An APC/C-Cdh1 Biosensor Reveals the Dynamics of Cdh1 Inactivation at the G1/S Transition.
Ondracka, Andrej; Robbins, Jonathan A; Cross, Frederick R
2016-01-01
B-type cyclin-dependent kinase activity must be turned off for mitotic exit and G1 stabilization. B-type cyclin degradation is mediated by the anaphase-promoting complex/cyclosome (APC/C); during and after mitotic exit, APC/C is dependent on Cdh1. Cdh1 is in turn phosphorylated and inactivated by cyclin-CDK at the Start transition of the new cell cycle. We developed a biosensor to assess the cell cycle dynamics of APC/C-Cdh1. Nuclear exit of the G1 transcriptional repressor Whi5 is a known marker of Start; APC/C-Cdh1 is inactivated 12 min after Whi5 nuclear exit with little measurable cell-to-cell timing variability. Multiple phosphorylation sites on Cdh1 act in a redundant manner to repress its activity. Reducing the number of phosphorylation sites on Cdh1 can to some extent be tolerated for cell viability, but it increases variability in timing of APC/C-Cdh1 inactivation. Mutants with minimal subsets of phosphorylation sites required for viability exhibit striking stochasticity in multiple responses including budding, nuclear division, and APC/C-Cdh1 activity itself. Multiple cyclin-CDK complexes, as well as the stoichiometric inhibitor Acm1, contribute to APC/C-Cdh1 inactivation; this redundant control is likely to promote rapid and reliable APC/C-Cdh1 inactivation immediately following the Start transition.
DeVry, C G; Tsai, W; Clarke, S
1996-11-15
The protein L-isoaspartyl/D-aspartyl O-methyltransferase (EC 2.1.1.77) catalyzes the first step in the repair of proteins damaged in the aging process by isomerization or racemization reactions at aspartyl and asparaginyl residues. A single gene has been localized to human chromosome 6 and multiple transcripts arising through alternative splicing have been identified. Restriction enzyme mapping, subcloning, and DNA sequence analysis of three overlapping clones from a human genomic library in bacteriophage P1 indicate that the gene spans approximately 60 kb and is composed of 8 exons interrupted by 7 introns. Analysis of intron/exon splice junctions reveals that all of the donor and acceptor splice sites are in agreement with the mammalian consensus splicing sequence. Determination of transcription initiation sites by primer extension analysis of poly(A)+ mRNA from human brain identifies multiple start sites, with a major site 159 nucleotides upstream from the ATG start codon. Sequence analysis of the 5'-untranslated region demonstrates several potential cis-acting DNA elements including SP1, ETF, AP1, AP2, ARE, XRE, CREB, MED-1, and half-palindromic ERE motifs. The promoter of this methyltransferase gene lacks an identifiable TATA box but is characterized by a CpG island which begins approximately 723 nucleotides upstream of the major transcriptional start site and extends through exon 1 and into the first intron. These features are characteristic of housekeeping genes and are consistent with the wide tissue distribution observed for this methyltransferase activity.
Mosaicked Historic Airborne Imagery from Seward Peninsula, Alaska, Starting in the 1950's
Cherry, Jessica; Wirth, Lisa
2016-12-06
Historical airborne imagery for each Seward Peninsula NGEE Arctic site - Teller, Kougarok, Council - with multiple years for each site. This dataset includes mosaicked, geolocated and, where possible, orthorectified, historic airborne and recent satellite imagery. The older photos were sourced from USGS's Earth Explorer site and the newer, satellite imagery is from the Statewide Digital Mapping Initiative (SDMI) project managed by the Geographic Information Network of Alaska on behalf of the state of Alaska.
EUGENE'HOM: A generic similarity-based gene finder using multiple homologous sequences.
Foissac, Sylvain; Bardou, Philippe; Moisan, Annick; Cros, Marie-Josée; Schiex, Thomas
2003-07-01
EUGENE'HOM is a gene prediction software for eukaryotic organisms based on comparative analysis. EUGENE'HOM is able to take into account multiple homologous sequences from more or less closely related organisms. It integrates the results of TBLASTX analysis, splice site and start codon prediction and a robust coding/non-coding probabilistic model which allows EUGENE'HOM to handle sequences from a variety of organisms. The current target of EUGENE'HOM is plant sequences. The EUGENE'HOM web site is available at http://genopole.toulouse.inra.fr/bioinfo/eugene/EuGeneHom/cgi-bin/EuGeneHom.pl.
NASA Astrophysics Data System (ADS)
Létourneau, Danny; Bédard, Mikaël; Cabana, Jérôme; Lefebvre, Andrée; Lehoux, Jean-Guy; Lavigne, Pierre
2016-06-01
START domain proteins are conserved α/β helix-grip fold that play a role in the non-vesicular and intracellular transport of lipids and sterols. The mechanism and conformational changes permitting the entry of the ligand into their buried binding sites is not well understood. Moreover, their functions and the identification of cognate ligands is still an active area of research. Here, we report the solution structure of STARD6 and the characterization of its backbone dynamics on multiple time-scales through 15N spin-relaxation and amide exchange studies. We reveal for the first time the presence of concerted fluctuations in the Ω1 loop and the C-terminal helix on the microsecond-millisecond time-scale that allows for the opening of the binding site and ligand entry. We also report that STARD6 binds specifically testosterone. Our work represents a milestone for the study of ligand binding mechanism by other START domains and the elucidation of the biological function of STARD6.
EUGÈNE'HOM: a generic similarity-based gene finder using multiple homologous sequences
Foissac, Sylvain; Bardou, Philippe; Moisan, Annick; Cros, Marie-Josée; Schiex, Thomas
2003-01-01
EUGÈNE'HOM is a gene prediction software for eukaryotic organisms based on comparative analysis. EUGÈNE'HOM is able to take into account multiple homologous sequences from more or less closely related organisms. It integrates the results of TBLASTX analysis, splice site and start codon prediction and a robust coding/non-coding probabilistic model which allows EUGÈNE'HOM to handle sequences from a variety of organisms. The current target of EUGÈNE'HOM is plant sequences. The EUGÈNE'HOM web site is available at http://genopole.toulouse.inra.fr/bioinfo/eugene/EuGeneHom/cgi-bin/EuGeneHom.pl. PMID:12824408
Pelch, Katherine E; Tokar, Erik J; Merrick, B Alex; Waalkes, Michael P
2015-08-01
Previous work shows altered methylation patterns in inorganic arsenic (iAs)- or cadmium (Cd)-transformed epithelial cells. Here, the methylation status near the transcriptional start site was assessed in the normal human prostate epithelial cell line (RWPE-1) that was malignantly transformed by 10μM Cd for 11weeks (CTPE) or 5μM iAs for 29weeks (CAsE-PE), at which time cells showed multiple markers of acquired cancer phenotype. Next generation sequencing of the transcriptome of CAsE-PE cells identified multiple dysregulated genes. Of the most highly dysregulated genes, five genes that can be relevant to the carcinogenic process (S100P, HYAL1, NTM, NES, ALDH1A1) were chosen for an in-depth analysis of the DNA methylation profile. DNA was isolated, bisulfite converted, and combined bisulfite restriction analysis was used to identify differentially methylated CpG sites, which was confirmed with bisulfite sequencing. Four of the five genes showed differential methylation in transformants relative to control cells that was inversely related to altered gene expression. Increased expression of HYAL1 (>25-fold) and S100P (>40-fold) in transformants was correlated with hypomethylation near the transcriptional start site. Decreased expression of NES (>15-fold) and NTM (>1000-fold) in transformants was correlated with hypermethylation near the transcriptional start site. ALDH1A1 expression was differentially expressed in transformed cells but was not differentially methylated relative to control. In conclusion, altered gene expression observed in Cd and iAs transformed cells may result from altered DNA methylation status. Published by Elsevier Inc.
Grarup, J; Rappoport, C; Engen, N W; Carey, C; Hudson, F; Denning, E; Sharma, S; Florence, E; Vjecha, M J
2015-04-01
The aim of this report is to describe the challenges, successes and patterns of enrolment in the Strategic Timing of AntiRetroviral Treatment (START) study. START is a collaboration of many partners with central coordination provided by the protocol team, the statistical and data management centre (SDMC), the International Network for Strategic Initiatives in Global HIV Trials (INSIGHT) network leadership, international coordinating centres and site coordinating centres. The SDMC prepared reports on study accrual, baseline characteristics and site performance that allowed monitoring of enrolment and data quality and helped to ensure the successful enrolment of this large international trial. We describe the pattern of enrolment and challenges faced during the enrolment period of the trial. An initial pilot phase began in April 2009 and established feasibility of accrual at 101 sites. In August 2010, funding approval for an expanded definitive phase led to the successful accrual of 4688 participants from 215 sites in 35 countries by December 2013. Challenges to accrual included regulatory delays (e.g. national/local ethics approval and drug importation approval) and logistical obstacles (e.g. execution of contracts with pharmaceutical companies, setting up of a central drug repository and translation of participant materials). The personal engagement of investigators, strong central study coordination, and frequent and transparent communication with site investigators, community members and participants were key contributing factors to this success. Accrual into START was completed in a timely fashion despite multiple challenges. This success was attributable to the efforts of site investigators committed to maintaining study equipoise, transparent and responsive study coordination, and community involvement in problem-solving. © 2015 British HIV Association.
Rappoport, C; Engen, NW; Carey, C; Hudson, F; Denning, E; Sharma, S; Florence, E; Vjecha, MJ
2015-01-01
Objectives The aim of this report is to describe the challenges, successes and patterns of enrolment in the Strategic Timing of AntiRetroviral Treatment (START) study. Methods START is a collaboration of many partners with central coordination provided by the protocol team, the statistical and data management centre (SDMC), the International Network for Strategic Initiatives in Global HIV Trials (INSIGHT) network leadership, international coordinating centres and site coordinating centres. The SDMC prepared reports on study accrual, baseline characteristics and site performance that allowed monitoring of enrolment and data quality and helped to ensure the successful enrolment of this large international trial. We describe the pattern of enrolment and challenges faced during the enrolment period of the trial. Results An initial pilot phase began in April 2009 and established feasibility of accrual at 101 sites. In August 2010, funding approval for an expanded definitive phase led to the successful accrual of 4688 participants from 215 sites in 35 countries by December 2013. Challenges to accrual included regulatory delays (e.g. national/local ethics approval and drug importation approval) and logistical obstacles (e.g. execution of contracts with pharmaceutical companies, setting up of a central drug repository and translation of participant materials). The personal engagement of investigators, strong central study coordination, and frequent and transparent communication with site investigators, community members and participants were key contributing factors to this success. Conclusions Accrual into START was completed in a timely fashion despite multiple challenges. This success was attributable to the efforts of site investigators committed to maintaining study equipoise, transparent and responsive study coordination, and community involvement in problem‐solving. PMID:25711319
ERIC Educational Resources Information Center
Smiraglia, Christina
2015-01-01
Reminiscence programs that stimulate participants' memories through discussion are popular as both enrichment activity and clinical treatment for older adults. Museums in multiple countries are starting to offer reminiscence opportunities on-site and through outreach. This study is an investigation of the qualities of the participant experience in…
ERIC Educational Resources Information Center
Sanchez-Valero, Joan-Anton; Padilla-Petry, Paulo
2016-01-01
This article presents partial results of a multi-sited ethnographic study about the role of multiple literacies in young people's learning in and outside school. In one of the five participant secondary schools, fourth grade students were segregated in groups according to their special needs. We start with a critical review on segregated and…
NASA Technical Reports Server (NTRS)
Gary, G. Allen; Moore, R. L.
2003-01-01
We present observations and an interpretation of a unique multiple-turn spiral flux tube eruption from AR10030 on 2002 July 15. The TRACE CIV observations clearly show a flux tube that is helical and that is erupting from within a sheared magnetic field. These observations are interpreted in the context of the breakout model for magnetic field explosions. The initiation of the helix eruption starts 25 seconds after the peak of the flare s strongest impulsive spike of microwave gryosynchrotron radiation early in the flare s explosive phase, implying that the sheared core field is not the site of the initial reconnection. Within the quadrupolar configuration of the active region, the external and internal reconnection sites are identified in each of two consecutive eruptive flares that produce a double CME. The first external breakout reconnection apparently releases an underlying sheared core field and allows it to erupt, leading to internal reconnection in the wake of the erupting helix. This internal reconnection heats the two-ribbon flare and might or might not produce the helix. These events lead to the first CME and are followed by a second breakout that initiates a second and larger halo CME. The strong magnetic shear in the region is associated with rapid proper motion and evolution of the active region. The multiple-turn helix originates from above a sheared-field magnetic inversion line within a filament channel, and starts to erupt only after fast breakout reconnection has started. These observations are counter to the standard flare model and support the breakout model for eruptive flare initiation. However, the observations are compatible with internal reconnection in a sheared magnetic arcade in the formation and eruption of the helix.
NASA Technical Reports Server (NTRS)
Gary, G. Allen; Moore, R. L.
2004-01-01
We present observations and an interpretation of a unique multiple-turn spiral flux tube eruption from active region 10030 on 2002 July 15. The TRACE C IV observations clearly show a flux tube that is helical and erupting from within a sheared magnetic field. These observations are interpreted in the context of the breakout model for magnetic field explosions. The initiation of the helix eruption. as determined by a linear backward extrapolation, starts 25 s after the peak of the flare's strongest impulsive spike of microwave gyrosynchrotron radiation early in the flare s explosive phase, implying that the sheared core field is not the site of the initial reconnection. Within the quadrupolar configuration of the active region, the external and internal reconnection sites are identified in each of two consecutive eruptive flares that produce a double coronal mass ejection (CME). The first external breakout reconnection apparently releases an underlying sheared core field and allows it to erupt, leading to internal reconnection in the wake of the erupting helix. This internal reconnection releases the helix and heats the two-ribbon flare. These events lead to the first CME and are followed by a second breakout that initiates a second and larger halo CME. The strong magnetic shear in the region is compatible with the observed rapid proper motion and evolution of the active region. The multiple-turn helix originates from above a sheared-field magnetic inversion line within a filament channel. and starts to erupt only after fast breakout reconnection has started. These observations are counter to the standard flare model and support the breakout model for eruptive flare initiation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pelch, Katherine E.; Tokar, Erik J.; Merrick, B. Alex
Previous work shows altered methylation patterns in inorganic arsenic (iAs)- or cadmium (Cd)-transformed epithelial cells. Here, the methylation status near the transcriptional start site was assessed in the normal human prostate epithelial cell line (RWPE-1) that was malignantly transformed by 10 μM Cd for 11 weeks (CTPE) or 5 μM iAs for 29 weeks (CAsE-PE), at which time cells showed multiple markers of acquired cancer phenotype. Next generation sequencing of the transcriptome of CAsE-PE cells identified multiple dysregulated genes. Of the most highly dysregulated genes, five genes that can be relevant to the carcinogenic process (S100P, HYAL1, NTM, NES, ALDH1A1)more » were chosen for an in-depth analysis of the DNA methylation profile. DNA was isolated, bisulfite converted, and combined bisulfite restriction analysis was used to identify differentially methylated CpG sites, which was confirmed with bisulfite sequencing. Four of the five genes showed differential methylation in transformants relative to control cells that was inversely related to altered gene expression. Increased expression of HYAL1 (> 25-fold) and S100P (> 40-fold) in transformants was correlated with hypomethylation near the transcriptional start site. Decreased expression of NES (> 15-fold) and NTM (> 1000-fold) in transformants was correlated with hypermethylation near the transcriptional start site. ALDH1A1 expression was differentially expressed in transformed cells but was not differentially methylated relative to control. In conclusion, altered gene expression observed in Cd and iAs transformed cells may result from altered DNA methylation status. - Highlights: • Cd and iAs are known human carcinogens, yet neither appears directly mutagenic. • Prior data suggest epigenetic modification plays a role in Cd or iAs induced cancer. • Altered methylation of four misregulated genes was found in Cd or iAs transformants. • The resulting altered gene expression may be relevant to cellular transformation.« less
Genomic structure and chromosomal mapping of the human CD22 gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wilson, G.L.; Kozlow, E.; Kehrl, J.H.
1993-06-01
The human CD22 gene is expressed specifically in B lymphocytes and likely has an important function in cell-cell interactions. A nearly full length human CD22 cDNA clone was used to isolate genomic clones that span the CD22 gene. The CD22 gene is spread over 22 kb of DNA and is composed of 15 exons. The first exon contains the major transcriptional start sites. The translation initiation codon is located in exon 3, which also encodes a portion of the signal peptide. Exons 4 to 10 encode the seven Ig domains of CD22, exon 11 encodes the transmembrane domain, exons 12more » to 15 encode the intracytoplasmic domain of CD22, and exon 15 also contains the 3' untranslated region. A minor form of CD22 mRNA likely results from splicing of exon 5 to exon 8, skipping exons 6 and 7. A 4.6-kb Xbal fragment of the CD22 gene was used to map the chromosomal location of CD22 by fluorescence in situ hybridization. The hybridization locus was identified by combining fluorescent images of the probe with the chromosomal banding pattern generated by an Alu probe. The results demonstrate the CD22 is located within the band region q13.1 of chromosome 19. Two closely clustered major transcription start sites and several minor start sites were mapped by primer extension. Similarly to many other lymphoid-specific genes, the CD22 promoter lacks an obvious TATA box. Approximately 4 kb of DNA 5' of the transcription start sites were sequenced and found to contain multiple Alu elements. Potential binding sites for the transcriptional factors NF-kB, AP-1, and Oct-2 are located within 300 bp 5' of the major transcription start sites. A 400-bp fragment (bp -339 through +71) of the CD22 promoter region was subcloned into a pGEM-chloramphenicol acetyltransferase vector and after transfection into B and T cells was found to be active in both B and T cells. 45 refs., 7 figs., 2 tabs.« less
Mechanisms and consequences of alternative polyadenylation
Di Giammartino, Dafne Campigli; Nishida, Kensei; Manley, James L.
2011-01-01
Summary Alternative polyadenylation (APA) is emerging as a widespread mechanism used to control gene expression. Like alternative splicing, usage of alternative poly(A) sites allows a single gene to encode multiple mRNA transcripts. In some cases, this changes the mRNA coding potential; in other cases, the code remains unchanged but the 3’UTR length is altered, influencing the fate of mRNAs in several ways, for example, by altering the availability of RNA binding protein sites and microRNA binding sites. The mechansims governing both global and gene-specific APA are only starting to be deciphered. Here we review what is known about these mechanisms and the functional consequences of alternative polyadenlyation. PMID:21925375
The Global Regulatory Architecture of Transcription during the Caulobacter Cell Cycle
Zhou, Bo; Schrader, Jared M.; Kalogeraki, Virginia S.; Abeliuk, Eduardo; Dinh, Cong B.; Pham, James Q.; Cui, Zhongying Z.; Dill, David L.; McAdams, Harley H.; Shapiro, Lucy
2015-01-01
Each Caulobacter cell cycle involves differentiation and an asymmetric cell division driven by a cyclical regulatory circuit comprised of four transcription factors (TFs) and a DNA methyltransferase. Using a modified global 5′ RACE protocol, we globally mapped transcription start sites (TSSs) at base-pair resolution, measured their transcription levels at multiple times in the cell cycle, and identified their transcription factor binding sites. Out of 2726 TSSs, 586 were shown to be cell cycle-regulated and we identified 529 binding sites for the cell cycle master regulators. Twenty-three percent of the cell cycle-regulated promoters were found to be under the combinatorial control of two or more of the global regulators. Previously unknown features of the core cell cycle circuit were identified, including 107 antisense TSSs which exhibit cell cycle-control, and 241 genes with multiple TSSs whose transcription levels often exhibited different cell cycle timing. Cumulatively, this study uncovered novel new layers of transcriptional regulation mediating the bacterial cell cycle. PMID:25569173
The global regulatory architecture of transcription during the Caulobacter cell cycle.
Zhou, Bo; Schrader, Jared M; Kalogeraki, Virginia S; Abeliuk, Eduardo; Dinh, Cong B; Pham, James Q; Cui, Zhongying Z; Dill, David L; McAdams, Harley H; Shapiro, Lucy
2015-01-01
Each Caulobacter cell cycle involves differentiation and an asymmetric cell division driven by a cyclical regulatory circuit comprised of four transcription factors (TFs) and a DNA methyltransferase. Using a modified global 5' RACE protocol, we globally mapped transcription start sites (TSSs) at base-pair resolution, measured their transcription levels at multiple times in the cell cycle, and identified their transcription factor binding sites. Out of 2726 TSSs, 586 were shown to be cell cycle-regulated and we identified 529 binding sites for the cell cycle master regulators. Twenty-three percent of the cell cycle-regulated promoters were found to be under the combinatorial control of two or more of the global regulators. Previously unknown features of the core cell cycle circuit were identified, including 107 antisense TSSs which exhibit cell cycle-control, and 241 genes with multiple TSSs whose transcription levels often exhibited different cell cycle timing. Cumulatively, this study uncovered novel new layers of transcriptional regulation mediating the bacterial cell cycle.
Central institutional review board review for an academic trial network.
Kaufmann, Petra; O'Rourke, P Pearl
2015-03-01
Translating discoveries into therapeutics is often delayed by lengthy start-up periods for multicenter clinical trials. One cause of delay can be multiple institutional review board (IRB) reviews of the same protocol. When developing the Network for Excellence in Neuroscience Clinical Trials (NeuroNEXT; hereafter, NN), the National Institute of Neurological Disorders and Stroke (NINDS) established a central IRB (CIRB) based at Massachusetts General Hospital, the academic medical center that received the NN clinical coordinating center grant. The 25 NN sites, located at U.S. academic institutions, agreed to required CIRB use for NN trials. To delineate roles and establish legal relationships between the NN sites and the CIRB, the CIRB executed reliance agreements with the sites and their affiliates that hold federalwide assurance for the protection of human subjects (FWA); this took, on average, 84 days. The first NN protocol reviewed by the CIRB achieved full approval to allow participant enrollment within 56 days and went from grant award to the first patient visit in less than four months. The authors describe anticipated challenges related to institutional oversight responsibilities versus regulatory CIRB review as well as unanticipated challenges related to working with complex organizations that include multiple FWA-holding affiliates. The authors anticipate that CIRB use will decrease NN trial start-up time and thus promote efficient trial implementation. They plan to collect data on timelines and costs associated with CIRB use. The NINDS plans to promote CIRB use in future initiatives.
Construction of a meteor orbit calculation system for comprehensive meteor observation
NASA Astrophysics Data System (ADS)
Mizumoto, S.; Madkour, W.; Yamamoto, M.
2016-01-01
At Kochi University of Technology (KUT), the development of an HRO (Ham-band Radio meteor Observation) -Interferometer (IF) was started in 2003, and we realized the meteor orbit calculation system by multiple-site radio observation with GPS time-keeping combining with the 5 channel (5ch) HRO-IF in 2012. Here, we introduce a future plan of comprehensive meteor observation by Radio, Optical and Infrasound observation.
Case-control analysis in highway safety: Accounting for sites with multiple crashes.
Gross, Frank
2013-12-01
There is an increased interest in the use of epidemiological methods in highway safety analysis. The case-control and cohort methods are commonly used in the epidemiological field to identify risk factors and quantify the risk or odds of disease given certain characteristics and factors related to an individual. This same concept can be applied to highway safety where the entity of interest is a roadway segment or intersection (rather than a person) and the risk factors of interest are the operational and geometric characteristics of a given roadway. One criticism of the use of these methods in highway safety is that they have not accounted for the difference between sites with single and multiple crashes. In the medical field, a disease either occurs or it does not; multiple occurrences are generally not an issue. In the highway safety field, it is necessary to evaluate the safety of a given site while accounting for multiple crashes. Otherwise, the analysis may underestimate the safety effects of a given factor. This paper explores the use of the case-control method in highway safety and two variations to account for sites with multiple crashes. Specifically, the paper presents two alternative methods for defining cases in a case-control study and compares the results in a case study. The first alternative defines a separate case for each crash in a given study period, thereby increasing the weight of the associated roadway characteristics in the analysis. The second alternative defines entire crash categories as cases (sites with one crash, sites with two crashes, etc.) and analyzes each group separately in comparison to sites with no crashes. The results are also compared to a "typical" case-control application, where the cases are simply defined as any entity that experiences at least one crash and controls are those entities without a crash in a given period. In a "typical" case-control design, the attributes associated with single-crash segments are weighted the same as the attributes of segments with multiple crashes. The results support the hypothesis that the "typical" case-control design may underestimate the safety effects of a given factor compared to methods that account for sites with multiple crashes. Compared to the first alternative case definition (where multiple crash segments represent multiple cases) the results from the "typical" case-control design are less pronounced (i.e., closer to unity). The second alternative (where case definitions are constructed for various crash categories and analyzed separately) provides further evidence that sites with single and multiple crashes should not be grouped together in a case-control analysis. This paper indicates a clear need to differentiate sites with single and multiple crashes in a case-control analysis. While the results suggest that sites with multiple crashes can be accounted for using a case-control design, further research is needed to determine the optimal method for addressing this issue. This paper provides a starting point for that research. Copyright © 2012 Elsevier Ltd. All rights reserved.
PreTIS: A Tool to Predict Non-canonical 5’ UTR Translational Initiation Sites in Human and Mouse
Reuter, Kerstin; Helms, Volkhard
2016-01-01
Translation of mRNA sequences into proteins typically starts at an AUG triplet. In rare cases, translation may also start at alternative non–AUG codons located in the annotated 5’ UTR which leads to an increased regulatory complexity. Since ribosome profiling detects translational start sites at the nucleotide level, the properties of these start sites can then be used for the statistical evaluation of functional open reading frames. We developed a linear regression approach to predict in–frame and out–of–frame translational start sites within the 5’ UTR from mRNA sequence information together with their translation initiation confidence. Predicted start codons comprise AUG as well as near–cognate codons. The underlying datasets are based on published translational start sites for human HEK293 and mouse embryonic stem cells that were derived by the original authors from ribosome profiling data. The average prediction accuracy of true vs. false start sites for HEK293 cells was 80%. When applied to mouse mRNA sequences, the same model predicted translation initiation sites observed in mouse ES cells with an accuracy of 76%. Moreover, we illustrate the effect of in silico mutations in the flanking sequence context of a start site on the predicted initiation confidence. Our new webservice PreTIS visualizes alternative start sites and their respective ORFs and predicts their ability to initiate translation. Solely, the mRNA sequence is required as input. PreTIS is accessible at http://service.bioinformatik.uni-saarland.de/pretis. PMID:27768687
Chang, D D; Clayton, D A
1986-01-01
Transcription of the heavy strand of mouse mitochondrial DNA starts from two closely spaced, distinct sites located in the displacement loop region of the genome. We report here an analysis of regulatory sequences required for faithful transcription from these two sites. Data obtained from in vitro assays demonstrated that a 51-base-pair region, encompassing nucleotides -40 to +11 of the downstream start site, contains sufficient information for accurate transcription from both start sites. Deletion of the 3' flanking sequences, including one or both start sites to -17, resulted in the initiation of transcription by the mitochondrial RNA polymerase from alternative sites within vector DNA sequences. This feature places the mouse heavy-strand promoter uniquely among other known mitochondrial promoters, all of which absolutely require cognate start sites for transcription. Comparison of the heavy-strand promoter with those of other vertebrate mitochondrial DNAs revealed a remarkably high rate of sequence divergence among species. Images PMID:3785226
26 CFR 1.415(b)-2 - Multiple annuity starting dates. [Reserved
Code of Federal Regulations, 2010 CFR
2010-04-01
... 26 Internal Revenue 5 2010-04-01 2010-04-01 false Multiple annuity starting dates. [Reserved] 1.415(b)-2 Section 1.415(b)-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY... Multiple annuity starting dates. [Reserved] ...
Moody-Thomas, Sarah; Sparks, Michael; Hamasaka, Laura; Ross-Viles, Sarah; Bullock, Amber
2014-08-01
Tobacco use continues to be the leading cause of preventable illness and death in the United States. Remarkably, more than nine million preschool-aged children are exposed to secondhand smoke, resulting in increased rates of morbidity and mortality. Even more disturbing is that tobacco use is highest among people with the lowest levels of income and education. Thus, reaching these populations is a challenge facing tobacco control programs. This report describes an innovative pilot project implementing a systems change model that involves multiple stakeholders in integrating evidence-based cessation strategies into federal Head Start programs, which serve low-income adults and their children. The Tobacco Cessation Initiative was developed through a partnership between the American Legacy Foundation, the Mailman School of Public Health at Columbia University, and the Louisiana State University Health Sciences Center School of Public Health. The partnership developed guidelines to fit into the overall mission of Head Start by enabling participating sites to incorporate tobacco cessation identification and referral protocols into their existing infrastructures. This program allowed Head Start sites to incorporate, into their existing family services, protocols for user identification and referral; build partnerships with groups supporting tobacco cessation; link families to cessation services; and educate families about risks associated with exposure to secondhand smoke. Applying system strategies in non-clinical settings such as Head Start offers a way to improve the health and quality of life of preschool children at the highest risk for exposure to secondhand smoke.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, S.P.; Robert, M.F.; Mitchell, G.A.
1996-04-01
3-hydroxy-3-methylglutaryl CoA lyase (HL, EC 4.1.3.4) catalyzes the cleavage of 3-hydroxy-3-methylglutaryl CoA to acetoacetic acid and acetyl CoA, the final reaction of both ketogenesis and leucine catabolism. Autosomal-recessive HL deficiency in humans results in episodes of hypoketotic hypoglycemia and coma. Using a mouse HL cDNA as a probe, we isolated a clone containing the full-length mouse HL gene that spans about 15 kb of mouse chromosome 4 and contains nine exons. The promoter region of the mouse HL gene contains elements characteristic of a housekeeping gene: a CpG island containing multiple Sp1 binding sites surrounds exon 1, and neither amore » TATA nor a CAAT box are present. We identified multiple transcription start sites in the mouse HL gene, 35 to 9 bases upstream of the translation start codon. We also isolated two human HL genomic clones that include HL exons 2 to 9 within 18 kb. The mouse and human HL genes (HGMW-approved symbol HMGCL) are highly homologous, with identical locations of intron-exon junctions. By genomic Southern blot analysis and exonic PCR, was found 2 of 33 HL-deficient probands to be homozygous for large deletions in the HL gene. 26 refs., 4 figs., 2 tabs.« less
Control site location and transcriptional regulation in Escherichia coli.
Collado-Vides, J; Magasanik, B; Gralla, J D
1991-01-01
The regulatory regions for 119 Escherichia coli promoters have been analyzed, and the locations of the regulatory sites have been cataloged. The following observations emerge. (i) More than 95% of promoters are coregulated with at least one other promoter. (ii) Virtually all sigma 70 promoters contain at least one regulatory site in a proximal position, touching at least position -65 with respect to the start point of transcription. There are not yet clear examples of upstream regulation in the absence of a proximal site. (iii) Operators within regulons appear in very variable proximal positions. By contrast, the proximal activation sites of regulons are much more fixed. (iv) There is a forbidden zone for activation elements downstream from approximately position -20 with respect to the start of transcription. By contrast, operators can occur throughout the proximal region. When activation elements appear in the forbidden zone, they repress. These latter examples usually involve autoregulation. (v) Approximately 40% of repressible promoters contain operator duplications. These occur either in certain regulons where duplication appears to be a requirement for repressor action or in promoters subject to complex regulation. (vi) Remote operator duplications occur in approximately 10% of repressible promoters. They generally appear when a multiple promoter region is coregulated by cyclic AMP receptor protein. (vii) Sigma 54 promoters do not require proximal or precisely positioned activator elements and are not generally subject to negative regulation. Rationales are presented for all of the above observations. PMID:1943993
Jenks, M Harley; O'Rourke, Thomas W; Reines, Daniel
2008-06-01
The IMD2 gene in Saccharomyces cerevisiae is regulated by intracellular guanine nucleotides. Regulation is exerted through the choice of alternative transcription start sites that results in synthesis of either an unstable short transcript terminating upstream of the start codon or a full-length productive IMD2 mRNA. Start site selection is dictated by the intracellular guanine nucleotide levels. Here we have mapped the polyadenylation sites of the upstream, unstable short transcripts that form a heterogeneous family of RNAs of approximately 200 nucleotides. The switch from the upstream to downstream start sites required the Rpb9 subunit of RNA polymerase II. The enzyme's ability to locate the downstream initiation site decreased exponentially as the start was moved downstream from the TATA box. This suggests that RNA polymerase II's pincer grip is important as it slides on DNA in search of a start site. Exosome degradation of the upstream transcripts was highly dependent upon the distance between the terminator and promoter. Similarly, termination was dependent upon the Sen1 helicase when close to the promoter. These findings extend the emerging concept that distinct modes of termination by RNA polymerase II exist and that the distance of the terminator from the promoter, as well as its sequence, is important for the pathway chosen.
Survey of atmospheric total gaseous mercury in Mexico
NASA Astrophysics Data System (ADS)
de la Rosa, D. A.; Volke-Sepúlveda, T.; Solórzano, G.; Green, C.; Tordon, R.; Beauchamp, S.
2004-09-01
While sources of gaseous mercury (natural and anthropogenic) are well known, studies on atmospheric mercury concentrations in Mexico are new. In order to assess the total gaseous mercury (TGM) levels at some characteristic Mexican sites, four locations were selected to start an exploratory survey and begin to asses the TGM behavior. This paper presents data obtained at an urban site (Mexico City), a rural site (Huejutla, Hidalgo), a coastline site (Puerto Angel, Oaxaca) and a closed mining site (Zacatecas City, Zacatecas). The highest TGM average values were found at this last site (71.82 ng m-3) together with the urban site (9.81 ng m-3). At the rural and coast line sites the lowest TGM values (1.32 and 1.46 ng m-3, respectively) were found. According to the ANOVA test, there were significant differences for the TGM values among all the studied sites, except between the coastline and the rural place. A multiple correlation test performed between TGM and some meteorological parameters showed that in sites without anthropogenic mercury sources influence (rural and coast line), the TGM levels are correlated with the temperature and relative humidity, while for the other two sites no clear correlation was found.
Long-range epidemic spreading in a random environment.
Juhász, Róbert; Kovács, István A; Iglói, Ferenc
2015-03-01
Modeling long-range epidemic spreading in a random environment, we consider a quenched, disordered, d-dimensional contact process with infection rates decaying with distance as 1/rd+σ. We study the dynamical behavior of the model at and below the epidemic threshold by a variant of the strong-disorder renormalization-group method and by Monte Carlo simulations in one and two spatial dimensions. Starting from a single infected site, the average survival probability is found to decay as P(t)∼t-d/z up to multiplicative logarithmic corrections. Below the epidemic threshold, a Griffiths phase emerges, where the dynamical exponent z varies continuously with the control parameter and tends to zc=d+σ as the threshold is approached. At the threshold, the spatial extension of the infected cluster (in surviving trials) is found to grow as R(t)∼t1/zc with a multiplicative logarithmic correction and the average number of infected sites in surviving trials is found to increase as Ns(t)∼(lnt)χ with χ=2 in one dimension.
Characterization of the human UDP-galactose:ceramide galactosyltransferase gene promoter.
Tencomnao, T; Yu, R K; Kapitonov, D
2001-02-16
UDP-galactose:ceramide galactosyltransferase (CGT, EC 2.4.1.45) is a key enzyme in the biosynthesis of galactocerebroside, the most abundant glycosphingolipid in the myelin sheath. An 8 kb fragment upstream from the transcription initiation site of CGT gene was isolated from a human genomic DNA library. Primer extension analysis revealed a single transcription initiation site 329 bp upstream from the ATG start codon. Neither a consensus TATA nor a CCAAT box was identified in the proximity to the transcription start site; however, this region contains a high GC content and multiple putative regulatory elements. To investigate the transcriptional regulation of CGT, a series of 5' deletion constructs of the 5'-flanking region were generated and cloned upstream from the luciferase reporter gene. By comparing promoter activity in the human oligodendroglioma (HOG) and human neuroblastoma (LAN-5) cell lines, we found that the CGT promoter functions in a cell type-specific manner. Three positive cis-acting regulatory regions were identified, including a proximal region at -292/-256 which contains the potential binding sites for known transcription factors (TFs) such as Ets and SP1 (GC box), a distal region at -747/-688 comprising a number of binding sites such as the ERE half-site, NF1-like, TGGCA-BP, and CRE, and a third positive cis-acting region distally localized at -1325/-1083 consisting of binding sites for TFs such as nitrogen regulatory, TCF-1, TGGCA-BP, NF-IL6, CF1, bHLH, NF1-like, GATA, and gamma-IRE. A negative cis-acting domain localized in a far distal region at -1594/-1326 was also identified. Our results suggest the presence of both positive and negative cis-regulatory regions essential for the cell-specific expression in the TATA-less promoter of the human CGT gene.
Transcriptional Profiling Identifies Functional Interactions of TGFβ and PPARβ/δ Signaling
Kaddatz, Kerstin; Adhikary, Till; Finkernagel, Florian; Meissner, Wolfgang; Müller-Brüsselbach, Sabine; Müller, Rolf
2010-01-01
Peroxisome proliferator-activated receptors (PPARs) not only play a key role in regulating metabolic pathways but also modulate inflammatory processes, pointing to a functional interaction between PPAR and cytokine signaling pathways. In this study, we show by genome-wide transcriptional profiling that PPARβ/δ and transforming growth factor-β (TGFβ) pathways functionally interact in human myofibroblasts and that a subset of these genes is cooperatively activated by TGFβ and PPARβ/δ. Using the angiopoietin-like 4 (ANGPTL4) gene as a model, we demonstrate that two enhancer regions cooperate to mediate the observed synergistic response. A TGFβ-responsive enhancer located ∼8 kb upstream of the transcriptional start site is regulated by a mechanism involving SMAD3, ETS1, RUNX, and AP-1 transcription factors that interact with multiple contiguous binding sites. A second enhancer (PPAR-E) consisting of three juxtaposed PPAR response elements is located in the third intron ∼3.5 kb downstream of the transcriptional start site. The PPAR-E is strongly activated by all three PPAR subtypes, with a novel type of PPAR response element motif playing a central role. Although the PPAR-E is not regulated by TGFβ, it interacts with SMAD3, ETS1, RUNX2, and AP-1 in vivo, providing a possible mechanistic explanation for the observed synergism. PMID:20595396
Pu, Jian; Sun, Haina; Wang, Jinda; Wu, Min; Wang, Kangxu; Denholm, Ian; Han, Zhaojun
2016-11-01
As well as arising from single point mutations in binding sites or detoxifying enzymes, it is likely that insecticide resistance mechanisms are frequently controlled by multiple genetic factors, resulting in resistance being inherited as a quantitative trait. However, empirical evidence for this is still rare. Here we analyse the causes of up-regulation of CYP6FU1, a monoxygenase implicated in resistance to deltamethrin in the rice pest Laodelphax striatellus. The 5'-flanking region of this gene was cloned and sequenced from individuals of a susceptible and a resistant strain. A luminescent reporter assay was used to evaluate different 5'-flanking regions and their fragments for promoter activity. Mutations enhancing promoter activity in various fragments were characterized, singly and in combination, by site mutation recovery. Nucleotide diversity in flanking sequences was greatly reduced in deltamethrin-resistant insects compared to susceptible ones. Phylogenetic sequence analysis found that CYP6FU1 had five different types of 5'-flanking region. All five types were present in a susceptible strain but only a single type showing the highest promoter activity was present in a resistant strain. Four cis-acting elements were identified whose influence on up-regulation was much more pronounced in combination than when present singly. Of these, two were new transcription factor (TF) binding sites produced by mutations, another one was also a new TF binding site alternated from an existing one, and the fourth was a unique transcription start site. These results demonstrate that multiple cis-acting elements are involved in up-regulating CYP6FU1 to generate a resistance phenotype. Copyright © 2016 Elsevier Ltd. All rights reserved.
Methylation of HPA axis related genes in men with hypersexual disorder.
Jokinen, Jussi; Boström, Adrian E; Chatzittofis, Andreas; Ciuculete, Diana M; Öberg, Katarina Görts; Flanagan, John N; Arver, Stefan; Schiöth, Helgi B
2017-06-01
Hypersexual Disorder (HD) defined as non-paraphilic sexual desire disorder with components of compulsivity, impulsivity and behavioral addiction, and proposed as a diagnosis in the DSM 5, shares some overlapping features with substance use disorder including common neurotransmitter systems and dysregulated hypothalamic-pituitary-adrenal (HPA) axis function. In this study, comprising 67 HD male patients and 39 male healthy volunteers, we aimed to identify HPA-axis coupled CpG-sites, in which modifications of the epigenetic profile are associated with hypersexuality. The genome-wide methylation pattern was measured in whole blood using the Illumina Infinium Methylation EPIC BeadChip, measuring the methylation state of over 850K CpG sites. Prior to analysis, the global DNA methylation pattern was pre-processed according to standard protocols and adjusted for white blood cell type heterogeneity. We included CpG sites located within 2000bp of the transcriptional start site of the following HPA-axis coupled genes: Corticotropin releasing hormone (CRH), corticotropin releasing hormone binding protein (CRHBP), corticotropin releasing hormone receptor 1 (CRHR1), corticotropin releasing hormone receptor 2 (CRHR2), FKBP5 and the glucocorticoid receptor (NR3C1). We performed multiple linear regression models of methylation M-values to a categorical variable of hypersexuality, adjusting for depression, dexamethasone non-suppression status, Childhood Trauma Questionnaire total score and plasma levels of TNF-alpha and IL-6. Of 76 tested individual CpG sites, four were nominally significant (p<0.05), associated with the genes CRH, CRHR2 and NR3C1. Cg23409074-located 48bp upstream of the transcription start site of the CRH gene - was significantly hypomethylated in hypersexual patients after corrections for multiple testing using the FDR-method. Methylation levels of cg23409074 were positively correlated with gene expression of the CRH gene in an independent cohort of 11 healthy male subjects. The methylation levels at the identified CRH site, cg23409074, were significantly correlated between blood and four different brain regions. CRH is an important integrator of neuroendocrine stress responses in the brain, with a key role in the addiction processes. Our results show epigenetic changes in the CRH gene related to hypersexual disorder in men. Copyright © 2017 Elsevier Ltd. All rights reserved.
Hullsiek, Katherine Huppler; Kagan, Jonathan M; Engen, Nicole; Grarup, Jesper; Hudson, Fleur; Denning, Eileen T; Carey, Catherine; Courtney-Rodgers, David; Finley, Elizabeth B; Jansson, Per O; Pearson, Mary T; Peavy, Dwight E; Belloso, Waldo H
2014-01-01
Background Trial monitoring protects participant safety and study integrity. While monitors commonly go on-site to verify source data, there is little evidence that this practice is efficient or effective. An ongoing international HIV treatment trial (START) provides an opportunity to explore the usefulness of different monitoring approaches. Methods All START sites are centrally monitored and required to follow a local monitoring plan requiring specific quality assurance activities. Additionally, sites were randomized (1:1) to receive, or not receive, annual on-site monitoring. The study will determine if on-site monitoring increases the identification of major protocol deviations (eligibility or consent violations, improper study drug use, primary or serious event underreporting, data alteration or fraud). Results The START study completed enrollment in December 2013, with planned follow-up through December 2016. The monitoring study is ongoing at 196 sites in 34 countries. Results are expected when the START study concludes in December 2016. PMID:25973346
Liu, J; Turnbough, C L
1994-01-01
In Escherichia coli, expression of the pyrC gene is regulated primarily by a translational control mechanism based on nucleotide-sensitive selection of transcriptional start sites at the pyrC promoter. When intracellular levels of CTP are high, pyrC transcripts are initiated predominantly with CTP at a site 7 bases downstream of the Pribnow box. These transcripts form a stable hairpin at their 5' ends that blocks ribosome binding. When the CTP level is low and the GTP level is high, conditions found in pyrimidine-limited cells, transcripts are initiated primarily with GTP at a site 9 bases downstream of the Pribnow box. These shorter transcripts are unable to form a hairpin at their 5' ends and are readily translated. In this study, we examined the effects of nucleotide sequence and position on the selection of transcriptional start sites at the pyrC promoter. We characterized promoter mutations that systematically alter the sequence at position 7 or 9 downstream of the Pribnow box or vary the spacing between the Pribnow box and wild-type transcriptional initiation region. The results reveal preferences for particular initiating nucleotides (ATP > or = GTP > UTP >> CTP) and for starting positions downstream of the Pribnow box (7 >> 6 and 8 > 9 > 10). The results indicate that optimal nucleotide-sensitive start site switching at the wild-type pyrC promoter is the result of competition between the preferred start site (position 7) that uses the poorest initiating nucleotide (CTP) and a weak start site (position 9) that uses a good initiating nucleotide (GTP). The sequence of the pyrC promoter also minimizes the synthesis of untranslatable transcripts and provides for maximum stability of the regulatory transcript hairpin. In addition, the results show that the effects of the mutations on pyrC expression and regulation are consistent with the current model for translational control. Possible effects of preferences for initiating nucleotides and start sites on the expression and regulation of other genes are discussed. Images PMID:7910603
Characterization of the human gene (TBXAS1) encoding thromboxane synthase.
Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T
1994-09-01
The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.
Genome-wide transcription start site profiling in biofilm-grown Burkholderia cenocepacia J2315.
Sass, Andrea M; Van Acker, Heleen; Förstner, Konrad U; Van Nieuwerburgh, Filip; Deforce, Dieter; Vogel, Jörg; Coenye, Tom
2015-10-13
Burkholderia cenocepacia is a soil-dwelling Gram-negative Betaproteobacterium with an important role as opportunistic pathogen in humans. Infections with B. cenocepacia are very difficult to treat due to their high intrinsic resistance to most antibiotics. Biofilm formation further adds to their antibiotic resistance. B. cenocepacia harbours a large, multi-replicon genome with a high GC-content, the reference genome of strain J2315 includes 7374 annotated genes. This study aims to annotate transcription start sites and identify novel transcripts on a whole genome scale. RNA extracted from B. cenocepacia J2315 biofilms was analysed by differential RNA-sequencing and the resulting dataset compared to data derived from conventional, global RNA-sequencing. Transcription start sites were annotated and further analysed according to their position relative to annotated genes. Four thousand ten transcription start sites were mapped over the whole B. cenocepacia genome and the primary transcription start site of 2089 genes expressed in B. cenocepacia biofilms were defined. For 64 genes a start codon alternative to the annotated one was proposed. Substantial antisense transcription for 105 genes and two novel protein coding sequences were identified. The distribution of internal transcription start sites can be used to identify genomic islands in B. cenocepacia. A potassium pump strongly induced only under biofilm conditions was found and 15 non-coding small RNAs highly expressed in biofilms were discovered. Mapping transcription start sites across the B. cenocepacia genome added relevant information to the J2315 annotation. Genes and novel regulatory RNAs putatively involved in B. cenocepacia biofilm formation were identified. These findings will help in understanding regulation of B. cenocepacia biofilm formation.
Multiphase flow microfluidics for the production of single or multiple emulsions for drug delivery.
Zhao, Chun-Xia
2013-11-01
Considerable effort has been directed towards developing novel drug delivery systems. Microfluidics, capable of generating monodisperse single and multiple emulsion droplets, executing precise control and operations on these droplets, is a powerful tool for fabricating complex systems (microparticles, microcapsules, microgels) with uniform size, narrow size distribution and desired properties, which have great potential in drug delivery applications. This review presents an overview of the state-of-the-art multiphase flow microfluidics for the production of single emulsions or multiple emulsions for drug delivery. The review starts with a brief introduction of the approaches for making single and multiple emulsions, followed by presentation of some potential drug delivery systems (microparticles, microcapsules and microgels) fabricated in microfluidic devices using single or multiple emulsions as templates. The design principles, manufacturing processes and properties of these drug delivery systems are also discussed and compared. Furthermore, drug encapsulation and drug release (including passive and active controlled release) are provided and compared highlighting some key findings and insights. Finally, site-targeting delivery using multiphase flow microfluidics is also briefly introduced. Copyright © 2013 Elsevier B.V. All rights reserved.
10 CFR 36.15 - Start of construction.
Code of Federal Regulations, 2010 CFR
2010-01-01
... Requirements § 36.15 Start of construction. The applicant may not begin construction of a new irradiator prior... work, purchase of a site, site surveys or soil testing, site preparation, site excavation, construction... license with respect to the requirements of the Atomic Energy Act of 1954, as amended, and rules...
Two alternative ways of start site selection in human norovirus reinitiation of translation.
Luttermann, Christine; Meyers, Gregor
2014-04-25
The calicivirus minor capsid protein VP2 is expressed via termination/reinitiation. This process depends on an upstream sequence element denoted termination upstream ribosomal binding site (TURBS). We have shown for feline calicivirus and rabbit hemorrhagic disease virus that the TURBS contains three sequence motifs essential for reinitiation. Motif 1 is conserved among caliciviruses and is complementary to a sequence in the 18 S rRNA leading to the model that hybridization between motif 1 and 18 S rRNA tethers the post-termination ribosome to the mRNA. Motif 2 and motif 2* are proposed to establish a secondary structure positioning the ribosome relative to the start site of the terminal ORF. Here, we analyzed human norovirus (huNV) sequences for the presence and importance of these motifs. The three motifs were identified by sequence analyses in the region upstream of the VP2 start site, and we showed that these motifs are essential for reinitiation of huNV VP2 translation. More detailed analyses revealed that the site of reinitiation is not fixed to a single codon and does not need to be an AUG, even though this codon is clearly preferred. Interestingly, we were able to show that reinitiation can occur at AUG codons downstream of the canonical start/stop site in huNV and feline calicivirus but not in rabbit hemorrhagic disease virus. Although reinitiation at the original start site is independent of the Kozak context, downstream initiation exhibits requirements for start site sequence context known for linear scanning. These analyses on start codon recognition give a more detailed insight into this fascinating mechanism of gene expression.
The genomic structure of the human UFO receptor.
Schulz, A S; Schleithoff, L; Faust, M; Bartram, C R; Janssen, J W
1993-02-01
Using a DNA transfection-tumorigenicity assay we have recently identified the UFO oncogene. It encodes a tyrosine kinase receptor characterized by the juxtaposition of two immunoglobulin-like and two fibronectin type III repeats in its extracellular domain. Here we describe the genomic organization of the human UFO locus. The UFO receptor is encoded by 20 exons that are distributed over a region of 44 kb. Different isoforms of UFO mRNA are generated by alternative splicing of exon 10 and differential usage of two imperfect polyadenylation sites resulting in the presence or absence of 1.5-kb 3' untranslated sequences. Primer extension and S1 nuclease analyses revealed multiple transcriptional initiation sites including a major site 169 bp upstream of the translation start site. The promoter region is GC rich, lacks TATA and CAAT boxes, but contains potential recognition sites for a variety of trans-acting factors, including Sp1, AP-2 and the cyclic AMP response element-binding protein. Proto-UFO and its oncogenic counterpart exhibit identical cDNA and promoter regions sequences. Possible modes of UFO activation are discussed.
Regulation of transcription of the cell division gene ftsA during sporulation of Bacillus subtilis.
Gholamhoseinian, A; Shen, Z; Wu, J J; Piggot, P
1992-01-01
Three distinct 5' ends of ftsA mRNA were identified by S1 mapping and by primer extension analysis. These are thought to represent three transcription start sites. The transcripts from the downstream and upstream sites were detected throughout growth. The transcript from the middle site was not detected during exponential growth but was detected within 30 min of the start of sporulation, when it was the predominant transcript. Insertion of a cat cassette in the middle promoter, ftsAp2 (p2), did not affect vegetative growth but prevented postexponential symmetrical division and spore formation. Transcription from p2 was dependent on RNA polymerase containing sigma H, and promoter p2 resembled the consensus sigma H promoter. Transcription from p2 did not require expression of the spo0A, spo0B, spo0E, spo0F, or spo0K loci. Northern (RNA) blot analysis indicated that ftsA is cotranscribed with the adjacent ftsZ gene. Multiple promoters provide a mechanism by which essential vegetative genes can be subjected to sporulation control independent of control during vegetative growth. In the case of ftsA,Z, the promoters provide a mechanism to permit septum formation in conditions of nutrient depletion that might be expected to shut down the vegetative division machinery. Images PMID:1624452
Dissecting Orthosteric Contacts for a Reverse-Fragment-Based Ligand Design.
Chandramohan, Arun; Tulsian, Nikhil K; Anand, Ganesh S
2017-08-01
Orthosteric sites on proteins are formed typically from noncontiguous interacting sites in three-dimensional space where the composite binding interaction of a biological ligand is mediated by multiple synergistic interactions of its constituent functional groups. Through these multiple interactions, ligands stabilize both the ligand binding site and the local secondary structure. However, relative energetic contributions of the individual contacts in these protein-ligand interactions are difficult to resolve. Deconvolution of the contributions of these various functional groups in natural inhibitors/ligand would greatly aid in iterative fragment-based drug discovery (FBDD). In this study, we describe an approach of progressive unfolding of a target protein using a gradient of denaturant urea to reveal the individual energetic contributions of various ligand-functional groups to the affinity of the entire ligand. Through calibrated unfolding of two protein-ligand systems: cAMP-bound regulatory subunit of Protein Kinase A (RIα) and IBMX-bound phosphodiesterase8 (PDE8), monitored by amide hydrogen-deuterium exchange mass spectrometry, we show progressive disruption of individual orthosteric contacts in the ligand binding sites, allowing us to rank the energetic contributions of these individual interactions. In the two cAMP-binding sites of RIα, exocyclic phosphate oxygens of cAMP were identified to mediate stronger interactions than ribose 2'-OH in both the RIα-cAMP binding interfaces. Further, we have also ranked the relative contributions of the different functional groups of IBMX based on their interactions with the orthosteric residues of PDE8. This strategy for deconstruction of individual binding sites and identification of the strongest functional group interaction in enzyme orthosteric sites offers a rational starting point for FBDD.
Influence of Translation Initiation on Organellar Protein Targeting in Arabidopsis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sally A. Mackenzie
2011-04-18
A primary focus of the Mackenzie laboratory is the elucidation of processes and machinery for mitochondrial genome maintenance and transmission in higher plants. We have found that numerous organellar DNA maintenance components in plants appear to be dual targeted to mitochondria and plastids. Of particular interest was the observation that some twin (tandemly arrayed) dual targeting presequences appeared to utilize non-AUG alternative translation initiation, allowing for multiple translation starts at a single gene. Two aspects of this phenomenon were of particular interest: (1) Alternative translation initiation might provide a mechanism to regulate protein targeting temporally and spatially, a possibility thatmore » had not been demonstrated previously, and (2) alternative translation initiation might occur in genes involved in nuclear-controlled mitochondrial genome recombination, thought to be exclusively mitochondrial in their function. During the course of this research, we pursued three aims, with an emphasis on two specific genes of interest: POLgamma2, an organellar DNA polymerase, and MSH1, a MutS homolog thought to participate in mitochondrial, but not plastid, genome recombination surveillance. Our aims were to (1) Identify additional genes within Arabidopsis and other genomes that employ non-AUG alternative translation initiation, (2) Locate sequences upstream to the annotated AUG that confer alternative non-AUG translation initiation activity, and (3) Identify cis and trans factors that influence start site selection in genes with non-AUG starts. Toward these ends, we have shown that non-AUG initiation occurs in a number of genes, likely influencing targeting behavior of the protein. We have also shown that start site selection is strongly influenced by Kozak consensus sequence environment, indicating that alternative translation initiation in plants occurs by relaxation of ribosome scanning.« less
National Airspace System (NAS)
2013-12-01
signed at Ft. Hood, Texas (Army Site) on August 29, 2013. DASR Installation and Check-Out ( INCO ) started at Dobbins AFB, Georgia (AF Site) on February 25...2013, with SAT completed on July 17, 2013 and DD250 signed on September 17, 2013. DASR INCO at Aviano AB, Italy started on September 9, 2013...Island (Navy site) on December 16, 2013. DASR INCO at Lajes Field, Portugal started on June 12, 2013; DASR SAT was completed on January 30, 2014
Raebel, Marsha A; Shetterly, Susan; Lu, Christine Y; Flory, James; Gagne, Joshua J; Harrell, Frank E; Haynes, Kevin; Herrinton, Lisa J; Patorno, Elisabetta; Popovic, Jennifer; Selvan, Mano; Shoaibi, Azadeh; Wang, Xingmei; Roy, Jason
2016-07-01
Our purpose was to quantify missing baseline laboratory results, assess predictors of missingness, and examine performance of missing data methods. Using the Mini-Sentinel Distributed Database from three sites, we selected three exposure-outcome scenarios with laboratory results as baseline confounders. We compared hazard ratios (HRs) or risk differences (RDs) and 95% confidence intervals (CIs) from models that omitted laboratory results, included only available results (complete cases), and included results after applying missing data methods (multiple imputation [MI] regression, MI predictive mean matching [PMM] indicator). Scenario 1 considered glucose among second-generation antipsychotic users and diabetes. Across sites, glucose was available for 27.7-58.9%. Results differed between complete case and missing data models (e.g., olanzapine: HR 0.92 [CI 0.73, 1.12] vs 1.02 [0.90, 1.16]). Across-site models employing different MI approaches provided similar HR and CI; site-specific models provided differing estimates. Scenario 2 evaluated creatinine among individuals starting high versus low dose lisinopril and hyperkalemia. Creatinine availability: 44.5-79.0%. Results differed between complete case and missing data models (e.g., HR 0.84 [CI 0.77, 0.92] vs. 0.88 [0.83, 0.94]). HR and CI were identical across MI methods. Scenario 3 examined international normalized ratio (INR) among warfarin users starting interacting versus noninteracting antimicrobials and bleeding. INR availability: 20.0-92.9%. Results differed between ignoring INR versus including INR using missing data methods (e.g., RD 0.05 [CI -0.03, 0.13] vs 0.09 [0.00, 0.18]). Indicator and PMM methods gave similar estimates. Multi-site studies must consider site variability in missing data. Different missing data methods performed similarly. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.
Denning, E; Sharma, S; Smolskis, M; Touloumi, G; Walker, S; Babiker, A; Clewett, M; Emanuel, E; Florence, E; Papadopoulos, A; Sánchez, A; Tavel, J; Grady, C
2015-04-01
Efforts are needed to improve informed consent of participants in research. The Strategic Timing of AntiRetroviral Therapy (START) study provides a unique opportunity to study the effect of length and complexity of informed consent documents on understanding and satisfaction among geographically diverse participants. Interested START sites were randomized to use either the standard consent form or the concise consent form for all of the site's participants. A total of 4473 HIV-positive participants at 154 sites world-wide took part in the Informed Consent Substudy, with consent given in 11 primary languages. Most sites sent written information to potential participants in advance of clinic visits, usually including the consent form. At about half the sites, staff reported spending less than an hour per participant in the consent process. The vast majority of sites assessed participant understanding using informal nonspecific questions or clinical judgment. These data reflect the interest of START research staff in evaluating the consent process and improving informed consent. The START Informed Consent Substudy is by far the largest study of informed consent intervention ever conducted. Its results have the potential to impact how consent forms are written around the world. © 2015 British HIV Association.
For Parents: Vaccines for Your Children
... content Start of Search Controls Search Form Controls Vaccines site Cancel Submit CDC A-Z Index MENU ... Z # Start of Search Controls Search Form Controls Vaccines site Cancel Submit For Parents: Vaccines for Your ...
Reisz, Robert R.; Evans, David C.; Roberts, Eric M.; Sues, Hans-Dieter; Yates, Adam M.
2012-01-01
The extensive Early Jurassic continental strata of southern Africa have yielded an exceptional record of dinosaurs that includes scores of partial to complete skeletons of the sauropodomorph Massospondylus, ranging from embryos to large adults. In 1976 an incomplete egg clutch including in ovo embryos of this dinosaur, the oldest known example in the fossil record, was collected from a road-cut talus, but its exact provenance was uncertain. An excavation program at the site started in 2006 has yielded multiple in situ egg clutches, documenting the oldest known dinosaurian nesting site, predating other similar sites by more than 100 million years. The presence of numerous clutches of eggs, some of which contain embryonic remains, in at least four distinct horizons within a small area, provides the earliest known evidence of complex reproductive behavior including site fidelity and colonial nesting in a terrestrial vertebrate. Thus, fossil and sedimentological evidence from this nesting site provides empirical data on reproductive strategies in early dinosaurs. A temporally calibrated optimization of dinosaurian reproductive biology not only demonstrates the primary significance of the Massospondylus nesting site, but also provides additional insights into the initial stages of the evolutionary history of dinosaurs, including evidence that deposition of eggs in a tightly organized single layer in a nest evolved independently from brooding. PMID:22308330
Prediction of lysine ubiquitylation with ensemble classifier and feature selection.
Zhao, Xiaowei; Li, Xiangtao; Ma, Zhiqiang; Yin, Minghao
2011-01-01
Ubiquitylation is an important process of post-translational modification. Correct identification of protein lysine ubiquitylation sites is of fundamental importance to understand the molecular mechanism of lysine ubiquitylation in biological systems. This paper develops a novel computational method to effectively identify the lysine ubiquitylation sites based on the ensemble approach. In the proposed method, 468 ubiquitylation sites from 323 proteins retrieved from the Swiss-Prot database were encoded into feature vectors by using four kinds of protein sequences information. An effective feature selection method was then applied to extract informative feature subsets. After different feature subsets were obtained by setting different starting points in the search procedure, they were used to train multiple random forests classifiers and then aggregated into a consensus classifier by majority voting. Evaluated by jackknife tests and independent tests respectively, the accuracy of the proposed predictor reached 76.82% for the training dataset and 79.16% for the test dataset, indicating that this predictor is a useful tool to predict lysine ubiquitylation sites. Furthermore, site-specific feature analysis was performed and it was shown that ubiquitylation is intimately correlated with the features of its surrounding sites in addition to features derived from the lysine site itself. The feature selection method is available upon request.
Experiments on the transportation of a magnetized plasma stream in the GOL-3 facility
DOE Office of Scientific and Technical Information (OSTI.GOV)
Postupaev, V. V., E-mail: V.V.Postupaev@inp.nsk.su; Batkin, V. I.; Burdakov, A. V.
2016-04-15
The program of the deep upgrade of the GOL-3 multiple-mirror trap is presented. The upgrade is aimed at creating a new GOL-NB open trap located at the GOL-3 site and intended to directly demonstrate the efficiency of using multiple-mirror magnetic cells to improve longitudinal plasma confinement in a gasdynamic open trap. The GOL-NB device will consist of a new central trap, adjoint cells with a multiple-mirror magnetic field, and end tanks (magnetic flux expanders). Plasma in the central trap will be heated by neutral beam injection with a power of up to 1.5 MW and duration of 1 ms. Atmore » present, physical experiments directed at developing plasma technologies that are novel for this facility are being carried out using the 6-m-long autonomous part of the GOL-3 solenoid. The aim of this work was to develop a method for filling the central trap with a low-temperature start plasma. Transportation of a plasma stream from an arc source over a distance of 3 m in a uniform magnetic field with an induction of 0.5–4.5 T is demonstrated. In these experiments, the axial plasma density was (1–4) × 10{sup 20} m{sup –3} and the mirror ratio varied from 5 to 60. In general, the experiments confirmed the correctness of the adopted decisions for the start plasma source of the GOL-NB device.« less
Zhang, Xin; Huang, Danping; Jia, Xiwei; Zou, Zhihua; Wang, Yilei; Zhang, Ziping
2018-04-01
In this study, the 5'-flanking region of molt-inhibiting hormone (MIH) gene was cloned by Tail-PCR. It is 2024 bp starting from the translation initiation site, and 1818 bp starting from the predicted transcription start site. Forecast analysis results by the bioinformatics software showed that the transcription start site is located at 207 bp upstream of the start codon ATG, and TATA box is located at 240 bp upstream of the start codon ATG. Potential transcription factor binding sites include Sp1, NF-1, Oct-1, Sox-2, RAP1, and so on. There are two CpG islands, located at -25- +183 bp and -1451- -1316 bp respectively. The transfection results of luciferase reporter constructs showed that the core promoter region was located in the fragment -308 bp to -26 bp. NF-kappaB and RAP1 were essential for mih basal transcriptional activity. There are three kinds of polymorphism CA in the 5'-flanking sequence, and they can influence mih promoter activity. These findings provide a genetic foundation of the further research of mih transcription regulation. Copyright © 2017 Elsevier Inc. All rights reserved.
Laine, Elodie; Martínez, Leandro; Blondel, Arnaud; Malliavin, Thérèse E
2010-10-06
Calmodulin (CaM) is a remarkably flexible protein which can bind multiple targets in response to changes in intracellular calcium concentration. It contains four calcium-binding sites, arranged in two globular domains. The calcium affinity of CaM N-terminal domain (N-CaM) is dramatically reduced when the complex with the edema factor (EF) of Bacillus anthracis is formed. Here, an atomic explanation for this reduced affinity is proposed through molecular dynamics simulations and free energy perturbation calculations of the EF-CaM complex starting from different crystallographic models. The simulations show that electrostatic interactions between CaM and EF disfavor the opening of N-CaM domains usually induced by calcium binding. Relative calcium affinities of the N-CaM binding sites are probed by free energy perturbation, and dissociation probabilities are evaluated with locally enhanced sampling simulations. We show that EF impairs calcium binding on N-CaM through a direct conformational restraint on Site 1, by an indirect destabilization of Site 2, and by reducing the cooperativity between the two sites. Copyright © 2010 Biophysical Society. Published by Elsevier Inc. All rights reserved.
A novel isoform of TET1 that lacks a CXXC domain is overexpressed in cancer
Good, Charly R.; Madzo, Jozef; Patel, Bela; Maegawa, Shinji; Engel, Nora; Jelinek, Jaroslav
2017-01-01
Abstract TET1 oxidizes methylated cytosine into 5-hydroxymethylcytosine (5hmC), resulting in regulation of DNA methylation and gene expression. Full length TET1 (TET1FL) has a CXXC domain that binds to unmethylated CpG islands (CGIs). This CXXC domain allows TET1 to protect CGIs from aberrant methylation, but it also limits its ability to regulate genes outside of CGIs. Here, we report a novel isoform of TET1 (TET1ALT) that has a unique transcription start site from an alternate promoter in intron 2, yielding a protein with a unique translation start site. Importantly, TET1ALT lacks the CXXC domain but retains the catalytic domain. TET1ALT is repressed in embryonic stem cells (ESCs) but becomes activated in embryonic and adult tissues while TET1FL is expressed in ESCs, but repressed in adult tissues. Overexpression of TET1ALT shows production of 5hmC with distinct (and weaker) effects on DNA methylation or gene expression when compared to TET1FL. TET1ALT is aberrantly activated in multiple cancer types including breast, uterine and glioblastoma, and TET1 activation is associated with a worse overall survival in breast, uterine and ovarian cancers. Our data suggest that the predominantly activated isoform of TET1 in cancer cells does not protect from CGI methylation and likely mediates dynamic site-specific demethylation outside of CGIs. PMID:28531272
Schwientek, Patrick; Neshat, Armin; Kalinowski, Jörn; Klein, Andreas; Rückert, Christian; Schneiker-Bekel, Susanne; Wendler, Sergej; Stoye, Jens; Pühler, Alfred
2014-11-20
Actinoplanes sp. SE50/110 is the producer of the alpha-glucosidase inhibitor acarbose, which is an economically relevant and potent drug in the treatment of type-2 diabetes mellitus. In this study, we present the detection of transcription start sites on this genome by sequencing enriched 5'-ends of primary transcripts. Altogether, 1427 putative transcription start sites were initially identified. With help of the annotated genome sequence, 661 transcription start sites were found to belong to the leader region of protein-coding genes with the surprising result that roughly 20% of these genes rank among the class of leaderless transcripts. Next, conserved promoter motifs were identified for protein-coding genes with and without leader sequences. The mapped transcription start sites were finally used to improve the annotation of the Actinoplanes sp. SE50/110 genome sequence. Concerning protein-coding genes, 41 translation start sites were corrected and 9 novel protein-coding genes could be identified. In addition to this, 122 previously undetermined non-coding RNA (ncRNA) genes of Actinoplanes sp. SE50/110 were defined. Focusing on antisense transcription start sites located within coding genes or their leader sequences, it was discovered that 96 of those ncRNA genes belong to the class of antisense RNA (asRNA) genes. The remaining 26 ncRNA genes were found outside of known protein-coding genes. Four chosen examples of prominent ncRNA genes, namely the transfer messenger RNA gene ssrA, the ribonuclease P class A RNA gene rnpB, the cobalamin riboswitch RNA gene cobRS, and the selenocysteine-specific tRNA gene selC, are presented in more detail. This study demonstrates that sequencing of enriched 5'-ends of primary transcripts and the identification of transcription start sites are valuable tools for advanced genome annotation of Actinoplanes sp. SE50/110 and most probably also for other bacteria. Copyright © 2014 Elsevier B.V. All rights reserved.
Starting Labor-Management Quality of Work Life Programs.
ERIC Educational Resources Information Center
Brower, Michael
This report summarizes the experiences of the Massachusetts Quality of Working Life Center in assisting the attempted and actual start-up of a number of quality of work life (QWL) programs in 1976 and 1977 and in providing ongoing assistance. Lessons learned by the three sites the center launched, other sites, as well as those sites that chose not…
Neymotin, Benjamin; Ettorre, Victoria; Gresham, David
2016-01-01
Degradation of mRNA contributes to variation in transcript abundance. Studies of individual mRNAs have shown that both cis and trans factors affect mRNA degradation rates. However, the factors underlying transcriptome-wide variation in mRNA degradation rates are poorly understood. We investigated the contribution of different transcript properties to transcriptome-wide degradation rate variation in the budding yeast, Saccharomyces cerevisiae, using multiple regression analysis. We find that multiple transcript properties are significantly associated with variation in mRNA degradation rates, and that a model incorporating these properties explains ∼50% of the genome-wide variance. Predictors of mRNA degradation rates include transcript length, ribosome density, biased codon usage, and GC content of the third position in codons. To experimentally validate these factors, we studied individual transcripts expressed from identical promoters. We find that decreasing ribosome density by mutating the first translational start site of a transcript increases its degradation rate. Using coding sequence variants of green fluorescent protein (GFP) that differ only at synonymous sites, we show that increased GC content of the third position of codons results in decreased rates of mRNA degradation. Thus, in steady-state conditions, a large fraction of genome-wide variation in mRNA degradation rates is determined by inherent properties of transcripts, many of which are related to translation, rather than specific regulatory mechanisms. PMID:27633789
Signature program: a platform of basket trials.
Slosberg, Eric D; Kang, Barinder P; Peguero, Julio; Taylor, Matthew; Bauer, Todd M; Berry, Donald A; Braiteh, Fadi; Spira, Alexander; Meric-Bernstam, Funda; Stein, Steven; Piha-Paul, Sarina A; Salvado, August
2018-04-20
Investigating targeted therapies can be challenging due to diverse tumor mutations and slow patient accrual for clinical studies. The Signature Program is a series of 8 phase 2, agent-specific basket protocols using a rapid study start-up approach involving no predetermined study sites. Each protocol evaluated 1 agent (buparlisib, dovitinib, binimetinib, encorafenib, sonidegib, BGJ398, ceritinib, or ribociclib) in patients with solid or hematologic malignancies and an actionable mutation. The primary endpoint of each study was the clinical benefit rate (ie, complete or partial response, or stable disease) at 16 weeks. A total of 192 individual sites were opened in the United States, with a median start-up time of 3.6 weeks. The most common tumor types among the 595 treated patients were colorectal (9.2%), non-small cell lung adenocarcinoma (9.1%), and ovarian (8.4%). Frequent genetic alterations were in PIK3CA , RAS , p16 , and PTEN . Overall, 30 partial or complete responses were observed with 6 compounds in 16 tumor types. The Signature Program presents a unique and successful approach for rapid signal finding across multiple tumors and allowed various agents to be evaluated in patients with rare alterations. Incorporating these program features in conventional studies could lead to improved trial efficiencies and patient outcomes.
Signature program: a platform of basket trials
Peguero, Julio; Taylor, Matthew; Bauer, Todd M.; Berry, Donald A.; Braiteh, Fadi; Spira, Alexander; Meric-Bernstam, Funda; Stein, Steven; Piha-Paul, Sarina A.; Salvado, August
2018-01-01
Investigating targeted therapies can be challenging due to diverse tumor mutations and slow patient accrual for clinical studies. The Signature Program is a series of 8 phase 2, agent-specific basket protocols using a rapid study start-up approach involving no predetermined study sites. Each protocol evaluated 1 agent (buparlisib, dovitinib, binimetinib, encorafenib, sonidegib, BGJ398, ceritinib, or ribociclib) in patients with solid or hematologic malignancies and an actionable mutation. The primary endpoint of each study was the clinical benefit rate (ie, complete or partial response, or stable disease) at 16 weeks. A total of 192 individual sites were opened in the United States, with a median start-up time of 3.6 weeks. The most common tumor types among the 595 treated patients were colorectal (9.2%), non-small cell lung adenocarcinoma (9.1%), and ovarian (8.4%). Frequent genetic alterations were in PIK3CA, RAS, p16, and PTEN. Overall, 30 partial or complete responses were observed with 6 compounds in 16 tumor types. The Signature Program presents a unique and successful approach for rapid signal finding across multiple tumors and allowed various agents to be evaluated in patients with rare alterations. Incorporating these program features in conventional studies could lead to improved trial efficiencies and patient outcomes. PMID:29765547
SEASTAR: systematic evaluation of alternative transcription start sites in RNA.
Qin, Zhiyi; Stoilov, Peter; Zhang, Xuegong; Xing, Yi
2018-05-04
Alternative first exons diversify the transcriptomes of eukaryotes by producing variants of the 5' Untranslated Regions (5'UTRs) and N-terminal coding sequences. Accurate transcriptome-wide detection of alternative first exons typically requires specialized experimental approaches that are designed to identify the 5' ends of transcripts. We developed a computational pipeline SEASTAR that identifies first exons from RNA-seq data alone then quantifies and compares alternative first exon usage across multiple biological conditions. The exons inferred by SEASTAR coincide with transcription start sites identified directly by CAGE experiments and bear epigenetic hallmarks of active promoters. To determine if differential usage of alternative first exons can yield insights into the mechanism controlling gene expression, we applied SEASTAR to an RNA-seq dataset that tracked the reprogramming of mouse fibroblasts into induced pluripotent stem cells. We observed dynamic temporal changes in the usage of alternative first exons, along with correlated changes in transcription factor expression. Using a combined sequence motif and gene set enrichment analysis we identified N-Myc as a regulator of alternative first exon usage in the pluripotent state. Our results demonstrate that SEASTAR can leverage the available RNA-seq data to gain insights into the control of gene expression and alternative transcript variation in eukaryotic transcriptomes.
Kinchington, P R; Vergnes, J P; Defechereux, P; Piette, J; Turse, S E
1994-01-01
Four of the 68 varicella-zoster virus (VZV) unique open reading frames (ORFs), i.e., ORFs 4, 61, 62, and 63, encode proteins that influence viral transcription and are considered to be positional homologs of herpes simplex virus type 1 (HSV-1) immediate-early (IE) proteins. In order to identify the elements that regulate transcription of VZV ORFs 4 and 63, the encoded mRNAs were mapped in detail. For ORF 4, a major 1.8-kb and a minor 3.0-kb polyadenylated [poly(A)+] RNA were identified, whereas ORF 63-specific probes recognized 1.3- and 1.9-kb poly(A)+ RNAs. Probes specific for sequences adjacent to the ORFs and mapping of the RNA 3' ends indicated that the ORF 4 RNAs were 3' coterminal, whereas the RNAs for ORF 63 represented two different termination sites. S1 nuclease mapping and primer extension analyses indicated a single transcription initiation site for ORF 4 at 38 bp upstream of the ORF start codon. For ORF 63, multiple transcriptional start sites at 87 to 95, 151 to 153, and (tentatively) 238 to 243 bp upstream of the ORF start codon were identified. TATA box motifs at good positional locations were found upstream of all mapped transcription initiation sites. However, no sequences resembling the TAATGARAT motif, which confers IE regulation upon HSV-1 IE genes, were found. The finding of the absence of this motif was supported through analyses of the regulatory sequences of ORFs 4 and 63 in transient transfection assays alongside those of ORFs 61 and 62. Sequences representing the promoters for ORFs 4, 61, and 63 were all stimulated by VZV infection but failed to be stimulated by coexpression with the HSV-1 transactivator Vmw65. In contrast, the promoter for ORF 62, which contains TAATGARAT motifs, was activated by VZV infection and coexpression with Vmw65. These results extend the transcriptional knowledge for VZV and suggest that ORFs 4 and 63 contain regulatory signals different from those of the ORF 62 and HSV-1 IE genes. Images PMID:8189496
Computational design of a red fluorophore ligase for site-specific protein labeling in living cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Daniel S.; Nivon, Lucas G.; Richter, Florian
In this study, chemical fluorophores offer tremendous size and photophysical advantages over fluorescent proteins but are much more challenging to target to specific cellular proteins. Here, we used Rosetta-based computation to design a fluorophore ligase that accepts the red dye resorufin, starting from Escherichia coli lipoic acid ligase. X-ray crystallography showed that the design closely matched the experimental structure. Resorufin ligase catalyzed the site-specific and covalent attachment of resorufin to various cellular proteins genetically fused to a 13-aa recognition peptide in multiple mammalian cell lines and in primary cultured neurons. We used resorufin ligase to perform superresolution imaging of themore » intermediate filament protein vimentin by stimulated emission depletion and electron microscopies. This work illustrates the power of Rosetta for major redesign of enzyme specificity and introduces a tool for minimally invasive, highly specific imaging of cellular proteins by both conventional and superresolution microscopies.« less
Computational design of a red fluorophore ligase for site-specific protein labeling in living cells
Liu, Daniel S.; Nivon, Lucas G.; Richter, Florian; ...
2014-10-13
In this study, chemical fluorophores offer tremendous size and photophysical advantages over fluorescent proteins but are much more challenging to target to specific cellular proteins. Here, we used Rosetta-based computation to design a fluorophore ligase that accepts the red dye resorufin, starting from Escherichia coli lipoic acid ligase. X-ray crystallography showed that the design closely matched the experimental structure. Resorufin ligase catalyzed the site-specific and covalent attachment of resorufin to various cellular proteins genetically fused to a 13-aa recognition peptide in multiple mammalian cell lines and in primary cultured neurons. We used resorufin ligase to perform superresolution imaging of themore » intermediate filament protein vimentin by stimulated emission depletion and electron microscopies. This work illustrates the power of Rosetta for major redesign of enzyme specificity and introduces a tool for minimally invasive, highly specific imaging of cellular proteins by both conventional and superresolution microscopies.« less
Anish, Ramakrishnan; Hossain, Mohammad B.; Jacobson, Raymond H.; Takada, Shinako
2009-01-01
Background More than 80% of mammalian protein-coding genes are driven by TATA-less promoters which often show multiple transcriptional start sites (TSSs). However, little is known about the core promoter DNA sequences or mechanisms of transcriptional initiation for this class of promoters. Methodology/Principal Findings Here we identify a new core promoter element XCPE2 (X core promoter element 2) (consensus sequence: A/C/G-C-C/T-C-G/A-T-T-G/A-C-C/A+1-C/T) that can direct specific transcription from the second TSS of hepatitis B virus X gene mRNA. XCPE2 sequences can also be found in human promoter regions and typically appear to drive one of the start sites within multiple TSS-containing TATA-less promoters. To gain insight into mechanisms of transcriptional initiation from this class of promoters, we examined requirements of several general transcription factors by in vitro transcription experiments using immunodepleted nuclear extracts and purified factors. Our results show that XCPE2-driven transcription uses at least TFIIB, either TFIID or free TBP, RNA polymerase II (RNA pol II) and the MED26-containing mediator complex but not Gcn5. Therefore, XCPE2-driven transcription can be carried out by a mechanism which differs from previously described TAF-dependent mechanisms for initiator (Inr)- or downstream promoter element (DPE)-containing promoters, the TBP- and SAGA (Spt-Ada-Gcn5-acetyltransferase)-dependent mechanism for yeast TATA-containing promoters, or the TFTC (TBP-free-TAF-containing complex)-dependent mechanism for certain Inr-containing TATA-less promoters. EMSA assays using XCPE2 promoter and purified factors further suggest that XCPE2 promoter recognition requires a set of factors different from those for TATA box, Inr, or DPE promoter recognition. Conclusions/Significance We identified a new core promoter element XCPE2 that are found in multiple TSS-containing TATA-less promoters. Mechanisms of promoter recognition and transcriptional initiation for XCPE2-driven promoters appear different from previously shown mechanisms for classical promoters that show single “focused” TSSs. Our studies provide insight into novel mechanisms of RNA Pol II transcription from multiple TSS-containing TATA-less promoters. PMID:19337366
Intraoperative language localization in multilingual patients with gliomas.
Bello, Lorenzo; Acerbi, Francesco; Giussani, Carlo; Baratta, Pietro; Taccone, Paolo; Songa, Valeria; Fava, Marica; Stocchetti, Nino; Papagno, Costanza; Gaini, Sergio M
2006-07-01
Intraoperative localization of speech is problematic in patients who are fluent in different languages. Previous studies have generated various results depending on the series of patients studied, the type of language, and the sensitivity of the tasks applied. It is not clear whether languages are mediated by multiple and separate cortical areas or shared by common areas. Globally considered, previous studies recommended performing a multiple intraoperative mapping for all the languages in which the patient is fluent. The aim of this work was to study the feasibility of performing an intraoperative multiple language mapping in a group of multilingual patients with a glioma undergoing awake craniotomy for tumor removal and to describe the intraoperative cortical and subcortical findings in the area of craniotomy, with the final goal to maximally preserve patients' functional language. Seven late, highly proficient multilingual patients with a left frontal glioma were submitted preoperatively to a battery of tests to evaluate oral language production, comprehension, and repetition. Each language was tested serially starting from the first acquired language. Items that were correctly named during these tests were used to build personalized blocks to be used intraoperatively. Language mapping was undertaken during awake craniotomies by the use of an Ojemann cortical stimulator during counting and oral naming tasks. Subcortical stimulation by using the same current threshold was applied during tumor resection, in a back and forth fashion, and the same tests. Cortical sites essential for oral naming were found in 87.5% of patients, those for the first acquired language in one to four sites, those for the other languages in one to three sites. Sites for each language were distinct and separate. Number and location of sites were not predictable, being randomly and widely distributed in the cortex around or less frequently over the tumor area. Subcortical stimulations found tracts for the first acquired language in four patients and for the other languages in three patients. Three of these patients decreased their fluency immediately after surgery, affecting the first acquired language, which fully recovered in two patients and partially in one. The procedure was agile and well tolerated by the patients. These findings show that multiple cortical and subcortical language mapping during awake craniotomy for tumor removal is a feasible procedure. They support the concept that intraoperative mapping should be performed for all the languages in which the patient is fluent in to preserve functional integrity.
O’Neil, So; Cook, Benjamin; Trebino, Lisa; Walker, Deborah Klein
2009-01-01
To describe the characteristics, access, utilization, satisfaction, and outcomes of Healthy Start participants in eight selected sites, a survey of Healthy Start participants with infants ages 6–12-months-old at time of interview was conducted between October 2006 and January 2007. The response rate was 66% (n = 646), ranging from 37% in one site to >70% in seven sites. Healthy Start participants’ outcomes were compared to two national benchmarks. Healthy Start participants reported that they were satisfied with the program (>90% on five measures). Level of unmet need was 6% or less for most services, except for dental appointments (11%), housing (13%), and child care (11%). Infants had significantly better access to medical care than did their mothers, with higher rates of insurance coverage, medical homes, and checkups, and fewer unmet needs for health care. Healthy Start participants’ rates of ever breastfeeding (72%) and putting infants to sleep on their backs (70%) were at or near the Healthy People 2010 objectives, and considerably higher than rates among low-income mothers in the ECLS. The high rate of health education (>90%) may have contributed to these outcomes. Elimination of smoking among Healthy Start participants (46%) fell short of the Healthy People 2010 objective (99%). The low-birth weight (LBW) rate among Black Healthy Start participants (14%) was three times higher than the rate for Whites and Hispanics (5% each). Overall, the LBW rate in the eight sites (7.5%) was similar to the rate for low-income mothers in the ECLS, but both rates were above the Healthy People 2010 objective (5%). Challenges remain in reducing disparities in maternal and child health outcomes. Further attention to risk factors associated with LBW (especially smoking) may help close the gaps. The life course theory suggests that improved outcomes may require longer-term investments. Healthy Start’s emerging focus on interconception care has the potential to address longer-term needs of participants. PMID:19590941
Post-transcriptional m6A editing of HIV-1 mRNAs enhances viral gene expression
Kennedy, Edward M.; Bogerd, Hal P.; Kornepati, Anand V. R.; Kang, Dong; Ghoshal, Delta; Marshall, Joy B.; Poling, Brigid C.; Tsai, Kevin; Gokhale, Nandan S.; Horner, Stacy M.; Cullen, Bryan R.
2016-01-01
Summary Covalent addition of a methyl group to the adenosine N6 (m6A) is an evolutionarily conserved and common RNA modification that is thought to modulate several aspects of RNA metabolism. While the presence of multiple m6A editing sites on diverse viral RNAs was reported starting almost 40 years ago, how m6A editing affects virus replication has remained unclear. Here, we used photo-crosslinking-assisted m6A sequencing techniques to precisely map several m6A editing sites on the HIV-1 genome and report that they cluster in the HIV-1 3’ untranslated region (3'UTR). Viral 3'UTR m6A sites or analogous cellular m6A sites strongly enhanced mRNA expression in cis by recruiting the cellular YTHDF m6A “reader” proteins. Reducing YTHDF expression inhibited, while YTHDF overexpression enhanced, HIV-1 protein and RNA expression, and virus replication in CD4+ T cells. These data identify m6A editing, and the resultant recruitment of YTHDF proteins, as major positive regulators of HIV-1 mRNA expression. PMID:27117054
2016-01-01
supportive of this work from the start . This research would not have been possible without the contributions made by a number of individuals throughout...and funding structures. We started with these questions in particular based on the primary concerns at AMOS identified in the results of Phase I...from the start . Keck maintains connections with a series of other sites within a remote observing network. Remote observing from the mainland
A randomized trial comparing concise and standard consent forms in the START trial
Touloumi, Giota; Walker, A. Sarah; Smolskis, Mary; Sharma, Shweta; Babiker, Abdel G.; Pantazis, Nikos; Tavel, Jorge; Florence, Eric; Sanchez, Adriana; Hudson, Fleur; Papadopoulos, Antonios; Emanuel, Ezekiel; Clewett, Megan; Munroe, David; Denning, Eileen
2017-01-01
Background Improving the effectiveness and efficiency of research informed consent is a high priority. Some express concern about longer, more complex, written consent forms creating barriers to participant understanding. A recent meta-analysis concluded that randomized comparisons were needed. Methods We conducted a cluster-randomized non-inferiority comparison of a standard versus concise consent form within a multinational trial studying the timing of starting antiretroviral therapy in HIV+ adults (START). Interested sites were randomized to standard or concise consent forms for all individuals signing START consent. Participants completed a survey measuring comprehension of study information and satisfaction with the consent process. Site personnel reported usual site consent practices. The primary outcome was comprehension of the purpose of randomization (pre-specified 7.5% non-inferiority margin). Results 77 sites (2429 participants) were randomly allocated to use standard consent and 77 sites (2000 participants) concise consent, for an evaluable cohort of 4229. Site and participant characteristics were similar for the two groups. The concise consent was non-inferior to the standard consent on comprehension of randomization (80.2% versus 82%, site adjusted difference: 0.75% (95% CI -3.8%, +5.2%)); and the two groups did not differ significantly on total comprehension score, satisfaction, or voluntariness (p>0.1). Certain independent factors, such as education, influenced comprehension and satisfaction but not differences between consent groups. Conclusions An easier to read, more concise consent form neither hindered nor improved comprehension of study information nor satisfaction with the consent process among a large number of participants. This supports continued efforts to make consent forms more efficient. Trial registration Informed consent substudy was registered as part of START study in clinicaltrials.gov #NCT00867048, and EudraCT # 2008-006439-12 PMID:28445471
Project Developmental Continuity Evaluation: Site Visitors' Manual.
ERIC Educational Resources Information Center
Morris, Mary; Smith, Allen
This site visitors' manual is part of a series of documents on the evaluation of Project Developmental Continuity (PDC), a Head Start demonstration program aimed at providing educational and developmental continuity between children's Head Start and primary school experiences. The PDC evaluation documents and analyzes the process of program…
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bender, Howard A.
This report presents results of multiple research projects, new and ongoing, funded under the Site-Directed Research and Development Program for the Nevada National Security Site during federal fiscal year 2015. The Site's legacy capabilities in remote sensing combined with new paradigms for emergency response and consequence management help drive the need to develop advanced aerial sensor platforms. Likewise, dynamic materials science is a critical area of scientific research for which basic physics issues are still unresolved. New methods of characterizing materials in extreme states are vitally needed, and these efforts are paving the way with new knowledge. Projects selected inmore » FY 2015 for the Exploratory Research portfolio exhibit a strong balance of NNSS mission relevance. Geoscience, seismology, and techniques for detecting underground nuclear events are still essential focus areas. Many of the project reports in the second major section of this annual report are ongoing continuations in multi-year lifecycles. Diagnostic techniques for stockpile and nuclear security science figured prominently as well, with a few key efforts coming to fruition, such as phase transition detection. In other areas, modeling efforts toward better understanding plasma focus physics has also started to pay dividends for major program needs.« less
Szałaj, Natalia; Bajda, Marek; Dudek, Katarzyna; Brus, Boris; Gobec, Stanislav; Malawska, Barbara
2015-08-01
Alzheimer's disease (AD) is a fatal and complex neurodegenerative disorder for which effective treatment remains the unmet challenge. Using donepezil as a starting point, we aimed to develop novel potential anti-AD agents with a multidirectional biological profile. We designed the target compounds as dual binding site acetylcholinesterase inhibitors, where the N-benzylamine pharmacophore is responsible for interactions with the catalytic anionic site of the enzyme. The heteroaromatic fragment responsible for interactions with the peripheral anionic site was modified and three different heterocycles were introduced: isoindoline, isoindolin-1-one, and saccharine. Based on the results of the pharmacological evaluation, we identified compound 8b with a saccharine moiety as the most potent and selective human acetylcholinesterase inhibitor (IC50 = 33 nM) and beta amyloid aggregation inhibitor. It acts as a non-competitive acetylcholinesterase inhibitor and is able to cross the blood-brain barrier in vitro. We believe that compound 8b represents an important lead compound for further development as potential anti-AD agent. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Tu, N; Chen, H; Winnikes, U; Reinert, I; Pirke, K M; Lentes, K U
2000-09-22
Uncoupling protein-3 (UCP3) is considered as an important regulator of energy expenditure and thermogenesis in humans. To get insight into the mechanisms regulating its expression we have cloned and characterized about 5 kb of the 5'-flanking region of the human UCP3 (hUCP3) gene. 5'-RACE analysis suggested a single transcription initiation site 187 bp upstream from the translational start site. The promoter region contains both TATA and CAAT boxes as well as consensus motifs for PPRE, TRE, CRE and muscle-specific factors like MyoD and MEF2 sites. Functional characterization of a 3 kb hUCP3 promoter fragment in multiple cell lines using a CAT-ELISA identified a cis-acting negative regulatory element between -2983 and -982 while the region between -982 and -284 showed greatly increased basal promoter activity suggesting the presence of a strong enhancer element. Promoter activity was particularly enhanced in the murine skeletal muscle cell line C2C12 reflecting the tissue-selective expression pattern of UCP3.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dong, Xiquan
In this proposed research, we will investigate how different meteorological regimes and aerosol sources affect DCS properties, diurnal and life cycles, and precipitation using multiple observational platforms (surface, satellite, and aircraft) and NARR reanalysis at the ARM SGP site. The Feng et al. (2011, 2012) DCS results will serve as a starting point for this proposed research, and help us to address some fundamental issues of DCSs, such as convective initiation, rain rate, areal extent (including stratiform and convective regions), and longevity. Convective properties will be stratified by meteorological regime (synoptic/mesoscale patterns) identified by reanalysis. Aerosol information obtained from themore » ARM SGP site will also be stratified by meteorological regimes to understand their effects on convection. Finally, the aircraft in-situ measurements and various radar observations and retrievals during the MC3E campaign will provide a “cloud-truth” dataset and are an invaluable data source for verifying the findings and investigating the proposed hypotheses in Objective 1.« less
ERIC Educational Resources Information Center
Callahan, Carolyn M.; Tomlinson, Carol A.; Moon, Tonya R.; Tomchin, Ellen M.; Plucker, Jonathan A.
This monograph describes Project START (Support To Affirm Rising Talent), a three-year collaborative research effort to develop and apply gifted identification procedures based on Howard Gardner's (1983) theory of multiple intelligences. Specifically, the study attempted to: (1) develop identification procedures; (2) identify high-potential…
NASA Astrophysics Data System (ADS)
Breinl, Korbinian; Di Baldassarre, Giuliano; Girons Lopez, Marc
2017-04-01
We assess uncertainties of multi-site rainfall generation across spatial scales and different climatic conditions. Many research subjects in earth sciences such as floods, droughts or water balance simulations require the generation of long rainfall time series. In large study areas the simulation at multiple sites becomes indispensable to account for the spatial rainfall variability, but becomes more complex compared to a single site due to the intermittent nature of rainfall. Weather generators can be used for extrapolating rainfall time series, and various models have been presented in the literature. Even though the large majority of multi-site rainfall generators is based on similar methods, such as resampling techniques or Markovian processes, they often become too complex. We think that this complexity has been a limit for the application of such tools. Furthermore, the majority of multi-site rainfall generators found in the literature are either not publicly available or intended for being applied at small geographical scales, often only in temperate climates. Here we present a revised, and now publicly available, version of a multi-site rainfall generation code first applied in 2014 in Austria and France, which we call TripleM (Multisite Markov Model). We test this fast and robust code with daily rainfall observations from the United States, in a subtropical, tropical and temperate climate, using rain gauge networks with a maximum site distance above 1,000km, thereby generating one million years of synthetic time series. The modelling of these one million years takes one night on a recent desktop computer. In this research, we first start the simulations with a small station network of three sites and progressively increase the number of sites and the spatial extent, and analyze the changing uncertainties for multiple statistical metrics such as dry and wet spells, rainfall autocorrelation, lagged cross correlations and the inter-annual rainfall variability. Our study contributes to the scientific community of earth sciences and the ongoing debate on extreme precipitation in a changing climate by making a stable, and very easily applicable, multi-site rainfall generation code available to the research community and providing a better understanding of the performance of multi-site rainfall generation depending on spatial scales and climatic conditions.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kolonko, Nadine; Bannach, Oliver; Aschermann, Katja
Viroids are single-stranded, circular RNAs of 250 to 400 bases, that replicate autonomously in their host plants but do not code for a protein. Viroids of the family Pospiviroidae, of which potato spindle tuber viroid (PSTVd) is the type strain, are replicated by the host's DNA-dependent RNA polymerase II in the nucleus. To analyze the initiation site of transcription from the (+)-stranded circles into (-)-stranded replication intermediates, we used a nuclear extract from a non-infected cell culture of the host plant S. tuberosum. The (-)-strands, which were de novo-synthesized in the extract upon addition of circular (+)-PSTVd, were purified bymore » affinity chromatography. This purification avoided contamination by host nucleic acids that had resulted in a misassignment of the start site in an earlier study. Primer-extension analysis of the de novo-synthesized (-)-strands revealed a single start site located in the hairpin loop of the left terminal region in circular PSTVd's secondary structure. This start site is supported further by analysis of the infectivity and replication behavior of site-directed mutants in planta.« less
NASA Astrophysics Data System (ADS)
Lengyel, Iván M.; Morelli, Luis G.
2017-04-01
Cells may control fluctuations in protein levels by means of negative autoregulation, where transcription factors bind DNA sites to repress their own production. Theoretical studies have assumed a single binding site for the repressor, while in most species it is found that multiple binding sites are arranged in clusters. We study a stochastic description of negative autoregulation with multiple binding sites for the repressor. We find that increasing the number of binding sites induces regular bursting of gene products. By tuning the threshold for repression, we show that multiple binding sites can also suppress fluctuations. Our results highlight possible roles for the presence of multiple binding sites of negative autoregulators.
Denning, Eileen; Sharma, Shweta; Smolskis, Mary; Touloumi, Giota; Walker, Sarah; Babiker, Abdel; Clewett, Megan; Emanuel, Ezekiel; Florence, Eric; Papadopoulos, Antonios; Sánchez, Adriana; Tavel, Jorge; Grady, Christine
2014-01-01
Objectives Efforts are needed to improve informed consent of participants in research. The Strategic Timing of AntiRetroviral Therapy (START) study provides a unique opportunity to study the effect of length and complexity of informed consent documents on understanding and satisfaction among geographically diverse participants. Methods Interested START sites were randomised to use either the standard consent form or the concise consent form for all of the site’s participants. Results A total of 4473 HIV-positive participants at 154 sites worldwide took part in the Informed Consent Substudy, with consent given in 11 primary languages. Most sites sent written information to potential participants in advance of clinic visits, usually including the consent form. At about half the sites, staff reported spending less than an hour per participant in the consent process. The vast majority of sites assessed participant understanding using informal nonspecific questions or clinical judgment. Conclusions These data reflect the interest of START research staff in evaluating the consent process and improving informed consent. The START Informed Consent Substudy is by far the largest study of informed consent intervention ever conducted. Its results have the potential to impact how consent forms are written around the world. PMID:25711320
In Situ Training for Increasing Head Start After-Care Teachers' Use of Praise
ERIC Educational Resources Information Center
LaBrot, Zachary C.; Pasqua, Jamie L.; Dufrene, Brad A.; Brewer, Elizabeth Ann; Goff, Brian
2016-01-01
This study tested the effects of the direct behavioral consultation in situ training procedure for increasing Head Start teachers' praise during an after-school program. Participants included four Head Start teachers in one Head Start center. A multiple baseline design across teachers was employed to test the effects of in situ training on…
Impact of chemical plant start-up emissions on ambient ozone concentration
NASA Astrophysics Data System (ADS)
Ge, Sijie; Wang, Sujing; Xu, Qiang; Ho, Thomas
2017-09-01
Flare emissions, especially start-up flare emissions, during chemical plant operations generate large amounts of ozone precursors that may cause highly localized and transient ground-level ozone increment. Such an adverse ozone impact could be aggravated by the synergies of multiple plant start-ups in an industrial zone. In this paper, a systematic study on ozone increment superposition due to chemical plant start-up emissions has been performed. It employs dynamic flaring profiles of two olefin plants' start-ups to investigate the superposition of the regional 1-hr ozone increment. It also summaries the superposition trend by manipulating the starting time (00:00-10:00) of plant start-up operations and the plant distance (4-32 km). The study indicates that the ozone increment induced by simultaneous start-up emissions from multiple chemical plants generally does not follow the linear superposition of the ozone increment induced by individual plant start-ups. Meanwhile, the trend of such nonlinear superposition related to the temporal (starting time and operating hours of plant start-ups) and spatial (plant distance) factors is also disclosed. This paper couples dynamic simulations of chemical plant start-up operations with air-quality modeling and statistical methods to examine the regional ozone impact. It could be helpful for technical decision support for cost-effective air-quality and industrial flare emission controls.
Shaver, Donna J.; Lamont, Margaret M.; Maxwell, Sharon; Walker, Jennifer Shelby; Dillingham, Ted
2016-01-01
A head-started Kemp’s ridley sea turtle (Lepidochelys kempii) was documented nesting on South Walton Beach, Florida on 25 May 2015. This record supports the possibility that exposure to Florida waters after being held in captivity through 1–3 yrs of age during the head-starting process may have influenced future nest site selection of this and perhaps other Kemp’s ridley turtles. Such findings could have important ramifications for marine water experimentation and release site selection for turtles that have been reared in captivity.
Just-in-time control of Spo0A synthesis in Bacillus subtilis by multiple regulatory mechanisms.
Chastanet, Arnaud; Losick, Richard
2011-11-01
The response regulator Spo0A governs multiple developmental processes in Bacillus subtilis, including most conspicuously sporulation. Spo0A is activated by phosphorylation via a multicomponent phosphorelay. Previous work has shown that the Spo0A protein is not rate limiting for sporulation. Rather, Spo0A is present at high levels in growing cells, rapidly rising to yet higher levels under sporulation-inducing conditions, suggesting that synthesis of the response regulator is subject to a just-in-time control mechanism. Transcription of spo0A is governed by a promoter switching mechanism, involving a vegetative, σ(A)-recognized promoter, P(v), and a sporulation σ(H)-recognized promoter, P(s), that is under phosphorylated Spo0A (Spo0A∼P) control. The spo0A regulatory region also contains four (including one identified in the present work) conserved elements that conform to the consensus binding site for Spo0A∼P binding sites. These are herein designated O(1), O(2), O(3), and O(4) in reverse order of their proximity to the coding sequence. Here we report that O(1) is responsible for repressing P(v) during the transition to stationary phase, that O(2) is responsible for repressing P(s) during growth, that O(3) is responsible for activating P(s) at the start of sporulation, and that O(4) is dispensable for promoter switching. We also report that Spo0A synthesis is subject to a posttranscriptional control mechanism such that translation of mRNAs originating from P(v) is impeded due to RNA secondary structure whereas mRNAs originating from P(s) are fully competent for protein synthesis. We propose that the opposing actions of O(2) and O(3) and the enhanced translatability of mRNAs originating from P(s) create a highly sensitive, self-reinforcing switch that is responsible for producing a burst of Spo0A synthesis at the start of sporulation.
Physical signals for protein-DNA recognition
NASA Astrophysics Data System (ADS)
Cao, Xiao-Qin; Zeng, Jia; Yan, Hong
2009-09-01
This paper discovers consensus physical signals around eukaryotic splice sites, transcription start sites, and replication origin start and end sites on a genome-wide scale based on their DNA flexibility profiles calculated by three different flexibility models. These salient physical signals are localized highly rigid and flexible DNAs, which may play important roles in protein-DNA recognition by the sliding search mechanism. The found physical signals lead us to a detailed hypothetical view of the search process in which a DNA-binding protein first finds a genomic region close to the target site from an arbitrary starting location by three-dimensional (3D) hopping and intersegment transfer mechanisms for long distances, and subsequently uses the one-dimensional (1D) sliding mechanism facilitated by the localized highly rigid DNAs to accurately locate the target flexible binding site within 30 bp (base pair) short distances. Guided by these physical signals, DNA-binding proteins rapidly search the entire genome to recognize a specific target site from the 3D to 1D pathway. Our findings also show that current promoter prediction programs (PPPs) based on DNA physical properties may suffer from lots of false positives because other functional sites such as splice sites and replication origins have similar physical signals as promoters do.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Andersson, J.
1993-12-31
The Swedish Nuclear Power Inspectorate, SKI, regulatory research program has to prepare for the process of licensing a repository for spent nuclear fuel, by building up the necessary knowledge and review capacity. SKIs main strategy for meeting this demand is to develop an independent performance assessment capability. SKIs first own performance assessment project, Project-90, was completed in 1991 and is now followed by a new project, SITE-94. SITE-94 is based on conclusions reached within Project-90. An independent review of Project-90, carried out by a NEA team of experts, has also contributed to the formation of the project. Another important reasonmore » for the project is that the implementing organization in Sweden, SKB, has proposed to submit an application to start detailed investigation of a repository candidate site around 1997. SITE-94 is a performance assessment of a hypothetical repository at a real site. The main objective of the project is to determine how site specific data should be assimilated into the performance assessment process, and to evaluate how uncertainties inherent in site characterization will influence performance assessment results. This will be addressed by exploring multiple interpretations, conceptual models, and parameters consistent with the site data. The site evaluation will strive for consistency between geological, hydrological, rock mechanical, and geochemical descriptions. Other important elements of SITE-94 are the development of a practical and defensible methodology for defining, constructing and analyzing scenarios, the development of approaches for treatment of uncertainties, evaluation of canister integrity, and the development and application of an appropriate quality assurance plan for performance assessments.« less
Komatsu, Ken; Hirata, Hisae; Fukagawa, Takako; Yamaji, Yasuyuki; Okano, Yukari; Ishikawa, Kazuya; Adachi, Tatsushi; Maejima, Kensaku; Hashimoto, Masayoshi; Namba, Shigetou
2012-07-01
The first open-reading frame (ORF) of apple stem grooving virus (ASGV), of the genus Capillovirus, encodes an apparently chimeric polyprotein containing conserved regions for replicase (Rep) and coat protein (CP). However, our previous study revealed that ASGV mutants with distinct and discontinuous Rep- and CP-coding regions successfully infect plants, indicating that CP expressed via a subgenomic RNA (sgRNA) is sufficient for viability of the virus. Here we identified a transcription start site of the CP sgRNA and revealed that CP translated from the sgRNA is essential for ASGV infection. We mapped the transcription start sites of both the CP and the movement protein (MP) sgRNAs of ASGV and found a hexanucleotide motif, UUAGGU, conserved upstream from both sgRNA transcription start sites. Mutational analysis of the putative CP initiation codon and of the UUAGGU sequence upstream from the transcription start site of CP sgRNA demonstrated their importance for ASGV accumulation. Our results also demonstrated that potato virus T (PVT), an unassigned species closely related to ASGV, produces two sgRNAs putatively deployed for the CP and MP expression and that the same hexanucleotide motif as found in ASGV is located upstream from the transcription start sites of both sgRNAs. This motif, which constituted putative core elements of the sgRNA promoter, is broadly conserved among viruses in the families Alphaflexiviridae and Betaflexiviridae, suggesting that the gene expression strategy of the viruses in both families has been conserved throughout evolution. Copyright © 2012 Elsevier B.V. All rights reserved.
Cross-Barnet, Caitlin; Courtot, Brigette; Hill, Ian; Benatar, Sarah; Cheeks, Morgan; Markell, Jenny
Closely spaced, unintended pregnancies are common among Medicaid beneficiaries and create avoidable risks for women and infants, including preterm birth. The Strong Start for Mothers and Newborns Initiative, a program of the Center for Medicare and Medicaid Innovation, intended to prevent preterm birth through psychosocially based enhanced prenatal care in maternity care homes, group prenatal care, and birth centers. Comprehensive care offers the opportunity for education and family planning to promote healthy pregnancy spacing. As of March 30, 2016, there were 42,138 women enrolled in Strong Start and 23,377 women had given birth. Individual-level data were collected through three participant survey instruments and a medical chart review, and approximately one-half of women who had delivered (n = 10,374) had nonmissing responses on a postpartum survey that asked about postpartum family planning. Qualitative case studies were conducted annually for the first 3 years of the program and included 629 interviews with staff and 122 focus groups with 887 Strong Start participants. Most programs tried to promote healthy pregnancy spacing through family planning education and provision with some success. Group care sites in particular established protocols for patient-centered family planning education and decision making. Despite program efforts, however, barriers to uptake remained. These included state and institutional policies, provider knowledge and bias, lack of protocols for timing and content of education, and participant issues such as transportation or cultural preferences. The Strong Start initiative introduced a number of successful strategies for increasing women's knowledge regarding healthy pregnancy spacing and access to family planning. Multiple barriers can impact postpartum Medicaid participants' capacity to plan and space pregnancies, and addressing such issues holistically is an important strategy for facilitating healthy interpregnancy intervals. Published by Elsevier Inc.
Washington State Even Start 1993-1994: Final Evaluation. A Report to the Office of Adult Literacy.
ERIC Educational Resources Information Center
Iglitzin, Lynne; Wandschneider, Mary
All 18 Washington State Even Start sites participated in the program's evaluation. Site coordinators administered the assessment and evaluation measures to the adults served by the program and to teachers working with children at both entry and exit from the program. An indepth study was conducted of 134 families for whom there were complete sets…
Multiscale Processes in Magnetic Reconnection
NASA Astrophysics Data System (ADS)
Surjalal Sharma, A.; Jain, Neeraj
The characteristic scales of the plasma processes in magnetic reconnection range from the elec-tron skin-depth to the magnetohydrodynamic (MHD) scale, and cross-scale coupling among them play a key role. Modeling these processes requires different physical models, viz. kinetic, electron-magnetohydrodynamics (EMHD), Hall-MHD, and MHD. The shortest scale processes are at the electron scale and these are modeled using an EMHD code, which provides many features of the multiscale behavior. In simulations using initial conditions consisting of pertur-bations with many scale sizes the reconnection takes place at many sites and the plasma flows from these interact with each other. This leads to thin current sheets with length less than 10 electron skin depths. The plasma flows also generate current sheets with multiple peaks, as observed by Cluster. The quadrupole structure of the magnetic field during reconnection starts on the electron scale and the interaction of inflow to the secondary sites and outflow from the dominant site generates a nested structure. In the outflow regions, the interaction of the electron outflows generated at the neighboring sites lead to the development of electron vortices. A signature of the nested structure of the Hall field is seen in Cluster observations, and more details of these features are expected from MMS.
Takaoka, N; Fukuzawa, M; Saito, T; Sakaitani, T; Ochiai, H
1999-10-28
We cloned a genomic fragment of the membrane protein gp64 gene of the cellular slime mold Polysphondylium pallidum by inverse PCR. Primer extension analysis identified a major transcription start site 65 bp upstream of the translation start codon. The promoter region of the gp64 gene contains sequences homologous to a TATA box at position -47 to -37 and to an initiator (Inr, PyPyCAPyPyPyPy) at position -3 to +5 from the transcription start site. Successively truncated segments of the promoter were tested for their ability to drive expression of the beta-galactosidase reporter gene in transformed cells; also the difference in activity between growth conditions was compared. The results indicated that there are two positive vegetative regulatory elements extending between -187 and -62 bp from the transcription start site of the gp64 promoter; also their activity was two to three times higher in the cells grown with bacteria in shaken suspension than in the cells grown in an axenic medium.
Lim, Kwang-il; Klimczak, Ryan; Yu, Julie H.; Schaffer, David V.
2010-01-01
Retroviral vectors offer benefits of efficient delivery and stable gene expression; however, their clinical use raises the concerns of insertional mutagenesis and potential oncogenesis due to genomic integration preferences in transcriptional start sites (TSS). We have shifted the integration preferences of retroviral vectors by generating a library of viral variants with a DNA-binding domain inserted at random positions throughout murine leukemia virus Gag-Pol, then selecting for variants that are viable and exhibit altered integration properties. We found seven permissive zinc finger domain (ZFD) insertion sites throughout Gag-Pol, including within p12, reverse transcriptase, and integrase. Comprehensive genome integration analysis showed that several ZFD insertions yielded retroviral vector variants with shifted integration patterns that did not favor TSS. Furthermore, integration site analysis revealed selective integration for numerous mutants. For example, two retroviral variants with a given ZFD at appropriate positions in Gag-Pol strikingly integrated primarily into four common sites out of 3.1 × 109 possible human genome locations (P = 4.6 × 10-29). Our findings demonstrate that insertion of DNA-binding motifs into multiple locations in Gag-Pol can make considerable progress toward engineering safer retroviral vectors that integrate into a significantly narrowed pool of sites on human genome and overcome the preference for TSS. PMID:20616052
Optimization of a Time-Lapse Gravity Network for Carbon Sequestration
NASA Astrophysics Data System (ADS)
Appriou, D.; Strickland, C. E.; Ruprecht Yonkofski, C. M.
2017-12-01
The objective of this study is to evaluate what could be a comprehensive and optimal state of the art gravity monitoring network that would meet the UIC class VI regulation and insure that 90% of the CO2 injected remain underground. Time-lapse gravity surveys have a long history of effective applications of monitoring temporal density changes in the subsurface. For decades, gravity measurements have been used for a wide range of applications. The interest of time-lapse gravity surveys for monitoring carbon sequestration sites started recently. The success of their deployment in such sites depends upon a combination of favorable conditions, such as the reservoir geometry, depth, thickness, density change over time induced by the CO2 injection and the location of the instrument. In most cases, the density changes induced by the CO2 plume in the subsurface are not detectable from the surface but the use of borehole gravimeters can provide excellent results. In the framework of the National Assessment and Risk Partnership (NRAP) funded by the Department of Energy, the evaluation of the effectiveness of the gravity monitoring of a CO2 storage site has been assessed using multiple synthetic scenarios implemented on a community model developed for the Kimberlina site (e.g., fault leakage scenarios, borehole leakage). The Kimberlina carbon sequestration project was a pilot project located in southern San Joaquin Valley, California, aimed to safely inject 250,000 t CO2/yr for four years. Although the project was cancelled in 2012, the site characterization efforts resulted in the development of a geologic model. In this study, we present the results of the time-lapse gravity monitoring applied on different multiphase flow and reactive transport models developed by Lawrence Berkeley National Laboratory (i.e., no leakage, permeable fault zone, wellbore leakage). Our monitoring approach considers an ideal network, consisting of multiple vertical and horizontal instrumented boreholes that could be used to track the CO2 plume and potential leaks. A preliminary cost estimate will also be provided.
Berlin, Lisa J; Whiteside-Mansell, Leanne; Roggman, Lori A; Green, Beth L; Robinson, JoAnn; Spieker, Susan
2011-01-01
This study examined maternal depression, attachment avoidance, and attachment anxiety as moderators of Early Head Start's effects on four parenting outcomes assessed at age three. Participants (N = 947) were drawn from six sites of the Early Head Start National Research and Evaluation Project, a multi-site randomized trial. Findings suggest more positive program effects for mothers with less initial attachment avoidance or attachment anxiety. First, baseline attachment avoidance moderated Early Head Start program effects on observed maternal supportiveness, such that program mothers with lower baseline attachment avoidance were rated as more supportive of their three-year-olds than program mothers with higher baseline attachment avoidance. Second, program effects on spanking varied depending on mothers' baseline attachment anxiety.
NASA Astrophysics Data System (ADS)
Tanuma, S.; Shibata, K.
2005-07-01
Space solar missions such as Yohkoh and RHESSI observe the hard X- and gamma-ray emission from energetic electrons in impulsive solar flares. Their energization mechanism, however, is unknown. In this Letter, we suggest that the internal shocks are created in the reconnection jet and that they are possible sites of particle acceleration. We examine how magnetic reconnection creates the multiple shocks by performing two-dimensional resistive magnetohydrodynamic simulations. In this Letter, we use a very small grid to resolve the diffusion region. As a result, we find that the current sheet becomes thin due to the tearing instability, and it collapses to a Sweet-Parker sheet. The thin sheet becomes unstable to the secondary tearing instability. Fast reconnection starts by the onset of anomalous resistivity immediately after the secondary tearing instability. During the bursty, time-dependent magnetic reconnection, the secondary tearing instability continues in the diffusion region where the anomalous resistivity is enhanced. As a result, many weak shocks are created in the reconnection jet. This situation produces turbulent reconnection. We suggest that multiple fast shocks are created in the jet and that the energetic electrons can be accelerated by these shocks.
Gosdin, Craig; Simmons, Jeffrey; Yau, Connie; Sucharew, Heidi; Carlson, Douglas; Paciorkowski, Natalia
2013-06-01
Many pediatric academic centers have hospital medicine programs. Anecdotal data suggest that variability exists in program structure. To provide a description of the organizational, administrative, and financial structures of academic pediatric hospital medicine (PHM). This online survey focused on the organizational, administrative, and financial aspects of academic PHM programs, which were defined as hospitalist programs at US institutions associated with accredited pediatric residency program (n = 246) and identified using the Accreditation Council for Graduate Medical Education (ACGME) Fellowship and Residency Electronic Interactive Database. PHM directors and/or residency directors were targeted by both mail and the American Academy of Pediatrics Section on Hospital Medicine LISTSERV. The overall response rate was 48.8% (120/246). 81.7% (98/120) of hospitals reported having an academic PHM program, and 9.1% (2/22) of hospitals without a program reported plans to start a program in the next 3 years. Over a quarter of programs provide coverage at multiple sites. Variability was identified in many program factors, including hospitalist workload and in-house coverage provided. Respondents reported planning increased in-house hospitalist coverage coinciding with the 2011 ACGME work-hour restrictions. Few programs reported having revenues greater than expenses (26% single site, 4% multiple site). PHM programs exist in the majority of academic centers, and there appears to be variability in many program factors. This study provides the most comprehensive data on academic PHM programs and can be used for benchmarking as well as program development. Copyright © 2013 Society of Hospital Medicine.
Space fireworks for upper atmospheric wind measurements by sounding rocket experiments
NASA Astrophysics Data System (ADS)
Yamamoto, M.
2016-01-01
Artificial meteor trains generated by chemical releases by using sounding rockets flown in upper atmosphere were successfully observed by multiple sites on ground and from an aircraft. We have started the rocket experiment campaign since 2007 and call it "Space fireworks" as it illuminates resonance scattering light from the released gas under sunlit/moonlit condition. By using this method, we have acquired a new technique to derive upper atmospheric wind profiles in twilight condition as well as in moonlit night and even in daytime. Magnificent artificial meteor train images with the surrounding physics and dynamics in the upper atmosphere where the meteors usually appear will be introduced by using fruitful results by the "Space firework" sounding rocket experiments in this decade.
Science plus management equals successful remediation -- A case study
DOE Office of Scientific and Technical Information (OSTI.GOV)
Buehlman, M.D.; Rogers, D.T.; Payne, F.C.
In the past, owners of contaminated sites attempted to remediate as quickly as possible, usually by excavating contaminated soil or pumping and treating contaminated groundwater. Often, they started remediation before identifying all potential types and sources of contaminants, and before conducting a thorough hydrogeologic study. Such premature action usually resulted in the selected remedy not working, the contamination spreading, or unnecessary remedial activities. Today, successful site remediation is recognized as a complex and time-consuming undertaking--requiring a combination of careful scientific study, effective negotiation with the regulatory agencies and skillful management of multidisciplinary efforts. A case study involving a Brownfields sitemore » in southeastern Michigan clearly illustrates the elements of successful remediation. The site`s soil was contaminated with polychlorinated biphenyls (PCBs) and its groundwater with a variety of chlorinated solvents. The original estimate for remediation had exceeded $30 million. Several phases of investigation were conducted to evaluate the nature and sources of contaminants, the site`s hydrogeology, potential risks to human health and the environment, and feasible remedial technologies. Multiple cleanup criteria were established for different affected areas based on the results of the investigations, changes that were taking place with the state cleanup regulations and standards and subsequent negotiations with state and federal regulators. Innovative remedial technologies were selected. The result was a remediation that met or exceeded all soil and groundwater cleanup objectives, was performed on schedule, and was highly cost-effective. The final cost was limited to $3 million--one-tenth of the original estimate.« less
ERIC Educational Resources Information Center
Hanson, Lori, Comp.; Deere, David, Comp.; Lee, Carol Amundson, Comp.; Lewin, Amy, Comp.; Seval, Carolyn, Comp.
This paper describes the Starting Early Starting Smart (SESS) project, an early intervention program that has been developed in the context of the national, multi-site program and evaluation. The emphasis in SESS is on the integration of behavioral health services into easily accessible, non-threatening settings where caregivers naturally and…
Transcription Start Site Evolution in Drosophila
Main, Bradley J.; Smith, Andrew D.; Jang, Hyosik; Nuzhdin, Sergey V.
2013-01-01
Transcription start site (TSS) evolution remains largely undescribed in Drosophila, likely due to limited annotations in non-melanogaster species. In this study, we introduce a concise new method that selectively sequences from the 5′-end of mRNA and used it to identify TSS in four Drosophila species, including Drosophila melanogaster, D. simulans, D. sechellia, and D. pseudoobscura. For verification, we compared our results in D. melanogaster with known annotations, published 5′-rapid amplification of cDNA ends data, and with RNAseq from the same mRNA pool. Then, we paired 2,849 D. melanogaster TSS with its closest equivalent TSS in each species (likely to be its true ortholog) using the available multiple sequence alignments. Most of the D. melanogaster TSSs were successfully paired with an ortholog in each species (83%, 86%, and 55% for D. simulans, D. sechellia, and D. pseudoobscura, respectively). On the basis of the number and distribution of reads mapped at each TSS, we also estimated promoter-specific expression (PSE) and TSS peak shape, respectively. Among paired TSS orthologs, the location and promoter activity were largely conserved. TSS location appears important as PSE, and TSS peak shape was more frequently divergent among TSS that had moved. Unpaired TSS were surprisingly common in D. pseudoobscura. An increased mutation rate upstream of TSS might explain this pattern. We found an enrichment of ribosomal protein genes among diverged TSS, suggesting that TSS evolution is not uniform across the genome. PMID:23649539
Signatures of Extended Storage of Used Nuclear Fuel in Casks
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rauch, Eric Benton
2016-09-28
As the amount of used nuclear fuel continues to grow, more and more used nuclear fuel will be transferred to storage casks. A consolidated storage facility is currently in the planning stages for storing these casks, where at least 10,000 MTHM of fuel will be stored. This site will have potentially thousands of casks once it is operational. A facility this large presents new safeguards and nuclear material accounting concerns. A new signature based on the distribution of neutron sources and multiplication within casks was part of the Department of Energy Office of Nuclear Energy’s Material Protection, Account and Controlmore » Technologies (MPACT) campaign. Under this project we looked at fingerprinting each cask's neutron signature. Each cask has a unique set of fuel, with a unique spread of initial enrichment, burnup, cooling time, and power history. The unique set of fuel creates a unique signature of neutron intensity based on the arrangement of the assemblies. The unique arrangement of neutron sources and multiplication produces a reliable and unique identification of the cask that has been shown to be relatively constant over long time periods. The work presented here could be used to restore from a loss of continuity of knowledge at the storage site. This presentation will show the steps used to simulate and form this signature from the start of the effort through its conclusion in September 2016.« less
Head Start Impact Study. Final Report
ERIC Educational Resources Information Center
Puma, Michael; Bell, Stephen; Cook, Ronna; Heid, Camilla; Shapiro, Gary; Broene, Pam; Jenkins, Frank; Fletcher, Philip; Quinn, Liz; Friedman, Janet; Ciarico, Janet; Rohacek, Monica; Adams, Gina; Spier, Elizabeth
2010-01-01
This report addresses the following four questions by reporting on the impacts of Head Start on children and families during the children's preschool, kindergarten, and 1st grade years: (1) What difference does Head Start make to key outcomes of development and learning (and in particular, the multiple domains of school readiness) for low-income…
Rogal, Shari S; Yakovchenko, Vera; Waltz, Thomas J; Powell, Byron J; Kirchner, JoAnn E; Proctor, Enola K; Gonzalez, Rachel; Park, Angela; Ross, David; Morgan, Timothy R; Chartier, Maggie; Chinman, Matthew J
2017-05-11
Hepatitis C virus (HCV) is a common and highly morbid illness. New medications that have much higher cure rates have become the new evidence-based practice in the field. Understanding the implementation of these new medications nationally provides an opportunity to advance the understanding of the role of implementation strategies in clinical outcomes on a large scale. The Expert Recommendations for Implementing Change (ERIC) study defined discrete implementation strategies and clustered these strategies into groups. The present evaluation assessed the use of these strategies and clusters in the context of HCV treatment across the US Department of Veterans Affairs (VA), Veterans Health Administration, the largest provider of HCV care nationally. A 73-item survey was developed and sent to all VA sites treating HCV via electronic survey, to assess whether or not a site used each ERIC-defined implementation strategy related to employing the new HCV medication in 2014. VA national data regarding the number of Veterans starting on the new HCV medications at each site were collected. The associations between treatment starts and number and type of implementation strategies were assessed. A total of 80 (62%) sites responded. Respondents endorsed an average of 25 ± 14 strategies. The number of treatment starts was positively correlated with the total number of strategies endorsed (r = 0.43, p < 0.001). Quartile of treatment starts was significantly associated with the number of strategies endorsed (p < 0.01), with the top quartile endorsing a median of 33 strategies, compared to 15 strategies in the lowest quartile. There were significant differences in the types of strategies endorsed by sites in the highest and lowest quartiles of treatment starts. Four of the 10 top strategies for sites in the top quartile had significant correlations with treatment starts compared to only 1 of the 10 top strategies in the bottom quartile sites. Overall, only 3 of the top 15 most frequently used strategies were associated with treatment. These results suggest that sites that used a greater number of implementation strategies were able to deliver more evidence-based treatment in HCV. The current assessment also demonstrates the feasibility of electronic self-reporting to evaluate ERIC strategies on a large scale. These results provide initial evidence for the clinical relevance of the ERIC strategies in a real-world implementation setting on a large scale. This is an initial step in identifying which strategies are associated with the uptake of evidence-based practices in nationwide healthcare systems.
Code of Federal Regulations, 2012 CFR
2012-10-01
... 43 Public Lands: Interior 2 2012-10-01 2012-10-01 false What do I need to start preparing a site and building and testing a utilization facility on Federal land leased for geothermal resources? 3271.10 Section 3271.10 Public Lands: Interior Regulations Relating to Public Lands (Continued) BUREAU OF LAND MANAGEMENT, DEPARTMENT OF THE INTERIOR...
Code of Federal Regulations, 2014 CFR
2014-10-01
... 43 Public Lands: Interior 2 2014-10-01 2014-10-01 false What do I need to start preparing a site and building and testing a utilization facility on Federal land leased for geothermal resources? 3271.10 Section 3271.10 Public Lands: Interior Regulations Relating to Public Lands (Continued) BUREAU OF LAND MANAGEMENT, DEPARTMENT OF THE INTERIOR...
Code of Federal Regulations, 2013 CFR
2013-10-01
... 43 Public Lands: Interior 2 2013-10-01 2013-10-01 false What do I need to start preparing a site and building and testing a utilization facility on Federal land leased for geothermal resources? 3271.10 Section 3271.10 Public Lands: Interior Regulations Relating to Public Lands (Continued) BUREAU OF LAND MANAGEMENT, DEPARTMENT OF THE INTERIOR...
Code of Federal Regulations, 2011 CFR
2011-10-01
... 43 Public Lands: Interior 2 2011-10-01 2011-10-01 false What do I need to start preparing a site and building and testing a utilization facility on Federal land leased for geothermal resources? 3271.10 Section 3271.10 Public Lands: Interior Regulations Relating to Public Lands (Continued) BUREAU OF LAND MANAGEMENT, DEPARTMENT OF THE INTERIOR...
NASA Astrophysics Data System (ADS)
Santamaría-Artigas, A. E.; Franch, B.; Vermote, E.; Roger, J. C.; Justice, C. O.
2017-12-01
The 30+ years daily surface reflectance long term data record (LTDR) from the Advanced Very High Resolution Radiometer (AVHRR) is a valuable source of information for long-term studies of the Earth surface. This LTDR was generated by combining observations from multiple AVHRR sensors aboard different NOAA satellites starting from the early 1980s, and due to the lack of on-board calibration its quality should be evaluated. Previous studies have used observations from the Moderate Resolution Imaging Spectroradiometer (MODIS) over pseudo-invariant calibration sites (PICS) as a calibrated reference to assess the performance of AVHRR products. However, this limits the evaluation to the period after MODIS launch. In this work, the AVHRR surface reflectance LTDR was evaluated against Landsat-5 Thematic Mapper (TM) data using observations from 4 well known pseudo-invariant calibration sites (i.e. Sonoran, Saharan, Sudan1, and Libya4) over an extended time period (1984-2011). For the intercomparison, AVHRR and TM observations of each site were extracted and averaged over a 20 km x 20 km area and aggregated to monthly mean values. In order to account for the spectral differences between sensors, Hyperion hyperspectral data from the Sonoran and Libya4 sites were convolved with sensor-specific relative spectral responses, and used to compute spectral band adjustment factors (SBAFs). Results of the intercomparison are reported in terms of the root mean square difference (RMSD) and determination coefficient (r2). In general, there is good agreement between the surface reflectance products from both sensors. The overall RMSD and r2 for all the sites and AVHRR/TM combinations were 0.03 and 0.85 for the red band, and 0.04 and 0.81 for the near-infrared band. These results show the strong performance of the AVHRR surface reflectance LTDR through all of the considered period. Thus, remarking its usefulness and value for long term Earth studies. Figure 1 shows the red (filled markers) and near-infrared (empty markers) surface reflectance from AVHRR and TM for the complete evaluation period over the Saharan (diamond), Libya4 (square), Sudan1 (triangle), and Sonoran (circle) PICS.
Studtmann, Katrin; Ölschläger-Schütt, Janin; Buck, Friedrich; Richter, Dietmar; Sala, Carlo; Bockmann, Jürgen; Kindler, Stefan; Kreienkamp, Hans-Jürgen
2014-01-01
Local protein synthesis in dendrites enables neurons to selectively change the protein complement of individual postsynaptic sites. Though it is generally assumed that this mechanism requires tight translational control of dendritically transported mRNAs, it is unclear how translation of dendritic mRNAs is regulated. We have analyzed here translational control elements of the dendritically localized mRNA coding for the postsynaptic scaffold protein Shank1. In its 5′ region, the human Shank1 mRNA exhibits two alternative translation initiation sites (AUG+1 and AUG+214), three canonical upstream open reading frames (uORFs1-3) and a high GC content. In reporter assays, fragments of the 5′UTR with high GC content inhibit translation, suggesting a contribution of secondary structures. uORF3 is most relevant to translation control as it overlaps with the first in frame start codon (AUG+1), directing translation initiation to the second in frame start codon (AUG+214). Surprisingly, our analysis points to an additional uORF initiated at a non-canonical ACG start codon. Mutation of this start site leads to an almost complete loss of translation initiation at AUG+1, demonstrating that this unconventional uORF is required for Shank1 synthesis. Our data identify a novel mechanism whereby initiation at a non-canonical site allows for translation of the main Shank1 ORF despite a highly structured 5′UTR. PMID:24533096
Federal Register 2010, 2011, 2012, 2013, 2014
2011-02-09
... Interior's (DOI) ``Smart from the Start'' wind energy initiative, to identify areas for wind energy leasing... November 23, 2010, Secretary of the Interior Ken Salazar announced the ``Smart from the Start'' renewable... the ``Smart from the Start'' initiative can be found at http://www.boemre.gov/offshore/RenewableEnergy...
Hydrodynamic Limit of Multiple SLE
NASA Astrophysics Data System (ADS)
Hotta, Ikkei; Katori, Makoto
2018-04-01
Recently del Monaco and Schleißinger addressed an interesting problem whether one can take the limit of multiple Schramm-Loewner evolution (SLE) as the number of slits N goes to infinity. When the N slits grow from points on the real line R in a simultaneous way and go to infinity within the upper half plane H, an ordinary differential equation describing time evolution of the conformal map g_t(z) was derived in the N → ∞ limit, which is coupled with a complex Burgers equation in the inviscid limit. It is well known that the complex Burgers equation governs the hydrodynamic limit of the Dyson model defined on R studied in random matrix theory, and when all particles start from the origin, the solution of this Burgers equation is given by the Stieltjes transformation of the measure which follows a time-dependent version of Wigner's semicircle law. In the present paper, first we study the hydrodynamic limit of the multiple SLE in the case that all slits start from the origin. We show that the time-dependent version of Wigner's semicircle law determines the time evolution of the SLE hull, K_t \\subset H\\cup R, in this hydrodynamic limit. Next we consider the situation such that a half number of the slits start from a>0 and another half of slits start from -a < 0, and determine the multiple SLE in the hydrodynamic limit. After reporting these exact solutions, we will discuss the universal long-term behavior of the multiple SLE and its hull K_t in the hydrodynamic limit.
Under What Assumptions Do Site-by-Treatment Instruments Identify Average Causal Effects?
ERIC Educational Resources Information Center
Reardon, Sean F.; Raudenbush, Stephen W.
2011-01-01
The purpose of this paper is to clarify the assumptions that must be met if this--multiple site, multiple mediator--strategy, hereafter referred to as "MSMM," is to identify the average causal effects (ATE) in the populations of interest. The authors' investigation of the assumptions of the multiple-mediator, multiple-site IV model demonstrates…
The Cherenkov Telescope Array production system for Monte Carlo simulations and analysis
NASA Astrophysics Data System (ADS)
Arrabito, L.; Bernloehr, K.; Bregeon, J.; Cumani, P.; Hassan, T.; Haupt, A.; Maier, G.; Moralejo, A.; Neyroud, N.; pre="for the"> CTA Consortium, 2017-10-01 The Cherenkov Telescope Array (CTA), an array of many tens of Imaging Atmospheric Cherenkov Telescopes deployed on an unprecedented scale, is the next-generation instrument in the field of very high energy gamma-ray astronomy. An average data stream of about 0.9 GB/s for about 1300 hours of observation per year is expected, therefore resulting in 4 PB of raw data per year and a total of 27 PB/year, including archive and data processing. The start of CTA operation is foreseen in 2018 and it will last about 30 years. The installation of the first telescopes in the two selected locations (Paranal, Chile and La Palma, Spain) will start in 2017. In order to select the best site candidate to host CTA telescopes (in the Northern and in the Southern hemispheres), massive Monte Carlo simulations have been performed since 2012. Once the two sites have been selected, we have started new Monte Carlo simulations to determine the optimal array layout with respect to the obtained sensitivity. Taking into account that CTA may be finally composed of 7 different telescope types coming in 3 different sizes, many different combinations of telescope position and multiplicity as a function of the telescope type have been proposed. This last Monte Carlo campaign represented a huge computational effort, since several hundreds of telescope positions have been simulated, while for future instrument response function simulations, only the operating telescopes will be considered. In particular, during the last 18 months, about 2 PB of Monte Carlo data have been produced and processed with different analysis chains, with a corresponding overall CPU consumption of about 125 M HS06 hours. In these proceedings, we describe the employed computing model, based on the use of grid resources, as well as the production system setup, which relies on the DIRAC interware. Finally, we present the envisaged evolutions of the CTA production system for the off-line data processing during CTA operations and the instrument response function simulations.
Measuring Physical Activity Intensity
MedlinePlus Videos and Cool Tools
... Skip directly to site content Start of Search Controls Search Form Controls Cancel Submit Search the CDC CDC A-Z ... V W X Y Z # Start of Search Controls Search Form Controls Search The CDC Cancel Submit ...
Cuffney, T.F.; Meador, M.R.; Porter, S.D.; Gurtz, M.E.
2000-01-01
The condition of 25 stream sites in the Yakima River Basin, Washington, were assessed by the U.S. Geological Survey's National Water-Quality Assessment Program. Multimetric condition indices were developed and used to rank sites on the basis of physical, chemical, and biological characteristics. These indices showed that sites in the Cascades and Eastern Cascades ecoregions were largely unimpaired. In contrast, all but two sites in the Columbia Basin ecoregion were impaired, some severely. Agriculture (nutrients and pesticides) was the primary factor associated with impairment and all impaired sites were characterized by multiple indicators of impairment. All indices of biological condition (fish, invertebrates, and algae) declined as agricultural intensity increased. The response exhibited by invertebrates and algae suggested a threshold response with conditions declining precipitously at relatively low levels of agricultural intensity and little response at moderate to high levels of agricultural intensity. This pattern of response suggests that the success of mitigation will vary depending upon where on the response curve the mitigation is undertaken. Because the form of the community condition response is critical to effective water-quality management, the National Water-Quality Assessment Program is conducting studies to examine the response of biota to gradients of land-use intensity and the relevance of these responses to water-quality management. These land-use gradient pilot studies will be conducted in several urban areas starting in 1999.
NASA Astrophysics Data System (ADS)
Reiß, Edda; Hölzel, Ralph; von Nickisch-Rosenegk, Markus; Bier, Frank F.
2006-09-01
In this article the usefulness of the enzyme phi29 DNA polymerase and the principle of rolling circle amplification (RCA) for creating single-stranded DNA (ssDNA) nanostructures is described. Currently we are working on the spatial orientation of a growing ssDNA molecule during its RCA-based synthesis by the application of a hydrodynamic force. Starting at an immobilized primer at single molecule level, the aim is to construct a nanostructure of known location and orientation, providing multiple repeating binding sites that can be addressed via complementary base-pairing. Proof-of-principle experiments demonstrate the potential of the enzymatic reaction. ssDNA molecules of more than 20 μm length were created at an immobilized primer and detected by means of fluorescence microscopy.
[Descending paralysis caused by wound botulism. A case report].
Hiersemenzel, L P; Jermann, M; Waespe, W
2000-02-01
We report on the history and clinical findings of an injecting drug abuser in the Canton of Zurich who presented with multiple deep abscesses in the arms and legs. A diagnosis of wound botulism was made based on his clinical presentation with a rapidly progressing descending paralysis starting at the cranial nerves, a neuromuscular junction disorder on neurophysiologic testing, and normal findings on lumbar puncture. Several cases of wound botulism have occurred in i.v. drug abuse in Switzerland since 1997. We suspect subcutaneous injections of contaminated heroin containing Clostridium spores as sites of entry. Wound botulism caused by Clostridium botulinum is a rare cause of rapidly progressing, generalized, flaccid paralysis and should be considered in patients with a history of i.v. drug abuse presenting with descending paralysis.
Multiple mobile promoter regions for the rare carbapenem resistance gene of Bacteroides fragilis.
Podglajen, I; Breuil, J; Rohaut, A; Monsempes, C; Collatz, E
2001-06-01
Two novel insertion sequences (IS), IS1187 and IS1188, are described upstream from the carbapenem resistance gene cfiA in strains of Bacteroides fragilis. Mapping, with the RACE procedure, of transcription start sites of cfiA in these and two other previously reported IS showed that transcription of this rarely encountered gene is initiated close to a variety of B. fragilis consensus promoter sequences, as recently defined (D. P. Bayley, E. R. Rocha, and C. J. Smith, FEMS Microbiol. Lett. 193:149-154, 2000). In the cases of IS1186 and IS1188, these sequences overlap with putative Esigma(70) promoter sequences, while in IS942 and IS1187 such sequences can be observed either upstream or downstream of the B. fragilis promoters.
The DNA-encoded nucleosome organization of a eukaryotic genome.
Kaplan, Noam; Moore, Irene K; Fondufe-Mittendorf, Yvonne; Gossett, Andrea J; Tillo, Desiree; Field, Yair; LeProust, Emily M; Hughes, Timothy R; Lieb, Jason D; Widom, Jonathan; Segal, Eran
2009-03-19
Nucleosome organization is critical for gene regulation. In living cells this organization is determined by multiple factors, including the action of chromatin remodellers, competition with site-specific DNA-binding proteins, and the DNA sequence preferences of the nucleosomes themselves. However, it has been difficult to estimate the relative importance of each of these mechanisms in vivo, because in vivo nucleosome maps reflect the combined action of all influencing factors. Here we determine the importance of nucleosome DNA sequence preferences experimentally by measuring the genome-wide occupancy of nucleosomes assembled on purified yeast genomic DNA. The resulting map, in which nucleosome occupancy is governed only by the intrinsic sequence preferences of nucleosomes, is similar to in vivo nucleosome maps generated in three different growth conditions. In vitro, nucleosome depletion is evident at many transcription factor binding sites and around gene start and end sites, indicating that nucleosome depletion at these sites in vivo is partly encoded in the genome. We confirm these results with a micrococcal nuclease-independent experiment that measures the relative affinity of nucleosomes for approximately 40,000 double-stranded 150-base-pair oligonucleotides. Using our in vitro data, we devise a computational model of nucleosome sequence preferences that is significantly correlated with in vivo nucleosome occupancy in Caenorhabditis elegans. Our results indicate that the intrinsic DNA sequence preferences of nucleosomes have a central role in determining the organization of nucleosomes in vivo.
Chasing zero: the drive to eliminate surgical site infections.
Thompson, Kristine M; Oldenburg, W Andrew; Deschamps, Claude; Rupp, William C; Smith, C Daniel
2011-09-01
It is estimated that healthcare associated infections (HAI) account for 1.7 million infections and 99,000 associated deaths each year, with annual direct medical costs of up to $45 billion. Surgical Site Infections (SSI) account for 17% of HAIs, an estimated annual cost of $3.5 to 10 billion for our country alone. This project was designed to pursue elimination of SSIs and document results. Starting in 2009 a program to eliminate SSIs was undertaken at a nationally recognized academic health center. Interventions already outlined by CMS and IHI were utilized, along with additional interventions based on literature showing relationships with SSI reduction and best practices. Rapid deployment of multiple interventions (SSI Bundle) was undertaken. Tactics included standardized order sets, a centralized preoperative evaluation (POE) clinic, high compliance with intraoperative interventions, and widespread monthly reporting of compliance and results. Data from 2008 to 2010 were collected and analyzed. Between May 1, 2008 and June 30, 2010, all patients with Class I and Class II wounds were tracked for SSIs. Baseline data (May-June 2008) was obtained showing a Class I surgical site infection rate of 1.78%, Class II of 2.82% (total surgical volume: 4160 cases). As of the second quarter 2010, those rates have dropped to 0.51% and 1.44%, respectively (P < 0.001 and P = 0.013; total surgical cases: 2826). This represents a 57% decrease in the SSI rate with an estimated institution specific cost savings of nearly $1 million during the study period. Committed leadership, aggressive assurance of high compliance with multiple known interventions (SSI Bundle), transparency to achieve high levels of staff engagement, and centralization of critical surgical activities result in significant declines in SSIs with resulting substantial cost savings.
Identification of a starting point of breast skin tears during chicken plucking.
Pitcovski, J; Ohana, N; Amzaleg, L; Krispel, S; Bercovich, D; Pinchasov, Y
1997-02-01
A site (STP) was identified on the skin of the chicken, during defeathering in the slaughter house, at which about 90% of breast skin tears started. This site is on the ventral side of the pectoral tract area. There was no difference in location of this site with respect to different commercial lines, sexes, flocks, or time of the day. In order to demonstrate the importance of a small skin tear to ultimate damage, defeathered chickens with a minor tear at a particular site and undamaged defeathered chickens were passed through the defeathering machine a second time. Thirty-six percent of the STP chickens were torn further, but only a small percentage (about 4%) of the undamaged chickens were harmed.
Code of Federal Regulations, 2010 CFR
2010-01-01
... management plan, and addition of multiple-site components. 921.33 Section 921.33 Commerce and Foreign Trade... management plan, and addition of multiple-site components. (a) Changes in the boundary of a Reserve and major... management plan shall address goals and objectives for all components of the multi-site Reserve and the...
Renovell, Agueda; Gago, Selma; Ruiz-Ruiz, Susana; Velázquez, Karelia; Navarro, Luis; Moreno, Pedro; Vives, Mari Carmen; Guerri, José
2010-10-25
Citrus leaf blotch virus has a single-stranded positive-sense genomic RNA (gRNA) of 8747 nt organized in three open reading frames (ORFs). The ORF1, encoding a polyprotein involved in replication, is translated directly from the gRNA, whereas ORFs encoding the movement (MP) and coat (CP) proteins are expressed via 3' coterminal subgenomic RNAs (sgRNAs). We characterized the minimal promoter region critical for the CP-sgRNA expression in infected cells by deletion analyses using Agrobacterium-mediated infection of Nicotiana benthamiana plants. The minimal CP-sgRNA promoter was mapped between nucleotides -67 and +50 nt around the transcription start site. Surprisingly, larger deletions in the region between the CP-sgRNA transcription start site and the CP translation initiation codon resulted in increased CP-sgRNA accumulation, suggesting that this sequence could modulate the CP-sgRNA transcription. Site-specific mutational analysis of the transcription start site revealed that the +1 guanylate and the +2 adenylate are important for CP-sgRNA synthesis. Copyright © 2010 Elsevier Inc. All rights reserved.
Dement, John M; Ringen, Knut; Welch, Laura S; Bingham, Eula; Quinn, Patricia
2009-09-01
The U.S. Department of Energy (DOE) established medical screening programs at the Hanford Nuclear Reservation, Oak Ridge Reservation, the Savannah River Site, and the Amchitka site starting in 1996. Workers participating in these programs have been followed to determine their vital status and mortality experience through December 31, 2004. A cohort of 8,976 former construction workers from Hanford, Savannah River, Oak Ridge, and Amchitka was followed using the National Death Index through December 31, 2004, to ascertain vital status and causes of death. Cause-specific standardized mortality ratios (SMRs) were calculated based on US death rates. Six hundred and seventy-four deaths occurred in this cohort and overall mortality was slightly less than expected (SMR = 0.93, 95% CI = 0.86-1.01), indicating a "healthy worker effect." However, significantly excess mortality was observed for all cancers (SMR = 1.28, 95% CI = 1.13-1.45), lung cancer (SMR = 1.54, 95% CI = 1.24-1.87), mesothelioma (SMR = 5.93, 95% CI = 2.56-11.68), and asbestosis (SMR = 33.89, 95% CI = 18.03-57.95). Non-Hodgkin's lymphoma was in excess at Oak Ridge and multiple myeloma was in excess at Hanford. Chronic obstructive pulmonary disease (COPD) was significantly elevated among workers at the Savannah River Site (SMR = 1.92, 95% CI = 1.02-3.29). DOE construction workers at these four sites were found to have significantly excess risk for combined cancer sites included in the Department of Labor' Energy Employees Occupational Illness Compensation Program (EEOCIPA). Asbestos-related cancers were significantly elevated. (c) 2009 Wiley-Liss, Inc.
Crammed signaling motifs in the T-cell receptor.
Borroto, Aldo; Abia, David; Alarcón, Balbino
2014-09-01
Although the T cell antigen receptor (TCR) is long known to contain multiple signaling subunits (CD3γ, CD3δ, CD3ɛ and CD3ζ), their role in signal transduction is still not well understood. The presence of at least one immunoreceptor tyrosine-based activation motif (ITAM) in each CD3 subunit has led to the idea that the multiplication of such elements essentially serves to amplify signals. However, the evolutionary conservation of non-ITAM sequences suggests that each CD3 subunit is likely to have specific non-redundant roles at some stage of development or in mature T cell function. The CD3ɛ subunit is paradigmatic because in a relatively short cytoplasmic sequence (∼55 amino acids) it contains several docking sites for proteins involved in intracellular trafficking and signaling, proteins whose relevance in T cell activation is slowly starting to be revealed. In this review we will summarize our current knowledge on the signaling effectors that bind directly to the TCR and we will propose a hierarchy in their response to TCR triggering. Copyright © 2014 Elsevier B.V. All rights reserved.
Mancio-Silva, Liliana; Lopez-Rubio, Jose Juan; Claes, Aurélie; Scherf, Artur
2013-01-01
The Plasmodium falciparum histone deacetylase Sir2a localizes at telomeric regions where it contributes to epigenetic silencing of clonally variant virulence genes. Apart from telomeres, PfSir2a also accumulates in the nucleolus, which harbours the developmentally regulated ribosomal RNA genes. Here we investigate the nucleolar function of PfSir2a and demonstrate that PfSir2a fine-tunes ribosomal RNA gene transcription. Using a parasite line in which PfSir2a has been disrupted, we observe that histones near the transcription start sites of all ribosomal RNA genes are hyperacetylated and that transcription of ribosomal RNA genes is upregulated. Complementation of the PfSir2a-disrupted parasites restores the ribosomal RNA levels, whereas PfSir2a overexpression in wild-type parasites decreases ribosomal RNA synthesis. Furthermore, we observe that PfSir2a modulation of ribosomal RNA synthesis is linked to an altered number of daughter merozoites and the parasite multiplication rate. These findings provide new insights into an epigenetic mechanism that controls malaria parasite proliferation and virulence. PMID:23443558
Home Start Evaluation Study. Interim Report II: Program Analysis. Revised Draft.
ERIC Educational Resources Information Center
Deloria, Dennis; And Others
This document is the second in a series of evaluative reports directed to evaluation needs of Home Start planners and administrators. It focuses on implementation data about programs gathered during local site visits conducted in the spring and fall of 1972. The two basic evaluative questions asked are: (1) What was Home Start intended by its…
Mapping Cancer Cells’ Starting Lines | Center for Cancer Research
Many of the defective regulatory pathways that lead to aberrant proliferation in cancer converge on DNA replication. So replication regulatory pathways could be targeted to more specifically kill cancer cells. Unfortunately such targeting would require knowing where and when DNA replication starts in the cancer genome. In yeast, the locations of replication initiation sites on chromatin have been extensively mapped, but in human cancer cells only a handful of these sites have been identified.
Thomason, Maureen K.; Bischler, Thorsten; Eisenbart, Sara K.; Förstner, Konrad U.; Zhang, Aixia; Herbig, Alexander; Nieselt, Kay
2014-01-01
While the model organism Escherichia coli has been the subject of intense study for decades, the full complement of its RNAs is only now being examined. Here we describe a survey of the E. coli transcriptome carried out using a differential RNA sequencing (dRNA-seq) approach, which can distinguish between primary and processed transcripts, and an automated prediction algorithm for transcriptional start sites (TSS). With the criterion of expression under at least one of three growth conditions examined, we predicted 14,868 TSS candidates, including 5,574 internal to annotated genes (iTSS) and 5,495 TSS corresponding to potential antisense RNAs (asRNAs). We examined expression of 14 candidate asRNAs by Northern analysis using RNA from wild-type E. coli and from strains defective for RNases III and E, two RNases reported to be involved in asRNA processing. Interestingly, nine asRNAs detected as distinct bands by Northern analysis were differentially affected by the rnc and rne mutations. We also compared our asRNA candidates with previously published asRNA annotations from RNA-seq data and discuss the challenges associated with these cross-comparisons. Our global transcriptional start site map represents a valuable resource for identification of transcription start sites, promoters, and novel transcripts in E. coli and is easily accessible, together with the cDNA coverage plots, in an online genome browser. PMID:25266388
Schwingel, Melanie; Bastmeyer, Martin
2013-01-01
Focal contacts act as mechanosensors allowing cells to respond to their biomechanical environment. Force transmission through newly formed contact sites is a highly dynamic process requiring a stable link between the intracellular cytoskeleton and the extracellular environment. To simultaneously investigate cellular traction forces in several individual maturing adhesion sites within the same cell, we established a custom-built multiple trap optical tweezers setup. Beads functionalized with fibronectin or RGD-peptides were placed onto the apical surface of a cell and trapped with a maximum force of 160 pN. Cells form adhesion contacts around the beads as demonstrated by vinculin accumulation and start to apply traction forces after 30 seconds. Force transmission was found to strongly depend on bead size, surface density of integrin ligands and bead location on the cell surface. Highest traction forces were measured for beads positioned on the leading edge. For mouse embryonic fibroblasts, traction forces acting on single beads are in the range of 80 pN after 5 minutes. If two beads were positioned parallel to the leading edge and with a center-to-center distance less than 10 µm, traction forces acting on single beads were reduced by 40%. This indicates a spatial and temporal coordination of force development in closely related adhesion sites. We also used our setup to compare traction forces, retrograde transport velocities, and migration velocities between two cell lines (mouse melanoma and fibroblasts) and primary chick fibroblasts. We find that maximal force development differs considerably between the three cell types with the primary cells being the strongest. In addition, we observe a linear relation between force and retrograde transport velocity: a high retrograde transport velocity is associated with strong cellular traction forces. In contrast, migration velocity is inversely related to traction forces and retrograde transport velocity. PMID:23372781
Learning to leverage existing information systems: Part 1. Principles.
Neil, Nancy; Nerenz, David
2003-10-01
The success of performance improvement efforts depends on effective measurement and feedback regarding clinical processes and outcomes. Yet most health care organizations have fragmented rather than integrated data systems. Methods and practical guidance are provided for leveraging available information sources to obtain and create valid performance improvement-related information for use by clinicians and administrators. At Virginia Mason Health System (VMHS; Seattle), a vertically integrated hospital and multispecialty group practice, patient records are paper based and are supplemented with electronic reporting for laboratory and radiology services. Despite growth in the resources and interest devoted to organization-wide performance measurement, quality improvement, and evidence-based tools, VMHS's information systems consist of largely stand-alone, legacy systems organized around the ability to retrieve information on patients, one at a time. By 2002, without any investment in technology, VMHS had developed standardized, clinic-wide key indicators of performance updated and reported regularly at the patient, provider, site, and organizational levels. On the basis of VHMS's experience, principles can be suggested to guide other organizations to explore solutions using their own information systems: for example, start simply, but start; identify information needs; tap multiple data streams; and improve incrementally.
ZNF750 is a p63 Target Gene that Induces KLF4 to Drive Terminal Epidermal Differentiation
Sen, George L.; Boxer, Lisa D.; Webster, Dan E.; Bussat, Rose T.; Qu, Kun; Zarnegar, Brian J.; Johnston, Danielle; Siprashvili, Zurab; Khavari, Paul A.
2012-01-01
SUMMARY Disrupted epidermal differentiation characterizes numerous diseases that impact >25% of the population. In a search for dominant mediators of differentiation, we defined a requirement for ZNF750 in terminal epidermal differentiation. ZNF750 controlled genes mutated in numerous human skin diseases, including FLG, LOR, LCE3B, ALOXE3, and SPINK5. ZNF750 induced progenitor differentiation via an evolutionarily conserved C2H2 zinc finger motif. The epidermal master regulator, p63, bound the ZNF750 promoter and was necessary for its induction. ZNF750 restored differentiation to p63-deficient tissue, suggesting it acts downstream of p63. A search for functionally important ZNF750 targets via analysis of ZNF750-regulated genes identified KLF4, a transcription factor that activates late epidermal differentiation. ZNF750 binds to KLF4 at multiple sites flanking the transcriptional start site and controls its expression. ZNF750 thus directly links a tissue-specifying factor, p63, to an effector of terminal differentiation, KLF4, and represents a potential future target for disorders of this process. PMID:22364861
Quantifying Libya-4 Surface Reflectance Heterogeneity With WorldView-1, 2 and EO-1 Hyperion
NASA Technical Reports Server (NTRS)
Neigh, Christopher S. R.; McCorkel, Joel; Middleton, Elizabeth M.
2015-01-01
The land surface imaging (LSI) virtual constellation approach promotes the concept of increasing Earth observations from multiple but disparate satellites. We evaluated this through spectral and spatial domains, by comparing surface reflectance from 30-m Hyperion and 2-m resolution WorldView-2 (WV-2) data in the Libya-4 pseudoinvariant calibration site. We convolved and resampled Hyperion to WV-2 bands using both cubic convolution and nearest neighbor (NN) interpolation. Additionally, WV-2 and WV-1 same-date imagery were processed as a cross-track stereo pair to generate a digital terrain model to evaluate the effects from large (>70 m) linear dunes. Agreement was moderate to low on dune peaks between WV-2 and Hyperion (R2 <; 0.4) but higher in areas of lower elevation and slope (R2 > 0.6). Our results provide a satellite sensor intercomparison protocol for an LSI virtual constellation at high spatial resolution, which should start with geolocation of pixels, followed by NN interpolation to avoid tall dunes that enhance surface reflectance differences across this internationally utilized site.
Technical and design update in the AUBE French low-level radioactive waste disposal facility
DOE Office of Scientific and Technical Information (OSTI.GOV)
Marque, Y.
1989-01-01
Long-term industrial management of radioactive waste in France is carried out by the Agence Nationale pour la Gestion des Dechets Radioactifs (ANDRA). ANDRA is in charge of design, siting, construction, and operation of disposal centers. The solution selected in France for the disposal of low- and medium-level, short-lived radioactive waste is near-surface disposal in the earth using the principle of multiple barriers, in accordance with national safety rules and regulations, and based on operating experience from the Centre de Stockage de la Manche. Since the center's start-up in 1969, 400,000 m{sup 3} of waste have been disposed of. The Frenchmore » national program for waste management is proceeding with the construction of a second near-surface disposal, which is expected to be operational in 1991. It is located in the department of AUBE (from which its name derives), 100 miles southeast of Paris. The paper describes the criteria for siting and design of the AUBE disposal facility, design of the AUBE facility disposal module, and comparison with North Carolina and Pennsylvania disposal facility designs.« less
Radioactive waste management treatments: A selection for the Italian scenario
DOE Office of Scientific and Technical Information (OSTI.GOV)
Locatelli, G.; Mancini, M.; Sardini, M.
2012-07-01
The increased attention for radioactive waste management is one of the most peculiar aspects of the nuclear sector considering both reactors and not power sources. The aim of this paper is to present the state-of-art of treatments for radioactive waste management all over the world in order to derive guidelines for the radioactive waste management in the Italian scenario. Starting with an overview on the international situation, it analyses the different sources, amounts, treatments, social and economic impacts looking at countries with different industrial backgrounds, energetic policies, geography and population. It lists all these treatments and selects the most reasonablemore » according to technical, economic and social criteria. In particular, a double scenario is discussed (to be considered in case of few quantities of nuclear waste): the use of regional, centralized, off site processing facilities, which accept waste from many nuclear plants, and the use of mobile systems, which can be transported among multiple nuclear sites for processing campaigns. At the end the treatments suitable for the Italian scenario are presented providing simplified work-flows and guidelines. (authors)« less
Link, Gerhard
1984-01-01
A nuclease-treated plastid extract from mustard (Sinapis alba L.) allows efficient transcription of cloned plastid DNA templates. In this in vitro system, the major runoff transcript of the truncated gene for the 32 000 mol. wt. photosystem II protein was accurately initiated from a site close to or identical with the in vivo start site. By using plasmids with deletions in the 5'-flanking region of this gene as templates, a DNA region required for efficient and selective initiation was detected ˜28-35 nucleotides upstream of the transcription start site. This region contains the sequence element TTGACA, which matches the consensus sequence for prokaryotic `−35' promoter elements. In the absence of this region, a region ˜13-27 nucleotides upstream of the start site still enables a basic level of specific transcription. This second region contains the sequence element TATATAA, which matches the consensus sequence for the `TATA' box of genes transcribed by RNA polymerase II (or B). The region between the `TATA'-like element and the transcription start site is not sufficient but may be required for specific transcription of the plastid gene. This latter region contains the sequence element TATACT, which resembles the prokaryotic `−10' (Pribnow) box. Based on the structural and transcriptional features of the 5' upstream region, a `promoter switch' mechanism is proposed, which may account for the developmentally regulated expression of this plastid gene. ImagesFig. 1.Fig. 2.Fig. 3.Fig. 4.Figure 5. PMID:16453540
Rodent Control: Seal Up! Trap Up! Clean Up!
... Skip directly to site content Start of Search Controls Search Form Controls Cancel Submit Search The CDC CDC A-Z ... V W X Y Z # Start of Search Controls Search Form Controls Cancel Submit Search The CDC ...
Infection Control: The Use and Handling of Toothbrushes
... Skip directly to site content Start of Search Controls Search Form Controls Cancel Submit Search the CDC CDC A-Z ... V W X Y Z # Start of Search Controls Search Form Controls Search The CDC Cancel Submit ...
Coalition Warfare Program Presentation to: 2009 EUCOM/AFRICOM Science and Technology Conference
2009-06-01
compac an nexpens ve m cro- fluxgate magnetometer for use in multiple COCOMs. To continue T&E with joint services and apply lessons learned to...Partners in EUCOM/AFRICOM FY08 Starts • Advanced Dynamic Magnetometer FY09 Starts • ADNS Coalition Network FY10 New Starts • Clip-on Night Vision...Partner 2008 New Starts Advanced Dynamic Magnetometer for Static and Moving Applications T d l t d i i i US Navy (SPAWAR) Italy, Sweden o eve op a a
Plasma Cell Neoplasms (Including Multiple Myeloma)—Patient Version
Plasma cell neoplasms occur when abnormal plasma cells form cancerous tumors. When there is only one tumor, the disease is called a plasmacytoma. When there are multiple tumors, it is called multiple myeloma. Start here to find information on plasma cell neoplasms treatment, research, and statistics.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Inam, A., E-mail: aqil.ceet@pu.edu.pk; Brydson, R., E-mail: mtlrmdb@leeds.ac.uk; Edmonds, D.V., E-mail: d.v.edmonds@leeds.ac.uk
The potential for using graphite particles as an internal lubricant during machining is considered. Graphite particles were found to form during graphitisation of experimental medium-carbon steel alloyed with Si and Al. The graphite nucleation sites were strongly influenced by the starting microstructure, whether ferrite–pearlite, bainite or martensite, as revealed by light and electron microscopy. Favourable nucleation sites in the ferrite–pearlite starting microstructure were, not unexpectedly, found to be located within pearlite colonies, no doubt due to the presence of abundant cementite as a source of carbon. In consequence, the final distribution of graphite nodules in ferrite–pearlite microstructures was less uniformmore » than for the bainite microstructure studied. In the case of martensite, this study found a predominance of nucleation at grain boundaries, again leading to less uniform graphite dispersions. - Highlights: • Metallography of formation of graphite particles in experimental carbon steel. • Potential for using graphite in steel as an internal lubricant during machining. • Microstructure features expected to influence improved machinability studied. • Influence of pre-anneal starting microstructure on graphite nucleation sites. • Influence of pre-anneal starting microstructure on graphite distribution. • Potential benefit is new free-cutting steel compositions without e.g. Pb alloying.« less
Sanchis Calvo, A; Martínez- Frías, M
2001-02-01
To identify the frequency at birth of neural tube defects (NTD) in the Spanish population. NTDs were considered as a whole as well as according to the different sites of closure failure, following the theory of multisite closure of the neural tube. To analyze the epidemiological characteristics of the different sites. Data derived from the Spanish Collaborative Study of Congenital Malformations (ECEMC), from April 1976 to March 1995. Among the 1,222,698 live births during this period, 784 infants had NTD were controlled. Among these, 784 infants had NTD. The prevalence of NTD in our population was 1.01 per 1,000 births, a frequency which is considered medium-to low. Only 5.74% of the NTD were of known etiology: 2.17% were genic, 1.27% were chromosomic and 2.29% were environmental. Excluding NTD of genetic etiology, whether genic or chromosomic, most of the remaining were isolated defects (multifactorial) and 16.78% multiple malformations. Site 1, where the closure of the neural tube starts, represented 24% of all the affected sites. However, more than 50% of the NTDs corresponded to closure failure at the junction of two sites. As in other populations with a low prevalence of NTD at birth, the prevalence of these defects in our population showed a trend to decrease with time, due to the possibility of interrupting gestation after prenatal diagnosis. All the NTD could be classified according to the theory of multisite closure of the neural tube, including 13 cases with several noncontiguous affected sites. Two types of NTD were observed: in the first, closure failed to occur and in the second, two closures failed to meet.
Formicola, Vincenzo; Holt, Brigitte
2015-07-20
The importance of the Grimaldi complex of caves and rock shelters is twofold: scientific and historical. Scientifically, it is one of the major Upper Paleolithic sites, considering the variety of mobiliary and parietal art, the number of single and multiple burials and associated grave goods, and the abundant lithic and fauna remains. Historically, the documentation of activity that took place in this site starting from the second half of the 19 th century and the studies carried out on the materials that have been recovered in the decades between 1870s-1910s, provide instructive examples of methods and goals of Paleolithic archeology and anthropology of the epoch. This paper combines the scientific and the historic interest of the site through a chronicle of the events that took place during the period of the most sensational discoveries, i.e. beginning with the identification in 1872 of the first Upper Paleolithic burial and ending with the results of the excavations carried out in 1901 at Grotte des Enfants published in four volumes a few years later. The paper discusses early interpretations and modern views on the different findings and documents changes in perspectives and goals of paleoanthropological research in over a century, raising some of the major issues of contemporary Upper Paleolithic studies.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Miura, Keiji; Kurosawa, Yoshikazu; Hirai, Momoki
1996-06-01
Nucleobindin (Nuc) was first identified as a secreted protein of 55 kDa that promotes production of DNA-specific antibodies in lupus-prone MRL/lpr mice. Analysis of cDNA that encoded Nuc revealed that the protein is composed of a signal peptide, a DNA-binding site, two calcium-binding motifs (EF-hand motifs), and a leucine zipper. In the present study, we analysed the organization of the human gene for Nuc (NUC). It consists of 13 exons that are distributed in a region of 32 kb. The functional motifs listed above are encoded in corresponding exons. NUC was expressed in all organs examined. Comparison of nucleotide sequencesmore » in the promotre regions between human and mouse NCU genes revealed several conserved sequences. Among them, two Sp1-binding sites and a CCAAT box are of particular interest. The promoter is of the TATA-less type, and transcription starts at multiple sites in both the human and the mouse genes. These features suggest that NUC might normally play a role as a housekeeping gene. NUC was located at human chromosome 19q13.2-q13.4. 25 refs., 4 figs., 1 tab.« less
Visualising landscape evolution: the effects of resolution on soil redistribution
NASA Astrophysics Data System (ADS)
Schoorl, Jeroen M.; Claessens, Lieven; (A) Veldkamp, Tom
2017-04-01
Landscape forming processes such as erosion by water, land sliding by water and gravity or ploughing by gravity, are closely related to resolution and land use changes. These processes may be controlled and influenced by multiple bio-physical and socio-economic driving factors, resulting in a complex multi-scale system. Consequently, land use changes should not be analysed in isolation without accounting for both on-site and off-site effects of these landscape processes in landscapes where water driven and or gravity driven processes are very active,. Especially the visualisation of these on- and off-site effects as a movie of evolving time series and changes is a potential valuable possibility in DEM modelling approaches. To investigate the interactions between land use, land use change, resolution of DEMs and landscape processes, a case study for the Álora region in southern Spain will presented, mainly as movies of modelling time-series, Starting from a baseline scenario of land use change, different levels of resolutions, interactions and feedbacks are added to the coupled LAPSUS model framework: Quantities and spatial patterns of both land use change and soil redistribution are compared between the baseline scenario without interactions and with each of the interaction mechanisms implemented consecutively. All as a function of spatial resolution. Keywords: LAPSUS; land use change; soil erosion, movie;
Manipulations of Start and Food Locations Affect Navigation on a Foraging Task
ERIC Educational Resources Information Center
Martin, Gerard M.; Pirzada, Ashar; Bridger, Alexander; Tomlin, Julian; Thorpe, Christina M.; Skinner, Darlene M.
2011-01-01
Rats were able to search multiple food cups in a foraging task and successfully return to a fixed, but not a variable, start location. Reducing the number of food cups to be searched resulted in an improvement in performance in the variable start condition. Performance was better when only one or two food cups had to be visited but was still…
Determine the Impact of Novel BRCA1 Translation Start Sites on Therapy Resistance in Ovarian Cancer
2017-09-01
Award Number: W81XWH-15-1-0197 TITLE: PRINCIPAL INVESTIGATOR: Neil Johnson, Ph.D. CONTRACTING ORGANIZATION: Institute for Cancer Research...Therapy Resistance in Ovarian Cancer The views, opinions and/or findings contained in this report are those of the author(s) and should not be...Start Sites on Therapy 5b. GRANT NUMBER Resistance in Ovarian Cancer W81XWH-15-1-0197 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d. PROJECT NUMBER Neil
ERIC Educational Resources Information Center
Bryant, Donna; Maxwell, Kelly; Taylor, Karen; Poe, Michele; Peisner-Feinberg, Ellen; Bernier, Kathleen
The primary goal of Smart Start is to ensure that all children enter school healthy and prepared to succeed. Smart Start has funded a variety of technical assistance (TA) activities to improve child care, including on-site technical assistance, quality improvement and facility grant, teacher education scholarships, license upgrades, teacher salary…
ERIC Educational Resources Information Center
Greene, Andrea; And Others
In 1991 the Department of Health and Human Services funded 32 sites throughout the United States to develop and implement Head Start-Public School Early Childhood Transition Demonstration Projects. The purpose of 31 projects, which are in their fourth year of operation, is to stimulate partnerships among Head Start agencies, public schools, and…
ERIC Educational Resources Information Center
Syracuse Univ., NY. Div. of Special Education and Rehabilitation.
An evaluation of the costs of serving handicapped children in Head Start was based on information collected in conjunction with on-site visits to regular Head Start programs, experimental programs, and specially selected model preschool programs, and from questionnaires completed by 1,353 grantees and delegate agencies of regular Head Start…
NASA Astrophysics Data System (ADS)
van Lew, Baldur; Botha, Charl P.; Milles, Julien R.; Vrooman, Henri A.; van de Giessen, Martijn; Lelieveldt, Boudewijn P. F.
2015-03-01
The cohort size required in epidemiological imaging genetics studies often mandates the pooling of data from multiple hospitals. Patient data, however, is subject to strict privacy protection regimes, and physical data storage may be legally restricted to a hospital network. To enable biomarker discovery, fast data access and interactive data exploration must be combined with high-performance computing resources, while respecting privacy regulations. We present a system using fast and inherently secure light-paths to access distributed data, thereby obviating the need for a central data repository. A secure private cloud computing framework facilitates interactive, computationally intensive exploration of this geographically distributed, privacy sensitive data. As a proof of concept, MRI brain imaging data hosted at two remote sites were processed in response to a user command at a third site. The system was able to automatically start virtual machines, run a selected processing pipeline and write results to a user accessible database, while keeping data locally stored in the hospitals. Individual tasks took approximately 50% longer compared to a locally hosted blade server but the cloud infrastructure reduced the total elapsed time by a factor of 40 using 70 virtual machines in the cloud. We demonstrated that the combination light-path and private cloud is a viable means of building an analysis infrastructure for secure data analysis. The system requires further work in the areas of error handling, load balancing and secure support of multiple users.
DMT1: A MAMMALIAN TRANSPORTER FOR MULTIPLE METALS
DMT1 has four names, transports as many as eight metals, may have four or more isoforms and carries out its transport for multiple purposes. This review is a start at sorting out these multiplicities. A G185R mutation results in diminished gastrointestinal iron uptake and decreas...
Berlin, Lisa J.; Whiteside-Mansell, Leanne; Roggman, Lori A.; Green, Beth L.; Robinson, JoAnn; Spieker, Susan
2010-01-01
This study examined maternal depression, attachment avoidance, and attachment anxiety as moderators of Early Head Start's effects on four parenting outcomes assessed at age 3. Participants (N = 947) were drawn from six sites of the Early Head Start National Research and Evaluation Project, a multi-site randomized trial. Findings suggest more positive program effects for mothers with less initial attachment avoidance or attachment anxiety. First, baseline attachment avoidance moderated EHS program effects on observed maternal supportiveness, such that program mothers with lower baseline attachment avoidance were rated as more supportive of their 3-year-olds than program mothers with higher baseline attachment avoidance. Second, program effects on spanking varied depending on mothers’ baseline attachment anxiety. PMID:21240694
This dataset consists of various site features from multiple Superfund sites in U.S. EPA Region 8. These data were acquired from multiple sources at different times and were combined into one region-wide layer.
Kan, Hideko; Kataoka-Shirasugi, Naoko; Amakawa, Taisaku
2011-09-01
Multiple pathways from three types of multiple receptor sites to three types of metabotropic signal transduction pathways were investigated in the whole cell-clamp experiments using isolated labellar sugar receptor neurons (cells) of the adult blowfly, Phormia regina. First, the concentration-response curves of three types of sweet taste components specialized to multiple receptor sites were obtained: sucrose for the pyranose sites (P-sites), fructose for the furanose sites (F-sites), and l-valine for the alkyl sites (R-sites). Next, the effects of inhibitors such as 2', 5'-dideoxyadenosine on adenylyl cyclase in the cAMP pathway, LY 83583 on guanylyl cyclase in the cGMP pathway, and U-73122 on phospholipase C in the IP₃ pathway were examined. The results showed that all of the inhibitors affected each specific target in the second-messenger transduction pathways. The obtained results verified that the P-site corresponded to the cAMP, the F-site to the cGMP, and the R-site to the IP₃ transduction pathway, and that these three signal pathways did not have crossing points. Copyright © 2011 Elsevier Inc. All rights reserved.
Concentrating Solar Power Projects - Aalborg CSP-Brønderslev CSP with ORC
trough Turbine Capacity: Gross: 16.6 MW Status: Operational Start Year: 2016 Do you have more information Contact(s): Webmaster Solar Key References: Web site Break Ground: April 2016 Start Production: December
Thomason, Maureen K; Bischler, Thorsten; Eisenbart, Sara K; Förstner, Konrad U; Zhang, Aixia; Herbig, Alexander; Nieselt, Kay; Sharma, Cynthia M; Storz, Gisela
2015-01-01
While the model organism Escherichia coli has been the subject of intense study for decades, the full complement of its RNAs is only now being examined. Here we describe a survey of the E. coli transcriptome carried out using a differential RNA sequencing (dRNA-seq) approach, which can distinguish between primary and processed transcripts, and an automated prediction algorithm for transcriptional start sites (TSS). With the criterion of expression under at least one of three growth conditions examined, we predicted 14,868 TSS candidates, including 5,574 internal to annotated genes (iTSS) and 5,495 TSS corresponding to potential antisense RNAs (asRNAs). We examined expression of 14 candidate asRNAs by Northern analysis using RNA from wild-type E. coli and from strains defective for RNases III and E, two RNases reported to be involved in asRNA processing. Interestingly, nine asRNAs detected as distinct bands by Northern analysis were differentially affected by the rnc and rne mutations. We also compared our asRNA candidates with previously published asRNA annotations from RNA-seq data and discuss the challenges associated with these cross-comparisons. Our global transcriptional start site map represents a valuable resource for identification of transcription start sites, promoters, and novel transcripts in E. coli and is easily accessible, together with the cDNA coverage plots, in an online genome browser. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Marketing E-Commerce by Social media using Product Recommendations and user Embedding
NASA Astrophysics Data System (ADS)
Ramalingam, V. V.; Pandian, A.; Masilamani, Kirthiga
2018-04-01
MarketingE-CommercebySodal media is the best way to improve marketing and business widely.The major issues faced with E-commerce and Social media interfacing is cold- start cross-site problem. The cold-start problem occurs at a situation when user is not having the history of purchase records.For the user who does not have a history of purchase records, we have introduced a method of finding the users’ interested product without knowing any of the demographic information of the user. The product is recommended on basesof visits i.e., the item which is most likely to be visited by the users occur in the hit list. This product is rated at the top position for the users to purchase. The e-commerce with social media sites uses the strategy of user embedding and product recommendations. The product recommendations are achieved by incorporating LatentDirichlet Allocation(LDA), Re Ranking and Collaborative Filtering algorithms. The proposed framework can enhance the recommendation system by embedding products and users. This shows the potential of solving cold-start cross-site problem across the e-commerce and social media sites and enhances the marketing strategy.
40 CFR 63.6645 - What notifications must I submit and when?
Code of Federal Regulations, 2010 CFR
2010-07-01
... standards. (b) As specified in § 63.9(b)(2), if you start up your stationary RICE with a site rating of more..., you must submit an Initial Notification not later than December 13, 2004. (c) If you start up your new... than 120 days after you become subject to this subpart. (d) As specified in § 63.9(b)(2), if you start...
ERIC Educational Resources Information Center
Shriver, Lenka H.; Hildebrand, Deana; Austin, Heidi
2010-01-01
Objective: Determine relationships between self-efficacy, decisional balance, and processes of change and Stages of Change (SOC) related to fruit and vegetable (FV) availability among Hispanic Head Start parents. Design: A 2-phase descriptive study with mixed methodology. Setting: Two Head Start sites in a city in the midwestern United States.…
Han, Seunggu J; Rolston, John D; Zygourakis, Corinna C; Sun, Matthew Z; McDermott, Michael W; Lau, Catherine Y; Aghi, Manish K
2016-01-01
On-time starts for the first case of the day are critical to maintaining efficiency in operating rooms (ORs). We studied whether a resident-led initiative to ensure on-time site marking and documentation of surgical consent could lead to improved first-case start time. In a resident-led initiative at a large 600-bed academic hospital with 25 ORs, we aimed to complete site marking and surgical consents half an hour before the scheduled start time for all first-case neurosurgical patients. We monitored the occurrence of delayed first starts and the length of delay during our initiative, and compared these cases to neurosurgical cases 3 months before the implementation of the initiative and to first-start nonneurosurgical cases. In the year of the initiative, both site marking and surgical consents were completed 30 minutes before the case start in 97% of neurosurgical cases. The average delay across all first-case starts was reduced to 7.17 minutes (N = 1271), compared with 9.67 minutes before the intervention (N = 345). During the study period, non-neurosurgical cases were delayed on average 10.3 minutes (N = 3592). There was a significant difference in latencies between the study period and the period before the initiative (p < 0.001), and also between neurosurgical cases and nonneurosurgical cases (p < 0.001). There was no reduction in delay times seen on the non-neurosurgical services in the study period when compared to the case 3 months before. Considering its effect across 1271 cases, this initiative over 1 year resulted in a total reduction of 52 hours and 57 minutes in delays. Through a resident-led quality improvement program, neurosurgical trainees successfully reduced delays in first-case starts on a surgical service. Engaging physician trainees in quality improvement and enhancing OR efficiency can be successfully achieved and can have a significant clinical and financial effect. Copyright © 2015 Association of Program Directors in Surgery. Published by Elsevier Inc. All rights reserved.
78 FR 20886 - Sunshine Act Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2013-04-08
... the BBG's public Web site at www.bbg.gov . Information regarding this meeting, including any updates or adjustments to its starting time, can also be found on the Agency's public Web site. CONTACT...
Zhang, Wei; Bock, David C.; Pelliccione, Christopher J.; ...
2016-03-08
Metal oxides, such as Fe 3O 4, hold promise for future battery applications due to their abundance, low cost, and opportunity for high lithium storage capacity. In order to better understand the mechanisms of multiple-electron transfer reactions leading to high capacity in Fe 3O 4, a comprehensive investigation on local ionic transport and ordering is made by probing site occupancies of anions (O 2–) and cations (Li +, Fe 3+/Fe 2+) using multiple synchrotron X-ray and electron-beam techniques, in combination with ab-initio calculations. Results from this study provide the first experimental evidence that the cubic-close-packed (ccp) O-anion array in Femore » 3O 4 is sustained throughout the lithiation and delithiation processes, thereby enabling multiple lithium intercalation and conversion reactions. Cation displacement/reordering occurs within the ccp O-anion framework, which leads to a series of phase transformations, starting from the inverse spinel phase and turning into intermediate rock-salt-like phases (Li xFe 3O 4; 0 < x < 2), then into a cation-segregated phase (Li 2O•FeO), and finally converting into metallic Fe and Li 2O. Subsequent delithiation and lithiation processes involve interconversion between metallic Fe and FeO-like phases. Lastly, these results may offer new insights into the structure-determined ionic transport and electrochemical reactions in metal oxides, and those of other compounds sharing a ccp anion framework, reminiscent of magnetite.« less
Protein Structure and Function Prediction Using I-TASSER
Yang, Jianyi; Zhang, Yang
2016-01-01
I-TASSER is a hierarchical protocol for automated protein structure prediction and structure-based function annotation. Starting from the amino acid sequence of target proteins, I-TASSER first generates full-length atomic structural models from multiple threading alignments and iterative structural assembly simulations followed by atomic-level structure refinement. The biological functions of the protein, including ligand-binding sites, enzyme commission number, and gene ontology terms, are then inferred from known protein function databases based on sequence and structure profile comparisons. I-TASSER is freely available as both an on-line server and a stand-alone package. This unit describes how to use the I-TASSER protocol to generate structure and function prediction and how to interpret the prediction results, as well as alternative approaches for further improving the I-TASSER modeling quality for distant-homologous and multi-domain protein targets. PMID:26678386
Identification of candidate transcription factor binding sites in the cattle genome
USDA-ARS?s Scientific Manuscript database
A resource that provides candidate transcription factor binding sites does not currently exist for cattle. Such data is necessary, as predicted sites may serve as excellent starting locations for future 'omics studies to develop transcriptional regulation hypotheses. In order to generate this resour...
Dayeh, Tasnim; Volkov, Petr; Salö, Sofia; Hall, Elin; Nilsson, Emma; Olsson, Anders H.; Kirkpatrick, Clare L.; Wollheim, Claes B.; Eliasson, Lena; Rönn, Tina; Bacos, Karl; Ling, Charlotte
2014-01-01
Impaired insulin secretion is a hallmark of type 2 diabetes (T2D). Epigenetics may affect disease susceptibility. To describe the human methylome in pancreatic islets and determine the epigenetic basis of T2D, we analyzed DNA methylation of 479,927 CpG sites and the transcriptome in pancreatic islets from T2D and non-diabetic donors. We provide a detailed map of the global DNA methylation pattern in human islets, β- and α-cells. Genomic regions close to the transcription start site showed low degrees of methylation and regions further away from the transcription start site such as the gene body, 3′UTR and intergenic regions showed a higher degree of methylation. While CpG islands were hypomethylated, the surrounding 2 kb shores showed an intermediate degree of methylation, whereas regions further away (shelves and open sea) were hypermethylated in human islets, β- and α-cells. We identified 1,649 CpG sites and 853 genes, including TCF7L2, FTO and KCNQ1, with differential DNA methylation in T2D islets after correction for multiple testing. The majority of the differentially methylated CpG sites had an intermediate degree of methylation and were underrepresented in CpG islands (∼7%) and overrepresented in the open sea (∼60%). 102 of the differentially methylated genes, including CDKN1A, PDE7B, SEPT9 and EXOC3L2, were differentially expressed in T2D islets. Methylation of CDKN1A and PDE7B promoters in vitro suppressed their transcriptional activity. Functional analyses demonstrated that identified candidate genes affect pancreatic β- and α-cells as Exoc3l silencing reduced exocytosis and overexpression of Cdkn1a, Pde7b and Sept9 perturbed insulin and glucagon secretion in clonal β- and α-cells, respectively. Together, our data can serve as a reference methylome in human islets. We provide new target genes with altered DNA methylation and expression in human T2D islets that contribute to perturbed insulin and glucagon secretion. These results highlight the importance of epigenetics in the pathogenesis of T2D. PMID:24603685
Buchet, Anne; Eichler, Knut; Mandrand-Berthelot, Marie-Andrée
1998-01-01
The divergent structural operons caiTABCDE and fixABCX of Escherichia coli are required for anaerobic carnitine metabolism. Transcriptional monocopy lacZ fusion studies showed that both operons are coexpressed during anaerobic growth in the presence of carnitine, respond to common environmental stimuli (like glucose and nitrate), and are modulated positively by the same general regulators, CRP and FNR, and negatively by H-NS. Overproduction of the CaiF specific regulatory protein mediating the carnitine signal restored induction in an fnr mutant, corresponding to its role as the primary target for anaerobiosis. Transcript analysis identified two divergent transcription start points initiating 289 bp apart. DNase I footprinting revealed three sites with various affinities for the binding of the cAMP-CRP complex inside this regulatory region. Site-directed mutagenesis experiments indicated that previously reported perfect CRP motif 1, centered at −41.5 of the cai transcriptional start site, plays a direct role in the sole cai activation. In contrast, mutation in CRP site 2, positioned at −69.5 of the fix promoter, caused only a threefold reduction in fix expression. Thus, the role of the third CRP site, located at −126.5 of fix, might be to reinforce the action of site 2. A critical 50-bp cis-acting sequence overlapping the fix mRNA start site was found, by deletion analysis, to be necessary for cai transcription. This region is thought to be involved in transduction of the signal mediated by the CaiF regulator. PMID:9573142
Centers for Disease Control and Prevention, Office of Minority Health & Health Equity (OMHHE)
... Skip directly to site content Start of Search Controls Search Form Controls Cancel Submit Search The CDC CDC A-Z ... V W X Y Z # Start of Search Controls Search Form Controls Cancel Submit Search The CDC ...
Gewurtz, Sarah B; Backus, Sean M; De Silva, Amila O; Ahrens, Lutz; Armellin, Alain; Evans, Marlene; Fraser, Susan; Gledhill, Melissa; Guerra, Paula; Harner, Tom; Helm, Paul A; Hung, Hayley; Khera, Nav; Kim, Min Gu; King, Martha; Lee, Sum Chi; Letcher, Robert J; Martin, Pamela; Marvin, Chris; McGoldrick, Daryl J; Myers, Anne L; Pelletier, Magella; Pomeroy, Joe; Reiner, Eric J; Rondeau, Myriam; Sauve, Marie-Claude; Sekela, Mark; Shoeib, Mahiba; Smith, Daniel W; Smyth, Shirley Anne; Struger, John; Spry, Doug; Syrgiannis, Jim; Waltho, Jasmine
2013-09-01
In Canada, perfluoroalkyl acids (PFAAs) have been the focus of several monitoring programs and research and surveillance studies. Here, we integrate recent data and perform a multi-media assessment to examine the current status and ongoing trends of PFAAs in Canada. Concentrations of perfluorooctane sulfonate (PFOS), perfluorooctanoate (PFOA), and other long-chain perfluorocarboxylates (PFCAs) in air, water, sediment, fish, and birds across Canada are generally related to urbanization, with elevated concentrations observed around cities, especially in southern Ontario. PFOS levels in water, fish tissue, and bird eggs were below their respective Draft Federal Environmental Quality Guidelines, suggesting there is low potential for adverse effects to the environment/organisms examined. However, PFOS in fish and bird eggs tended to exceed guidelines for the protection of mammalian and avian consumers, suggesting a potential risk to their wildlife predators, although wildlife population health assessments are needed to determine whether negative impacts are actually occurring. Long-term temporal trends of PFOS in suspended sediment, sediment cores, Lake Trout (Salvelinus namaycush), and Herring Gull (Larus argentatus) eggs collected from Lake Ontario increased consistently from the start of data collection until the 1990s. However, after this time, the trends varied by media, with concentrations stabilizing in Lake Trout and Herring Gull eggs, and decreasing and increasing in suspended sediment and the sediment cores, respectively. For PFCAs, concentrations in suspended sediment, sediment cores, and Herring Gulls generally increased from the start of data collection until present and concentrations in Lake Trout increased until the late 1990s and subsequently stabilized. A multimedia comparison of PFAA profiles provided evidence that unexpected patterns in biota of some of the lakes were due to unique source patterns rather than internal lake processes. High concentrations of PFAAs in the leachate and air of landfill sites, in the wastewater influent/effluent, biosolids, and air at wastewater treatment plants, and in indoor air and dust highlight the waste sector and current-use products (used primarily indoors) as ongoing sources of PFAAs to the Canadian environment. The results of this study demonstrate the utility of integrating data from different media. Simultaneous evaluation of spatial and temporal trends in multiple media allows inferences that would be impossible with data on only one medium. As such, more co-ordination among monitoring sites for different media is suggested for future sampling, especially at the northern sites. We emphasize the importance of continued monitoring of multiple-media for determining future responses of environmental PFAA concentrations to voluntary and regulatory actions. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.
Geospatial optimization of siting large-scale solar projects
Macknick, Jordan; Quinby, Ted; Caulfield, Emmet; Gerritsen, Margot; Diffendorfer, James E.; Haines, Seth S.
2014-01-01
guidelines by being user-driven, transparent, interactive, capable of incorporating multiple criteria, and flexible. This work provides the foundation for a dynamic siting assistance tool that can greatly facilitate siting decisions among multiple stakeholders.
Annualized earthquake loss estimates for California and their sensitivity to site amplification
Chen, Rui; Jaiswal, Kishor; Bausch, D; Seligson, H; Wills, C.J.
2016-01-01
Input datasets for annualized earthquake loss (AEL) estimation for California were updated recently by the scientific community, and include the National Seismic Hazard Model (NSHM), site‐response model, and estimates of shear‐wave velocity. Additionally, the Federal Emergency Management Agency’s loss estimation tool, Hazus, was updated to include the most recent census and economic exposure data. These enhancements necessitated a revisit to our previous AEL estimates and a study of the sensitivity of AEL estimates subjected to alternate inputs for site amplification. The NSHM ground motions for a uniform site condition are modified to account for the effect of local near‐surface geology. The site conditions are approximated in three ways: (1) by VS30 (time‐averaged shear‐wave velocity in the upper 30 m) value obtained from a geology‐ and topography‐based map consisting of 15 VS30 groups, (2) by site classes categorized according to National Earthquake Hazards Reduction Program (NEHRP) site classification, and (3) by a uniform NEHRP site class D. In case 1, ground motions are amplified using the Seyhan and Stewart (2014) semiempirical nonlinear amplification model. In cases 2 and 3, ground motions are amplified using the 2014 version of the NEHRP site amplification factors, which are also based on the Seyhan and Stewart model but are approximated to facilitate their use for building code applications. Estimated AELs are presented at multiple resolutions, starting with the state level assessment and followed by detailed assessments for counties, metropolitan statistical areas (MSAs), and cities. AEL estimate at the state level is ∼$3.7 billion, 70% of which is contributed from Los Angeles–Long Beach–Santa Ana, San Francisco–Oakland–Fremont, and Riverside–San Bernardino–Ontario MSAs. The statewide AEL estimate is insensitive to alternate assumptions of site amplification. However, we note significant differences in AEL estimates among the three sensitivity cases for smaller geographic units.
Multiple-Use Site Demand Analysis: An Application to the Boundary Waters Canoe Area Wilderness.
ERIC Educational Resources Information Center
Peterson, George L.; And Others
1982-01-01
A single-site, multiple-use model for analyzing trip demand is derived from a multiple site regional model based on utility maximizing choice theory. The model is used to analyze and compare trips to the Boundary Waters Canoe Area Wilderness for several types of use. Travel cost elasticities of demand are compared and discussed. (Authors/JN)
Kwon, Inchan; Choi, Eun Sil
2016-01-01
Multiple-site-specific incorporation of a noncanonical amino acid into a recombinant protein would be a very useful technique to generate multiple chemical handles for bioconjugation and multivalent binding sites for the enhanced interaction. Previously combination of a mutant yeast phenylalanyl-tRNA synthetase variant and the yeast phenylalanyl-tRNA containing the AAA anticodon was used to incorporate a noncanonical amino acid into multiple UUU phenylalanine (Phe) codons in a site-specific manner. However, due to the less selective codon recognition of the AAA anticodon, there was significant misincorporation of a noncanonical amino acid into unwanted UUC Phe codons. To enhance codon selectivity, we explored degenerate leucine (Leu) codons instead of Phe degenerate codons. Combined use of the mutant yeast phenylalanyl-tRNA containing the CAA anticodon and the yPheRS_naph variant allowed incorporation of a phenylalanine analog, 2-naphthylalanine, into murine dihydrofolate reductase in response to multiple UUG Leu codons, but not to other Leu codon sites. Despite the moderate UUG codon occupancy by 2-naphthylalaine, these results successfully demonstrated that the concept of forced ambiguity of the genetic code can be achieved for the Leu codons, available for multiple-site-specific incorporation. PMID:27028506
Kwon, Inchan; Choi, Eun Sil
2016-01-01
Multiple-site-specific incorporation of a noncanonical amino acid into a recombinant protein would be a very useful technique to generate multiple chemical handles for bioconjugation and multivalent binding sites for the enhanced interaction. Previously combination of a mutant yeast phenylalanyl-tRNA synthetase variant and the yeast phenylalanyl-tRNA containing the AAA anticodon was used to incorporate a noncanonical amino acid into multiple UUU phenylalanine (Phe) codons in a site-specific manner. However, due to the less selective codon recognition of the AAA anticodon, there was significant misincorporation of a noncanonical amino acid into unwanted UUC Phe codons. To enhance codon selectivity, we explored degenerate leucine (Leu) codons instead of Phe degenerate codons. Combined use of the mutant yeast phenylalanyl-tRNA containing the CAA anticodon and the yPheRS_naph variant allowed incorporation of a phenylalanine analog, 2-naphthylalanine, into murine dihydrofolate reductase in response to multiple UUG Leu codons, but not to other Leu codon sites. Despite the moderate UUG codon occupancy by 2-naphthylalaine, these results successfully demonstrated that the concept of forced ambiguity of the genetic code can be achieved for the Leu codons, available for multiple-site-specific incorporation.
Parsons, Michael T.; Whiley, Phillip J.; Beesley, Jonathan; Drost, Mark; de Wind, Niels; Thompson, Bryony A.; Marquart, Louise; Hopper, John L.; Jenkins, Mark A.; Brown, Melissa A.; Tucker, Kathy; Warwick, Linda; Buchanan, Daniel D.; Spurdle, Amanda B.
2014-01-01
Variants that disrupt the translation initiation sequences in cancer predisposition genes are generally assumed to be deleterious. However few studies have validated these assumptions with functional and clinical data. Two cancer syndrome gene variants likely to affect native translation initiation were identified by clinical genetic testing: MLH1:c.1A>G p.(Met1?) and BRCA2:c.67+3A>G. In vitro GFP-reporter assays were conducted to assess the consequences of translation initiation disruption on alternative downstream initiation codon usage. Analysis of MLH1:c.1A>G p.(Met1?) showed that translation was mostly initiated at an in-frame position 103 nucleotides downstream, but also at two ATG sequences downstream. The protein product encoded by the in-frame transcript initiating from position c.103 showed loss of in vitro mismatch repair activity comparable to known pathogenic mutations. BRCA2:c.67+3A>G was shown by mRNA analysis to result in an aberrantly spliced transcript deleting exon 2 and the consensus ATG site. In the absence of exon 2, translation initiated mostly at an out-of-frame ATG 323 nucleotides downstream, and to a lesser extent at an in-frame ATG 370 nucleotides downstream. Initiation from any of the downstream alternative sites tested in both genes would lead to loss of protein function, but further clinical data is required to confirm if these variants are associated with a high cancer risk. Importantly, our results highlight the need for caution in interpreting the functional and clinical consequences of variation that leads to disruption of the initiation codon, since translation may not necessarily occur from the first downstream alternative start site, or from a single alternative start site. PMID:24302565
Inomata, Takeshi; Triadan, Daniela; MacLellan, Jessica; Burham, Melissa; Aoyama, Kazuo; Palomo, Juan Manuel; Yonenobu, Hitoshi; Pinzón, Flory; Nasu, Hiroo
2017-01-01
The lowland Maya site of Ceibal, Guatemala, had a long history of occupation, spanning from the Middle Preclassic Period through the Terminal Classic (1000 BC to AD 950). The Ceibal-Petexbatun Archaeological Project has been conducting archaeological investigations at this site since 2005 and has obtained 154 radiocarbon dates, which represent the largest collection of radiocarbon assays from a single Maya site. The Bayesian analysis of these dates, combined with a detailed study of ceramics, allowed us to develop a high-precision chronology for Ceibal. Through this chronology, we traced the trajectories of the Preclassic collapse around AD 150–300 and the Classic collapse around AD 800–950, revealing similar patterns in the two cases. Social instability started with the intensification of warfare around 75 BC and AD 735, respectively, followed by the fall of multiple centers across the Maya lowlands around AD 150 and 810. The population of Ceibal persisted for some time in both cases, but the center eventually experienced major decline around AD 300 and 900. Despite these similarities in their diachronic trajectories, the outcomes of these collapses were different, with the former associated with the development of dynasties centered on divine rulership and the latter leading to their downfalls. The Ceibal dynasty emerged during the period of low population after the Preclassic collapse, suggesting that this dynasty was placed under the influence from, or by the direct intervention of, an external power. PMID:28115691
Inomata, Takeshi; Triadan, Daniela; MacLellan, Jessica; Burham, Melissa; Aoyama, Kazuo; Palomo, Juan Manuel; Yonenobu, Hitoshi; Pinzón, Flory; Nasu, Hiroo
2017-02-07
The lowland Maya site of Ceibal, Guatemala, had a long history of occupation, spanning from the Middle Preclassic Period through the Terminal Classic (1000 BC to AD 950). The Ceibal-Petexbatun Archaeological Project has been conducting archaeological investigations at this site since 2005 and has obtained 154 radiocarbon dates, which represent the largest collection of radiocarbon assays from a single Maya site. The Bayesian analysis of these dates, combined with a detailed study of ceramics, allowed us to develop a high-precision chronology for Ceibal. Through this chronology, we traced the trajectories of the Preclassic collapse around AD 150-300 and the Classic collapse around AD 800-950, revealing similar patterns in the two cases. Social instability started with the intensification of warfare around 75 BC and AD 735, respectively, followed by the fall of multiple centers across the Maya lowlands around AD 150 and 810. The population of Ceibal persisted for some time in both cases, but the center eventually experienced major decline around AD 300 and 900. Despite these similarities in their diachronic trajectories, the outcomes of these collapses were different, with the former associated with the development of dynasties centered on divine rulership and the latter leading to their downfalls. The Ceibal dynasty emerged during the period of low population after the Preclassic collapse, suggesting that this dynasty was placed under the influence from, or by the direct intervention of, an external power.
Estimate of temperature change due to ice and snow accretion in the boreal forest regions
NASA Astrophysics Data System (ADS)
Sugiura, K.; Nagai, S.; Suzuki, R.; Eicken, H.; Maximov, T. C.
2016-12-01
Previous research has demonstrated that there is a wide difference between the surface albedo in winter/spring in snow-covered forest regions in various global climate models. If the forest is covered with snow, the surface albedo would increase. In this study, we carried out field observations to monitor the frequency of ice and snow accretion in the boreal forest regions. The time-lapse digital camera was set up on each side of the observation towers at the site located to the north of Fairbanks (USA) and at the site located to the north of Yakutsk (Russia). It was confirmed that both forests were not necessarily covered with snow without a break from the start of continuous snow cover until the end. In addition, the boreal forest at the Yakutsk site is covered with snow in comparison with the boreal forest at the Fairbanks site for a long term such as for about five month. Using a one-dimensional mathematics model about the energy flow including atmospheric multiple scattering, we estimated temperature change due to ice and snow accretion in the boreal forest regions. The result show that the mean surface temperature rises approximately 0.5 [oC] when the boreal forest is not covered with snow. In this presentation, we discuss the snow albedo parameterization in the boreal forest regions and the one-dimensional mathematics model to provide a basis for a better understanding of the role of snow in the climate system.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Farajzadeh, Leila; Hornshøj, Henrik; Momeni, Jamal
Highlights: •Transcriptome sequencing yielded 223 mill porcine RNA-seq reads, and 59,000 transcribed locations. •Establishment of unique transcription profiles for ten porcine tissues including four brain tissues. •Comparison of transcription profiles at gene, isoform, promoter and transcription start site level. •Highlights a high level of regulation of neuro-related genes at both gene, isoform, and TSS level. •Our results emphasize the pig as a valuable animal model with respect to human biological issues. -- Abstract: The transcriptome is the absolute set of transcripts in a tissue or cell at the time of sampling. In this study RNA-Seq is employed to enable themore » differential analysis of the transcriptome profile for ten porcine tissues in order to evaluate differences between the tissues at the gene and isoform expression level, together with an analysis of variation in transcription start sites, promoter usage, and splicing. Totally, 223 million RNA fragments were sequenced leading to the identification of 59,930 transcribed gene locations and 290,936 transcript variants using Cufflinks with similarity to approximately 13,899 annotated human genes. Pairwise analysis of tissues for differential expression at the gene level showed that the smallest differences were between tissues originating from the porcine brain. Interestingly, the relative level of differential expression at the isoform level did generally not vary between tissue contrasts. Furthermore, analysis of differential promoter usage between tissues, revealed a proportionally higher variation between cerebellum (CBE) versus frontal cortex and cerebellum versus hypothalamus (HYP) than in the remaining comparisons. In addition, the comparison of differential transcription start sites showed that the number of these sites is generally increased in comparisons including hypothalamus in contrast to other pairwise assessments. A comprehensive analysis of one of the tissue contrasts, i.e. cerebellum versus heart for differential variation at the gene, isoform, and transcription start site (TSS), and promoter level showed that several of the genes differed at all four levels. Interestingly, these genes were mainly annotated to the “electron transport chain” and neuronal differentiation, emphasizing that “tissue important” genes are regulated at several levels. Furthermore, our analysis shows that the “across tissue approach” has a promising potential when screening for possible explanations for variations, such as those observed at the gene expression levels.« less
Scieglinska, D; Widłak, W; Konopka, W; Poutanen, M; Rahman, N; Huhtaniemi, I; Krawczyk, Z
2001-01-01
The rat Hst70 gene and its mouse counterpart Hsp70.2 belong to the family of Hsp70 heat shock genes and are specifically expressed in male germ cells. Previous studies regarding the structure of the 5' region of the transcription unit of these genes as well as localization of the 'cis' elements conferring their testis-specific expression gave contradictory results [Widlak, Markkula, Krawczyk, Kananen and Huhtaniemi (1995) Biochim. Biophys. Acta 1264, 191-200; Dix, Rosario-Herrle, Gotoh, Mori, Goulding, Barret and Eddy (1996) Dev. Biol. 174, 310-321]. In the present paper we solve these controversies and show that the 5' untranslated region (UTR) of the Hst70 gene contains an intron which is localized similar to that of the mouse Hsp70.2 gene. Reverse transcriptase-mediated PCR, Northern blotting and RNase protection analysis revealed that the transcription initiation of both genes starts at two main distant sites, and one of them is localized within the intron. As a result two populations of Hst70 gene transcripts with similar sizes but different 5' UTR structures can be detected in total testicular RNA. Functional analysis of the Hst70 gene promoter in transgenic mice and transient transfection assays proved that the DNA fragment of approx. 360 bp localized upstream of the ATG transcription start codon is the minimal promoter required for testis-specific expression of the HST70/chloramphenicol acetyltransferase transgene. These experiments also suggest that the expression of the gene may depend on 'cis' regulatory elements localized within exon 1 and the intron sequences. PMID:11563976
Human-Specific Histone Methylation Signatures at Transcription Start Sites in Prefrontal Neurons
Cheung, Iris; Bharadwaj, Rahul; Chou, Hsin-Jung; Houston, Isaac B.; Peter, Cyril J.; Mitchell, Amanda C.; Yao, Wei-Dong; Myers, Richard H.; Chen, Jiang-fan; Preuss, Todd M.; Rogaev, Evgeny I.; Jensen, Jeffrey D.; Weng, Zhiping; Akbarian, Schahram
2012-01-01
Cognitive abilities and disorders unique to humans are thought to result from adaptively driven changes in brain transcriptomes, but little is known about the role of cis-regulatory changes affecting transcription start sites (TSS). Here, we mapped in human, chimpanzee, and macaque prefrontal cortex the genome-wide distribution of histone H3 trimethylated at lysine 4 (H3K4me3), an epigenetic mark sharply regulated at TSS, and identified 471 sequences with human-specific enrichment or depletion. Among these were 33 loci selectively methylated in neuronal but not non-neuronal chromatin from children and adults, including TSS at DPP10 (2q14.1), CNTN4 and CHL1 (3p26.3), and other neuropsychiatric susceptibility genes. Regulatory sequences at DPP10 and additional loci carried a strong footprint of hominid adaptation, including elevated nucleotide substitution rates and regulatory motifs absent in other primates (including archaic hominins), with evidence for selective pressures during more recent evolution and adaptive fixations in modern populations. Chromosome conformation capture at two neurodevelopmental disease loci, 2q14.1 and 16p11.2, revealed higher order chromatin structures resulting in physical contact of multiple human-specific H3K4me3 peaks spaced 0.5–1 Mb apart, in conjunction with a novel cis-bound antisense RNA linked to Polycomb repressor proteins and downregulated DPP10 expression. Therefore, coordinated epigenetic regulation via newly derived TSS chromatin could play an important role in the emergence of human-specific gene expression networks in brain that contribute to cognitive functions and neurological disease susceptibility in modern day humans. PMID:23185133
Bhattarai, Sunil; Aly, Ahmed; Garcia, Kristy; Ruiz, Diandra; Pontarelli, Fabrizio; Dharap, Ashutosh
2018-06-03
Gene expression in cerebral ischemia has been a subject of intense investigations for several years. Studies utilizing probe-based high-throughput methodologies such as microarrays have contributed significantly to our existing knowledge but lacked the capacity to dissect the transcriptome in detail. Genome-wide RNA-sequencing (RNA-seq) enables comprehensive examinations of transcriptomes for attributes such as strandedness, alternative splicing, alternative transcription start/stop sites, and sequence composition, thus providing a very detailed account of gene expression. Leveraging this capability, we conducted an in-depth, genome-wide evaluation of the protein-coding transcriptome of the adult mouse cortex after transient focal ischemia at 6, 12, or 24 h of reperfusion using RNA-seq. We identified a total of 1007 transcripts at 6 h, 1878 transcripts at 12 h, and 1618 transcripts at 24 h of reperfusion that were significantly altered as compared to sham controls. With isoform-level resolution, we identified 23 splice variants arising from 23 genes that were novel mRNA isoforms. For a subset of genes, we detected reperfusion time-point-dependent splice isoform switching, indicating an expression and/or functional switch for these genes. Finally, for 286 genes across all three reperfusion time-points, we discovered multiple, distinct, simultaneously expressed and differentially altered isoforms per gene that were generated via alternative transcription start/stop sites. Of these, 165 isoforms derived from 109 genes were novel mRNAs. Together, our data unravel the protein-coding transcriptome of the cerebral cortex at an unprecedented depth to provide several new insights into the flexibility and complexity of stroke-related gene transcription and transcript organization.
Fukuda, Hidetsugu; Takahashi, Misaki; Kato, Keiichi; Oharaseki, Toshiaki; Mukai, Hideki
2015-05-01
Primary syphilis caused by Treponema pallidum usually develops after sexual contact as an initial solitary sclerosis or hard chancre in the genital region. We describe a case of primary syphilis at three sites in genital and extragenital regions of a man who had sex with men. A 29-year-old man visited our hospital for skin lesions on his lower lip, nipple-areola and penis. A positive syphilis serological test for rapid plasma reagin had a titer of 1:16; the patient also tested positive for specific antibodies against T. pallidum, with a cut-off index of 39.0. Histopathological examination of a nipple-areola biopsy specimen revealed a thickened epidermis and dense infiltration of inflammatory cells extending from the upper dermal layers to the deep dermis. The inflammatory cells were composed of abundant lymphocytes, plasma cells, histiocytes and neutrophils. Immunohistochemical staining for T. pallidum using an anti-T. pallidum antibody showed numerous spirochetes in the lower portion of the epidermis, scattered inside inflammatory cell infiltrate and perivascular sites throughout the dermis. Based on these findings, the patient was diagnosed with primary syphilis. Treatment with oral amoxicillin hydrate was started. Five days after starting treatment, a diffuse maculopapular rash (syphilitic roseola) occurred on his trunk and extremities. Perivascular cuffing due to T. pallidum was present throughout the dermis in the biopsy specimen of a localized lesion of primary syphilis. Moreover, syphilitic roseola, which indicates generalized dissemination of T. pallidum, developed during the course of treatment for primary syphilis. Therefore, we considered perivascular cuffing to be indicative of the dissemination phase. © 2015 Japanese Dermatological Association.
Optimal design of compact and connected nature reserves for multiple species.
Wang, Yicheng; Önal, Hayri
2016-04-01
When designing a conservation reserve system for multiple species, spatial attributes of the reserves must be taken into account at species level. The existing optimal reserve design literature considers either one spatial attribute or when multiple attributes are considered the analysis is restricted only to one species. We built a linear integer programing model that incorporates compactness and connectivity of the landscape reserved for multiple species. The model identifies multiple reserves that each serve a subset of target species with a specified coverage probability threshold to ensure the species' long-term survival in the reserve, and each target species is covered (protected) with another probability threshold at the reserve system level. We modeled compactness by minimizing the total distance between selected sites and central sites, and we modeled connectivity of a selected site to its designated central site by selecting at least one of its adjacent sites that has a nearer distance to the central site. We considered structural distance and functional distances that incorporated site quality between sites. We tested the model using randomly generated data on 2 species, one ground species that required structural connectivity and the other an avian species that required functional connectivity. We applied the model to 10 bird species listed as endangered by the state of Illinois (U.S.A.). Spatial coherence and selection cost of the reserves differed substantially depending on the weights assigned to these 2 criteria. The model can be used to design a reserve system for multiple species, especially species whose habitats are far apart in which case multiple disjunct but compact and connected reserves are advantageous. The model can be modified to increase or decrease the distance between reserves to reduce or promote population connectivity. © 2015 Society for Conservation Biology.
Modulatory mechanisms and multiple functions of somatodendritic A-type K+ channel auxiliary subunits
Jerng, Henry H.; Pfaffinger, Paul J.
2014-01-01
Auxiliary subunits are non-conducting, modulatory components of the multi-protein ion channel complexes that underlie normal neuronal signaling. They interact with the pore-forming α-subunits to modulate surface distribution, ion conductance, and channel gating properties. For the somatodendritic subthreshold A-type potassium (ISA) channel based on Kv4 α-subunits, two types of auxiliary subunits have been extensively studied: Kv channel-interacting proteins (KChIPs) and dipeptidyl peptidase-like proteins (DPLPs). KChIPs are cytoplasmic calcium-binding proteins that interact with intracellular portions of the Kv4 subunits, whereas DPLPs are type II transmembrane proteins that associate with the Kv4 channel core. Both KChIPs and DPLPs genes contain multiple start sites that are used by various neuronal populations to drive the differential expression of functionally distinct N-terminal variants. In turn, these N-terminal variants generate tremendous functional diversity across the nervous system. Here, we focus our review on (1) the molecular mechanism underlying the unique properties of different N-terminal variants, (2) the shaping of native ISA properties by the concerted actions of KChIPs and DPLP variants, and (3) the surprising ways that KChIPs and DPLPs coordinate the activity of multiple channels to fine-tune neuronal excitability. Unlocking the unique contributions of different auxiliary subunit N-terminal variants may provide an important opportunity to develop novel targeted therapeutics to treat numerous neurological disorders. PMID:24723849
Jerng, Henry H; Pfaffinger, Paul J
2014-01-01
Auxiliary subunits are non-conducting, modulatory components of the multi-protein ion channel complexes that underlie normal neuronal signaling. They interact with the pore-forming α-subunits to modulate surface distribution, ion conductance, and channel gating properties. For the somatodendritic subthreshold A-type potassium (ISA) channel based on Kv4 α-subunits, two types of auxiliary subunits have been extensively studied: Kv channel-interacting proteins (KChIPs) and dipeptidyl peptidase-like proteins (DPLPs). KChIPs are cytoplasmic calcium-binding proteins that interact with intracellular portions of the Kv4 subunits, whereas DPLPs are type II transmembrane proteins that associate with the Kv4 channel core. Both KChIPs and DPLPs genes contain multiple start sites that are used by various neuronal populations to drive the differential expression of functionally distinct N-terminal variants. In turn, these N-terminal variants generate tremendous functional diversity across the nervous system. Here, we focus our review on (1) the molecular mechanism underlying the unique properties of different N-terminal variants, (2) the shaping of native ISA properties by the concerted actions of KChIPs and DPLP variants, and (3) the surprising ways that KChIPs and DPLPs coordinate the activity of multiple channels to fine-tune neuronal excitability. Unlocking the unique contributions of different auxiliary subunit N-terminal variants may provide an important opportunity to develop novel targeted therapeutics to treat numerous neurological disorders.
Greenhouse Gas Reporting Program (GHGRP)
Site provides information on EPA's GHG reported data starting with RY 2010 to the present. The site also provides information on regulatory requirements, applicability, how to register a facility and report data, and how to access the GHG data.
Wu, C J; Janssen, G R
1996-10-01
The Streptomyces vinaceus viomycin phosphotransferase (vph) mRNA contains an untranslated leader with a conventional Shine-Dalgarno homology. The vph leader was removed by ligation of the vph coding sequence to the transcriptional start site of a Streptomyces or an Escherichia coli promoter, such that transcription would initiate at the first position of the vph start codon. Analysis of mRNA demonstrated that transcription initiated primarily at the A of the vph AUG translational start codon in both Streptomyces lividans and E. coli; cells expressing the unleadered vph mRNA were resistant to viomycin indicating that the Shine-Dalgarno sequence, or other features contained within the leader, was not necessary for vph translation. Addition of four nucleotides (5'-AUGC-3') onto the 5' end of the unleadered vph mRNA resulted in translation initiation from the vph start codon and the AUG triplet contained within the added sequence. Translational fusions of vph sequence to a Tn5 neo reporter gene indicated that the first 16 codons of vph coding sequence were sufficient to specify the translational start site and reading frame for expression of neomycin resistance in both E. coli and S. lividans.
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
Evaluation of Swift Start TCP in Long-Delay Environment
NASA Technical Reports Server (NTRS)
Lawas-Grodek, Frances J.; Tran, Diepchi T.
2004-01-01
This report presents the test results of the Swift Start algorithm in single-flow and multiple-flow testbeds under the effects of high propagation delays, various slow bottlenecks, and small queue sizes. Although this algorithm estimates capacity and implements packet pacing, the findings were that in a heavily congested link, the Swift Start algorithm will not be applicable. The reason is that the bottleneck estimation is falsely influenced by timeouts induced by retransmissions and the expiration of delayed acknowledgment (ACK) timers, thus causing the modified Swift Start code to fall back to regular transmission control protocol (TCP).
Chuckwalla Valley multiple-well monitoring site, Chuckwalla Valley, Riverside County
Everett, Rhett
2013-01-01
The U.S. Geological Survey (USGS), in cooperation with the Bureau of Land Management, is evaluating the geohydrology and water availability of the Chuckwalla Valley, California. As part of this evaluation, the USGS installed the Chuckwalla Valley multiple-well monitoring site (CWV1) in the southeastern portion of the Chuckwalla Basin. Data collected at this site provide information about the geology, hydrology, geophysics, and geochemistry of the local aquifer system, thus enhancing the understanding of the geohydrologic framework of the Chuckwalla Valley. This report presents construction information for the CWV1 multiple-well monitoring site and initial geohydrologic data collected from the site.
Kemter, Franziska S.; Messerschmidt, Sonja J.; Schallopp, Nadine; Sobetzko, Patrick; Bunk, Boyke; Spröer, Cathrin; Teschler, Jennifer K.; Yildiz, Fitnat H.
2018-01-01
Vibrio cholerae, the causative agent of the cholera disease, is commonly used as a model organism for the study of bacteria with multipartite genomes. Its two chromosomes of different sizes initiate their DNA replication at distinct time points in the cell cycle and terminate in synchrony. In this study, the time-delayed start of Chr2 was verified in a synchronized cell population. This replication pattern suggests two possible regulation mechanisms for other Vibrio species with different sized secondary chromosomes: Either all Chr2 start DNA replication with a fixed delay after Chr1 initiation, or the timepoint at which Chr2 initiates varies such that termination of chromosomal replication occurs in synchrony. We investigated these two models and revealed that the two chromosomes of various Vibrionaceae species terminate in synchrony while Chr2-initiation timing relative to Chr1 is variable. Moreover, the sequence and function of the Chr2-triggering crtS site recently discovered in V. cholerae were found to be conserved, explaining the observed timing mechanism. Our results suggest that it is beneficial for bacterial cells with multiple chromosomes to synchronize their replication termination, potentially to optimize chromosome related processes as dimer resolution or segregation. PMID:29505558
Mid-Piacensian mean annual sea surface temperature: an analysis for data-model comparisons
Dowsett, Harry J.; Robinson, Marci M.; Foley, Kevin M.; Stoll, Danielle K.
2010-01-01
Numerical models of the global climate system are the primary tools used to understand and project climate disruptions in the form of future global warming. The Pliocene has been identified as the closest, albeit imperfect, analog to climate conditions expected for the end of this century, making an independent data set of Pliocene conditions necessary for ground truthing model results. Because most climate model output is produced in the form ofmean annual conditions, we present a derivative of the USGS PRISM3 Global Climate Reconstruction which integrates multiple proxies of sea surface temperature (SST) into single surface temperature anomalies. We analyze temperature estimates from faunal and floral assemblage data,Mg/Ca values and alkenone unsaturation indices to arrive at a single mean annual SST anomaly (Pliocene minus modern) best describing each PRISM site, understanding that multiple proxies should not necessarily show concordance. The power of themultiple proxy approach lies within its diversity, as no two proxies measure the same environmental variable. This data set can be used to verify climate model output, to serve as a starting point for model inter-comparisons, and for quantifying uncertainty in Pliocene model prediction in perturbed physics ensembles.
Katoh, Hiroto; Qin, Zhaohui S.; Liu, Runhua; Wang, Lizhong; Li, Weiquan; Li, Xiangzhi; Wu, Lipeng; Du, Zhanwen; Lyons, Robert; Liu, Chang-Gong; Liu, Xiuping; Dou, Yali; Zheng, Pan; Liu, Yang
2011-01-01
SUMMARY Both H4K16 acetylation and H3K4 tri-methylation are required for gene activation. However, it is still largely unclear how these modifications are orchestrated by transcriptional factors. Here we analyzed the mechanism of the transcriptional activation by FOXP3, an X-linked suppressor of autoimmune diseases and cancers. FOXP3 binds near transcriptional start sites of its target genes. By recruiting MOF and displacing histone H3K4 demethylase PLU-1, FOXP3 increases both H4K16 acetylation and H3K4 tri-methylation at the FOXP3-associated chromatins of multiple FOXP3-activated genes. RNAi-mediated silencing of MOF reduced both gene activation and tumor suppression by FOXP3, while both somatic mutations in clinical cancer samples and targeted mutation of FOXP3 in mouse prostate epithelial disrupted nuclear localization of MOF. Our data demonstrate a pull-push model in which a single transcription factor orchestrates two epigenetic alterations necessary for gene activation and provide a mechanism for somatic inactivation of the FOXP3 protein function in cancer cells. PMID:22152480
Bochkareva, Aleksandra; Zenkin, Nikolay
2013-01-01
The mechanisms of abortive synthesis and promoter escape during initiation of transcription are poorly understood. Here, we show that, after initiation of RNA synthesis, non-specific interaction of σ70 region 1.2, present in all σ70 family factors, with the non-template strand around position −4 relative to the transcription start site facilitates unwinding of the DNA duplex downstream of the transcription start site. This leads to stabilization of short RNA products and allows their extension, i.e. promoter escape. We show that this activity of σ70 region 1.2 is assisted by the β-lobe domain, but does not involve the β′-rudder or the β′-switch-2, earlier proposed to participate in promoter escape. DNA sequence independence of this function of σ70 region 1.2 suggests that it may be conserved in all σ70 family factors. Our results indicate that the abortive nature of initial synthesis is caused, at least in part, by failure to open the downstream DNA by the β-lobe and σ region 1.2. PMID:23430153
Gülşen, İsmail; Ak, Hakan; Evcılı, Gökhan; Balbaloglu, Özlem; Sösüncü, Enver
2013-01-01
Background. In this retrospective study, we aimed to compare the results of two surgical techniques, conventional and transverse mini-incision. Materials and Methods. 95 patients were operated between 2011 and 2012 in Bitlis State Hospital. 50 patients were operated with conventional technique and 45 of them were operated with minimal transverse incision. Postoperative complications, incision site problems, and the time of starting to use their hands in daily activities were noted. Results. 95 patients were included in the study. The mean age was 48. 87 of them were female and 8 were male. There was no problem of incision site in both of the two surgical techniques. Only in one patient, anesthesia developed in minimal incision technique. The time of starting to use their hands in daily activities was 22,2 days and 17 days in conventional and minimal incision technique, respectively. Conclusion. Two surgical techniques did not show superiority to each other in terms of postoperative complications and incision site problems except the time of starting to use their hands in daily activities. PMID:24396607
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, Lei
2008-01-01
Open reading frame 11 (ORF11) of Kaposi's sarcoma-associated herpesvirus belongs to a herpesviral homologous protein family shared by some members of the gamma- herpesvirus subfamily. Little is known about this ORF11 homologous protein family. We have characterized an unknown open reading frame, ORF11, located adjacent and in the opposite orientation to a well-characterized viral IL-6 gene. Northern blot analysis reveals that ORF11 is expressed during the KSHV lytic cycle with delayed-early transcription kinetics. We have determined the 5{prime} and 3{prime} untranslated region of the unspliced ORF11 transcript and identified both the transcription start site and the transcription termination site. Coremore » promoter region, representing ORF11 promoter activity, was mapped to a 159nt fragment 5{prime} most proximal to the transcription start site. A functional TATA box was identified in the core promoter region. Interestingly, we found that ORF11 transcriptional activation is not responsive to Rta, the KSHV lytic switch protein. We also discovered that part of the ORF11 promoter region, the 209nt fragment upstream of the transcription start site, was repressed by phorbol esters. Our data help to understand transcription regulation of ORF11 and to elucidate roles of ORF11 in KSHV pathogenesis and life cycle.« less
Intermediate Outcomes, Strategies, and Challenges of Eight Healthy Start Projects
Walker, Deborah Klein; Hargreaves, Margaret; Rosenbach, Margo
2008-01-01
Site visits were conducted for the evaluation of the national Healthy Start program to gain an understanding of how projects design and implement five service components (outreach, case management, health education, depression screening and interconceptional care) and four system components (consortium, coordination/collaboration, local health system action plan and sustainability) as well as program staff’s perceptions of these components’ influence on intermediate outcomes. Interviews with project directors, case managers, local evaluators, clinicians, consortium members, outreach/lay workers and other stakeholders were conducted during 3-day in-depth site visits with eight Healthy Start grantees. Grantees reported that both services and systems components were related to self-reported service achievements (e.g. earlier entry into prenatal care) and systems achievements (e.g. consumer involvement). Outreach, case management, and health education were perceived as the service components that contributed most to their achievements while consortia was perceived as the most influential systems component in reaching their goals. Furthermore, cultural competence and community voice were overarching project components that addressed racial/ethnic disparities. Finally, there was great variability across sites regarding the challenges they faced, with poor service availability and limited funding the two most frequently reported. Service provision and systems development are both critical for successful Healthy Start projects to achieve intermediate program outcomes. Unique contextual and community issues influence Healthy Start project design, implementation and reported accomplishments. All eight projects implement the required program components yet outreach, case management, and health education are cited most frequently for contributing to their perceived achievements. PMID:19011959
Nahal Ein Gev II, a Late Natufian Community at the Sea of Galilee
Grosman, Leore; Munro, Natalie D.; Abadi, Itay; Boaretto, Elisabetta; Shaham, Dana; Belfer-Cohen, Anna; Bar-Yosef, Ofer
2016-01-01
The Natufian culture is of great importance as a starting point to investigate the dynamics of the transition to agriculture. Given its chronological position at the threshold of the Neolithic (ca. 12,000 years ago) and its geographic setting in the productive Jordan Valley, the site of Nahal Ein Gev II (NEG II) reveals aspects of the Late Natufian adaptations and its implications for the transition to agriculture. The size of the site, the thick archaeological deposits, invested architecture and multiple occupation sub-phases reveal a large, sedentary community at least on par with Early Natufian camps in the Mediterranean zone. Although the NEG II lithic tool kit completely lacks attributes typical of succeeding Pre Pottery Neolithic A (PPNA) assemblages, the artistic style is more closely related to the early PPNA world, despite clear roots in Early Natufian tradition. The site does not conform to current perceptions of the Late Natufians as a largely mobile population coping with reduced resource productivity caused by the Younger Dryas. Instead, the faunal and architectural data suggest that the sedentary populations of the Early Natufian did not revert back to a nomadic way of life in the Late Natufian in the Jordan Valley. NEG II encapsulates cultural characteristics typical of both Natufian and PPNA traditions and thus bridges the crossroads between Late Paleolithic foragers and Neolithic farmers. PMID:26815363
Fluorophore Labeled Kinase Detects Ligands That Bind within the MAPK Insert of p38α Kinase
Termathe, Martin; Grütter, Christian; Rabiller, Matthias; van Otterlo, Willem A. L.; Rauh, Daniel
2012-01-01
The vast majority of small molecules known to modulate kinase activity, target the highly conserved ATP-pocket. Consequently, such ligands are often less specific and in case of inhibitors, this leads to the inhibition of multiple kinases. Thus, selective modulation of kinase function remains a major hurdle. One of the next great challenges in kinase research is the identification of ligands which bind to less conserved sites and target the non-catalytic functions of protein kinases. However, approaches that allow for the unambiguous identification of molecules that bind to these less conserved sites are few in number. We have previously reported the use of fluorescent labels in kinases (FLiK) to develop direct kinase binding assays that exclusively detect ligands which stabilize inactive (DFG-out) kinase conformations. Here, we present the successful application of the FLiK approach to develop a high-throughput binding assay capable of directly monitoring ligand binding to a remote site within the MAPK insert of p38α mitogen-activated protein kinase (MAPK). Guided by the crystal structure of an initially identified hit molecule in complex with p38α, we developed a tight binding ligand which may serve as an ideal starting point for further investigations of the biological function of the MAPK insert in regulating the p38α signaling pathway. PMID:22768308
Cistrome of the aldosterone-activated mineralocorticoid receptor in human renal cells.
Le Billan, Florian; Khan, Junaid A; Lamribet, Khadija; Viengchareun, Say; Bouligand, Jérôme; Fagart, Jérôme; Lombès, Marc
2015-09-01
Aldosterone exerts its effects mainly by activating the mineralocorticoid receptor (MR), a transcription factor that regulates gene expression through complex and dynamic interactions with coregulators and transcriptional machinery, leading to fine-tuned control of vectorial ionic transport in the distal nephron. To identify genome-wide aldosterone-regulated MR targets in human renal cells, we set up a chromatin immunoprecipitation (ChIP) assay by using a specific anti-MR antibody in a differentiated human renal cell line expressing green fluorescent protein (GFP)-MR. This approach, coupled with high-throughput sequencing, allowed identification of 974 genomic MR targets. Computational analysis identified an MR response element (MRE) including single or multiple half-sites and palindromic motifs in which the AGtACAgxatGTtCt sequence was the most prevalent motif. Most genomic MR-binding sites (MBSs) are located >10 kb from the transcriptional start sites of target genes (84%). Specific aldosterone-induced recruitment of MR on the first most relevant genomic sequences was further validated by ChIP-quantitative (q)PCR and correlated with concomitant and positive aldosterone-activated transcriptional regulation of the corresponding gene, as assayed by RT-qPCR. It was notable that most MBSs lacked MREs but harbored DNA recognition motifs for other transcription factors (FOX, EGR1, AP1, PAX5) suggesting functional interaction. This work provides new insights into aldosterone MR-mediated renal signaling and opens relevant perspectives for mineralocorticoid-related pathophysiology. © FASEB.
Medicinal chemistry of P2X receptors: allosteric modulators.
Müller, Christa E
2015-01-01
P2X receptors are trimeric ligand-gated ion channels whose potential as novel drug targets for a number of diseases has been recognized. They are mainly involved in inflammatory processes, including neuroinflammation, and pain sensation. The orthosteric binding site is lined by basic amino acid residues that bind the negatively charged agonist ATP. Therefore it is not easy to develop orthosteric ligands that possess drug-like properties for such a highly polar binding site. However, ligand-gated ion channels offer multiple additional binding sites for allosteric ligands, positive or negative allosteric modulators enhancing or blocking receptor function. So far, the P2X3 (and P2X2/3), as well as the P2X7 receptor subtype have been the main focus of drug development efforts. A number of potent and selective allosteric antagonists have been developed to block these receptors. We start to see the development of novel allosteric ligands also for the other P2X receptor subtypes, P2X1, P2X2 and especially P2X4. The times when only poor, non-selective, non-drug-like tools for studying P2X receptor function were available have been overcome. The first clinical studies with allosteric P2X3 and P2X7 antagonists suggest that P2X therapeutics may soon become a reality.
Nahal Ein Gev II, a Late Natufian Community at the Sea of Galilee.
Grosman, Leore; Munro, Natalie D; Abadi, Itay; Boaretto, Elisabetta; Shaham, Dana; Belfer-Cohen, Anna; Bar-Yosef, Ofer
2016-01-01
The Natufian culture is of great importance as a starting point to investigate the dynamics of the transition to agriculture. Given its chronological position at the threshold of the Neolithic (ca. 12,000 years ago) and its geographic setting in the productive Jordan Valley, the site of Nahal Ein Gev II (NEG II) reveals aspects of the Late Natufian adaptations and its implications for the transition to agriculture. The size of the site, the thick archaeological deposits, invested architecture and multiple occupation sub-phases reveal a large, sedentary community at least on par with Early Natufian camps in the Mediterranean zone. Although the NEG II lithic tool kit completely lacks attributes typical of succeeding Pre Pottery Neolithic A (PPNA) assemblages, the artistic style is more closely related to the early PPNA world, despite clear roots in Early Natufian tradition. The site does not conform to current perceptions of the Late Natufians as a largely mobile population coping with reduced resource productivity caused by the Younger Dryas. Instead, the faunal and architectural data suggest that the sedentary populations of the Early Natufian did not revert back to a nomadic way of life in the Late Natufian in the Jordan Valley. NEG II encapsulates cultural characteristics typical of both Natufian and PPNA traditions and thus bridges the crossroads between Late Paleolithic foragers and Neolithic farmers.
Dust Storm Impacts on Human Mars Mission Equipment and Operations
NASA Technical Reports Server (NTRS)
Rucker, M. A.
2017-01-01
Although it is tempting to use dust impacts on Apollo lunar exploration mission equipment and operations as an analog for human Mars exploration, there are a number of important differences to consider. Apollo missions were about a week long; a human Mars mission will start at least two years before crew depart from Earth, when cargo is pre-deployed, and crewed mission duration may be over 800 days. Each Apollo mission landed at a different site; although no decisions have been made, NASA is investigating multiple human missions to a single Mars landing site, building up capability over time and lowering costs by re-using surface infrastructure. Apollo missions used two, single-use spacecraft; a human Mars mission may require as many as six craft for different phases of the mission, most of which would be re-used by subsequent crews. Apollo crews never ventured more than a few kilometers from their lander; Mars crews may take "camping trips" a hundred kilo-meters or more from their landing site, utilizing pressurized rovers to explore far from their base. Apollo mission designers weren't constrained by human for-ward contamination of the Moon; if we plan to search for evidence of life on Mars we'll have to be more careful. These differences all impact how we will mitigate and manage dust on our human Mars mission equipment and operations.
Ferris, Maria; Norwood, Victoria; Radeva, Milena; Gassman, Jennifer J; Al-Uzri, Amira; Askenazi, David; Matoo, Tej; Pinsk, Maury; Sharma, Amita; Smoyer, William; Stults, Jenna; Vyas, Shefali; Weiss, Robert; Gipson, Debbie; Kaskel, Frederick; Friedman, Aaron; Moxey-Mims, Marva; Trachtman, Howard
2013-02-01
We describe the experience of the focal segmental glomerulosclerosis clinical trial (FSGS CT) in the identification and recruitment of participants into the study. This National Institutes of Health funded study, a multicenter, open-label, randomized comparison of cyclosporine versus oral dexamethasone pulses plus mycophenolate mofetil, experienced difficulty and delays meeting enrollment goals. These problems occurred despite the support of patient advocacy groups and aggressive recruitment strategies. Multiple barriers were identified including: (1) inaccurate estimates of the number of potential incident FSGS patients at participating centers; (2) delays in securing one of the test agents; (3) prolonged time between IRB approval and execution of a subcontract (mean 7.5 ± 0.8 months); (4) prolonged time between IRB approval and enrollment of the first patient at participating sites (mean 19.6 ± 1.4 months); and (5) reorganization of clinical coordinating core infrastructure to align resources with enrollment. A Web-based anonymous survey of site investigators revealed site-related barriers to patient recruitment. The value of a variety of recruitment tools was of marginal utility in facilitating patient enrollment. We conclude that improvements in the logistics of study approval and regulatory start-up and testing of promising novel agents are important factors in promoting enrollment into randomized clinical trials in nephrology. © 2013 Wiley Periodicals, Inc.
A Comparative Study of Immigrant Children Starting Childcare
ERIC Educational Resources Information Center
Guo, Karen
2017-01-01
This comparative study investigated the experiences of starting childcare of three immigrant children in three different learning environments in New Zealand. The notion of learning environment was explored as a way of thinking about how different people, places, and approaches to learning have interacted to create a particular site for the…
Grandparent Headed Families and Head Start: Developing Effective Services.
ERIC Educational Resources Information Center
Dannison, Linda L.; Smith, Andrea B.
Numerous challenges face the growing number of grandparent-headed households, including isolation from friends and social supports, and difficulties in caring for grandchildren exhibiting multiple needs. This paper describes a pilot program in which a university and a large county-wide Head Start program formed a partnership to focus on serving…
ERIC Educational Resources Information Center
Friedman, Mollie; Woods, Juliann
2015-01-01
This study investigates the use of a situated coaching protocol in Early Head Start (EHS) classrooms to increase teachers' use of communication facilitation strategies with children identified with delays during typical play and caregiving routines. A single-case, multiple baseline design across 3 EHS teachers and children with communication…
Child and Family Development Research. OPRE Report 2014-89
ERIC Educational Resources Information Center
Administration for Children & Families, 2014
2014-01-01
This catalog provides short descriptions of major Division of Child and Family Development (DCFD) projects from Fiscal Year 2014. Multiple projects are described in the areas of child care, Head Start/Early Head Start, child welfare promotion, and the recognition of cultural diversity. An additional section features projects that fall into more…
Father Beliefs as a Mediator between Contextual Barriers and Father Involvement
ERIC Educational Resources Information Center
Freeman, Harry; Newland, Lisa A.; Coyl, Diana D.
2008-01-01
Fathers' beliefs were examined as mediators between multiple risk factors and involvement practices with children age zero to five enrolled in Head Start or Early Head Start. A diverse sample of 101 fathers, living in rural Midwestern communities of the USA completed questionnaires assessing "mediators" (i.e. parenting efficacy, role beliefs, and…
Diffusional correlations among multiple active sites in a single enzyme.
Echeverria, Carlos; Kapral, Raymond
2014-04-07
Simulations of the enzymatic dynamics of a model enzyme containing multiple substrate binding sites indicate the existence of diffusional correlations in the chemical reactivity of the active sites. A coarse-grain, particle-based, mesoscopic description of the system, comprising the enzyme, the substrate, the product and solvent, is constructed to study these effects. The reactive and non-reactive dynamics is followed using a hybrid scheme that combines molecular dynamics for the enzyme, substrate and product molecules with multiparticle collision dynamics for the solvent. It is found that the reactivity of an individual active site in the multiple-active-site enzyme is reduced substantially, and this effect is analyzed and attributed to diffusive competition for the substrate among the different active sites in the enzyme.
ATP Synthase: A Molecular Therapeutic Drug Target for Antimicrobial and Antitumor Peptides
Ahmad, Zulfiqar; Okafor, Florence; Azim, Sofiya; Laughlin, Thomas F.
2015-01-01
In this review we discuss the role of ATP synthase as a molecular drug target for natural and synthetic antimi-crobial/antitumor peptides. We start with an introduction of the universal nature of the ATP synthase enzyme and its role as a biological nanomotor. Significant structural features required for catalytic activity and motor functions of ATP synthase are described. Relevant details regarding the presence of ATP synthase on the surface of several animal cell types, where it is associated with multiple cellular processes making it a potential drug target with respect to antimicrobial peptides and other inhibitors such as dietary polyphenols, is also reviewed. ATP synthase is known to have about twelve discrete inhibitor binding sites including peptides and other inhibitors located at the interface of α/β subunits on the F1 sector of the enzyme. Molecular interaction of peptides at the β DEELSEED site on ATP synthase is discussed with specific examples. An inhibitory effect of other natural/synthetic inhibitors on ATP is highlighted to explore the therapeutic roles played by peptides and other inhibitors. Lastly, the effect of peptides on the inhibition of the Escherichia coli model system through their action on ATP synthase is presented. PMID:23432591
Combining multiple ChIP-seq peak detection systems using combinatorial fusion.
Schweikert, Christina; Brown, Stuart; Tang, Zuojian; Smith, Phillip R; Hsu, D Frank
2012-01-01
Due to the recent rapid development in ChIP-seq technologies, which uses high-throughput next-generation DNA sequencing to identify the targets of Chromatin Immunoprecipitation, there is an increasing amount of sequencing data being generated that provides us with greater opportunity to analyze genome-wide protein-DNA interactions. In particular, we are interested in evaluating and enhancing computational and statistical techniques for locating protein binding sites. Many peak detection systems have been developed; in this study, we utilize the following six: CisGenome, MACS, PeakSeq, QuEST, SISSRs, and TRLocator. We define two methods to merge and rescore the regions of two peak detection systems and analyze the performance based on average precision and coverage of transcription start sites. The results indicate that ChIP-seq peak detection can be improved by fusion using score or rank combination. Our method of combination and fusion analysis would provide a means for generic assessment of available technologies and systems and assist researchers in choosing an appropriate system (or fusion method) for analyzing ChIP-seq data. This analysis offers an alternate approach for increasing true positive rates, while decreasing false positive rates and hence improving the ChIP-seq peak identification process.
RNA Editing and Its Molecular Mechanism in Plant Organelles
Ichinose, Mizuho; Sugita, Mamoru
2016-01-01
RNA editing by cytidine (C) to uridine (U) conversions is widespread in plant mitochondria and chloroplasts. In some plant taxa, “reverse” U-to-C editing also occurs. However, to date, no instance of RNA editing has yet been reported in green algae and the complex thalloid liverworts. RNA editing may have evolved in early land plants 450 million years ago. However, in some plant species, including the liverwort, Marchantia polymorpha, editing may have been lost during evolution. Most RNA editing events can restore the evolutionarily conserved amino acid residues in mRNAs or create translation start and stop codons. Therefore, RNA editing is an essential process to maintain genetic information at the RNA level. Individual RNA editing sites are recognized by plant-specific pentatricopeptide repeat (PPR) proteins that are encoded in the nuclear genome. These PPR proteins are characterized by repeat elements that bind specifically to RNA sequences upstream of target editing sites. In flowering plants, non-PPR proteins also participate in multiple RNA editing events as auxiliary factors. C-to-U editing can be explained by cytidine deamination. The proteins discovered to date are important factors for RNA editing but a bona fide RNA editing enzyme has yet to be identified. PMID:28025543
After-School Spaces: Looking for Learning in All the Right Places
NASA Astrophysics Data System (ADS)
Schnittka, Christine G.; Evans, Michael A.; Won, Samantha G. L.; Drape, Tiffany A.
2016-06-01
After-school settings provide youth with homework support, social outlets and fun activities, and help build self-confidence. They are safe places for forming relationships with caring adults. More after-school settings are starting to integrate Science, Technology, Engineering, and Mathematics (STEM) topics. What science skills and concepts might youth learn in engineering design-based after-school settings? Traditional assessments often fail to capture the ways youth learn in informal settings, and deep science understandings are notoriously difficult to measure. In this study, we examined three after-school settings where 65 youth were learning science through engineering design challenges. In this informal setting, we examined storyboards, social networking forum (SNF) chat logs, videos of whole-class interactions, interviews with groups and single participants, and traditional multiple-choice pre- and posttest results. As we looked for evidence of learning, we found that the social networking forum was rich with data. Interviews were even more informative, much more so than traditional pencil and paper multiple-choice tests. We found that different kinds of elicitation strategies adopted by site leaders and facilitators played an important role in the ways youth constructed knowledge. These elicitation strategies also helped us find evidence of learning. Based on findings, future iterations of the curricula will involve tighter integration of social networking forums, continued use of videotaped interviews for data collection, an increased focus on training site leaders and facilitators in elicitation strategies, and more open-ended pencil and paper assessments in order to facilitate the process of looking for learning.
The Micro-Pulse Lidar Network (MPL-Net)
NASA Technical Reports Server (NTRS)
Welton, Ellsworth J.; Campbell, James R.; Berkoff, Timothy A.; Spinhirne, James D.; Tsay, Si-Chee; Holben, Brent; Shiobara, Masataka; Starr, David OC. (Technical Monitor)
2002-01-01
In the early 1990s, the first small, eye-safe, and autonomous lidar system was developed, the Micro-pulse Lidar (MPL). The MPL has proven to be useful in the field because it can be automated, runs continuously (day and night), is eye-safe, can easily be transported and set up, and has a small field-of-view which limits multiple scattering concerns. The MPL acquires signal profiles of backscattered laser light from aerosols and clouds. The signals are analyzed to yield multiple layer heights, optical depths of each layer, average extinction-to-backscatter ratio of each layer, and profiles of extinction in each layer. The MPL has been used in a wide variety of field studies over the past 10 years, leading to nearly 20 papers and many conference presentations. In 2000, a new project using MPL systems was started at NASA Goddard Space Flight Center. The MPL-Net project is currently working to establish a worldwide network of MPL systems, all co-located with NASA's AERONET sunphotometers for joint measurements of optical depth and sky radiance. Automated processing algorithms have been developed to produce data products on a next day basis for all sites and some field experiments. Initial results from the first several sites are shown, along with aerosol data collected during several major field campaigns. Measurements of the aerosol extinction-to-backscatter ratio at several different geographic regions, and for various aerosol types are shown. This information is used to improve the construction of look up tables of the ratio, needed to process aerosol profiles acquired with satellite based lidars.
NASA Astrophysics Data System (ADS)
Thornton, P. E.; Nacp Site Synthesis Participants
2010-12-01
The North American Carbon Program (NACP) synthesis effort includes an extensive intercomparison of modeled and observed ecosystem states and fluxes preformed with multiple models across multiple sites. The participating models span a range of complexity and intended application, while the participating sites cover a broad range of natural and managed ecosystems in North America, from the subtropics to arctic tundra, and coastal to interior climates. A unique characteristic of this collaborative effort is that multiple independent observations are available at all sites: fluxes are measured with the eddy covariance technique, and standard biometric and field sampling methods provide estimates of standing stock and annual production in multiple categories. In addition, multiple modeling approaches are employed to make predictions at each site, varying, for example, in the use of diagnostic vs. prognostic leaf area index. Given multiple independent observational constraints and multiple classes of model, we evaluate the internal consistency of observations at each site, and use this information to extend previously derived estimates of uncertainty in the flux observations. Model results are then compared with all available observations and models are ranked according to their consistency with each type of observation (high frequency flux measurement, carbon stock, annual production). We demonstrate a range of internal consistency across the sites, and show that some models which perform well against one observational metric perform poorly against others. We use this analysis to construct a hypothesis for combining eddy covariance, biometrics, and other standard physiological and ecological measurements which, as data collection proceeded over several years, would present an increasingly challenging target for next generation models.
Evaluation of a social marketing campaign targeting preschool children.
Johnson, Susan L; Bellows, Laura; Beckstrom, Leslie; Anderson, Jennifer
2007-01-01
To determine the effectiveness of a pilot social marketing program to increase preschoolers' willingness to try new foods. Four Head Start centers participated (2 experimental, 2 control) in a study using a quasi-experimental design. Experimental sites received a 12-week intervention developed using social marketing techniques. The program was evaluated via preference assessments, classroom observations, and teacher surveys. Increased preference for and willingness to try new foods were observed in children from the experimental sites (P<0.05). The program was positively received by Head Start staff. A social marketing campaign is an effective method to reduce children's neophobia.
Navigation analysis for Viking 1979, option B
NASA Technical Reports Server (NTRS)
Mitchell, P. H.
1971-01-01
A parametric study performed for 48 trans-Mars reference missions in support of the Viking program is reported. The launch dates cover several months in the year 1979, and each launch date has multiple arrival dates in 1980. A plot of launch versus arrival dates with case numbers designated for reference purposes is included. The analysis consists of the computation of statistical covariance matrices based on certain assumptions about the ground-based tracking systems. The error model statistics are listed in tables. Tracking systems were assumed at three sites: Goldstone, California; Canberra, Australia; and Madrid, Spain. The tracking data consisted of range and Doppler measurements taken during the tracking intervals starting at E-30(d) and ending at E-10(d) for the control data and ending at E-18(h) for the knowledge data. The control and knowledge covariance matrices were delivered to the Planetary Mission Analysis Branch for inputs into a delta V dispersion analysis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Arnold, Bill Walter; Chang, Fu-lin; Mattie, Patrick D.
2006-02-01
Sandia National Laboratories (SNL) and Taiwan's Institute for Nuclear Energy Research (INER) have teamed together to evaluate several candidate sites for Low-Level Radioactive Waste (LLW) disposal in Taiwan. Taiwan currently has three nuclear power plants, with another under construction. Taiwan also has a research reactor, as well as medical and industrial wastes to contend with. Eventually the reactors will be decomissioned. Operational and decommissioning wastes will need to be disposed in a licensed disposal facility starting in 2014. Taiwan has adopted regulations similar to the US Nuclear Regulatory Commission's (NRC's) low-level radioactive waste rules (10 CFR 61) to govern themore » disposal of LLW. Taiwan has proposed several potential sites for the final disposal of LLW that is now in temporary storage on Lanyu Island and on-site at operating nuclear power plants, and for waste generated in the future through 2045. The planned final disposal facility will have a capacity of approximately 966,000 55-gallon drums. Taiwan is in the process of evaluating the best candidate site to pursue for licensing. Among these proposed sites there are basically two disposal concepts: shallow land burial and cavern disposal. A representative potential site for shallow land burial is located on a small island in the Taiwan Strait with basalt bedrock and interbedded sedimentary rocks. An engineered cover system would be constructed to limit infiltration for shallow land burial. A representative potential site for cavern disposal is located along the southeastern coast of Taiwan in a tunnel system that would be about 500 to 800 m below the surface. Bedrock at this site consists of argillite and meta-sedimentary rocks. Performance assessment analyses will be performed to evaluate future performance of the facility and the potential dose/risk to exposed populations. Preliminary performance assessment analyses will be used in the site-selection process and to aid in design of the disposal system. Final performance assessment analyses will be used in the regulatory process of licensing a site. The SNL/INER team has developed a performance assessment methodology that is used to simulate processes associated with the potential release of radionuclides to evaluate these sites. The following software codes are utilized in the performance assessment methodology: GoldSim (to implement a probabilistic analysis that will explicitly address uncertainties); the NRC's Breach, Leach, and Transport - Multiple Species (BLT-MS) code (to simulate waste-container degradation, waste-form leaching, and transport through the host rock); the Finite Element Heat and Mass Transfer code (FEHM) (to simulate groundwater flow and estimate flow velocities); the Hydrologic Evaluation of Landfill performance Model (HELP) code (to evaluate infiltration through the disposal cover); the AMBER code (to evaluate human health exposures); and the NRC's Disposal Unit Source Term -- Multiple Species (DUST-MS) code (to screen applicable radionuclides). Preliminary results of the evaluations of the two disposal concept sites are presented.« less
SPAGETTA, a Gridded Weather Generator: Calibration, Validation and its Use for Future Climate
NASA Astrophysics Data System (ADS)
Dubrovsky, Martin; Rotach, Mathias W.; Huth, Radan
2017-04-01
Spagetta is a new (started in 2016) stochastic multi-site multi-variate weather generator (WG). It can produce realistic synthetic daily (or monthly, or annual) weather series representing both present and future climate conditions at multiple sites (grids or stations irregularly distributed in space). The generator, whose model is based on the Wilks' (1999) multi-site extension of the parametric (Richardson's type) single site M&Rfi generator, may be run in two modes: In the first mode, it is run as a classical generator, which is calibrated in the first step using weather data from multiple sites, and only then it may produce arbitrarily long synthetic time series mimicking the spatial and temporal structure of the calibration weather data. To generate the weather series representing the future climate, the WG parameters are modified according to the climate change scenario, typically derived from GCM or RCM simulations. In the second mode, the user provides only basic information (not necessarily to be realistic) on the temporal and spatial auto-correlation structure of the surface weather variables and their mean annual cycle; the generator itself derives the parameters of the underlying autoregressive model, which produces the multi-site weather series. In the latter mode of operation, the user is allowed to prescribe the spatially varying trend, which is superimposed to the values produced by the generator; this feature has been implemented for use in developing the methodology for assessing significance of trends in multi-site weather series (for more details see another EGU-2017 contribution: Huth and Dubrovsky, 2017, Evaluating collective significance of climatic trends: A comparison of methods on synthetic data; EGU2017-4993). This contribution will focus on the first (classical) mode. The poster will present (a) model of the generator, (b) results of the validation tests made in terms of the spatial hot/cold/dry/wet spells, and (c) results of the pilot climate change impact experiment, in which (i) the WG parameters representing the spatial and temporal variability are modified using the climate change scenarios and then (ii) the effect on the above spatial validation indices derived from the synthetic series produced by the modified WG is analysed. In this experiment, the generator is calibrated using the E-OBS gridded daily weather data for several European regions, and the climate change scenarios are derived from the selected RCM simulation (taken from the CORDEX database).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schneemann, Matthias; Carius, Reinhard; Rau, Uwe
2015-05-28
This paper studies the effective electrical size and carrier multiplication of breakdown sites in multi-crystalline silicon solar cells. The local series resistance limits the current of each breakdown site and is thereby linearizing the current-voltage characteristic. This fact allows the estimation of the effective electrical diameters to be as low as 100 nm. Using a laser beam induced current (LBIC) measurement with a high spatial resolution, we find carrier multiplication factors on the order of 30 (Zener-type breakdown) and 100 (avalanche breakdown) as new lower limits. Hence, we prove that also the so-called Zener-type breakdown is followed by avalanche multiplication. Wemore » explain that previous measurements of the carrier multiplication using thermography yield results higher than unity, only if the spatial defect density is high enough, and the illumination intensity is lower than what was used for the LBIC method. The individual series resistances of the breakdown sites limit the current through these breakdown sites. Therefore, the measured multiplication factors depend on the applied voltage as well as on the injected photocurrent. Both dependencies are successfully simulated using a series-resistance-limited diode model.« less
Are Prospective English Teachers Linguistically Intelligent?
ERIC Educational Resources Information Center
Tezel, Kadir Vefa
2017-01-01
Language is normally associated with linguistic capabilities of individuals. In the theory of multiple intelligences, language is considered to be related primarily to linguistic intelligence. Using the theory of Multiple Intelligences as its starting point, this descriptive survey study investigated to what extent prospective English teachers'…
Kamuyango, Alfred A.; Hirschhorn, Lisa R; Wang, Wenjia; Jansen, Perry; Hoffman, Risa M.
2015-01-01
Objective To compare one-year outcomes of women started on antiretroviral therapy (ART) during pregnancy in the pre-Option B+ era to those in the Option B+ era. Methods A retrospective chart review was performed at three sites in Malawi. Women were included in the ‘pre-Option B+’ cohort if they started ART during pregnancy for a CD4 count < 350 cells/mm3 or WHO 3/4 condition and in the ‘Option B+’ cohort if they started ART during pregnancy regardless of CD4 count or clinical stage. One-year outcomes were compared using Fisher's exact and ANOVA F-tests. Results A higher proportion of women in the pre-Option B+ cohort started ART at WHO stage 3/4 (11.9% versus 1.1%, P < 0.001), switched ART regimens (5.9% versus 0%, P = 0.002), or died in the first year after starting treatment (3.9% versus .5%, P = 0.05). While more women in the Option B+ cohort had poor adherence or defaulted, these differences were not significant. Conclusions At our study sites, the transition to Option B+ has been associated with ART initiation in women with less advanced HIV infection, improved medication tolerability, and lower mortality. Further research is needed to better understand outcomes of Option B+. PMID:25774326
Kamuyango, Alfred A; Hirschhorn, Lisa R; Wang, Wenjia; Jansen, Perry; Hoffman, Risa M
2014-09-01
To compare one-year outcomes of women started on antiretroviral therapy (ART) during pregnancy in the pre-Option B+ era to those in the Option B+ era. A retrospective chart review was performed at three sites in Malawi. Women were included in the 'pre-Option B+' cohort if they started ART during pregnancy for a CD4 count < 350 cells/mm 3 or WHO 3/4 condition and in the 'Option B+' cohort if they started ART during pregnancy regardless of CD4 count or clinical stage. One-year outcomes were compared using Fisher's exact and ANOVA F-tests. A higher proportion of women in the pre-Option B+ cohort started ART at WHO stage 3/4 (11.9% versus 1.1%, P < 0.001), switched ART regimens (5.9% versus 0%, P = 0.002), or died in the first year after starting treatment (3.9% versus .5%, P = 0.05). While more women in the Option B+ cohort had poor adherence or defaulted, these differences were not significant. At our study sites, the transition to Option B+ has been associated with ART initiation in women with less advanced HIV infection, improved medication tolerability, and lower mortality. Further research is needed to better understand outcomes of Option B+.
Module 3: Text Versions | State, Local, and Tribal Governments | NREL
walk through the key considerations and activities that should be performed when evaluating a site for speak about larger systems. So generally when you start thinking about site evaluation and kinda moving some of the key considerations, key things that should be considered when you're doing a site
EPA True NO2 ground site measurements ?? multiple sites - http://www-air.larc.nasa.gov/cgi-bin/ArcView/discover-aq.tx-2013; TCEQ ground site measurements of meteorological and air pollution parameters ?? multiple sites - http://www-air.larc.nasa.gov/cgi-bin/ArcView/discover-aq.tx-2013; GeoTASO NO2 Vertical Column - http://www-air.larc.nasa.gov/cgi-bin/ArcView/discover-aq.tx-2013?FALCON=1This dataset is associated with the following publication:Nowlan, C., X. Lu, J. Leitch, K. Chance, G. González Abad, C. Lu, P. Zoogman, J. Cole, T. Delker, W. Good, F. Murcray, L. Ruppert, D. Soo, M. Follette-Cook, S. Janz, M. Kowalewski, C. Loughner, K. Pickering, J. Herman, M. Beaver, R. Long, J. Szykman, L. Judd, P. Kelley, W. Luke, X. Ren, and J. Al-Saadi. Nitrogen dioxide observations from the Geostationary Trace gas and Aerosol Sensor Optimization (GeoTASO) airborne instrument: Retrieval algorithm and measurements during DISCOVER-AQ Texas 2013. Atmospheric Measurement Techniques. Copernicus Publications, Katlenburg-Lindau, GERMANY, 9(6): 2647-2668, (2016).
Engineering a plant community to deliver multiple ecosystem services.
Storkey, Jonathan; Döring, Thomas; Baddeley, John; Collins, Rosemary; Roderick, Stephen; Jones, Hannah; Watson, Christine
2015-06-01
The sustainable delivery of multiple ecosystem services requires the management of functionally diverse biological communities. In an agricultural context, an emphasis on food production has often led to a loss of biodiversity to the detriment of other ecosystem services such as the maintenance of soil health and pest regulation. In scenarios where multiple species can be grown together, it may be possible to better balance environmental and agronomic services through the targeted selection of companion species. We used the case study of legume-based cover crops to engineer a plant community that delivered the optimal balance of six ecosystem services: early productivity, regrowth following mowing, weed suppression, support of invertebrates, soil fertility building (measured as yield of following crop), and conservation of nutrients in the soil. An experimental species pool of 12 cultivated legume species was screened for a range of functional traits and ecosystem services at five sites across a geographical gradient in the United Kingdom. All possible species combinations were then analyzed, using a process-based model of plant competition, to identify the community that delivered the best balance of services at each site. In our system, low to intermediate levels of species richness (one to four species) that exploited functional contrasts in growth habit and phenology were identified as being optimal. The optimal solution was determined largely by the number of species and functional diversity represented by the starting species pool, emphasizing the importance of the initial selection of species for the screening experiments. The approach of using relationships between functional traits and ecosystem services to design multifunctional biological communities has the potential to inform the design of agricultural systems that better balance agronomic and environmental services and meet the current objective of European agricultural policy to maintain viable food production in the context of the sustainable management of natural resources.
Panni, M K; Shah, S J; Chavarro, C; Rawl, M; Wojnarwsky, P K; Panni, J K
2013-10-01
There are multiple components leading to improved operating room efficiency. We undertook a project focusing on first case starts; accounting for each delay component on a global basis. Our hypothesis was there would be a reduction in first start delays after we implemented strategies to address the issues identified through this accounting process. An orange sheet checklist was implemented, with specific items that needed to be clear prior to roll back to the operating room (OR), and an OR facilitator was employed to intervene whenever there were any missing items needed for a specific patient. We present the data from this quality improvement project over an 18-month period. Initially, 10.07 (± 0.73) delayed first starts occurred per day but declined steadily over time to a low of 4.95 (± 0.38) per day after 6 months (-49.2 %, P < 0.001). By the end of the project, the most common reasons for delay still included late surgical attending (19%), schedule changes (14%) as well as 'other reasons' (13%), but with an overall reduction per day of each. Total anaesthesia delay initially totalled 11% of the first start delays, but was negligible (< 1%) at the project's completion. While we have a challenging operating room environment based on our patient population, multiple trainees in both the surgery and anaesthesiology teams: an orange sheet - pre-operative checklist in addition to a dedicated pre-operative facilitator; allowed us to make a substantial improvement in our first start on time starts. © 2013 The Acta Anaesthesiologica Scandinavica Foundation. Published by John Wiley & Sons Ltd.
Speeding on the Information Superhighway: Strategies for Saving Time on the Web.
ERIC Educational Resources Information Center
Colaric, Susan M.; Carr-Chellman, Alison A.
2000-01-01
Outlines ways to make online searching more efficient. Highlights include starting with printed materials; online reference libraries; subject directories such as Yahoo; search engines; evaluating Web sites, including reliability; bookmarking helpful sites; and using links. (LRW)
Analysis Concerning the Inspection Threshold for Multi-Site Damage.
DOT National Transportation Integrated Search
1993-12-01
Periodic inspections, at a prescribed interval, for Multi-Site Damage (MS) in longitudinal fuselage lap-joints start when the aircraft has accumulated a certain number of flights, the inspection threshold. The work reported here was an attempt to obt...
Park, Sung Woo; Oh, Tae Suk; Eom, Jin Sup; Sun, Yoon Chi; Suh, Hyun Suk; Hong, Joon Pio
2015-05-01
The reconstruction of the posterior trunk remains to be a challenge as defects can be extensive, with deep dead space, and fixation devices exposed. Our goal was to achieve a tension-free closure for complex defects on the posterior trunk. From August 2006 to May 2013, 18 cases were reconstructed with multiple flaps combining perforator(s) and local skin flaps. The reconstructions were performed using freestyle approach. Starting with propeller flap(s) in single or multilobed design and sequentially in conjunction with adjacent random pattern flaps such as fitting puzzle. All defects achieved tensionless primary closure. The final appearance resembled a jigsaw puzzle-like appearance. The average size of defect was 139.6 cm(2) (range, 36-345 cm(2)). A total of 26 perforator flaps were used in addition to 19 random pattern flaps for 18 cases. In all cases, a single perforator was used for each propeller flap. The defect and the donor site all achieved tension-free closure. The reconstruction was 100% successful without flap loss. One case of late infection was noted at 12 months after surgery. Using multiple lobe designed propeller flaps in conjunction with random pattern flaps in a freestyle approach, resembling putting a jigsaw puzzle together, we can achieve a tension-free closure by distributing the tension to multiple flaps, supplying sufficient volume to obliterate dead space, and have reliable vascularity as the flaps do not need to be oversized. This can be a viable approach to reconstruct extensive defects on the posterior trunk. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.
Bone marrow derived stem cells in joint and bone diseases: a concise review.
Marmotti, Antonio; de Girolamo, Laura; Bonasia, Davide Edoardo; Bruzzone, Matteo; Mattia, Silvia; Rossi, Roberto; Montaruli, Angela; Dettoni, Federico; Castoldi, Filippo; Peretti, Giuseppe
2014-09-01
Stem cells have huge applications in the field of tissue engineering and regenerative medicine. Their use is currently not restricted to the life-threatening diseases but also extended to disorders involving the structural tissues, which may not jeopardize the patients' life, but certainly influence their quality of life. In fact, a particularly popular line of research is represented by the regeneration of bone and cartilage tissues to treat various orthopaedic disorders. Most of these pioneering research lines that aim to create new treatments for diseases that currently have limited therapies are still in the bench of the researchers. However, in recent years, several clinical trials have been started with satisfactory and encouraging results. This article aims to review the concept of stem cells and their characterization in terms of site of residence, differentiation potential and therapeutic prospective. In fact, while only the bone marrow was initially considered as a "reservoir" of this cell population, later, adipose tissue and muscle tissue have provided a considerable amount of cells available for multiple differentiation. In reality, recently, the so-called "stem cell niche" was identified as the perivascular space, recognizing these cells as almost ubiquitous. In the field of bone and joint diseases, their potential to differentiate into multiple cell lines makes their application ideally immediate through three main modalities: (1) cells selected by withdrawal from bone marrow, subsequent culture in the laboratory, and ultimately transplant at the site of injury; (2) bone marrow aspirate, concentrated and directly implanted into the injury site; (3) systemic mobilization of stem cells and other bone marrow precursors by the use of growth factors. The use of this cell population in joint and bone disease will be addressed and discussed, analysing both the clinical outcomes but also the basic research background, which has justified their use for the treatment of bone, cartilage and meniscus tissues.
PNNL Delivers Expertise, Technology to Biofuels Start-up, InEnTec
Surma, Jeff
2017-12-09
Initially through its Entrepreneurial Leave of Absence Program, PNNL gives biofuels innovators a start in opening up a new business based on technology developed for incinerating waste on the Hanford Site. Today, the companies Plasma Enhanced Melters are in operation around the world converting organic waste into valuable, clean fuels.
ERIC Educational Resources Information Center
Edgecombe, Nikki; Jaggars, Shanna Smith; Baker, Elaine DeLott; Bailey, Thomas
2013-01-01
Originally designed for students who test into at least two levels of developmental education in a particular subject area, FastStart is a compressed course program model launched in 2005 at the Community College of Denver (CCD). The program combines multiple semester-length courses into a single intensive semester, while providing case…
ERIC Educational Resources Information Center
Mihai, Alina; Butera, Gretchen; Friesen, Amber
2017-01-01
Research Findings: This qualitative study examined how Head Start teachers thought about children's early literacy and how they enacted their thinking in a year-long curriculum reform effort. Data collected included interviews, observations, questionnaires, concept maps, and teachers' reflections on implementation. The results indicated that as…
Infant Mental Health and Early Head Start: Lessons for Early Childhood Programs.
ERIC Educational Resources Information Center
Fenichel, Emily, Ed.
2001-01-01
"Zero to Three" is a single-focus bulletin of the National Center for Infants, Toddlers, and Families providing insight from multiple disciplines on the development of infants, toddlers, and their families. An outgrowth of the Head Start Forum on Infant Mental Health, this issue focuses on infant mental health and implications for Early…
Evaluation of the Preschool Life Skills Program in Head Start Classrooms: A Systematic Replication
ERIC Educational Resources Information Center
Hanley, Gregory P.; Fahmie, Tara A.; Heal, Nicole A.
2014-01-01
In an attempt to address risk factors associated with extensive nonfamilial child care, we implemented the preschool life skills (PLS) program (Hanley, Heal, Tiger, & Ingvarsson, 2007) in two community-based Head Start classrooms. A multiple baseline design across classrooms, repeated across skills, showed that the program resulted in a 5-fold…
Consistency of gene starts among Burkholderia genomes
2011-01-01
Background Evolutionary divergence in the position of the translational start site among orthologous genes can have significant functional impacts. Divergence can alter the translation rate, degradation rate, subcellular location, and function of the encoded proteins. Results Existing Genbank gene maps for Burkholderia genomes suggest that extensive divergence has occurred--53% of ortholog sets based on Genbank gene maps had inconsistent gene start sites. However, most of these inconsistencies appear to be gene-calling errors. Evolutionary divergence was the most plausible explanation for only 17% of the ortholog sets. Correcting probable errors in the Genbank gene maps decreased the percentage of ortholog sets with inconsistent starts by 68%, increased the percentage of ortholog sets with extractable upstream intergenic regions by 32%, increased the sequence similarity of intergenic regions and predicted proteins, and increased the number of proteins with identifiable signal peptides. Conclusions Our findings highlight an emerging problem in comparative genomics: single-digit percent errors in gene predictions can lead to double-digit percentages of inconsistent ortholog sets. The work demonstrates a simple approach to evaluate and improve the quality of gene maps. PMID:21342528
40 CFR 1066.410 - Dynamometer test procedure.
Code of Federal Regulations, 2014 CFR
2014-07-01
... drive mode. (For purposes of this paragraph (g), the term four-wheel drive includes other multiple drive... Dynamometer test procedure. (a) Dynamometer testing may consist of multiple drive cycles with both cold-start...-setting part identifies the driving schedules and the associated sample intervals, soak periods, engine...
Ethical Considerations of Patient-Funded Research for Multiple Sclerosis Therapeutics.
Amezcua, Lilyana; Nelson, Flavia
2017-10-01
Patient-funded research has started to emerge in multiple sclerosis studies, such as low-dose naltrexone and stem-cell therapy. While these represent greater opportunities for the physician, scientist, and patient, ethical concerns concerning protocol review, conflict of interests, and protection of subjects are reviewed.
Higaki, Takashi; Chisaka, Toshiyuki; Moritani, Tomozo; Ohta, Masaaki; Takata, Hidemi; Yamauchi, Toshifumi; Yamaguchi, Youhei; Konishi, Kyoko; Yamamoto, Eiichi; Ochi, Fumihiro; Eguchi, Mariko; Eguchi-Ishimae, Minenori; Mitani, Yoshihide; Ishii, Eiichi
2016-12-01
Recently, a student died of idiopathic ventricular fibrillation in a school where an automated external defibrillator (AED) had been installed. The tragedy could not be prevented because the only AED in the school was installed in the teachers' office, far from the school ground where the accident took place. This prompted establishment of a multiple AED system in schools. The aim of this study was to analyze the efficacy of the multiple AED system to prevent sudden death in school-aged children. Assumed accident sites consisted of the school ground, gymnasium, Judo and Kendo hall, swimming pool, and classrooms on the first and the fourth floor. Multiple AED were installed in the teachers' office, gymnasium, some classrooms, and also provided as a portable AED in a rucksack. The time from the accident site to the teachers' office for single AED, and from the accident site to the nearest AED for multiple AED, was calculated. The AED retrieval time was significantly shorter in 55 elementary schools and in 29 junior high schools when multiple AED were installed compared with single AED. Except for the classroom on the fourth floor, the number of people who took >120 s to bring the AED to the accident site was lower when multiple AED were installed compared with the single AED. Multiple AED provided in appropriate sites can reduce the time to reach the casualty and hence prevent sudden death in school-aged children. © 2016 Japan Pediatric Society.
Su, Hongsheng
2017-12-18
Distributed power grids generally contain multiple diverse types of distributed generators (DGs). Traditional particle swarm optimization (PSO) and simulated annealing PSO (SA-PSO) algorithms have some deficiencies in site selection and capacity determination of DGs, such as slow convergence speed and easily falling into local trap. In this paper, an improved SA-PSO (ISA-PSO) algorithm is proposed by introducing crossover and mutation operators of genetic algorithm (GA) into SA-PSO, so that the capabilities of the algorithm are well embodied in global searching and local exploration. In addition, diverse types of DGs are made equivalent to four types of nodes in flow calculation by the backward or forward sweep method, and reactive power sharing principles and allocation theory are applied to determine initial reactive power value and execute subsequent correction, thus providing the algorithm a better start to speed up the convergence. Finally, a mathematical model of the minimum economic cost is established for the siting and sizing of DGs under the location and capacity uncertainties of each single DG. Its objective function considers investment and operation cost of DGs, grid loss cost, annual purchase electricity cost, and environmental pollution cost, and the constraints include power flow, bus voltage, conductor current, and DG capacity. Through applications in an IEEE33-node distributed system, it is found that the proposed method can achieve desirable economic efficiency and safer voltage level relative to traditional PSO and SA-PSO algorithms, and is a more effective planning method for the siting and sizing of DGs in distributed power grids.
A Large-Scale, Multiagency Approach to Defining a Reference Network for Pacific Northwest Streams
NASA Astrophysics Data System (ADS)
Miller, Stephanie; Eldred, Peter; Muldoon, Ariel; Anlauf-Dunn, Kara; Stein, Charlie; Hubler, Shannon; Merrick, Lesley; Haxton, Nick; Larson, Chad; Rehn, Andrew; Ode, Peter; Vander Laan, Jake
2016-12-01
Aquatic monitoring programs vary widely in objectives and design. However, each program faces the unifying challenge of assessing conditions and quantifying reasonable expectations for measured indicators. A common approach for setting resource expectations is to define reference conditions that represent areas of least human disturbance or most natural state of a resource characterized by the range of natural variability across a region of interest. Identification of reference sites often relies heavily on professional judgment, resulting in varying and unrepeatable methods. Standardized methods for data collection, site characterization, and reference site selection facilitate greater cooperation among assessment programs and development of assessment tools that are readily shareable and comparable. We illustrate an example that can serve the broader global monitoring community on how to create a consistent and transparent reference network for multiple stream resource agencies. We provide a case study that offers a simple example of how reference sites can be used, at the landscape level, to link upslope management practices to a specific in-channel response. We found management practices, particularly areas with high road densities, have more fine sediments than areas with fewer roads. While this example uses data from only one of the partner agencies, if data were collected in a similar manner they can be combined and create a larger, more robust dataset. We hope that this starts a dialog regarding more standardized ways through inter-agency collaborations to evaluate data. Creating more consistency in physical and biological field protocols will increase the ability to share data.
Adamson, P.; Bishai, M.; Diwan, M. V.; ...
2015-06-09
We report the first observation of seasonal modulations in the rates of cosmic ray multiple-muon events at two underground sites, the MINOS Near Detector with an overburden of 225 mwe, and the MINOS Far Detector site at 2100 mwe. At the deeper site, multiple-muon events with muons separated by more than 8 m exhibit a seasonal rate that peaks during the summer, similar to that of single-muon events. Conversely, the rate of multiple-muon events with muons separated by less than 5–8 m, and the rate of multiple-muon events in the smaller, shallower Near Detector, exhibit a seasonal rate modulation thatmore » peaks in the winter.« less
Dissecting transcription-coupled and global genomic repair in the chromatin of yeast GAL1-10 genes.
Li, Shisheng; Smerdon, Michael J
2004-04-02
Transcription-coupled repair (TCR) and global genomic repair (GGR) of UV-induced cyclobutane pyrimidine dimers were investigated in the yeast GAL1-10 genes. Both Rpb9- and Rad26-mediated TCR are confined to the transcribed strands, initiating at upstream sites approximately 100 nucleotides from the upstream activating sequence shared by the two genes. However, TCR initiation sites do not correlate with either transcription start sites or TATA boxes. Rad16-mediated GGR tightly correlates with nucleosome positioning when the genes are repressed and are slow in the nucleosome core and fast in linker DNA. Induction of transcription enhanced GGR in nucleosome core DNA, especially in the nucleosomes around and upstream of the transcription start sites. Furthermore, when the genes were induced, GGR was slower in the transcribed regions than in the upstream regions. Finally, simultaneous deletion of RAD16, RAD26, and RPB9 resulted in no detectable repair in all sites along the region analyzed. Our results suggest that (a). TCR may be initiated by a transcription activator, presumably through the loading of RNA polymerase II, rather than by transcription initiation or elongation per se; (b). TCR and nucleosome disruption-enhanced GGR are the major causes of rapid repair in regions around and upstream of transcription start sites; (c). transcription machinery may hinder access of NER factors to a DNA lesion in the absence of a transcription-repair coupling factor; and (d). other than GGR mediated by Rad16 and TCR mediated by Rad26 and Rpb9, no other nucleotide excision repair pathway exists in these RNA polymerase II-transcribed genes.
Multiple Site-Directed and Saturation Mutagenesis by the Patch Cloning Method.
Taniguchi, Naohiro; Murakami, Hiroshi
2017-01-01
Constructing protein-coding genes with desired mutations is a basic step for protein engineering. Herein, we describe a multiple site-directed and saturation mutagenesis method, termed MUPAC. This method has been used to introduce multiple site-directed mutations in the green fluorescent protein gene and in the moloney murine leukemia virus reverse transcriptase gene. Moreover, this method was also successfully used to introduce randomized codons at five desired positions in the green fluorescent protein gene, and for simple DNA assembly for cloning.
Polak, Michel; Blair, Jo; Kotnik, Primoz; Pournara, Effie; Pedersen, Birgitte Tønnes; Rohrer, Tilman R
2017-11-01
To investigate the effect of age at growth hormone (GH) treatment start on near adult height (NAH) in children with isolated GH deficiency (GHD). NordiNet® International Outcome Study (IOS) (Nbib960128), a non-interventional, multicentre study, evaluates the long-term effectiveness and safety of Norditropin® (somatropin) (Novo Nordisk A/S) in the real-life clinical setting. Patients ( n = 172) treated to NAH (height at ≥18 years, or height velocity <2 cm/year at ≥16 (boys) or ≥15 (girls) years) were grouped by age (years) at treatment start (early (girls, <8; boys, <9), intermediate (girls, 8-10; boys, 9-11) or late (girls, >10; boys, >11)) and GHD severity (<3 ng/mL or 3 to ≤10 ng/mL). Multiple regression analysis was used to evaluate the effect of age at treatment start (as a categorical and continuous variable) on NAH standard deviation score (SDS). Age at treatment start had a marked effect on NAH SDS; NAH SDS achieved by patients starting treatment early ( n = 40 (boys, 70.0%); least squares mean (standard error) -0.76 (0.14)) exceeded that achieved by those starting later (intermediate, n = 42 (boys, 57.1%); -1.14 (0.15); late, n = 90 (boys, 68.9%); -1.21 (0.10)). Multiple regression analysis showed a significant association between NAH SDS and age at treatment start ( P < 0.0242), baseline height SDS (HSDS) ( P < 0.0001), target HSDS ( P < 0.0001), and GHD severity ( P = 0.0012). Most (78.5%) patients achieved a normal NAH irrespective of age at treatment start. Early initiation of GH treatment in children with isolated GHD improves their chance of achieving their genetic height potential. © 2017 The authors.
You, Qi; Yan, Hengyu; Liu, Yue; Yi, Xin; Zhang, Kang; Xu, Wenying; Su, Zhen
2017-05-01
The 22-nucleotide non-coding microRNAs (miRNAs) are mostly transcribed by RNA polymerase II and are similar to protein-coding genes. Unlike the clear process from stem-loop precursors to mature miRNAs, the primary transcriptional regulation of miRNA, especially in plants, still needs to be further clarified, including the original transcription start site, functional cis-elements and primary transcript structures. Due to several well-characterized transcription signals in the promoter region, we proposed a systemic approach integrating multidimensional "omics" (including genomics, transcriptomics, and epigenomics) data to improve the genome-wide identification of primary miRNA transcripts. Here, we used the model plant Arabidopsis thaliana to improve the ability to identify candidate promoter locations in intergenic miRNAs and to determine rules for identifying primary transcription start sites of miRNAs by integrating high-throughput omics data, such as the DNase I hypersensitive sites, chromatin immunoprecipitation-sequencing of polymerase II and H3K4me3, as well as high throughput transcriptomic data. As a result, 93% of refined primary transcripts could be confirmed by the primer pairs from a previous study. Cis-element and secondary structure analyses also supported the feasibility of our results. This work will contribute to the primary transcriptional regulatory analysis of miRNAs, and the conserved regulatory pattern may be a suitable miRNA characteristic in other plant species.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Adamson, P.; Bishai, M.; Diwan, M. V.
We report the first observation of seasonal modulations in the rates of cosmic ray multiple-muon events at two underground sites, the MINOS Near Detector with an overburden of 225 mwe, and the MINOS Far Detector site at 2100 mwe. At the deeper site, multiple-muon events with muons separated by more than 8 m exhibit a seasonal rate that peaks during the summer, similar to that of single-muon events. Conversely, the rate of multiple-muon events with muons separated by less than 5–8 m, and the rate of multiple-muon events in the smaller, shallower Near Detector, exhibit a seasonal rate modulation thatmore » peaks in the winter.« less
NASA Astrophysics Data System (ADS)
Goto, J.; Miwa, T.; Tsuchi, H.; Karasaki, K.
2009-12-01
The Nuclear Waste Management Organization of Japan (NUMO), after volunteering municipalities arise, will start a three-staged program for selecting a HLW and TRU waste repository site. It is recognized from experiences from various site characterization programs in the world that the hydrologic property of faults is one of the most important parameters in the early stage of the program. It is expected that numerous faults of interest exist in an investigation area of several tens of square kilometers. It is, however, impossible to characterize all these faults in a limited time and budget. This raises problems in the repository designing and safety assessment that we may have to accept unrealistic or over conservative results by using a single model or parameters for all the faults in the area. We, therefore, seek to develop an efficient and practical methodology to characterize hydrologic property of faults. This project is a five year program started in 2007, and comprises the basic methodology development through literature study and its verification through field investigations. The literature study tries to classify faults by correlating their geological features with hydraulic property, to search for the most efficient technology for fault characterization, and to develop a work flow diagram. The field investigation starts from selection of a site and fault(s), followed by existing site data analyses, surface geophysics, geological mapping, trenching, water sampling, a series of borehole investigations and modeling/analyses. Based on the results of the field investigations, we plan to develop a systematic hydrologic characterization methodology of faults. A classification method that correlates combinations of geological features (rock type, fault displacement, fault type, position in a fault zone, fracture zone width, damage zone width) with widths of high permeability zones around a fault zone was proposed through a survey on available documents of the site characterization programs. The field investigation started in 2008, by selecting the Wildcat Fault that cut across the Laurence Berkeley National Laboratory (LBNL) site as the target. Analyses on site-specific data, surface geophysics, geological mapping and trenching have confirmed the approximate location and characteristics of the fault (see Session H48, Onishi, et al). The plan for the remaining years includes borehole investigations at LBNL, and another series of investigations in the northern part of the Wildcat Fault.
Clark, Dennis A.; Izbicki, John A.; Metzger, Loren F.; Everett, Rhett; Smith, Gregory A.; O'Leary, David R.; Teague, Nicholas F.; Burgess, Matthew K.
2012-01-01
Data were collected by the U.S. Geological Survey from 2003 through 2008 in the Eastern San Joaquin Groundwater Subbasin, 80 miles east of San Francisco, California, as part of a study of the increasing chloride concentrations in groundwater processes. Data collected include geologic, geophysical, chemical, and hydrologic data collected during and after the installation of five multiple-well monitoring sites, from three existing multiple-well sites, and from 79 selected public-supply, irrigation, and domestic wells. Each multiple-well monitoring site installed as part of this study contained three to five 2-inch diameter polyvinyl chloride (PVC)-cased wells ranging in depth from 68 to 880 feet below land surface. Continuous water-level data were collected from the 19 wells installed at these 5 sites and from 10 existing monitoring wells at 3 additional multiple-well sites in the study area. Thirty-one electromagnetic logs were collected seasonally from the deepest PVC-cased monitoring well at seven multiple-well sites. About 200 water samples were collected from 79 wells in the study area. Coupled well-bore flow data and depth-dependent water-quality data were collected from 12 production wells under pumped conditions, and well-bore flow data were collected from 10 additional wells under unpumped conditions.
Under What Assumptions Do Site-by-Treatment Instruments Identify Average Causal Effects?
ERIC Educational Resources Information Center
Reardon, Sean F.; Raudenbush, Stephen W.
2013-01-01
The increasing availability of data from multi-site randomized trials provides a potential opportunity to use instrumental variables methods to study the effects of multiple hypothesized mediators of the effect of a treatment. We derive nine assumptions needed to identify the effects of multiple mediators when using site-by-treatment interactions…
Evaluation of free to grow: head start partnerships to promote substance-free communities.
Wolfson, Mark; Champion, Heather; Rogers, Todd; Neiberg, Rebecca H; Barker, Dianne C; Talton, Jennifer W; Ip, Edward H; D'Agostino, Ralph B; Parries, Maria T; Easterling, Doug
2011-04-01
Free to Grow: Head Start Partnerships to Promote Substance-free Communities (FTG) was a national initiative in which local Head Start (HS) agencies, in partnership with other community organizations, implemented a mix of evidence-based family-strengthening and community-strengthening strategies. The evaluation of FTG used a quasi-experimental design to compare 14 communities that participated in the FTG intervention with 14 matched comparison communities. Telephone surveys were conducted with two cohorts of the primary caregivers of children in HS at baseline and then annually for 2 years. The survey was also administered to repeated cross-sectional samples of primary caregivers of young children who were not enrolled in HS. No consistent evidence was found in changes in family functioning or neighborhood conditions when the 14 FTG sites were compared to 14 matched sites. However, caregivers of young children who were not in HS in three high-implementing FTG sites showed evidence of improvements in neighborhood organization, neighborhood norms against substance abuse, and child disciplinary practices. Results provide highly limited support for the concept that family and neighborhood conditions that are likely to affect child development and well-being can be changed through organized efforts implemented by local HS programs.
Multi-chain Markov chain Monte Carlo methods for computationally expensive models
NASA Astrophysics Data System (ADS)
Huang, M.; Ray, J.; Ren, H.; Hou, Z.; Bao, J.
2017-12-01
Markov chain Monte Carlo (MCMC) methods are used to infer model parameters from observational data. The parameters are inferred as probability densities, thus capturing estimation error due to sparsity of the data, and the shortcomings of the model. Multiple communicating chains executing the MCMC method have the potential to explore the parameter space better, and conceivably accelerate the convergence to the final distribution. We present results from tests conducted with the multi-chain method to show how the acceleration occurs i.e., for loose convergence tolerances, the multiple chains do not make much of a difference. The ensemble of chains also seems to have the ability to accelerate the convergence of a few chains that might start from suboptimal starting points. Finally, we show the performance of the chains in the estimation of O(10) parameters using computationally expensive forward models such as the Community Land Model, where the sampling burden is distributed over multiple chains.
ERIC Educational Resources Information Center
Wisconsin Early Childhood Association, Madison.
A collection of 26 fact sheets on child care administration produced by the Wisconsin Child Care Improvement Project from 1986 through 1989 is presented. Individual fact sheets concern: national trends, center start-up, family day care start-up, site and facility acquisition, public funding, effective center operation, reporting of child abuse and…
The Home Visit as a Teaching Event: Lessons from Eight Even Start Family Literacy Sites.
ERIC Educational Resources Information Center
Roth, Jeffrey
Family literacy programs have arisen in an attempt to break the cycle of intergenerational poverty and illiteracy. Numerous federally-supported family literacy programs have recognized the importance of instructing parents and children in a home setting. The legislation of Even Start seeks to integrate parenting education, adult basic education,…
ERIC Educational Resources Information Center
Bernstein, V.J.; Harris, E.J.; Long, C.W.; Iida, E.; Hans, S.L.
2005-01-01
A national, multi-site study of behavioral health services integration developed a parent-child interaction assessment tool and culturally anchored videotape protocol. Representatives from programs serving Chinese, Native American, Latin-American, African-American, and Anglo-American families discussed cross-cultural issues in parenting and…
Mapping Cancer Cells’ Starting Lines | Center for Cancer Research
Many of the defective regulatory pathways that lead to aberrant proliferation in cancer converge on DNA replication. So replication regulatory pathways could be targeted to more specifically kill cancer cells. Unfortunately such targeting would require knowing where and when DNA replication starts in the cancer genome. In yeast, the locations of replication initiation sites
Identifying Martian Hydrothermal Sites: Geological Investigation Utilizing Multiple Datasets
NASA Technical Reports Server (NTRS)
Dohm, J. M.; Baker, V. R.; Anderson, R. C.; Scott, D. H.; Rice, J. W., Jr.; Hare, T. M.
2000-01-01
Comprehensive geological investigations of martian landscapes that may have been modified by magmatic-driven hydrothermal activity, utilizing multiple datasets, will yield prime target sites for future hydrological, mineralogical, and biological investigations.
Koedijk, F D H; van Bergen, J E A M; Dukers-Muijrers, N H T M; van Leeuwen, A P; Hoebe, C J P A; van der Sande, M A B
2012-09-01
National surveillance data from 2006 to 2010 of the Dutch sexually transmitted infection (STI) centres were used to analyse current practices on testing extragenital sites for chlamydia and gonorrhoea in men who have sex with men (MSM) and women. In MSM, 76.0% and 88.9% were tested at least at one extragenital site (pharyngeal and/or anorectal) for chlamydia and gonorrhoea, respectively; for women this was 20.5% and 30.2%. Testing more than one anatomic site differed by STI centre, ranging from 2% to 100%. In MSM tested at multiple sites, 63.0% and 66.5% of chlamydia and gonorrhoea diagnoses, respectively, would have been missed if screened at the urogenital site only, mainly anorectal infections. For women tested at multiple sites, the proportions of missed chlamydia and gonorrhoea diagnoses would have been 12.9% and 30.0%, respectively. Testing extragenital sites appears warranted, due to the numerous infections that would have been missed. Adding anorectal screening to urogenital screening for all MSM visiting an STI centre should be recommended. Since actual testing practices differ by centre, there is a need for clearer guidelines. Routine gonorrhoea and chlamydia screening at multiple sites in STI centres should be investigated further as this might be a more effective approach to reduce transmission than current practice.
Nusse, R; Theunissen, H; Wagenaar, E; Rijsewijk, F; Gennissen, A; Otte, A; Schuuring, E; van Ooyen, A
1990-01-01
Wnt-1 (int-1) is a cellular oncogene often activated by insertion of proviral DNA of the mouse mammary tumor virus. We have mapped the 5' end and the promoter area of the Wnt-1 gene by nuclease protection and primer extension assays. In differentiating P19 embryonal carcinoma cells, in which Wnt-1 is naturally expressed, two start sites of transcription were found, one preceded by two TATA boxes and one preceded by several GC boxes. In P19 cells, a 1-kilobase upstream sequence of Wnt-1 was able to confer differentiation-specific expression on a heterologous gene. We have investigated how Wnt-1 transcription was affected by mouse mammary tumor virus proviral integrations in various configurations near the promoters of the gene. One provirus has been inserted in the 5' nontranslated part of Wnt-1, in the same transcriptional orientation, and has functionally replaced the Wnt-1 promoters. Wnt-1 transcription in this tumor starts in the right long terminal repeat of the provirus, with considerable readthrough transcription from the left long terminal repeat. Another provirus has been inserted in the orientation opposite that of Wnt-1 into a GC box, disrupting the first Wnt-1 transcription start site but not the downstream start site. Most insertions have not structurally altered the Wnt-1 transcripts and have enhanced the activity of the normal two promoters. Images PMID:1695322
Identifying Nonprovider Factors Affecting Pediatric Emergency Medicine Provider Efficiency.
Saleh, Fareed; Breslin, Kristen; Mullan, Paul C; Tillett, Zachary; Chamberlain, James M
2017-10-31
The aim of this study was to create a multivariable model of standardized relative value units per hour by adjusting for nonprovider factors that influence efficiency. We obtained productivity data based on billing records measured in emergency relative value units for (1) both evaluation and management of visits and (2) procedures for 16 pediatric emergency medicine providers with more than 750 hours worked per year. Eligible shifts were in an urban, academic pediatric emergency department (ED) with 2 sites: a tertiary care main campus and a satellite community site. We used multivariable linear regression to adjust for the impact of shift and pediatric ED characteristics on individual-provider efficiency and then removed variables from the model with minimal effect on productivity. There were 2998 eligible shifts for the 16 providers during a 3-year period. The resulting model included 4 variables when looking at both ED sites combined. These variables include the following: (1) number of procedures billed by provider, (2) season of the year, (3) shift start time, and (4) day of week. Results were improved when we separately modeled each ED location. A 3-variable model using procedures billed by provider, shift start time, and season explained 23% of the variation in provider efficiency at the academic ED site. A 3-variable model using procedures billed by provider, patient arrivals per hour, and shift start time explained 45% of the variation in provider efficiency at the satellite ED site. Several nonprovider factors affect provider efficiency. These factors should be considered when designing productivity-based incentives.
Ederveen, Thomas H. A.; Overmars, Lex; van Hijum, Sacha A. F. T.
2013-01-01
Nowadays, prokaryotic genomes are sequenced faster than the capacity to manually curate gene annotations. Automated genome annotation engines provide users a straight-forward and complete solution for predicting ORF coordinates and function. For many labs, the use of AGEs is therefore essential to decrease the time necessary for annotating a given prokaryotic genome. However, it is not uncommon for AGEs to provide different and sometimes conflicting predictions. Combining multiple AGEs might allow for more accurate predictions. Here we analyzed the ab initio open reading frame (ORF) calling performance of different AGEs based on curated genome annotations of eight strains from different bacterial species with GC% ranging from 35–52%. We present a case study which demonstrates a novel way of comparative genome annotation, using combinations of AGEs in a pre-defined order (or path) to predict ORF start codons. The order of AGE combinations is from high to low specificity, where the specificity is based on the eight genome annotations. For each AGE combination we are able to derive a so-called projected confidence value, which is the average specificity of ORF start codon prediction based on the eight genomes. The projected confidence enables estimating likeliness of a correct prediction for a particular ORF start codon by a particular AGE combination, pinpointing ORFs notoriously difficult to predict start codons. We correctly predict start codons for 90.5±4.8% of the genes in a genome (based on the eight genomes) with an accuracy of 81.1±7.6%. Our consensus-path methodology allows a marked improvement over majority voting (9.7±4.4%) and with an optimal path ORF start prediction sensitivity is gained while maintaining a high specificity. PMID:23675487
Fingolimod Prescribed for the Treatment of Multiple Sclerosis in Patients Younger Than Age 18 Years.
Fragoso, Yara Dadalti; Alves-Leon, Soniza Vieira; Barreira, Amilton Antunes; Callegaro, Dagoberto; Brito Ferreira, Maria Lucia; Finkelsztejn, Alessandro; Gomes, Sidney; Magno Goncalves, Marcus Vinicius; Moraes Machado, Maria Iris; Marques, Vanessa Daccach; Cunha Matta, Andre Palma; Papais-Alvarenga, Regina Maria; Apostolos Pereira, Samira Luisa; Tauil, Carlos Bernardo
2015-08-01
There have been no clinical trials for approval of medications for treating multiple sclerosis in patients younger than age 18 years. All treatments are based on personal experience and data from open observational studies. Fingolimod is an oral drug for multiple sclerosis that has been shown to be efficient and safe in adults. The aim of our study is to describe patients with multiple sclerosis who started treatment with fingolimod before the age of 18 years. Seventeen patients treated with fingolimod were identified in the Brazilian database of children and adolescents with multiple sclerosis. The average time of use of the drug was 8.6 months. Fingolimod showed a good safety and efficacy profile in these patients, all of whom had very active multiple sclerosis. After starting treatment with fingolimod, only one patient had a relapse and a new lesion on magnetic resonance imaging. The patients' degree of disability did not progress. No major adverse events were reported in relation to the first dose of the drug, nor in the short- and medium-term treatment. No patient has been followed for longer than 18 months, thus limiting long-term conclusions. Off-label use of fingolimod in patients younger than age 18 years may be a good therapeutic option for multiple sclerosis control. Copyright © 2015 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Lee, K. K.; Lee, S. S.; Kim, H. H.; Koh, E. H.; Kim, M. O.; Lee, K.; Kim, H. J.
2016-12-01
Multiple tracers were applied for source and pathway detection at two different sites. CO2 gas injected in the subsurface for a shallow-depth CO2 injection and leak test can be regarded as a potential contaminant source. Therefore, it is necessary to identify the migration pattern of CO2 gas. Also, at a DNAPL contaminated site, it is important to figure out the characteristics of plume evolution from the source zone. In this study, multiple tracers (SF6 and chloride) were used to evaluate the applicability of volatile and non-volatile tracers and to identify the characteristics of contaminant transport at each CO2 injection and leak test site and DNAPL contaminated site. Firstly, at the CO2 test site, multiple tracers were used to perform the single well push-drift-pull tracer test at total 3 specific depth zones. As results of tests, volatile and non-volatile tracers showed different mass recovery percentage. Most of chloride mass was recovered but less than half of SF6 mass was recovered due to volatile property. This means that only gaseous SF6 leak out to unsaturated zone. However, breakthrough curves of both tracers indicated similar peak time, effective porosity, and regional groundwater velocity. Also, at both contaminated sites, natural gradient tracer tests were performed with multiple tracers. With the results of natural gradient tracer test, it was possible to confirm the applicability of multiple tracers and to understand the contaminant transport in highly heterogeneous aquifer systems through the long-term monitoring of tracers. Acknowledgement: financial support was provided by the R&D Project on Environmental Management of Geologic CO2 Storage)" from the KEITI (Project Number: 2014001810003) and Korea Ministry of Environment as "The GAIA project (2014000540010)".
NASA Astrophysics Data System (ADS)
Zhang, Renping
2017-12-01
A mathematical model was developed for predicting start-up characteristics of Swallow-tailed Axial-grooved Heat Pipe under the conditions of Multiple Heat Sources. The effects of heat capacitance of heat source, liquid-vapour interfacial evaporation-condensation heat transfer, shear stress at the interface was considered in current model. The interfacial evaporating mass flow rate is based on the kinetic analysis. Time variations of evaporating mass rate, wall temperature and liquid velocity are studied from the start-up to steady state. The calculated results show that wall temperature demonstrates step transition at the junction between the heat source and non-existent heat source on the evaporator. The liquid velocity changes drastically at the evaporator section, however, it has slight variation at the evaporator section without heat source. When the effect of heat source is ignored, the numerical temperature demonstrates a quicker response. With the consideration of capacitance of the heat source, the data obtained from the proposed model agree well with the experimental results.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Adamson, P.
We report the first observation of seasonal modulations in the rates of cosmic ray multiple-muon events at two underground sites, the MINOS Near Detector with an overburden of 225 mwe, and the MINOS Far Detector site at 2100 mwe. Thus, at the deeper site, multiple-muon events with muons separated by more than 8 m exhibit a seasonal rate that peaks during the summer, similar to that of single-muon events. In contrast and unexpectedly, the rate of multiple-muon events with muons separated by less than 5–8 m, and the rate of multiple-muon events in the smaller, shallower Near Detector, exhibit amore » seasonal rate modulation that peaks in the winter.« less
The Holocene Geoarchaeology of the Desert Nile in Northern Sudan
NASA Astrophysics Data System (ADS)
Woodward, Jamie; Macklin, Mark; Spencer, Neal; Welsby, Derek; Dalton, Matthew; Hay, Sophie; Hardy, Andrew
2016-04-01
Invited Paper Forty years ago Colin Renfrew declared that "every archaeological problem starts as a problem in geoarchaeology" (Renfrew, 1976 p. 2). With this assertion in mind, this paper draws upon the findings from field research in two sectors of the Nile Valley of Northern Sudan dedicated to the exploration of human-environment interactions during the middle and late Holocene. This part of the Nile corridor contains a rich cultural record and an exceptionally well preserved Holocene fluvial archive. A distinctive feature of these records is the variety of evidence for interaction between desert and river over a range of spatial and temporal scales. This interaction presented both challenges and opportunities for its ancient inhabitants. This paper will present evidence for large-scale landscape changes driven by shifts in global climate. It will also show how we have integrated the archaeological and geological records in the Northern Dongola Reach and at Amara West - where long-term field projects led by archaeologists from the British Museum have recognised the importance of a sustained commitment to interdisciplinary research to achieve a fully integrated geoarchaeological approach across a range of scales. The former project is a large-scale landscape survey with multiple sites across an 80 km reach of the Nile whilst the latter has a strong focus on a single New Kingdom town site and changes in its environmental setting. By combining multiple archaeological and geological datasets - and pioneering the use of OSL dating and strontium isotope analysis in the Desert Nile - we have developed a new understanding of human responses to Holocene climate and landscape change in this region. Renfrew, C. (1976) Archaeology and the earth sciences. In: D.A. Davidson and M.I. Shackley (eds) Geoarchaeology: Earth Science and the Past, Duckworth, London, 1-5.
Soffritti, Morando; Belpoggi, Fiorella; Manservigi, Marco; Tibaldi, Eva; Lauriola, Michelina; Falcioni, Laura; Bua, Luciano
2010-12-01
Aspartame (APM) is a well-known intense artificial sweetener used in more than 6,000 products. Among the major users of aspartame are children and women of childbearing age. In previous lifespan experiments conducted on Sprague-Dawley rats we have shown that APM is a carcinogenic agent in multiple sites and that its effects are increased when exposure starts from prenatal life. The aim of this study is to evaluate the potential of APM to induce carcinogenic effects in mice. Six groups of 62-122 male and female Swiss mice were treated with APM in feed at doses of 32,000, 16,000, 8,000, 2,000, or 0 ppm from prenatal life (12 days of gestation) until death. At death each animal underwent complete necropsy and all tissues and organs of all animals in the experiment were microscopically examined. APM in our experimental conditions induces in males a significant dose-related increased incidence of hepatocellular carcinomas (P < 0.01), and a significant increase at the dose levels of 32,000 ppm (P < 0.01) and 16,000 ppm (P < 0.05). Moreover, the results show a significant dose-related increased incidence of alveolar/bronchiolar carcinomas in males (P < 0.05), and a significant increase at 32,000 ppm (P < 0.05). The results of the present study confirm that APM is a carcinogenic agent in multiple sites in rodents, and that this effect is induced in two species, rats (males and females) and mice (males). No carcinogenic effects were observed in female mice. Am. J. Ind. Med. 53:1197-1206, 2010. © 2010 Wiley-Liss, Inc.
Banderas, Alvaro; Guiliani, Nicolas
2013-08-16
The biomining bacterium Acidithiobacillus ferrooxidans oxidizes sulfide ores and promotes metal solubilization. The efficiency of this process depends on the attachment of cells to surfaces, a process regulated by quorum sensing (QS) cell-to-cell signalling in many Gram-negative bacteria. At. ferrooxidans has a functional QS system and the presence of AHLs enhances its attachment to pyrite. However, direct targets of the QS transcription factor AfeR remain unknown. In this study, a bioinformatic approach was used to infer possible AfeR direct targets based on the particular palindromic features of the AfeR binding site. A set of Hidden Markov Models designed to maintain palindromic regions and vary non-palindromic regions was used to screen for putative binding sites. By annotating the context of each predicted binding site (PBS), we classified them according to their positional coherence relative to other putative genomic structures such as start codons, RNA polymerase promoter elements and intergenic regions. We further used the Multiple EM for Motif Elicitation algorithm (MEME) to further filter out low homology PBSs. In summary, 75 target-genes were identified, 34 of which have a higher confidence level. Among the identified genes, we found afeR itself, zwf, genes encoding glycosyltransferase activities, metallo-beta lactamases, and active transport-related proteins. Glycosyltransferases and Zwf (Glucose 6-phosphate-1-dehydrogenase) might be directly involved in polysaccharide biosynthesis and attachment to minerals by At. ferrooxidans cells during the bioleaching process.
Banderas, Alvaro; Guiliani, Nicolas
2013-01-01
The biomining bacterium Acidithiobacillus ferrooxidans oxidizes sulfide ores and promotes metal solubilization. The efficiency of this process depends on the attachment of cells to surfaces, a process regulated by quorum sensing (QS) cell-to-cell signalling in many Gram-negative bacteria. At. ferrooxidans has a functional QS system and the presence of AHLs enhances its attachment to pyrite. However, direct targets of the QS transcription factor AfeR remain unknown. In this study, a bioinformatic approach was used to infer possible AfeR direct targets based on the particular palindromic features of the AfeR binding site. A set of Hidden Markov Models designed to maintain palindromic regions and vary non-palindromic regions was used to screen for putative binding sites. By annotating the context of each predicted binding site (PBS), we classified them according to their positional coherence relative to other putative genomic structures such as start codons, RNA polymerase promoter elements and intergenic regions. We further used the Multiple EM for Motif Elicitation algorithm (MEME) to further filter out low homology PBSs. In summary, 75 target-genes were identified, 34 of which have a higher confidence level. Among the identified genes, we found afeR itself, zwf, genes encoding glycosyltransferase activities, metallo-beta lactamases, and active transport-related proteins. Glycosyltransferases and Zwf (Glucose 6-phosphate-1-dehydrogenase) might be directly involved in polysaccharide biosynthesis and attachment to minerals by At. ferrooxidans cells during the bioleaching process. PMID:23959118
NASA Astrophysics Data System (ADS)
Simons, M.; Duputel, Z.; Fielding, E. J.; Galetzka, J.; Genrich, J. F.; Jiang, J.; Jolivet, R.; Kanamori, H.; Moore, A. W.; Ortega Culaciati, F. H.; Owen, S. E.; Riel, B. V.; Rivera, L. A.; Carrizo, D.; Cotte, N.; Jara, J.; Klotz, J.; Norabuena, E. O.; Ortega, I.; Socquet, A.; Samsonov, S. V.; Valderas Bermejo, M.
2014-12-01
The April 1, 2014 (Mw 8.2) Pisagua Earthquake occurred in Northern Chile, within a long recognized seismic gap in the Central Andean region that last experienced major megathrust events in 1868 and 1877. We built a continuous GPS network starting in 2005, with the ultimate goal of understanding the kinematics and dynamics of this portion of the subduction zone. Using observations from this network, as well as others in the region, combined with InSAR, seismic and tsunami observations, we obtain estimates of inter-seismic, co-seismic and initial post-seismic fault slip using an internally consistent Bayesian unregularized approach. We evaluate the extent of spatial overlap between regions of fault slip during this different time periods. Of particular interest to this event is the extent and nature of any geodetic evidence for transient slow fault slip preceding the Pisagua Earthquake mainshock. To this end, we compare daily and high rate GPS solutions, the former of which shows long period transient motion started about 15 days before the mainshock and with maximum registered amplitude of 14.2 +/- 2 [mm] at site PSGA. Contrary to published findings, we find that pre-seismic deformation seen by the GPS network can be explained as coseismic motion associated with the multiple foreshocks.
Project Developmental Continuity: Field Procedures Manual.
ERIC Educational Resources Information Center
Morris, Mary
This operations manual for field staff (site monitors, site coordinators, and testers) involved in the observation and testing of children is part of a series of documents on the evaluation of Project Developmental Continuity (PDC), a Head Start demonstration program aimed at providing educational and developmental continuity between children's…
DOE Office of Scientific and Technical Information (OSTI.GOV)
NONE
1999-03-01
This decision document presents the selected No Further Action decision for the Bennington Landfill Site (the Site), located in Bennington, Vermont. EPA will perform 10 years of additional monitoring of the groundwater, surface water, and sediments starting with the completion of the NTCRA.
2006-11-29
Ames and Moffett Field (MFA) historical sites and memorials Site of the John W. Whisman Home. Headquarters and stopping place of the first stagecoach line between San Jose and San Francisco. Started in early autumn of 1849. Located at R.T.Jones Road and the Ames Child Care Center fence boundary.
2008-03-01
capture archived encoded data. A black basalt slab with strange inscriptions on it, the Rosetta Stone was unearthed in July 1799 by Napoleon’s army...the bitstream. When you start thinking about 1s and 0s and when you start thinking about fiber optics, its just either on or off. So there is a
ERIC Educational Resources Information Center
Howard, Eboni C.; Rankin, Victoria E.; Fishman, Mike; Hawkinson, Laura E.; McGroder, Sharon M.; Helsel, Fiona K.; Farber, Jonathan; Tuchman, Ariana; Wille, Jessica
2014-01-01
The purpose of this study was to describe the coaching that occurred at Head Start (HS) grantees as a result of the Early Learning Mentor Coach (ELMC) initiative. This provided a unique opportunity to describe the different dimensions of coaching within HS settings from the perspective of multiple stakeholders--administrators, coaches, and staff.…
ERIC Educational Resources Information Center
Abrahams, Alan
2010-01-01
In this paper, we review a variety of e-commerce startups created by senior information systems students, under the author's guidance, over a number of years at multiple universities. We compare the characteristics of the start-ups and comment on various factors which appear to have contributed to their success or failure. Our recommendations are…
ERIC Educational Resources Information Center
Spencer, Lynn, Ed.
These 7 case studies are part of a series of documents on the evaluation of Project Developmental Continuity (PDC), a Head Start demonstration program aimed at providing educational and developmental continuity between children's Head Start and primary school experiences. Each case study reviews the planning year at a PDC demonstration site in one…
ERIC Educational Resources Information Center
Spencer, Lynn, Ed.
These 8 case studies are part of a series of documents on the evaluation of Project Developmental Continuity (PDC), a Head Start demonstration program aimed at providing educational and developmental continuity between children's Head Start and primary school experiences. Each case study reviews the planning year at a PDC demonstration site in one…
Case Study of a Discontinued Start-Up Engineering Program: Critical Challenges and Lessons Learned
ERIC Educational Resources Information Center
Friess, Wilhelm A.
2017-01-01
The explanatory case study presented here analyzes the factors that have contributed to the failure of a start-up engineering program launched at an off-campus site, and aimed at imparting the first two years of the BSc Mechanical, Electrical, Computer and Civil Engineering utilizing an integrated curriculum. Findings indicate the root cause for…
Unveiled: Interrogating the Use of Applied Drama in Multiple and Specific Sites
ERIC Educational Resources Information Center
Daboo, Jerri
2007-01-01
This article examines a view of site through postcolonial feminism to suggest that multiple and contradictory discourses of culture, location, gender and context are all vital in an understanding of a specific site when working with a community. These views are applied to a project undertaken with a group of Asian women in Britain exploring issues…
Geospatial Optimization of Siting Large-Scale Solar Projects
DOE Office of Scientific and Technical Information (OSTI.GOV)
Macknick, Jordan; Quinby, Ted; Caulfield, Emmet
2014-03-01
Recent policy and economic conditions have encouraged a renewed interest in developing large-scale solar projects in the U.S. Southwest. However, siting large-scale solar projects is complex. In addition to the quality of the solar resource, solar developers must take into consideration many environmental, social, and economic factors when evaluating a potential site. This report describes a proof-of-concept, Web-based Geographical Information Systems (GIS) tool that evaluates multiple user-defined criteria in an optimization algorithm to inform discussions and decisions regarding the locations of utility-scale solar projects. Existing siting recommendations for large-scale solar projects from governmental and non-governmental organizations are not consistent withmore » each other, are often not transparent in methods, and do not take into consideration the differing priorities of stakeholders. The siting assistance GIS tool we have developed improves upon the existing siting guidelines by being user-driven, transparent, interactive, capable of incorporating multiple criteria, and flexible. This work provides the foundation for a dynamic siting assistance tool that can greatly facilitate siting decisions among multiple stakeholders.« less
The firehose instability during multiple reconnection in the Earth's magnetotail
NASA Astrophysics Data System (ADS)
Alexandrova, Alexandra; Divin, Andrey; Retino, Alessandro; Deca, Jan; Catapano, Filomena; Cozzani, Giulia
2017-04-01
We found unique events in the Cluster spacecraft observations of the Earth's magnetotail which correspond to the case of multiple reconnection sites. The ion temperature anisotropy of more energized ions in the direction parallel to the magnetic field, rather than in the perpendicular direction, is observed in the region of dynamical interaction between two active X-lines. The magnetic field and plasma parameters associated with the anisotropy correspond to the firehose instability conditions. We discuss possible scenarios of development of the firehose instability in multiple reconnection by comparing the observations with numerical simulations. Conventional Particle-in-Cell simulations of 2D magnetic reconnection starting from Harris equilibria are performed using implicit PIC code iPIC3D [Markidis, 2010]. At earlier stages the evolution creates fronts which push the weakly magnetized current sheet plasma away from the X-line. Fronts accelerate and reflect particles, producing parallel ion beams and increasing parallel ion temperature ahead of the front. If multiple X-lines are present, then the counterstreaming ion beams appear inside the original current sheet between colliding reconnection jet fronts. For large enough parallel ion pressure anisotropy, the firehose-like mode is excited inside the original current sheet with a flapping-like appearance along the X GSM direction but not Y GSM (current) direction. One should note that our simulations do not include the Bz magnetic field component (normal to the current sheet), hence ion beams cannot escape into the lobes and the whole region between two colliding fronts is unstable to firehose-like instability. In the Earth's magnetotail such configuration likely occurs when two active X-lines are close enough to each other, similar to a few cases we found in the Cluster observations.
Driver, Hannah R
2016-06-01
It is essential that a medical assessment is completed before commencing electroconvulsive therapy (ECT) to identify possible risk factors that may complicate anesthesia. This audit aimed to improve the physical examination and documented medical history of this assessment usually performed by referring psychiatrists. Patients from 2 sites (A and B) were retrospectively audited against standards from the Scottish ECT Accreditation Network. The timing and systems examined for the physical examination were noted. Site A used an examination sheet; at site B there was no standard way of recording examination. Documented medical histories were compared with comprehensive histories obtained using multiple sources. Discrepancies were noted. Site A was reaudited after amending the examination sheet and adding prompts to use multiple sources when gathering histories. There were repeat examinations for ECT in 30 patients (100%) at site A and 6 (23%) of 26 at site B. Physical examinations were incomplete in 47% of patients at A and 100% at B. Oral examination was frequently missed at both sites. Medical histories were accurate in 20% at A and 38% at B. In the reaudit of site A, all 12 patients had a complete repeat examination; histories were accurate in 8 (67%), with multiple sources used in 11 (92%). Incomplete or inaccurate assessments put patients at risk. Oral examinations should be part of initial medical assessments. This audit shows the benefits of using a physical examination sheet to ensure a repeat complete examination. Using multiple sources to gather medical histories is encouraged.
Barta, Endre; Sebestyén, Endre; Pálfy, Tamás B.; Tóth, Gábor; Ortutay, Csaba P.; Patthy, László
2005-01-01
DoOP (http://doop.abc.hu/) is a database of eukaryotic promoter sequences (upstream regions) aiming to facilitate the recognition of regulatory sites conserved between species. The annotated first exons of human and Arabidopsis thaliana genes were used as queries in BLAST searches to collect the most closely related orthologous first exon sequences from Chordata and Viridiplantae species. Up to 3000 bp DNA segments upstream from these first exons constitute the clusters in the chordate and plant sections of the Database of Orthologous Promoters. Release 1.0 of DoOP contains 21 061 chordate clusters from 284 different species and 7548 plant clusters from 269 different species. The database can be used to find and retrieve promoter sequences of a given gene from various species and it is also suitable to see the most trivial conserved sequence blocks in the orthologous upstream regions. Users can search DoOP with either sequence or text (annotation) to find promoter clusters of various genes. In addition to the sequence data, the positions of the conserved sequence blocks derived from multiple alignments, the positions of repetitive elements and the positions of transcription start sites known from the Eukaryotic Promoter Database (EPD) can be viewed graphically. PMID:15608291
Barta, Endre; Sebestyén, Endre; Pálfy, Tamás B; Tóth, Gábor; Ortutay, Csaba P; Patthy, László
2005-01-01
DoOP (http://doop.abc.hu/) is a database of eukaryotic promoter sequences (upstream regions) aiming to facilitate the recognition of regulatory sites conserved between species. The annotated first exons of human and Arabidopsis thaliana genes were used as queries in BLAST searches to collect the most closely related orthologous first exon sequences from Chordata and Viridiplantae species. Up to 3000 bp DNA segments upstream from these first exons constitute the clusters in the chordate and plant sections of the Database of Orthologous Promoters. Release 1.0 of DoOP contains 21,061 chordate clusters from 284 different species and 7548 plant clusters from 269 different species. The database can be used to find and retrieve promoter sequences of a given gene from various species and it is also suitable to see the most trivial conserved sequence blocks in the orthologous upstream regions. Users can search DoOP with either sequence or text (annotation) to find promoter clusters of various genes. In addition to the sequence data, the positions of the conserved sequence blocks derived from multiple alignments, the positions of repetitive elements and the positions of transcription start sites known from the Eukaryotic Promoter Database (EPD) can be viewed graphically.
Sansó, Miriam; Fisher, Robert P
2013-01-01
Cyclin-dependent kinases (CDKs) play a central role in governing eukaryotic cell division. It is becoming clear that the transcription cycle of RNA polymerase II (RNAP II) is also regulated by CDKs; in metazoans, the cell cycle and transcriptional CDK networks even share an upstream activating kinase, which is itself a CDK. From recent chemical-genetic analyses we know that CDKs and their substrates control events both early in transcription (the transition from initiation to elongation) and late (3′ end formation and transcription termination). Moreover, mutual dependence on CDK activity might couple the “beginning” and “end” of the cycle, to ensure the fidelity of mRNA maturation and the efficient recycling of RNAP II from sites of termination to the transcription start site (TSS). As is the case for CDKs involved in cell cycle regulation, different transcriptional CDKs act in defined sequence on multiple substrates. These phosphorylations are likely to influence gene expression by several mechanisms, including direct, allosteric effects on the transcription machinery, co-transcriptional recruitment of proteins needed for mRNA-capping, splicing and 3′ end maturation, dependent on multisite phosphorylation of the RNAP II C-terminal domain (CTD) and, perhaps, direct regulation of RNA-processing or histone-modifying machinery. Here we review these recent advances, and preview the emerging challenges for transcription-cycle research. PMID:23756342
77 FR 28240 - Airworthiness Directives; The Boeing Company Airplanes
Federal Register 2010, 2011, 2012, 2013, 2014
2012-05-14
... multiple site damage cracks in the radial web lap and tear strap splices of the aft pressure bulkhead at... multiple site damage cracks in the radial web lap and tear strap splices of the aft pressure bulkhead at...
Chatterjee, Abhijit; Vlachos, Dionisios G
2007-07-21
While recently derived continuum mesoscopic equations successfully bridge the gap between microscopic and macroscopic physics, so far they have been derived only for simple lattice models. In this paper, general deterministic continuum mesoscopic equations are derived rigorously via nonequilibrium statistical mechanics to account for multiple interacting surface species and multiple processes on multiple site types and/or different crystallographic planes. Adsorption, desorption, reaction, and surface diffusion are modeled. It is demonstrated that contrary to conventional phenomenological continuum models, microscopic physics, such as the interaction potential, determines the final form of the mesoscopic equation. Models of single component diffusion and binary diffusion of interacting particles on single-type site lattice and of single component diffusion on complex microporous materials' lattices consisting of two types of sites are derived, as illustrations of the mesoscopic framework. Simplification of the diffusion mesoscopic model illustrates the relation to phenomenological models, such as the Fickian and Maxwell-Stefan transport models. It is demonstrated that the mesoscopic equations are in good agreement with lattice kinetic Monte Carlo simulations for several prototype examples studied.
Hereditary Angioedema Attacks: Local Swelling at Multiple Sites.
Hofman, Zonne L M; Relan, Anurag; Hack, C Erik
2016-02-01
Hereditary angioedema (HAE) patients experience recurrent local swelling in various parts of the body including painful swelling of the intestine and life-threatening laryngeal oedema. Most HAE literature is about attacks located in one anatomical site, though it is mentioned that HAE attacks may also involve multiple anatomical sites simultaneously. A detailed description of such multi-location attacks is currently lacking. This study investigated the occurrence, severity and clinical course of HAE attacks with multiple anatomical locations. HAE patients included in a clinical database of recombinant human C1-inhibitor (rhC1INH) studies were evaluated. Visual analog scale scores filled out by the patients for various symptoms at various locations and investigator symptoms scores during the attack were analysed. Data of 219 eligible attacks in 119 patients was analysed. Thirty-three patients (28%) had symptoms at multiple locations in anatomically unrelated regions at the same time during their first attack. Up to five simultaneously affected locations were reported. The observation that severe HAE attacks often affect multiple sites in the body suggests that HAE symptoms result from a systemic rather than from a local process as is currently believed.
Bianchi, L; Monaldi, F; Paolucci, S; Iani, C; Lacquaniti, F
1999-01-01
The aim of this study was to develop quantitative analytical methods in the application of the pendulum test to both normal and spastic subjects. The lower leg was released by a torque motor from different starting positions. The resulting changes in the knee angle were fitted by means of a time-varying model. Stiffness and viscosity coefficients were derived for each half-cycle oscillation in both flexion and extension, and for all knee starting positions. This method was applied to the assessment of the effects of Botulinum toxin A (BTX) in progressive multiple sclerosis patients in a follow-up study. About half of the patients showed a significant decrement in stiffness and viscosity coefficients.
Le, Vu H.; Buscaglia, Robert; Chaires, Jonathan B.; Lewis, Edwin A.
2013-01-01
Isothermal Titration Calorimetry, ITC, is a powerful technique that can be used to estimate a complete set of thermodynamic parameters (e.g. Keq (or ΔG), ΔH, ΔS, and n) for a ligand binding interaction described by a thermodynamic model. Thermodynamic models are constructed by combination of equilibrium constant, mass balance, and charge balance equations for the system under study. Commercial ITC instruments are supplied with software that includes a number of simple interaction models, for example one binding site, two binding sites, sequential sites, and n-independent binding sites. More complex models for example, three or more binding sites, one site with multiple binding mechanisms, linked equilibria, or equilibria involving macromolecular conformational selection through ligand binding need to be developed on a case by case basis by the ITC user. In this paper we provide an algorithm (and a link to our MATLAB program) for the non-linear regression analysis of a multiple binding site model with up to four overlapping binding equilibria. Error analysis demonstrates that fitting ITC data for multiple parameters (e.g. up to nine parameters in the three binding site model) yields thermodynamic parameters with acceptable accuracy. PMID:23262283
Genomic dissection of conserved transcriptional regulation in intestinal epithelial cells
Camp, J. Gray; Weiser, Matthew; Cocchiaro, Jordan L.; Kingsley, David M.; Furey, Terrence S.; Sheikh, Shehzad Z.; Rawls, John F.
2017-01-01
The intestinal epithelium serves critical physiologic functions that are shared among all vertebrates. However, it is unknown how the transcriptional regulatory mechanisms underlying these functions have changed over the course of vertebrate evolution. We generated genome-wide mRNA and accessible chromatin data from adult intestinal epithelial cells (IECs) in zebrafish, stickleback, mouse, and human species to determine if conserved IEC functions are achieved through common transcriptional regulation. We found evidence for substantial common regulation and conservation of gene expression regionally along the length of the intestine from fish to mammals and identified a core set of genes comprising a vertebrate IEC signature. We also identified transcriptional start sites and other putative regulatory regions that are differentially accessible in IECs in all 4 species. Although these sites rarely showed sequence conservation from fish to mammals, surprisingly, they drove highly conserved IEC expression in a zebrafish reporter assay. Common putative transcription factor binding sites (TFBS) found at these sites in multiple species indicate that sequence conservation alone is insufficient to identify much of the functionally conserved IEC regulatory information. Among the rare, highly sequence-conserved, IEC-specific regulatory regions, we discovered an ancient enhancer upstream from her6/HES1 that is active in a distinct population of Notch-positive cells in the intestinal epithelium. Together, these results show how combining accessible chromatin and mRNA datasets with TFBS prediction and in vivo reporter assays can reveal tissue-specific regulatory information conserved across 420 million years of vertebrate evolution. We define an IEC transcriptional regulatory network that is shared between fish and mammals and establish an experimental platform for studying how evolutionarily distilled regulatory information commonly controls IEC development and physiology. PMID:28850571
Hou, Guangjin; Gupta, Rupal; Polenova, Tatyana; Vega, Alexander J
2014-02-01
Proton chemical shifts are a rich probe of structure and hydrogen bonding environments in organic and biological molecules. Until recently, measurements of 1 H chemical shift tensors have been restricted to either solid systems with sparse proton sites or were based on the indirect determination of anisotropic tensor components from cross-relaxation and liquid-crystal experiments. We have introduced an MAS approach that permits site-resolved determination of CSA tensors of protons forming chemical bonds with labeled spin-1/2 nuclei in fully protonated solids with multiple sites, including organic molecules and proteins. This approach, originally introduced for the measurements of chemical shift tensors of amide protons, is based on three RN -symmetry based experiments, from which the principal components of the 1 H CS tensor can be reliably extracted by simultaneous triple fit of the data. In this article, we expand our approach to a much more challenging system involving aliphatic and aromatic protons. We start with a review of the prior work on experimental-NMR and computational-quantum-chemical approaches for the measurements of 1 H chemical shift tensors and for relating these to the electronic structures. We then present our experimental results on U- 13 C, 15 N-labeled histdine demonstrating that 1 H chemical shift tensors can be reliably determined for the 1 H 15 N and 1 H 13 C spin pairs in cationic and neutral forms of histidine. Finally, we demonstrate that the experimental 1 H(C) and 1 H(N) chemical shift tensors are in agreement with Density Functional Theory calculations, therefore establishing the usefulness of our method for characterization of structure and hydrogen bonding environment in organic and biological solids.
Uittenbogaard, Martine; Martinka, Debra L.; Johnson, Peter F.; Vinson, Charles; Chiaramello, Anne
2009-01-01
Expression of the bHLH transcription factor Nex1/MATH-2/NeuroD6, a member of the NeuroD subfamily, parallels overt neuronal differentiation and synaptogenesis during brain development. Our previous studies have shown that Nex1 is a critical effector of the NGF pathway and promotes neuronal differentiation and survival of PC12 cells in the absence of growth factors. In this study, we investigated the transcriptional regulation of the Nex1 gene during NGF-induced neuronal differentiation. We found that Nex1 expression is under the control of two conserved promoters, Nex1-P1 and Nex1-P2, located in two distinct non-coding exons. Both promoters are TATA-less with multiple transcription start sites, and are activated on NGF or cAMP exposure. Luciferase-reporter assays showed that the Nex1-P2 promoter activity is stronger than the Nex1-P1 promoter activity, which supports the previously reported differential expression levels of Nex1 transcripts throughout brain development. Using a combination of DNaseI footprinting, EMSA assays, and site-directed mutagenesis, we identified the essential regulatory elements within the first 2 kb of the Nex1 5′UTR. The Nex1-P1 promoter is mainly regulated by a conserved CRE element, whereas the Nex1-P2 promoter is under the control of a conserved C/EBP binding site. Overexpression of wild-type C/EBPβ resulted in increased Nex1-P2 promoter activity in NGF-differentiated PC12 cells. The fact that Nex1 is a target gene of C/EBPβ provides new insight into the C/EBP transcriptional cascade known to promote neurogenesis, while repressing gliogenesis. PMID:17075921
A Data Scientist's Guide to Start-Ups.
Provost, Foster; Webb, Geoffrey I; Bekkerman, Ron; Etzioni, Oren; Fayyad, Usama; Perlich, Claudia
2014-09-01
In August 2013, we held a panel discussion at the KDD 2013 conference in Chicago on the subject of data science, data scientists, and start-ups. KDD is the premier conference on data science research and practice. The panel discussed the pros and cons for top-notch data scientists of the hot data science start-up scene. In this article, we first present background on our panelists. Our four panelists have unquestionable pedigrees in data science and substantial experience with start-ups from multiple perspectives (founders, employees, chief scientists, venture capitalists). For the casual reader, we next present a brief summary of the experts' opinions on eight of the issues the panel discussed. The rest of the article presents a lightly edited transcription of the entire panel discussion.
Rectangular Array Model Supporting Students' Spatial Structuring in Learning Multiplication
ERIC Educational Resources Information Center
Shanty, Nenden Octavarulia; Wijaya, Surya
2012-01-01
We examine how rectangular array model can support students' spatial structuring in learning multiplication. To begin, we define what we mean by spatial structuring as the mental operation of constructing an organization or form for an object or set of objects. For that reason, the eggs problem was chosen as the starting point in which the…
Comprehension of Multiple Documents with Conflicting Information: A Two-Step Model of Validation
ERIC Educational Resources Information Center
Richter, Tobias; Maier, Johanna
2017-01-01
In this article, we examine the cognitive processes that are involved when readers comprehend conflicting information in multiple texts. Starting from the notion of routine validation during comprehension, we argue that readers' prior beliefs may lead to a biased processing of conflicting information and a one-sided mental model of controversial…
Code of Federal Regulations, 2011 CFR
2011-01-01
... Construct and Licenses To Operate Nuclear Power Reactors of Identical Design at Multiple Sites N Appendix N... Construct and Licenses To Operate Nuclear Power Reactors of Identical Design at Multiple Sites Section 101... nuclear power reactors of essentially the same design to be located at different sites. 1 1 If the design...
Code of Federal Regulations, 2012 CFR
2012-01-01
... Construct and Licenses To Operate Nuclear Power Reactors of Identical Design at Multiple Sites N Appendix N... Construct and Licenses To Operate Nuclear Power Reactors of Identical Design at Multiple Sites Section 101... nuclear power reactors of essentially the same design to be located at different sites. 1 1 If the design...
Code of Federal Regulations, 2013 CFR
2013-01-01
... Construct and Licenses To Operate Nuclear Power Reactors of Identical Design at Multiple Sites N Appendix N... Construct and Licenses To Operate Nuclear Power Reactors of Identical Design at Multiple Sites Section 101... nuclear power reactors of essentially the same design to be located at different sites. 1 1 If the design...
Federal Register 2010, 2011, 2012, 2013, 2014
2012-02-06
...] Commercial Wind Leasing and Site Assessment Activities on the Atlantic Outer Continental Shelf Offshore... governments, offshore wind energy developers, and the public in the Department of the Interior's (DOI) ``Smart from the Start'' wind energy initiative offshore Massachusetts. The purpose of the ``Smart from the...
Energized Learning Students Lessons Bullet Getting Started Bullet Bringing It Home Bullet Unit activities with keys to subject matter standards. As students work through one or more of the standards-based Why Use the Energized Learning Site? How will teachers and Students Use the Energized Learning Site
Ocean Drilling Program: Web Site Access Statistics
and products Drilling services and tools Online Janus database Search the ODP/TAMU web site ODP's main See statistics for JOIDES members. See statistics for Janus database. 1997 October November December accessible only on www-odp.tamu.edu. ** End of ODP, start of IODP. Privacy Policy ODP | Search | Database
ERIC Educational Resources Information Center
Speakman, Sheree T.; And Others
1997-01-01
Examines the need for new financial reporting and analysis, starting with rethinking the school finance field, retooling the management information systems for school finance, and re-evaluating knowledge about school-site management, accounting, and reporting. Demonstrates a new reporting methodology, the Financial Analysis Model, that traces…
Social Network Sites: A Starting Point for Career Development Practitioners
ERIC Educational Resources Information Center
Strehlke, Christina
2010-01-01
This action research study explores the career influence of social network sites (SNSs) by examining 14 web-based articles that consider the risks and opportunities of SNSs from a job search perspective. Three themes are discussed: user visibility, self-presentation, and network connections. Practical strategies are identified to help career…
Current reversals and metastable states in the infinite Bose-Hubbard chain with local particle loss
NASA Astrophysics Data System (ADS)
Kiefer-Emmanouilidis, M.; Sirker, J.
2017-12-01
We present an algorithm which combines the quantum trajectory approach to open quantum systems with a density-matrix renormalization-group scheme for infinite one-dimensional lattice systems. We apply this method to investigate the long-time dynamics in the Bose-Hubbard model with local particle loss starting from a Mott-insulating initial state with one boson per site. While the short-time dynamics can be described even quantitatively by an equation of motion (EOM) approach at the mean-field level, many-body interactions lead to unexpected effects at intermediate and long times: local particle currents far away from the dissipative site start to reverse direction ultimately leading to a metastable state with a total particle current pointing away from the lossy site. An alternative EOM approach based on an effective fermion model shows that the reversal of currents can be understood qualitatively by the creation of holon-doublon pairs at the edge of the region of reduced particle density. The doublons are then able to escape while the holes move towards the dissipative site, a process reminiscent—in a loose sense—of Hawking radiation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jung, Haeryong; Lee, Eunyong; Jeong, YiYeong
Korea Radioactive-waste Management Corporation (KRMC) established in 2009 has started a new project to collect information on long-term stability of deep geological environments on the Korean Peninsula. The information has been built up in the integrated natural barrier database system available on web (www.deepgeodisposal.kr). The database system also includes socially and economically important information, such as land use, mining area, natural conservation area, population density, and industrial complex, because some of this information is used as exclusionary criteria during the site selection process for a deep geological repository for safe and secure containment and isolation of spent nuclear fuel andmore » other long-lived radioactive waste in Korea. Although the official site selection process has not been started yet in Korea, current integrated natural barrier database system and socio-economic database is believed that the database system will be effectively utilized to narrow down the number of sites where future investigation is most promising in the site selection process for a deep geological repository and to enhance public acceptance by providing readily-available relevant scientific information on deep geological environments in Korea. (authors)« less
Ellis, Vincenzo A; Medeiros, Matthew C I; Collins, Michael D; Sari, Eloisa H R; Coffey, Elyse D; Dickerson, Rebecca C; Lugarini, Camile; Stratford, Jeffrey A; Henry, Donata R; Merrill, Loren; Matthews, Alix E; Hanson, Alison A; Roberts, Jackson R; Joyce, Michael; Kunkel, Melanie R; Ricklefs, Robert E
2017-01-01
Parasite prevalence is thought to be positively related to host population density owing to enhanced contagion. However, the relationship between prevalence and local abundance of multiple host species is underexplored. We surveyed birds and their haemosporidian parasites (genera Plasmodium and Haemoproteus) at multiple sites across eastern North America to test whether the prevalence of these parasites in a host species at a particular site is related to that host's local abundance. Prevalence was positively related to host abundance within most sites, although the effect was stronger and more consistent for Plasmodium than for Haemoproteus. In contrast, prevalence was not related to variation in the abundance of most individual host species among sites across the region. These results suggest that parasite prevalence partly reflects the relative abundances of host species in local assemblages. However, three nonnative host species had low prevalence despite being relatively abundant at one site, as predicted by the enemy release hypothesis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Talamo, Alberto; Gohar, Yousry
2016-06-01
This report describes different methodologies to calculate the effective neutron multiplication factor of subcritical assemblies by processing the neutron detector signals using MATLAB scripts. The subcritical assembly can be driven either by a spontaneous fission neutron source (e.g. californium) or by a neutron source generated from the interactions of accelerated particles with target materials. In the latter case, when the particle accelerator operates in a pulsed mode, the signals are typically stored into two files. One file contains the time when neutron reactions occur and the other contains the times when the neutron pulses start. In both files, the timemore » is given by an integer representing the number of time bins since the start of the counting. These signal files are used to construct the neutron count distribution from a single neutron pulse. The built-in functions of MATLAB are used to calculate the effective neutron multiplication factor through the application of the prompt decay fitting or the area method to the neutron count distribution. If the subcritical assembly is driven by a spontaneous fission neutron source, then the effective multiplication factor can be evaluated either using the prompt neutron decay constant obtained from Rossi or Feynman distributions or the Modified Source Multiplication (MSM) method.« less
A laboratory study of multiple site damage in fuselage lap splices
DOT National Transportation Integrated Search
1993-12-01
This report details an experimental study that was conducted to explore the causes of : fuselage lap splice multiple site damage (MSD), which has been observed in several : aging aircraft. MSD was partially responsible for the 1988 Aloha Airlines acc...
Peng, Fred Y; Yang, Rong-Cai
2017-06-20
The resistance to leaf rust (Lr) caused by Puccinia triticina in wheat (Triticum aestivum L.) has been well studied over the past decades with over 70 Lr genes being mapped on different chromosomes and numerous QTLs (quantitative trait loci) being detected or mapped using DNA markers. Such resistance is often divided into race-specific and race-nonspecific resistance. The race-nonspecific resistance can be further divided into resistance to most or all races of the same pathogen and resistance to multiple pathogens. At the molecular level, these three types of resistance may cover across the whole spectrum of pathogen specificities that are controlled by genes encoding different protein families in wheat. The objective of this study is to predict and analyze genes in three such families: NBS-LRR (nucleotide-binding sites and leucine-rich repeats or NLR), START (Steroidogenic Acute Regulatory protein [STaR] related lipid-transfer) and ABC (ATP-Binding Cassette) transporter. The focus of the analysis is on the patterns of relationships between these protein-coding genes within the gene families and QTLs detected for leaf rust resistance. We predicted 526 ABC, 1117 NLR and 144 START genes in the hexaploid wheat genome through a domain analysis of wheat proteome. Of the 1809 SNPs from leaf rust resistance QTLs in seedling and adult stages of wheat, 126 SNPs were found within coding regions of these genes or their neighborhood (5 Kb upstream from transcription start site [TSS] or downstream from transcription termination site [TTS] of the genes). Forty-three of these SNPs for adult resistance and 18 SNPs for seedling resistance reside within coding or neighboring regions of the ABC genes whereas 14 SNPs for adult resistance and 29 SNPs for seedling resistance reside within coding or neighboring regions of the NLR gene. Moreover, we found 17 nonsynonymous SNPs for adult resistance and five SNPs for seedling resistance in the ABC genes, and five nonsynonymous SNPs for adult resistance and six SNPs for seedling resistance in the NLR genes. Most of these coding SNPs were predicted to alter encoded amino acids and such information may serve as a starting point towards more thorough molecular and functional characterization of the designated Lr genes. Using the primer sequences of 99 known non-SNP markers from leaf rust resistance QTLs, we found candidate genes closely linked to these markers, including Lr34 with distances to its two gene-specific markers being 1212 bases (to cssfr1) and 2189 bases (to cssfr2). This study represents a comprehensive analysis of ABC, NLR and START genes in the hexaploid wheat genome and their physical relationships with QTLs for leaf rust resistance at seedling and adult stages. Our analysis suggests that the ABC (and START) genes are more likely to be co-located with QTLs for race-nonspecific, adult resistance whereas the NLR genes are more likely to be co-located with QTLs for race-specific resistance that would be often expressed at the seedling stage. Though our analysis was hampered by inaccurate or unknown physical positions of numerous QTLs due to the incomplete assembly of the complex hexaploid wheat genome that is currently available, the observed associations between (i) QTLs for race-specific resistance and NLR genes and (ii) QTLs for nonspecific resistance and ABC genes will help discover SNP variants for leaf rust resistance at seedling and adult stages. The genes containing nonsynonymous SNPs are promising candidates that can be investigated in future studies as potential new sources of leaf rust resistance in wheat breeding.
Multiple antibiotic resistant Escherichia coli from a tropical rain forest stream
DOE Office of Scientific and Technical Information (OSTI.GOV)
Carrasco, C.E.; Alvarez, H.J.; Ortiz, N.
1988-12-31
High densities of fecal coliforms were obtained from a pristine site and sewage contaminated site in a tropical rain forest watershed in Puerto Rico. Confirmation of fecal coliform isolates as Escherichia coli was significantly lower than for temperate waters. Antibiotic resistance and multiple antibiotic resistance were common for isolates at both sites; however, the site receiving sewage effluent had a greater proportion of multiple antibiotic resistant isolates. R. plasmids were recovered from 4 MAR isolates, 2 from each site. All recovered plasmids were approximately 1 kilobase. The recovered plasmid were also capable of transforming E. coli HB101 in vitro. Themore » high concentrations of enterobacteriaceae, small R-plasmid size, R-plasmid transformability, and long term survival of fecal origin bacteria in tropical freshwater environments give increasing importance to adequate sewage treatment, and better indicator monitoring methods for tropical areas.« less
Nilsen, Trine; Yan, Arthur W; Gale, Gregory; Goldberg, Marcia B
2005-09-01
In rod-shaped bacteria, certain proteins are specifically localized to the cell poles. The nature of the positional information that leads to the proper localization of these proteins is unclear. In a screen for factors required for the localization of the Shigella sp. actin assembly protein IcsA to the bacterial pole, a mutant carrying a transposon insertion in mreB displayed altered targeting of IcsA. The phenotype of cells containing a transposon insertion in mreB was indistinguishable from that of cells containing a nonpolar mutation in mreB or that of wild-type cells treated with the MreB inhibitor A22. In cells lacking MreB, a green fluorescent protein (GFP) fusion to a cytoplasmic derivative of IcsA localized to multiple sites. Secreted full-length native IcsA was present in multiple faint patches on the surfaces of these cells in a pattern similar to that seen for the cytoplasmic IcsA-GFP fusion. EpsM, the polar Vibrio cholerae inner membrane protein, also localized to multiple sites in mreB cells and colocalized with IcsA, indicating that localization to multiple sites is not unique to IcsA. Our results are consistent with the requirement, either direct or indirect, for MreB in the restriction of certain polar material to defined sites within the cell and, in the absence of MreB, with the formation of ectopic sites containing polar material.
Olm, Matthew R.; Brown, Christopher T.; Brooks, Brandon; Firek, Brian; Baker, Robyn; Burstein, David; Soenjoyo, Karina; Thomas, Brian C.; Morowitz, Michael; Banfield, Jillian F.
2017-01-01
The initial microbiome impacts the health and future development of premature infants. Methodological limitations have led to gaps in our understanding of the habitat range and subpopulation complexity of founding strains, as well as how different body sites support microbial growth. Here, we used metagenomics to reconstruct genomes of strains that colonized the skin, mouth, and gut of two hospitalized premature infants during the first month of life. Seven bacterial populations, considered to be identical given whole-genome average nucleotide identity of >99.9%, colonized multiple body sites, yet none were shared between infants. Gut-associated Citrobacter koseri genomes harbored 47 polymorphic sites that we used to define 10 subpopulations, one of which appeared in the gut after 1 wk but did not spread to other body sites. Differential genome coverage was used to measure bacterial population replication rates in situ. In all cases where the same bacterial population was detected in multiple body sites, replication rates were faster in mouth and skin compared to the gut. The ability of identical strains to colonize multiple body sites underscores the habit flexibility of initial colonists, whereas differences in microbial replication rates between body sites suggest differences in host control and/or resource availability. Population genomic analyses revealed microdiversity within bacterial populations, implying initial inoculation by multiple individual cells with distinct genotypes. Overall, however, the overlap of strains across body sites implies that the premature infant microbiome can exhibit very low microbial diversity. PMID:28073918
Risk factors for epistaxis in jump racing in Great Britain (2001-2009).
Reardon, Richard J M; Boden, Lisa A; Mellor, Dominic J; Love, Sandy; Newton, Richard J; Stirk, Anthony J; Parkin, Timothy D
2015-07-01
The aim of this study was to evaluate risk factors associated with developing epistaxis in jump racing in Great Britain (GB). A retrospective analysis of records from horses running in all hurdle and steeplechase races in GB between 2001 and 2009 identified diagnoses of epistaxis whilst still at the racecourse. Data were used from 603 starts resulting in epistaxis (event) and 169,065 starts resulting in no epistaxis (non-event) in hurdle racing, and from 550 event starts and 102,344 non-event starts in steeplechase racing. Two multivariable logistic regression models to evaluate risk factors associated with epistaxis were produced. The potential effect of clustering of data (within horse, horse dam, horse sire, trainer, jockey, course, race and race meet) on the associations between risk factors and epistaxis was examined using mixed-effects models. Multiple factors associated with increased risk of epistaxis were identified. Those identified in both types of jump racing included running on firmer ground; horses with >75% of career starts in flat racing and a previous episode of epistaxis recorded during racing. Risk factors identified only in hurdle racing included racing in the spring and increased age at first race; and those identified only in steeplechase racing included running in a claiming race and more starts in the previous 3-6 months. The risk factors identified provide important information about the risk of developing epistaxis. Multiple avenues for further investigation are highlighted, including unmeasured variables at the level of the racecourse. The results of this study can be used to guide the development of interventions to minimise the risk of epistaxis in jump racing. Copyright © 2015. Published by Elsevier Ltd.
Manual wheelchair propulsion patterns on natural surfaces during start-up propulsion.
Koontz, Alicia M; Roche, Bailey M; Collinger, Jennifer L; Cooper, Rory A; Boninger, Michael L
2009-11-01
To classify propulsion patterns over surfaces encountered in the natural environment during start-up and compare selected biomechanical variables between pattern types. Case series. National Veterans Wheelchair Games, Minneapolis, MN, 2005. Manual wheelchair users (N=29). Subjects pushed their wheelchairs from a resting position over high-pile carpet, over linoleum, and up a ramp with a 5 degrees incline while propulsion kinematics and kinetics were recorded with a motion capture system and an instrumented wheel. Three raters classified the first 3 strokes as 1 of 4 types on each surface: arc, semicircular (SC), single looping over propulsion (SL), and double looping over propulsion (DL). The Fisher exact test was used to assess pattern changes between strokes and surface type. A multiple analysis of variance test was used to compare peak and average resultant force and moment about the hub, average wheel velocity, stroke frequency, contact angle, and distance traveled between stroke patterns. SL was the most common pattern used during start-up propulsion (44.9%), followed by arc (35.9%), DL (14.1%), and SC (5.1%). Subjects who dropped their hands below the rim during recovery achieved faster velocities and covered greater distances (.016< or =P< or =.075) during start-up on linoleum and carpet and applied more force during start-up on the ramp compared with those who used an arc pattern (P=.066). Classifying propulsion patterns is a difficult task that should use multiple raters. In addition, propulsion patterns change during start-up, with an arc pattern most prevalent initially. The biomechanical findings in this study agree with current clinical guidelines that recommend training users to drop the hand below the pushrim during recovery.
A multidisciplinary decision support system for forest fire crisis management.
Keramitsoglou, Iphigenia; Kiranoudis, Chris T; Sarimveis, Haralambos; Sifakis, Nicolaos
2004-02-01
A wildland fire is a serious threat for forest ecosystems in Southern Europe affecting severely and irreversibly regions of significant ecological value as well as human communities. To support decision makers during large-scale forest fire incidents, a multidisciplinary system has been developed that provides rational and quantitative information based on the site-specific circumstances and the possible consequences. The system's architecture consists of several distinct supplementary modules of near real-time satellite monitoring and fire forecast using an integrated framework of satellite Remote Sensing, GIS, and RDBMS technologies equipped with interactive communication capabilities. The system may handle multiple fire ignitions and support decisions regarding dispatching of utilities, equipment, and personnel that would appropriately attack the fire front. The operational system was developed for the region of Penteli Mountain in Attika, Greece, one of the mountain areas in the country most hit by fires. Starting from a real fire incident in August 2000, a scenario is presented to illustrate the effectiveness of the proposed approach.
Perspectives on the mechanism of transcriptional regulation by long non-coding RNAs.
Roberts, Thomas C; Morris, Kevin V; Weinberg, Marc S
2014-01-01
Long non-coding RNAs (lncRNAs) are increasingly being recognized as epigenetic regulators of gene transcription. The diversity and complexity of lncRNA genes means that they exert their regulatory effects by a variety of mechanisms. Although there is still much to be learned about the mechanism of lncRNA function, general principles are starting to emerge. In particular, the application of high throughput (deep) sequencing methodologies has greatly advanced our understanding of lncRNA gene function. lncRNAs function as adaptors that link specific chromatin loci with chromatin-remodeling complexes and transcription factors. lncRNAs can act in cis or trans to guide epigenetic-modifier complexes to distinct genomic sites, or act as scaffolds which recruit multiple proteins simultaneously, thereby coordinating their activities. In this review we discuss the genomic organization of lncRNAs, the importance of RNA secondary structure to lncRNA functionality, the multitude of ways in which they interact with the genome, and what evolutionary conservation tells us about their function.
NASA Astrophysics Data System (ADS)
Liu, Juewen; Lu, Yi
This chapter reviews recent progress in the interface between functional nucleic acids and nanoscale science and technology, and its analytical applications. In particular, the use of metallic nanoparticles as the color reporting groups for the action (binding, catalysis, or both) of aptamers, DNAzymes, and aptazymes is described in detail. Because metallic nanoparticles possess high extinction coefficients and distance-dependent optical properties, they allow highly sensitive detections with minimal consumption of materials. The combination of quantum dots (QDs) with functional nucleic acids as fluorescent sensors is also described. The chapter starts with the design of colorimetric and fluorescent sensors responsive to single analytes, followed by sensors responsive to multiple analytes with controllable cooperativity and multiplex detection using both colorimetric and fluorescent signals in one pot, and ends by transferring solution-based detections into litmus paper type of tests, making them generally applicable and usable for a wide range of on-site and real-time analytical applications such as household tests, environmental monitoring, and clinical diagnostics.
Computational Design of DNA-Binding Proteins.
Thyme, Summer; Song, Yifan
2016-01-01
Predicting the outcome of engineered and naturally occurring sequence perturbations to protein-DNA interfaces requires accurate computational modeling technologies. It has been well established that computational design to accommodate small numbers of DNA target site substitutions is possible. This chapter details the basic method of design used in the Rosetta macromolecular modeling program that has been successfully used to modulate the specificity of DNA-binding proteins. More recently, combining computational design and directed evolution has become a common approach for increasing the success rate of protein engineering projects. The power of such high-throughput screening depends on computational methods producing multiple potential solutions. Therefore, this chapter describes several protocols for increasing the diversity of designed output. Lastly, we describe an approach for building comparative models of protein-DNA complexes in order to utilize information from homologous sequences. These models can be used to explore how nature modulates specificity of protein-DNA interfaces and potentially can even be used as starting templates for further engineering.
Conéjéro, Geneviève
2014-01-01
A multiple cell imaging approach combining immunofluorescence by confocal microscopy, fluorescence spectral analysis by multiphotonic microscopy, and transmission electron microscopy identified the site of accumulation of 4-O-(3-methoxybenzaldehyde) β-d-glucoside, a phenol glucoside massively stockpiled by vanilla fruit. The glucoside is sufficiently abundant to be detected by spectral analysis of its autofluorescence. The convergent results obtained by these different techniques demonstrated that the phenol glucoside accumulates in the inner volume of redifferentiating chloroplasts as solid amorphous deposits, thus ensuring phenylglucoside cell homeostasis. Redifferentiation starts with the generation of loculi between thylakoid membranes which are progressively filled with the glucoside until a fully matured organelle is obtained. This peculiar mode of storage of a phenolic secondary metabolite is suspected to occur in other plants and its generalization in the Plantae could be considered. This new chloroplast-derived organelle is referred to as a ‘phenyloplast’. PMID:24683183
Brillouet, Jean-Marc; Verdeil, Jean-Luc; Odoux, Eric; Lartaud, Marc; Grisoni, Michel; Conéjéro, Geneviève
2014-06-01
A multiple cell imaging approach combining immunofluorescence by confocal microscopy, fluorescence spectral analysis by multiphotonic microscopy, and transmission electron microscopy identified the site of accumulation of 4-O-(3-methoxybenzaldehyde) β-d-glucoside, a phenol glucoside massively stockpiled by vanilla fruit. The glucoside is sufficiently abundant to be detected by spectral analysis of its autofluorescence. The convergent results obtained by these different techniques demonstrated that the phenol glucoside accumulates in the inner volume of redifferentiating chloroplasts as solid amorphous deposits, thus ensuring phenylglucoside cell homeostasis. Redifferentiation starts with the generation of loculi between thylakoid membranes which are progressively filled with the glucoside until a fully matured organelle is obtained. This peculiar mode of storage of a phenolic secondary metabolite is suspected to occur in other plants and its generalization in the Plantae could be considered. This new chloroplast-derived organelle is referred to as a 'phenyloplast'. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Gene chips and arrays revealed: a primer on their power and their uses.
Watson, S J; Akil, H
1999-03-01
This article provides an overview and general explanation of the rapidly developing area of gene chips and expression array technology. These are methods targeted at allowing the simultaneous study of thousands of genes or messenger RNAs under various physiological and pathological states. Their technical basis grows from the Human Genome Project. Both methods place DNA strands on glass computer chips (or microscope slides). Expression arrays start with complementary DNA (cDNA) clones derived from the EST data base, whereas Gene Chips synthesize oligonucleotides directly on the chip itself. Both are analyzed using image analysis systems, are capable of reading values from two different individuals at any one site, and can yield quantitative data for thousands of genes or mRNAs per slide. These methods promise to revolutionize molecular biology, cell biology, neuroscience and psychiatry. It is likely that this technology will radically open up our ability to study the actions and structure of the multiple genes involved in the complex genetics of brain disorders.
Darwin Assembly: fast, efficient, multi-site bespoke mutagenesis
Cozens, Christopher
2018-01-01
Abstract Engineering proteins for designer functions and biotechnological applications almost invariably requires (or at least benefits from) multiple mutations to non-contiguous residues. Several methods for multiple site-directed mutagenesis exist, but there remains a need for fast and simple methods to efficiently introduce such mutations – particularly for generating large, high quality libraries for directed evolution. Here, we present Darwin Assembly, which can deliver high quality libraries of >108 transformants, targeting multiple (>10) distal sites with minimal wild-type contamination (<0.25% of total population) and which takes a single working day from purified plasmid to library transformation. We demonstrate its efficacy with whole gene codon reassignment of chloramphenicol acetyl transferase, mutating 19 codons in a single reaction in KOD DNA polymerase and generating high quality, multiple-site libraries in T7 RNA polymerase and Tgo DNA polymerase. Darwin Assembly uses commercially available enzymes, can be readily automated, and offers a cost-effective route to highly complex and customizable library generation. PMID:29409059
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Hongsen; Abruña, Héctor D.
2015-05-21
The study of the electrooxidation mechanism of COad on Pt based catalysts is very important for designing more effective CO-tolerant electrocatalysts for fuel cells. We have studied the origin of multiple peaks in the cyclic voltammograms of CO stripping from polycrystalline Pt and Ru modified polycrystalline Pt (Pt/Ru) surfaces in both acidic and alkaline media by differential electrochemical mass spectrometry (DEMS), DFT calculations, and kinetic Monte Carlo (KMC) simulations. A new COad electrooxidation kinetic model on heterogeneous Pt and Pt/Ru catalysts is proposed to account for the multiple peaks experimentally observed. In this model, OH species prefer to adsorb atmore » low-coordination sites or Ru sites and, thus, suppress CO repopulation from high-coordination sites onto these sites. Therefore, COad oxidation occurs on different facets or regions, leading to multiplicity of CO stripping peaks. This work provides a new insight into the CO electrooxidation mechanism and kinetics on heterogeneous catalysts.« less
HIV integration sites in latently infected cell lines: evidence of ongoing replication.
Symons, Jori; Chopra, Abha; Malatinkova, Eva; De Spiegelaere, Ward; Leary, Shay; Cooper, Don; Abana, Chike O; Rhodes, Ajantha; Rezaei, Simin D; Vandekerckhove, Linos; Mallal, Simon; Lewin, Sharon R; Cameron, Paul U
2017-01-13
Assessing the location and frequency of HIV integration sites in latently infected cells can potentially inform our understanding of how HIV persists during combination antiretroviral therapy. We developed a novel high throughput sequencing method to evaluate HIV integration sites in latently infected cell lines to determine whether there was virus replication or clonal expansion in these cell lines observed as multiple integration events at the same position. We modified a previously reported method using random DNA shearing and PCR to allow for high throughput robotic processing to identify the site and frequency of HIV integration in latently infected cell lines. Latently infected cell lines infected with intact virus demonstrated multiple distinct HIV integration sites (28 different sites in U1, 110 in ACH-2 and 117 in J1.1 per 150,000 cells). In contrast, cell lines infected with replication-incompetent viruses (J-Lat cells) demonstrated single integration sites. Following in vitro passaging of the ACH-2 cell line, we observed a significant increase in the frequency of unique HIV integration sites and there were multiple mutations and large deletions in the proviral DNA. When the ACH-2 cell line was cultured with the integrase inhibitor raltegravir, there was a significant decrease in the number of unique HIV integration sites and a transient increase in the frequency of 2-LTR circles consistent with virus replication in these cells. Cell lines latently infected with intact HIV demonstrated multiple unique HIV integration sites indicating that these cell lines are not clonal and in the ACH-2 cell line there was evidence of low level virus replication. These findings have implications for the use of latently infected cell lines as models of HIV latency and for the use of these cells as standards.
Human Mars Landing Site and Impacts on Mars Surface Operations
NASA Technical Reports Server (NTRS)
Hoffman, Stephen J.; Bussey, Ben
2016-01-01
This paper describes NASA's initial steps for identifying and evaluating candidate Exploration Zones (EZs) and Regions of Interests (ROIs) for the first human crews that will explore the surface of Mars. NASA's current effort to define the exploration of this planet by human crews, known as the Evolvable Mars Campaign (EMC), provides the context in which these EZs and ROIs are being considered. The EMC spans all aspects of a human Mars mission including launch from Earth, transit to and from Mars, and operations on the surface of Mars. An EZ is a collection of ROIs located within approximately 100 kilometers of a centralized landing site. ROIs are areas relevant for scientific investigation and/or development/maturation of capabilities and resources necessary for a sustainable human presence. The EZ also contains one or more landing sites and a habitation site that will be used by multiple human crews during missions to explore and utilize the ROIs within the EZ. With the EMC as a conceptual basis, the EZ model has been refined to a point where specific site selection criteria for scientific exploration and in situ resource utilization can be defined. In 2015 these criteria were distributed to the planetary sciences community and the in situ resource utilization and civil engineering communities as part of a call for EZ proposals. The resulting "First Landing Site/Exploration Zone Workshop for Human Missions to the Surface of Mars" was held in October 2015 during which 47 proposals for EZs and ROIs were presented and discussed. Proposed locations spanned all longitudes and all allowable latitudes (+/- 50 degrees). Proposed justification for selecting one of these EZs also spanned a significant portion of the scientific and resource criteria provided to the community. Several important findings resulted from this Workshop including: (a) a strong consensus that, at a scale of 100 km (radius), multiple places on Mars exist that have both sufficient scientific interest to sustain multiple crews of exploring astronauts, AND potential resource deposits for ISRU indicating the current EZ definition is viable and should be retained for now, (b) new data types (needed for more definitive analysis of EZs) argued strongly for a new orbiter mission, and possibly one or more surface missions, to obtain these data, (c) a general consensus that this Workshop was an excellent start to identifying a place where future human missions to Mars can productively explore this planet and learn to live and work there for the long term. Building on these findings, HEOMD and SMD are: (a) refining the EZ selection criteria and overall selection process to improve on lessons learned from the first EZ workshop, (b) using these proposed locations to develop "reference EZs" for assessment purposes (primarily engineering assessments), (c) gathering data and conducting analyses to better understanding the different potential sources for water, including the ease of extraction and purification, and (d) assessing trends in additional data that are needed to better characterize EZs proposed at the workshop and how these data needs impact the design and operation of future robotic Mars missions.
Recruitment of participants to a multiple sclerosis trial: The CombiRx experience
Bhanushali, Minal J; Gustafson, Tarah; Powell, Steve; Conwit, Robin A; Wolinsky, Jerry S; Cutter, Gary R; Lublin, Fred; Cofield, Stacey S
2014-01-01
Background and Purpose: Participant recruitment is central to all clinical trials. Any delay in recruitment affects the completion and ultimate success of the trial. We report our experience with patient screening and randomization in CombiRx, which may inform the design of other trials. CombiRx was a multi-center, phase III, double-blind, randomized clinical trial comparing the combined use of interferon beta-1a and glatiramer acetate to either agent alone in patients with relapsing-remitting multiple sclerosis (RRMS). This trial was launched in January 2005 in 69 centers in the U.S. and Canada under a co-operative agreement with the National Institute of Neurological Disorders and Stroke (NINDS). The goal was to recruit 1000 patients over 1.5 years after a 6 month startup period. Instead, the investigators required 4.25 years to enroll 1008 patients. Methods: During this trial, we assessed the effectiveness of various recruitment strategies, utility of rescreening prior screen failures, and potential factors and strategies used in study conduct, research and infrastructure, all of which affected recruitment of participants and ultimately time to completion of CombiRx. We particularly were interested in the variability in time to site initiation between academic centers and private practice sites. Results: Physicians who were directly involved in the medical care of patients with RRMS were the primary source of patients recruited to CombiRx. A flexible study design that allowed for re-screening of the initial screen failures after a period of time was useful due to the relapsing/remitting course of the disease. Academic centers took longer to implement the trial than the private practice centers, but once sites were approved for enrollment, there was no important difference in the number of participants enrolled. Limitations: The CombiRx trial was conducted during a period when multiple new medications were being tested, thus affecting the pace of recruitment and limiting ability to generalize our experiences. However, the lessons we learned about process are relevant. Conclusion: Participants can be enrolled successfully in a clinical trial for RRMS, but factors affecting the time to achieve the requirements needed to start screening can be unpredictable and problematic. Prospective planning by the sponsors and investigators, use of central IRBs, master trial agreements and secure remote desktop access to the trial database may expedite trial implementation and participant recruitment. A good scientific research question with flexible study design and active involvement of the clinicians are important factors driving recruitment. Clinical trials can be implemented successfully both in private practices and at academic centers, a consideration when selecting sites. PMID:24686106
Peng, Shiyong; Liu, Suna; Zhang, Sai; Cao, Shengyu; Sun, Jiangtao
2015-10-16
Polyheteroaromatic compounds are potential optoelectronic conjugated materials due to their electro- and photochemical properties. Transition-metal-catalyzed multiple C-H activation and sequential oxidative annulation allows rapidly assembling of those compounds from readily available starting materials. A rhodium-catalyzed cascade oxidative annulation of β-enamino esters or 4-aminocoumarins with internal alkynes is described to access those compounds, featuring multiple C-H/N-H bond cleavages and sequential C-C/C-N bond formations in one pot.
ERIC Educational Resources Information Center
Arrimada, María; Torrance, Mark; Fidalgo, Raquel
2018-01-01
We report a multiple-baseline single-case study, based in the response to intervention framework, evaluating transcription-only and transcription-and-planning interventions for young, struggling writers. In a baseline phase, 8 classes of Spanish children at the start of their first year of primary (elementary) education completed short, probe…
ERIC Educational Resources Information Center
Rider-Bertrand, Joey H.
2017-01-01
At the start of the 21st century, STEM education was a new priority in many schools as the focus shifted from separate disciplines to integrative STEM education. Unfortunately, there was limited research to offer guidance to practitioners (Brown, 2012; Honey, Pearson & Schweingruber, 2014). This qualitative, multiple case study explored the…
24 CFR 1710.15 - Regulatory exemption-multiple site subdivision-determination required.
Code of Federal Regulations, 2011 CFR
2011-04-01
.... Any development will likely have some impact on the surrounding environment. Development which... 24 Housing and Urban Development 5 2011-04-01 2011-04-01 false Regulatory exemption-multiple site subdivision-determination required. 1710.15 Section 1710.15 Housing and Urban Development Regulations Relating...
24 CFR 1710.15 - Regulatory exemption-multiple site subdivision-determination required.
Code of Federal Regulations, 2014 CFR
2014-04-01
.... Any development will likely have some impact on the surrounding environment. Development which... 24 Housing and Urban Development 5 2014-04-01 2014-04-01 false Regulatory exemption-multiple site subdivision-determination required. 1710.15 Section 1710.15 Housing and Urban Development Regulations Relating...
24 CFR 1710.15 - Regulatory exemption-multiple site subdivision-determination required.
Code of Federal Regulations, 2013 CFR
2013-04-01
.... Any development will likely have some impact on the surrounding environment. Development which... 24 Housing and Urban Development 5 2013-04-01 2013-04-01 false Regulatory exemption-multiple site subdivision-determination required. 1710.15 Section 1710.15 Housing and Urban Development Regulations Relating...
24 CFR 1710.15 - Regulatory exemption-multiple site subdivision-determination required.
Code of Federal Regulations, 2012 CFR
2012-04-01
.... Any development will likely have some impact on the surrounding environment. Development which... 24 Housing and Urban Development 5 2012-04-01 2012-04-01 false Regulatory exemption-multiple site subdivision-determination required. 1710.15 Section 1710.15 Housing and Urban Development Regulations Relating...
2017-10-01
Colonization PRINCIPAL INVESTIGATOR: Srinivas Nandana CONTRACTING ORGANIZATION: Cedars-Sinai Medical Center Los Angeles, CA, 90048 REPORT DATE...8. PERFORMING ORGANIZATION REPORT NUMBER Cedars-Sinai Medical Center, 8700 Beverly Blvd, Los Angeles, CA, 90048 9. SPONSORING / MONITORING...Revised Statement of Work (SOW): PROPOSED START DATE Sep 30, 2016 ACTUAL START DATE – Sep 18, 2017 Site: Uro -Oncology, Dept of Medicine
NASA Astrophysics Data System (ADS)
Lemon, M. G.; Keim, R.
2017-12-01
Although specific controls are not well understood, the phenology of temperate forests is generally thought to be controlled by photoperiod and temperature, although recent research suggests that soil moisture may also be important. The phenological controls of forested wetlands have not been thoroughly studied, and may be more controlled by site hydrology than other forests. For this study, remotely sensed vegetation indices were used to investigate hydrological controls on start-of-season timing, growing season length, and end-of-season timing at five floodplains in Louisiana, Arkansas, and Texas. A simple spring green-up model was used to determine the null spring start of season time for each site as a function of land surface temperature and photoperiod, or two remotely sensed indices: MODIS phenology data product and the MODIS Nadir Bidirectional Reflectance Distribution Function-Adjusted Reflectance (NBAR) product. Preliminary results indicate that topographically lower areas within the floodplain with higher flood frequency experience later start-of-season timing. In addition, start-of-season is delayed in wet years relative to predicted timing based solely on temperature and photoperiod. The consequences for these controls unclear, but results suggest hydrological controls on floodplain ecosystem structure and carbon budgets are likely at least partially expressed by variations in growing season length.
Non-AUG translation: a new start for protein synthesis in eukaryotes
Kearse, Michael G.; Wilusz, Jeremy E.
2017-01-01
Although it was long thought that eukaryotic translation almost always initiates at an AUG start codon, recent advancements in ribosome footprint mapping have revealed that non-AUG start codons are used at an astonishing frequency. These non-AUG initiation events are not simply errors but instead are used to generate or regulate proteins with key cellular functions; for example, during development or stress. Misregulation of non-AUG initiation events contributes to multiple human diseases, including cancer and neurodegeneration, and modulation of non-AUG usage may represent a novel therapeutic strategy. It is thus becoming increasingly clear that start codon selection is regulated by many trans-acting initiation factors as well as sequence/structural elements within messenger RNAs and that non-AUG translation has a profound impact on cellular states. PMID:28982758
Tsunekawa, Ryuji; Hanaya, Kengo; Higashibayashi, Shuhei; Sugai, Takeshi
2018-04-26
Fisetin and 2',4',6'-trihydroxydihyrochalcone 4'-O-β-neohesperidoside were synthesized from commercially available quercetin and naringin in five steps. The key steps are site-selective deacetylation and subsequent deoxygenation. The target molecules were obtained in 37% and 23% yields from the starting materials, respectively.
Second Information Technology in Education Study: SITES 2006 Technical Report
ERIC Educational Resources Information Center
Carstens, Ralph, Ed.; Pelgrum, Willem J., Ed.
2009-01-01
The International Association for the Evaluation of Educational Achievement (IEA) has been conducting comparative studies for 50 years. SITES 2006 is the fifth wave of surveys related to information and communication technology (ICT), a wave that IEA started with its Computers in Education Study (two studies with data collection in 1989 and 1992),…
Monitoring of natural outbreaks of Phytophthora ramorum in the United Kingdom.
Judith Turner; Alex Appiah; Philip Jennings; Gilli Humphries; Debbie Liddell; Sam McDonough; Jackie Stonehouse; David Lockley; Stephen Eales
2006-01-01
Over 40 outbreaks of Phytophthora ramorum have occurred in managed gardens in the United Kingdom. Three of these sites, one in the southeast of England and two in the southwest, have been closely monitored since October 2003. These sites represented differing disease scenarios at the start of monitoring, as eradication action had already taken...
Interrelationship between Attachment Styles and Facebook Addiction
ERIC Educational Resources Information Center
Eroglu, Yuksel
2016-01-01
Social networking sites have started to become one of the most frequently used online communication types in the world. It is reported that one of the commonly used social networking sites is Facebook. Since Facebook use is new yet, it can be stated that researches on the Facebook addiction are at the beginning level. For this reason, determining…
Effects of wildfires on riparian restoration sites, [electronic resource
Jonathan W. Long; B. Mae Burnette
2004-01-01
We monitored changes in vegetation and channel morphology along reaches of two perennial streams, Limestone Canyon and East Cedar Creek, on the White Mountain Apache Reservation in Arizona starting in the fall of 1995. Enormous wildfires caused extensive erosion and runoff in the watersheds containing the sites in 2002 and 2003, respectively. All reaches within the...
Multifocal pigmented villonodular synovitis in a child. A case report.
Kay, R M; Eckardt, J J; Mirra, J M
1996-01-01
Pigmented villonodular synovitis is a well-described disease that almost universally involves a single site. This is a report of an unusual case of multiple site involvement of pigmented villonodular synovitis in a child. In addition to multiple site involvement, the case is unusual for several reasons: asymmetric involvement, involvement of both upper and lower extremities, involvement of the pes anserine tendons, and the patient is an otherwise healthy child.
Amid, C; Olstedt, M; Gunnarsson, J S; Le Lan, H; Tran Thi Minh, H; Van den Brink, P J; Hellström, M; Tedengren, M
2018-05-01
The combined effects of the herbicide glyphosate and elevated temperature were studied on the tropical staghorn coral Acropora formosa, in Nha Trang bay, Vietnam. The corals were collected from two different reefs, one close to a polluted fish farm and one in a marine-protected area (MPA). In the laboratory, branches of the corals were exposed to the herbicide glyphosate at ambient (28 °C) and at 3 °C elevated water temperatures (31 °C). Effects of herbicide and elevated temperature were studied on coral bleaching using photography and digital image analysis (new colorimetric method developed here based on grayscale), chlorophyll a analysis, and symbiotic dinoflagellate (Symbiodinium, referred to as zooxanthellae) counts. All corals from the MPA started to bleach in the laboratory before they were exposed to the treatments, indicating that they were very sensitive, as opposed to the corals collected from the more polluted site, which were more tolerant and showed no bleaching response to temperature increase or herbicide alone. However, the combined exposure to the stressors resulted in significant loss of color, proportional to loss in chlorophyll a and zooxanthellae. The difference in sensitivity of the corals collected from the polluted site versus the MPA site could be explained by different symbiont types: the resilient type C3u and the stress-sensitive types C21 and C23, respectively. The additive effect of elevated temperatures and herbicides adds further weight to the notion that the bleaching of coral reefs is accelerated in the presence of multiple stressors. These results suggest that the corals in Nha Trang bay have adapted to the ongoing pollution to become more tolerant to anthropogenic stressors, and that multiple stressors hamper this resilience. The loss of color and decrease of chlorophyll a suggest that bleaching is related to concentration of chloro-pigments. The colorimetric method could be further fine-tuned and used as a precise, non-intrusive tool for monitoring coral bleaching in situ.
Factors affecting measured aircraft sound levels in the vicinity of start-of-takeoff roll
NASA Astrophysics Data System (ADS)
Richard, Horonjeff; Fleming, Gregg G.; Rickley, Edward J.; Connor, Thomas L.
This paper presents the findings of a recently conducted measurement and analysis program of jet transport aircraft sound levels in the vicinity of the star-of-takeoff roll. The purpose of the program was two-fold: (1) to evaluate the computational accuracy of the Federal Aviation Administration's Integrated Noise Model (INM) in the vicinity of start-of-takeoff roll with a recently updated database (INM 3.10), and (2) to provide guidance for future model improvements. Focusing on the second of these two goals, this paper examines several factors affecting Sound Exposure Levels (SELs) in the hemicircular area behind the aircraft brake release point at the start-of-takeoff. In addition to the aircraft type itself, these factors included the geometric relationship of the measurement site to the runway, the wind velocity (speed and direction), aircraft grow weight, and start-of-roll mode (static or rolling start).
Journal Article: EPA's National Dioxin Air Monitoring Network ...
The U.S. Environmental Protection Agency (U.S. EPA) established the National Dioxin Air Monitoring Network (NDAMN) in June of 1998, and operated it until November of 2004. The objective of NDAMN was to determine background air concentrations of polychlorinated dibenzo-p-dioxins (PCDDs), polychlorinated dibenzofurans (PCDFs), and dioxin-like polychlorinated biphenyls (dl-PCBs). NDAMN started with 10 sampling sites, adding more over time until the final count of 34 sites was reached by the beginning of 2003. Samples were taken quarterly, and the final sample count was 685. All samples were measured for 17 PCDD/PCDF congeners, 8 PCDD/PCDF homologue groups, and 7 dl-PCBs (note: 5 additional dl-PCBs were added for samples starting in the summer of 2002; 317 samples had measurements of 12 dl-PCBs). The overall average total toxic equivalent (TEQ) concentration in the United States was 11.2 fg TEQ m−3 with dl-PCBs contributing 0.8 fg TEQ m−3 (7%) to this total. The archetype dioxin and furan background air congener profile was seen in the survey averages and in most individual samples. This archetype profile is characterized by low and similar concentrations for tetra – through hexa PCDD/PCDF congeners, with elevations in four congeners – a hepta dioxin and furan congener, and both octa congeners. Sites were generally categorized as urban (4 sites), rural (23 sites), or remote (7 sites). The average TEQ concentrations over all sites and samples within these cat
Kördel, Werner; Bernhardt, Cornelia; Derz, Kerstin; Hund-Rinke, Kerstin; Harmsen, Joop; Peijnenburg, Willie; Comans, Rob; Terytze, Konstantin
2013-10-15
Nearly all publications dealing with availability or bioavailability of soil pollutants start with the following statement: the determination of total pollutant content will lead to an over-estimation of risk. However, an assessment of contaminated sites should be based on the determination of mobile fractions of pollutants, and the fractions with potential for mobilisation that threaten groundwater and surface water, and the actual and potential fractions available for uptake by plants, soil microflora and soil organisms. After reviewing the literature for method proposals concerning the determination of available/bioavailable fractions of contaminants with respect to leaching, plants, microorganisms (biodegradation) and soil organisms, we propose a testing and assessment scheme for contaminated sites. The proposal includes (i) already accepted and used methods, (ii) methods which are under standardisation, and (iii) methods for which development has just started in order to promote urgently needed research. Copyright © 2013 Elsevier B.V. All rights reserved.
[Percutaneous needle aponeurotomy for Dupuytren's disease].
Spies, C K; Müller, L P; Skouras, E; Bassemir, D; Hahn, P; Unglaub, F
2016-02-01
Percutaneous transverse aponeurotomy of the cord by using a hypodermic needle as a scalpel blade in order to improve function of the hand. Symptomatic flexion contracture with positive table top test caused by a single, palpable cord within the palm (primarily Tubiana stages I and II). Multiple, infiltrating or broad-based cords within the palm; irritated skin conditions; exclusive digital cord localization; recurrence after aponeurectomy; previous surgical intervention at the site of interest, digital nerve lesions; lack of patient compliance. Pinpoint surface anesthesia is obtained by injecting each portal area subdermally with 0.1 ml of local anesthetic. These applications start from distally to proximally within the palm while the most distal injection site is located proximal to the distal palm crease. Then the needle tip is introduced perpendicular to the cord. Sawing movements through the cord are performed transversely. While passively extending the contracted finger, the cord is held under tension which guarantees safe cutting. Patients are encouraged to report immediate pain sensation or numbness in order to prevent injuries to neurovascular structures and active finger flexion excludes tendon lesions during the procedure. Introducing the needle tip may be performed at several sites along the cord, if necessary, from distal to proximal at least 5 mm apart with prior pinpoint surface anesthesia. Finally, cautious passive stretching may be done after each release. Bandaging allowing immediate motion; application of a hand-based extension splint-glove during the night for 3-6 months. Recurrence rate was 53% in 15 retrospectively examined patients after a mean interval of 40 months postoperatively.
DNA Editing of LTR Retrotransposons Reveals the Impact of APOBECs on Vertebrate Genomes
Knisbacher, Binyamin A.; Levanon, Erez Y.
2016-01-01
Long terminal repeat retrotransposons (LTR) are widespread in vertebrates and their dynamism facilitates genome evolution. However, these endogenous retroviruses (ERVs) must be restricted to maintain genomic stability. The APOBECs, a protein family that can edit C-to-U in DNA, do so by interfering with reverse transcription and hypermutating retrotransposon DNA. In some cases, a retrotransposon may integrate into the genome despite being hypermutated. Such an event introduces a unique sequence into the genome, increasing retrotransposon diversity and the probability of developing new function at the locus of insertion. The prevalence of this phenomenon and its effects on vertebrate genomes are still unclear. In this study, we screened ERV sequences in the genomes of 123 diverse species and identified hundreds of thousands of edited sites in multiple vertebrate lineages, including placental mammals, marsupials, and birds. Numerous edited ERVs carry high mutation loads, some with greater than 350 edited sites, profoundly damaging their open-reading frames. For many of the species studied, this is the first evidence that APOBECs are active players in their innate immune system. Unexpectedly, some birds and especially zebra finch and medium ground-finch (one of Darwin’s finches) are exceptionally enriched in DNA editing. We demonstrate that edited retrotransposons may be preferentially retained in active genomic regions, as reflected from their enrichment in genes, exons, promoters, and transcription start sites, thereby raising the probability of their exaptation for novel function. In conclusion, DNA editing of retrotransposons by APOBECs has a substantial role in vertebrate innate immunity and may boost genome evolution. PMID:26541172
NASA Astrophysics Data System (ADS)
Greenberg, Mitchell; Sharan, Riti; Galbadage, Thushara; Sule, Preeti; Smith, Robert; Lovelady, April; Cirillo, Jeffrey D.; Glowczwski, Alan; Maitland, Kristen C.
2018-02-01
Surgical site infections (SSIs) are a leading cause of morbidity and mortality and a significant expense to the healthcare system and hospitals. The majority of these infections are preventable; however, increasing bacterial resistance, biofilm persistence, and human error contribute to the occurrence of these healthcare-associated infections. We present a flexible antimicrobial blue-light emitting bandage designed for use on postoperative incisions and wounds. The photonic device is designed to inactivate bacteria present on the skin and prevent bacterial colonization of the site, thus reducing the occurrence of SSIs. This antimicrobial light emitting bandage uses blue light's proven abilities to inactivate a wide range of clinical pathogens regardless of their resistance to antibiotics, inactivate bacteria without harming mammalian cells, improve wound healing, and inactivate bacteria in biofilms. The antimicrobial bandage consists of a thin 2"x2" silicone sheet with an array of 77 LEDs embedded in multiple layers of the material for thermal management. The 405 nm center wavelength LED array is designed to be a wearable device that integrates with standard hospital infection prevention protocols. The device was characterized for irradiance of 44.5 mW/cm2. Methicillin-resistant Staphylococcus aureus seeded in a petri dish was used to evaluate bacterial inactivation in vitro. Starting with a concentration of 2.16 x 107 colony forming units (CFU)/mL, 45% of the bacteria was inactivated within 15 minutes, 65% had been inactivated by 30 minutes, 99% was inactivated by 60 minutes, and a 7 log reduction and complete sterilization was achieved within 120 minutes.
Rating knowledge sharing in cross-domain collaborative filtering.
Li, Bin; Zhu, Xingquan; Li, Ruijiang; Zhang, Chengqi
2015-05-01
Cross-domain collaborative filtering (CF) aims to share common rating knowledge across multiple related CF domains to boost the CF performance. In this paper, we view CF domains as a 2-D site-time coordinate system, on which multiple related domains, such as similar recommender sites or successive time-slices, can share group-level rating patterns. We propose a unified framework for cross-domain CF over the site-time coordinate system by sharing group-level rating patterns and imposing user/item dependence across domains. A generative model, say ratings over site-time (ROST), which can generate and predict ratings for multiple related CF domains, is developed as the basic model for the framework. We further introduce cross-domain user/item dependence into ROST and extend it to two real-world cross-domain CF scenarios: 1) ROST (sites) for alleviating rating sparsity in the target domain, where multiple similar sites are viewed as related CF domains and some items in the target domain depend on their correspondences in the related ones; and 2) ROST (time) for modeling user-interest drift over time, where a series of time-slices are viewed as related CF domains and a user at current time-slice depends on herself in the previous time-slice. All these ROST models are instances of the proposed unified framework. The experimental results show that ROST (sites) can effectively alleviate the sparsity problem to improve rating prediction performance and ROST (time) can clearly track and visualize user-interest drift over time.
Menzel, Annette; Helm, Raimund; Zang, Christian
2015-01-01
Damage by late spring frost is a risk deciduous trees have to cope with in order to optimize the length of their growing season. The timing of spring phenological development plays a crucial role, not only at the species level, but also at the population and individual level, since fresh new leaves are especially vulnerable. For the pronounced late spring frost in May 2011 in Germany, we studied the individual leaf development of 35 deciduous trees (mainly European beech Fagus sylvatica L.) at a mountainous forest site in the Bayerischer Wald National Park using repeated digital photographs. Analyses of the time series of greenness by a novel Bayesian multiple change point approach mostly revealed five change points which almost perfectly matched the expected break points in leaf development: (i) start of the first greening between day of the year (DOY) 108–119 (mean 113), (ii) end of greening, and (iii) visible frost damage after the frost on the night of May 3rd/4th (DOY 123/124), (iv) re-sprouting 19–38 days after the frost, and (v) full maturity around DOY 178 (166–184) when all beech crowns had fully recovered. Since frost damage was nearly 100%, individual susceptibility did not depend on the timing of first spring leaf unfolding. However, we could identify significant patterns in fitness linked to an earlier start of leaf unfolding. Those individuals that had an earlier start of greening during the first flushing period had a shorter period of recovery and started the second greening earlier. Thus, phenological timing triggered the speed of recovery from such an extreme event. The maximum greenness achieved, however, did not vary with leaf unfolding dates. Two mountain ashes (Sorbus aucuparia L.) were not affected by the low temperatures of -5°C. Time series analysis of webcam pictures can thus improve process-based knowledge and provide valuable insights into the link between phenological variation, late spring frost damage, and recovery within one stand. PMID:25759707
Menzel, Annette; Helm, Raimund; Zang, Christian
2015-01-01
Damage by late spring frost is a risk deciduous trees have to cope with in order to optimize the length of their growing season. The timing of spring phenological development plays a crucial role, not only at the species level, but also at the population and individual level, since fresh new leaves are especially vulnerable. For the pronounced late spring frost in May 2011 in Germany, we studied the individual leaf development of 35 deciduous trees (mainly European beech Fagus sylvatica L.) at a mountainous forest site in the Bayerischer Wald National Park using repeated digital photographs. Analyses of the time series of greenness by a novel Bayesian multiple change point approach mostly revealed five change points which almost perfectly matched the expected break points in leaf development: (i) start of the first greening between day of the year (DOY) 108-119 (mean 113), (ii) end of greening, and (iii) visible frost damage after the frost on the night of May 3rd/4th (DOY 123/124), (iv) re-sprouting 19-38 days after the frost, and (v) full maturity around DOY 178 (166-184) when all beech crowns had fully recovered. Since frost damage was nearly 100%, individual susceptibility did not depend on the timing of first spring leaf unfolding. However, we could identify significant patterns in fitness linked to an earlier start of leaf unfolding. Those individuals that had an earlier start of greening during the first flushing period had a shorter period of recovery and started the second greening earlier. Thus, phenological timing triggered the speed of recovery from such an extreme event. The maximum greenness achieved, however, did not vary with leaf unfolding dates. Two mountain ashes (Sorbus aucuparia L.) were not affected by the low temperatures of -5°C. Time series analysis of webcam pictures can thus improve process-based knowledge and provide valuable insights into the link between phenological variation, late spring frost damage, and recovery within one stand.
Qiao, Huan; May, James M.
2012-01-01
Transcription of the ascorbate transporter, SVCT2, is driven by two distinct promoters in exon 1 of the transporter sequence. The exon 1a promoter lacks a classical transcription start site and little is known about regulation of promoter activity in the transcription start site core (TSSC) region. Here we present evidence that the TSSC binds the multifunctional initiator-binding protein YY1. Electrophoresis shift assays using YY1 antibody showed that YY1 is present as one of two major complexes that specifically bind to the TSSC. The other complex contains the transcription factor NF-Y. Mutations in the TSSC that decreased YY1 binding also impaired the exon 1a promoter activity despite the presence of an upstream activating NF-Y/USF complex, suggesting that YY1 is involved in the regulation of the exon 1a transcription. Furthermore, YY1 interaction with NF-Y and/or USF synergistically enhanced the exon 1a promoter activity in transient transfections and co-activator p300 enhanced their synergistic activation. We propose that the TSSC plays a vital role in the exon 1a transcription and that this function is partially carried out by the transcription factor YY1. Moreover, co-activator p300 might be able to synergistically enhance the TSSC function via a “bridge” mechanism with upstream sequences. PMID:22532872
Identifying arbitrary parameter zonation using multiple level set functions
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lu, Zhiming; Vesselinov, Velimir Valentinov; Lei, Hongzhuan
In this paper, we extended the analytical level set method [1, 2] for identifying a piece-wisely heterogeneous (zonation) binary system to the case with an arbitrary number of materials with unknown material properties. In the developed level set approach, starting from an initial guess, the material interfaces are propagated through iterations such that the residuals between the simulated and observed state variables (hydraulic head) is minimized. We derived an expression for the propagation velocity of the interface between any two materials, which is related to the permeability contrast between the materials on two sides of the interface, the sensitivity ofmore » the head to permeability, and the head residual. We also formulated an expression for updating the permeability of all materials, which is consistent with the steepest descent of the objective function. The developed approach has been demonstrated through many examples, ranging from totally synthetic cases to a case where the flow conditions are representative of a groundwater contaminant site at the Los Alamos National Laboratory. These examples indicate that the level set method can successfully identify zonation structures, even if the number of materials in the model domain is not exactly known in advance. Although the evolution of the material zonation depends on the initial guess field, inverse modeling runs starting with different initial guesses fields may converge to the similar final zonation structure. These examples also suggest that identifying interfaces of spatially distributed heterogeneities is more important than estimating their permeability values.« less
NASA Astrophysics Data System (ADS)
Chornock, R.; Berger, E.; Kasen, D.; Cowperthwaite, P. S.; Nicholl, M.; Villar, V. A.; Alexander, K. D.; Blanchard, P. K.; Eftekhari, T.; Fong, W.; Margutti, R.; Williams, P. K. G.; Annis, J.; Brout, D.; Brown, D. A.; Chen, H.-Y.; Drout, M. R.; Farr, B.; Foley, R. J.; Frieman, J. A.; Fryer, C. L.; Herner, K.; Holz, D. E.; Kessler, R.; Matheson, T.; Metzger, B. D.; Quataert, E.; Rest, A.; Sako, M.; Scolnic, D. M.; Smith, N.; Soares-Santos, M.
2017-10-01
We present a near-infrared spectral sequence of the electromagnetic counterpart to the binary neutron star merger GW170817 detected by Advanced Laser Interferometer Gravitational-wave Observatory (LIGO)/Virgo. Our data set comprises seven epochs of J+H spectra taken with FLAMINGOS-2 on Gemini-South between 1.5 and 10.5 days after the merger. In the initial epoch, the spectrum is dominated by a smooth blue continuum due to a high-velocity, lanthanide-poor blue kilonova component. Starting the following night, all of the subsequent spectra instead show features that are similar to those predicted in model spectra of material with a high concentration of lanthanides, including spectral peaks near 1.07 and 1.55 μm. Our fiducial model with 0.04 M ⊙ of ejecta, an ejection velocity of v = 0.1c, and a lanthanide concentration of X lan = 10-2 provides a good match to the spectra taken in the first five days, although it over-predicts the late-time fluxes. We also explore models with multiple fitting components, in each case finding that a significant abundance of lanthanide elements is necessary to match the broad spectral peaks that we observe starting at 2.5 days after the merger. These data provide direct evidence that binary neutron star mergers are significant production sites of even the heaviest r-process elements.
Chornock, R.; Berger, E.; Kasen, D.; ...
2017-10-16
Here, we present a near-infrared spectral sequence of the electromagnetic counterpart to the binary neutron star merger GW170817 detected by Advanced Laser Interferometer Gravitational-wave Observatory (LIGO)/Virgo. Our data set comprises seven epochs of J+H spectra taken with FLAMINGOS-2 on Gemini-South between 1.5 and 10.5 days after the merger. In the initial epoch, the spectrum is dominated by a smooth blue continuum due to a high-velocity, lanthanide-poor blue kilonova component. Starting the following night, all of the subsequent spectra instead show features that are similar to those predicted in model spectra of material with a high concentration of lanthanides, including spectralmore » peaks near 1.07 and 1.55 μm. Our fiducial model with 0.04 M ⊙ of ejecta, an ejection velocity of v = 0.1c, and a lanthanide concentration of X lan = 10 –2 provides a good match to the spectra taken in the first five days, although it over-predicts the late-time fluxes. We also explore models with multiple fitting components, in each case finding that a significant abundance of lanthanide elements is necessary to match the broad spectral peaks that we observe starting at 2.5 days after the merger. These data provide direct evidence that binary neutron star mergers are significant production sites of even the heaviest r-process elements.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chornock, R.; Berger, E.; Cowperthwaite, P. S.
We present a near-infrared spectral sequence of the electromagnetic counterpart to the binary neutron star merger GW170817 detected by Advanced Laser Interferometer Gravitational-wave Observatory (LIGO)/Virgo. Our data set comprises seven epochs of J + H spectra taken with FLAMINGOS-2 on Gemini-South between 1.5 and 10.5 days after the merger. In the initial epoch, the spectrum is dominated by a smooth blue continuum due to a high-velocity, lanthanide-poor blue kilonova component. Starting the following night, all of the subsequent spectra instead show features that are similar to those predicted in model spectra of material with a high concentration of lanthanides, includingmore » spectral peaks near 1.07 and 1.55 μ m. Our fiducial model with 0.04 M {sub ⊙} of ejecta, an ejection velocity of v = 0.1 c , and a lanthanide concentration of X {sub lan} = 10{sup −2} provides a good match to the spectra taken in the first five days, although it over-predicts the late-time fluxes. We also explore models with multiple fitting components, in each case finding that a significant abundance of lanthanide elements is necessary to match the broad spectral peaks that we observe starting at 2.5 days after the merger. These data provide direct evidence that binary neutron star mergers are significant production sites of even the heaviest r -process elements.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chornock, R.; Berger, E.; Kasen, D.
Here, we present a near-infrared spectral sequence of the electromagnetic counterpart to the binary neutron star merger GW170817 detected by Advanced Laser Interferometer Gravitational-wave Observatory (LIGO)/Virgo. Our data set comprises seven epochs of J+H spectra taken with FLAMINGOS-2 on Gemini-South between 1.5 and 10.5 days after the merger. In the initial epoch, the spectrum is dominated by a smooth blue continuum due to a high-velocity, lanthanide-poor blue kilonova component. Starting the following night, all of the subsequent spectra instead show features that are similar to those predicted in model spectra of material with a high concentration of lanthanides, including spectralmore » peaks near 1.07 and 1.55 μm. Our fiducial model with 0.04 M ⊙ of ejecta, an ejection velocity of v = 0.1c, and a lanthanide concentration of X lan = 10 –2 provides a good match to the spectra taken in the first five days, although it over-predicts the late-time fluxes. We also explore models with multiple fitting components, in each case finding that a significant abundance of lanthanide elements is necessary to match the broad spectral peaks that we observe starting at 2.5 days after the merger. These data provide direct evidence that binary neutron star mergers are significant production sites of even the heaviest r-process elements.« less
Evaluation of Growing Season Milestones, Using Eddy Covariance Time-Series of Net Ecosystem Exchange
NASA Astrophysics Data System (ADS)
Pastorello, G.; Faybishenko, B.; Poindexter, C.; Menzer, O.; Agarwal, D.; Papale, D.; Baldocchi, D. D.
2014-12-01
Common methods for determining timing of plants' developmental events, such as direct observation and remote sensing of NDVI, usually produce data of temporal resolution on the order of one week or more. This limitation can make observing subtle trends across years difficult. The goal of this presentation is to demonstrate a conceptual approach and a computational technique to quantify seasonal, annual and long-term phenological indices and patterns, based on continuous eddy covariance measurements of net ecosystem exchange (NEE) measured at eddy covariance towers in the AmeriFlux network. Using a comprehensive time series analysis of NEE fluxes in different climatic zones, we determined multiple characteristics (and their confidence intervals) of the growing season including: the initiation day—the day when canopy photosynthesis development starts, the photosynthesis stabilization day - the day when the development process of canopy photosynthesis starts to slow down and gradually moves toward stabilization, and the growing season effective termination day. We also determined the spring photosynthetic development velocity and the fall photosynthetic development velocity. The results of calculations using NEE were compared with those from temperature and precipitation data measured at the same AmeriFlux tower stations, as well as with the in-situ directly observed phenological records. The results of calculations of phenological indices from the NEE time-series collected at AmeriFlux sites can be used to constrain the application of other time- and labor-intensive sensing methods and to reduce the uncertainty in identifying trends in the timing of phenological indices.
Microbial Changes during Pregnancy, Birth, and Infancy
Nuriel-Ohayon, Meital; Neuman, Hadar; Koren, Omry
2016-01-01
Several healthy developmental processes such as pregnancy, fetal development, and infant development include a multitude of physiological changes: weight gain, hormonal, and metabolic changes, as well as immune changes. In this review, we present an additional important factor which both influences and is affected by these physiological processes—the microbiome. We summarize the known changes in microbiota composition at a variety of body sites including gut, vagina, oral cavity, and placenta, throughout pregnancy, fetal development, and early childhood. There is still a lot to be discovered; yet several pieces of research point to the healthy desired microbial changes. Future research is likely to unravel precise roles and mechanisms of the microbiota in gestation; perhaps linking the metabolic, hormonal, and immune changes together. Although some research has started to link microbial dysbiosis and specific microbial populations with unhealthy pregnancy complications, it is important to first understand the context of the natural healthy microbial changes occurring. Until recently the placenta and developing fetus were considered to be germ free, containing no apparent microbiome. We present multiple study results showing distinct microbiota compositions in the placenta and meconium, alluding to early microbial colonization. These results may change dogmas and our overall understanding of the importance and roles of microbiota from the beginning of life. We further review the main factors shaping the infant microbiome—modes of delivery, feeding, weaning, and exposure to antibiotics. Taken together, we are starting to build a broader understanding of healthy vs. abnormal microbial alterations throughout major developmental time-points. PMID:27471494
Identifying arbitrary parameter zonation using multiple level set functions
Lu, Zhiming; Vesselinov, Velimir Valentinov; Lei, Hongzhuan
2018-03-14
In this paper, we extended the analytical level set method [1, 2] for identifying a piece-wisely heterogeneous (zonation) binary system to the case with an arbitrary number of materials with unknown material properties. In the developed level set approach, starting from an initial guess, the material interfaces are propagated through iterations such that the residuals between the simulated and observed state variables (hydraulic head) is minimized. We derived an expression for the propagation velocity of the interface between any two materials, which is related to the permeability contrast between the materials on two sides of the interface, the sensitivity ofmore » the head to permeability, and the head residual. We also formulated an expression for updating the permeability of all materials, which is consistent with the steepest descent of the objective function. The developed approach has been demonstrated through many examples, ranging from totally synthetic cases to a case where the flow conditions are representative of a groundwater contaminant site at the Los Alamos National Laboratory. These examples indicate that the level set method can successfully identify zonation structures, even if the number of materials in the model domain is not exactly known in advance. Although the evolution of the material zonation depends on the initial guess field, inverse modeling runs starting with different initial guesses fields may converge to the similar final zonation structure. These examples also suggest that identifying interfaces of spatially distributed heterogeneities is more important than estimating their permeability values.« less
Identifying arbitrary parameter zonation using multiple level set functions
NASA Astrophysics Data System (ADS)
Lu, Zhiming; Vesselinov, Velimir V.; Lei, Hongzhuan
2018-07-01
In this paper, we extended the analytical level set method [1,2] for identifying a piece-wisely heterogeneous (zonation) binary system to the case with an arbitrary number of materials with unknown material properties. In the developed level set approach, starting from an initial guess, the material interfaces are propagated through iterations such that the residuals between the simulated and observed state variables (hydraulic head) is minimized. We derived an expression for the propagation velocity of the interface between any two materials, which is related to the permeability contrast between the materials on two sides of the interface, the sensitivity of the head to permeability, and the head residual. We also formulated an expression for updating the permeability of all materials, which is consistent with the steepest descent of the objective function. The developed approach has been demonstrated through many examples, ranging from totally synthetic cases to a case where the flow conditions are representative of a groundwater contaminant site at the Los Alamos National Laboratory. These examples indicate that the level set method can successfully identify zonation structures, even if the number of materials in the model domain is not exactly known in advance. Although the evolution of the material zonation depends on the initial guess field, inverse modeling runs starting with different initial guesses fields may converge to the similar final zonation structure. These examples also suggest that identifying interfaces of spatially distributed heterogeneities is more important than estimating their permeability values.
BiP clustering facilitates protein folding in the endoplasmic reticulum.
Griesemer, Marc; Young, Carissa; Robinson, Anne S; Petzold, Linda
2014-07-01
The chaperone BiP participates in several regulatory processes within the endoplasmic reticulum (ER): translocation, protein folding, and ER-associated degradation. To facilitate protein folding, a cooperative mechanism known as entropic pulling has been proposed to demonstrate the molecular-level understanding of how multiple BiP molecules bind to nascent and unfolded proteins. Recently, experimental evidence revealed the spatial heterogeneity of BiP within the nuclear and peripheral ER of S. cerevisiae (commonly referred to as 'clusters'). Here, we developed a model to evaluate the potential advantages of accounting for multiple BiP molecules binding to peptides, while proposing that BiP's spatial heterogeneity may enhance protein folding and maturation. Scenarios were simulated to gauge the effectiveness of binding multiple chaperone molecules to peptides. Using two metrics: folding efficiency and chaperone cost, we determined that the single binding site model achieves a higher efficiency than models characterized by multiple binding sites, in the absence of cooperativity. Due to entropic pulling, however, multiple chaperones perform in concert to facilitate the resolubilization and ultimate yield of folded proteins. As a result of cooperativity, multiple binding site models used fewer BiP molecules and maintained a higher folding efficiency than the single binding site model. These insilico investigations reveal that clusters of BiP molecules bound to unfolded proteins may enhance folding efficiency through cooperative action via entropic pulling.
Ionic modulation of QPX stability as a nano-switch regulating gene expression in neurons
NASA Astrophysics Data System (ADS)
Baghaee Ravari, Soodeh
G-quadruplexes (G-QPX) have been the subject of intense research due to their unique structural configuration and potential applications, particularly their functionality in biological process as a novel type of nano--switch. They have been found in critical regions of the human genome such as telomeres, promoter regions, and untranslated regions of RNA. About 50% of human DNA in promoters has G-rich regions with the potential to form G-QPX structures. A G-QPX might act mechanistically as an ON/OFF switch, regulating gene expression, meaning that the formation of G-QPX in a single strand of DNA disrupts double stranded DNA, prevents the binding of transcription factors (TF) to their recognition sites, resulting in gene down-regulation. Although there are numerous studies on biological roles of G-QPXs in oncogenes, their potential formation in neuronal cells, in particular upstream of transcription start sites, is poorly investigated. The main focus of this research is to identify stable G-QPXs in the 97bp active promoter region of the choline acetyltransferase (ChAT) gene, the terminal enzyme involved in synthesis of the neurotransmitter acetylcholine, and to clarify ionic modulation of G-QPX nanostructures through the mechanism of neural action potentials. Different bioinformatics analyses (in silico), including the QGRS, quadparser and G4-Calculator programs, have been used to predict stable G-QPX in the active promoter region of the human ChAT gene, located 1000bp upstream from the TATA box. The results of computational studies (using those three different algorithms) led to the identification of three consecutive intramolecular G-QPX structures in the negative strand (ChAT G17-2, ChAT G17, and ChAT G29) and one intramolecular G-QPX structure in the positive strand (ChAT G30). Also, the results suggest the possibility that nearby G-runs in opposed DNA strands with a short distance of each other may be able to form a stable intermolecular G-QPX involving two DNA complementary strands (ds ChAT G21). Formation of G-QPX structures, by blocking the availability of the transcription factor binding site (TFBS) on double stranded DNA, can interfere with transcriptional activation. This suggests that there is competition between TFBS binding to dsDNA and the conversion to high order non-B form secondary structures (G-QPXs) in the active promoter region. TFBS mapping analysis of the active promoter region of the human ChAT gene revealed that it contains multiple consensus AP-2alpha and Sp1 binding sites and consensus sites for other TF, including multiple sites for GR-alpha, Pax-5, p53 and GC box proteins. (Abstract shortened by ProQuest.).
Wray, Lewis V.; Zalieckas, Jill M.; Ferson, Amy E.; Fisher, Susan H.
1998-01-01
Transcription of the Bacillus subtilis nrgAB promoter is activated during nitrogen-limited growth by the TnrA protein. A common inverted repeat, TGTNAN7TNACA (TnrA site), is centered 49 to 51 bp upstream of the transcriptional start sites for the TnrA-regulated nrgAB, gabP P2, and nas promoters. Oligonucleotide-directed mutagenesis of the nrgAB promoter region showed that conserved nucleotides within the TnrA site, the A+T-rich region between the two TnrA half-sites, and an upstream A tract are all required for high-level activation of nrgAB expression. Mutations that alter the relative distance between the two half-sites of the nrgAB TnrA site abolish nitrogen regulation of nrgAB expression. Spacer mutations that change the relative distance between the TnrA site and −35 region of the nrgAB promoter reveal that activation of nrgAB expression occurs only when the TnrA site is located 49 to 51 bp upstream of the transcriptional start site. Mutational analysis of the conserved nucleotides in the gabP P2 TnrA site showed that this sequence is also required for nitrogen-regulated gabP P2 expression. The TnrA protein, expressed in an overproducing Escherichia coli strain, had a 625-fold-higher affinity for the wild-type nrgAB promoter DNA than for a mutated nrgAB promoter DNA fragment that is unable to activate nrgAB expression in vivo. These results indicate that the proposed TnrA site functions as the binding site for the TnrA protein. TnrA was found to activate nrgAB expression during late exponential growth in nutrient sporulation medium containing glucose, suggesting that cells become nitrogen limited during growth in this medium. PMID:9603886
Analysis and prediction of Multiple-Site Damage (MSD) fatigue crack growth
NASA Technical Reports Server (NTRS)
Dawicke, D. S.; Newman, J. C., Jr.
1992-01-01
A technique was developed to calculate the stress intensity factor for multiple interacting cracks. The analysis was verified through comparison with accepted methods of calculating stress intensity factors. The technique was incorporated into a fatigue crack growth prediction model and used to predict the fatigue crack growth life for multiple-site damage (MSD). The analysis was verified through comparison with experiments conducted on uniaxially loaded flat panels with multiple cracks. Configuration with nearly equal and unequal crack distribution were examined. The fatigue crack growth predictions agreed within 20 percent of the experimental lives for all crack configurations considered.
Nebraska files suit to block disposal site
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
Just when the Central Interstate Low-Level Radioactive Waste Compact thought things might be starting to go its way, the state of Nebraska, following instructions from Gov. Ben Nelson, has filed a new lawsuit to block development of an LLW disposal site within its borders. The suit maintains that the recently reconfigured proposed site (in which an area of wetlands was excluded) has not received [open quotes]community consent,[close quotes] as required by state law; says that site developer, US Ecology, has not obtained county consent; and asks that the court permanently prevent development of any LLW site in Nebraska until communitymore » consent is demonstrated.« less
Nonstationary EO/IR Clutter Suppression and Dim Object Tracking
2010-01-01
Brown, A., and Brown, J., Enhanced Algorithms for EO /IR Electronic Stabilization, Clutter Suppression, and Track - Before - Detect for Multiple Low...estimation-suppression and nonlinear filtering-based multiple-object track - before - detect . These algorithms are suitable for integration into...In such cases, it is imperative to develop efficient real or near-real time tracking before detection methods. This paper continues the work started
Balasubramonian, Rajeev [Sandy, UT; Dwarkadas, Sandhya [Rochester, NY; Albonesi, David [Ithaca, NY
2012-01-24
In a processor having multiple clusters which operate in parallel, the number of clusters in use can be varied dynamically. At the start of each program phase, the configuration option for an interval is run to determine the optimal configuration, which is used until the next phase change is detected. The optimum instruction interval is determined by starting with a minimum interval and doubling it until a low stability factor is reached.
Multiple-Valued Programmable Logic Array Minimization by Simulated Annealing
1992-02-10
time is controllable, allowing one to tradeoff time for minimalit ’. It has been incorporated in the HAMLET PLA minimization tool. AcOSSIOn P? DTTC TAB C...specified along the horizontal axis. Each slice represents one temperature. The slice in the very front represents the highest and starting ...rectangle with a pair of adjacent 2’s in between. This func- tion can yield five product terms by a sequence of reshape moves starting from four
Harraghy, Niamh; Homerova, Dagmar; Herrmann, Mathias; Kormanec, Jan
2008-01-01
Mapping the transcription start points of the eap, emp, and vwb promoters revealed a conserved octanucleotide sequence (COS). Deleting this sequence abolished the expression of eap, emp, and vwb. However, electrophoretic mobility shift assays gave no evidence that this sequence was a binding site for SarA or SaeR, known regulators of eap and emp.
NASA Astrophysics Data System (ADS)
Green, Rebecca M.; Bebbington, Mark S.; Cronin, Shane J.; Jones, Geoff
2014-09-01
Detailed tephrochronologies are built to underpin probabilistic volcanic hazard forecasting, and to understand the dynamics and history of diverse geomorphic, climatic, soil-forming and environmental processes. Complicating factors include highly variable tephra distribution over time; difficulty in correlating tephras from site to site based on physical and chemical properties; and uncertain age determinations. Multiple sites permit construction of more accurate composite tephra records, but correctly merging individual site records by recognizing common events and site-specific gaps is complex. We present an automated procedure for matching tephra sequences between multiple deposition sites using stochastic local optimization techniques. If individual tephra age determinations are not significantly different between sites, they are matched and a more precise age is assigned. Known stratigraphy and mineralogical or geochemical compositions are used to constrain tephra matches. We apply this method to match tephra records from five long sediment cores (≤ 75 cal ka BP) in Auckland, New Zealand. Sediments at these sites preserve basaltic tephras from local eruptions of the Auckland Volcanic Field as well as distal rhyolitic and andesitic tephras from Okataina, Taupo, Egmont, Tongariro, and Tuhua (Mayor Island) volcanic centers. The new correlated record compiled is statistically more likely than previously published arrangements from this area.
Social Network Privacy: Overcoming Facebook Policies that put Users at Risk
2011-01-01
risks. The Rise of Facebook Facebook is one of the largest web sites in the world. The site was started in 2004 by Mark Zucker- berg when he was...sites collect. Aggregation of Facebook Data Could a more sophisticated aggregation of Facebook data allow privacy to be exposed? Facebook CEO Mark ... Zuckerberg says he is providing “the power to share in or- der to make the world more open…” Facebook’s advanced search allows one to query the
Preparation of Metal Nanowire Decorated Carbon Allotropes
NASA Technical Reports Server (NTRS)
Southward, Robin E. (Inventor); Ghose, Sayata (Inventor); Connell, John W. (Inventor); Delozier, Donavon Mark (Inventor); Smith, Joseph G. (Inventor); Watson, Kent A. (Inventor)
2014-01-01
In the method of embodiments of the invention, the metal seeded carbon allotropes are reacted in solution forming zero valent metallic nanowires at the seeded sites. A polymeric passivating reagent, which selects for anisotropic growth is also used in the reaction to facilitate nanowire formation. The resulting structure resembles a porcupine, where carbon allotropes have metallic wires of nanometer dimensions that emanate from the seed sites on the carbon allotrope. These sites are populated by nanowires having approximately the same diameter as the starting nanoparticle diameter.
Preparation of Metal Nanowire Decorated Carbon Allotropes
NASA Technical Reports Server (NTRS)
Smith, Jr., Joseph G. (Inventor); Ghose, Sayata (Inventor); Connell, John W. (Inventor); Southward, Robin E. (Inventor); Delozier, Donavon Mark (Inventor); Watson, Kent A. (Inventor)
2016-01-01
In the method of embodiments of the invention, the metal seeded carbon allotropes are reacted in solution forming zero valent metallic nanowires at the seeded sites. A polymeric passivating reagent, which selects for anisotropic growth is also used in the reaction to facilitate nanowire formation. The resulting structure resembles a porcupine, where carbon allotropes have metallic wires of nanometer dimensions that emanate from the seed sites on the carbon allotrope. These sites are populated by nanowires having approximately the same diameter as the starting nanoparticle diameter.
Novel Immune Modulating Cellular Vaccine for Prostate Cancer
2014-10-01
restriction sites. Murine PSMA : The cDNA encoding mPSMA was purchased from Sino Biologicals and was cloned into the HindIII and BamHI sites of pSP73-Sph/A64...sequence) and reverse primer 5’-TATATAGAGCTCTCAGATGTTCCGATACACATCTC-3’ Murine PSMA no signal sequence (mPSMA-SS): Murine PSMA minus the signal sequence...contains a HindIII site for cloning and utilizes an ATG that lies downstream of the signal sequence as the start codon in PSMA -SS ( PSMA without signal
Radioactive waste management in Poland status and strategy for the future
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wlodarski, J.
1995-12-01
Site selection for a new radioactive waste repository in Poland has been started. The repository will contain low- and intermediate-level radioactive wastes and spent fuel. Superficial, shallow underground and deep underground disposal options were considered; 39 potential sites have been selected. Issues to be resolved regarding waste management in Poland are also outlined in this paper.
77 FR 32637 - Sunshine Act Meeting Notice
Federal Register 2010, 2011, 2012, 2013, 2014
2012-06-01
... 20551. Status: Open. On the day of the meeting, you will be able to view the meeting via Web cast from a link available on the Board's public Web site. You do not need to register to view the Web cast of the... start of the meeting. Both links may be accessed from the Board's public Web site at www.federalreserve...
A proposed site index for red spruce in the Northeast
T. F. McLintock; C. A. Bickford
1957-01-01
A basic principle that should be recognized at the start of any forward-looking forest-management plan is that the intensity or level of management that can be profitably applied to a given tract will be controlled largely by four factors: markets, labor supply, accessibility, and site. The more favorable these factors are, the higher the intensity of management that...
NASA Technical Reports Server (NTRS)
Wang, Zhuosen; Schaaf, Crystal B.; Chopping, Mark J.; Strahler, Alan H.; Wang, Jindi; Roman, Miguel O.; Rocha, Adrian V.; Woodcock, Curtis E.; Shuai, Yanmin
2012-01-01
This study assesses the MODIS standard Bidirectional Reflectance Distribution Function (BRDF)/Albedo product, and the daily Direct Broadcast BRDF/Albedo algorithm at tundra locations under large solar zenith angles and high anisotropic diffuse illumination and multiple scattering conditions. These products generally agree with ground-based albedo measurements during the snow cover period when the Solar Zenith Angle (SZA) is less than 70deg. An integrated validation strategy, including analysis of the representativeness of the surface heterogeneity, is performed to decide whether direct comparisons between field measurements and 500- m satellite products were appropriate or if the scaling of finer spatial resolution airborne or spaceborne data was necessary. Results indicate that the Root Mean Square Errors (RMSEs) are less than 0.047 during the snow covered periods for all MCD43 albedo products at several Alaskan tundra areas. The MCD43 1- day daily albedo product is particularly well suited to capture the rapidly changing surface conditions during the spring snow melt. Results also show that a full expression of the blue sky albedo is necessary at these large SZA snow covered areas because of the effects of anisotropic diffuse illumination and multiple scattering. In tundra locations with dark residue as a result of fire, the MODIS albedo values are lower than those at the unburned site from the start of snowmelt.
Foothill yellow-legged frog (Rana boylii) oviposition site choice at multiple spatial scales
Amy J. Lind; Hartwell H. Welsh; Clara A. Wheeler
2016-01-01
Studies of resource selection at multiple scales are critical to understanding ecological and evolutionary attributes of a species. We analyzed relative abundance, habitat use, and oviposition site selection of Foothill Yellow-Legged Frogs (Rana boylii) at 11 localities across two geographic regions in California (northern Coast Range and Sierra...
Person Name Disambiguation in the Multicultural and Online Setting
ERIC Educational Resources Information Center
Treeratpituk, Pucktada
2012-01-01
With the recent rise in popularity of social network sites, more and more personal information is becoming available online. Since a person's information is generally available in various formats across multiple sites, there are ever increasing interests in consolidating such personal information from multiple information sources. The goal of…
He, Jianjun; Gu, Hong; Liu, Wenqi
2012-01-01
It is well known that an important step toward understanding the functions of a protein is to determine its subcellular location. Although numerous prediction algorithms have been developed, most of them typically focused on the proteins with only one location. In recent years, researchers have begun to pay attention to the subcellular localization prediction of the proteins with multiple sites. However, almost all the existing approaches have failed to take into account the correlations among the locations caused by the proteins with multiple sites, which may be the important information for improving the prediction accuracy of the proteins with multiple sites. In this paper, a new algorithm which can effectively exploit the correlations among the locations is proposed by using gaussian process model. Besides, the algorithm also can realize optimal linear combination of various feature extraction technologies and could be robust to the imbalanced data set. Experimental results on a human protein data set show that the proposed algorithm is valid and can achieve better performance than the existing approaches.
Calculating the habitable zones of multiple star systems with a new interactive Web site
DOE Office of Scientific and Technical Information (OSTI.GOV)
Müller, Tobias W. A.; Haghighipour, Nader
We have developed a comprehensive methodology and an interactive Web site for calculating the habitable zone (HZ) of multiple star systems. Using the concept of spectral weight factor, as introduced in our previous studies of the calculations of HZ in and around binary star systems, we calculate the contribution of each star (based on its spectral energy distribution) to the total flux received at the top of the atmosphere of an Earth-like planet, and use the models of the HZ of the Sun to determine the boundaries of the HZ in multiple star systems. Our interactive Web site for carryingmore » out these calculations is publicly available at http://astro.twam.info/hz. We discuss the details of our methodology and present its application to some of the multiple star systems detected by the Kepler space telescope. We also present the instructions for using our interactive Web site, and demonstrate its capabilities by calculating the HZ for two interesting analytical solutions of the three-body problem.« less
Alten, Bulent; Maia, Carla; Afonso, Maria Odete; Campino, Lenea; Jiménez, Maribel; González, Estela; Molina, Ricardo; Bañuls, Anne Laure; Prudhomme, Jorian; Vergnes, Baptiste; Toty, Celine; Cassan, Cécile; Rahola, Nil; Thierry, Magali; Sereno, Denis; Bongiorno, Gioia; Bianchi, Riccardo; Khoury, Cristina; Tsirigotakis, Nikolaos; Dokianakis, Emmanouil; Antoniou, Maria; Christodoulou, Vasiliki; Mazeris, Apostolos; Karakus, Mehmet; Ozbel, Yusuf; Arserim, Suha K.; Erisoz Kasap, Ozge; Gunay, Filiz; Oguz, Gizem; Kaynas, Sinan; Tsertsvadze, Nikoloz; Tskhvaradze, Lamzira; Gramiccia, Marina; Volf, Petr; Gradoni, Luigi
2016-01-01
Background The recent geographical expansion of phlebotomine vectors of Leishmania infantum in the Mediterranean subregion has been attributed to ongoing climate changes. At these latitudes, the activity of sand flies is typically seasonal; because seasonal phenomena are also sensitive to general variations in climate, current phenological data sets can provide a baseline for continuing investigations on sand fly population dynamics that may impact on future scenarios of leishmaniasis transmission. With this aim, in 2011–2013 a consortium of partners from eight Mediterranean countries carried out entomological investigations in sites where L. infantum transmission was recently reported. Methods/Principal Findings A common protocol for sand fly collection included monthly captures by CDC light traps, complemented by sticky traps in most of the sites. Collections were replicated for more than one season in order to reduce the effects of local weather events. In each site, the trapping effort was left unchanged throughout the survey to legitimate inter-seasonal comparisons. Data from 99,000 collected specimens were analyzed, resulting in the description of seasonal dynamics of 56,000 sand flies belonging to L. infantum vector species throughout a wide geographical area, namely P. perniciosus (Portugal, Spain and Italy), P. ariasi (France), P. neglectus (Greece), P. tobbi (Cyprus and Turkey), P. balcanicus and P. kandelakii (Georgia). Time of sand fly appearance/disappearance in collections differed between sites, and seasonal densities showed variations in each site. Significant correlations were found between latitude/mean annual temperature of sites and i) the first month of sand fly appearance, that ranged from early April to the first half of June; ii) the type of density trend, varying from a single peak in July/August to multiple peaks increasing in magnitude from May through September. A 3-modal trend, recorded for P. tobbi in Cyprus, represents a novel finding for a L. infantum vector. Adults ended the activity starting from mid September through November, without significant correlation with latitude/mean annual temperature of sites. The period of potential exposure to L.infantum in the Mediterranean subregion, as inferred by adult densities calculated from 3 years, 37 sites and 6 competent vector species, was associated to a regular bell-shaped density curve having a wide peak center encompassing the July-September period, and falling between early May to late October for more than 99% of values. Apparently no risk for leishmaniasis transmission took place from December through March in the years considered. We found a common pattern of nocturnal females activity, whose density peaked between 11 pm and 2 am. Conclusions Despite annual variations, multiple collections performed over consecutive years provided homogeneous patterns of the potential behavior of leishmaniasis vectors in selected sites, which we propose may represent sentinel areas for future monitoring. In the investigated years, higher potential risk for L. infantum transmission in the Mediterranean was identified in the June-October period (97% relative vector density), however such risk was not equally distributed throughout the region, since density waves of adults occurred earlier and were more frequent in southern territories. PMID:26900688
Different enzyme kinetic models.
Seibert, Eleanore; Tracy, Timothy S
2014-01-01
As described in Chapter 2 , a large number of enzymatic reactions can be adequately described by Michaelis-Menten kinetics. The Michaelis-Menten equation represents a rectangular hyperbola, with a y-asymptote at the V max value. In many cases, more complex kinetic models are required to explain the observed data. Atypical kinetic profiles are believed to arise from the simultaneous binding of multiple molecules within the active site of the enzyme (Tracy and Hummel, Drug Metab Rev 36:231-242, 2004). Several cytochromes P450 have large active sites that enable binding of multiple molecules (Wester et al. J Biol Chem 279:35630-35637, 2004; Yano et al. J Biol Chem 279:38091-38094, 2004). Thus, atypical kinetics are not uncommon in in vitro drug metabolism studies. This chapter covers enzyme kinetic reactions in which a single enzyme has multiple binding sites for substrates and/or inhibitors as well as reactions catalyzed by multiple enzymes.
Roseate Tern breeding dispersal and fidelity: Responses to two newly restored colony sites
Spendelow, Jeffrey A.; Monticelli, David; Nichols, James D.; Hines, James; Nisbet, Ian; Cormons, Grace; Hays, Helen; Hatch, Jeremy; Mostello, Carolyn
2016-01-01
We used 22 yr of capture–mark–reencounter (CMR) data collected from 1988 to 2009 on about 12,500 birds at what went from three to five coastal colony sites in Massachusetts, New York, and Connecticut, United States, to examine spatial and temporal variation in breeding dispersal/fidelity rates of adult Roseate Terns (Sterna dougallii). At the start of our study, Roseate Terns nested at only one site (Bird Island) in Buzzards Bay, Massachusetts, but two more sites in this bay (Ram and Penikese Islands) were subsequently recolonized and became incorporated into our CMR metapopulation study. We examined four major hypotheses about factors we thought might influence colony-site fidelity and movement rates in the restructured system. We found some evidence that colony-site fidelity remained higher at long-established sites compared with newer ones and that breeding dispersal was more likely to occur among nearby sites than distant ones. Sustained predation at Falkner Island, Connecticut, did not result in a sustained drop in fidelity rates of breeders. Patterns of breeding dispersal differed substantially at the two restored sites. The fidelity of Roseate Terns at Bird dropped quickly after nearby Ram was recolonized in 1994, and fidelity rates for Ram soon approached those for Bird. After an oil spill in Buzzards Bay in April 2003, hazing (deliberate disturbance) of the terns at Ram prior to the start of egg-laying resulted in lowering of fidelity at this site, a decrease in immigration from Bird, and recolonization of Penikese by Roseate Terns. Annual fidelity rates at Penikese increased somewhat several years after the initial recolonization, but they remained much lower there than at all the other sites throughout the study period. The sustained high annual rates of emigration from Penikese resulted in the eventual failure of the restoration effort there, and in 2013, no Roseate Terns nested at this site.
Thomas, Maren; Lange-Grünweller, Kerstin; Hartmann, Dorothee; Golde, Lara; Schlereth, Julia; Streng, Dennis; Aigner, Achim; Grünweller, Arnold; Hartmann, Roland K.
2013-01-01
The human polycistronic miRNA cluster miR-17-92 is frequently overexpressed in hematopoietic malignancies and cancers. Its transcription is in part controlled by an E2F-regulated host gene promoter. An intronic A/T-rich region directly upstream of the miRNA coding region also contributes to cluster expression. Our deletion analysis of the A/T-rich region revealed a strong dependence on c-Myc binding to the functional E3 site. Yet, constructs lacking the 5′-proximal ~1.3 kb or 3′-distal ~0.1 kb of the 1.5 kb A/T-rich region still retained residual specific promoter activity, suggesting multiple transcription start sites (TSS) in this region. Furthermore, the protooncogenic kinase, Pim-1, its phosphorylation target HP1γ and c-Myc colocalize to the E3 region, as inferred from chromatin immunoprecipitation. Analysis of pri-miR-17-92 expression levels in K562 and HeLa cells revealed that silencing of E2F3, c-Myc or Pim-1 negatively affects cluster expression, with a synergistic effect caused by c-Myc/Pim-1 double knockdown in HeLa cells. Thus, we show, for the first time, that the protooncogene Pim-1 is part of the network that regulates transcription of the human miR-17-92 cluster. PMID:23749113
AnchorDock for Blind Flexible Docking of Peptides to Proteins.
Slutzki, Michal; Ben-Shimon, Avraham; Niv, Masha Y
2017-01-01
Due to increasing interest in peptides as signaling modulators and drug candidates, several methods for peptide docking to their target proteins are under active development. The "blind" docking problem, where the peptide-binding site on the protein surface is unknown, presents one of the current challenges in the field. AnchorDock protocol was developed by Ben-Shimon and Niv to address this challenge.This protocol narrows the docking search to the most relevant parts of the conformational space. This is achieved by pre-folding the free peptide and by computationally detecting anchoring spots on the surface of the unbound protein. Multiple flexible simulated annealing molecular dynamics (SAMD) simulations are subsequently carried out, starting from pre-folded peptide conformations, constrained to the various precomputed anchoring spots.Here, AnchorDock is demonstrated using two known protein-peptide complexes. A PDZ-peptide complex provides a relatively easy case due to the relatively small size of the protein, and a typical peptide conformation and binding region; a more challenging example is a complex between USP7 N-term and a p53-derived peptide, where the protein is larger, and the peptide conformation and a binding site are generally assumed to be unknown. AnchorDock returned native-like solutions ranked first and third for the PDZ and USP7 complexes, respectively. We describe the procedure step by step and discuss possible modifications where applicable.
Inhibition of Non-ATG Translational Events in Cells via Covalent Small Molecules Targeting RNA.
Yang, Wang-Yong; Wilson, Henry D; Velagapudi, Sai Pradeep; Disney, Matthew D
2015-04-29
One major class of disease-causing RNAs is expanded repeating transcripts. These RNAs cause diseases via multiple mechanisms, including: (i) gain-of-function, in which repeating RNAs bind and sequester proteins involved in RNA biogenesis and (ii) repeat associated non-ATG (RAN) translation, in which repeating transcripts are translated into toxic proteins without use of a canonical, AUG, start codon. Herein, we develop and study chemical probes that bind and react with an expanded r(CGG) repeat (r(CGG)(exp)) present in a 5' untranslated region that causes fragile X-associated tremor/ataxia syndrome (FXTAS). Reactive compounds bind to r(CGG)(exp) in cellulo as shown with Chem-CLIP-Map, an approach to map small molecule binding sites within RNAs in cells. Compounds also potently improve FXTAS-associated pre-mRNA splicing and RAN translational defects, while not affecting translation of the downstream open reading frame. In contrast, oligonucleotides affect both RAN and canonical translation when they bind to r(CGG)(exp), which is mechanistically traced to a decrease in polysome loading. Thus, designer small molecules that react with RNA targets can be used to profile the RNAs to which they bind in cells, including identification of binding sites, and can modulate several aspects of RNA-mediated disease pathology in a manner that may be more beneficial than oligonucleotides.
Cruz, Theresa H; Davis, Sally M; FitzGerald, Courtney A; Canaca, Glenda F; Keane, Patricia C
2014-06-01
Engagement, recruitment and retention of participants are critical to the success of research studies but specific strategies are rarely elucidated in the literature. The purpose of this paper is to describe the engagement, recruitment and retention process and outcomes in the Child Health Initiative for Lifelong Eating and Exercise (CHILE) study, and to describe lessons learned in the process. CHILE is a multi-level, group randomized controlled trial of a childhood obesity prevention intervention in rural American Indian and predominantly Hispanic Head Start (HS) centers in New Mexico. Barriers to engagement, recruitment and retention included distrust of researchers, long travel distances, and different HS and community structures. CHILE employed multiple strategies from the onset including the use of formative assessment, building on previous relationships, developing Memoranda of Agreement, using a community engagement specialist, and gaining support of a community champion. As a result of lessons learned, additional strategies were employed, including more frequent feedback to intervention sites, revised permission forms, telephone reminders, increased site visits and over-scheduling of interviews. These strategies resulted in the recruitment of 16 HS centers, 1,879 children, 655 parents, 7 grocery stores and 14 healthcare providers, meeting or exceeding recruitment goals. By combining principles of community engagement, a variety of recruitment strategies, and lessons learned, this study obtained a high level of recruitment and retention.
Empirically Derived Lessons Learned about What Makes Peer-Led Exercise Groups Flourish.
Fletcher, Kathlyn E; Ertl, Kristyn; Ruffalo, Leslie; Harris, LaTamba; Whittle, Jeff
2017-01-01
Physical exercise confers many health benefits, but it is difficult to motivate people to exercise. Although community exercise groups may facilitate initiation and persistence in an exercise program, reports regarding factors that allow such groups to flourish are limited. We performed a prospective qualitative evaluation of our experience starting a program of community-based, peer-led exercise groups for military veterans to identify important lessons learned. We synthesized data from structured observations, post-observation debriefings, and focus groups. Our participants were trained peer leaders and exercise group members. Our main outcomes consisted of empirically derived lessons learned during the implementation of a peer-led group exercise program for veterans at multiple community sites. We collected and analyzed data from 40 observation visits (covering 14 sites), 7 transcribed debriefings, and 5 focus groups. We identified five lessons learned. (1) The camaraderie and social aspect of the exercise groups provided motivation for people to stay involved. (2) Shared responsibility and commitment to each other by the group members was instrumental to success. (3) Regular meeting times encouraged participation. (4) Variety, especially getting outdoors, was very popular for some groups. (5) Modest involvement of professionals encouraged ongoing engagement with the program. Both social and programmatic issues influence implementation of group exercise programs for older, predominantly male, veterans. These results should be confirmed in other settings.
Kawano, Noriyuki; Ohtaki, Megu
2006-02-01
The main objective of this paper is to identify salient experiences of those who were exposed to radiation by the nuclear tests at the Semipalatinsk Nuclear Tests Site (SNTS). In 2002, our research team of the Research Institute for Radiation Biology and Medicine, Hiroshima University, started to conduct some field research by means of a questionnaire survey. Through this, we expected to examine the health condition of the residents near the SNTS, identify their experiences from the nuclear tests, and understand the exposure path. This attempt at clarifying the reality of radiation exposure at Semipalatinsk through the use of a survey research method is the first of its kind. Among the responses to our survey, the present paper focuses mainly upon responses to the questions concerning the experiences of the nuclear tests. It deals mainly with direct experiences of nuclear tests of the residents characteristic to Semipalatinsk, including some new experiences hitherto unnoticed. The present paper touches upon their concrete direct experiences of flash, bomb blast, heat, rain and dust. We also discuss distinct experiences in Semipalatinsk such as evacuation, through the additional use of their testimonies. The data have been compared with the results obtained in a similar survey made in Hiroshima and Nagasaki. For the data analysis, a statistical method called logistic multiple linear regression analysis has been used.
Davis, Sally M.; FitzGerald, Courtney A.; Canaca, Glenda F.; Keane, Patricia C.
2016-01-01
Engagement, recruitment and retention of participants are critical to the success of research studies but specific strategies are rarely elucidated in the literature. The purpose of this paper is to describe the engagement, recruitment and retention process and outcomes in the Child Health Initiative for Lifelong Eating and Exercise (CHILE) study, and to describe lessons learned in the process. CHILE is a multi-level, group randomized controlled trial of a childhood obesity prevention intervention in rural American Indian and predominantly Hispanic Head Start (HS) centers in New Mexico. Barriers to engagement, recruitment and retention included distrust of researchers, long travel distances, and different HS and community structures. CHILE employed multiple strategies from the onset including the use of formative assessment, building on previous relationships, developing Memoranda of Agreement, using a community engagement specialist, and gaining support of a community champion. As a result of lessons learned, additional strategies were employed, including more frequent feedback to intervention sites, revised permission forms, telephone reminders, increased site visits and over-scheduling of interviews. These strategies resulted in the recruitment of 16 HS centers, 1,879 children, 655 parents, 7 grocery stores and 14 healthcare providers, meeting or exceeding recruitment goals. By combining principles of community engagement, a variety of recruitment strategies, and lessons learned, this study obtained a high level of recruitment and retention. PMID:24549525
Effects of pumice mining on soil quality
NASA Astrophysics Data System (ADS)
Cruz-Ruíz, A.; Cruz-Ruíz, E.; Vaca, R.; Del Aguila, P.; Lugo, J.
2016-01-01
Mexico is the world's fourth most important maize producer; hence, there is a need to maintain soil quality for sustainable production in the upcoming years. Pumice mining is a superficial operation that modifies large areas in central Mexico. The main aim was to assess the present state of agricultural soils differing in elapsed time since pumice mining (0-15 years) in a representative area of the Calimaya region in the State of Mexico. The study sites in 0, 1, 4, 10, and 15 year old reclaimed soils were compared with an adjacent undisturbed site. Our results indicate that gravimetric moisture content, water hold capacity, bulk density, available phosphorus, total nitrogen, soil organic carbon, microbial biomass carbon and phosphatase and urease activity were greatly impacted by disturbance. A general trend of recovery towards the undisturbed condition with reclamation age was found after disturbance, the recovery of soil total N being faster than soil organic C. The soil quality indicators were selected using principal component analysis (PCA), correlations and multiple linear regressions. The first three components gathered explain 76.4 % of the total variability. The obtained results revealed that the most appropriate indicators to diagnose the quality of the soils were urease, available phosphorus and bulk density and minor total nitrogen. According to linear score analysis and the additive index, the soils showed a recuperation starting from 4 years of pumice extraction.
Flight Testing of the Capillary Pumped Loop 3 Experiment
NASA Technical Reports Server (NTRS)
Ottenstein, Laura; Butler, Dan; Ku, Jentung; Cheung, Kwok; Baldauff, Robert; Hoang, Triem
2002-01-01
The Capillary Pumped Loop 3 (CAPL 3) experiment was a multiple evaporator capillary pumped loop experiment that flew in the Space Shuttle payload bay in December 2001 (STS-108). The main objective of CAPL 3 was to demonstrate in micro-gravity a multiple evaporator capillary pumped loop system, capable of reliable start-up, reliable continuous operation, and heat load sharing, with hardware for a deployable radiator. Tests performed on orbit included start-ups, power cycles, low power tests (100 W total), high power tests (up to 1447 W total), heat load sharing, variable/fixed conductance transition tests, and saturation temperature change tests. The majority of the tests were completed successfully, although the experiment did exhibit an unexpected sensitivity to shuttle maneuvers. This paper describes the experiment, the tests performed during the mission, and the test results.
Keldysh formalism for multiple parallel worlds
NASA Astrophysics Data System (ADS)
Ansari, M.; Nazarov, Y. V.
2016-03-01
We present a compact and self-contained review of the recently developed Keldysh formalism for multiple parallel worlds. The formalism has been applied to consistent quantum evaluation of the flows of informational quantities, in particular, to the evaluation of Renyi and Shannon entropy flows. We start with the formulation of the standard and extended Keldysh techniques in a single world in a form convenient for our presentation. We explain the use of Keldysh contours encompassing multiple parallel worlds. In the end, we briefly summarize the concrete results obtained with the method.
SERT 2 hollow cathode multiple restarts in space
NASA Technical Reports Server (NTRS)
Kerslake, W. R.; Finke, R. C.
1973-01-01
Future missions, both station keeping and primary electric propulsion, will require multiple thrust restarts after periods of inactivity from a few hours to over one year. Although not a part of the original SERT 2 (Space Electric Rocket Test) flight objective, the opportunity to demonstrate multiple cathode restarts in space became available following completion of thruster running. Both neutralizer and main cathodes of each flight thruster were restarted repeatedly following storage periods up to 490 days. No deterioration of cathode heaters was noted nor was any change required in starting voltages or currents.
Keldysh formalism for multiple parallel worlds
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ansari, M.; Nazarov, Y. V., E-mail: y.v.nazarov@tudelft.nl
We present a compact and self-contained review of the recently developed Keldysh formalism for multiple parallel worlds. The formalism has been applied to consistent quantum evaluation of the flows of informational quantities, in particular, to the evaluation of Renyi and Shannon entropy flows. We start with the formulation of the standard and extended Keldysh techniques in a single world in a form convenient for our presentation. We explain the use of Keldysh contours encompassing multiple parallel worlds. In the end, we briefly summarize the concrete results obtained with the method.
Managing data from multiple disciplines, scales, and sites to support synthesis and modeling
Olson, R. J.; Briggs, J. M.; Porter, J.H.; Mah, Grant R.; Stafford, S.G.
1999-01-01
The synthesis and modeling of ecological processes at multiple spatial and temporal scales involves bringing together and sharing data from numerous sources. This article describes a data and information system model that facilitates assembling, managing, and sharing diverse data from multiple disciplines, scales, and sites to support integrated ecological studies. Cross-site scientific-domain working groups coordinate the development of data associated with their particular scientific working group, including decisions about data requirements, data to be compiled, data formats, derived data products, and schedules across the sites. The Web-based data and information system consists of nodes for each working group plus a central node that provides data access, project information, data query, and other functionality. The approach incorporates scientists and computer experts in the working groups and provides incentives for individuals to submit documented data to the data and information system.
... bony framework, resulting in the development of an enlargement. The fifth metatarsal bone starts to protrude outward, ... swelling and pain at the site of the enlargement. These symptoms occur when wearing shoes that rub ...
A strategy for health promotion at multiple corporate sites.
Alexy, B; Eynon, D
1991-02-01
1. The logistical problems associated with delivery of health promotion programs at multiple corporate sites can be addressed through the use of health education packets. 2. The role of the nurse or health coordinator is critical in assisting and guiding the employee as the health plan is executed. 3. Problematic areas related to implementation of programs at remote sites can be alleviated through careful planning and extensive communication. 4. Advertising, input from employees and staff, and follow up are important in the success of a program.
PAM multiplicity marks genomic target sites as inhibitory to CRISPR-Cas9 editing.
Malina, Abba; Cameron, Christopher J F; Robert, Francis; Blanchette, Mathieu; Dostie, Josée; Pelletier, Jerry
2015-12-08
In CRISPR-Cas9 genome editing, the underlying principles for selecting guide RNA (gRNA) sequences that would ensure for efficient target site modification remain poorly understood. Here we show that target sites harbouring multiple protospacer adjacent motifs (PAMs) are refractory to Cas9-mediated repair in situ. Thus we refine which substrates should be avoided in gRNA design, implicating PAM density as a novel sequence-specific feature that inhibits in vivo Cas9-driven DNA modification.
PAM multiplicity marks genomic target sites as inhibitory to CRISPR-Cas9 editing
Malina, Abba; Cameron, Christopher J. F.; Robert, Francis; Blanchette, Mathieu; Dostie, Josée; Pelletier, Jerry
2015-01-01
In CRISPR-Cas9 genome editing, the underlying principles for selecting guide RNA (gRNA) sequences that would ensure for efficient target site modification remain poorly understood. Here we show that target sites harbouring multiple protospacer adjacent motifs (PAMs) are refractory to Cas9-mediated repair in situ. Thus we refine which substrates should be avoided in gRNA design, implicating PAM density as a novel sequence-specific feature that inhibits in vivo Cas9-driven DNA modification. PMID:26644285
Tong, Pin; Monahan, Jack; Prendergast, James G D
2017-03-01
Large-scale gene expression datasets are providing an increasing understanding of the location of cis-eQTLs in the human genome and their role in disease. However, little is currently known regarding the extent of regulatory site-sharing between genes. This is despite it having potentially wide-ranging implications, from the determination of the way in which genetic variants may shape multiple phenotypes to the understanding of the evolution of human gene order. By first identifying the location of non-redundant cis-eQTLs, we show that regulatory site-sharing is a relatively common phenomenon in the human genome, with over 10% of non-redundant regulatory variants linked to the expression of multiple nearby genes. We show that these shared, local regulatory sites are linked to high levels of chromatin looping between the regulatory sites and their associated genes. In addition, these co-regulated gene modules are found to be strongly conserved across mammalian species, suggesting that shared regulatory sites have played an important role in shaping human gene order. The association of these shared cis-eQTLs with multiple genes means they also appear to be unusually important in understanding the genetics of human phenotypes and pleiotropy, with shared regulatory sites more often linked to multiple human phenotypes than other regulatory variants. This study shows that regulatory site-sharing is likely an underappreciated aspect of gene regulation and has important implications for the understanding of various biological phenomena, including how the two and three dimensional structures of the genome have been shaped and the potential causes of disease pleiotropy outside coding regions.
Hagopian, Raffi; Davidson, John R; Datta, Ruchira S; Samad, Bushra; Jarvis, Glen R; Sjölander, Kimmen
2010-07-01
We present the jump-start simultaneous alignment and tree construction using hidden Markov models (SATCHMO-JS) web server for simultaneous estimation of protein multiple sequence alignments (MSAs) and phylogenetic trees. The server takes as input a set of sequences in FASTA format, and outputs a phylogenetic tree and MSA; these can be viewed online or downloaded from the website. SATCHMO-JS is an extension of the SATCHMO algorithm, and employs a divide-and-conquer strategy to jump-start SATCHMO at a higher point in the phylogenetic tree, reducing the computational complexity of the progressive all-versus-all HMM-HMM scoring and alignment. Results on a benchmark dataset of 983 structurally aligned pairs from the PREFAB benchmark dataset show that SATCHMO-JS provides a statistically significant improvement in alignment accuracy over MUSCLE, Multiple Alignment using Fast Fourier Transform (MAFFT), ClustalW and the original SATCHMO algorithm. The SATCHMO-JS webserver is available at http://phylogenomics.berkeley.edu/satchmo-js. The datasets used in these experiments are available for download at http://phylogenomics.berkeley.edu/satchmo-js/supplementary/.
Enhanced sequencing coverage with digital droplet multiple displacement amplification
Sidore, Angus M.; Lan, Freeman; Lim, Shaun W.; Abate, Adam R.
2016-01-01
Sequencing small quantities of DNA is important for applications ranging from the assembly of uncultivable microbial genomes to the identification of cancer-associated mutations. To obtain sufficient quantities of DNA for sequencing, the small amount of starting material must be amplified significantly. However, existing methods often yield errors or non-uniform coverage, reducing sequencing data quality. Here, we describe digital droplet multiple displacement amplification, a method that enables massive amplification of low-input material while maintaining sequence accuracy and uniformity. The low-input material is compartmentalized as single molecules in millions of picoliter droplets. Because the molecules are isolated in compartments, they amplify to saturation without competing for resources; this yields uniform representation of all sequences in the final product and, in turn, enhances the quality of the sequence data. We demonstrate the ability to uniformly amplify the genomes of single Escherichia coli cells, comprising just 4.7 fg of starting DNA, and obtain sequencing coverage distributions that rival that of unamplified material. Digital droplet multiple displacement amplification provides a simple and effective method for amplifying minute amounts of DNA for accurate and uniform sequencing. PMID:26704978
Su, S Y; Dodson, M V; Li, X B; Li, Q F; Wang, H W; Xie, Z
2009-11-01
We evaluated the effects of betaine supplementation on liver weight, liver/body weight, serum parameters and morphological changes. Compared with the control and overfed groups, the geese that were fed the betaine diet showed increased liver weight and decreased abdominal adipose tissue weight compared with the overfeeding groups. Betaine treatment also significantly increased ChE, HDL, LDH and ALT levels (P<0.01 or P<0.05). Decreased macrovesicular steatosis and increased microvesicular steatosis were observed in the betaine-treated group, and the lipid was well-distributed in the betaine supplement group. The expression of S14alpha mRNA in the livers of the betaine-treated geese was higher than that in the control or the overfed geese. We performed sodium bisulfite sequencing of the individual alleles of this region (between +374 and -8 base pairs relative to the transcription start site), containing 33 CpG dinucleotides. In the overfed group expressing higher S14alpha transcripts, the average methylation at the 33 CpGs sites was 87.9%. This contrasted with 69.6% in the control group that showed lower expression of the S14alpha gene (P<0.01). However, no significant change in methylation in the transcription start site was found between the betaine-treated geese (82.6%) and the overfed geese (87.9%). These results indicate that the DNA methylation pattern in the S14alpha gene transcription start site may not be related to the expression of S14alpha transcript in response to betaine supplementation.
Zhukova, Anna; Fernandes, Luis Guilherme; Hugon, Perrine; Pappas, Christopher J.; Sismeiro, Odile; Coppée, Jean-Yves; Becavin, Christophe; Malabat, Christophe; Eshghi, Azad; Zhang, Jun-Jie; Yang, Frank X.; Picardeau, Mathieu
2017-01-01
Leptospira are emerging zoonotic pathogens transmitted from animals to humans typically through contaminated environmental sources of water and soil. Regulatory pathways of pathogenic Leptospira spp. underlying the adaptive response to different hosts and environmental conditions remains elusive. In this study, we provide the first global Transcriptional Start Site (TSS) map of a Leptospira species. RNA was obtained from the pathogen Leptospira interrogans grown at 30°C (optimal in vitro temperature) and 37°C (host temperature) and selectively enriched for 5′ ends of native transcripts. A total of 2865 and 2866 primary TSS (pTSS) were predicted in the genome of L. interrogans at 30 and 37°C, respectively. The majority of the pTSSs were located between 0 and 10 nucleotides from the translational start site, suggesting that leaderless transcripts are a common feature of the leptospiral translational landscape. Comparative differential RNA-sequencing (dRNA-seq) analysis revealed conservation of most pTSS at 30 and 37°C. Promoter prediction algorithms allow the identification of the binding sites of the alternative sigma factor sigma 54. However, other motifs were not identified indicating that Leptospira consensus promoter sequences are inherently different from the Escherichia coli model. RNA sequencing also identified 277 and 226 putative small regulatory RNAs (sRNAs) at 30 and 37°C, respectively, including eight validated sRNAs by Northern blots. These results provide the first global view of TSS and the repertoire of sRNAs in L. interrogans. These data will establish a foundation for future experimental work on gene regulation under various environmental conditions including those in the host. PMID:28154810
Study site characterization. Chapter 2
Chris Potter; Richard Birdsey
2008-01-01
This chapter is an overview of the main site characterization requirements at landscape-scale sampling locations. The overview is organized according to multiple "Site Attribute" headings that require descriptions throughout a given study site area, leading ultimately to a sufficient overall site characterization. Guidance is provided to describe the major...
Balasubramonian, Rajeev [Sandy, UT; Dwarkadas, Sandhya [Rochester, NY; Albonesi, David [Ithaca, NY
2009-02-10
In a processor having multiple clusters which operate in parallel, the number of clusters in use can be varied dynamically. At the start of each program phase, the configuration option for an interval is run to determine the optimal configuration, which is used until the next phase change is detected. The optimum instruction interval is determined by starting with a minimum interval and doubling it until a low stability factor is reached.
ERIC Educational Resources Information Center
Educational Testing Service, Princeton, NJ.
As part of its 6-year longitudinal study designed to assess the impact of Head Start, Educational Testing Service (ETS) has summarized and compiled tables of data collected on 16 of the 33 instruments administered to children in 1969 in three sites (St. Louis, Missouri; Trenton, New Jersey; and Portland, Oregon). Data from the parent interview and…
Sellers, Brian G; Viljoen, Jodi L.; Cruise, Keith R.; Nicholls, Tonia L.; Dvoskin, Joel A.
2012-01-01
The Short-Term Assessment of Risk and Treatability: Adolescent Version (START:AV) is a new structured professional judgment guide for assessing short-term risks in adolescents. The scheme may be distinguished from other youth risk assessment and treatment planning instruments by its inclusion of 23 dynamic factors that are each rated for both vulnerability and strength. In addition, START:AV is also unique in that it focuses on multiple adverse outcomes—namely, violence, self-harm, suicide, unauthorized leave, substance abuse, self-neglect, victimization, and general offending—over the short-term (i.e., weeks to months) rather than long-term (i.e., years). This paper describes a pilot implementation and preliminary evaluation of START:AV in three secure juvenile correctional facilities in the southern United States. Specifically, we examined the descriptive characteristics and psychometric properties of START:AV assessments completed by 21 case managers on 291 adolescent offenders (250 boys and 41 girls) at the time of admission. Results provide preliminary support for the feasibility of completing START:AV assessments as part of routine practice. Findings also highlight differences in the characteristics of START:AV assessments for boys and girls and differential associations between the eight START:AV risk domains. Though results are promising, further research is needed to establish the reliability and validity of START:AV assessments completed in the field. PMID:23316116
Generalized interactions using virtual tools within the spring framework: cutting
NASA Technical Reports Server (NTRS)
Montgomery, Kevin; Bruyns, Cynthia D.
2002-01-01
We present schemes for real-time generalized mesh cutting. Starting with the a basic example, we describe the details of implementing cutting on single and multiple surface objects as well as hybrid and volumetric meshes using virtual tools with single and multiple cutting surfaces. These methods have been implemented in a robust surgical simulation environment allowing us to model procedures ranging from animal dissection to cleft lip correction.
USDA-ARS?s Scientific Manuscript database
Work of multiple organizations to improve seed potato health in U.S.A. and an example of change to reduce Potato virus Y in seed lots. In the United States, seed potato improvement starts with the individual seed potato grower. The seed grower also has resources that are available from university e...
Multiple Site Action Research Case Studies: Practical and Theoretical Benefits and Challenges
ERIC Educational Resources Information Center
Pereira, Mary Delfin; Vallance, Roger
2006-01-01
A curriculum initiative project was implemented in four schools in Singapore over a span of five to six weeks during 2004. The project employed a number of different schools: girls only, boys only and co-educational schools; different levels of performance in a graded situation; multiple teachers and classes within each site; and control and…
Using Standardized Pre-Posttests to Establish Program Equivalency at Multiple Sites
ERIC Educational Resources Information Center
Ritchie, William F.; Kreitner, David
2005-01-01
Keiser College is a private, for-profit Level II institution with thirteen branch campuses throughout Florida. Most of its academic programs are offered at multiple sites. A major concern has been to establish and maintain the consistency of its academic offerings at all campuses as the College expands. Building on a pre- posttesting mechanism…
Tucker, Thomas R; Katz, Lawrence C
2003-01-01
To investigate how neurons in cortical layer 2/3 integrate horizontal inputs arising from widely distributed sites, we combined intracellular recording and voltage-sensitive dye imaging to visualize the spatiotemporal dynamics of neuronal activity evoked by electrical stimulation of multiple sites in visual cortex. Individual stimuli evoked characteristic patterns of optical activity, while delivering stimuli at multiple sites generated interacting patterns in the regions of overlap. We observed that neurons in overlapping regions received convergent horizontal activation that generated nonlinear responses due to the emergence of large inhibitory potentials. The results indicate that co-activation of multiple sets of horizontal connections recruit strong inhibition from local inhibitory networks, causing marked deviations from simple linear integration.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Guss, Adam M.; Rother, Michael; Zhang, Jun Kai
A highly efficient method for chromosomal integration of cloned DNA into Methanosarcina spp. was developed utilizing the site-specific recombination system from the Streptomyces phage φC31. Host strains expressing the φC31 integrase gene and carrying an appropriate recombination site can be transformed with non-replicating plasmids carrying the complementary recombination site at efficiencies similar to those obtained with self-replicating vectors. We have also constructed a series of hybrid promoters that combine the highly expressed M. barkeri P mcrB promoter with binding sites for the tetracycline-responsive, bacterial TetR protein. These promoters are tightly regulated by the presence or absence of tetracycline in strainsmore » that express the tetR gene. The hybrid promoters can be used in genetic experiments to test gene essentiality by placing a gene of interest under their control. Thus, growth of strains with tetR -regulated essential genes becomes tetracycline-dependent. A series of plasmid vectors that utilize the site-specific recombination system for construction of reporter gene fusions and for tetracycline regulated expression of cloned genes are reported. These vectors were used to test the efficiency of translation at a variety of start codons. Fusions using an ATG start site were the most active, whereas those using GTG and TTG were approximately one half or one fourth as active, respectively. The CTG fusion was 95% less active than the ATG fusion.« less
Guss, Adam M.; Rother, Michael; Zhang, Jun Kai; ...
2008-01-01
A highly efficient method for chromosomal integration of cloned DNA into Methanosarcina spp. was developed utilizing the site-specific recombination system from the Streptomyces phage φC31. Host strains expressing the φC31 integrase gene and carrying an appropriate recombination site can be transformed with non-replicating plasmids carrying the complementary recombination site at efficiencies similar to those obtained with self-replicating vectors. We have also constructed a series of hybrid promoters that combine the highly expressed M. barkeri P mcrB promoter with binding sites for the tetracycline-responsive, bacterial TetR protein. These promoters are tightly regulated by the presence or absence of tetracycline in strainsmore » that express the tetR gene. The hybrid promoters can be used in genetic experiments to test gene essentiality by placing a gene of interest under their control. Thus, growth of strains with tetR -regulated essential genes becomes tetracycline-dependent. A series of plasmid vectors that utilize the site-specific recombination system for construction of reporter gene fusions and for tetracycline regulated expression of cloned genes are reported. These vectors were used to test the efficiency of translation at a variety of start codons. Fusions using an ATG start site were the most active, whereas those using GTG and TTG were approximately one half or one fourth as active, respectively. The CTG fusion was 95% less active than the ATG fusion.« less
Site-wide seismic risk model for Savannah River Site nuclear facilities
DOE Office of Scientific and Technical Information (OSTI.GOV)
Eide, S.A.; Shay, R.S.; Durant, W.S.
1993-09-01
The 200,000 acre Savannah River Site (SRS) has nearly 30 nuclear facilities spread throughout the site. The safety of each facility has been established in facility-specific safety analysis reports (SARs). Each SAR contains an analysis of risk from seismic events to both on-site workers and the off-site population. Both radiological and chemical releases are considered, and air and water pathways are modeled. Risks to the general public are generally characterized by evaluating exposure to the maximally exposed individual located at the SRS boundary and to the off-site population located within 50 miles. Although the SARs are appropriate methods for studyingmore » individual facility risks, there is a class of accident initiators that can simultaneously affect several of all of the facilities, Examples include seismic events, strong winds or tornados, floods, and loss of off-site electrical power. Overall risk to the off-site population from such initiators is not covered by the individual SARs. In such cases multiple facility radionuclide or chemical releases could occur, and off-site exposure would be greater than that indicated in a single facility SAR. As a step towards an overall site-wide risk model that adequately addresses multiple facility releases, a site-wide seismic model for determining off-site risk has been developed for nuclear facilities at the SRS. Risk from seismic events up to the design basis earthquake (DBE) of 0.2 g (frequency of 2.0E-4/yr) is covered by the model. Present plans include expanding the scope of the model to include other types of initiators that can simultaneously affect multiple facilities.« less
Panda, Ananya; Kumar, Atin; Gamanagatti, Shivanand; Das, Ranjita; Paliwal, Swati; Gupta, Amit; Kumar, Subodh
2017-01-01
PURPOSE We aimed to assess the performance of computed tomography (CT) in localizing site of traumatic gastrointestinal tract (GIT) injury and determine the diagnostic value of CT signs in site localization. METHODS CT scans of 97 patients with surgically proven GIT or mesenteric injuries were retrospectively reviewed by radiologists blinded to surgical findings. Diagnosis of either GIT or mesenteric injuries was made. In patients with GIT injuries, site of injury and presence of CT signs such as focal bowel wall hyperenhancement, hypoenhancement, wall discontinuity, wall thickening, extramural air, intramural air, perivisceral infiltration, and active vascular contrast leak were evaluated. RESULTS Out of 97 patients, 90 had GIT injuries (70 single site injuries and 20 multiple site injuries) and seven had isolated mesenteric injury. The overall concordance between CT and operative findings for exact site localization was 67.8% (61/90), partial concordance rate was 11.1% (10/90), and discordance rate was 21.1% (19/90). For single site localization, concordance rate was 77.1% (54/70), discordance rate was 21.4% (15/70), and partial concordance rate was 1.4% (1/70). In multiple site injury, concordance rate for all sites of injury was 35% (7/20), partial concordance rate was 45% (9/20), and discordance rate was 20% (4/20). For upper GIT injuries, wall discontinuity was the most accurate sign for localization. For small bowel injury, intramural air and hyperenhancement were the most specific signs for site localization, while for large bowel injury, wall discontinuity and hypoenhancement were the most specific signs. CONCLUSION CT performs better in diagnosing small bowel injury compared with large bowel injury. CT can well predict the presence of multiple site injury but has limited performance in exact localization of all injury sites. PMID:27924777
Gibbons, R. J.; Moreno, E. C.; Etherden, I.
1983-01-01
The influence of bacterial cell concentration on estimates of the number of binding sites and the affinity for the adsorption of a strain of Streptococcus sanguis to saliva-treated hydroxyapatite was determined, and the possible presence of multiple binding sites for this organism was tested. The range of concentrations of available bacteria varied from 4.7 × 106 to 5,960 × 106 cells per ml. The numbers of adsorbed bacteria increased over the entire range tested, but a suggestion of a break in an otherwise smooth adsorption isotherm was evident. Values for the number of binding sites and the affinity varied considerably depending upon the range of available bacterial concentrations used to estimate them; high correlation coefficients were obtained in all cases. The use of low bacterial cell concentrations yielded lower values for the number of sites and much higher values for the affinity constant than did the use of high bacterial cell concentrations. When data covering the entire range of bacterial concentrations were employed, values for the number of sites and the affinity were similar to those obtained by using only high bacterial cell concentrations. The simplest explanation for these results is that there are multiple binding sites for S. sanguis on saliva-treated hydroxyapatite surfaces. When present in low concentration, the streptococci evidently attach to more specific high-affinity sites which become saturated when higher bacterial concentrations are employed. The possibility of multiple binding sites was substantiated by comparing estimates of the adsorption parameters from a computer-simulated isotherm with those derived from the experimentally generated isotherm. A mathematical model describing bacterial adsorption to binary binding sites was further evidence for the existence of at least two classes of binding sites for S. sanguis. Far fewer streptococci adsorbed to experimental pellicles prepared from saliva depleted of bacterial aggregating activity when low numbers of streptococci were used, but the magnitude of this difference was considerably less when high streptococcal concentrations were employed. This suggests an association between salivary components which possess bacterial-aggregating activity and bacterial adsorption to high-affinity specific binding sites on saliva-treated hydroxyapatite surfaces. PMID:6822416
Brigo, Alessandro; Lee, Keun Woo; Iurcu Mustata, Gabriela; Briggs, James M.
2005-01-01
HIV-1 integrase (IN) is an essential enzyme for the viral replication and an interesting target for the design of new pharmaceuticals for multidrug therapy of AIDS. Single and multiple mutations of IN at residues T66, S153, or M154 confer degrees of resistance to several inhibitors that prevent the enzyme from performing its normal strand transfer activity. Four different conformations of IN were chosen from a prior molecular dynamics (MD) simulation on the modeled IN T66I/M154I catalytic core domain as starting points for additional MD studies. The aim of this article is to understand the dynamic features that may play roles in the catalytic activity of the double mutant enzyme in the absence of any inhibitor. Moreover, we want to verify the influence of using different starting points on the MD trajectories and associated dynamical properties. By comparison of the trajectories obtained from these MD simulations we have demonstrated that the starting point does not affect the conformational space explored by this protein and that the time of the simulation is long enough to achieve convergence for this system. PMID:15764656
45 CFR 1308.8 - Eligibility criteria: Emotional/behavioral disorders.
Code of Federal Regulations, 2010 CFR
2010-10-01
... or emotional functioning in multiple settings. (c) The evaluation process must include a review of the child's regular Head Start physical examination to eliminate the possibility of misdiagnosis due to an underlying physical condition. ...
USEPA SITE PROGRAM APPROACH TO TECHNOLOGY TRANSFER AND REGULATORY ACCEPTANCE
The USEPA's SITE program was created to meet the demand for innovative technologies for hazardous waste treatment. The primary mission of the SITe Program is to expedite the cleanup of sites on the NPL. These sites often have multiple contaminants in soil and groundwater, and few...
Keller, Peggy S; Gilbert, Lauren R; Haak, Eric A; Bi, Shuang; Smith, Olivia A
2017-04-01
Early school start times may curtail children's sleep and inadvertently promote sleep restriction. The current study examines the potential implications for early school start times for behavioral problems in public elementary schools (student ages 5-12 years) in Kentucky. School start times were obtained from school Web sites or by calling school offices; behavioral and disciplinary problems, along with demographic information about schools, were obtained from the Kentucky Department of Education. Estimated associations controlled for teacher/student ratio, racial composition, school rank, enrollment, and Appalachian location. Associations between early school start time and greater behavioral problems (harassment, in-school removals, suspensions, and expulsions) were observed, although some of these associations were found only for schools serving the non-Appalachian region. Findings support the growing body of research showing that early school start times may contribute to student problems, and extend this research through a large-scale examination of elementary schools, behavioral outcomes, and potential moderators of risk. Copyright © 2017 National Sleep Foundation. Published by Elsevier Inc. All rights reserved.
Macroglobulinemia of Waldenstrom
... or T immune cells start dividing rapidly. The exact cause of too much production of the IgM ... must be authorized in writing by ADAM Health Solutions. About MedlinePlus Site Map FAQs Customer Support Get ...
A 3/2-Approximation Algorithm for Multiple Depot Multiple Traveling Salesman Problem
NASA Astrophysics Data System (ADS)
Xu, Zhou; Rodrigues, Brian
As an important extension of the classical traveling salesman problem (TSP), the multiple depot multiple traveling salesman problem (MDMTSP) is to minimize the total length of a collection of tours for multiple vehicles to serve all the customers, where each vehicle must start or stay at its distinct depot. Due to the gap between the existing best approximation ratios for the TSP and for the MDMTSP in literature, which are 3/2 and 2, respectively, it is an open question whether or not a 3/2-approximation algorithm exists for the MDMTSP. We have partially addressed this question by developing a 3/2-approximation algorithm, which runs in polynomial time when the number of depots is a constant.
Soni, Vijay; Suryadevara, Priyanka; Sriram, Dharmarajan; Kumar, Santhosh; Nandicoori, Vinay Kumar; Yogeeswari, Perumal
2015-07-01
Persistent nature of Mycobacterium tuberculosis is one of the major factors which make the drug development process monotonous against this organism. The highly lipophilic cell wall, which constituting outer mycolic acid and inner peptidoglycan layers, acts as a barrier for the drugs to enter the bacteria. The rigidity of the cell wall is imparted by the peptidoglycan layer, which is covalently linked to mycolic acid by arabinogalactan. Uridine diphosphate-N-acetylglucosamine (UDP-GlcNAc) serves as the starting material in the biosynthesis of this peptidoglycan layers. This UDP-GlcNAc is synthesized by N-acetylglucosamine-1-phosphate uridyltransferase (GlmU(Mtb)), a bi-functional enzyme with two functional sites, acetyltransferase site and uridyltransferase site. Here, we report design and screening of nine inhibitors against UTP and NAcGlc-1-P of uridyltransferase active site of glmU(Mtb). Compound 4 was showing good inhibition and was selected for further analysis. The isothermal titration calorimetry (ITC) experiments showed the binding energy pattern of compound 4 to the uridyltransferase active site is similar to that of substrate UTP. In silico molecular dynamics (MD) simulation studies, for compound 4, carried out for 10 ns showed the protein-compound complex to be stable throughout the simulation with relative rmsd in acceptable range. Hence, these compounds can serve as a starting point in the drug discovery processes against Mycobacterium tuberculosis.
Immunoglobulin A multiple myeloma with cutaneous involvement in a dog.
Mayer, Monique N; Kerr, Moira E; Grier, Candace K; Macdonald, Valerie S
2008-07-01
An 8-year-old rottweiler, diagnosed with multiple myeloma and multiple sites of cutaneous involvement, was treated with chemotherapy and radiation therapy. The diagnostic criteria for canine multiple myeloma, limitations of diagnostic testing for light chain proteinuria in dogs, and the role of radiation therapy in multiple myeloma patients is discussed.
Immunoglobulin A multiple myeloma with cutaneous involvement in a dog
Mayer, Monique N.; Kerr, Moira E.; Grier, Candace K.; MacDonald, Valerie S.
2008-01-01
An 8-year-old rottweiler, diagnosed with multiple myeloma and multiple sites of cutaneous involvement, was treated with chemotherapy and radiation therapy. The diagnostic criteria for canine multiple myeloma, limitations of diagnostic testing for light chain proteinuria in dogs, and the role of radiation therapy in multiple myeloma patients is discussed. PMID:18827847
Estimating hydraulic properties using a moving-model approach and multiple aquifer tests
Halford, K.J.; Yobbi, D.
2006-01-01
A new method was developed for characterizing geohydrologic columns that extended >600 m deep at sites with as many as six discrete aquifers. This method was applied at 12 sites within the Southwest Florida Water Management District. Sites typically were equipped with multiple production wells, one for each aquifer and one or more observation wells per aquifer. The average hydraulic properties of the aquifers and confining units within radii of 30 to >300 m were characterized at each site. Aquifers were pumped individually and water levels were monitored in stressed and adjacent aquifers during each pumping event. Drawdowns at a site were interpreted using a radial numerical model that extended from land surface to the base of the geohydrologic column and simulated all pumping events. Conceptually, the radial model moves between stress periods and recenters on the production well during each test. Hydraulic conductivity was assumed homogeneous and isotropic within each aquifer and confining unit. Hydraulic property estimates for all of the aquifers and confining units were consistent and reasonable because results from multiple aquifers and pumping events were analyzed simultaneously. Copyright ?? 2005 National Ground Water Association.
Estimating hydraulic properties using a moving-model approach and multiple aquifer tests.
Halford, Keith J; Yobbi, Dann
2006-01-01
A new method was developed for characterizing geohydrologic columns that extended >600 m deep at sites with as many as six discrete aquifers. This method was applied at 12 sites within the Southwest Florida Water Management District. Sites typically were equipped with multiple production wells, one for each aquifer and one or more observation wells per aquifer. The average hydraulic properties of the aquifers and confining units within radii of 30 to >300 m were characterized at each site. Aquifers were pumped individually and water levels were monitored in stressed and adjacent aquifers during each pumping event. Drawdowns at a site were interpreted using a radial numerical model that extended from land surface to the base of the geohydrologic column and simulated all pumping events. Conceptually, the radial model moves between stress periods and recenters on the production well during each test. Hydraulic conductivity was assumed homogeneous and isotropic within each aquifer and confining unit. Hydraulic property estimates for all of the aquifers and confining units were consistent and reasonable because results from multiple aquifers and pumping events were analyzed simultaneously.
Mattingly, Julie A; Andresen, Pamela A
2016-01-01
Low-income American Indian preschoolers are at greatest risk for overweight and obesity among children aged 2-5 years. The Nutrition and Physical Activity Self-Assessment for Child Care (NAP SACC) program is an evidence-based intervention that promotes healthy weight development for children enrolled in child care centers. The goal of this continuous quality improvement program is for the child care staff to establish environmental policies and practices that positively influence nutrition and physical activity-related behaviors. A community needs assessment of a Head Start program on an American Indian reservation identified obesity as a priority issue. This project implemented NAP SACC at 15 Head Start sites on the reservation.
Molecular Structure and Transformation of the Glucose Dehydrogenase Gene in Drosophila Melanogaster
Whetten, R.; Organ, E.; Krasney, P.; Cox-Foster, D.; Cavener, D.
1988-01-01
We have precisely mapped and sequenced the three 5' exons of the Drosophila melanogaster Gld gene and have identified the start sites for transcription and translation. The first exon is composed of 335 nucleotides and does not contain any putative translation start codons. The second exon is separated from the first exon by 8 kb and contains the Gld translation start codon. The inferred amino acid sequence of the amino terminus contains two unusual features: three tandem repeats of serine-alanine, and a relatively high density of cysteine residues. P element-mediated transformation experiments demonstrated that a 17.5-kb genomic fragment contains the functional and regulatory components of the Gld gene. PMID:3143620
Ma, X X; Feng, Y P; Gu, Y X; Zhou, J H; Ma, Z R
2016-06-01
As for the alternative AUGs in foot-and-mouth disease virus (FMDV), nucleotide bias of the context flanking the AUG(2nd) could be used as a strong signal to initiate translation. To determine the role of the specific nucleotide context, dicistronic reporter constructs were engineered to contain different versions of nucleotide context linking between internal ribosome entry site (IRES) and downstream gene. The results indicate that under FMDV IRES-dependent mechanism, the nucleotide contexts flanking start codon can influence the translation initiation efficiencies. The most optimal sequences for both start codons have proved to be UUU AUG(1st) AAC and AAG AUG(2nd) GAA.
... More for Teens Teens site Sitio para adolescentes Body Mind Sexual Health Food & Fitness Diseases & Conditions Infections Drugs & ... that if you start to use nicotine, your body and mind will become so used to it that you' ...
77 FR 74666 - Submission for OMB Review; Comment Request
Federal Register 2010, 2011, 2012, 2013, 2014
2012-12-17
... sites: The Best Start Los Angeles Pilot Community Evaluation, currently led by the Urban Institute's... Poverty Center of the University of Michigan. Respondents: Low-income women who have resident children and...
Large Scale Helium Liquefaction and Considerations for Site Services for a Plant Located in Algeria
NASA Astrophysics Data System (ADS)
Froehlich, P.; Clausen, J. J.
2008-03-01
The large-scale liquefaction of helium extracted from natural gas is depicted. Based on a block diagram the process chain, starting with the pipeline downstream of the natural-gas plant to the final storage of liquid helium, is explained. Information will be provided about the recent experiences during installation and start-up of a bulk helium liquefaction plant located in Skikda, Algeria, including part-load operation based on a reduced feed gas supply. The local working and ambient conditions are described, including challenging logistic problems like shipping and receiving of parts, qualified and semi-qualified subcontractors, basic provisions and tools on site, and precautions to sea water and ambient conditions. Finally, the differences in commissioning (technically and evaluation of time and work packages) to European locations and standards will be discussed.
Demonstration of a PC 25 Fuel Cell in Russia
DOE Office of Scientific and Technical Information (OSTI.GOV)
John C. Trocciola; Thomas N. Pompa; Linda S. Boyd
2004-09-01
This project involved the installation of a 200kW PC25C{trademark} phosphoric-acid fuel cell power plant at Orgenergogaz, a Gazprom industrial site in Russia. In April 1997, a PC25C{trademark} was sold by ONSI Corporation to Orgenergogaz, a subsidiary of the Russian company ''Gazprom''. Due to instabilities in the Russian financial markets, at that time, the unit was never installed and started by Orgenergogaz. In October of 2001 International Fuel Cells (IFC), now known as UTC Fuel Cells (UTCFC), received a financial assistance award from the United States Department of Energy (DOE) entitled ''Demonstration of PC 25 Fuel Cell in Russia''. Three majormore » tasks were part of this award: the inspection of the proposed site and system, start-up assistance, and installation and operation of the powerplant.« less
Thermodynamics of Strecker synthesis in hydrothermal systems
NASA Technical Reports Server (NTRS)
Schulte, Mitchell; Shock, Everett
1995-01-01
Submarine hydrothermal systems on the early Earth may have been the sites from which life emerged. The potential for Strecker synthesis to produce biomolecules (amino and hydroxy acids) from starting compounds (ketones, aldehydes, HCN and ammonia) in such environments is evaluated quantitatively using thermodynamic data and parameters for the revised Helgeson-Kirkham-Flowers (HKF) equation of state. Although there is an overwhelming thermodynamic drive to form biomolecules by the Strecker synthesis at hydrothermal conditions, the availability and concentration of starting compounds limit the efficiency and productivity of Strecker reactions. Mechanisms for concentrating reactant compounds could help overcome this problem, but other mechanisms for production of biomolecules may have been required to produce the required compounds on the early Earth. Geochemical constraints imposed by hydrothermal systems provide important clues for determining the potential of these and other systems as sites for the emergence of life.
Choto, R. C.; Harries, A. D.; Mutasa-Apollo, T.; Chakanyuka-Musanhu, C.
2017-01-01
Setting: Seven pilot sites in Zimbabwe implementing 6 months of isoniazid preventive therapy (IPT) for people living with the human immunodeficiency virus (PLHIV). Objectives: To determine, among PLHIV started on IPT, the completion rates for a 6-month course of IPT and factors associated with non-adherence. Design: A retrospective cohort study. Results: Of 578 patients, 466 (81%) completed IPT. Of the 112 patients who failed to complete IPT, 69 (60%) were lost to follow-up, 30 (27%) stopped treatment with no documented reasons, 8 (7%) developed toxicity/adverse reactions, 5 (5%) were documented as having drug stock-outs and the remainder transferred out or refused to continue treatment. Currently being on antiretroviral therapy (ART) (aOR 0.09, 95%CI 0.03–0.28) and receiving a ⩾2 month supply of isoniazid at the start of treatment were associated with a lower risk of not completing IPT, while missing clinic visits prior to starting IPT (aOR 5.25, 95%CI 2.10–13.14) was associated with a higher risk of non-completion. Conclusion: IPT completion rates in seven pilot sites of Zimbabwe were comparatively high, showing that IPT roll-out in public health facilities is feasible. Enhanced adherence counselling or active tracing among pre-ART patients and those with a history of loss to follow-up may improve IPT completion rates, along with synchronising IPT and ART resupplies. PMID:28775944
DOE Office of Scientific and Technical Information (OSTI.GOV)
Burkhardt E.; Adham, I.M.; Brosig, B.
1994-03-01
Leydig insulin-like protein (LEY I-L) is a member of the insulin-like hormone superfamily. The LEY I-L gene (designated INSL3) is expressed exclusively in prenatal and postnatal Leydig cells. The authors report here the cloning and nucleotide sequence of porcine and human LEY I-L genes including the 5[prime] regions. Both genes consist of two exons and one intron. The organization of the LEY I-L gene is similar to that of insulin and relaxin. The transcription start site in the porcine and human LEY I-L gene is localized 13 and 14 bp upstream of the translation start site, respectively. Alignment of themore » 5[prime] flanking regions of both genes reveals that the first 107 nucleotides upstream of the transcription start site exhibit an overall sequence similarity of 80%. This conserved region contains a consensus TATAA box, a CAAT-like element (GAAT), and a consensus SP1 sequence (GGGCGG) at equivalent positions in both genes and therefore may play a role in regulation of expression of the LEY I-L gene. The porcine and human genome contains a single copy of the LEY I-L gene. By in situ hybridization, the human gene was assigned to bands p13.2-p12 of the short arm of chromosome 19. 25 refs., 6 figs.« less
Grichnik, J M; French, B A; Schwartz, R J
1988-01-01
The chicken skeletal alpha-actin gene promoter region (-202 to -12) provides myogenic transcriptional specificity. This promoter contains partial dyad symmetry about an axis at nucleotide -108 and in transfection experiments is capable of directing transcription in a bidirectional manner. At least three different transcription initiation start sites, oriented toward upstream sequences, were mapped 25 to 30 base pairs from TATA-like regions. The opposing transcriptional activity was potentiated upon the deletion of sequences proximal to the alpha-actin transcription start site. Thus, sequences which serve to position RNA polymerase for alpha-actin transcription may allow, in their absence, the selection of alternative and reverse-oriented start sites. Nuclear runoff transcription assays of embryonic muscle indicated that divergent transcription may occur in vivo but with rapid turnover of nuclear transcripts. Divergent transcriptional activity enabled us to define the 3' regulatory boundary of the skeletal alpha-actin promoter which retains a high level of myogenic transcriptional activity. The 3' regulatory border was detected when serial 3' deletions bisected the element (-91 CCAAA TATGG -82) which reduced transcriptional activity by 80%. Previously we showed that disruption of its upstream counterpart (-127 CCAAAGAAGG -136) resulted in about a 90% decrease in activity. These element pairs, which we describe as CCAAT box-associated repeats, are conserved in all sequenced vertebrate sarcomeric actin genes and may act in a cooperative manner to facilitate transcription in myogenic cells. Images PMID:3211124
Modeling Classical Swine Fever Outbreak-Related Outcomes
Yadav, Shankar; Olynk Widmar, Nicole J.; Weng, Hsin-Yi
2016-01-01
The study was carried out to estimate classical swine fever (CSF) outbreak-related outcomes, such as epidemic duration and number of infected, vaccinated, and depopulated premises, using defined most likely CSF outbreak scenarios. Risk metrics were established using empirical data to select the most likely CSF outbreak scenarios in Indiana. These scenarios were simulated using a stochastic between-premises disease spread model to estimate outbreak-related outcomes. A total of 19 single-site (i.e., with one index premises at the onset of an outbreak) and 15 multiple-site (i.e., with more than one index premises at the onset of an outbreak) outbreak scenarios of CSF were selected using the risk metrics. The number of index premises in the multiple-site outbreak scenarios ranged from 4 to 32. The multiple-site outbreak scenarios were further classified into clustered (N = 6) and non-clustered (N = 9) groups. The estimated median (5th, 95th percentiles) epidemic duration (days) was 224 (24, 343) in the single-site and was 190 (157, 251) and 210 (167, 302) in the clustered and non-clustered multiple-site outbreak scenarios, respectively. The median (5th, 95th percentiles) number of infected premises was 323 (0, 488) in the single-site outbreak scenarios and was 529 (395, 662) and 465 (295, 640) in the clustered and non-clustered multiple-site outbreak scenarios, respectively. Both the number and spatial distributions of the index premises affected the outcome estimates. The results also showed the importance of implementing vaccinations to accommodate depopulation in the CSF outbreak controls. The use of routinely collected surveillance data in the risk metrics and disease spread model allows end users to generate timely outbreak-related information based on the initial outbreak’s characteristics. Swine producers can use this information to make an informed decision on the management of swine operations and continuity of business, so that potential losses could be minimized during a CSF outbreak. Government authorities might use the information to make emergency preparedness plans for CSF outbreak control. PMID:26870741
Thangasamy, Saminathan; Chen, Pei-Wei; Lai, Ming-Hsing; Chen, Jychian; Jauh, Guang-Yuh
2012-07-01
Tiller initiation and panicle development are important agronomical traits for grain production in Oryza sativa L. (rice), but their regulatory mechanisms are not yet fully understood. In this study, T-DNA mutant and RNAi transgenic approaches were used to functionally characterize a unique rice gene, LAGGING GROWTH AND DEVELOPMENT 1 (LGD1). The lgd1 mutant showed slow growth, reduced tiller number and plant height, altered panicle architecture and reduced grain yield. The fewer unelongated internodes and cells in lgd1 led to respective reductions in tiller number and to semi-dwarfism. Several independent LGD1-RNAi lines exhibited defective phenotypes similar to those observed in lgd1. Interestingly, LGD1 encodes multiple transcripts with different transcription start sites (TSSs), which were validated by RNA ligase-mediated rapid amplification of 5' and 3' cDNA ends (RLM-RACE). Additionally, GUS assays and a luciferase promoter assay confirmed the promoter activities of LGD1.1 and LGD1.5. LGD1 encoding a von Willebrand factor type A (vWA) domain containing protein is a single gene in rice that is seemingly specific to grasses. GFP-tagged LGD1 isoforms were predominantly detected in the nucleus, and weakly in the cytoplasm. In vitro northwestern analysis showed the RNA-binding activity of the recombinant C-terminal LGD1 protein. Our results demonstrated that LGD1 pleiotropically regulated rice vegetative growth and development through both the distinct spatiotemporal expression patterns of its multiple transcripts and RNA binding activity. Hence, the study of LGD1 will strengthen our understanding of the molecular basis of the multiple transcripts, and their corresponding polypeptides with RNA binding activity, that regulate pleiotropic effects in rice. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.
Masseroli, Marco; Kaitoua, Abdulrahman; Pinoli, Pietro; Ceri, Stefano
2016-12-01
While a huge amount of (epi)genomic data of multiple types is becoming available by using Next Generation Sequencing (NGS) technologies, the most important emerging problem is the so-called tertiary analysis, concerned with sense making, e.g., discovering how different (epi)genomic regions and their products interact and cooperate with each other. We propose a paradigm shift in tertiary analysis, based on the use of the Genomic Data Model (GDM), a simple data model which links genomic feature data to their associated experimental, biological and clinical metadata. GDM encompasses all the data formats which have been produced for feature extraction from (epi)genomic datasets. We specifically describe the mapping to GDM of SAM (Sequence Alignment/Map), VCF (Variant Call Format), NARROWPEAK (for called peaks produced by NGS ChIP-seq or DNase-seq methods), and BED (Browser Extensible Data) formats, but GDM supports as well all the formats describing experimental datasets (e.g., including copy number variations, DNA somatic mutations, or gene expressions) and annotations (e.g., regarding transcription start sites, genes, enhancers or CpG islands). We downloaded and integrated samples of all the above-mentioned data types and formats from multiple sources. The GDM is able to homogeneously describe semantically heterogeneous data and makes the ground for providing data interoperability, e.g., achieved through the GenoMetric Query Language (GMQL), a high-level, declarative query language for genomic big data. The combined use of the data model and the query language allows comprehensive processing of multiple heterogeneous data, and supports the development of domain-specific data-driven computations and bio-molecular knowledge discovery. Copyright © 2016 Elsevier Inc. All rights reserved.
Teichroeb, Julie Annette; Smeltzer, Eve Ann
2018-01-01
Animal paths are analogous to intractable mathematical problems like the Traveling Salesman Problem (TSP) and the shortest path problem (SPP). Both the TSP and SPP require an individual to find the shortest path through multiple targets but the TSP demands a return to the start, while the SPP does not. Vervet monkeys are very efficient in solving TSPs but this species is a multiple central place forager that does not always return to the same sleeping site and thus theoretically should be selected to find solutions to SPPs rather than TSPs. We examined path choice by wild vervets in an SPP experimental array where the shortest paths usually differed from those consistent with common heuristic strategies, the nearest-neighbor rule (NNR-go to the closest resource that has not been visited), and the convex hull (put a mental loop around sites, adding inner targets in order of distance from the edge)-an efficient strategy for TSPs but not SPPs. In addition, humans solving SPPs use an initial segment strategy (ISS-choose the straightest path at the beginning, only turning when necessary) and we looked at vervet paths consistent with this strategy. In 615 trials by single foragers, paths usually conformed to the NNR and rarely the slightly more efficient convex hull, supporting that vervets may be selected to solve SPPs. Further, like humans solving SPPs, vervets showed a tendency to use the ISS. Paths consistent with heuristics dropped off sharply, and use of the shortest path increased, when heuristics led to longer paths showing trade-offs in efficiency versus cognitive load. Two individuals out of 17, found the shortest path most often, showing inter-individual variation in path planning. Given support for the NNR and the ISS, we propose a new rule-of-thumb termed the "region heuristic" that vervets may apply in multi-destination routes.
Smeltzer, Eve Ann
2018-01-01
Animal paths are analogous to intractable mathematical problems like the Traveling Salesman Problem (TSP) and the shortest path problem (SPP). Both the TSP and SPP require an individual to find the shortest path through multiple targets but the TSP demands a return to the start, while the SPP does not. Vervet monkeys are very efficient in solving TSPs but this species is a multiple central place forager that does not always return to the same sleeping site and thus theoretically should be selected to find solutions to SPPs rather than TSPs. We examined path choice by wild vervets in an SPP experimental array where the shortest paths usually differed from those consistent with common heuristic strategies, the nearest-neighbor rule (NNR–go to the closest resource that has not been visited), and the convex hull (put a mental loop around sites, adding inner targets in order of distance from the edge)–an efficient strategy for TSPs but not SPPs. In addition, humans solving SPPs use an initial segment strategy (ISS–choose the straightest path at the beginning, only turning when necessary) and we looked at vervet paths consistent with this strategy. In 615 trials by single foragers, paths usually conformed to the NNR and rarely the slightly more efficient convex hull, supporting that vervets may be selected to solve SPPs. Further, like humans solving SPPs, vervets showed a tendency to use the ISS. Paths consistent with heuristics dropped off sharply, and use of the shortest path increased, when heuristics led to longer paths showing trade-offs in efficiency versus cognitive load. Two individuals out of 17, found the shortest path most often, showing inter-individual variation in path planning. Given support for the NNR and the ISS, we propose a new rule-of-thumb termed the “region heuristic” that vervets may apply in multi-destination routes. PMID:29813105
Single-site labeling of lysine in proteins through a metal-free multicomponent approach.
Chilamari, Maheshwerreddy; Kalra, Neetu; Shukla, Sanjeev; Rai, Vishal
2018-06-15
We report a chemoselective and site-selective approach that distinguishes one Lys from its multiple copies, N-terminus, and other competitors. The phospha-Mannich protocol works with multiple proteins and installs probes without structural and functional perturbations. It delivers an antibody-drug conjugate with selective anti-proliferative activity towards HER2 expressing SKBR3 breast cancer cells.
The Marine Corps Operating Concept: How an Expeditionary Force Operates in the 21st Century
2016-09-01
Moderator: Capt Pierce, you were a company commander on the MEU. How did OLR start for you? Well, up to the point that the enemy started crossing the...came in fast from long range on small boats. Worst beaches you’ve ever seen. Windward side, rocks everywhere, shoving boats in between the breakers...While the landing force didn’t get ashore unscathed, they mitigated the damage by using numerous small landing sites and emphasizing speed and
Timely topics on spent fuel storage
DOE Office of Scientific and Technical Information (OSTI.GOV)
Selin, I.
1994-12-31
The history of spent fuel management in this country has taken several turns, with a final resolution still out of reach. Several repository programs started, stalled ans stopped. The latest effort at Yucca Mountain is progressing but, at best, is years from the early phases of licensing, much less the actual underground disposal of spent fuel. A monitored retrieval storage [MRS] facility was expected to start accepting commercial spent fuel beginning in 1998, but no such facility is clearly on the horizon. All of these recent developments changed the circumstances that we face in spent fuel management. The obvious conclusionmore » is that an increasing number of plants, both operating and permanently shut-down reactors, will have to provide for additional spent fuel storage on-site for a longer period than originally planned, and even after plant decommissioning, prudence requires that provision be made for continual, stand-alone, on-site storage. After pool capacity is reached, most utilities opt for some sort of dry storage. But the dry storage option has triggered an unprecedented amount of local opposition at many sites, further taxing NRC and industry resources.« less
TSSi--an R package for transcription start site identification from 5' mRNA tag data.
Kreutz, C; Gehring, J S; Lang, D; Reski, R; Timmer, J; Rensing, S A
2012-06-15
High-throughput sequencing has become an essential experimental approach for the investigation of transcriptional mechanisms. For some applications like ChIP-seq, several approaches for the prediction of peak locations exist. However, these methods are not designed for the identification of transcription start sites (TSSs) because such datasets contain qualitatively different noise. In this application note, the R package TSSi is presented which provides a heuristic framework for the identification of TSSs based on 5' mRNA tag data. Probabilistic assumptions for the distribution of the data, i.e. for the observed positions of the mapped reads, as well as for systematic errors, i.e. for reads which map closely but not exactly to a real TSS, are made and can be adapted by the user. The framework also comprises a regularization procedure which can be applied as a preprocessing step to decrease the noise and thereby reduce the number of false predictions. The R package TSSi is available from the Bioconductor web site: www.bioconductor.org/packages/release/bioc/html/TSSi.html.
Puértolas, B; Navlani-García, M; García, T; Navarro, M V; Lozano-Castelló, D; Cazorla-Amorós, D
2014-08-30
A key target to reduce current hydrocarbon emissions from vehicular exhaust is to improve their abatement under cold-start conditions. Herein, we demonstrate the potential of factorial analysis to design a highly efficient catalytic trap. The impact of the synthesis conditions on the preparation of copper-loaded ZSM-5 is clearly revealed by XRD, N2 sorption, FTIR, NH3-TPD, SEM and TEM. A high concentration of copper nitrate precursor in the synthesis improves the removal of hydrocarbons, providing both strong adsorption sites for hydrocarbon retention at low temperature and copper oxide nanoparticles for full hydrocarbon catalytic combustion at high temperature. The use of copper acetate precursor leads to a more homogeneous dispersion of copper oxide nanoparticles also providing enough catalytic sites for the total oxidation of hydrocarbons released from the adsorption sites, although lower copper loadings are achieved. Thus, synthesis conditions leading to high copper loadings jointly with highly dispersed copper oxide nanoparticles would result in an exceptional catalytic trap able to reach superior hydrocarbon abatement under highly demanding operational conditions. Copyright © 2014 Elsevier B.V. All rights reserved.
Return to the Moon: NASA's LCROSS AND LRO Missions
NASA Technical Reports Server (NTRS)
Morales, Lester
2012-01-01
NASA s goals include objectives for robotic and human spaceflight: a) Implement a sustained and affordable human and robotic program to explore the solar system and beyond; b) Extend human presence across the solar system, starting with a human return to the Moon by the year 2020, in preparation for human exploration of Mars and other destinations; c) A lunar outpost is envisioned. Site Considerations: 1) General accessibility of landing site (orbital mechanics) 2) Landing site safety 3) Mobility 4) Mars analog 5) Power 6) Communications 7) Geologic diversity 8) ISRU considerations
Human renin 5'-flanking DNA to nucleotide-2750.
Smith, D L; Jeyapalan, S; Lang, J A; Guo, X H; Sigmund, C D; Morris, B J
1995-01-01
Renin is one of the most important factors in blood pressure and electrolyte regulation in mammals and the renin locus has been implicated in hypertension. To assist studies of promoter control we therefore determined the 5'-flanking sequence of the human gene (REN) to residue -2750 relative to the transcription start site (+1). Sites of homology to consensus sequences for binding of trans-acting factors involved in transcriptional control of other genes were identified, and functionality for two of these (a CRE and Pit-1 site) have so far been demonstrated.
Holland, Neil R; Grinberg, Ilya; Tabby, David
2014-01-01
The Drexel neurology clerkship experience can vary from large groups at a university hospital inpatient unit to smaller groups at private physician offices. Evaluations are based on the site director's subjective assessment and performance on the National Board of Medical Examiners neurology shelf examination. We are developing a standardized online clinical neurology course and quiz for the whole clerkship. We piloted the course and quiz at a single site for one academic year and compared their test scores with a control group of students at other clerkship sites who took the online quiz without viewing the course. Students at the pilot site achieved higher scores both on the neurology shelf examination and the clinical quiz and also reported higher teaching satisfaction scores than students at all other sites. There was a 97 % participation rate in the online quiz from the other sites. Use of this online course and quiz provides effective standardized clinical neurology teaching and evaluation that can be applied to students across multiple sites.
External Validity in Policy Evaluations That Choose Sites Purposively
ERIC Educational Resources Information Center
Olsen, Robert B.; Orr, Larry L.; Bell, Stephen H.; Stuart, Elizabeth A.
2013-01-01
Evaluations of the impact of social programs are often carried out in multiple sites, such as school districts, housing authorities, local TANF offices, or One-Stop Career Centers. Most evaluations select sites purposively following a process that is nonrandom. Unfortunately, purposive site selection can produce a sample of sites that is not…
Design of a Ku band miniature multiple beam klystron
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bandyopadhyay, Ayan Kumar, E-mail: ayan.bandyopadhyay@gmail.com; Pal, Debasish; Kant, Deepender
2016-03-09
The design of a miniature multiple beam klystron (MBK) working in the Ku-band frequency range is presented in this article. Starting from the main design parameters, design of the electron gun, the input and output couplers and radio frequency section (RF-section) are presented. The design methodology using state of the art commercial electromagnetic design tools, analytical formulae as well as noncommercial design tools are briefly presented in this article.
Land, Michael; Everett, R.R.; Crawford, S.M.
2002-01-01
In 1995, the U.S. Geological Survey (USGS), in cooperation with the HYPERLINK 'http://wrd.org' Water Replenishment District of Southern California (WRDSC), began a study to examine ground-water resources in the Central and West Coast Basins in Los Angeles County, California. The study characterizes the geohydrology and geochemistry of the regional ground-water flow system and provides extensive data for evaluating ground-water management issues. This report is a compilation of geologic, hydrologic, and water-quality data collected from 24 recently constructed multiple-well monitoring sites for the period 1995?2000. Descriptions of the collected drill cuttings were compiled into lithologic logs, which are summarized along with geophysical logs?including gamma-ray, spontaneous potential, resistivity, electromagnetic induction, and temperature tool logs?for each monitoring site. At selected sites, cores were analyzed for magnetic orientation, physical and thermal properties, and mineralogy. Field and laboratory estimates of hydraulic conductivity are presented for most multiple-well monitoring sites. Periodic water-level measurements are also reported. Water-quality information for major ions, nutrients, trace elements, deuterium and oxygen-18, and tritium is presented for the multiple-well monitoring locations, and for selected existing production and observation wells. In addition, boron-11, carbon-13, carbon-14, sulfur-34, and strontium-87/86 data are presented for selected wells.
Gilbert, Kathleen M.; Blossom, Sarah J.; Reisfeld, Brad; Erickson, Stephen W.; Vyas, Kanan; Maher, Mary; Broadfoot, Brannon; West, Kirk; Bai, Shasha; Cooney, Craig A.; Bhattacharyya, Sudeepa
2017-01-01
Abstract Exposure to industrial solvent and water pollutant trichloroethylene (TCE) can promote autoimmunity, and expand effector/memory (CD62L) CD4+ T cells. In order to better understand etiology reduced representation bisulfite sequencing was used to study how a 40-week exposure to TCE in drinking water altered methylation of ∼337 770 CpG sites across the entire genome of effector/memory CD4+ T cells from MRL+/+ mice. Regardless of TCE exposure, 62% of CpG sites in autosomal chromosomes were hypomethylated (0–15% methylation), and 25% were hypermethylated (85–100% methylation). In contrast, only 6% of the CpGs on the X chromosome were hypomethylated, and 51% had mid-range methylation levels. In terms of TCE impact, TCE altered (≥ 10%) the methylation of 233 CpG sites in effector/memory CD4+ T cells. Approximately 31.7% of these differentially methylated sites occurred in regions known to bind one or more Polycomb group (PcG) proteins, namely Ezh2, Suz12, Mtf2 or Jarid2. In comparison, only 23.3% of CpG sites not differentially methylated by TCE were found in PcG protein binding regions. Transcriptomics revealed that TCE altered the expression of ∼560 genes in the same effector/memory CD4+ T cells. At least 80% of the immune genes altered by TCE had binding sites for PcG proteins flanking their transcription start site, or were regulated by other transcription factors that were in turn ordered by PcG proteins at their own transcription start site. Thus, PcG proteins, and the differential methylation of their binding sites, may represent a new mechanism by which TCE could alter the function of effector/memory CD4+ T cells. PMID:29129997
Huynh, Alexis K; Lee, Martin L; Farmer, Melissa M; Rubenstein, Lisa V
2016-10-21
Stepped wedge designs have gained recognition as a method for rigorously assessing implementation of evidence-based quality improvement interventions (QIIs) across multiple healthcare sites. In theory, this design uses random assignment of sites to successive QII implementation start dates based on a timeline determined by evaluators. However, in practice, QII timing is often controlled more by site readiness. We propose an alternate version of the stepped wedge design that does not assume the randomized timing of implementation while retaining the method's analytic advantages and applying to a broader set of evaluations. To test the feasibility of a nonrandomized stepped wedge design, we developed simulated data on patient care experiences and on QII implementation that had the structures and features of the expected data from a planned QII. We then applied the design in anticipation of performing an actual QII evaluation. We used simulated data on 108,000 patients to model nonrandomized stepped wedge results from QII implementation across nine primary care sites over 12 quarters. The outcome we simulated was change in a single self-administered question on access to care used by Veterans Health Administration (VA), based in the United States, as part of its quarterly patient ratings of quality of care. Our main predictors were QII exposure and time. Based on study hypotheses, we assigned values of 4 to 11 % for improvement in access when sites were first exposed to implementation and 1 to 3 % improvement in each ensuing time period thereafter when sites continued with implementation. We included site-level (practice size) and respondent-level (gender, race/ethnicity) characteristics that might account for nonrandomized timing in site implementation of the QII. We analyzed the resulting data as a repeated cross-sectional model using HLM 7 with a three-level hierarchical data structure and an ordinal outcome. Levels in the data structure included patient ratings, timing of adoption of the QII, and primary care site. We were able to demonstrate a statistically significant improvement in adoption of the QII, as postulated in our simulation. The linear time trend while sites were in the control state was not significant, also as expected in the real life scenario of the example QII. We concluded that the nonrandomized stepped wedge design was feasible within the parameters of our planned QII with its data structure and content. Our statistical approach may be applicable to similar evaluations.
Integrated multiple patch-clamp array chip via lateral cell trapping junctions
NASA Astrophysics Data System (ADS)
Seo, J.; Ionescu-Zanetti, C.; Diamond, J.; Lal, R.; Lee, L. P.
2004-03-01
We present an integrated multiple patch-clamp array chip by utilizing lateral cell trapping junctions. The intersectional design of a microfluidic network provides multiple cell addressing and manipulation sites for efficient electrophysiological measurements at a number of patch sites. The patch pores consist of openings in the sidewall of a main fluidic channel, and a membrane patch is drawn into a smaller horizontal channel. This device geometry not only minimizes capacitive coupling between the cell reservoir and the patch channel, but also allows simultaneous optical and electrical measurements of ion channel proteins. Evidence of the hydrodynamic placement of mammalian cells at the patch sites as well as measurements of patch sealing resistance is presented. Device fabrication is based on micromolding of polydimethylsiloxane, thus allowing inexpensive mass production of disposable high-throughput biochips.
SHRINE: Enabling Nationally Scalable Multi-Site Disease Studies
McMurry, Andrew J.; Murphy, Shawn N.; MacFadden, Douglas; Weber, Griffin; Simons, William W.; Orechia, John; Bickel, Jonathan; Wattanasin, Nich; Gilbert, Clint; Trevvett, Philip; Churchill, Susanne; Kohane, Isaac S.
2013-01-01
Results of medical research studies are often contradictory or cannot be reproduced. One reason is that there may not be enough patient subjects available for observation for a long enough time period. Another reason is that patient populations may vary considerably with respect to geographic and demographic boundaries thus limiting how broadly the results apply. Even when similar patient populations are pooled together from multiple locations, differences in medical treatment and record systems can limit which outcome measures can be commonly analyzed. In total, these differences in medical research settings can lead to differing conclusions or can even prevent some studies from starting. We thus sought to create a patient research system that could aggregate as many patient observations as possible from a large number of hospitals in a uniform way. We call this system the ‘Shared Health Research Information Network’, with the following properties: (1) reuse electronic health data from everyday clinical care for research purposes, (2) respect patient privacy and hospital autonomy, (3) aggregate patient populations across many hospitals to achieve statistically significant sample sizes that can be validated independently of a single research setting, (4) harmonize the observation facts recorded at each institution such that queries can be made across many hospitals in parallel, (5) scale to regional and national collaborations. The purpose of this report is to provide open source software for multi-site clinical studies and to report on early uses of this application. At this time SHRINE implementations have been used for multi-site studies of autism co-morbidity, juvenile idiopathic arthritis, peripartum cardiomyopathy, colorectal cancer, diabetes, and others. The wide range of study objectives and growing adoption suggest that SHRINE may be applicable beyond the research uses and participating hospitals named in this report. PMID:23533569
In vitro and ex vivo analysis of CHRNA3 and CHRNA5 haplotype expression.
Doyle, Glenn A; Wang, Min-Jung; Chou, Andrew D; Oleynick, John U; Arnold, Steven E; Buono, Russell J; Ferraro, Thomas N; Berrettini, Wade H
2011-01-01
Genome-wide association studies implicate variations in CHRNA5 and CHRNA3 as being associated with nicotine addiction (NA). Multiple common haplotypes ("risk", "mixed" and "protective") exist in Europeans; however, high linkage disequilibrium between variations in CHRNA5 and CHRNA3 makes assigning causative allele(s) for NA difficult through genotyping experiments alone. We investigated whether CHRNA5 or CHRNA3 promoter haplotypes, associated previously with NA, might influence allelic expression levels. For in vitro analyses, promoter haplotypes were sub-cloned into a luciferase reporter vector. When assessed in BE(2)-C cells, luciferase expression was equivalent among CHRNA3 haplotypes, but the combination of deletion at rs3841324 and variation at rs503464 decreased CHRNA5 promoter-derived luciferase activity, possibly due to loss of an SP-1 and other site(s). Variation within the CHRNA5 5'UTR at rs55853698 and rs55781567 also altered luciferase expression in BE(2)-C cells. Allelic expression imbalance (AEI) from the "risk" or "protective" haplotypes was assessed in post-mortem brain tissue from individuals heterozygous at coding polymorphisms in CHRNA3 (rs1051730) or CHRNA5 (rs16969968). In most cases, equivalent allelic expression was observed; however, one individual showed CHRNA5 AEI that favored the "protective" allele and that was concordant with heterozygosity at polymorphisms ∼13.5 kb upstream of the CHRNA5 transcription start site. Putative enhancer activity from these distal promoter elements was assessed using heterologous promoter constructs. We observed no differences in promoter activity from the two distal promoter haplotypes examined, but found that the distal promoter region strongly repressed transcription. We conclude that CHRNA5 promoter variants may affect relative risk for NA in some heterozygous individuals.
miRNA-Processing Gene Methylation and Cancer Risk.
Joyce, Brian T; Zheng, Yinan; Zhang, Zhou; Liu, Lei; Kocherginsky, Masha; Murphy, Robert; Achenbach, Chad J; Musa, Jonah; Wehbe, Firas; Just, Allan; Shen, Jincheng; Vokonas, Pantel; Schwartz, Joel; Baccarelli, Andrea A; Hou, Lifang
2018-05-01
Background: Dysregulation of miRNA and methylation levels are epigenetic hallmarks of cancer, potentially linked via miRNA-processing genes. Studies have found genetic alterations to miRNA-processing genes in cancer cells and human population studies. Our objective was to prospectively examine changes in DNA methylation of miRNA-processing genes and their associations with cancer risk. Methods: We examined cohort data from the Department of Veterans' Affairs Normative Aging Study. Participants were assessed every 3 to 5 years starting in 1999 through 2013 including questionnaires, medical record review, and blood collection. Blood from 686 consenting participants was analyzed using the Illumina 450K BeadChip array to measure methylation at CpG sites throughout the genome. We selected 19 genes based on a literature review, with 519 corresponding CpG sites. We then used Cox proportional hazards models to examine associations with cancer incidence, and generalized estimating equations to examine associations with cancer prevalence. Associations at false discovery rate < 0.05 were considered statistically significant. Results: Methylation of three CpGs ( DROSHA : cg23230564, TNRC6B : cg06751583, and TNRC6B : cg21034183) was prospectively associated with time to cancer development (positively for cg06751583, inversely for cg23230564 and cg21034183), whereas methylation of one CpG site ( DROSHA : cg16131300) was positively associated with cancer prevalence. Conclusions: DNA methylation of DROSHA , a key miRNA-processing gene, and TNRC6B may play a role in early carcinogenesis. Impact: Changes in miRNA processing may exert multiple effects on cancer development, including protecting against it via altered global miRNAs, and may be a useful early detection biomarker of cancer. Cancer Epidemiol Biomarkers Prev; 27(5); 550-7. ©2018 AACR . ©2018 American Association for Cancer Research.
Nuclear Waste Disposal: Can Government Cope?
1983-12-01
Kansas (1972) and Alpena , Michigan (1975) sites. Less publicized are the increased costs (transaction costs and delayed schedules) which result when...first site focused on by OWI (in 1975) was in Alpena , Michigan. S In response to the criticism that ERDA officials had not consulted adequately with...Congressman Phillip Ruppe, in whose district Alpena lay, of its intention to start exploratory drilling activities. In response to being confronted with what
SRS SWPF Construction Completion
Craig, Jack; Sheppard, Frank; Marks, Pam
2018-01-16
Now that construction is complete, DOE and construction contractor Parsons, are focusing on testing the Savannah River Siteâs Salt Waste Processing Facility (SWPF) systems and training the workforce to operate the plant in preparation for the start of operations. Once in operation, the SWPF will significantly increase processing rates at SRS tank farms in an effort to empty the siteâs high-level radioactive waste tanks.
Zahnd, Whitney E; Smith, Tracey; Ryherd, Susan J; Cleer, Melissa; Rogers, Valerie; Steward, David E
2017-06-01
Schools may be an effective avenue for interventions that prevent childhood obesity. I am Moving I am Learning/Choosy Kids © (IMIL/CK) is a curriculum recommended by Head Start (HS) for education in nutrition, physical activity, and healthy lifestyle habits. We formed an academic-community partnership (ACP), the Springfield Collaborative for Active Child Health, to promote prevention of childhood obesity, in part, to implement the IMIL/CK curriculum in local HS sites. The ACP included a medical school, HS program, public school district, and state health department. Community-based participatory research principles helped identify and organize important implementation activities: community engagement, curriculum support, professional teacher training, and evaluation. IMIL/CK was piloted in 1 school then implemented in all local HS sites. All sites were engaged in IMIL/CK professional teacher training, classroom curriculum delivery, and child physical activity assessments. Local HS policy changed to include IMIL/CK in lesson plans and additional avenues of collaboration were initiated. Furthermore, improvements in physical activity and/or maintenance or improvement of healthy weight prevalence was seen in 4 of the 5 years evaluated. An ACP is an effective vehicle to implement and evaluate childhood obesity prevention programming in HS sites. © 2017, American School Health Association.
Atmospheric chemistry: The return of ethane
NASA Astrophysics Data System (ADS)
Hakola, Hannele; Hellén, Heidi
2016-07-01
Ethane emissions can lead to ozone pollution. Measurements at 49 sites show that long-declining atmospheric ethane concentrations started rising in 2010 in the Northern Hemisphere, largely due to greater oil and gas production in the USA.
Eldon, Bjarki; Birkner, Matthias; Blath, Jochen; Freund, Fabian
2015-01-01
The ability of the site-frequency spectrum (SFS) to reflect the particularities of gene genealogies exhibiting multiple mergers of ancestral lines as opposed to those obtained in the presence of population growth is our focus. An excess of singletons is a well-known characteristic of both population growth and multiple mergers. Other aspects of the SFS, in particular, the weight of the right tail, are, however, affected in specific ways by the two model classes. Using an approximate likelihood method and minimum-distance statistics, our estimates of statistical power indicate that exponential and algebraic growth can indeed be distinguished from multiple-merger coalescents, even for moderate sample sizes, if the number of segregating sites is high enough. A normalized version of the SFS (nSFS) is also used as a summary statistic in an approximate Bayesian computation (ABC) approach. The results give further positive evidence as to the general eligibility of the SFS to distinguish between the different histories. PMID:25575536
Flood routing of the Maja outflow across Xanthe Terra
NASA Technical Reports Server (NTRS)
Dehon, R. A.
1991-01-01
The object is to trace a single flood crest through the Maja outflow system and to evaluate the effects of topography on ponding and multiple channel routing. Maja Valles provides a good model because it has a single source and a well defined channel system. The 1500 km long Maja Valles originates in Juventae Chasma. The outflow system stretches 1100 km northward along the Lunae Planum/Xanthe Terra boundary, then eastward across the Xanthe Terra highlands. It descends to Chryse Planitia where it extends northeastward toward the middle of the basin. It is concluded that flood routing through multiple channels and retardation in local impoundments are responsible for breakup of the initial flood crest and the formation of multiple flood crests. Recombined flow near the mouths of these canyons results in an extended flow regime and multiple flood surges. As a result of ponding along the flood course, depositional sites are localized and renewed erosion downstream (from ponded sites) results in sediment source areas not greatly removed from depositional sites.
Quantifying site-specific physical heterogeneity within an estuarine seascape
Kennedy, Cristina G.; Mather, Martha E.; Smith, Joseph M.
2017-01-01
Quantifying physical heterogeneity is essential for meaningful ecological research and effective resource management. Spatial patterns of multiple, co-occurring physical features are rarely quantified across a seascape because of methodological challenges. Here, we identified approaches that measured total site-specific heterogeneity, an often overlooked aspect of estuarine ecosystems. Specifically, we examined 23 metrics that quantified four types of common physical features: (1) river and creek confluences, (2) bathymetric variation including underwater drop-offs, (3) land features such as islands/sandbars, and (4) major underwater channel networks. Our research at 40 sites throughout Plum Island Estuary (PIE) provided solutions to two problems. The first problem was that individual metrics that measured heterogeneity of a single physical feature showed different regional patterns. We solved this first problem by combining multiple metrics for a single feature using a within-physical feature cluster analysis. With this approach, we identified sites with four different types of confluences and three different types of underwater drop-offs. The second problem was that when multiple physical features co-occurred, new patterns of total site-specific heterogeneity were created across the seascape. This pattern of total heterogeneity has potential ecological relevance to structure-oriented predators. To address this second problem, we identified sites with similar types of total physical heterogeneity using an across-physical feature cluster analysis. Then, we calculated an additive heterogeneity index, which integrated all physical features at a site. Finally, we tested if site-specific additive heterogeneity index values differed for across-physical feature clusters. In PIE, the sites with the highest additive heterogeneity index values were clustered together and corresponded to sites where a fish predator, adult striped bass (Morone saxatilis), aggregated in a related acoustic tracking study. In summary, we have shown general approaches to quantifying site-specific heterogeneity.
Antigen-specific therapy of Graves´ disease and orbitopathy by induction of tolerance.
Ungerer, Martin; Fabbender, Julia; Holthoff, Hans-Peter
2018-06-01
Graves´ disease is an autoimmune disorder, which is characterized by stimulatory antibodies targeting the human thyrotropin receptor (TSHR), resulting in hyperthyroidism and multiple organ damage. The disease can be modelled in mice using adenoviral immunizations with the extracellular A subunit of the TSHR, which induces a long-term stable disease state. TSHR binding cAMP-stimulatory antibodies, thyroid enlargement, elevated serum thyroxin levels, tachycardia, cardiac hypertrophy and orbitopathy are observed in these Ad-TSHR-immunized mice. T cell epitope-derived linear peptides have been identified using immunized HLA-DR3 transgenic mice, which may induce tolerance towards TSHR. A combination of such peptides are being investigated in a first clinical phase I trial in patients with Graves´ disease. Alternatively, intravenous administration of cyclic peptides derived from the interaction site of the TSHR A domain with stimulatory anti-TSHR antibodies can re-establish tolerance towards the antigen in immunized mice, improving symptoms of Graves´ disease within 3 - 4 months after starting these therapies. In immunologically naïve mice, administration of the cyclic peptides did not induce any immune response.
Enhancement of superexchange pairing in the periodically driven Hubbard model
NASA Astrophysics Data System (ADS)
Coulthard, J. R.; Clark, S. R.; Al-Assam, S.; Cavalleri, A.; Jaksch, D.
2017-08-01
Recent experiments performed on cuprates and alkali-doped fullerides have demonstrated that key signatures of superconductivity can be induced above the equilibrium critical temperature by optical modulation. These observations in disparate physical systems may indicate a general underlying mechanism. Multiple theories have been proposed, but these either consider specific features, such as competing instabilities, or focus on conventional BCS-type superconductivity. Here we show that periodic driving can enhance electron pairing in strongly correlated systems. Focusing on the strongly repulsive limit of the doped Hubbard model, we investigate in-gap, spatially inhomogeneous, on-site modulations. We demonstrate that such modulations substantially reduce electronic hopping, while simultaneously sustaining superexchange interactions and pair hopping via driving-induced virtual charge excitations. We calculate real-time dynamics for the one-dimensional case, starting from zero- and finite-temperature initial states, and we show that enhanced singlet-pair correlations emerge quickly and robustly in the out-of-equilibrium many-body state. Our results reveal a fundamental pairing mechanism that might underpin optically induced superconductivity in some strongly correlated quantum materials.
[Disseminated cryptococcosis in an immunocompetent patient].
Elkhihal, B; Hasnaoui, A; Ghfir, I; Moustachi, A; Aoufi, S; Lyagoubi, M
2015-09-01
Disseminated cryptococcosis is a serious opportunistic fungal infection caused by a yeast-encapsulated fungus of the genus Cryptococcus neoformans. It occurs most often in patients with a significant deficit of cellular immunity and preferentially affects the central nervous system. The skin and the lungs are the most commonly affected sites outside the neuro-subarachnoid location. We report the case of a patient apparently immunocompetent who had a disseminated cryptococcosis. The disease started with the multiple purplish skin lesions, large umbilicated on the face, groin, forearm and leg with progressively increasing volume. This symptomatology had evolved in the context of weight loss and poor general condition. The diagnosis was established by the presence of cryptococcal at the skin biopsy and cerebrospinal fluid. Research of immunosuppression common pathologies were negative. Treatment was initiated based on amphotericin B for 40 days. The patient's condition deteriorates onset of paraplegia and swallowing disorders causing death in an array of cachexia. This observation points out that disseminated cryptococcosis can occur in an immunocompetent patient. The skin lesions may be the first sign of the disease. Copyright © 2015. Published by Elsevier Masson SAS.
Gaji, Rajshekhar Y; Howe, Daniel K
2009-07-01
The apicomplexan parasite Sarcocystis neurona undergoes a complex process of intracellular development, during which many genes are temporally regulated. The described study was undertaken to begin identifying the basic promoter elements that control gene expression in S. neurona. Sequence analysis of the 5'-flanking region of five S. neurona genes revealed a conserved heptanucleotide motif GAGACGC that is similar to the WGAGACG motif described upstream of multiple genes in Toxoplasma gondii. The promoter region for the major surface antigen gene SnSAG1, which contains three heptanucleotide motifs within 135 bases of the transcription start site, was dissected by functional analysis using a dual luciferase reporter assay. These analyses revealed that a minimal promoter fragment containing all three motifs was sufficient to drive reporter molecule expression, with the presence and orientation of the 5'-most heptanucleotide motif being absolutely critical for promoter function. Further studies should help to identify additional sequence elements important for promoter function and for controlling gene expression during intracellular development by this apicomplexan pathogen.
Advance Resource Provisioning in Bulk Data Scheduling
DOE Office of Scientific and Technical Information (OSTI.GOV)
Balman, Mehmet
2012-10-01
Today?s scientific and business applications generate mas- sive data sets that need to be transferred to remote sites for sharing, processing, and long term storage. Because of increasing data volumes and enhancement in current net- work technology that provide on-demand high-speed data access between collaborating institutions, data handling and scheduling problems have reached a new scale. In this paper, we present a new data scheduling model with ad- vance resource provisioning, in which data movement operations are defined with earliest start and latest comple- tion times. We analyze time-dependent resource assign- ment problem, and propose a new methodology to improvemore » the current systems by allowing researchers and higher-level meta-schedulers to use data-placement as-a-service, so they can plan ahead and submit transfer requests in advance. In general, scheduling with time and resource conflicts is NP-hard. We introduce an efficient algorithm to organize multiple requests on the fly, while satisfying users? time and resource constraints. We successfully tested our algorithm in a simple benchmark simulator that we have developed, and demonstrated its performance with initial test results.« less
MacAlpine, Heather K.; Lubelsky, Yoav; Hartemink, Alexander J.
2015-01-01
Start sites of DNA replication are marked by the origin recognition complex (ORC), which coordinates Mcm2–7 helicase loading to form the prereplicative complex (pre-RC). Although pre-RC assembly is well characterized in vitro, the process is poorly understood within the local chromatin environment surrounding replication origins. To reveal how the chromatin architecture modulates origin selection and activation, we “footprinted” nucleosomes, transcription factors, and replication proteins at multiple points during the Saccharomyces cerevisiae cell cycle. Our nucleotide-resolution protein occupancy profiles resolved a precise ORC-dependent footprint at 269 origins in G2. A separate class of inefficient origins exhibited protein occupancy only in G1, suggesting that stable ORC chromatin association in G2 is a determinant of origin efficiency. G1 nucleosome remodeling concomitant with pre-RC assembly expanded the origin nucleosome-free region and enhanced activation efficiency. Finally, the local chromatin environment restricts the loading of the Mcm2–7 double hexamer either upstream of or downstream from the ARS consensus sequence (ACS). PMID:25593310
Multi-Harmony: detecting functional specificity from sequence alignment
Brandt, Bernd W.; Feenstra, K. Anton; Heringa, Jaap
2010-01-01
Many protein families contain sub-families with functional specialization, such as binding different ligands or being involved in different protein–protein interactions. A small number of amino acids generally determine functional specificity. The identification of these residues can aid the understanding of protein function and help finding targets for experimental analysis. Here, we present multi-Harmony, an interactive web sever for detecting sub-type-specific sites in proteins starting from a multiple sequence alignment. Combining our Sequence Harmony (SH) and multi-Relief (mR) methods in one web server allows simultaneous analysis and comparison of specificity residues; furthermore, both methods have been significantly improved and extended. SH has been extended to cope with more than two sub-groups. mR has been changed from a sampling implementation to a deterministic one, making it more consistent and user friendly. For both methods Z-scores are reported. The multi-Harmony web server produces a dynamic output page, which includes interactive connections to the Jalview and Jmol applets, thereby allowing interactive analysis of the results. Multi-Harmony is available at http://www.ibi.vu.nl/ programs/shmrwww. PMID:20525785
LWD-TCP complex activates the morning gene CCA1 in Arabidopsis.
Wu, Jing-Fen; Tsai, Huang-Lung; Joanito, Ignasius; Wu, Yi-Chen; Chang, Chin-Wen; Li, Yi-Hang; Wang, Ying; Hong, Jong Chan; Chu, Jhih-Wei; Hsu, Chao-Ping; Wu, Shu-Hsing
2016-10-13
A double-negative feedback loop formed by the morning genes CIRCADIAN CLOCK ASSOCIATED1 (CCA1)/LATE ELONGATED HYPOCOTYL (LHY) and the evening gene TIMING OF CAB EXPRESSION1 (TOC1) contributes to regulation of the circadian clock in Arabidopsis. A 24-h circadian cycle starts with the peak expression of CCA1 at dawn. Although CCA1 is targeted by multiple transcriptional repressors, including PSEUDO-RESPONSE REGULATOR9 (PRR9), PRR7, PRR5 and CCA1 HIKING EXPEDITION (CHE), activators of CCA1 remain elusive. Here we use mathematical modelling to infer a co-activator role for LIGHT-REGULATED WD1 (LWD1) in CCA1 expression. We show that the TEOSINTE BRANCHED 1-CYCLOIDEA-PCF20 (TCP20) and TCP22 proteins act as LWD-interacting transcriptional activators. The concomitant binding of LWD1 and TCP20/TCP22 to the TCP-binding site in the CCA1 promoter activates CCA1. Our study reveals activators of the morning gene CCA1 and provides an action mechanism that ensures elevated expression of CCA1 at dawn to sustain a robust clock.
LWD–TCP complex activates the morning gene CCA1 in Arabidopsis
Wu, Jing-Fen; Tsai, Huang-Lung; Joanito, Ignasius; Wu, Yi-Chen; Chang, Chin-Wen; Li, Yi-Hang; Wang, Ying; Hong, Jong Chan; Chu, Jhih-Wei; Hsu, Chao-Ping; Wu, Shu-Hsing
2016-01-01
A double-negative feedback loop formed by the morning genes CIRCADIAN CLOCK ASSOCIATED1 (CCA1)/LATE ELONGATED HYPOCOTYL (LHY) and the evening gene TIMING OF CAB EXPRESSION1 (TOC1) contributes to regulation of the circadian clock in Arabidopsis. A 24-h circadian cycle starts with the peak expression of CCA1 at dawn. Although CCA1 is targeted by multiple transcriptional repressors, including PSEUDO-RESPONSE REGULATOR9 (PRR9), PRR7, PRR5 and CCA1 HIKING EXPEDITION (CHE), activators of CCA1 remain elusive. Here we use mathematical modelling to infer a co-activator role for LIGHT-REGULATED WD1 (LWD1) in CCA1 expression. We show that the TEOSINTE BRANCHED 1-CYCLOIDEA-PCF20 (TCP20) and TCP22 proteins act as LWD-interacting transcriptional activators. The concomitant binding of LWD1 and TCP20/TCP22 to the TCP-binding site in the CCA1 promoter activates CCA1. Our study reveals activators of the morning gene CCA1 and provides an action mechanism that ensures elevated expression of CCA1 at dawn to sustain a robust clock. PMID:27734958
NASA Technical Reports Server (NTRS)
Ledbetter, Kenneth W.
1992-01-01
Four trends in spacecraft flight operations are discussed which will reduce overall program costs. These trends are the use of high-speed, highly reliable data communications systems for distributing operations functions to more convenient and cost-effective sites; the improved capability for remote operation of sensors; a continued rapid increase in memory and processing speed of flight qualified computer chips; and increasingly capable ground-based hardware and software systems, notably those augmented by artificial intelligence functions. Changes reflected by these trends are reviewed starting from the NASA Viking missions of the early 70s, when mission control was conducted at one location using expensive and cumbersome mainframe computers and communications equipment. In the 1980s, powerful desktop computers and modems enabled the Magellan project team to operate the spacecraft remotely. In the 1990s, the Hubble Space Telescope project uses multiple color screens and automated sequencing software on small computers. Given a projection of current capabilities, future control centers will be even more cost-effective.
Comparison of Spectral Characteristic between LAPAN-A3 and Sentinel-2A
NASA Astrophysics Data System (ADS)
Zylshal, Z.; Sari, N. M.; Nugroho, J. T.; Kushardono, D.
2017-12-01
Indonesian National Institute of Aeronautics and Space (LAPAN) started building its experimental microsatellite back in 2007 and finally able to launch its first microsatellite dubbed as LAPAN-A1/LAPAN-Tubsat. With the launch of LAPAN-A3/LAPAN-IPB, Indonesian experimental satellite programme hit its third generation. LAPAN-A3 is carrying multiple payloads including multispectral push-broom imager, digital matrix camera, as well as video camera. This paper aims to highlight the spectral differences between LAPAN-A3 and the well-established Sentinel-2A multispectral to investigate the potential of using LAPAN-A3 data to complement the other well-established medium resolution satellite data. Comparisons between corresponding bands and band transformations were performed over a dataset. Three areas of interest were chosen as the test sites. Linear regression and Pearson correlation coefficient were then calculated between the corresponding bands. The preliminary results showed a moderate correlation between the two sensors with Pearson correlation coefficient ranging from 0.39 to 0.65. Some issues were found regarding the radiometric quality over the whole scene of LAPAN-A3.
NASA Astrophysics Data System (ADS)
Heidrich-Meisner, Fabian; Pollet, Lode; Sorg, Stefan; Vidmar, Lev
2015-03-01
We study the relaxation dynamics and thermalization in the one-dimensional Bose-Hubbard model induced by a global interaction quench. Specifically, we start from an initial state that has exactly one boson per site and is the ground state of a system with infinitely strong repulsive interactions at unit filling. The same interaction quench was realized in a recent experiment. Using exact diagonalization and the density-matrix renormalization-group method, we compute the time dependence of such observables as the multiple occupancy and the momentum distribution function. We discuss our numerical results in the framework of the eigenstate thermalization hypothesis and we observe that the microcanonical ensemble describes the time averages of many observables reasonably well for small and intermediate interaction strength. Moreover, the diagonal and the canonical ensembles are practically identical for our initial conditions already on the level of their respective energy distributions for small interaction strengths. Supported by the DFG through FOR 801 and the Alexander von Humboldt foundation.
NASA Astrophysics Data System (ADS)
An Heyvaert, Vanessa Mary; Baeteman, Cecile
2008-12-01
Geoarchaeological research was performed to reconstruct the floodplain history in the surroundings of two ancient Mesopotamian cities: Tell ed-Dēr and Sippar. The mapping of the floodplain is based on facies analyses of the sedimentary succession of 225 hand-operated boreholes. The archaeological sites Tell ed-Dēr and Sippar are closely linked to a palaeochannelbelt of the Euphrates, located in the western part of the study area. Channel activity started at least in ca 3100 BC/5050 cal BP, until ca 1400-1000 BC/3350-2950 cal BP. The channel belt was part of an avulsion driven multiple Euphrates channel network that gradually became abandoned from the second half of the 2nd millennium BC. A second mapped Euphrates, Tigris or Joint Euphrates -Tigris palaeochannel belt became abandoned well before 3100 BC. Examples of natural processes as well as human interactions triggering avulsion are given. Moreover, textual, archaeological and geological data show clearly that flood-control techniques and the construction of large-scale dikes seemed to be a common practice.
Tail reconnection in the global magnetospheric context: Vlasiator first results
NASA Astrophysics Data System (ADS)
Palmroth, Minna; Hoilijoki, Sanni; Juusola, Liisa; Pulkkinen, Tuija I.; Hietala, Heli; Pfau-Kempf, Yann; Ganse, Urs; von Alfthan, Sebastian; Vainio, Rami; Hesse, Michael
2017-11-01
The key dynamics of the magnetotail have been researched for decades and have been associated with either three-dimensional (3-D) plasma instabilities and/or magnetic reconnection. We apply a global hybrid-Vlasov code, Vlasiator, to simulate reconnection self-consistently in the ion kinetic scales in the noon-midnight meridional plane, including both dayside and nightside reconnection regions within the same simulation box. Our simulation represents a numerical experiment, which turns off the 3-D instabilities but models ion-scale reconnection physically accurately in 2-D. We demonstrate that many known tail dynamics are present in the simulation without a full description of 3-D instabilities or without the detailed description of the electrons. While multiple reconnection sites can coexist in the plasma sheet, one reconnection point can start a global reconfiguration process, in which magnetic field lines become detached and a plasmoid is released. As the simulation run features temporally steady solar wind input, this global reconfiguration is not associated with sudden changes in the solar wind. Further, we show that lobe density variations originating from dayside reconnection may play an important role in stabilising tail reconnection.
Multiple Smaller Missions as a Direct Pathway to Mars Sample Return
NASA Technical Reports Server (NTRS)
Niles, P. B.; Draper, D. S.; Evans, C. A.; Gibson, E. K.; Graham, L. D.; Jones, J. H.; Lederer, S. M.; Ming, D.; Seaman, C. H.; Archer, P. D.;
2012-01-01
Recent discoveries by the Mars Exploration Rovers, Mars Express, Mars Odyssey, and Mars Reconnaissance Orbiter spacecraft include multiple, tantalizing astrobiological targets representing both past and present environments on Mars. The most desirable path to Mars Sample Return (MSR) would be to collect and return samples from that site which provides the clearest examples of the variety of rock types considered a high priority for sample return (pristine igneous, sedimentary, and hydrothermal). Here we propose an MSR architecture in which the next steps (potentially launched in 2018) would entail a series of smaller missions, including caching, to multiple landing sites to verify the presence of high priority sample return targets through in situ analyses. This alternative architecture to one flagship-class sample caching mission to a single site would preserve a direct path to MSR as stipulated by the Planetary Decadal Survey, while permitting investigation of diverse deposit types and providing comparison of the site of returned samples to other aqueous environments on early Mars
Wade, S.; Greenberg, S.
2009-01-01
This paper introduces the concept of social site characterization as a parallel effort to technical site characterization to be used in evaluating and planning carbon dioxides capture and storage (CCS) projects. Social site characterization, much like technical site characterization, relies on a series of iterative investigations into public attitudes towards a CCS project and the factors that will shape those views. This paper also suggests ways it can be used to design approaches for actively engaging stakeholders and communities in the deployment of CCS projects. This work is informed by observing the site selection process for FutureGen and the implementation of research projects under the Regional Carbon Sequestration Partnership Program. ?? 2009 Elsevier Ltd. All rights reserved.
Bare, J Christopher; Shannon, Paul T; Schmid, Amy K; Baliga, Nitin S
2007-01-01
Background Information resources on the World Wide Web play an indispensable role in modern biology. But integrating data from multiple sources is often encumbered by the need to reformat data files, convert between naming systems, or perform ongoing maintenance of local copies of public databases. Opportunities for new ways of combining and re-using data are arising as a result of the increasing use of web protocols to transmit structured data. Results The Firegoose, an extension to the Mozilla Firefox web browser, enables data transfer between web sites and desktop tools. As a component of the Gaggle integration framework, Firegoose can also exchange data with Cytoscape, the R statistical package, Multiexperiment Viewer (MeV), and several other popular desktop software tools. Firegoose adds the capability to easily use local data to query KEGG, EMBL STRING, DAVID, and other widely-used bioinformatics web sites. Query results from these web sites can be transferred to desktop tools for further analysis with a few clicks. Firegoose acquires data from the web by screen scraping, microformats, embedded XML, or web services. We define a microformat, which allows structured information compatible with the Gaggle to be embedded in HTML documents. We demonstrate the capabilities of this software by performing an analysis of the genes activated in the microbe Halobacterium salinarum NRC-1 in response to anaerobic environments. Starting with microarray data, we explore functions of differentially expressed genes by combining data from several public web resources and construct an integrated view of the cellular processes involved. Conclusion The Firegoose incorporates Mozilla Firefox into the Gaggle environment and enables interactive sharing of data between diverse web resources and desktop software tools without maintaining local copies. Additional web sites can be incorporated easily into the framework using the scripting platform of the Firefox browser. Performing data integration in the browser allows the excellent search and navigation capabilities of the browser to be used in combination with powerful desktop tools. PMID:18021453
Stakeholder involvement for management of the coastal zone.
Oen, Amy Mp; Bouma, Geiske M; Botelho, Maria; Pereira, Patrícia; Haeger-Eugensson, Marie; Conides, Alexis; Przedrzymirska, Joanna; Isaksson, Ingela; Wolf, Christina; Breedveld, Gijs D; Slob, Adriaan
2016-10-01
The European Union (EU) has taken the lead to promote the management of coastal systems. Management strategies are implemented by the Water Framework Directive (WFD) and the Marine Strategy Framework Directive (MSFD), as well as the recent Maritime Spatial Planning (MSP) Directive. Most EU directives have a strong focus on public participation; however, a recent review found that the actual involvement of stakeholders was variable. The "Architecture and roadmap to manage multiple pressures on lagoons" (ARCH) research project has developed and implemented participative methodologies at different case study sites throughout Europe. These cases represent a broad range of coastal systems, and they highlight different legislative frameworks that are relevant for coastal zone management. Stakeholder participation processes were subsequently evaluated at 3 case study sites in order to assess the actual implementation of participation in the context of their respective legislative frameworks: 1) Byfjorden in Bergen, Norway, in the context of the WFD; 2) Amvrakikos Gulf, Greece, in the context of the MSFD; and 3) Nordre Älv Estuary, Sweden, in the context of the MSP Directive. An overall assessment of the evaluation criteria indicates that the ARCH workshop series methodology of focusing first on the current status of the lagoon or estuary, then on future challenges, and finally on identifying management solutions provided a platform that was conducive for stakeholder participation. Results suggest that key criteria for a good participatory process were present and above average at the 3 case study sites. The results also indicate that the active engagement that was initiated at the 3 case study sites has led to capacity building among the participants, which is an important intermediary outcome of public participation. A strong connection between participatory processes and policy can ensure the legacy of the intermediary outcomes, which is an important and necessary start toward more permanent resource management outcomes such as ecological and economic improvement. Integr Environ Assess Manag 2016;12:701-710. © 2016 SETAC. © 2016 SETAC.
Fernando, Malindu E.; Crowther, Robert G.; Lazzarini, Peter A.; Yogakanthi, Saiumaeswar; Sangla, Kunwarjit S.; Buttner, Petra; Jones, Rhondda; Golledge, Jonathan
2017-01-01
Objective High plantar pressures are implicated in the development of diabetes-related foot ulcers. Whether plantar pressures remain high in patients with chronic diabetes-related foot ulcers over time is uncertain. The primary aim of this study was to compare plantar pressures at baseline and three and six months later in participants with chronic diabetes-related foot ulcers (cases) to participants without foot ulcers (controls). Methods Standardised protocols were used to measure mean peak plantar pressure and pressure-time integral at 10 plantar foot sites (the hallux, toes, metatarsals 1 to 5, mid-foot, medial heel and lateral heel) during barefoot walking. Measurements were performed at three study visits: baseline, three and six months. Linear mixed effects random-intercept models were utilised to assess whether plantar pressures differed between cases and controls after adjusting for age, sex, body mass index, neuropathy status and follow-up time. Standardised mean differences (Cohen’s d) were used to measure effect size. Results Twenty-one cases and 69 controls started the study and 16 cases and 63 controls completed the study. Cases had a higher mean peak plantar pressure at several foot sites including the toes (p = 0.005, Cohen’s d = 0.36) and mid-foot (p = 0.01, d = 0.36) and a higher pressure-time integral at the hallux (p<0.001, d = 0.42), metatarsal 1 (p = 0.02, d = 0.33) and mid-foot (p = 0.04, d = 0.64) compared to controls throughout follow-up. A reduction in pressure-time integral at multiple plantar sites over time was detected in all participants (p<0.05, respectively). Conclusions Plantar pressures assessed during gait are higher in diabetes patients with chronic foot ulcers than controls at several plantar sites throughout prolonged follow-up. Long term offloading is needed in diabetes patients with diabetes-related foot ulcers to facilitate ulcer healing. PMID:28859075
Bare, J Christopher; Shannon, Paul T; Schmid, Amy K; Baliga, Nitin S
2007-11-19
Information resources on the World Wide Web play an indispensable role in modern biology. But integrating data from multiple sources is often encumbered by the need to reformat data files, convert between naming systems, or perform ongoing maintenance of local copies of public databases. Opportunities for new ways of combining and re-using data are arising as a result of the increasing use of web protocols to transmit structured data. The Firegoose, an extension to the Mozilla Firefox web browser, enables data transfer between web sites and desktop tools. As a component of the Gaggle integration framework, Firegoose can also exchange data with Cytoscape, the R statistical package, Multiexperiment Viewer (MeV), and several other popular desktop software tools. Firegoose adds the capability to easily use local data to query KEGG, EMBL STRING, DAVID, and other widely-used bioinformatics web sites. Query results from these web sites can be transferred to desktop tools for further analysis with a few clicks. Firegoose acquires data from the web by screen scraping, microformats, embedded XML, or web services. We define a microformat, which allows structured information compatible with the Gaggle to be embedded in HTML documents. We demonstrate the capabilities of this software by performing an analysis of the genes activated in the microbe Halobacterium salinarum NRC-1 in response to anaerobic environments. Starting with microarray data, we explore functions of differentially expressed genes by combining data from several public web resources and construct an integrated view of the cellular processes involved. The Firegoose incorporates Mozilla Firefox into the Gaggle environment and enables interactive sharing of data between diverse web resources and desktop software tools without maintaining local copies. Additional web sites can be incorporated easily into the framework using the scripting platform of the Firefox browser. Performing data integration in the browser allows the excellent search and navigation capabilities of the browser to be used in combination with powerful desktop tools.
Effective Population Size Dynamics and the Demographic Collapse of Bornean Orang-Utans
Goossens, Benoit; Nater, Alexander; Morf, Nadja; Salmona, Jordi; Bruford, Michael W.; Van Schaik, Carel P.; Krützen, Michael; Chikhi, Lounès
2012-01-01
Bornean orang-utans experienced a major demographic decline and local extirpations during the Pleistocene and Holocene due to climate change, the arrival of modern humans, of farmers and recent commercially-driven habitat loss and fragmentation. The recent loss of habitat and its dramatic fragmentation has affected the patterns of genetic variability and differentiation among the remaining populations and increased the extinction risk of the most isolated ones. However, the contribution of recent demographic events to such genetic patterns is still not fully clear. Indeed, it can be difficult to separate the effects of recent anthropogenic fragmentation from the genetic signature of prehistoric demographic events. Here, we investigated the genetic structure and population size dynamics of orang-utans from different sites. Altogether 126 individuals were analyzed and a full-likelihood Bayesian approach was applied. All sites exhibited clear signals of population decline. Population structure is known to generate spurious bottleneck signals and we found that it does indeed contribute to the signals observed. However, population structure alone does not easily explain the observed patterns. The dating of the population decline varied across sites but was always within the 200–2000 years period. This suggests that in some sites at least, orang-utan populations were affected by demographic events that started before the recent anthropogenic effects that occurred in Borneo. These results do not mean that the recent forest exploitation did not leave its genetic mark on orang-utans but suggests that the genetic pool of orang-utans is also impacted by more ancient events. While we cannot identify the main cause for this decline, our results suggests that the decline may be related to the arrival of the first farmers or climatic events, and that more theoretical work is needed to understand how multiple demographic events impact the genome of species and how we can assess their relative contributions. PMID:23166666