids and formulating them as a single immunization. By increasing the number of Envs within a formulation, we were able to show an increased breadth of responses as well as improved functionality induced in a nonhuman primate model. This increased breadth could be built upon, leading to better coverage against circulating strains with broader vaccine-induced protection. PMID:26085155
Graham, Simon P.; Pellé, Roger; Yamage, Mat; Mwangi, Duncan M.; Honda, Yoshikazu; Mwakubambanya, Ramadhan S.; de Villiers, Etienne P.; Abuya, Evelyne; Awino, Elias; Gachanja, James; Mbwika, Ferdinand; Muthiani, Anthony M.; Muriuki, Cecelia; Nyanjui, John K.; Onono, Fredrick O.; Osaso, Julius; Riitho, Victor; Saya, Rosemary M.; Ellis, Shirley A.; McKeever, Declan J.; MacHugh, Niall D.; Gilbert, Sarah C.; Audonnet, Jean-Christophe; Morrison, W. Ivan; van der Bruggen, Pierre; Taracha, Evans L. N.
2008-01-01
Immunity against the bovine intracellular protozoan parasite Theileria parva has been shown to be mediated by CD8 T cells. Six antigens targeted by CD8 T cells from T. parva-immune cattle of different major histocompatibility complex (MHC) genotypes have been identified, raising the prospect of developing a subunit vaccine. To facilitate further dissection of the specificity of protective CD8 T-cell responses and to assist in the assessment of responses to vaccination, we set out to identify the epitopes recognized in these T. parva antigens and their MHC restriction elements. Nine epitopes in six T. parva antigens, together with their respective MHC restriction elements, were successfully identified. Five of the cytotoxic-T-lymphocyte epitopes were found to be restricted by products of previously described alleles, and four were restricted by four novel restriction elements. Analyses of CD8 T-cell responses to five of the epitopes in groups of cattle carrying the defined restriction elements and immunized with live parasites demonstrated that, with one exception, the epitopes were consistently recognized by animals of the respective genotypes. The analysis of responses was extended to animals immunized with multiple antigens delivered in separate vaccine constructs. Specific CD8 T-cell responses were detected in 19 of 24 immunized cattle. All responder cattle mounted responses specific for antigens for which they carried an identified restriction element. By contrast, only 8 of 19 responder cattle displayed a response to antigens for which they did not carry an identified restriction element. These data demonstrate that the identified antigens are inherently dominant in animals with the corresponding MHC genotypes. PMID:18070892
Zimmermann, Michael T.; Kennedy, Richard B.; Grill, Diane E.; Oberg, Ann L.; Goergen, Krista M.; Ovsyannikova, Inna G.; Haralambieva, Iana H.; Poland, Gregory A.
2017-01-01
The development of a humoral immune response to influenza vaccines occurs on a multisystems level. Due to the orchestration required for robust immune responses when multiple genes and their regulatory components across multiple cell types are involved, we examined an influenza vaccination cohort using multiple high-throughput technologies. In this study, we sought a more thorough understanding of how immune cell composition and gene expression relate to each other and contribute to interindividual variation in response to influenza vaccination. We first hypothesized that many of the differentially expressed (DE) genes observed after influenza vaccination result from changes in the composition of participants’ peripheral blood mononuclear cells (PBMCs), which were assessed using flow cytometry. We demonstrated that DE genes in our study are correlated with changes in PBMC composition. We gathered DE genes from 128 other publically available PBMC-based vaccine studies and identified that an average of 57% correlated with specific cell subset levels in our study (permutation used to control false discovery), suggesting that the associations we have identified are likely general features of PBMC-based transcriptomics. Second, we hypothesized that more robust models of vaccine response could be generated by accounting for the interplay between PBMC composition, gene expression, and gene regulation. We employed machine learning to generate predictive models of B-cell ELISPOT response outcomes and hemagglutination inhibition (HAI) antibody titers. The top HAI and B-cell ELISPOT model achieved an area under the receiver operating curve (AUC) of 0.64 and 0.79, respectively, with linear model coefficients of determination of 0.08 and 0.28. For the B-cell ELISPOT outcomes, CpG methylation had the greatest predictive ability, highlighting potentially novel regulatory features important for immune response. B-cell ELISOT models using only PBMC composition had lower performance (AUC = 0.67), but highlighted well-known mechanisms. Our analysis demonstrated that each of the three data sets (cell composition, mRNA-Seq, and DNA methylation) may provide distinct information for the prediction of humoral immune response outcomes. We believe that these findings are important for the interpretation of current omics-based studies and set the stage for a more thorough understanding of interindividual immune responses to influenza vaccination. PMID:28484452
Moore, Sophie E; Fulford, Anthony Jc; Darboe, Momodou K; Jobarteh, Modou Lamin; Jarjou, Landing M; Prentice, Andrew M
2012-10-11
Recent observational research indicates that immune development may be programmed by nutritional exposures early in life. Such findings require replication from trials specifically designed to assess the impact of nutritional intervention during pregnancy on infant immune development. The current trial seeks to establish: (a) which combination of protein-energy (PE) and multiple-micronutrient (MMN) supplements would be most effective; and (b) the most critical periods for intervention in pregnancy and infancy, for optimal immune development in infancy. The ENID Trial is a 2 x 2 x 2 factorial randomized, partially blind trial to assess whether nutritional supplementation to pregnant women (from < 20 weeks gestation to term) and their infants (from 6 to 12 months of age) can enhance infant immune development. Eligible pregnant women from the West Kiang region of The Gambia (pregnancy dated by ultrasound examination) are randomized on entry to 4 intervention groups (Iron-folate (FeFol = standard care), multiple micronutrients (MMN), protein-energy (PE), PE + MMN). Women are visited at home weekly for supplement administration and morbidity assessment and seen at MRC Keneba at 20 and 30 weeks gestation for a detailed antenatal examination, including ultrasound. At delivery, cord blood and placental samples are collected, with detailed infant anthropometry collected within 72 hours. Infants are visited weekly thereafter for a morbidity questionnaire. From 6 to 12 months of age, infants are further randomized to a lipid-based nutritional supplement, with or without additional MMN. The primary outcome measures of this study are thymic development during infancy, and antibody response to vaccination. Measures of cellular markers of immunity will be made in a selected sub-cohort. Subsidiary studies to the main trial will additionally assess the impact of supplementation on infant growth and development to 24 months of age. The proposed trial is designed to test whether nutritional repletion can enhance early immune development and, if so, to help determine the most efficacious form of nutritional support. Where there is evidence of benefit from a specific intervention/combination of interventions, future research should focus on refining the supplements to achieve the optimal, most cost-effective balance of interventions for improved health outcomes.
Kang, Duck-Hee; Park, Na-Jin; McArdle, Traci
2012-01-01
Purpose. To determine the levels of cancer-specific stress and mood disturbance in women shortly after diagnosis of breast cancer and to assess their associations with symptom perception, quality of life, and immune response. Design. Descriptive and correlational. Sample and Setting. One hundred women with newly diagnosed breast cancer were recruited from interdisciplinary breast clinics. Methods. Baseline data were collected using standardized questionnaires and established bioassay prior to the initiation of cancer adjuvant therapy. Blood samples were collected about the same time of day. Results. High cancer-specific stress was significantly correlated with high mood disturbance, which, in turn, was correlated with high symptom perception, poor quality of life, and an immune profile indicating high neutrophils and low lymphocytes. Conclusions. High cancer-specific stress and related mood disturbance show extensive negative relationships with multiple behavioral, clinical, and biological factors. Implications for Nursing. Routine screening for cancer-related stress and mood disturbance should be incorporated into nursing practice for all patients diagnosed with cancer. Given broad negative associations with other biobehavioral factors, early identification of patients at risk and provision and evaluation of stress and mood management programs may have a beneficial effect on subsequent health outcomes over time. PMID:23316388
Public clonotype usage identifies protective Gag-specific CD8+ T cell responses in SIV infection
Asher, Tedi E.; Wilson, Nancy A.; Nason, Martha C.; Brenchley, Jason M.; Metzler, Ian S.; Venturi, Vanessa; Gostick, Emma; Chattopadhyay, Pratip K.; Roederer, Mario; Davenport, Miles P.; Watkins, David I.; Douek, Daniel C.
2009-01-01
Despite the pressing need for an AIDS vaccine, the determinants of protective immunity to HIV remain concealed within the complexity of adaptive immune responses. We dissected immunodominant virus-specific CD8+ T cell populations in Mamu-A*01+ rhesus macaques with primary SIV infection to elucidate the hallmarks of effective immunity at the level of individual constituent clonotypes, which were identified according to the expression of distinct T cell receptors (TCRs). The number of public clonotypes, defined as those that expressed identical TCR β-chain amino acid sequences and recurred in multiple individuals, contained within the acute phase CD8+ T cell population specific for the biologically constrained Gag CM9 (CTPYDINQM; residues 181–189) epitope correlated negatively with the virus load set point. This independent molecular signature of protection was confirmed in a prospective vaccine trial, in which clonotype engagement was governed by the nature of the antigen rather than the context of exposure and public clonotype usage was associated with enhanced recognition of epitope variants. Thus, the pattern of antigen-specific clonotype recruitment within a protective CD8+ T cell population is a prognostic indicator of vaccine efficacy and biological outcome in an AIDS virus infection. PMID:19349463
Autoantigens in systemic autoimmunity: critical partner in pathogenesis
Rosen, A.; Casciola-Rosen, L.
2013-01-01
Understanding the mechanisms of human autoimmune rheumatic diseases presents a major challenge, due to marked complexity involving multiple domains, including genetics, environment and kinetics. In spite of this, the immune response in each of these diseases is largely specific, with distinct autoantibodies associated with different disease phenotypes. Defining the basis of such specificity will provide important insights into disease mechanism. Accumulating data suggest an interesting paradigm for antigen selection in autoimmunity, in which target tissue and immune effector pathways form a mutually reinforcing partnership. In this model, distinct autoantibody patterns in autoimmunity may be viewed as the integrated, amplified output of several interacting systems, including: (i) the specific target tissue, (ii) the immune effector pathways that modify antigen structure and cause tissue damage and dysfunction, and (iii) the homeostatic pathways activated in response to damage (e.g. regeneration/differentiation/cytokine effects). As unique antigen expression and structure may occur exclusively under these amplifying circumstances, it is useful to view the molecules targeted as ‘neo-antigens’, that is, antigens expressed under specific conditions, rather than ubiquitously. This model adds an important new dynamic element to selection of antigen targets in autoimmunity, and suggests that the amplifying loop will only be identified by studying the diseased target tissue in vivo. PMID:19493056
Re-engineering the Pancreas Tumor Microenvironment: A “Regenerative Program” Hacked
Evan, Gerard I.; Hah, Nasun; Littlewood, Trevor D.; Sodir, Nicole M.; Vidal, Tania Campos; Downes, Michael; Evans, Ronald M.
2017-01-01
The “hallmarks” of pancreatic ductal adenocarcinoma (PDAC) include proliferative, invasive and metastatic tumor cells and an associated dense desmoplasia comprised of fibroblasts, pancreatic stellate cells, extracellular matrix and immune cells. The oncogenically-activated pancreatic epithelium and its associated stroma are obligatorily interdependent, with the resulting inflammatory and immune-suppressive microenvironment contributing greatly to the evolution and maintenance of PDAC. The peculiar pancreas-specific tumor phenotype is a consequence of oncogenes hacking the resident pancreas regenerative program, a tissue specific repair mechanism regulated by discrete super enhancer networks. Defined as genomic regions containing clusters of multiple enhancers, super enhancers play pivotal roles in cell/tissue specification, identity and maintenance. Hence, interfering with such super enhancer driven repair networks should exert a disproportionately disruptive effect on tumor versus normal pancreatic tissue. Novel drugs that directly or indirectly inhibit processes regulating epigenetic status and integrity, including those driven by histone deacetylases, histone methyltransferase and hydroxylases, DNA methyltransferases, various metabolic enzymes, and bromodomain and extra-terminal motif proteins (BETs) have shown the feasibility of disrupting super enhancer-dependent transcription in treating multiple tumor types, including PDAC. The idea that pancreatic adenocarcinomas rely on embedded super enhancer transcriptional mechanism suggests a vulnerability that can be potentially targeted as novel therapies for this intractable disease. PMID:28373363
McCutcheon, Krista M; Gray, Julia; Chen, Natalie Y; Liu, Keyi; Park, Minha; Ellsworth, Stote; Tripp, Ralph A; Tompkins, S Mark; Johnson, Scott K; Samet, Shelly; Pereira, Lenore; Kauvar, Lawrence M
2014-01-01
Viral entry targets with therapeutic neutralizing potential are subject to multiple escape mechanisms, including antigenic drift, immune dominance of functionally irrelevant epitopes, and subtle variations in host cell mechanisms. A surprising finding of recent years is that potent neutralizing antibodies to viral epitopes independent of strain exist, but are poorly represented across the diverse human population. Identifying these antibodies and understanding the biology mediating the specific immune response is thus difficult. An effective strategy for meeting this challenge is to incorporate multiplexed antigen screening into a high throughput survey of the memory B cell repertoire from immune individuals. We used this approach to discover suites of cross-clade antibodies directed to conformational epitopes in the stalk region of the influenza A hemagglutinin (HA) protein and to select high-affinity anti-peptide antibodies to the glycoprotein B (gB) of human cytomegalovirus. In each case, our screens revealed a restricted VH and VL germline usage, including published and previously unidentified gene families. The in vivo evolution of paratope specificity with optimal neutralizing activity was understandable after correlating biological activities with kinetic binding and epitope recognition. Iterative feedback between antigen probe design based on structure and function information with high throughput multiplexed screening demonstrated a generally applicable strategy for efficient identification of safe, native, finely tuned antibodies with the potential for high genetic barriers to viral escape.
2012-01-01
Background The genus Ebolavirus includes five distinct viruses. Four of these viruses cause hemorrhagic fever in humans. Currently there are no licensed vaccines for any of them; however, several vaccines are under development. Ebola virus envelope glycoprotein (GP1,2) is highly immunogenic, but antibodies frequently arise against its least conserved mucin-like domain (MLD). We hypothesized that immunization with MLD-deleted GP1,2 (GPΔMLD) would induce cross-species immunity by making more conserved regions accessible to the immune system. Methods To test this hypothesis, mice were immunized with retrovirus-like particles (retroVLPs) bearing Ebola virus GPΔMLD, DNA plasmids (plasmo-retroVLP) that can produce such retroVLPs in vivo, or plasmo-retroVLP followed by retroVLPs. Results Cross-species neutralizing antibody and GP1,2-specific cellular immune responses were successfully induced. Conclusion Our findings suggest that GPΔMLD presented through retroVLPs may provide a strategy for development of a vaccine against multiple ebolaviruses. Similar vaccination strategies may be adopted for other viruses whose envelope proteins contain highly variable regions that may mask more conserved domains from the immune system. PMID:22273269
Ou, Wu; Delisle, Josie; Jacques, Jerome; Shih, Joanna; Price, Graeme; Kuhn, Jens H; Wang, Vivian; Verthelyi, Daniela; Kaplan, Gerardo; Wilson, Carolyn A
2012-01-25
The genus Ebolavirus includes five distinct viruses. Four of these viruses cause hemorrhagic fever in humans. Currently there are no licensed vaccines for any of them; however, several vaccines are under development. Ebola virus envelope glycoprotein (GP1,2) is highly immunogenic, but antibodies frequently arise against its least conserved mucin-like domain (MLD). We hypothesized that immunization with MLD-deleted GP1,2 (GPΔMLD) would induce cross-species immunity by making more conserved regions accessible to the immune system. To test this hypothesis, mice were immunized with retrovirus-like particles (retroVLPs) bearing Ebola virus GPΔMLD, DNA plasmids (plasmo-retroVLP) that can produce such retroVLPs in vivo, or plasmo-retroVLP followed by retroVLPs. Cross-species neutralizing antibody and GP1,2-specific cellular immune responses were successfully induced. Our findings suggest that GPΔMLD presented through retroVLPs may provide a strategy for development of a vaccine against multiple ebolaviruses. Similar vaccination strategies may be adopted for other viruses whose envelope proteins contain highly variable regions that may mask more conserved domains from the immune system.
Innate lymphoid cells in autoimmunity and chronic inflammatory diseases.
Xiong, Tingting; Turner, Jan-Eric
2018-03-22
Abnormal activation of the innate immune system is a common feature of autoimmune and chronic inflammatory diseases. Since their identification as a separate family of leukocytes, innate lymphoid cells (ILCs) have emerged as important effector cells of the innate immune system. Alterations in ILC function and subtype distribution have been observed in a variety of immune-mediated diseases in humans and evidence from experimental models suggests a subtype specific role of ILCs in the pathophysiology of autoimmune inflammation. In this review, we discuss recent advances in the understanding of ILC biology in autoimmune and chronic inflammatory disorders, including multiple sclerosis, inflammatory bowel diseases, psoriasis, and rheumatic diseases, with a special focus on the potential of ILCs as therapeutic targets for the development of novel treatment strategies in humans.
Transcriptome landscape of a bacterial pathogen under plant immunity.
Nobori, Tatsuya; Velásquez, André C; Wu, Jingni; Kvitko, Brian H; Kremer, James M; Wang, Yiming; He, Sheng Yang; Tsuda, Kenichi
2018-03-27
Plant pathogens can cause serious diseases that impact global agriculture. The plant innate immunity, when fully activated, can halt pathogen growth in plants. Despite extensive studies into the molecular and genetic bases of plant immunity against pathogens, the influence of plant immunity in global pathogen metabolism to restrict pathogen growth is poorly understood. Here, we developed RNA sequencing pipelines for analyzing bacterial transcriptomes in planta and determined high-resolution transcriptome patterns of the foliar bacterial pathogen Pseudomonas syringae in Arabidopsis thaliana with a total of 27 combinations of plant immunity mutants and bacterial strains. Bacterial transcriptomes were analyzed at 6 h post infection to capture early effects of plant immunity on bacterial processes and to avoid secondary effects caused by different bacterial population densities in planta We identified specific "immune-responsive" bacterial genes and processes, including those that are activated in susceptible plants and suppressed by plant immune activation. Expression patterns of immune-responsive bacterial genes at the early time point were tightly linked to later bacterial growth levels in different host genotypes. Moreover, we found that a bacterial iron acquisition pathway is commonly suppressed by multiple plant immune-signaling pathways. Overexpression of a P. syringae sigma factor gene involved in iron regulation and other processes partially countered bacterial growth restriction during the plant immune response triggered by AvrRpt2. Collectively, this study defines the effects of plant immunity on the transcriptome of a bacterial pathogen and sheds light on the enigmatic mechanisms of bacterial growth inhibition during the plant immune response.
Pathogenesis and spectrum of autoimmunity.
Perl, Andras
2012-01-01
The immune system specifically recognizes and eliminates foreign antigens and, thus, protects integrity of the host. During maturation of the immune system, tolerance mechanisms develop that prevent or inhibit potentially harmful reactivities to self-antigens. Autoreactive B and T cells that are generated during immune responses are eliminated by apoptosis in the thymus, lymph nodes, or peripheral circulation or actively suppressed by regulatory T cells. However, autoreactive cells may survive due to failure of apoptosis or molecular mimicry, i.e., presentation and recognition of cryptic epitopes of self-antigens, or aberrant lymphokine production. Preservation of the host requires the development of immune responses to foreign antigen and tolerance to self-antigens. Autoimmunity results from a breakdown of tolerance to self-antigens through an interplay of genetic and environmental factors.One of the basic functions of the immune system is to specifically recognize and eliminate foreign antigens and, thus, protect integrity of the host. Through rearrangements and somatic mutations of various gene segments encoding T and B cell receptors and antibody molecules, the immune system acquires tremendous diversity. During maturation of the immune system, recognition of self-antigens plays an important role in shaping the repertoires of immune receptors. Tolerance mechanisms develop that prevent or inhibit potentially harmful reactivities to self-antigens. These self-defense mechanisms are mediated on the levels of central and peripheral tolerance, i.e., autoreactive T cells are either eliminated by apoptosis in the thymus, lymph nodes, or peripheral circulation or actively suppressed by regulatory T cells. Likewise, autoreactive B cells are eliminated in the bone marrow or peripheral lymphoid organs. However, immune responses triggered by foreign antigens may be sustained by molecular mimicry, i.e., presentation and recognition of cryptic epitopes of self-antigens. Further downstream, execution of immune responses depends on the functioning of intracellular signaling networks and the cooperation of many cell types communicating via surface receptors, cytokines, chemokines, and antibody molecules. Therefore, autoimmunity represents the end result of the breakdown of one or multiple basic mechanisms of immune tolerance (Table 1).
Two is better than one: advances in pathogen-boosted immunotherapy and adoptive T-cell therapy.
Xin, Gang; Schauder, David M; Zander, Ryan; Cui, Weiguo
2017-09-01
The recent tremendous successes in clinical trials take cancer immunotherapy into a new era and have attracted major attention from both academia and industry. Among the variety of immunotherapy strategies developed to boost patients' own immune systems to fight against malignant cells, the pathogen-based and adoptive cell transfer therapies have shown the most promise for treating multiple types of cancer. Pathogen-based therapies could either break the immune tolerance to enhance the effectiveness of cancer vaccines or directly infect and kill cancer cells. Adoptive cell transfer can induce a strong durable antitumor response, with recent advances including engineering dual specificity into T cells to recognize multiple antigens and improving the metabolic fitness of transferred cells. In this review, we focus on the recent prospects in these two areas and summarize some ongoing studies that represent potential advancements for anticancer immunotherapy, including testing combinations of these two strategies.
Signaling mechanisms underlying the robustness and tunability of the plant immune network
Kim, Yungil; Tsuda, Kenichi; Igarashi, Daisuke; Hillmer, Rachel A.; Sakakibara, Hitoshi; Myers, Chad L.; Katagiri, Fumiaki
2014-01-01
Summary How does robust and tunable behavior emerge in a complex biological network? We sought to understand this for the signaling network controlling pattern-triggered immunity (PTI) in Arabidopsis. A dynamic network model containing four major signaling sectors, the jasmonate, ethylene, PAD4, and salicylate sectors, which together explain up to 80% of the PTI level, was built using data for dynamic sector activities and PTI levels under exhaustive combinatorial sector perturbations. Our regularized multiple regression model had a high level of predictive power and captured known and unexpected signal flows in the network. The sole inhibitory sector in the model, the ethylene sector, was central to the network robustness via its inhibition of the jasmonate sector. The model's multiple input sites linked specific signal input patterns varying in strength and timing to different network response patterns, indicating a mechanism enabling tunability. PMID:24439900
Kamran, Neha; Kadiyala, Padma; Saxena, Meghna; Candolfi, Marianela; Li, Youping; Moreno-Ayala, Mariela A; Raja, Nicholas; Shah, Diana; Lowenstein, Pedro R; Castro, Maria G
2017-01-04
Survival of glioma (GBM) patients treated with the current standard of care remains dismal. Immunotherapeutic approaches that harness the cytotoxic and memory potential of the host immune system have shown great benefit in other cancers. GBMs have developed multiple strategies, including the accumulation of myeloid-derived suppressor cells (MDSCs) to induce immunosuppression. It is therefore imperative to develop multipronged approaches when aiming to generate a robust anti-tumor immune response. Herein, we tested whether combining MDSC depletion or checkpoint blockade would augment the efficacy of immune-stimulatory herpes simplex type-I thymidine kinase (TK) plus Fms-like tyrosine kinase ligand (Flt3L)-mediated immune stimulatory gene therapy. Our results show that MDSCs constitute >40% of the tumor-infiltrating immune cells. These cells express IL-4Rα, inducible nitric oxide synthase (iNOS), arginase, programmed death ligand 1 (PDL1), and CD80, molecules that are critically involved in antigen-specific T cell suppression. Depletion of MDSCs strongly enhanced the TK/Flt3L gene therapy-induced tumor-specific CD8 T cell response, which lead to increased median survival and percentage of long-term survivors. Also, combining PDL1 or CTLA-4 immune checkpoint blockade greatly improved the efficacy of TK/Flt3L gene therapy. Our results, therefore, indicate that blocking MDSC-mediated immunosuppression holds great promise for increasing the efficacy of gene therapy-mediated immunotherapies for GBM. Copyright © 2017 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.
Verweij, Marieke C.; Horst, Daniëlle; Griffin, Bryan D.; Luteijn, Rutger D.; Davison, Andrew J.; Ressing, Maaike E.; Wiertz, Emmanuel J. H. J.
2015-01-01
Herpesviruses are large DNA viruses that are highly abundant within their host populations. Even in the presence of a healthy immune system, these viruses manage to cause lifelong infections. This persistence is partially mediated by the virus entering latency, a phase of infection characterized by limited viral protein expression. Moreover, herpesviruses have devoted a significant part of their coding capacity to immune evasion strategies. It is believed that the close coexistence of herpesviruses and their hosts has resulted in the evolution of viral proteins that specifically attack multiple arms of the host immune system. Cytotoxic T lymphocytes (CTLs) play an important role in antiviral immunity. CTLs recognize their target through viral peptides presented in the context of MHC molecules at the cell surface. Every herpesvirus studied to date encodes multiple immune evasion molecules that effectively interfere with specific steps of the MHC class I antigen presentation pathway. The transporter associated with antigen processing (TAP) plays a key role in the loading of viral peptides onto MHC class I molecules. This is reflected by the numerous ways herpesviruses have developed to block TAP function. In this review, we describe the characteristics and mechanisms of action of all known virus-encoded TAP inhibitors. Orthologs of these proteins encoded by related viruses are identified, and the conservation of TAP inhibition is discussed. A phylogenetic analysis of members of the family Herpesviridae is included to study the origin of these molecules. In addition, we discuss the characteristics of the first TAP inhibitor identified outside the herpesvirus family, namely, in cowpox virus. The strategies of TAP inhibition employed by viruses are very distinct and are likely to have been acquired independently during evolution. These findings and the recent discovery of a non-herpesvirus TAP inhibitor represent a striking example of functional convergent evolution. PMID:25880312
Callendret, Benoit; Vellinga, Jort; Wunderlich, Kerstin; Rodriguez, Ariane; Steigerwald, Robin; Dirmeier, Ulrike; Cheminay, Cedric; Volkmann, Ariane; Brasel, Trevor; Carrion, Ricardo; Giavedoni, Luis D; Patterson, Jean L; Mire, Chad E; Geisbert, Thomas W; Hooper, Jay W; Weijtens, Mo; Hartkoorn-Pasma, Jutta; Custers, Jerome; Grazia Pau, Maria; Schuitemaker, Hanneke; Zahn, Roland
2018-01-01
The search for a universal filovirus vaccine that provides protection against multiple filovirus species has been prompted by sporadic but highly lethal outbreaks of Ebolavirus and Marburgvirus infections. A good prophylactic vaccine should be able to provide protection to all known filovirus species and as an upside potentially protect from newly emerging virus strains. We investigated the immunogenicity and protection elicited by multivalent vaccines expressing glycoproteins (GP) from Ebola virus (EBOV), Sudan virus (SUDV), Taï Forest virus (TAFV) and Marburg virus (MARV). Immune responses against filovirus GP have been associated with protection from disease. The GP antigens were expressed by adenovirus serotypes 26 and 35 (Ad26 and Ad35) and modified Vaccinia virus Ankara (MVA) vectors, all selected for their strong immunogenicity and good safety profile. Using fully lethal NHP intramuscular challenge models, we assessed different vaccination regimens for immunogenicity and protection from filovirus disease. Heterologous multivalent Ad26-Ad35 prime-boost vaccination regimens could give full protection against MARV (range 75%-100% protection) and EBOV (range 50% to 100%) challenge, and partial protection (75%) against SUDV challenge. Heterologous multivalent Ad26-MVA prime-boost immunization gave full protection against EBOV challenge in a small cohort study. The use of such multivalent vaccines did not show overt immune interference in comparison with monovalent vaccines. Multivalent vaccines induced GP-specific antibody responses and cellular IFNγ responses to each GP expressed by the vaccine, and cross-reactivity to TAFV GP was detected in a trivalent vaccine expressing GP from EBOV, SUDV and MARV. In the EBOV challenge studies, higher humoral EBOV GP-specific immune responses (p = 0.0004) were associated with survival from EBOV challenge and less so for cellular immune responses (p = 0.0320). These results demonstrate that it is feasible to generate a multivalent filovirus vaccine that can protect against lethal infection by multiple members of the filovirus family.
Callendret, Benoit; Vellinga, Jort; Wunderlich, Kerstin; Steigerwald, Robin; Dirmeier, Ulrike; Cheminay, Cedric; Volkmann, Ariane; Brasel, Trevor; Carrion, Ricardo; Giavedoni, Luis D.; Patterson, Jean L.; Mire, Chad E.; Geisbert, Thomas W.; Hooper, Jay W.; Weijtens, Mo; Hartkoorn-Pasma, Jutta; Custers, Jerome; Grazia Pau, Maria; Schuitemaker, Hanneke
2018-01-01
The search for a universal filovirus vaccine that provides protection against multiple filovirus species has been prompted by sporadic but highly lethal outbreaks of Ebolavirus and Marburgvirus infections. A good prophylactic vaccine should be able to provide protection to all known filovirus species and as an upside potentially protect from newly emerging virus strains. We investigated the immunogenicity and protection elicited by multivalent vaccines expressing glycoproteins (GP) from Ebola virus (EBOV), Sudan virus (SUDV), Taï Forest virus (TAFV) and Marburg virus (MARV). Immune responses against filovirus GP have been associated with protection from disease. The GP antigens were expressed by adenovirus serotypes 26 and 35 (Ad26 and Ad35) and modified Vaccinia virus Ankara (MVA) vectors, all selected for their strong immunogenicity and good safety profile. Using fully lethal NHP intramuscular challenge models, we assessed different vaccination regimens for immunogenicity and protection from filovirus disease. Heterologous multivalent Ad26-Ad35 prime-boost vaccination regimens could give full protection against MARV (range 75%-100% protection) and EBOV (range 50% to 100%) challenge, and partial protection (75%) against SUDV challenge. Heterologous multivalent Ad26-MVA prime-boost immunization gave full protection against EBOV challenge in a small cohort study. The use of such multivalent vaccines did not show overt immune interference in comparison with monovalent vaccines. Multivalent vaccines induced GP-specific antibody responses and cellular IFNγ responses to each GP expressed by the vaccine, and cross-reactivity to TAFV GP was detected in a trivalent vaccine expressing GP from EBOV, SUDV and MARV. In the EBOV challenge studies, higher humoral EBOV GP-specific immune responses (p = 0.0004) were associated with survival from EBOV challenge and less so for cellular immune responses (p = 0.0320). These results demonstrate that it is feasible to generate a multivalent filovirus vaccine that can protect against lethal infection by multiple members of the filovirus family. PMID:29462200
Cannabis use by individuals with multiple sclerosis: effects on specific immune parameters.
Sexton, Michelle; Cudaback, Eiron; Abdullah, Rehab A; Finnell, John; Mischley, Laurie K; Rozga, Mary; Lichtman, Aron H; Stella, Nephi
2014-10-01
Cannabinoids affect immune responses in ways that may be beneficial for autoimmune diseases. We sought to determine whether chronic Cannabis use differentially modulates a select number of immune parameters in healthy controls and individuals with multiple sclerosis (MS cases). Subjects were enrolled and consented to a single blood draw, matched for age and BMI. We measured monocyte migration isolated from each subject, as well as plasma levels of endocannabinoids and cytokines. Cases met definition of MS by international diagnostic criteria. Monocyte cell migration measured in control subjects and individuals with MS was similarly inhibited by a set ratio of phytocannabinoids. The plasma levels of CCL2 and IL17 were reduced in non-naïve cannabis users irrespective of the cohorts. We detected a significant increase in the endocannabinoid arachidonoylethanolamine (AEA) in serum from individuals with MS compared to control subjects, and no significant difference in levels of other endocannabinoids and signaling lipids irrespective of Cannabis use. Chronic Cannabis use may affect the immune response to similar extent in individuals with MS and control subjects through the ability of phytocannabinoids to reduce both monocyte migration and cytokine levels in serum. From a panel of signaling lipids, only the levels of AEA are increased in individuals with MS, irrespective of Cannabis use or not. Our results suggest that both MS cases and controls respond similarly to chronic Cannabis use with respect to the immune parameters measured in this study.
CANNABIS USE BY INDIVIDUALS WITH MULTIPLE SCLEROSIS: EFFECTS ON SPECIFIC IMMUNE PARAMETERS
Sexton, Michelle; Cudaback, Eiron; Abdullah, Rehab A.; Finnell, John; Mischley, Laurie K; Rozga, Mary; Lichtman, Aron H.; Stella, Nephi
2014-01-01
Cannabinoids affect immune responses in ways that may be beneficial for autoimmune diseases. We sought to determine whether chronic Cannabis use differentially modulates a select number of immune parameters in healthy controls and individuals with multiple sclerosis (MS cases). Subjects were enrolled and consented to a single blood draw, matched for age and BMI. We measured monocyte migration isolated from each subject, as well as plasma levels of endocannabinoids and cytokines. Cases met definition of MS by international diagnostic criteria. Monocyte cell migration measured in control subjects and individuals with MS were similarly inhibited by a set ratio of phytocannabinoids. The plasma levels of CCL2 and IL17 were reduced in non-naïve cannabis users irrespective of the cohorts. We detected a significant increase in the endocannabinoid arachidonoylethanolamine (AEA) in serum from individuals with MS compared to control subjects, and no significant difference in levels of other endocannabinoids and signaling lipids irrespective of Cannabis use. Chronic Cannabis use may affect the immune response to similar extent in individuals with MS and control subjects through the ability of phytocannabinoids to reduce both monocyte migration and cytokine levels in serum. From a panel of signaling lipids, only the levels of AEA are increased in individuals with MS, irrespective from Cannabis use or not. Our results suggest that both MS cases and controls respond similarly to chronic Cannabis use with respect to the immune parameters measured in this study. PMID:25135301
Baker, Sarah M; Davitt, Christopher J H; Motyka, Natalya; Kikendall, Nicole L; Russell-Lodrigue, Kasi; Roy, Chad J; Morici, Lisa A
2017-12-09
Burkholderia mallei is a Gram-negative, non-motile, facultative intracellular bacillus and the causative agent of glanders, a highly contagious zoonotic disease. B. mallei is naturally resistant to multiple antibiotics and there is concern for its potential use as a bioweapon, making the development of a vaccine against B. mallei of critical importance. We have previously demonstrated that immunization with multivalent outer membrane vesicles (OMV) derived from B. pseudomallei provide significant protection against pneumonic melioidosis. Given that many virulence determinants are highly conserved between the two species, we sought to determine if the B. pseudomallei OMV vaccine could cross-protect against B. mallei . We immunized C57Bl/6 mice and rhesus macaques with B. pseudomallei OMVs and subsequently challenged animals with aerosolized B. mallei . Immunization with B. pseudomallei OMVs significantly protected mice against B. mallei and the protection observed was comparable to that achieved with a live attenuated vaccine. OMV immunization induced the production of B.mallei- specific serum IgG and a mixed Th1/Th17 CD4 and CD8 T cell response in mice. Additionally, immunization of rhesus macaques with B. pseudomallei OMVs provided protection against glanders and induced B.mallei -specific serum IgG in non-human primates. These results demonstrate the ability of the multivalent OMV vaccine platform to elicit cross-protection against closely-related intracellular pathogens and to induce robust humoral and cellular immune responses against shared protective antigens.
Davitt, Christopher J. H.; Motyka, Natalya; Kikendall, Nicole L.; Roy, Chad J.
2017-01-01
Burkholderia mallei is a Gram-negative, non-motile, facultative intracellular bacillus and the causative agent of glanders, a highly contagious zoonotic disease. B. mallei is naturally resistant to multiple antibiotics and there is concern for its potential use as a bioweapon, making the development of a vaccine against B. mallei of critical importance. We have previously demonstrated that immunization with multivalent outer membrane vesicles (OMV) derived from B. pseudomallei provide significant protection against pneumonic melioidosis. Given that many virulence determinants are highly conserved between the two species, we sought to determine if the B. pseudomallei OMV vaccine could cross-protect against B. mallei. We immunized C57Bl/6 mice and rhesus macaques with B. pseudomallei OMVs and subsequently challenged animals with aerosolized B. mallei. Immunization with B. pseudomallei OMVs significantly protected mice against B. mallei and the protection observed was comparable to that achieved with a live attenuated vaccine. OMV immunization induced the production of B.mallei-specific serum IgG and a mixed Th1/Th17 CD4 and CD8 T cell response in mice. Additionally, immunization of rhesus macaques with B. pseudomallei OMVs provided protection against glanders and induced B.mallei-specific serum IgG in non-human primates. These results demonstrate the ability of the multivalent OMV vaccine platform to elicit cross-protection against closely-related intracellular pathogens and to induce robust humoral and cellular immune responses against shared protective antigens. PMID:29232837
Grigoryev, Yevgeniy A.; Kurian, Sunil M.; Avnur, Zafi; Borie, Dominic; Deng, Jun; Campbell, Daniel; Sung, Joanna; Nikolcheva, Tania; Quinn, Anthony; Schulman, Howard; Peng, Stanford L.; Schaffer, Randolph; Fisher, Jonathan; Mondala, Tony; Head, Steven; Flechner, Stuart M.; Kantor, Aaron B.; Marsh, Christopher; Salomon, Daniel R.
2010-01-01
A major challenge for the field of transplantation is the lack of understanding of genomic and molecular drivers of early post-transplant immunity. The early immune response creates a complex milieu that determines the course of ensuing immune events and the ultimate outcome of the transplant. The objective of the current study was to mechanistically deconvolute the early immune response by purifying and profiling the constituent cell subsets of the peripheral blood. We employed genome-wide profiling of whole blood and purified CD4, CD8, B cells and monocytes in tandem with high-throughput laser-scanning cytometry in 10 kidney transplants sampled serially pre-transplant, 1, 2, 4, 8 and 12 weeks. Cytometry confirmed early cell subset depletion by antibody induction and immunosuppression. Multiple markers revealed the activation and proliferative expansion of CD45RO+CD62L− effector memory CD4/CD8 T cells as well as progressive activation of monocytes and B cells. Next, we mechanistically deconvoluted early post-transplant immunity by serial monitoring of whole blood using DNA microarrays. Parallel analysis of cell subset-specific gene expression revealed a unique spectrum of time-dependent changes and functional pathways. Gene expression profiling results were validated with 157 different probesets matching all 65 antigens detected by cytometry. Thus, serial blood cell monitoring reflects the profound changes in blood cell composition and immune activation early post-transplant. Each cell subset reveals distinct pathways and functional programs. These changes illuminate a complex, early phase of immunity and inflammation that includes activation and proliferative expansion of the memory effector and regulatory cells that may determine the phenotype and outcome of the kidney transplant. PMID:20976225
Grigoryev, Yevgeniy A; Kurian, Sunil M; Avnur, Zafi; Borie, Dominic; Deng, Jun; Campbell, Daniel; Sung, Joanna; Nikolcheva, Tania; Quinn, Anthony; Schulman, Howard; Peng, Stanford L; Schaffer, Randolph; Fisher, Jonathan; Mondala, Tony; Head, Steven; Flechner, Stuart M; Kantor, Aaron B; Marsh, Christopher; Salomon, Daniel R
2010-10-14
A major challenge for the field of transplantation is the lack of understanding of genomic and molecular drivers of early post-transplant immunity. The early immune response creates a complex milieu that determines the course of ensuing immune events and the ultimate outcome of the transplant. The objective of the current study was to mechanistically deconvolute the early immune response by purifying and profiling the constituent cell subsets of the peripheral blood. We employed genome-wide profiling of whole blood and purified CD4, CD8, B cells and monocytes in tandem with high-throughput laser-scanning cytometry in 10 kidney transplants sampled serially pre-transplant, 1, 2, 4, 8 and 12 weeks. Cytometry confirmed early cell subset depletion by antibody induction and immunosuppression. Multiple markers revealed the activation and proliferative expansion of CD45RO(+)CD62L(-) effector memory CD4/CD8 T cells as well as progressive activation of monocytes and B cells. Next, we mechanistically deconvoluted early post-transplant immunity by serial monitoring of whole blood using DNA microarrays. Parallel analysis of cell subset-specific gene expression revealed a unique spectrum of time-dependent changes and functional pathways. Gene expression profiling results were validated with 157 different probesets matching all 65 antigens detected by cytometry. Thus, serial blood cell monitoring reflects the profound changes in blood cell composition and immune activation early post-transplant. Each cell subset reveals distinct pathways and functional programs. These changes illuminate a complex, early phase of immunity and inflammation that includes activation and proliferative expansion of the memory effector and regulatory cells that may determine the phenotype and outcome of the kidney transplant.
Conservation of NLR-triggered immunity across plant lineages.
Maekawa, Takaki; Kracher, Barbara; Vernaldi, Saskia; Ver Loren van Themaat, Emiel; Schulze-Lefert, Paul
2012-12-04
The nucleotide-binding domain and leucine-rich repeat (NLR) family of plant receptors detects pathogen-derived molecules, designated effectors, inside host cells and mediates innate immune responses to pathogenic invaders. Genetic evidence revealed species-specific coevolution of many NLRs with effectors from host-adapted pathogens, suggesting that the specificity of these NLRs is restricted to the host or closely related plant species. However, we report that an NLR immune receptor (MLA1) from monocotyledonous barley is fully functional in partially immunocompromised dicotyledonous Arabidopsis thaliana against the barley powdery mildew fungus, Blumeria graminis f. sp. hordei. This implies ~200 million years of evolutionary conservation of the underlying immune mechanism. A time-course RNA-seq analysis in transgenic Arabidopsis lines detected sustained expression of a large MLA1-dependent gene cluster. This cluster is greatly enriched in genes known to respond to the fungal cell wall-derived microbe-associated molecular pattern chitin. The MLA1-dependent sustained transcript accumulation could define a conserved function of the nuclear pool of MLA1 detected in barley and Arabidopsis. We also found that MLA1-triggered immunity was fully retained in mutant plants that are simultaneously depleted of ethylene, jasmonic acid, and salicylic acid signaling. This points to the existence of an evolutionarily conserved and phytohormone-independent MLA1-mediated resistance mechanism. This also suggests a conserved mechanism for internalization of B. graminis f. sp. hordei effectors into host cells of flowering plants. Furthermore, the deduced connectivity of the NLR to multiple branches of immune signaling pathways likely confers increased robustness against pathogen effector-mediated interception of host immune signaling and could have contributed to the evolutionary preservation of the immune mechanism.
Immuno-therapy of Acute Radiation Syndromes : Extracorporeal Immuno-Lympho-Plasmo-Sorption.
NASA Astrophysics Data System (ADS)
Popov, Dmitri; Maliev, Slava
Methods Results Summary and conclusions Introduction: Existing Medical Management of the Acute Radiation Syndromes (ARS) does not include methods of specific immunotherapy and active detoxication. Though the Acute Radiation Syndromes were defined as an acute toxic poisonous with development of pathological processes: Systemic Inflammatory Response Syndrome (SIRS), Toxic Multiple Organ Injury (TMOI), Toxic Multiple Organ Dysfunction Syndrome(TMODS), Toxic Multiple Organ Failure (TMOF). Radiation Toxins of SRD Group play an important role as the trigger mechanisms in development of the ARS clinical symptoms. Methods: Immuno-Lympho-Plasmo-Sorption is a type of Immuno-therapy which includes prin-ciples of immunochromato-graphy, plasmopheresis, and hemodialysis. Specific Antiradiation Antitoxic Antibodies are the active pharmacological agents of immunotherapy . Antiradia-tion Antitoxic Antibodies bind selectively to Radiation Neurotoxins, Cytotoxins, Hematotox-ins and neutralize their toxic activity. We have developed the highly sensitive method and system for extracorporeal-immune-lypmh-plasmo-sorption with antigen-specific IgG which is clinically important for treatment of the toxic and immunologic phases of the ARS. The method of extracorporeal-immune-lypmh-plasmo-sorption includes Antiradiation Antitoxic Antibodies (AAA) immobilized on microporous polymeric membranes with a pore size that is capable to provide diffusion of blood-lymph plasma. Plasma of blood or lymph of irradiated mammals contains Radiation Toxins (RT) that have toxic and antigenic properties. Radiation Toxins are Antigen-specific to Antitoxic blocking antibodies (Immunoglobulin G). Plasma diffuses through membranes with immobilized AAA and AA-antibodies bind to the polysaccharide chain of tox-ins molecules and complexes of AAA-RT that are captured on membrane surfaces. RT were removed from plasma. Re-transfusion of plasma of blood and lymph had been provided. We show a statistical significant reduction in postradiation lethality.
Duran-Flores, Dalia; Heil, Martin
2017-10-16
Mammals sense self or non-self extracellular or extranuclear DNA fragments (hereinafter collectively termed eDNA) as indicators of injury or infection and respond with immunity. We hypothesised that eDNA acts as a damage-associated molecular pattern (DAMP) also in plants and that it contributes to self versus non-self discrimination. Treating plants and suspension-cultured cells of common bean (Phaseolus vulgaris) with fragmented self eDNA (obtained from other plants of the same species) induced early, immunity-related signalling responses such as H 2 O 2 generation and MAPK activation, decreased the infection by a bacterial pathogen (Pseudomonas syringae) and increased an indirect defence to herbivores (extrafloral nectar secretion). By contrast, non-self DNA (obtained from lima bean, Phaseolus lunatus, and Acacia farnesiana) had significantly lower or no detectable effects. Only fragments below a size of 700 bp were active, and treating the eDNA preparation DNAse abolished its inducing effects, whereas treatment with RNAse or proteinase had no detectable effect. These findings indicate that DNA fragments, rather than small RNAs, single nucleotides or proteins, accounted for the observed effects. We suggest that eDNA functions a DAMP in plants and that plants discriminate self from non-self at a species-specific level. The immune systems of plants and mammals share multiple central elements, but further work will be required to understand the mechanisms and the selective benefits of an immunity response that is triggered by eDNA in a species-specific manner. Copyright © 2017 Elsevier Inc. All rights reserved.
Masking of antigenic epitopes by antibodies shapes the humoral immune response to influenza
Zarnitsyna, Veronika I.; Ellebedy, Ali H.; Davis, Carl; Jacob, Joshy; Ahmed, Rafi; Antia, Rustom
2015-01-01
The immune responses to influenza, a virus that exhibits strain variation, show complex dynamics where prior immunity shapes the response to the subsequent infecting strains. Original antigenic sin (OAS) describes the observation that antibodies to the first encountered influenza strain, specifically antibodies to the epitopes on the head of influenza's main surface glycoprotein, haemagglutinin (HA), dominate following infection with new drifted strains. OAS suggests that responses to the original strain are preferentially boosted. Recent studies also show limited boosting of the antibodies to conserved epitopes on the stem of HA, which are attractive targets for a ‘universal vaccine’. We develop multi-epitope models to explore how pre-existing immunity modulates the immune response to new strains following immunization. Our models suggest that the masking of antigenic epitopes by antibodies may play an important role in describing the complex dynamics of OAS and limited boosting of antibodies to the stem of HA. Analysis of recently published data confirms model predictions for how pre-existing antibodies to an epitope on HA decrease the magnitude of boosting of the antibody response to this epitope following immunization. We explore strategies for boosting of antibodies to conserved epitopes and generating broadly protective immunity to multiple strains. PMID:26194761
Defective B cell response to T-dependent immunization in lupus-prone mice
Niu, Haitao; Sobel, Eric S.; Morel, Laurence
2009-01-01
Lupus anti-nuclear Abs show the characteristics of Ag-driven T cell-dependent (TD) humoral responses. If autoAgs elicit the same response as exogenous Ags, lupus should enhance humoral responses to immunization. Blunted responses to various immunizations have, however, been reported in a significant portion of lupus patients. In this study, we show that lupus-prone B6.Sle1.Sle2.Sle3 (B6.TC) mice produce significantly less Ab in response to TD immunization than congenic controls, while producing significantly more total Ig. This blunted Ab response to TD Ag could be reconstituted with B6.TC B and CD4+ T cells. Multiple defects were found in the B6.TC response to NP-KLH as compared to total Ig, including a smaller percentage of B cells participating to the NP-response, a reduced entry into germinal centers, and highly defective production of NP-specific long-lived plasma cells in the bone marrow. B6.TC plasma cells expressed reduced levels of FcγRIIb, which suggests that reduced apoptosis in resident plasma cells prevents the establishment of newly-formed NP-specific plasma cells in bone marrow niches. Overall, these results show that lupus-prone mice responded differently to auto- and exogenous antigens and suggest that low FcγRIIb, hypergammaglobulinemia and high autoantibody production would be predictive of a poor response to immunization in lupus patients. PMID:18924209
Viro-immune therapy: A new strategy for treatment of pancreatic cancer
Ibrahim, Andrea Marie; Wang, Yao-He
2016-01-01
Pancreatic ductal adenocarcinoma (PDAC) is an almost uniformly lethal disease with less than 5% survival at five years. This is largely due to metastatic disease, which is already present in the majority of patients when diagnosed. Even when the primary cancer can be removed by radical surgery, local recurrence occurs within one year in 50%-80% of cases. Therefore, it is imperative to develop new approaches for the treatment of advanced cancer and the prevention of recurrence after surgery. Tumour-targeted oncolytic viruses (TOVs) have become an attractive therapeutic agent as TOVs can kill cancer cells through multiple mechanisms of action, especially via virus-induced engagement of the immune response specifically against tumour cells. To attack tumour cells effectively, tumour-specific T cells need to overcome negative regulatory signals that suppress their activation or that induce tolerance programmes such as anergy or exhaustion in the tumour microenvironment. In this regard, the recent breakthrough in immunotherapy achieved with immune checkpoint blockade agents, such as anti-cytotoxic T-lymphocyte-associate protein 4, programmed death 1 (PD-1) or PD-L1 antibodies, has demonstrated the possibility of relieving immune suppression in PDAC. Therefore, the combination of oncolytic virotherapy and immune checkpoint blockade agents may synergistically function to enhance the antitumour response, lending the opportunity to be the future for treatment of pancreatic cancer. PMID:26811622
Nature plus nurture: the triggering of multiple sclerosis.
Wekerle, Hartmut
2015-01-01
Recent clinical and experimental studies indicate that multiple sclerosis develops as consequence of a failed interplay between genetic ("nature") and environmental ("nurture") factors. A large number of risk genes favour an autoimmune response against the body's own brain matter. New experimental data indicate that the actual trigger of this attack is however provided by an interaction of brain-specific immune cells with components of the regular commensal gut flora, the intestinal microbiota. This concept opens the way for new therapeutic approaches involving modulation of the microbiota by dietary or antibiotic regimens.
Estorninho, Megan; Gibson, Vivienne B; Kronenberg-Versteeg, Deborah; Liu, Yuk-Fun; Ni, Chester; Cerosaletti, Karen; Peakman, Mark
2013-12-01
Extensive diversity in the human repertoire of TCRs for Ag is both a cornerstone of effective adaptive immunity that enables host protection against a multiplicity of pathogens and a weakness that gives rise to potential pathological self-reactivity. The complexity arising from diversity makes detection and tracking of single Ag-specific CD4 T cells (ASTs) involved in these immune responses challenging. We report a tandem, multistep process to quantify rare TCRβ-chain variable sequences of ASTs in large polyclonal populations. The approach combines deep high-throughput sequencing (HTS) within functional CD4 T cell compartments, such as naive/memory cells, with shallow, multiple identifier-based HTS of ASTs identified by activation marker upregulation after short-term Ag stimulation in vitro. We find that clonotypes recognizing HLA class II-restricted epitopes of both pathogen-derived Ags and self-Ags are oligoclonal and typically private. Clonotype tracking within an individual reveals private AST clonotypes resident in the memory population, as would be expected, representing clonal expansions (identical nucleotide sequence; "ultraprivate"). Other AST clonotypes share CDR3β amino acid sequences through convergent recombination and are found in memory populations of multiple individuals. Tandem HTS-based clonotyping will facilitate studying AST dynamics, epitope spreading, and repertoire changes that arise postvaccination and following Ag-specific immunotherapies for cancer and autoimmune disease.
Lee, Lian N; Bolinger, Beatrice; Banki, Zoltan; de Lara, Catherine; Highton, Andrew J; Colston, Julia M; Hutchings, Claire; Klenerman, Paul
2017-12-01
The efficacies of many new T cell vaccines rely on generating large populations of long-lived pathogen-specific effector memory CD8 T cells. However, it is now increasingly recognized that prior infection history impacts on the host immune response. Additionally, the order in which these infections are acquired could have a major effect. Exploiting the ability to generate large sustained effector memory (i.e. inflationary) T cell populations from murine cytomegalovirus (MCMV) and human Adenovirus-subtype (AdHu5) 5-beta-galactosidase (Ad-lacZ) vector, the impact of new infections on pre-existing memory and the capacity of the host's memory compartment to accommodate multiple inflationary populations from unrelated pathogens was investigated in a murine model. Simultaneous and sequential infections, first with MCMV followed by Ad-lacZ, generated inflationary populations towards both viruses with similar kinetics and magnitude to mono-infected groups. However, in Ad-lacZ immune mice, subsequent acute MCMV infection led to a rapid decline of the pre-existing Ad-LacZ-specific inflating population, associated with bystander activation of Fas-dependent apoptotic pathways. However, responses were maintained long-term and boosting with Ad-lacZ led to rapid re-expansion of the inflating population. These data indicate firstly that multiple specificities of inflating memory cells can be acquired at different times and stably co-exist. Some acute infections may also deplete pre-existing memory populations, thus revealing the importance of the order of infection acquisition. Importantly, immunization with an AdHu5 vector did not alter the size of the pre-existing memory. These phenomena are relevant to the development of adenoviral vectors as novel vaccination strategies for diverse infections and cancers. (241 words).
Bolinger, Beatrice; de Lara, Catherine; Hutchings, Claire
2017-01-01
The efficacies of many new T cell vaccines rely on generating large populations of long-lived pathogen-specific effector memory CD8 T cells. However, it is now increasingly recognized that prior infection history impacts on the host immune response. Additionally, the order in which these infections are acquired could have a major effect. Exploiting the ability to generate large sustained effector memory (i.e. inflationary) T cell populations from murine cytomegalovirus (MCMV) and human Adenovirus-subtype (AdHu5) 5-beta-galactosidase (Ad-lacZ) vector, the impact of new infections on pre-existing memory and the capacity of the host’s memory compartment to accommodate multiple inflationary populations from unrelated pathogens was investigated in a murine model. Simultaneous and sequential infections, first with MCMV followed by Ad-lacZ, generated inflationary populations towards both viruses with similar kinetics and magnitude to mono-infected groups. However, in Ad-lacZ immune mice, subsequent acute MCMV infection led to a rapid decline of the pre-existing Ad-LacZ-specific inflating population, associated with bystander activation of Fas-dependent apoptotic pathways. However, responses were maintained long-term and boosting with Ad-lacZ led to rapid re-expansion of the inflating population. These data indicate firstly that multiple specificities of inflating memory cells can be acquired at different times and stably co-exist. Some acute infections may also deplete pre-existing memory populations, thus revealing the importance of the order of infection acquisition. Importantly, immunization with an AdHu5 vector did not alter the size of the pre-existing memory. These phenomena are relevant to the development of adenoviral vectors as novel vaccination strategies for diverse infections and cancers. (241 words) PMID:29281733
Nosratabadi, Reza; Rastin, Maryam; Sankian, Mojtaba; Haghmorad, Dariush; Tabasi, Nafiseh; Zamani, Shahrzad; Aghaee, Azita; Salehipour, Zohre; Mahmoudi, Mahmoud
2016-05-01
Multiple sclerosis (MS) is a central nervous system disorder mainly characterized by inflammation, demyelination and axonal injury. Anti-inflammatory agents can be used to ameliorate the disease process. Hypericum perforatum L or St. John's wort is widely used as an anti-depressant and anti-inflammatory remedy in traditional and herbal medicine. Based on St. John's wort properties, the therapeutic potentials of an H. perforatum extract (HPE) and a single component, hyperforin were evaluated for effectiveness against MOG35-55-induced experimental autoimmune encephalomyelitis (EAE), an animal model for human multiple sclerosis. Female C57BL/6 mice were immunized with specific antigen MOG35-55 and then administered different doses of hyperforin or HPE post-immunization. Clinical symptoms/other relevant parameters were assessed daily. Histological analysis of the spinal cord was performed. T-cell proliferative activity was also evaluated using a BrdU assay. The effect of hyperforin on regulatory T-cells (Treg cells) was assessed using flow cytometry. The results indicate hyperforin and HPE reduced the incidence and severity of EAE, an outcome that closely correlated with an inhibition of pathological features (leukocyte infiltration and demyelination) and antigen-specific T-cell proliferation. The study also showed that hyperforin caused increased Treg cell levels in the spleen. These results indicated that hyperforin and HPE could attenuate EAE autoimmune responses by inhibiting immune cell infiltration and expansion of Treg cell and could eventually be considered as a potential candidate for use in the treatment of MS.
Duan, Litian; Wang, Zizhong John; Duan, Fu
2016-11-16
In the multiple-reader environment (MRE) of radio frequency identification (RFID) system, multiple readers are often scheduled to interrogate the randomized tags via operating at different time slots or frequency channels to decrease the signal interferences. Based on this, a Geometric Distribution-based Multiple-reader Scheduling Optimization Algorithm using Artificial Immune System (GD-MRSOA-AIS) is proposed to fairly and optimally schedule the readers operating from the viewpoint of resource allocations. GD-MRSOA-AIS is composed of two parts, where a geometric distribution function combined with the fairness consideration is first introduced to generate the feasible scheduling schemes for reader operation. After that, artificial immune system (including immune clone, immune mutation and immune suppression) quickly optimize these feasible ones as the optimal scheduling scheme to ensure that readers are fairly operating with larger effective interrogation range and lower interferences. Compared with the state-of-the-art algorithm, the simulation results indicate that GD-MRSOA-AIS could efficiently schedules the multiple readers operating with a fairer resource allocation scheme, performing in larger effective interrogation range.
Duan, Litian; Wang, Zizhong John; Duan, Fu
2016-01-01
In the multiple-reader environment (MRE) of radio frequency identification (RFID) system, multiple readers are often scheduled to interrogate the randomized tags via operating at different time slots or frequency channels to decrease the signal interferences. Based on this, a Geometric Distribution-based Multiple-reader Scheduling Optimization Algorithm using Artificial Immune System (GD-MRSOA-AIS) is proposed to fairly and optimally schedule the readers operating from the viewpoint of resource allocations. GD-MRSOA-AIS is composed of two parts, where a geometric distribution function combined with the fairness consideration is first introduced to generate the feasible scheduling schemes for reader operation. After that, artificial immune system (including immune clone, immune mutation and immune suppression) quickly optimize these feasible ones as the optimal scheduling scheme to ensure that readers are fairly operating with larger effective interrogation range and lower interferences. Compared with the state-of-the-art algorithm, the simulation results indicate that GD-MRSOA-AIS could efficiently schedules the multiple readers operating with a fairer resource allocation scheme, performing in larger effective interrogation range. PMID:27854342
Divergent evolution of multiple virus-resistance genes from a progenitor in Capsicum spp.
Kim, Saet-Byul; Kang, Won-Hee; Huy, Hoang Ngoc; Yeom, Seon-In; An, Jeong-Tak; Kim, Seungill; Kang, Min-Young; Kim, Hyun Jung; Jo, Yeong Deuk; Ha, Yeaseong; Choi, Doil; Kang, Byoung-Cheorl
2017-01-01
Plants have evolved hundreds of nucleotide-binding and leucine-rich domain proteins (NLRs) as potential intracellular immune receptors, but the evolutionary mechanism leading to the ability to recognize specific pathogen effectors is elusive. Here, we cloned Pvr4 (a Potyvirus resistance gene in Capsicum annuum) and Tsw (a Tomato spotted wilt virus resistance gene in Capsicum chinense) via a genome-based approach using independent segregating populations. The genes both encode typical NLRs and are located at the same locus on pepper chromosome 10. Despite the fact that these two genes recognize completely different viral effectors, the genomic structures and coding sequences of the two genes are strikingly similar. Phylogenetic studies revealed that these two immune receptors diverged from a progenitor gene of a common ancestor. Our results suggest that sequence variations caused by gene duplication and neofunctionalization may underlie the evolution of the ability to specifically recognize different effectors. These findings thereby provide insight into the divergent evolution of plant immune receptors. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.
Systems analysis of protective immune responses to RTS,S malaria vaccination in humans
Kazmin, Dmitri; Nakaya, Helder I.; Lee, Eva K.; Johnson, Matthew J.; van der Most, Robbert; van den Berg, Robert A.; Ballou, W. Ripley; Jongert, Erik; Wille-Reece, Ulrike; Ockenhouse, Christian; Aderem, Alan; Zak, Daniel E.; Sadoff, Jerald; Hendriks, Jenny; Wrammert, Jens; Ahmed, Rafi; Pulendran, Bali
2017-01-01
RTS,S is an advanced malaria vaccine candidate and confers significant protection against Plasmodium falciparum infection in humans. Little is known about the molecular mechanisms driving vaccine immunity. Here, we applied a systems biology approach to study immune responses in subjects receiving three consecutive immunizations with RTS,S (RRR), or in those receiving two immunizations of RTS,S/AS01 following a primary immunization with adenovirus 35 (Ad35) (ARR) vector expressing circumsporozoite protein. Subsequent controlled human malaria challenge (CHMI) of the vaccinees with Plasmodium-infected mosquitoes, 3 wk after the final immunization, resulted in ∼50% protection in both groups of vaccinees. Circumsporozoite protein (CSP)-specific antibody titers, prechallenge, were associated with protection in the RRR group. In contrast, ARR-induced lower antibody responses, and protection was associated with polyfunctional CD4+ T-cell responses 2 wk after priming with Ad35. Molecular signatures of B and plasma cells detected in PBMCs were highly correlated with antibody titers prechallenge and protection in the RRR cohort. In contrast, early signatures of innate immunity and dendritic cell activation were highly associated with protection in the ARR cohort. For both vaccine regimens, natural killer (NK) cell signatures negatively correlated with and predicted protection. These results suggest that protective immunity against P. falciparum can be achieved via multiple mechanisms and highlight the utility of systems approaches in defining molecular correlates of protection to vaccination. PMID:28193898
The Gas6/TAM System and Multiple Sclerosis.
Bellan, Mattia; Pirisi, Mario; Sainaghi, Pier Paolo
2016-10-28
Growth arrest specific 6 (Gas6) is a multimodular circulating protein, the biological actions of which are mediated by the interaction with three transmembrane tyrosine kinase receptors: Tyro3, Axl, and MerTK, collectively named TAM. Over the last few decades, many progresses have been done in the understanding of the biological activities of this highly pleiotropic system, which plays a role in the regulation of immune response, inflammation, coagulation, cell growth, and clearance of apoptotic bodies. Recent findings have further related Gas6 and TAM receptors to neuroinflammation in general and, specifically, to multiple sclerosis (MS). In this paper, we review the biology of the Gas6/TAM system and the current evidence supporting its potential role in the pathogenesis of MS.
Antigen-specific therapy of Graves´ disease and orbitopathy by induction of tolerance.
Ungerer, Martin; Fabbender, Julia; Holthoff, Hans-Peter
2018-06-01
Graves´ disease is an autoimmune disorder, which is characterized by stimulatory antibodies targeting the human thyrotropin receptor (TSHR), resulting in hyperthyroidism and multiple organ damage. The disease can be modelled in mice using adenoviral immunizations with the extracellular A subunit of the TSHR, which induces a long-term stable disease state. TSHR binding cAMP-stimulatory antibodies, thyroid enlargement, elevated serum thyroxin levels, tachycardia, cardiac hypertrophy and orbitopathy are observed in these Ad-TSHR-immunized mice. T cell epitope-derived linear peptides have been identified using immunized HLA-DR3 transgenic mice, which may induce tolerance towards TSHR. A combination of such peptides are being investigated in a first clinical phase I trial in patients with Graves´ disease. Alternatively, intravenous administration of cyclic peptides derived from the interaction site of the TSHR A domain with stimulatory anti-TSHR antibodies can re-establish tolerance towards the antigen in immunized mice, improving symptoms of Graves´ disease within 3 - 4 months after starting these therapies. In immunologically naïve mice, administration of the cyclic peptides did not induce any immune response.
O'Connor, Brian P.; Gleeson, Michael W.; Noelle, Randolph J.; Erickson, Loren D.
2010-01-01
Summary Long-lived humoral immune responses are a hallmark of thymus-dependent immunity. The cellular basis for enduring antibody-mediated immunity is long-lived memory B cells and plasma cells (PCs). Both of these cell populations acquire longevity as a result of antigen-specific, CD40–dependent, cognate interactions with helper T cells within germinal centers (GCs). At the molecular level, defined functional domains of CD40 control the post-GC fate of B cells. PC precursors that emerge from these GC reactions are highly proliferative and terminally differentiate to end-stage cells within the bone marrow (BM). The striking phenotypic similarities between the PC precursors and the putative malignant cell in multiple myeloma (MM) suggests that MM may result from the transformation of PC precursors. Within the domain of autoimmune disease, recent studies have shown that dysregulated migration of PCs to the BM may impact immune homeostasis and the development of lupus. Understanding the processes of normal PC differentiation will provide strategic insights into identifying therapeutic targets for the treatment of differentiated B-cell disorders. PMID:12846808
DOE Office of Scientific and Technical Information (OSTI.GOV)
Venkatachari, Narasimhan J.; Majumder, Biswanath; Ayyavoo, Velpandi
2007-02-20
Human immunodeficiency virus type 1 (HIV-1) viral proteins disrupt the normal host cellular immune pathways thus exploiting the cellular machinery for replication, survival and to escape host immune attack. Here we evaluated the direct effects of HIV-1 Vpr-mediated immune modulation of infected T cells. Vpr specifically downregulated the expression of CD28 and increased the expression of CTLA-4, whereas no significant difference in the expression of CD25 and HLA-DR was observed. Interferon gamma (IFN-{gamma}) production in T cells was evaluated as a measure of the downstream effector functions. Results indicate that Vpr significantly inhibited IFN-{gamma} production and this may, in part,more » due to Vpr's ability to inhibit the nuclear translocation of NF-{kappa}B, and its transcriptional regulation. Together these results support that HIV-1 Vpr selectively dysregulates the immune functions at multiple levels and exerts its inhibitory effects in the presence of other viral proteins.« less
Plasmid DNA vaccination using skin electroporation promotes poly-functional CD4 T-cell responses.
Bråve, Andreas; Nyström, Sanna; Roos, Anna-Karin; Applequist, Steven E
2011-03-01
Plasmid DNA vaccination using skin electroporation (EP) is a promising method able to elicit robust humoral and CD8(+) T-cell immune responses while limiting invasiveness of delivery. However, there is still only limited data available on the induction of CD4(+) T-cell immunity using this method. Here, we compare the ability of homologous prime/boost DNA vaccinations by skin EP and intramuscular (i.m.) injection to elicit immune responses by cytokine enzyme-linked immunosorbent spot (ELISPOT) assay, as well as study the complexity of CD4(+) T-cell responses to the human immunodeficiency virus antigen Gag, using multiparamater flow cytometry. We find that DNA vaccinations by skin EP and i.m. injection are capable of eliciting both single- and poly-functional vaccine-specific CD4(+) T cells. However, although DNA delivered by skin EP was administered at a five-fold lower dose it elicited significant increases in the magnitude of multiple-cytokine producers compared with i.m. immunization suggesting that the skin EP could provide greater poly-functional T-cell help, a feature associated with successful immune defense against infectious agents.
A serine proteinase homologue, SPH-3, plays a central role in insect immunity.
Felföldi, Gabriella; Eleftherianos, Ioannis; Ffrench-Constant, Richard H; Venekei, István
2011-04-15
Numerous vertebrate and invertebrate genes encode serine proteinase homologues (SPHs) similar to members of the serine proteinase family, but lacking one or more residues of the catalytic triad. These SPH proteins are thought to play a role in immunity, but their precise functions are poorly understood. In this study, we show that SPH-3 (an insect non-clip domain-containing SPH) is of central importance in the immune response of a model lepidopteran, Manduca sexta. We examine M. sexta infection with a virulent, insect-specific, Gram-negative bacterium Photorhabdus luminescens. RNA interference suppression of bacteria-induced SPH-3 synthesis severely compromises the insect's ability to defend itself against infection by preventing the transcription of multiple antimicrobial effector genes, but, surprisingly, not the transcription of immune recognition genes. Upregulation of the gene encoding prophenoloxidase and the activity of the phenoloxidase enzyme are among the antimicrobial responses that are severely attenuated on SPH-3 knockdown. These findings suggest the existence of two largely independent signaling pathways controlling immune recognition by the fat body, one governing effector gene transcription, and the other regulating genes encoding pattern recognition proteins.
Helminth–host immunological interactions: prevention and control of immune-mediated diseases
Elliott, David E.; Weinstock, Joel V.
2013-01-01
Exposure to commensal and pathogenic organisms strongly influences our immune system. Exposure to helminths was frequent before humans constructed their current highly hygienic environment. Today, in highly industrialized countries, contact between humans and helminths is rare. Congruent with the decline in helminth infections is an increase in the prevalence of autoimmune and inflammatory disease. It is possible that exclusion of helminths from the environment has permitted the emergence of immune-mediated disease. We review the protective effects of helminths on expression of inflammatory bowel disease, multiple sclerosis, and animal models of these and other inflammatory diseases. We also review the immune pathways altered by helminths that may afford protection from these illnesses. Helminth exposure tends to inhibit IFN-γ and IL-17 production, promote IL-4, IL-10, and TGF-β release, induce CD4+ T cell Foxp3 expression, and generate regulatory macrophages, dendritic cells, and B cells. Helminths enable protective pathways that may vary by specific species and disease model. Helminths or their products likely have therapeutic potential to control or prevent immune-mediated illness. PMID:22239614
Insights into the innate immunome of actiniarians using a comparative genomic approach.
van der Burg, Chloé A; Prentis, Peter J; Surm, Joachim M; Pavasovic, Ana
2016-11-02
Innate immune genes tend to be highly conserved in metazoans, even in early divergent lineages such as Cnidaria (jellyfish, corals, hydroids and sea anemones) and Porifera (sponges). However, constant and diverse selection pressures on the immune system have driven the expansion and diversification of different immune gene families in a lineage-specific manner. To investigate how the innate immune system has evolved in a subset of sea anemone species (Order: Actiniaria), we performed a comprehensive and comparative study using 10 newly sequenced transcriptomes, as well as three publically available transcriptomes, to identify the origins, expansions and contractions of candidate and novel immune gene families. We characterised five conserved genes and gene families, as well as multiple novel innate immune genes, including the newly recognised putative pattern recognition receptor CniFL. Single copies of TLR, MyD88 and NF-κB were found in most species, and several copies of IL-1R-like, NLR and CniFL were found in almost all species. Multiple novel immune genes were identified with domain architectures including the Toll/interleukin-1 receptor (TIR) homology domain, which is well documented as functioning in protein-protein interactions and signal transduction in immune pathways. We hypothesise that these genes may interact as novel proteins in immune pathways of cnidarian species. Novelty in the actiniarian immunome is not restricted to only TIR-domain-containing proteins, as we identify a subset of NLRs which have undergone neofunctionalisation and contain 3-5 N-terminal transmembrane domains, which have so far only been identified in two anthozoan species. This research has significance in understanding the evolution and origin of the core eumetazoan gene set, including how novel innate immune genes evolve. For example, the evolution of transmembrane domain containing NLRs indicates that these NLRs may be membrane-bound, while all other metazoan and plant NLRs are exclusively cytosolic receptors. This is one example of how species without an adaptive immune system may evolve innovative solutions to detect pathogens or interact with native microbiota. Overall, these results provide an insight into the evolution of the innate immune system, and show that early divergent lineages, such as actiniarians, have a diverse repertoire of conserved and novel innate immune genes.
NASA Astrophysics Data System (ADS)
Shi, Ya Ping; Hasnain, Seyed E.; Sacci, John B.; Holloway, Brian P.; Fujioka, Hisashi; Kumar, Nirbhay; Wohlhueter, Robert; Hoffman, Stephen L.; Collins, William E.; Lal, Altaf A.
1999-02-01
Compared with a single-stage antigen-based vaccine, a multistage and multivalent Plasmodium falciparum vaccine would be more efficacious by inducing "multiple layers" of immunity. We have constructed a synthetic gene that encodes for 12 B cell, 6 T cell proliferative, and 3 cytotoxic T lymphocyte epitopes derived from 9 stage-specific P. falciparum antigens corresponding to the sporozoite, liver, erythrocytic asexual, and sexual stages. The gene was expressed in the baculovirus system, and a 41-kDa antigen, termed CDC/NIIMALVAC-1, was purified. Immunization in rabbits with the purified protein in the presence of different adjuvants generated antibody responses that recognized vaccine antigen, linear peptides contained in the vaccine, and all stages of P. falciparum. In vitro assays of protection revealed that the vaccine-elicited antibodies strongly inhibited sporozoite invasion of hepatoma cells and growth of blood-stage parasites in the presence of monocytes. These observations demonstrate that a multicomponent, multistage malaria vaccine can induce immune responses that inhibit parasite development at multiple stages. The rationale and approach used in the development of a multicomponent P. falciparum vaccine will be useful in the development of a multispecies human malaria vaccine and vaccines against other infectious diseases.
Restoring Natural Killer Cell Immunity against Multiple Myeloma in the Era of New Drugs
Pittari, Gianfranco; Vago, Luca; Festuccia, Moreno; Bonini, Chiara; Mudawi, Deena; Giaccone, Luisa; Bruno, Benedetto
2017-01-01
Transformed plasma cells in multiple myeloma (MM) are susceptible to natural killer (NK) cell-mediated killing via engagement of tumor ligands for NK activating receptors or “missing-self” recognition. Similar to other cancers, MM targets may elude NK cell immunosurveillance by reprogramming tumor microenvironment and editing cell surface antigen repertoire. Along disease continuum, these effects collectively result in a progressive decline of NK cell immunity, a phenomenon increasingly recognized as a critical determinant of MM progression. In recent years, unprecedented efforts in drug development and experimental research have brought about emergence of novel therapeutic interventions with the potential to override MM-induced NK cell immunosuppression. These NK-cell enhancing treatment strategies may be identified in two major groups: (1) immunomodulatory biologics and small molecules, namely, immune checkpoint inhibitors, therapeutic antibodies, lenalidomide, and indoleamine 2,3-dioxygenase inhibitors and (2) NK cell therapy, namely, adoptive transfer of unmanipulated and chimeric antigen receptor-engineered NK cells. Here, we summarize the mechanisms responsible for NK cell functional suppression in the context of cancer and, specifically, myeloma. Subsequently, contemporary strategies potentially able to reverse NK dysfunction in MM are discussed. PMID:29163516
Yokokawa, Hiroshi; Higashino, Atsunori; Suzuki, Saori; Moriyama, Masaki; Nakamura, Noriko; Suzuki, Tomohiko; Suzuki, Ryosuke; Ishii, Koji; Kobiyama, Kouji; Ishii, Ken J; Wakita, Takaji; Akari, Hirofumi; Kato, Takanobu
2018-02-01
Although HCV is a major cause of chronic liver disease worldwide, there is currently no prophylactic vaccine for this virus. Thus, the development of an HCV vaccine that can induce both humoural and cellular immunity is urgently needed. To create an effective HCV vaccine, we evaluated neutralising antibody induction and cellular immune responses following the immunisation of a non-human primate model with cell culture-generated HCV (HCVcc). To accomplish this, 10 common marmosets were immunised with purified, inactivated HCVcc in combination with two different adjuvants: the classically used aluminum hydroxide (Alum) and the recently established adjuvant: CpG oligodeoxynucleotide (ODN) wrapped by schizophyllan (K3-SPG). The coadministration of HCVcc with K3-SPG efficiently induced immune responses against HCV, as demonstrated by the production of antibodies with specific neutralising activity against chimaeric HCVcc with structural proteins from multiple HCV genotypes (1a, 1b, 2a and 3a). The induction of cellular immunity was also demonstrated by the production of interferon-γ mRNA in spleen cells following stimulation with the HCV core protein. These changes were not observed following immunisation with HCVcc/Alum preparation. No vaccination-related abnormalities were detected in any of the immunised animals. The current preclinical study demonstrated that a vaccine included both HCVcc and K3-SPG induced humoural and cellular immunity in marmosets. Vaccination with this combination resulted in the production of antibodies exhibiting cross-neutralising activity against multiple HCV genotypes. Based on these findings, the vaccine created in this study represents a promising, potent and safe prophylactic option against HCV. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.
Novel immunotherapeutic approaches for the treatment of acute leukemia (myeloid and lymphoblastic)
Ishii, Kazusa; Barrett, Austin J.
2016-01-01
There have been major advances in our understanding of the multiple interactions between malignant cells and the innate and adaptive immune system. While the attention of immunologists has hitherto focused on solid tumors, the specific immunobiology of acute leukemias is now becoming defined. These discoveries have pointed the way to immune interventions building on the established graft-versus-leukemia (GVL) effect from hematopoietic stem-cell transplant (HSCT) and extending immunotherapy beyond HSCT to individuals with acute leukemia with a diversity of immune manipulations early in the course of the leukemia. At present, clinical results are in their infancy. In the coming years larger studies will better define the place of immunotherapy in the management of acute leukemias and lead to treatment approaches that combine conventional chemotherapy, immunotherapy and HSCT to achieve durable cures. PMID:26834952
Biosignatures of Exposure/Transmission and Immunity.
King, Christopher L; Davies, D Huw; Felgner, Phil; Baum, Elizabeth; Jain, Aarti; Randall, Arlo; Tetteh, Kevin; Drakeley, Christopher J; Greenhouse, Bryan
2015-09-01
A blood test that captures cumulative exposure over time and assesses levels of naturally acquired immunity (NAI) would provide a critical tool to monitor the impact of interventions to reduce malaria transmission and broaden our understanding of how NAI develops around the world as a function of age and exposure. This article describes a collaborative effort in multiple International Centers of Excellence in Malaria Research (ICEMRs) to develop such tests using malaria-specific antibody responses as biosignatures of transmission and immunity. The focus is on the use of Plasmodium falciparum and Plasmodium vivax protein microarrays to identify a panel of the most informative antibody responses in diverse malaria-endemic settings representing an unparalleled spectrum of malaria transmission and malaria species mixes before and after interventions to reduce malaria transmission. © The American Society of Tropical Medicine and Hygiene.
Targeting methionine cycle as a potential therapeutic strategy for immune disorders.
Li, Heng; Lu, Huimin; Tang, Wei; Zuo, Jianping
2017-08-23
Methionine cycle plays an essential role in regulating many cellular events, especially transmethylation reactions, incorporating the methyl donor S-adenosylmethionine (SAM). The transmethylations and substances involved in the cycle have shown complicated effects and mechanisms on immunocytes developments and activations, and exert crucial impacts on the pathological processes in immune disorders. Areas covered: Methionine cycle has been considered as an effective means of drug developments. This review discussed the role of methionine cycle in immune responses and summarized the potential therapeutic strategies based on the cycle, including SAM analogs, methyltransferase inhibitors, S-adenosylhomocysteine hydrolase (SAHH) inhibitors, adenosine receptors specific agonists or antagonists and homocysteine (Hcy)-lowering reagents, in treating human immunodeficiency virus (HIV) infections, systemic lupus erythematosus (SLE), rheumatoid arthritis (RA), multiple sclerosis (MS), systemic sclerosis (SSc) and other immune disorders. Expert opinion: New targets and biomarkers grown out of methionine cycle have developed rapidly in the past decades. However, impacts of epigenetic regulations on immune disorders are unclear and whether the substances in methionine cycle can be clarified as biomarkers remains controversial. Therefore, further elucidation on the role of epigenetic regulations and substances in methionine cycle may contribute to exploring the cycle-derived biomarkers and drugs in immune disorders.
As we age: Does slippage of quality control in the immune system lead to collateral damage?
Müller, Ludmila; Pawelec, Graham
2015-09-01
The vertebrate adaptive immune system is remarkable for its possession of a very broad range of antigen receptors imbuing the system with exquisite specificity, in addition to the phagocytic and inflammatory cells of the innate system shared with invertebrates. This system requires strict control both at the level of the generation the cells carrying these receptors and at the level of their activation and effector function mediation in order to avoid autoimmunity and mitigate immune pathology. Thus, quality control checkpoints are built into the system at multiple nodes in the response, relying on clonal selection and regulatory networks to maximize pathogen-directed effects and minimize collateral tissue damage. However, these checkpoints are compromised with age, resulting in poorer immune control manifesting as tissue-damaging autoimmune and inflammatory phenomena which can cause widespread systemic disease, paradoxically compounding the problems associated with increased susceptibility to infectious disease and possibly cancer in the elderly. Better understanding the reasons for slippage of immune control will pave the way for developing rational strategies for interventions to maintain appropriate immunity while reducing immunopathology. Copyright © 2015 Elsevier B.V. All rights reserved.
Effects of chalcone derivatives on players of the immune system
Lee, Jian Sian; Bukhari, Syed Nasir Abbas; Fauzi, Norsyahida Mohd
2015-01-01
The immune system is the defense mechanism in living organisms that protects against the invasion of foreign materials, microorganisms, and pathogens. It involves multiple organs and tissues in human body, such as lymph nodes, spleen, and mucosa-associated lymphoid tissues. However, the execution of immune activities depends on a number of specific cell types, such as B cells, T cells, macrophages, and granulocytes, which provide various immune responses against pathogens. In addition to normal physiological functions, abnormal proliferation, migration, and differentiation of these cells (in response to various chemical stimuli produced by invading pathogens) have been associated with several pathological disorders. The unwanted conditions related to these cells have made them prominent targets in the development of new therapeutic interventions against various pathological implications, such as atherosclerosis and autoimmune diseases. Chalcone derivatives exhibit a broad spectrum of pharmacological activities, such as immunomodulation, as well as anti-inflammatory, anticancer, antiviral, and antimicrobial properties. Many studies have been conducted to determine their inhibitory or stimulatory activities in immune cells, and the findings are of significance to provide a new direction for subsequent research. This review highlights the effects of chalcone derivatives in different types of immune cells. PMID:26316713
Ricciardi, M; Zanotto, M; Malpeli, G; Bassi, G; Perbellini, O; Chilosi, M; Bifari, F; Krampera, M
2015-03-17
Epithelial-to-mesenchymal transition (EMT) has a central role in cancer progression and metastatic dissemination and may be induced by local inflammation. We asked whether the inflammation-induced acquisition of mesenchymal phenotype by neoplastic epithelial cells is associated with the onset of mesenchymal stromal cell-like immune-regulatory properties that may enhance tumour immune escape. Cell lines of lung adenocarcinoma (A549), breast cancer (MCF7) and hepatocellular carcinoma (HepG2) were co-cultured with T, B and NK cells before and after EMT induction by either the supernatant of mixed-lymphocyte reactions or inflammatory cytokines. EMT occurrence following inflammatory priming elicited multiple immune-regulatory effects in cancer cells resulting in NK and T-cell apoptosis, inhibition of lymphocyte proliferation and stimulation of regulatory T and B cells. Indoleamine 2,3-dioxygenase, but not Fas ligand pathway, was involved at least in part in these effects, as shown by the use of specific inhibitors. EMT induced by inflammatory stimuli confers to cancer cells some mesenchymal stromal cell-like immune-modulatory properties, which could be a cue for cancer progression and metastatic dissemination by favouring immune escape.
Advances in the understanding of cancer immunotherapy.
Shore, Neal D
2015-09-01
The principal role of the immune system is to prevent and eradicate pathogens and infections. The key characteristics or features of an effective immune response include specificity, trafficking, antigen spread and durability (memory). The immune system is recognised to have a critical role in controlling cancer through a dynamic relationship with tumour cells. Normally, at the early stages of tumour development, the immune system is capable of eliminating tumour cells or keeping tumour growth abated; however, tumour cells may evolve multiple pathways over time to evade immune control. Immunotherapy may be viewed as a treatment designed to boost or restore the ability of the immune system to fight cancer, infections and other diseases. Immunotherapy manifests differently from traditional cancer treatments, eliciting delayed response kinetics and thus may be more effective in patients with lower tumour burden, in whom disease progression may be less rapid, thereby allowing ample time for the immunotherapy to evolve. Because immunotherapies may have a different mechanism of action from traditional cytotoxic or targeted biological agents, immunotherapy techniques have the potential to combine synergistically with traditional therapies. © 2014 The Authors. BJU International © 2014 BJU International Published by John Wiley & Sons Ltd.
Mbaeyi, Chukwuma; Kamawal, Noor Shah; Porter, Kimberly A; Azizi, Adam Khan; Sadaat, Iftekhar; Hadler, Stephen; Ehrhardt, Derek
2017-07-01
The Basic Package of Health Services (BPHS) program has increased access to immunization services for children living in rural Afghanistan. However, multiple surveys have indicated persistent immunization coverage gaps. Hence, to identify gaps in implementation, an assessment of the BPHS program was undertaken, with specific focus on the routine immunization (RI) component. A cross-sectional survey was conducted in 2014 on a representative sample drawn from a sampling frame of 1858 BPHS health facilities. Basic descriptive analysis was performed, capturing general characteristics of survey respondents and assessing specific RI components, and χ2 tests were used to evaluate possible differences in service delivery by type of health facility. Of 447 survey respondents, 27% were health subcenters (HSCs), 30% were basic health centers, 32% were comprehensive health centers, and 12% were district hospitals. Eighty-seven percent of all respondents offered RI services, though only 61% of HSCs did so. Compared with other facility types, HSCs were less likely to have adequate stock of vaccines, essential cold-chain equipment, or proper documentation of vaccination activities. There is an urgent need to address manpower and infrastructural deficits in RI service delivery through the BPHS program, especially at the HSC level. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America.
Spritz, Richard; Andersen, Genevieve
2016-01-01
Synopsis Vitiligo is “complex disorder” (also termed polygenic and multifactorial), reflecting simultaneous contributions of multiple genetic risk factors and environmental triggers. Large-scale genome-wide association studies, principally in European-derived whites and in Chinese, have discovered approximately 50 different genetic loci that contribute to vitiligo risk, some of which also contribute to other autoimmune diseases that are epidemiologically associated with vitiligo. At many of these vitiligo susceptibility loci the corresponding relevant genes have now been identified, and for some of these genes the specific DNA sequence variants that contribute to vitiligo risk are also now known. A large fraction of these genes encode proteins involved in immune regulation, a number of others play roles in cellular apoptosis, and still others are involved in regulating functions of melanocytes. For this last group, there appears to be an opposite relationship between susceptibility to vitiligo and susceptibility to melanoma, suggesting that vitiligo may engage a normal mechanism of immune surveillance for melanoma. While many of the specific biologic mechanisms through which these genetic factors operate to cause vitiligo remain to be elucidated, it is now clear that vitiligo is an autoimmune disease involving a complex relationship between programming and function of the immune system, aspects of the melanocyte autoimmune target, and dysregulation of the immune response. PMID:28317533
The Immune Landscape of Cancer.
Thorsson, Vésteinn; Gibbs, David L; Brown, Scott D; Wolf, Denise; Bortone, Dante S; Ou Yang, Tai-Hsien; Porta-Pardo, Eduard; Gao, Galen F; Plaisier, Christopher L; Eddy, James A; Ziv, Elad; Culhane, Aedin C; Paull, Evan O; Sivakumar, I K Ashok; Gentles, Andrew J; Malhotra, Raunaq; Farshidfar, Farshad; Colaprico, Antonio; Parker, Joel S; Mose, Lisle E; Vo, Nam Sy; Liu, Jianfang; Liu, Yuexin; Rader, Janet; Dhankani, Varsha; Reynolds, Sheila M; Bowlby, Reanne; Califano, Andrea; Cherniack, Andrew D; Anastassiou, Dimitris; Bedognetti, Davide; Rao, Arvind; Chen, Ken; Krasnitz, Alexander; Hu, Hai; Malta, Tathiane M; Noushmehr, Houtan; Pedamallu, Chandra Sekhar; Bullman, Susan; Ojesina, Akinyemi I; Lamb, Andrew; Zhou, Wanding; Shen, Hui; Choueiri, Toni K; Weinstein, John N; Guinney, Justin; Saltz, Joel; Holt, Robert A; Rabkin, Charles E; Lazar, Alexander J; Serody, Jonathan S; Demicco, Elizabeth G; Disis, Mary L; Vincent, Benjamin G; Shmulevich, Llya
2018-04-17
We performed an extensive immunogenomic analysis of more than 10,000 tumors comprising 33 diverse cancer types by utilizing data compiled by TCGA. Across cancer types, we identified six immune subtypes-wound healing, IFN-γ dominant, inflammatory, lymphocyte depleted, immunologically quiet, and TGF-β dominant-characterized by differences in macrophage or lymphocyte signatures, Th1:Th2 cell ratio, extent of intratumoral heterogeneity, aneuploidy, extent of neoantigen load, overall cell proliferation, expression of immunomodulatory genes, and prognosis. Specific driver mutations correlated with lower (CTNNB1, NRAS, or IDH1) or higher (BRAF, TP53, or CASP8) leukocyte levels across all cancers. Multiple control modalities of the intracellular and extracellular networks (transcription, microRNAs, copy number, and epigenetic processes) were involved in tumor-immune cell interactions, both across and within immune subtypes. Our immunogenomics pipeline to characterize these heterogeneous tumors and the resulting data are intended to serve as a resource for future targeted studies to further advance the field. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.
Vasilevko, Vitaly; Pop, Viorela; Kim, Hyun Jin; Saing, Tommy; Glabe, Charles C.; Milton, Saskia; Barrett, Edward G.; Cotman, Carl W.; Cribbs, David H.; Head, Elizabeth
2010-01-01
Previously we showed that anti-Aβ peptide immunotherapy significantly attenuated Alzheimer’s-like amyloid deposition in the central nervous system of aged canines. In this report we have characterized the changes that occurred in the humoral immune response over 2.4 years in canines immunized repeatedly with aggregated Aβ1–42 (AN1792) formulated in alum adjuvant. We observed a rapid and robust induction of anti-Aβ antibody titers, which were associated with an anti-inflammatory T helper type 2 (Th2) response. The initial antibody response was against dominant linear epitope at the N-terminus region of the Aβ1–42 peptide, which is identical to the one in humans and vervet monkeys. After multiple immunizations the antibody response drifted toward the elevation of antibodies that recognized conformational epitopes of assembled forms of Aβ and other types of amyloid. Our findings indicate that prolonged immunization results in distinctive temporal changes in antibody profiles, which may be important for other experimental and clinical settings. PMID:20451612
dOCRL maintains immune cell quiescence by regulating endosomal traffic
Del Signore, Steven J.; Biber, Sarah A.; Lehmann, Katherine S.; Heimler, Stephanie R.; Rosenfeld, Benjamin H.; Eskin, Tania L.
2017-01-01
Lowe Syndrome is a developmental disorder characterized by eye, kidney, and neurological pathologies, and is caused by mutations in the phosphatidylinositol-5-phosphatase OCRL. OCRL plays diverse roles in endocytic and endolysosomal trafficking, cytokinesis, and ciliogenesis, but it is unclear which of these cellular functions underlie specific patient symptoms. Here, we show that mutation of Drosophila OCRL causes cell-autonomous activation of hemocytes, which are macrophage-like cells of the innate immune system. Among many cell biological defects that we identified in docrl mutant hemocytes, we pinpointed the cause of innate immune cell activation to reduced Rab11-dependent recycling traffic and concomitantly increased Rab7-dependent late endosome traffic. Loss of docrl amplifies multiple immune-relevant signals, including Toll, Jun kinase, and STAT, and leads to Rab11-sensitive mis-sorting and excessive secretion of the Toll ligand Spåtzle. Thus, docrl regulation of endosomal traffic maintains hemocytes in a poised, but quiescent state, suggesting mechanisms by which endosomal misregulation of signaling may contribute to symptoms of Lowe syndrome. PMID:29028801
Molecular mechanisms of CRISPR-mediated microbial immunity.
Gasiunas, Giedrius; Sinkunas, Tomas; Siksnys, Virginijus
2014-02-01
Bacteriophages (phages) infect bacteria in order to replicate and burst out of the host, killing the cell, when reproduction is completed. Thus, from a bacterial perspective, phages pose a persistent lethal threat to bacterial populations. Not surprisingly, bacteria evolved multiple defense barriers to interfere with nearly every step of phage life cycles. Phages respond to this selection pressure by counter-evolving their genomes to evade bacterial resistance. The antagonistic interaction between bacteria and rapidly diversifying viruses promotes the evolution and dissemination of bacteriophage-resistance mechanisms in bacteria. Recently, an adaptive microbial immune system, named clustered regularly interspaced short palindromic repeats (CRISPR) and which provides acquired immunity against viruses and plasmids, has been identified. Unlike the restriction–modification anti-phage barrier that subjects to cleavage any foreign DNA lacking a protective methyl-tag in the target site, the CRISPR–Cas systems are invader-specific, adaptive, and heritable. In this review, we focus on the molecular mechanisms of interference/immunity provided by different CRISPR–Cas systems.
Ahonen, Cory L; Wasiuk, Anna; Fuse, Shinichiro; Turk, Mary Jo; Ernstoff, Marc S; Suriawinata, Arief A; Gorham, James D; Kedl, Ross M; Usherwood, Edward J; Noelle, Randolph J
2008-03-15
Identification of Toll-like receptors (TLRs) and their ligands, and tumor necrosis factor-tumor necrosis factor receptor (TNF-TNFR) pairs have provided the first logical, hypothesis-based strategies to molecularly concoct adjuvants to elicit potent cell-mediated immunity via activation of innate and adaptive immunity. However, isolated activation of one immune pathway in the absence of others can be toxic, ineffective, and detrimental to long-term, protective immunity. Effective engineered vaccines must include agents that trigger multiple immunologic pathways. Here, we report that combinatorial use of CD40 and TLR agonists as a cancer vaccine, compared with monotherapy, elicits high frequencies of self-reactive CD8(+) T cells, potent tumor-specific CD8(+) memory, CD8(+) T cells that efficiently infiltrate the tumor-burdened target organ; therapeutic efficacy; heightened ratios of CD8(+) T cells to FoxP3(+) cells at the tumor site; and reduced hepatotoxicity. These findings provide intelligent strategies for the formulation of multifactorial vaccines to achieve maximal efficacy in cancer vaccine trials in humans.
Kaplan, Barbara L F
2018-02-21
Cannabinoid compounds refer to a group of more than 60 plant-derived compounds in Cannabis sativa, more commonly known as marijuana. Exposure to marijuana and cannabinoid compounds has been increasing due to increased societal acceptance for both recreational and possible medical use. Cannabinoid compounds suppress immune function, and while this could compromise one's ability to fight infections, immune suppression is the desired effect for therapies for autoimmune diseases. It is critical, therefore, to understand the effects and mechanisms by which cannabinoid compounds alter immune function, especially immune responses induced in autoimmune disease. Therefore, this unit will describe induction and assessment of the experimental autoimmune encephalomyelitis (EAE) model of multiple sclerosis (MS), and its potential alteration by cannabinoid compounds. The unit includes three approaches to induce EAE, two of which provide correlations to two forms of MS, and the third specifically addresses the role of autoreactive T cells in EAE. © 2018 by John Wiley & Sons, Inc. Copyright © 2018 John Wiley & Sons, Inc.
Neutrophils Are Central to Antibody-Mediated Protection against Genital Chlamydia.
Naglak, Elizabeth K; Morrison, Sandra G; Morrison, Richard P
2017-10-01
Determining the effector populations involved in humoral protection against genital chlamydia infection is crucial to development of an effective chlamydial vaccine. Antibody has been implicated in protection studies in multiple animal models, and we previously showed that the passive transfer of immune serum alone does not confer immunity in the mouse. Using the Chlamydia muridarum model of genital infection, we demonstrate a protective role for both Chlamydia -specific immunoglobulin G (IgG) and polymorphonuclear neutrophils and show the importance of an antibody/effector cell interaction in mediating humoral immunity. While neutrophils were found to contribute significantly to antibody-mediated protection in vivo , natural killer (NK) cells were dispensable for protective immunity. Furthermore, gamma interferon (IFN-γ)-stimulated primary peritoneal neutrophils (PPNs) killed chlamydiae in vitro in an antibody-dependent manner. The results from this study support the view that an IFN-γ-activated effector cell population cooperates with antibody to protect against genital chlamydia and establish neutrophils as a key effector cell in this response. Copyright © 2017 Naglak et al.
Redundant role of tissue-selective TAF(II)105 in B lymphocytes.
Freiman, Richard N; Albright, Shane R; Chu, Leslie E; Zheng, Shuang; Liang, Hong-Erh; Sha, William C; Tjian, Robert
2002-09-01
Regulated gene expression is a complex process achieved through the function of multiple protein factors acting in concert at a given promoter. The transcription factor TFIID is a central component of the machinery regulating mRNA synthesis by RNA polymerase II. This large multiprotein complex is composed of the TATA box binding protein (TBP) and several TBP-associated factors (TAF(II)s). The recent discovery of multiple TBP-related factors and tissue-specific TAF(II)s suggests the existence of specialized TFIID complexes that likely play a critical role in regulating transcription in a gene- and tissue-specific manner. The tissue-selective factor TAF(II)105 was originally identified as a component of TFIID derived from a human B-cell line. In this report we demonstrate the specific induction of TAF(II)105 in cultured B cells in response to bacterial lipopolysaccharide (LPS). To examine the in vivo role of TAF(II)105, we have generated TAF(II)105-null mice by homologous recombination. Here we show that B-lymphocyte development is largely unaffected by the absence of TAF(II)105. TAF(II)105-null B cells can proliferate in response to LPS, produce relatively normal levels of resting antibodies, and can mount an immune response by producing antigen-specific antibodies in response to immunization. Taken together, we conclude that the function of TAF(II)105 in B cells is likely redundant with the function of other TAF(II)105-related cellular proteins.
Jiang, Janina; Liu, Guangchao; Kickhoefer, Valerie A; Rome, Leonard H; Li, Lin-Xi; McSorley, Stephen J; Kelly, Kathleen A
2017-01-19
Chlamydia trachomatis genital infection is the most common sexually transmitted bacterial disease, causing a significant burden to females due to reproductive dysfunction. Intensive screening and antibiotic treatment are unable to completely prevent female reproductive dysfunction, thus, efforts have become focused on developing a vaccine. A major impediment is identifying a safe and effective adjuvant which induces cluster of differentiation 4 (CD4) cells with attributes capable of halting genital infection and inflammation. Previously, we described a natural nanocapsule called the vault which was engineered to contain major outer membrane protein (MOMP) and was an effective vaccine which significantly reduced early infection and favored development of a cellular immune response in a mouse model. In the current study, we used another chlamydial antigen, a polymorphic membrane protein G-1 (PmpG) peptide, to track antigen-specific cells and evaluate, in depth, the vault vaccine for its protective capacity in the absence of an added adjuvant. We found PmpG-vault immunized mice significantly reduced the genital bacterial burden and histopathologic parameters of inflammation following a C. muridarum challenge. Immunization boosted antigen-specific CD4 cells with a multiple cytokine secretion pattern and reduced the number of inflammatory cells in the genital tract making the vault vaccine platform safe and effective for chlamydial genital infection. We conclude that vaccination with a Chlamydia -vault vaccine boosts antigen-specific immunities that are effective at eradicating infection and preventing reproductive tract inflammation.
Immune defense and reproductive pace of life in Peromyscus mice.
Martin, Lynn B; Weil, Zachary M; Nelson, Randy J
2007-10-01
Immune activity is variable within and among vertebrates despite the potentially large fitness costs of pathogens to their hosts. From the perspective of life history theory, immunological variability may be the consequence of counterbalancing investments in immune defense against other expensive physiological processes, namely, reproduction. In the present study, we tested the hypothesis that immune defense among captive-bred, disease-free Peromyscus mice would be influenced by their reproductive life history strategies. Specifically, we expected that small species that reproduce prolifically and mature rapidly (i.e., fast pace of life) would favor inexpensive, nonspecific immune defenses to promote reproductive proclivity. Alternatively, we expected that large species that mature slowly and invest modestly in reproduction over multiple events (i.e., slow pace of life) would favor developmentally expensive, specific immune defenses and avoid cheap, nonspecific ones because such defenses are predisposed to self-damage. We found that species exhibited either strong ability to kill (gram-negative) bacteria, a developmentally inexpensive defense, or strong ability to produce antibodies against a novel protein, a developmentally expensive defense, but not both. Cell-mediated inflammation also varied significantly among species, but in a unique fashion relative to bacteria killing or antibody production; wound healing was comparatively similar among species. These results indicate that Peromyscus species use immune strategies that are constrained to a dominant axis, but this axis is not determined solely by reproductive pace of life. Further comparisons, ideally with broader phylogenetic coverage, could identify what ecological and evolutionary forces produce the pattern we detected. Importantly, our study indicates that species may not be differentially immunocompetent; rather, they use unique defense strategies to prevent infection.
Stuehler, Claudia; Bernardini, Claudia; Elzi, Luigia; Stoeckle, Marcel; Zimmerli, Stefan; Furrer, Hansjakob; Günthard, Huldrych F.; Leibundgut-Landmann, Salomé; Battegay, Manuel; Khanna, Nina
2016-01-01
Objective: Candida esophagitis belongs to the most common AIDS-defining diseases; however, a comprehensive immune pathogenic concept is lacking. Design: We investigated the immune status of 37 HIV-1-infected patients from the Swiss HIV cohort study at diagnosis of Candida esophagitis, 1 year before, 1 year later and after 2 years of suppressed HIV RNA. We compared these patients with three groups: 37 HIV-1-infected patients without Candida esophagitis but similar CD4+ cell counts as the patients at diagnosis (advanced HIV group), 15 HIV-1-infected patients with CD4+ cell counts higher than 500 cells/μl, CD4+ cell nadirs higher than 350 cells/μl and suppressed HIV RNA under combination antiretroviral therapy (cART) (early cART group) and 20 healthy individuals. Methods: We investigated phenotype, cytokine production and proliferative capacity of different immune cells by flow cytometry and enzyme-linked immunosorbent spot. Results: We found that patients with Candida esophagitis had nearly abolished CD4+ cell proliferation in response to Candida albicans, significantly increased percentages of dysfunctional CD4+ cells, significantly decreased cytotoxic natural killer cell counts and peripheral innate lymphoid cell counts and significantly reduced IFN-γ and IL-17 production compared with the early cART group and healthy individuals. Most of these defects remained for more than 2 years despite viral suppression. The advanced HIV group without opportunistic infection showed partly improved immune recovery. Conclusion: Our data indicate that Candida esophagitis in HIV-1-infected patients is caused by an accumulation of multiple, partly Candida-specific immunological defects. Long-term immune recovery is impaired, illustrating that specific immunological gaps persist despite cART. These data also support the rationale for early cART initiation to prevent irreversible immune defects. PMID:27149086
Inbreeding effects on immune response in free-living song sparrows (Melospiza melodia).
Reid, Jane M; Arcese, Peter; Keller, Lukas F; Elliott, Kyle H; Sampson, Laura; Hasselquist, Dennis
2007-03-07
The consequences of inbreeding for host immunity to parasitic infection have broad implications for the evolutionary and dynamical impacts of parasites on populations where inbreeding occurs. To rigorously assess the magnitude and the prevalence of inbreeding effects on immunity, multiple components of host immune response should be related to inbreeding coefficient (f) in free-living individuals. We used a pedigreed, free-living population of song sparrows (Melospiza melodia) to test whether individual responses to widely used experimental immune challenges varied consistently with f. The patagial swelling response to phytohaemagglutinin declined markedly with f in both females and males in both 2002 and 2003, although overall inbreeding depression was greater in males. The primary antibody response to tetanus toxoid declined with f in females but not in males in both 2004 and 2005. Primary antibody responses to diphtheria toxoid were low but tended to decline with f in 2004. Overall inbreeding depression did not solely reflect particularly strong immune responses in outbred offspring of immigrant-native pairings or weak responses in highly inbred individuals. These data indicate substantial and apparently sex-specific inbreeding effects on immune response, implying that inbred hosts may be relatively susceptible to parasitic infection to differing degrees in males and females.
Kill: boosting HIV-specific immune responses.
Trautmann, Lydie
2016-07-01
Increasing evidence suggests that purging the latent HIV reservoir in virally suppressed individuals will require both the induction of viral replication from its latent state and the elimination of these reactivated HIV-infected cells ('Shock and Kill' strategy). Boosting potent HIV-specific CD8 T cells is a promising way to achieve an HIV cure. Recent studies provided the rationale for developing immune interventions to increase the numbers, function and location of HIV-specific CD8 T cells to purge HIV reservoirs. Multiple approaches are being evaluated including very early suppression of HIV replication in acute infection, adoptive cell transfer, therapeutic vaccination or use of immunomodulatory molecules. New assays to measure the killing and antiviral function of induced HIV-specific CD8 T cells have been developed to assess the efficacy of these new approaches. The strategies combining HIV reactivation and immunobased therapies to boost HIV-specific CD8 T cells can be tested in in-vivo and in-silico models to accelerate the design of new clinical trials. New immunobased strategies are explored to boost HIV-specific CD8 T cells able to purge the HIV-infected cells with the ultimate goal of achieving spontaneous control of viral replication without antiretroviral treatment.
“Viral déjà vu” elicits organ-specific immune disease independent of reactivity to self
Merkler, Doron; Horvath, Edit; Bruck, Wolfgang; Zinkernagel, Rolf M.; del la Torre, Juan Carlos; Pinschewer, Daniel D.
2006-01-01
Autoimmune diseases are often precipitated by viral infections. Yet our current understanding fails to explain how viruses trigger organ-specific autoimmunity despite thymic tolerance extending to many nonlymphohematopoietic self antigens. Additionally, a key epidemiological finding needs to be explained: In genetically susceptible individuals, early childhood infections seem to predispose them to multiple sclerosis (MS) or type 1 diabetes years or even decades before clinical onset. In the present work, we show that the innate immune system of neonatal mice was sufficient to eliminate an attenuated lymphocytic choriomeningitis virus (LCMV) from most tissues except for the CNS, where the virus persisted in neurons (predisposing virus). Virus-specific cytotoxic T cells (CTLs) were neither deleted nor sufficiently primed to cause disease, but they were efficiently triggered in adulthood upon WT LCMV infection (precipitating virus). This defined sequence of viral infections caused severe CNS inflammation that was histomorphologically reminiscent of rasmussen encephalitis, a fatal human autoimmune disease. Yet disease in mice was mediated by antiviral CTLs targeting an epitope shared by the precipitating virus and the predisposing virus persisting in neurons (déjà vu). Thus the concept of “viral déjà vu” demonstrates how 2 related but independently encountered viral infections can cause organ-specific immune disease without molecular mimicry of self and without breaking self tolerance. PMID:16604192
Plant immunity: unravelling the complexity of plant responses to biotic stresses.
Miller, Robert Neil Gerard; Costa Alves, Gabriel Sergio; Van Sluys, Marie-Anne
2017-03-01
Plants are constantly exposed to evolving pathogens and pests, with crop losses representing a considerable threat to global food security. As pathogen evolution can overcome disease resistance that is conferred by individual plant resistance genes, an enhanced understanding of the plant immune system is necessary for the long-term development of effective disease management strategies. Current research is rapidly advancing our understanding of the plant innate immune system, with this multidisciplinary subject area reflected in the content of the 18 papers in this Special Issue. Advances in specific areas of plant innate immunity are highlighted in this issue, with focus on molecular interactions occurring between plant hosts and viruses, bacteria, phytoplasmas, oomycetes, fungi, nematodes and insect pests. We provide a focus on research across multiple areas related to pathogen sensing and plant immune response. Topics covered are categorized as follows: binding proteins in plant immunity; cytokinin phytohormones in plant growth and immunity; plant-virus interactions; plant-phytoplasma interactions; plant-fungus interactions; plant-nematode interactions; plant immunity in Citrus; plant peptides and volatiles; and assimilate dynamics in source/sink metabolism. Although knowledge of the plant immune system remains incomplete, the considerable ongoing scientific progress into pathogen sensing and plant immune response mechanisms suggests far reaching implications for the development of durable disease resistance against pathogens and pests. © The Author 2017. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com
Anti-tumor immunity induced by an anti-idiotype antibody mimicking human Her-2/neu.
Mohanty, Kartik; Saha, Asim; Pal, Smarajit; Mallick, Palash; Chatterjee, Sunil K; Foon, Kenneth A; Bhattacharya-Chatterjee, Malaya
2007-07-01
Our goal is to apply an anti-idiotype (Id) antibody based vaccine approach for the treatment of Her-2/neu-positive human cancer. Amplification and/or over-expression of Her-2/neu occur in multiple human malignancies and are associated with poor prognosis. Her-2/neu proto-oncogene is a suitable target for cancer immunotherapy. We have developed and characterized a murine monoclonal anti-Id antibody, 6D12 that mimics a specific epitope of Her-2/neu and can be used as a surrogate antigen for Her-2/neu. In this study, the efficacy of 6D12 as a tumor vaccine was evaluated in a murine tumor model. Immunization of immunocompetent C57BL/6 mice with 6D12 conjugated to keyhole limpet hemocyanin and mixed with Freund's adjuvant or 6D12 combined with the adjuvant QS21 induced anti-6D12 as well as anti-Her-2/neu immunity. Her-2/neu-positive human breast carcinoma cells, SK-BR-3 reacted with immunized mice sera as determined by ELISA and flow cytometry. Flow cytometry analysis also demonstrated strong reactivity of immunized mice sera with human Her-2/neu transfected EL4 cells (EL4-Her-2), but no reactivity with nontransfected parental EL4 cells. Antibody dependent cellular cytotoxicity against EL4-Her-2 cells was also observed in presence of immune sera. Mice immunized with 6D12 were protected against a challenge with lethal doses of EL4-Her-2 cells, whereas no protection was observed against parental EL4 cells or when mice were immunized with an unrelated anti-Id antibody and challenged with EL4-Her-2 cells. These data suggest that anti-Id 6D12 vaccine can induce protective Her-2/neu specific antitumor immunity and may serve as a potential network antigen for the treatment of patients with Her-2/neu-positive tumors.
Newman, T A; Woolley, S T; Hughes, P M; Sibson, N R; Anthony, D C; Perry, V H
2001-11-01
Recent evidence has highlighted the fact that axon injury is an important component of multiple sclerosis pathology. The issue of whether a CNS antigen-specific immune response is required to produce axon injury remains unresolved. We investigated the extent and time course of axon injury in a rodent model of a delayed-type hypersensitivity (DTH) reaction directed against the mycobacterium bacille Calmette-Guérin (BCG). Using MRI, we determined whether the ongoing axon injury is restricted to the period during which the blood-brain barrier is compromised. DTH lesions were initiated in adult rats by intracerebral injection of heat-killed BCG followed by a peripheral challenge with BCG. Our findings demonstrate that a DTH reaction to a non-CNS antigen within a CNS white matter tract leads to axon injury. Ongoing axon injury persisted throughout the 3-month period studied and was not restricted to the period of blood-brain barrier breakdown, as detected by MRI enhancing lesions. We have previously demonstrated that matrix metalloproteinases (MMPs) are upregulated in multiple sclerosis plaques and DTH lesions. In this study we demonstrated that microinjection of activated MMPs into the cortical white matter results in axon injury. Our results show that axon injury, possibly mediated by MMPs, is immunologically non-specific and may continue behind an intact blood-brain barrier.
Functional Analysis of the Anti-adalimumab Response Using Patient-derived Monoclonal Antibodies♦
van Schouwenburg, Pauline A.; Kruithof, Simone; Votsmeier, Christian; van Schie, Karin; Hart, Margreet H.; de Jong, Rob N.; van Buren, Esther E. L.; van Ham, Marieke; Aarden, Lucien; Wolbink, Gertjan; Wouters, Diana; Rispens, Theo
2014-01-01
The production of antibodies to adalimumab in autoimmune patients treated with adalimumab is shown to diminish treatment efficacy. We previously showed that these antibodies are almost exclusively neutralizing, indicating a restricted response. Here, we investigated the characteristics of a panel of patient-derived monoclonal antibodies for binding to adalimumab. Single B-cells were isolated from two patients, cultured, and screened for adalimumab specificity. Analysis of variable region sequences of 16 clones suggests that the immune response against adalimumab is broad, involving multiple B-cell clones each using different combinations of V(D)J segments. A strong bias for replacement mutations in the complementarity determining regions was found, indicating an antigen-driven response. We recombinantly expressed 11 different monoclonal antibodies and investigated their affinity and specificity. All clones except one are of high affinity (Kd between 0.6 and 233 pm) and compete with TNF as well as each other for binding to adalimumab. However, binding to a panel of single-point mutants of adalimumab indicates markedly different fine specificities that also result in a differential tendency of each clone to form dimeric and multimeric immune complexes. We conclude that although all anti-adalimumab antibodies compete for binding to TNF, the response is clonally diverse and involves multiple epitopes on adalimumab. These results are important for understanding the relationship between self and non-self or idiotypic determinants on therapeutic antibodies and their potential immunogenicity. PMID:25326381
PD-1 suppresses protective immunity to Streptococcus pneumoniae through a B cell-intrinsic mechanism
McKay, Jerome T.; Egan, Ryan P.; Yammani, Rama D.; Chen, Lieping; Shin, Tahiro; Yagita, Hideo; Haas, Karen M.
2015-01-01
Despite the emergence of the PD-1:PD-1 ligand (PD-L) regulatory axis as a promising target for treating multiple human diseases, remarkably little is known about how this pathway regulates responses to extracellular bacterial infections. We found that PD-1−/− mice, as well as wild type mice treated with a PD-1 blocking antibody, exhibited significantly increased survival against lethal Streptococcus pneumoniae infection following either priming with low-dose pneumococcal respiratory infection or S. pneumoniae-capsular polysaccharide immunization. Enhanced survival in mice with disrupted PD-1:PD-L interactions was explained by significantly increased proliferation, isotype switching, and IgG production by pneumococcal capsule-specific B cells. Both PD-1 ligands, B7-H1 and B7-DC, contributed to PD-1-mediated suppression of protective capsule-specific IgG. Importantly, PD-1 was induced on capsule-specific B cells and suppressed IgG production and protection against pneumococcal infection in a B cell-intrinsic manner. These results provide the first demonstration of a physiologic role for B cell-intrinsic PD-1 expression in vivo. In summary, our study reveals that B cell-expressed PD-1 plays a central role in regulating protection against S. pneumoniae, and thereby represents a promising target for bolstering immunity to encapsulated bacteria. PMID:25624454
Jafri, Salema; Ormiston, Mark L
2017-12-01
Systemic hypertension, preeclampsia, and pulmonary arterial hypertension (PAH) are diseases of high blood pressure in the systemic or pulmonary circulation. Beyond the well-defined contribution of more traditional pathophysiological mechanisms, such as changes in the renin-angiotensin-aldosterone system, to the development of these hypertensive disorders, there is substantial clinical evidence supporting an important role for inflammation and immunity in the pathogenesis of each of these three conditions. Over the last decade, work in small animal models, bearing targeted deficiencies in specific cytokines or immune cell subsets, has begun to clarify the immune-mediated mechanisms that drive changes in vascular structure and tone in hypertensive disease. By summarizing the clinical and experimental evidence supporting a contribution of the immune system to systemic hypertension, preeclampsia, and PAH, the current review highlights the cellular and molecular pathways that are common to all three hypertensive disorders. These mechanisms are centered on an imbalance in CD4 + helper T cell populations, defined by excessive Th17 responses and impaired T reg activity, as well as the excessive activation or impairment of additional immune cell types, including macrophages, dendritic cells, CD8 + T cells, B cells, and natural killer cells. The identification of common immune mechanisms in systemic hypertension, preeclampsia, and PAH raises the possibility of new therapeutic strategies that target the immune component of hypertension across multiple disorders. Copyright © 2017 the American Physiological Society.
Translation Control: A Multifaceted Regulator of Inflammatory Response
Mazumder, Barsanjit; Li, Xiaoxia; Barik, Sailen
2010-01-01
A robust innate immune response is essential to the protection of all vertebrates from infection, but it often comes with the price tag of acute inflammation. If unchecked, a runaway inflammatory response can cause significant tissue damage, resulting in myriad disorders, such as dermatitis, toxicshock, cardiovascular disease, acute pelvic and arthritic inflammatory diseases, and various infections. To prevent such pathologies, cells have evolved mechanisms to rapidly and specifically shut off these beneficial inflammatory activities before they become detrimental. Our review of recent literature, including our own work, reveals that the most dominant and common mechanism is translational silencing, in which specific regulatory proteins or complexes are recruited to cis-acting RNA structures in the untranslated regions of single or multiple mRNAs that code for the inflammatory protein(s). Enhancement of the silencing function may constitute a novel pharmacological approach to prevent immunity-related inflammation. PMID:20304832
Translation control: a multifaceted regulator of inflammatory response.
Mazumder, Barsanjit; Li, Xiaoxia; Barik, Sailen
2010-04-01
A robust innate immune response is essential to the protection of all vertebrates from infection, but it often comes with the price tag of acute inflammation. If unchecked, a runaway inflammatory response can cause significant tissue damage, resulting in myriad disorders, such as dermatitis, toxic shock, cardiovascular disease, acute pelvic and arthritic inflammatory diseases, and various infections. To prevent such pathologies, cells have evolved mechanisms to rapidly and specifically shut off these beneficial inflammatory activities before they become detrimental. Our review of recent literature, including our own work, reveals that the most dominant and common mechanism is translational silencing, in which specific regulatory proteins or complexes are recruited to cis-acting RNA structures in the untranslated regions of single or multiple mRNAs that code for the inflammatory protein(s). Enhancement of the silencing function may constitute a novel pharmacological approach to prevent immunity-related inflammation.
The Immune Response in Measles: Virus Control, Clearance and Protective Immunity.
Griffin, Diane E
2016-10-12
Measles is an acute systemic viral infection with immune system interactions that play essential roles in multiple stages of infection and disease. Measles virus (MeV) infection does not induce type 1 interferons, but leads to production of cytokines and chemokines associated with nuclear factor kappa-light-chain-enhancer of activated B cells (NFκB) signaling and activation of the NACHT, LRR and PYD domains-containing protein (NLRP3) inflammasome. This restricted response allows extensive virus replication and spread during a clinically silent latent period of 10-14 days. The first appearance of the disease is a 2-3 day prodrome of fever, runny nose, cough, and conjunctivitis that is followed by a characteristic maculopapular rash that spreads from the face and trunk to the extremities. The rash is a manifestation of the MeV-specific type 1 CD4⁺ and CD8⁺ T cell adaptive immune response with lymphocyte infiltration into tissue sites of MeV replication and coincides with clearance of infectious virus. However, clearance of viral RNA from blood and tissues occurs over weeks to months after resolution of the rash and is associated with a period of immunosuppression. However, during viral RNA clearance, MeV-specific antibody also matures in type and avidity and T cell functions evolve from type 1 to type 2 and 17 responses that promote B cell development. Recovery is associated with sustained levels of neutralizing antibody and life-long protective immunity.
Specificity, cross-talk and adaptation in Interferon signaling
NASA Astrophysics Data System (ADS)
Zilman, Anton
Innate immune system is the first line of defense of higher organisms against pathogens. It coordinates the behavior of millions of cells of multiple types, achieved through numerous signaling molecules. This talk focuses on the signaling specificity of a major class of signaling molecules - Type I Interferons - which are also used therapeutically in the treatment of a number of diseases, such as Hepatitis C, multiple sclerosis and some cancers. Puzzlingly, different Interferons act through the same cell surface receptor but have different effects on the target cells. They also exhibit a strange pattern of temporal cross-talk resulting in a serious clinical problem - loss of response to Interferon therapy. We combined mathematical modeling with quantitative experiments to develop a quantitative model of specificity and adaptation in the Interferon signaling pathway. The model resolves several outstanding experimental puzzles and directly affects the clinical use of Type I Interferons in treatment of viral hepatitis and other diseases.
Cytomegalovirus Retinitis: A Review.
Port, Alexander D; Orlin, Anton; Kiss, Szilard; Patel, Sarju; D'Amico, Donald J; Gupta, Mrinali P
2017-05-01
Cytomegalovirus (CMV) is a ubiquitous DNA herpes virus that causes significant morbidity and mortality in immunocompromised individuals. CMV retinitis is a potentially blinding manifestation of CMV infection that was commonly seen in advanced acquired immunodeficiency syndrome (AIDS) in the era before modern combination antiretroviral therapy era, but is also recognized in patients with immune deficiency from multiple causes. The advent of and advances in antiretroviral therapies for human immunodeficiency virus have decreased the incidence of CMV retinitis by over 90% among AIDS patients, and improved visual outcomes in those affected. The diagnosis is generally a clinical one, and treatment modalities include systemic and intravitreal antiviral medications. Retinal detachment and immune recovery uveitis are sight-threatening complications of CMV retinitis that require specific treatments.
Immune responses to HTLV-I(ACH) during acute infection of pig-tailed macaques.
McGinn, Therese M; Wei, Qing; Stallworth, Jackie; Fultz, Patricia N
2004-04-01
Human T cell lymphotropic virus type 1 (HTLV-I) is causally linked to adult T cell leukemia/lymphoma (ATL) and a chronic progressive neurological disease, HTLV-I-associated myelopathy/tropical spastic paraparesis (HAM/TSP). A nonhuman primate model that reproduces disease symptoms seen in HTLV-I-infected humans might facilitate identification of initial immune responses to the virus and an understanding of pathogenic mechanisms in HTLV-I-related disease. Previously, we showed that infection of pig-tailed macaques with HTLV-I(ACH) is associated with multiple signs of disease characteristic of both HAM/TSP and ATL. We report here that within the first few weeks after HTLV-I(ACH) infection of pig-tailed macaques, serum concentrations of interferon (IFN)-alpha increased and interleukin-12 decreased transiently, levels of nitric oxide were elevated, and activation of CD4(+) and CD8(+) lymphocytes and CD16(+) natural killer cells in peripheral blood were observed. HTLV-I(ACH) infection elicited virus-specific antibodies in all four animals within 4 to 6 weeks; however, Tax-specific lymphoproliferative responses were not detected until 25-29 weeks after infection in all four macaques. IFN-gamma production by peripheral blood cells stimulated with a Tax or Gag peptide was detected to varying degrees in all four animals by ELISPOT assay. Peripheral blood lymphocytes from one animal that developed only a marginal antigen-specific cellular response were unresponsive to mitogen stimulation during the last few weeks preceding its death from a rapidly progressive disease syndrome associated with HTLV-I(ACH) infection of pig-tailed macaques. The results show that during the first few months after HTLV-I(ACH) infection, activation of both innate and adaptive immunity, limited virus-specific cellular responses, sustained immune system activation, and, in some cases, immunodeficiency were evident. Thus, this animal model might be valuable for understanding early stages of infection and causes of immune system dysregulation in HTLV-I-infected humans.
Wooldridge, Amy L; Bischof, Robert J; Meeusen, Els N; Liu, Hong; Heinemann, Gary K; Hunter, Damien S; Giles, Lynne C; Kind, Karen L; Owens, Julie A; Clifton, Vicki L; Gatford, Kathryn L
2014-04-01
Prenatal and early childhood exposures are implicated as causes of allergy, but the effects of intrauterine growth restriction on immune function and allergy are poorly defined. We therefore evaluated effects of experimental restriction of fetal growth on immune function and allergic sensitization in adolescent sheep. Immune function (circulating total red and white blood cells, neutrophils, lymphocytes, monocytes, eosinophils, and basophils, and the antibody response to Clostridial vaccination) and responses to house dust mite (HDM) allergen and ovalbumin (OVA) antigen sensitization (specific total Ig, IgG1, and IgE antibodies, and cutaneous hypersensitivity) were investigated in adolescent sheep from placentally restricted (PR, n = 23) and control (n = 40) pregnancies. Increases in circulating HDM-specific IgE (P = 0.007) and OVA-specific IgE (P = 0.038) were greater in PR than control progeny. PR did not alter total Ig, IgG1, or IgM responses to either antigen. PR increased OVA-specific but not HDM-specific IgA responses in females only (P = 0.023). Multiple birth increased Ig responses to OVA in a sex-specific manner. PR decreased the proportion of positive cutaneous hypersensitivity responders to OVA at 24 h (P = 0.030) but had no effect on cutaneous responses to HDM. Acute wheal responses to intradermal histamine correlated positively with birth weight in singletons (P = 0.023). Intrauterine growth restriction may suppress inflammatory responses in skin downstream of IgE induction, without impairment in antibody responses to a nonpolysaccharide vaccine. Discord between cutaneous and IgE responses following sensitization suggests new mechanisms for prenatal allergy programming.
Rádl, J.; van den Berg, P.; Voormolen, M.; Hendriks, W. D. H.; Schaefer, U. W.
1974-01-01
The immunoglobulin pattern in the sera of lethally irradiated and bone marrow transplanted Rhesus monkeys was studied during the reconstitution of their immune system. All of the irradiated monkeys which survived longer than 30 days, and in which reconstitution of their immune system took place, also developed homogeneous immunoglobulins (HI) in their sera. These homogeneous, sometimes multiple, immunoglobulins were transient. However, they persisted frequently in the sera for several months. In two monkeys which were additionally immunized with a complex antigen (normal human serum), clear-cut M-components appeared in the serum about 10 days later. These HI of IgG class did not precipitate the antigen in immunodiffusion techniques; however, when passing the serum through an immunoadsorbent prepared from normal human serum, only the HI were specifically retained on the column and afterwards isolated by elution. ImagesFIG. 1FIG. 2 PMID:4143277
Immunotoxicology of arc welding fume: Worker and experimental animal studies
Zeidler-Erdely, Patti C.; Erdely, Aaron; Antonini, James M.
2015-01-01
Arc welding processes generate complex aerosols composed of potentially hazardous metal fumes and gases. Millions of workers worldwide are exposed to welding aerosols daily. A health effect of welding that is of concern to the occupational health community is the development of immune system dysfunction. Increased severity, frequency, and duration of upper and lower respiratory tract infections have been reported among welders. Specifically, multiple studies have observed an excess mortality from pneumonia in welders and workers exposed to metal fumes. Although several welder cohort and experimental animal studies investigating the adverse effects of welding fume exposure on immune function have been performed, the potential mechanisms responsible for these effects are limited. The objective of this report was to review both human and animal studies that have examined the effect of welding fume pulmonary exposure on local and systemic immune responses. PMID:22734811
Anti-Ig autoantibody and complement-mediated destruction of neoplastic cells
NASA Technical Reports Server (NTRS)
Towmey, J. J.
1976-01-01
Some immune response are effected through immunoglobulins (Ig), of which five classes have been recognized, namely, IgA, IgD, IgE, IgG, and IgM. Auto-antibodies associated with rheumatoid arthritis, termed rheumatoid factors (RF) react with antigenic determinants on IgG heavy chains. RF has predominant but not complete IgM specificity. This auto-antibody response was not detected in treated patients with primary brain tumors (where tissue is sequestered from the immune system by an intact bloodbrain barrier) or with multiple myeloma where humoral immunity is usually impaired. In addition, the prevalence of RF is not increased with solid tumors prior to initiation of chemotherapy or radiotherapy. It is proposed that RF is related to prior chemotherapy or radiotherapy of tumors anatomically accessible to immunologic tissues capable of antibody responses. A primary IgG response occurs, antigen-antibody complexes form, complexed IgG becomes immunologic, and an RF response results.
The mediator subunit Med23 contributes to controlling T-cell activation and prevents autoimmunity.
Sun, Yang; Zhu, Xiaoyan; Chen, Xufeng; Liu, Haifeng; Xu, Yu; Chu, Yajing; Wang, Gang; Liu, Xiaolong
2014-10-10
T-cell activation is critical for successful immune responses and is controlled at multiple levels. Although many changes of T-cell receptor-associated signalling molecules affect T-cell activation, the transcriptional mechanisms that control this process remain largely unknown. Here we find that T cell-specific deletion of the mediator subunit Med23 leads to hyperactivation of T cells and aged Med23-deficient mice exhibit an autoimmune syndrome. Med23 specifically and consistently promotes the transcription of multiple negative regulators of T-cell activation. In the absence of Med23, the T-cell activation threshold is lower, which results in enhanced antitumour T-cell function. Cumulatively, our data suggest that Med23 contributes to controlling T-cell activation at the transcriptional level and prevents the development of autoimmunity.
Hsp70 Regulates Immune Response in Experimental Autoimmune Encephalomyelitis
Mansilla, M. José; Costa, Carme; Eixarch, Herena; Tepavcevic, Vanja; Castillo, Mireia; Martin, Roland; Lubetzki, Catherine; Aigrot, Marie-Stéphane; Montalban, Xavier; Espejo, Carmen
2014-01-01
Heat shock protein (Hsp)70 is one of the most important stress-inducible proteins. Intracellular Hsp70 not only mediates chaperone-cytoprotective functions but can also block multiple steps in the apoptosis pathway. In addition, Hsp70 is actively released into the extracellular milieu, thereby promoting innate and adaptive immune responses. Thus, Hsp70 may be a critical molecule in multiple sclerosis (MS) pathogenesis and a potential target in this disease due to its immunological and cytoprotective functions. To investigate the role of Hsp70 in MS pathogenesis, we examined its immune and cytoprotective roles using both in vitro and in vivo experimental procedures. We found that Hsp70.1-deficient mice were more resistant to developing experimental autoimmune encephalomyelitis (EAE) compared with their wild-type (WT) littermates, suggesting that Hsp70.1 plays a critical role in promoting an effective myelin oligodendrocyte glycoprotein (MOG)-specific T cell response. Conversely, Hsp70.1-deficient mice that developed EAE showed an increased level of autoreactive T cells to achieve the same production of cytokines compared with the WT mice. Although a neuroprotective role of HSP70 has been suggested, Hsp70.1-deficient mice that developed EAE did not exhibit increased demyelination compared with the control mice. Accordingly, Hsp70 deficiency did not influence the vulnerability to apoptosis of oligodendrocyte precursor cells (OPCs) in culture. Thus, the immunological role of Hsp70 may be relevant in EAE, and specific therapies down-regulating Hsp70 expression may be a promising approach to reduce the early autoimmune response in MS patients. PMID:25153885
Minet, V; Baudar, J; Bailly, N; Douxfils, J; Laloy, J; Lessire, S; Gourdin, M; Devalet, B; Chatelain, B; Dogné, J M; Mullier, F
2014-06-01
Accurate diagnosis of heparin-induced thrombocytopenia (HIT) is essential but remains challenging. We have previously demonstrated, in a retrospective study, the usefulness of the combination of the 4Ts score, AcuStar HIT and heparin-induced multiple electrode aggregometry (HIMEA) with optimized thresholds. We aimed at exploring prospectively the performances of our optimized diagnostic algorithm on suspected HIT patients. The secondary objective is to evaluate performances of AcuStar HIT-Ab (PF4-H) in comparison with the clinical outcome. 116 inpatients with clinically suspected immune HIT were included. Our optimized diagnostic algorithm was applied to each patient. Sensitivity, specificity, negative predictive value (NPV), positive predictive value (PPV) of the overall diagnostic strategy as well as AcuStar HIT-Ab (at manufacturer's thresholds and at our thresholds) were calculated using clinical diagnosis as the reference. Among 116 patients, 2 patients had clinically-diagnosed HIT. These 2 patients were positive on AcuStar HIT-Ab, AcuStar HIT-IgG and HIMEA. Using our optimized algorithm, all patients were correctly diagnosed. AcuStar HIT-Ab at our cut-off (>9.41 U/mL) and at manufacturer's cut-off (>1.00 U/mL) showed both a sensitivity of 100.0% and a specificity of 99.1% and 90.4%, respectively. The combination of the 4Ts score, the HemosIL® AcuStar HIT and HIMEA with optimized thresholds may be useful for the rapid and accurate exclusion of the diagnosis of immune HIT. Copyright © 2014 Elsevier Ltd. All rights reserved.
Massoud, Raya; Enose-Akahata, Yoshimi; Tagaya, Yutaka; Azimi, Nazli; Basheer, Asjad; Jacobson, Steven
2015-09-01
Human T-cell lymphotropic virus type 1 (HTLV-1)-associated myelopathy/tropical spastic paraparesis (HAM/TSP) is a progressive inflammatory myelopathy occurring in a subset of HTLV-1-infected individuals. Despite advances in understanding its immunopathogenesis, an effective treatment remains to be found. IL-2 and IL-15, members of the gamma chain (γc) family of cytokines, are prominently deregulated in HAM/TSP and underlie many of the characteristic immune abnormalities, such as spontaneous lymphocyte proliferation (SP), increased STAT5 phosphorylation in the lymphocytes, and increased frequency and cytotoxicity of virus-specific cytotoxic CD8(+) T lymphocytes (CTLs). In this study, we describe a novel immunomodulatory strategy consisting of selective blockade of certain γc family cytokines, including IL-2 and IL-15, with a γc antagonistic peptide. In vitro, a PEGylated form of the peptide, named BNZ132-1-40, reduced multiple immune activation markers such as SP, STAT5 phosphorylation, spontaneous degranulation of CD8(+) T cells, and the frequency of transactivator protein (Tax)-specific CD8(+) CTLs, thought to be major players in the immunopathogenesis of the disease. This strategy is thus a promising therapeutic approach to HAM/TSP with the potential of being more effective than single monoclonal antibodies targeting either IL-2 or IL-15 receptors and safer than inhibitors of downstream signaling molecules such as JAK1 inhibitors. Finally, selective cytokine blockade with antagonistic peptides might be applicable to multiple other conditions in which cytokines are pathogenic.
Innate Immune Responses of Drosophila melanogaster Are Altered by Spaceflight
Marcu, Oana; Lera, Matthew P.; Sanchez, Max E.; Levic, Edina; Higgins, Laura A.; Shmygelska, Alena; Fahlen, Thomas F.; Nichol, Helen; Bhattacharya, Sharmila
2011-01-01
Alterations and impairment of immune responses in humans present a health risk for space exploration missions. The molecular mechanisms underpinning innate immune defense can be confounded by the complexity of the acquired immune system of humans. Drosophila (fruit fly) innate immunity is simpler, and shares many similarities with human innate immunity at the level of molecular and genetic pathways. The goals of this study were to elucidate fundamental immune processes in Drosophila affected by spaceflight and to measure host-pathogen responses post-flight. Five containers, each containing ten female and five male fruit flies, were housed and bred on the space shuttle (average orbit altitude of 330.35 km) for 12 days and 18.5 hours. A new generation of flies was reared in microgravity. In larvae, the immune system was examined by analyzing plasmatocyte number and activity in culture. In adults, the induced immune responses were analyzed by bacterial clearance and quantitative real-time polymerase chain reaction (qPCR) of selected genes following infection with E. coli. The RNA levels of relevant immune pathway genes were determined in both larvae and adults by microarray analysis. The ability of larval plasmatocytes to phagocytose E. coli in culture was attenuated following spaceflight, and in parallel, the expression of genes involved in cell maturation was downregulated. In addition, the level of constitutive expression of pattern recognition receptors and opsonins that specifically recognize bacteria, and of lysozymes, antimicrobial peptide (AMP) pathway and immune stress genes, hallmarks of humoral immunity, were also reduced in larvae. In adults, the efficiency of bacterial clearance measured in vivo following a systemic infection with E. coli post-flight, remained robust. We show that spaceflight altered both cellular and humoral immune responses in Drosophila and that the disruption occurs at multiple interacting pathways. PMID:21264297
Zhong, Hua; Xibing, Gu; Yaping, Dai; Zheng, Wang; Decai, Fu; Xiaoye, Guo; Hangyuan, Wu; Dong, Wang; Zhonghua, Lu
2016-09-01
In patients with chronic hepatitis B (CHB), the relation of interkeukin-7 (IL-7) to either the T follicular helper cells (Tfh cells) or to a specific cellular immune response is not clear. The present study aims to explore the possible relationship of IL-7 to Tfh cells and to hepatitis B virus (HBV)-specific cellular immune response in patients with CHB. Ninety-one adult patients with CHB were divided into groups A, B, and C, according to the patients' IL-7 levels (low, medium, and high). Tfh cells and HBV-specific cytotoxic T lymphocytes (CTLs) were detected with flow cytometry; IL-7 and IL-21 were determined with a double antibody sandwich enzyme-linked immunosorbent assay; and HBV DNA was determined by using a real-time fluorescent quantitative polymerase chain reaction. The results showed that the levels of IL-7, Tfh cells, IL-21, and HBV-specific CTLs of patients in group C were significantly higher than those of patients in group B, (P < 0.01 for each comparison) and that the levels of these four parameters of patients in group B were significantly higher than those of the patients in group A (P < 0.01 for each comparison). Meanwhile, the level of HBV DNA of the patients in group C was significantly lower than that of the patients in group B (P < 0.01), and that of the patients in group B was significantly lower than that of the patients in group A (P < 0.05). Multiple linear regression analyses showed that IL-7, Tfh cells, IL-21, and HBV-specific CTL might have effects on HBV DNA and that only the HBV-specific CTL had an independent effect on HBV DNA (P < 0.01). IL-7, Tfh cells, and IL-21 showed independent effects on HBV-specific CTL (P < 0.05, P < 0.01, and P < 0.01). This study suggests that the IL-7 level of CHB patients may be related to Tfh cells. In CHB patients, IL-7 possibly increases the level of Tfh cells and HBV-specific cellular immune responses and thereby reduces the HBV DNA level.
NASA Technical Reports Server (NTRS)
Crucian, Brian E.; Stowe, Raymond P.; Mehta, Satish K.; Yetman, Deborah L.; Leaf, Melanie J.; Pierson, Duane L.; Sams, Clarence F.
2007-01-01
As logistical access for in-flight space research becomes more limited, the use of ground based spaceflight analogs for life science studies will increase. These studies are particularly important as NASA progresses towards the Lunar and eventually Mars missions outlined in the 2005 Vision for Space Exploration. Countermeasures must be developed to mitigate the clinical risks associated with exploration class space missions. In an effort to coordinate studies across multiple disciplines, NASA has selected 90-day bed rest as the analog of choice, and initiated the Flight Analogs Project to implement research studies with or without the evaluation of countermeasures. Although bed rest is not the analog of choice to evaluate spaceflight-associated immune dysfunction, a standard Immune Assessment was developed for subjects participating in the 90-day bed best studies. The Immune Assessment consists of: leukocyte subset distribution, T cell functional responses, intracellular cytokine production profiles, latent viral reactivation, virus specific T cell levels, virus specific T cell function, stress hormone levels and a behavioral assessment using stress questionnaires. The purpose of the assessment during the initial studies (without countermeasure) is to establish control data against which future studies (with countermeasure) will be evaluated. It is believed that some of the countermeasures planned to be evaluated in future studies, such as exercise, pharmacologic intervention or nutritional supplementation, have the ability to impact immune function. Therefore immunity will likely be monitored during those studies. The data generated during the first three control studies showed that the subjects in general did not display altered peripheral leukocyte subsets, constitutive immune activation, significant latent viral reactivation (EBV, VZV) or altered T cell function. Interestingly, for some subjects the level of constitutively activated T cells (CD8+/CD69+) and virus-specific T cells (CMV and EBV) both decreased during the studies. This likely reflects the isolation of the subjects (from an immunological perspective) and absence of everyday subclinical challenges to the immune system. Cortisol levels (plasma and saliva) did not vary significantly during the studies. This probably reflects a lack of physiological stress during the study and the stress of readaptation to the 1xG environment at R+1. These data demonstrate the absence of significant immune alteration during 90-day bed rest, and establish control data against which future studies (including countermeasures) may be compared.
Helminths as governors of immune-mediated inflammation.
Elliott, David E; Summers, Robert W; Weinstock, Joel V
2007-04-01
Immune-mediated diseases (e.g. inflammatory bowel disease, asthma, multiple sclerosis and autoimmune diabetes) are increasing in prevalence and emerge as populations adopt meticulously hygienic lifestyles. This change in lifestyles precludes exposure to helminths (parasitic worms). Loss of natural helminth exposure removes a previously universal Th2 and regulatory immune biasing imparted by these organisms. Helminths protect animals from developing immune-mediated diseases (colitis, reactive airway disease, encephalitis and diabetes). Clinical trials show that exposure to helminths can reduce disease activity in patients with ulcerative colitis or Crohn's disease. This paper summarises work by multiple groups demonstrating that colonization with helminths alters immune reactivity and protects against disease from dysregulated inflammation.
Santoro, Francesco; Pettini, Elena; Kazmin, Dmitri; Ciabattini, Annalisa; Fiorino, Fabio; Gilfillan, Gregor D; Evenroed, Ida M; Andersen, Peter; Pozzi, Gianni; Medaglini, Donata
2018-01-01
Transcriptomic profiling of the immune response induced by vaccine adjuvants is of critical importance for the rational design of vaccination strategies. In this study, transcriptomics was employed to profile the effect of the vaccine adjuvant used for priming on the immune response following re-exposure to the vaccine antigen alone. Mice were primed with the chimeric vaccine antigen H56 of Mycobacterium tuberculosis administered alone or with the CAF01 adjuvant and boosted with the antigen alone. mRNA sequencing was performed on blood samples collected 1, 2, and 7 days after priming and after boosting. Gene expression analysis at day 2 after priming showed that the CAF01 adjuvanted vaccine induced a stronger upregulation of the innate immunity modules compared with the unadjuvanted formulation. The immunostimulant effect of the CAF01 adjuvant, used in the primary immunization, was clearly seen after a booster immunization with a low dose of antigen alone. One day after boost, we observed a strong upregulation of multiple genes in blood of mice primed with H56 + CAF01 compared with mice primed with the H56 alone. In particular, blood transcription modules related to innate immune response, such as monocyte and neutrophil recruitment, activation of antigen-presenting cells, and interferon response were activated. Seven days after boost, differential expression of innate response genes faded while a moderate differential expression of T cell activation modules was appreciable. Indeed, immunological analysis showed a higher frequency of H56-specific CD4+ T cells and germinal center B cells in draining lymph nodes, a strong H56-specific humoral response and a higher frequency of antibody-secreting cells in spleen of mice primed with H56 + CAF01. Taken together, these data indicate that the adjuvant used for priming strongly reprograms the immune response that, upon boosting, results in a stronger recall innate response essential for shaping the downstream adaptive response.
Ha, Sha; Li, Fengsheng; Troutman, Matthew C.; Freed, Daniel C.; Tang, Aimin; Loughney, John W.; Wang, I-Ming; Vlasak, Josef; Nickle, David C.; Rustandi, Richard R.; Hamm, Melissa; DePhillips, Pete A.; Zhang, Ningyan; McLellan, Jason S.; Zhu, Hua; Adler, Stuart P.; McVoy, Michael A.; An, Zhiqiang
2017-01-01
ABSTRACT Human cytomegalovirus (HCMV) is the leading cause of congenital viral infection, and developing a prophylactic vaccine is of high priority to public health. We recently reported a replication-defective human cytomegalovirus with restored pentameric complex glycoprotein H (gH)/gL/pUL128-131 for prevention of congenital HCMV infection. While the quantity of vaccine-induced antibody responses can be measured in a viral neutralization assay, assessing the quality of such responses, including the ability of vaccine-induced antibodies to cross-neutralize the field strains of HCMV, remains a challenge. In this study, with a panel of neutralizing antibodies from three healthy human donors with natural HCMV infection or a vaccinated animal, we mapped eight sites on the dominant virus-neutralizing antigen—the pentameric complex of glycoprotein H (gH), gL, and pUL128, pUL130, and pUL131. By evaluating the site-specific antibodies in vaccine immune sera, we demonstrated that vaccination elicited functional antiviral antibodies to multiple neutralizing sites in rhesus macaques, with quality attributes comparable to those of CMV hyperimmune globulin. Furthermore, these immune sera showed antiviral activities against a panel of genetically distinct HCMV clinical isolates. These results highlighted the importance of understanding the quality of vaccine-induced antibody responses, which includes not only the neutralizing potency in key cell types but also the ability to protect against the genetically diverse field strains. IMPORTANCE HCMV is the leading cause of congenital viral infection, and development of a preventive vaccine is a high public health priority. To understand the strain coverage of vaccine-induced immune responses in comparison with natural immunity, we used a panel of broadly neutralizing antibodies to identify the immunogenic sites of a dominant viral antigen—the pentameric complex. We further demonstrated that following vaccination of a replication-defective virus with the restored pentameric complex, rhesus macaques can develop broadly neutralizing antibodies targeting multiple immunogenic sites of the pentameric complex. Such analyses of site-specific antibody responses are imperative to our assessment of the quality of vaccine-induced immunity in clinical studies. PMID:28077654
Nguyen, Ut V; Melkebeek, Vesna; Devriendt, Bert; Goetstouwers, Tiphanie; Van Poucke, Mario; Peelman, Luc; Goddeeris, Bruno M; Cox, Eric
2015-06-23
F4 enterotoxigenic Escherichia coli (ETEC) cause diarrhoea and mortality in piglets leading to severe economic losses. Oral immunization of piglets with F4 fimbriae induces a protective intestinal immune response evidenced by an F4-specific serum and intestinal IgA response. However, successful oral immunization of pigs with F4 fimbriae in the presence of maternal immunity has not been demonstrated yet. In the present study we aimed to evaluate the effect of maternal immunity on the induction of a systemic immune response upon oral immunization of piglets. Whereas F4-specific IgG and IgA could be induced by oral immunization of pigs without maternal antibodies and by intramuscular immunization of pigs with maternal antibodies, no such response was seen in the orally immunized animals with maternal antibodies. Since maternal antibodies can mask an antibody response, we also looked by ELIspot assays for circulating F4-specific antibody secreting cells (ASCs). Enumerating the F4-specific ASCs within the circulating peripheral blood mononuclear cells, and the number of F4-specific IgA ASCs within the circulating IgA(+) B-cells revealed an F4-specific immune response in the orally immunized animals with maternal antibodies. Interestingly, results suggest a more robust IgA booster response by oral immunization of pigs with than without maternal antibodies. These results demonstrate that oral immunization of piglets with F4-specific maternal antibodies is feasible and that these maternal antibodies seem to enhance the secondary systemic immune response. Furthermore, our ELIspot assay on enriched IgA(+) B-cells could be used as a screening procedure to optimize mucosal immunization protocols in pigs with maternal immunity.
Dendritic cell activation enhances anti-PD-1 mediated immunotherapy against glioblastoma.
Garzon-Muvdi, Tomas; Theodros, Debebe; Luksik, Andrew S; Maxwell, Russell; Kim, Eileen; Jackson, Christopher M; Belcaid, Zineb; Ganguly, Sudipto; Tyler, Betty; Brem, Henry; Pardoll, Drew M; Lim, Michael
2018-04-17
The glioblastoma (GBM) immune microenvironment is highly suppressive as it targets and hinders multiple components of the immune system. Checkpoint blockade (CB) is being evaluated for GBM patients. However, biomarker analyses suggest that CB monotherapy may be effective only in a small fraction of GBM patients. We hypothesized that activation of antigen presentation would increase the therapeutic response to PD-1 blockade. We show that activating DCs through TLR3 agonists enhances the anti-tumor immune response to CB and increases survival in GBM. Mice treated with TLR3 agonist poly(I:C) and anti-PD-1 demonstrated increased DC activation and increased T cell proliferation in tumor draining lymph nodes. We show that DCs are necessary for the improved anti-tumor immune response. This study suggests that augmenting antigen presentation is an effective multimodal immunotherapy strategy that intensifies anti-tumor responses in GBM. Specifically, these data represent an expanded role for TLR3 agonists as adjuvants to CB. Using a preclinical model of GBM, we tested the efficacy of combinatorial immunotherapy with anti-PD-1 and TLR3 agonist, poly(I:C). Characterization of the immune response in tumor infiltrating immune cells and in secondary lymphoid organs was performed. Additionally, dendritic cell (DC) depletion experiments were performed.
Combining evidence and diffusion of innovation theory to enhance influenza immunization.
Britto, Maria T; Pandzik, Geralyn M; Meeks, Connie S; Kotagal, Uma R
2006-08-01
Children and adolescents with chronic conditions such as asthma, diabetes, and HIV are at high risk of influenza-related morbidity, and there are recommendations to immunize these populations annually. At Cincinnati Children's Hospital Medical Center, the influenza immunization rate increased to 90.4% (5% declined) among 200 patients with cystic fibrosis (CF). Diffusion of innovation theory was used to guide the design and implementation of spread to other clinics. The main intervention strategies were: (1) engagement of interested, nurse-led teams, (2) A collaborative learning session, (3) A tool kit including literature, sample goals, reminder postcards, communication strategies, and team member roles and processes, (4) open-access scheduling and standing orders (5) A simple Web-based registry, (6) facilitated vaccine ordering, (7) recall phone calls, and (8) weekly results posting. Clinic-specific immunization rates ranged from 32.7% to 92.8%, with the highest rate reported in the CF clinic. All teams used multiple strategies; with six of the seven using four or more. Overall, 60.0% (762/1,269) of the population was immunized. Barriers included vaccine shortages, lack of time for reminder calls, and lack of physician support in one clinic. A combination of interventions, guided by evidence and diffusion of innovation theory, led to immunization rates higher than those reported in the literature.
Neuroendocrine host factors and inflammatory disease susceptibility.
Ligier, S; Sternberg, E M
1999-01-01
The etiology of autoimmune diseases is multifactorial, resulting from a combination of genetically predetermined host characteristics and environmental exposures. As the term autoimmune implies, immune dysfunction and dysregulated self-tolerance are key elements in the pathophysiology of all these diseases. The neuroendocrine and sympathetic nervous systems are increasingly recognized as modulators of the immune response at the levels of both early inflammation and specific immunity. As such, alterations in their response represent a potential mechanism by which pathologic autoimmunity may develop. Animal models of autoimmune diseases show pre-existing changes in neuroendocrine responses to a variety of stimuli, and both animal and human studies have shown altered stress responses in the setting of active immune activation. The potential role of the neuroendocrine system in linking environmental exposures and autoimmune diseases is 2-fold. First, it may represent a direct target for toxic compounds. Second, its inadequate function may result in the inappropriate response of the immune system to an environmental agent with immunogenic properties. This article reviews the relationship between autoimmune diseases and the neuroendocrine system and discusses the difficulties and pitfalls of investigating a physiologic response that is sensitive to such a multiplicity of environmental exposures. PMID:10502534
Lin, Rui-Qing; Lillehoj, Hyun S; Lee, Seung Kyoo; Oh, Sungtaek; Panebra, Alfredo; Lillehoj, Erik P
2017-08-30
Avian coccidiosis is caused by multiple species of the apicomplexan protozoan, Eimeria, and is one of the most economically devastating enteric diseases for the poultry industry worldwide. Host immunity to Eimeria infection, however, is relatively species-specific. The ability to immunize chickens against different species of Eimeria using a single vaccine will have a major beneficial impact on commercial poultry production. In this paper, we describe the molecular cloning, purification, and vaccination efficacy of a novel Eimeria vaccine candidate, elongation factor-1α (EF-1α). One day-old broiler chickens were given two subcutaneous immunizations one week apart with E. coli-expressed E. tenella recombinant (r)EF-1α protein and evaluated for protection against challenge infection with E. tenella or E. maxima. rEF-1α-vaccinated chickens exhibited increased body weight gains, decreased fecal oocyst output, and greater serum anti-EF-1α antibody levels following challenge infection with either E. tenella or E. maxima compared with unimmunized controls. Vaccination with EF-1α may represent a new approach to inducing cross-protective immunity against avian coccidiosis in the field. Published by Elsevier B.V.
Combined Active Humoral and Cellular Immunization Approaches for the Treatment of Synucleinopathies.
Rockenstein, Edward; Ostroff, Gary; Dikengil, Fusun; Rus, Florentina; Mante, Michael; Florio, Jazmin; Adame, Anthony; Trinh, Ivy; Kim, Changyoun; Overk, Cassia; Masliah, Eliezer; Rissman, Robert A
2018-01-24
Dementia with Lewy bodies, Parkinson's disease, and Multiple System Atrophy are age-related neurodegenerative disorders characterized by progressive accumulation of α-synuclein (α-syn) and jointly termed synucleinopathies. Currently, no disease-modifying treatments are available for these disorders. Previous preclinical studies demonstrate that active and passive immunizations targeting α-syn partially ameliorate behavioral deficits and α-syn accumulation; however, it is unknown whether combining humoral and cellular immunization might act synergistically to reduce inflammation and improve microglial-mediated α-syn clearance. Since combined delivery of antigen plus rapamycin (RAP) in nanoparticles is known to induce antigen-specific regulatory T cells (Tregs), we adapted this approach to α-syn using the antigen-presenting cell-targeting glucan microparticle (GP) vaccine delivery system. PDGF-α-syn transgenic (tg) male and female mice were immunized with GP-alone, GP-α-syn (active humoral immunization), GP+RAP, or GP+RAP/α-syn (combined active humoral and Treg) and analyzed using neuropathological and biochemical markers. Active immunization resulted in higher serological total IgG, IgG1, and IgG2a anti-α-syn levels. Compared with mice immunized with GP-alone or GP-α-syn, mice vaccinated with GP+RAP or GP+RAP/α-syn displayed increased numbers of CD25-, FoxP3-, and CD4-positive cells in the CNS. GP-α-syn or GP+RAP/α-syn immunizations resulted in a 30-45% reduction in α-syn accumulation, neuroinflammation, and neurodegeneration. Mice immunized with GP+RAP/α-syn further rescued neurons and reduced neuroinflammation. Levels of TGF-β1 were increased with GP+RAP/α-syn immunization, while levels of TNF-α and IL-6 were reduced. We conclude that the observed effects of GP+RAP/α-syn immunization support the hypothesis that cellular immunization may enhance the effects of active immunotherapy for the treatment of synucleinopathies. SIGNIFICANCE STATEMENT We show that a novel vaccination modality combining an antigen-presenting cell-targeting glucan particle (GP) vaccine delivery system with encapsulated antigen (α-synuclein) + rapamycin (RAP) induced both strong anti-α-synuclein antibody titers and regulatory T cells (Tregs). This vaccine, collectively termed GP+RAP/α-syn, is capable of triggering neuroprotective Treg responses in synucleinopathy models, and the combined vaccine is more effective than the humoral or cellular immunization alone. Together, these results support the further development of this multifunctional vaccine approach for the treatment of synucleinopathies, such as Parkinson's disease, dementia with Lewy bodies, and multiple systems atrophy. Copyright © 2018 the authors 0270-6474/18/381000-15$15.00/0.
Fuller, Michael J; Callendret, Benoit; Zhu, Baogong; Freeman, Gordon J; Hasselschwert, Dana L; Satterfield, William; Sharpe, Arlene H; Dustin, Lynn B; Rice, Charles M; Grakoui, Arash; Ahmed, Rafi; Walker, Christopher M
2013-09-10
Hepatitis C virus (HCV) persistence is facilitated by exhaustion of CD8+ T cells that express the inhibitory receptor programmed cell death 1 (PD-1). Blockade of PD-1 signaling improves in vitro proliferation of HCV-specific T lymphocytes, but whether antiviral function can be restored in infected individuals is unknown. To address this question, chimpanzees with persistent HCV infection were treated with anti-PD-1 antibodies. A significant reduction in HCV viremia was observed in one of three treated animals without apparent hepatocellular injury. Viremia rebounded in the responder animal when antibody treatment was discontinued. Control of HCV replication was associated with restoration of intrahepatic CD4+ and CD8+ T-cell immunity against multiple HCV proteins. The responder animal had a history of broader T-cell immunity to multiple HCV proteins than the two chimpanzees that did not respond to PD-1 therapy. The results suggest that successful PD-1 blockade likely requires a critical threshold of preexisting virus-specific T cells in liver and warrants consideration of therapeutic vaccination strategies in combination with PD-1 blockade to broaden narrow responses. Anti-PD-1 immunotherapy may also facilitate control of other persistent viruses, notably the hepatitis B virus where options for long-term control of virus replication are limited.
Grigoriadis, Nikolaos; Linnebank, Michael; Alexandri, Nektaria; Muehl, Sarah; Hofbauer, Günther F L
2016-10-01
As management of multiple sclerosis (MS) requires life-long treatment with disease-modifying agents, any risks associated with long-term use should be considered when evaluating therapeutic options. Immune cells of the innate and adaptive immune systems play various roles in the pathogenesis of MS. MS therapies affect the immune system, each with a unique mode of action, and consequently possess different long-term safety profiles. Rare, but serious safety concerns, including an increased risk of infection and cancer, have been associated with immunosuppressant use. The risks associated with newer immunosuppressive agents, which target specific elements of MS disease pathophysiology, are not yet fully established as the duration of clinical trials is relatively short and post-marketing experience is limited. Non-immunosuppressants used to treat MS have well-defined safety profiles established over a large number of patient-years demonstrating them to be well-tolerated long-term treatment options. When considering the long-term use of disease-modifying agents for treating MS, classification as immunosuppressants or non-immunosuppressants can be useful when evaluating potential risks associated with chronic use. A successful therapeutic strategy for any serious, chronic disease such as MS should weigh effectiveness versus long-term safety of available treatments.
Jacek, Elzbieta; Tang, Kevin S; Komorowski, Lars; Ajamian, Mary; Probst, Christian; Stevenson, Brian; Wormser, Gary P; Marques, Adriana R; Alaedini, Armin
2016-02-01
Most immunogenic proteins of Borrelia burgdorferi, the causative agent of Lyme disease, are known or expected to contain multiple B cell epitopes. However, the kinetics of the development of human B cell responses toward the various epitopes of individual proteins during the course of Lyme disease has not been examined. Using the highly immunogenic VlsE as a model Ag, we investigated the evolution of humoral immune responses toward its immunodominant sequences in 90 patients with a range of early to late manifestations of Lyme disease. The results demonstrate the existence of asynchronous, independently developing, Ab responses against the two major immunogenic regions of the VlsE molecule in the human host. Despite their strong immunogenicity, the target epitopes were inaccessible to Abs on intact spirochetes, suggesting a lack of direct immunoprotective effect. These observations document the association of immune reactivity toward specific VlsE sequences with different phases of Lyme disease, demonstrating the potential use of detailed epitope mapping of Ags for staging of the infection, and offer insights regarding the pathogen's possible immune evasion mechanisms. Copyright © 2016 by The American Association of Immunologists, Inc.
Joseph, Jamie; Depp, Colin; Shih, Pei-an B.; Cadenhead, Kristen S.; Schmid-Schönbein, Geert
2017-01-01
Growing interest in gut and digestive processes and their potential link to brain and peripheral based inflammation or biobehavioral phenotypes has led to an increasing number of basic and translational scientific reports focused on the role of gut microbiota within the context of neuropsychiatric disorders. However, the effect of dietary modification on specific gut metabolites, in association with immune, metabolic, and psychopathological functioning in schizophrenia spectrum disorders has not been well characterized. The short chain fatty acids (SCFA) acetate, butyrate, and propionate, major metabolites derived from fermentation of dietary fibers by gut microbes, interact with multiple immune and metabolic pathways. The specific pathways that SCFA are thought to target, are dysregulated in cardiovascular disease, type II diabetes, and systemic inflammation. Most notably, these disorders are consistently linked to an attenuated lifespan in schizophrenia. Although, unhealthy dietary intake patterns and increased prevalence of immune and metabolic dysfunction has been observed in people with schizophrenia; dietary interventions have not been well utilized to target immune or metabolic illness. Prior schizophrenia patient trials primarily focused on the effects of gluten free diets. Findings from these studies indicate that a diet avoiding gluten benefits a limited subset of patients, individuals with celiac disease or non-celiac gluten sensitivity. Therefore, alternative dietary and nutritional modifications such as high-fiber, Mediterranean style, diets that enrich the production of SCFA, while being associated with a minimal likelihood of adverse events, may improve immune and cardiovascular outcomes linked to premature mortality in schizophrenia. With a growing literature demonstrating that SCFA can cross the blood brain barrier and target key inflammatory and metabolic pathways, this article highlights enriching dietary intake for SCFA as a potential adjunctive therapy for people with schizophrenia. PMID:28396623
Wu, Zhanshuai; Tang, Zeli; Shang, Mei; Zhao, Lu; Zhou, Lina; Kong, Xiangzhan; Lin, Zhipeng; Sun, Hengchang; Chen, Tingjin; Xu, Jin; Li, Xuerong; Huang, Yan; Yu, Xinbing
2017-07-01
Clonorchiasis remains a nonnegligible public health problem in endemic areas. Cysteine protease of Clonorchis sinensis (CsCP) plays indispensable roles in the parasitic physiology and pathology, and has been exploited as a promising drug and vaccine candidate. In recent years, development of spore-based vaccines against multiple pathogens has attracted many investigators' interest. In previous studies, the recombinant Escherichia coli (BL21) and Bacillus subtilis spores expressing CsCP have been successfully constructed, respectively. In this study, the immune effects of CsCP protein purified from recombinant BL21 (rCsCP) and B. subtilis spores presenting CsCP (B.s-CsCP) in Balb/c mice model were conducted with comparative analysis. Levels of specific IgG, IgG1 and IgG2a were significantly increased in sera from both rCsCP and B.s-CsCP intraperitoneally immunized mice. Additionally, recombinant spores expressing abundant fusion CsCP (0.03125 pg/spore) could strongly enhance the immunogenicity of CsCP with significantly higher levels of IgG and isotypes. Compared with rCsCP alone, intraperitoneal administration of mice with spores expressing CsCP achieved a better effect of fighting against C. sinensis infection by slowing down the process of fibrosis. Our results demonstrated that a combination of Th1/Th2 immune responses could be elicited by rCsCP, while spores displaying CsCP prominently induced Th1-biased specific immune responses, and the complex cytokine network maybe mediates protective immune responses against C. sinensis. This work further confirmed that the usage of B. subtilis spores displaying CsCP is an effective way to against C. sinensis.
Fucikova, Jitka; Truxova, Iva; Hensler, Michal; Becht, Etienne; Kasikova, Lenka; Moserova, Irena; Vosahlikova, Sarka; Klouckova, Jana; Church, Sarah E.; Cremer, Isabelle; Kepp, Oliver; Kroemer, Guido; Galluzzi, Lorenzo; Salek, Cyril
2016-01-01
Cancer cell death can be perceived as immunogenic by the host only when malignant cells emit immunostimulatory signals (so-called “damage-associated molecular patterns,” DAMPs), as they die in the context of failing adaptive responses to stress. Accumulating preclinical and clinical evidence indicates that the capacity of immunogenic cell death to (re-)activate an anticancer immune response is key to the success of various chemo- and radiotherapeutic regimens. Malignant blasts from patients with acute myeloid leukemia (AML) exposed multiple DAMPs, including calreticulin (CRT), heat-shock protein 70 (HSP70), and HSP90 on their plasma membrane irrespective of treatment. In these patients, high levels of surface-exposed CRT correlated with an increased proportion of natural killer cells and effector memory CD4+ and CD8+ T cells in the periphery. Moreover, CRT exposure on the plasma membrane of malignant blasts positively correlated with the frequency of circulating T cells specific for leukemia-associated antigens, indicating that ecto-CRT favors the initiation of anticancer immunity in patients with AML. Finally, although the levels of ecto-HSP70, ecto-HSP90, and ecto-CRT were all associated with improved relapse-free survival, only CRT exposure significantly correlated with superior overall survival. Thus, CRT exposure represents a novel powerful prognostic biomarker for patients with AML, reflecting the activation of a clinically relevant AML-specific immune response. PMID:27802968
Purcell, Maureen K.; Nichols, Krista M.; Winton, James R.; Kurath, Gael; Thorgaard, Gary H.; Wheeler, Paul; Hansen, John D.; Herwig, Russell P.; Park, Linda K.
2006-01-01
The DNA vaccine based on the glycoprotein gene of Infectious hematopoietic necrosis virus induces a non-specific anti-viral immune response and long-term specific immunity against IHNV. This study characterized gene expression responses associated with the early anti-viral response. Homozygous rainbow trout were injected intra-muscularly (I.M.) with vector DNA or the IHNV DNA vaccine. Gene expression in muscle tissue (I.M. site) was evaluated using a 16,008 feature salmon cDNA microarray. Eighty different genes were significantly modulated in the vector DNA group while 910 genes were modulated in the IHNV DNA vaccinate group relative to control group. Quantitative reverse-transcriptase PCR was used to examine expression of selected immune genes at the I.M. site and in other secondary tissues. In the localized response (I.M. site), the magnitudes of gene expression changes were much greater in the vaccinate group relative to the vector DNA group for the majority of genes analyzed. At secondary systemic sites (e.g. gill, kidney and spleen), type I IFN-related genes were up-regulated in only the IHNV DNA vaccinated group. The results presented here suggest that the IHNV DNA vaccine induces up-regulation of the type I IFN system across multiple tissues, which is the functional basis of early anti-viral immunity.
Abdulhaqq, S A; Zorrilla, C; Kang, G; Yin, X; Tamayo, V; Seaton, K E; Joseph, J; Garced, S; Tomaras, G D; Linn, K A; Foulkes, A S; Azzoni, L; VerMilyea, M; Coutifaris, C; Kossenkov, A V; Showe, L; Kraiselburd, E N; Li, Q; Montaner, L J
2016-07-01
Sex workers practicing in high HIV endemic areas have been extensively targeted to test anti-HIV prophylactic strategies. We hypothesize that in women with high levels of genital exposure to semen changes in cervico-vaginal mucosal and/or systemic immune activation will contribute to a decreased susceptibility to HIV-1 infection. To address this question, we assessed sexual activity and immune activation status (in peripheral blood), as well as cellular infiltrates and gene expression in ectocervical mucosa biopsies in female sex workers (FSWs; n=50), as compared with control women (CG; n=32). FSWs had low-to-absent HIV-1-specific immune responses with significantly lower CD38 expression on circulating CD4(+) or CD8(+) T-cells (both: P<0.001) together with lower cervical gene expression of genes associated with leukocyte homing and chemotaxis. FSWs also had increased levels of interferon-ɛ (IFNɛ) gene and protein expression in the cervical epithelium together with reduced expression of genes associated with HIV-1 integration and replication. A correlative relationship between semen exposure and elevated type-1 IFN expression in FSWs was also established. Overall, our data suggest that long-term condomless sex work can result in multiple changes within the cervico-vaginal compartment that would contribute to sustaining a lower susceptibility for HIV-1 infection in the absence of HIV-specific responses.
Da Silva, Diane M.; Woodham, Andrew W.; Naylor, Paul H.; Egan, James E.; Berinstein, Neil L.
2016-01-01
Langerhans cells (LCs) are the antigen-presenting cells of the epithelial layer and are responsible for initiating immune responses against skin and mucosa-invading viruses. Human papillomavirus (HPV)-mediated suppression of LC function is a crucial mechanism of HPV immune evasion, which can lead to persistent infection and development of several human cancers, including cervical, anal, and head and neck cancers. The cell-derived cytokine-based biologic, IRX-2, consists of multiple well-defined cytokines and is broadly active on various immune cell subsets. In this study, we investigated primary human LC activation after exposure to HPV16, followed by treatment with IRX-2 in vitro, and evaluated their subsequent ability to induce HPV16-specific T cells. In contrast to its activity on dendritic cells, HPV16 alone is not sufficient to induce phenotypic and functional activation of LCs. However, IRX-2 induces a significant upregulation of antigen presentation and costimulatory molecules, T helper 1 (Th1)-associated cytokine release, and chemokine-directed migration of LCs pre-exposed to HPV16. Furthermore, LCs treated with IRX-2 after HPV16 exposure induced CD8+ T-cell responses against specific HLA-A*0201-binding HPV16 T-cell epitopes. The present study suggests that IRX-2 is an attractive immunomodulator for assisting the immune response in eradication of HPV-infected cells, thereby potentially preventing HPV-induced cancers. PMID:26653678
Da Silva, Diane M; Woodham, Andrew W; Naylor, Paul H; Egan, James E; Berinstein, Neil L; Kast, W Martin
2016-05-01
Langerhans cells (LCs) are the antigen-presenting cells of the epithelial layer and are responsible for initiating immune responses against skin and mucosa-invading viruses. Human papillomavirus (HPV)-mediated suppression of LC function is a crucial mechanism of HPV immune evasion, which can lead to persistent infection and development of several human cancers, including cervical, anal, and head and neck cancers. The cell-derived cytokine-based biologic, IRX-2, consists of multiple well-defined cytokines and is broadly active on various immune cell subsets. In this study, we investigated primary human LC activation after exposure to HPV16, followed by treatment with IRX-2 in vitro, and evaluated their subsequent ability to induce HPV16-specific T cells. In contrast to its activity on dendritic cells, HPV16 alone is not sufficient to induce phenotypic and functional activation of LCs. However, IRX-2 induces a significant upregulation of antigen presentation and costimulatory molecules, T helper 1 (Th1)-associated cytokine release, and chemokine-directed migration of LCs pre-exposed to HPV16. Furthermore, LCs treated with IRX-2 after HPV16 exposure induced CD8(+) T-cell responses against specific HLA-A*0201-binding HPV16 T-cell epitopes. The present study suggests that IRX-2 is an attractive immunomodulator for assisting the immune response in eradication of HPV-infected cells, thereby potentially preventing HPV-induced cancers.
Jiang, Xinyu; Zhang, Chao; Zhao, Yanjing; Kong, Xianghui; Pei, Chao; Li, Li; Nie, Guoxing; Li, Xuejun
2016-06-08
Aeromonas hydrophila, as a strong Gram-negative bacterium, can infect a wide range of freshwater fish, including common carp Cyprinus carpio, and cause the huge economic loss. To create the effective vaccine is the best way to control the outbreak of the disease caused by A. hydrophila. In this study, a live attenuated A. hydrophila strain, XX1LA, was screened from the pathogenic A. hydrophila strain XX1 cultured on medium containing the antibiotic rifampicin, which was used as a live attenuated vaccine candidate. The immune protection of XX1LA against the pathogen A. hydrophila in common carp was evaluated by the relative percent survival (RPS), the specific IgM antibody titers, serum lysozyme activity and the expression profiles of multiple immune-related genes at the different time points following immunization. The results showed that the variable up-regulations of the immune-related genes, such as the pro-inflammatory cytokine IL-1β, the chemokine IL-10 and IgM, were observed in spleen and liver of common carp injected in the vaccines with the formalin-killed A. hydrophila (FKA) and the live attenuated XX1LA. Specific antibody to A. hydrophila was found to gradually increase during 28 days post-vaccination (dpv), and the RPS (83.7%) in fish vaccinated with XX1LA, was significant higher than that (37.2%) in fish vaccinated with FKA (P<0.05) on Day 28 after challenged by pathogen. It was demonstrated that the remarkable immune protection presented in the group vaccinated with XX1LA. During the late stage of 4-week immunization phase, compared with FKA and the control, specific IgM antibody titers significantly increased (P<0.05) in the XX1LA group. The activity of the lysozyme in serum indicated no significant change among three groups. In summary, the live attenuated bacterial vaccine XX1LA, screened in this study, indicates the better protect effect on common carp against A. hydrophila, which can be applied in aquaculture of common carp to prevent from the disease outbreak in the future. Copyright © 2016 Elsevier Ltd. All rights reserved.
Tae, Donghyun; Seok, Junhee
2018-05-29
In this paper, we introduce multiple-matching Evidence-based Translator (mEBT) to discover genomic responses from murine expression data for human immune studies, which are significant in the given condition of mice and likely have similar responses in the corresponding condition of human. mEBT is evaluated over multiple data sets and shows improved inter-species agreement. mEBT is expected to be useful for research groups who use murine models to study human immunity. http://cdal.korea.ac.kr/mebt/. jseok14@korea.ac.kr. Supplementary data are available at Bioinformatics online.
Epstein–Barr virus and multiple sclerosis: potential opportunities for immunotherapy
Pender, Michael P; Burrows, Scott R
2014-01-01
Multiple sclerosis (MS) is a common chronic inflammatory demyelinating disease of the central nervous system (CNS) causing progressive disability. Many observations implicate Epstein–Barr virus (EBV) in the pathogenesis of MS, namely universal EBV seropositivity, high anti-EBV antibody levels, alterations in EBV-specific CD8+ T-cell immunity, increased spontaneous EBV-induced transformation of peripheral blood B cells, increased shedding of EBV from saliva and accumulation of EBV-infected B cells and plasma cells in the brain. Several mechanisms have been postulated to explain the role of EBV in the development of MS including cross-reactivity between EBV and CNS antigens, bystander damage to the CNS by EBV-specific CD8+ T cells, activation of innate immunity by EBV-encoded small RNA molecules in the CNS, expression of αB-crystallin in EBV-infected B cells leading to a CD4+ T-cell response against oligodendrocyte-derived αB-crystallin and EBV infection of autoreactive B cells, which produce pathogenic autoantibodies and provide costimulatory survival signals to autoreactive T cells in the CNS. The rapidly accumulating evidence for a pathogenic role of EBV in MS provides ground for optimism that it might be possible to prevent and cure MS by effectively controlling EBV infection through vaccination, antiviral drugs or treatment with EBV-specific cytotoxic CD8+ T cells. Adoptive immunotherapy with in vitro-expanded autologous EBV-specific CD8+ T cells directed against viral latent proteins was recently used to treat a patient with secondary progressive MS. Following the therapy, there was clinical improvement, decreased disease activity on magnetic resonance imaging and reduced intrathecal immunoglobulin production. PMID:25505955
Alexander, Jeff; Mendy, Jason; Vang, Lo; Avanzini, Jenny B.; Garduno, Fermin; Manayani, Darly J.; Ishioka, Glenn; Farness, Peggy; Ping, Li-Hua; Swanstrom, Ronald; Parks, Robert; Liao, Hua-Xin; Haynes, Barton F.; Montefiori, David C.; LaBranche, Celia; Smith, Jonathan; Gurwith, Marc; Mayall, Tim
2013-01-01
Background There is a well-acknowledged need for an effective AIDS vaccine that protects against HIV-1 infection or limits in vivo viral replication. The objective of these studies is to develop a replication-competent, vaccine vector based on the adenovirus serotype 4 (Ad4) virus expressing HIV-1 envelope (Env) 1086 clade C glycoprotein. Ad4 recombinant vectors expressing Env gp160 (Ad4Env160), Env gp140 (Ad4Env140), and Env gp120 (Ad4Env120) were evaluated. Methods The recombinant Ad4 vectors were generated with a full deletion of the E3 region of Ad4 to accommodate the env gene sequences. The vaccine candidates were assessed in vitro following infection of A549 cells for Env-specific protein expression and for posttranslational transport to the cell surface as monitored by the binding of broadly neutralizing antibodies (bNAbs). The capacity of the Ad4Env vaccines to induce humoral immunity was evaluated in rabbits for Env gp140 and V1V2-specific binding antibodies, and HIV-1 pseudovirus neutralization. Mice immunized with the Ad4Env160 vaccine were assessed for IFNγ T cell responses specific for overlapping Env peptide sets. Results Robust Env protein expression was confirmed by western blot analysis and recognition of cell surface Env gp160 by multiple bNAbs. Ad4Env vaccines induced humoral immune responses in rabbits that recognized Env 1086 gp140 and V1V2 polypeptide sequences derived from 1086 clade C, A244 clade AE, and gp70 V1V2 CASE A2 clade B fusion protein. The immune sera efficiently neutralized tier 1 clade C pseudovirus MW965.26 and neutralized the homologous and heterologous tier 2 pseudoviruses to a lesser extent. Env-specific T cell responses were also induced in mice following Ad4Env160 vector immunization. Conclusions The Ad4Env vaccine vectors express high levels of Env glycoprotein and induce both Env-specific humoral and cellular immunity thus supporting further development of this new Ad4 HIV-1 Env vaccine platform in Phase 1 clinical trials. PMID:24312658
Hajam, Irshad Ahmed; Lee, John Hwa
2017-06-01
Recombinant Salmonella strains expressing foreign heterologous antigens have been extensively studied as promising live vaccine delivery vehicles. In this study, we constructed attenuated smooth (S-HA) and rough (R-HA) Salmonella strains expressing hemagglutinin (HA) of H9N2, a low pathogenic avian influenza A virus. We then investigated the HA-specific immune responses following oral immunization with either S-HA or R-HA strain in chicken model. We further examined the effects of the preexisting anti-Salmonella immunity on the subsequent elicitation of the HA and the Salmonella ompA specific immune responses. Our results showed that primary immunization with either the S-HA or the R-HA strain elicited comparable HA-specific immune responses and the responses were significantly (p<0.05) higher compared to the Salmonella vector control. When chickens were pre-immunized with the smooth Salmonella carrier alone and then vaccinated with either S-HA or R-HA strain 3, 6 and 9 weeks later, respectively, significant reductions were seen for HA-specific immune responses at week 6, a point which corresponded to the peak of the primary Salmonella-specific antibody responses. No reductions were seen at week 3 and 9, albeit, the HA-specific immune responses were boosted at week 9, a point which corresponded to the lowest primary Salmonella-specific antibody responses. The ompA recall responses remain refractory at week 3 and 6 following deliberate immunization with the carrier strain, but were significantly (p<0.05) increased at week 9 post-primary immunization. We conclude that preexisting anti-Salmonella immunity inhibits antigen-specific immune responses and this effect could be avoided by carefully selecting the time point when carrier-specific immune responses are relatively low. Copyright © 2017 Elsevier B.V. All rights reserved.
Kirschbaum, Klara; Sonner, Jana K; Zeller, Matthias W; Deumelandt, Katrin; Bode, Julia; Sharma, Rakesh; Krüwel, Thomas; Fischer, Manuel; Hoffmann, Angelika; Costa da Silva, Milene; Muckenthaler, Martina U; Wick, Wolfgang; Tews, Björn; Chen, John W; Heiland, Sabine; Bendszus, Martin; Platten, Michael; Breckwoldt, Michael O
2016-11-15
Innate immune cells play a key role in the pathogenesis of multiple sclerosis and experimental autoimmune encephalomyelitis (EAE). Current clinical imaging is restricted to visualizing secondary effects of inflammation, such as gliosis and blood-brain barrier disruption. Advanced molecular imaging, such as iron oxide nanoparticle imaging, can allow direct imaging of cellular and molecular activity, but the exact cell types that phagocytose nanoparticles in vivo and how phagocytic activity relates to disease severity is not well understood. In this study we used MRI to map inflammatory infiltrates using high-field MRI and fluorescently labeled cross-linked iron oxide nanoparticles for cell tracking. We confirmed nanoparticle uptake and MR detectability ex vivo. Using in vivo MRI, we identified extensive nanoparticle signal in the cerebellar white matter and circumscribed cortical gray matter lesions that developed during the disease course (4.6-fold increase of nanoparticle accumulation in EAE compared with healthy controls, P < 0.001). Nanoparticles showed good cellular specificity for innate immune cells in vivo, labeling activated microglia, infiltrating macrophages, and neutrophils, whereas there was only sparse uptake by adaptive immune cells. Importantly, nanoparticle signal correlated better with clinical disease than conventional gadolinium (Gd) imaging (r, 0.83 for nanoparticles vs. 0.71 for Gd-imaging, P < 0.001). We validated our approach using the Food and Drug Administration-approved iron oxide nanoparticle ferumoxytol. Our results show that noninvasive molecular imaging of innate immune responses can serve as an imaging biomarker of disease activity in autoimmune-mediated neuroinflammation with potential clinical applications in a wide range of inflammatory diseases.
Li, Yan; Tu, Zhidan; Qian, Shiguang; Fung, John J.; Markowitz, Sanford D.; Kusner, Linda L.; Kaminski, Henry J.; Lu, Lina; Lin, Feng
2016-01-01
We recently demonstrated that hepatic stellate cells induce the differentiation of myeloid-derived suppressor cells (MDSCs) from myeloid progenitors. In this study, we found that adoptive transfer of these MDSCs effectively reversed disease progression in experimental autoimmune myasthenia gravis (EAMG), a T-cell-dependent and B-cell-mediated model for myasthenia gravis. In addition to ameliorated disease severity, MDSC-treated EAMG mice showed suppressed acetylcholine receptors (AChR)-specific T-cell responses, decreased levels of serum anti-AChR IgGs, and reduced complement activation at the neuromuscular junctions. Incubating MDSCs with B cells activated by anti-IgM or anti-CD40 antibodies inhibited the proliferation of these in vitro activated B cells. Administering MDSCs into mice immunized with a T-cell-independent antigen inhibited the antigen-specific antibody production in vivo. MDSCs directly inhibit B cells through multiple mechanisms including prostaglandin E2, inducible nitric oxide synthase and arginase. Interestingly, MDSC treatment in EMAG mice does not appear to significantly inhibit their immune response to a non-relevant antigen, ovalbumin. These results demonstrated that hepatic stellate cell-induced MDSCs concurrently suppress both T- and B- cell autoimmunity, leading to effective treatment of established EAMG; and that the MDSCs inhibit AChR-specific immune responses at least partially in an antigen-specific manner. These data suggest that MDSCs could be further developed as a novel approach to treating myasthenia gravis and, even more broadly, other diseases in which T and B cells are involved in pathogenesis. PMID:25057008
Kill: Boosting HIV-specific immune responses
Trautmann, Lydie
2016-01-01
Purpose of review Increasing evidences suggest that purging the latent HIV reservoir in virally-suppressed individuals will require both the induction of viral replication from its latent state and the elimination of these reactivated HIV infected cells (“Shock and Kill” strategy). Boosting potent HIV-specific CD8 T cells is a promising way to achieve an HIV cure. Recent findings Recent studies provided the rationale for developing immune interventions to increase the numbers, function and location of HIV-specific CD8 T cells to purge HIV reservoirs. Multiple approaches are being evaluated including very early suppression of HIV replication in acute infection, adoptive cell transfer, therapeutic vaccination or use of immunomodulatory molecules. New assays to measure the killing and antiviral function of induced HIV-specific CD8 T cells have been developed to assess the efficacy of these new approaches. The strategies combining HIV reactivation and immunobased therapies to boost HIV-specific CD8 T cells can be tested in in vivo and in silico models to accelerate the design of new clinical trials. Summary New immunobased strategies are explored to boost HIV-specific CD8 T cells able to purge the HIV-infected cells with the ultimate goal of achieving spontaneous control of viral replication without antiretroviral treatment. PMID:27054280
Mechanisms Underlying CD4+ Treg Immune Regulation in the Adult: From Experiments to Models
Caridade, Marta; Graca, Luis; Ribeiro, Ruy M.
2013-11-18
To maintain immunological balance the organism has to be tolerant to self while remaining competent to mount an effective immune response against third-party antigens. An important mechanism of this immune regulation involves the action of regulatory T-cell (Tregs). In this mini-review, we discuss some of the known and proposed mechanisms by which Tregs exert their influence in the context of immune regulation, and the contribution of mathematical modeling for these mechanistic studies. These models explore the mechanisms of action of regulatory T cells, and include hypotheses of multiple signals, delivered through simultaneous antigen-presenting cell (APC) conjugation; interaction of feedback loopsmore » between APC, Tregs, and effector cells; or production of specific cytokines that act on effector cells. As the field matures, and competing models are winnowed out, it is likely that we will be able to quantify how tolerance-inducing strategies, such as CD4-blockade, affect T-cell dynamics and what mechanisms explain the observed behavior of T-cell based tolerance.« less
Barry, Kevin C; Ingolia, Nicholas T; Vance, Russell E
2017-01-01
The inducible innate immune response to infection requires a concerted process of gene expression that is regulated at multiple levels. Most global analyses of the innate immune response have focused on transcription induced by defined immunostimulatory ligands, such as lipopolysaccharide. However, the response to pathogens involves additional complexity, as pathogens interfere with virtually every step of gene expression. How cells respond to pathogen-mediated disruption of gene expression to nevertheless initiate protective responses remains unclear. We previously discovered that a pathogen-mediated blockade of host protein synthesis provokes the production of specific pro-inflammatory cytokines. It remains unclear how these cytokines are produced despite the global pathogen-induced block of translation. We addressed this question by using parallel RNAseq and ribosome profiling to characterize the response of macrophages to infection with the intracellular bacterial pathogen Legionella pneumophila. Our results reveal that mRNA superinduction is required for the inducible immune response to a bacterial pathogen. DOI: http://dx.doi.org/10.7554/eLife.22707.001 PMID:28383283
Hernández-Torres, Gloria; Enríquez-Palacios, Ernesto; Mecha, Miriam; Feliú, Ana; Rueda-Zubiaurre, Ainoa; Angelina, Alba; Martín-Cruz, Leticia; Martín-Fontecha, Mar; Palomares, Oscar; Guaza, Carmen; Peña-Cabrera, Eduardo; López-Rodríguez, María L; Ortega-Gutiérrez, Silvia
2018-05-14
Serotonin (5-HT) modulates key aspects of the immune system. However, its precise function and the receptors involved in the observed effects have remained elusive. Among the different serotonin receptors, 5-HT 1A plays an important role in the immune system given its presence in cells involved in both the innate and adaptive immune responses, but its actual levels of expression under different conditions have not been comprehensively studied due to the lack of suitable tools. To further clarify the role of 5-HT 1A receptor in the immune system, we have developed a fluorescent small molecule probe that enables the direct study of the receptor levels in native cells. This probe allows direct profiling of the receptor expression in immune cells using flow cytometry. Our results show that important subsets of immune cells including human monocytes and dendritic cells express functional 5-HT 1A and that its activation is associated with anti-inflammatory signaling. Furthermore, application of the probe to the experimental autoimmune encephalomyelitis model of multiple sclerosis demonstrates its potential to detect the specific overexpression of the 5-HT 1A receptor in CD4+ T cells. Accordingly, the probe reported herein represents a useful tool whose use can be extended to study the levels of 5-HT 1A receptor in ex vivo samples of different immune system conditions.
Systematic pan-cancer analysis reveals immune cell interactions in the tumor microenvironment
Varn, Frederick S.; Wang, Yue; Mullins, David W.; Fiering, Steven; Cheng, Chao
2017-01-01
With the recent advent of immunotherapy, there is a critical need to understand immune cell interactions in the tumor microenvironment in both pan-cancer and tissue-specific contexts. Multi-dimensional datasets have enabled systematic approaches to dissect these interactions in large numbers of patients, furthering our understanding of the patient immune response to solid tumors. Using an integrated approach, we inferred the infiltration levels of distinct immune cell subsets in 23 tumor types from The Cancer Genome Atlas. From these quantities, we constructed a co-infiltration network, revealing interactions between cytolytic cells and myeloid cells in the tumor microenvironment. By integrating patient mutation data, we found that while mutation burden was associated with immune infiltration differences between distinct tumor types, additional factors likely explained differences between tumors originating from the same tissue. We concluded this analysis by examining the prognostic value of individual immune cell subsets as well as how co-infiltration of functionally discordant cell types associated with patient survival. In multiple tumor types, we found that the protective effect of CD8+ T cell infiltration was heavily modulated by co-infiltration of macrophages and other myeloid cell types, suggesting the involvement of myeloid-derived suppressor cells in tumor development. Our findings illustrate complex interactions between different immune cell types in the tumor microenvironment and indicate these interactions play meaningful roles in patient survival. These results demonstrate the importance of personalized immune response profiles when studying the factors underlying tumor immunogenicity and immunotherapy response. PMID:28126714
Criscitiello, Carmen; Viale, Giulia; Gelao, Lucia; Esposito, Angela; De Laurentiis, Michele; De Placido, Sabino; Santangelo, Michele; Goldhirsch, Aron; Curigliano, Giuseppe
2015-02-01
There is a well recognized link between the bone and the immune system and in recent years there has been a major effort to elucidate the multiple functions of the molecules expressed in both bone and immune cells. Several molecules that were initially identified and studied in the immune system have been shown to have essential functions also in the bone. An interdisciplinary field embracing immune and bone biology has been brought together and called "osteoimmunology". The co-regulation of the skeletal and immune systems strikingly exemplifies the extreme complexity of such an interaction. Their interdependency must be considered in designing therapeutic approaches for either of the two systems. In other words, it is necessary to think of the osteoimmune system as a complex physiological unit. Denosumab was originally introduced to specifically target bone resorption, but it is now under evaluation for its effect on the long term immune response. Similarly, our current and still growing knowledge of the intimate link between the immune system and bone will be beneficial for the safety of drugs targeting either of these integrated systems. Given the large number of molecules exerting functions on both the skeletal and immune systems, osteoimmunological understanding is becoming increasingly important. Both bone and immune systems are frequently disrupted in cancer; and they may be crucial in regulating tumor growth and progression. Some therapies - such as bisphosphonates and receptor activator of NF-κB ligand (RANKL) targeted drugs - that aim at reducing pathologic osteolysis in cancer may interact with the immune system, thus providing potential favorable effects on survival. Copyright © 2014 Elsevier Ltd. All rights reserved.
Harbige, James; Eichmann, Martin; Peakman, Mark
2017-11-01
The mechanism by which immune tolerance is breached in autoimmune disease is poorly understood. One possibility is that post-translational modification of self-antigens leads to peripheral recognition of neo-epitopes against which central and peripheral tolerance is inadequate. Accumulating evidence points to multiple mechanisms through which non-germline encoded sequences can give rise to these non-conventional epitopes which in turn engage the immune system as T cell targets. In particular, where these modifications alter the rules of epitope engagement with MHC molecules, such non-conventional epitopes offer a persuasive explanation for associations between specific HLA alleles and autoimmune diseases. In this review article, we discuss current understanding of mechanisms through which non-conventional epitopes may be generated, focusing on several recently described pathways that can transpose germline-encoded sequences. We contextualise these discoveries around type 1 diabetes, the prototypic organ-specific autoimmune disease in which specific HLA-DQ molecules confer high risk. Non-conventional epitopes have the potential to act as tolerance breakers or disease drivers in type 1 diabetes, prompting a timely re-evaluation of models of a etiopathogenesis. Future studies are required to elucidate the disease-relevance of a range of potential non-germline epitopes and their relationship to the natural peptide repertoire. Copyright © 2017 Elsevier Ltd. All rights reserved.
Gwathmey, Kelly G.; Conaway, Mark R.; Seyedsadjadi, Reza; Joshi, Amruta; Barnett, Carolina; Bril, Vera; Ng, Eduardo; David, William; Gable, Karissa; Guptill, Jeffrey T.; Hobson-Webb, Lisa D.; Dineen, Jennifer; Hehir, Michael; Brannagan, Thomas H.; Byun, Esther; Adler, Margaret; Burns, Ted M.
2016-01-01
Introduction Generic health-related quality of life (HRQOL) patient-reported outcome measures have been used in patients with chronic immune-mediated polyneuropathies. We have created a disease-specific HRQOL instrument. Methods and Results The 15-item chronic acquired polyneuropathy patient-reported index (CAP-PRI) was developed and validated in multiple steps. Items were initially generated through patient and specialist input. The performance of the preliminary 20 items was analyzed from a prospective, 5-center study involving chronic immune-mediated polyneuropathy patients. Data analysis suggested modification to a 15-item scale with 3 response categories, rather than 5. The final CAP-PRI was then validated in another prospective, 5-center study. The CAP-PRI appeared to be a unidimensional outcome measure that fits the Rasch Partial Credit Model in our multicenter cohort. It correlated appropriately with the outcome measures commonly used in this patient population. Discussion The CAP-PRI is a simple, easy, disease-specific HRQOL measure that appears to be useful for clinical care and possibly also for clinical trials. PMID:26600438
TLR4, NOD1 and NOD2 mediate immune recognition of putative newly identified periodontal pathogens.
Marchesan, Julie; Jiao, Yizu; Schaff, Riley A; Hao, Jie; Morelli, Thiago; Kinney, Janet S; Gerow, Elizabeth; Sheridan, Rachel; Rodrigues, Vinicius; Paster, Bruce J; Inohara, Naohiro; Giannobile, William V
2016-06-01
Periodontitis is a polymicrobial inflammatory disease that results from the interaction between the oral microbiota and the host immunity. Although the innate immune response is important for disease initiation and progression, the innate immune receptors that recognize both classical and putative periodontal pathogens that elicit an immune response have not been elucidated. By using the Human Oral Microbe Identification Microarray (HOMIM), we identified multiple predominant oral bacterial species in human plaque biofilm that strongly associate with severe periodontitis. Ten of the identified species were evaluated in greater depth, six being classical pathogens and four putative novel pathogens. Using human peripheral blood monocytes (HPBM) and murine bone-marrow-derived macrophages (BMDM) from wild-type (WT) and Toll-like receptor (TLR)-specific and MyD88 knockouts (KOs), we demonstrated that heat-killed Campylobacter concisus, Campylobacter rectus, Selenomonas infelix, Porphyromonas endodontalis, Porphyromonas gingivalis, and Tannerella forsythia mediate high immunostimulatory activity. Campylobacter concisus, C. rectus, and S. infelix exhibited robust TLR4 stimulatory activity. Studies using mesothelial cells from WT and NOD1-specific KOs and NOD2-expressing human embryonic kidney cells demonstrated that Eubacterium saphenum, Eubacterium nodatum and Filifactor alocis exhibit robust NOD1 stimulatory activity, and that Porphyromonas endodontalis and Parvimonas micra have the highest NOD2 stimulatory activity. These studies allowed us to provide important evidence on newly identified putative pathogens in periodontal disease pathogenesis showing that these bacteria exhibit different immunostimulatory activity via TLR4, NOD1, and NOD2 (Clinicaltrials.gov NCT01154855). © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
TLR4, NOD1 and NOD2 Mediate Immune Recognition of Putative Newly-Identified Periodontal Pathogens
Schaff, Riley A.; Hao, Jie; Morelli, Thiago; Kinney, Janet S.; Gerow, Elizabeth; Sheridan, Rachel; Rodrigues, Vinicius; Paster, Bruce J.; Inohara, Naohiro; Giannobile, William V.
2015-01-01
SUMMARY Periodontitis is a polymicrobial inflammatory disease that results from the interaction between the oral microbiota and the host immunity. While the innate immune response is important for disease initiation and progression, the innate immune receptors that recognize both classical and putative periodontal pathogens that elicit an immune response have not been elucidated. By using the Human Oral Microbe Identification Microarray (HOMIM), we identified multiple predominant oral bacterial species in human plaque biofilm that strongly associate with severe periodontitis. Ten of the identified species were evaluated in greater depth, 6 being classical pathogens and 4 putative novel pathogens. Using human peripheral blood monocytes (HPBM) and murine bone marrow–derived macrophages (BMDM) from wild-type (WT) and toll-like receptor (TLR)-specific and MyD88 knockouts (KOs), we demonstrated that heat-killed Campylobacter concisus, Campylobacter rectus, Selenomonas infelix, Porphyromonas endodontalis, Porphyromonas gingivalis, and Tannerella forsythia mediate high immunostimulatory activity. C. concisus, C. rectus, and S. infelix exhibited robust TLR4 stimulatory activity. Studies using mesothelial cells from WT and NOD1-specific KOs and NOD2-expressing human embryonic kidney (HEK) cells demonstrated that Eubacterium saphenum, Eubacterium nodatum and Filifactor alocis exhibit robust NOD1 stimulatory activity, and that Porphyromonas endodontalis and Parvimonas micra have the highest NOD2-stimulatory activity. These studies allowed us to provide important evidence on newly-identified putative pathogens in periodontal disease pathogenesis showing that these bacteria exhibit different immunostimulatory activity via TLR4, NOD1, and NOD2 (Clinicaltrials.gov NCT01154855). PMID:26177212
'Dressed for success' C-type lectin receptors for the delivery of glyco-vaccines to dendritic cells.
Unger, Wendy W J; van Kooyk, Yvette
2011-02-01
Current strategies in immunotherapy for the treatment of tumors or autoimmunity focus on direct in vivo targeting of antigens to dendritic cells (DC), as these cells are the key regulators of immune responses. Multiple DC subsets can be distinguished in both humans and mice, based on phenotype and location. Moreover, recent data show that these subsets have distinct functions. All these features have implications for the design of DC-targeting vaccines. In this review we integrate recent knowledge on the different DC subsets in human and mice and how DC-expressed C-type lectin receptors (CLR) can be exploited for the induction of either antigen-specific immunity or tolerance. Copyright © 2010 Elsevier Ltd. All rights reserved.
CD4 T-Cell Memory Generation and Maintenance
Gasper, David J.; Tejera, Melba Marie; Suresh, M.
2014-01-01
Immunologic memory is the adaptive immune system's powerful ability to remember a previous antigen encounter and react with accelerated vigor upon antigen re-exposure. It provides durable protection against reinfection with pathogens and is the foundation for vaccine-induced immunity. Unlike the relatively restricted immunologic purview of memory B cells and CD8 T cells, the field of CD4 T-cell memory must account for multiple distinct lineages with diverse effector functions, the issue of lineage commitment and plasticity, and the variable distribution of memory cells within each lineage. Here, we discuss the evidence for lineage-specific CD4 T-cell memory and summarize the known factors contributing to memory-cell generation, plasticity, and long-term maintenance. PMID:24940912
Immune Ecosystem of Virus-Infected Host Tissues.
Maarouf, Mohamed; Rai, Kul Raj; Goraya, Mohsan Ullah; Chen, Ji-Long
2018-05-06
Virus infected host cells serve as a central immune ecological niche during viral infection and replication and stimulate the host immune response via molecular signaling. The viral infection and multiplication process involves complex intracellular molecular interactions between viral components and the host factors. Various types of host cells are also involved to modulate immune factors in delicate and dynamic equilibrium to maintain a balanced immune ecosystem in an infected host tissue. Antiviral host arsenals are equipped to combat or eliminate viral invasion. However, viruses have evolved with strategies to counter against antiviral immunity or hijack cellular machinery to survive inside host tissue for their multiplication. However, host immune systems have also evolved to neutralize the infection; which, in turn, either clears the virus from the infected host or causes immune-mediated host tissue injury. A complex relationship between viral pathogenesis and host antiviral defense could define the immune ecosystem of virus-infected host tissues. Understanding of the molecular mechanism underlying this ecosystem would uncover strategies to modulate host immune function for antiviral therapeutics. This review presents past and present updates of immune-ecological components of virus infected host tissue and explains how viruses subvert the host immune surveillances.
The Role of B Cells and Humoral Immunity in Mycobacterium tuberculosis Infection
Kozakiewicz, Lee; Phuah, Jiayao; Flynn, JoAnne
2014-01-01
Tuberculosis (TB) remains a serious threat to public health, causing 2 million deaths annually world-wide. The control of TB has been hindered by the requirement of long duration of treatment involving multiple chemotherapeutic agents, the increased susceptibility to Mycobacterium tuberculosis infection in the HIV-infected population, and the development of multi-drug resistant and extensively resistant strains of tubercle bacilli. An efficacious and cost-efficient way to control TB is the development of effective anti-TB vaccines. This measure requires thorough understanding of the immune response to M. tuberculosis. While the role of cell-mediated immunity in the development of protective immune response to the tubercle bacillus has been well established, the role of B cells in this process is not clearly understood. Emerging evidence suggests that B cells and humoral immunity can modulate the immune response to various intracellular pathogens, including M. tuberculosis. These lymphocytes form conspicuous aggregates in the lungs of tuberculous humans, non-human primates, and mice, which display features of germinal center B cells. In murine TB, it has been shown that B cells can regulate the level of granulomatous reaction, cytokine production, and the T cell response. This chapter discusses the potential mechanisms by which specific functions of B cells and humoral immunity can shape the immune response to intracellular pathogens in general, and to M. tuberculosis in particular. Knowledge of the B cell-mediated immune response to M. tuberculosis may lead to the design of novel strategies, including the development of effective vaccines, to better control TB. PMID:23468112
Autoantigen cross-reactive environmental antigen can trigger multiple sclerosis-like disease.
Reynolds, Catherine J; Sim, Malcolm J W; Quigley, Kathryn J; Altmann, Daniel M; Boyton, Rosemary J
2015-05-13
Multiple sclerosis is generally considered an autoimmune disease resulting from interaction between predisposing genes and environmental factors, together allowing immunological self-tolerance to be compromised. The precise nature of the environmental inputs has been elusive, infectious agents having received considerable attention. A recent study generated an algorithm predicting naturally occurring T cell receptor (TCR) ligands from the proteome database. Taking the example of a multiple sclerosis patient-derived anti-myelin TCR, the study identified a number of stimulatory, cross-reactive peptide sequences from environmental and human antigens. Having previously generated a spontaneous multiple sclerosis (MS) model through expression of this TCR, we asked whether any of these could indeed function in vivo to trigger CNS disease by cross-reactive activation. A number of myelin epitope cross-reactive epitopes could stimulate T cell immunity in this MS anti-myelin TCR transgenic model. Two of the most stimulatory of these 'environmental' epitopes, from Dictyostyelium slime mold and from Emiliania huxleyi, were tested for the ability to induce MS-like disease in the transgenics. We found that immunization with cross-reactive peptide from Dictyostyelium slime mold (but not from E. huxleyi) induces severe disease. These specific environmental epitopes are unlikely to be common triggers of MS, but this study suggests that our search for the cross-reactivity triggers of autoimmune activation leading to MS should encompass epitopes not just from the 'infectome' but also from the full environmental 'exposome.'
Childhood Immunization - Multiple Languages
... What to Do If Your Child Has Discomfort - English PDF After the Shots: What to Do If ... Coalition Immunizations for Babies: A Guide for Parents - English PDF Immunizations for Babies: A Guide for Parents - ...
Environmental Mycobiome Modifiers of Inflammation and Fibrosis in Systemic Sclerosis
2016-09-01
TUBB), and ribosomal proteins), while others are considered specific to SSc despite trace level detection in controls. For ex- ample, multiple SSc...Strong re- activity was seen against all five proteins in SSc with only trace levels detected in controls (Fig. 3a), indicating widespread immune...sequences in SSc RNA-seq data was used to detect microbial sequences in human tissues in an unbiased, quantitative manner. Our studies suggest that
Dendritic Cell Immune Responses in HIV-1 Controllers.
Martin-Gayo, Enrique; Yu, Xu G
2017-02-01
Robust HIV-1-specific CD8 T cell responses are currently regarded as the main correlate of immune defense in rare individuals who achieve natural, drug-free control of HIV-1; however, the mechanisms that support evolution of such powerful immune responses are not well understood. Dendritic cells (DCs) are specialized innate immune cells critical for immune recognition, immune regulation, and immune induction, but their possible contribution to HIV-1 immune defense in controllers remains ill-defined. Recent studies suggest that myeloid DCs from controllers have improved abilities to recognize HIV-1 through cytoplasmic immune sensors, resulting in more potent, cell-intrinsic type I interferon secretion in response to viral infection. This innate immune response may facilitate DC-mediated induction of highly potent antiviral HIV-1-specific T cells. Moreover, protective HLA class I isotypes restricting HIV-1-specific CD8 T cells may influence DC function through specific interactions with innate myelomonocytic MHC class I receptors from the leukocyte immunoglobulin-like receptor family. Bi-directional interactions between dendritic cells and HIV-1-specific T cells may contribute to natural HIV-1 immune control, highlighting the importance of a fine-tuned interplay between innate and adaptive immune activities for effective antiviral immune defense.
Wei, Junping; Yang, Xiao Yi; Lei, Gangjun; Wang, Tao; Liu, Cong-Xiao; Morse, Michael A.; Gouin, Kenneth; Knott, Simon R. V.; Hartman, Zachary C.
2018-01-01
ABSTRACT Triple-negative breast cancer (TNBC) is an aggressive and molecularly diverse breast cancer subtype typified by the presence of p53 mutations (∼80%), elevated immune gene signatures and neoantigen expression, as well as the presence of tumor infiltrating lymphocytes (TILs). As these factors are hypothesized to be strong immunologic prerequisites for the use of immune checkpoint blockade (ICB) antibodies, multiple clinical trials testing single ICBs have advanced to Phase III, with early indications of heterogeneous response rates of <20% to anti-PD1 and anti-PDL1 ICB. While promising, these modest response rates highlight the need for mechanistic studies to understand how different ICBs function, how their combination impacts functionality and efficacy, as well as what immunologic parameters predict efficacy to different ICBs regimens in TNBC. To address these issues, we tested anti-PD1 and anti-CTLA4 in multiple models of TNBC and found that their combination profoundly enhanced the efficacy of either treatment alone. We demonstrate that this efficacy is due to anti-CTLA4-driven expansion of an individually unique T-cell receptor (TCR) repertoire whose functionality is enhanced by both intratumoral Treg suppression and anti-PD1 blockade of tumor expressed PDL1. Notably, the individuality of the TCR repertoire was observed regardless of whether the tumor cells expressed a nonself antigen (ovalbumin) or if tumor-specific transgenic T-cells were transferred prior to sequencing. However, responsiveness was strongly correlated with systemic measures of tumor-specific T-cell and B-cell responses, which along with systemic assessment of TCR expansion, may serve as the most useful predictors for clinical responsiveness in future clinical trials of TNBC utilizing anti-PD1/anti-CTLA4 ICB. PMID:29721371
Consensus guidelines for the detection of immunogenic cell death
Kepp, Oliver; Senovilla, Laura; Vitale, Ilio; Vacchelli, Erika; Adjemian, Sandy; Agostinis, Patrizia; Apetoh, Lionel; Aranda, Fernando; Barnaba, Vincenzo; Bloy, Norma; Bracci, Laura; Breckpot, Karine; Brough, David; Buqué, Aitziber; Castro, Maria G.; Cirone, Mara; Colombo, Maria I.; Cremer, Isabelle; Demaria, Sandra; Dini, Luciana; Eliopoulos, Aristides G.; Faggioni, Alberto; Formenti, Silvia C.; Fučíková, Jitka; Gabriele, Lucia; Gaipl, Udo S.; Galon, Jérôme; Garg, Abhishek; Ghiringhelli, François; Giese, Nathalia A.; Guo, Zong Sheng; Hemminki, Akseli; Herrmann, Martin; Hodge, James W.; Holdenrieder, Stefan; Honeychurch, Jamie; Hu, Hong-Min; Huang, Xing; Illidge, Tim M.; Kono, Koji; Korbelik, Mladen; Krysko, Dmitri V.; Loi, Sherene; Lowenstein, Pedro R.; Lugli, Enrico; Ma, Yuting; Madeo, Frank; Manfredi, Angelo A.; Martins, Isabelle; Mavilio, Domenico; Menger, Laurie; Merendino, Nicolò; Michaud, Michael; Mignot, Gregoire; Mossman, Karen L.; Multhoff, Gabriele; Oehler, Rudolf; Palombo, Fabio; Panaretakis, Theocharis; Pol, Jonathan; Proietti, Enrico; Ricci, Jean-Ehrland; Riganti, Chiara; Rovere-Querini, Patrizia; Rubartelli, Anna; Sistigu, Antonella; Smyth, Mark J.; Sonnemann, Juergen; Spisek, Radek; Stagg, John; Sukkurwala, Abdul Qader; Tartour, Eric; Thorburn, Andrew; Thorne, Stephen H.; Vandenabeele, Peter; Velotti, Francesca; Workenhe, Samuel T.; Yang, Haining; Zong, Wei-Xing; Zitvogel, Laurence; Kroemer, Guido; Galluzzi, Lorenzo
2014-01-01
Apoptotic cells have long been considered as intrinsically tolerogenic or unable to elicit immune responses specific for dead cell-associated antigens. However, multiple stimuli can trigger a functionally peculiar type of apoptotic demise that does not go unnoticed by the adaptive arm of the immune system, which we named “immunogenic cell death” (ICD). ICD is preceded or accompanied by the emission of a series of immunostimulatory damage-associated molecular patterns (DAMPs) in a precise spatiotemporal configuration. Several anticancer agents that have been successfully employed in the clinic for decades, including various chemotherapeutics and radiotherapy, can elicit ICD. Moreover, defects in the components that underlie the capacity of the immune system to perceive cell death as immunogenic negatively influence disease outcome among cancer patients treated with ICD inducers. Thus, ICD has profound clinical and therapeutic implications. Unfortunately, the gold-standard approach to detect ICD relies on vaccination experiments involving immunocompetent murine models and syngeneic cancer cells, an approach that is incompatible with large screening campaigns. Here, we outline strategies conceived to detect surrogate markers of ICD in vitro and to screen large chemical libraries for putative ICD inducers, based on a high-content, high-throughput platform that we recently developed. Such a platform allows for the detection of multiple DAMPs, like cell surface-exposed calreticulin, extracellular ATP and high mobility group box 1 (HMGB1), and/or the processes that underlie their emission, such as endoplasmic reticulum stress, autophagy and necrotic plasma membrane permeabilization. We surmise that this technology will facilitate the development of next-generation anticancer regimens, which kill malignant cells and simultaneously convert them into a cancer-specific therapeutic vaccine. PMID:25941621
Multispecificity of Immunoglobulin M Antibodies Raised against Advanced Glycation End Products
Chikazawa, Miho; Otaki, Natsuki; Shibata, Takahiro; Miyashita, Hiroaki; Kawai, Yoshichika; Maruyama, Shoichi; Toyokuni, Shinya; Kitaura, Yasuyuki; Matsuda, Tsukasa; Uchida, Koji
2013-01-01
Advanced glycation end products (AGEs) are a heterogeneous and complex group of compounds that are formed when reducing sugars, such as dehydroascorbic acid, react in a nonenzymatic way with amino acids in proteins and other macromolecules. AGEs are prevalent in the diabetic vasculature and contribute to the development of atherosclerosis. The presence and accumulation of AGEs in many different cell types affect the extracellular and intracellular structure and function. In the present study, we studied the immune response to the dehydroascorbic acid-derived AGEs and provide multiple lines of evidence suggesting that the AGEs could be an endogenous source of innate epitopes recognized by natural IgM antibodies. Prominent IgM titers to the AGEs were detected in the sera of normal mice and were significantly accelerated by the immunization with the AGEs. Patients with systemic lupus erythematosus (SLE), a potentially fatal systemic autoimmune disease characterized by the increased production of autoantibodies, showed significantly higher serum levels of the IgM titer against the AGEs than healthy individuals. A progressive increase in the IgM response against the AGEs was also observed in the SLE-prone mice. Strikingly, a subset of monoclonal antibodies, showing a specificity toward the AGEs, prepared from normal mice immunized with the AGEs and from the SLE mice cross-reacted with the double-stranded DNA. Moreover, they also cross-reacted with several other modified proteins, including the acetylated proteins, suggesting that the multiple specificity of the antibodies might be ascribed, at least in part, to the increased electronegative potential of the proteins. These findings suggest that the protein modification by the endogenous carbonyl compounds, generating electronegative proteins, could be a source of multispecific natural antibodies. PMID:23543734
Crosby, Erika J; Wei, Junping; Yang, Xiao Yi; Lei, Gangjun; Wang, Tao; Liu, Cong-Xiao; Agarwal, Pankaj; Korman, Alan J; Morse, Michael A; Gouin, Kenneth; Knott, Simon R V; Lyerly, H Kim; Hartman, Zachary C
2018-01-01
Triple-negative breast cancer (TNBC) is an aggressive and molecularly diverse breast cancer subtype typified by the presence of p53 mutations (∼80%), elevated immune gene signatures and neoantigen expression, as well as the presence of tumor infiltrating lymphocytes (TILs). As these factors are hypothesized to be strong immunologic prerequisites for the use of immune checkpoint blockade (ICB) antibodies, multiple clinical trials testing single ICBs have advanced to Phase III, with early indications of heterogeneous response rates of <20% to anti-PD1 and anti-PDL1 ICB. While promising, these modest response rates highlight the need for mechanistic studies to understand how different ICBs function, how their combination impacts functionality and efficacy, as well as what immunologic parameters predict efficacy to different ICBs regimens in TNBC. To address these issues, we tested anti-PD1 and anti-CTLA4 in multiple models of TNBC and found that their combination profoundly enhanced the efficacy of either treatment alone. We demonstrate that this efficacy is due to anti-CTLA4-driven expansion of an individually unique T-cell receptor (TCR) repertoire whose functionality is enhanced by both intratumoral Treg suppression and anti-PD1 blockade of tumor expressed PDL1. Notably, the individuality of the TCR repertoire was observed regardless of whether the tumor cells expressed a nonself antigen (ovalbumin) or if tumor-specific transgenic T-cells were transferred prior to sequencing. However, responsiveness was strongly correlated with systemic measures of tumor-specific T-cell and B-cell responses, which along with systemic assessment of TCR expansion, may serve as the most useful predictors for clinical responsiveness in future clinical trials of TNBC utilizing anti-PD1/anti-CTLA4 ICB.
Lymphocyte reactivity to Ostertagia ostertagi L3 antigen in type I ostertagiasis.
Klesius, P H; Washburn, S M; Ciordia, H; Haynes, T B; Snider, T G
1984-02-01
To better understand the immune response of calves infected with Ostertagia ostertagi, studies were conducted to examine cell-mediated immune responses to L3 antigen and phytohemagglutinin (PHA) by lymphocyte reactivity assay. The L3 antigen was prepared by freeze-thawing and sonication of exsheathed O ostertagi L3. Antigen preparations contained 40 to 60 micrograms of protein/ml and no detectable endotoxin. Cell-mediated immune responses of peripheral blood lymphocytes were determined in 3 groups of 12 calves each: (i) calves given consecutive multiple dose inoculations with L3; (ii) noninfected controls. Consecutive multiple-dose-inoculated calves showed marked increases in stimulation indices (SI) to L3 antigen over the SI of naturally inoculated calves (56.5 and 25.8, respectively). Negative SI were obtained in calves of the noninoculated control group (-1.0). No significant difference (P greater than or equal to 0.05) in response to PHA was obtained between lymphocytes from calves inoculated with O ostertagi and lymphocytes obtained from noninoculated control calves. There was significant (P less than or equal to 0.01) agreement between positive SI and evidence of patent infection (development of type I ostertagiasis). Specificity of lymphocyte reactivity was determined, using lymphocytes from 4 O ostertagi- and 2 Cooperia punctata-infected calves after challenge inoculation. Positive SI to L3 antigen were obtained, using lymphocytes from either O ostertagi- or C punctata-infected calves, indicating that there may be a lack of genus specificity for O ostertagi L3 antigen in lymphocyte reactivity assay. Kinetic studies of lymphocyte reactivity to L3 antigen and PHA showed that responses were briefly suppressed to both of these stimuli in prepatent calves.(ABSTRACT TRUNCATED AT 250 WORDS)
Mansilla, F C; Czepluch, W; Malacari, D A; Hecker, Y P; Bucafusco, D; Franco-Mahecha, O L; Moore, D P; Capozzo, A V
2013-10-18
Mice immunized with a soluble extract of Neospora caninum tachyzoites (sNcAg) formulated with Providean-AVEC, an aqueous soy-based adjuvant, are fully protected from N. caninum multiplication. Here we evaluated the dose-dependent immunogenicity of this vaccine formulation in cattle. Cattle (N=3 per group) were immunized with two applications (30 days apart) of formulations containing Providean-AVEC and different payloads of sNcAg (100, 50 and 10 μg), that were five to fifty times lower than the only reported study using this same antigen in cattle. Kinetics and magnitude of the vaccine-induced immune responses were dose-dependent. Cattle immunized with 100 μg-sNcAg elicited high-avidity specific antibodies 3 weeks after the primary vaccination while those that received 50 μg of antigen had maximum levels of specific high-avidity antibodies 5 days after the day 30 boost. Vaccination with 10 μg of sNcAg induced comparable antibody responses after 2 weeks post re-vaccination. IgG1 was the predominant isotype in all vaccinated animals. Maximum systemic IFN-γ levels were measured in cattle immunized with 50 and 100 μg-sNcAg (14 ± 2.8 ng/ml). CD4(+)-T cells from vaccinated animals proliferated after sNcAg stimulation in vitro, producing IFN-γ. Recall IFN-γ responses mediated by CD4(+)-T cells were detected up to 140 days post vaccination. Formulations containing Providean-AVEC and 50 μg of sNcAg stimulated broad cellular and humoral immune responses against N. caninum in cattle. The profile and magnitude of the immune response elicited by this vaccine can be modified by the antigen-dose and vaccination schedule. This is the first dose-response study performed in cattle using sNcAg as antigen. Copyright © 2013 Elsevier B.V. All rights reserved.
Host-microbiota interactions in the intestine.
Elson, Charles O; Alexander, Katie L
2015-01-01
The comprehensive collection of bacterial species, termed microbiota, within human and other mammalian hosts has profound effects on both innate and adaptive immunity. Multiple host innate mechanisms contribute to intestinal homeostasis, including epithelial production of protective mucin layers maintaining spatial segregation in the intestine as well as epithelial cell secretion of a broad range of antimicrobial peptides. Additionally, epithelial cells employ autophagy to contain and eliminate invading bacteria; interestingly, genetic variants in specific autophagy genes are linked to susceptibility to Crohn's disease. Innate lymphoid cells, which rapidly respond to cytokine and microbial signals, have emerged as important regulators of the intestinal immune response to the microbiota. With regard to adaptive immunity, specific microbial species stimulate induction of regulatory T cells while others induce effector T cells within the gut. Such stimulation is subject to dysregulation during inflammation and disease, contributing to 'dysbiosis' or an abnormal microbiota composition that has been associated with a variety of immune-mediated inflammatory disorders, including celiac disease. The microbiota communicates with the immune system and vice versa; thus, an abnormal microbiota composition likely translates into an altered host immune response, though the exact mechanisms of such are not yet clear. Immunoglobulin A plays a critical role in limiting bacterial access to the host and in maintaining mutualism with the microbiota. Perturbation of the mucosal barrier via infection or other means can induce effector T cells reactive to the intestinal microbiota, and these cells can persist as memory cells for extended periods of time and potentially serve as pathogenic effector cells upon re-encounter with antigen. Health is associated with a diverse microbiota that functions to maintain the balance between T effector and T regulatory cells in the intestine. Whether dysbiosis can be reversed in immune-mediated disease, thus restoring health, is a question of intense interest for this active area of research. © 2015 S. Karger AG, Basel.
Paper-based immune-affinity arrays for detection of multiple mycotoxins in cereals.
Li, Li; Chen, Hongpu; Lv, Xiaolan; Wang, Min; Jiang, Xizhi; Jiang, Yifei; Wang, Heye; Zhao, Yongfu; Xia, Liru
2018-03-01
Mycotoxins produced by different species of fungi may coexist in cereals and feedstuffs, and could be highly toxic for humans and animals. For quantification of multiple mycotoxins in cereals, we developed a paper-based mycotoxin immune-affinity array. First, paper-based microzone arrays were fabricated by photolithography. Then, monoclonal mycotoxin antibodies were added in a copolymerization reaction with a cross-linker to form an immune-affinity monolith on the paper-based microzone array. With use of a competitive immune-response format, paper-based mycotoxin immune-affinity arrays were successfully applied to detect mycotoxins in samples. The detection limits for deoxynivalenol, zearalenone, T-2 toxin, and HT-2 toxin were 62.7, 10.8, 0.36, and 0.23 μg·kg -1 , respectively, which meet relevant requirements for these compounds in food. The recovery rates were 81-86% for deoxynivalenol, 89-117% for zearalenone, 79-86% for T-2 toxin, and 78-83% for HT-2 toxin, and showed the paper-based immune-affinity arrays had good reproducibility. In summary, the paper-based mycotoxin immune-affinity array provides a sensitive, rapid, accurate, stable, and convenient platform for detection of multiple mycotoxins in agro-foods. Graphical abstract Paper-based immune-affinity monolithic array. DON deoxynivalenol, HT-2 HT-2 toxin, T-2 T-2 toxin, PEGDA polyethylene glycol diacrylate, ZEN zearalenone.
Mitsuya, H; Jarrett, R F; Cossman, J; Cohen, O J; Kao, C S; Guo, H G; Reitz, M S; Broder, S
1986-01-01
Human T lymphotropic virus-I (HTLV-I)-specific T cell lines were established and cloned. K5, an OKT8+ clone bearing multiple proviral integration sites, retained its HTLV-I-specific cytotoxicity and a normal dependence on interleukin 2 (IL-2), indicating that there is a finite number of transforming integration sites. R2, an OKT4+ HTLV-I-infected clone, initially mounted a proliferative response to HTLV-I; but then its IL-2-independent proliferation increased and the antigen specificity was lost. All HTLV-I-infected clones tested including K7, another OKT8+ transformed cytotoxic clone that had lost its reactivity, expressed comparable levels of T cell receptor beta-chain (TCR-beta) messenger (m)RNA. Although clones K5 and K7 had different functional properties, they had the same rearrangement of the TCR-beta gene, suggesting that they had the same clonal origin. These data indicate that HTLV-I-specific T cells retain their immune reactivity for variable periods of time following infection, but then usually lose it; in some cases, however, no alteration in function can be detected. The data also suggest that different consequences can take place in the same clone depending on the pattern of retroviral infection. Images PMID:2877011
NASA Technical Reports Server (NTRS)
Knisley, Keith A.; Rodkey, L. Scott
1986-01-01
A sensitive and specific method is proposed for the analysis of specific antibody clonotype changes occurring during an immune response and for comparing multiple sera for antibody clonotype similarities. Polyclonal serum antibodies separated by isoelectric focusing (IEF) were analyzed by an affinity immunoblotting method using antigen-coated nitrocellulose membranes. Antibodies present on the surface of the acrylamide gels following IEF bind the antigen on the nitrocellulose when the coated nitrocellulose is laid over the gels. The technique has been used to analyze Ig clonotypes specific for five protein antigens and two carbohydrate antigens. Optimal antigen concentrations for coating the nitrocellulose membranes were found to range from 10-100 microgram/ml.
The neurobiology of varicella zoster virus infection
Gilden, D.; Mahalingam, R.; Nagel, M. A.; Pugazhenthi, S.; Cohrs, R. J.
2011-01-01
Varicella zoster virus (VZV) is a neurotropic herpesvirus that infects nearly all humans. Primary infection usually causes chickenpox (varicella), after which virus becomes latent in cranial nerve ganglia, dorsal root ganglia and autonomic ganglia along the entire neuraxis. Although VZV cannot be isolated from human ganglia, nucleic acid hybridization and, later, polymerase chain reaction proved that VZV is latent in ganglia. Declining VZV-specific host immunity decades after primary infection allows virus to reactivate spontaneously, resulting in shingles (zoster) characterized by pain and rash restricted to 1-3 dermatomes. Multiple other serious neurological and ocular disorders also result from VZV reactivation. This review summarizes the current state of knowledge of the clinical and pathological complications of neurological and ocular disease produced by VZV reactivation, molecular aspects of VZV latency, VZV virology and VZV-specific immunity, the role of apoptosis in VZV-induced cell death, and the development of an animal model provided by simian varicella virus infection of monkeys. PMID:21342215
Phillips, Dennis R.
2017-01-01
The innate immune system of insects responds to wounding and pathogens by mobilizing multiple pathways that provide both systemic and localized protection. Key localized responses in hemolymph include melanization, coagulation, and hemocyte encapsulation, which synergistically seal wounds and envelop and destroy pathogens. To be effective, these pathways require a targeted deposition of their components to provide protection without compromising the host. Extensive research has identified a large number of the effectors that comprise these responses, but questions remain regarding their post-translational processing, function, and targeting. Here, we used mass spectrometry to demonstrate the integration of pathogen recognition proteins, coagulants, and melanization components into stable, high-mass, multi-functional Immune Complexes (ICs) in Bombyx mori and Aedes aegypti. Essential proteins common to both include phenoloxidases, apolipophorins, serine protease homologs, and a serine protease that promotes hemocyte recruitment through cytokine activation. Pattern recognition proteins included C-type Lectins in B. mori, while A. aegypti contained a protein homologous to Plasmodium-resistant LRIM1 from Anopheles gambiae. We also found that the B. mori IC is stabilized by extensive transglutaminase-catalyzed cross-linking of multiple components. The melanization inhibitor Egf1.0, from the parasitoid wasp Microplitis demolitor, blocked inclusion of specific components into the IC and also inhibited transglutaminase activity. Our results show how coagulants, melanization components, and hemocytes can be recruited to a wound surface or pathogen, provide insight into the mechanism by which a parasitoid evades this immune response, and suggest that insects as diverse as Lepidoptera and Diptera utilize similar defensive mechanisms. PMID:28199361
DOE Office of Scientific and Technical Information (OSTI.GOV)
Watanabe, Daisuke; Brockman, Mark A.; Ndung'u, Thumbi
2007-01-20
Herpes simplex virus (HSV) recombinants induce durable immune responses in rhesus macaques and mice and have induced partial protection in rhesus macaques against mucosal challenge with virulent simian immunodeficiency virus (SIV). In this study, we evaluated the properties of a new generation HSV vaccine vector, an HSV-1 multiple immediate-early (IE) gene deletion mutant virus, d106, which contains deletions in the ICP4, ICP27, ICP22, and ICP47 genes. Because several of the HSV IE genes have been implicated in immune evasion, inactivation of the genes encoding these proteins was expected to result in enhanced immunogenicity. The d106 virus expresses few HSV genemore » products and shows minimal cytopathic effect in cultured cells. When d106 was inoculated into mice, viral DNA accumulated at high levels in draining lymph nodes, consistent with an ability to transduce dendritic cells and activate their maturation and movement to lymph nodes. A d106 recombinant expressing Escherichia coli {beta}-galactosidase induced durable {beta}-gal-specific IgG and CD8{sup +} T cell responses in naive and HSV-immune mice. Finally, d106-based recombinants have been constructed that express simian immunodeficiency virus (SIV) gag, env, or a rev-tat-nef fusion protein for several days in cultured cells. Thus, d106 shows many of the properties desirable in a vaccine vector: limited expression of HSV gene products and cytopathogenicity, high level expression of transgenes, ability to induce durable immune responses, and an ability to transduce dendritic cells and induce their maturation and migration to lymph nodes.« less
Phillips, Dennis R; Clark, Kevin D
2017-01-01
The innate immune system of insects responds to wounding and pathogens by mobilizing multiple pathways that provide both systemic and localized protection. Key localized responses in hemolymph include melanization, coagulation, and hemocyte encapsulation, which synergistically seal wounds and envelop and destroy pathogens. To be effective, these pathways require a targeted deposition of their components to provide protection without compromising the host. Extensive research has identified a large number of the effectors that comprise these responses, but questions remain regarding their post-translational processing, function, and targeting. Here, we used mass spectrometry to demonstrate the integration of pathogen recognition proteins, coagulants, and melanization components into stable, high-mass, multi-functional Immune Complexes (ICs) in Bombyx mori and Aedes aegypti. Essential proteins common to both include phenoloxidases, apolipophorins, serine protease homologs, and a serine protease that promotes hemocyte recruitment through cytokine activation. Pattern recognition proteins included C-type Lectins in B. mori, while A. aegypti contained a protein homologous to Plasmodium-resistant LRIM1 from Anopheles gambiae. We also found that the B. mori IC is stabilized by extensive transglutaminase-catalyzed cross-linking of multiple components. The melanization inhibitor Egf1.0, from the parasitoid wasp Microplitis demolitor, blocked inclusion of specific components into the IC and also inhibited transglutaminase activity. Our results show how coagulants, melanization components, and hemocytes can be recruited to a wound surface or pathogen, provide insight into the mechanism by which a parasitoid evades this immune response, and suggest that insects as diverse as Lepidoptera and Diptera utilize similar defensive mechanisms.
Ziraldo, Cordelia; Gong, Chang; Kirschner, Denise E.; ...
2016-01-06
Lack of an effective vaccine results in 9 million new cases of tuberculosis (TB) every year and 1.8 million deaths worldwide. While many infants are vaccinated at birth with BCG (an attenuated M. bovis), this does not prevent infection or development of TB after childhood. Immune responses necessary for prevention of infection or disease are still unknown, making development of effective vaccines against TB challenging. Several new vaccines are ready for human clinical trials, but these trials are difficult and expensive; especially challenging is determining the appropriate cellular response necessary for protection. The magnitude of an immune response is likelymore » key to generating a successful vaccine. Characteristics such as numbers of central memory (CM) and effector memory (EM) T cells responsive to a diverse set of epitopes are also correlated with protection. Promising vaccines against TB contain mycobacterial subunit antigens (Ag) present during both active and latent infection. We hypothesize that protection against different key immunodominant antigens could require a vaccine that produces different levels of EM and CM for each Ag-specific memory population. We created a computational model to explore EM and CM values, and their ratio, within what we term Memory Design Space. Our model captures events involved in T cell priming within lymph nodes and tracks their circulation through blood to peripheral tissues. We used the model to test whether multiple Ag-specific memory cell populations could be generated with distinct locations within Memory Design Space at a specific time point post vaccination. Boosting can further shift memory populations to memory cell ratios unreachable by initial priming events. By strategically varying antigen load, properties of cellular interactions within the LN, and delivery parameters (e.g., number of boosts) of multi-subunit vaccines, we can generate multiple Ag-specific memory populations that cover a wide range of Memory Design Space. As a result, given a set of desired characteristics for Ag-specific memory populations, we can use our model as a tool to predict vaccine formulations that will generate those populations.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ziraldo, Cordelia; Gong, Chang; Kirschner, Denise E.
Lack of an effective vaccine results in 9 million new cases of tuberculosis (TB) every year and 1.8 million deaths worldwide. While many infants are vaccinated at birth with BCG (an attenuated M. bovis), this does not prevent infection or development of TB after childhood. Immune responses necessary for prevention of infection or disease are still unknown, making development of effective vaccines against TB challenging. Several new vaccines are ready for human clinical trials, but these trials are difficult and expensive; especially challenging is determining the appropriate cellular response necessary for protection. The magnitude of an immune response is likelymore » key to generating a successful vaccine. Characteristics such as numbers of central memory (CM) and effector memory (EM) T cells responsive to a diverse set of epitopes are also correlated with protection. Promising vaccines against TB contain mycobacterial subunit antigens (Ag) present during both active and latent infection. We hypothesize that protection against different key immunodominant antigens could require a vaccine that produces different levels of EM and CM for each Ag-specific memory population. We created a computational model to explore EM and CM values, and their ratio, within what we term Memory Design Space. Our model captures events involved in T cell priming within lymph nodes and tracks their circulation through blood to peripheral tissues. We used the model to test whether multiple Ag-specific memory cell populations could be generated with distinct locations within Memory Design Space at a specific time point post vaccination. Boosting can further shift memory populations to memory cell ratios unreachable by initial priming events. By strategically varying antigen load, properties of cellular interactions within the LN, and delivery parameters (e.g., number of boosts) of multi-subunit vaccines, we can generate multiple Ag-specific memory populations that cover a wide range of Memory Design Space. As a result, given a set of desired characteristics for Ag-specific memory populations, we can use our model as a tool to predict vaccine formulations that will generate those populations.« less
Butler, Michael W.; Stahlschmidt, Zachary R.; Ardia, Daniel R.; Davies, Scott; Davis, Jon; Guillette, Louis J.; Johnson, Nicholas; McCormick, Stephen D.; McGraw, Kevin J.; DeNardo, Dale F.
2013-01-01
Animal body temperature (Tbody) varies over daily and annual cycles, affecting multiple aspects of biological performance in both endothermic and ectothermic animals. Yet a comprehensive comparison of thermal performance among animals varying in Tbody (mean and variance) and heat production is lacking. Thus, we examined the thermal sensitivity of immune function (a crucial fitness determinant) in Vertebrata, a group encompassing species of varying thermal biology. Specifically, we investigated temperature-related variation in two innate immune performance metrics, hemagglutination and hemolysis, for 13 species across all seven major vertebrate clades. Agglutination and lysis were temperature dependent and were more strongly related to the thermal biology of species (e.g., mean Tbody) than to the phylogenetic relatedness of species, although these relationships were complex and frequently surprising (e.g., heterotherms did not exhibit broader thermal performance curves than homeotherms). Agglutination and lysis performance were positively correlated within species, except in taxa that produce squalamine, a steroidal antibiotic that does not lyse red blood cells. Interestingly, we found the antithesis of a generalist-specialist trade-off: species with broader temperature ranges of immune performance also had higher peak performance levels. In sum, we have uncovered thermal sensitivity of immune performance in both endotherms and ectotherms, highlighting the role that temperature and life history play in immune function across Vertebrata.
Liu, Chengwen; Lou, Yanyan; Lizée, Gregory; Qin, Hong; Liu, Shujuan; Rabinovich, Brian; Kim, Grace J; Wang, Yi-Hong; Ye, Yang; Sikora, Andrew G; Overwijk, Willem W; Liu, Yong-Jun; Wang, Gang; Hwu, Patrick
2008-03-01
A prerequisite for strong adaptive antiviral immunity is the robust initial activation of the innate immune system, which is frequently mediated by TLR-activated plasmacytoid DCs (pDCs). Natural antitumor immunity is often comparatively weak, potentially due to the lack of TLR-mediated activation signals within the tumor microenvironment. To assess whether pDCs are capable of directly facilitating effective antitumor immune responses, mice bearing established subcutaneous B16 melanoma tumors were administered TLR9-activated pDCs directly into the tumor. We found that TLR9-activated pDCs induced robust, spontaneous CTL cross-priming against multiple B16 tumor antigens, leading to the regression of both treated tumors and untreated tumors at distant contralateral sites. This T cell cross-priming was mediated by conventional DCs (cDCs) and was completely dependent upon the early recruitment and activation of NK cells at the tumor site. NK cell recruitment was mediated by CCR5 via chemokines secreted by pDCs, and optimal IFN-gamma production by NK cells was mediated by OX40L expressed by pDCs. Our data thus demonstrated that activated pDCs are capable of initiating effective and systemic antitumor immunity through the orchestration of an immune cascade involving the sequential activation of NK cells, cDCs, and CD8(+) T cells.
Transient Treg depletion enhances therapeutic anti‐cancer vaccination
Aston, Wayne J.; Chee, Jonathan; Khong, Andrea; Cleaver, Amanda L.; Solin, Jessica N.; Ma, Shaokang; Lesterhuis, W. Joost; Dick, Ian; Holt, Robert A.; Creaney, Jenette; Boon, Louis; Robinson, Bruce; Lake, Richard A.
2016-01-01
Abstract Introduction Regulatory T cells (Treg) play an important role in suppressing anti‐ immunity and their depletion has been linked to improved outcomes. To better understand the role of Treg in limiting the efficacy of anti‐cancer immunity, we used a Diphtheria toxin (DTX) transgenic mouse model to specifically target and deplete Treg. Methods Tumor bearing BALB/c FoxP3.dtr transgenic mice were subjected to different treatment protocols, with or without Treg depletion and tumor growth and survival monitored. Results DTX specifically depleted Treg in a transient, dose‐dependent manner. Treg depletion correlated with delayed tumor growth, increased effector T cell (Teff) activation, and enhanced survival in a range of solid tumors. Tumor regression was dependent on Teffs as depletion of both CD4 and CD8 T cells completely abrogated any survival benefit. Severe morbidity following Treg depletion was only observed, when consecutive doses of DTX were given during peak CD8 T cell activation, demonstrating that Treg can be depleted on multiple occasions, but only when CD8 T cell activation has returned to base line levels. Finally, we show that even minimal Treg depletion is sufficient to significantly improve the efficacy of tumor‐peptide vaccination. Conclusions BALB/c.FoxP3.dtr mice are an ideal model to investigate the full therapeutic potential of Treg depletion to boost anti‐tumor immunity. DTX‐mediated Treg depletion is transient, dose‐dependent, and leads to strong anti‐tumor immunity and complete tumor regression at high doses, while enhancing the efficacy of tumor‐specific vaccination at low doses. Together this data highlight the importance of Treg manipulation as a useful strategy for enhancing current and future cancer immunotherapies. PMID:28250921
Transient Treg depletion enhances therapeutic anti-cancer vaccination.
Fisher, Scott A; Aston, Wayne J; Chee, Jonathan; Khong, Andrea; Cleaver, Amanda L; Solin, Jessica N; Ma, Shaokang; Lesterhuis, W Joost; Dick, Ian; Holt, Robert A; Creaney, Jenette; Boon, Louis; Robinson, Bruce; Lake, Richard A
2017-03-01
Regulatory T cells (Treg) play an important role in suppressing anti- immunity and their depletion has been linked to improved outcomes. To better understand the role of Treg in limiting the efficacy of anti-cancer immunity, we used a Diphtheria toxin (DTX) transgenic mouse model to specifically target and deplete Treg. Tumor bearing BALB/c FoxP3.dtr transgenic mice were subjected to different treatment protocols, with or without Treg depletion and tumor growth and survival monitored. DTX specifically depleted Treg in a transient, dose-dependent manner. Treg depletion correlated with delayed tumor growth, increased effector T cell (Teff) activation, and enhanced survival in a range of solid tumors. Tumor regression was dependent on Teffs as depletion of both CD4 and CD8 T cells completely abrogated any survival benefit. Severe morbidity following Treg depletion was only observed, when consecutive doses of DTX were given during peak CD8 T cell activation, demonstrating that Treg can be depleted on multiple occasions, but only when CD8 T cell activation has returned to base line levels. Finally, we show that even minimal Treg depletion is sufficient to significantly improve the efficacy of tumor-peptide vaccination. BALB/c.FoxP3.dtr mice are an ideal model to investigate the full therapeutic potential of Treg depletion to boost anti-tumor immunity. DTX-mediated Treg depletion is transient, dose-dependent, and leads to strong anti-tumor immunity and complete tumor regression at high doses, while enhancing the efficacy of tumor-specific vaccination at low doses. Together this data highlight the importance of Treg manipulation as a useful strategy for enhancing current and future cancer immunotherapies.
Yoshizaki, Yuta; Yuba, Eiji; Sakaguchi, Naoki; Koiwai, Kazunori; Harada, Atsushi; Kono, Kenji
2017-10-01
Efficient vaccine carriers for cancer immunotherapy require two functions: antigen delivery to dendritic cells (DCs) and the activation of DCs, a so-called adjuvant effect. We previously reported antigen delivery system using liposomes modified with pH-sensitive polymers, such as 3-methylglutarylated hyperbranched poly(glycidol) (MGlu-HPG), for the induction of antigen-specific immune responses. We reported that inclusion of cationic lipids to MGlu-HPG-modified liposomes activates DCs and enhances antitumor effects. In this study, CpG-DNA, a ligand to Toll-like receptor 9 (TLR9) expressing in endosomes of DCs, was introduced to MGlu-HPG-modified liposomes containing cationic lipids using two complexation methods (Pre-mix and Post-mix) for additional activation of antigen-specific immunity. For Pre-mix, thin membrane of lipids and polymers were dispersed by a mixture of antigen/CpG-DNA. For Post-mix, CpG-DNA was added to pre-formed liposomes. Both Pre-mix and Post-mix delivered CpG-DNA to DC endosomes, where TLR9 is expressing, more efficiently than free CpG-DNA solution did. These liposomes promoted cytokine production from DCs and the expression of co-stimulatory molecules in vitro and induced antigen-specific immune responses in vivo. Both Pre-mix and Post-mix exhibited strong antitumor effects compared with conventional pH-sensitive polymer-modified liposomes. Results show that inclusion of multiple adjuvant molecules into pH-sensitive polymer-modified liposomes and suitable CpG-DNA complexation methods are important to design potent vaccine carriers. Copyright © 2017 Elsevier Ltd. All rights reserved.
Wada, Hisashi; Isobe, Midori; Kakimi, Kazuhiro; Mizote, Yu; Eikawa, Shingo; Sato, Eiichi; Takigawa, Nagio; Kiura, Katsuyuki; Tsuji, Kazuhide; Iwatsuki, Keiji; Yamasaki, Makoto; Miyata, Hiroshi; Matsushita, Hirokazu; Udono, Heiichiro; Seto, Yasuyuki; Yamada, Kazuhiro; Nishikawa, Hiroyoshi; Pan, Linda; Venhaus, Ralph; Oka, Mikio; Doki, Yuichiro; Nakayama, Eiichi
2014-01-01
We conducted a clinical trial of an NY-ESO-1 cancer vaccine using 4 synthetic overlapping long peptides (OLP; peptides #1, 79-108; #2, 100-129; #3, 121-150; and #4, 142-173) that include a highly immunogenic region of the NY-ESO-1 molecule. Nine patients were immunized with 0.25 mg each of three 30-mer and a 32-mer long NY-ESO-1 OLP mixed with 0.2 KE Picibanil OK-432 and 1.25 mL Montanide ISA-51. The primary endpoints of this study were safety and NY-ESO-1 immune responses. Five to 18 injections of the NY-ESO-1 OLP vaccine were well tolerated. Vaccine-related adverse events observed were fever and injection site reaction (grade 1 and 2). Two patients showed stable disease after vaccination. An NY-ESO-1-specific humoral immune response was observed in all patients and an antibody against peptide #3 (121-150) was detected firstly and strongly after vaccination. NY-ESO-1 CD4 and CD8 T-cell responses were elicited in these patients and their epitopes were identified. Using a multifunctional cytokine assay, the number of single or double cytokine-producing cells was increased in NY-ESO-1-specific CD4 and CD8 T cells after vaccination. Multiple cytokine-producing cells were observed in PD-1 (-) and PD-1 (+) CD4 T cells. In conclusion, our study indicated that the NY-ESO-1 OLP vaccine mixed with Picibanil OK-432 and Montanide ISA-51 was well tolerated and elicited NY-ESO-1-specific humoral and CD4 and CD8 T-cell responses in immunized patients.
The immune system and skin cancer.
Yu, Sherry H; Bordeaux, Jeremy S; Baron, Elma D
2014-01-01
Carcinogenesis involves multiple mechanisms that disturb genomic integrity and encourage abnormal proliferation. The immune system plays an integral role in maintaining homeostasis and these mechanisms may arrest or enhance dysplasia. There exists a large body of evidence from organ transplantation literature supporting the significance of the immune suppression in the development of skin cancer. Nonmelanoma skin cancers are the most frequent neoplasms after organ transplantation, with organ transplant recipients having a 65-fold increase in squamous cell carcinoma incidence and 10-fold increase in basal cell carcinoma incidence. Similarly, UV-radiation (UVR) induced immunosuppression is correlated with the development of cutaneous malignancies in a dose-dependent manner. This was first shown several decades ago by Margaret Kripke, when transplanted tumors were rejected in mice with competent immune systems, but grew unchecked in immunosuppressed specimens. After UV exposure, chromophores initiate a cascade that leads to immunosuppression via derangement of Langerhans cells' antigen-presenting capacity. UV-irradiated Langerhans cells present antigens to Th2 cells, but fail to stimulate Th1 cells. A subset of T regulatory cells, specific for the antigen encountered after UVR, is also stimulated to proliferate. In general UV irradiation leads to a greater number of T regulatory cells and fewer effector T cells in the skin, shiftingthe balance from T-cell-mediated immunity to immunosuppression. These regulatory cells have the phenotype CD4+, CD25+, Foxp3+, CTLA-4+. These and many other changes in local immunity lead to a suppressed immune state, which allow for skin cancer development.
Kuster, Ryan D; Boncristiani, Humberto F; Rueppell, Olav
2014-05-15
The ectoparasitic Varroa destructor mite is a major contributor to the ongoing honey bee health crisis. Varroa interacts with honey bee viruses, exacerbating their pathogenicity. In addition to vectoring viruses, immunosuppression of the developing honey bee hosts by Varroa has been proposed to explain the synergy between viruses and mites. However, the evidence for honey bee immune suppression by V. destructor is contentious. We systematically studied the quantitative effects of experimentally introduced V. destructor mites on immune gene expression at five specific time points during the development of the honey bee hosts. Mites reproduced normally and were associated with increased titers of deformed wing virus in the developing bees. Our data on different immune genes show little evidence for immunosuppression of honey bees by V. destructor. Experimental wounding of developing bees increases relative immune gene expression and deformed wing virus titers. Combined, these results suggest that mite feeding activity itself and not immunosuppression may contribute to the synergy between viruses and mites. However, our results also suggest that increased expression of honey bee immune genes decreases mite reproductive success, which may be explored to enhance mite control strategies. Finally, our expression data for multiple immune genes across developmental time and different experimental treatments indicates co-regulation of several of these genes and thus improves our understanding of the understudied honey bee immune system. © 2014. Published by The Company of Biologists Ltd.
Arima, Yasunobu; Kamimura, Daisuke; Sabharwal, Lavannya; Yamada, Moe; Bando, Hidenori; Ogura, Hideki; Atsumi, Toru; Murakami, Masaaki
2013-01-01
The central nervous system (CNS) is an immune-privileged environment protected by the blood-brain barrier (BBB), which consists of specific endothelial cells that are brought together by tight junctions and tight liner sheets formed by pericytes and astrocytic end-feet. Despite the BBB, various immune and tumor cells can infiltrate the CNS parenchyma, as seen in several autoimmune diseases like multiple sclerosis (MS), cancer metastasis, and virus infections. Aside from a mechanical disruption of the BBB like trauma, how and where these cells enter and accumulate in the CNS from the blood is a matter of debate. Recently, using experimental autoimmune encephalomyelitis (EAE), an animal model of MS, we found a "gateway" at the fifth lumber cord where pathogenic autoreactive CD4+ T cells can cross the BBB. Interestingly, this gateway is regulated by regional neural stimulations that can be mechanistically explained by the gate theory. In this review, we also discuss this theory and its potential for treating human diseases.
Won, Harim I.; Schulze, Thomas T.; Clement, Emalie J.; Watson, Gabrielle F.; Watson, Sean M.; Warner, Rosalie C.; Ramler, Elizabeth A. M.; Witte, Elias J.; Schoenbeck, Mark A.; Rauter, Claudia M.; Davis, Paul H.
2018-01-01
Burying beetles (Nicrophorus spp.) are among the relatively few insects that provide parental care while not belonging to the eusocial insects such as ants or bees. This behavior incurs energy costs as evidenced by immune deficits and shorter life-spans in reproducing beetles. In the absence of an assembled transcriptome, relatively little is known concerning the molecular biology of these beetles. This work details the assembly and analysis of the Nicrophorus orbicollis transcriptome at multiple developmental stages. RNA-Seq reads were obtained by next-generation sequencing and the transcriptome was assembled using the Trinity assembler. Validation of the assembly was performed by functional characterization using Gene Ontology (GO), Eukaryotic Orthologous Groups (KOG), and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses. Differential expression analysis highlights developmental stage-specific expression patterns, and immunity-related transcripts are discussed. The data presented provides a valuable molecular resource to aid further investigation into immunocompetence throughout this organism's sexual development. PMID:29707046
Ionizing Radiation Selectively Reduces Skin Regulatory T Cells and Alters Immune Function
Zhou, Yu; Ni, Houping; Balint, Klara; Sanzari, Jenine K.; Dentchev, Tzvete; Diffenderfer, Eric S.; Wilson, Jolaine M.; Cengel, Keith A.; Weissman, Drew
2014-01-01
The skin serves multiple functions that are critical for life. The protection from pathogens is achieved by a complicated interaction between aggressive effectors and controlling functions that limit damage. Inhomogeneous radiation with limited penetration is used in certain types of therapeutics and is experienced with exposure to solar particle events outside the protection of the Earth’s magnetic field. This study explores the effect of ionizing radiation on skin immune function. We demonstrate that radiation, both homogeneous and inhomogeneous, induces inflammation with resultant specific loss of regulatory T cells from the skin. This results in a hyper-responsive state with increased delayed type hypersensitivity in vivo and CD4+ T cell proliferation in vitro. The effects of inhomogeneous radiation to the skin of astronauts or as part of a therapeutic approach could result in an unexpected enhancement in skin immune function. The effects of this need to be considered in the design of radiation therapy protocols and in the development of countermeasures for extended space travel. PMID:24959865
MOLECULAR ALTERATIONS IN GLIOBLASTOMA: POTENTIAL TARGETS FOR IMMUNOTHERAPY
Haque, Azizul; Banik, Naren L.; Ray, Swapan K.
2015-01-01
Glioblastoma is the most common and deadly brain tumor, possibly arising from genetic and epigenetic alterations in normal astroglial cells. Multiple cytogenetic, chromosomal, and genetic alterations have been identified in glioblastoma, with distinct expression of antigens (Ags) and biomarkers that may alter therapeutic potential of this aggressive cancer. Current therapy consists of surgical resection, followed by radiation therapy and chemotherapy. In spite of these treatments, the prognosis for glioblastoma patients is poor. Although recent studies have focused on the development of novel immunotherapeutics against glioblastoma, little is known about glioblastoma specific immune responses. A better understanding of the molecular interactions among glioblastoma tumors, host immune cells, and the tumor microenvironment may give rise to novel integrated approaches for the simultaneous control of tumor escape pathways and the activation of antitumor immune responses. This review provides a detailed overview concerning genetic alterations in glioblastoma, their effects on Ag and biomarker expression and the future design of chemoimmunotherapeutics against glioblastoma. PMID:21199773
DOE Office of Scientific and Technical Information (OSTI.GOV)
Caridade, Marta; Graca, Luis; Ribeiro, Ruy M.
To maintain immunological balance the organism has to be tolerant to self while remaining competent to mount an effective immune response against third-party antigens. An important mechanism of this immune regulation involves the action of regulatory T-cell (Tregs). In this mini-review, we discuss some of the known and proposed mechanisms by which Tregs exert their influence in the context of immune regulation, and the contribution of mathematical modeling for these mechanistic studies. These models explore the mechanisms of action of regulatory T cells, and include hypotheses of multiple signals, delivered through simultaneous antigen-presenting cell (APC) conjugation; interaction of feedback loopsmore » between APC, Tregs, and effector cells; or production of specific cytokines that act on effector cells. As the field matures, and competing models are winnowed out, it is likely that we will be able to quantify how tolerance-inducing strategies, such as CD4-blockade, affect T-cell dynamics and what mechanisms explain the observed behavior of T-cell based tolerance.« less
Proteome-wide survey of the autoimmune target repertoire in autoimmune polyendocrine syndrome type 1
Landegren, Nils; Sharon, Donald; Freyhult, Eva; Hallgren, Åsa; Eriksson, Daniel; Edqvist, Per-Henrik; Bensing, Sophie; Wahlberg, Jeanette; Nelson, Lawrence M.; Gustafsson, Jan; Husebye, Eystein S.; Anderson, Mark S.; Snyder, Michael; Kämpe, Olle
2016-01-01
Autoimmune polyendocrine syndrome type 1 (APS1) is a monogenic disorder that features multiple autoimmune disease manifestations. It is caused by mutations in the Autoimmune regulator (AIRE) gene, which promote thymic display of thousands of peripheral tissue antigens in a process critical for establishing central immune tolerance. We here used proteome arrays to perform a comprehensive study of autoimmune targets in APS1. Interrogation of established autoantigens revealed highly reliable detection of autoantibodies, and by exploring the full panel of more than 9000 proteins we further identified MAGEB2 and PDILT as novel major autoantigens in APS1. Our proteome-wide assessment revealed a marked enrichment for tissue-specific immune targets, mirroring AIRE’s selectiveness for this category of genes. Our findings also suggest that only a very limited portion of the proteome becomes targeted by the immune system in APS1, which contrasts the broad defect of thymic presentation associated with AIRE-deficiency and raises novel questions what other factors are needed for break of tolerance. PMID:26830021
Weigand, Kilian; Voigt, Franziska; Encke, Jens; Hoyler, Birgit; Stremmel, Wolfgang; Eisenbach, Christoph
2012-01-01
AIM: To explore dendritic cells (DCs) multiple functions in immune modulation. METHODS: We used bone-marrow derived dendritic cells from BALB/c mice pulsed with pseudo particles from the hepatitis C virus to vaccinate naive BALB/c mice. Hepatitis C virus (HCV) pseudo particles consist of the genotype 1b derived envelope proteins E1 and E2, covering a non-HCV core structure. Thus, not a single epitope, but the whole “viral surface” induces immunogenicity. For vaccination, mature and activated DC were injected subcutaneously twice. RESULTS: Humoral and cellular immune responses measured by enzyme-linked immunosorbent assay and interferon-gamma enzyme-linked immunosorbent spot test showed antibody production as well as T-cells directed against HCV. Furthermore, T-cell responses confirmed two highly immunogenic regions in E1 and E2 outside the hypervariable region 1. CONCLUSION: Our results indicate dendritic cells as a promising vaccination model for HCV infection that should be evaluated further. PMID:22371638
Low-dose naltrexone (LDN): A promising treatment in immune-related diseases and cancer therapy.
Li, Zijian; You, Yue; Griffin, Noreen; Feng, Juan; Shan, Fengping
2018-06-06
Naltrexone, a non-selective antagonist of opioid receptors, is mainly used as rehabilitation therapy for discharged opiate addicts to eliminate addiction in order to maintain a normal life and prevent or reduce relapse. In recent years, there have been some novel and significant findings on the off-label usage of naltrexone. Within a specific dosage window, LDN can act as an immunomodulator in multiple autoimmune diseases and malignant tumors as well as alleviate the symptoms of some mental disorders. The results of increasing studies indicate that LDN exerts its immunoregulatory activity by binding to opioid receptors in or on immune cells and tumor cells. These new discoveries indicate that LDN may become a promising immunomodulatory agent in the therapy for cancer and many immune-related diseases. In this article, we review the pharmacological functions and mechanisms of LDN as well as its clinical therapeutic potential as revealed by our team and other researchers. Copyright © 2018. Published by Elsevier B.V.
Hoek, Kristen L; Samir, Parimal; Howard, Leigh M; Niu, Xinnan; Prasad, Nripesh; Galassie, Allison; Liu, Qi; Allos, Tara M; Floyd, Kyle A; Guo, Yan; Shyr, Yu; Levy, Shawn E; Joyce, Sebastian; Edwards, Kathryn M; Link, Andrew J
2015-01-01
Systems biology is an approach to comprehensively study complex interactions within a biological system. Most published systems vaccinology studies have utilized whole blood or peripheral blood mononuclear cells (PBMC) to monitor the immune response after vaccination. Because human blood is comprised of multiple hematopoietic cell types, the potential for masking responses of under-represented cell populations is increased when analyzing whole blood or PBMC. To investigate the contribution of individual cell types to the immune response after vaccination, we established a rapid and efficient method to purify human T and B cells, natural killer (NK) cells, myeloid dendritic cells (mDC), monocytes, and neutrophils from fresh venous blood. Purified cells were fractionated and processed in a single day. RNA-Seq and quantitative shotgun proteomics were performed to determine expression profiles for each cell type prior to and after inactivated seasonal influenza vaccination. Our results show that transcriptomic and proteomic profiles generated from purified immune cells differ significantly from PBMC. Differential expression analysis for each immune cell type also shows unique transcriptomic and proteomic expression profiles as well as changing biological networks at early time points after vaccination. This cell type-specific information provides a more comprehensive approach to monitor vaccine responses.
Malondialdehyde epitopes as targets of immunity and the implications for atherosclerosis
Binder, Christoph J.
2018-01-01
Accumulating evidence suggests that oxidation-specific epitopes (OSEs) constitute a novel class of damage-associated molecular patterns (DAMPs) generated during high oxidative stress but also in the physiological process of apoptosis. To deal with the potentially harmful consequences of such epitopes, the immune system has developed several mechanisms to protect from OSEs and to orchestrate their clearance, including IgM natural antibodies and both cellular and membrane-bound receptors. Here, we focus on malondialdehyde (MDA) epitopes as prominent examples of OSEs that trigger both innate and adaptive immune responses. First, we review the mechanism of MDA generation, the different types of adducts on various biomolecules and provide relevant examples for physiological carriers of MDA such as apoptotic cells, microvesicles (MV) or oxidized low-density lipoproteins (LDL). Based on recent insights, we argue that MDA epitopes contribute to the maintenance of homeostatic functions by acting as markers of elevated oxidative stress and tissue damage. We discuss multiple lines of evidence that MDA epitopes are pro-inflammatory and thus important targets of innate and adaptive immune responses. Finally, we illustrate the relevance of MDA epitopes in human pathologies by describing their capacity to drive inflammatory processes in atherosclerosis and highlighting protective mechanisms of immunity that could be exploited for therapeutic purposes. PMID:27235680
White, L J; Mandl, J N; Gomes, M G M; Bodley-Tickell, A T; Cane, P A; Perez-Brena, P; Aguilar, J C; Siqueira, M M; Portes, S A; Straliotto, S M; Waris, M; Nokes, D J; Medley, G F
2007-09-01
The nature and role of re-infection and partial immunity are likely to be important determinants of the transmission dynamics of human respiratory syncytial virus (hRSV). We propose a single model structure that captures four possible host responses to infection and subsequent reinfection: partial susceptibility, altered infection duration, reduced infectiousness and temporary immunity (which might be partial). The magnitude of these responses is determined by four homotopy parameters, and by setting some of these parameters to extreme values we generate a set of eight nested, deterministic transmission models. In order to investigate hRSV transmission dynamics, we applied these models to incidence data from eight international locations. Seasonality is included as cyclic variation in transmission. Parameters associated with the natural history of the infection were assumed to be independent of geographic location, while others, such as those associated with seasonality, were assumed location specific. Models incorporating either of the two extreme assumptions for immunity (none or solid and lifelong) were unable to reproduce the observed dynamics. Model fits with either waning or partial immunity to disease or both were visually comparable. The best fitting structure was a lifelong partial immunity to both disease and infection. Observed patterns were reproduced by stochastic simulations using the parameter values estimated from the deterministic models.
Rajasuriar, Reena; Wright, Edwina; Lewin, Sharon R
2015-01-01
The purpose of this review was to summarize recent studies on the effect of early antiretroviral therapy (ART) in HIV-infected patients on markers of immune activation/inflammation, viral persistence and serious non-AIDS events. Early ART, initiated within days to months of HIV infection, was associated with marked reduction in T-cell activation often reaching levels observed in HIV-uninfected individuals. However, the impact of early ART on markers of innate immune activation, microbial translocation and inflammation/coagulation was less clear. Early ART has also been associated with a significant reduction in the frequency of latently infected cells, which was greater if ART was initiated within days to weeks rather than months following infection. However, few studies have evaluated the relationship between immune activation and viral reservoirs, specifically following early ART. Early ART may potentially reduce serious non-AIDS events and associated mortality, but most of these studies have extrapolated from changes in surrogate markers, such as CD4 : CD8 ratio. Early ART was associated with beneficial effects on multiple markers of immune activation, inflammation and viral persistence. Longer term prospective studies are still needed to determine whether early ART translates to a significant reduction in serious non-AIDS events and mortality.
Doyle, Michael; Holland, John J.
1973-01-01
Defective interfering T particles of vesicular stomatitis virus provide remarkable protection against viral disease and death when introduced intracerebrally in large numbers along with an otherwise rapidly fatal low dose of standard infectious virus. This profound prophylactic effect of defective T particles is due to homologous autointerference since it is serotype-specific and interferon is not induced. This protective effect can be demonstrated only with preparations of T particles that have been purified completely free of infectious virions. When pure T particles are injected intracerebrally along with large doses of infectious virus, they convert an otherwise rapidly fatal disease process to a slowly progressing virus infection that generally terminates in death after many days of wasting disease and paralysis. Intracerebral injection of virus-free T particles alone is apparently innocuous to mice and stimulates immunity to massive doses of homologous infectious virus. In vitro, virus-free T particles at extremely high multiplicities depress cellular RNA and protein synthesis and kill BHK21 cells in culture, but do not exhibit such effects at moderately high multiplicities. PMID:4352972
Peterson, Daniel A; Planer, Joseph D; Guruge, Janaki L; Xue, Lai; Downey-Virgin, Whitt; Goodman, Andrew L; Seedorf, Henning; Gordon, Jeffrey I
2015-05-15
The adaptive immune response to the human gut microbiota consists of a complex repertoire of antibodies interacting with a broad range of taxa. Fusing intestinal lamina propria lymphocytes from mice monocolonized with Bacteroides thetaiotaomicron to a myeloma fusion partner allowed us to recover hybridomas that captured naturally primed, antigen-specific antibody responses representing multiple isotypes, including IgA. One of these hybridomas, 260.8, produced a monoclonal antibody that recognizes an epitope specific for B. thetaiotaomicron isolates in a large panel of hospital- and community-acquired Bacteroides. Whole genome transposon mutagenesis revealed a 19-gene locus, involved in LPS O-antigen polysaccharide synthesis and conserved among multiple B. thetaiotaomicron isolates, that is required for 260.8 epitope expression. Mutants in this locus exhibited marked fitness defects in vitro during growth in rich medium and in gnotobiotic mice colonized with defined communities of human gut symbionts. Expression of the 260.8 epitope was sustained during 10 months of daily passage in vitro and during 14 months of monocolonization of gnotobiotic wild-type, Rag1-/-, or Myd88-/- mice. Comparison of gnotobiotic Rag1-/- mice with and without subcutaneous 260.8 hybridomas disclosed that this IgA did not affect B. thetaiotaomicron population density or suppress 260.8 epitope production but did affect bacterial gene expression in ways emblematic of a diminished host innate immune response. Our study illustrates an approach for (i) generating diagnostic antibodies, (ii) characterizing IgA responses along a continuum of specificity/degeneracy that defines the IgA repertoire to gut symbionts, and (iii) identifying immunogenic epitopes that affect competitiveness and help maintain host-microbe mutualism. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Peterson, Daniel A.; Planer, Joseph D.; Guruge, Janaki L.; Xue, Lai; Downey-Virgin, Whitt; Goodman, Andrew L.; Seedorf, Henning; Gordon, Jeffrey I.
2015-01-01
The adaptive immune response to the human gut microbiota consists of a complex repertoire of antibodies interacting with a broad range of taxa. Fusing intestinal lamina propria lymphocytes from mice monocolonized with Bacteroides thetaiotaomicron to a myeloma fusion partner allowed us to recover hybridomas that captured naturally primed, antigen-specific antibody responses representing multiple isotypes, including IgA. One of these hybridomas, 260.8, produced a monoclonal antibody that recognizes an epitope specific for B. thetaiotaomicron isolates in a large panel of hospital- and community-acquired Bacteroides. Whole genome transposon mutagenesis revealed a 19-gene locus, involved in LPS O-antigen polysaccharide synthesis and conserved among multiple B. thetaiotaomicron isolates, that is required for 260.8 epitope expression. Mutants in this locus exhibited marked fitness defects in vitro during growth in rich medium and in gnotobiotic mice colonized with defined communities of human gut symbionts. Expression of the 260.8 epitope was sustained during 10 months of daily passage in vitro and during 14 months of monocolonization of gnotobiotic wild-type, Rag1−/−, or Myd88−/− mice. Comparison of gnotobiotic Rag1−/− mice with and without subcutaneous 260.8 hybridomas disclosed that this IgA did not affect B. thetaiotaomicron population density or suppress 260.8 epitope production but did affect bacterial gene expression in ways emblematic of a diminished host innate immune response. Our study illustrates an approach for (i) generating diagnostic antibodies, (ii) characterizing IgA responses along a continuum of specificity/degeneracy that defines the IgA repertoire to gut symbionts, and (iii) identifying immunogenic epitopes that affect competitiveness and help maintain host-microbe mutualism. PMID:25795776
Pandey, Manisha; Ozberk, Victoria; Calcutt, Ainslie; Langshaw, Emma; Powell, Jessica; Rivera-Hernandez, Tania; Philips, Zachary; Batzloff, Michael R.; Good, Michael F.
2016-01-01
The immunobiology underlying the slow acquisition of skin immunity to group A streptococci (GAS), is not understood, but attributed to specific virulence factors impeding innate immunity and significant antigenic diversity of the type-specific M-protein, hindering acquired immunity. We used a number of epidemiologically distinct GAS strains to model the development of acquired immunity. We show that infection leads to antibody responses to the serotype-specific determinants on the M-protein and profound protective immunity; however, memory B cells do not develop and immunity is rapidly lost. Furthermore, antibodies do not develop to a conserved M-protein epitope that is able to induce immunity following vaccination. However, if re-infected with the same strain within three weeks, enduring immunity and memory B-cells (MBCs) to type-specific epitopes do develop. Such MBCs can adoptively transfer protection to naïve recipients. Thus, highly protective M-protein-specific MBCs may never develop following a single episode of pyoderma, contributing to the slow acquisition of immunity and to streptococcal endemicity in at-risk populations. PMID:28027314
Immune response of mice to non-adapted avian influenza A virus.
Stropkovská, A; Mikušková, T; Bobišová, Z; Košík, I; Mucha, V; Kostolanský, F; Varečková, E
2015-12-01
Human infections with avian influenza A viruses (IAVs) without or with clinical symptoms of disease were recently reported from several continents, mainly in high risk groups of people, who came into the contact with infected domestic birds or poultry. It was shown that avian IAVs are able to infect humans directly without previous adaptation, however, their ability to replicate and to cause a disease in this new host can differ. No spread of these avian IAVs among humans has been documented until now, except for one case described in Netherlands in the February of 2003 in people directly involved in handling IAV (H7N7)-infected poultry. The aim of our work was to examine whether a low pathogenic avian IAV can induce a virus-specific immune response of biological relevancy, in spite of its restricted replication in mammals. As a model we used a low pathogenic virus A/Duck/Czechoslovakia/1956 (H4N6) (A/Duck), which replicated well in MDCK cells and produced plaques on cell monolayers, but was unable to replicate productively in mouse lungs. We examined how the immune system of mice responds to the intranasal application of this non-adapted avian virus. Though we did not prove the infectious virus in lungs of mice following A/Duck application even after its multiple passaging in mice, we detected virus-specific vRNA till day 8 post infection. Moreover, we detected virus-specific mRNA and de novo synthesized viral nucleoprotein (NP) and membrane protein (M1) in lungs of mice on day 2 and 4 after exposure to A/Duck. Virus-specific antibodies in sera of these mice were detectable by ELISA already after a single intranasal dose of A/Duck virus. Not only antibodies specific to the surface glycoprotein hemagglutinin (HA) were induced, but also antibodies specific to the NP and M1 of IAV were detected by Western blot and their titers increased after the second exposure of mice to this virus. Importantly, antibodies neutralizing virus A/Duck were proved in mouse immune sera after the second dose of virus and a slight increase of mRNA expression of immune mediators tumor necrosis factor alpha (TNF-α) and IP10 has been observed in lungs of these mice 48 hr after the infection. These observations correspond to the limited replication ability of the virus in mice and provided an important information about its ability to induce virus-specific antibodies, including those neutralizing virus, even without the previous virus adaptation to the new mammalian host. Such antibodies could consequently influence the immune potential of exposed individuals and their defensive capability against the newly emerged, even more virulent IAV.
Zhou, Bangjun; Zeng, Lirong
2017-01-01
Virus-induced gene silencing (VIGS) has been used in many plant species as an attractive post transcriptional gene silencing (PTGS) method for studying gene function either individually or at large-scale in a high-throughput manner. However, the specificity and efficiency for knocking down members of a highly homologous gene family have remained to date a significant challenge in VIGS due to silencing of off-targets. Here we present an improved method for the selection and evaluation of gene fragments used for VIGS to specifically and efficiently knock down members of a highly homologous gene family. Using this method, we knocked down twelve and four members, respectively of group III of the gene family encoding ubiquitin-conjugating enzymes (E2) in Nicotiana benthamiana . Assays using these VIGS-treated plants revealed that the group III E2s are essential for plant development, plant immunity-associated reactive oxygen species (ROS) production, expression of the gene NbRbohB that is required for ROS production, and suppression of immunity-associated programmed cell death (PCD) by AvrPtoB, an effector protein of the bacterial pathogen Pseudomons syringae . Moreover, functional redundancy for plant development and ROS production was found to exist among members of group III E2s. We have found that employment of a gene fragment as short as approximately 70 base pairs (bp) that contains at least three mismatched nucleotides to other genes within any 21-bp sequences prevents silencing of off-target(s) in VIGS. This improved approach in the selection and evaluation of gene fragments allows for specific and efficient knocking down of highly homologous members of a gene family. Using this approach, we implicated N. benthamiana group III E2s in plant development, immunity-associated ROS production, and suppression of multiple immunity-associated PCD by AvrPtoB. We also unraveled functional redundancy among group III members in their requirement for plant development and plant immunity-associated ROS production.
Fuentes, Nathalie; Roy, Arpan; Mishra, Vikas; Cabello, Noe; Silveyra, Patricia
2018-05-08
Sex differences in the incidence and prognosis of respiratory diseases have been reported. Studies have shown that women are at increased risk of adverse health outcomes from air pollution than men, but sex-specific immune gene expression patterns and regulatory networks have not been well studied in the lung. MicroRNAs (miRNAs) are environmentally sensitive posttranscriptional regulators of gene expression that may mediate the damaging effects of inhaled pollutants in the lung, by altering the expression of innate immunity molecules. Male and female mice of the C57BL/6 background were exposed to 2 ppm of ozone or filtered air (control) for 3 h. Female mice were also exposed at different stages of the estrous cycle. Following exposure, lungs were harvested and total RNA was extracted. We used PCR arrays to study sex differences in the expression of 84 miRNAs predicted to target inflammatory and immune genes. We identified differentially expressed miRNA signatures in the lungs of male vs. female exposed to ozone. In silico pathway analyses identified sex-specific biological networks affected by exposure to ozone that ranged from direct predicted gene targeting to complex interactions with multiple intermediates. We also identified differences in miRNA expression and predicted regulatory networks in females exposed to ozone at different estrous cycle stages. Our results indicate that both sex and hormonal status can influence lung miRNA expression in response to ozone exposure, indicating that sex-specific miRNA regulation of inflammatory gene expression could mediate differential pollution-induced health outcomes in men and women.
Li, Yan; Tu, Zhidan; Qian, Shiguang; Fung, John J; Markowitz, Sanford D; Kusner, Linda L; Kaminski, Henry J; Lu, Lina; Lin, Feng
2014-09-01
We recently demonstrated that hepatic stellate cells induce the differentiation of myeloid-derived suppressor cells (MDSCs) from myeloid progenitors. In this study, we found that adoptive transfer of these MDSCs effectively reversed disease progression in experimental autoimmune myasthenia gravis (EAMG), a T cell-dependent and B cell-mediated model for myasthenia gravis. In addition to ameliorated disease severity, MDSC-treated EAMG mice showed suppressed acetylcholine receptor (AChR)-specific T cell responses, decreased levels of serum anti-AChR IgGs, and reduced complement activation at the neuromuscular junctions. Incubating MDSCs with B cells activated by anti-IgM or anti-CD40 Abs inhibited the proliferation of these in vitro-activated B cells. Administering MDSCs into mice immunized with a T cell-independent Ag inhibited the Ag-specific Ab production in vivo. MDSCs directly inhibit B cells through multiple mechanisms, including PGE2, inducible NO synthase, and arginase. Interestingly, MDSC treatment in EAMG mice does not appear to significantly inhibit their immune response to a nonrelevant Ag, OVA. These results demonstrated that hepatic stellate cell-induced MDSCs concurrently suppress both T and B cell autoimmunity, leading to effective treatment of established EAMG, and that the MDSCs inhibit AChR-specific immune responses at least partially in an Ag-specific manner. These data suggest that MDSCs could be further developed as a novel approach to treating myasthenia gravis and, even more broadly, other diseases in which T and B cells are involved in pathogenesis. Copyright © 2014 by The American Association of Immunologists, Inc.
de Silva, Thushan I; Gould, Victoria; Mohammed, Nuredin I; Cope, Alethea; Meijer, Adam; Zutt, Ilse; Reimerink, Johan; Kampmann, Beate; Hoschler, Katja; Zambon, Maria; Tregoning, John S
2017-10-01
We need greater understanding of the mechanisms underlying protection against influenza virus to develop more effective vaccines. To do this, we need better, more reproducible methods of sampling the nasal mucosa. The aim of the current study was to compare levels of influenza virus A subtype-specific IgA collected using three different methods of nasal sampling. Samples were collected from healthy adult volunteers before and after LAIV immunization by nasal wash, flocked swabs and Synthetic Absorptive Matrix (SAM) strips. Influenza A virus subtype-specific IgA levels were measured by haemagglutinin binding ELISA or haemagglutinin binding microarray and the functional response was assessed by microneutralization. Nasosorption using SAM strips lead to the recovery of a more concentrated sample of material, with a significantly higher level of total and influenza H1-specific IgA. However, an equivalent percentage of specific IgA was observed with all sampling methods when normalized to the total IgA. Responses measured using a recently developed antibody microarray platform, which allows evaluation of binding to multiple influenza strains simultaneously with small sample volumes, were compared to ELISA. There was a good correlation between ELISA and microarray values. Material recovered from SAM strips was weakly neutralizing when used in an in vitro assay, with a modest correlation between the level of IgA measured by ELISA and neutralization, but a greater correlation between microarray-measured IgA and neutralizing activity. In conclusion we have tested three different methods of nasal sampling and show that flocked swabs and novel SAM strips are appropriate alternatives to traditional nasal washes for assessment of mucosal influenza humoral immunity. Copyright © 2017 Elsevier B.V. All rights reserved.
Wijayalath, Wathsala; Cheesman, Sandra; Tanabe, Kazuyuki; Handunnetti, Shiroma; Carter, Richard; Pathirana, Sisira
2012-01-01
The efficacy of a whole-sporozoite malaria vaccine would partly be determined by the strain-specificity of the protective responses against malarial sporozoites and liver-stage parasites. Evidence from previous reports were inconsistent, where some studies have shown that the protective immunity induced by irradiated or live sporozoites in rodents or humans were cross-protective and in others strain-specific. In the present work, we have studied the strain-specificity of live sporozoite-induced immunity using two genetically and immunologically different strains of Plasmodium cynomolgi, Pc746 and PcCeylon, in toque monkeys. Two groups of monkeys were immunized against live sporozoites of either the Pc746 (n = 5), or the PcCeylon (n = 4) strain, by the bites of 2–4 sporozoite-infected Anopheles tessellates mosquitoes per monkey under concurrent treatments with chloroquine and primaquine to abrogate detectable blood infections. Subsequently, a group of non-immunized monkeys (n = 4), and the two groups of immunized monkeys were challenged with a mixture of sporozoites of the two strains by the bites of 2–5 infective mosquitoes from each strain per monkey. In order to determine the strain-specificity of the protective immunity, the proportions of parasites of the two strains in the challenge infections were quantified using an allele quantification assay, Pyrosequencing™, based on a single nucleotide polymorphism (SNP) in the parasites’ circumsporozoite protein gene. The Pyrosequencing™ data showed that a significant reduction of parasites of the immunizing strain in each group of strain-specifically immunized monkeys had occurred, indicating a stronger killing effect on parasites of the immunizing strain. Thus, the protective immunity developed following a single, live sporozoite/chloroquine immunization, acted specifically against the immunizing strain and was, therefore, strain-specific. As our experiment does not allow us to determine the parasite stage at which the strain-specific protective immunity is directed, it is possible that the target of this immunity could be either the pre-erythrocytic stage, or the blood-stage, or both. PMID:23029282
Krishna, Benjamin A.; Poole, Emma L.; Smit, Martine J.; Wills, Mark R.
2017-01-01
ABSTRACT Reactivation of human cytomegalovirus (HCMV) latent infection from early myeloid lineage cells constitutes a threat to immunocompromised or immune-suppressed individuals. Consequently, understanding the control of latency and reactivation to allow targeting and killing of latently infected cells could have far-reaching clinical benefits. US28 is one of the few viral genes that is expressed during latency and encodes a cell surface G protein-coupled receptor (GPCR), which, during lytic infection, is a constitutive cell-signaling activator. Here we now show that in monocytes, which are recognized sites of HCMV latency in vivo, US28 attenuates multiple cell signaling pathways, including mitogen-activated protein (MAP) kinase and NF-κB, and that this is required to establish a latent infection; viruses deleted for US28 initiate a lytic infection in infected monocytes. We also show that these monocytes then become potent targets for the HCMV-specific host immune response and that latently infected cells treated with an inverse agonist of US28 also reactivate lytic infection and similarly become immune targets. Consequently, we suggest that the use of inhibitors of US28 could be a novel immunotherapeutic strategy to reactivate the latent viral reservoir, allowing it to be targeted by preexisting HCMV-specific T cells. PMID:29208743
Stress-induced enhancement of leukocyte trafficking into sites of surgery or immune activation
NASA Astrophysics Data System (ADS)
Viswanathan, Kavitha; Dhabhar, Firdaus S.
2005-04-01
Effective immunoprotection requires rapid recruitment of leukocytes into sites of surgery, wounding, infection, or vaccination. In contrast to immunosuppressive chronic stressors, short-term acute stressors have immunoenhancing effects. Here, we quantify leukocyte infiltration within a surgical sponge to elucidate the kinetics, magnitude, subpopulation, and chemoattractant specificity of an acute stress-induced increase in leukocyte trafficking to a site of immune activation. Mice acutely stressed before sponge implantation showed 200-300% higher neutrophil, macrophage, natural killer cell, and T cell infiltration than did nonstressed animals. We also quantified the effects of acute stress on lymphotactin- (LTN; a predominantly lymphocyte-specific chemokine), and TNF-- (a proinflammatory cytokine) stimulated leukocyte infiltration. An additional stress-induced increase in infiltration was observed for neutrophils, in response to TNF-, macrophages, in response to TNF- and LTN, and natural killer cells and T cells in response to LTN. These results show that acute stress initially increases trafficking of all major leukocyte subpopulations to a site of immune activation. Tissue damage-, antigen-, or pathogen-driven chemoattractants subsequently determine which subpopulations are recruited more vigorously. Such stress-induced increases in leukocyte trafficking may enhance immunoprotection during surgery, vaccination, or infection, but may also exacerbate immunopathology during inflammatory (cardiovascular disease or gingivitis) or autoimmune (psoriasis, arthritis, or multiple sclerosis) diseases. chemokine | psychophysiological stress | surgical sponge | wound healing | lymphotactin
Winarski, Katie L.; Thornburg, Natalie J.; Yu, Yingchun; ...
2015-07-13
Antigenic drift of circulating seasonal influenza viruses necessitates an international vaccine effort to reduce the impact on human health. A critical feature of the seasonal vaccine is that it stimulates an already primed immune system to diversify memory B cells to recognize closely related, but antigenically distinct, influenza glycoproteins (hemagglutinins). Influenza pandemics arise when hemagglutinins to which no preexisting adaptive immunity exists acquire the capacity to infect humans. Hemagglutinin 5 is one subtype to which little preexisting immunity exists and is only a few acquired mutations away from the ability to transmit efficiently between ferrets, and possibly humans. In thismore » paper, we describe the structure and molecular mechanism of neutralization by H5.3, a vaccine-elicited antibody that neutralizes hemagglutinin 5 viruses and variants with expanded host range. H5.3 binds in the receptor-binding site, forming contacts that recapitulate many of the sialic acid interactions, as well as multiple peripheral interactions, yet is not sensitive to mutations that alter sialic acid binding. H5.3 is highly specific for a subset of H5 strains, and this specificity arises from interactions to the periphery of the receptor-binding site. Finally, H5.3 is also extremely potent, despite retaining germ line-like conformational flexibility.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Winarski, Katie L.; Thornburg, Natalie J.; Yu, Yingchun
Antigenic drift of circulating seasonal influenza viruses necessitates an international vaccine effort to reduce the impact on human health. A critical feature of the seasonal vaccine is that it stimulates an already primed immune system to diversify memory B cells to recognize closely related, but antigenically distinct, influenza glycoproteins (hemagglutinins). Influenza pandemics arise when hemagglutinins to which no preexisting adaptive immunity exists acquire the capacity to infect humans. Hemagglutinin 5 is one subtype to which little preexisting immunity exists and is only a few acquired mutations away from the ability to transmit efficiently between ferrets, and possibly humans. In thismore » paper, we describe the structure and molecular mechanism of neutralization by H5.3, a vaccine-elicited antibody that neutralizes hemagglutinin 5 viruses and variants with expanded host range. H5.3 binds in the receptor-binding site, forming contacts that recapitulate many of the sialic acid interactions, as well as multiple peripheral interactions, yet is not sensitive to mutations that alter sialic acid binding. H5.3 is highly specific for a subset of H5 strains, and this specificity arises from interactions to the periphery of the receptor-binding site. Finally, H5.3 is also extremely potent, despite retaining germ line-like conformational flexibility.« less
Nguyen-Pham, Thanh-Nhan; Jung, Sung-Hoon; Vo, Manh-Cuong; Thanh-Tran, Huong-Thi; Lee, Youn-Kyung; Lee, Hyun-Ju; Choi, Nu-Ri; Hoang, My-Dung; Kim, Hyeoung-Joon; Lee, Je-Jung
2015-10-01
We investigated the efficacy of lenalidomide (LEN) in combination with dendritic cell (DC) vaccination in the MOPC-315 murine myeloma model. After tumor growth, LEN was injected intraperitoneally for 4 consecutive days in combination with DC vaccination. The combination of LEN and vaccination efficiently inhibited tumor growth compared with the single agents alone. A cytotoxic assay revealed that the anticancer effects of DC vaccination plus LEN involved not only generation of antigen-specific cytotoxic T lymphocytes but also NK cells. Vaccinated mice had reduced numbers of suppressor cells, including both myeloid-derived suppressor cells and regulatory T cells, in the spleen. The proportions of CD4+ and CD8+ T cells increased in the spleen, and a Th1 cytokine (interferon-γ) rather than a Th2 cytokine (interleukin-10) was synthesized in response to tumor antigens. LEN enhanced the innate immune response by modulating NK cell numbers and function. In addition, LEN reduced the production levels of angiogenesis-inducing factors in tumor-bearing mice. Together, these results suggest that a combination of LEN and DC vaccination may synergistically enhance anticancer immunity in the murine myeloma model, by inhibiting immunosuppressor cells and stimulating effector cells, as well as effectively polarizing the Th1/Th2 balance in favor of a Th1-specific immune response.
A minimal model for multiple epidemics and immunity spreading.
Sneppen, Kim; Trusina, Ala; Jensen, Mogens H; Bornholdt, Stefan
2010-10-18
Pathogens and parasites are ubiquitous in the living world, being limited only by availability of suitable hosts. The ability to transmit a particular disease depends on competing infections as well as on the status of host immunity. Multiple diseases compete for the same resource and their fate is coupled to each other. Such couplings have many facets, for example cross-immunization between related influenza strains, mutual inhibition by killing the host, or possible even a mutual catalytic effect if host immunity is impaired. We here introduce a minimal model for an unlimited number of unrelated pathogens whose interaction is simplified to simple mutual exclusion. The model incorporates an ongoing development of host immunity to past diseases, while leaving the system open for emergence of new diseases. The model exhibits a rich dynamical behavior with interacting infection waves, leaving broad trails of immunization in the host population. This obtained immunization pattern depends only on the system size and on the mutation rate that initiates new diseases.
Chewing the fat: lipid metabolism and homeostasis during M. tuberculosis infection.
Lovewell, Rustin R; Sassetti, Christopher M; VanderVen, Brian C
2016-02-01
The interplay between Mycobacterium tuberculosis lipid metabolism, the immune response and lipid homeostasis in the host creates a complex and dynamic pathogen-host interaction. Advances in imaging and metabolic analysis techniques indicate that M. tuberculosis preferentially associates with foamy cells and employs multiple physiological systems to utilize exogenously derived fatty-acids and cholesterol. Moreover, novel insights into specific host pathways that control lipid accumulation during infection, such as the PPARγ and LXR transcriptional regulators, have begun to reveal mechanisms by which host immunity alters the bacterial micro-environment. As bacterial lipid metabolism and host lipid regulatory pathways are both important, yet inherently complex, components of active tuberculosis, delineating the heterogeneity in lipid trafficking within disease states remains a major challenge for therapeutic design. Copyright © 2015. Published by Elsevier Ltd.
The many sounds of T lymphocyte silence.
Melero, Ignacio; Arina, Ainhoa; Chen, Lieping
2005-01-01
It is not unusual for antigens and potentially responsive T cells to co-exist in the same organism while these T cells remain silent and do not mount life-threatening immune responses. A rich array of mechanisms has been proposed to explain these observations. T cell silencing is controlled in multiple levels. Initially, dendritic cells and regulatory T cells appear to play critical roles. In addition, T cell immunity is tightly regulated by a molecular network of cytokines and cell receptor interactions by the opposed surfaces of antigen-presenting cells and T cells. Recognition of a specific antigen is therefore shaped and tuned by co-stimulatory and co-inhibitory receptor-ligand pairs. At last, immunologists are beginning to exploit the rules governing these assorted sounds of T cell silence.
IMMUNE DIFFUSION ANALYSIS OF THE EXTRACELLULAR SOLUBLE ANTIGENS OF TWO STRAINS OF RHIZOBIUM MELILOTI
Dudman, W. F.
1964-01-01
Dudman, W. F. (Commonwealth Scientific and Industrial Research Organization, Canberra, Australia). Immune diffusion analysis of the extracellular soluble antigens of two strains of Rhizobium meliloti. J. Bacteriol. 88:782–794. 1964.—Immune diffusion techniques applied to cultures of two strains of Rhizobium meliloti grown in liquid defined medium showed the presence of multiple antigens. Improved resolution of precipitin patterns was obtained with concentrated antigens separated from the cultures as the extracellular soluble fraction or as suspensions of washed cells. The extracellular fraction contained the same diffusible antigens as the washed cells, but additional antigens were found in the cells after ultrasonic disruption. The extracellular soluble antigens were shown by analysis to contain polysaccharide and protein components. In immune diffusion systems, they gave rise to three groups of precipitin bands, two of which were characterized as polysaccharides by their susceptibility to periodate oxidation, and the third as protein by its lability to heat. All the extracellular antigens of both strains were shared except a fast-diffusing polysaccharide, which was specific for each strain. Despite the sharing of all but one of their antigens, cells of these strains showed only a low degree of cross-agglutination, suggesting that their surfaces are dominated by the specific polysaccharide. No differences could be found in the composition of the polysaccharides in the unfractionated extracellular antigens of the two strains, the main components of which were glucose (66%) and galactose (12%) in the presence of several other unidentified sugars in smaller amounts. The pattern of precipitin bands produced in immune diffusion systems by the extracellular soluble fraction could be changed by altering the cultural conditions. Images PMID:14208519
Skoberne, Mojca; Cardin, Rhonda; Lee, Alexander; Kazimirova, Ana; Zielinski, Veronica; Garvie, Danielle; Lundberg, Amy; Larson, Shane; Bravo, Fernando J.; Bernstein, David I.; Flechtner, Jessica B.
2013-01-01
Immunotherapeutic herpes simplex virus 2 (HSV-2) vaccine efficacy depends upon the promotion of antigen-specific immune responses that inhibit reactivation or reactivated virus, thus controlling both recurrent lesions and viral shedding. In the present study, a candidate subunit vaccine, GEN-003/MM-2, was evaluated for its ability to induce a broad-spectrum immune response in mice and therapeutic efficacy in HSV-2-infected guinea pigs. GEN-003 is comprised of HSV-2 glycoprotein D2 (gD2ΔTMR340-363) and a truncated form of infected cell polypeptide 4 (ICP4383-766), formulated with Matrix M-2 (MM-2) adjuvant (GEN-003/MM-2). In addition to eliciting humoral immune responses, CD4+ and CD8+ T cells characterized by the secretion of multiple cytokines and cytolytic antigen-specific T cell responses that were able to be recalled at least 44 days after the last immunization were induced in immunized mice. Furthermore, vaccination with either GEN-003 or GEN-003/MM-2 led to significant reductions in both the prevalence and severity of lesions in HSV-2-infected guinea pigs compared to those of phosphate-buffered saline (PBS) control-vaccinated animals. While vaccination with MM-2 adjuvant alone decreased recurrent disease symptoms compared to the PBS control group, the difference was not statistically significant. Importantly, the frequency of recurrent viral shedding was considerably reduced in GEN-003/MM-2-vaccinated animals but not in GEN-003- or MM-2-vaccinated animals. These findings suggest a possible role for immunotherapeutic GEN-003/MM-2 vaccination as a viable alternative to chronic antiviral drugs in the treatment and control of genital herpes disease. PMID:23365421
Cancer Clonal Theory, Immune Escape, and Their Evolving Roles in Cancer Multi-Agent Therapeutics.
Messerschmidt, Jonathan L; Bhattacharya, Prianka; Messerschmidt, Gerald L
2017-08-12
The knowledge base of malignant cell growth and resulting targets is rapidly increasing every day. Clonal theory is essential to understand the changes required for a cell to become malignant. These changes are then clues to therapeutic intervention strategies. Immune system optimization is a critical piece to find, recognize, and eliminate all cancer cells from the host. Only by administering (1) multiple therapies that counteract the cancer cell's mutational and externally induced survival traits and (2) by augmenting the immune system to combat immune suppression processes and by enhancing specific tumor trait recognition can cancer begin to be treated with a truly targeted focus. Since the sequencing of the human genome during the 1990s, steady progress in understanding genetic alterations and gene product functions are being unraveled. In cancer, this is proceeding very fast and demonstrates that genetic mutations occur very rapidly to allow for selection of survival traits within various cancer clones. Hundreds of mutations have been identified in single individual cancers, but spread across many clones in the patient's body. Precision oncology will require accurate measurement of these cancer survival-benefiting mutations to develop strategies for effective therapy. Inhibiting these cellular mechanisms is a first step, but these malignant cells need to be eliminated by the host's mechanisms, which we are learning to direct more specifically. Cancer is one of the most complicated cellular aberrations humans have encountered. Rapidly developing significant survival traits require prompt, repeated, and total body measurements of these attributes to effectively develop multi-agent treatment of the individual's malignancy. Focused drug development to inhibit these beneficial mutations is critical to slowing cancer cell growth and, perhaps, triggering apoptosis. In many cases, activation and targeting of the immune system to kill the remaining malignant cells is essential to a cure.
Innate lymphoid cells and natural killer T cells in the gastrointestinal tract immune system.
Montalvillo, Enrique; Garrote, José Antonio; Bernardo, David; Arranz, Eduardo
2014-05-01
The gastrointestinal tract is equipped with a highly specialized intrinsic immune system. However, the intestine is exposed to a high antigenic burden that requires a fast, nonspecific response -so-called innate immunity- to maintain homeostasis and protect the body from incoming pathogens. In the last decade multiple studies helped to unravel the particular developmental requirements and specific functions of the cells that play a role in innate immunity. In this review we shall focus on innate lymphoid cells, a newly discovered, heterogeneous set of cells that derive from an Id2-dependent lymphoid progenitor cell population. These cells have been categorized on the basis of the pattern of cytokines that they secrete, and the transcription factors that regulate their development and functions. Innate lymphoid cells play a role in the early response to pathogens, the anatomical contention of the commensal flora, and the maintenance of epithelial integrity.Amongst the various innate lymphoid cells we shall lay emphasis on a subpopulation with several peculiarities, namely that of natural killer T cells, a subset of T lymphocytes that express both T-cell and NK-cell receptors. The most numerous fraction of the NKT population are the so-called invariant NKT or iNKT cells. These iNKT cells have an invariant TCR and recognize the glycolipidic structures presented by the CD1d molecule, a homolog of class-I MHC molecules. Following activation they rapidly acquire cytotoxic activity and secrete both Th1 and Th2 cytokines, including IL-17. While their specific role is not yet established, iNKT cells take part in a great variety of intestinal immune responses ranging from oral tolerance to involvement in a number of gastrointestinal conditions.
Antigen Cross-Presentation of Immune Complexes
Platzer, Barbara; Stout, Madeleine; Fiebiger, Edda
2014-01-01
The ability of dendritic cells (DCs) to cross-present tumor antigens has long been a focus of interest to physicians, as well as basic scientists, that aim to establish efficient cell-based cancer immune therapy. A prerequisite for exploiting this pathway for therapeutic purposes is a better understanding of the mechanisms that underlie the induction of tumor-specific cytotoxic T-lymphocyte (CTL) responses when initiated by DCs via cross-presentation. The ability of humans DC to perform cross-presentation is of utmost interest, as this cell type is a main target for cell-based immunotherapy in humans. The outcome of a cross-presentation event is guided by the nature of the antigen, the form of antigen uptake, and the subpopulation of DCs that performs presentation. Generally, CD8α+ DCs are considered to be the most potent cross-presenting DCs. This paradigm, however, only applies to soluble antigens. During adaptive immune responses, immune complexes form when antibodies interact with their specific epitopes on soluble antigens. Immunoglobulin G (IgG) immune complexes target Fc-gamma receptors on DCs to shuttle exogenous antigens efficiently into the cross-presentation pathway. This receptor-mediated cross-presentation pathway is a well-described route for the induction of strong CD8+ T cell responses. IgG-mediated cross-presentation is intriguing because it permits the CD8− DCs, which are commonly considered to be weak cross-presenters, to efficiently cross-present. Engaging multiple DC subtypes for cross-presentation might be a superior strategy to boost CTL responses in vivo. We here summarize our current understanding of how DCs use IgG-complexed antigens for the efficient induction of CTL responses. Because of its importance for human cell therapy, we also review the recent advances in the characterization of cross-presentation properties of human DC subsets. PMID:24744762
Alexander, Jeff; Ward, Simone; Mendy, Jason; Manayani, Darly J; Farness, Peggy; Avanzini, Jenny B; Guenther, Ben; Garduno, Fermin; Jow, Lily; Snarsky, Victoria; Ishioka, Glenn; Dong, Xin; Vang, Lo; Newman, Mark J; Mayall, Tim
2012-01-01
Influenza virus remains a significant health and social concern in part because of newly emerging strains, such as avian H5N1 virus. We have developed a prototype H5N1 vaccine using a recombinant, replication-competent Adenovirus serotype 4 (Ad4) vector, derived from the U.S. military Ad4 vaccine strain, to express the hemagglutinin (HA) gene from A/Vietnam/1194/2004 influenza virus (Ad4-H5-Vtn). Our hypothesis is that a mucosally-delivered replicating Ad4-H5-Vtn recombinant vector will be safe and induce protective immunity against H5N1 influenza virus infection and disease pathogenesis. The Ad4-H5-Vtn vaccine was designed with a partial deletion of the E3 region of Ad4 to accommodate the influenza HA gene. Replication and growth kinetics of the vaccine virus in multiple human cell lines indicated that the vaccine virus is attenuated relative to the wild type virus. Expression of the HA transgene in infected cells was documented by flow cytometry, western blot analysis and induction of HA-specific antibody and cellular immune responses in mice. Of particular note, mice immunized intranasally with the Ad4-H5-Vtn vaccine were protected against lethal H5N1 reassortant viral challenge even in the presence of pre-existing immunity to the Ad4 wild type virus. Several non-clinical attributes of this vaccine including safety, induction of HA-specific humoral and cellular immunity, and efficacy were demonstrated using an animal model to support Phase 1 clinical trial evaluation of this new vaccine.
The Transcriptional Regulator CpsY Is Important for Innate Immune Evasion in Streptococcus pyogenes
Vega, Luis A.; Valdes, Kayla M.; Sundar, Ganesh S.; Belew, Ashton T.; Islam, Emrul; Berge, Jacob; Curry, Patrick; Chen, Steven
2016-01-01
ABSTRACT As an exclusively human pathogen, Streptococcus pyogenes (the group A streptococcus [GAS]) has specifically adapted to evade host innate immunity and survive in multiple tissue niches, including blood. GAS can overcome the metabolic constraints of the blood environment and expresses various immunomodulatory factors necessary for survival and immune cell resistance. Here we present our investigation of one such factor, the predicted LysR family transcriptional regulator CpsY. The encoding gene, cpsY, was initially identified as being required for GAS survival in a transposon-site hybridization (TraSH) screen in whole human blood. CpsY is homologous with transcriptional regulators of Streptococcus mutans (MetR), Streptococcus iniae (CpsY), and Streptococcus agalactiae (MtaR) that regulate methionine transport, amino acid metabolism, resistance to neutrophil-mediated killing, and survival in vivo. Our investigation indicated that CpsY is involved in GAS resistance to innate immune cells of its human host. However, GAS CpsY does not manifest the in vitro phenotypes of its homologs in other streptococcal species. GAS CpsY appears to regulate a small set of genes that is markedly different from the regulons of its homologs. The differential expression of these genes depends on the growth medium, and CpsY modestly influences their expression. The GAS CpsY regulon includes known virulence factors (mntE, speB, spd, nga [spn], prtS [SpyCEP], and sse) and cell surface-associated factors of GAS (emm1, mur1.2, sibA [cdhA], and M5005_Spy0500). Intriguingly, the loss of CpsY in GAS does not result in virulence defects in murine models of infection, suggesting that CpsY function in immune evasion is specific to the human host. PMID:27993974
Odnokoz, Olena; Nakatsuka, Kyle; Klichko, Vladimir I.; Nguyen, Jacqueline; Solis, Liz Calderon; Ostling, Kaitlin; Badinloo, Marziyeh; Orr, William C.; Radyuk, Svetlana N.
2016-01-01
Previously, we have shown that flies under-expressing the two mitochondrial peroxiredoxins (Prxs), dPrx3 and dPrx5, display increases in tissue-specific apoptosis and dramatically shortened life span, associated with a redox crisis, manifested as changes in GSH:GSSG and accumulation of protein mixed disulfides. To identify specific pathways responsible for the observed biological effects, we performed a transcriptome analysis. Functional clustering revealed a prominent group enriched for immunity-related genes, including a considerable number of NF-kB-dependent antimicrobial peptides (AMP) that are up-regulated in the Prx double mutant. Using qRT-PCR analysis we determined that the age-dependent changes in AMP levels in mutant flies were similar to those observed in controls when scaled to percentage of life span. To further clarify the role of Prx-dependent mitochondrial signaling, we expressed different forms of dPrx5, which unlike the uniquely mitochondrial dPrx3 is found in multiple subcellular compartments, including mitochondrion, nucleus and cytosol. Ectopic expression of dPrx5 in mitochondria but not nucleus or cytosol partially extended longevity under normal or oxidative stress conditions while complete restoration of life span occurred when all three forms of dPrx5 were expressed from the wild type dPrx5 transgene. When dPrx5 was expressed in mitochondria or in all three compartments, it substantially delayed the development of hyperactive immunity while expression of cytosolic or nuclear forms had no effect on the immune phenotype. The data suggest a critical role of mitochondria in development of chronic activation of the immune response triggered by impaired redox control. PMID:27770625
2010-01-01
Background CJ9-gD is a novel dominant-negative recombinant herpes simplex virus type 1 (HSV-1) that is completely replication-defective, cannot establish detectable latent infection in vivo, and expresses high levels of the major HSV-1 antigen glycoprotein D immediately following infection. In the present study, CJ9-gD was evaluated as a vaccine against HSV-2 genital infection in guinea pigs. Results Animals immunized with CJ9-gD developed at least 700-fold higher titers of HSV-2-specific neutralization antibodies than mock-immunized controls. After challenge with wild-type HSV-2, all 10 control guinea pigs developed multiple genital lesions with an average of 21 lesions per animal. In contrast, only 2 minor lesions were found in 2 of 8 CJ9-gD-immunized animals, representing a 40-fold reduction on the incidence of primary genital lesions in immunized animals (p < 0.0001). Immunization significantly reduced the amount and duration of viral shedding and provided complete protection against neurological symptoms, while 90% of mock-immunized animals succumbed due to the severity of disease. Importantly, immunized animals showed no signs of recurrent disease or viral shedding during a 60-days observation period after recovery from primary infection, and carried 50-fold less latent viral DNA load in their dorsal root ganglia than the surviving mock-vaccinated controls (p < 0.0001). Conclusions Collectively, we demonstrate that vaccination with the HSV-1 recombinant CJ9-gD elicits strong and protective immune responses against primary and recurrent HSV-2 genital disease and significantly reduces the extent of latent infection. PMID:20525279
Applying Convergent Immunity to Innovative Vaccines Targeting Staphylococcus aureus
Yeaman, Michael R.; Filler, Scott G.; Schmidt, Clint S.; Ibrahim, Ashraf S.; Edwards, John E.; Hennessey, John P.
2014-01-01
Recent perspectives forecast a new paradigm for future “third generation” vaccines based on commonalities found in diverse pathogens or convergent immune defenses to such pathogens. For Staphylococcus aureus, recurring infections and a limited success of vaccines containing S. aureus antigens imply that native antigens induce immune responses insufficient for optimal efficacy. These perspectives exemplify the need to apply novel vaccine strategies to high-priority pathogens. One such approach can be termed convergent immunity, where antigens from non-target organisms that contain epitope homologs found in the target organism are applied in vaccines. This approach aims to evoke atypical immune defenses via synergistic processes that (1) afford protective efficacy; (2) target an epitope from one organism that contributes to protective immunity against another; (3) cross-protect against multiple pathogens occupying a common anatomic or immunological niche; and/or (4) overcome immune subversion or avoidance strategies of target pathogens. Thus, convergent immunity has a potential to promote protective efficacy not usually elicited by native antigens from a target pathogen. Variations of this concept have been mainstays in the history of viral and bacterial vaccine development. A more far-reaching example is the pre-clinical evidence that specific fungal antigens can induce cross-kingdom protection against bacterial pathogens. This trans-kingdom protection has been demonstrated in pre-clinical studies of the recombinant Candida albicans agglutinin-like sequence 3 protein (rAls3) where it was shown that a vaccine containing rAls3 provides homologous protection against C. albicans, heterologous protection against several other Candida species, and convergent protection against several strains of S. aureus. Convergent immunity reflects an intriguing new approach to designing and developing vaccine antigens and is considered here in the context of vaccines to target S. aureus. PMID:25309545
2012-01-01
Background There is increasing awareness that, aside from producing cerebrospinal fluid, the choroid plexus (CP) might be a key regulator of immune activity in the central nervous system (CNS) during neuroinflammation. Specifically, the CP has recently been posited to control entry of sentinel T cells into the uninflamed CNS during the early stages of neuroinflammatory diseases, like multiple sclerosis (MS) and its animal model experimental autoimmune encephalomyelitis (EAE). As the CP is compartmentalized into a stromal core containing fenestrated capillaries devoid of typical blood–brain barrier properties, surrounded by a tight junction-expressing choroidal epithelium, each of these compartments might mount unique responses that instigate the neuroinflammatory process. Methods To discern responses of the respective CP stromal capillary and choroidal epithelial tissues during evolving neuroinflammation, we investigated morphology and in situ expression of 93 immune-related genes during early stages of EAE induced by immunization with myelin oligodendrocyte glycoprotein peptide (MOG35-55). Specifically, 3-D immunofluorescent imaging was employed to gauge morphological changes, and laser capture microdissection was coupled to an Immune Panel TaqMan Low Density Array to detail alterations in gene expression patterns at these separate CP sites on days 9 and 15 post-immunization (p.i.). To resolve CP effects due to autoimmunity against MOG peptide, from those due to complete Freund’s adjuvant (CFA) and pertussis toxin (PTX) included in the immunization, analysis was performed on MOG-CFA/PTX-treated, CFA/PTX-treated, and naïve cohorts. Results The CP became swollen and displayed significant molecular changes in response to MOG-CFA/PTX immunization. Both stromal capillary and choroidal epithelial tissues mounted vigorous, yet different, changes in expression of numerous genes over the time course analyzed - including those encoding adhesion molecules, cytokines, chemokines, statins, interleukins, T cell activation markers, costimulatory molecules, cyclooxygenase, pro-inflammatory transcription factors and pro-apoptotic markers. Moreover, CFA/PTX-treatment, alone, resulted in extensive, though less robust, alterations in both CP compartments. Conclusions MOG-CFA/PTX immunization significantly affects CP morphology and stimulates distinct expression patterns of immune-related genes in CP stromal capillary and epithelial tissues during evolving EAE. CFA/PTX treatment, alone, causes widespread gene alterations that could prime the CP to unlock the CNS to T cell infiltration during neuroinflammatory disease. PMID:22870943
Shan, Libo; He, Ping; Li, Jianming; Heese, Antje; Peck, Scott C; Nürnberger, Thorsten; Martin, Gregory B; Sheen, Jen
2008-07-17
Successful pathogens have evolved strategies to interfere with host immune systems. For example, the ubiquitous plant pathogen Pseudomonas syringae injects two sequence-distinct effectors, AvrPto and AvrPtoB, to intercept convergent innate immune responses stimulated by multiple microbe-associated molecular patterns (MAMPs). However, the direct host targets and precise molecular mechanisms of bacterial effectors remain largely obscure. We show that AvrPto and AvrPtoB bind the Arabidopsis receptor-like kinase BAK1, a shared signaling partner of both the flagellin receptor FLS2 and the brassinosteroid receptor BRI1. This targeting interferes with ligand-dependent association of FLS2 with BAK1 during infection. It also impedes BAK1-dependent host immune responses to diverse other MAMPs and brassinosteroid signaling. Significantly, the structural basis of AvrPto-BAK1 interaction appears to be distinct from AvrPto-Pto association required for effector-triggered immunity. These findings uncover a unique strategy of bacterial pathogenesis where virulence effectors block signal transmission through a key common component of multiple MAMP-receptor complexes.
Doolan, Denise L
2011-01-01
The Plasmodium parasite, the causative agent of malaria, is an excellent model for immunomic-based approaches to vaccine development. The Plasmodium parasite has a complex life cycle with multiple stages and stage-specific expression of ∼5300 putative proteins. No malaria vaccine has yet been licensed. Many believe that an effective vaccine will need to target several antigens and multiple stages, and will require the generation of both antibody and cellular immune responses. Vaccine efforts to date have been stage-specific and based on only a very limited number of proteins representing <0.5% of the genome. The recent availability of comprehensive genomic, proteomic and transcriptomic datasets from human and selected non-human primate and rodent malarias provide a foundation to exploit for vaccine development. This information can be mined to identify promising vaccine candidate antigens, by proteome-wide screening of antibody and T cell reactivity using specimens from individuals exposed to malaria and technology platforms such as protein arrays, high throughput protein production and epitope prediction algorithms. Such antigens could be incorporated into a rational vaccine development process that targets specific stages of the Plasmodium parasite life cycle with immune responses implicated in parasite elimination and control. Immunomic approaches which enable the selection of the best possible targets by prioritising antigens according to clinically relevant criteria may overcome the problem of poorly immunogenic, poorly protective vaccines that has plagued malaria vaccine developers for the past 25 years. Herein, current progress and perspectives regarding Plasmodium immunomics are reviewed. Copyright © 2010 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.
Wu, Yanhong; Deng, Zhenling; Wang, Huiru; Ma, Wenbo; Zhou, Chunxia; Zhang, Shuren
2016-09-20
Recently, the immunostimulatory roles of chemotherapeutics have been increasingly revealed, although bone marrow suppression is still a common toxicity of chemotherapy. While the numbers and ratios of different immune subpopulations are analyzed after chemotherapy, changes to immune status after each cycle of treatment are less studied and remain unclear. To determine the tumor-specific immune status and functions after different cycles of chemotherapy, we treated CT26 tumor-bearing mice with one to four cycles of 5-fluorouracil (5-FU). Overall survival was not improved when more than one cycle of 5-FU was administered. Here we present data concerning the immune statuses after one and three cycles of chemotherapy. We analyzed the amount of spleen cells from mice treated with one and three cycles of 5-FU as well as assayed their proliferation and cytotoxicity against the CT26 tumor cell line. We found that the absolute numbers of CD8 T-cells and NK cells were not influenced significantly after either one or three cycles of chemotherapy. However, after three cycles of 5-FU, proliferated CD8 T-cells were decreased, and CT26-specific cytotoxicity and IFN-γ secretion of spleen cells were impaired in vitro. After one cycle of 5-FU, there was a greater percentage of tumor infiltrating CD8 T-cells. In addition, more proliferated CD8 T-cells, enhanced tumor-specific cytotoxicity as well as IFN-γ secretion of spleen cells against CT26 in vitro were observed. Given the increased expression of immunosuppressive factors, such as PD-L1 and TGF-β, we assessed the effect of early introduction of immunotherapy in combination with chemotherapy. We found that mice treated with cytokine induced killer cells and PD-L1 monoclonal antibodies after one cycle of 5-FU had a better anti-tumor performance than those treated with chemotherapy or immunotherapy alone. These data suggest that a single cycle of 5-FU treatment promoted an anti-tumor immune response, whereas repeated chemotherapy cycles impaired anti-tumor immune functions. Though the amount of immune cells could recover after chemotherapy suspension, their anti-tumor functions were damaged by multiple rounds of chemotherapy. These findings also point towards early implementation of immunotherapy to improve the anti-tumor effect.
Guo, Le; Yin, Runting; Xu, Guangxian; Gong, Xiaojuan; Chang, Zisong; Hong, Dantong; Liu, Hongpeng; Ding, Shuqin; Han, Xuebo; Li, Yuan; Tang, Feng; Liu, Kunmei
2017-12-01
Therapeutic vaccination is a desirable alternative for controlling Helicobacter pylori (H. pylori) infection. Attachment to the gastric mucosa is the first step in establishing bacterial colonization, and adhesins, which are on the surface of H. pylori, play a pivotal role in binding to human gastric mucosa. In the present study, we constructed a multivalent epitope-based vaccine named CFAdE with seven carefully selected antigenic fragments from four H. pylori adhesins (urease, Lpp20, HpaA and CagL). The specificity, immunogenicity and ability to produce neutralizing antibodies of CFAdE were evaluated in BALB/c mice. After that, its therapeutic efficacy and protective immune mechanisms were explored in H. pylori-infected Mongolian gerbils. The results indicated that CFAdE could induce comparatively high levels of specific antibodies against urease, Lpp20, HpaA and CagL. Additionally, oral therapeutic immunization with CFAdE plus polysaccharide adjuvant (PA) significantly decreased H. pylori colonization compared with oral immunization with urease plus PA, and the protection was correlated with IgG and sIgA antibody and antigen-specific CD4 + T cells. This study indicated that the multivalent epitope-based vaccine, which targeted multiple adhesins in adherence of H. pylori to the gastric mucosa, is more effective than the univalent vaccine targeting urease only. This multivalent epitope-based vaccine may be a promising therapeutic candidate vaccine against H. pylori infection. © 2017 John Wiley & Sons Ltd.
Thompson, Elizabeth A; Ols, Sebastian; Miura, Kazutoyo; Rausch, Kelly; Narum, David L; Spångberg, Mats; Juraska, Michal; Wille-Reece, Ulrike; Weiner, Amy; Howard, Randall F; Long, Carole A; Duffy, Patrick E; Johnston, Lloyd; O'Neil, Conlin P; Loré, Karin
2018-05-17
Transmission-blocking vaccines (TBVs) are considered an integral element of malaria eradication efforts. Despite promising evaluations of Plasmodium falciparum Pfs25-based TBVs in mice, clinical trials have failed to induce robust and long-lived Ab titers, in part due to the poorly immunogenic nature of Pfs25. Using nonhuman primates, we demonstrate that multiple aspects of Pfs25 immunity were enhanced by antigen encapsulation in poly(lactic-co-glycolic acid)-based [(PLGA)-based] synthetic vaccine particles (SVP[Pfs25]) and potent TLR-based adjuvants. SVP[Pfs25] increased Ab titers, Pfs25-specific plasmablasts, circulating memory B cells, and plasma cells in the bone marrow when benchmarked against the clinically tested multimeric form Pfs25-EPA given with GLA-LSQ. SVP[Pfs25] also induced the first reported Pfs25-specific circulating Th1 and Tfh cells to our knowledge. Multivariate correlative analysis indicated several mechanisms for the improved Ab responses. While Pfs25-specific B cells were responsible for increasing Ab titers, T cell responses stimulated increased Ab avidity. The innate immune activation differentially stimulated by the adjuvants revealed a strong correlation between type I IFN polarization, induced by R848 and CpG, and increased Ab half-life and longevity. Collectively, the data identify ways to improve vaccine-induced immunity to poorly immunogenic proteins, both by the choice of antigen and adjuvant formulation, and highlight underlying immunological mechanisms.
CELL SEPARATION ON ANTIGEN-COATED COLUMNS
Wigzell, Hans; Andersson, Birger
1969-01-01
Glass and plastic bead columns coated with antigenic protein molecules were used as an immunological filter for cell populations containing immune cells of relevant specificity. A selective elimination of these immune cells from the passing cell suspension was regularly noted and it approached, in some experiments, complete abolition of the specific immune reactivity of the filtered cell population. This specific retention of immune cells by antigenic columns could be selectively blocked by the presence of free antigen molecules in the medium during filtration. The results obtained support the concept of a cell-associated antigen-specific receptor being present on the outer surface of immune cells, displaying the same antigen-binding specificity as the potential product of the cell, the humoral antibody. Using the present bead column system, results were obtained indicating that this receptor was an active product of the immune cells and not any passively adsorbed, cytophilic antibody. Antigenic bead columns may very well constitute a tool for the production in vitro of cell populations being specifically deprived of immune reactivity and allow detailed analysis of the characteristics of the cell-associated antibody of immune cells. PMID:5782770
Trametes versicolor Mushroom Immune Therapy in Breast Cancer
Standish, Leanna J.; Wenner, Cynthia A.; Sweet, Erin S.; Bridge, Carly; Nelson, Ana; Martzen, Mark; Novack, Jeffrey; Torkelson, Carolyn
2009-01-01
Data from multiple epidemiologic and clinical studies on immune effects of conventional cancer treatment and the clinical benefits of polysaccharide immune therapy suggest that immune function has a role in breast cancer prevention. Immune therapy utilizing the polysaccharide constituents of Trametes versicolor (Tv) as concurrent adjuvant cancer therapy may be warranted as part of a comprehensive cancer treatment and secondary prevention strategy. PMID:19087769
Induction of Broad-Spectrum Protective Immunity against Disparate Cryptococcus Serotypes
Van Dyke, Marley C. Caballero; Chaturvedi, Ashok K.; Hardison, Sarah E.; Leopold Wager, Chrissy M.; Castro-Lopez, Natalia; Hole, Camaron R.; Wozniak, Karen L.; Wormley, Floyd L.
2017-01-01
Cryptococcosis is a fungal disease caused by multiple Cryptococcus serotypes; particularly C. neoformans (serotypes A and D) and C. gattii (serotypes B and C). To date, there is no clinically available vaccine to prevent cryptococcosis. Mice given an experimental pulmonary vaccination with a C. neoformans serotype A strain engineered to produce interferon-γ, denoted H99γ, are protected against a subsequent otherwise lethal experimental infection with C. neoformans serotype A. Thus, we determined the efficacy of immunization with C. neoformans strain H99γ to elicit broad-spectrum protection in BALB/c mice against multiple disparate Cryptococcus serotypes. We observed significantly increased survival rates and significantly decreased pulmonary fungal burden in H99γ immunized mice challenged with Cryptococcus serotypes A, B, or D compared to heat-killed H99γ (HKH99γ) immunized mice. Results indicated that prolonged protection against Cryptococcus serotypes B or D in H99γ immunized mice was CD4+ T cell dependent and associated with the induction of predominantly Th1-type cytokine responses. Interestingly, immunization with H99γ did not elicit greater protection against challenge with the Cryptococcus serotype C tested either due to low overall virulence of this strain or enhanced capacity of this strain to evade host immunity. Altogether, these studies provide “proof-of-concept” for the development of a cryptococcal vaccine that provides cross-protection against multiple disparate serotypes of Cryptococcus. PMID:29163469
Wolf, Amaya I.; Mozdzanowska, Krystyna; Williams, Katie L.; Singer, David; Richter, Monique; Hoffmann, Ralf; Caton, Andrew J.; Otvos, Laszlo; Erikson, Jan
2011-01-01
Background The extracellular domain of the influenza A virus protein matrix protein 2 (M2e) is remarkably conserved between various human isolates and thus is a viable target antigen for a universal influenza vaccine. With the goal of inducing protection in multiple mouse haplotypes, M2e-based multiple antigenic peptides (M2e-MAP) were synthesized to contain promiscuous T helper determinants from the Plasmodium falciparum circumsporozoite protein, the hepatitis B virus antigen and the influenza virus hemagglutinin. Here, we investigated the nature of the M2e-MAP-induced B cell response in terms of the distribution of antibody (Ab) secreting cells (ASCs) and Ab isotypes, and tested the protective efficacy in various mouse strains. Methodology/Principal Findings Immunization of BALB/c mice with M2e-MAPs together with potent adjuvants, CpG 1826 oligonucleotides (ODN) and cholera toxin (CT) elicited high M2e-specific serum Ab titers that protected mice against viral challenge. Subcutaneous (s.c.) and intranasal (i.n.) delivery of M2e-MAPs resulted in the induction of IgG in serum and airway secretions, however only i.n. immunization induced anti-M2e IgA ASCs locally in the lungs, correlating with M2-specific IgA in the bronchio-alveolar lavage (BAL). Interestingly, both routes of vaccination resulted in equal protection against viral challenge. Moreover, M2e-MAPs induced cross-reactive and protective responses to diverse M2e peptides and variant influenza viruses. However, in contrast to BALB/c mice, immunization of other inbred and outbred mouse strains did not induce protective Abs. This correlated with a defect in T cell but not B cell responsiveness to the M2e-MAPs. Conclusion/Significance Anti-M2e Abs induced by M2e-MAPs are highly cross-reactive and can mediate protection to variant viruses. Although synthetic MAPs are promising designs for vaccines, future constructs will need to be optimized for use in the genetically heterogeneous human population. PMID:22180783
Wolf, Amaya I; Mozdzanowska, Krystyna; Williams, Katie L; Singer, David; Richter, Monique; Hoffmann, Ralf; Caton, Andrew J; Otvos, Laszlo; Erikson, Jan
2011-01-01
The extracellular domain of the influenza A virus protein matrix protein 2 (M2e) is remarkably conserved between various human isolates and thus is a viable target antigen for a universal influenza vaccine. With the goal of inducing protection in multiple mouse haplotypes, M2e-based multiple antigenic peptides (M2e-MAP) were synthesized to contain promiscuous T helper determinants from the Plasmodium falciparum circumsporozoite protein, the hepatitis B virus antigen and the influenza virus hemagglutinin. Here, we investigated the nature of the M2e-MAP-induced B cell response in terms of the distribution of antibody (Ab) secreting cells (ASCs) and Ab isotypes, and tested the protective efficacy in various mouse strains. Immunization of BALB/c mice with M2e-MAPs together with potent adjuvants, CpG 1826 oligonucleotides (ODN) and cholera toxin (CT) elicited high M2e-specific serum Ab titers that protected mice against viral challenge. Subcutaneous (s.c.) and intranasal (i.n.) delivery of M2e-MAPs resulted in the induction of IgG in serum and airway secretions, however only i.n. immunization induced anti-M2e IgA ASCs locally in the lungs, correlating with M2-specific IgA in the bronchio-alveolar lavage (BAL). Interestingly, both routes of vaccination resulted in equal protection against viral challenge. Moreover, M2e-MAPs induced cross-reactive and protective responses to diverse M2e peptides and variant influenza viruses. However, in contrast to BALB/c mice, immunization of other inbred and outbred mouse strains did not induce protective Abs. This correlated with a defect in T cell but not B cell responsiveness to the M2e-MAPs. Anti-M2e Abs induced by M2e-MAPs are highly cross-reactive and can mediate protection to variant viruses. Although synthetic MAPs are promising designs for vaccines, future constructs will need to be optimized for use in the genetically heterogeneous human population.
Martín-Gandul, Cecilia; Pérez-Romero, Pilar; Mena-Romo, Damián; Molina-Ortega, Alejandro; González-Roncero, Francisco M; Suñer, Marta; Bernal, Gabriel; Cordero, Elisa
2018-03-23
Some studies have suggested that rATG treatment may be associated with an increased incidence of CMV infection and delayed CMV immune response. However, the evidences supporting this matter are scarce. This study aims to characterize the kinetic of the CMV-specific T-cell immune response before and after rATG induction therapy and the relationship with the development of CMV infection in CMV-seropositive kidney transplant recipients. An observational prospective study of CMV-seropositive kidney transplant patients that received rATG induction therapy was performed. A pretransplant sample was obtained before the surgery to determine the CMV-specific immunity. CMV viral load (by PCR) and CMV-specific T-cell immune response (by flow cytometry) were determined during the follow-up at 0.5, 1, 2, 3, 6, and 12 months post transplantation. A total of 23 patients were included in the study. CMV prophylaxis was administrated for a media of 90 days after transplantation. At the end of follow-up, 18 (78.3%) patients had CMV-specific immunity with a median value of 0.31% CD8 + CD69 + INF-γ + T cells at a median of 16 weeks post transplantation. Five patients never acquired CMV-specific immunity. No statistically significant association between CMV infection and CMV-specific T-cell immune response (P = .086) was observed. However, patients with positive pretransplant CMV-specific immunity developed earlier immunity and achieved higher levels of CD8 + CD69 + INF-γ+ T-cell post-transplantation than patients with negative pretransplant immunity. CMV-specific immune monitoring in addition to CMV-serology may be useful to stratify patient's risk of CMV infection before transplantation. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Moghadam, Samira; Erfanmanesh, Maryam; Esmaeilzadeh, Abdolreza
2017-11-01
An autoimmune demyelination disease of the Central Nervous System, Multiple Sclerosis, is a chronic inflammation which mostly involves young adults. Suffering people face functional loss with a severe pain. Most current MS treatments are focused on the immune response suppression. Approved drugs suppress the inflammatory process, but factually, there is no definite cure for Multiple Sclerosis. Recently developed knowledge has demonstrated that gene and cell therapy as a hopeful approach in tissue regeneration. The authors propose a novel combined immune gene therapy for Multiple Sclerosis treatment using anti-inflammatory and remyelination of Interleukine-35 and Hepatocyte Growth Factor properties, respectively. In this hypothesis Interleukine-35 and Hepatocyte Growth Factor introduce to Mesenchymal Stem Cells of EAE mouse model via an adenovirus based vector. It is expected that Interleukine-35 and Hepatocyte Growth Factor genes expressed from MSCs could effectively perform in immunotherapy of Multiple Sclerosis. Copyright © 2017. Published by Elsevier Ltd.
Rowat, S C
1998-01-01
The central nervous, immune, and endocrine systems communicate through multiple common messengers. Over evolutionary time, what may be termed integrated defense system(s) (IDS) have developed to coordinate these communications for specific contexts; these include the stress response, acute-phase response, nonspecific immune response, immune response to antigen, kindling, tolerance, time-dependent sensitization, neurogenic switching, and traumatic dissociation (TD). These IDSs are described and their overlap is examined. Three models of disease production are generated: damage, in which IDSs function incorrectly; inadequate/inappropriate, in which IDS response is outstripped by a changing context; and evolving/learning, in which the IDS learned response to a context is deemed pathologic. Mechanisms of multiple chemical sensitivity (MCS) are developed from several IDS disease models. Model 1A is pesticide damage to the central nervous system, overlapping with body chemical burdens, TD, and chronic zinc deficiency; model 1B is benzene disruption of interleukin-1, overlapping with childhood developmental windows and hapten-antigenic spreading; and model 1C is autoimmunity to immunoglobulin-G (IgG), overlapping with spreading to other IgG-inducers, sudden spreading of inciters, and food-contaminating chemicals. Model 2A is chemical and stress overload, including comparison with the susceptibility/sensitization/triggering/spreading model; model 2B is genetic mercury allergy, overlapping with: heavy metals/zinc displacement and childhood/gestational mercury exposures; and model 3 is MCS as evolution and learning. Remarks are offered on current MCS research. Problems with clinical measurement are suggested on the basis of IDS models. Large-sample patient self-report epidemiology is described as an alternative or addition to clinical biomarker and animal testing. Images Figure 1 Figure 2 Figure 3 Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 PMID:9539008
Systems Biology Analysis of Heterocellular Signaling.
Tape, Christopher J
2016-08-01
Tissues comprise multiple heterotypic cell types (e.g., epithelial, mesenchymal, and immune cells). Communication between heterotypic cell types is essential for biological cohesion and is frequently dysregulated in disease. Despite the importance of heterocellular communication, most systems biology techniques do not report cell-specific signaling data from mixtures of cells. As a result, our existing perspective of cellular behavior under-represents the influence of heterocellular signaling. Recent technical advances now permit the resolution of systems-level cell-specific signaling data. This review discusses how new physical, spatial, and isotopic resolving methods are facilitating unique systems biology studies of heterocellular communication. Copyright © 2016 Elsevier Ltd. All rights reserved.
Immune Mediators of Rotavirus Antigenemia Clearance in Mice ▿
Marcelin, Glendie; Miller, Amber D.; Blutt, Sarah E.; Conner, Margaret E.
2011-01-01
The immunological mediators that clear rotavirus antigenemia or viremia remain undefined. Immunodeficient mice and antibody transfer were used to test whether lymphocytes or rotavirus-specific serum antibodies are essential for resolving antigenemia. Clearance of antigenemia required lymphocytes, but neither T nor B lymphocytes were absolutely required. Transfer of convalescent-phase or nonneutralizing rotavirus-specific serum antibodies to the systemic compartment of severe-combined-immunodeficient (SCID) mice temporarily suppressed the onset or level of chronic rotavirus antigenemia. Our findings provide the first report demonstrating that clearance of rotavirus antigenemia and possibly viremia are mediated by multiple effector lymphocyte subsets and serum antibodies. PMID:21593155
Assessing immune competence in pigs by immunization with tetanus toxoid.
Gimsa, U; Tuchscherer, A; Gimsa, J; Tuchscherer, M
2018-01-01
Immune competence can be tested by challenging organisms with a set of infectious agents. However, disease control requirements impose restrictions on the infliction of infections upon domestic pigs. Alternatively, vaccinations induce detectable immune responses that reflect immune competence. Here, we tested this approach with tetanus toxoid (TT) in young domestic pigs. To optimize the vaccination protocol, we immunized the pigs with a commercial TT vaccine at the age of 21 or 35 days. Booster immunizations were performed either 14 or 21 days later. TT-specific antibodies in plasma as well as lymphoproliferative responses were determined both 7 and 14 days after booster immunization using ELISA and lymphocyte transformation tests, respectively. In addition, general IgG and IgM plasma concentrations and mitogen-induced proliferation were measured. The highest TT-specific antibody responses were detected when blood samples were collected 1 week after a booster immunization conducted 21 days after primary immunization. The pigs' age at primary immunization did not have a significant influence on TT-specific antibody responses. Similarly, the TT-specific proliferative responses were highest when blood samples were collected 1 week after booster immunization, while age and time of primary and booster immunization were irrelevant in our setup. While general IgG and IgM plasma levels were highly age dependent, there were no significant age effects for TT-specific immune responses. In addition, mitogen-induced proliferation was independent of immunization as well as blood sampling protocols. In summary, our model of TT vaccination provides an interesting approach for the assessment of immune competence in young pigs. The detected vaccination effects were not biased by age, even though our data were acquired from immune systems that were under development during our tests.
"Disease modifying nutricals" for multiple sclerosis.
Schmitz, Katja; Barthelmes, Julia; Stolz, Leonie; Beyer, Susanne; Diehl, Olaf; Tegeder, Irmgard
2015-04-01
The association between vitamin D and multiple sclerosis has (re)-opened new interest in nutrition and natural compounds in the prevention and treatment of this neuroinflammatory disease. The dietary amount and type of fat, probiotics and biologicals, salmon proteoglycans, phytoestrogens and protease inhibitor of soy, sodium chloride and trace elements, and fat soluble vitamins including D, A and E were all considered as disease-modifying nutraceuticals. Studies in experimental autoimmune encephalomyelitis mice suggest that poly-unsaturated fatty acids and their 'inflammation-resolving' metabolites and the gut microflora may reduce auto-aggressive immune cells and reduce progression or risk of relapse, and infection with whipworm eggs may positively change the gut-brain communication. Encouraged by the recent interest in multiple sclerosis-nutrition nature's pharmacy has been searched for novel compounds with anti-inflammatory, immune-modifying and antioxidative properties, the most interesting being the scorpion toxins that inhibit specific potassium channels of T cells and antioxidative compounds including the green tea flavonoid epigallocatechin-3-gallate, curcumin and the mustard oil glycoside from e.g. broccoli and sulforaphane. They mostly also inhibit pro-inflammatory signaling through NF-κB or toll-like receptors and stabilize the blood brain barrier. Disease modifying functions may also complement analgesic and anti-spastic effects of cannabis, its constituents, and of 'endocannabinoid enhancing' drugs or nutricals like inhibitors of fatty acid amide hydrolase. Nutricals will not solve multiple sclerosis therapeutic challenges but possibly support pharmacological interventions or unearth novel structures. Copyright © 2014 Elsevier Inc. All rights reserved.
Hou, Jue; Zhang, Qicheng; Liu, Zheng; Wang, Shuhui; Li, Dan; Liu, Chang; Liu, Ying; Shao, Yiming
2016-01-01
Previous research has shown that host Cyclophilin A (CyPA) can promote dendritic cell maturation and the subsequent innate immune response when incorporated into an HIV-1 Gag protein to circumvent the resistance of dendritic cells to HIV-1 infection. This led us to hypothesize that CyPA may improve HIV-1 Gag-specific vaccine immunogenicity via binding with Gag antigen. The adjuvant effect of CyPA was evaluated using a DNA vaccine with single or dual expression cassettes. Mouse studies indicated that CyPA specifically and markedly promoted HIV-1 Gag-specific cellular immunity but not an HIV-1 Env-specific cellular response. The Gag/CyPA dual expression cassettes stimulated a greater Gag-specific cellular immune response, than Gag immunization alone. Furthermore, CyPA induced a broad Gag-specific T cell response and strong cellular immunity that lasted up to 5 months. In addition, CyPA skewed to cellular rather than humoral immunity. To investigate the mechanisms of the adjuvant effect, site-directed mutagenesis in CyPA, including active site residues H54Q and F60A resulted in mutants that were co-expressed with Gag in dual cassettes. The immune response to this vaccine was analyzed in vivo. Interestingly, the wild type CyPA markedly increased Gag cellular immunity, but the H54Q and F60A mutants drastically reduced CyPA adjuvant activation. Therefore, we suggest that the adjuvant effect of CyPA was based on Gag-CyPA-specific interactions. Herein, we report that Cyclophilin A can augment HIV-1 Gag-specific cellular immunity as a genetic adjuvant in multiplex DNA immunization strategies, and that activity of this adjuvant is specific, broad, long-term, and based on Gag-CyPA interaction.
Amare, Bemnet; Moges, Beyene; Mulu, Andargachew; Yifru, Sisay; Kassu, Afework
2015-01-01
Human immunodeficiency virus (HIV), tuberculosis (TB), and helminthic infections are among the commonest public health problems in the sub-Saharan African countries like Ethiopia. Multiple micronutrient deficiencies also known as the “hidden hunger” are common in people living in these countries either playing a role in their pathogenesis or as consequences. This results in a vicious cycle of multiple micronutrient deficiencies and infection/disease progression. As infection is profoundly associated with nutritional status resulting from decreased nutrient intake, decreased nutrient absorption, and nutrient losses, micronutrient deficiencies affect immune system and impact infection and diseases progression. As a result, micronutrients, immunity, and infection are interrelated. The goal of this review is therefore to provide a summary of available findings regarding the “quadruple burden trouble” of HIV, TB, intestinal parasitic infections, and multiple micronutrient deficiencies to describe immune-modulating effects related to disorders. PMID:25767808
Amare, Bemnet; Moges, Beyene; Mulu, Andargachew; Yifru, Sisay; Kassu, Afework
2015-01-01
Human immunodeficiency virus (HIV), tuberculosis (TB), and helminthic infections are among the commonest public health problems in the sub-Saharan African countries like Ethiopia. Multiple micronutrient deficiencies also known as the "hidden hunger" are common in people living in these countries either playing a role in their pathogenesis or as consequences. This results in a vicious cycle of multiple micronutrient deficiencies and infection/disease progression. As infection is profoundly associated with nutritional status resulting from decreased nutrient intake, decreased nutrient absorption, and nutrient losses, micronutrient deficiencies affect immune system and impact infection and diseases progression. As a result, micronutrients, immunity, and infection are interrelated. The goal of this review is therefore to provide a summary of available findings regarding the "quadruple burden trouble" of HIV, TB, intestinal parasitic infections, and multiple micronutrient deficiencies to describe immune-modulating effects related to disorders.
James McNeil; Diana Cox-Foster; James Slavicek; Kelli Hoover
2010-01-01
How the innate immune system functions to defend insects from viruses is an emerging field of study. We examined the impact of melanized encapsulation, a component of innate immunity that integrates both cellular and humoral immune responses, on the success of the baculovirus Lymantria dispar multiple nucleocapsid nucleopolyhedrovirus (LdMNPV) in its...
How do plants achieve immunity? Defence without specialized immune cells.
Spoel, Steven H; Dong, Xinnian
2012-01-25
Vertebrates have evolved a sophisticated adaptive immune system that relies on an almost infinite diversity of antigen receptors that are clonally expressed by specialized immune cells that roam the circulatory system. These immune cells provide vertebrates with extraordinary antigen-specific immune capacity and memory, while minimizing self-reactivity. Plants, however, lack specialized mobile immune cells. Instead, every plant cell is thought to be capable of launching an effective immune response. So how do plants achieve specific, self-tolerant immunity and establish immune memory? Recent developments point towards a multilayered plant innate immune system comprised of self-surveillance, systemic signalling and chromosomal changes that together establish effective immunity.
Ontogeny and function of murine epidermal Langerhans cells.
Kaplan, Daniel H
2017-09-19
Langerhans cells (LCs) are epidermis-resident antigen-presenting cells that share a common ontogeny with macrophages but function as dendritic cells (DCs). Their development, recruitment and retention in the epidermis is orchestrated by interactions with keratinocytes through multiple mechanisms. LC and dermal DC subsets often show functional redundancy, but LCs are required for specific types of adaptive immune responses when antigen is concentrated in the epidermis. This Review will focus on those developmental and functional properties that are unique to LCs.
2018-06-18
Multiple Sclerosis; Pathologic Processes; Demyelinating Diseases; Demyelinating Autoimmune Diseases; Nervous System Diseases; Autoimmune Diseases; Immune System Diseases; Primary Progressive Multiple Sclerosis; Relapsing Remitting Multiple Sclerosis
O'Gorman, William E.; Hsieh, Elena W.Y.; Savig, Erica S.; Gherardini, Pier Federico; Hernandez, Joseph D.; Hansmann, Leo; Balboni, Imelda M.; Utz, Paul J.; Bendall, Sean C.; Fantl, Wendy J.; Lewis, David B.; Nolan, Garry P.; Davis, Mark M.
2015-01-01
Background Activation of Toll-Like Receptors (TLRs) induces inflammatory responses involved in immunity to pathogens and autoimmune pathogenesis, such as in Systemic Lupus Erythematosus (SLE). Although TLRs are differentially expressed across the immune system, a comprehensive analysis of how multiple immune cell subsets respond in a system-wide manner has previously not been described. Objective To characterize TLR activation across multiple immune cell subsets and individuals, with the goal of establishing a reference framework against which to compare pathological processes. Methods Peripheral whole blood samples were stimulated with TLR ligands, and analyzed by mass cytometry simultaneously for surface marker expression, activation states of intracellular signaling proteins, and cytokine production. We developed a novel data visualization tool to provide an integrated view of TLR signaling networks with single-cell resolution. We studied seventeen healthy volunteer donors and eight newly diagnosed untreated SLE patients. Results Our data revealed the diversity of TLR-induced responses within cell types, with TLR ligand specificity. Subsets of NK and T cells selectively induced NF-κB in response to TLR2 ligands. CD14hi monocytes exhibited the most polyfunctional cytokine expression patterns, with over 80 distinct cytokine combinations. Monocytic TLR-induced cytokine patterns were shared amongst a group of healthy donors, with minimal intra- and inter- individual variability. Furthermore, autoimmune disease altered baseline cytokine production, as newly diagnosed untreated SLE patients shared a distinct monocytic chemokine signature, despite clinical heterogeneity. Conclusion Mass cytometry analysis defined a systems-level reference framework for human TLR activation, which can be applied to study perturbations in inflammatory disease, such as SLE. PMID:26037552
Vascular, glial, and lymphatic immune gateways of the central nervous system.
Engelhardt, Britta; Carare, Roxana O; Bechmann, Ingo; Flügel, Alexander; Laman, Jon D; Weller, Roy O
2016-09-01
Immune privilege of the central nervous system (CNS) has been ascribed to the presence of a blood-brain barrier and the lack of lymphatic vessels within the CNS parenchyma. However, immune reactions occur within the CNS and it is clear that the CNS has a unique relationship with the immune system. Recent developments in high-resolution imaging techniques have prompted a reassessment of the relationships between the CNS and the immune system. This review will take these developments into account in describing our present understanding of the anatomical connections of the CNS fluid drainage pathways towards regional lymph nodes and our current concept of immune cell trafficking into the CNS during immunosurveillance and neuroinflammation. Cerebrospinal fluid (CSF) and interstitial fluid are the two major components that drain from the CNS to regional lymph nodes. CSF drains via lymphatic vessels and appears to carry antigen-presenting cells. Interstitial fluid from the CNS parenchyma, on the other hand, drains to lymph nodes via narrow and restricted basement membrane pathways within the walls of cerebral capillaries and arteries that do not allow traffic of antigen-presenting cells. Lymphocytes targeting the CNS enter by a two-step process entailing receptor-mediated crossing of vascular endothelium and enzyme-mediated penetration of the glia limitans that covers the CNS. The contribution of the pathways into and out of the CNS as initiators or contributors to neurological disorders, such as multiple sclerosis and Alzheimer's disease, will be discussed. Furthermore, we propose a clear nomenclature allowing improved precision when describing the CNS-specific communication pathways with the immune system.
Yu, Yun-Zhou; Ma, Yao; Xu, Wen-Hui; Wang, Shuang; Sun, Zhi-Wei
2015-08-01
DNA vaccines are generally weak stimulators of the immune system. Fortunately, their efficacy can be improved using a viral replicon vector or by the addition of immunostimulatory CpG motifs, although the design of these engineered DNA vectors requires optimization. Our results clearly suggest that multiple copies of three types of CpG motifs or combinations of various types of CpG motifs cloned into a viral replicon vector backbone with strong immunostimulatory activities on human PBMC are efficient adjuvants for these DNA vaccines to modulate and enhance protective immunity against anthrax, although modifications with these different CpG forms in vivo elicited inconsistent immune response profiles. Modification with more copies of CpG motifs elicited more potent adjuvant effects leading to the generation of enhanced immunity, which indicated a CpG motif dose-dependent enhancement of antigen-specific immune responses. Notably, the enhanced and/or synchronous adjuvant effects were observed in modification with combinations of two different types of CpG motifs, which provides not only a contribution to the knowledge base on the adjuvant activities of CpG motifs combinations but also implications for the rational design of optimal DNA vaccines with combinations of CpG motifs as "built-in" adjuvants. We describe an efficient strategy to design and optimize DNA vaccines by the addition of combined immunostimulatory CpG motifs in a viral replicon DNA plasmid to produce strong immune responses, which indicates that the CpG-modified viral replicon DNA plasmid may be desirable for use as vector of DNA vaccines.
Lugade, Amit A.; Bogner, Paul N.; Thatcher, Thomas H.; Sime, Patricia J.; Phipps, Richard P.; Thanavala, Yasmin
2014-01-01
The detrimental impact of tobacco on human health is clearly recognized and despite aggressive efforts to prevent smoking, close to one billion individuals worldwide continue to smoke. People with chronic obstructive pulmonary disease (COPD) are susceptible to recurrent respiratory infections with pathogens, including non-typeable Haemophilus influenzae (NTHI), yet the reasons for this increased susceptibility are poorly understood. As mortality rapidly increases with multiple exacerbations, development of protective immunity is critical to improving patient survival. Acute NTHI infection has been studied in the context of cigarette smoke exposure, but this is the first study to investigate chronic infection and the generation of adaptive immune responses to NTHI following chronic smoke exposure. After chronic NTHI infection, mice that had previously been exposed to cigarette smoke developed increased lung inflammation and compromised adaptive immunity relative to air-exposed controls. Importantly, NTHI-specific T cells from mice exposed to cigarette smoke produced lower levels of IFN-γ and IL-4, and B cells produced reduced levels of antibodies against outer membrane lipoprotein P6, with impaired IgG1, IgG2a and IgA class-switching. However, production of IL-17, which is associated with neutrophilic inflammation, was enhanced. Interestingly, cigarette smoke exposed mice exhibited a similar defect in the generation of adaptive immunity following immunization with P6. Our study has conclusively demonstrated that cigarette smoke exposure has a profound suppressive effect on the generation of adaptive immune responses to NTHI and suggests the mechanism by which prior cigarette smoke exposure predisposes COPD patients to recurrent infections, leading to exacerbations and contributing to mortality. PMID:24752444
Comparison of the Functional microRNA Expression in Immune Cell Subsets of Neonates and Adults
Yu, Hong-Ren; Hsu, Te-Yao; Huang, Hsin-Chun; Kuo, Ho-Chang; Li, Sung-Chou; Yang, Kuender D.; Hsieh, Kai-Sheng
2016-01-01
Diversity of biological molecules in newborn and adult immune cells contributes to differences in cell function and atopic properties. Micro RNAs (miRNAs) are reported to involve in the regulation of immune system. Therefore, determining the miRNA expression profile of leukocyte subpopulations is important for understanding immune system regulation. In order to explore the unique miRNA profiling that contribute to altered immune in neonates, we comprehensively analyzed the functional miRNA signatures of eight leukocyte subsets (polymorphonuclear cells, monocytes, CD4+ T cells, CD8+ T cells, natural killer cells, B cells, plasmacytoid dendritic cells, and myeloid dendritic cells) from both neonatal and adult umbilical cord and peripheral blood samples, respectively. We observed distinct miRNA profiles between adult and neonatal blood leukocyte subsets, including unique miRNA signatures for each cell lineage. Leukocyte miRNA signatures were altered after stimulation. Adult peripheral leukocytes had higher let-7b-5p expression levels compared to neonatal cord leukocytes across multiple subsets, irrespective of stimulation. Transfecting neonatal monocytes with a let-7b-5p mimic resulted in a reduction of LPS-induced interleukin (IL)-6 and TNF-α production, while transfection of a let-7b-5p inhibitor into adult monocytes enhanced IL-6 and TNF-α production. With this functional approach, we provide intact differential miRNA expression profiling of specific immune cell subsets between neonates and adults. These studies serve as a basis to further understand the altered immune response observed in neonates and advance the development of therapeutic strategies. PMID:28066425
Rashid, Mohammad B; Talukder, Anup K; Kusama, Kazuya; Haneda, Shingo; Takedomi, Toshiro; Yoshino, Hitomi; Moriyasu, Satoru; Matsui, Motozumi; Shimada, Masayuki; Imakawa, Kazuhiko; Miyamoto, Akio
2018-06-12
Recent studies suggest that Day-7 bovine embryo starts to communicate with the uterine epithelium through interferon-tau (IFNT) signaling. However, immune modulatory role of IFNT in the uterus just after the embryo moves from the oviduct is unclear. We aimed to examine the hypothesis that Day-7 bovine embryo secretes IFNT in the uterus, which induces anti-inflammatory response in immune cells. The uterine flush (UF) with multiple embryos was collected from Day-7 donor pregnant cows and peripheral blood mononuclear cells (PBMCs) were then cultured in UF. Transcripts detected in PBMCs revealed that UF from pregnant cows down-regulated pro-inflammatory cytokines (TNFA, IL1B) and up-regulated anti-inflammatory cytokine (IL10) expression, with activation of interferon-stimulated genes (ISGs; ISG15, OAS1) as compared with UF from non-pregnant cows. An addition of specific anti-IFNT antibody to the UF inhibited the effect on PBMCs, indicating that IFNT is a major factor for such immune modulation. The observation that conditioned media from bovine uterine epithelial cells both stimulated with IFNT in vitro and supplemented with fresh IFNT induced similar PBMCs gene expression, confirming that IFNT directly acts on this immune crosstalk. This study shows that IFNT secreted from Day-7 embryo in vivo generates anti-inflammatory response in immune cells, which may provide immunological tolerance to accept the embryo. Copyright © 2018 Elsevier Inc. All rights reserved.
Adhikary, Till; Wortmann, Annika; Schumann, Tim; Finkernagel, Florian; Lieber, Sonja; Roth, Katrin; Toth, Philipp M.; Diederich, Wibke E.; Nist, Andrea; Stiewe, Thorsten; Kleinesudeik, Lara; Reinartz, Silke; Müller-Brüsselbach, Sabine; Müller, Rolf
2015-01-01
Peroxisome proliferator-activated receptor β/δ (PPARβ/δ) is a lipid ligand-inducible transcription factor with established metabolic functions, whereas its anti-inflammatory function is poorly understood. To address this issue, we determined the global PPARβ/δ-regulated signaling network in human monocyte-derived macrophages. Besides cell type-independent, canonical target genes with metabolic and immune regulatory functions we identified a large number of inflammation-associated NFκB and STAT1 target genes that are repressed by agonists. Accordingly, PPARβ/δ agonists inhibited the expression of multiple pro-inflammatory mediators and induced an anti-inflammatory, IL-4-like morphological phenotype. Surprisingly, bioinformatic analyses also identified immune stimulatory effects. Consistent with this prediction, PPARβ/δ agonists enhanced macrophage survival under hypoxic stress and stimulated CD8+ T cell activation, concomitantly with the repression of immune suppressive target genes and their encoded products CD274 (PD-1 ligand), CD32B (inhibitory Fcγ receptor IIB) and indoleamine 2,3-dioxygenase 1 (IDO-1), as well as a diminished release of the immune suppressive IDO-1 metabolite kynurenine. Comparison with published data revealed a significant overlap of the PPARβ/δ transcriptome with coexpression modules characteristic of both anti-inflammatory and pro-inflammatory cytokines. Our findings indicate that PPARβ/δ agonists induce a unique macrophage activation state with strong anti-inflammatory but also specific immune stimulatory components, pointing to a context-dependent function of PPARβ/δ in immune regulation. PMID:25934804
Zhang, Ming; Dong, Chunsheng; Xiong, Sidong
2017-01-01
Tuberculosis (TB) remains a serious health problem worldwide, and an urgent need exists to improve or replace the available vaccine, Mycobacterium bovis bacillus Calmette-Guérin (BCG). Most vaccination protocols adapt two or three doses to induce long-term lasting immunity. Our previous study showed that the naked DNA encoding the triple-antigen fusion TFP846 (Rv3615c-Mtb10.4-Rv2660c) induced robust T cellular immune responses accompanying four inoculations against mycobacteria infection. However, a number of compliance issues exist in some areas lacking the appropriate medical infrastructure with multiple administrations. In this study, a novel vesicular stomatitis virus expressing TFP846 (VSV-846) was developed and the immune responses elicited by VSV-846 were evaluated. We observed that intranasal delivery of VSV-846 induced a potent antigen-specific T cell response following a single dose and VSV-846 efficiently controlled bacterial growth to levels ~10-fold lower than that observed in the mock group 6 weeks post-infection in BCG-infected mice. Importantly, mice immunized with VSV-846 provided long-term protection against mycobacteria infection compared with those receiving p846 or BCG immunization. Increased memory T cells were also observed in the spleens of VSV-846-vaccinated mice, which could be a potential mechanism associated with long-term protective immune response. These findings supported the use of VSV as an antigen delivery vector with the potential for TB vaccine development. PMID:28224119
Potassium Channel KIR4.1 as an Immune Target in Multiple Sclerosis
Srivastava, Rajneesh; Aslam, Muhammad; Kalluri, Sudhakar Reddy; Schirmer, Lucas; Buck, Dorothea; Tackenberg, Björn; Rothhammer, Veit; Chan, Andrew; Gold, Ralf; Berthele, Achim; Bennett, Jeffrey L.; Korn, Thomas; Hemmer, Bernhard
2016-01-01
BACKGROUND Multiple sclerosis is a chronic inflammatory demyelinating disease of the central nervous system. Many findings suggest that the disease has an autoimmune pathogenesis; the target of the immune response is not yet known. METHODS We screened serum IgG from persons with multiple sclerosis to identify antibodies that are capable of binding to brain tissue and observed specific binding of IgG to glial cells in a subgroup of patients. Using a proteomic approach focusing on membrane proteins, we identified the ATP-sensitive inward rectifying potassium channel KIR4.1 as the target of the IgG antibodies. We used a multifaceted validation strategy to confirm KIR4.1 as a target of the autoantibody response in multiple sclerosis and to show its potential pathogenicity in vivo. RESULTS Serum levels of antibodies to KIR4.1 were higher in persons with multiple sclerosis than in persons with other neurologic diseases and healthy donors (P<0.001 for both comparisons). We replicated this finding in two independent groups of persons with multiple sclerosis or other neurologic diseases (P<0.001 for both comparisons). Analysis of the combined data sets indicated the presence of serum antibodies to KIR4.1 in 186 of 397 persons with multiple sclerosis (46.9%), in 3 of 329 persons with other neurologic diseases (0.9%), and in none of the 59 healthy donors. These antibodies bound to the first extracellular loop of KIR4.1. Injection of KIR4.1 serum IgG into the cisternae magnae of mice led to a profound loss of KIR4.1 expression, altered expression of glial fibrillary acidic protein in astrocytes, and activation of the complement cascade at sites of KIR4.1 expression in the cerebellum. CONCLUSIONS KIR4.1 is a target of the autoantibody response in a subgroup of persons with multiple sclerosis. (Funded by the German Ministry for Education and Research and Deutsche Forschungsgemeinschaft.) PMID:22784115
Holmes, Tyson H; He, Xiao-Song
2016-10-01
Small, wide data sets are commonplace in human immunophenotyping research. As defined here, a small, wide data set is constructed by sampling a small to modest quantity n,1
Holmes, Tyson H.; He, Xiao-Song
2016-01-01
Small, wide data sets are commonplace in human immunophenotyping research. As defined here, a small, wide data set is constructed by sampling a small to modest quantity n, 1 < n < 50, of human participants for the purpose of estimating many parameters p, such that n < p < 1,000. We offer a set of prescriptions that are designed to facilitate low-variance (i.e. stable), low-bias, interpretive regression modeling of small, wide data sets. These prescriptions are distinctive in their especially heavy emphasis on minimizing use of out-of-sample information for conducting statistical inference. That allows the working immunologist to proceed without being encumbered by imposed and often untestable statistical assumptions. Problems of unmeasured confounders, confidence-interval coverage, feature selection, and shrinkage/denoising are defined clearly and treated in detail. We propose an extension of an existing nonparametric technique for improved small-sample confidence-interval tail coverage from the univariate case (single immune feature) to the multivariate (many, possibly correlated immune features). An important role for derived features in the immunological interpretation of regression analyses is stressed. Areas of further research are discussed. Presented principles and methods are illustrated through application to a small, wide data set of adults spanning a wide range in ages and multiple immunophenotypes that were assayed before and after immunization with inactivated influenza vaccine (IIV). Our regression modeling prescriptions identify some potentially important topics for future immunological research. 1) Immunologists may wish to distinguish age-related differences in immune features from changes in immune features caused by aging. 2) A form of the bootstrap that employs linear extrapolation may prove to be an invaluable analytic tool because it allows the working immunologist to obtain accurate estimates of the stability of immune parameter estimates with a bare minimum of imposed assumptions. 3) Liberal inclusion of immune features in phenotyping panels can facilitate accurate separation of biological signal of interest from noise. In addition, through a combination of denoising and potentially improved confidence interval coverage, we identify some candidate immune correlates (frequency of cell subset and concentration of cytokine) with B cell response as measured by quantity of IIV-specific IgA antibody-secreting cells and quantity of IIV-specific IgG antibody-secreting cells. PMID:27196789
Bebo, Bruce F; Dehghani, Babak; Foster, Scott; Kurniawan, Astrid; Lopez, Francisco J; Sherman, Larry S
2009-05-01
Steroidal estrogens can regulate inflammatory immune responses and may be involved in the suppression of multiple sclerosis (MS) during pregnancy. However, the risks and side effects associated with steroidal estrogens may limit their usefulness for long-term MS therapy. Selective estrogen receptor modulators (SERMs) could provide an alternative therapeutic strategy, because they behave as estrogen agonists in some tissues, but are either inert or behave like estrogen antagonists in other tissues. In this study, we investigated the ability of two commercially available SERMs (tamoxifen and raloxifene) to regulate myelin specific immunity and experimental autoimmune encephalomyelitis (EAE) in mice. Both tamoxifen and raloxifene suppressed myelin antigen specific T-cell proliferation. However, tamoxifen was more effective in this regard. Tamoxifen treatment reduced the induction of major histocompatibility complex II by lipopolysaccharide stimulated dendritic cells and decreased their ability to activate myelin specific T-cells. At lower doses, tamoxifen was found to increase the levels of Th2 transcription factors and induce a Th2 bias in cultures of myelin-specific splenocytes. EAE symptoms and the degree of demyelination were less severe in mice treated with tamoxifen than in control mice. These findings support the notion that tamoxifen or related SERMs are potential agents that could be used in the treatment of inflammatory autoimmune disorders that affect the central nervous system.
Pessoa de Magalhães, Roberto J.; Vidriales, María-Belén; Paiva, Bruno; Fernandez-Gimenez, Carlos; García-Sanz, Ramón; Mateos, Maria-Victoria; Gutierrez, Norma C.; Lecrevisse, Quentin; Blanco, Juan F; Hernández, Jose; de las Heras, Natalia; Martinez-Lopez, Joaquin; Roig, Monica; Costa, Elaine Sobral; Ocio, Enrique M.; Perez-Andres, Martin; Maiolino, Angelo; Nucci, Marcio; De La Rubia, Javier; Lahuerta, Juan-Jose; San-Miguel, Jesús F.; Orfao, Alberto
2013-01-01
Multiple myeloma remains largely incurable. However, a few patients experience more than 10 years of relapse-free survival and can be considered as operationally cured. Interestingly, long-term disease control in multiple myeloma is not restricted to patients with a complete response, since some patients revert to having a profile of monoclonal gammopathy of undetermined significance. We compared the distribution of multiple compartments of lymphocytes and dendritic cells in the bone marrow and peripheral blood of multiple myeloma patients with long-term disease control (n=28), patients with newly diagnosed monoclonal gammopathy of undetermined significance (n=23), patients with symptomatic multiple myeloma (n=23), and age-matched healthy adults (n=10). Similarly to the patients with monoclonal gammopathy of undetermined significance and symptomatic multiple myeloma, patients with long-term disease control showed an expansion of cytotoxic CD8+ T cells and natural killer cells. However, the numbers of bone marrow T-regulatory cells were lower in patients with long-term disease control than in those with symptomatic multiple myeloma. It is noteworthy that B cells were depleted in patients with monoclonal gammopathy of undetermined significance and in those with symptomatic multiple myeloma, but recovered in both the bone marrow and peripheral blood of patients with long-term disease control, due to an increase in normal bone marrow B-cell precursors and plasma cells, as well as pre-germinal center peripheral blood B cells. The number of bone marrow dendritic cells and tissue macrophages differed significantly between patients with long-term disease control and those with symptomatic multiple myeloma, with a trend to cell count recovering in the former group of patients towards levels similar to those found in healthy adults. In summary, our results indicate that multiple myeloma patients with long-term disease control have a constellation of unique immune changes favoring both immune cytotoxicity and recovery of B-cell production and homing, suggesting improved immune surveillance. PMID:22773604
The early cellular signatures of protective immunity induced by live viral vaccination.
Kohler, Siegfried; Bethke, Nicole; Böthe, Matthias; Sommerick, Sophie; Frentsch, Marco; Romagnani, Chiara; Niedrig, Matthias; Thiel, Andreas
2012-09-01
Here, we have used primary vaccination of healthy donors with attenuated live yellow fever virus 17D (YFV-17D) as a model to study the generation of protective immunity. In short intervals after vaccination, we analyzed the induction of YFV-17D specific T- and B-cell immunity, bystander activation, dendritic cell subsets, changes in serum cytokine levels, and YFV-17D-specific antibodies. We show activation of innate immunity and a concomitant decline of numbers of peripheral blood T and B cells. An early peak of antigen-specific T cells at day 2, followed by mobilization of innate immune cells, preceded the development of maximal adaptive immunity against YFV-17D at day 14 after vaccination. Interestingly, potent adaptive immunity as measured by high titers of neutralizing YFV-17D-specific antibodies, correlated with early activation and recruitment of YFV-17D-specific CD4(+) T cells and higher levels of sIL-6R. Thus our data might provide new insights into the interplay of innate and adaptive immunity for the induction of protective immunity. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Kleber, Christian; Becker, Christopher A; Malysch, Tom; Reinhold, Jens M; Tsitsilonis, Serafeim; Duda, Georg N; Schmidt-Bleek, Katharina; Schaser, Klaus D
2015-07-01
Hemorrhagic shock (hS) interacts with the posttraumatic immune response and fracture healing in multiple trauma. Due to the lack of a long-term survival multiple trauma animal models, no standardized analysis of fracture healing referring the impact of multiple trauma on fracture healing was performed. We propose a new long-term survival (21 days) murine multiple trauma model combining hS (microsurgical cannulation of carotid artery, withdrawl of blood and continuously blood pressure measurement), femoral (osteotomy/external fixation) and tibial fracture (3-point bending technique/antegrade nail). The posttraumatic immune response was measured via IL-6, sIL-6R ELISA. The hS was investigated via macrohemodynamics, blood gas analysis, wet-dry lung ration and histologic analysis of the shock organs. We proposed a new murine long-term survival (21 days) multiple trauma model mimicking clinical relevant injury patterns and previously published human posttraumatic immune response. Based on blood gas analysis and histologic analysis of shock organs we characterized and standardized our murine multiple trauma model. Furthermore, we revealed hemorrhagic shock as a causative factor that triggers sIL-6R formation underscoring the fundamental pathophysiologic role of the transsignaling mechanism in multiple trauma. © 2015 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.
The association between immune activation and manic symptoms in patients with a depressive disorder.
Becking, K; Boschloo, L; Vogelzangs, N; Haarman, B C M; Riemersma-van der Lek, R; Penninx, B W J H; Schoevers, R A
2013-10-22
Although recent studies have shown that immunological processes play an important role in the pathophysiology of mood disorders, immune activation may only be present in specific subgroups of patients. Our study aimed to examine whether immune activation was associated with (a) the presence of manic symptoms and (b) the onset of manic symptoms during 2 years of follow-up in depressed patients. Patients with a depressive disorder at baseline (N=957) and healthy controls (N=430) were selected from the Netherlands Study of Depression and Anxiety. Assessments included lifetime manic symptoms at baseline and two-year follow up, as well as C-reactive protein (CRP), interleukin-6 (IL-6) and tumor necrosis factor alpha (TNF-α) at baseline. Within depressed patients, immune activation was not related to the presence or absence of lifetime manic symptoms at baseline. However, CRP levels were strongly elevated in depressed men who developed manic symptoms compared with those who did not develop manic symptoms over 2 years (P<0.001, Cohen's d=0.89). IL-6 and TNF-α were also higher in depressed men with an onset of manic symptoms, but this association was not significant. However, we found that the onset of manic symptoms was particularly high in men with multiple elevated levels of inflammatory markers. Depressed men who developed manic symptoms during follow-up had increased immunological activity (especially CRP) compared with depressed men who did not develop manic symptoms. Further research should explore whether a treatment approach focusing on inflammatory processes may be more effective in this specific subgroup of depressed patients.
Gupta, Sachin; Clark, Emily S.; Termini, James M.; Boucher, Justin; Kanagavelu, Saravana; LeBranche, Celia C.; Abraham, Sakhi; Montefiori, David C.
2015-01-01
ABSTRACT Broadly neutralizing antibodies (bNAbs) specific for conserved epitopes on the HIV-1 envelope (Env) are believed to be essential for protection against multiple HIV-1 clades. However, vaccines capable of stimulating the production of bNAbs remain a major challenge. Given that polyreactivity and autoreactivity are considered important characteristics of anti-HIV bNAbs, we designed an HIV vaccine incorporating the molecular adjuvants BAFF (B cell activating factor) and APRIL (a proliferation-inducing ligand) with the potential to facilitate the maturation of polyreactive and autoreactive B cells as well as to enhance the affinity and/or avidity of Env-specific antibodies. We designed recombinant DNA plasmids encoding soluble multitrimers of BAFF and APRIL using surfactant protein D as a scaffold, and we vaccinated mice with these molecular adjuvants using DNA and DNA-protein vaccination strategies. We found that immunization of mice with a DNA vaccine encoding BAFF or APRIL multitrimers, together with interleukin 12 (IL-12) and membrane-bound HIV-1 Env gp140, induced neutralizing antibodies against tier 1 and tier 2 (vaccine strain) viruses. The APRIL-containing vaccine was particularly effective at generating tier 2 neutralizing antibodies following a protein boost. These BAFF and APRIL effects coincided with an enhanced germinal center (GC) reaction, increased anti-gp120 antibody-secreting cells, and increased anti-gp120 functional avidity. Notably, BAFF and APRIL did not cause indiscriminate B cell expansion or an increase in total IgG. We propose that BAFF and APRIL multitrimers are promising molecular adjuvants for vaccines designed to induce bNAbs against HIV-1. IMPORTANCE Recent identification of antibodies that neutralize most HIV-1 strains has revived hopes and efforts to create novel vaccines that can effectively stimulate HIV-1 neutralizing antibodies. However, the multiple immune evasion properties of HIV have hampered these efforts. These include the instability of the gp120 trimer, the inaccessibility of the conserved sequences, highly variable protein sequences, and the loss of HIV-1-specific antibody-producing cells during development. We have shown previously that tumor necrosis factor (TNF) superfamily ligands, including BAFF and APRIL, can be multitrimerized using the lung protein SP-D (surfactant protein D), enhancing immune responses. Here we show that DNA or DNA-protein vaccines encoding BAFF or APRIL multitrimers, IL-12p70, and membrane-bound HIV-1 Env gp140 induced tier 1 and tier 2 neutralizing antibodies in a mouse model. BAFF and APRIL enhanced the immune reaction, improved antibody binding, and increased the numbers of anti-HIV-1 antibody-secreting cells. Adaptation of this vaccine design may prove useful in designing preventive HIV-1 vaccines for humans. PMID:25631080
Lu, Xunli; Kracher, Barbara; Saur, Isabel M. L.; Bauer, Saskia; Ellwood, Simon R.; Wise, Roger; Yaeno, Takashi; Maekawa, Takaki; Schulze-Lefert, Paul
2016-01-01
Disease-resistance genes encoding intracellular nucleotide-binding domain and leucine-rich repeat proteins (NLRs) are key components of the plant innate immune system and typically detect the presence of isolate-specific avirulence (AVR) effectors from pathogens. NLR genes define the fastest-evolving gene family of flowering plants and are often arranged in gene clusters containing multiple paralogs, contributing to copy number and allele-specific NLR variation within a host species. Barley mildew resistance locus a (Mla) has been subject to extensive functional diversification, resulting in allelic resistance specificities each recognizing a cognate, but largely unidentified, AVRa gene of the powdery mildew fungus, Blumeria graminis f. sp. hordei (Bgh). We applied a transcriptome-wide association study among 17 Bgh isolates containing different AVRa genes and identified AVRa1 and AVRa13, encoding candidate-secreted effectors recognized by Mla1 and Mla13 alleles, respectively. Transient expression of the effector genes in barley leaves or protoplasts was sufficient to trigger Mla1 or Mla13 allele-specific cell death, a hallmark of NLR receptor-mediated immunity. AVRa1 and AVRa13 are phylogenetically unrelated, demonstrating that certain allelic MLA receptors evolved to recognize sequence-unrelated effectors. They are ancient effectors because corresponding loci are present in wheat powdery mildew. AVRA1 recognition by barley MLA1 is retained in transgenic Arabidopsis, indicating that AVRA1 directly binds MLA1 or that its recognition involves an evolutionarily conserved host target of AVRA1. Furthermore, analysis of transcriptome-wide sequence variation among the Bgh isolates provides evidence for Bgh population structure that is partially linked to geographic isolation. PMID:27702901
Lu, Xunli; Kracher, Barbara; Saur, Isabel M L; Bauer, Saskia; Ellwood, Simon R; Wise, Roger; Yaeno, Takashi; Maekawa, Takaki; Schulze-Lefert, Paul
2016-10-18
Disease-resistance genes encoding intracellular nucleotide-binding domain and leucine-rich repeat proteins (NLRs) are key components of the plant innate immune system and typically detect the presence of isolate-specific avirulence (AVR) effectors from pathogens. NLR genes define the fastest-evolving gene family of flowering plants and are often arranged in gene clusters containing multiple paralogs, contributing to copy number and allele-specific NLR variation within a host species. Barley mildew resistance locus a (Mla) has been subject to extensive functional diversification, resulting in allelic resistance specificities each recognizing a cognate, but largely unidentified, AVR a gene of the powdery mildew fungus, Blumeria graminis f. sp. hordei (Bgh). We applied a transcriptome-wide association study among 17 Bgh isolates containing different AVR a genes and identified AVR a1 and AVR a13 , encoding candidate-secreted effectors recognized by Mla1 and Mla13 alleles, respectively. Transient expression of the effector genes in barley leaves or protoplasts was sufficient to trigger Mla1 or Mla13 allele-specific cell death, a hallmark of NLR receptor-mediated immunity. AVR a1 and AVR a13 are phylogenetically unrelated, demonstrating that certain allelic MLA receptors evolved to recognize sequence-unrelated effectors. They are ancient effectors because corresponding loci are present in wheat powdery mildew. AVR A1 recognition by barley MLA1 is retained in transgenic Arabidopsis, indicating that AVR A1 directly binds MLA1 or that its recognition involves an evolutionarily conserved host target of AVR A1 Furthermore, analysis of transcriptome-wide sequence variation among the Bgh isolates provides evidence for Bgh population structure that is partially linked to geographic isolation.
PD-L1 Detection in Tumors Using [(64)Cu]Atezolizumab with PET.
Lesniak, Wojciech G; Chatterjee, Samit; Gabrielson, Matthew; Lisok, Ala; Wharram, Bryan; Pomper, Martin G; Nimmagadda, Sridhar
2016-09-21
The programmed death protein 1 (PD-1) and programmed death-ligand 1 (PD-L1) pair is a major immune checkpoint pathway exploited by cancer cells to develop and maintain immune tolerance. With recent approvals of anti-PD-1 and anti-PD-L1 therapeutic antibodies, there is an urgent need for noninvasive detection methods to quantify dynamic PD-L1 expression in tumors and to evaluate the tumor response to immune modulation therapies. To address this need, we assessed [(64)Cu]atezolizumab for the detection of PD-L1 expression in tumors. Atezolizumab (MPDL3208A) is a humanized, human and mouse cross-reactive, therapeutic PD-L1 antibody that is being investigated in several cancers. Atezolizumab was conjugated with DOTAGA and radiolabeled with copper-64. The resulting [(64)Cu]atezolizumab was assessed for in vitro and in vivo specificity in multiple cell lines and tumors of variable PD-L1 expression. We performed PET-CT imaging, biodistribution, and blocking studies in NSG mice bearing tumors with constitutive PD-L1 expression (CHO-hPD-L1) and in controls (CHO). Specificity of [(64)Cu]atezolizumab was further confirmed in orthotopic tumor models of human breast cancer (MDAMB231 and SUM149) and in a syngeneic mouse mammary carcinoma model (4T1). We observed specific binding of [(64)Cu]atezolizumab to tumor cells in vitro, correlating with PD-L1 expression levels. Specific accumulation of [(64)Cu]atezolizumab was also observed in tumors with high PD-L1 expression (CHO-hPD-L1 and MDAMB231) compared to tumors with low PD-L1 expression (CHO, SUM149). Collectively, these studies demonstrate the feasibility of using [(64)Cu]atezolizumab for the detection of PD-L1 expression in different tumor types.
Altenburg, Arwen F; van Trierum, Stella E; de Bruin, Erwin; de Meulder, Dennis; van de Sandt, Carolien E; van der Klis, Fiona R M; Fouchier, Ron A M; Koopmans, Marion P G; Rimmelzwaan, Guus F; de Vries, Rory D
2018-04-24
The replication-deficient orthopoxvirus modified vaccinia virus Ankara (MVA) is a promising vaccine vector against various pathogens and has an excellent safety record. However, pre-existing vector-specific immunity is frequently suggested to be a drawback of MVA-based vaccines. To address this issue, mice were vaccinated with MVA-based influenza vaccines in the presence or absence of orthopoxvirus-specific immunity. Importantly, protective efficacy of an MVA-based influenza vaccine against a homologous challenge was not impaired in the presence of orthopoxvirus-specific pre-existing immunity. Nonetheless, orthopoxvirus-specific pre-existing immunity reduced the induction of antigen-specific antibodies under specific conditions and completely prevented induction of antigen-specific T cell responses by rMVA-based vaccination. Notably, antibodies induced by vaccinia virus vaccination, both in mice and humans, were not capable of neutralizing MVA. Thus, when using rMVA-based vaccines it is important to consider the main correlate of protection induced by the vaccine, the vaccine dose and the orthopoxvirus immune status of vaccine recipients.
Modeled Microgravity Inhibits Apoptosis in Peripheral Blood Lymphocytes
NASA Technical Reports Server (NTRS)
Risin, Diana; Pellis, Neal R.
1999-01-01
Impairment of the immunity in astronauts and cosmonauts even in short term flights is a recognized risk. Long term orbital space missions and anticipated interplanetary flights increase the concern for more pronounced effects on the immune system with potential clinical consequences. Impairment of the immunity in space may be due tonumerous physiological changes caused by space-related factors, which in turn affect the immune system, or alternatively, it may be due to direct effects of different factors encountered in space on lymphoid cells and their interactions. Indeed, in modeled microgravity (MMG) experiments on Earth we and others showed that microgravity directly affects multiple lymphocyte functions. It interferes with expression of cell surface molecules, causes inhibition of lymphocyte locomotion, suppresses polyclopal and antigen-specific lymphocyte activation, selectively inhibits protein kinase C (PKC) isoforms. Some of these effects were also confirmed in cell culture experiments in real space conditions during Spacelab, Biokosmos and Shuttle Missions. The results of these studies, taken together, strongly indicated that microgravity interferes with fundamental biological processes associated with functional and structural changes in cell surface membranes, cell surface molecules and in their interaction. Based on the data and on their interpretation, we hypothesized that microgravity in addition to observed functional changes affects programmed cell death (PCD) in lymphocyte populations and that this mechanism could contribute to the impairment of the immunity.
Leptin-based Adjuvants: An Innovative Approach to Improve Vaccine Response
White, Sarah J.; Taylor, Matthew J.; Hurt, Ryan; Jensen, Michael D.; Poland, Gregory A.
2013-01-01
Leptin is a pleiotropic hormone with multiple direct and regulatory immune functions. Leptin deficiency or resistance hinders the immunologic, metabolic, and neuroendocrinologic processes necessary to thwart infections and their associated complications, and to possibly protect against infectious diseases following vaccination. Circulating leptin levels are proportional to body fat mass. High circulating leptin concentrations, as observed in obesity, are indicative of the development of leptin transport saturation/signaling desensitization. Leptin bridges nutritional status and immunity. Although its role in vaccine response is currently unknown, over-nutrition has been shown to suppress vaccine-induced immune responses. For instance, obesity (BMI ≥ 30 kg/m2) is associated with lower antigen-specific antibody titers following influenza, hepatitis B, and tetanus vaccinations. This suggests that obesity, and possibly saturable leptin levels, are contributing factors to poor vaccine immunogenicity. While leptin-based therapies have not been investigated as vaccine adjuvants thus far, leptin’s role in immunity suggests that application of these therapies is promising and worth investigation to enhance vaccine response in people with leptin signaling impairments. This review will examine the possibility of using leptin as a vaccine adjuvant by: briefly reviewing the distribution and signal transduction of leptin and its receptors; discussing the physiology of leptin with emphasis on its immune functions; reviewing the causes of attenuation of leptin signaling; and finally, providing plausible inferences for the innovative use of leptin-based pharmacotherapies as vaccine adjuvants. PMID:23370154
ELISPOT Assays in 384-Well Format: Up to 30 Data Points with One Million Cells
Hanson, Jodi; Sundararaman, Srividya; Caspell, Richard; Karacsony, Edith; Karulin, Alexey Y.; Lehmann, Paul V.
2015-01-01
Comprehensive immune monitoring requires that frequencies of T cells, producing different cytokines, are measured to establish the magnitude of Th1, Th2, and Th17 components of cell-mediated immunity. Antigen titration provides additional information about the affinity of T cell response. In tumor immunity, it is also advisable to account for determinant spreading by testing multiple epitopes. Efforts for comprehensive immune monitoring would require substantial numbers of PBMC to run the above tests systematically, which in most test cases is limiting. Immune monitoring with ELISPOT assays have been performed, thus far, in a 96-well format. In this study we show that one can increase cell utilization by performing the assay in 384-well plates whose membrane surface area is one third that of 96-well plates. Systematic testing of PBMC for antigen-specific T cell response in the two formats demonstrated that the 384-well assay corresponds to a one-in-three miniaturization of the 96-well assay. The lowest number of cells that can be used in the 384-well format, while allowing for sufficient contact with APC, is 33,000 PBMC/well. Therefore, with one million PBMC typically obtained from 1 mL of blood, a 30 well T cell ELISPOT assay can be performed in a 384-well format. PMID:25643292
Li, Bo; Jiang, Shan; Yu, Xiao; Cheng, Cheng; Chen, Sixue; Cheng, Yanbing; Yuan, Joshua S.; Jiang, Daohong; He, Ping; Shan, Libo
2015-01-01
Proper control of immune-related gene expression is crucial for the host to launch an effective defense response. Perception of microbe-associated molecular patterns (MAMPs) induces rapid and profound transcriptional reprogramming via unclear mechanisms. Here, we show that ASR3 (ARABIDOPSIS SH4-RELATED3) functions as a transcriptional repressor and plays a negative role in regulating pattern-triggered immunity (PTI) in Arabidopsis thaliana. ASR3 belongs to a plant-specific trihelix transcription factor family for which functional studies are lacking. MAMP treatments induce rapid phosphorylation of ASR3 at threonine 189 via MPK4, a mitogen-activated protein kinase that negatively regulates PTI responses downstream of multiple MAMP receptors. ASR3 possesses transcriptional repressor activity via its ERF-associated amphiphilic repression motifs and negatively regulates a large subset of flg22-induced genes. Phosphorylation of ASR3 by MPK4 enhances its DNA binding activity to suppress gene expression. Importantly, the asr3 mutant shows enhanced disease resistance to virulent bacterial pathogen infection, whereas transgenic plants overexpressing the wild-type or phospho-mimetic form of ASR3 exhibit compromised PTI responses. Our studies reveal a function of the trihelix transcription factors in plant innate immunity and provide evidence that ASR3 functions as a transcriptional repressor regulated by MAMP-activated MPK4 to fine-tune plant immune gene expression. PMID:25770109
Immunoglobulin superfamily members encoded by viruses and their multiple roles in immune evasion.
Farré, Domènec; Martínez-Vicente, Pablo; Engel, Pablo; Angulo, Ana
2017-05-01
Pathogens have developed a plethora of strategies to undermine host immune defenses in order to guarantee their survival. For large DNA viruses, these immune evasion mechanisms frequently rely on the expression of genes acquired from host genomes. Horizontally transferred genes include members of the immunoglobulin superfamily, whose products constitute the most diverse group of proteins of vertebrate genomes. Their promiscuous immunoglobulin domains, which comprise the building blocks of these molecules, are involved in a large variety of functions mediated by ligand-binding interactions. The flexible structural nature of the immunoglobulin domains makes them appealing targets for viral capture due to their capacity to generate high functional diversity. Here, we present an up-to-date review of immunoglobulin superfamily gene homologs encoded by herpesviruses, poxviruses, and adenoviruses, that include CD200, CD47, Fc receptors, interleukin-1 receptor 2, interleukin-18 binding protein, CD80, carcinoembryonic antigen-related cell adhesion molecules, and signaling lymphocyte activation molecules. We discuss their distinct structural attributes, binding properties, and functions, shaped by evolutionary pressures to disarm specific immune pathways. We include several novel genes identified from extensive genome database surveys. An understanding of the properties and modes of action of these viral proteins may guide the development of novel immune-modulatory therapeutic tools. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Panda, Samiran; Das, Aritra; Samanta, Saheli
2014-08-11
The debate on the relevance of rotavirus vaccine to immunization program in India, where 27 million children are born every year, rages on. We synthesized the issues raised during these debates and reviewed the current literature to identify themes that could inform public health policy decision. The paradigm we used integrated disease burden data, host and environmental factors, vaccine efficacy, immunization program issues, and economic considerations. Our synthesis reveals that substantive country specific information on disease burden and economic impact of rotavirus illness in India is constrained by lack of public discussion and qualitative studies on mothers' perceptions of the vaccine in concern. The need to improve the performance of current immunization program against six major vaccine preventable diseases (tuberculosis, diphtheria, tetanus, pertussis, polio, and measles) is often cited as a priority over introduction of rotavirus vaccine. Health in India being a state subject, we emphasize that the states which are in a position to reap the benefit of rotavirus vaccine, due to their good immunization program performance, should not be restrained from doing so. Meanwhile, the poorly performing states should step up their vaccination program and increase immunization coverage. Scientific, ethical and societal concerns captured through multiple sources indicate that the introduction of rotavirus vaccine would be a good investment for India. Copyright © 2014. Published by Elsevier Ltd.
Tang, Xinming; Liu, Xianyong; Yin, Guangwen; Suo, Jingxia; Tao, Geru; Zhang, Sixin; Suo, Xun
2018-01-01
Vaccine delivery is critical in antigen discovery and vaccine efficacy and safety. The diversity of infectious diseases in humans and livestock has required the development of varied delivery vehicles to target different pathogens. In livestock animals, previous strategies for the development of coccidiosis vaccines have encountered several hurdles, limiting the development of multiple species vaccine formulations. Here, we describe a novel vaccine delivery system using transgenic Eimeria tenella expressing immunodominant antigens of Eimeria maxima. In this delivery system, the immune mapped protein 1 of E. maxima (EmIMP1) was delivered by the closely related species of E. tenella to the host immune system during the whole endogenous life cycle. The overexpression of the exogenous antigen did not interfere with the reproduction and immunogenicity of transgenic Eimeria. After immunization with the transgenic parasite, we detected EmIMP1’s and E. maxima oocyst antigens’ specific humoral and cellular immune responses. In particular, we observed partial protection of chickens immunized with transgenic E. tenella against subsequent E. maxima infections. Our results demonstrate that the transgenic Eimeria parasite is an ideal coccidia antigen delivery vehicle and represents a new type of coccidiosis vaccines. In addition, this model could potentially be used in the development of malaria live sporozoite vaccines, in which antigens from different strains can be expressed in the vaccine strain. PMID:29375584
Lee, Hyun Gyu; Cho, Nam-Chul; Jeong, Ae Jin; Li, Yu-Chen; Rhie, Sung-Ja; Choi, Jung Sook; Lee, Kwang-Ho; Kim, Youngsoo; Kim, Yong-Nyun; Kim, Myoung-Hwan; Pae, Ae Nim; Ye, Sang-Kyu; Kim, Byung-Hak
2016-01-01
T-cell-mediated immune responses play an important role in body protection. However, aberrantly activated immune responses are responsible for inflammatory and autoimmune diseases. The regulation of pathologic immune responses may be a potential therapeutic strategy for the treatment of these diseases. Despite that multiple pharmacologic properties of benzoxathiole derivatives have been defined, the molecular mechanisms underlying these properties remain to be clarified. Here, we demonstrated the benzoxathiole derivative 2-cyclohexylimino-6-methyl-6,7-dihydro-5H-benzo[1,3]oxathiol-4-one (BOT-4-one) regulated immune responses and ameliorated experimentally induced inflammatory skin diseases both in vitro and in vivo. BOT-4-one inhibited the differentiation of CD4(+) T-cell subsets by regulating the expression and production of T-cell lineage-specific master transcription factors and cytokines and activating the signal transducer and activator of transcription proteins. In addition, BOT-4-one inhibited TCR-mediated Akt and NF-κB signaling. Topical application of BOT-4-one ameliorated experimentally induced inflammatory skin diseases in mice models such as 2,4,6-trinitrochlorobenzene-induced contact and atopic dermatitis and IL-23-induced psoriasis-like skin inflammation. Our study demonstrated that BOT-4-one ameliorates inflammatory skin diseases by suppressing the pathogenic CD4(+) T cell differentiation and overall immune responses. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
Tang, Xinming; Liu, Xianyong; Yin, Guangwen; Suo, Jingxia; Tao, Geru; Zhang, Sixin; Suo, Xun
2017-01-01
Vaccine delivery is critical in antigen discovery and vaccine efficacy and safety. The diversity of infectious diseases in humans and livestock has required the development of varied delivery vehicles to target different pathogens. In livestock animals, previous strategies for the development of coccidiosis vaccines have encountered several hurdles, limiting the development of multiple species vaccine formulations. Here, we describe a novel vaccine delivery system using transgenic Eimeria tenella expressing immunodominant antigens of Eimeria maxima . In this delivery system, the immune mapped protein 1 of E. maxima (EmIMP1) was delivered by the closely related species of E. tenella to the host immune system during the whole endogenous life cycle. The overexpression of the exogenous antigen did not interfere with the reproduction and immunogenicity of transgenic Eimeria . After immunization with the transgenic parasite, we detected EmIMP1's and E. maxima oocyst antigens' specific humoral and cellular immune responses. In particular, we observed partial protection of chickens immunized with transgenic E. tenella against subsequent E. maxima infections. Our results demonstrate that the transgenic Eimeria parasite is an ideal coccidia antigen delivery vehicle and represents a new type of coccidiosis vaccines. In addition, this model could potentially be used in the development of malaria live sporozoite vaccines, in which antigens from different strains can be expressed in the vaccine strain.
Stavrou, Spyridon; Aguilera, Alexya N; Blouch, Kristin; Ross, Susan R
2018-06-05
Host recognition of viral nucleic acids generated during infection leads to the activation of innate immune responses essential for early control of virus. Retrovirus reverse transcription creates numerous potential ligands for cytosolic host sensors that recognize foreign nucleic acids, including single-stranded RNA (ssRNA), RNA/DNA hybrids, and double-stranded DNA (dsDNA). We and others recently showed that the sensors cyclic GMP-AMP synthase (cGAS), DEAD-box helicase 41 (DDX41), and members of the Aim2-like receptor (ALR) family participate in the recognition of retroviral reverse transcripts. However, why multiple sensors might be required and their relative importance in in vivo control of retroviral infection are not known. Here, we show that DDX41 primarily senses the DNA/RNA hybrid generated at the first step of reverse transcription, while cGAS recognizes dsDNA generated at the next step. We also show that both DDX41 and cGAS are needed for the antiretroviral innate immune response to murine leukemia virus (MLV) and HIV in primary mouse macrophages and dendritic cells (DCs). Using mice with cell type-specific knockout of the Ddx41 gene, we show that DDX41 sensing in DCs but not macrophages was critical for controlling in vivo MLV infection. This suggests that DCs are essential in vivo targets for infection, as well as for initiating the antiviral response. Our work demonstrates that the innate immune response to retrovirus infection depends on multiple host nucleic acid sensors that recognize different reverse transcription intermediates. IMPORTANCE Viruses are detected by many different host sensors of nucleic acid, which in turn trigger innate immune responses, such as type I interferon (IFN) production, required to control infection. We show here that at least two sensors are needed to initiate a highly effective innate immune response to retroviruses-DDX41, which preferentially senses the RNA/DNA hybrid generated at the first step of retrovirus replication, and cGAS, which recognizes double-stranded DNA generated at the second step. Importantly, we demonstrate using mice lacking DDX41 or cGAS that both sensors are needed for the full antiviral response needed to control in vivo MLV infection. These findings underscore the need for multiple host factors to counteract retroviral infection. Copyright © 2018 Stavrou et al.
Nonclassical T Cells and Their Antigens in Tuberculosis
De Libero, Gennaro; Singhal, Amit; Lepore, Marco; Mori, Lucia
2014-01-01
T cells that recognize nonpeptidic antigens, and thereby are identified as nonclassical, represent important yet poorly characterized effectors of the immune response. They are present in large numbers in circulating blood and tissues and are as abundant as T cells recognizing peptide antigens. Nonclassical T cells exert multiple functions including immunoregulation, tumor control, and protection against infections. They recognize complexes of nonpeptidic antigens such as lipid and glycolipid molecules, vitamin B2 precursors, and phosphorylated metabolites of the mevalonate pathway. Each of these antigens is presented by antigen-presenting molecules other than major histocompatibility complex (MHC), including CD1, MHC class I–related molecule 1 (MR1), and butyrophilin 3A1 (BTN3A1) molecules. Here, we discuss how nonclassical T cells participate in the recognition of mycobacterial antigens and in the mycobacterial-specific immune response. PMID:25059739
Immunoglobulins drive terminal maturation of splenic dendritic cells
Ziętara, Natalia; Łyszkiewicz, Marcin; Puchałka, Jacek; Pei, Gang; Gutierrez, Maximiliano Gabriel; Lienenklaus, Stefan; Hobeika, Elias; Reth, Michael; Martins dos Santos, Vitor A. P.; Krueger, Andreas; Weiss, Siegfried
2013-01-01
Nature and physiological status of antigen-presenting cells, such as dendritic cells DCs, are decisive for the immune reactions elicited. Multiple factors and cell interactions have been described that affect maturation of DCs. Here, we show that DCs arising in the absence of immunoglobulins (Ig) in vivo are impaired in cross-presentation of soluble antigen. This deficiency was due to aberrant cellular targeting of antigen to lysosomes and its rapid degradation. Function of DCs could be restored by transfer of Ig irrespective of antigen specificity and isotype. Modulation of cross-presentation by Ig was inhibited by coapplication of mannan and, thus, likely to be mediated by C-type lectin receptors. This unexpected dependency of splenic DCs on Ig to cross-present antigen provides insights into the interplay between cellular and humoral immunity and the immunomodulatory capacity of Ig. PMID:23345431
Ramp, A A; Hall, C; Orian, J M
2010-07-01
Parasitic infections are a concern in animal facilities, in view of their influence on physiological processes and the immune status of animals. Pinworms are effectively controlled with the anthelminthic fenbendazole (FBZ, [5-(phenylthio)-1H-benzamidazol-2-yl]carbamic acid methyl ester; C(15)H(13)N(3)O(2)S); however, questions remain as to whether prolonged FBZ exposure alters the disease course in specific experimental models, such as those pertaining to the immune system. We report that a three-month regimen of FBZ-medicated feed severely affected the onset and disease severity of murine experimental autoimmune encephalomyelitis (EAE), a disease that mimics multiple sclerosis. Differences were recorded between mouse strains used. Our data suggest that where the use of FBZ is mandatory, its full effect should be verified on the particular EAE variant adopted by the laboratory.
Strategies for Enhanced Crop Resistance to Insect Pests.
Douglas, Angela E
2018-04-29
Insect pests are responsible for substantial crop losses worldwide through direct damage and transmission of plant diseases, and novel approaches that complement or replace broad-spectrum chemical insecticides will facilitate the sustainable intensification of food production in the coming decades. Multiple strategies for improved crop resistance to insect pests, especially strategies relating to plant secondary metabolism and immunity and microbiome science, are becoming available. Recent advances in metabolic engineering of plant secondary chemistry offer the promise of specific toxicity or deterrence to insect pests; improved understanding of plant immunity against insects provides routes to optimize plant defenses against insects; and the microbiomes of insect pests can be exploited, either as a target or as a vehicle for delivery of insecticidal agents. Implementation of these advances will be facilitated by ongoing advances in plant breeding and genetic technologies.
Tesfay, Mulu Z.; Kirk, Amber C.; Hadac, Elizabeth M.; Griesmann, Guy E.; Federspiel, Mark J.; Barber, Glen N.; Henry, Stephen M.; Peng, Kah-Whye
2013-01-01
We are developing oncolytic vesicular stomatitis viruses (VSVs) for systemic treatment of multiple myeloma, an incurable malignancy of antibody-secreting plasma cells that are specifically localized in the bone marrow. One of the presumed advantages for using VSV as an oncolytic virus is that human infections are rare and preexisting anti-VSV immunity is typically lacking in cancer patients, which is very important for clinical success. However, our studies show that nonimmune human and mouse serum can neutralize clinical-grade VSV, reducing the titer by up to 4 log units in 60 min. In addition, we show that neutralizing anti-VSV antibodies negate the antitumor efficacy of VSV, a concern for repeat VSV administration. We have investigated the potential use of covalent modification of VSV with polyethylene glycol (PEG) or a function-spacer-lipid (FSL)–PEG construct to inhibit serum neutralization and to limit hepatosplenic sequestration of systemically delivered VSV. We report that in mice passively immunized with neutralizing anti-VSV antibodies, PEGylation of VSV improved the persistence of VSV in the blood circulation, maintaining a more than 1-log-unit increase in VSV genome copies for up to 1 h compared to the genome copy numbers for the non-PEGylated virus, which was mostly cleared within 10 min after intravenous injection. We are currently investigating if this increase in PEGylated VSV circulating half-life can translate to increased virus delivery and better efficacy in mouse models of multiple myeloma. PMID:23325695
Curcumin and autoimmune disease.
Bright, John J
2007-01-01
The immune system has evolved to protect the host from microbial infection; nevertheless, a breakdown in the immune system often results in infection, cancer, and autoimmune diseases. Multiple sclerosis, rheumatoid arthritis, type 1 diabetes, inflammatory bowel disease, myocarditis, thyroiditis, uveitis, systemic lupus erythromatosis, and myasthenia gravis are organ-specific autoimmune diseases that afflict more than 5% of the population worldwide. Although the etiology is not known and a cure is still wanting, the use of herbal and dietary supplements is on the rise in patients with autoimmune diseases, mainly because they are effective, inexpensive, and relatively safe. Curcumin is a polyphenolic compound isolated from the rhizome of the plant Curcuma longa that has traditionally been used for pain and wound-healing. Recent studies have shown that curcumin ameliorates multiple sclerosis, rheumatoid arthritis, psoriasis, and inflammatory bowel disease in human or animal models. Curcumin inhibits these autoimmune diseases by regulating inflammatory cytokines such as IL-1beta, IL-6, IL-12, TNF-alpha and IFN-gamma and associated JAK-STAT, AP-1, and NF-kappaB signaling pathways in immune cells. Although the beneficial effects of nutraceuticals are traditionally achieved through dietary consumption at low levels for long periods of time, the use of purified active compounds such as curcumin at higher doses for therapeutic purposes needs extreme caution. A precise understanding of effective dose, safe regiment, and mechanism of action is required for the use of curcumin in the treatment of human autoimmune diseases.
Mameli, G; Madeddu, G; Cossu, D; Galleri, G; Manetti, R; Babudieri, S; Mura, M Stella; Sechi, L A
2016-01-01
Infectious mononucleosis (IM) caused by Epstein-Barr virus (EBV) has been associated with increased risk of multiple sclerosis (MS). However, the mechanism linking these pathologies is unclear. Different reports indicate the association of EBV, and recently Mycobacterium avium subsp. paratuberculosis (MAP), with MS. For a better understanding of the role of these pathogens, the host response induced by selected antigenic peptides in subjects with a history of IM that significantly increases the risk of MS was investigated. Both humoral and cell-mediated response against peptides able to induce a specific immune activation in MS patients deriving from lytic and latent EBV antigens BOLF1(305-320), EBNA1(400-413), from MAP MAP_4027(18-32), MAP_0106c(121-132) and from human proteins IRF5(424-434) and MBP(85-98) in subjects with current and past IM were examined. EBNA1 and MAP_0106c peptides were able to induce a humoral immune response in subjects with a history of clinical IM in an independent manner. Moreover, these peptides were capable of inducing pro-inflammatory cytokine interferon γ by CD4+ and CD8+ T lymphocytes and interleukin 6 and tumour necrosis factor α by CD14+ monocyte cells. Our results highlight that EBV and MAP may be involved independently in the same causal process leading to MS in subjects with a history of IM. © 2015 EAN.
Characterization of γδ regulatory T cells from peripheral blood in patients with multiple myeloma
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ma, Yongyong; Department of Hematology, The First Affiliated Hospital of Wenzhou Medical University, Wenzhou, 325000; Lei, Huyi
γδ regulatory T cells are able to inhibit the activation and function of T cells involved in antigen-specific immune responses. This study aimed to investigate the potential role of γδ regulatory T cells in inhibiting anti-tumor immune responses in patients diagnosed as multiple myeloma (MM). We measured the levels of γδ T cells, the distribution and clonally amplified TCR Vγ and VδT cells in peripheral blood of healthy donors, patients recently diagnosed with MM, and MM patients in remission cohorts. In addition, we evaluated the ability of γδ regulatory T cells to inhibit the proliferation of CD4+CD25- T cells andmore » detected the expression of immunoregulatory-associated molecules. We found that the levels of γδ regulatory T cells from the peripheral blood in patients of MM were significantly higher than those in healthy donors. Comparison of γδT regulatory cells function in MM and healthy donors showed similarly inhibitory effects on the proliferation of T cells. Additionally, TLR8 expression level increased significantly in MM patients compared to healthy donors, while the expression levels of Foxp3, CD25, CTLA4, GITR, GATA3 and Tbet in MM patients and healthy donors showed no significant difference. Taken together, our study reveals the potential role of γδ regulatory T cells in inhibiting anti-tumor immune responses in MM patients.« less
Dekeyser, Manon; François, Hélène; Beaudreuil, Séverine; Durrbach, Antoine
2015-01-01
In renal transplantation, BK-virus (BKV)-associated nephropathy has emerged as a major complication, with a prevalence of 1–10% and graft loss in >50% of cases. BKV is a member of the polyomavirus family and rarely induces apparent clinical disease in the general population. However, replication of polyomaviruses, associated with significant organ disease, is observed in patients with acquired immunosuppression. Monitoring of specific immunity combined with viral load could be used to individually assess the risk of viral reactivation and virus control. We review the current knowledge on BKV-specific cellular immunity and, more specifically, in immunocompromised patients. In the future, immune-based therapies could allow us to treat and prevent BKV-associated nephropathy. PMID:26136745
Floris, Gianluca; Di Stefano, Francesca; Cherchi, Maria Valeria; Costa, Gianna; Marrosu, Francesco; Marrosu, Maria Giovanna
2015-01-01
Cerebral microbleeds (CMB) might reflect specific underlying vascular pathologies like cerebral amyloid angiopathy (CAA). In the present study we report the gradient-echo MRI pattern of two siblings with P284S PSEN1 mutation. T2* gradient-echo images of the two subjects demonstrated multiple microbleeds in lobar regions. The role and causes of CMB in sporadic Alzheimer's disease (AD) patients have not been clearly established and useful contributions could derive from familial AD studies. Furthermore, since CAA is a potential risk factor for developing adverse events in AD immunization trials, the identification in vivo of CAA through non-invasive MRI methods could be useful to monitoring side effects.
Induction of antigen-specific immunity by pH-sensitive carbonate apatite as a potent vaccine carrier
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hebishima, Takehisa; Tada, Seiichi; Takeshima, Shin-nosuke
Highlights: Black-Right-Pointing-Pointer To develop effective vaccine, we examined the effects of CO{sub 3}Ap as an antigen carrier. Black-Right-Pointing-Pointer OVA contained in CO{sub 3}Ap was taken up by BMDCs more effectively than free OVA. Black-Right-Pointing-Pointer OVA-immunized splenocytes was activated by OVA contained in CO{sub 3}Ap effectively. Black-Right-Pointing-Pointer OVA contained in CO{sub 3}Ap induced strong OVA-specific immune responses to C57BL/6 mice. Black-Right-Pointing-Pointer CO{sub 3}Ap is promising antigen carrier for the achievement of effective vaccine. -- Abstract: The ability of carbonate apatite (CO{sub 3}Ap) to enhance antigen-specific immunity was examined in vitro and in vivo to investigate its utility as a vaccine carrier.more » Murine bone marrow-derived dendritic cells took up ovalbumin (OVA) containing CO{sub 3}Ap more effectively than free OVA. Interestingly, mice immunized with OVA-containing CO{sub 3}Ap produced OVA-specific antibodies more effectively than mice immunized with free OVA. Furthermore, immunization of C57BL/6 mice with OVA-containing CO{sub 3}Ap induced the proliferation and antigen-specific production of IFN-{gamma} by splenocytes more strongly than immunization with free OVA. Moreover, no significant differences were detected in the induction of delayed-type hypersensitivity responses, an immune reaction involving an antigen-specific, cell-mediated immune response between OVA-containing CO{sub 3}Ap and OVA-containing alumina salt (Alum), suggesting that CO{sub 3}Ap induced cell-mediated immune response to the same degree as Alum, which is commonly used for clinical applications. This study is the first to demonstrate the induction of antigen-specific immune responses in vivo by CO{sub 3}Ap.« less
Kim, Ki-Hye; Lee, Young-Tae; Hwang, Hye Suk; Kwon, Young-Man; Jung, Yu-Jin; Lee, Youri; Lee, Jong Seok; Lee, Yu-Na; Park, Soojin; Kang, Sang-Moo
2015-01-01
Respiratory syncytial virus (RSV) is well-known for inducing vaccine-enhanced respiratory disease after vaccination of young children with formalin-inactivated RSV (FI-RSV) in alum formulation. Here, we investigated alum adjuvant effects on protection and disease after FI-RSV immunization with or without alum in comparison with live RSV reinfections. Despite viral clearance, live RSV reinfections caused weight loss and substantial pulmonary inflammation probably due to high levels of RSV specific IFN-γ+IL4-, IFN-γ-TNF-α+, IFN-γ+TNF-α- effector CD4 and CD8 T cells. Alum adjuvant significantly improved protection as evidenced by effective viral clearance compared to unadjuvanted FI-RSV. However, in contrast to unadjuvanted FI-RSV, alum-adjuvanted FI-RSV (FI-RSV-A) induced severe vaccine-enhanced RSV disease including weight loss, eosinophilia, and lung histopathology. Alum adjuvant in the FI-RSV-A was found to be mainly responsible for inducing high levels of RSV-specific IFN-γ-IL4+, IFN-γ-TNF-α+ CD4+ T cells, and proinflammatory cytokines IL-6 and IL-4 as well as B220+ plasmacytoid and CD4+ dendritic cells, and inhibiting the induction of IFN-γ+CD8 T cells. This study suggests that alum adjuvant in FI-RSV vaccines increases immunogenicity and viral clearance but also induces atypical T helper CD4+ T cells and multiple inflammatory dendritic cell subsets responsible for vaccine-enhanced severe RSV disease. PMID:26468884
Uauy, Ricardo
2007-10-01
The interaction between nutrition and infection is a key determinant of human health. Traditionally the interaction has centered on the role of nutrients in defining host defenses and the impact of infection in defining nutritional needs and status. Over the past decades the interaction has expanded its scope to encompass the role of specific nutrients in defining acquired immune function, in the modulation of inflammatory processes and on the virulence of the infectious agent itself. More recently the role of micronutrients and fatty acids on the response of cells and tissues to hypoxic and toxic damage has been recognized suggesting a fourth dimension to the interaction. The list of nutrients affecting infection, immunity, inflammation and cell injury has expanded from traditional protein-energy supply to several vitamins, multiple minerals and more recently specific lipid components of the diet. The promise of nutrition in the defense against infection, inflammation and tissue injury has spawned a thriving pharma-nutritional supplement industry and the development of novel foods that require appropriate evaluation of efficacy, safety and effectiveness relative to costs. Academics need to aware of the ethics and the pitfalls in the interaction with industry; conversely industry has to define its role in the process of bringing new knowledge to useful products. The process needs to be interactive, transparent and clearly place public interest above all other considerations.
The delicate balance in genetically engineering live vaccines
Galen, James E.; Curtiss, Roy
2014-01-01
Contemporary vaccine development relies less on empirical methods of vaccine construction, and now employs a powerful array of precise engineering strategies to construct immunogenic live vaccines. In this review, we will survey various engineering techniques used to create attenuated vaccines, with an emphasis on recent advances and insights. We will further explore the adaptation of attenuated strains to create multivalent vaccine platforms for immunization against multiple unrelated pathogens. These carrier vaccines are engineered to deliver sufficient levels of protective antigens to appropriate lymphoid inductive sites to elicit both carrier-specific and foreign antigen-specific immunity. Although many of these technologies were originally developed for use in Salmonella vaccines, application of the essential logic of these approaches will be extended to development of other enteric vaccines where possible. A central theme driving our discussion will stress that the ultimate success of an engineered vaccine rests on achieving the proper balance between attenuation and immunogenicity. Achieving this balance will avoid over-activation of inflammatory responses, which results in unacceptable reactogenicity, but will retain sufficient metabolic fitness to enable the live vaccine to reach deep tissue inductive sites and trigger protective immunity. The breadth of examples presented herein will clearly demonstrate that genetic engineering offers the potential for rapidly propelling vaccine development forward into novel applications and therapies which will significantly expand the role of vaccines in public health. PMID:24370705
Sandoz, Patrick
2013-04-01
Korzybski's general semantics recommends considering living beings as organisms-as-a-whole in their environment. Our cognitive abilities, specific to the human species, have thus to be taken into account. In this framework we establish a semantic similarity between particular stressful events of the 20th century and AIDS in which the immune-deficiency-caused is semiotically seen as a biological state of disarmament of the organism. It then appears that: These observations suggest that AIDS could benefit from some collusion by the neuro-immune system because of positive learning of the semiotic concept of disarmament, thus making the terrain favorable to the germ in response to intense stress. The disease would then result from a conditioning process based on semiotics and involve some confusion at the level of the unconscious cognitive system between disarmament toward outside the body and disarmament toward inside the body. This hypothesis is discussed within a multidisciplinary perspective considering the specificities of our modern lifestyles, the cybernetic ability of signs to control metabolism and behavior, and the recent advances of epigenetics and cognition sciences. This hypothesis may explain the multiple cross-species transmissions of the immunodeficiency virus into humans during the 20th century. Further research is suggested for evaluating this hypothesis. Copyright © 2012 Elsevier Ltd. All rights reserved.
He, Fang; Kiener, Tanja K; Lim, Xiao Fang; Tan, Yunrui; Raj, Kattur Venkatachalam Ashok; Tang, Manli; Chow, Vincent T K; Chen, Qingfeng; Kwang, Jimmy
2013-01-01
Human Enterovirus 71 (EV71) is a common cause of hand, foot and mouth disease (HFMD) in young children. It is often associated with severe neurological diseases and mortalities in recent outbreaks across the Asia Pacific region. Currently, there is no efficient universal antibody test available to detect EV71 infections. In the present study, an epitope-blocking ELISA was developed to detect specific antibodies to human EV71 viruses in human or animal sera. The assay relies on a novel monoclonal antibody (Mab 1C6) that specifically binds to capsid proteins in whole EV71 viruses without any cross reaction to any EV71 capsid protein expressed alone. The sensitivity and specificity of the epitope-blocking ELISA for EV71 was evaluated and compared to microneutralization using immunized animal sera to multiple virus genotypes of EV71 and coxsackieviruses. Further, 200 serum sample from human individuals who were potentially infected with EV71 viruses were tested in both the blocking ELISA and microneutralization. Results indicated that antibodies to EV71 were readily detected in immunized animals or human sera by the epitope blocking ELISA whereas specimens with antibodies to other enteroviruses yielded negative results. This assay is not only simpler to perform but also shows higher sensitivity and specificity as compared to microneutralization. The epitope-blocking ELISA based on a unique Mab 1C6 provided highly sensitive and 100% specific detection of antibodies to human EV71 viruses in human sera.
Induction of pneumococcal polysaccharide-specific mucosal immune responses by oral immunization.
VanCott, J L; Kobayashi, T; Yamamoto, M; Pillai, S; McGhee, J R; Kiyono, H
1996-04-01
Liposome and cholera toxin (CT) are considered to be effective antigen delivery vehicles and adjuvants for mucosal vaccines. The effect of these antigen delivery systems on adjuvant responses to mucosally administered pneumococcal polysaccharide (Pnup) was investigated in this study. Both mucosal (e.g. oral) and systemic (i.p.) immunization of mice with purified preparations of Pnup type 23F induced antigen-specific IgM responses in sera. Interestingly, oral immunization of as little as 10 micrograms of Pnup type 23F was sufficient to induce systemic IgM responses. Pnup-specific IgM antibodies peaked by day 7 and no booster responses were evident after a second dose on day 14. In order to examine whether IgG and IgA Pnup-specific immune responses are induced by mucosal immunization, the mucosal adjuvant CT was mixed with Pnup type 23 as an oral vaccine. Co-oral administration of CT and Pnup type 23F resulted in the induction of Pnup-specific faecal IgA antibodies. These results were confirmed by detecting antigen-specific IgA-spot-forming cells in mononuclear cell suspensions prepared from the intestine of immunized mice. These findings suggest that oral immunization with Pnup in the presence of mucosal adjuvants, such as CT, could induce Pnup-specific IgA responses whereas Pnup alone did not. In an attempt to further enhance antigen-specific antibody responses, Pnup type 23F was encapsulated in liposomes and used as mucosal vaccine. However, immunogenicity of Pnup was not improved.
Mycobacterium tuberculosis genome-wide screen exposes multiple CD8+ T cell epitopes
Hammond, A S; Klein, M R; Corrah, T; Fox, A; Jaye, A; McAdam, K P; Brookes, R H
2005-01-01
Mounting evidence suggests human leucocyte antigen (HLA) class I-restricted CD8+ T cells play a role in protective immunity against tuberculosis yet relatively few epitopes specific for the causative organism, Mycobacterium tuberculosis, are reported. Here a total genome-wide screen of M. tuberculosis was used to identify putative HLA-B*3501 T cell epitopes. Of 479 predicted epitopes, 13 with the highest score were synthesized and used to restimulate lymphocytes from naturally exposed HLA-B*3501 healthy individuals in cultured and ex vivo enzyme-linked immunospot (ELISPOT) assays for interferon (IFN)-γ. All 13 peptides elicited a response that varied considerably between individuals. For three peptides CD8+ T cell lines were expanded and four of the 13 were recognized permissively through the HLA-B7 supertype family. Although further testing is required we show the genome-wide screen to be feasible for the identification of unknown mycobacterial antigens involved in immunity against natural infection. While the mechanisms of protective immunity against M. tuberculosis infection remain unclear, conventional class I-restricted CD8+ T cell responses appear to be widespread throughout the genome. PMID:15762882
Mechanisms for Cell-to-Cell Transmission of HIV-1
Bracq, Lucie; Xie, Maorong; Benichou, Serge; Bouchet, Jérôme
2018-01-01
While HIV-1 infection of target cells with cell-free viral particles has been largely documented, intercellular transmission through direct cell-to-cell contact may be a predominant mode of propagation in host. To spread, HIV-1 infects cells of the immune system and takes advantage of their specific particularities and functions. Subversion of intercellular communication allows to improve HIV-1 replication through a multiplicity of intercellular structures and membrane protrusions, like tunneling nanotubes, filopodia, or lamellipodia-like structures involved in the formation of the virological synapse. Other features of immune cells, like the immunological synapse or the phagocytosis of infected cells are hijacked by HIV-1 and used as gateways to infect target cells. Finally, HIV-1 reuses its fusogenic capacity to provoke fusion between infected donor cells and target cells, and to form infected syncytia with high capacity of viral production and improved capacities of motility or survival. All these modes of cell-to-cell transfer are now considered as viral mechanisms to escape immune system and antiretroviral therapies, and could be involved in the establishment of persistent virus reservoirs in different host tissues. PMID:29515578
Raina, Anupuma; Chaudhary, Garima; Dogra, Tirath Das; Khandelwal, Deepchand; Balayan, Ajay; Jain, Vandana; Kanga, Uma; Seth, Tulika
2016-04-01
Transfusion-associated graft-versus-host disease (TA-GVHD) is a rare condition. It can occur after blood transfusion in immune-compromised and occasionally even in immune-competent patients, and is associated with a mortality rate of >90%. The diagnosis of TA-GVHD is often delayed because of its non-specific clinical features. A case of an immune-competent child who developed TA-GVHD is reported here. DNA profiling (short tandem repeat analysis), a technique that has a wide application in forensic medicine, was performed to detect the presence of donor cells in this patient. The findings suggest that more studies are needed with this tool, and the diagnostic potential of using other multiple biological specimens for DNA profiling such as the hair follicle and buccal swab should be evaluated. This is the first case report where the donor's DNA fingerprinting pattern was substantiated from a patient's hair follicle sample. Chimerism was also present in the blood and buccal swab specimens. © The Author(s) 2015.
Darwish, Ibrahim A; Alzoman, Nourh Z; Abuhejail, Reem M; El-Samani, Tilal E
2012-10-26
For therapeutic monitoring and pharmacokinetic studies of lenalidomide (LND), the potent drug for treatment of multiple myeloma (MM), a specific antibody was required for the development of a sensitive immunoassay system for the accurate determination of LND in plasma. In this study, a hapten of LND (N-glutaryl-LND) was synthesized by introducing the glutaryl moiety, as a spacer, into the primary aromatic amine site of the LND molecular structure. The structure of the hapten (G-LND) was confirmed by mass, 1H-NMR, and 13C spectrometric techniques. G-LND was coupled to each of bovine serum albumin (BSA) and keyhole limpet hemocyanin (KLH) proteins by ethyl-3-(3-dimethylaminopropyl) carbodiimide as a coupling reagent. LND-KLH conjugate was used as an immunogen. Four female 2-3 months old New Zealand white rabbits were immunized with an emulsion of LND-KLH with Freund`s adjuvant. The immune response of the rabbits was monitored by direct enzyme-linked immunosorbent assay (ELISA) using LND-BSA immobilized onto microwell plates as a solid phase. The rabbit that showed the highest antibody titer and affinity to LND was scarified and its sera were collected. The IgG fraction was isolated and purified by affinity chromatography on protein A column. The specificity of the purified antibody for LND was evaluated by indirect competitive ELISA using dexamethasone as a competitor as it is used with LND in a combination therapy. The high affinity of the antibody (IC50 = 10 ng/mL) will be useful in the development of an immunoassay system for the determination of plasma LND concentrations. Current research is going to optimize the assay conditions and validate the procedures for the routine application in clinical laboratories.
Ipilimumab (Yervoy) and the TGN1412 catastrophe.
Bakacs, Tibor; Mehrishi, Jitendra N; Moss, Ralph W
2012-06-01
The development of the anti-CTLA-4 antibody (ipilimumab; marketed as Yervoy) immune regulatory therapy was based on the premise that "Abrogation of the function of CTLA-4 would permit CD28 to function unopposed and might swing the balance in favor of immune stimulation, tolerance breakdown and tumor eradication…" (Weber, 2009). By now, the vast majority of data collected from more than 4000 patients proves that this prediction was entirely correct. Paradoxically, the successful blockade of immune checkpoints raises the question whether an anti-CTLA-4 antibody could ever become an important therapy against cancer. T cells lost their ability to discriminate between self and non-self. Thus, tolerance to self tissues was broken in ∼70% of the patients. In the recent industry-sponsored phase III clinical trial of ipilimumab, 147 (38.7%) of the patients experienced severe adverse events and 6.8% suffered dose-limiting events (8.4%, in the ipilimumab-alone group). There were 14 deaths related to the study drugs and 7 of these were associated with immune-related adverse events. In contrast, the complete response rate was only 0.2%, in one patient out of 403 who received ipilimumab plus a peptide vaccine. Promoters of ipilimumab appear to be unmindful of the clinical trial catastrophe in London. Then, a humanized "superagonist" anti-CD28 monoclonal antibody, TGN1412, which "preferentially" activated regulatory T cells, at a higher dose, also activated all CD28 positive T cells. This precipitated a "cytokine storm" leading to life-threatening multiple organ failure in the six healthy human volunteers. Neither anti-CD28 nor anti-CTLA-4 therapies rely on antigen-specificity. Both release free antibody into the body against common molecular targets that are expressed on the targeted as well as on the non-targeted T cells. At lower antibody doses specific T cells are preferentially activated. With increasing antibody dose, however, the kinetics of the interaction is pushed in favor of widespread non-specific T cell expansion. Using the law of mass action we calculated that the vast majority of the CTLA-4 receptors on all activated T cells (including melanoma specific T cells) in the phase III clinical trial of ipilimumab will have been saturated. This would explain the runaway immune response observed. The conclusions drawn by the authors of the ipilimumab trial paper could bear an independent inspection and reassessment concerning the validation of the blockade of immune checkpoints as an important therapeutic strategy against cancer. Copyright © 2011 Elsevier GmbH. All rights reserved.
Innate control of adaptive immunity: Beyond the three-signal paradigm
Jain, Aakanksha; Pasare, Chandrashekhar
2017-01-01
Activation of cells in the adaptive immune system is a highly orchestrated process dictated by multiples cues from the innate immune system. Although the fundamental principles of innate control of adaptive immunity are well established, it is not fully understood how innate cells integrate qualitative pathogenic information in order to generate tailored protective adaptive immune responses. In this review, we discuss complexities involved in the innate control of adaptive immunity that extend beyond T cell receptor engagement, co-stimulation and priming cytokine production but are critical for generation of protective T cell immunity. PMID:28483987
Townsley, Samantha; Mohamed, Zeinab; Guo, Wenjin; McKenna, Jennifer; Cleveland, Brad; LaBranche, Celia; Beaumont, David; Shen, Xiaoying; Yates, Nicole L.; Pinter, Abraham; Tomaras, Georgia D.; Ferrari, Guido; Montefiori, David C.
2016-01-01
ABSTRACT Poxvirus prime-protein boost used in the RV144 trial remains the only immunization strategy shown to elicit a modest level of protection against HIV-1 acquisition in humans. Although neutralizing antibodies (NAb) were generated, they were against sensitive viruses, not the more resistant “tier 2” isolates that dominate circulating strains. Instead, risk reduction correlated with antibodies recognizing epitopes in the V1/V2 region of HIV-1 envelope glycoprotein (Env). Here, we examined whether tier 2 virus NAb and V1/V2-specific non-NAb could be elicited by a poxvirus prime-gp120 boost strategy in a rabbit model. We studied two clade B Envs that differ in multiple parameters, including tissue origin, neutralization sensitivity, and presence of the N197 (N7) glycan that was previously shown to modulate the exposure of conserved epitopes on Env. We demonstrate that immunized rabbits generated cross-reactive neutralizing activities against >50% of the tier 2 global HIV-1 isolates tested. Some of these activities were directed against the CD4 binding site (CD4bs). These rabbits also generated antibodies that recognized protein scaffolds bearing V1/V2 sequences from diverse HIV-1 isolates and mediated antibody-dependent cellular cytotoxicity. However, there are subtle differences in the specificities and the response rates of V1/V2-specific antibodies between animals immunized with different Envs, with or without the N7 glycan. These findings demonstrate that antibody responses that have been correlated with protection against HIV-1 acquisition in humans can be elicited in a preclinical model by a poxvirus prime-gp120 boost strategy and that improvements may be achievable by optimizing the nature of the priming and boosting immunogens. IMPORTANCE The only vaccine approach shown to elicit any protective efficacy against HIV-1 acquisition is based on a poxvirus prime-protein boost regimen (RV144 Thai trial). Reduction of risk was associated with nonneutralizing antibodies targeting the V1/V2 loops of the envelope protein gp120. However, the modest efficacy (31.2%) achieved in this trial highlights the need to examine approaches and factors that may improve vaccine-induced responses, including cross-reactive neutralizing activities. We show here that rabbits immunized with a novel recombinant vaccinia virus prime-gp120 protein boost regimen generated antibodies that recognize protein scaffolds bearing V1/V2 sequences from diverse HIV-1 isolates and mediated antibody-dependent cellular cytotoxicity. Importantly, immunized rabbits also showed neutralizing activities against heterologous tier 2 HIV-1 isolates. These findings may inform the design of prime-boost immunization approaches and help improve the protective efficacy of candidate HIV-1 vaccines. PMID:27440894
Townsley, Samantha; Mohamed, Zeinab; Guo, Wenjin; McKenna, Jennifer; Cleveland, Brad; LaBranche, Celia; Beaumont, David; Shen, Xiaoying; Yates, Nicole L; Pinter, Abraham; Tomaras, Georgia D; Ferrari, Guido; Montefiori, David C; Hu, Shiu-Lok
2016-10-01
Poxvirus prime-protein boost used in the RV144 trial remains the only immunization strategy shown to elicit a modest level of protection against HIV-1 acquisition in humans. Although neutralizing antibodies (NAb) were generated, they were against sensitive viruses, not the more resistant "tier 2" isolates that dominate circulating strains. Instead, risk reduction correlated with antibodies recognizing epitopes in the V1/V2 region of HIV-1 envelope glycoprotein (Env). Here, we examined whether tier 2 virus NAb and V1/V2-specific non-NAb could be elicited by a poxvirus prime-gp120 boost strategy in a rabbit model. We studied two clade B Envs that differ in multiple parameters, including tissue origin, neutralization sensitivity, and presence of the N197 (N7) glycan that was previously shown to modulate the exposure of conserved epitopes on Env. We demonstrate that immunized rabbits generated cross-reactive neutralizing activities against >50% of the tier 2 global HIV-1 isolates tested. Some of these activities were directed against the CD4 binding site (CD4bs). These rabbits also generated antibodies that recognized protein scaffolds bearing V1/V2 sequences from diverse HIV-1 isolates and mediated antibody-dependent cellular cytotoxicity. However, there are subtle differences in the specificities and the response rates of V1/V2-specific antibodies between animals immunized with different Envs, with or without the N7 glycan. These findings demonstrate that antibody responses that have been correlated with protection against HIV-1 acquisition in humans can be elicited in a preclinical model by a poxvirus prime-gp120 boost strategy and that improvements may be achievable by optimizing the nature of the priming and boosting immunogens. The only vaccine approach shown to elicit any protective efficacy against HIV-1 acquisition is based on a poxvirus prime-protein boost regimen (RV144 Thai trial). Reduction of risk was associated with nonneutralizing antibodies targeting the V1/V2 loops of the envelope protein gp120. However, the modest efficacy (31.2%) achieved in this trial highlights the need to examine approaches and factors that may improve vaccine-induced responses, including cross-reactive neutralizing activities. We show here that rabbits immunized with a novel recombinant vaccinia virus prime-gp120 protein boost regimen generated antibodies that recognize protein scaffolds bearing V1/V2 sequences from diverse HIV-1 isolates and mediated antibody-dependent cellular cytotoxicity. Importantly, immunized rabbits also showed neutralizing activities against heterologous tier 2 HIV-1 isolates. These findings may inform the design of prime-boost immunization approaches and help improve the protective efficacy of candidate HIV-1 vaccines. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
A number of allergic and autoimmune disorders, such as Crohn’s disease, asthma, type I diabetes and multiple sclerosis, are associated with polymorphisms in a gene encoding the transcription factor, BACH2. Despite this, the mechanism Bach2 uses to prevent immune-mediated diseases was not known. To function appropriately, the immune system relies on a delicate balance between immune-stimulating and immune-regulating cells. When immune-stimulating cells become too active, or immune-regulating cells become ineffective, autoimmune and allergic diseases can ensue.
McKay, Alexa Fritzsche; Ezenwa, Vanessa O; Altizer, Sonia
2016-01-01
Organisms have a finite pool of resources to allocate toward multiple competing needs, such as development, reproduction, and enemy defense. Abundant resources can support investment in multiple traits simultaneously, but limited resources might promote trade-offs between fitness-related traits and immune defenses. We asked how food restriction at both larval and adult life stages of the monarch butterfly (Danaus plexippus) affected measures of immunity, fitness, and immune-fitness interactions. We experimentally infected a subset of monarchs with a specialist protozoan parasite to determine whether parasitism further affected these relationships and whether food restriction influenced the outcome of infection. Larval food restriction reduced monarch fitness measures both within the same life stage (e.g., pupal mass) as well as later in life (e.g., adult lifespan); adult food restriction further reduced adult lifespan. Larval food restriction lowered both hemocyte concentration and phenoloxidase activity at the larval stage, and the effects of larval food restriction on phenoloxidase activity persisted when immunity was sampled at the adult stage. Adult food restriction reduced only adult phenoloxidase activity but not hemocyte concentration. Parasite spore load decreased with one measure of larval immunity, but food restriction did not increase the probability of parasite infection. Across monarchs, we found a negative relationship between larval hemocyte concentration and pupal mass, and a trade-off between adult hemocyte concentration and adult life span was evident in parasitized female monarchs. Adult life span increased with phenoloxidase activity in some subsets of monarchs. Our results emphasize that food restriction can alter fitness and immunity across multiple life stages. Understanding the consequences of resource limitation for immune defense is therefore important for predicting how increasing constraints on wildlife resources will affect fitness and resistance to natural enemies.
Novel Therapeutics for Multiple Sclerosis Designed by Parasitic Worms.
Dixit, Aakanksha; Tanaka, Akane; Greer, Judith M; Donnelly, Sheila
2017-10-13
The evolutionary response to endemic infections with parasitic worms (helminth) was the development of a distinct regulatory immune profile arising from the need to encapsulate the helminths while simultaneously repairing tissue damage. According to the old friend's hypothesis, the diminished exposure to these parasites in the developed world has resulted in a dysregulated immune response that contributes to the increased incidence of immune mediated diseases such as Multiple Sclerosis (MS). Indeed, the global distribution of MS shows an inverse correlation to the prevalence of helminth infection. On this basis, the possibility of treating MS with helminth infection has been explored in animal models and phase 1 and 2 human clinical trials. However, the possibility also exists that the individual immune modulatory molecules secreted by helminth parasites may offer a more defined therapeutic strategy.
Heimberger, Amy B; Archer, Gary E; Crotty, Laura E; McLendon, Roger E; Friedman, Allan H; Friedman, Henry S; Bigner, Darell D; Sampson, John H
2002-01-01
Dendritic cells (DCs) are specialized cells of the immune system that are capable of generating potent immune responses that are active even within the "immunologically privileged" central nervous system. However, immune responses generated by DCs have also been demonstrated to produce clinically significant autoimmunity. Targeting the epidermal growth factor receptor variant III (EGFRvIII), which is a mutation specific to tumor tissue, could eliminate this risk. The purpose of this study was to demonstrate that DC-based immunizations directed solely against this tumor-specific antigen, which is commonly found on tumors that originate within or metastasize to the brain, could be efficacious. C3H mice were vaccinated with DCs mixed with a keyhole limpet hemocyanin conjugate of the tumor-specific peptide, PEP-3, which spans the EGFRvIII mutation, or the random-sequence peptide, PEP-1, and were intracerebrally challenged with a syngeneic melanoma expressing a murine homologue of EGFRvIII. Systemic immunization with DCs mixed with PEP-3-keyhole limpet hemocyanin generated antigen-specific immunity. Among mice challenged with intracerebral tumors, this resulted in an approximately 600% increase in the median survival time (>300 d, P < 0.0016), relative to control values. Sixty-three percent of mice treated with DCs mixed with the tumor-specific peptide survived in the long term and 100% survived rechallenge with tumor, indicating that antitumor immunological memory was also induced. In a murine melanoma model, immunization with DCs mixed with tumor-specific peptide results in an antigen-specific immunological response that recognizes the EGFRvIII mutation, has potent antitumor efficacy against intracerebral tumors that express EGFRvIII, and results in long-lasting antitumor immunity.
Insect immunity shows specificity in protection upon secondary pathogen exposure.
Sadd, Ben M; Schmid-Hempel, Paul
2006-06-20
Immunological memory in vertebrates, conferring lasting specific protection after an initial pathogen exposure, has implications for a broad spectrum of evolutionary, epidemiological, and medical phenomena . However, the existence of specificity in protection upon secondary pathogen exposure in invertebrates remains controversial . To separate this functional phenomenon from a particular mechanism, we refer to it as specific immune priming. We investigate the presence of specific immune priming in workers of the social insect Bombus terrestris. Using three bacterial pathogens, we test whether a prior homologous pathogen exposure gives a benefit in terms of long-term protection against a later challenge, over and above a heterologous combination. With a reciprocally designed initial and second-exposure protocol (i.e., all combinations of bacteria were tested), we demonstrate, even several weeks after the clearance of a first exposure, increased protection and narrow specificity upon secondary exposure. This demonstrates that the invertebrate immune system is functionally capable of unexpectedly specific and durable induced protection. Ultimately, despite general broad differences between vertebrates and invertebrates, the ability of both immune systems to show specificity in protection suggests that their immune defenses have found comparable solutions to similar selective pressures over evolutionary time.
Westdorp, Harm; Kolders, Sigrid; Hoogerbrugge, Nicoline; de Vries, I Jolanda M; Jongmans, Marjolijn C J; Schreibelt, Gerty
2017-09-10
Monoallelic germline mutations in one of the DNA mismatch repair (MMR) genes cause Lynch syndrome, with a high lifetime risks of colorectal and endometrial cancer at adult age. Less well known, is the constitutional mismatch repair deficiency (CMMRD) syndrome caused by biallelic germline mutations in MMR genes. This syndrome is characterized by the development of childhood cancer. Patients with CMMRD are at extremely high risk of developing multiple cancers including hematological, brain and intestinal tumors. Mutations in MMR genes impair DNA repair and therefore most tumors of patients with CMMRD are hypermutated. These mutations lead to changes in the translational reading frame, which consequently result in neoantigen formation. Neoantigens are recognized as foreign by the immune system and can induce specific immune responses. The growing evidence on the clinical efficacy of immunotherapies, such as immune checkpoint inhibitors, offers the prospect for treatment of patients with CMMRD. Combining neoantigen-based vaccination strategies and immune checkpoint inhibitors could be an effective way to conquer CMMRD-related tumors. Neoantigen-based vaccines might also be a preventive treatment option in healthy biallelic MMR mutation carriers. Future studies need to reveal the safety and efficacy of immunotherapies for patients with CMMRD. Copyright © 2017 The Author(s). Published by Elsevier B.V. All rights reserved.
Anti-CD20 Antibody Therapy and Susceptibility to Pneumocystis Pneumonia
Elsegeiny, Waleed; Eddens, Taylor; Chen, Kong
2015-01-01
Anti-CD20 antibody therapy has been a useful medication for managing non-Hodgkin's lymphoma as well as autoimmune diseases characterized by autoantibody generation. CD20 is expressed during most developmental stages of B lymphocytes; thus, CD20 depletion leads to B-lymphocyte deficiency. As the drug has become more widely used, there has been an increase in the number of case reports of patients developing Pneumocystis pneumonia. The role of anti-CD20 in Pneumocystis jirovecii infection is under debate due to the fact that most patients receiving it are on a regimen of multiple immunosuppressive medications. To address the specific role of CD20 depletion in host immunity against Pneumocystis, we examined a murine anti-CD20 depleting antibody. We demonstrated that anti-CD20 alone is permissive for Pneumocystis infection and that anti-CD20 impairs components of type II immunity, such as production of interleukin-4 (IL-4), IL-5, and IL-13 by whole-lung cells, in response to Pneumocystis murina. We also demonstrated that CD4+ T cells from mice treated with anti-CD20 during Pneumocystis infection are incapable of mounting a protective immune response when transferred into Rag1−/− mice. Thus, CD20+ cells are critical for generating protective CD4+ T-cell immune responses against this organism. PMID:25733518
Suppression of antigen-specific lymphocyte activation in modeled microgravity
NASA Technical Reports Server (NTRS)
Cooper, D.; Pride, M. W.; Brown, E. L.; Risin, D.; Pellis, N. R.; McIntire, L. V. (Principal Investigator)
2001-01-01
Various parameters of immune suppression are observed in lymphocytes from astronauts during and after a space flight. It is difficult to ascribe this suppression to microgravity effects on immune cells in crew specimens, due to the complex physiological response to space flight and the resultant effect on in vitro immune performance. Use of isolated immune cells in true and modeled microgravity in immune performance tests, suggests a direct effect of microgravity on in vitro cellular function. Specifically, polyclonal activation of T-cells is severely suppressed in true and modeled microgravity. These recent findings suggest a potential suppression of oligoclonal antigen-specific lymphocyte activation in microgravity. We utilized rotating wall vessel (RWV) bioreactors as an analog of microgravity for cell cultures to analyze three models of antigen-specific activation. A mixed-lymphocyte reaction, as a model for a primary immune response, a tetanus toxoid response and a Borrelia burgdorferi response, as models of a secondary immune response, were all suppressed in the RWV bioreactor. Our findings confirm that the suppression of activation observed with polyclonal models also encompasses oligoclonal antigen-specific activation.
Surace, Laura; Lysenko, Veronika; Fontana, Andrea Orlando; Cecconi, Virginia; Janssen, Hans; Bicvic, Antonela; Okoniewski, Michal; Pruschy, Martin; Dummer, Reinhard; Neefjes, Jacques; Knuth, Alexander; Gupta, Anurag; van den Broek, Maries
2015-04-21
Radiotherapy induces DNA damage and cell death, but recent data suggest that concomitant immune stimulation is an integral part of the therapeutic action of ionizing radiation. It is poorly understood how radiotherapy supports tumor-specific immunity. Here we report that radiotherapy induced tumor cell death and transiently activated complement both in murine and human tumors. The local production of pro-inflammatory anaphylatoxins C3a and C5a was crucial to the tumor response to radiotherapy and concomitant stimulation of tumor-specific immunity. Dexamethasone, a drug frequently given during radiotherapy, limited complement activation and the anti-tumor effects of the immune system. Overall, our findings indicate that anaphylatoxins are key players in radiotherapy-induced tumor-specific immunity and the ensuing clinical responses. Copyright © 2015 Elsevier Inc. All rights reserved.
Ji, Zhiwei; Su, Jing; Wu, Dan; Peng, Huiming; Zhao, Weiling; Nlong Zhao, Brian; Zhou, Xiaobo
2017-01-31
Multiple myeloma is a malignant still incurable plasma cell disorder. This is due to refractory disease relapse, immune impairment, and development of multi-drug resistance. The growth of malignant plasma cells is dependent on the bone marrow (BM) microenvironment and evasion of the host's anti-tumor immune response. Hence, we hypothesized that targeting tumor-stromal cell interaction and endogenous immune system in BM will potentially improve the response of multiple myeloma (MM). Therefore, we proposed a computational simulation of the myeloma development in the complicated microenvironment which includes immune cell components and bone marrow stromal cells and predicted the effects of combined treatment with multi-drugs on myeloma cell growth. We constructed a hybrid multi-scale agent-based model (HABM) that combines an ODE system and Agent-based model (ABM). The ODEs was used for modeling the dynamic changes of intracellular signal transductions and ABM for modeling the cell-cell interactions between stromal cells, tumor, and immune components in the BM. This model simulated myeloma growth in the bone marrow microenvironment and revealed the important role of immune system in this process. The predicted outcomes were consistent with the experimental observations from previous studies. Moreover, we applied this model to predict the treatment effects of three key therapeutic drugs used for MM, and found that the combination of these three drugs potentially suppress the growth of myeloma cells and reactivate the immune response. In summary, the proposed model may serve as a novel computational platform for simulating the formation of MM and evaluating the treatment response of MM to multiple drugs.
Immune repertoire: A potential biomarker and therapeutic for hepatocellular carcinoma.
Han, Yingxin; Li, Hongmei; Guan, Yanfang; Huang, Jian
2016-09-01
The immune repertoire (IR) refers to the sum of B cells and T cells with functional diversity in the circulatory system of one individual at any given time. Immune cells, which reside within microenvironments and are responsible for protecting the human body, include T cells, B cells, macrophages, and dendritic cells. These dedicated immune cells have a characteristic structure and function. T and B cells are the main lymphocytes and are responsible for cellular immunity and humoral immunity, respectively. The T cell receptor (TCR) and B cell receptor (BCR) are composed of multiple peptide chains with antigen specificity. The amino acid composition and sequence order are more diverse in the complementarity-determining regions (including CDR1, CDR2 and CDR3) of each peptide chain, allowing a vast library of TCRs and BCRs. IR research is becoming increasingly focused on the study of CDR3 diversity. Deep profiling of CDR3s using high-throughput sequencing is a powerful approach for elucidating the composition and distribution of the CDR3s in a given sample, with in-depth information at the sequence level. Hepatocellular carcinoma (HCC) is one of the most common malignancies in the world. To identify novel biomarkers for diagnosis and drug targets for therapeutic interventions, several groups attempted to describe immune repertoire characteristics of the liver in the physiological environment or/and pathological conditions. This paper reviews the recent progress in IR research on human diseases, including hepatocellular carcinoma, attempting to depict the relationships between hepatocellular carcinogenesis and the IR, and discusses the possibility of IR as a potential biomarker and therapeutic for hepatocellular carcinoma. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
The Pathogenesis of Autoimmune Liver Disease.
Arndtz, Katherine; Hirschfield, Gideon M
Autoimmune liver disease (AILD) encompasses 3 main distinct clinical diseases: autoimmune hepatitis, primary biliary cholangitis (formally known as cirrhosis, PBC) and primary sclerosing cholangitis (PSC). These conditions are an important, yet under-appreciated cause of patient morbidity and mortality with ongoing unmet needs for further research and clinical advances. There is observational evidence for genetic predisposition, with all 3 conditions being more common in first degree relatives. AILD is associated with the presence of auto-antibodies and higher risks of other non-hepatic auto-immune conditions. Genetic risk association studies have identified HLA and non-HLA risk loci for the development of disease, with some HLA loci providing prognostic information. This re-enforces the concept that genetic predisposition to autoimmunity is important, likely in the context of environmental exposures. Such environmental triggers are unclear but relevant risks include smoking, drug and xenobiotic exposure as well as the complexities of the microbiome. There is evidence for a loss of immune tolerance to self-antigens playing a part in the development of these conditions. In particular the IL-2 and IL-12 regulatory pathways have been implicated in pre-disposing to an unopposed inflammatory response within the liver. Main immunological themes revolve around loss of immune tolerance leading to T-cell mediated injury, imbalance in the regulation of immune cells and defective immune response to foreign antigens. For PBC and PSC, there is then the added complexity of the consequences of cholestasis on hepato-biliary injury, immune regulation and liver fibrosis. Whilst specific disease causes and triggers are still lacking, AILD arises on the background of collective genetic and environmental risk, leading to chronic and abnormal hepato-biliary immune responses. Effective and more rational therapy will ultimately be developed when the multiple pathways to liver injury are better understood. © 2016 S. Karger AG, Basel.
Metcalf, Talibah U; Cubas, Rafael A; Ghneim, Khader; Cartwright, Michael J; Grevenynghe, Julien Van; Richner, Justin M; Olagnier, David P; Wilkinson, Peter A; Cameron, Mark J; Park, Byung S; Hiscott, John B; Diamond, Michael S; Wertheimer, Anne M; Nikolich-Zugich, Janko; Haddad, Elias K
2015-01-01
Aging leads to dysregulation of multiple components of the immune system that results in increased susceptibility to infections and poor response to vaccines in the aging population. The dysfunctions of adaptive B and T cells are well documented, but the effect of aging on innate immunity remains incompletely understood. Using a heterogeneous population of peripheral blood mononuclear cells (PBMCs), we first undertook transcriptional profiling and found that PBMCs isolated from old individuals (≥ 65 years) exhibited a delayed and altered response to stimulation with TLR4, TLR7/8, and RIG-I agonists compared to cells obtained from adults (≤ 40 years). This delayed response to innate immune agonists resulted in the reduced production of pro-inflammatory and antiviral cytokines and chemokines including TNFα, IL-6, IL-1β, IFNα, IFNγ, CCL2, and CCL7. While the major monocyte and dendritic cell subsets did not change numerically with aging, activation of specific cell types was altered. PBMCs from old subjects also had a lower frequency of CD40+ monocytes, impaired up-regulation of PD-L1 on monocytes and T cells, and increased expression of PD-L2 and B7-H4 on B cells. The defective immune response to innate agonists adversely affected adaptive immunity as TLR-stimulated PBMCs (minus CD3 T cells) from old subjects elicited significantly lower levels of adult T-cell proliferation than those from adult subjects in an allogeneic mixed lymphocyte reaction (MLR). Collectively, these age-associated changes in cytokine, chemokine and interferon production, as well as co-stimulatory protein expression could contribute to the blunted memory B- and T-cell immune responses to vaccines and infections. PMID:25728020
Konradi, Christine; Sillivan, Stephanie E.; Clay, Hayley B.
2011-01-01
Gene expression studies of bipolar disorder (BPD) have shown changes in transcriptome profiles in multiple brain regions. Here we summarize the most consistent findings in the scientific literature, and compare them to data from schizophrenia (SZ) and major depressive disorder (MDD). The transcriptome profiles of all three disorders overlap, making the existence of a BPD-specific profile unlikely. Three groups of functionally related genes are consistently expressed at altered levels in BPD, SZ and MDD. Genes involved in energy metabolism and mitochondrial function are downregulated, genes involved in immune response and inflammation are upregulated, and genes expressed in oligodendrocytes are downregulated. Experimental paradigms for multiple sclerosis demonstrate a tight link between energy metabolism, inflammation and demyelination. These studies also show variabilities in the extent of oligodendrocyte stress, which can vary from a downregulation of oligodendrocyte genes, such as observed in psychiatric disorders, to cell death and brain lesions seen in multiple sclerosis. We conclude that experimental models of multiple sclerosis could be of interest for the research of BPD, SZ and MDD. PMID:21310238
Ayala, Victor I.; Trivett, Matthew T.; Barsov, Eugene V.; Jain, Sumiti; Piatak, Michael; Trubey, Charles M.; Alvord, W. Gregory; Chertova, Elena; Roser, James D.; Smedley, Jeremy; Komin, Alexander; Keele, Brandon F.; Ohlen, Claes
2016-01-01
ABSTRACT AIDS virus infections are rarely controlled by cell-mediated immunity, in part due to viral immune evasion and immunodeficiency resulting from CD4+ T-cell infection. One likely aspect of this failure is that antiviral cellular immune responses are either absent or present at low levels during the initial establishment of infection. To test whether an extensive, timely, and effective response could reduce the establishment of infection from a high-dose inoculum, we adoptively transferred large numbers of T cells that were molecularly engineered with anti-simian immunodeficiency virus (anti-SIV) activity into rhesus macaques 3 days following an intrarectal SIV inoculation. To measure in vivo antiviral activity, we assessed the number of viruses transmitted using SIVmac239X, a molecularly tagged viral stock containing 10 genotypic variants, at a dose calculated to transmit 12 founder viruses. Single-genome sequencing of plasma virus revealed that the two animals receiving T cells expressing SIV-specific T-cell receptors (TCRs) had significantly fewer viral genotypes than the two control animals receiving non-SIV-specific T cells (means of 4.0 versus 7.5 transmitted viral genotypes; P = 0.044). Accounting for the likelihood of transmission of multiple viruses of a particular genotype, the calculated means of the total number of founder viruses transmitted were 4.5 and 14.5 in the experimental and control groups, respectively (P = 0.021). Thus, a large antiviral T-cell response timed with virus exposure can limit viral transmission. The presence of strong, preexisting T-cell responses, including those induced by vaccines, might help prevent the establishment of infection at the lower-exposure doses in humans that typically transmit only a single virus. IMPORTANCE The establishment of AIDS virus infection in an individual is essentially a race between the spreading virus and host immune defenses. Cell-mediated immune responses induced by infection or vaccination are important contributors in limiting viral replication. However, in human immunodeficiency virus (HIV)/SIV infection, the virus usually wins the race, irreversibly crippling the immune system before an effective cellular immune response is developed and active. We found that providing an accelerated response by adoptively transferring large numbers of antiviral T cells shortly after a high-dose mucosal inoculation, while not preventing infection altogether, limited the number of individual viruses transmitted. Thus, the presence of strong, preexisting T-cell responses, including those induced by vaccines, might prevent infection in humans, where the virus exposure is considerably lower. PMID:27558423
Ayala, Victor I; Trivett, Matthew T; Barsov, Eugene V; Jain, Sumiti; Piatak, Michael; Trubey, Charles M; Alvord, W Gregory; Chertova, Elena; Roser, James D; Smedley, Jeremy; Komin, Alexander; Keele, Brandon F; Ohlen, Claes; Ott, David E
2016-11-01
AIDS virus infections are rarely controlled by cell-mediated immunity, in part due to viral immune evasion and immunodeficiency resulting from CD4 + T-cell infection. One likely aspect of this failure is that antiviral cellular immune responses are either absent or present at low levels during the initial establishment of infection. To test whether an extensive, timely, and effective response could reduce the establishment of infection from a high-dose inoculum, we adoptively transferred large numbers of T cells that were molecularly engineered with anti-simian immunodeficiency virus (anti-SIV) activity into rhesus macaques 3 days following an intrarectal SIV inoculation. To measure in vivo antiviral activity, we assessed the number of viruses transmitted using SIVmac239X, a molecularly tagged viral stock containing 10 genotypic variants, at a dose calculated to transmit 12 founder viruses. Single-genome sequencing of plasma virus revealed that the two animals receiving T cells expressing SIV-specific T-cell receptors (TCRs) had significantly fewer viral genotypes than the two control animals receiving non-SIV-specific T cells (means of 4.0 versus 7.5 transmitted viral genotypes; P = 0.044). Accounting for the likelihood of transmission of multiple viruses of a particular genotype, the calculated means of the total number of founder viruses transmitted were 4.5 and 14.5 in the experimental and control groups, respectively (P = 0.021). Thus, a large antiviral T-cell response timed with virus exposure can limit viral transmission. The presence of strong, preexisting T-cell responses, including those induced by vaccines, might help prevent the establishment of infection at the lower-exposure doses in humans that typically transmit only a single virus. The establishment of AIDS virus infection in an individual is essentially a race between the spreading virus and host immune defenses. Cell-mediated immune responses induced by infection or vaccination are important contributors in limiting viral replication. However, in human immunodeficiency virus (HIV)/SIV infection, the virus usually wins the race, irreversibly crippling the immune system before an effective cellular immune response is developed and active. We found that providing an accelerated response by adoptively transferring large numbers of antiviral T cells shortly after a high-dose mucosal inoculation, while not preventing infection altogether, limited the number of individual viruses transmitted. Thus, the presence of strong, preexisting T-cell responses, including those induced by vaccines, might prevent infection in humans, where the virus exposure is considerably lower. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Uddin, Muhammad Ikhtear; Islam, Shahidul; Nishat, Naoshin S.; Hossain, Motaher; Rafique, Tanzeem Ahmed; Rashu, Rasheduzzaman; Hoq, Mohammad Rubel; Zhang, Yue; Saha, Amit; Harris, Jason B.; Calderwood, Stephen B.; Bhuiyan, Taufiqur Rahman; Ryan, Edward T.; Leung, Daniel T.; Qadri, Firdausi
2016-01-01
Environmental enteropathy (EE) is a poorly understood condition that refers to chronic alterations in intestinal permeability, absorption, and inflammation, which mainly affects young children in resource-limited settings. Recently, EE has been linked to suboptimal oral vaccine responses in children, although immunological mechanisms are poorly defined. The objective of this study was to determine host factors associated with immune responses to an oral cholera vaccine (OCV). We measured antibody and memory T cell immune responses to cholera antigens, micronutrient markers in blood, and EE markers in blood and stool from 40 Bangladeshi children aged 3–14 years who received two doses of OCV given 14 days apart. EE markers included stool myeloperoxidase (MPO) and alpha anti-trypsin (AAT), and plasma endotoxin core antibody (EndoCab), intestinal fatty acid binding protein (i-FABP), and soluble CD14 (sCD14). We used multiple linear regression analysis with LASSO regularization to identify host factors, including EE markers, micronutrient (nutritional) status, age, and HAZ score, predictive for each response of interest. We found stool MPO to be positively associated with IgG antibody responses to the B subunit of cholera toxin (P = 0.03) and IgA responses to LPS (P = 0.02); plasma sCD14 to be positively associated with LPS IgG responses (P = 0.07); plasma i-FABP to be positively associated with LPS IgG responses (P = 0.01) and with memory T cell responses specific to cholera toxin (P = 0.01); stool AAT to be negatively associated with IL-10 (regulatory) T cell responses specific to cholera toxin (P = 0.02), and plasma EndoCab to be negatively associated with cholera toxin-specific memory T cell responses (P = 0.02). In summary, in a cohort of children 3–14 years old, we demonstrated that the majority of biomarkers of environmental enteropathy were positively associated with immune responses after vaccination with an OCV. PMID:27824883
Multi-Dimensional Measurement of Antibody-Mediated Heterosubtypic Immunity to Influenza.
Wang, Jiong; Hilchey, Shannon P; Hyrien, Ollivier; Huertas, Nelson; Perry, Sheldon; Ramanunninair, Manojkumar; Bucher, Doris; Zand, Martin S
2015-01-01
The human immune response to influenza vaccination depends in part on preexisting cross-reactive (heterosubtypic) immunity from previous infection by, and/or vaccination with, influenza strains that share antigenic determinants with the vaccine strains. However, current methods for assessing heterosubtypic antibody responses against influenza, including the hemagglutination-inhibition (HAI) assay and ELISA, are time and labor intensive, and require moderate amounts of serum and reagents. To address these issues we have developed a fluorescent multiplex assay, mPlex-Flu, that rapidly and simultaneously measures strain specific IgG, IgA, and IgM antibodies against influenza hemagglutinin (HA) from multiple viral strains. We cloned, expressed and purified HA proteins from 12 influenza strains, and coupled them to multiplex beads. Assay validation showed that minimal sample volumes (<5 μl of serum) were needed, and the assay had a linear response over a four Log10 range. The assay detected nanogram levels of anti-influenza specific antibodies, had high accuracy and reproducibility, with an average percentage coefficient of variation (%CV) of 9.06 for intra-assay and 12.94 for inter-assay variability. Pre- and post-intramuscular trivalent influenza vaccination levels of virus specific Ig were consistent with HAI titer and ELISA measurements. A significant advantage of the mPLEX-Flu assay over the HAI assay is the ability to perform antigenic cartography, determining the antigenic distances between influenza HA's, without mathematical correction for HAI data issues. For validation we performed antigenic cartography on 14 different post-influenza infection ferret sera assayed against 12 different influenza HA's. Results were in good agreement with a phylogenetic tree generated from hierarchical clustering of the genomic HA sequences. This is the first report of the use of a multiplex method for antigenic cartography using ferret sera. Overall, the mPlex-Flu assay provides a powerful tool to rapidly assess the influenza antibody repertoire in large populations and to study heterosubtypic immunity induced by influenza vaccination.
Uddin, Muhammad Ikhtear; Islam, Shahidul; Nishat, Naoshin S; Hossain, Motaher; Rafique, Tanzeem Ahmed; Rashu, Rasheduzzaman; Hoq, Mohammad Rubel; Zhang, Yue; Saha, Amit; Harris, Jason B; Calderwood, Stephen B; Bhuiyan, Taufiqur Rahman; Ryan, Edward T; Leung, Daniel T; Qadri, Firdausi
2016-11-01
Environmental enteropathy (EE) is a poorly understood condition that refers to chronic alterations in intestinal permeability, absorption, and inflammation, which mainly affects young children in resource-limited settings. Recently, EE has been linked to suboptimal oral vaccine responses in children, although immunological mechanisms are poorly defined. The objective of this study was to determine host factors associated with immune responses to an oral cholera vaccine (OCV). We measured antibody and memory T cell immune responses to cholera antigens, micronutrient markers in blood, and EE markers in blood and stool from 40 Bangladeshi children aged 3-14 years who received two doses of OCV given 14 days apart. EE markers included stool myeloperoxidase (MPO) and alpha anti-trypsin (AAT), and plasma endotoxin core antibody (EndoCab), intestinal fatty acid binding protein (i-FABP), and soluble CD14 (sCD14). We used multiple linear regression analysis with LASSO regularization to identify host factors, including EE markers, micronutrient (nutritional) status, age, and HAZ score, predictive for each response of interest. We found stool MPO to be positively associated with IgG antibody responses to the B subunit of cholera toxin (P = 0.03) and IgA responses to LPS (P = 0.02); plasma sCD14 to be positively associated with LPS IgG responses (P = 0.07); plasma i-FABP to be positively associated with LPS IgG responses (P = 0.01) and with memory T cell responses specific to cholera toxin (P = 0.01); stool AAT to be negatively associated with IL-10 (regulatory) T cell responses specific to cholera toxin (P = 0.02), and plasma EndoCab to be negatively associated with cholera toxin-specific memory T cell responses (P = 0.02). In summary, in a cohort of children 3-14 years old, we demonstrated that the majority of biomarkers of environmental enteropathy were positively associated with immune responses after vaccination with an OCV.
Multi-Dimensional Measurement of Antibody-Mediated Heterosubtypic Immunity to Influenza
Wang, Jiong; Hilchey, Shannon P.; Hyrien, Ollivier; Huertas, Nelson; Perry, Sheldon; Ramanunninair, Manojkumar; Bucher, Doris; Zand, Martin S.
2015-01-01
The human immune response to influenza vaccination depends in part on preexisting cross-reactive (heterosubtypic) immunity from previous infection by, and/or vaccination with, influenza strains that share antigenic determinants with the vaccine strains. However, current methods for assessing heterosubtypic antibody responses against influenza, including the hemagglutination-inhibition (HAI) assay and ELISA, are time and labor intensive, and require moderate amounts of serum and reagents. To address these issues we have developed a fluorescent multiplex assay, mPlex-Flu, that rapidly and simultaneously measures strain specific IgG, IgA, and IgM antibodies against influenza hemagglutinin (HA) from multiple viral strains. We cloned, expressed and purified HA proteins from 12 influenza strains, and coupled them to multiplex beads. Assay validation showed that minimal sample volumes (<5 μl of serum) were needed, and the assay had a linear response over a four Log10 range. The assay detected nanogram levels of anti-influenza specific antibodies, had high accuracy and reproducibility, with an average percentage coefficient of variation (%CV) of 9.06 for intra-assay and 12.94 for inter-assay variability. Pre- and post-intramuscular trivalent influenza vaccination levels of virus specific Ig were consistent with HAI titer and ELISA measurements. A significant advantage of the mPLEX-Flu assay over the HAI assay is the ability to perform antigenic cartography, determining the antigenic distances between influenza HA’s, without mathematical correction for HAI data issues. For validation we performed antigenic cartography on 14 different post-influenza infection ferret sera assayed against 12 different influenza HA’s. Results were in good agreement with a phylogenetic tree generated from hierarchical clustering of the genomic HA sequences. This is the first report of the use of a multiplex method for antigenic cartography using ferret sera. Overall, the mPlex-Flu assay provides a powerful tool to rapidly assess the influenza antibody repertoire in large populations and to study heterosubtypic immunity induced by influenza vaccination. PMID:26103163
HBV-specific and global T-cell dysfunction in chronic hepatitis B
Park, Jang-June; Wong, David K.; Wahed, Abdus S.; Lee, William M.; Feld, Jordan J.; Terrault, Norah; Khalili, Mandana; Sterling, Richard K.; Kowdley, Kris V.; Bzowej, Natalie; Lau, Daryl T.; Kim, W. Ray; Smith, Coleman; Carithers, Robert L.; Torrey, Keith W.; Keith, James W.; Levine, Danielle L.; Traum, Daniel; Ho, Suzanne; Valiga, Mary E.; Johnson, Geoffrey S.; Doo, Edward; Lok, Anna S. F.; Chang, Kyong-Mi
2015-01-01
Background & Aims T cells play a critical role in in viral infection. We examined whether T-cell effector and regulatory responses can define clinical stages of chronic hepatitis B (CHB). Methods We enrolled 200 adults with CHB who participated in the NIH-supported Hepatitis B Research Network from 2011 through 2013 and 20 uninfected individuals (controls). Peripheral blood lymphocytes from these subjects were analyzed for T-cell responses (proliferation and production of interferon-γ and interleukin-10) to overlapping hepatitis B virus (HBV) peptides (preS, S, preC, core, and reverse transcriptase), influenza matrix peptides, and lipopolysaccharide. T-cell expression of regulatory markers FOXP3, programmed death-1 (PD1), and cytotoxic T lymphocyte-associated antigen-4 (CTLA4) was examined by flow cytometry. Immune measures were compared with clinical parameters, including physician-defined immune-active, immune-tolerant, or inactive CHB phenotypes, in a blinded fashion. Results Compared to controls, patients with CHB had weak T-cell proliferative, interferon-γ, and interleukin-10 responses to HBV, with increased frequency of circulating FOXP3+CD127− regulatory T cells and CD4+ T-cell expression of PD1 and CTLA4. T-cell measures did not clearly distinguish between clinical CHB phenotypes, although the HBV core-specific T-cell response was weaker in HBeAg+ than HBeAg− patients (% responders: 3% vs 23%, P=.00008). Although in vitro blockade of PD1 or CTLA4 increased T-cell responses to HBV, the effect was weaker in HBeAg+ than HBeAg− patients. Furthermore, T-cell responses to influenza and lipopolysaccharide were weaker in CHB patients than controls. Conclusion HBV persists with virus-specific and global T-cell dysfunction mediated by multiple regulatory mechanisms including circulating HBeAg, but without distinct T-cell–based immune signatures for clinical phenotypes. These findings suggest additional T-cell independent or regulatory mechanisms of CHB pathogenesis that warrant further investigation. PMID:26684441
Sayed, Blayne A; Christy, Alison L; Walker, Margaret E; Brown, Melissa A
2010-06-15
Mast cells contribute to the pathogenesis of experimental autoimmune encephalomyelitis, a rodent model of the human demyelinating disease multiple sclerosis. Yet their site and mode of action is unknown. In both diseases, myelin-specific T cells are initially activated in peripheral lymphoid organs. However, for disease to occur, these cells must enter the immunologically privileged CNS through a breach in the relatively impermeable blood-brain barrier. In this study, we demonstrate that a dense population of resident mast cells in the meninges, structures surrounding the brain and spinal cord, regulate basal CNS barrier function, facilitating initial T cell CNS entry. Through the expression of TNF, mast cells recruit an early wave of neutrophils to the CNS. We propose that neutrophils in turn promote the blood-brain barrier breach and together with T cells lead to further inflammatory cell influx and myelin damage. These findings provide specific targets for intervention in multiple sclerosis as well as other immune-mediated CNS diseases.
Kar, Swagata; Arjunaraja, Swadhinya; Akkoyunlu, Mustafa; Pier, Gerald B; Snapper, Clifford M
2016-06-01
Priming of mice with intact, heat-killed cells of Gram-negative Neisseria meningitidis, capsular serogroup C (MenC) or Gram-positive group B Streptococcus, capsular type III (GBS-III) bacteria resulted in augmented serum polysaccharide (PS)-specific IgG titers following booster immunization. Induction of memory required CD4(+) T cells during primary immunization. We determined whether PS-specific memory for IgG production was contained within the B cell and/or T cell populations, and whether augmented IgG responses following booster immunization were also dependent on CD4(+) T cells. Adoptive transfer of purified B cells from MenC- or GBS-III-primed, but not naive mice resulted in augmented PS-specific IgG responses following booster immunization. Similar responses were observed when cotransferred CD4(+) T cells were from primed or naive mice. Similarly, primary immunization with unencapsulated MenC or GBS-III, to potentially prime CD4(+) T cells, failed to enhance PS-specific IgG responses following booster immunization with their encapsulated isogenic partners. Furthermore, in contrast to GBS-III, depletion of CD4(+) T cells during secondary immunization with MenC or another Gram-negative bacteria, Acinetobacter baumannii, did not inhibit augmented PS-specific IgG booster responses of mice primed with heat-killed cells. Also, in contrast with GBS-III, booster immunization of MenC-primed mice with isolated MenC-PS, a TI Ag, or a conjugate of MenC-PS and tetanus toxoid elicited an augmented PS-specific IgG response similar to booster immunization with intact MenC. These data demonstrate that memory for augmented PS-specific IgG booster responses to Gram-negative and Gram-positive bacteria is contained solely within the B cell compartment, with a differential requirement for CD4(+) T cells for augmented IgG responses following booster immunization. Copyright © 2016 by The American Association of Immunologists, Inc.
Holmström, Morten Orebo; Riley, Caroline Hasselbalch; Skov, Vibe; Svane, Inge Marie; Hasselbalch, Hans Carl; Andersen, Mads Hald
2018-01-01
The Chronic Myeloproliferative Neoplasms (MPN) are cancers characterized by hyperinflammation and immune deregulation. Concurrently, the expression of the immune check point programmed death ligand 1 (PD-L1) is induced by inflammation. In this study we report on the occurrence of spontaneous T cell responses against a PD-L1 derived epitope in patients with MPN. We show that 71% of patients display a significant immune response against PD-L1, and patients with advanced MPN have significantly fewer and weaker PD-L1 specific immune responses compared to patients with non-advanced MPN. The PD-L1 specific T cell responses are CD4 + T cell responses, and by gene expression analysis we show that expression of PD-L1 is enhanced in patients with MPN. This could imply that the tumor specific immune response in MPN could be enhanced by vaccination with PD-L1 derived epitopes by boosting the anti-regulatory immune response hereby allowing tumor specific T cell to exert anti-tumor immunity.
Each cell counts: Hematopoiesis and immunity research in the era of single cell genomics.
Jaitin, Diego Adhemar; Keren-Shaul, Hadas; Elefant, Naama; Amit, Ido
2015-02-01
Hematopoiesis and immunity are mediated through complex interactions between multiple cell types and states. This complexity is currently addressed following a reductionist approach of characterizing cell types by a small number of cell surface molecular features and gross functions. While the introduction of global transcriptional profiling technologies enabled a more comprehensive view, heterogeneity within sampled populations remained unaddressed, obscuring the true picture of hematopoiesis and immune system function. A critical mass of technological advances in molecular biology and genomics has enabled genome-wide measurements of single cells - the fundamental unit of immunity. These new advances are expected to boost detection of less frequent cell types and fuzzy intermediate cell states, greatly expanding the resolution of current available classifications. This new era of single-cell genomics in immunology research holds great promise for further understanding of the mechanisms and circuits regulating hematopoiesis and immunity in both health and disease. In the near future, the accuracy of single-cell genomics will ultimately enable precise diagnostics and treatment of multiple hematopoietic and immune related diseases. Copyright © 2015 Elsevier Ltd. All rights reserved.
Das De, Tanwee; Sharma, Punita; Thomas, Tina; Singla, Deepak; Tevatiya, Sanjay; Kumari, Seena; Chauhan, Charu; Rani, Jyoti; Srivastava, Vartika; Kaur, Ramandeep; Pandey, Kailash C; Dixit, Rajnikant
2018-01-01
Mosquitoes that transmit many deadly infectious diseases also need to keep fighting against many microbial infections. Constitutive expression of multiple antimicrobial peptides (AMPs) in almost all body tissues is believed to facilitate the effective management of these local infections. When any infection breaches the local barrier, AMPs are induced rapidly in non-target tissues such as hemocytes (HCs) and establish their co-ordination with systemic immune effectors to clear off the body infection. But how interorgan immune communication is managed during local and systemic infections remain largely unknown. To understand this interorgan molecular relationship, we identified, extensively profiled and compared the expression of AMPs in three important mosquito tissues viz . midgut, fat body (FB), and HCs. dsRNA -mediated AMPs silencing suggests that mosquito tissues are able to manage an optimal expression of AMPs at the physiological level. We also examined the possible contribution of two important immune regulator genes relish (REL) and nitric oxide synthase, controlling AMPs expression in these tissues during local or systemic infections. We show that each tissue has a unique ability to respond to local/systemic challenges, but HCs are more specialized to recognize and discriminate-specific antigens than gut and FB. Our investigation also revealed that both REL and NO participate in the overall management of the interorgan immune responses, but at the same time each tissue also has its own ability to maintain the interorgan flow of signals. In our knowledge, this is the first large-scale study examining the interorgan immune relationship in the mosquito.
Development of an Aotus nancymaae Model for Shigella Vaccine Immunogenicity and Efficacy Studies
Gregory, Michael; Lugo-Roman, Luis A.; Galvez Carrillo, Hugo; Tilley, Drake Hamilton; Baldeviano, Christian; Simons, Mark P.; Reynolds, Nathanael D.; Ranallo, Ryan T.; Suvarnapunya, Akamol E.; Venkatesan, Malabi M.; Oaks, Edwin V.
2014-01-01
Several animal models exist to evaluate the immunogenicity and protective efficacy of candidate Shigella vaccines. The two most widely used nonprimate models for vaccine development include a murine pulmonary challenge model and a guinea pig keratoconjunctivitis model. Nonhuman primate models exhibit clinical features and gross and microscopic colonic lesions that mimic those induced in human shigellosis. Challenge models for enterotoxigenic Escherichia coli (ETEC) and Campylobacter spp. have been successfully developed with Aotus nancymaae, and the addition of a Shigella-Aotus challenge model would facilitate the testing of combination vaccines. A series of experiments were designed to identify the dose of Shigella flexneri 2a strain 2457T that induces an attack rate of 75% in the Aotus monkey. After primary challenge, the dose required to induce an attack rate of 75% was calculated to be 1 × 1011 CFU. Shigella-specific immune responses were low after primary challenge and subsequently boosted upon rechallenge. However, preexisting immunity derived from the primary challenge was insufficient to protect against the homologous Shigella serotype. A successive study in A. nancymaae evaluated the ability of multiple oral immunizations with live-attenuated Shigella vaccine strain SC602 to protect against challenge. After three oral immunizations, animals were challenged with S. flexneri 2a 2457T. A 70% attack rate was demonstrated in control animals, whereas animals immunized with vaccine strain SC602 were protected from challenge (efficacy of 80%; P = 0.05). The overall study results indicate that the Shigella-Aotus nancymaae challenge model may be a valuable tool for evaluating vaccine efficacy and investigating immune correlates of protection. PMID:24595138
Lucas, Kenyatta; Karamichos, Dimitris; Mathew, Rose; Zieske, James D.; Stein-Streilein, Joan
2012-01-01
Inflammation in the eye is tightly regulated by multiple mechanisms that together contribute to ocular immune privilege. Many studies have shown that it is very difficult to abrogate the immune privileged mechanism called anterior chamber associated immune deviation (ACAID). Previously, we showed that retinal laser burn (RLB) to one eye abrogated immune privilege (ACAID) bilaterally for an extended period of time. In an effort to explain the inflammation in the non-burned eye, we postulated that neuronal signals initiated inflammation in the contralateral eye. Here, we test the role of substance P, a neuroinflamatory peptide, in RLB-induced loss of ACAID. Histological examination of the retina with and without RLB revealed an increase of the substance P-inducible neurokinin 1 receptor (NK1-R) in the retina of first, the burned eye, and then the contralateral eye. Specific antagonists for NK1-R, given locally with antigen within 24h, but not 3,5, or 7 days post RLB treatment, prevented the bilateral loss of ACAID. Substance P Knockout (KO) mice retained their ability to develop ACAID post RLB. These data support the postulate that substance P transmits early inflammatory signals from the RLB eye to the contralateral eye to induce changes to ocular immune privilege and has a central role in the bilateral loss of ACAID. The possibility is raised that blocking of the substance P pathway with NK1-R antagonists post ocular trauma may prevent unwanted and perhaps extended consequences of trauma-induced inflammation in the eye. PMID:22745377
An Update on the Role of Immunotherapy and Vaccine Strategies for Primary Brain Tumors.
Neagu, Martha R; Reardon, David A
2015-11-01
Existing therapies for glioblastoma (GBM), the most common malignant primary brain tumor in adults, have fallen short of improving the dismal patient outcomes, with an average 14-16-month median overall survival. The biological complexity and adaptability of GBM, redundancy of dysregulated signaling pathways, and poor penetration of therapies through the blood-brain barrier contribute to poor therapeutic progress. The current standard of care for newly diagnosed GBM consists of maximal safe resection, followed by fractionated radiotherapy combined with concurrent temozolomide (TMZ) and 6-12 cycles of adjuvant TMZ. At progression, bevacizumab with or without additional chemotherapy is an option for salvage therapy. The recent FDA approval of sipuleucel-T for prostate cancer and ipilumimab, nivolumab, and pembrolizumab for select solid tumors and the ongoing trials showing clinical efficacy and response durability herald a new era of cancer treatment with the potential to change standard-of-care treatment across multiple cancers. The evaluation of various immunotherapeutics is advancing for GBM, putting into question the dogma of the CNS as an immuno-privileged site. While the field is yet young, both active immunotherapy involving vaccine strategies and cellular therapy as well as reversal of GBM-induced global immune-suppression through immune checkpoint blockade are showing promising results and revealing essential immunological insights regarding kinetics of the immune response, immune evasion, and correlative biomarkers. The future holds exciting promise in establishing new treatment options for GBM that harness the patients' own immune system by activating it with immune checkpoint inhibitors, providing specificity using vaccine therapy, and allowing for modulation and enhancement by combinatorial approaches.
Mutua, Martin Kavao; Kimani-Murage, Elizabeth; Ngomi, Nicholas; Ravn, Henrik; Mwaniki, Peter; Echoka, Elizabeth
2016-01-01
More efforts have been put in place to increase full immunization coverage rates in the last decade. Little is known about the levels and consequences of delaying or vaccinating children in different schedules. Vaccine effectiveness depends on the timing of its administration, and it is not optimal if given early, delayed or not given as recommended. Evidence of non-specific effects of vaccines is well documented and could be linked to timing and sequencing of immunization. This paper documents the levels of coverage, timing and sequencing of routine childhood vaccines. The study was conducted between 2007 and 2014 in two informal urban settlements in Nairobi. A total of 3856 children, aged 12-23 months and having a vaccination card seen were included in analysis. Vaccination dates recorded from the cards seen were used to define full immunization coverage, timeliness and sequencing. Proportions, medians and Kaplan-Meier curves were used to assess and describe the levels of full immunization coverage, vaccination delays and sequencing. The findings indicate that 67 % of the children were fully immunized by 12 months of age. Missing measles and third doses of polio and pentavalent vaccine were the main reason for not being fully immunized. Delays were highest for third doses of polio and pentavalent and measles. About 22 % of fully immunized children had vaccines in an out-of-sequence manner with 18 % not receiving pentavalent together with polio vaccine as recommended. Results show higher levels of missed opportunities and low coverage of routine childhood vaccinations given at later ages. New strategies are needed to enable health care providers and parents/guardians to work together to increase the levels of completion of all required vaccinations. In particular, more focus is needed on vaccines given in multiple doses (polio, pentavalent and pneumococcal conjugate vaccines).
Host response mechanisms in periodontal diseases
SILVA, Nora; ABUSLEME, Loreto; BRAVO, Denisse; DUTZAN, Nicolás; GARCIA-SESNICH, Jocelyn; VERNAL, Rolando; HERNÁNDEZ, Marcela; GAMONAL, Jorge
2015-01-01
Periodontal diseases usually refer to common inflammatory disorders known as gingivitis and periodontitis, which are caused by a pathogenic microbiota in the subgingival biofilm, including Porphyromonas gingivalis, Aggregatibacter actinomycetemcomitans, Tannerella forsythia and Treponema denticola that trigger innate, inflammatory, and adaptive immune responses. These processes result in the destruction of the tissues surrounding and supporting the teeth, and eventually in tissue, bone and finally, tooth loss. The innate immune response constitutes a homeostatic system, which is the first line of defense, and is able to recognize invading microorganisms as non-self, triggering immune responses to eliminate them. In addition to the innate immunity, adaptive immunity cells and characteristic cytokines have been described as important players in the periodontal disease pathogenesis scenario, with a special attention to CD4+ T-cells (T-helper cells). Interestingly, the T cell-mediated adaptive immunity development is highly dependent on innate immunity-associated antigen presenting cells, which after antigen capture undergo into a maturation process and migrate towards the lymph nodes, where they produce distinct patterns of cytokines that will contribute to the subsequent polarization and activation of specific T CD4+ lymphocytes. Skeletal homeostasis depends on a dynamic balance between the activities of the bone-forming osteoblasts (OBLs) and bone-resorbing osteoclasts (OCLs). This balance is tightly controlled by various regulatory systems, such as the endocrine system, and is influenced by the immune system, an osteoimmunological regulation depending on lymphocyte- and macrophage-derived cytokines. All these cytokines and inflammatory mediators are capable of acting alone or in concert, to stimulate periodontal breakdown and collagen destruction via tissue-derived matrix metalloproteinases, a characterization of the progression of periodontitis as a stage that presents a significantly host immune and inflammatory response to the microbial challenge that determine of susceptibility to develop the destructive/progressive periodontitis under the influence of multiple behavioral, environmental and genetic factors. PMID:26221929
Defining dysbiosis and its influence on host immunity and disease
Petersen, Charisse; Round, June L
2014-01-01
Mammalian immune system development depends on instruction from resident commensal microorganisms. Diseases associated with abnormal immune responses towards environmental and self antigens have been rapidly increasing over the last 50 years. These diseases include inflammatory bowel disease (IBD), multiple sclerosis (MS), type I diabetes (T1D), allergies and asthma. The observation that people with immune mediated diseases house a different microbial community when compared to healthy individuals suggests that pathogenesis arises from improper training of the immune system by the microbiota. However, with hundreds of different microorganisms on our bodies it is hard to know which of these contribute to health and more importantly how? Microbiologists studying pathogenic organisms have long adhered to Koch's postulates to directly relate a certain disease to a specific microbe, raising the question of whether this might be true of commensal–host relationships as well. Emerging evidence supports that rather than one or two dominant organisms inducing host health, the composition of the entire community of microbial residents influences a balanced immune response. Thus, perturbations to the structure of complex commensal communities (referred to as dysbiosis) can lead to deficient education of the host immune system and subsequent development of immune mediated diseases. Here we will overview the literature that describes the causes of dysbiosis and the mechanisms evolved by the host to prevent these changes to community structure. Building off these studies, we will categorize the different types of dysbiosis and define how collections of microorganisms can influence the host response. This research has broad implications for future therapies that go beyond the introduction of a single organism to induce health. We propose that identifying mechanisms to re-establish a healthy complex microbiota after dysbiosis has occurred, a process we will refer to as rebiosis, will be fundamental to treating complex immune diseases. PMID:24798552
Tenzer, Stefan; Crawford, Hayley; Pymm, Phillip; Gifford, Robert; Sreenu, Vattipally B; Weimershaus, Mirjana; de Oliveira, Tulio; Burgevin, Anne; Gerstoft, Jan; Akkad, Nadja; Lunn, Daniel; Fugger, Lars; Bell, John; Schild, Hansjörg; van Endert, Peter; Iversen, Astrid K N
2014-04-24
The recent HIV-1 vaccine failures highlight the need to better understand virus-host interactions. One key question is why CD8(+) T cell responses to two HIV-Gag regions are uniquely associated with delayed disease progression only in patients expressing a few rare HLA class I variants when these regions encode epitopes presented by ~30 more common HLA variants. By combining epitope processing and computational analyses of the two HIV subtypes responsible for ~60% of worldwide infections, we identified a hitherto unrecognized adaptation to the antigen-processing machinery through substitutions at subtype-specific motifs. Multiple HLA variants presenting epitopes situated next to a given subtype-specific motif drive selection at this subtype-specific position, and epitope abundances correlate inversely with the HLA frequency distribution in affected populations. This adaptation reflects the sum of intrapatient adaptations, is predictable, facilitates viral subtype diversification, and increases global HIV diversity. Because low epitope abundance is associated with infrequent and weak T cell responses, this most likely results in both population-level immune evasion and inadequate responses in most people vaccinated with natural HIV-1 sequence constructs. Our results suggest that artificial sequence modifications at subtype-specific positions in vitro could refocus and reverse the poor immunogenicity of HIV proteins. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.
Sharma, Neekun; Hotta, Akitoyo; Yamamoto, Yoshie; Fujita, Osamu; Uda, Akihiko; Morikawa, Shigeru; Yamada, Akio
2013-01-01
A novel competitive enzyme-linked immunosorbent assay (cELISA) was developed and evaluated for detection of antibodies against Francisella tularensis in humans. The assay is based on the ability of serum antibodies to inhibit the binding of monoclonal antibodies (MAbs) directed against F. tularensis lipopolysaccharide antigens. The assay was evaluated using serum samples of tularemia patients, inactivated F. tularensis-immunized rabbits, and F. tularensis-infected mice. Antibodies against F. tularensis were successfully detected in serum samples of tularemia patients as well as the immunized and infected animals. The cELISA method was compared to indirect ELISA (iELISA) and the commonly used microagglutination test (MA) using serum samples of 19 tularemia patients and 50 healthy individuals. The sensitivity and specificity of cELISA were 93.9 and 96.1%, respectively, in comparison to the iELISA. MA was less sensitive than cELISA with a sensitivity and specificity of only 81.8 and 98.0%, respectively. A high degree of correlation (R2 = 0.8226) was observed between cELISA and iELISA results. The novel cELISA developed in this study appears to be highly sensitive and specific for serodiagnosis of human tularemia. The potential of the MAb-based cELISA to be used in both human and animal samples emphasizes its usefulness for serological survey of tularemia among multiple animal species. PMID:23114700
In Depth Analysis of Citrulline Specific CD4 T Cells in Rheumatoid Arthritis
2018-01-01
activation of lymphoid , myeloid and mast cells , indicating MALT1’s crucial role in innate and adaptive signaling. Therefore, MALT1 is regarded a...Session 7: Adaptive immunity vs. innate immunity and mesenchymal functions in RA Genetics, T cell specificity and T cell regulation in RA Jane Buckner...IFRA) Program Session 7: Adaptive immunity vs. innate immunity and mesenchymal functions in RA Genetics, T cell specificity and T cell regulation in
In-Depth Analysis of Citrulline-Specific CD4 T-Cells in Rheumatoid Arthritis
2018-01-01
player in the activation of lymphoid , myeloid and mast cells , indicating MALT1’s crucial role in innate and adaptive signaling. Therefore, MALT1 is...for RA (IFRA) Program Session 7: Adaptive immunity vs. innate immunity and mesenchymal functions in RA Genetics, T cell specificity and T cell ...Program Session 7: Adaptive immunity vs. innate immunity and mesenchymal functions in RA Genetics, T cell specificity and T cell regulation in RA
2002-01-01
The potential threat of biological warfare with a specific agent is proportional to the susceptibility of the population to that agent. Preventing disease after exposure to a biological agent is partially a function of the immunity of the exposed individual. The only available countermeasure that can provide immediate immunity against a biological agent is passive antibody. Unlike vaccines, which require time to induce protective immunity and depend on the host’s ability to mount an immune response, passive antibody can theoretically confer protection regardless of the immune status of the host. Passive antibody therapy has substantial advantages over antimicrobial agents and other measures for postexposure prophylaxis, including low toxicity and high specific activity. Specific antibodies are active against the major agents of bioterrorism, including anthrax, smallpox, botulinum toxin, tularemia, and plague. This article proposes a biological defense initiative based on developing, producing, and stockpiling specific antibody reagents that can be used to protect the population against biological warfare threats. PMID:12141970
Assessing humoral and cell-mediated immune response in Hawaiian green turtles, Chelonia mydas
Work, Thierry M.; Balazs, George H.; Rameyer, Robert; Chang, S.P.; Berestecky, J.
2000-01-01
Seven immature green turtles, Chelonia mydas, captured from Kaneohe Bay on the island of Oahu were used to evaluate methods for assessing their immune response. Two turtles each were immunized intramuscularly with egg white lysozyme (EWL) in Freund’s complete adjuvant, Gerbu, or ISA-70; a seventh turtle was immunized with saline only and served as a control. Humoral immune response was measured with an indirect enzyme linked immunosorbent assay (ELISA). Cell-mediated immune response was measured using in vitro cell proliferation assays (CPA) using whole blood or peripheral blood mononuclear cells (PBM) cultured with concanavalin A (ConA), phytohaemagglutinin (PHA), or soluble egg EWL antigen. All turtles, except for one immunized with Gerbu and the control, produced a detectable humoral immune response by 6 weeks which persisted for at least 14 weeks after a single immunization. All turtles produced an anamnestic humoral immune response after secondary immunization. Antigen specific cell-mediated immune response in PBM was seen in all turtles either after primary or secondary immunization, but it was not as consistent as humoral immune response; antigen specific cell-mediated immune response in whole blood was rarely seen. Mononuclear cells had significantly higher stimulation indices than whole blood regardless of adjuvant, however, results with whole blood had lower variability. Both Gerbu and ISA-70 appeared to potentiate the cell-mediated immune response when PBM or whole blood were cultured with PHA. This is the first time cell proliferation assays have been compared between whole blood and PBM for reptiles. This is also the first demonstration of antigen specific cell-mediated response in reptiles. Cell proliferation assays allowed us to evaluate the cell-mediated immune response of green turtles. However, CPA may be less reliable than ELISA for detecting antigen specific immune response. Either of the three adjuvants appears suitable to safely elicit a detectable immune response in green turtles.
Screening Immunomodulators To Skew the Antigen-Specific Autoimmune Response.
Northrup, Laura; Sullivan, Bradley P; Hartwell, Brittany L; Garza, Aaron; Berkland, Cory
2017-01-03
Current therapies to treat autoimmune diseases often result in side effects such as nonspecific immunosuppression. Therapies that can induce antigen-specific immune tolerance provide an opportunity to reverse autoimmunity and mitigate the risks associated with global immunosuppression. In an effort to induce antigen-specific immune tolerance, co-administration of immunomodulators with autoantigens has been investigated in an effort to reprogram autoimmunity. To date, identifying immunomodulators that may skew the antigen-specific immune response has been ad hoc at best. To address this need, we utilized splenocytes obtained from mice with experimental autoimmune encephalomyelitis (EAE) in order to determine if certain immunomodulators may induce markers of immune tolerance following antigen rechallenge. Of the immunomodulatory compounds investigated, only dexamethasone modified the antigen-specific immune response by skewing the cytokine response and decreasing T-cell populations at a concentration corresponding to a relevant in vivo dose. Thus, antigen-educated EAE splenocytes provide an ex vivo screen for investigating compounds capable of skewing the antigen-specific immune response, and this approach could be extrapolated to antigen-educated cells from other diseases or human tissues.
Pombo, Marina A; Zheng, Yi; Fernandez-Pozo, Noe; Dunham, Diane M; Fei, Zhangjun; Martin, Gregory B
2014-01-01
Plants have two related immune systems to defend themselves against pathogen attack. Initially,pattern-triggered immunity is activated upon recognition of microbe-associated molecular patterns by pattern recognition receptors. Pathogenic bacteria deliver effector proteins into the plant cell that interfere with this immune response and promote disease. However, some plants express resistance proteins that detect the presence of specific effectors leading to a robust defense response referred to as effector-triggered immunity. The interaction of tomato with Pseudomonas syringae pv. tomato is an established model system for understanding the molecular basis of these plant immune responses. We apply high-throughput RNA sequencing to this pathosystem to identify genes whose expression changes specifically during pattern-triggered or effector-triggered immunity. We then develop reporter genes for each of these responses that will enable characterization of the host response to the large collection of P. s. pv. tomato strains that express different combinations of effectors. Virus-induced gene silencing of 30 of the effector-triggered immunity-specific genes identifies Epk1 which encodes a predicted protein kinase from a family previously unknown to be involved in immunity. Knocked-down expression of Epk1 compromises effector-triggered immunity triggered by three bacterial effectors but not by effectors from non-bacterial pathogens. Epistasis experiments indicate that Epk1 acts upstream of effector-triggered immunity-associated MAP kinase signaling. Using RNA-seq technology we identify genes involved in specific immune responses. A functional genomics screen led to the discovery of Epk1, a novel predicted protein kinase required for plant defense activation upon recognition of three different bacterial effectors.
NASA Astrophysics Data System (ADS)
Belyakov, Igor M.; Moss, Bernard; Strober, Warren; Berzofsky, Jay A.
1999-04-01
Overcoming preexisting immunity to vaccinia virus in the adult population is a key requirement for development of otherwise potent recombinant vaccinia vaccines. Based on our observation that s.c. immunization with vaccinia induces cellular and antibody immunity to vaccinia only in systemic lymphoid tissue and not in mucosal sites, we hypothesized that the mucosal immune system remains naive to vaccinia and therefore amenable to immunization with recombinant vaccinia vectors despite earlier vaccinia exposure. We show that mucosal immunization of vaccinia-immune BALB/c mice with recombinant vaccinia expressing HIV gp160 induced specific serum antibody and strong HIV-specific cytotoxic T lymphocyte responses. These responses occurred not only in mucosal but also in systemic lymphoid tissue, whereas systemic immunization was ineffective under these circumstances. In this context, intrarectal immunization was more effective than intranasal immunization. Boosting with a second dose of recombinant vaccinia was also more effective via the mucosal route. The systemic HIV-specific cytotoxic T lymphocyte response was enhanced by coadministration of IL-12 at the mucosal site. These results also demonstrate the independent compartmentalization of the mucosal versus systemic immune systems and the asymmetric trafficking of lymphocytes between them. This approach to circumvent previous vaccinia immunity may be useful for induction of protective immunity against infectious diseases and cancer in the sizable populations with preexisting immunity to vaccinia from smallpox vaccination.
Vaccines and Autism: A Tale of Shifting Hypotheses
Gerber, Jeffrey S.; Offit, Paul A.
2010-01-01
Although child vaccination rates remain high, some parental concern persists that vaccines might cause autism. Three specific hypotheses have been proposed: (1) the combination measles-mumps-rubella vaccine causes autism by damaging the intestinal lining, which allows the entrance of encephalopathic proteins; (2) thimerosal, an ethylmercury-containing preservative in some vaccines, is toxic to the central nervous system; and (3) the simultaneous administration of multiple vaccines overwhelms or weakens the immune system. We will discuss the genesis of each of these theories and review the relevant epidemiological evidence. PMID:19128068
Vaccines and autism: a tale of shifting hypotheses.
Gerber, Jeffrey S; Offit, Paul A
2009-02-15
Although child vaccination rates remain high, some parental concern persists that vaccines might cause autism. Three specific hypotheses have been proposed: (1) the combination measles-mumps-rubella vaccine causes autism by damaging the intestinal lining, which allows the entrance of encephalopathic proteins; (2) thimerosal, an ethylmercury-containing preservative in some vaccines, is toxic to the central nervous system; and (3) the simultaneous administration of multiple vaccines overwhelms or weakens the immune system. We will discuss the genesis of each of these theories and review the relevant epidemiological evidence.
Optimisation of the zinc sulphate turbidity test for the determination of immune status.
Hogan, I; Doherty, M; Fagan, J; Kennedy, E; Conneely, M; Crowe, B; Lorenz, I
2016-02-13
Failure of passive transfer of maternal immunity occurs in calves that fail to absorb sufficient immunoglobulins from ingested colostrum. The zinc sulphate turbidity test has been developed to test bovine neonates for this failure. The specificity of this test has been shown to be less than ideal. The objective was to examine how parameters of the zinc sulphate turbidity test may be manipulated in order to improve its diagnostic accuracy. One hundred and five blood samples were taken from calves of dairy cows receiving various rates of colostrum feeding. The zinc sulphate turbidity test was carried out multiple times on each sample, varying the solution strength, time of reaction and wavelength of light used and the results compared with those of a radial immunodiffusion test, which is the reference method for measuring immunoglobulin concentration in serum. Reducing the time over which the reaction occurs, or increasing the wavelength of light used to read the turbidity, resulted in decreased specificity without improving sensitivity. Increasing the concentration of the zinc sulphate solution used in the test was shown to improve the specificity without decreasing sensitivity. Examination of the cut-off points suggested that a lower cut-off point would improve the performance. British Veterinary Association.
Strain-specific priming of resistance in the red flour beetle, Tribolium castaneum
Roth, Olivia; Sadd, Ben M; Schmid-Hempel, Paul; Kurtz, Joachim
2008-01-01
As invertebrates lack the molecular machinery employed by the vertebrate adaptive immune system, it was thought that they consequently lack the ability to produce lasting and specific immunity. However, in recent years, it has been demonstrated that the immune defence of invertebrates is by far more complicated and specific than previously envisioned. Lasting immunity following an initial exposure that proves protection on a secondary exposure has been shown in several species of invertebrates. This phenomenon has become known as immune priming. In the cases where it is explicitly tested, this priming can also be highly specific. In this study, we used survival assays to test for specific priming of resistance in the red flour beetle, Tribolium castaneum, using bacteria of different degrees of relatedness. Our results suggest an unexpected degree of specificity that even allows for differentiation between different strains of the same bacterium. However, our findings also demonstrate that specific priming of resistance in insects may not be ubiquitous across all bacteria. PMID:18796392
Antigen-specific response of murine immune system toward a yeast beta-glucan preparation, zymosan.
Miura, T; Ohno, N; Miura, N N; Adachi, Y; Shimada, S; Yadomae, T
1999-06-01
Zymosan, a particulate beta-glucan preparation from Saccharomyces cerevisiae, shows various biological activities, including anti-tumor activity. We have previously shown that soluble beta-glucan initiated anti-tumor activity was long-lived and was effective even by prophylactic treatment at 1 month prior to tumor challenge. However, the activity by zymosan was relatively short-lived. Antigen-specific responses of mice to zymosan might be a causative mechanism. In this paper, mice were immunized with zymosan and antibody production and antigen-specific responses of lymphocytes to zymosan were analyzed. Sera of zymosan immune mice contained zymosan-specific IgG assessed by enzyme-linked immunosorbent assay and FACS. Spleen and bone marrow cells of zymosan-immune mice showed higher cytokine production in response to zymosan. Specificity of zymosan-specific responses were also analyzed using various derivatives prepared from zymosan. These facts strongly suggested that mice recognize zymosan as antigen in addition to non-specific immune stimulant.
Nanoparticle based-immunotherapy against allergy.
Gamazo, Carlos; Gastaminza, Gabriel; Ferrer, Marta; Sanz, María L; Irache, Juan M
2014-01-01
Allergic diseases are one of the most prevalent diseases, reaching epidemic proportions in developed countries. An allergic reaction occurs after contact with an environmental protein, such as inhalants allergens (pollen, animal dander, house dust mites), or food proteins. This response is known as part of the type 2 immunity that is counterbalanced by Type 1 immunity and Tregs. Widely used allergen-specific immunotherapy (IT) is a long term treatment to induce such switch from Th2 to Th1 response. However, conventional IT requires multiple allergen injections over a long period of time and is not free of risk of producing allergic reactions. As a consequence, new safer and faster immunotherapeutic methods are required. This review deals with allergen IT using nanoparticles as allergen delivery system that will allow a different way of administration, reduce dose and diminish allergen exposure to IgE bound to mast cells or basophils.
Chimpanzee adenoviral vectors as vaccines for outbreak pathogens
2017-01-01
ABSTRACT The 2014–15 Ebola outbreak in West Africa highlighted the potential for large disease outbreaks caused by emerging pathogens and has generated considerable focus on preparedness for future epidemics. Here we discuss drivers, strategies and practical considerations for developing vaccines against outbreak pathogens. Chimpanzee adenoviral (ChAd) vectors have been developed as vaccine candidates for multiple infectious diseases and prostate cancer. ChAd vectors are safe and induce antigen-specific cellular and humoral immunity in all age groups, as well as circumventing the problem of pre-existing immunity encountered with human Ad vectors. For these reasons, such viral vectors provide an attractive platform for stockpiling vaccines for emergency deployment in response to a threatened outbreak of an emerging pathogen. Work is already underway to develop vaccines against a number of other outbreak pathogens and we will also review progress on these approaches here, particularly for Lassa fever, Nipah and MERS. PMID:29083948
Green supplier selection: a new genetic/immune strategy with industrial application
NASA Astrophysics Data System (ADS)
Kumar, Amit; Jain, Vipul; Kumar, Sameer; Chandra, Charu
2016-10-01
With the onset of the 'climate change movement', organisations are striving to include environmental criteria into the supplier selection process. This article hybridises a Green Data Envelopment Analysis (GDEA)-based approach with a new Genetic/Immune Strategy for Data Envelopment Analysis (GIS-DEA). A GIS-DEA approach provides a different view to solving multi-criteria decision making problems using data envelopment analysis (DEA) by considering DEA as a multi-objective optimisation problem with efficiency as one objective and proximity of solution to decision makers' preferences as the other objective. The hybrid approach called GIS-GDEA is applied here to a well-known automobile spare parts manufacturer in India and the results presented. User validation developed based on specific set of criteria suggests that the supplier selection process with GIS-GDEA is more practical than other approaches in a current industrial scenario with multiple decision makers.
Rapid identification of genes controlling virulence and immunity in malaria parasites
Xangsayarath, Phonepadith; Tang, Jianxia; Yahata, Kazuhide; Zoungrana, Augustin; Mitaka, Hayato; Acharjee, Arita; Datta, Partha P.; Hunt, Paul; Carter, Richard; Kaneko, Osamu; Mustonen, Ville; Pain, Arnab
2017-01-01
Identifying the genetic determinants of phenotypes that impact disease severity is of fundamental importance for the design of new interventions against malaria. Here we present a rapid genome-wide approach capable of identifying multiple genetic drivers of medically relevant phenotypes within malaria parasites via a single experiment at single gene or allele resolution. In a proof of principle study, we found that a previously undescribed single nucleotide polymorphism in the binding domain of the erythrocyte binding like protein (EBL) conferred a dramatic change in red blood cell invasion in mutant rodent malaria parasites Plasmodium yoelii. In the same experiment, we implicated merozoite surface protein 1 (MSP1) and other polymorphic proteins, as the major targets of strain-specific immunity. Using allelic replacement, we provide functional validation of the substitution in the EBL gene controlling the growth rate in the blood stages of the parasites. PMID:28704525
Cutforth, Tyler; DeMille, Mellissa MC; Agalliu, Ilir; Agalliu, Dritan
2016-01-01
Streptococcus pyogenes infections have been associated with two autoimmune diseases of the CNS: Sydenham’s chorea (SC) and Pediatric Autoimmune Neuropsychiatric Disorders Associated with Streptococcus infections (PANDAS). Despite the high frequency of pharyngeal streptococcus infections among children, only a small fraction develops SC or PANDAS. This suggests that several factors in combination are necessary to trigger autoimmune complications: specific S. pyogenes strains that induce a strong immune response toward the host nervous system; genetic susceptibility that predispose children toward an autoimmune response involving movement or tic symptoms; and multiple infections of the throat or tonsils that lead to a robust Th17 cellular and humoral immune response when untreated. In this review, we summarize the evidence for each factor and propose that all must be met for the requisite neurovascular pathology and behavioral deficits found in SC/PANDAS. PMID:27110222
Garfias-López, Julio Adrián; Castro-Escarpuli, Graciela; Cárdenas, Pedro E; Moreno-Altamirano, María Maximina Bertha; Padierna-Olivos, Juan; Sánchez-García, F Javier
2018-04-01
A wide array of microorganisms colonizes distinctive anatomical regions of animals, being the intestine the one that harbors the most abundant and complex microbiota. Phylogenetic analyses indicate that it is composed mainly of bacteria, and that Bacterioidetes and Firmicutes are the most represented phyla (>90% of the total eubacteria) in mice and humans. Intestinal microbiota plays an important role in host physiology, contributing to digestion, epithelial cells metabolism, stimulation of intestinal immune responses, and protection against intestinal pathogens. Changes in its composition may affect intestinal homeostasis, a condition known as dysbiosis, which may lead to non-specific inflammation and disease. The aim of this work was to analyze the effect that a bacteria-specific systemic immune response would have on the intestinal re-colonization by that particular bacterium. Bacteria were isolated and identified from the feces of Balb/c mice, bacterial cell-free extracts were used to immunize the same mice from which bacteria came from. Concurrently with immunization, mice were subjected to a previously described antibiotic-based protocol to eliminate most of their intestinal bacteria. Serum IgG and feces IgA, specific for the immunizing bacteria were determined. After antibiotic treatment was suspended, specific bacteria were orally administered, in an attempt to specifically re-colonize the intestine. Results showed that parenteral immunization with gut-derived bacteria elicited the production of both anti-bacterial IgG and IgA, and that immunization reduces bacteria specific recolonization of the gut. These findings support the idea that the systemic immune response may, at least in part, determine the bacterial composition of the gut. Copyright © 2018. Published by Elsevier B.V.