Sample records for multiple upstream elements

  1. Identification of novel craniofacial regulatory domains located far upstream of SOX9 and disrupted in Pierre Robin sequence

    PubMed Central

    Gordon, Christopher T.; Attanasio, Catia; Bhatia, Shipra; Benko, Sabina; Ansari, Morad; Tan, Tiong Y.; Munnich, Arnold; Pennacchio, Len A.; Abadie, Véronique; Temple, I. Karen; Goldenberg, Alice; van Heyningen, Veronica; Amiel, Jeanne; FitzPatrick, David; Kleinjan, Dirk A.; Visel, Axel; Lyonnet, Stanislas

    2015-01-01

    Mutations in the coding sequence of SOX9 cause campomelic dysplasia (CD), a disorder of skeletal development associated with 46,XY disorders of sex development (DSDs). Translocations, deletions and duplications within a ~2 Mb region upstream of SOX9 can recapitulate the CD-DSD phenotype fully or partially, suggesting the existence of an unusually large cis-regulatory control region. Pierre Robin sequence (PRS) is a craniofacial disorder that is frequently an endophenotype of CD and a locus for isolated PRS at ~1.2-1.5 Mb upstream of SOX9 has been previously reported. The craniofacial regulatory potential within this locus, and within the greater genomic domain surrounding SOX9, remains poorly defined. We report two novel deletions upstream of SOX9 in families with PRS, allowing refinement of the regions harbouring candidate craniofacial regulatory elements. In parallel, ChIP-Seq for p300 binding sites in mouse craniofacial tissue led to the identification of several novel craniofacial enhancers at the SOX9 locus, which were validated in transgenic reporter mice and zebrafish. Notably, some of the functionally validated elements fall within the PRS deletions. These studies suggest that multiple non-coding elements contribute to the craniofacial regulation of SOX9 expression, and that their disruption results in PRS. PMID:24934569

  2. Low exhaust temperature electrically heated particulate matter filter system

    DOEpatents

    Gonze, Eugene V [Pinckney, MI; Paratore, Jr., Michael J.; Bhatia, Garima [Bangalore, IN

    2012-02-14

    A system includes a particulate matter (PM) filter, a sensor, a heating element, and a control module. The PM filter includes with an upstream end that receives exhaust gas, a downstream end and multiple zones. The sensor detects a temperature of the exhaust gas. The control module controls current to the heating element to convection heat one of the zones and initiate a regeneration process. The control module selectively increases current to the heating element relative to a reference regeneration current level when the temperature is less than a predetermined temperature.

  3. Absence of mutation at the 5'-upstream promoter region of the TPM4 gene from cardiac mutant axolotl (Ambystoma mexicanum).

    PubMed

    Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K

    2011-09-01

    Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.

  4. The muscle creatine kinase gene is regulated by multiple upstream elements, including a muscle-specific enhancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jaynes, J.B.; Johnson, J.E.; Buskin, J.N.

    1988-01-01

    Muscle creatine kinase (MCK) is induced to high levels during skeletal muscle differentiation. The authors examined the upstream regulatory elements of the mouse MCK gene which specify its activation during myogenesis in culture. Fusion genes containing up to 3,300 nucleotides (nt) of MCK 5' flanking DNA in various positions and orientations relative to the bacterial chloramphenicol acetyltransferase (CAT) structural gene were transfected into cultured cells. Transient expression of CAT was compared between proliferating and differentiated MM14 mouse myoblasts and with nonmyogenic mouse L cells. The major effector of high-level expression was found to have the properties of a transcriptional enhancer.more » This element, located between 1,050 and 1,256 nt upstream of the transcription start site, was also found to have a major influence on the tissue and differentiation specificity of MCK expression; it activated either the MCK promoter or heterologous promoters only in differentiated muscle cells. Comparisons of viral and cellular enhancer sequences with the MCK enhancer revealed some similarities to essential regions of the simian virus 40 enhancer as well as to a region of the immunoglobulin heavy-chain enhancer, which has been implicated in tissue-specific protein binding. Even in the absence of the enhancer, low-level expression from a 776-nt MCK promoter retained differentiation specificity. In addition to positive regulatory elements, our data provide some evidence for negative regulatory elements with activity in myoblasts. These may contribute to the cell type and differentiation specificity of MCK expression.« less

  5. Identification of the first PAR1 deletion encompassing upstream SHOX enhancers in a family with idiopathic short stature.

    PubMed

    Benito-Sanz, Sara; Aza-Carmona, Miriam; Rodríguez-Estevez, Amaya; Rica-Etxebarria, Ixaso; Gracia, Ricardo; Campos-Barros, Angel; Heath, Karen E

    2012-01-01

    Short stature homeobox-containing gene, MIM 312865 (SHOX) is located within the pseudoautosomal region 1 (PAR1) of the sex chromosomes. Mutations in SHOX or its downstream transcriptional regulatory elements represent the underlying molecular defect in ~60% of Léri-Weill dyschondrosteosis (LWD) and ~5-15% of idiopathic short stature (ISS) patients. Recently, three novel enhancer elements have been identified upstream of SHOX but to date, no PAR1 deletions upstream of SHOX have been observed that only encompass these enhancers in LWD or ISS patients. We set out to search for genetic alterations of the upstream SHOX regulatory elements in 63 LWD and 100 ISS patients with no known alteration in SHOX or the downstream enhancer regions using a specifically designed MLPA assay, which covers the PAR1 upstream of SHOX. An upstream SHOX deletion was identified in an ISS proband and her affected father. The deletion was confirmed and delimited by array-CGH, to extend ~286 kb. The deletion included two of the upstream SHOX enhancers without affecting SHOX. The 13.3-year-old proband had proportionate short stature with normal GH and IGF-I levels. In conclusion, we have identified the first PAR1 deletion encompassing only the upstream SHOX transcription regulatory elements in a family with ISS. The loss of these elements may result in SHOX haploinsufficiency because of decreased SHOX transcription. Therefore, this upstream region should be included in the routine analysis of PAR1 in patients with LWD, LMD and ISS.

  6. Identification of the first PAR1 deletion encompassing upstream SHOX enhancers in a family with idiopathic short stature

    PubMed Central

    Benito-Sanz, Sara; Aza-Carmona, Miriam; Rodríguez-Estevez, Amaya; Rica-Etxebarria, Ixaso; Gracia, Ricardo; Campos-Barros, Ángel; Heath, Karen E

    2012-01-01

    Short stature homeobox-containing gene, MIM 312865 (SHOX) is located within the pseudoautosomal region 1 (PAR1) of the sex chromosomes. Mutations in SHOX or its downstream transcriptional regulatory elements represent the underlying molecular defect in ∼60% of Léri-Weill dyschondrosteosis (LWD) and ∼5–15% of idiopathic short stature (ISS) patients. Recently, three novel enhancer elements have been identified upstream of SHOX but to date, no PAR1 deletions upstream of SHOX have been observed that only encompass these enhancers in LWD or ISS patients. We set out to search for genetic alterations of the upstream SHOX regulatory elements in 63 LWD and 100 ISS patients with no known alteration in SHOX or the downstream enhancer regions using a specifically designed MLPA assay, which covers the PAR1 upstream of SHOX. An upstream SHOX deletion was identified in an ISS proband and her affected father. The deletion was confirmed and delimited by array-CGH, to extend ∼286 kb. The deletion included two of the upstream SHOX enhancers without affecting SHOX. The 13.3-year-old proband had proportionate short stature with normal GH and IGF-I levels. In conclusion, we have identified the first PAR1 deletion encompassing only the upstream SHOX transcription regulatory elements in a family with ISS. The loss of these elements may result in SHOX haploinsufficiency because of decreased SHOX transcription. Therefore, this upstream region should be included in the routine analysis of PAR1 in patients with LWD, LMD and ISS. PMID:22071895

  7. Both positive and negative regulatory elements mediate expression of a photoregulated CAB gene from Nicotiana plumbaginifolia.

    PubMed Central

    Castresana, C; Garcia-Luque, I; Alonso, E; Malik, V S; Cashmore, A R

    1988-01-01

    We have analyzed promoter regulatory elements from a photoregulated CAB gene (Cab-E) isolated from Nicotiana plumbaginifolia. These studies have been performed by introducing chimeric gene constructs into tobacco cells via Agrobacterium tumefaciens-mediated transformation. Expression studies on the regenerated transgenic plants have allowed us to characterize three positive and one negative cis-acting elements that influence photoregulated expression of the Cab-E gene. Within the upstream sequences we have identified two positive regulatory elements (PRE1 and PRE2) which confer maximum levels of photoregulated expression. These sequences contain multiple repeated elements related to the sequence-ACCGGCCCACTT-. We have also identified within the upstream region a negative regulatory element (NRE) extremely rich in AT sequences, which reduces the level of gene expression in the light. We have defined a light regulatory element (LRE) within the promoter region extending from -396 to -186 bp which confers photoregulated expression when fused to a constitutive nopaline synthase ('nos') promoter. Within this region there is a 132-bp element, extending from -368 to -234 bp, which on deletion from the Cab-E promoter reduces gene expression from high levels to undetectable levels. Finally, we have demonstrated for a full length Cab-E promoter conferring high levels of photoregulated expression, that sequences proximal to the Cab-E TATA box are not replaceable by corresponding sequences from a 'nos' promoter. This contrasts with the apparent equivalence of these Cab-E and 'nos' TATA box-proximal sequences in truncated promoters conferring low levels of photoregulated expression. Images PMID:2901343

  8. Activation of HIV-1 pre-mRNA 3' processing in vitro requires both an upstream element and TAR.

    PubMed Central

    Gilmartin, G M; Fleming, E S; Oetjen, J

    1992-01-01

    The architecture of the human immunodeficiency virus type 1 (HIV-1) genome presents an intriguing dilemma for the 3' processing of viral transcripts--to disregard a canonical 'core' poly(A) site processing signal present at the 5' end of the transcript and yet to utilize efficiently an identical signal that resides at the 3' end of the message. The choice of processing sites in HIV-1 appears to be influenced by two factors: (i) proximity to the cap site, and (ii) sequences upstream of the core poly(A) site. We now demonstrate that an in vivo-defined upstream element that resides within the U3 region, 76 nucleotides upstream of the AAUAAA hexamer, acts specifically to enhance 3' processing at the HIV-1 core poly(A) site in vitro. We furthermore show that efficient in vitro 3' processing requires the RNA stem-loop structure of TAR, which serves to juxtapose spatially the upstream element and the core poly(A) site. An analysis of the stability of 3' processing complexes formed at the HIV-1 poly(A) site in vitro suggests that the upstream element may function by increasing processing complex stability at the core poly(A) site. Images PMID:1425577

  9. Potential Novel Mechanism for Axenfeld-Rieger Syndrome: Deletion of a Distant Region Containing Regulatory Elements of PITX2

    PubMed Central

    Volkmann, Bethany A.; Zinkevich, Natalya S.; Mustonen, Aki; Schilter, Kala F.; Bosenko, Dmitry V.; Reis, Linda M.; Broeckel, Ulrich; Link, Brian A.

    2011-01-01

    Purpose. Mutations in PITX2 are associated with Axenfeld-Rieger syndrome (ARS), which involves ocular, dental, and umbilical abnormalities. Identification of cis-regulatory elements of PITX2 is important to better understand the mechanisms of disease. Methods. Conserved noncoding elements surrounding PITX2/pitx2 were identified and examined through transgenic analysis in zebrafish; expression pattern was studied by in situ hybridization. Patient samples were screened for deletion/duplication of the PITX2 upstream region using arrays and probes. Results. Zebrafish pitx2 demonstrates conserved expression during ocular and craniofacial development. Thirteen conserved noncoding sequences positioned within a gene desert as far as 1.1 Mb upstream of the human PITX2 gene were identified; 11 have enhancer activities consistent with pitx2 expression. Ten elements mediated expression in the developing brain, four regions were active during eye formation, and two sequences were associated with craniofacial expression. One region, CE4, located approximately 111 kb upstream of PITX2, directed a complex pattern including expression in the developing eye and craniofacial region, the classic sites affected in ARS. Screening of ARS patients identified an approximately 7600-kb deletion that began 106 to 108 kb upstream of the PITX2 gene, leaving PITX2 intact while removing regulatory elements CE4 to CE13. Conclusions. These data suggest the presence of a complex distant regulatory matrix within the gene desert located upstream of PITX2 with an essential role in its activity and provides a possible mechanism for the previous reports of ARS in patients with balanced translocations involving the 4q25 region upstream of PITX2 and the current patient with an upstream deletion. PMID:20881290

  10. Multiple enhancers located in a 1-Mb region upstream of POU3F4 promote expression during inner ear development and may be required for hearing

    PubMed Central

    Naranjo, Silvia; Voesenek, Krysta; de la Calle-Mustienes, Elisa; Robert-Moreno, Alex; Kokotas, Haris; Grigoriadou, Maria; Economides, John; Van Camp, Guy; Hilgert, Nele; Moreno, Felipe; Alsina, Berta; Petersen, Michael B.; Kremer, Hannie

    2010-01-01

    POU3F4 encodes a POU-domain transcription factor required for inner ear development. Defects in POU3F4 function are associated with X-linked deafness type 3 (DFN3). Multiple deletions affecting up to ~900-kb upstream of POU3F4 are found in DFN3 patients, suggesting the presence of essential POU3F4 enhancers in this region. Recently, an inner ear enhancer was reported that is absent in most DFN3 patients with upstream deletions. However, two indications suggest that additional enhancers in the POU3F4 upstream region are required for POU3F4 function during inner ear development. First, there is at least one DFN3 deletion that does not eliminate the reported enhancer. Second, the expression pattern driven by this enhancer does not fully recapitulate Pou3f4 expression in the inner ear. Here, we screened a 1-Mb region upstream of the POU3F4 gene for additional cis-regulatory elements and searched for novel DFN3 mutations in the identified POU3F4 enhancers. We found several novel enhancers for otic vesicle expression. Some of these also drive expression in kidney, pancreas and brain, tissues that are known to express Pou3f4. In addition, we report a new and smallest deletion identified so far in a DFN3 family which eliminates 3.9 kb, comprising almost exclusively the previous reported inner ear enhancer. We suggest that multiple enhancers control the expression of Pou3f4 in the inner ear and these may contribute to the phenotype observed in DFN3 patients. In addition, the novel deletion demonstrates that the previous reported enhancer, although not sufficient, is essential for POU3F4 function during inner ear development. Electronic supplementary material The online version of this article (doi:10.1007/s00439-010-0864-x) contains supplementary material, which is available to authorized users. PMID:20668882

  11. DoOP: Databases of Orthologous Promoters, collections of clusters of orthologous upstream sequences from chordates and plants

    PubMed Central

    Barta, Endre; Sebestyén, Endre; Pálfy, Tamás B.; Tóth, Gábor; Ortutay, Csaba P.; Patthy, László

    2005-01-01

    DoOP (http://doop.abc.hu/) is a database of eukaryotic promoter sequences (upstream regions) aiming to facilitate the recognition of regulatory sites conserved between species. The annotated first exons of human and Arabidopsis thaliana genes were used as queries in BLAST searches to collect the most closely related orthologous first exon sequences from Chordata and Viridiplantae species. Up to 3000 bp DNA segments upstream from these first exons constitute the clusters in the chordate and plant sections of the Database of Orthologous Promoters. Release 1.0 of DoOP contains 21 061 chordate clusters from 284 different species and 7548 plant clusters from 269 different species. The database can be used to find and retrieve promoter sequences of a given gene from various species and it is also suitable to see the most trivial conserved sequence blocks in the orthologous upstream regions. Users can search DoOP with either sequence or text (annotation) to find promoter clusters of various genes. In addition to the sequence data, the positions of the conserved sequence blocks derived from multiple alignments, the positions of repetitive elements and the positions of transcription start sites known from the Eukaryotic Promoter Database (EPD) can be viewed graphically. PMID:15608291

  12. DoOP: Databases of Orthologous Promoters, collections of clusters of orthologous upstream sequences from chordates and plants.

    PubMed

    Barta, Endre; Sebestyén, Endre; Pálfy, Tamás B; Tóth, Gábor; Ortutay, Csaba P; Patthy, László

    2005-01-01

    DoOP (http://doop.abc.hu/) is a database of eukaryotic promoter sequences (upstream regions) aiming to facilitate the recognition of regulatory sites conserved between species. The annotated first exons of human and Arabidopsis thaliana genes were used as queries in BLAST searches to collect the most closely related orthologous first exon sequences from Chordata and Viridiplantae species. Up to 3000 bp DNA segments upstream from these first exons constitute the clusters in the chordate and plant sections of the Database of Orthologous Promoters. Release 1.0 of DoOP contains 21,061 chordate clusters from 284 different species and 7548 plant clusters from 269 different species. The database can be used to find and retrieve promoter sequences of a given gene from various species and it is also suitable to see the most trivial conserved sequence blocks in the orthologous upstream regions. Users can search DoOP with either sequence or text (annotation) to find promoter clusters of various genes. In addition to the sequence data, the positions of the conserved sequence blocks derived from multiple alignments, the positions of repetitive elements and the positions of transcription start sites known from the Eukaryotic Promoter Database (EPD) can be viewed graphically.

  13. Apparatus for purifying exhaust gases of internal combustion engines

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kakinuma, O.; Oya, H.

    1980-06-03

    Apparatus for purifying the exhaust gases of internal combustion engines is disclosed is comprised of a pair of upstream exhaust pipes, a catalytic converter, and a downstream exhaust pipe. The catalytic converter comprises a shell having an inlet chamber, catalyst chamber, and an outlet chamber. The axial lines of the inlet ports are arranged to cross each other in the inlet chamber at a position near, but upstream of, the upstream facing end of said monolithic catalyst element, so that gas flow can diffuse to the entire plane of the element.

  14. A banana NAC transcription factor (MusaSNAC1) impart drought tolerance by modulating stomatal closure and H2O2 content.

    PubMed

    Negi, Sanjana; Tak, Himanshu; Ganapathi, T R

    2018-03-01

    MusaSNAC1 function in H 2 O 2 mediated stomatal closure and promote drought tolerance by directly binding to CGT[A/G] motif in regulatory region of multiple stress-related genes. Drought is a abiotic stress-condition, causing reduced plant growth and diminished crop yield. Guard cells of the stomata control photosynthesis and transpiration by regulating CO 2 exchange and water loss, thus affecting growth and crop yield. Roles of NAC (NAM, ATAF1/2 and CUC2) protein in regulation of stress-conditions has been well documented however, their control over stomatal aperture is largely unknown. In this study we report a banana NAC protein, MusaSNAC1 which induced stomatal closure by elevating H 2 O 2 content in guard cells during drought stress. Overexpression of MusaSNAC1 in banana resulted in higher number of stomata closure causing reduced water loss and thus elevated drought-tolerance. During drought, expression of GUS (β-glucuronidase) under P MusaSNAC1 was remarkably elevated in guard cells of stomata which correlated with its function as a transcription factor regulating stomatal aperture closing. MusaSNAC1 is a transcriptional activator belonging to SNAC subgroup and its 5'-upstream region contain multiple Dof1 elements as well as stress-associated cis-elements. Moreover, MusaSNAC1 also regulate multiple stress-related genes by binding to core site of NAC-proteins CGT[A/G] in their 5'-upstream region. Results indicated an interesting mechanism of drought tolerance through stomatal closure by H 2 O 2 generation in guard cells, regulated by a NAC-protein in banana.

  15. Fast acting multiple element valve

    DOEpatents

    Yang, Jefferson Y. S.; Wada, James M.

    1991-01-01

    A plurality of slide valve elements having plural axial-spaced annular parts and an internal slide are inserted into a bulkhead in a fluid conduit from a downstream side of the bulkhead, locked in place by a bayonet coupling and set screw, and project through the bulkhead into the upstream conduit. Pneumatic lines connecting the slide valve element actuator to pilot valves are brought out the throat of the valve element to the downstream side. Pilot valves are radially spaced around the exterior of the valve to permit the pneumatic lines to be made identical, thereby to minimize adverse timing tolerances in operation due to pressure variations. Ring manifolds surround the valve adjacent respective pilot valve arrangements to further reduce adverse timing tolerances due to pressure variations, the manifolds being directly connected to the respective pilot valves. Position sensors are provided the valve element slides to signal the precise time at which a slide reaches or passes through a particular point in its stroke to initiate a calibrated timing function.

  16. Enhancer elements upstream of the SHOX gene are active in the developing limb.

    PubMed

    Durand, Claudia; Bangs, Fiona; Signolet, Jason; Decker, Eva; Tickle, Cheryll; Rappold, Gudrun

    2010-05-01

    Léri-Weill Dyschondrosteosis (LWD) is a dominant skeletal disorder characterized by short stature and distinct bone anomalies. SHOX gene mutations and deletions of regulatory elements downstream of SHOX resulting in haploinsufficiency have been found in patients with LWD. SHOX encodes a homeodomain transcription factor and is known to be expressed in the developing limb. We have now analyzed the regulatory significance of the region upstream of the SHOX gene. By comparative genomic analyses, we identified several conserved non-coding elements, which subsequently were tested in an in ovo enhancer assay in both chicken limb bud and cornea, where SHOX is also expressed. In this assay, we found three enhancers to be active in the developing chicken limb, but none were functional in the developing cornea. A screening of 60 LWD patients with an intact SHOX coding and downstream region did not yield any deletion of the upstream enhancer region. Thus, we speculate that SHOX upstream deletions occur at a lower frequency because of the structural organization of this genomic region and/or that SHOX upstream deletions may cause a phenotype that differs from the one observed in LWD.

  17. Enhancer elements upstream of the SHOX gene are active in the developing limb

    PubMed Central

    Durand, Claudia; Bangs, Fiona; Signolet, Jason; Decker, Eva; Tickle, Cheryll; Rappold, Gudrun

    2010-01-01

    Léri-Weill Dyschondrosteosis (LWD) is a dominant skeletal disorder characterized by short stature and distinct bone anomalies. SHOX gene mutations and deletions of regulatory elements downstream of SHOX resulting in haploinsufficiency have been found in patients with LWD. SHOX encodes a homeodomain transcription factor and is known to be expressed in the developing limb. We have now analyzed the regulatory significance of the region upstream of the SHOX gene. By comparative genomic analyses, we identified several conserved non-coding elements, which subsequently were tested in an in ovo enhancer assay in both chicken limb bud and cornea, where SHOX is also expressed. In this assay, we found three enhancers to be active in the developing chicken limb, but none were functional in the developing cornea. A screening of 60 LWD patients with an intact SHOX coding and downstream region did not yield any deletion of the upstream enhancer region. Thus, we speculate that SHOX upstream deletions occur at a lower frequency because of the structural organization of this genomic region and/or that SHOX upstream deletions may cause a phenotype that differs from the one observed in LWD. PMID:19997128

  18. A Genome-Wide Identification of the WRKY Family Genes and a Survey of Potential WRKY Target Genes in Dendrobium officinale.

    PubMed

    He, Chunmei; Teixeira da Silva, Jaime A; Tan, Jianwen; Zhang, Jianxia; Pan, Xiaoping; Li, Mingzhi; Luo, Jianping; Duan, Jun

    2017-08-23

    The WRKY family, one of the largest families of transcription factors, plays important roles in the regulation of various biological processes, including growth, development and stress responses in plants. In the present study, 63 DoWRKY genes were identified from the Dendrobium officinale genome. These were classified into groups I, II, III and a non-group, each with 14, 28, 10 and 11 members, respectively. ABA-responsive, sulfur-responsive and low temperature-responsive elements were identified in the 1-k upstream regulatory region of DoWRKY genes. Subsequently, the expression of the 63 DoWRKY genes under cold stress was assessed, and the expression profiles of a large number of these genes were regulated by low temperature in roots and stems. To further understand the regulatory mechanism of DoWRKY genes in biological processes, potential WRKY target genes were investigated. Among them, most stress-related genes contained multiple W-box elements in their promoters. In addition, the genes involved in polysaccharide synthesis and hydrolysis contained W-box elements in their 1-k upstream regulatory regions, suggesting that DoWRKY genes may play a role in polysaccharide metabolism. These results provide a basis for investigating the function of WRKY genes and help to understand the downstream regulation network in plants within the Orchidaceae.

  19. Promoter-proximal rDNA terminator augments initiation by preventing disruption of the stable transcription complex caused by polymerase read-in

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Henderson, S.L.; Ryan, K.; Sollner-Webb, B.

    1989-02-01

    We have examined the mechanism by which transcriptional initiation at the mouse rDNA promoter is augmented by the RNA polymerase I terminator element that resides just upstream of it. Using templates in which terminator elements are instead positioned at the opposite side of the plasmid rather than proximal to the promoter, or conditions where transcription is terminated elsewhere in the plasmid by UV-induced lesions, we show that the terminator's stimulatory effect is not position dependent. Mouse terminator elements therefore do not stimulate via the previously postulated 'read-through enhancement' model in which terminated polymerases are handed off to an adjacent promotermore » in a concerted reaction. The position independence and orientation dependence of the terminator also makes it unlikely that the terminator functions as a promoter element or as an enhancer. Instead, terminators serve to augment initiation by preventing polymerases from reading completely around the plasmid and through the promoter from upstream, an event which we show interferes with subsequent rounds of initiation. Notably, this transcriptional interference arises because polymerase passage across a promoter disrupts the otherwise stable transcription complex, specifically releasing the bound transcription factor D. These liberated D molecules can then bind to other templates and activate their expression. The rDNA transcriptional interference is not due to a steric impediment to the binding of new polymerase molecules, and it does not similarly liberate the initiation-competent polymerase (factor C). These studies have also convincingly demonstrated that multiple rounds of transcription are obtained from rDNA template molecules in vitro.« less

  20. Cooperative action of multiple cis-acting elements is required for N-myc expression in branchial arches: specific contribution of GATA3.

    PubMed

    Potvin, Eric; Beuret, Laurent; Cadrin-Girard, Jean-François; Carter, Marcelle; Roy, Sophie; Tremblay, Michel; Charron, Jean

    2010-11-01

    The precise expression of the N-myc proto-oncogene is essential for normal mammalian development, whereas altered N-myc gene regulation is known to be a determinant factor in tumor formation. Using transgenic mouse embryos, we show that N-myc sequences from kb -8.7 to kb +7.2 are sufficient to reproduce the N-myc embryonic expression profile in developing branchial arches and limb buds. These sequences encompass several regulatory elements dispersed throughout the N-myc locus, including an upstream limb bud enhancer, a downstream somite enhancer, a branchial arch enhancer in the second intron, and a negative regulatory element in the first intron. N-myc expression in the limb buds is under the dominant control of the limb bud enhancer. The expression in the branchial arches necessitates the interplay of three regulatory domains. The branchial arch enhancer cooperates with the somite enhancer region to prevent an inhibitory activity contained in the first intron. The characterization of the branchial arch enhancer has revealed a specific role of the transcription factor GATA3 in the regulation of N-myc expression. Together, these data demonstrate that correct N-myc developmental expression is achieved via cooperation of multiple positive and negative regulatory elements.

  1. Functional elements in the minimal promoter of the human proton-coupled folate transporter

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stark, Michal; Gonen, Nitzan; Assaraf, Yehuda G., E-mail: assaraf@tx.technion.ac.il

    2009-10-09

    The proton-coupled folate transporter (PCFT) is the dominant intestinal folate transporter, however, its promoter has yet to be revealed. Hence, we here cloned a 3.1 kb fragment upstream to the first ATG of the human PCFT gene and generated sequential deletion constructs evaluated in luciferase reporter assay. This analysis mapped the minimal promoter to 157 bp upstream to the first ATG. Crucial GC-box sites were identified within the minimal promoter and in its close vicinity which substantially contribute to promoter activity, as their disruption resulted in 94% loss of luciferase activity. We also identified upstream enhancer elements including YY1 andmore » AP1 which, although distantly located, prominently transactivated the minimal promoter, as their inactivation resulted in 50% decrease in reporter activity. This is the first functional identification of the minimal PCFT promoter harboring crucial GC-box elements that markedly contribute to its transcriptional activation via putative interaction with distal YY1 and AP1 enhancer elements.« less

  2. Defective distal regulatory element at the 5' upstream of rat prolactin gene of steroid-nonresponsive GH-subclone.

    PubMed

    Kumar, V; Wong, D T; Pasion, S G; Biswas, D K

    1987-12-08

    The prolactin-nonproducing (PRL-) GH cell strains (rat pituitary tumor cells in culture). GH12C1 and F1BGH12C1, do not respond to steroid hormones estradiol or hydrocortisone (HC). However, the stimulatory effect of estradiol and the inhibitory effect of hydrocortisone on prolactin synthesis can be demonstrated in the prolactin-producing GH cell strain, GH4C1. In this investigation we have examined the 5' end flanking region of rat prolactin (rat PRL) gene of steroid-responsive, GH4C1 cells to identify the positive and negative regulatory elements and to verify the status of these elements in steroid-nonresponsive F1BGH12C1 cells. Results presented in this report demonstrate that the basel level expression of the co-transferred Neo gene (neomycin phosphoribosyl transferase) is modulated by the distal upstream regulatory elements of rat PRL gene in response to steroid hormones. The expression of adjacent Neo gene is inhibited by dexamethasone and is stimulated by estradiol in transfectants carrying distal regulatory elements (SRE) of steroid-responsive cells. These responses are not observed in transfectants with the rat PRL upstream sequences derived from steroid-nonresponsive cells. The basal level expression of the host cell alpha-2 tubulin gene is not affected by dexamethasone. We report here the identification of the distal steroid regulatory element (SRE) located between 3.8 and 7.8 kb upstream of the transcription initiation site of rat PRL gene. Both the positive and the negative effects of steroid hormones can be identified within this upstream sequence. This distal SRE appears to be nonfunctional in steroid-nonresponsive cells. Though the proximal SRE is functional, the defect in the distal SRE makes the GH substrain nonresponsive to steroid hormones. These results suggest that both the proximal and the distal SREs are essential for the mediation of action of steroid hormones in GH cells.

  3. A proximal promoter region of Arabidopsis DREB2C confers tissue-specific expression under heat stress.

    PubMed

    Chen, Huan; Je, Jihyun; Song, Chieun; Hwang, Jung Eun; Lim, Chae Oh

    2012-09-01

    The dehydration-responsive element-binding factor 2C (DREB2C) is a member of the CBF/DREB subfamily of proteins, which contains a single APETALA2/Ethylene responsive element-binding factor (AP2/ERF) domain. To identify the expression pattern of the DREB2C gene, which contains multiple transcription cis-regulatory elements in its promoter, an approximately 1.4 kb upstream DREB2C sequence was fused to the β-glucuronidase reporter gene (GUS) and the recombinant p1244 construct was transformed into Arabidopsis thaliana (L.) Heynh. The promoter of the gene directed prominent GUS activity in the vasculature in diverse young dividing tissues. Upon applying heat stress (HS), GUS staining was also enhanced in the vasculature of the growing tissues. Analysis of a series of 5'-deletions of the DREB2C promoter revealed that a proximal upstream sequence sufficient for the tissue-specific spatial and temporal induction of GUS expression by HS is localized in the promoter region between -204 and -34 bps relative to the transcriptional start site. Furthermore, electrophoretic mobility shift assay (EMSA) demonstrated that nuclear protein binding activities specific to a -120 to -32 bp promoter fragment increased after HS. These results indicate that the TATA-proximal region and some latent trans-acting factors may cooperate in HS-induced activation of the Arabidopsis DREB2C promoter. © 2012 Institute of Botany, Chinese Academy of Sciences.

  4. Functional Intersection Area -- Oregon Department of Transportation

    DOT National Transportation Integrated Search

    1996-01-01

    This discussion paper addresses the concepts involved in defining the functional area of an intersection. The elements which comprise the upstream functional area are identified; dimensions of the upstream area exclusive of queue storage, are given f...

  5. A cis-regulatory sequence driving metabolic insecticide resistance in mosquitoes: functional characterisation and signatures of selection.

    PubMed

    Wilding, Craig S; Smith, Ian; Lynd, Amy; Yawson, Alexander Egyir; Weetman, David; Paine, Mark J I; Donnelly, Martin J

    2012-09-01

    Although cytochrome P450 (CYP450) enzymes are frequently up-regulated in mosquitoes resistant to insecticides, no regulatory motifs driving these expression differences with relevance to wild populations have been identified. Transposable elements (TEs) are often enriched upstream of those CYP450s involved in insecticide resistance, leading to the assumption that they contribute regulatory motifs that directly underlie the resistance phenotype. A partial CuRE1 (Culex Repetitive Element 1) transposable element is found directly upstream of CYP9M10, a cytochrome P450 implicated previously in larval resistance to permethrin in the ISOP450 strain of Culex quinquefasciatus, but is absent from the equivalent genomic region of a susceptible strain. Via expression of CYP9M10 in Escherichia coli we have now demonstrated time- and NADPH-dependant permethrin metabolism, prerequisites for confirmation of a role in metabolic resistance, and through qPCR shown that CYP9M10 is >20-fold over-expressed in ISOP450 compared to a susceptible strain. In a fluorescent reporter assay the region upstream of CYP9M10 from ISOP450 drove 10× expression compared to the equivalent region (lacking CuRE1) from the susceptible strain. Close correspondence with the gene expression fold-change implicates the upstream region including CuRE1 as a cis-regulatory element involved in resistance. Only a single CuRE1 bearing allele, identical to the CuRE1 bearing allele in the resistant strain, is found throughout Sub-Saharan Africa, in contrast to the diversity encountered in non-CuRE1 alleles. This suggests a single origin and subsequent spread due to selective advantage. CuRE1 is detectable using a simple diagnostic. When applied to C. quinquefasciatus larvae from Ghana we have demonstrated a significant association with permethrin resistance in multiple field sites (mean Odds Ratio = 3.86) suggesting this marker has relevance to natural populations of vector mosquitoes. However, when CuRE1 was excised from the allele used in the reporter assay through fusion PCR, expression was unaffected, indicating that the TE has no direct role in resistance and hence that CuRE1 is acting only as a marker of an as yet unidentified regulatory motif in the association analysis. This suggests that a re-evaluation of the assumption that TEs contribute regulatory motifs involved in gene expression may be necessary. Copyright © 2012 Elsevier Ltd. All rights reserved.

  6. Spatial and temporal distribution of metals in suspended particulate matter of the Kali estuary, India

    NASA Astrophysics Data System (ADS)

    Suja, S.; Kessarkar, Pratima M.; Fernandes, Lina L.; Kurian, Siby; Tomer, Arti

    2017-09-01

    Major (Al, Fe, Mn, Ti, Mg) and trace (Cu, Zn, Pb, Cr, Ni, Co, Zr, Rb, Sr, Ba, Li, Be, Sc, V, Ga, Nb, Mo, Sn, Sb, Cs, Hf, Ta, Bi, Th, U) elements and particulate organic carbon (POC) concentrations in surface suspended particulate matter (SPM) of the Kali estuary, (central west coast of India) were studied during the pre-monsoon, monsoon and post monsoon seasons to infer estuarine processes, source of SPM and Geoaccumulation Index (Igeo) assigned pollutionIgeo levels. Distribution of SPM indicates the presence of the estuarine turbidity maximum (ETM) during all three seasons near the river mouth and a second ETM during the post monsoon time in the upstream associated with salinities gradient. The SPM during the monsoon is finer grained (avg. 53 μm), characterized by uniformly low normalized elemental concentration, whereas the post and pre monsoon are characterized by high normalized elemental concentration with coarser grain size (avg. 202 μm and 173 μm respectively) with highest ratios in the upstream estuary. The elemental composition and principal component analysis for the upstream estuary SPM support more contribution from the upstream catchment area rocks during the monsoon season; there is additional contribution from the downstream catchment area during the pre and post monsoon period due to the tidal effect. The Kali estuarine SPM has higher Al, Fe, Mn, Ti, Mg, Ni, Co, Ba, Li and V with respect to Average World River SPM (WRSPM). Igeo values for the SPM indicate Kali Estuary to be severely enriched with Mn and moderately enriched with Cu, Zn, Ni, Co, U and Mo in the upstream estuary during pre and post monsoon seasons. Seasonal changes in salinity gradient (reduced freshwater flow due to closing of the dam gates), reduced velocity at meandering region of the estuary and POC of 1.6-2.3% resulted in co-precipitation of trace elements that were further fortified by flocculation and coagulation throughout the water column resulting in metal trapping in the upstream region.

  7. The positive regulatory function of the 5'-proximal open reading frames in GCN4 mRNA can be mimicked by heterologous, short coding sequences.

    PubMed Central

    Williams, N P; Mueller, P P; Hinnebusch, A G

    1988-01-01

    Translational control of GCN4 expression in the yeast Saccharomyces cerevisiae is mediated by multiple AUG codons present in the leader of GCN4 mRNA, each of which initiates a short open reading frame of only two or three codons. Upstream AUG codons 3 and 4 are required to repress GCN4 expression in normal growth conditions; AUG codons 1 and 2 are needed to overcome this repression in amino acid starvation conditions. We show that the regulatory function of AUG codons 1 and 2 can be qualitatively mimicked by the AUG codons of two heterologous upstream open reading frames (URFs) containing the initiation regions of the yeast genes PGK and TRP1. These AUG codons inhibit GCN4 expression when present singly in the mRNA leader; however, they stimulate GCN4 expression in derepressing conditions when inserted upstream from AUG codons 3 and 4. This finding supports the idea that AUG codons 1 and 2 function in the control mechanism as translation initiation sites and further suggests that suppression of the inhibitory effects of AUG codons 3 and 4 is a general consequence of the translation of URF 1 and 2 sequences upstream. Several observations suggest that AUG codons 3 and 4 are efficient initiation sites; however, these sequences do not act as positive regulatory elements when placed upstream from URF 1. This result suggests that efficient translation is only one of the important properties of the 5' proximal URFs in GCN4 mRNA. We propose that a second property is the ability to permit reinitiation following termination of translation and that URF 1 is optimized for this regulatory function. Images PMID:3065626

  8. Robust Translation of the Nucleoid Protein Fis Requires a Remote Upstream AU Element and Is Enhanced by RNA Secondary Structure

    PubMed Central

    Nafissi, Maryam; Chau, Jeannette; Xu, Jimin

    2012-01-01

    Synthesis of the Fis nucleoid protein rapidly increases in response to nutrient upshifts, and Fis is one of the most abundant DNA binding proteins in Escherichia coli under nutrient-rich growth conditions. Previous work has shown that control of Fis synthesis occurs at transcription initiation of the dusB-fis operon. We show here that while translation of the dihydrouridine synthase gene dusB is low, unusual mechanisms operate to enable robust translation of fis. At least two RNA sequence elements located within the dusB coding region are responsible for high fis translation. The most important is an AU element centered 35 nucleotides (nt) upstream of the fis AUG, which may function as a binding site for ribosomal protein S1. In addition, a 44-nt segment located upstream of the AU element and predicted to form a stem-loop secondary structure plays a prominent role in enhancing fis translation. On the other hand, mutations close to the AUG, including over a potential Shine-Dalgarno sequence, have little effect on Fis protein levels. The AU element and stem-loop regions are phylogenetically conserved within dusB-fis operons of representative enteric bacteria. PMID:22389479

  9. Alphavirus replicon approach to promoterless analysis of IRES elements.

    PubMed

    Kamrud, K I; Custer, M; Dudek, J M; Owens, G; Alterson, K D; Lee, J S; Groebner, J L; Smith, J F

    2007-04-10

    Here we describe a system for promoterless analysis of putative internal ribosome entry site (IRES) elements using an alphavirus (family Togaviridae) replicon vector. The system uses the alphavirus subgenomic promoter to produce transcripts that, when modified to contain a spacer region upstream of an IRES element, allow analysis of cap-independent translation of genes of interest (GOI). If the IRES element is removed, translation of the subgenomic transcript can be reduced >95% compared to the same transcript containing a functional IRES element. Alphavirus replicons, used in this manner, offer an alternative to standard dicistronic DNA vectors or in vitro translation systems currently used to analyze putative IRES elements. In addition, protein expression levels varied depending on the spacer element located upstream of each IRES. The ability to modulate the level of expression from alphavirus vectors should extend the utility of these vectors in vaccine development.

  10. Alphavirus Replicon Approach to Promoterless Analysis of IRES Elements

    PubMed Central

    Kamrud, K.I.; Custer, M.; Dudek, J.M.; Owens, G.; Alterson, K.D.; Lee, J.S.; Groebner, J.L.; Smith, J.F.

    2007-01-01

    Here we describe a system for promoterless analysis of putative internal ribosome entry site (IRES) elements using an alphavirus (Family Togaviridae) replicon vector. The system uses the alphavirus subgenomic promoter to produce transcripts that, when modified to contain a spacer region upstream of an IRES element, allow analysis of cap-independent translation of genes of interest (GOI). If the IRES element is removed, translation of the subgenomic transcript can be reduced > 95 % compared to the same transcript containing a functional IRES element. Alphavirus replicons, used in this manner, offer an alternative to standard dicistronic DNA vectors or in-vitro translation systems currently used to analyze putative IRES elements. In addition, protein expression levels varied depending on the spacer element located upstream of each IRES. The ability to modulate the level of expression from alphavirus vectors should extend the utility of these vectors in vaccine development. PMID:17156813

  11. ERalpha and AP-1 interact in vivo with a specific sequence of the F promoter of the human ERalpha gene in osteoblasts.

    PubMed

    Lambertini, Elisabetta; Tavanti, Elisa; Torreggiani, Elena; Penolazzi, Letizia; Gambari, Roberto; Piva, Roberta

    2008-07-01

    Estrogen-responsive genes often have an estrogen response element (ERE) positioned next to activator protein-1 (AP-1) binding sites. Considering that the interaction between ERE and AP-1 elements has been described for the modulation of bone-specific genes, we investigated the 17-beta-estradiol responsiveness and the role of these cis-elements present in the F promoter of the human estrogen receptor alpha (ERalpha) gene. The F promoter, containing the sequence analyzed here, is one of the multiple promoters of the human ERalpha gene and is the only active promoter in bone tissue. Through electrophoretic mobility shift (EMSA), chromatin immunoprecipitation (ChIP), and re-ChIP assays, we investigated the binding of ERalpha and four members of the AP-1 family (c-Jun, c-fos, Fra-2, and ATF2) to a region located approximately 800 bp upstream of the transcriptional start site of exon F of the human ERalpha gene in SaOS-2 osteoblast-like cells. Reporter gene assay experiments in combination with DNA binding assays demonstrated that F promoter activity is under the control of upstream cis-acting elements which are recognized by specific combinations of ERalpha, c-Jun, c-fos, and ATF2 homo- and heterodimers. Moreover, ChIP and re-ChIP experiments showed that these nuclear factors bind the F promoter in vivo with a simultaneous occupancy stimulated by 17-beta-estradiol. Taken together, our findings support a model in which ERalpha/AP-1 complexes modulate F promoter activity under conditions of 17-beta-estradiol stimulation. (c) 2008 Wiley-Liss, Inc.

  12. Functional organization of DNA elements regulating SM30alpha, a spicule matrix gene of sea urchin embryos.

    PubMed

    Yamasu, K; Wilt, F H

    1999-02-01

    The SM30a gene encodes a protein in the embryonic endoskeleton of the sea urchin Strongylocentrotus purpuratus, and is specifically expressed in the skeletogenic primary mesenchyme cell lineage. To clarify the mechanism for the differentiation of this cell lineage, which proceeds rather autonomously in the embryo, regulation of the SM30alpha gene was investigated previously and it was shown that the distal DNA region upstream of this gene from - 1.6 to - 1.0 kb contained numerous negative regulatory elements that suppressed the ectopic expression of the gene in the gut. Here we study the influence of the proximal region from - 303 to + 104 bp. Analysis of the expression of reporter constructs indicated that a strong positive enhancer element existed in the region from -142 to -105bp. This element worked both in forward and reverse orientations and additively when placed tandemly upstream to the reporter gene. In addition, other weaker positive and negative regulatory sites were also detected throughout the proximal region. Electrophoretic gel mobility shift analyses showed that multiple nuclear proteins were bound to the putative strong enhancer region. One of the proteins binding to this region was present in ear y blastulae, a time when the SM30 gene was still silent, but it was not in prism embryos actively expressing the gene. The binding region for this blastula-specific protein was narrowed down to the region from - 132 to -122 bp, which included the consensus binding site for the mammalian proto-oncogene product, Ets. Two possible SpGCF1 binding sites were identified in the vicinity of the enhancer region. This information was used to make a comparison of the general regulatory architecture of genes that contribute to the formation of the skeletal spicule.

  13. Compilation of mRNA Polyadenylation Signals in Arabidopsis Revealed a New Signal Element and Potential Secondary Structures1[w

    PubMed Central

    Loke, Johnny C.; Stahlberg, Eric A.; Strenski, David G.; Haas, Brian J.; Wood, Paul Chris; Li, Qingshun Quinn

    2005-01-01

    Using a novel program, SignalSleuth, and a database containing authenticated polyadenylation [poly(A)] sites, we analyzed the composition of mRNA poly(A) signals in Arabidopsis (Arabidopsis thaliana), and reevaluated previously described cis-elements within the 3′-untranslated (UTR) regions, including near upstream elements and far upstream elements. As predicted, there are absences of high-consensus signal patterns. The AAUAAA signal topped the near upstream elements patterns and was found within the predicted location to only approximately 10% of 3′-UTRs. More importantly, we identified a new set, named cleavage elements, of poly(A) signals flanking both sides of the cleavage site. These cis-elements were not previously revealed by conventional mutagenesis and are contemplated as a cluster of signals for cleavage site recognition. Moreover, a single-nucleotide profile scan on the 3′-UTR regions unveiled a distinct arrangement of alternate stretches of U and A nucleotides, which led to a prediction of the formation of secondary structures. Using an RNA secondary structure prediction program, mFold, we identified three main types of secondary structures on the sequences analyzed. Surprisingly, these observed secondary structures were all interrupted in previously constructed mutations in these regions. These results will enable us to revise the current model of plant poly(A) signals and to develop tools to predict 3′-ends for gene annotation. PMID:15965016

  14. A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor.

    PubMed Central

    Mink, S; Härtig, E; Jennewein, P; Doppler, W; Cato, A C

    1992-01-01

    Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites. Images PMID:1328867

  15. Applications of numerical methods to simulate the movement of contaminants in groundwater.

    PubMed Central

    Sun, N Z

    1989-01-01

    This paper reviews mathematical models and numerical methods that have been extensively used to simulate the movement of contaminants through the subsurface. The major emphasis is placed on the numerical methods of advection-dominated transport problems and inverse problems. Several mathematical models that are commonly used in field problems are listed. A variety of numerical solutions for three-dimensional models are introduced, including the multiple cell balance method that can be considered a variation of the finite element method. The multiple cell balance method is easy to understand and convenient for solving field problems. When the advection transport dominates the dispersion transport, two kinds of numerical difficulties, overshoot and numerical dispersion, are always involved in solving standard, finite difference methods and finite element methods. To overcome these numerical difficulties, various numerical techniques are developed, such as upstream weighting methods and moving point methods. A complete review of these methods is given and we also mention the problems of parameter identification, reliability analysis, and optimal-experiment design that are absolutely necessary for constructing a practical model. PMID:2695327

  16. Small gene family encoding an eggshell (chorion) protein of the human parasite Schistosoma mansoni

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bobek, L.A.; Rekosh, D.M.; Lo Verde, P.T.

    1988-08-01

    The authors isolated six independent genomic clones encoding schistosome chorion or eggshell proteins from a Schistosoma mansoni genomic library. A linkage map of five of the clones spanning 35 kilobase pairs (kbp) of the S. mansoni genome was constructed. The region contained two eggshell protein genes closely linked, separated by 7.5 kbp of intergenic DNA. The two genes of the cluster were arranged in the same orientation, that is, they were transcribed from the same strand. The sixth clone probably represents a third copy of the eggshell gene that is not contained within the 35-kbp region. The 5- end ofmore » the mRNA transcribed from these genes was defined by primer extension directly off the RNA. The ATCAT cap site sequence was homologous to a silkmoth chorion PuTCATT cap site sequence, where Pu indicates any purine. DNA sequence analysis showed that there were no introns in these genes. The DNA sequences of the three genes were very homologous to each other and to a cDNA clone, pSMf61-46, differing only in three or four nucleotices. A multiple TATA box was located at positions -23 to -31, and a CAAAT sequence was located at -52 upstream of the eggshell transcription unit. Comparison of sequences in regions further upstream with silkmoth and Drosophila sequences revealed very short elements that were shared. One such element, TCACGT, recently shown to be an essential cis-regulatory element for silkmoth chorion gene promoter function, was found at a similar position in all three organisms.« less

  17. Spacing requirements for interactions between the C-terminal domain of the alpha subunit of Escherichia coli RNA polymerase and the cAMP receptor protein.

    PubMed Central

    Lloyd, G S; Busby, S J; Savery, N J

    1998-01-01

    During transcription initiation at bacterial promoters, the C-terminal domain of the RNA polymerase alpha subunit (alphaCTD) can interact with DNA-sequence elements (known as UP elements) and with activator proteins. We have constructed a series of semi-synthetic promoters carrying both an UP element and a consensus DNA-binding site for the Escherichia coli cAMP receptor protein (CRP; a factor that activates transcription by making direct contacts with alphaCTD). At these promoters, the UP element was located at a variety of distances upstream of the CRP-binding site, which was fixed at position -41.5 bp upstream of the transcript start. At some positions, the UP element caused enhanced promoter activity whereas, at other positions, it had very little effect. In no case was the CRP-dependence of the promoter relieved. DNase I and hydroxyl-radical footprinting were used to study ternary RNA polymerase-CRP-promoter complexes formed at two of the most active of these promoters, and co-operativity between the binding of CRP and purified alpha subunits was studied. The footprints show that alphaCTD binds to the UP element as it is displaced upstream but that this displacement does not prevent alphaCTD from being contacted by CRP. Models to account for this are discussed. PMID:9461538

  18. Contactor/filter improvements

    DOEpatents

    Stelman, David

    1989-01-01

    A contactor/filter arrangement for removing particulate contaminants from a gaseous stream includes a housing having a substantially vertically oriented granular material retention member with upstream and downstream faces, a substantially vertically oriented microporous gas filter element, wherein the retention member and the filter element are spaced apart to provide a zone for the passage of granular material therethrough. The housing further includes a gas inlet means, a gas outlet means, and means for moving a body of granular material through the zone. A gaseous stream containing particulate contaminants passes through the gas inlet means as well as through the upstream face of the granular material retention member, passing through the retention member, the body of granular material, the microporous gas filter element, exiting out of the gas outlet means. Disposed on the upstream face of the filter element is a cover screen which isolates the filter element from contact with the moving granular bed and collects a portion of the particulates so as to form a dust cake having openings small enough to exclude the granular material, yet large enough to receive the dust particles. In one embodiment, the granular material is comprised of prous alumina impregnated with CuO, with the cover screen cleaned by the action of the moving granular material as well as by backflow pressure pulses.

  19. Modulation of tissue repair by regeneration enhancer elements.

    PubMed

    Kang, Junsu; Hu, Jianxin; Karra, Ravi; Dickson, Amy L; Tornini, Valerie A; Nachtrab, Gregory; Gemberling, Matthew; Goldman, Joseph A; Black, Brian L; Poss, Kenneth D

    2016-04-14

    How tissue regeneration programs are triggered by injury has received limited research attention. Here we investigate the existence of enhancer regulatory elements that are activated in regenerating tissue. Transcriptomic analyses reveal that leptin b (lepb) is highly induced in regenerating hearts and fins of zebrafish. Epigenetic profiling identified a short DNA sequence element upstream and distal to lepb that acquires open chromatin marks during regeneration and enables injury-dependent expression from minimal promoters. This element could activate expression in injured neonatal mouse tissues and was divisible into tissue-specific modules sufficient for expression in regenerating zebrafish fins or hearts. Simple enhancer-effector transgenes employing lepb-linked sequences upstream of pro- or anti-regenerative factors controlled the efficacy of regeneration in zebrafish. Our findings provide evidence for 'tissue regeneration enhancer elements' (TREEs) that trigger gene expression in injury sites and can be engineered to modulate the regenerative potential of vertebrate organs.

  20. Sequence Elements Upstream of the Core Promoter Are Necessary for Full Transcription of the Capsule Gene Operon in Streptococcus pneumoniae Strain D39

    PubMed Central

    Wen, Zhensong; Sertil, Odeniel; Cheng, Yongxin; Zhang, Shanshan; Liu, Xue; Wang, Wen-Ching

    2015-01-01

    Streptococcus pneumoniae is a major bacterial pathogen in humans. Its polysaccharide capsule is a key virulence factor that promotes bacterial evasion of human phagocytic killing. While S. pneumoniae produces at least 94 antigenically different types of capsule, the genes for biosynthesis of almost all capsular types are arranged in the same locus. The transcription of the capsular polysaccharide (cps) locus is not well understood. This study determined the transcriptional features of the cps locus in the type 2 virulent strain D39. The initial analysis revealed that the cps genes are cotranscribed from a major transcription start site at the −25 nucleotide (G) upstream of cps2A, the first gene in the locus. Using unmarked chromosomal truncations and a luciferase-based transcriptional reporter, we showed that the full transcription of the cps genes not only depends on the core promoter immediately upstream of cps2A, but also requires additional elements upstream of the core promoter, particularly a 59-bp sequence immediately upstream of the core promoter. Unmarked deletions of these promoter elements in the D39 genome also led to significant reduction in CPS production and virulence in mice. Lastly, common cps gene (cps2ABCD) mutants did not show significant abnormality in cps transcription, although they produced significantly less CPS, indicating that the CpsABCD proteins are involved in the encapsulation of S. pneumoniae in a posttranscriptional manner. This study has yielded important information on the transcriptional characteristics of the cps locus in S. pneumoniae. PMID:25733517

  1. Vertical distribution of trace-element concentrations and occurrence of metallurgical slag particles in accumulated bed sediments of Lake Roosevelt, Washington, September 2002

    USGS Publications Warehouse

    Cox, S.E.; Bell, P.R.; Lowther, J.S.; Van Metre, P.C.

    2005-01-01

    Sediment cores were collected from six locations in Lake Roosevelt to determine the vertical distributions of trace-element concentrations in the accumulated sediments of Lake Roosevelt. Elevated concentrations of arsenic, cadmium, copper, lead, mercury, and zinc occurred throughout much of the accumulated sediments. Concentrations varied greatly within the sediment core profiles, often covering a range of 5 to 10 fold. Trace-element concentrations typically were largest below the surficial sediments in the lower one-half of each profile, with generally decreasing concentrations from the 1964 horizon to the surface of the core. The trace-element profiles reflect changes in historical discharges of trace elements to the Columbia River by an upstream smelter. All samples analyzed exceeded clean-up guidelines adopted by the Confederated Tribes of the Colville Reservation for cadmium, lead, and zinc and more than 70 percent of the samples exceeded cleanup guidelines for mercury, arsenic, and copper. Although 100 percent of the samples exceeded sediment guidelines for cadmium, lead, and zinc, surficial concentrations of arsenic, copper, and mercury in some cores were less than the sediment-quality guidelines. With the exception of copper, the trace-element profiles of the five cores collected along the pre-reservoir Columbia River channel typically showed trends of decreasing concentrations in sediments deposited after the 1964 time horizon. The decreasing concentrations of trace elements in the upper half of cores from along the pre-reservoir Columbia River showed a pattern of decreasing concentrations similar to reductions in trace-element loading in liquid effluent from an upstream smelter. Except for arsenic, trace-element concentrations typically were smaller at downstream reservoir locations along the pre-reservoir Columbia River. Trace-element concentration in sediments from the Spokane Arm of the reservoir showed distinct differences compared to the similarities observed in cores from along the pre-reservoir Columbia River. Particles of slag, which have physical and chemical characteristics of slag discharged to the Columbia River by a lead-zinc smelter upstream of the reservoir at Trail, British Columbia, were found in sediments of Lake Roosevelt. Slag particles are more common in the upstream reaches of the reservoir. The chemical composition of the interior matrix of slag collected from Lake Roosevelt closely approximated the reported elemental concentrations of fresh smelter slag, although evidence of slag weathering was observed. Exfoliation flakes were observed on the surface of weathered slag particles isolated from the core sediments. The concentrations of zinc on the exposed surface of slag grains were smaller than concentrations on interior surfaces. Weathering rinds also were observed in the cross section of weathered slag grains, indicating that the glassy slag material was undergoing hydration and chemical weathering. Trace elements observed in accumulated sediments in the middle and lower reaches of the reservoir are more likely due to the input from liquid effluent discharges compared to slag discharges from the upstream smelter.

  2. Hereditary mixed polyposis syndrome is caused by a 40-kb upstream duplication that leads to increased and ectopic expression of the BMP antagonist GREM1.

    PubMed

    Jaeger, Emma; Leedham, Simon; Lewis, Annabelle; Segditsas, Stefania; Becker, Martin; Cuadrado, Pedro Rodenas; Davis, Hayley; Kaur, Kulvinder; Heinimann, Karl; Howarth, Kimberley; East, James; Taylor, Jenny; Thomas, Huw; Tomlinson, Ian

    2012-05-06

    Hereditary mixed polyposis syndrome (HMPS) is characterized by apparent autosomal dominant inheritance of multiple types of colorectal polyp, with colorectal carcinoma occurring in a high proportion of affected individuals. Here, we use genetic mapping, copy-number analysis, exclusion of mutations by high-throughput sequencing, gene expression analysis and functional assays to show that HMPS is caused by a duplication spanning the 3' end of the SCG5 gene and a region upstream of the GREM1 locus. This unusual mutation is associated with increased allele-specific GREM1 expression. Whereas GREM1 is expressed in intestinal subepithelial myofibroblasts in controls, GREM1 is predominantly expressed in the epithelium of the large bowel in individuals with HMPS. The HMPS duplication contains predicted enhancer elements; some of these interact with the GREM1 promoter and can drive gene expression in vitro. Increased GREM1 expression is predicted to cause reduced bone morphogenetic protein (BMP) pathway activity, a mechanism that also underlies tumorigenesis in juvenile polyposis of the large bowel.

  3. Two DNA-binding factors recognize specific sequences at silencers, upstream activating sequences, autonomously replicating sequences, and telomeres in Saccharomyces cerevisiae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Buchman, A.R.; Kimmerly, W.J.; Rine, J.

    1988-01-01

    Two DNA-binding factors from Saccharomyces cerevisiae have been characterized, GRFI (general regulatory factor I) and ABFI (ARS-binding factor I), that recognize specific sequences within diverse genetic elements. GRFI bound to sequences at the negative regulatory elements (silencers) of the silent mating type loci HML E and HMR E and to the upstream activating sequence (UAS) required for transcription of the MAT ..cap alpha.. genes. A putative conserved UAS located at genes involved in translation (RPG box) was also recognized by GRFI. In addition, GRFI bound with high affinity to sequences within the (C/sub 1-3/A)-repeat region at yeast telomeres. Binding sitesmore » for GRFI with the highest affinity appeared to be of the form 5'-(A/G)(A/C)ACCCAN NCA(T/C)(T/C)-3', where N is any nucleotide. ABFI-binding sites were located next to autonomously replicating sequences (ARSs) at controlling elements of the silent mating type loci HMR E, HMR I, and HML I and were associated with ARS1, ARS2, and the 2..mu..m plasmid ARS. Two tandem ABFI binding sites were found between the HIS3 and DED1 genes, several kilobase pairs from any ARS, indicating that ABFI-binding sites are not restricted to ARSs. The sequences recognized by AFBI showed partial dyad-symmetry and appeared to be variations of the consensus 5'-TATCATTNNNNACGA-3'. GRFI and ABFI were both abundant DNA-binding factors and did not appear to be encoded by the SIR genes, whose product are required for repression of the silent mating type loci. Together, these results indicate that both GRFI and ABFI play multiple roles within the cell.« less

  4. Multiple splicing defects in an intronic false exon.

    PubMed

    Sun, H; Chasin, L A

    2000-09-01

    Splice site consensus sequences alone are insufficient to dictate the recognition of real constitutive splice sites within the typically large transcripts of higher eukaryotes, and large numbers of pseudoexons flanked by pseudosplice sites with good matches to the consensus sequences can be easily designated. In an attempt to identify elements that prevent pseudoexon splicing, we have systematically altered known splicing signals, as well as immediately adjacent flanking sequences, of an arbitrarily chosen pseudoexon from intron 1 of the human hprt gene. The substitution of a 5' splice site that perfectly matches the 5' consensus combined with mutation to match the CAG/G sequence of the 3' consensus failed to get this model pseudoexon included as the central exon in a dhfr minigene context. Provision of a real 3' splice site and a consensus 5' splice site and removal of an upstream inhibitory sequence were necessary and sufficient to confer splicing on the pseudoexon. This activated context also supported the splicing of a second pseudoexon sequence containing no apparent enhancer. Thus, both the 5' splice site sequence and the polypyrimidine tract of the pseudoexon are defective despite their good agreement with the consensus. On the other hand, the pseudoexon body did not exert a negative influence on splicing. The introduction into the pseudoexon of a sequence selected for binding to ASF/SF2 or its replacement with beta-globin exon 2 only partially reversed the effect of the upstream negative element and the defective polypyrimidine tract. These results support the idea that exon-bridging enhancers are not a prerequisite for constitutive exon definition and suggest that intrinsically defective splice sites and negative elements play important roles in distinguishing the real splicing signal from the vast number of false splicing signals.

  5. Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

    PubMed

    Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

    1994-09-01

    The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

  6. OsSLI1, a homeodomain containing transcription activator, involves abscisic acid related stress response in rice (Oryza sativa L.).

    PubMed

    Huang, Xi; Duan, Min; Liao, Jiakai; Yuan, Xi; Chen, Hui; Feng, Jiejie; Huang, Ji; Zhang, Hong-Sheng

    2014-01-01

    Homeodomain-leucine zipper type I (HD-Zip I) proteins are involved in the regulation of plant development and response to environmental stresses. In this study, OsSLI1 (Oryza sativa stress largely induced 1), encoding a member of the HD-Zip I subfamily, was isolated from rice. The expression of OsSLI1 was dramatically induced by multiple abiotic stresses and exogenous abscisic acid (ABA). In silico sequence analysis discovered several cis-acting elements including multiple ABREs (ABA-responsive element binding factors) in the upstream promoter region of OsSLI1. The OsSLI1-GFP fusion protein was localized in the nucleus of rice protoplast cells and the transcriptional activity of OsSLI1 was confirmed by the yeast hybrid system. Further, it was found that OsSLI1 expression was enhanced in an ABI5-Like1 (ABL1) deficiency rice mutant abl1 under stress conditions, suggesting that ABL1 probably negatively regulates OsSLI1 gene expression. Moreover, it was found that OsSLI1 was regulated in panicle development. Taken together, OsSLI1 may be a transcriptional activator regulating stress-responsive gene expression and panicle development in rice.

  7. Contactor/filter improvements

    DOEpatents

    Stelman, D.

    1988-06-30

    A contactor/filter arrangement for removing particulate contaminants from a gaseous stream is described. The filter includes a housing having a substantially vertically oriented granular material retention member with upstream and downstream faces, a substantially vertically oriented microporous gas filter element, wherein the retention member and the filter element are spaced apart to provide a zone for the passage of granular material therethrough. A gaseous stream containing particulate contaminants passes through the gas inlet means as well as through the upstream face of the granular material retention member, passing through the retention member, the body of granular material, the microporous gas filter element, exiting out of the gas outlet means. A cover screen isolates the filter element from contact with the moving granular bed. In one embodiment, the granular material is comprised of porous alumina impregnated with CuO, with the cover screen cleaned by the action of the moving granular material as well as by backflow pressure pulses. 6 figs.

  8. The heptanucleotide motif GAGACGC is a key component of a cis-acting promoter element that is critical for SnSAG1 expression in Sarcocystis neurona.

    PubMed

    Gaji, Rajshekhar Y; Howe, Daniel K

    2009-07-01

    The apicomplexan parasite Sarcocystis neurona undergoes a complex process of intracellular development, during which many genes are temporally regulated. The described study was undertaken to begin identifying the basic promoter elements that control gene expression in S. neurona. Sequence analysis of the 5'-flanking region of five S. neurona genes revealed a conserved heptanucleotide motif GAGACGC that is similar to the WGAGACG motif described upstream of multiple genes in Toxoplasma gondii. The promoter region for the major surface antigen gene SnSAG1, which contains three heptanucleotide motifs within 135 bases of the transcription start site, was dissected by functional analysis using a dual luciferase reporter assay. These analyses revealed that a minimal promoter fragment containing all three motifs was sufficient to drive reporter molecule expression, with the presence and orientation of the 5'-most heptanucleotide motif being absolutely critical for promoter function. Further studies should help to identify additional sequence elements important for promoter function and for controlling gene expression during intracellular development by this apicomplexan pathogen.

  9. Mycobacterium tuberculosis Exploits a Molecular Off Switch of the Immune System for Intracellular Survival.

    PubMed

    von Both, Ulrich; Berk, Maurice; Agapow, Paul-Michael; Wright, Joseph D; Git, Anna; Hamilton, Melissa Shea; Goldgof, Greg; Siddiqui, Nazneen; Bellos, Evangelos; Wright, Victoria J; Coin, Lachlan J; Newton, Sandra M; Levin, Michael

    2018-01-12

    Mycobacterium tuberculosis (M. tuberculosis) survives and multiplies inside human macrophages by subversion of immune mechanisms. Although these immune evasion strategies are well characterised functionally, the underlying molecular mechanisms are poorly understood. Here we show that during infection of human whole blood with M. tuberculosis, host gene transcriptional suppression, rather than activation, is the predominant response. Spatial, temporal and functional characterisation of repressed genes revealed their involvement in pathogen sensing and phagocytosis, degradation within the phagolysosome and antigen processing and presentation. To identify mechanisms underlying suppression of multiple immune genes we undertook epigenetic analyses. We identified significantly differentially expressed microRNAs with known targets in suppressed genes. In addition, after searching regions upstream of the start of transcription of suppressed genes for common sequence motifs, we discovered novel enriched composite sequence patterns, which corresponded to Alu repeat elements, transposable elements known to have wide ranging influences on gene expression. Our findings suggest that to survive within infected cells, mycobacteria exploit a complex immune "molecular off switch" controlled by both microRNAs and Alu regulatory elements.

  10. Flanking HS-62.5 and 3' HS1, and regions upstream of the LCR, are not required for beta-globin transcription.

    PubMed

    Bender, M A; Byron, Rachel; Ragoczy, Tobias; Telling, Agnes; Bulger, Michael; Groudine, Mark

    2006-08-15

    The locus control region (LCR) was thought to be necessary and sufficient for establishing and maintaining an open beta-globin locus chromatin domain in the repressive environment of the developing erythrocyte. However, deletion of the LCR from the endogenous locus had no significant effect on chromatin structure and did not silence transcription. Thus, the cis-regulatory elements that confer the open domain remain unidentified. The conserved DNaseI hypersensitivity sites (HSs) HS-62.5 and 3'HS1 that flank the locus, and the region upstream of the LCR have been implicated in globin gene regulation. The flanking HSs bind CCCTC binding factor (CTCF) and are thought to interact with the LCR to form a "chromatin hub" involved in beta-globin gene activation. Hispanic thalassemia, a deletion of the LCR and 27 kb upstream, leads to heterochromatinization and silencing of the locus. Thus, the region upstream of the LCR deleted in Hispanic thalassemia (upstream Hispanic region [UHR]) may be required for expression. To determine the importance of the UHR and flanking HSs for beta-globin expression, we generated and analyzed mice with targeted deletions of these elements. We demonstrate deletion of these regions alone, and in combination, do not affect transcription, bringing into question current models for the regulation of the beta-globin locus.

  11. Two distinct auto-regulatory loops operate at the PU.1 locus in B cells and myeloid cells

    PubMed Central

    Leddin, Mathias; Perrod, Chiara; Hoogenkamp, Maarten; Ghani, Saeed; Assi, Salam; Heinz, Sven; Wilson, Nicola K.; Follows, George; Schönheit, Jörg; Vockentanz, Lena; Mosammam, Ali M.; Chen, Wei; Tenen, Daniel G.; Westhead, David R.; Göttgens, Berthold

    2011-01-01

    The transcription factor PU.1 occupies a central role in controlling myeloid and early B-cell development, and its correct lineage-specific expression is critical for the differentiation choice of hematopoietic progenitors. However, little is known of how this tissue-specific pattern is established. We previously identified an upstream regulatory cis element whose targeted deletion in mice decreases PU.1 expression and causes leukemia. We show here that the upstream regulatory cis element alone is insufficient to confer physiologic PU.1 expression in mice but requires the cooperation with other, previously unidentified elements. Using a combination of transgenic studies, global chromatin assays, and detailed molecular analyses we present evidence that PU.1 is regulated by a novel mechanism involving cross talk between different cis elements together with lineage-restricted autoregulation. In this model, PU.1 regulates its expression in B cells and macrophages by differentially associating with cell type–specific transcription factors at one of its cis-regulatory elements to establish differential activity patterns at other elements. PMID:21239694

  12. Steady film flow over a substrate with rectangular trenches forming air inclusions

    NASA Astrophysics Data System (ADS)

    Varchanis, S.; Dimakopoulos, Y.; Tsamopoulos, J.

    2017-12-01

    Film flow along an inclined, solid substrate featuring periodic rectangular trenches may either completely wet the trench floor (Wenzel state) or get pinned on the entrance and exit corners of the trench (Cassie state) or assume other configurations in between these two extremes. Such intermediate configurations are examined in the present study. They are bounded by a second gas-liquid interface inside the trench, which adheres to its walls forming two three-phase contact lines, and encloses a different amount of air under different physical conditions. The Galerkin finite-element method is used to solve the Navier-Stokes equations in a physical domain, which is adaptively remeshed. Multiple steady solutions, connected by turning points and transcritical bifurcations as well as isolated solution branches, are revealed by pseudo-arc-length continuation. Two possible configurations of a single air inclusion inside the trench are examined: the inclusion either surrounds the upstream convex corner or is attached to the upstream trench wall. The penetration of the liquid inside the trench is enhanced primarily by increasing either the wettability of the substrate or capillary over viscous forces or by decreasing the flow rate. Flow hysteresis may occur when the liquid wetting of the upstream wall decreases abruptly, leading to drastically different flow patterns for the same parameter values. The interplay of inertia, viscous, gravity, and capillary forces along with substrate wettability determines the volume of the air encapsulated in the trench and the extent of deformation of the outer free surface.

  13. Molecular characterization of Ambler class A to D β-lactamases, ISAba1, and integrons reveals multidrug-resistant Acinetobacter spp. isolates in northeastern China.

    PubMed

    Sun, Xiaoyu; Liu, Bin; Chen, Yan; Huang, Honglan; Wang, Guoqing; Li, Fan; Ni, Zhaohui

    2016-12-01

    The prevalence of various Ambler class A to D β-lactamases, ISAba1, and class 1 and 2 integrons as well as the clonal relatedness in 105 Acinetobacter spp. isolates found in northeastern China was investigated. All 105 Acinetobacter spp. isolates were determined to be multidrug resistant (MDR), and the resistance rates to carbapenem agents were approximately 50%. PER, IMP, AmpC, and OXA-23 were found to be dominant β-lactamases belonging to different classes, respectively. This is the first report of the coexistence of bla PER , bla IMP , bla AmpC , and bla OXA-23-like genes in Acinetobacter spp. isolates from northeastern China. ISAba1 was found upstream of the bla OXA-23-like gene in 87.8% (36/41) strains and upstream of the bla OXA-51-like gene in 26.5% (13/49) strains. ISAba3-like element was found upstream of the bla OXA-58-like gene in one bla OXA-58-like -positive strain. The presence of IntI1 was detected in 63.8% (67/105) of the isolates and the most prevalent gene cassettes were aacA4, aadA1, and catB8. The highly prevalent isolates belong to international clonal lineage (ICL)-II. These results indicate that the wide horizontal and clonal spread of MDR Acinetobacter spp. isolates harbouring multiple β-lactamase genes has become a serious problem in northeastern China.

  14. Apparatus for purifying exhaust gases of internal combustion engines

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kakinuma, A.; Oya, H.

    1980-06-03

    Apparatus for purifying the exhaust gases of internal combustion engines is disclosed that is comprised of a pair of upstream exhaust pipes, a catalytic converter, and a downstream exhaust pipe. The catalytic converter comprises a cylindrical shell having an inlet chamber, a catalyst chamber, an outlet chamber, and a monolithic catalyst element in the catalyst chamber. The inlet chamber has inlet ports communicating with the upstream exhaust pipes respectively and axial lines of the inlet ports cross each other in the inlet chamber. In the inlet chamber, a diffusion means is provided to diffuse the exhaust gas for uniformly distributingmore » it to the catalyst element.« less

  15. Structure of the human gene encoding the protein repair L-isoaspartyl (D-aspartyl) O-methyltransferase.

    PubMed

    DeVry, C G; Tsai, W; Clarke, S

    1996-11-15

    The protein L-isoaspartyl/D-aspartyl O-methyltransferase (EC 2.1.1.77) catalyzes the first step in the repair of proteins damaged in the aging process by isomerization or racemization reactions at aspartyl and asparaginyl residues. A single gene has been localized to human chromosome 6 and multiple transcripts arising through alternative splicing have been identified. Restriction enzyme mapping, subcloning, and DNA sequence analysis of three overlapping clones from a human genomic library in bacteriophage P1 indicate that the gene spans approximately 60 kb and is composed of 8 exons interrupted by 7 introns. Analysis of intron/exon splice junctions reveals that all of the donor and acceptor splice sites are in agreement with the mammalian consensus splicing sequence. Determination of transcription initiation sites by primer extension analysis of poly(A)+ mRNA from human brain identifies multiple start sites, with a major site 159 nucleotides upstream from the ATG start codon. Sequence analysis of the 5'-untranslated region demonstrates several potential cis-acting DNA elements including SP1, ETF, AP1, AP2, ARE, XRE, CREB, MED-1, and half-palindromic ERE motifs. The promoter of this methyltransferase gene lacks an identifiable TATA box but is characterized by a CpG island which begins approximately 723 nucleotides upstream of the major transcriptional start site and extends through exon 1 and into the first intron. These features are characteristic of housekeeping genes and are consistent with the wide tissue distribution observed for this methyltransferase activity.

  16. Observations on the Growth of Roughness Elements Into Icing Feathers

    NASA Technical Reports Server (NTRS)

    Vargas, Mario; Tsao, Jen, Ching

    2007-01-01

    This work presents the results of an experiment conducted in the Icing Research Tunnel at NASA Glenn Research Center to understand the process by which icing feathers are formed in the initial stages of ice accretion formation on swept wings. Close-up photographic data were taken on an aluminum NACA 0012 swept wing tip airfoil. Two types of photographic data were obtained: time sequence close-up photographic data during the run and close-up photographic data of the ice accretion at the end of each run. Icing runs were conducted for short ice accretion times from 10 to 180 sec. The time sequence close-up photographic data was used to study the process frame by frame and to create movies of how the process developed. The movies confirmed that at glaze icing conditions in the attachment line area icing feathers develop from roughness elements. The close-up photographic data at the end of each run showed that roughness elements change into a pointed shape with an upstream facet and join on the side with other elements having the same change to form ridges with pointed shape and upstream facet. The ridges develop into feathers when the upstream facet grows away to form the stem of the feather. The ridges and their growth into feathers were observed to form the initial scallop tips present in complete scallops.

  17. Transcriptional activation of Mina by Sp1/3 factors.

    PubMed

    Lian, Shangli; Potula, Hari Hara S K; Pillai, Meenu R; Van Stry, Melanie; Koyanagi, Madoka; Chung, Linda; Watanabe, Makiko; Bix, Mark

    2013-01-01

    Mina is an epigenetic gene regulatory protein known to function in multiple physiological and pathological contexts, including pulmonary inflammation, cell proliferation, cancer and immunity. We showed previously that the level of Mina gene expression is subject to natural genetic variation linked to 21 SNPs occurring in the Mina 5' region. In order to explore the mechanisms regulating Mina gene expression, we set out to molecularly characterize the Mina promoter in the region encompassing these SNPs. We used three kinds of assays--reporter, gel shift and chromatin immunoprecipitation--to analyze a 2 kb genomic fragment spanning the upstream and intron 1 regions flanking exon 1. Here we discovered a pair of Mina promoters (P1 and P2) and a P1-specific enhancer element (E1). Pharmacologic inhibition and siRNA knockdown experiments suggested that Sp1/3 transcription factors trigger Mina expression through additive activity targeted to a cluster of four Sp1/3 binding sites forming the P1 promoter. These results set the stage for comprehensive analysis of Mina gene regulation from the context of tissue specificity, the impact of inherited genetic variation and the nature of upstream signaling pathways.

  18. Transcriptional Activation of Mina by Sp1/3 Factors

    PubMed Central

    Lian, Shangli; Potula, Hari Hara S. K.; Pillai, Meenu R.; Van Stry, Melanie; Koyanagi, Madoka; Chung, Linda; Watanabe, Makiko; Bix, Mark

    2013-01-01

    Mina is an epigenetic gene regulatory protein known to function in multiple physiological and pathological contexts, including pulmonary inflammation, cell proliferation, cancer and immunity. We showed previously that the level of Mina gene expression is subject to natural genetic variation linked to 21 SNPs occurring in the Mina 5′ region [1]. In order to explore the mechanisms regulating Mina gene expression, we set out to molecularly characterize the Mina promoter in the region encompassing these SNPs. We used three kinds of assays – reporter, gel shift and chromatin immunoprecipitation – to analyze a 2 kb genomic fragment spanning the upstream and intron 1 regions flanking exon 1. Here we discovered a pair of Mina promoters (P1 and P2) and a P1-specific enhancer element (E1). Pharmacologic inhibition and siRNA knockdown experiments suggested that Sp1/3 transcription factors trigger Mina expression through additive activity targeted to a cluster of four Sp1/3 binding sites forming the P1 promoter. These results set the stage for comprehensive analysis of Mina gene regulation from the context of tissue specificity, the impact of inherited genetic variation and the nature of upstream signaling pathways. PMID:24324617

  19. The nT1 translocation separates vulval regulatory elements from the egl-18 and elt-6 GATA factor genes.

    PubMed

    Koh, Kyunghee; Bernstein, Yelena; Sundaram, Meera V

    2004-03-01

    egl-18 and elt-6 are partially redundant, adjacent genes encoding GATA factors essential for viability, seam cell development, and vulval development in Caenorhabditis elegans. The nT1 reciprocal translocation causes a strong Vulvaless phenotype, and an nT1 breakpoint was previously mapped to the left arm of LGIV, where egl-18/elt-6 are located. Here we present evidence that the nT1 vulval phenotype is due to a disruption of egl-18/elt-6 function specifically in the vulva. egl-18 mutations do not complement nT1 for vulval defects, and the nT1 breakpoint on LGIV is located within approximately 800 bp upstream of a potential transcriptional start site of egl-18. In addition, we have identified a approximately 350-bp cis-regulatory region sufficient for vulval expression just upstream of the nT1 breakpoint. By examining the fusion state and division patterns of the cells in the developing vulva of nT1 mutants, we demonstrate that egl-18/elt-6 prevent fusion and promote cell proliferation at multiple steps of vulval development.

  20. Inductively heated particulate matter filter regeneration control system

    DOEpatents

    Gonze, Eugene V; Paratore Jr., Michael J; Kirby, Kevin W; Phelps, Amanda; Gregoire, Daniel J

    2012-10-23

    A system includes a particulate matter (PM) filter with an upstream end for receiving exhaust gas, a downstream end and zones. The system also includes a heating element. A control module selectively activates the heating element to inductively heat one of the zones.

  1. Application of finite element approach to transonic flow problems

    NASA Technical Reports Server (NTRS)

    Hafez, M. M.; Murman, E. M.; Wellford, L. C., Jr.

    1976-01-01

    A variational finite element model for transonic small disturbance calculations is described. Different strategy is adopted in subsonic and supersonic regions, and blending elements are introduced between different regions. In the supersonic region, no upstream effect is allowed. If rectangular elements with linear shape functions are used, the model is similar to Murman's finite difference operators. Higher order shape functions, nonrectangular elements, and discontinuous approximation of shock waves are also discussed.

  2. Structural and functional analysis of an enhancer GPEI having a phorbol 12-O-tetradecanoate 13-acetate responsive element-like sequence found in the rat glutathione transferase P gene.

    PubMed

    Okuda, A; Imagawa, M; Maeda, Y; Sakai, M; Muramatsu, M

    1989-10-05

    We have recently identified a typical enhancer, termed GPEI, located about 2.5 kilobases upstream from the transcription initiation site of the rat glutathione transferase P gene. Analyses of 5' and 3' deletion mutants revealed that the cis-acting sequence of GPEI contained the phorbol 12-O-tetradecanoate 13-acetate responsive element (TRE)-like sequence in it. For the maximal activity, however, GPEI required an adjacent upstream sequence of about 19 base pairs in addition to the TRE-like sequence. With the DNA binding gel-shift assay, we could detect protein(s) that specifically binds to the TRE-like sequence of GPEI fragment, which was possibly c-jun.c-fos complex or a similar protein complex. The sequence immediately upstream of the TRE-like sequence did not have any activity by itself, but augmented the latter activity by about 5-fold.

  3. Optimal frequency-response sensitivity of compressible flow over roughness elements

    NASA Astrophysics Data System (ADS)

    Fosas de Pando, Miguel; Schmid, Peter J.

    2017-04-01

    Compressible flow over a flat plate with two localised and well-separated roughness elements is analysed by global frequency-response analysis. This analysis reveals a sustained feedback loop consisting of a convectively unstable shear-layer instability, triggered at the upstream roughness, and an upstream-propagating acoustic wave, originating at the downstream roughness and regenerating the shear-layer instability at the upstream protrusion. A typical multi-peaked frequency response is recovered from the numerical simulations. In addition, the optimal forcing and response clearly extract the components of this feedback loop and isolate flow regions of pronounced sensitivity and amplification. An efficient parametric-sensitivity framework is introduced and applied to the reference case which shows that first-order increases in Reynolds number and roughness height act destabilising on the flow, while changes in Mach number or roughness separation cause corresponding shifts in the peak frequencies. This information is gained with negligible effort beyond the reference case and can easily be applied to more complex flows.

  4. DNA sequence requirements for the accurate transcription of a protein-coding plastid gene in a plastid in vitro system from mustard (Sinapis alba L.)

    PubMed Central

    Link, Gerhard

    1984-01-01

    A nuclease-treated plastid extract from mustard (Sinapis alba L.) allows efficient transcription of cloned plastid DNA templates. In this in vitro system, the major runoff transcript of the truncated gene for the 32 000 mol. wt. photosystem II protein was accurately initiated from a site close to or identical with the in vivo start site. By using plasmids with deletions in the 5'-flanking region of this gene as templates, a DNA region required for efficient and selective initiation was detected ˜28-35 nucleotides upstream of the transcription start site. This region contains the sequence element TTGACA, which matches the consensus sequence for prokaryotic `−35' promoter elements. In the absence of this region, a region ˜13-27 nucleotides upstream of the start site still enables a basic level of specific transcription. This second region contains the sequence element TATATAA, which matches the consensus sequence for the `TATA' box of genes transcribed by RNA polymerase II (or B). The region between the `TATA'-like element and the transcription start site is not sufficient but may be required for specific transcription of the plastid gene. This latter region contains the sequence element TATACT, which resembles the prokaryotic `−10' (Pribnow) box. Based on the structural and transcriptional features of the 5' upstream region, a `promoter switch' mechanism is proposed, which may account for the developmentally regulated expression of this plastid gene. ImagesFig. 1.Fig. 2.Fig. 3.Fig. 4.Figure 5. PMID:16453540

  5. Estimating bioaccessibility of trace elements in particles suspended in the Athabasca River using sequential extraction.

    PubMed

    Javed, Muhammad Babar; Shotyk, William

    2018-05-10

    Employing protocols developed for polar snow and ice, water samples were collected upstream, midstream and downstream of open pit bitumen mines and upgraders along the Lower Athabasca River (AR). The purpose was to: i) estimate the bioaccessibility of trace elements associated with particulate matter in the AR using sequential extraction, and ii) determine whether their forms have been measurably impacted by industrial activities. Of the trace metals known to be enriched in bitumen (V, Ni, Mo and Re), a substantial proportion of V (78-93%) and Ni (35-81%) was found in the residual fraction representing stable minerals. In contrast, Mo and Re were partitioned mainly into more reactive forms (water soluble, acid extractable, reducible and oxidisable). Comparing the non-residual fractions in upstream versus downstream sites, only water soluble Re was significantly (P = 0.005) greater downstream of industry. In respect to the potentially toxic chalcophile elements (Cu, Pb and Tl), no measurable change was observed in Cu and Pb distribution in upstream versus downstream sites. Only residual Tl was found at upstream and midstream sites, whereas a significant proportion of Tl was also present in the reducible fraction in downstream sites. Overall, a greater proportion of trace metals in the residual fraction at midstream sites appears to be due to inputs of atmospheric dust, clearly evident in microscopic images: energy dispersive spectroscopy and x-ray diffraction analyses showed that these particles were predominantly silicates, which are assumed to have limited bioaccessibility. Copyright © 2018 Elsevier Ltd. All rights reserved.

  6. PROSPECT improves cis-acting regulatory element prediction by integrating expression profile data with consensus pattern searches

    PubMed Central

    Fujibuchi, Wataru; Anderson, John S. J.; Landsman, David

    2001-01-01

    Consensus pattern and matrix-based searches designed to predict cis-acting transcriptional regulatory sequences have historically been subject to large numbers of false positives. We sought to decrease false positives by incorporating expression profile data into a consensus pattern-based search method. We have systematically analyzed the expression phenotypes of over 6000 yeast genes, across 121 expression profile experiments, and correlated them with the distribution of 14 known regulatory elements over sequences upstream of the genes. Our method is based on a metric we term probabilistic element assessment (PEA), which is a ranking of potential sites based on sequence similarity in the upstream regions of genes with similar expression phenotypes. For eight of the 14 known elements that we examined, our method had a much higher selectivity than a naïve consensus pattern search. Based on our analysis, we have developed a web-based tool called PROSPECT, which allows consensus pattern-based searching of gene clusters obtained from microarray data. PMID:11574681

  7. Near-field flow structures about subcritical surface roughness

    NASA Astrophysics Data System (ADS)

    Doolittle, Charles J.; Drews, Scott D.; Goldstein, David B.

    2014-12-01

    Laminar flow over a periodic array of cylindrical surface roughness elements is simulated with an immersed boundary spectral method both to validate the method for subsequent studies and to examine how persistent streamwise vortices are introduced by a low Reynolds number roughness element. Direct comparisons are made with prior studies at a roughness-based Reynolds number Rek (=U(k) k/ν) of 205 and a diameter to spanwise spacing ratio d/λ of 1/3. Downstream velocity contours match present and past experiments very well. The shear layer developed over the top of the roughness element produces the downstream velocity deficit. Upstream of the roughness element, the vortex topology is found to be consistent with juncture flow experiments, creating three cores along the recirculation line. Streamtraces stemming from these upstream cores, however, have unexpectedly little effect on the downstream flowfield as lateral divergence of the boundary layer quickly dissipates their vorticity. Long physical relaxation time of the recirculating wake behind the roughness remains a prominent issue for simulating this type of flowfield.

  8. Shielded regeneration heating element for a particulate filter

    DOEpatents

    Gonze, Eugene V [Pinckney, MI; Ament, Frank [Troy, MI

    2011-01-04

    An exhaust system includes a particulate filter (PF) that is disposed downstream from an engine. The PF filters particulates within an exhaust from the engine. A heating element heats particulate matter in the PF. A catalyst substrate or a flow converter is disposed upstream from said heating element. The catalyst substrate oxidizes the exhaust prior to reception by the heating element. The flow converter converts turbulent exhaust flow to laminar exhaust flow prior to reception by the heating element.

  9. Multiple circadian transcriptional elements cooperatively regulate cell-autonomous transcriptional oscillation of Period3, a mammalian clock gene.

    PubMed

    Matsumura, Ritsuko; Akashi, Makoto

    2017-09-29

    Cell-autonomous oscillation in clock gene expression drives circadian rhythms. The development of comprehensive analytical techniques, such as bioinformatics and ChIP-sequencing, has enabled the genome-wide identification of potential circadian transcriptional elements that regulate the transcriptional oscillation of clock genes. However, detailed analyses using traditional biochemical and molecular-biological approaches, such as binding and reporter assays, are still necessary to determine whether these potential circadian transcriptional elements are actually functional and how significantly they contribute to driving transcriptional oscillation. Here, we focused on the molecular mechanism of transcriptional oscillations in the mammalian clock gene Period3 ( Per3 ). The PER3 protein is essential for robust peripheral clocks and is a key component in circadian output processes. We found three E box-like elements located upstream of human Per3 transcription start sites that additively contributed to cell-autonomous transcriptional oscillation. However, we also found that Per3 is still expressed in a circadian manner when all three E box-like elements are functionally impaired. We noted that Per3 transcription was activated by the synergistic actions of two D box-like elements and the three E box-like elements, leading to a drastic increase in circadian amplitude. Interestingly, circadian expression of Per3 was completely disrupted only when all five transcriptional elements were functionally impaired. These results indicate that three E box-like and two D box-like elements cooperatively and redundantly regulate cell-autonomous transcriptional oscillation of Per3 . © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Control of early cardiac-specific transcription of Nkx2-5 by a GATA-dependent enhancer.

    PubMed

    Lien, C L; Wu, C; Mercer, B; Webb, R; Richardson, J A; Olson, E N

    1999-01-01

    The homeobox gene Nkx2-5 is the earliest known marker of the cardiac lineage in vertebrate embryos. Nkx2-5 expression is first detected in mesodermal cells specified to form heart at embryonic day 7.5 in the mouse and expression is maintained throughout the developing and adult heart. In addition to the heart, Nkx2-5 is transiently expressed in the developing pharynx, thyroid and stomach. To investigate the mechanisms that initiate cardiac transcription during embryogenesis, we analyzed the Nkx2-5 upstream region for regulatory elements sufficient to direct expression of a lacZ transgene in the developing heart of transgenic mice. We describe a cardiac enhancer, located about 9 kilobases upstream of the Nkx2-5 gene, that fully recapitulates the expression pattern of the endogenous gene in cardiogenic precursor cells from the onset of cardiac lineage specification and throughout the linear and looping heart tube. Thereafter, as the atrial and ventricular chambers become demarcated, enhancer activity becomes restricted to the developing right ventricle. Transcription of Nkx2-5 in pharynx, thyroid and stomach is controlled by regulatory elements separable from the cardiac enhancer. This distal cardiac enhancer contains a high-affinity binding site for the cardiac-restricted zinc finger transcription factor GATA4 that is essential for transcriptional activity. These results reveal a novel GATA-dependent mechanism for activation of Nkx2-5 transcription in the developing heart and indicate that regulation of Nkx2-5 is controlled in a modular manner, with multiple regulatory regions responding to distinct transcriptional networks in different compartments of the developing heart.

  11. Refining the regulatory region upstream of SOX9 associated with 46,XX testicular disorders of Sex Development (DSD).

    PubMed

    Hyon, Capucine; Chantot-Bastaraud, Sandra; Harbuz, Radu; Bhouri, Rakia; Perrot, Nicolas; Peycelon, Matthieu; Sibony, Mathilde; Rojo, Sandra; Piguel, Xavier; Bilan, Frederic; Gilbert-Dussardier, Brigitte; Kitzis, Alain; McElreavey, Ken; Siffroi, Jean-Pierre; Bashamboo, Anu

    2015-08-01

    Disorders of Sex Development (DSD) are a heterogeneous group of disorders affecting gonad and/or genito-urinary tract development and usually the endocrine-reproductive system. A genetic diagnosis is made in only around 20% of these cases. The genetic causes of 46,XX-SRY negative testicular DSD as well as ovotesticular DSD are poorly defined. Duplications involving a region located ∼600 kb upstream of SOX9, a key gene in testis development, were reported in several cases of 46,XX DSD. Recent studies have narrowed this region down to a 78 kb interval that is duplicated or deleted respectively in 46,XX or 46,XY DSD. We identified three phenotypically normal patients presenting with azoospermia and 46,XX testicular DSD. Two brothers carried a 83.8 kb duplication located ∼600 kb upstream of SOX9 that overlapped with the previously reported rearrangements. This duplication refines the minimal region associated with 46,XX-SRY negative DSD to a 40.7-41.9 kb element located ∼600 kb upstream of SOX9. Predicted enhancer elements and evolutionary-conserved binding sites for proteins known to be involved in testis determination are located within this region. © 2015 Wiley Periodicals, Inc.

  12. Prediction of Geomagnetic Activity and Key Parameters in High-latitude Ionosphere

    NASA Technical Reports Server (NTRS)

    Khazanov, George V.; Lyatsky, Wladislaw; Tan, Arjun; Ridley, Aaron

    2007-01-01

    Prediction of geomagnetic activity and related events in the Earth's magnetosphere and ionosphere are important tasks of US Space Weather Program. Prediction reliability is dependent on the prediction method, and elements included in the prediction scheme. Two of the main elements of such prediction scheme are: an appropriate geomagnetic activity index, and an appropriate coupling function (the combination of solar wind parameters providing the best correlation between upstream solar wind data and geomagnetic activity). We have developed a new index of geomagnetic activity, the Polar Magnetic (PM) index and an improved version of solar wind coupling function. PM index is similar to the existing polar cap PC index but it shows much better correlation with upstream solar wind/IMF data and other events in the magnetosphere and ionosphere. We investigate the correlation of PM index with upstream solar wind/IMF data for 10 years (1995-2004) that include both low and high solar activity. We also have introduced a new prediction function for the predicting of cross-polar-cap voltage and Joule heating based on using both PM index and upstream solar wind/IMF data. As we show such prediction function significantly increase the reliability of prediction of these important parameters. The correlation coefficients between the actual and predicted values of these parameters are approx. 0.9 and higher.

  13. Repression of enhancer II activity by a negative regulatory element in the hepatitis B virus genome.

    PubMed Central

    Lo, W Y; Ting, L P

    1994-01-01

    Enhancer II of human hepatitis B virus has dual functions in vivo. Located at nucleotides (nt) 1646 to 1741, it can stimulate the surface and X promoters from a downstream position. Moreover, the same sequence can also function as upstream regulatory element that activates the core promoter in a position- and orientation-dependent manner. In this study, we report the identification and characterization of a negative regulatory element (NRE) upstream of enhancer II (nt 1613 to 1636) which can repress both the enhancer and upstream stimulatory function of the enhancer II sequence in differentiated liver cells. This NRE has marginal inhibitory effect by itself but a strong repressive function in the presence of a functional enhancer II. Mutational analysis reveals that sequence from nt 1616 to 1621 is required for repression of enhancer activity by the NRE. Gel shift analysis reveals that this negative regulatory region can be recognized by a specific protein factor(s) present at the 0.4 M NaCl fraction of HepG2 nuclear extracts. The discovery of the NRE indicates that HBV gene transcription is controlled by combined effects of both positive and negative regulation. It also provides a unique system with which to study the mechanism of negative regulation of gene expression. Images PMID:8107237

  14. Full duplex dense-wavelength-division-multiplexing radio-over-fiber system transmission of 75-GHz W-band frequency multiple-input multiple-output orthogonal-frequency-division-multiplexing signals with 3×12 Gbps downstream and 6 Gbps upstream

    NASA Astrophysics Data System (ADS)

    Fang, Wei Jin; Huang, Xu Guang; Yang, Kai; Zhang, Xiao Min

    2012-09-01

    We propose and demonstrate a full duplex dense-wavelength-division-multiplexing radio-over-fiber (DWDM-ROF) system for transmitting 75-GHz W-band frequency multiple-input multiple-output orthogonal-frequency-division-multiplexing (MIMO-OFDM) signals with 12 Gbps downstream and 6 Gbps upstream. The downstream transmitting terminal is based on a three-channels sextupling-frequency scheme using an external modulation of a distributed feedback laser diode (DFB-LD) and dual drive Mach-Zehnder modulator (DD-MZM) for carrying downstream signals. MIMO-OFDM algorithms effectively compensate for impairments in the wireless link. Without using costly W-band components in the transmitter, a 12 Gbps downstream transmission system operation at 75 GHz is experimentally validated. For the downstream transmission, a power penalty of less than 3 dB was observed after a 50 km single mode fiber (SMF) and 4 m wireless transmission at a bit error rate (BER) of 3.8×10-3. For the upstream transmission, we use a commercially available 1.5 GHz bandwidth reflective semiconductor optical amplifier (RSOA) to achieve 6 Gbps upstream traffic for 16 QAM-OFDM signals. A power penalty of 3 dB was observed after a 50 km SMF transmission at a BER of 3.8×10-3. The frequency of the local oscillator is reduced due to the frequency sextupling scheme. The cost of the proposed system is largely reduced.

  15. Premature terminator analysis sheds light on a hidden world of bacterial transcriptional attenuation.

    PubMed

    Naville, Magali; Gautheret, Daniel

    2010-01-01

    Bacterial transcription attenuation occurs through a variety of cis-regulatory elements that control gene expression in response to a wide range of signals. The signal-sensing structures in attenuators are so diverse and rapidly evolving that only a small fraction have been properly annotated and characterized to date. Here we apply a broad-spectrum detection tool in order to achieve a more complete view of the transcriptional attenuation complement of key bacterial species. Our protocol seeks gene families with an unusual frequency of 5' terminators found across multiple species. Many of the detected attenuators are part of annotated elements, such as riboswitches or T-boxes, which often operate through transcriptional attenuation. However, a significant fraction of candidates were not previously characterized in spite of their unmistakable footprint. We further characterized some of these new elements using sequence and secondary structure analysis. We also present elements that may control the expression of several non-homologous genes, suggesting co-transcription and response to common signals. An important class of such elements, which we called mobile attenuators, is provided by 3' terminators of insertion sequences or prophages that may be exapted as 5' regulators when inserted directly upstream of a cellular gene. We show here that attenuators involve a complex landscape of signal-detection structures spanning the entire bacterial domain. We discuss possible scenarios through which these diverse 5' regulatory structures may arise or evolve.

  16. Self-regulation of 70-kilodalton heat shock proteins in Saccharomyces cerevisiae.

    PubMed Central

    Stone, D E; Craig, E A

    1990-01-01

    To determine whether the 70-kilodalton heat shock proteins of Saccharomyces cerevisiae play a role in regulating their own synthesis, we studied the effect of overexpressing the SSA1 protein on the activity of the SSA1 5'-regulatory region. The constitutive level of Ssa1p was increased by fusing the SSA1 structural gene to the GAL1 promoter. A reporter vector consisting of an SSA1-lacZ translational fusion was used to assess SSA1 promoter activity. In a strain producing approximately 10-fold the normal heat shock level of Ssa1p, induction of beta-galactosidase activity by heat shock was almost entirely blocked. Expression of a transcriptional fusion vector in which the CYC1 upstream activating sequence of a CYC1-lacZ chimera was replaced by a sequence containing a heat shock upstream activating sequence (heat shock element 2) from the 5'-regulatory region of SSA1 was inhibited by excess Ssa1p. The repression of an SSA1 upstream activating sequence by the SSA1 protein indicates that SSA1 self-regulation is at least partially mediated at the transcriptional level. The expression of another transcriptional fusion vector, containing heat shock element 2 and a lesser amount of flanking sequence, is not inhibited when Ssa1p is overexpressed. This suggests the existence of an element, proximal to or overlapping heat shock element 2, that confers sensitivity to the SSA1 protein. Images PMID:2181281

  17. An RNA Element That Facilitates Programmed Ribosomal Readthrough in Turnip Crinkle Virus Adopts Multiple Conformations

    PubMed Central

    Kuhlmann, Micki M.; Chattopadhyay, Maitreyi; Stupina, Vera A.; Gao, Feng

    2016-01-01

    ABSTRACT Ribosome recoding is used by RNA viruses for translational readthrough or frameshifting past termination codons for the synthesis of extension products. Recoding sites, along with downstream recoding stimulatory elements (RSEs), have long been studied in reporter constructs, because these fragments alone mediate customary levels of recoding and are thus assumed to contain complete instructions for establishment of the proper ratio of termination to recoding. RSEs from the Tombusviridae and Luteoviridae are thought to be exceptions, since they contain a long-distance RNA-RNA connection with the 3′ end. This interaction has been suggested to substitute for pseudoknots, thought to be missing in tombusvirid RSEs. We provide evidence that the phylogenetically conserved RSE of the carmovirus Turnip crinkle virus (TCV) adopts an alternative, smaller structure that extends an upstream conserved hairpin and that this alternative structure is the predominant form of the RSE within nascent viral RNA in plant cells and when RNA is synthesized in vitro. The TCV RSE also contains an internal pseudoknot along with the long-distance interaction, and the pseudoknot is not compatible with the phylogenetically conserved structure. Conserved residues just past the recoding site are important for recoding, and these residues are also conserved in the RSEs of gammaretroviruses. Our data demonstrate the dynamic nature of the TCV RSE and suggest that studies using reporter constructs may not be effectively recapitulating RSE-mediated recoding within viral genomes. IMPORTANCE Ribosome recoding is used by RNA viruses to enable ribosomes to extend translation past termination codons for the synthesis of longer products. Recoding sites and a downstream recoding stimulatory element (RSE) mediate expected levels of recoding when excised and placed in reporter constructs and thus are assumed to contain complete instructions for the establishment of the proper ratio of termination to recoding. We provide evidence that most of the TCV RSE adopts an alternative structure that extends an upstream conserved hairpin and that this alternative structure, and not the phylogenetically conserved structure, is the predominant form of the RSE in RNA synthesized in vitro and in plant cells. The TCV RSE also contains an internal pseudoknot that is not compatible with the phylogenetically conserved structure and an RNA bridge to the 3′ end. These data suggest that the TCV RSE is structurally dynamic and that multiple conformations are likely required to regulate ribosomal readthrough. PMID:27440887

  18. Water-quality trends for selected sampling sites in the upper Clark Fork Basin, Montana, water years 1996-2010

    USGS Publications Warehouse

    Sando, Steven K.; Vecchia, Aldo V.; Lorenz, David L.; Barnhart, Elliott P.

    2014-01-01

    A large-scale trend analysis was done on specific conductance, selected trace elements (arsenic, cadmium, copper, iron, lead, manganese, and zinc), and suspended-sediment data for 22 sites in the upper Clark Fork Basin for water years 1996–2010. Trend analysis was conducted by using two parametric methods: a time-series model (TSM) and multiple linear regression on time, streamflow, and season (MLR). Trend results for 1996–2010 indicate moderate to large decreases in flow-adjusted concentrations (FACs) and loads of copper (and other metallic elements) and suspended sediment in Silver Bow Creek upstream from Warm Springs. Deposition of metallic elements and suspended sediment within Warm Springs Ponds substantially reduces the downstream transport of those constituents. However, mobilization of copper and suspended sediment from floodplain tailings and stream banks in the Clark Fork reach from Galen to Deer Lodge is a large source of metallic elements and suspended sediment, which also affects downstream transport of those constituents. Copper and suspended-sediment loads mobilized from within this reach accounted for about 40 and 20 percent, respectively, of the loads for Clark Fork at Turah Bridge (site 20); whereas, streamflow contributed from within this reach only accounted for about 8 percent of the streamflow at Turah Bridge. Minor changes in FACs and loads of copper and suspended sediment are indicated for this reach during 1996–2010. Clark Fork reaches downstream from Deer Lodge are relatively smaller sources of metallic elements than the reach from Galen to Deer Lodge. In general, small decreases in loads and FACs of copper and suspended sediment are indicated for Clark Fork sites downstream from Deer Lodge during 1996–2010. Thus, although large decreases in FACs and loads of copper and suspended sediment are indicated for Silver Bow Creek upstream from Warm Springs, those large decreases are not translated to the more downstream reaches largely because of temporal stationarity in constituent transport relations in the Clark Fork reach from Galen to Deer Lodge. Unlike metallic elements, arsenic (a metalloid element) in streams in the upper Clark Fork Basin typically is mostly in dissolved phase, has less variability in concentrations, and has weaker direct relations with suspended-sediment concentrations and streamflow. Arsenic trend results for 1996–2010 indicate generally moderate decreases in FACs and loads in Silver Bow Creek upstream from Opportunity. In general, small temporal changes in loads and FACs of arsenic are indicated for Silver Bow Creek and Clark Fork reaches downstream from Opportunity during 1996–2010. Contribution of arsenic (from Warm Springs Ponds, the Mill-Willow bypass, and groundwater sources) in the Silver Bow Creek reach from Opportunity to Warm Springs is a relatively large source of arsenic. Arsenic loads originating from within this reach accounted for about 11 percent of the load for Clark Fork at Turah Bridge; whereas, streamflow contributed from within this reach only accounted for about 2 percent of the streamflow at Turah Bridge.

  19. TEs or not TEs? That is the evolutionary question.

    PubMed

    Vaknin, Keren; Goren, Amir; Ast, Gil

    2009-10-23

    Transposable elements (TEs) have contributed a wide range of functional sequences to their host genomes. A recent paper in BMC Molecular Biology discusses the creation of new transcripts by transposable element insertion upstream of retrocopies and the involvement of such insertions in tissue-specific post-transcriptional regulation.

  20. Impact of hydrological alterations on river-groundwater exchange and water quality in a semi-arid area: Nueces River, Texas.

    PubMed

    Murgulet, Dorina; Murgulet, Valeriu; Spalt, Nicholas; Douglas, Audrey; Hay, Richard G

    2016-12-01

    There is a lack of understanding and methods for assessing the effects of anthropogenic disruptions, (i.e. river fragmentation due to dam construction) on the extent and degree of groundwater-surface water interaction and geochemical processes affecting the quality of water in semi-arid, coastal catchments. This study applied a novel combination of electrical resistivity tomography (ERT) and elemental and isotope geochemistry in a coastal river disturbed by extended drought and periodic flooding due to the operation of multiple dams. Geochemical analyses show that the saltwater barrier causes an increase in salinity in surface water in the downstream river as a result of limited freshwater inflows, strong evaporation effects on shallow groundwater and mostly stagnant river water, and is not due to saltwater intrusion by tidal flooding. Discharge from bank storage is dominant (~84%) in the downstream fragment and its contribution could increase salinity levels within the hyporheic zone and surface water. When surface water levels go up due to upstream freshwater releases the river temporarily displaces high salinity water trapped in the hyporheic zone to the underlying aquifer. Geochemical modeling shows a higher contribution of distant and deeper groundwater (~40%) in the upstream river and lower discharge from bank storage (~13%) through the hyporheic zone. Recharge from bank storage is a source of high salt to both upstream and downstream portions of the river but its contribution is higher below the dam. Continuous ERT imaging of the river bed complements geochemistry findings and indicate that while lithologically similar, downstream of the dam, the shallow aquifer is affected by salinization while fresher water saturates the aquifer in the upstream fragment. The relative contribution of flows (i.e. surface water releases or groundwater discharge) as related to the river fragmentation control changes of streamwater chemistry and likely impact the interpretation of seasonal trends. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Retroviruses Hijack Chromatin Loops to Drive Oncogene Expression and Highlight the Chromatin Architecture around Proto-Oncogenic Loci

    PubMed Central

    Pattison, Jillian M.; Wright, Jason B.; Cole, Michael D.

    2015-01-01

    The majority of the genome consists of intergenic and non-coding DNA sequences shown to play a major role in different gene regulatory networks. However, the specific potency of these distal elements as well as how these regions exert function across large genomic distances remains unclear. To address these unresolved issues, we closely examined the chromatin architecture around proto-oncogenic loci in the mouse and human genomes to demonstrate a functional role for chromatin looping in distal gene regulation. Using cell culture models, we show that tumorigenic retroviral integration sites within the mouse genome occur near existing large chromatin loops and that this chromatin architecture is maintained within the human genome as well. Significantly, as mutagenesis screens are not feasible in humans, we demonstrate a way to leverage existing screens in mice to identify disease relevant human enhancers and expose novel disease mechanisms. For instance, we characterize the epigenetic landscape upstream of the human Cyclin D1 locus to find multiple distal interactions that contribute to the complex cis-regulation of this cell cycle gene. Furthermore, we characterize a novel distal interaction upstream of the Cyclin D1 gene which provides mechanistic evidence for the abundant overexpression of Cyclin D1 occurring in multiple myeloma cells harboring a pathogenic translocation event. Through use of mapped retroviral integrations and translocation breakpoints, our studies highlight the importance of chromatin looping in oncogene expression, elucidate the epigenetic mechanisms crucial for distal cis-regulation, and in one particular instance, explain how a translocation event drives tumorigenesis through upregulation of a proto-oncogene. PMID:25799187

  2. Wake Instabilities Behind Discrete Roughness Elements in High Speed Boundary Layers

    NASA Technical Reports Server (NTRS)

    Choudhari, Meelan; Li, Fei; Chang, Chau-Lyan; Norris, Andrew; Edwards, Jack

    2013-01-01

    Computations are performed to study the flow past an isolated, spanwise symmetric roughness element in zero pressure gradient boundary layers at Mach 3.5 and 5.9, with an emphasis on roughness heights of less than 55 percent of the local boundary layer thickness. The Mach 5.9 cases include flow conditions that are relevant to both ground facility experiments and high altitude flight ("cold wall" case). Regardless of the Mach number, the mean flow distortion due to the roughness element is characterized by long-lived streamwise streaks in the roughness wake, which can support instability modes that did not exist in the absence of the roughness element. The higher Mach number cases reveal a variety of instability mode shapes with velocity fluctuations concentrated in different localized regions of high base flow shear. The high shear regions vary from the top of a mushroom shaped structure characterizing the centerline streak to regions that are concentrated on the sides of the mushroom. Unlike the Mach 3.5 case with nearly same values of scaled roughness height k/delta and roughness height Reynolds number Re(sub kk), the odd wake modes in both Mach 5.9 cases are significantly more unstable than the even modes of instability. Additional computations for a Mach 3.5 boundary layer indicate that the presence of a roughness element can also enhance the amplification of first mode instabilities incident from upstream. Interactions between multiple roughness elements aligned along the flow direction are also explored.

  3. Contact sheet recording with a self-acting negative air bearing

    NASA Technical Reports Server (NTRS)

    Muftu , Sinan (Inventor); Hinteregger, Hans F (Inventor)

    2000-01-01

    A flat head and a tape transport arrangement impart a wrap angle to the tape at the upstream corner of the head. The wrap angle, corner sharpness and tape stiffness are sufficient to cause a moving tape to form a hollow bump at the upstream corner, thereby creating a hollow into which entrained air can expand, causing a subambient pressure within and downstream of the bump. This pressure keeps the tape in contact with the head. It is created without the need for a groove or complex pressure relief slot(s). No contact pressure arises at the signal exchange site due to media wrap. The highest contact pressures are developed at a wrapped upstream corner. For a tape drive, traveling in both forward and reverse, the wrap can be at both the upstream and downstream (which is the reverse upstream) corners. Heads that are not flat can also be used, if the wrap angle relative to a main surface is sufficient and not too large. The wrapped head can also be used with rotating media, such as disks (floppy and hard) and rotating heads, such as helical wound heads for video recording. Multiple flat tape bearing surfaces can be separated by grooves and/or angles. Each flat can carry heads along one or more gap lines. Multiple adjacent narrow tracks can thus be written for extreme high track density recording.

  4. Genomic sequences of murine gamma B- and gamma C-crystallin-encoding genes: promoter analysis and complete evolutionary pattern of mouse, rat and human gamma-crystallins.

    PubMed

    Graw, J; Liebstein, A; Pietrowski, D; Schmitt-John, T; Werner, T

    1993-12-22

    The murine genes, gamma B-cry and gamma C-cry, encoding the gamma B- and gamma C-crystallins, were isolated from a genomic DNA library. The complete nucleotide (nt) sequences of both genes were determined from 661 and 711 bp, respectively, upstream from the first exon to the corresponding polyadenylation sites, comprising more than 2650 and 2890 bp, respectively. The new sequences were compared to the partial cDNA sequences available for the murine gamma B-cry and gamma C-cry, as well as to the corresponding genomic sequences from rat and man, at both the nt and predicted amino acid (aa) sequence levels. In the gamma B-cry promoter region, a canonical CCAAT-box, a TATA-box, putative NF-I and C/EBP sites were detected. An R-repeat is inserted 366 bp upstream from the transcription start point. In contrast, the gamma C-cry promoter does not contain a CCAAT-box, but some other putative binding sites for transcription factors (AP-2, UBP-1, LBP-1) were located by computer analysis. The promoter regions of all six gamma-cry from mouse, rat and human, except human psi gamma F-cry, were analyzed for common sequence elements. A complex sequence element of about 70-80 bp was found in the proximal promoter, which contains a gamma-cry-specific and almost invariant sequence (crygpel) of 14 nt, and ends with the also invariant TATA-box. Within the complex sequence element, a minimum of three further features specific for the gamma A-, gamma B- and gamma D/E/F-cry genes can be defined, at least two of which were recently shown to be functional. In addition to these four sequence elements, a subtype-specific structure of inverted repeats with different-sized spacers can be deduced from the multiple sequence alignment. A phylogenetic analysis based on the promoter region, as well as the complete exon 3 of all gamma-cry from mouse, rat and man, suggests separation of only five gamma-cry subtypes (gamma A-, gamma B-, gamma C-, gamma D- and gamma E/F-cry) prior to species separation.

  5. Transcription initiation from the dihydrofolate reductase promoter is positioned by HIP1 binding at the initiation site.

    PubMed

    Means, A L; Farnham, P J

    1990-02-01

    We have identified a sequence element that specifies the position of transcription initiation for the dihydrofolate reductase gene. Unlike the functionally analogous TATA box that directs RNA polymerase II to initiate transcription 30 nucleotides downstream, the positioning element of the dihydrofolate reductase promoter is located directly at the site of transcription initiation. By using DNase I footprint analysis, we have shown that a protein binds to this initiator element. Transcription initiated at the dihydrofolate reductase initiator element when 28 nucleotides were inserted between it and all other upstream sequences, or when it was placed on either side of the DNA helix, suggesting that there is no strict spatial requirement between the initiator and an upstream element. Although neither a single Sp1-binding site nor a single initiator element was sufficient for transcriptional activity, the combination of one Sp1-binding site and the dihydrofolate reductase initiator element cloned into a plasmid vector resulted in transcription starting at the initiator element. We have also shown that the simian virus 40 late major initiation site has striking sequence homology to the dihydrofolate reductase initiation site and that the same, or a similar, protein binds to both sites. Examination of the sequences at other RNA polymerase II initiation sites suggests that we have identified an element that is important in the transcription of other housekeeping genes. We have thus named the protein that binds to the initiator element HIP1 (Housekeeping Initiator Protein 1).

  6. Cloning and functional analysis of 5'-upstream region of the Pokemon gene.

    PubMed

    Yang, Yutao; Zhou, Xiaowei; Zhu, Xudong; Zhang, Chuanfu; Yang, Zhixin; Xu, Long; Huang, Peitang

    2008-04-01

    Pokemon, the POK erythroid myeloid ontogenic factor, not only regulates the expression of many genes, but also plays an important role in cell tumorigenesis. To investigate the molecular mechanism regulating expression of the Pokemon gene in humans, its 5'-upstream region was cloned and analyzed. Transient analysis revealed that the Pokemon promoter is constitutive. Deletion analysis and a DNA decoy assay indicated that the NEG-U and NEG-D elements were involved in negative regulation of the Pokemon promoter, whereas the POS-D element was mainly responsible for its strong activity. Electrophoretic mobility shift assays suggested that the NEG-U, NEG-D and POS-D elements were specifically bound by the nuclear extract from A549 cells in vitro. Mutation analysis demonstrated that cooperation of the NEG-U and NEG-D elements led to negative regulation of the Pokemon promoter. Moreover, the NEG-U and NEG-D elements needed to be an appropriate distance apart in the Pokemon promoter in order to cooperate. Taken together, our results elucidate the mechanism underlying the regulation of Pokemon gene transcription, and also define a novel regulatory sequence that may be used to decrease expression of the Pokemon gene in cancer gene therapy.

  7. Alu-derived cis-element regulates tumorigenesis-dependent gastric expression of GASDERMIN B (GSDMB).

    PubMed

    Komiyama, Hiromitsu; Aoki, Aya; Tanaka, Shigekazu; Maekawa, Hiroshi; Kato, Yoriko; Wada, Ryo; Maekawa, Takeo; Tamura, Masaru; Shiroishi, Toshihiko

    2010-02-01

    GASDERMIN B (GSDMB) belongs to the novel gene family GASDERMIN (GSDM). All GSDM family members are located in amplicons, genomic regions often amplified during cancer development. Given that GSDMB is highly expressed in cancerous cells and the locus resides in an amplicon, GSDMB may be involved in cancer development and/or progression. However, only limited information is available on GSDMB expression in tissues, normal and cancerous, from cancer patients. Furthermore, the molecular mechanisms that regulate GSDMB expression in gastric tissues are poorly understood. We investigated the spatiotemporal expression patterns of GSDMB in gastric cancer patients and the 5' regulatory sequences upstream of GSDMB. GSDMB was not expressed in the majority of normal gastric-tissue samples, and the expression level was very low in the few normal samples with GSDMB expression. Most pre-cancer samples showed moderate GSDMB expression, and most cancerous samples showed augmented GSDMB expression. Analysis of genome sequences revealed that an Alu element resides in the 5' region upstream of GSDMB. Reporter assays using intact, deleted, and mutated Alu elements clearly showed that this Alu element positively regulates GSDMB expression and that a putative IKZF binding motif in this element is crucial to upregulate GSDMB expression.

  8. Particle Velocity Measuring System

    NASA Technical Reports Server (NTRS)

    Arndt, G. Dickey (Inventor); Carl, James R. (Inventor)

    1998-01-01

    Method and apparatus are provided for determining the velocity of individual food particles within a liquid/solid food mixture that is cooked by an aseptic cooking method whereby the food mixture is heated as it flows through a flowline. At least one upstream and at least one downstream microwave transducer are provided to determine the minimum possible travel time of the fastest food particle through the flowline. In one embodiment, the upstream detector is not required. In another embodiment, a plurality of small dipole antenna markers are secured to a plurality of food particles to provide a plurality of signals as the markers pass the upstream and downstream transducers. The dipole antenna markers may also include a non-linear element to reradiate a harmonic frequency of a transmitter frequency. Upstream and downstream transducers include dipole antennas that are matched to the impedance of the food slurry and a signal transmission cable by various impedance matching means including unbalanced feed to the antennas.

  9. Trichomonas vaginalis ribosomal RNA: identification and characterisation of the transcription promoter and terminator sequences.

    PubMed

    Franco, Bernardo; Hernández, Roberto; López-Villaseñor, Imelda

    2012-09-01

    Trichomonas vaginalis is a parasitic protozoan of both medical and biological relevance. Transcriptional studies in this organism have focused mainly on type II pol promoters, whereas the elements necessary for transcription by polI or polIII have not been investigated. Here, with the aid of a transient transcription system, we characterised the rDNA intergenic region, defining both the promoter and the terminator sequences required for transcription. We defined the promoter as a compact region of approximately 180 bp. We also identified a potential upstream control element (UCE) that was located 80 bp upstream of the transcription start point (TSP). A transcription termination element was identified within a 34 bp region that was located immediately downstream of the 28S coding sequence. The function of this element depends upon polarity and the presence of both a stretch of uridine residues (U's) and a hairpin structure in the transcript. Our observations provide a strong basis for the study of DNA recognition by the polI transcriptional machinery in this early divergent organism. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. Mutations that alter a conserved element upstream of the potato virus X triple block and coat protein genes affect subgenomic RNA accumulation.

    PubMed

    Kim, K H; Hemenway, C

    1997-05-26

    The putative subgenomic RNA (sgRNA) promoter regions upstream of the potato virus X (PVX) triple block and coat protein (CP) genes contain sequences common to other potexviruses. The importance of these sequences to PVX sgRNA accumulation was determined by inoculation of Nicotiana tabacum NT1 cell suspension protoplasts with transcripts derived from wild-type and modified PVX cDNA clones. Analyses of RNA accumulation by S1 nuclease digestion and primer extension indicated that a conserved octanucleotide sequence element and the spacing between this element and the start-site for sgRNA synthesis are critical for accumulation of the two major sgRNA species. The impact of mutations on CP sgRNA levels was also reflected in the accumulation of CP. In contrast, genomic minus- and plus-strand RNA accumulation were not significantly affected by mutations in these regions. Studies involving inoculation of tobacco plants with the modified transcripts suggested that the conserved octanucleotide element functions in sgRNA accumulation and some other aspect of the infection process.

  11. Upstream regulatory elements are necessary and sufficient for transcription of a U6 RNA gene by RNA polymerase III.

    PubMed Central

    Das, G; Henning, D; Wright, D; Reddy, R

    1988-01-01

    Whereas the genes coding for trimethyl guanosine-capped snRNAs are transcribed by RNA polymerase II, the U6 RNA genes are transcribed by RNA polymerase III. In this study, we have analyzed the cis-regulatory elements involved in the transcription of a mouse U6 snRNA gene in vitro and in frog oocytes. Transcriptional analysis of mutant U6 gene constructs showed that, unlike most known cases of polymerase III transcription, intragenic sequences except the initiation nucleotide are dispensable for efficient and accurate transcription of U6 gene in vitro. Transcription of 5' deletion mutants in vitro and in frog oocytes showed that the upstream region, within 79 bp from the initiation nucleotide, contains elements necessary for U6 gene transcription. Transcription studies were carried out in frog oocytes with U6 genes containing 5' distal sequence; these studies revealed that the distal element acts as an orientation-dependent enhancer when present upstream to the gene, while it is orientation-independent but distance-dependent enhancer when placed down-stream to the U6 gene. Analysis of 3' deletion mutants showed that the transcription termination of U6 RNA is dependent on a T cluster present on the 3' end of the gene, thus providing further support to other lines of evidence that U6 genes are transcribed by RNA polymerase III. These observations suggest the involvement of a composite of components of RNA polymerase II and III transcription machineries in the transcription of U6 genes by RNA polymerase III. Images PMID:3366121

  12. High cancer-specific expression of mesothelin (MSLN) is attributable to an upstream enhancer containing a transcription enhancer factor dependent MCAT motif.

    PubMed

    Hucl, Tomas; Brody, Jonathan R; Gallmeier, Eike; Iacobuzio-Donahue, Christine A; Farrance, Iain K; Kern, Scott E

    2007-10-01

    Identification of genes with cancer-specific overexpression offers the potential to efficiently discover cancer-specific activities in an unbiased manner. We apply this paradigm to study mesothelin (MSLN) overexpression, a nearly ubiquitous, diagnostically and therapeutically useful characteristic of pancreatic cancer. We identified an 18-bp upstream enhancer, termed CanScript, strongly activating transcription from an otherwise weak tissue-nonspecific promoter and operating selectively in cells having aberrantly elevated cancer-specific MSLN transcription. Introducing mutations into CanScript showed two functionally distinct sites: an Sp1-like site and an MCAT element. Gel retardation and chromatin immunoprecipitation assays showed the MCAT element to be bound by transcription enhancer factor (TEF)-1 (TEAD1) in vitro and in vivo. The presence of TEF-1 was required for MSLN protein overexpression as determined by TEF-1 knockdown experiments. The cancer specificity seemed to be provided by a putative limiting cofactor of TEF-1 that could be outcompeted by exogenous TEF-1 only in a MSLN-overexpressing cell line. A CanScript concatemer offered enhanced activity. These results identify a TEF family member as a major regulator of MSLN overexpression, a fundamental characteristic of pancreatic and other cancers, perhaps due to an upstream and highly frequent aberrant cellular activity. The CanScript sequence represents a modular element for cancer-specific targeting, potentially suitable for nearly a third of human malignancies.

  13. Cross-talk between abscisic acid-dependent and abscisic acid-independent pathways during abiotic stress.

    PubMed

    Roychoudhury, Aryadeep; Paul, Saikat; Basu, Supratim

    2013-07-01

    Salinity, drought and low temperature are the common forms of abiotic stress encountered by land plants. To cope with these adverse environmental factors, plants execute several physiological and metabolic responses. Both osmotic stress (elicited by water deficit or high salt) and cold stress increase the endogenous level of the phytohormone abscisic acid (ABA). ABA-dependent stomatal closure to reduce water loss is associated with small signaling molecules like nitric oxide, reactive oxygen species and cytosolic free calcium, and mediated by rapidly altering ion fluxes in guard cells. ABA also triggers the expression of osmotic stress-responsive (OR) genes, which usually contain single/multiple copies of cis-acting sequence called abscisic acid-responsive element (ABRE) in their upstream regions, mostly recognized by the basic leucine zipper-transcription factors (TFs), namely, ABA-responsive element-binding protein/ABA-binding factor. Another conserved sequence called the dehydration-responsive element (DRE)/C-repeat, responding to cold or osmotic stress, but not to ABA, occurs in some OR promoters, to which the DRE-binding protein/C-repeat-binding factor binds. In contrast, there are genes or TFs containing both DRE/CRT and ABRE, which can integrate input stimuli from salinity, drought, cold and ABA signaling pathways, thereby enabling cross-tolerance to multiple stresses. A strong candidate that mediates such cross-talk is calcium, which serves as a common second messenger for abiotic stress conditions and ABA. The present review highlights the involvement of both ABA-dependent and ABA-independent signaling components and their interaction or convergence in activating the stress genes. We restrict our discussion to salinity, drought and cold stress.

  14. Role of UME6 in transcriptional regulation of a DNA repair gene in Saccharomyces cerevisiae.

    PubMed

    Sweet, D H; Jang, Y K; Sancar, G B

    1997-11-01

    In Saccharomyces cerevisiae UV radiation and a variety of chemical DNA-damaging agents induce the transcription of specific genes, including several involved in DNA repair. One of the best characterized of these genes is PHR1, which encodes the apoenzyme for DNA photolyase. Basal-level and damage-induced expression of PHR1 require an upstream activation sequence, UAS(PHR1), which has homology with DRC elements found upstream of at least 19 other DNA repair and DNA metabolism genes in yeast. Here we report the identification of the UME6 gene of S. cerevisiae as a regulator of UAS(PHR1) activity. Multiple copies of UME6 stimulate expression from UAS(PHR1) and the intact PHR1 gene. Surprisingly, the effect of deletion of UME6 is growth phase dependent. In wild-type cells PHR1 is induced in late exponential phase, concomitant with the initiation of glycogen accumulation that precedes the diauxic shift. Deletion of UME6 abolishes this induction, decreases the steady-state concentration of photolyase molecules and PHR1 mRNA, and increases the UV sensitivity of a rad2 mutant. Despite the fact that UAS(PHR1) does not contain the URS1 sequence, which has been previously implicated in UME6-mediated transcriptional regulation, we find that Ume6p binds to UAS(PHR1) with an affinity and a specificity similar to those seen for a URS1 site. Similar binding is also seen for DRC elements from RAD2, RAD7, and RAD53, suggesting that UME6 contributes to the regulated expression of a subset of damage-responsive genes in yeast.

  15. Computation of Feedback Aeroacoustic System by the CE/SE Method

    NASA Technical Reports Server (NTRS)

    Loh, Ching Y.; Wang, Xiao Y.; Chang, Sin-Chung; Jorgenson, Philip C. E.

    2000-01-01

    It is well known that due to vortex shedding in high speed flow over cutouts, cavities, and gaps, intense noise may be generated. Strong tonal oscillations occur in a feedback cycle in which the vortices shed from the upstream edge of the cavity convect downstream and impinge on the cavity lip, generating acoustic waves that propagate upstream to excite new vortices. Numerical simulation of such a complicated process requires a scheme that can: (1) resolve acoustic waves with low dispersion and numerical dissipation, (2) handle nonlinear and discontinuous waves (e.g. shocks), and (3) have an effective (near field) nonreflecting boundary condition (NRBC). The new space time conservation element and solution element method, or CE/SE for short, is a numerical method that meets the above requirements.

  16. Promoter and Terminator Discovery and Engineering.

    PubMed

    Deaner, Matthew; Alper, Hal S

    Control of gene expression is crucial to optimize metabolic pathways and synthetic gene networks. Promoters and terminators are stretches of DNA upstream and downstream (respectively) of genes that control both the rate at which the gene is transcribed and the rate at which mRNA is degraded. As a result, both of these elements control net protein expression from a synthetic construct. Thus, it is highly important to discover and engineer promoters and terminators with desired characteristics. This chapter highlights various approaches taken to catalogue these important synthetic elements. Specifically, early strategies have focused largely on semi-rational techniques such as saturation mutagenesis to diversify native promoters and terminators. Next, in an effort to reduce the length of the synthetic biology design cycle, efforts in the field have turned towards the rational design of synthetic promoters and terminators. In this vein, we cover recently developed methods such as hybrid engineering, high throughput characterization, and thermodynamic modeling which allow finer control in the rational design of novel promoters and terminators. Emphasis is placed on the methodologies used and this chapter showcases the utility of these methods across multiple host organisms.

  17. Functional characterization of the 5'-flanking and the promoter region of the human UCP3 (hUCP3) gene.

    PubMed

    Tu, N; Chen, H; Winnikes, U; Reinert, I; Pirke, K M; Lentes, K U

    2000-09-22

    Uncoupling protein-3 (UCP3) is considered as an important regulator of energy expenditure and thermogenesis in humans. To get insight into the mechanisms regulating its expression we have cloned and characterized about 5 kb of the 5'-flanking region of the human UCP3 (hUCP3) gene. 5'-RACE analysis suggested a single transcription initiation site 187 bp upstream from the translational start site. The promoter region contains both TATA and CAAT boxes as well as consensus motifs for PPRE, TRE, CRE and muscle-specific factors like MyoD and MEF2 sites. Functional characterization of a 3 kb hUCP3 promoter fragment in multiple cell lines using a CAT-ELISA identified a cis-acting negative regulatory element between -2983 and -982 while the region between -982 and -284 showed greatly increased basal promoter activity suggesting the presence of a strong enhancer element. Promoter activity was particularly enhanced in the murine skeletal muscle cell line C2C12 reflecting the tissue-selective expression pattern of UCP3.

  18. In-cell SHAPE uncovers dynamic interactions between the untranslated regions of the foot-and-mouth disease virus RNA.

    PubMed

    Diaz-Toledano, Rosa; Lozano, Gloria; Martinez-Salas, Encarnacion

    2017-02-17

    The genome of RNA viruses folds into 3D structures that include long-range RNA–RNA interactions relevant to control critical steps of the viral cycle. In particular, initiation of translation driven by the IRES element of foot-and-mouth disease virus is stimulated by the 3΄UTR. Here we sought to investigate the RNA local flexibility of the IRES element and the 3΄UTR in living cells. The SHAPE reactivity observed in vivo showed statistically significant differences compared to the free RNA, revealing protected or exposed positions within the IRES and the 3΄UTR. Importantly, the IRES local flexibility was modified in the presence of the 3΄UTR, showing significant protections at residues upstream from the functional start codon. Conversely, presence of the IRES element in cis altered the 3΄UTR local flexibility leading to an overall enhanced reactivity. Unlike the reactivity changes observed in the IRES element, the SHAPE differences of the 3΄UTR were large but not statistically significant, suggesting multiple dynamic RNA interactions. These results were supported by covariation analysis, which predicted IRES-3΄UTR conserved helices in agreement with the protections observed by SHAPE probing. Mutational analysis suggested that disruption of one of these interactions could be compensated by alternative base pairings, providing direct evidences for dynamic long-range interactions between these distant elements of the viral genome.

  19. Improved Dual-Luciferase Reporter Assays for Nuclear Receptors

    PubMed Central

    Paguio, Aileen; Stecha, Pete; Wood, Keith V; Fan, Frank

    2010-01-01

    Nuclear receptors play important roles in many cellular functions through control of gene transcription. It is also a large target class for drug discovery. Luciferase reporter assays are frequently used to study nuclear receptor function because of their wide dynamic range, low endogenous activity, and ease of use. Recent improvements of luciferase genes and vectors have further enhanced their utilities. Here we applied these improvements to two reporter formats for studying nuclear receptors. The first assay contains a Murine Mammary Tumor Virus promoter upstream of a destabilized luciferase. The presence of response elements for nuclear hormone receptor in this promoter allows the studies of endogenous and/or exogenous full length receptors. The second assay contains a ligand binding domain (LBD) of a nuclear receptor fused to the GAL4 DNA binding domain (DBD) on one vector and multiple Gal4 Upstream Activator Sequences (UAS) upstream of luciferase reporter on another vector. We showed that codon optimization of luciferase reporter genes increased expression levels in conjunction with the incorporation of protein destabilizing sequences into luciferase led to a larger assay dynamic range in both formats. The optimum number of UAS to generate the best response was determined. The expression vector for nuclear receptor LBD/GAL4 DBD fusion also constitutively expresses a Renilla luciferase-neoR fusion protein, which provides selection capability (G418 resistance, neoR) as well as an internal control (Renilla luciferase). This dual-luciferase format allowed detecting compound cytotoxicity or off-target change in expression during drug screening, therefore improved data quality. These luciferase reporter assays provided better research and drug discovery tools for studying the functions of full length nuclear receptors and ligand binding domains. PMID:21687560

  20. Characterization of the human UDP-galactose:ceramide galactosyltransferase gene promoter.

    PubMed

    Tencomnao, T; Yu, R K; Kapitonov, D

    2001-02-16

    UDP-galactose:ceramide galactosyltransferase (CGT, EC 2.4.1.45) is a key enzyme in the biosynthesis of galactocerebroside, the most abundant glycosphingolipid in the myelin sheath. An 8 kb fragment upstream from the transcription initiation site of CGT gene was isolated from a human genomic DNA library. Primer extension analysis revealed a single transcription initiation site 329 bp upstream from the ATG start codon. Neither a consensus TATA nor a CCAAT box was identified in the proximity to the transcription start site; however, this region contains a high GC content and multiple putative regulatory elements. To investigate the transcriptional regulation of CGT, a series of 5' deletion constructs of the 5'-flanking region were generated and cloned upstream from the luciferase reporter gene. By comparing promoter activity in the human oligodendroglioma (HOG) and human neuroblastoma (LAN-5) cell lines, we found that the CGT promoter functions in a cell type-specific manner. Three positive cis-acting regulatory regions were identified, including a proximal region at -292/-256 which contains the potential binding sites for known transcription factors (TFs) such as Ets and SP1 (GC box), a distal region at -747/-688 comprising a number of binding sites such as the ERE half-site, NF1-like, TGGCA-BP, and CRE, and a third positive cis-acting region distally localized at -1325/-1083 consisting of binding sites for TFs such as nitrogen regulatory, TCF-1, TGGCA-BP, NF-IL6, CF1, bHLH, NF1-like, GATA, and gamma-IRE. A negative cis-acting domain localized in a far distal region at -1594/-1326 was also identified. Our results suggest the presence of both positive and negative cis-regulatory regions essential for the cell-specific expression in the TATA-less promoter of the human CGT gene.

  1. Nuclear reactor control

    DOEpatents

    Cawley, William E.; Warnick, Robert F.

    1982-01-01

    1. In a nuclear reactor incorporating a plurality of columns of tubular fuel elements disposed in horizontal tubes in a mass of graphite wherein water flows through the tubes to cool the fuel elements, the improvement comprising at least one control column disposed in a horizontal tube including fewer fuel elements than in a normal column of fuel elements and tubular control elements disposed at both ends of said control column, and means for varying the horizontal displacement of the control column comprising a winch at the upstream end of the control column and a cable extending through the fuel and control elements and attached to the element at the downstream end of the column.

  2. Multiple Cis-acting elements modulate programmed -1 ribosomal frameshifting in Pea enation mosaic virus

    PubMed Central

    Gao, Feng; Simon, Anne E.

    2016-01-01

    Programmed -1 ribosomal frameshifting (-1 PRF) is used by many positive-strand RNA viruses for translation of required products. Despite extensive studies, it remains unresolved how cis-elements just downstream of the recoding site promote a precise level of frameshifting. The Umbravirus Pea enation mosaic virus RNA2 expresses its RNA polymerase by -1 PRF of the 5′-proximal ORF (p33). Three hairpins located in the vicinity of the recoding site are phylogenetically conserved among Umbraviruses. The central Recoding Stimulatory Element (RSE), located downstream of the p33 termination codon, is a large hairpin with two asymmetric internal loops. Mutational analyses revealed that sequences throughout the RSE and the RSE lower stem (LS) structure are important for frameshifting. SHAPE probing of mutants indicated the presence of higher order structure, and sequences in the LS may also adapt an alternative conformation. Long-distance pairing between the RSE and a 3′ terminal hairpin was less critical when the LS structure was stabilized. A basal level of frameshifting occurring in the absence of the RSE increases to 72% of wild-type when a hairpin upstream of the slippery site is also deleted. These results suggest that suppression of frameshifting may be needed in the absence of an active RSE conformation. PMID:26578603

  3. Morphine biosynthesis in opium poppy involves two cell types: sieve elements and laticifers.

    PubMed

    Onoyovwe, Akpevwe; Hagel, Jillian M; Chen, Xue; Khan, Morgan F; Schriemer, David C; Facchini, Peter J

    2013-10-01

    Immunofluorescence labeling and shotgun proteomics were used to establish the cell type-specific localization of morphine biosynthesis in opium poppy (Papaver somniferum). Polyclonal antibodies for each of six enzymes involved in converting (R)-reticuline to morphine detected corresponding antigens in sieve elements of the phloem, as described previously for all upstream enzymes transforming (S)-norcoclaurine to (S)-reticuline. Validated shotgun proteomics performed on whole-stem and latex total protein extracts generated 2031 and 830 distinct protein families, respectively. Proteins corresponding to nine morphine biosynthetic enzymes were represented in the whole stem, whereas only four of the final five pathway enzymes were detected in the latex. Salutaridine synthase was detected in the whole stem, but not in the latex subproteome. The final three enzymes converting thebaine to morphine were among the most abundant active latex proteins despite a limited occurrence in laticifers suggested by immunofluorescence labeling. Multiple charge isoforms of two key O-demethylases in the latex were revealed by two-dimensional immunoblot analysis. Salutaridine biosynthesis appears to occur only in sieve elements, whereas conversion of thebaine to morphine is predominant in adjacent laticifers, which contain morphine-rich latex. Complementary use of immunofluorescence labeling and shotgun proteomics has substantially resolved the cellular localization of morphine biosynthesis in opium poppy.

  4. Computational methods in sequence and structure prediction

    NASA Astrophysics Data System (ADS)

    Lang, Caiyi

    This dissertation is organized into two parts. In the first part, we will discuss three computational methods for cis-regulatory element recognition in three different gene regulatory networks as the following: (a) Using a comprehensive "Phylogenetic Footprinting Comparison" method, we will investigate the promoter sequence structures of three enzymes (PAL, CHS and DFR) that catalyze sequential steps in the pathway from phenylalanine to anthocyanins in plants. Our result shows there exists a putative cis-regulatory element "AC(C/G)TAC(C)" in the upstream of these enzyme genes. We propose this cis-regulatory element to be responsible for the genetic regulation of these three enzymes and this element, might also be the binding site for MYB class transcription factor PAP1. (b) We will investigate the role of the Arabidopsis gene glutamate receptor 1.1 (AtGLR1.1) in C and N metabolism by utilizing the microarray data we obtained from AtGLR1.1 deficient lines (antiAtGLR1.1). We focus our investigation on the putatively co-regulated transcript profile of 876 genes we have collected in antiAtGLR1.1 lines. By (a) scanning the occurrence of several groups of known abscisic acid (ABA) related cisregulatory elements in the upstream regions of 876 Arabidopsis genes; and (b) exhaustive scanning of all possible 6-10 bps motif occurrence in the upstream regions of the same set of genes, we are able to make a quantative estimation on the enrichment level of each of the cis-regulatory element candidates. We finally conclude that one specific cis-regulatory element group, called "ABRE" elements, are statistically highly enriched within the 876-gene group as compared to their occurrence within the genome. (c) We will introduce a new general purpose algorithm, called "fuzzy REDUCE1", which we have developed recently for automated cis-regulatory element identification. In the second part, we will discuss our newly devised protein design framework. With this framework we have developed a software package which is capable of designing novel protein structures at the atomic resolution. This software package allows us to perform protein structure design with a flexible backbone. The backbone flexibility includes loop region relaxation as well as a secondary structure collective mode relaxation scheme. (Abstract shortened by UMI.)

  5. Submarine Alkalic Lavas Around the Hawaiian Hotspot; Plume and Non-Plume Signatures Determined by Noble Gases

    NASA Astrophysics Data System (ADS)

    Hanyu, T.; Clague, D. A.; Kaneoka, I.; Dunai, T. J.; Davies, G. R.

    2004-12-01

    Noble gas isotopic ratios were determined for submarine alkalic volcanic rocks distributed around the Hawaiian islands to constrain the origin of such alkalic volcanism. Samples were collected by dredging or using submersibles from the Kauai Channel between Oahu and Kauai, north of Molokai, northwest of Niihau, Southwest Oahu, South Arch and North Arch volcanic fields. Sites located downstream from the center of the hotspot have 3He/4He ratios close to MORB at about 8 Ra, demonstrating that the magmas erupted at these sites had minimum contribution of volatiles from a mantle plume. In contrast, the South Arch, located upstream of the hotspot on the Hawaiian Arch, has 3He/4He ratios between 17 and 21 Ra, indicating a strong plume influence. Differences in noble gas isotopic characteristics between alkalic volcanism downstream and upstream of the hotspot imply that upstream volcanism contains incipient melts from an upwelling mantle plume, having primitive 3He/4He. In combination with lithophile element isotopic data, we conclude that the most likely source of the upstream magmatism is depleted asthenospheric mantle that has been metasomatised by incipient melt from a mantle plume. After major melt extraction from the mantle plume during production of magmas for the shield stage, the plume material is highly depleted in noble gases and moderately depleted in lithophile elements. Partial melting of the depleted mantle impregnated by melts derived from this volatile depleted plume source may explain the isotopic characteristics of the downstream alkalic magmatism.

  6. FAT1 cadherin acts upstream of Hippo signalling through TAZ to regulate neuronal differentiation.

    PubMed

    Ahmed, Abdulrzag F; de Bock, Charles E; Lincz, Lisa F; Pundavela, Jay; Zouikr, Ihssane; Sontag, Estelle; Hondermarck, Hubert; Thorne, Rick F

    2015-12-01

    The Hippo pathway is emerging as a critical nexus that balances self-renewal of progenitors against differentiation; however, upstream elements in vertebrate Hippo signalling are poorly understood. High expression of Fat1 cadherin within the developing neuroepithelium and the manifestation of severe neurological phenotypes in Fat1-knockout mice suggest roles in neurogenesis. Using the SH-SY5Y model of neuronal differentiation and employing gene silencing techniques, we show that FAT1 acts to control neurite outgrowth, also driving cells towards terminal differentiation via inhibitory effects on proliferation. FAT1 actions were shown to be mediated through Hippo signalling where it activated core Hippo kinase components and antagonised functions of the Hippo effector TAZ. Suppression of FAT1 promoted the nucleocytoplasmic shuttling of TAZ leading to enhanced transcription of the Hippo target gene CTGF together with accompanying increases in nuclear levels of Smad3. Silencing of TAZ reversed the effects of FAT1 depletion thus connecting inactivation of TAZ-TGFbeta signalling with Hippo signalling mediated through FAT1. These findings establish FAT1 as a new upstream Hippo element regulating early stages of differentiation in neuronal cells.

  7. Identification of a negative element in the human vimentin promoter: modulation by the human T-cell leukemia virus type I Tax protein.

    PubMed Central

    Salvetti, A; Lilienbaum, A; Li, Z; Paulin, D; Gazzolo, L

    1993-01-01

    The vimentin gene is a member of the intermediate filament multigene family and encodes a protein expressed, in vivo, in all mesenchymal derivatives and, in vitro, in cell types of various origin. We have previously demonstrated that the expression of this growth-regulated gene could be trans activated by the 40-kDa Tax protein of HTLV-I (human T-cell leukemia virus type I) and that responsiveness to this viral protein was mediated by the presence of an NF-kappa B binding site located between -241 and -210 bp upstream of the mRNA cap site (A. Lilienbaum, M. Duc Dodon, C. Alexandre, L. Gazzolo, and D. Paulin, J. Virol. 64:256-263, 1990). These previous assays, performed with deletion mutants of the vimentin promoter linked to the chloramphenicol acetyltransferase gene, also revealed the presence of an upstream negative region between -529 and -241 bp. Interestingly, the inhibitory activity exerted by this negative region was overcome after cotransfection of a Tax-expressing plasmid. In this study, we further characterize the vimentin negative element and define the effect of the Tax protein on the inhibitory activity of this element. We first demonstrate that a 187-bp domain (-424 to -237 bp) behaves as a negative region when placed upstream either of the NF-kappa B binding site of vimentin or of a heterologous enhancer such as that present in the desmin gene promoter. The negative effect can be further assigned to a 32-bp element which is indeed shown to repress the basal or induced activity of the NF-kappa B binding site.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:8417364

  8. The yeast DNA ligase gene CDC9 is controlled by six orientation specific upstream activating sequences that respond to cellular proliferation but which alone cannot mediate cell cycle regulation.

    PubMed Central

    White, J H; Johnson, A L; Lowndes, N F; Johnston, L H

    1991-01-01

    By fusing the CDC9 structural gene to the PGK upstream sequences and the CDC9 upstream to lacZ, we showed that the cell cycle expression of CDC9 is largely due to transcriptional regulation. To investigate the role of six ATGATT upstream repeats in CDC9 regulation, synthetic copies of the sequence were attached to a heterologous gene. The repeats stimulated transcription strongly and additively, but, unlike conventional yeast UAS elements, only when present in one orientation. Transcription driven by the repeats declines in cells held at START of the cell cycle or in stationary phase, as occurs with CDC9. However, the repeats by themselves cannot impart cell cycle regulation to a heterologous gene. CDC9 may therefore be controlled by an activating system operating through the repeats that is sensitive to cellular proliferation and a separate mechanism that governs the periodic expression in the cell cycle. Images PMID:1901644

  9. Nutrient, suspended sediment, and trace element loads in the Blackstone River Basin in Massachusetts and Rhode Island, 2007 to 2009

    USGS Publications Warehouse

    Zimmerman, Marc J.; Waldron, Marcus C.; DeSimone, Leslie A.

    2015-01-01

    Analysis of the representative constituents (total phosphorus, total chromium, and suspended sediment) upstream and downstream of impoundments indicated that the existing impoundments, such as Rice City Pond, can be sources of particulate contaminant loads in the Blackstone River. Loads of particulate phosphorus, particulate chromium, and suspended sediment were consistently higher downstream from Rice City Pond than upstream during high-flow events, and there was a positive, linear relation between streamflow and changes in these constituents from upstream to downstream of the impoundment. Thus, particulate contaminants were mobilized from Rice City Pond during high-flow events and transported downstream. In contrast, downstream loads of particulate phosphorus, particulate chromium, and suspended sediment were generally lower than or equal to upstream loads for the former Rockdale Pond impoundment. Sediments associated with the former impoundment at Rockdale Pond, breached in the late 1960s, did not appear to be mobilized during the high-flow events monitored during this study.

  10. Regulatory elements of Caenorhabditis elegans ribosomal protein genes

    PubMed Central

    2012-01-01

    Background Ribosomal protein genes (RPGs) are essential, tightly regulated, and highly expressed during embryonic development and cell growth. Even though their protein sequences are strongly conserved, their mechanism of regulation is not conserved across yeast, Drosophila, and vertebrates. A recent investigation of genomic sequences conserved across both nematode species and associated with different gene groups indicated the existence of several elements in the upstream regions of C. elegans RPGs, providing a new insight regarding the regulation of these genes in C. elegans. Results In this study, we performed an in-depth examination of C. elegans RPG regulation and found nine highly conserved motifs in the upstream regions of C. elegans RPGs using the motif discovery algorithm DME. Four motifs were partially similar to transcription factor binding sites from C. elegans, Drosophila, yeast, and human. One pair of these motifs was found to co-occur in the upstream regions of 250 transcripts including 22 RPGs. The distance between the two motifs displayed a complex frequency pattern that was related to their relative orientation. We tested the impact of three of these motifs on the expression of rpl-2 using a series of reporter gene constructs and showed that all three motifs are necessary to maintain the high natural expression level of this gene. One of the motifs was similar to the binding site of an orthologue of POP-1, and we showed that RNAi knockdown of pop-1 impacts the expression of rpl-2. We further determined the transcription start site of rpl-2 by 5’ RACE and found that the motifs lie 40–90 bases upstream of the start site. We also found evidence that a noncoding RNA, contained within the outron of rpl-2, is co-transcribed with rpl-2 and cleaved during trans-splicing. Conclusions Our results indicate that C. elegans RPGs are regulated by a complex novel series of regulatory elements that is evolutionarily distinct from those of all other species examined up until now. PMID:22928635

  11. Double-multiple streamtube model for Darrieus in turbines

    NASA Technical Reports Server (NTRS)

    Paraschivoiu, I.

    1981-01-01

    An analytical model is proposed for calculating the rotor performance and aerodynamic blade forces for Darrieus wind turbines with curved blades. The method of analysis uses a multiple-streamtube model, divided into two parts: one modeling the upstream half-cycle of the rotor and the other, the downstream half-cycle. The upwind and downwind components of the induced velocities at each level of the rotor were obtained using the principle of two actuator disks in tandem. Variation of the induced velocities in the two parts of the rotor produces larger forces in the upstream zone and smaller forces in the downstream zone. Comparisons of the overall rotor performance with previous methods and field test data show the important improvement obtained with the present model. The calculations were made using the computer code CARDAA developed at IREQ. The double-multiple streamtube model presented has two major advantages: it requires a much shorter computer time than the three-dimensional vortex model and is more accurate than multiple-streamtube model in predicting the aerodynamic blade loads.

  12. Multiple functions of a multi-component mating pheromone in sea lamprey Petromyzon marinus

    USGS Publications Warehouse

    Johnson, N.S.; Yun, S.-S.; Buchinger, T.J.; Li, W.

    2012-01-01

    The role of the C24 sulphate in the mating pheromone component, 7α,12α,24-trihydroxy-5α-cholan-3-one 24-sulphate (3kPZS), to specifically induce upstream movement in ovulated female sea lampreys Petromyzon marinus was investigated. 7α,12α-dihydroxy-5α-cholan-3-one 24-oic acid (3kACA), a structurally similar bile acid released by spermiated males, but lacking the C24 sulphate ester, was tested in bioassays at concentrations between 10−11 and 10−14 molar (M). 3kACA did not induce upstream movement in females or additional reproductive behaviours. In contrast, spermiated male washings induced upstream movement, prolonged retention on a nest and induced an array of nesting behaviours. Differential extraction and elution by solid-phase extraction resins showed that components other than 3kPZS + 3kACA are necessary to retain females on nests and induce nest cleaning behaviours. All pheromone components, including components in addition to 3kPZS + 3kACA that retain females and induce nest cleaning behaviours were released from the anterior region of the males, as had been reported for 3kPZS. It is concluded that the sea lamprey male mating pheromone has multiple functions and is composed of multiple components.

  13. Compressor Stator Time-Variant Aerodynamic Response to Upstream Rotor Wakes.

    DTIC Science & Technology

    1976-11-01

    periodic varia t i ons in pressure , velocity and flow direction in the exit field of an upstream element , wh i ch appea r as temporall y vary ing in a...compressor features blad i ng (42 rotor blades and 40 stator vanes , NACA 65 F Series ) that is aerodynamicall y l oaded to levels that are typical of...measurements were accom- — p lished by instrumenting a pair of the NACA Series 65 stator — vanes with flush mounted Ku lite thin -line des i gn dynamic

  14. Barriers impede upstream spawning migration of flathead chub

    USGS Publications Warehouse

    Walters, David M.; Zuellig, Robert E.; Crockett, Harry J.; Bruce, James F.; Lukacs, Paul M.; Fitzpatrick, Ryan M.

    2014-01-01

    Many native cyprinids are declining throughout the North American Great Plains. Some of these species require long reaches of contiguous, flowing riverine habitat for drifting eggs or larvae to develop, and their declining populations have been attributed to habitat fragmentation or barriers (e.g., dams, dewatered channels, and reservoirs) that restrict fish movement. Upstream dispersal is also needed to maintain populations of species with passively drifting eggs or larvae, and prior researchers have suggested that these fishes migrate upstream to spawn. To test this hypothesis, we conducted a mark–recapture study of Flathead Chub Platygobio gracilis within a 91-km reach of continuous riverine habitat in Fountain Creek, Colorado. We measured CPUE, spawning readiness (percent of Flathead Chub expressing milt), and fish movement relative to a channel-spanning dam. Multiple lines of evidence indicate that Flathead Chub migrate upstream to spawn during summer. The CPUE was much higher at the base of the dam than at downstream sites; the seasonal increases in CPUE at the dam closely tracked seasonal increases in spawning readiness, and marked fish moved upstream as far as 33 km during the spawning run. The upstream migration was effectively blocked by the dam. The CPUE of Flathead Chub was much lower upstream of the OHDD than at downstream sites, and <0.2% of fish marked at the dam were recaptured upstream. This study provides the first direct evidence of spawning migration for Flathead Chub and supports the general hypothesis that barriers limit adult dispersal of these and other plains fishes.

  15. Effects of metals on a montane aquatic system evaluated using an integrated assessment approach

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Beltman, D.; Lipton, J.; Cacela, D.

    Surface water, benthic invertebrates, aufwuchs, and sediments were sampled in a Rocky Mountain stream impacted by a cobalt-copper mine. A randomized study design was employed to ensure valid inferences beyond the areas sampled. As, Co, and Cu concentrations in all media downstream of the mine were 1--3 orders of magnitude greater than concentrations upstream, and concentrations in invertebrates were greater than those that adversely affect trout via dietary intake. Correlational analysis shows that bioaccumulation mechanisms and pathways between the different media differ from element to element; the differences are related to geochemical characteristics of the elements. The benthic invertebrate communitymore » is severely impacted for at least 50 km downstream of the mine: Ephemeropteran density, number of taxa, and total biomass are as low as 0.1% of values upstream. Other indices of the effects of metals on invertebrate communities that have been used elsewhere were ineffective in detecting these severe impacts. The integrated assessment approach used in this study provides information on contaminant sources, exposure pathways and mechanisms, and impacts to the stream ecosystem at several organizational levels.« less

  16. Metagenomic exploration reveals a marked change in the river resistome and mobilome after treated wastewater discharges.

    PubMed

    Lekunberri, Itziar; Balcázar, José Luis; Borrego, Carles M

    2018-03-01

    Mobile genetic elements (MGEs) are key agents in the spread of antibiotic resistance genes (ARGs) across environments. Here we used metagenomics to compare the river resistome (collection of all ARGs) and mobilome (e.g., integrases, transposases, integron integrases and insertion sequence common region "ISCR" elements) between samples collected upstream (n = 6) and downstream (n = 6) of an urban wastewater treatment plant (UWWTP). In comparison to upstream metagenomes, downstream metagenomes showed a drastic increase in the abundance of ARGs, as well as markers of MGEs, particularly integron integrases and ISCR elements. These changes were accompanied by a concomitant prevalence of 16S rRNA gene signatures of bacteria affiliated to families encompassing well-known human and animal pathogens. Our results confirm that chronic discharges of treated wastewater severely impact the river resistome affecting not only the abundance and diversity of ARGs but also their potential spread by enriching the river mobilome in a wide variety of MGEs. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Curcumin activates human glutathione S-transferase P1 expression through antioxidant response element.

    PubMed

    Nishinaka, Toru; Ichijo, Yusuke; Ito, Maki; Kimura, Masayoshi; Katsuyama, Masato; Iwata, Kazumi; Miura, Takeshi; Terada, Tomoyuki; Yabe-Nishimura, Chihiro

    2007-05-15

    Curcumin is a plant-derived diferuloylmethane compound extracted from Curcuma longa, possessing antioxidative and anticarcinogenic properties. Antioxidants and oxidative stress are known to induce the expression of certain classes of detoxification enzymes. Since the upregulation of detoxifying enzymes affects the drug metabolism and cell defense system, it is important to understand the gene regulation by such agents. In this study, we demonstrated that curcumin could induce the expression of human glutathione S-transferase P1 (GSTP1). In HepG2 cells treated with 20muM curcumin, the level of GSTP1 mRNA was significantly increased. In luciferase reporter assays, curcumin augmented the promoter activity of a reporter construct carrying 336bp upstream of the 5'-flanking region of the GSTP1 gene. Mutation analyses revealed that the region including antioxidant response element (ARE), which overlaps AP1 in sequence, was essential to the response to curcumin. While the introduction of a wild-type Nrf2 expression construct augmented the promoter activity of the GSTP1 gene, co-expression of a dominant-negative Nrf2 abolished the responsiveness to curcumin. In addition, curcumin activated the expression of the luciferase gene from a reporter construct carrying multiple ARE consensus sequences but not one with multiple AP1 sites. In a gel mobility shift assay with an oligonucleotide with GSTP1 ARE, an increase in the amount of the binding complex was observed in the nuclear extracts of curcumin-treated HepG2 cells. These results suggested that ARE is the primary sequence for the curcumin-induced transactivation of the GSTP1 gene. The induction of GSTP1 may be one of the mechanisms underlying the multiple actions of curcumin.

  18. Culvert roughness elements for native Utah fish passage : phase II.

    DOT National Transportation Integrated Search

    2012-04-01

    Native fishes have become an increasingly important concern when designing fish passable culverts. Many operational culverts constrict waterways which increase velocities and prevent upstream passage of small fish species. The current method to ensur...

  19. Concentrated energy addition for active drag reduction in hypersonic flow regime

    NASA Astrophysics Data System (ADS)

    Ashwin Ganesh, M.; John, Bibin

    2018-01-01

    Numerical optimization of hypersonic drag reduction technique based on concentrated energy addition is presented in this study. A reduction in wave drag is realized through concentrated energy addition in the hypersonic flowfield upstream of the blunt body. For the exhaustive optimization presented in this study, an in-house high precision inviscid flow solver has been developed. Studies focused on the identification of "optimum energy addition location" have revealed the existence of multiple minimum drag points. The wave drag coefficient is observed to drop from 0.85 to 0.45 when 50 Watts of energy is added to an energy bubble of 1 mm radius located at 74.7 mm upstream of the stagnation point. A direct proportionality has been identified between energy bubble size and wave drag coefficient. Dependence of drag coefficient on the upstream added energy magnitude is also revealed. Of the observed multiple minimum drag points, the energy deposition point (EDP) that offers minimum wave drag just after a sharp drop in drag is proposed as the most optimum energy addition location.

  20. Widespread promoter-mediated coordination of transcription and mRNA degradation

    PubMed Central

    2012-01-01

    Background Previous work showed that mRNA degradation is coordinated with transcription in yeast, and in several genes the control of mRNA degradation was linked to promoter elements through two different mechanisms. Here we show at the genomic scale that the coordination of transcription and mRNA degradation is promoter-dependent in yeast and is also observed in humans. Results We first demonstrate that swapping upstream cis-regulatory sequences between two yeast species affects both transcription and mRNA degradation and suggest that while some cis-regulatory elements control either transcription or degradation, multiple other elements enhance both processes. Second, we show that adjacent yeast genes that share a promoter (through divergent orientation) have increased similarity in their patterns of mRNA degradation, providing independent evidence for the promoter-mediated coupling of transcription to mRNA degradation. Finally, analysis of the differences in mRNA degradation rates between mammalian cell types or mammalian species suggests a similar coordination between transcription and mRNA degradation in humans. Conclusions Our results extend previous studies and suggest a pervasive promoter-mediated coordination between transcription and mRNA degradation in yeast. The diverse genes and regulatory elements associated with this coordination suggest that it is generated by a global mechanism of gene regulation and modulated by gene-specific mechanisms. The observation of a similar coupling in mammals raises the possibility that coupling of transcription and mRNA degradation may reflect an evolutionarily conserved phenomenon in gene regulation. PMID:23237624

  1. Sall4-Gli3 system in early limb progenitors is essential for the development of limb skeletal elements.

    PubMed

    Akiyama, Ryutaro; Kawakami, Hiroko; Wong, Julia; Oishi, Isao; Nishinakamura, Ryuichi; Kawakami, Yasuhiko

    2015-04-21

    Limb skeletal elements originate from the limb progenitor cells, which undergo expansion and patterning to develop each skeletal element. Posterior-distal skeletal elements, such as the ulna/fibula and posterior digits develop in a Sonic hedgehog (Shh)-dependent manner. However, it is poorly understood how anterior-proximal elements, such as the humerus/femur, the radius/tibia and the anterior digits, are developed. Here we show that the zinc finger factors Sall4 and Gli3 cooperate for proper development of the anterior-proximal skeletal elements and also function upstream of Shh-dependent posterior skeletal element development. Conditional inactivation of Sall4 in the mesoderm before limb outgrowth caused severe defects in the anterior-proximal skeletal elements in the hindlimb. We found that Gli3 expression is reduced in Sall4 mutant hindlimbs, but not in forelimbs. This reduction caused posteriorization of nascent hindlimb buds, which is correlated with a loss of anterior digits. In proximal development, Sall4 integrates Gli3 and the Plzf-Hox system, in addition to proliferative expansion of cells in the mesenchymal core of nascent hindlimb buds. Whereas forelimbs developed normally in Sall4 mutants, further genetic analysis identified that the Sall4-Gli3 system is a common regulator of the early limb progenitor cells in both forelimbs and hindlimbs. The Sall4-Gli3 system also functions upstream of the Shh-expressing ZPA and the Fgf8-expressing AER in fore- and hindlimbs. Therefore, our study identified a critical role of the Sall4-Gli3 system at the early steps of limb development for proper development of the appendicular skeletal elements.

  2. Molecular Regulatory Pathways Link Sepsis With Metabolic Syndrome: Non-coding RNA Elements Underlying the Sepsis/Metabolic Cross-Talk.

    PubMed

    Meydan, Chanan; Bekenstein, Uriya; Soreq, Hermona

    2018-01-01

    Sepsis and metabolic syndrome (MetS) are both inflammation-related entities with high impact for human health and the consequences of concussions. Both represent imbalanced parasympathetic/cholinergic response to insulting triggers and variably uncontrolled inflammation that indicates shared upstream regulators, including short microRNAs (miRs) and long non-coding RNAs (lncRNAs). These may cross talk across multiple systems, leading to complex molecular and clinical outcomes. Notably, biomedical and RNA-sequencing based analyses both highlight new links between the acquired and inherited pathogenic, cardiac and inflammatory traits of sepsis/MetS. Those include the HOTAIR and MIAT lncRNAs and their targets, such as miR-122, -150, -155, -182, -197, -375, -608 and HLA-DRA. Implicating non-coding RNA regulators in sepsis and MetS may delineate novel high-value biomarkers and targets for intervention.

  3. Identification of a functional element in the promoter of the silkworm (Bombyx mori) fat body-specific gene Bmlp3.

    PubMed

    Xu, Hanfu; Deng, Dangjun; Yuan, Lin; Wang, Yuancheng; Wang, Feng; Xia, Qingyou

    2014-08-01

    30K proteins are a group of structurally related proteins that play important roles in the life cycle of the silkworm Bombyx mori and are largely synthesized and regulated in a time-dependent manner in the fat body. Little is known about the upstream regulatory elements associated with the genes encoding these proteins. In the present study, the promoter of Bmlp3, a fat body-specific gene encoding a 30K protein family member, was characterized by joining sequences containing the Bmlp3 promoter with various amounts of 5' upstream sequences to a luciferase reporter gene. The results indicated that the sequences from -150 to -250bp and -597 to -675bp upstream of the Bmlp3 transcription start site were necessary for high levels of luciferase activity. Further analysis showed that a 21-bp sequence located between -230 and -250 was specifically recognized by nuclear factors from silkworm fat bodies and BmE cells, and could enhance luciferase reporter-gene expression 2.8-fold in BmE cells. This study provides new insights into the Bmlp3 promoter and contributes to the further clarification of the function and developmental regulation of Bmlp3. Copyright © 2014. Published by Elsevier B.V.

  4. Comparative analysis on the structural features of the 5' flanking region of κ-casein genes from six different species

    PubMed Central

    Gerencsér, Ákos; Barta, Endre; Boa, Simon; Kastanis, Petros; Bösze, Zsuzsanna; Whitelaw, C Bruce A

    2002-01-01

    κ-casein plays an essential role in the formation, stabilisation and aggregation of milk micelles. Control of κ-casein expression reflects this essential role, although an understanding of the mechanisms involved lags behind that of the other milk protein genes. We determined the 5'-flanking sequences for the murine, rabbit and human κ-casein genes and compared them to the published ruminant sequences. The most conserved region was not the proximal promoter region but an approximately 400 bp long region centred 800 bp upstream of the TATA box. This region contained two highly conserved MGF/STAT5 sites with common spacing relative to each other. In this region, six conserved short stretches of similarity were also found which did not correspond to known transcription factor consensus sites. On the contrary to ruminant and human 5' regulatory sequences, the rabbit and murine 5'-flanking regions did not harbour any kind of repetitive elements. We generated a phylogenetic tree of the six species based on multiple alignment of the κ-casein sequences. This study identified conserved candidate transcriptional regulatory elements within the κ-casein gene promoter. PMID:11929628

  5. Culvert roughness elements for native Utah fish passage : phase I.

    DOT National Transportation Integrated Search

    2011-01-01

    Laboratory flume testing of native Utah non-salmonid fish was performed to observe how : they use altered flow around obstacles to swim upstream. Three experimental setups included : a bare Plexiglas flume, vertical cylinders, and natural substrate p...

  6. The dyad palindromic glutathione transferase P enhancer binds multiple factors including AP1.

    PubMed Central

    Diccianni, M B; Imagawa, M; Muramatsu, M

    1992-01-01

    Glutathione Transferase P (GST-P) gene expression is dominantly regulated by an upstream enhancer (GPEI) consisting of a dyad of palindromically oriented imperfect TPA (12-O-tetradecanoyl-phorbol-13-acetate)-responsive elements (TRE). GPEI is active in AP1-lacking F9 cells as well in AP1-containing HeLa cells. Despite GPEI's similarity to a TRE, c-jun co-transfection has only a minimal effect on transactivation. Antisense c-jun and c-fos co-transfection experiments further demonstrate the lack of a role for AP1 in GPEI mediated trans-activation in F9 cells, although endogenously present AP1 can influence GPEI in HeLa cells. Co-transfection of delta fosB with c-jun, which forms an inactive c-Jun/delta FosB heterodimer that binds TRE sequences, inhibits GPEI-mediated transcription in AP1-lacking F9 cells as well as AP1-containing HeLa cells. These data suggest novel factor(s) other than AP1 are influencing GPEI. Binding studies reveal multiple nucleoproteins bind to GPEI. These factors are likely responsible for the high level of GPEI-mediated transcription observed in the absence of AP1 and during hepatocarcinogenesis. Images PMID:1408831

  7. The dyad palindromic glutathione transferase P enhancer binds multiple factors including AP1.

    PubMed

    Diccianni, M B; Imagawa, M; Muramatsu, M

    1992-10-11

    Glutathione Transferase P (GST-P) gene expression is dominantly regulated by an upstream enhancer (GPEI) consisting of a dyad of palindromically oriented imperfect TPA (12-O-tetradecanoyl-phorbol-13-acetate)-responsive elements (TRE). GPEI is active in AP1-lacking F9 cells as well in AP1-containing HeLa cells. Despite GPEI's similarity to a TRE, c-jun co-transfection has only a minimal effect on transactivation. Antisense c-jun and c-fos co-transfection experiments further demonstrate the lack of a role for AP1 in GPEI mediated trans-activation in F9 cells, although endogenously present AP1 can influence GPEI in HeLa cells. Co-transfection of delta fosB with c-jun, which forms an inactive c-Jun/delta FosB heterodimer that binds TRE sequences, inhibits GPEI-mediated transcription in AP1-lacking F9 cells as well as AP1-containing HeLa cells. These data suggest novel factor(s) other than AP1 are influencing GPEI. Binding studies reveal multiple nucleoproteins bind to GPEI. These factors are likely responsible for the high level of GPEI-mediated transcription observed in the absence of AP1 and during hepatocarcinogenesis.

  8. Identification of estrogen-responsive genes using a genome-wide analysis of promoter elements for transcription factor binding sites.

    PubMed

    Kamalakaran, Sitharthan; Radhakrishnan, Senthil K; Beck, William T

    2005-06-03

    We developed a pipeline to identify novel genes regulated by the steroid hormone-dependent transcription factor, estrogen receptor, through a systematic analysis of upstream regions of all human and mouse genes. We built a data base of putative promoter regions for 23,077 human and 19,984 mouse transcripts from National Center for Biotechnology Information annotation and 8793 human and 6785 mouse promoters from the Data Base of Transcriptional Start Sites. We used this data base of putative promoters to identify potential targets of estrogen receptor by identifying estrogen response elements (EREs) in their promoters. Our program correctly identified EREs in genes known to be regulated by estrogen in addition to several new genes whose putative promoters contained EREs. We validated six genes (KIAA1243, NRIP1, MADH9, NME3, TPD52L, and ABCG2) to be estrogen-responsive in MCF7 cells using reverse transcription PCR. To allow for extensibility of our program in identifying targets of other transcription factors, we have built a Web interface to access our data base and programs. Our Web-based program for Promoter Analysis of Genome, PAGen@UIC, allows a user to identify putative target genes for vertebrate transcription factors through the analysis of their upstream sequences. The interface allows the user to search the human and mouse promoter data bases for potential target genes containing one or more listed transcription factor binding sites (TFBSs) in their upstream elements, using either regular expression-based consensus or position weight matrices. The data base can also be searched for promoters harboring user-defined TFBSs given as a consensus or a position weight matrix. Furthermore, the user can retrieve putative promoter sequences for any given gene together with identified TFBSs located on its promoter. Orthologous promoters are also analyzed to determine conserved elements.

  9. The effects of road crossings on prairie stream habitat and function

    USGS Publications Warehouse

    Bouska, Wesley W.; Keane, Timothy; Paukert, Craig P.

    2010-01-01

    Improperly designed stream crossing structures may alter the form and function of stream ecosystems and habitat and prohibit the movement of aquatic organisms. Stream sections adjoining five concrete box culverts, five low-water crossings (concrete slabs vented by one or multiple culverts), and two large, single corrugated culvert vehicle crossings in eastern Kansas streams were compared to reference reaches using a geomorphologic survey and stream classification. Stream reaches were also compared upstream and downstream of crossings, and crossing measurements were used to determine which crossing design best mimicked the natural dimensions of the adjoining stream. Four of five low-water crossings, three of five box culverts, and one of two large, single corrugated pipe culverts changed classification from upstream to downstream of the crossings. Mean riffle spacing upstream at low-water crossings (8.6 bankfull widths) was double that of downstream reaches (mean 4.4 bankfull widths) but was similar upstream and downstream of box and corrugated pipe culverts. There also appeared to be greater deposition of fine sediments directly upstream of these designs. Box and corrugated culverts were more similar to natural streams than low-water crossings at transporting water, sediments, and debris during bankfull flows.

  10. Transcriptional "silencer" element in rat repetitive sequences associated with the rat insulin 1 gene locus.

    PubMed Central

    Laimins, L; Holmgren-König, M; Khoury, G

    1986-01-01

    The enhancer elements from either simian virus 40 or murine sarcoma virus activate the expression of a transfected rat insulin 1 (rI1) gene when placed within 2.0 kilobases or less of the rI1 gene cap site. Inclusion of 4.0 kilobases of upstream rI1 sequence, however, results in a substantial reduction in the enhancer-dependent insulin gene expression. These observations suggested that a negative transcriptional regulatory element was present between 2.0 and 4.0 kilobases of the rI1 sequence. To test this notion, we employed a heterologous enhancer-dependent transcription assay in which the simian virus 40 72-base-pair repeat is linked to a human beta-globin gene. Addition of the upstream rI1 element to this system decreased the level of enhancer-dependent beta-globin transcription by a factor of 5 to 15. This rI1 "silencer" element functions in a manner relatively independent of position and orientation and requires a cis-dependent relationship to the transcription unit on which it acts. Thus, the silencer sequence seems to have a number of the characteristics of enhancer elements, and we suggest that it may function by the converse of the enhancer mechanism. The rI1 silencer sequence was identified as a member of a long interspersed rat repetitive family. Thus, a potential role for certain repetitive sequences interspersed throughout the eukaryotic genome may be to regulate gene expression by retaining transcriptional activity within defined domains. Images PMID:3010279

  11. Isolation and functional characterization of TIF-IB, a factor that confers promoter specificity to mouse RNA polymerase I.

    PubMed

    Schnapp, A; Clos, J; Hädelt, W; Schreck, R; Cvekl, A; Grummt, I

    1990-03-25

    The murine ribosomal gene promoter contains two cis-acting control elements which operate in concert to promote efficient and accurate transcription initiation by RNA polymerase I. The start site proximal core element which is indispensable for promoter recognition by RNA polymerase I (pol I) encompasses sequences from position -39 to -1. An upstream control element (UCE) which is located between nucleotides -142 and -112 stimulates the efficiency of transcription initiation both in vivo and in vitro. Here we report the isolation and functional characterization of a specific rDNA binding protein, the transcription initiation factor TIF-IB, which specifically interacts with the core region of the mouse ribosomal RNA gene promoter. Highly purified TIF-IB complements transcriptional activity in the presence of two other essential initiation factors TIF-IA and TIF-IC. We demonstrate that the binding efficiency of purified TIF-IB to the core promoter is strongly enhanced by the presence in cis of the UCE. This positive effect of upstream sequences on TIF-IB binding is observed throughout the purification procedure suggesting that the synergistic action of the two distant promoter elements is not mediated by a protein different from TIF-IB. Increasing the distance between both control elements still facilitates stable factor binding but eliminates transcriptional activation. The results demonstrate that TIF-IB binding to the rDNA promoter is an essential early step in the assembly of a functional transcription initiation complex. The subsequent interaction of TIF-IB with other auxiliary transcription initiation factors, however, requires the correct spacing between the UCE and the core promoter element.

  12. Association of the 5′-upstream regulatory region of the α7 nicotinic acetylcholine receptor subunit gene (CHRNA7) with schizophrenia

    PubMed Central

    Stephens, Sarah H.; Logel, Judith; Barton, Amanda; Franks, Alexis; Schultz, Jessica; Short, Margaret; Dickenson, Jane; James, Benjamin; Fingerlin, Tasha E.; Wagner, Brandie; Hodgkinson, Colin; Graw, Sharon; Ross, Randal G.; Freedman, Robert; Leonard, Sherry

    2009-01-01

    Background The α7 neuronal nicotinic acetylcholine receptor subunit gene (CHRNA7) is localized in a chromosomal region (15q14) linked to schizophrenia in multiple independent studies. CHRNA7 was selected as the best candidate gene in the region for a well-documented endophenotype of schizophrenia, the P50 sensory processing deficit, by genetic linkage and biochemical studies. Methods Subjects included Caucasian-Non Hispanic and African-American case-control subjects collected in Denver, and schizophrenic subjects from families in the NIMH Genetics Initiative on Schizophrenia. Thirty-five single nucleotide polymorphisms (SNPs) in the 5′-upstream regulatory region of CHRNA7 were genotyped for association with schizophrenia, and for smoking in schizophrenia. Results The rs3087454 SNP, located at position −1831 bp in the upstream regulatory region of CHRNA7, was significantly associated with schizophrenia in the case-control samples after multiple-testing correction (P = 0.0009, African American; P = 0.013, Caucasian-Non Hispanic); the association was supported in family members. There was nominal association of this SNP with smoking in schizophrenia. Conclusions The data support association of regulatory region polymorphisms in the CHRNA7 gene with schizophrenia. PMID:19181484

  13. Characterization of Rous sarcoma virus polyadenylation site use in vitro

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maciolek, Nicole L.; McNally, Mark T.

    2008-05-10

    Polyadenylation of Rous sarcoma virus (RSV) RNA is inefficient, as approximately 15% of RSV RNAs represent read-through transcripts that use a downstream cellular polyadenylation site (poly(A) site). Read-through transcription has implications for the virus and the host since it is associated with oncogene capture and tumor induction. To explore the basis of inefficient RSV RNA 3'-end formation, we characterized RSV polyadenylation in vitro using HeLa cell nuclear extracts and HEK293 whole cell extracts. RSV polyadenylation substrates composed of the natural 3' end of viral RNA and various lengths of upstream sequence showed little or no polyadenylation, indicating that the RSVmore » poly(A) site is suboptimal. Efficiently used poly(A) sites often have identifiable upstream and downstream elements (USEs and DSEs) in close proximity to the conserved AAUAAA signal. The sequences upstream and downstream of the RSV poly(A) site deviate from those found in efficiently used poly(A) sites, which may explain inefficient RSV polyadenylation. To assess the quality of the RSV USEs and DSEs, the well-characterized SV40 late USEs and/or DSEs were substituted for the RSV elements and vice versa, which showed that the USEs and DSEs from RSV are suboptimal but functional. CstF interacted poorly with the RSV polyadenylation substrate, and the inactivity of the RSV poly(A) site was at least in part due to poor CstF binding since tethering CstF to the RSV substrate activated polyadenylation. Our data are consistent with poor polyadenylation factor binding sites in both the USE and DSE as the basis for inefficient use of the RSV poly(A) site and point to the importance of additional elements within RSV RNA in promoting 3' end formation.« less

  14. Blade-to-Blade Variations in Shocks Upstream of Both a Forward-Swept and an Aft-Swept Fan

    NASA Technical Reports Server (NTRS)

    Podboy, Gary G.; Krupar, Martin J.

    2006-01-01

    Detailed laser Doppler velocimeter (LDV) flow field measurements were made upstream of two fans, one forward-swept and one aft-swept, in order to learn more about the shocks which propagate upstream of these rotors when they are operated at supersonic tip speeds. The blade-to-blade variations in the flows associated with these shocks are thought to be responsible for generating Multiple Pure Tone (MPT) noise. The measured blade-to-blade variations are documented in this report through a series of slideshows which show relative Mach number contours computed from the velocity measurements. Data are presented for the forward-swept fan operating at three speeds (corresponding to tip relative Mach numbers of 0.817, 1.074, and 1.189), and for the aft-swept fan operating at two (tip relative Mach numbers of 1.074 and 1.189). These LDV data illustrate how the perturbations in the upstream flow field created by the rotating blades vary with axial position, radial position and rotor speed. As expected, at the highest tested speed the forward-swept fan swallowed the shocks which occur in the tip region, whereas the aftswept fan did not. This resulted in a much smaller flow disturbance just upstream of the tip of the forward-swept fan. Nevertheless, further upstream the two fan flows were much more similar.

  15. Cumulative impacts of mountaintop mining on an Appalachian watershed

    PubMed Central

    Lindberg, T. Ty; Bernhardt, Emily S.; Bier, Raven; Helton, A. M.; Merola, R. Brittany; Vengosh, Avner; Di Giulio, Richard T.

    2011-01-01

    Mountaintop mining is the dominant form of coal mining and the largest driver of land cover change in the central Appalachians. The waste rock from these surface mines is disposed of in the adjacent river valleys, leading to a burial of headwater streams and dramatic increases in salinity and trace metal concentrations immediately downstream. In this synoptic study we document the cumulative impact of more than 100 mining discharge outlets and approximately 28 km2 of active and reclaimed surface coal mines on the Upper Mud River of West Virginia. We measured the concentrations of major and trace elements within the tributaries and the mainstem and found that upstream of the mines water quality was equivalent to state reference sites. However, as eight separate mining-impacted tributaries contributed their flow, conductivity and the concentrations of selenium, sulfate, magnesium, and other inorganic solutes increased at a rate directly proportional to the upstream areal extent of mining. We found strong linear correlations between the concentrations of these contaminants in the river and the proportion of the contributing watershed in surface mines. All tributaries draining mountaintop-mining-impacted catchments were characterized by high conductivity and increased sulfate concentration, while concentrations of some solutes such as Se, Sr, and N were lower in the two tributaries draining reclaimed mines. Our results demonstrate the cumulative impact of multiple mines within a single catchment and provide evidence that mines reclaimed nearly two decades ago continue to contribute significantly to water quality degradation within this watershed. PMID:22160676

  16. GLUCOCORTICOID RECEPTOR EXPRESSION DURING THE DEVELOPMENT OF THE EMBRYONIC MOUSE SECONDARY PALATE

    EPA Science Inventory

    Glucocorticoids are important regulators of embryonic growth and development. hese effects are mediated through glucocorticoid receptors (GR) which bind to glucocorticoid response elements upstream of regulated genes. his study examines the expression of GR and GR mRNA in embryon...

  17. A SHORT SEQUENCE IMMEDIATELY UPSTREAM OF THE INTERNAL REPEAT ELEMENTS IS CRITICAL FOR KSHV LANA MEDIATED DNA REPLICATION AND IMPACTS EPISOME PERSISTENCE

    PubMed Central

    León Vázquez, Erika De; Juillard, Franceline; Rosner, Bernard; Kaye, Kenneth M.

    2013-01-01

    Kaposi’s sarcoma-associated herpesvirus LANA (1162 residues) mediates episomal persistence of viral genomes during latency. LANA mediates viral DNA replication and segregates episomes to daughter nuclei. A 59 residue deletion immediately upstream of the internal repeat elements rendered LANA highly deficient for DNA replication and modestly deficient for the ability to segregate episomes, while smaller deletions did not. The 59 amino acid deletion reduced LANA episome persistence by ~14-fold, while sequentially smaller deletions resulted in ~3-fold, or no deficiency. Three distinct LANA regions reorganized heterochromatin, one of which contains the deleted sequence, but the deletion did not abolish LANA’s ability to alter chromatin. Therefore, this work identifies a short internal LANA sequence that is critical for DNA replication, has modest effects on episome segregation, and substantially impacts episome persistence; this region may exert its effects through an interacting host cell protein(s). PMID:24314665

  18. Isolation and characterization of a water stress-specific genomic gene, pwsi 18, from rice.

    PubMed

    Joshee, N; Kisaka, H; Kitagawa, Y

    1998-01-01

    One of the water stress-specific cDNA clones of rice characterised previously, wsi18, was selected for further study. The wsi18 gene can be induced by water stress conditions such as mannitol, NaCl, and dryness, but not by ABA, cold, or heat. A genomic clone for wsi18, pwsi18, contained about 1.7 kbp of the 5' upstream sequence, two introns, and the full coding sequence. The 5'-upstream sequence of pwsi18 contained putative cis-acting elements, namely an ABA-responsive element (ABRE), three G-boxes, three E-boxes, a MEF-2 sequence, four direct and two inverted repeats, and four sequences similar to DRE, which is involved in the dehydration response of Arabidopsis genes. The gusA reporter gene under the control of the pwsi18 promoter showed transient expression in response to water stress. Deletion of the downstream DRE-like sequence between the distal G-boxes-2 and -3 resulted in rather low GUS expression.

  19. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liebhaber, S.A.; Weiss, I.; Cash, F.E.

    Synthesis of normal human hemoglobin A, {alpha}{sub 2}{beta}{sub 2}, is based upon balanced expression of genes in the {alpha}-globin gene cluster on chromosome 15 and the {beta}-globin gene cluster on chromosome 11. Full levels of erythroid-specific activation of the {beta}-globin cluster depend on sequences located at a considerable distance 5{prime} to the {beta}-globin gene, referred to as the locus-activating or dominant control region. The existence of an analogous element(s) upstream of the {alpha}-globin cluster has been suggested from observations on naturally occurring deletions and experimental studies. The authors have identified an individual with {alpha}-thalassemia in whom structurally normal {alpha}-globin genesmore » have been inactivated in cis by a discrete de novo 35-kilobase deletion located {approximately}30 kilobases 5{prime} from the {alpha}-globin gene cluster. They conclude that this deletion inactivates expression of the {alpha}-globin genes by removing one or more of the previously identified upstream regulatory sequences that are critical to expression of the {alpha}-globin genes.« less

  20. The flow field around a pair of cubic roughness elements with different spacings immersed in turbulent boundary layer

    NASA Astrophysics Data System (ADS)

    Agarwal, Karuna; Gao, Jian; Katz, Joseph

    2017-11-01

    The shape, size, and spacing between roughness elements in turbulent boundary layers affect the associated drag and noise. Understanding them require data on the flow structure around these elements. Dual-view tomographic holography is used to study the 3D 3-component velocity field around a pair of cubic roughness elements immersed in a turbulent boundary layer at Reτ = 2500 . These a = 1 mm high cubes correspond to 4% of the half channel height and 90 wall units (δν = 11 μ m). Tests are performed for spanwise spacings of a, 1.5 a and 2.5 a. The sample volume is 385δν × 250δν × 190δν and the vector spacing is 5.4δν. Conversed statistics is obtained by recording 1500 realizations in volumes centered upstream, downstream and around a cube. The boundary layer separating upstream of the cube does not reattach until the wake region, resulting in formation of a vortical ``canopy'' that engulfs each cube. It is dominated by spanwise vorticity above the cube and separated region, bounded by vertical vorticity on the sides. Flow channeling in the space between cubes causes asymmetry in the vorticity distributions along the inner and outer walls. The legs of horseshoe vortices remain near the wall between cubes, but grow and expand in the wake region. Funded by NSF and ONR.

  1. Identification of cis-acting regulatory elements in the human oxytocin gene promoter.

    PubMed

    Richard, S; Zingg, H H

    1991-12-01

    The expression of hormone-inducible genes is determined by the interaction of trans-acting factors with hormone-inducible elements and elements mediating basal and cell-specific expression. We have shown earlier that the gene encoding the hypothalamic nonapeptide oxytocin (OT) is under the control of an estrogen response element (ERE). The present study was aimed at identifying cis-acting elements mediating basal expression of the OT gene. A construct containing sequences -381 to +36 of the human OT gene was linked to a reporter gene and transiently transfected into a series of neuronal and nonneuronal cell lines. Expression of this construct was cell specific: it was highest in the neuroblastoma-derived cell line, Neuro-2a, and lowest in NIH 3T3 and JEG-3 cells. By 5' deletion analysis, we determined that a segment from -49 to +36 was capable of mediating cells-pecific promoter activity. Within this segment, we identified three proximal promoter elements (PPE-1, PPE-2, and PPE-3) that are each required for promoter activity. Most notably, mutation of a conserved purine-rich element (GAGAGA) contained within PPE-2 leads to a 10-fold decrease in promoter strength. Gel mobility shift analysis with three different double-stranded oligonucleotides demonstrated that each proximal promoter element binds distinct nuclear factors. In each case, only the homologous oligonucleotide, but neither of the oligonucleotides corresponding to adjacent elements, was able to act as a competitor. Thus, a different set of factors appears to bind independently to each element. By reinserting the homologous ERE or a heterologous glucocorticoid response element upstream of intact or altered proximal promoter segments we determined that removal or mutation of proximal promoter elements decreases basal expression, but does not abrogate the hormone responsiveness of the promoter. In conclusion, these results indicate that an important component of the transcriptional activity of the OT promoter resides in a small region extending only 50 bases upstream of the cap site and that this activity is the result of a cooperative interaction of at least three distinct proximal promoter elements.

  2. Growth and stress response mechanisms underlying post-feeding regenerative organ growth in the Burmese python.

    PubMed

    Andrew, Audra L; Perry, Blair W; Card, Daren C; Schield, Drew R; Ruggiero, Robert P; McGaugh, Suzanne E; Choudhary, Amit; Secor, Stephen M; Castoe, Todd A

    2017-05-02

    Previous studies examining post-feeding organ regeneration in the Burmese python (Python molurus bivittatus) have identified thousands of genes that are significantly differentially regulated during this process. However, substantial gaps remain in our understanding of coherent mechanisms and specific growth pathways that underlie these rapid and extensive shifts in organ form and function. Here we addressed these gaps by comparing gene expression in the Burmese python heart, liver, kidney, and small intestine across pre- and post-feeding time points (fasted, one day post-feeding, and four days post-feeding), and by conducting detailed analyses of molecular pathways and predictions of upstream regulatory molecules across these organ systems. Identified enriched canonical pathways and upstream regulators indicate that while downstream transcriptional responses are fairly tissue specific, a suite of core pathways and upstream regulator molecules are shared among responsive tissues. Pathways such as mTOR signaling, PPAR/LXR/RXR signaling, and NRF2-mediated oxidative stress response are significantly differentially regulated in multiple tissues, indicative of cell growth and proliferation along with coordinated cell-protective stress responses. Upstream regulatory molecule analyses identify multiple growth factors, kinase receptors, and transmembrane receptors, both within individual organs and across separate tissues. Downstream transcription factors MYC and SREBF are induced in all tissues. These results suggest that largely divergent patterns of post-feeding gene regulation across tissues are mediated by a core set of higher-level signaling molecules. Consistent enrichment of the NRF2-mediated oxidative stress response indicates this pathway may be particularly important in mediating cellular stress during such extreme regenerative growth.

  3. Orientation and navigation relative to water flow, prey, conspecifics, and predators by the nudibranch mollusc Tritonia diomedea.

    PubMed

    Wyeth, Russell C; Woodward, Owen M; Willows, A O Dennis

    2006-04-01

    Progress in understanding sensory and locomotory systems in Tritonia diomedea has created the potential for the neuroethological study of animal navigation in this species. Our goal is to describe the navigational behaviors to guide further work on how the nervous system integrates information from multiple senses to produce oriented locomotion. Observation of T. diomedea in its habitat has suggested that it uses water flow to navigate relative to prey, predators, and conspecifics. We test these hypotheses in the field by comparing slug orientation in time-lapse videos to flow direction in circumstances with and without prey, predators, or conspecifics upstream. T. diomedea oriented upstream both while crawling and after turning. This trend was strongest before feeding or mating; after feeding or mating, the slugs did not orient significantly to flow. Slugs turned downstream away from an upstream predator but did not react in control situations without an upstream predator. These data support the hypothesis that T. diomedea uses a combination of odors (or some other cue transported downstream) and water flow to navigate relative to prey, predators, and conspecifics. Understanding the context-dependent choice between upstream and downstream crawling in T. diomedea provides an opportunity for further work on the sensory integration underlying navigation behavior.

  4. Control site location and transcriptional regulation in Escherichia coli.

    PubMed Central

    Collado-Vides, J; Magasanik, B; Gralla, J D

    1991-01-01

    The regulatory regions for 119 Escherichia coli promoters have been analyzed, and the locations of the regulatory sites have been cataloged. The following observations emerge. (i) More than 95% of promoters are coregulated with at least one other promoter. (ii) Virtually all sigma 70 promoters contain at least one regulatory site in a proximal position, touching at least position -65 with respect to the start point of transcription. There are not yet clear examples of upstream regulation in the absence of a proximal site. (iii) Operators within regulons appear in very variable proximal positions. By contrast, the proximal activation sites of regulons are much more fixed. (iv) There is a forbidden zone for activation elements downstream from approximately position -20 with respect to the start of transcription. By contrast, operators can occur throughout the proximal region. When activation elements appear in the forbidden zone, they repress. These latter examples usually involve autoregulation. (v) Approximately 40% of repressible promoters contain operator duplications. These occur either in certain regulons where duplication appears to be a requirement for repressor action or in promoters subject to complex regulation. (vi) Remote operator duplications occur in approximately 10% of repressible promoters. They generally appear when a multiple promoter region is coregulated by cyclic AMP receptor protein. (vii) Sigma 54 promoters do not require proximal or precisely positioned activator elements and are not generally subject to negative regulation. Rationales are presented for all of the above observations. PMID:1943993

  5. Sediment-quality assessment of Franklin D. Roosevelt Lake and the upstream reach of the Columbia River, Washington, 1992

    USGS Publications Warehouse

    Bortleson, Gilbert Carl; Cox, S.E.; Munn, M.D.; Schumaker, R.J.; Block, E.K.

    2001-01-01

    Elevated concentrations of trace elements were found in bed sediment of Lake Roosevelt and the Columbia River, its principal source of inflow. Trace-element concentrations in whole water samples did not exceed criteria for freshwater organisms. Bed sediments of Lake Roosevelt were analyzed for organic compounds associated with wood-pulp waste. Dioxins and furans were found in suspended sediment and water of the Columbia River. Abundance and diversity of benthic invertebrate communities were analyzed.

  6. Transcriptional Profiling Identifies Functional Interactions of TGFβ and PPARβ/δ Signaling

    PubMed Central

    Kaddatz, Kerstin; Adhikary, Till; Finkernagel, Florian; Meissner, Wolfgang; Müller-Brüsselbach, Sabine; Müller, Rolf

    2010-01-01

    Peroxisome proliferator-activated receptors (PPARs) not only play a key role in regulating metabolic pathways but also modulate inflammatory processes, pointing to a functional interaction between PPAR and cytokine signaling pathways. In this study, we show by genome-wide transcriptional profiling that PPARβ/δ and transforming growth factor-β (TGFβ) pathways functionally interact in human myofibroblasts and that a subset of these genes is cooperatively activated by TGFβ and PPARβ/δ. Using the angiopoietin-like 4 (ANGPTL4) gene as a model, we demonstrate that two enhancer regions cooperate to mediate the observed synergistic response. A TGFβ-responsive enhancer located ∼8 kb upstream of the transcriptional start site is regulated by a mechanism involving SMAD3, ETS1, RUNX, and AP-1 transcription factors that interact with multiple contiguous binding sites. A second enhancer (PPAR-E) consisting of three juxtaposed PPAR response elements is located in the third intron ∼3.5 kb downstream of the transcriptional start site. The PPAR-E is strongly activated by all three PPAR subtypes, with a novel type of PPAR response element motif playing a central role. Although the PPAR-E is not regulated by TGFβ, it interacts with SMAD3, ETS1, RUNX2, and AP-1 in vivo, providing a possible mechanistic explanation for the observed synergism. PMID:20595396

  7. Cloning the promoter for transforming growth factor-beta type III receptor. Basal and conditional expression in fetal rat osteoblasts

    NASA Technical Reports Server (NTRS)

    Ji, C.; Chen, Y.; McCarthy, T. L.; Centrella, M.

    1999-01-01

    Transforming growth factor-beta binds to three high affinity cell surface molecules that directly or indirectly regulate its biological effects. The type III receptor (TRIII) is a proteoglycan that lacks significant intracellular signaling or enzymatic motifs but may facilitate transforming growth factor-beta binding to other receptors, stabilize multimeric receptor complexes, or segregate growth factor from activating receptors. Because various agents or events that regulate osteoblast function rapidly modulate TRIII expression, we cloned the 5' region of the rat TRIII gene to assess possible control elements. DNA fragments from this region directed high reporter gene expression in osteoblasts. Sequencing showed no consensus TATA or CCAAT boxes, whereas several nuclear factors binding sequences within the 3' region of the promoter co-mapped with multiple transcription initiation sites, DNase I footprints, gel mobility shift analysis, or loss of activity by deletion or mutation. An upstream enhancer was evident 5' proximal to nucleotide -979, and a silencer region occurred between nucleotides -2014 and -2194. Glucocorticoid sensitivity mapped between nucleotides -687 and -253, whereas bone morphogenetic protein 2 sensitivity co-mapped within the silencer region. Thus, the TRIII promoter contains cooperative basal elements and dispersed growth factor- and hormone-sensitive regulatory regions that can control TRIII expression by osteoblasts.

  8. Translation initiation events on structured eukaryotic mRNAs generate gene expression noise

    PubMed Central

    Dacheux, Estelle; Malys, Naglis; Meng, Xiang; Ramachandran, Vinoy; Mendes, Pedro

    2017-01-01

    Abstract Gene expression stochasticity plays a major role in biology, creating non-genetic cellular individuality and influencing multiple processes, including differentiation and stress responses. We have addressed the lack of knowledge about posttranscriptional contributions to noise by determining cell-to-cell variations in the abundance of mRNA and reporter protein in yeast. Two types of structural element, a stem–loop and a poly(G) motif, not only inhibit translation initiation when inserted into an mRNA 5΄ untranslated region, but also generate noise. The noise-enhancing effect of the stem–loop structure also remains operational when combined with an upstream open reading frame. This has broad significance, since these elements are known to modulate the expression of a diversity of eukaryotic genes. Our findings suggest a mechanism for posttranscriptional noise generation that will contribute to understanding of the generally poor correlation between protein-level stochasticity and transcriptional bursting. We propose that posttranscriptional stochasticity can be linked to cycles of folding/unfolding of a stem–loop structure, or to interconversion between higher-order structural conformations of a G-rich motif, and have created a correspondingly configured computational model that generates fits to the experimental data. Stochastic events occurring during the ribosomal scanning process can therefore feature alongside transcriptional bursting as a source of noise. PMID:28521011

  9. Engineering Promoter Architecture in Oleaginous Yeast Yarrowia lipolytica.

    PubMed

    Shabbir Hussain, Murtaza; Gambill, Lauren; Smith, Spencer; Blenner, Mark A

    2016-03-18

    Eukaryotic promoters have a complex architecture to control both the strength and timing of gene transcription spanning up to thousands of bases from the initiation site. This complexity makes rational fine-tuning of promoters in fungi difficult to predict; however, this very same complexity enables multiple possible strategies for engineering promoter strength. Here, we studied promoter architecture in the oleaginous yeast, Yarrowia lipolytica. While recent studies have focused on upstream activating sequences, we systematically examined various components common in fungal promoters. Here, we examine several promoter components including upstream activating sequences, proximal promoter sequences, core promoters, and the TATA box in autonomously replicating expression plasmids and integrated into the genome. Our findings show that promoter strength can be fine-tuned through the engineering of the TATA box sequence, core promoter, and upstream activating sequences. Additionally, we identified a previously unreported oleic acid responsive transcription enhancement in the XPR2 upstream activating sequences, which illustrates the complexity of fungal promoters. The promoters engineered here provide new genetic tools for metabolic engineering in Y. lipolytica and provide promoter engineering strategies that may be useful in engineering other non-model fungal systems.

  10. A minimal murine Msx-1 gene promoter. Organization of its cis-regulatory motifs and their role in transcriptional activation in cells in culture and in transgenic mice.

    PubMed

    Takahashi, T; Guron, C; Shetty, S; Matsui, H; Raghow, R

    1997-09-05

    To dissect the cis-regulatory elements of the murine Msx-1 promoter, which lacks a conventional TATA element, a putative Msx-1 promoter DNA fragment (from -1282 to +106 base pairs (bp)) or its congeners containing site-specific alterations were fused to luciferase reporter and introduced into NIH3T3 and C2C12 cells, and the expression of luciferase was assessed in transient expression assays. The functional consequences of the sequential 5' deletions of the promotor revealed that multiple positive and negative regulatory elements participate in regulating transcription of the Msx-1 gene. Surprisingly, however, the optimal expression of Msx-1 promoter in either NIH3T3 or C2C12 cells required only 165 bp of the upstream sequence to warrant detailed examination of its structure. Therefore, the functional consequences of site-specific deletions and point mutations of the cis-acting elements of the minimal Msx-1 promoter were systematically examined. Concomitantly, potential transcriptional factor(s) interacting with the cis-acting elements of the minimal promoter were also studied by gel electrophoretic mobility shift assays and DNase I footprinting. Combined analyses of the minimal promoter by DNase I footprinting, electrophoretic mobility shift assays, and super shift assays with specific antibodies revealed that 5'-flanking regions from -161 to -154 and from -26 to -13 of the Msx-1 promoter contains an authentic E box (proximal E box), capable of binding a protein immunologically related to the upstream stimulating factor 1 (USF-1) and a GC-rich sequence motif which can bind to Sp1 (proximal Sp1), respectively. Additionally, we observed that the promoter activation was seriously hampered if the proximal E box was removed or mutated, and the promoter activity was eliminated completely if the proximal Sp1 site was similarly altered. Absolute dependence of the Msx-1 minimal promoter on Sp1 could be demonstrated by transient expression assays in the Sp1-deficient Drosophila cell line cotransfected with Msx-1-luciferase and an Sp1 expression vector pPacSp1. The transgenic mice embryos containing -165/106-bp Msx-1 promoter-LacZ DNA in their genomes abundantly expressed beta-galactosidase in maxillae and mandibles and in the cellular primordia involved in the formation of the meninges and the bones of the skull. Thus, the truncated murine Msx-1 promoter can target expression of a heterologous gene in the craniofacial tissues of transgenic embryos known for high level of expression of the endogenous Msx-1 gene and found to be severely defective in the Msx-1 knock-out mice.

  11. Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites

    PubMed Central

    Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot

    2013-01-01

    Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958

  12. NF-Y loss triggers p53 stabilization and apoptosis in HPV18-positive cells by affecting E6 transcription.

    PubMed

    Benatti, Paolo; Basile, Valentina; Dolfini, Diletta; Belluti, Silvia; Tomei, Margherita; Imbriano, Carol

    2016-07-19

    The expression of the high risk HPV18 E6 and E7 oncogenic proteins induces the transformation of epithelial cells, through the disruption of p53 and Rb function. The binding of cellular transcription factors to cis-regulatory elements in the viral Upstream Regulatory Region (URR) stimulates E6/E7 transcription. Here, we demonstrate that the CCAAT-transcription factor NF-Y binds to a non-canonical motif within the URR and activates viral gene expression. In addition, NF-Y indirectly up-regulates HPV18 transcription through the transactivation of multiple cellular transcription factors. NF-YA depletion inhibits the expression of E6 and E7 genes and re-establishes functional p53. The activation of p53 target genes in turn leads to apoptotic cell death. Finally, we show that NF-YA loss sensitizes HPV18-positive cells toward the DNA damaging agent Doxorubicin, via p53-mediated transcriptional response.

  13. Optical beat interference noise reduction in OFDMA optical access link using self-homodyne balanced detection

    NASA Astrophysics Data System (ADS)

    Jung, Sang-Min; Won, Yong-Yuk; Han, Sang-Kook

    2013-12-01

    A Novel technique for reducing the OBI noise in optical OFDMA-PON uplink is presented. OFDMA is a multipleaccess/ multiplexing scheme that can provide multiplexing operation of user data streams onto the downlink sub-channels and uplink multiple access by means of dividing OFDM subcarriers as sub-channels. The main issue of high-speed, single-wavelength upstream OFDMA-PON arises from optical beating interference noise. Because the sub-channels are allocated dynamically to multiple access users over same nominal wavelength, it generates the optical beating interference among upstream signals. In this paper, we proposed a novel scheme using self-homodyne balanced detection in the optical line terminal (OLT) to reduce OBI noise which is generated in the uplink transmission of OFDMA-PON system. When multiple OFDMA sub-channels over the same nominal wavelength are received at the same time in the proposed architecture, OBI noises can be removed using balanced detection. Using discrete multitone modulation (DMT) to generate real valued OFDM signals, the proposed technique is verified through experimental demonstration.

  14. On the role of acoustic feedback in boundary-layer instability.

    PubMed

    Wu, Xuesong

    2014-07-28

    In this paper, the classical triple-deck formalism is employed to investigate two instability problems in which an acoustic feedback loop plays an essential role. The first concerns a subsonic boundary layer over a flat plate on which two well-separated roughness elements are present. A spatially amplifying Tollmien-Schlichting (T-S) wave between the roughness elements is scattered by the downstream roughness to emit a sound wave that propagates upstream and impinges on the upstream roughness to regenerate the T-S wave, thereby forming a closed feedback loop in the streamwise direction. Numerical calculations suggest that, at high Reynolds numbers and for moderate roughness heights, the long-range acoustic coupling may lead to absolute instability, which is characterized by self-sustained oscillations at discrete frequencies. The dominant peak frequency may jump from one value to another as the Reynolds number, or the distance between the roughness elements, is varied gradually. The second problem concerns the supersonic 'twin boundary layers' that develop along two well-separated parallel flat plates. The two boundary layers are in mutual interaction through the impinging and reflected acoustic waves. It is found that the interaction leads to a new instability that is absent in the unconfined boundary layer. © 2014 The Author(s) Published by the Royal Society. All rights reserved.

  15. Characterization of calcineurin-dependent response element binding protein and its involvement in copper-metallothionein gene expression in Neurospora

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kumar, Kalari Satish; Ravi Kumar, B.; Siddavattam, Dayananda

    2006-07-07

    In continuation of our recent observations indicating the presence of a lone calcineurin-dependent response element (CDRE) in the -3730 bp upstream region of copper-induced metallothionein (CuMT) gene of Neurospora [K.S. Kumar, S. Dayananda, C. Subramanyam, Copper alone, but not oxidative stress, induces copper-metallothionein gene in Neurospora crassa, FEMS Microbiol. Lett. 242 (2005) 45-50], we isolated and characterized the CDRE-binding protein. The cloned upstream region of CuMT gene was used as the template to specifically amplify CDRE element, which was immobilized on CNBr-activated Sepharose 4B for use as the affinity matrix to purify the CDRE binding protein from nuclear extracts obtainedmore » from Neurospora cultures grown in presence of copper. Two-dimensional gel electrophoresis of the affinity purified protein revealed the presence of a single 17 kDa protein, which was identified and characterized by MALDI-TOF. Peptide mass finger printing of tryptic digests and analysis of the 17 kDa protein matched with the regulatory {beta}-subunit of calcineurin (Ca{sup 2+}-calmodulin dependent protein phosphatase). Parallel identification of nuclear localization signals in this protein by in silico analysis suggests a putative role for calcineurin in the regulation of CuMT gene expression.« less

  16. Designing synthetic RNAs to determine the relevance of structural motifs in picornavirus IRES elements

    NASA Astrophysics Data System (ADS)

    Fernandez-Chamorro, Javier; Lozano, Gloria; Garcia-Martin, Juan Antonio; Ramajo, Jorge; Dotu, Ivan; Clote, Peter; Martinez-Salas, Encarnacion

    2016-04-01

    The function of Internal Ribosome Entry Site (IRES) elements is intimately linked to their RNA structure. Viral IRES elements are organized in modular domains consisting of one or more stem-loops that harbor conserved RNA motifs critical for internal initiation of translation. A conserved motif is the pyrimidine-tract located upstream of the functional initiation codon in type I and II picornavirus IRES. By computationally designing synthetic RNAs to fold into a structure that sequesters the polypyrimidine tract in a hairpin, we establish a correlation between predicted inaccessibility of the pyrimidine tract and IRES activity, as determined in both in vitro and in vivo systems. Our data supports the hypothesis that structural sequestration of the pyrimidine-tract within a stable hairpin inactivates IRES activity, since the stronger the stability of the hairpin the higher the inhibition of protein synthesis. Destabilization of the stem-loop immediately upstream of the pyrimidine-tract also decreases IRES activity. Our work introduces a hybrid computational/experimental method to determine the importance of structural motifs for biological function. Specifically, we show the feasibility of using the software RNAiFold to design synthetic RNAs with particular sequence and structural motifs that permit subsequent experimental determination of the importance of such motifs for biological function.

  17. The membrane-tethered transcription factor ANAC089 serves as redox-dependent suppressor of stromal ascorbate peroxidase gene expression

    PubMed Central

    Klein, Peter; Seidel, Thorsten; Stöcker, Benedikt; Dietz, Karl-Josef

    2012-01-01

    The stromal ascorbate peroxidase (sAPX) functions as central element of the chloroplast antioxidant defense system. Its expression is under retrograde control of chloroplast signals including redox- and reactive oxygen species-linked cues. The sAPX promoter of Arabidopsis thaliana was dissected in transient reporter assays using mesophyll protoplasts. The study revealed regulatory elements up to –1868 upstream of the start codon. By yeast-one-hybrid screening, the transcription factor ANAC089 was identified to bind to the promoter fragment 2 (–1262 to –1646 bp upstream of translational initiation). Upon mutation of the cis-acting element CACG, binding of ANAC089 was abolished. Expression of a fused fluorescent protein version and comparison with known endomembrane markers localized ANAC089 to the trans-Golgi network and the ER. The transcription factor was released upon treatment with reducing agents and targeted to the nucleus. Transactivation assays using wild type and mutated versions of the promoter showed a partial suppression of reporter expression. The data indicate that ANAC089 functions in a negative retrograde loop, lowering sAPX expression if the cell encounters a highly reducing condition. This conclusion was supported by reciprocal transcript accumulation of ANAC089 and sAPX during acclimation to low, normal, and high light conditions. PMID:23162559

  18. A nuclear factor I-like activity and a liver-specific repressor govern estrogen-regulated in vitro transcription from the Xenopus laevis vitellogenin B1 promoter.

    PubMed

    Corthésy, B; Cardinaux, J R; Claret, F X; Wahli, W

    1989-12-01

    A hormone-controlled in vitro transcription system derived from Xenopus liver nuclear extracts was exploited to identify novel cis-acting elements within the vitellogenin gene B1 promoter region. In addition to the already well-documented estrogen-responsive element (ERE), two elements were found within the 140 base pairs upstream of the transcription initiation site. One of them, a negative regulatory element, is responsible for the lack of promoter activity in the absence of the hormone and, as demonstrated by DNA-binding assays, interacts with a liver-specific transcription factor. The second is required in association with the estrogen-responsive element to mediate hormonal induction and is recognized by the Xenopus liver homolog of nuclear factor I.

  19. Identification and positional distribution analysis of transcription factor binding sites for genes from the wheat fl-cDNA sequences.

    PubMed

    Chen, Zhen-Yong; Guo, Xiao-Jiang; Chen, Zhong-Xu; Chen, Wei-Ying; Wang, Ji-Rui

    2017-06-01

    The binding sites of transcription factors (TFs) in upstream DNA regions are called transcription factor binding sites (TFBSs). TFBSs are important elements for regulating gene expression. To date, there have been few studies on the profiles of TFBSs in plants. In total, 4,873 sequences with 5' upstream regions from 8530 wheat fl-cDNA sequences were used to predict TFBSs. We found 4572 TFBSs for the MADS TF family, which was twice as many as for bHLH (1951), B3 (1951), HB superfamily (1914), ERF (1820), and AP2/ERF (1725) TFs, and was approximately four times higher than the remaining TFBS types. The percentage of TFBSs and TF members showed a distinct distribution in different tissues. Overall, the distribution of TFBSs in the upstream regions of wheat fl-cDNA sequences had significant difference. Meanwhile, high frequencies of some types of TFBSs were found in specific regions in the upstream sequences. Both TFs and fl-cDNA with TFBSs predicted in the same tissues exhibited specific distribution preferences for regulating gene expression. The tissue-specific analysis of TFs and fl-cDNA with TFBSs provides useful information for functional research, and can be used to identify relationships between tissue-specific TFs and fl-cDNA with TFBSs. Moreover, the positional distribution of TFBSs indicates that some types of wheat TFBS have different positional distribution preferences in the upstream regions of genes.

  20. HIV-1 and M-PMV RNA Nuclear Export Elements Program Viral Genomes for Distinct Cytoplasmic Trafficking Behaviors.

    PubMed

    Pocock, Ginger M; Becker, Jordan T; Swanson, Chad M; Ahlquist, Paul; Sherer, Nathan M

    2016-04-01

    Retroviruses encode cis-acting RNA nuclear export elements that override nuclear retention of intron-containing viral mRNAs including the full-length, unspliced genomic RNAs (gRNAs) packaged into assembling virions. The HIV-1 Rev-response element (RRE) recruits the cellular nuclear export receptor CRM1 (also known as exportin-1/XPO1) using the viral protein Rev, while simple retroviruses encode constitutive transport elements (CTEs) that directly recruit components of the NXF1(Tap)/NXT1(p15) mRNA nuclear export machinery. How gRNA nuclear export is linked to trafficking machineries in the cytoplasm upstream of virus particle assembly is unknown. Here we used long-term (>24 h), multicolor live cell imaging to directly visualize HIV-1 gRNA nuclear export, translation, cytoplasmic trafficking, and virus particle production in single cells. We show that the HIV-1 RRE regulates unique, en masse, Rev- and CRM1-dependent "burst-like" transitions of mRNAs from the nucleus to flood the cytoplasm in a non-localized fashion. By contrast, the CTE derived from Mason-Pfizer monkey virus (M-PMV) links gRNAs to microtubules in the cytoplasm, driving them to cluster markedly to the centrosome that forms the pericentriolar core of the microtubule-organizing center (MTOC). Adding each export element to selected heterologous mRNAs was sufficient to confer each distinct export behavior, as was directing Rev/CRM1 or NXF1/NXT1 transport modules to mRNAs using a site-specific RNA tethering strategy. Moreover, multiple CTEs per transcript enhanced MTOC targeting, suggesting that a cooperative mechanism links NXF1/NXT1 to microtubules. Combined, these results reveal striking, unexpected features of retroviral gRNA nucleocytoplasmic transport and demonstrate roles for mRNA export elements that extend beyond nuclear pores to impact gRNA distribution in the cytoplasm.

  1. HIV-1 and M-PMV RNA Nuclear Export Elements Program Viral Genomes for Distinct Cytoplasmic Trafficking Behaviors

    PubMed Central

    Pocock, Ginger M.; Becker, Jordan T.; Swanson, Chad M.; Ahlquist, Paul; Sherer, Nathan M.

    2016-01-01

    Retroviruses encode cis-acting RNA nuclear export elements that override nuclear retention of intron-containing viral mRNAs including the full-length, unspliced genomic RNAs (gRNAs) packaged into assembling virions. The HIV-1 Rev-response element (RRE) recruits the cellular nuclear export receptor CRM1 (also known as exportin-1/XPO1) using the viral protein Rev, while simple retroviruses encode constitutive transport elements (CTEs) that directly recruit components of the NXF1(Tap)/NXT1(p15) mRNA nuclear export machinery. How gRNA nuclear export is linked to trafficking machineries in the cytoplasm upstream of virus particle assembly is unknown. Here we used long-term (>24 h), multicolor live cell imaging to directly visualize HIV-1 gRNA nuclear export, translation, cytoplasmic trafficking, and virus particle production in single cells. We show that the HIV-1 RRE regulates unique, en masse, Rev- and CRM1-dependent “burst-like” transitions of mRNAs from the nucleus to flood the cytoplasm in a non-localized fashion. By contrast, the CTE derived from Mason-Pfizer monkey virus (M-PMV) links gRNAs to microtubules in the cytoplasm, driving them to cluster markedly to the centrosome that forms the pericentriolar core of the microtubule-organizing center (MTOC). Adding each export element to selected heterologous mRNAs was sufficient to confer each distinct export behavior, as was directing Rev/CRM1 or NXF1/NXT1 transport modules to mRNAs using a site-specific RNA tethering strategy. Moreover, multiple CTEs per transcript enhanced MTOC targeting, suggesting that a cooperative mechanism links NXF1/NXT1 to microtubules. Combined, these results reveal striking, unexpected features of retroviral gRNA nucleocytoplasmic transport and demonstrate roles for mRNA export elements that extend beyond nuclear pores to impact gRNA distribution in the cytoplasm. PMID:27070420

  2. Degrees of connectivity: Systems model for upstream risk assessment and mitigation.

    PubMed

    Gambatese, John; AlOmari, Kasim

    2016-08-01

    There is growing recognition that in order to further improve safety performance, attention needs to be given beyond the immediate working conditions and worker actions. A systems approach to construction safety enables considering: multiple project elements simultaneously; connections between different elements; and all system elements affected by safety risk. This paper describes recent and current research to conceptualize a typical building project in terms of connections between workers, activities, and design elements, and to verify and analyze impacts of the design and worker interactions on worker safety. Prior research provides the basis for a network tying the design elements, construction activities, and work crews on a typical building project together along with the extent of interaction between each of the system elements in terms of safety. In conjunction with this systems approach, the researchers propose a concept for viewing and managing construction safety through four different types of connections, or "degrees of connectivity," between the different workers, activities, and design elements in the system. The degrees of connectivity are defined as: interacting with the design element during its construction (DoC #1); interacting with the design element in its final form to attach another component to it (DoC #2) or by working in the vicinity of it (DoC #3); and indirectly interacting with the design element through another worker (DoC #4). To support and verify the presence of the concept in practice, the researchers conducted a survey of construction personnel. The survey results confirm that the four different degrees of connectivity are present and felt during construction operations, and indicate that attention should be given to all design elements, activities, and workers to which a worker is "connected". According to the survey respondents, DoC's #1 and #2 are recognized as the most widely present on construction sites. Eighty percent of the respondents believe that the design element has a moderate or greater impact on worker safety while it is being constructed. These initial research steps provide the starting point for continuing study that aims to develop and demonstrate the degrees of connectivity concept linking workers and design elements, with the goal of understanding how to design a project and work operations in order to improve safety during construction. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. Molecular architecture of the hsp70 promoter after deletion of the TATA box or the upstream regulation region.

    PubMed Central

    Weber, J A; Taxman, D J; Lu, Q; Gilmour, D S

    1997-01-01

    GAGA factor, TFIID, and paused polymerase are present on the hsp70 promoter in Drosophila melanogaster prior to transcriptional activation. In order to investigate the interplay between these components, mutant constructs were analyzed after they had been transformed into flies on P elements. One construct lacked the TATA box and the other lacked the upstream regulatory region where GAGA factor binds. Transcription of each mutant during heat shock was at least 50-fold less than that of a normal promoter construct. Before and after heat shock, both mutant promoters were found to adopt a DNase I hypersensitive state that included the region downstream from the transcription start site. High-resolution analysis of the DNase I cutting pattern identified proteins that could be contributing to the hypersensitivity. GAGA factor footprints were clearly evident in the upstream region of the TATA deletion construct, and a partial footprint possibly caused by TFIID was evident on the TATA box of the upstream deletion construct. Permanganate treatment of intact salivary glands was used to further characterize each promoter construct. Paused polymerase and TFIID were readily detected on the normal promoter construct, whereas both deletions exhibited reduced levels of each of these factors. Hence both the TATA box and the upstream region are required to efficiently recruit TFIID and a paused polymerase to the promoter prior to transcriptional activation. In contrast, GAGA factor appears to be capable of binding and establishing a DNase I hypersensitive region in the absence of TFIID and polymerase. Interestingly, purified GAGA factor was found to bind near the transcription start site, and the strength of this interaction was increased by the presence of the upstream region. GAGA factor alone might be capable of establishing an open chromatin structure that encompasses the upstream regulatory region as well as the core promoter region, thus facilitating the binding of TFIID. PMID:9199313

  4. In silico Analysis of 3′-End-Processing Signals in Aspergillus oryzae Using Expressed Sequence Tags and Genomic Sequencing Data

    PubMed Central

    Tanaka, Mizuki; Sakai, Yoshifumi; Yamada, Osamu; Shintani, Takahiro; Gomi, Katsuya

    2011-01-01

    To investigate 3′-end-processing signals in Aspergillus oryzae, we created a nucleotide sequence data set of the 3′-untranslated region (3′ UTR) plus 100 nucleotides (nt) sequence downstream of the poly(A) site using A. oryzae expressed sequence tags and genomic sequencing data. This data set comprised 1065 sequences derived from 1042 unique genes. The average 3′ UTR length in A. oryzae was 241 nt, which is greater than that in yeast but similar to that in plants. The 3′ UTR and 100 nt sequence downstream of the poly(A) site is notably U-rich, while the region located 15–30 nt upstream of the poly(A) site is markedly A-rich. The most frequently found hexanucleotide in this A-rich region is AAUGAA, although this sequence accounts for only 6% of all transcripts. These data suggested that A. oryzae has no highly conserved sequence element equivalent to AAUAAA, a mammalian polyadenylation signal. We identified that putative 3′-end-processing signals in A. oryzae, while less well conserved than those in mammals, comprised four sequence elements: the furthest upstream U-rich element, A-rich sequence, cleavage site, and downstream U-rich element flanking the cleavage site. Although these putative 3′-end-processing signals are similar to those in yeast and plants, some notable differences exist between them. PMID:21586533

  5. Separation of the PROX1 gene from upstream conserved elements in a complex inversion/translocation patient with hypoplastic left heart

    PubMed Central

    Gill, Harinder K; Parsons, Sian R; Spalluto, Cosma; Davies, Angela F; Knorz, Victoria J; Burlinson, Clare EG; Ng, Bee Ling; Carter, Nigel P; Ogilvie, Caroline Mackie; Wilson, David I; Roberts, Roland G

    2009-01-01

    Hypoplastic left heart (HLH) occurs in at least 1 in 10 000 live births but may be more common in utero. Its causes are poorly understood but a number of affected cases are associated with chromosomal abnormalities. We set out to localize the breakpoints in a patient with sporadic HLH and a de novo translocation. Initial studies showed that the apparently simple 1q41;3q27.1 translocation was actually combined with a 4-Mb inversion, also de novo, of material within 1q41. We therefore localized all four breakpoints and found that no known transcription units were disrupted. However we present a case, based on functional considerations, synteny and position of highly conserved non-coding sequence elements, and the heterozygous Prox1+/− mouse phenotype (ventricular hypoplasia), for the involvement of dysregulation of the PROX1 gene in the aetiology of HLH in this case. Accordingly, we show that the spatial expression pattern of PROX1 in the developing human heart is consistent with a role in cardiac development. We suggest that dysregulation of PROX1 gene expression due to separation from its conserved upstream elements is likely to have caused the heart defects observed in this patient, and that PROX1 should be considered as a potential candidate gene for other cases of HLH. The relevance of another breakpoint separating the cardiac gene ESRRG from a conserved downstream element is also discussed. PMID:19471316

  6. HEAVY METALS STRUCTURE BENTHIC COMUNITIES IN COLORADO MOUNTAIN STREAMS

    EPA Science Inventory

    The development of field sampling designs that employ multiple reference and polluted sites has been proposed as an alternative to the traditional upstream vs. downstream approach used in most biomonitoring studies. Spatially extensive monitoring programs can characterize ecologi...

  7. Integration of Carbon, Nitrogen, and Oxygen Metabolism in Escherichia coli--Final Report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rabinowitz, Joshua D; Wingreen, Ned s; Rabitz, Herschel A

    2012-10-22

    A key challenge for living systems is balancing utilization of multiple elemental nutrients, such as carbon, nitrogen, and oxygen, whose availability is subject to environmental fluctuations. As growth can be limited by the scarcity of any one nutrient, the rate at which each nutrient is assimilated must be sensitive not only to its own availability, but also to that of other nutrients. Remarkably, across diverse nutrient conditions, E. coli grows nearly optimally, balancing effectively the conversion of carbon into energy versus biomass. To investigate the link between the metabolism of different nutrients, we quantified metabolic responses to nutrient perturbations usingmore » LC-MS based metabolomics and built differential equation models that bridge multiple nutrient systems. We discovered that the carbonaceous substrate of nitrogen assimilation, -ketoglutarate, directly inhibits glucose uptake and that the upstream glycolytic metabolite, fructose-1,6-bisphosphate, ultrasensitively regulates anaplerosis to allow rapid adaptation to changing carbon availability. We also showed that NADH controls the metabolic response to changing oxygen levels. Our findings support a general mechanism for nutrient integration: limitation for a nutrient other than carbon leads to build-up of the most closely related product of carbon metabolism, which in turn feedback inhibits further carbon uptake.« less

  8. Cyclic nucleotide-gated ion channel gene family in rice, identification, characterization and experimental analysis of expression response to plant hormones, biotic and abiotic stresses.

    PubMed

    Nawaz, Zarqa; Kakar, Kaleem Ullah; Saand, Mumtaz A; Shu, Qing-Yao

    2014-10-04

    Cyclic nucleotide-gated channels (CNGCs) are Ca2+-permeable cation transport channels, which are present in both animal and plant systems. They have been implicated in the uptake of both essential and toxic cations, Ca2+ signaling, pathogen defense, and thermotolerance in plants. To date there has not been a genome-wide overview of the CNGC gene family in any economically important crop, including rice (Oryza sativa L.). There is an urgent need for a thorough genome-wide analysis and experimental verification of this gene family in rice. In this study, a total of 16 full length rice CNGC genes distributed on chromosomes 1-6, 9 and 12, were identified by employing comprehensive bioinformatics analyses. Based on phylogeny, the family of OsCNGCs was classified into four major groups (I-IV) and two sub-groups (IV-A and IV- B). Likewise, the CNGCs from all plant lineages clustered into four groups (I-IV), where group II was conserved in all land plants. Gene duplication analysis revealed that both chromosomal segmentation (OsCNGC1 and 2, 10 and 11, 15 and 16) and tandem duplications (OsCNGC1 and 2) significantly contributed to the expansion of this gene family. Motif composition and protein sequence analysis revealed that the CNGC specific domain "cyclic nucleotide-binding domain (CNBD)" comprises a "phosphate binding cassette" (PBC) and a "hinge" region that is highly conserved among the OsCNGCs. In addition, OsCNGC proteins also contain various other functional motifs and post-translational modification sites. We successively built a stringent motif: (LI-X(2)-[GS]-X-[FV]-X-G-[1]-ELL-X-W-X(12,22)-SA-X(2)-T-X(7)-[EQ]-AF-X-L) that recognizes the rice CNGCs specifically. Prediction of cis-acting regulatory elements in 5' upstream sequences and expression analyses through quantitative qPCR demonstrated that OsCNGC genes were highly responsive to multiple stimuli including hormonal (abscisic acid, indoleacetic acid, kinetin and ethylene), biotic (Pseudomonas fuscovaginae and Xanthomonas oryzae pv. oryzae) and abiotic (cold) stress. There are 16 CNGC genes in rice, which were probably expanded through chromosomal segmentation and tandem duplications and comprise a PBC and a "hinge" region in the CNBD domain, featured by a stringent motif. The various cis-acting regulatory elements in the upstream sequences may be responsible for responding to multiple stimuli, including hormonal, biotic and abiotic stresses.

  9. Structure and Dynamic Properties of a Glucocorticoid Receptor-Induced Chromatin Transition

    PubMed Central

    Fletcher, Terace M.; Ryu, Byung-Woo; Baumann, Christopher T.; Warren, Barbour S.; Fragoso, Gilberto; John, Sam; Hager, Gordon L.

    2000-01-01

    Activation of the mouse mammary tumor virus (MMTV) promoter by the glucocorticoid receptor (GR) is associated with a chromatin structural transition in the B nucleosome region of the viral long terminal repeat (LTR). Recent evidence indicates that this transition extends upstream of the B nucleosome, encompassing a region larger than a single nucleosome (G. Fragoso, W. D. Pennie, S. John, and G. L. Hager, Mol. Cell. Biol. 18:3633–3644). We have reconstituted MMTV LTR DNA into a polynucleosome array using Drosophila embryo extracts. We show binding of purified GR to specific GR elements within a large, multinucleosome array and describe a GR-induced nucleoprotein transition that is dependent on ATP and a HeLa nuclear extract. Previously uncharacterized GR binding sites in the upstream C nucleosome region are involved in the extended region of chromatin remodeling. We also show that GR-dependent chromatin remodeling is a multistep process; in the absence of ATP, GR binds to multiple sites on the chromatin array and prevents restriction enzyme access to recognition sites. Upon addition of ATP, GR induces remodeling and a large increase in access to enzymes sites within the transition region. These findings suggest a dynamic model in which GR first binds to chromatin after ligand activation, recruits a remodeling activity, and is then lost from the template. This model is consistent with the recent description of a “hit-and-run” mechanism for GR action in living cells (J. G. McNally, W. G. Müller, D. Walker, and G. L. Hager, Science 287:1262–1264, 2000). PMID:10938123

  10. Modelling tidal current energy extraction in large area using a three-dimensional estuary model

    NASA Astrophysics Data System (ADS)

    Chen, Yaling; Lin, Binliang; Lin, Jie

    2014-11-01

    This paper presents a three-dimensional modelling study for simulating tidal current energy extraction in large areas, with a momentum sink term being added into the momentum equations. Due to the limits of computational capacity, the grid size of the numerical model is generally much larger than the turbine rotor diameter. Two models, i.e. a local grid refinement model and a coarse grid model, are employed and an idealized estuary is set up. The local grid refinement model is constructed to simulate the power generation of an isolated turbine and its impacts on hydrodynamics. The model is then used to determine the deployment of turbine farm and quantify a combined thrust coefficient for multiple turbines located in a grid element of coarse grid model. The model results indicate that the performance of power extraction is affected by array deployment, with more power generation from outer rows than inner rows due to velocity deficit influence of upstream turbines. Model results also demonstrate that the large-scale turbine farm has significant effects on the hydrodynamics. The tidal currents are attenuated within the turbine swept area, and both upstream and downstream of the array. While the currents are accelerated above and below turbines, which is contributed to speeding up the wake mixing process behind the arrays. The water levels are heightened in both low and high water levels as the turbine array spanning the full width of estuary. The magnitude of water level change is found to increase with the array expansion, especially at the low water level.

  11. Zebrafish U6 small nuclear RNA gene promoters contain a SPH element in an unusual location.

    PubMed

    Halbig, Kari M; Lekven, Arne C; Kunkel, Gary R

    2008-09-15

    Promoters for vertebrate small nuclear RNA (snRNA) genes contain a relatively simple array of transcriptional control elements, divided into proximal and distal regions. Most of these genes are transcribed by RNA polymerase II (e.g., U1, U2), whereas the U6 gene is transcribed by RNA polymerase III. Previously identified vertebrate U6 snRNA gene promoters consist of a proximal sequence element (PSE) and TATA element in the proximal region, plus a distal region with octamer (OCT) and SphI postoctamer homology (SPH) elements. We have found that zebrafish U6 snRNA promoters contain the SPH element in a novel proximal position immediately upstream of the TATA element. The zebrafish SPH element is recognized by SPH-binding factor/selenocysteine tRNA gene transcription activating factor/zinc finger protein 143 (SBF/Staf/ZNF143) in vitro. Furthermore, a zebrafish U6 promoter with a defective SPH element is inefficiently transcribed when injected into embryos.

  12. BEHAVIOR OF ARSENIC AND OTHER REDOX-SENSITIVE ELEMENTS IN CROWLEY LAKE, CA: A RESERVOIR IN THE LOS ANGELES AQUEDUCT SYSTEM. (R826202)

    EPA Science Inventory

    Elevated arsenic concentrations in Crowley Lake derive from upstream geothermal inputs. We examined the water column of Crowley Lake under stratified and unstratified conditions, seeking evidence for algal uptake and transformation of arsenic and its deposition to and release fro...

  13. The human luteinizing hormone receptor gene promoter: activation by Sp1 and Sp3 and inhibitory regulation.

    PubMed

    Geng, Y; Tsai-Morris, C H; Zhang, Y; Dufau, M L

    1999-09-24

    To understand the transcriptional mechanism(s) of human LH receptor (LHR) gene expression, we have identified the dominant functional cis-elements that regulate the activity of the promoter domain (-1 to -176 bp from ATG). Mutagenesis demonstrated that the promoter activity was dependent on two Sp1 domains (-79 bp, -120 bp) in a transformed normal placental cell (PLC) and the choriocarcinoma JAR cell. Both elements interacted with endogenous Sp1 and Sp3 factors but not with Sp2 or Sp4. In Drosophila SL2 cells, the promoter was activated by either Sp1 or Sp3. An ERE half-site (EREhs) at -174 bp was inhibitory (by 100%), but was unresponsive to estradiol and did not bind the estrogen receptor or orphan receptors ERR1 and SF-1. The 5' upstream sequence (-177 to -2056 bp) inhibited promoter activity in PLC by 60%, but only minimally in JAR cells. Activation of the human LHR promoter through Sp1/3 factors is negatively regulated through EREhs and upstream sequences to exert control of gene expression. Copyright 1999 Academic Press.

  14. Evidence that sea lampreys (Petromyzon marinus) complete their life cycle within a tributary of the Laurentian Great Lakes by parasitizing fishes in inland lakes

    USGS Publications Warehouse

    Johnson, Nicholas; Twohey, Michael B.; Miehls, Scott M.; Cwalinski, Tim A; Godby, Neal A; Lochet, Aude; Slade, Jeffrey W.; Jubar, Aaron K.; Siefkes, Michael J.

    2016-01-01

    The sea lamprey (Petromyzon marinus) invaded the upper Laurentian Great Lakes and feeds on valued fish. The Cheboygan River, Michigan, USA, is a large sea lamprey producing tributary to Lake Huron and despite having a renovated dam 2 km from the river mouth that presumably blocks sea lamprey spawning migrations, the watershed upstream of the dam remains infested with larval sea lamprey. A navigational lock near the dam has been hypothesized as the means of escapement of adult sea lampreys from Lake Huron and source of the upper river population (H1). However, an alternative hypothesis (H2) is that some sea lampreys complete their life cycle upstream of the dam, without entering Lake Huron. To evaluate the alternative hypothesis, we gathered angler reports of lamprey wounds on game fishes upstream of the dam, and captured adult sea lampreys downstream and upstream of the dam to contrast abundance, run timing, size, and statolith microchemistry. Results indicate that a small population of adult sea lampreys (n < 200) completed their life cycle upstream of the dam during 2013 and 2014. This is the most comprehensive evidence that sea lampreys complete their life history within a tributary of the upper Great Lakes, and indicates that similar landlocked populations could occur in other watersheds. Because the adult sea lamprey population upstream of the dam is small, complete elimination of the already low adult escapement from Lake Huron might allow multiple control tactics such as lampricides, trapping, and sterile male release to eradicate the population.

  15. Regulatory motifs for CREB-binding protein and Nfe2l2 transcription factors in the upstream enhancer of the mitochondrial uncoupling protein 1 gene.

    PubMed

    Rim, Jong S; Kozak, Leslie P

    2002-09-13

    Thermogenesis against cold exposure in mammals occurs in brown adipose tissue (BAT) through mitochondrial uncoupling protein (UCP1). Expression of the Ucp1 gene is unique in brown adipocytes and is regulated tightly. The 5'-flanking region of the mouse Ucp1 gene contains cis-acting elements including PPRE, TRE, and four half-site cAMP-responsive elements (CRE) with BAT-specific enhancer elements. In the course of analyzing how these half-site CREs are involved in Ucp1 expression, we found that a DNA regulatory element for NF-E2 overlaps CRE2. Electrophoretic mobility shift assay and competition assays with the CRE2 element indicates that nuclear proteins from BAT, inguinal fat, and retroperitoneal fat tissue interact with the CRE2 motif (CGTCA) in a specific manner. A supershift assay using an antibody against the CRE-binding protein (CREB) shows specific affinity to the complex from CRE2 and nuclear extract of BAT. Additionally, Western blot analysis for phospho-CREB/ATF1 shows an increase in phosphorylation of CREB/ATF1 in HIB-1B cells after norepinephrine treatment. Transient transfection assay using luciferase reporter constructs also indicates that the two half-site CREs are involved in transcriptional regulation of Ucp1 in response to norepinephrine and cAMP. We also show that a second DNA regulatory element for NF-E2 is located upstream of the CRE2 region. This element, which is found in a similar location in the 5'-flanking region of the human and rodent Ucp1 genes, shows specific binding to rat and human NF-E2 by electrophoretic mobility shift assay with nuclear extracts from brown fat. Co-transfections with an Nfe2l2 expression vector and a luciferase reporter construct of the Ucp1 enhancer region provide additional evidence that Nfe2l2 is involved in the regulation of Ucp1 by cAMP-mediated signaling.

  16. Diurnal cycles control the fate of contaminants at an Andean river confluence impacted by legacy mining

    NASA Astrophysics Data System (ADS)

    Pasten, P.; Guerra, P. A.; Simonson, K.; Bonilla, C.; Pizarro, G. E.; Escauriaza, C. R.; González, C.

    2014-12-01

    The importance of hydrologic-geochemical interactions in arid environments is a controlling factor in quality and quantity of water available for human consumption and agriculture. When acid drainage affects these watersheds, water quality is gravely degraded. Despite its effect on watersheds, the relationship between time changes in hydrological variables and water quality in arid regions has not been studied thoroughly. Temporal variations in acid drainage can control when the transport of toxic elements is increased. We performed field work at the Azufre River (pH 2, E.C~10.9 mS/cm) and Caracarani River (pH 8.7, E.C~1.2 mS/cm) confluence, located in the Northern Chilean Altiplano (at 4000 m asl). We registered stream flowrates (total flowrate~430 L/s), temperature and electric conductivity (E.C) hourly using in-stream data loggers during one year. We also measured turbidity and pH during one field survey at different distances from the junction, as a proxy of the formation of iron-aluminum particles that cycle trace elements in these environments. We found turbidity-pH diurnal cycles were caused by upstream hourly changes in upstream flowrate: when the Caracarani River flowrate reached its daily peak, particle formation occurred, while the dissolution of particles occurred when the Azufre River reached its maximum value. This last process occurred due to upstream freeze-thaw cycles. This study shows how the dynamics of natural confluences determines chemical transport. The formation of particles enriched in toxic elements can promote settling as a natural attenuation process, while their dissolution will produce their release and transport long distances downstream. It is important to consider time as an important variable in water quality monitoring and in water management infrastructure where pulses of contamination can have potentially negative effects in its use. Acknowledgements: Funding was provided by "Proyecto Fondecyt 1130936" and "CONICYT/FONDAP 15110020".

  17. Mutations That Stimulate flhDC Expression in Escherichia coli K-12.

    PubMed

    Fahrner, Karen A; Berg, Howard C

    2015-10-01

    Motility is a beneficial attribute that enables cells to access and explore new environments and to escape detrimental ones. The organelle of motility in Escherichia coli is the flagellum, and its production is initiated by the activating transcription factors FlhD and FlhC. The expression of these factors by the flhDC operon is highly regulated and influenced by environmental conditions. The flhDC promoter is recognized by σ(70) and is dependent on the transcriptional activator cyclic AMP (cAMP)-cAMP receptor protein complex (cAMP-CRP). A number of K-12 strains exhibit limited motility due to low expression levels of flhDC. We report here a large number of mutations that stimulate flhDC expression in such strains. They include single nucleotide changes in the -10 element of the promoter, in the promoter spacer, and in the cAMP-CRP binding region. In addition, we show that insertion sequence (IS) elements or a kanamycin gene located hundreds of base pairs upstream of the promoter can effectively enhance transcription, suggesting that the topology of a large upstream region plays a significant role in the regulation of flhDC expression. None of the mutations eliminated the requirement for cAMP-CRP for activation. However, several mutations allowed expression in the absence of the nucleoid organizing protein, H-NS, which is normally required for flhDC expression. The flhDC operon of Escherichia coli encodes transcription factors that initiate flagellar synthesis, an energetically costly process that is highly regulated. Few deregulating mutations have been reported thus far. This paper describes new single nucleotide mutations that stimulate flhDC expression, including a number that map to the promoter spacer region. In addition, this work shows that insertion sequence elements or a kanamycin gene located far upstream from the promoter or repressor binding sites also stimulate transcription, indicating a role of regional topology in the regulation of flhDC expression. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  18. Distal regulatory regions restrict the expression of cis-linked genes to the tapetal cells.

    PubMed

    Franco, Luciana O; de O Manes, Carmem Lara; Hamdi, Said; Sachetto-Martins, Gilberto; de Oliveira, Dulce E

    2002-04-24

    The oleosin glycine-rich protein genes Atgrp-6, Atgrp-7, and Atgrp-8 occur in clusters in the Arabidopsis genome and are expressed specifically in the tapetum cells. The cis-regulatory regions involved in the tissue-specific gene expression were investigated by fusing different segments of the gene cluster to the uidA reporter gene. Common distal regulatory regions were identified that coordinate expression of the sequential genes. At least two of these genes were regulated spatially by proximal and distal sequences. The cis-acting elements (122 bp upstream of the transcriptional start point) drive the uidA expression to floral tissues, whereas distal 5' upstream regions restrict the gene activity to tapetal cells.

  19. Sequence Requirements of the 5-Enolpyruvylshikimate-3-phosphate Synthase 5[prime]-Upstream Region for Tissue-Specific Expression in Flowers and Seedlings.

    PubMed Central

    Benfey, PN; Takatsuji, H; Ren, L; Shah, DM; Chua, NH

    1990-01-01

    We have analyzed expression from deletion derivatives of the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) 5[prime]-upstream region in transgenic petunia flowers and seedlings. In seedlings, expression was strongest in root cortex cells and in trichomes. High-level expression in petals and in seedling roots was conferred by large (>500 base-pair) stretches of sequence, but was lost when smaller fragments were analyzed individually. This apparent requirement for extensive sequence suggests that combinations of cis-elements that are widely separated control tissue-specific expression from the EPSPS promoter. We have also used the high-level, petal-specific expression of the EPSPS promoter to change petal color in two mutant petunia lines. PMID:12354968

  20. Method and apparatus for in-cell vacuuming of radiologically contaminated materials

    DOEpatents

    Spadaro, Peter R.; Smith, Jay E.; Speer, Elmer L.; Cecconi, Arnold L.

    1987-01-01

    A vacuum air flow operated cyclone separator arrangement for collecting, handling and packaging loose contaminated material in accordance with acceptable radiological and criticality control requirements. The vacuum air flow system includes a specially designed fail-safe prefilter installed upstream of the vacuum air flow power supply. The fail-safe prefilter provides in-cell vacuum system flow visualization and automatically reduces or shuts off the vacuum air flow in the event of an upstream prefilter failure. The system is effective for collecting and handling highly contaminated radiological waste in the form of dust, dirt, fuel element fines, metal chips and similar loose material in accordance with radiological and criticality control requirements for disposal by means of shipment and burial.

  1. Wireless zoned particulate matter filter regeneration control system

    DOEpatents

    Gonze, Eugene V [Pinckney, MI; Kirby, Kevin W [Calabasas Hills, CA; Phelps, Amanda [Malibu, CA; Gregoire, Daniel J [Thousand Oaks, CA

    2011-10-04

    An assembly includes a particulate matter (PM) filter that comprises an upstream end for receiving exhaust gas, a downstream end and multiple zones. An absorbing layer absorbs microwave energy in one of N frequency ranges and is arranged with the upstream end. N is an integer. A frequency selective filter has M frequency selective segments and receives microwave energy in the N frequency ranges. M is an integer. One of the M frequency selective segments permits passage of the microwave energy in one of the N frequency ranges and does not permit passage of microwave energy in the other of the N frequency ranges.

  2. Computational fluid dynamics modeling of intracranial aneurysms: effects of parent artery segmentation on intra-aneurysmal hemodynamics.

    PubMed

    Castro, M A; Putman, C M; Cebral, J R

    2006-09-01

    The purpose of this study is to show the influence of the upstream parent artery geometry on intraaneurysmal hemodynamics of cerebral aneurysms. Patient-specific models of 4 cerebral aneurysms (1 posterior communicating artery [PcomA], 2 middle cerebral artery [MCA], and 1 anterior communicating artery [AcomA]) were constructed from 3D rotational angiography images. Two geometric models were constructed for each aneurysm. One model had the native parent vessel geometry; the second model was truncated approximately 1 cm upstream from the aneurysm, and the parent artery replaced with a straight cylinder. Corresponding finite element grids were generated and computational fluid dynamics simulations were carried out under pulsatile flow conditions. The intra-aneurysmal flow patterns and wall shear stress (WSS) distributions were visualized and compared. Models using the truncated parent vessel underestimated the WSS in the aneurysms in all cases and shifted the impaction zone to the neck compared with the native geometry. These effects were more pronounced in the PcomA and AcomA aneurysms where upstream curvature was substantial. The MCA aneurysm with a long M1 segment was the least effected. The more laminar flow pattern within the parent vessel in truncated models resulted in a less complex intra-aneurysmal flow patterns with fewer vortices and less velocity at the dome. Failure to properly model the inflow stream contributed by the upstream parent artery can significantly influence the results of intra-aneurysmal hemodynamic models. The upstream portion of the parent vessel of cerebral aneurysms should be included to accurately represent the intra-aneurysmal hemodynamics.

  3. Transcriptional mapping of the varicella-zoster virus regulatory genes encoding open reading frames 4 and 63.

    PubMed Central

    Kinchington, P R; Vergnes, J P; Defechereux, P; Piette, J; Turse, S E

    1994-01-01

    Four of the 68 varicella-zoster virus (VZV) unique open reading frames (ORFs), i.e., ORFs 4, 61, 62, and 63, encode proteins that influence viral transcription and are considered to be positional homologs of herpes simplex virus type 1 (HSV-1) immediate-early (IE) proteins. In order to identify the elements that regulate transcription of VZV ORFs 4 and 63, the encoded mRNAs were mapped in detail. For ORF 4, a major 1.8-kb and a minor 3.0-kb polyadenylated [poly(A)+] RNA were identified, whereas ORF 63-specific probes recognized 1.3- and 1.9-kb poly(A)+ RNAs. Probes specific for sequences adjacent to the ORFs and mapping of the RNA 3' ends indicated that the ORF 4 RNAs were 3' coterminal, whereas the RNAs for ORF 63 represented two different termination sites. S1 nuclease mapping and primer extension analyses indicated a single transcription initiation site for ORF 4 at 38 bp upstream of the ORF start codon. For ORF 63, multiple transcriptional start sites at 87 to 95, 151 to 153, and (tentatively) 238 to 243 bp upstream of the ORF start codon were identified. TATA box motifs at good positional locations were found upstream of all mapped transcription initiation sites. However, no sequences resembling the TAATGARAT motif, which confers IE regulation upon HSV-1 IE genes, were found. The finding of the absence of this motif was supported through analyses of the regulatory sequences of ORFs 4 and 63 in transient transfection assays alongside those of ORFs 61 and 62. Sequences representing the promoters for ORFs 4, 61, and 63 were all stimulated by VZV infection but failed to be stimulated by coexpression with the HSV-1 transactivator Vmw65. In contrast, the promoter for ORF 62, which contains TAATGARAT motifs, was activated by VZV infection and coexpression with Vmw65. These results extend the transcriptional knowledge for VZV and suggest that ORFs 4 and 63 contain regulatory signals different from those of the ORF 62 and HSV-1 IE genes. Images PMID:8189496

  4. Experimental measurements and Monte Carlo simulations of dose perturbation around a nonradioactive brachytherapy seed due to 6- and 18-MV photons.

    PubMed

    Steinman, James Paul; Bakhtiari, Mohammad; Malhotra, Harish Kumar

    2012-01-01

    Radioactive seeds used in permanent prostate brachytherapy are composed of high-Z metals and may exceed 100 in a patient. If supplemental external beam treatment is administered afterward, the seeds may cause substantial dose perturbation, which is being investigated in this article. Film measurements using 6-MV beam were primarily carried out using Kodak XV2 film layered above and below a nonradioactive iodine-125 ((125)I) seed. Monte Carlo simulations were carried out using DOSXYZnrc. Other experimental comparisons looked at changing beam energy, depth, and field size, including two opposing fields' pair. Effect of multiple seeds spatially spaced 0.5cm vertically was also studied. For a single (125)I seed, on XV film, there is a localized dose enhancement of 6.3% upstream and -10.9% downstream. With two opposing fields, a cold spot around the seed of ∼3% was noticed. Increasing beam energy and field size decreased the magnitude of this effect, whereas the effect was found to increase with the increasing Z of material. DOSXYZnrc and EBT-2 film verified maximum dose enhancement of +15% upstream and -20% downstream of the (125)I seed surface. In general, the dose perturbation because of the seeds was spatially limited to ∼2mm upstream and ∼5mm downstream to the incident beam. Similar to other heterogeneities, the seeds perturbation depends on incident beam energy, field size, and its Z. With multiple seeds spatially apart and multiple radiation fields routinely used in external beam radiotherapy, the cumulative effect may not result in clinically significant dose perturbation. Copyright © 2012 American Brachytherapy Society. Published by Elsevier Inc. All rights reserved.

  5. The Advanced Composition Explorer Shock Database and Application to Particle Acceleration Theory

    NASA Technical Reports Server (NTRS)

    Parker, L. Neergaard; Zank, G. P.

    2015-01-01

    The theory of particle acceleration via diffusive shock acceleration (DSA) has been studied in depth by Gosling et al. (1981), van Nes et al. (1984), Mason (2000), Desai et al. (2003), Zank et al. (2006), among many others. Recently, Parker and Zank (2012, 2014) and Parker et al. (2014) using the Advanced Composition Explorer (ACE) shock database at 1 AU explored two questions: does the upstream distribution alone have enough particles to account for the accelerated downstream distribution and can the slope of the downstream accelerated spectrum be explained using DSA? As was shown in this research, diffusive shock acceleration can account for a large population of the shocks. However, Parker and Zank (2012, 2014) and Parker et al. (2014) used a subset of the larger ACE database. Recently, work has successfully been completed that allows for the entire ACE database to be considered in a larger statistical analysis. We explain DSA as it applies to single and multiple shocks and the shock criteria used in this statistical analysis. We calculate the expected injection energy via diffusive shock acceleration given upstream parameters defined from the ACE Solar Wind Electron, Proton, and Alpha Monitor (SWEPAM) data to construct the theoretical upstream distribution. We show the comparison of shock strength derived from diffusive shock acceleration theory to observations in the 50 keV to 5 MeV range from an instrument on ACE. Parameters such as shock velocity, shock obliquity, particle number, and time between shocks are considered. This study is further divided into single and multiple shock categories, with an additional emphasis on forward-forward multiple shock pairs. Finally with regard to forward-forward shock pairs, results comparing injection energies of the first shock, second shock, and second shock with previous energetic population will be given.

  6. The Advanced Composition Explorer Shock Database and Application to Particle Acceleration Theory

    NASA Technical Reports Server (NTRS)

    Parker, L. Neergaard; Zank, G. P.

    2015-01-01

    The theory of particle acceleration via diffusive shock acceleration (DSA) has been studied in depth by Gosling et al. (1981), van Nes et al. (1984), Mason (2000), Desai et al. (2003), Zank et al. (2006), among many others. Recently, Parker and Zank (2012, 2014) and Parker et al. (2014) using the Advanced Composition Explorer (ACE) shock database at 1 AU explored two questions: does the upstream distribution alone have enough particles to account for the accelerated downstream distribution and can the slope of the downstream accelerated spectrum be explained using DSA? As was shown in this research, diffusive shock acceleration can account for a large population of the shocks. However, Parker and Zank (2012, 2014) and Parker et al. (2014) used a subset of the larger ACE database. Recently, work has successfully been completed that allows for the entire ACE database to be considered in a larger statistical analysis. We explain DSA as it applies to single and multiple shocks and the shock criteria used in this statistical analysis. We calculate the expected injection energy via diffusive shock acceleration given upstream parameters defined from the ACE Solar Wind Electron, Proton, and Alpha Monitor (SWEPAM) data to construct the theoretical upstream distribution. We show the comparison of shock strength derived from diffusive shock acceleration theory to observations in the 50 keV to 5 MeV range from an instrument on ACE. Parameters such as shock velocity, shock obliquity, particle number, and time between shocks are considered. This study is further divided into single and multiple shock categories, with an additional emphasis on forward-forward multiple shock pairs. Finally with regard to forwardforward shock pairs, results comparing injection energies of the first shock, second shock, and second shock with previous energetic population will be given.

  7. Identification of a peroxisome proliferator-responsive element upstream of the gene encoding rat peroxisomal enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase.

    PubMed Central

    Zhang, B; Marcus, S L; Sajjadi, F G; Alvares, K; Reddy, J K; Subramani, S; Rachubinski, R A; Capone, J P

    1992-01-01

    Ciprofibrate, a hypolipidemic drug that acts as a peroxisome proliferator, induces the transcription of genes encoding peroxisomal beta-oxidation enzymes. To identify cis-acting promoter elements involved in this induction, 5.8 kilobase pairs of promoter sequence from the gene encoding rat peroxisomal enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase (EC 4.2.1.17/EC 1.1.1.35) was inserted upstream of a luciferase reporter gene. Transfection of this expression vector into rat hepatoma H4IIEC3 cells in the presence of ciprofibrate resulted in a 5- to 10-fold, cell type-specific increase in luciferase activity as compared to cells transfected in the absence of drug. A peroxisome proliferator-responsive element (PPRE) was localized to a 196-nucleotide region centered at position -2943 from the transcription start site. This PPRE conferred ciprofibrate responsiveness on a heterologous promoter and functioned independently of orientation or position. Gel retardation analysis with nuclear extracts demonstrated that ciprofibrate-treated or untreated H4IIEC3 cells, but not HeLa cells or monkey kidney cells, contained sequence-specific DNA binding factors that interact with the PPRE. These results have implications for understanding the mechanisms of coordinated transcriptional induction of genes encoding peroxisomal proteins by hypolipidemic agents and other peroxisome proliferators. Images PMID:1502166

  8. Heat pump system with selective space cooling

    DOEpatents

    Pendergrass, J.C.

    1997-05-13

    A reversible heat pump provides multiple heating and cooling modes and includes a compressor, an evaporator and heat exchanger all interconnected and charged with refrigerant fluid. The heat exchanger includes tanks connected in series to the water supply and a condenser feed line with heat transfer sections connected in counterflow relationship. The heat pump has an accumulator and suction line for the refrigerant fluid upstream of the compressor. Sub-cool transfer tubes associated with the accumulator/suction line reclaim a portion of the heat from the heat exchanger. A reversing valve switches between heating/cooling modes. A first bypass is operative to direct the refrigerant fluid around the sub-cool transfer tubes in the space cooling only mode and during which an expansion valve is utilized upstream of the evaporator/indoor coil. A second bypass is provided around the expansion valve. A programmable microprocessor activates the first bypass in the cooling only mode and deactivates the second bypass, and vice-versa in the multiple heating modes for said heat exchanger. In the heating modes, the evaporator may include an auxiliary outdoor coil for direct supplemental heat dissipation into ambient air. In the multiple heating modes, the condensed refrigerant fluid is regulated by a flow control valve. 4 figs.

  9. Heat pump system with selective space cooling

    DOEpatents

    Pendergrass, Joseph C.

    1997-01-01

    A reversible heat pump provides multiple heating and cooling modes and includes a compressor, an evaporator and heat exchanger all interconnected and charged with refrigerant fluid. The heat exchanger includes tanks connected in series to the water supply and a condenser feed line with heat transfer sections connected in counterflow relationship. The heat pump has an accumulator and suction line for the refrigerant fluid upstream of the compressor. Sub-cool transfer tubes associated with the accumulator/suction line reclaim a portion of the heat from the heat exchanger. A reversing valve switches between heating/cooling modes. A first bypass is operative to direct the refrigerant fluid around the sub-cool transfer tubes in the space cooling only mode and during which an expansion valve is utilized upstream of the evaporator/indoor coil. A second bypass is provided around the expansion valve. A programmable microprocessor activates the first bypass in the cooling only mode and deactivates the second bypass, and vice-versa in the multiple heating modes for said heat exchanger. In the heating modes, the evaporator may include an auxiliary outdoor coil for direct supplemental heat dissipation into ambient air. In the multiple heating modes, the condensed refrigerant fluid is regulated by a flow control valve.

  10. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  11. Comparing Experiment and Computation of Hypersonic Laminar Boundary Layers with Isolated Roughness

    NASA Technical Reports Server (NTRS)

    Bathel, Brett F.; Iyer, Prahladh S.; Mahesh, Krishnan; Danehy, Paul M.; Inman, Jennifer A.; Jones, Stephen B.; Johansen, Craig T.

    2014-01-01

    Streamwise velocity profile behavior in a hypersonic laminar boundary layer in the presence of an isolated roughness element is presented for an edge Mach number of 8.2. Two different roughness element types are considered: a 2-mm tall, 4-mm diameter cylinder, and a 2-mm radius hemisphere. Measurements of the streamwise velocity behavior using nitric oxide (NO) planar laser-induced fluorescence (PLIF) molecular tagging velocimetry (MTV) have been performed on a 20-degree wedge model. The top surface of this model acts as a flat-plate and is oriented at 5 degrees with respect to the freestream flow. Computations using direct numerical simulation (DNS) of these flows have been performed and are compared to the measured velocity profiles. Particular attention is given to the characteristics of velocity profiles immediately upstream and downstream of the roughness elements. In these regions, the streamwise flow can experience strong deceleration or acceleration. An analysis in which experimentally measured MTV profile displacements are compared with DNS particle displacements is performed to determine if the assumption of constant velocity over the duration of the MTV measurement is valid. This assumption is typically made when reporting MTV-measured velocity profiles, and may result in significant errors when comparing MTV measurements to computations in regions with strong deceleration or acceleration. The DNS computations with the cylindrical roughness element presented in this paper were performed with and without air injection from a rectangular slot upstream of the cylinder. This was done to determine the extent to which gas seeding in the MTV measurements perturbs the boundary layer flowfield.

  12. RNA from the 5' end of the R2 retrotransposon controls R2 protein binding to and cleavage of its DNA target site.

    PubMed

    Christensen, Shawn M; Ye, Junqiang; Eickbush, Thomas H

    2006-11-21

    Non-LTR retrotransposons insert into eukaryotic genomes by target-primed reverse transcription (TPRT), a process in which cleaved DNA targets are used to prime reverse transcription of the element's RNA transcript. Many of the steps in the integration pathway of these elements can be characterized in vitro for the R2 element because of the rigid sequence specificity of R2 for both its DNA target and its RNA template. R2 retrotransposition involves identical subunits of the R2 protein bound to different DNA sequences upstream and downstream of the insertion site. The key determinant regulating which DNA-binding conformation the protein adopts was found to be a 320-nt RNA sequence from near the 5' end of the R2 element. In the absence of this 5' RNA the R2 protein binds DNA sequences upstream of the insertion site, cleaves the first DNA strand, and conducts TPRT when RNA containing the 3' untranslated region of the R2 transcript is present. In the presence of the 320-nt 5' RNA, the R2 protein binds DNA sequences downstream of the insertion site. Cleavage of the second DNA strand by the downstream subunit does not appear to occur until after the 5' RNA is removed from this subunit. We postulate that the removal of the 5' RNA normally occurs during reverse transcription, and thus provides a critical temporal link to first- and second-strand DNA cleavage in the R2 retrotransposition reaction.

  13. Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene.

    PubMed Central

    Mavrothalassitis, G J; Watson, D K; Papas, T S

    1990-01-01

    The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical "TATA" and "CAAT" elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1400 base pairs (bp) upstream from the first major transcription initiation site. A G + C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long (approximately 250-bp) polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. This region of 159 bp contains putative binding sites for transcription factors Sp1 and AP2 (one for each), the GC element, one small forward repeat, one inverted repeat, and half of the polypurine-pyrimidine tract. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with "TATA-less" promoters. Images PMID:2405393

  14. An Insulator Element Located at the Cyclin B1 Interacting Protein 1 Gene Locus Is Highly Conserved among Mammalian Species

    PubMed Central

    Yoshida, Wataru; Tomikawa, Junko; Inaki, Makoto; Kimura, Hiroshi; Onodera, Masafumi; Hata, Kenichiro; Nakabayashi, Kazuhiko

    2015-01-01

    Insulators are cis-elements that control the direction of enhancer and silencer activities (enhancer-blocking) and protect genes from silencing by heterochromatinization (barrier activity). Understanding insulators is critical to elucidate gene regulatory mechanisms at chromosomal domain levels. Here, we focused on a genomic region upstream of the mouse Ccnb1ip1 (cyclin B1 interacting protein 1) gene that was methylated in E9.5 embryos of the C57BL/6 strain, but unmethylated in those of the 129X1/SvJ and JF1/Ms strains. We hypothesized the existence of an insulator-type element that prevents the spread of DNA methylation within the 1.8 kbp segment, and actually identified a 242-bp and a 185-bp fragments that were located adjacent to each other and showed insulator and enhancer activities, respectively, in reporter assays. We designated these genomic regions as the Ccnb1ip1 insulator and the Ccnb1ip1 enhancer. The Ccnb1ip1 insulator showed enhancer-blocking activity in the luciferase assays and barrier activity in the colony formation assays. Further examination of the Ccnb1ip1 locus in other mammalian species revealed that the insulator and enhancer are highly conserved among a wide variety of species, and are located immediately upstream of the transcriptional start site of Ccnb1ip1. These newly identified cis-elements may be involved in transcriptional regulation of Ccnb1ip1, which is important in meiotic crossing-over and G2/M transition of the mitotic cell cycle. PMID:26110280

  15. Origins of extrinsic variability in eukaryotic gene expression

    NASA Astrophysics Data System (ADS)

    Volfson, Dmitri; Marciniak, Jennifer; Blake, William J.; Ostroff, Natalie; Tsimring, Lev S.; Hasty, Jeff

    2006-02-01

    Variable gene expression within a clonal population of cells has been implicated in a number of important processes including mutation and evolution, determination of cell fates and the development of genetic disease. Recent studies have demonstrated that a significant component of expression variability arises from extrinsic factors thought to influence multiple genes simultaneously, yet the biological origins of this extrinsic variability have received little attention. Here we combine computational modelling with fluorescence data generated from multiple promoter-gene inserts in Saccharomyces cerevisiae to identify two major sources of extrinsic variability. One unavoidable source arising from the coupling of gene expression with population dynamics leads to a ubiquitous lower limit for expression variability. A second source, which is modelled as originating from a common upstream transcription factor, exemplifies how regulatory networks can convert noise in upstream regulator expression into extrinsic noise at the output of a target gene. Our results highlight the importance of the interplay of gene regulatory networks with population heterogeneity for understanding the origins of cellular diversity.

  16. Origins of extrinsic variability in eukaryotic gene expression

    NASA Astrophysics Data System (ADS)

    Volfson, Dmitri; Marciniak, Jennifer; Blake, William J.; Ostroff, Natalie; Tsimring, Lev S.; Hasty, Jeff

    2006-03-01

    Variable gene expression within a clonal population of cells has been implicated in a number of important processes including mutation and evolution, determination of cell fates and the development of genetic disease. Recent studies have demonstrated that a significant component of expression variability arises from extrinsic factors thought to influence multiple genes in concert, yet the biological origins of this extrinsic variability have received little attention. Here we combine computational modeling with fluorescence data generated from multiple promoter-gene inserts in Saccharomyces cerevisiae to identify two major sources of extrinsic variability. One unavoidable source arising from the coupling of gene expression with population dynamics leads to a ubiquitous noise floor in expression variability. A second source which is modeled as originating from a common upstream transcription factor exemplifies how regulatory networks can convert noise in upstream regulator expression into extrinsic noise at the output of a target gene. Our results highlight the importance of the interplay of gene regulatory networks with population heterogeneity for understanding the origins of cellular diversity.

  17. Filament condition-specific response elements control the expression of NRG1 and UME6, key transcriptional regulators of morphology and virulence in Candida albicans.

    PubMed

    Childers, Delma S; Kadosh, David

    2015-01-01

    Candida albicans is the most frequently isolated human fungal pathogen and can cause a range of mucosal and systemic infections in immunocompromised individuals. Morphogenesis, the ability to undergo a reversible transition from budding yeast to elongated filaments, is an essential virulence trait. The yeast-to-filament transition is associated with expression of genes specifically important for filamentation as well as other virulence-related processes, and is controlled, in part, by the key transcriptional regulators Nrg1 and Ume6. Both of these regulators are themselves controlled at the transcriptional level by filament-inducing environmental cues, although little is known about how this process occurs. In order to address this question and determine whether environmental signals regulate transcription of UME6 and NRG1 via distinct and/or common promoter elements, we performed promoter deletion analyses. Strains bearing promoter deletion constructs were induced to form filaments in YEPD plus 10% serum at 37°C, Spider medium (nitrogen and carbon starvation) and/or Lee's medium pH 6.8 (neutral pH) and reporter gene expression was measured. In the NRG1 promoter we identified several distinct condition-specific response elements for YEPD plus 10% serum at 37°C and Spider medium. In the UME6 promoter we also identified response elements for YEPD plus 10% serum at 37°C. While a few of these elements are distinct, others overlap with those which respond to Lee's pH 6.8 medium. Consistent with UME6 possessing a very long 5' UTR, many response elements in the UME6 promoter are located significantly upstream from the coding sequence. Our data indicate that certain distinct condition-specific elements can control expression of C. albicans UME6 and NRG1 in response to key filament-inducing environmental cues. Because C. albicans encounters a variety of host microenvironments during infection, our results suggest that UME6 and NRG1 expression can be differentially modulated by multiple signaling pathways to control filamentation and virulence in vivo.

  18. Profiles of embryonic nuclear protein binding to the proximal promoter region of the soybean β-conglycinin α subunit gene.

    PubMed

    Yoshino, M; Tsutsumi, K; Kanazawa, A

    2015-01-01

    β-Conglycinin, a major component of seed storage protein in soybean, comprises three subunits: α, α' and β. The expression of genes for these subunits is strictly controlled during embryogenesis. The proximal promoter region up to 245 bp upstream of the transcription start site of the α subunit gene sufficiently confers spatial and temporal control of transcription in embryos. Here, the binding profile of nuclear proteins in the proximal promoter region of the α subunit gene was analysed. DNase I footprinting analysis indicated binding of proteins to the RY element and DNA regions including box I, a region conserved in cognate gene promoters. An electrophoretic mobility shift assay (EMSA) using different portions of box I as a probe revealed that multiple portions of box I bind to nuclear proteins. In addition, an EMSA using nuclear proteins extracted from embryos at different developmental stages indicated that the levels of major DNA-protein complexes on box I increased during embryo maturation. These results are consistent with the notion that box I is important for the transcriptional control of seed storage protein genes. Furthermore, the present data suggest that nuclear proteins bind to novel motifs in box I including 5'-TCAATT-3' rather than to predicted cis-regulatory elements. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

  19. Concentrations of mercury and other trace elements in walleye, smallmouth bass, and rainbow trout in Franklin D. Roosevelt Lake and the upper Columbia River, Washington, 1994

    USGS Publications Warehouse

    Munn, M.D.; Cox, S.E.; Dean, C.J.

    1995-01-01

    Three species of sportfish--walleye, smallmouth bass, and rainbow trout--were collected from Franklin D. Roosevelt Lake and the upstream reach of the Columbia River within the state of Washington, to determine the concentrations of mercury and other selected trace elements in fish tissue. Concentrations of total mercury in walleye fillets ranged from 0.11 to 0.44 milligram per kilogram, with the higher concentrations in the larger fish. Fillets of smallmouth bass and rainbow trout also contained mercury, but generally at lower concentrations. Other selected trace elements were found in fillet samples, but the concentrations were generally low depending on species and the specific trace element. The trace elements cadmium, copper, lead, and zinc were found in liver tissue of these same species with zinc consistently present in the highest concentration.

  20. Functional Architecture of T7 RNA Polymerase Transcription Complexes

    PubMed Central

    Nayak, Dhananjaya; Guo, Qing; Sousa, Rui

    2007-01-01

    Summary T7 RNA polymerase is the best-characterized member of a widespread family of single-subunit RNA polymerases. Crystal structures of T7 RNA polymerase initiation and elongation complexes have provided a wealth of detailed information on RNA polymerase interactions with the promoter and transcription bubble, but the absence of DNA downstream of the melted region of the template in the initiation complex structure, and the absence of DNA upstream of the transcription bubble in the elongation complex structure means that our picture of the functional architecture of T7 RNA polymerase transcription complexes remains incomplete. Here we use the site-specifically tethered chemical nucleases and functional characterization of directed T7 RNAP mutants to both reveal the architecture of the duplex DNA that flanks the transcription bubble in the T7 RNAP initiation and elongation complexes, and to define the function of the interactions made by these duplex elements. We find that downstream duplex interactions made with a cluster of lysines (K711/K713/K714) are present during both elongation and initiation where they contribute to stabilizing a bend in the downstream DNA that is important for promoter opening. The upstream DNA in the elongation complex is also found to be sharply bent at the upstream edge of the transcription bubble, thereby allowing formation of upstream duplex:polymerase interactions that contribute to elongation complex stability. PMID:17580086

  1. Identification of cis-elements and evaluation of upstream regulatory region of a rice anther-specific gene, OSIPP3, conferring pollen-specific expression in Oryza sativa (L.) ssp. indica.

    PubMed

    Manimaran, P; Raghurami Reddy, M; Bhaskar Rao, T; Mangrauthia, Satendra K; Sundaram, R M; Balachandran, S M

    2015-12-01

    Pollen-specific expression. Promoters comprise of various cis-regulatory elements which control development and physiology of plants by regulating gene expression. To understand the promoter specificity and also identification of functional cis-acting elements, progressive 5' deletion analysis of the promoter fragments is widely used. We have evaluated the activity of regulatory elements of 5' promoter deletion sequences of anther-specific gene OSIPP3, viz. OSIPP3-∆1 (1504 bp), OSIPP3-∆2 (968 bp), OSIPP3-∆3 (388 bp) and OSIPP3-∆4 (286 bp) through the expression of transgene GUS in rice. In silico analysis of 1504-bp sequence harboring different copy number of cis-acting regulatory elements such as POLLENLELAT52, GTGANTG10, enhancer element of LAT52 and LAT56 indicated that they were essential for high level of expression in pollen. Histochemical GUS analysis of the transgenic plants revealed that 1504- and 968-bp fragments directed GUS expression in roots and anthers, while the 388- and 286-bp fragments restricted the GUS expression to only pollen, of which 388 bp conferred strong GUS expression. Further, GUS staining analysis of different panicle development stages (P1-P6) confirmed that the GUS gene was preferentially expressed only at P6 stage (late pollen stage). The qRT-PCR analysis of GUS transcript revealed 23-fold higher expression of GUS transcript in OSIPP3-Δ1 followed by OSIPP3-Δ2 (eightfold) and OSIPP3-Δ3 (threefold) when compared to OSIPP3-Δ4. Based on our results, we proposed that among the two smaller fragments, the 388-bp upstream regulatory region could be considered as a promising candidate for pollen-specific expression of agronomically important transgenes in rice.

  2. The conserved upstream region of lscB/C determines expression of different levansucrase genes in plant pathogen Pseudomonas syringae

    PubMed Central

    2014-01-01

    Background Pseudomonas syringae pv. glycinea PG4180 is an opportunistic plant pathogen which causes bacterial blight of soybean plants. It produces the exopolysaccharide levan by the enzyme levansucrase. Levansucrase has three gene copies in PG4180, two of which, lscB and lscC, are expressed while the third, lscA, is cryptic. Previously, nucleotide sequence alignments of lscB/C variants in various P. syringae showed that a ~450-bp phage-associated promoter element (PAPE) including the first 48 nucleotides of the ORF is absent in lscA. Results Herein, we tested whether this upstream region is responsible for the expression of lscB/C and lscA. Initially, the transcriptional start site for lscB/C was determined. A fusion of the PAPE with the ORF of lscA (lscB UpN A) was generated and introduced to a levan-negative mutant of PG4180. Additionally, fusions comprising of the non-coding part of the upstream region of lscB with lscA (lscB Up A) or the upstream region of lscA with lscB (lscA Up B) were generated. Transformants harboring the lscB UpN A or the lscB Up A fusion, respectively, showed levan formation while the transformant carrying lscA Up B did not. qRT-PCR and Western blot analyses showed that lscB UpN A had an expression similar to lscB while lscB Up A had a lower expression. Accuracy of protein fusions was confirmed by MALDI-TOF peptide fingerprinting. Conclusions Our data suggested that the upstream sequence of lscB is essential for expression of levansucrase while the N-terminus of LscB mediates an enhanced expression. In contrast, the upstream region of lscA does not lead to expression of lscB. We propose that lscA might be an ancestral levansucrase variant upstream of which the PAPE got inserted by potentially phage-mediated transposition events leading to expression of levansucrase in P. syringae. PMID:24670199

  3. Metal loading in Soda Butte Creek upstream of Yellowstone National Park, Montana and Wyoming; a retrospective analysis of previous research; and quantification of metal loading, August 1999

    USGS Publications Warehouse

    Boughton, G.K.

    2001-01-01

    Acid drainage from historic mining activities has affected the water quality and aquatic biota of Soda Butte Creek upstream of Yellowstone National Park. Numerous investigations focusing on metals contamination have been conducted in the Soda Butte Creek basin, but interpretations of how metals contamination is currently impacting Soda Butte Creek differ greatly. A retrospective analysis of previous research on metal loading in Soda Butte Creek was completed to provide summaries of studies pertinent to metal loading in Soda Butte Creek and to identify data gaps warranting further investigation. Identification and quantification of the sources of metal loading to Soda Butte Creek was recognized as a significant data gap. The McLaren Mine tailings impoundment and mill site has long been identified as a source of metals but its contribution relative to the total metal load entering Yellowstone National Park was unknown. A tracer-injection and synoptic-sampling study was designed to determine metal loads upstream of Yellowstone National Park.A tracer-injection and synoptic-sampling study was conducted on an 8,511-meter reach of Soda Butte Creek from upstream of the McLaren Mine tailings impoundment and mill site downstream to the Yellowstone National Park boundary in August 1999. Synoptic-sampling sites were selected to divide the creek into discrete segments. A lithium bromide tracer was injected continuously into Soda Butte Creek for 24.5 hours. Downstream dilution of the tracer and current-meter measurements were used to calculate the stream discharge. Stream discharge values, combined with constituent concentrations obtained by synoptic sampling, were used to quantify constituent loading in each segment of Soda Butte Creek.Loads were calculated for dissolved calcium, silica, and sulfate, as well as for dissolved and total-recoverable iron, aluminum, and manganese. Loads were not calculated for cadmium, copper, lead, and zinc because these elements were infrequently detected in mainstem synoptic samples. All of these elements were detected at high concentrations in the seeps draining the McLaren Mine tailings impoundment. The lack of detection of these elements in the downstream mainstem synoptic samples is probably because of sorption (coprecipitation and adsorption) to metal colloids in the stream.Most of the metal load that entered Soda Butte Creek was contributed by the inflows draining the McLaren Mine tailings impoundment (between 505 meters and 760 meters downstream from the tracer-injection site), Republic Creek (1,859 meters), and Unnamed Tributary (8,267 meters). Results indicate that treatment or removal of the McLaren Mine tailings impoundment would greatly reduce metal loading in Soda Butte Creek upstream of Yellowstone National Park. However, removing only that single source may not reduce metal loads to acceptable levels. The sources of metal loading in Republic Creek and Unnamed Tributary merit further investigation.

  4. RHIC Prefire Protection Masks

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Drees, A.; Biscardi, C.; Curcio, T.

    2015-01-07

    The protection of the RHIC experimental detectors from damage due to beam hitting close upstream elements in cases of abort kicker prefires requires some dedicated precautionary measures with two general options: to bring the beam close to a limiting aperture (i.e. the beam pipe wall), as far upstream of the detector components as possible or, alternatively, to bring a limiting aperture close to the circulating beam. During the FY 2014 RHIC Heavy Ion run the first option was chosen because of the limited time available for preparation before the start of the run. For future runs the second option, inmore » this case the installation of dual-sided movable masks, is preferred. The installation of the masks, one per ring, is planned before the start of the FY 2015 run.« less

  5. Water- and Bed-Sediment Quality of Seguchie Creek and Selected Wetlands Tributary to Mille Lacs Lake in Crow Wing County, Minnesota, October 2003 to October 2006

    USGS Publications Warehouse

    Fallon, James D.; Yaeger, Christine S.

    2009-01-01

    Mille Lacs Lake and its tributaries, located in east-central Minnesota, are important resources to the public. In addition, many wetlands and lakes that feed Mille Lacs Lake are of high resource quality and vulnerable to degradation. Construction of a new four-lane expansion of U.S. Highway 169 has been planned along the western part of the drainage area of Mille Lacs Lake in Crow Wing County. Concerns exist that the proposed highway could affect the resource quality of surface waters tributary to Mille Lacs Lake. Baseline water- and bed-sediment quality characteristics of surface waters tributary to Mille Lacs Lake were needed prior to the proposed highway construction. The U.S. Geological Survey, in cooperation with the Minnesota Department of Transportation, characterized the water- and bed-sediment quality at selected locations that the proposed route intersects from October 2003 to October 2006. Locations included Seguchie Creek upstream and downstream from the proposed route and three wetlands draining to Mille Lacs Lake. The mean streamflow of Seguchie Creek increased between the two sites: flow at the downstream streamflow-gaging station of 0.22 cubic meter per second was 5.6 percent greater than the mean streamflow at the upstream streamflow-gaging station of 0.21 cubic meter per second. Because of the large amount of storage immediately upstream from both gaging stations, increases in flow were gradual even during intense precipitation. The ranges of most constituent concentrations in water were nearly identical between the two sampling sites on Seguchie Creek. No concentrations exceeded applicable water-quality standards set by the State of Minnesota. Dissolved-oxygen concentrations at the downstream gaging station were less than the daily minimum standard of 4.0 milligrams per liter for 6 of 26 measurements. Constituent loads in Seguchie Creek were greater at the downstream site than the upstream site for all measured, including dissolved chloride (1.7 percent), ammonia plus organic nitrogen (13 percent), total phosphorus (62 percent), and suspended sediment (11 percent) during the study. All constituents had seasonal peaks in spring and fall. The large loads during the fall resulted from unusually large precipitation and streamflow patterns. This caused the two greatest streamflow peaks at both sites to occur during October (2004 and 2005). In Seguchie Creek, bed-sediment concentrations of five metals and trace elements (arsenic, cadmium, chromium, lead, and zinc) exceeded the Interim Sediment Quality Guidelines (ISQG) set by the Canadian Council of Ministers of the Environment. Bed-sediment samples from the upstream site had more exceedances of ISQGs for metals and trace elements than did samples from the downstream site (seven and two exceedances, respectively). Bed-sediment samples from the downstream site had more exceedances of ISQGs (20 exceedances) for semivolatile organic compounds than did samples from the upstream site (8 exceedances), indicating different sources for organic compounds than for metals and trace elements. Concentrations of 11 semivolatile organic compounds exceeded ISQGs: ancenaphthene, acenaphthylene, anthracene, benzo[a]anthracene, benzo[a]pyrene, chrysene, fluoranthene, fluorene, naphthalene, phenanthrene, and pyrene. In bed-sediment samples collected from three wetlands, concentrations of all six metals exceeded ISQGs: arsenic, cadmium, chromium, copper, lead, and zinc. Concentrations of three semivolatile organic compounds exceeded ISQGs: flouranthene, phenanthrene, and pyrene. Results indicate that areas appearing relatively undisturbed and of high resource value can have degraded quality from previous unknown land use.

  6. Monocyte-specific Accessibility of a Matrix Attachment Region in the Tumor Necrosis Factor Locus*

    PubMed Central

    Biglione, Sebastian; Tsytsykova, Alla V.; Goldfeld, Anne E.

    2011-01-01

    Regulation of TNF gene expression is cell type- and stimulus-specific. We have previously identified highly conserved noncoding regulatory elements within DNase I-hypersensitive sites (HSS) located 9 kb upstream (HSS−9) and 3 kb downstream (HSS+3) of the TNF gene, which play an important role in the transcriptional regulation of TNF in T cells. They act as enhancers and interact with the TNF promoter and with each other, generating a higher order chromatin structure. Here, we report a novel monocyte-specific AT-rich DNase I-hypersensitive element located 7 kb upstream of the TNF gene (HSS−7), which serves as a matrix attachment region in monocytes. We show that HSS−7 associates with topoisomerase IIα (Top2) in vivo and that induction of endogenous TNF mRNA expression is suppressed by etoposide, a Top2 inhibitor. Moreover, Top2 binds to and cleaves HSS−7 in in vitro analysis. Thus, HSS−7, which is selectively accessible in monocytes, can tether the TNF locus to the nuclear matrix via matrix attachment region formation, potentially promoting TNF gene expression by acting as a Top2 substrate. PMID:22027829

  7. Molecular cloning and functional characterization of the promoter region of the human uncoupling protein-2 gene.

    PubMed

    Tu, N; Chen, H; Winnikes, U; Reinert, I; Marmann, G; Pirke, K M; Lentes, K U

    1999-11-19

    As a member of the uncoupling protein family, UCP2 is ubiquitously expressed in rodents and humans, implicating a major role in thermogenesis. To analyze promoter function and regulatory motifs involved in the transcriptional regulation of UCP2 gene expression, 3.3 kb of 5'-flanking region of the human UCP2 (hUCP2) gene have been cloned. Sequence analysis showed that the promoter region of hUCP2 lacks a classical TATA or CAAT box, however, appeared GC-rich resulting in the presence of several Sp-1 motifs and Ap-1/-2 binding sites near the transcription initiation site. Functional characterization of human UCP2 promoter-CAT fusion constructs in transient expression assays showed that minimal promoter activity was observed within 65 bp upstream of the transcriptional start site (+1). 75 bp further upstream (from nt -141 to -66) a strong cis-acting regulatory element (or enhancer) was identified, which significantly enhanced basal promoter activity. The regulation of human UCP2 gene expression involves complex interactions among positive and negative regulatory elements distributed over a minimum of 3.3 kb of the promoter region. Copyright 1999 Academic Press.

  8. The genomic structure of the human UFO receptor.

    PubMed

    Schulz, A S; Schleithoff, L; Faust, M; Bartram, C R; Janssen, J W

    1993-02-01

    Using a DNA transfection-tumorigenicity assay we have recently identified the UFO oncogene. It encodes a tyrosine kinase receptor characterized by the juxtaposition of two immunoglobulin-like and two fibronectin type III repeats in its extracellular domain. Here we describe the genomic organization of the human UFO locus. The UFO receptor is encoded by 20 exons that are distributed over a region of 44 kb. Different isoforms of UFO mRNA are generated by alternative splicing of exon 10 and differential usage of two imperfect polyadenylation sites resulting in the presence or absence of 1.5-kb 3' untranslated sequences. Primer extension and S1 nuclease analyses revealed multiple transcriptional initiation sites including a major site 169 bp upstream of the translation start site. The promoter region is GC rich, lacks TATA and CAAT boxes, but contains potential recognition sites for a variety of trans-acting factors, including Sp1, AP-2 and the cyclic AMP response element-binding protein. Proto-UFO and its oncogenic counterpart exhibit identical cDNA and promoter regions sequences. Possible modes of UFO activation are discussed.

  9. Transcriptional Dysregulation of MYC Reveals Common Enhancer-Docking Mechanism.

    PubMed

    Schuijers, Jurian; Manteiga, John Colonnese; Weintraub, Abraham Selby; Day, Daniel Sindt; Zamudio, Alicia Viridiana; Hnisz, Denes; Lee, Tong Ihn; Young, Richard Allen

    2018-04-10

    Transcriptional dysregulation of the MYC oncogene is among the most frequent events in aggressive tumor cells, and this is generally accomplished by acquisition of a super-enhancer somewhere within the 2.8 Mb TAD where MYC resides. We find that these diverse cancer-specific super-enhancers, differing in size and location, interact with the MYC gene through a common and conserved CTCF binding site located 2 kb upstream of the MYC promoter. Genetic perturbation of this enhancer-docking site in tumor cells reduces CTCF binding, super-enhancer interaction, MYC gene expression, and cell proliferation. CTCF binding is highly sensitive to DNA methylation, and this enhancer-docking site, which is hypomethylated in diverse cancers, can be inactivated through epigenetic editing with dCas9-DNMT. Similar enhancer-docking sites occur at other genes, including genes with prominent roles in multiple cancers, suggesting a mechanism by which tumor cell oncogenes can generally hijack enhancers. These results provide insights into mechanisms that allow a single target gene to be regulated by diverse enhancer elements in different cell types. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  10. Lack of robustness of life extension associated with several single-gene P element mutations in Drosophila melanogaster.

    PubMed

    Mockett, Robin J; Nobles, Amber C

    2013-10-01

    The hypothesis tested in this study was that single-gene mutations found previously to extend the life span of Drosophila melanogaster could do so consistently in both long-lived y w and standard w (1118) genetic backgrounds. GAL4 drivers were used to express upstream activation sequence (UAS)-responder transgenes globally or in the nervous system. Transgenes associated with oxidative damage prevention (UAS-hSOD1 and UAS-GCLc) or removal (EP-UAS-Atg8a and UAS-dTOR (FRB) ) failed to increase mean life spans in any expression pattern in either genetic background. Flies containing a UAS-EGFP-bMSRA (C) transgene associated with protein repair were found not to exhibit life extension or detectable enhanced green fluorescent protein (EGFP) activity. The presence of UAS-responder transgenes was confirmed by PCR amplification and sequencing at the 5' and 3' end of each insertion. These results cast doubt on the robustness of life extension in flies carrying single-gene mutations and suggest that the effects of all such mutations should be tested independently in multiple genetic backgrounds and laboratory environments.

  11. Water Quality, Fish Tissue, and Bed Sediment Monitoring in Waterbodies of Fort Chaffee Maneuver Training Center, Arkansas, 2002-2004

    USGS Publications Warehouse

    Justus, B.G.; Stanton, Gregory P.

    2005-01-01

    The Fort Chaffee Maneuver Training Center is a facility used to train as many as 50,000 Arkansas National Guardsmen each year. Due to the nature of ongoing training and also to a poor understanding of environmental procedures that were practiced in the World War II era, areas within Fort Chaffee have the potential to be sources of a large number of contaminants. Because some streams flow on to Fort Chaffee, there is also the potential for sources that are off post to affect environmental conditions on post. This study evaluates constituent concentrations in water, fish tissue, and bed sediment collected from waterbodies on Fort Chaffee between September 2002 and July 2004. Constituent concentrations detected in the three media and measured at nine stream sites and four lake sites were compared to national and regional criteria when available. Two of the larger streams, Big and Vache Grasse Creeks, were sampled at multiple sites. All three sampled media were analyzed for insecticides, PCBs, explosives, and trace elements. Additionally, water samples were analyzed for nutrients and herbicides. The different constituents detected in the three sample media (water, fish tissue, and bed sediment) indicate that land-use activities both on and off post are influencing environmental conditions. Contaminants such as explosives that were sometimes detected in water samples have an obvious relation to military training; however, the occurrence and locations of some nutrients, insecticides, and trace elements suggest that land use both on and off post also could be influencing environmental conditions to some degree. Constituent concentrations at sites on Vache Grasse Creek, and particularly the most upstream site, which was located immediately downstream from an off-post wastewater-treatment facility, indicate that environmental conditions were being influenced by an off-post source. The most upstream site on Vache Grasse Creek had both the highest number of detections and the highest concentrations detected of all sites sampled. Event-mean storm concentrations and storm loads calculated from storm-flow samples at two sites each for Big and Vache Grasse Creeks indicate that storm loads were highest at the two Vache Grasse Creek sites for 24 of the 25 constituents detected. Further evaluation by normalizing storm loads at Big Creek to storm loads at Vache Grasse Creek by stream flow indicate that event loads at Vache Grasse Creek were about two or more times higher than those on Big Creek for 15 of the 25 constituents measured. Low concentrations of arsenic and lead were detected in water samples, but all detections for the two trace elements occurred in samples collected at the upstream site on Vache Grasse Creek. The nickel concentration in fish livers collected from the upstream site on Vache Grasse Creek was 45 percent higher than the median of a national study of 145 sites. Mercury concentrations in edible fish tissue, which are a widespread concern in the United States, exceeded an USEPA criterion for methylmercury of 300 ?g/kg in four of nine samples; however, concentrations are typical of mercury concentrations in fish tissues for the State of Arkansas. Constituent concentrations at some sites indicate that environmental conditions are being influenced by on-post activities. Of the 55 (excluding total organic carbon) organic constituents analyzed in water samples, only 10 were detected above the minimum detection limit but four of those were explosives. Bed-sediment samples from one site located on Grayson Creek, and nearest the administrative and residential (cantonment) area, had detections for arsenic, copper, lead, manganese, nickel, and zinc that were above background concentrations, and concentrations for arsenic and nickel at this site exceeded lowest effect level criteria established by the U.S. Environmental Protection Agency. The site on Grayson Creek also had the only detections of DDT metabolites in bed sedi

  12. 3-Hydroxy-3-methylglutaryl CoA lyase (HL): Mouse and human HL gene (HMGCL) cloning and detection of large gene deletions in two unrelated HL-deficient patients

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, S.P.; Robert, M.F.; Mitchell, G.A.

    1996-04-01

    3-hydroxy-3-methylglutaryl CoA lyase (HL, EC 4.1.3.4) catalyzes the cleavage of 3-hydroxy-3-methylglutaryl CoA to acetoacetic acid and acetyl CoA, the final reaction of both ketogenesis and leucine catabolism. Autosomal-recessive HL deficiency in humans results in episodes of hypoketotic hypoglycemia and coma. Using a mouse HL cDNA as a probe, we isolated a clone containing the full-length mouse HL gene that spans about 15 kb of mouse chromosome 4 and contains nine exons. The promoter region of the mouse HL gene contains elements characteristic of a housekeeping gene: a CpG island containing multiple Sp1 binding sites surrounds exon 1, and neither amore » TATA nor a CAAT box are present. We identified multiple transcription start sites in the mouse HL gene, 35 to 9 bases upstream of the translation start codon. We also isolated two human HL genomic clones that include HL exons 2 to 9 within 18 kb. The mouse and human HL genes (HGMW-approved symbol HMGCL) are highly homologous, with identical locations of intron-exon junctions. By genomic Southern blot analysis and exonic PCR, was found 2 of 33 HL-deficient probands to be homozygous for large deletions in the HL gene. 26 refs., 4 figs., 2 tabs.« less

  13. In vivo and in vitro neurochemical-based assessments of wastewater effluents from the Maumee River area of concern.

    EPA Science Inventory

    Fathead minnows (Pimephales promelas) were caged for four days at multiple locations upstream and downstream of a wastewater treatment plant (WWTP) discharge into the Maumee River (USA, OH). Grab water samples collected at the same location were extracted using several different ...

  14. Whole body-element composition of Atlantic salmon Salmo salar influenced by migration direction and life stage in three distinct populations.

    PubMed

    Ebel, J D; Leroux, S J; Robertson, M J; Dempson, J B

    2016-11-01

    Body-element content was measured for three life stages of wild Atlantic salmon Salmo salar from three distinct Newfoundland populations as individuals crossed between freshwater and marine ecosystems. Life stage explained most of the variation in observed body-element concentration whereas river of capture explained very little variation. Element composition of downstream migrating post-spawn adults (i.e. kelts) and juvenile smolts were similar and the composition of these two life stages strongly differed from adults migrating upstream to spawn. Low variation within life stages and across populations suggests that S. salar may exert rheostatic control of their body-element composition. Additionally, observed differences in trace element concentration between adults and other life stages were probably driven by the high carbon concentration in adults because abundant elements, such as carbon, can strongly influence the observed concentrations of less abundant elements. Thus, understanding variation among individuals in trace elements composition requires the measurement of more abundant elements. Changes in element concentration with ontogeny have important consequences the role of fishes in ecosystem nutrient cycling and should receive further attention. © 2016 The Fisheries Society of the British Isles.

  15. Mapping the functional versatility and fragility of Ras GTPase signaling circuits through in vitro network reconstitution.

    PubMed

    Coyle, Scott M; Lim, Wendell A

    2016-01-14

    The Ras-superfamily GTPases are central controllers of cell proliferation and morphology. Ras signaling is mediated by a system of interacting molecules: upstream enzymes (GEF/GAP) regulate Ras's ability to recruit multiple competing downstream effectors. We developed a multiplexed, multi-turnover assay for measuring the dynamic signaling behavior of in vitro reconstituted H-Ras signaling systems. By including both upstream regulators and downstream effectors, we can systematically map how different network configurations shape the dynamic system response. The concentration and identity of both upstream and downstream signaling components strongly impacted the timing, duration, shape, and amplitude of effector outputs. The distorted output of oncogenic alleles of Ras was highly dependent on the balance of positive (GAP) and negative (GEF) regulators in the system. We found that different effectors interpreted the same inputs with distinct output dynamics, enabling a Ras system to encode multiple unique temporal outputs in response to a single input. We also found that different Ras-to-GEF positive feedback mechanisms could reshape output dynamics in distinct ways, such as signal amplification or overshoot minimization. Mapping of the space of output behaviors accessible to Ras provides a design manual for programming Ras circuits, and reveals how these systems are readily adapted to produce an array of dynamic signaling behaviors. Nonetheless, this versatility comes with a trade-off of fragility, as there exist numerous paths to altered signaling behaviors that could cause disease.

  16. Characterization of 5' end of human thromboxane receptor gene. Organizational analysis and mapping of protein kinase C--responsive elements regulating expression in platelets.

    PubMed

    D'Angelo, D D; Davis, M G; Houser, W A; Eubank, J J; Ritchie, M E; Dorn, G W

    1995-09-01

    Platelet thromboxane receptors are acutely and reversibly upregulated after acute myocardial infarction. To determine if platelet thromboxane receptors are under transcriptional control, we isolated and characterized human genomic DNA clones containing the 5' flanking region of the thromboxane receptor gene. The exon-intron structure of the 5' portion of the thromboxane receptor gene was determined initially by comparing the nucleotide sequence of the 5' flanking genomic clone with that of a novel human uterine thromboxane receptor cDNA that extended the mRNA 141 bp further upstream than the previously identified human placental cDNA. A major transcription initiation site was located in three human tissues approximately 560 bp upstream from the translation initiation codon and 380 bp upstream from any previously identified transcription initiation site. The thromboxane receptor gene has neither a TATA nor a CAAT consensus site. Promoter function of the 5' flanking region of the thromboxane receptor gene was evaluated by transfection of thromboxane receptor gene promoter/chloramphenicol acetyltransferase (CAT) chimera plasmids into platelet-like K562 cells. Thromboxane receptor promoter activity, as assessed by CAT expression, was relatively weak but was significantly enhanced by phorbol ester treatment. Functional analysis of 5' deletion constructs in transfected K562 cells and gel mobility shift localized the major phorbol ester-responsive motifs in the thromboxane receptor gene promoter to a cluster of activator protein-2 (AP-2) binding consensus sites located approximately 1.8 kb 5' from the transcription initiation site. These studies are the first to determine the structure and organization of the 5' end of the thromboxane receptor gene and demonstrate that thromboxane receptor gene expression can be regulated by activation of protein kinase C via induction of an AP-2-like nuclear factor binding to upstream promoter elements. These findings strongly suggest that the mechanism for previously described upregulation of platelet thromboxane receptors after acute myocardial infarction is increased thromboxane receptor gene transcription in platelet-progenitor cells.

  17. A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements

    DOE PAGES

    Henry, Kelli F.; Kawashima, Tomokazu; Goldberg, Robert B.

    2015-03-22

    Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean ( Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we usemore » site-directed mutagenesis experiments in transgenic tobacco globularstage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. Lastly, a homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.« less

  18. A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Henry, Kelli F.; Kawashima, Tomokazu; Goldberg, Robert B.

    Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean ( Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we usemore » site-directed mutagenesis experiments in transgenic tobacco globularstage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. Lastly, a homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.« less

  19. Efficiency of plasma actuator ionization in shock wave modification in a rarefied supersonic flow over a flat plate

    NASA Astrophysics Data System (ADS)

    Joussot, Romain; Lago, Viviana; Parisse, Jean-Denis

    2014-12-01

    This paper describes experimental and numerical investigations focused on the shock wave modification, induced by a dc glow discharge, of a Mach 2 flow under rarefied regime. The model under investigation is a flat plate equipped with a plasma actuator composed of two electrodes. The glow discharge is generated by applying a negative potential to the upstream electrode, enabling the creation of a weakly ionized plasma. The natural flow (i.e. without the plasma) exhibits a thick laminar boundary layer and a shock wave with a hyperbolic shape. Images of the flow obtained with an ICCD camera revealed that the plasma discharge induces an increase in the shock wave angle. Thermal effects (volumetric, and at the surface) and plasma effects (ionization, and thermal non-equilibrium) are the most relevant processes explaining the observed modifications. The effect induced by the heating of the flat plate surface is studied experimentally by replacing the upstream electrode by a heating element, and numerically by modifying the thermal boundary condition of the model surface. The results show that for a similar temperature distribution over the plate surface, modifications induced by the heating element are lower than those produced by the plasma. This difference shows that other effects than purely thermal effects are involved with the plasma actuator. Measurements of the electron density with a Langmuir probe highlight the fact that the ionization degree plays an important role into the modification of the flow. The gas properties, especially the isentropic exponent, are indeed modified by the plasma above the actuator and upstream the flat plate. This leads to a local modification of the flow conditions, inducing an increase in the shock wave angle.

  20. A real-time control system of gene expression using ligand-bound nucleic acid aptamer for metabolic engineering.

    PubMed

    Wang, Jing; Cui, Xun; Yang, Le; Zhang, Zhe; Lv, Liping; Wang, Haoyuan; Zhao, Zhenmin; Guan, Ningzi; Dong, Lichun; Chen, Rachel

    2017-07-01

    Artificial control of bio-functions through regulating gene expression is one of the most important and attractive technologies to build novel living systems that are useful in the areas of chemical synthesis, nanotechnology, pharmacology, cell biology. Here, we present a novel real-time control system of gene regulation that includes an enhancement element by introducing duplex DNA aptamers upstream promoter and a repression element by introducing a RNA aptamer upstream ribosome binding site. With the presence of ligands corresponding to the DNA aptamers, the expression of the target gene can be potentially enhanced at the transcriptional level by strengthening the recognition capability of RNAP to the recognition region and speeding up the separation efficiency of the unwinding region due to the induced DNA bubble around the thrombin-bound aptamers; while with the presence of RNA aptamer ligand, the gene expression can be repressed at the translational level by weakening the recognition capability of ribosome to RBS due to the shielding of RBS by the formed aptamer-ligand complex upstream RBS. The effectiveness and potential utility of the developed gene regulation system were demonstrated by regulating the expression of ecaA gene in the cell-free systems. The realistic metabolic engineering application of the system has also tested by regulating the expression of mgtC gene and thrombin cDNA in Escherichia coli JD1021 for controlling metabolic flux and improving thrombin production, verifying that the real-time control system of gene regulation is able to realize the dynamic regulation of gene expression with potential applications in bacterial physiology studies and metabolic engineering. Copyright © 2017. Published by Elsevier Inc.

  1. A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements.

    PubMed

    Henry, Kelli F; Kawashima, Tomokazu; Goldberg, Robert B

    2015-06-01

    Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean (Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we use site-directed mutagenesis experiments in transgenic tobacco globular-stage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. A homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.

  2. Synergistic and singular effects of river discharge and lunar illumination on dam passage of upstream migrant yellow-phase American eels

    USGS Publications Warehouse

    Welsh, Stuart A.; Aldinger, Joni L.; Braham, Melissa A.; Zimmerman, Jennifer L.

    2016-01-01

    Monitoring of dam passage can be useful for management and conservation assessments of American eel, particularly if passage counts can be examined over multiple years. During a 7-year study (2007–2013) of upstream migration of American eels within the lower Shenandoah River (Potomac River drainage), we counted and measured American eels at the Millville Dam eel pass, where annual study periods were determined by the timing of the eel pass installation during spring or summer and removal during fall. Daily American eel counts were analysed with negative binomial regression models, with and without a year (YR) effect, and with the following time-varying environmental covariates: river discharge of the Shenandoah River at Millville (RDM) and of the Potomac River at Point of Rocks, lunar illumination (LI), water temperature, and cloud cover. A total of 17 161 yellow-phase American eels used the pass during the seven annual periods, and length measurements were obtained from 9213 individuals (mean = 294 mm TL, s.e. = 0.49, range 183–594 mm). Data on passage counts of American eels supported an additive-effects model (YR + LI + RDM) where parameter estimates were positive for river discharge (β = 7.3, s.e. = 0.01) and negative for LI (β = −1.9, s.e. = 0.34). Interestingly, RDM and LI acted synergistically and singularly as correlates of upstream migration of American eels, but the highest daily counts and multiple-day passage events were associated with increased RDM. Annual installation of the eel pass during late spring or summer prevented an early spring assessment, a period with higher RDM relative to those values obtained during sampling periods. Because increases in river discharge are climatically controlled events, upstream migration events of American eels within the Potomac River drainage are likely linked to the influence of climate variability on flow regime.

  3. Lentivirus Vectors Incorporating the Immunoglobulin Heavy Chain Enhancer and Matrix Attachment Regions Provide Position-Independent Expression in B Lymphocytes

    PubMed Central

    Lutzko, Carolyn; Senadheera, Dinithi; Skelton, Dianne; Petersen, Denise; Kohn, Donald B.

    2003-01-01

    In the present studies we developed lentivirus vectors with regulated, consistent transgene expression in B lymphocytes by incorporating the immunoglobulin heavy chain enhancer (Eμ) with and without associated matrix attachment regions (EμMAR) into lentivirus vectors. Incorporation of these fragments upstream of phosphoglycerate kinase (PGK) or cytomegalovirus promoters resulted in a two- to threefold increase in enhanced green fluorescent protein (EGFP) mean fluorescence intensity (MFI) in B-lymphoid but not T-lymphoid, myeloid, fibroblast, or carcinoma cell lines. A 1-log increase in EGFP expression was observed in B-lymphoid cells (but not myeloid cells) differentiated from human CD34+ progenitors in vitro transduced with Eμ- and EμMAR-containing lentivectors. Lastly, we evaluated the expression from the EμMAR element in mice 2 to 24 weeks posttransplant with transduced hematopoietic stem cells. In mice receiving vectors with the Eμ and EμMAR elements upstream of the PGK promoter, there was a 2- to 10-fold increase in EGFP expression in B cells (but not other cell types). Evaluation of the coefficient of variation of expression among different cell types demonstrated that consistent, position-independent transgene expression was observed exclusively in B cells transduced with the EμMAR-containing vector and not other cells types or vectors. Proviral genomes with the EμMAR element had increased chromatin accessibility, which likely contributed to the position independence of expression in B lymphocytes. In summary, incorporation of the EμMAR element in lentivirus vectors resulted in enhanced, position-independent expression in primary B lymphocytes. These vectors provide a useful tool for the study of B-lymphocyte biology and the development of gene therapy for disorders affecting B lymphocytes, such as immune deficiencies. PMID:12805432

  4. Accumulation of trace elements, pesticides, and polychlorinated biphenyls in sediments and the clam Corbicula manilensis of the Apalachicola River, Florida

    USGS Publications Warehouse

    Elder, J.F.; Mattraw, H.C.

    1984-01-01

    A survey of trace element and synthetic organic compound concentrations in botton materials was conducted on the Apalachichola River in northwest Florida in 1979-80 as part of the Apalachicola River Quality Assessment. Substances analyzed included trace elements (predominantly heavy metals), organochlorine insecticides, organophosphorus insecticides, chlorinated phenoxy-acid herbicides, and polychlorinated biphenyls (PCBs). Three kinds of materials were surveyed: fine-grained sediments, whole-body tissue of the Asiatic clam Corbicula manilensis, and bottom-load organic detritus. No hazardous levels of any of the substances were found. Concentrations in the fine-grained sediments and clams were generally at least ten times lower than maximum limits considered safe for biota of aquatic systems. A comparison of trace-substance data from the Apalachicola River with data from Lake Seminole (upstream) and Apalachicola Bay (downstream) showed lower concentrations in riverine clams. Sediment concentrations in all parts of the system were comparable. Most trace substances in the Apalachicola River enter the river from the upstream part of the basin (the Chattahoochee and Flint Rivers in Georgia and Alabama) and from nonpoint sources throughout the basin. There are no major point discharges along the Apalachicola. Trend analysis was limited by the scope of the study, but did not reveal any spatial or temporal trends in concentrations of any of the substances analyzed. Concentrations of organic compounds and most metals in Corbicula manilensis did not correlate with those in sediments.

  5. Upstream water resource management to address downstream pollution concerns: A policy framework with application to the Nakdong River basin in South Korea

    NASA Astrophysics Data System (ADS)

    Yoon, Taeyeon; Rhodes, Charles; Shah, Farhed A.

    2015-02-01

    An empirical framework for assisting with water quality management is proposed that relies on open-source hydrologic data. Such data are measured periodically at fixed water stations and commonly available in time-series form. To fully exploit the data, we suggest that observations from multiple stations should be combined into a single long-panel data set, and an econometric model developed to estimate upstream management effects on downstream water quality. Selection of the model's functional form and explanatory variables would be informed by rating curves, and idiosyncrasies across and within stations handled in an error term by testing contemporary correlation, serial correlation, and heteroskedasticity. Our proposed approach is illustrated with an application to the Nakdong River basin in South Korea. Three alternative policies to achieve downstream BOD level targets are evaluated: upstream water treatment, greater dam discharge, and development of a new water source. Upstream water treatment directly cuts off incoming pollutants, thereby presenting the smallest variation in its downstream effects on BOD levels. Treatment is advantageous when reliability of water quality is a primary concern. Dam discharge is a flexible tool, and may be used strategically during a low-flow season. We consider development of a new water corridor from an extant dam as our third policy option. This turns out to be the most cost-effective way for securing lower BOD levels in the downstream target city. Even though we consider a relatively simple watershed to illustrate the usefulness of our approach, it can be adapted easily to analyze more complex upstream-downstream issues.

  6. Class I PI3-kinase or Akt inhibition do not impair axonal polarization, but slow down axonal elongation.

    PubMed

    Diez, Héctor; Benitez, Ma José; Fernandez, Silvia; Torres-Aleman, Ignacio; Garrido, Juan José; Wandosell, Francisco

    2016-11-01

    PI3K proteins family have multiple and essential functions in most cellular events. This family is composed of class I, class II and class III PI3Ks, which upstream and downstream elements are not completely elucidated. Previous studies using the broad PI3K inhibitor, LY294002 allowed to propose that PI3 kinase>Akt pathway is a key element in the determination of axonal polarity in hippocampal neurons. Recently, new inhibitors with a higher selectivity for class I PI3K have been characterized. In the present study we have examined this widely accepted theory using a new class I PI3K inhibitor (GDC-0941), as well as Akt inhibitors, and PTEN phosphatase constructs to reduce PIP3 levels. Our present data show that both, class I PI3K inhibitor and Akt inhibitor did not alter axon specification in hippocampal neurons, but greatly reduced axon length. However, in the same experiments LY294002 effectively impeded axonal polarization, as previously reported. Our biochemical data show that both, class I PI3K and Akt inhibitors, effectively block downstream elements from Akt to S6K1 activity. Both inhibitors are stable in culture medium along the time period analysed, maintaining the inhibition better than LY294002. Besides, we found evidence that LY294002 directly inhibits mTORC1. However, further analysis using an mTORC1 inhibitor showed no change in neuron polarity. Same result was obtained using a general class III PI3K inhibitor. Interestingly, we found that either, wild-type PTEN, or a phosphatase-dead form of PTEN, disrupted axonal polarization, strongly suggesting that the role of PTEN in axonal polarity can be independent of PIP3. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Fine-tuning the onset of myogenesis by homeobox proteins that interact with the Myf5 limb enhancer

    PubMed Central

    Daubas, Philippe; Duval, Nathalie; Bajard, Lola; Langa Vives, Francina; Robert, Benoît; Mankoo, Baljinder S.; Buckingham, Margaret

    2015-01-01

    ABSTRACT Skeletal myogenesis in vertebrates is initiated at different sites of skeletal muscle formation during development, by activation of specific control elements of the myogenic regulatory genes. In the mouse embryo, Myf5 is the first myogenic determination gene to be expressed and its spatiotemporal regulation requires multiple enhancer sequences, extending over 120 kb upstream of the Mrf4-Myf5 locus. An enhancer, located at −57/−58 kb from Myf5, is responsible for its activation in myogenic cells derived from the hypaxial domain of the somite, that will form limb muscles. Pax3 and Six1/4 transcription factors are essential activators of this enhancer, acting on a 145-bp core element. Myogenic progenitor cells that will form the future muscle masses of the limbs express the factors necessary for Myf5 activation when they delaminate from the hypaxial dermomyotome and migrate into the forelimb bud, however they do not activate Myf5 and the myogenic programme until they have populated the prospective muscle masses. We show that Msx1 and Meox2 homeodomain-containing transcription factors bind in vitro and in vivo to specific sites in the 145-bp element, and are implicated in fine-tuning activation of Myf5 in the forelimb. Msx1, when bound between Pax and Six sites, prevents the binding of these key activators, thus inhibiting transcription of Myf5 and consequent premature myogenic differentiation. Meox2 is required for Myf5 activation at the onset of myogenesis via direct binding to other homeodomain sites in this sequence. Thus, these homeodomain factors, acting in addition to Pax3 and Six1/4, fine-tune the entry of progenitor cells into myogenesis at early stages of forelimb development. PMID:26538636

  8. Transcription elongation rate has a tissue-specific impact on alternative cleavage and polyadenylation in Drosophila melanogaster.

    PubMed

    Liu, Xiaochuan; Freitas, Jaime; Zheng, Dinghai; Oliveira, Marta S; Hoque, Mainul; Martins, Torcato; Henriques, Telmo; Tian, Bin; Moreira, Alexandra

    2017-12-01

    Alternative polyadenylation (APA) is a mechanism that generates multiple mRNA isoforms with different 3'UTRs and/or coding sequences from a single gene. Here, using 3' region extraction and deep sequencing (3'READS), we have systematically mapped cleavage and polyadenylation sites (PASs) in Drosophila melanogaster , expanding the total repertoire of PASs previously identified for the species, especially those located in A-rich genomic sequences. Cis -element analysis revealed distinct sequence motifs around fly PASs when compared to mammalian ones, including the greater enrichment of upstream UAUA elements and the less prominent presence of downstream UGUG elements. We found that over 75% of mRNA genes in Drosophila melanogaster undergo APA. The head tissue tends to use distal PASs when compared to the body, leading to preferential expression of APA isoforms with long 3'UTRs as well as with distal terminal exons. The distance between the APA sites and intron location of PAS are important parameters for APA difference between body and head, suggesting distinct PAS selection contexts. APA analysis of the RpII215 C4 mutant strain, which harbors a mutant RNA polymerase II (RNAPII) with a slower elongation rate, revealed that a 50% decrease in transcriptional elongation rate leads to a mild trend of more usage of proximal, weaker PASs, both in 3'UTRs and in introns, consistent with the "first come, first served" model of APA regulation. However, this trend was not observed in the head, suggesting a different regulatory context in neuronal cells. Together, our data expand the PAS collection for Drosophila melanogaster and reveal a tissue-specific effect of APA regulation by RNAPII elongation rate. © 2017 Liu et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  9. Differential regulation of mnp2, a new manganese peroxidase-encoding gene from the ligninolytic fungus Trametes versicolor PRL 572

    Treesearch

    Tomas Johansson; Per Olof Nyman; Daniel Cullen

    2002-01-01

    A peroxidase-encoding gene, mnp2, and its corresponding cDNA were characterized from the white-rot basidiomycete Trametes versicolor PRL 572. We used quantitative reverse transcriptase-mediated PCR to identify mnp2 transcripts in nutrient-limited stationary cultures. Although mnp2 lacks upstream metal response elements (MREs), addition of MnSO4 to cultures increased...

  10. Identification of hot spot area of sediment contamination in a lake system using texture characteristics.

    PubMed

    Sheela, A M; Letha, J; Joseph, Sabu; Thomas, Jobin

    2013-04-01

    Texture plays an important role in the identification of polluted stretch in a lake system. The organic matter as well as toxic elements get accumulated in the finer sediments. The aim of the work is to show the spatio-temporal distribution of texture of the lake sediment (Akkulam-Veli lake, Kerala) and to identify the hot spot areas of contamination. Hot spot areas vary with seasons. During PRM, (premonsoon), the upstream portion of the Akkulam lake is the hot spot. During MON (monsoon), the downstream portion of the Akkulam lake and the upstream portion of the Veli lake are the hot spots. During POM (postmonsoon), hot spot area is the downstream portion of the Akkulam lake. This methodology can be used for the quick identification of hot spots in water bodies.

  11. Protecting LHC components against radiation resulting from an unsynchronized beam abort

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nikolai V. Mokhov et al.

    2001-06-26

    The effect of possible accidental beam loss in the LHC on the IP5 and IP6 insertion elements is studied via realistic Monte Carlo simulations. The scenario studied is beam loss due to unsynchronized abort at an accidental prefire of one of the abort kicker modules. Simulations show that this beam loss would result in severe heating of the IP5 and IP6 superconducting (SC) quadrupoles. Contrary to the previous considerations with a stationary set of collimators in IP5, collimators in IP6 close to the cause are proposed: a movable collimator upstream of the Q4 quadrupole and a stationary one upstream ofmore » the extraction septumMSD. The calculated temperature rise in the optimal set of collimators is quite acceptable. All SC magnets are protected by these collimators against damage.« less

  12. The CGTCA sequence motif is essential for biological activity of the vasoactive intestinal peptide gene cAMP-regulated enhancer.

    PubMed Central

    Fink, J S; Verhave, M; Kasper, S; Tsukada, T; Mandel, G; Goodman, R H

    1988-01-01

    cAMP-regulated transcription of the human vasoactive intestinal peptide gene is dependent upon a 17-base-pair DNA element located 70 base pairs upstream from the transcriptional initiation site. This element is similar to sequences in other genes known to be regulated by cAMP and to sequences in several viral enhancers. We have demonstrated that the vasoactive intestinal peptide regulatory element is an enhancer that depends upon the integrity of two CGTCA sequence motifs for biological activity. Mutations in either of the CGTCA motifs diminish the ability of the element to respond to cAMP. Enhancers containing the CGTCA motif from the somatostatin and adenovirus genes compete for binding of nuclear proteins from C6 glioma and PC12 cells to the vasoactive intestinal peptide enhancer, suggesting that CGTCA-containing enhancers interact with similar transacting factors. Images PMID:2842787

  13. Assessment of potential effects of water produced from coalbed natural gas development on macroinvertebrate and algal communities in the Powder River and Tongue River, Wyoming and Montana, 2010

    USGS Publications Warehouse

    Peterson, David A.; Hargett, Eric G.; Feldman, David L.

    2011-01-01

    Ongoing development of coalbed natural gas in the Powder River structural basin in Wyoming and Montana led to formation of an interagency aquatic task group to address concerns about the effects of the resulting production water on biological communities in streams of the area. Ecological assessments, made from 2005–08 under the direction of the task group, indicated biological condition of the macroinvertebrate and algal communities in the middle reaches of the Powder was lower than in the upper or lower reaches. On the basis of the 2005–08 results, sampling of the macroinvertebrate and algae communities was conducted at 18 sites on the mainstem Powder River and 6 sites on the mainstem Tongue River in 2010. Sampling-site locations were selected on a paired approach, with sites located upstream and downstream of discharge points and tributaries associated with coalbed natural gas development. Differences in biological condition among site pairs were evaluated graphically and statistically using multiple lines of evidence that included macroinvertebrate and algal community metrics (such as taxa richness, relative abundance, functional feeding groups, and tolerance) and output from observed/expected (O/E) macroinvertebrate models from Wyoming and Montana. Multiple lines of evidence indicated a decline in biological condition in the middle reaches of the Powder River, potentially indicating cumulative effects from coalbed natural gas discharges within one or more reaches between Flying E Creek and Wild Horse Creek in Wyoming. The maximum concentrations of alkalinity in the Powder River also occurred in the middle reaches. Biological condition in the upper and lower reaches of the Powder River was variable, with declines between some site pairs, such as upstream and downstream of Dry Fork and Willow Creek, and increases at others, such as upstream and downstream of Beaver Creek. Biological condition at site pairs on the Tongue River showed an increase in one case, near the Wyoming-Montana border, and a decrease in another case, upstream of Tongue River Reservoir. Few significant differences were noted from upstream to downstream of Prairie Dog Creek, a major tributary to the Tongue River. Further study would be needed to confirm the observed patterns and choose areas to examine in greater detail.

  14. EMMPRIN, an upstream regulator of MMPs, in CNS biology.

    PubMed

    Kaushik, Deepak Kumar; Hahn, Jennifer Nancy; Yong, V Wee

    2015-01-01

    Matrix metalloproteinases (MMPs) are engaged in pathologies associated with infections, tumors, autoimmune disorders and neurological dysfunctions. With the identification of an upstream regulator of MMPs, EMMPRIN (Extracellular matrix metalloproteinase inducer, CD147), it is relevant to address if EMMPRIN plays a role in the pathology of central nervous system (CNS) diseases. This would enable the possibility of a more upstream and effective therapeutic target. Indeed, conditions including gliomas, Alzheimer's disease (AD), multiple sclerosis (MS), and other insults such as hypoxia/ischemia show elevated levels of EMMPRIN which correlate with MMP production. In contrast, given EMMPRIN's role in CNS homeostasis with respect to regulation of monocarboxylate transporters (MCTs) and interactions with adhesion molecules including integrins, we need to consider that EMMPRIN may also serve important regulatory or protective functions. This review summarizes the current understanding of EMMPRIN's involvement in CNS homeostasis, its possible roles in escalating or reducing neural injury, and the mechanisms of EMMPRIN including and apart from MMP induction. Copyright © 2015 International Society of Matrix Biology. Published by Elsevier B.V. All rights reserved.

  15. Development of Multiple-Element Flame Emission Spectrometer Using CCD Detection

    ERIC Educational Resources Information Center

    Seney, Caryn S.; Sinclair, Karen V.; Bright, Robin M.; Momoh, Paul O.; Bozeman, Amelia D.

    2005-01-01

    The full wavelength coverage of charge coupled device (CCD) detector when coupled with an echelle spectrography, the system allows for simultaneously multiple element spectroscopy to be performed. The multiple-element flame spectrometer was built and characterized through the analysis of environmentally significant elements such as Ca, K, Na, Cu,…

  16. The LINEs and SINEs of Entamoeba histolytica: comparative analysis and genomic distribution.

    PubMed

    Bakre, Abhijeet A; Rawal, Kamal; Ramaswamy, Ram; Bhattacharya, Alok; Bhattacharya, Sudha

    2005-07-01

    Autonomous non-long terminal repeat retrotransposons are commonly referred to as long interspersed elements (LINEs). Short non-autonomous elements that borrow the LINE machinery are called SINES. The Entamoeba histolytica genome contains three classes of LINEs and SINEs. Together the EhLINEs/SINEs account for about 6% of the genome. The recognizable functional domains in all three EhLINEs included reverse transcriptase and endonuclease. A novel feature was the presence of two types of members-some with a single long ORF (less frequent) and some with two ORFs (more frequent) in both EhLINE1 and 2. The two ORFs were generated by conserved changes leading to stop codon. Computational analysis of the immediate flanking sequences for each element showed that they inserted in AT-rich sequences, with a preponderance of Ts in the upstream site. The elements were very frequently located close to protein-coding genes and other EhLINEs/SINEs. The possible influence of these elements on expression of neighboring genes needs to be determined.

  17. Multiple cis-acting sequence elements are required for efficient splicing of simian virus 40 small-t antigen pre-mRNA.

    PubMed Central

    Fu, X Y; Colgan, J D; Manley, J L

    1988-01-01

    We have determined the effects of a number of mutations in the small-t antigen mRNA intron on the alternative splicing pattern of the simian virus 40 early transcript. Expansion of the distance separating the small-t pre-mRNA lariat branch point and the shared large T-small t 3' splice site from 18 to 29 nucleotides (nt) resulted in a relative enhancement of small-t splicing in vivo. This finding, coupled with the observation that large-T pre-RNA splicing in vitro was not affected by this expansion, suggests that small-t splicing is specifically constrained by a short branch point-3' splice site distance. Similarly, the distance separating the 5' splice site and branch point (48 nt) was found to be at or near a minimum for small-t splicing, because deletions in this region as small as 2 nt dramatically reduced the ratio of small-t to large-T mRNA that accumulated in transfected cells. Finally, a specific sequence within the small-t intron, encompassing the upstream branch sites used in large-T splicing, was found to be an important element in the cell-specific pattern of early alternative splicing. Substitutions within this region reduced the ratio of small-t to large-T mRNA produced in HeLa cells but had only minor effects in human 293 cells. Images PMID:2851720

  18. Interactions of a co-rotating vortex pair at multiple offsets

    NASA Astrophysics Data System (ADS)

    Forster, Kyle J.; Barber, Tracie J.; Diasinos, Sammy; Doig, Graham

    2017-05-01

    Two NACA0012 vanes at various lateral offsets were investigated by wind tunnel testing to observe the interactions between the streamwise vortices. The vanes were separated by nine chord lengths in the streamwise direction to allow the upstream vortex to impact on the downstream geometry. These vanes were evaluated at an angle of incidence of 8° and a Reynolds number of 7 ×104 using particle image velocimetry. A helical motion of the vortices was observed, with rotational rate increasing as the offset was reduced to the point of vortex merging. Downstream meandering of the weaker vortex was found to increase in magnitude near the point of vortex merging. The merging process occurred more rapidly when the upstream vortex was passed on the pressure side of the vane, with the downstream vortex being produced with less circulation and consequently merging into the upstream vortex. The merging distance was found to be statistical rather than deterministic quantity, indicating that the meandering of the vortices affected their separations and energies. This resulted in a fluctuation of the merging location. A loss of circulation associated with the merging process was identified, with the process of achieving vortex circularity causing vorticity diffusion, however all merged cases maintained higher circulation than a single vortex condition. The presence of the upstream vortex was found to reduce the strength of the downstream vortex in all offsets evaluated.

  19. Matrix multiplication operations with data pre-conditioning in a high performance computing architecture

    DOEpatents

    Eichenberger, Alexandre E; Gschwind, Michael K; Gunnels, John A

    2013-11-05

    Mechanisms for performing matrix multiplication operations with data pre-conditioning in a high performance computing architecture are provided. A vector load operation is performed to load a first vector operand of the matrix multiplication operation to a first target vector register. A load and splat operation is performed to load an element of a second vector operand and replicating the element to each of a plurality of elements of a second target vector register. A multiply add operation is performed on elements of the first target vector register and elements of the second target vector register to generate a partial product of the matrix multiplication operation. The partial product of the matrix multiplication operation is accumulated with other partial products of the matrix multiplication operation.

  20. Mapping the functional versatility and fragility of Ras GTPase signaling circuits through in vitro network reconstitution

    PubMed Central

    Coyle, Scott M; Lim, Wendell A

    2016-01-01

    The Ras-superfamily GTPases are central controllers of cell proliferation and morphology. Ras signaling is mediated by a system of interacting molecules: upstream enzymes (GEF/GAP) regulate Ras’s ability to recruit multiple competing downstream effectors. We developed a multiplexed, multi-turnover assay for measuring the dynamic signaling behavior of in vitro reconstituted H-Ras signaling systems. By including both upstream regulators and downstream effectors, we can systematically map how different network configurations shape the dynamic system response. The concentration and identity of both upstream and downstream signaling components strongly impacted the timing, duration, shape, and amplitude of effector outputs. The distorted output of oncogenic alleles of Ras was highly dependent on the balance of positive (GAP) and negative (GEF) regulators in the system. We found that different effectors interpreted the same inputs with distinct output dynamics, enabling a Ras system to encode multiple unique temporal outputs in response to a single input. We also found that different Ras-to-GEF positive feedback mechanisms could reshape output dynamics in distinct ways, such as signal amplification or overshoot minimization. Mapping of the space of output behaviors accessible to Ras provides a design manual for programming Ras circuits, and reveals how these systems are readily adapted to produce an array of dynamic signaling behaviors. Nonetheless, this versatility comes with a trade-off of fragility, as there exist numerous paths to altered signaling behaviors that could cause disease. DOI: http://dx.doi.org/10.7554/eLife.12435.001 PMID:26765565

  1. Thermodynamics of complex structures formed between single-stranded DNA oligomers and the KH domains of the far upstream element binding protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in

    The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitablemore » statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4–DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3–DNA complex.« less

  2. Regulation of the grapevine polygalacturonase-inhibiting protein encoding gene: expression pattern, induction profile and promoter analysis.

    PubMed

    Joubert, D Albert; de Lorenzo, Giulia; Vivier, Melané A

    2013-03-01

    Regulation of defense in plants is a complex process mediated by various signaling pathways. Promoter analysis of defense-related genes is useful to understand these signaling pathways involved in regulation. To this end, the regulation of the polygalacturonase-inhibiting protein encoding gene from Vitis vinifera L. (Vvpgip1) was analyzed with regard to expression pattern and induction profile as well as the promoter in terms of putative regulatory elements present, core promoter size and the start of transcription. Expression of Vvpgip1 is tissue-specific and developmentally regulated. Vvpgip1 expression was induced in response to auxin, salicylic acid and sugar treatment, wounding and pathogen infection. The start of transcription was mapped to 17 bp upstream of the ATG and the core promoter was mapped to the 137 bp upstream of the ATG. Fructose- and Botrytis responsiveness were identified in the region between positions -3.1 and -1.5 kb. The analyses showed induction in water when the leaves were submersed and this response and the response to wounding mapped to the region between positions -1.1 and -0.1 kb. In silico analyses revealed putative cis-acting elements in these areas that correspond well to the induction stimuli tested.

  3. Differential Acetylation of Histone H3 at the Regulatory Region of OsDREB1b Promoter Facilitates Chromatin Remodelling and Transcription Activation during Cold Stress

    PubMed Central

    Roy, Dipan; Paul, Amit; Roy, Adrita; Ghosh, Ritesh; Ganguly, Payel; Chaudhuri, Shubho

    2014-01-01

    The rice ortholog of DREB1, OsDREB1b, is transcriptionally induced by cold stress and over-expression of OsDREB1b results in increase tolerance towards high salt and freezing stress. This spatio-temporal expression of OsDREB1b is preceded by the change in chromatin structure at the promoter and the upstream region for gene activation. The promoter and the upstream region of OsDREB1b genes appear to be arranged into a nucleosome array. Nucleosome mapping of ∼700bp upstream region of OsDREB1b shows two positioned nucleosomes between −610 to −258 and a weakly positioned nucleosome at the core promoter and the TSS. Upon cold stress, there is a significant change in the nucleosome arrangement at the upstream region with increase in DNaseI hypersensitivity or MNase digestion in the vicinity of cis elements and TATA box at the core promoter. ChIP assays shows hyper-acetylation of histone H3K9 throughout the locus whereas region specific increase was observed in H3K14ac and H3K27ac. Moreover, there is an enrichment of RNA PolII occupancy at the promoter region during transcription activation. There is no significant change in the H3 occupancy in OsDREB1b locus negating the possibility of nucleosome loss during cold stress. Interestingly, cold induced enhanced transcript level of OsDREB1b as well as histone H3 acetylation at the upstream region was found to diminish when stressed plants were returned to normal temperature. The result indicates absolute necessity of changes in chromatin conformation for the transcription up-regulation of OsDREB1b gene in response to cold stress. The combined results show the existence of closed chromatin conformation at the upstream and promoter region of OsDREB1b in the transcription “off” state. During cold stress, changes in region specific histone modification marks promote the alteration of chromatin structure to facilitate the binding of transcription machinery for proper gene expression. PMID:24940877

  4. Short interspersed elements (SINEs) from insectivores. Two classes of mammalian SINEs distinguished by A-rich tail structure.

    PubMed

    Borodulina, O R; Kramerov, D A

    2001-10-01

    Four tRNA-related SINE families were isolated from the genome of the shrew Sorex araneus (SOR element), mole Mogera robusta (TAL element), and hedgehog Mesechinus dauuricus (ERI-1 and ERI-2 elements). Each of these SINEs families is specific for a single Insectivora family: SOR, for Soricidae (shrews); TAL, for Talpidae (moles and desmans); ERI-1 and ERI-2, for Erinaceidae (hedgehogs). There is a long polypyrimidine region (TC-motif) in TAL, ERI-1, and ERI-2 elements located immediately upstream of an A-rich tail with polyadenylation signals (AATAAA) and an RNA polymerase III terminator (T(4-6)) or TCT(3-4)). Ten out of 14 analyzed mammalian tRNA-related SINE families have an A-rich tail similar to that of TAL, ERI-1, and ERI-2 elements. These elements were assigned to class T+. The other four SINEs including SOR element have no polyadenylation signal and transcription terminator in their A-rich tail and were assigned to class T-. Class T+ SINEs occur only in mammals, and most of them have a long polypyrimidine region. Possible models of retroposition of class T+ and T- SINEs are discussed.

  5. Diel periodicity and chronology of upstream migration in yellow-phase American eels (Anguilla rostrata)

    USGS Publications Warehouse

    Aldinger, Joni L.; Welsh, Stuart A.

    2017-01-01

    Yellow-phase American eel (Anguilla rostrata) upstream migration is temporally punctuated, yet migration chronology within diel time periods is not well-understood. This study examined diel periodicity, chronology, and total length (TL) of six multi-day, high-count (285–1,868 eels) passage events of upstream migrant yellow-phase American eels at the Millville Dam eel ladder, lower Shenandoah River, West Virginia during 2011–2014. We categorized passage by diel periods (vespertine, nocturnal, matutinal, diurnal) and season (spring, summer, late summer/early fall, fall). We depicted passage counts as time-series histograms and used time-series spectral analysis (Fast Fourier Transformation) to identify cyclical patterns and diel periodicity of upstream migration. We created histograms to examine movement patterns within diel periods for each passage event and fit normal mixture models (2–9 mixtures) to describe multiple peaks of passage counts. Periodicity of movements for each passage event followed a 24-h activity cycle with mostly nocturnal movement. Multimodal models were supported by the data; most modes represented nocturnal movements, but modes at or near the transition between twilight and night were also common. We used mixed-model methodology to examine relationships among TL, diel period, and season. An additive-effects model of diel period + season was the best approximating model. A decreasing trend of mean TL occurred across diel movement periods, with the highest mean TL occurring during fall relative to similar mean values of TL for spring, summer, and late summer/early fall. This study increased our understanding of yellow-phase American eels by demonstrating the non-random nature of their upstream migration.

  6. The proteins encoded by the Drosophila Planar Polarity Effector genes inturned, fuzzy and fritz interact physically and can re-pattern the accumulation of “upstream” Planar Cell Polarity proteins

    PubMed Central

    Wang, Ying; Yan, Jie; Lee, Haeryun; Lu, Qiuheng; Adler, Paul N.

    2014-01-01

    The frizzled/starry night pathway regulates planar cell polarity in a wide variety of tissues in many types of animals. It was discovered and has been most intensively studied in the Drosophila wing where it controls the formation of the array of distally pointing hairs that cover the wing. The pathway does this by restricting the activation of the cytoskeleton to the distal edge of wing cells. This results in hairs initiating at the distal edge and growing in the distal direction. All of the proteins encoded by genes in the pathway accumulate asymmetrically in wing cells. The pathway is a hierarchy with the Planar Cell Polarity (PCP) genes (aka the core genes) functioning as a group upstream of the Planar Polarity Effector (PPE) genes which in turn function as a group upstream of multiple wing hairs. Upstream proteins, such as Frizzled accumulate on either the distal and/or proximal edges of wing cells. Downstream PPE proteins accumulate on the proximal edge under the instruction of the upstream proteins. A variety of types of data support this hierarchy, however, we have found that when over expressed the PPE proteins can alter both the subcellular location and level of accumulation of the upstream proteins. Thus, the epistatic relationship is context dependent. We further show that the PPE proteins interact physically and can modulate the accumulation of each other in wing cells. We also find that over expression of Frtz results in a marked delay in hair initiation suggesting that it has a separate role/activity in regulating the cytoskeleton that is not shared by other members of the group. PMID:25072625

  7. Negative and Translation Termination-Dependent Positive Control of FLI-1 Protein Synthesis by Conserved Overlapping 5′ Upstream Open Reading Frames in Fli-1 mRNA

    PubMed Central

    Sarrazin, Sandrine; Starck, Joëlle; Gonnet, Colette; Doubeikovski, Alexandre; Melet, Fabrice; Morle, François

    2000-01-01

    The proto-oncogene Fli-1 encodes a transcription factor of the ets family whose overexpression is associated with multiple virally induced leukemias in mouse, inhibits murine and avian erythroid cell differentiation, and induces drastic perturbations of early development in Xenopus. This study demonstrates the surprisingly sophisticated regulation of Fli-1 mRNA translation. We establish that two FLI-1 protein isoforms (of 51 and 48 kDa) detected by Western blotting in vivo are synthesized by alternative translation initiation through the use of two highly conserved in-frame initiation codons, AUG +1 and AUG +100. Furthermore, we show that the synthesis of these two FLI-1 isoforms is regulated by two short overlapping 5′ upstream open reading frames (uORF) beginning at two highly conserved upstream initiation codons, AUG −41 and GUG −37, and terminating at two highly conserved stop codons, UGA +35 and UAA +15. The mutational analysis of these two 5′ uORF revealed that each of them negatively regulates FLI-1 protein synthesis by precluding cap-dependent scanning to the 48- and 51-kDa AUG codons. Simultaneously, the translation termination of the two 5′ uORF appears to enhance 48-kDa protein synthesis, by allowing downstream reinitiation at the 48-kDa AUG codon, and 51-kDa protein synthesis, by allowing scanning ribosomes to pile up and consequently allowing upstream initiation at the 51-kDa AUG codon. To our knowledge, this is the first example of a cellular mRNA displaying overlapping 5′ uORF whose translation termination appears to be involved in the positive control of translation initiation at both downstream and upstream initiation codons. PMID:10757781

  8. Differential regulation of mnp2, a new manganese peroxidase-encoding gene from the ligninolytic fungus Trametes versicolor PRL 572.

    PubMed

    Johansson, Tomas; Nyman, Per Olof; Cullen, Daniel

    2002-04-01

    A peroxidase-encoding gene, mnp2, and its corresponding cDNA were characterized from the white-rot basidiomycete Trametes versicolor PRL 572. We used quantitative reverse transcriptase-mediated PCR to identify mnp2 transcripts in nutrient-limited stationary cultures. Although mnp2 lacks upstream metal response elements (MREs), addition of MnSO(4) to cultures increased mnp2 transcript levels 250-fold. In contrast, transcript levels of an MRE-containing gene of T. versicolor, mnp1, increased only eightfold under the same conditions. Thus, the manganese peroxidase genes in T. versicolor are differentially regulated, and upstream MREs are not necessarily involved. Our results support the hypothesis that fungal and plant peroxidases arose through an ancient duplication and folding of two structural domains, since we found the mnp1 and mnp2 polypeptides to have internal homology.

  9. Differential Regulation of mnp2, a New Manganese Peroxidase-Encoding Gene from the Ligninolytic Fungus Trametes versicolor PRL 572

    PubMed Central

    Johansson, Tomas; Nyman, Per Olof; Cullen, Daniel

    2002-01-01

    A peroxidase-encoding gene, mnp2, and its corresponding cDNA were characterized from the white-rot basidiomycete Trametes versicolor PRL 572. We used quantitative reverse transcriptase-mediated PCR to identify mnp2 transcripts in nutrient-limited stationary cultures. Although mnp2 lacks upstream metal response elements (MREs), addition of MnSO4 to cultures increased mnp2 transcript levels 250-fold. In contrast, transcript levels of an MRE-containing gene of T. versicolor, mnp1, increased only eightfold under the same conditions. Thus, the manganese peroxidase genes in T. versicolor are differentially regulated, and upstream MREs are not necessarily involved. Our results support the hypothesis that fungal and plant peroxidases arose through an ancient duplication and folding of two structural domains, since we found the mnp1 and mnp2 polypeptides to have internal homology. PMID:11916737

  10. Hydrodynamic Influence Dabanhu River Bridge Holes Widening Based on Two-Dimensional Finite Element Numerical Model

    NASA Astrophysics Data System (ADS)

    Li, Dong Feng; Bai, Fu Qing; Nie, Hui

    2018-06-01

    In order to analyze the influence of bridge holes widening on hydrodynamic such as water level, a two-dimensional mathematical model was used to calculate the hydrodynamic factors, river network flow velocity vector distribution is given, water level and difference of bridge widening before and after is calculated and charted, water surface gradient in seven different river sections near the upper reaches of bridges is counted and revealed. The results of hydrodynamic calculation indicate that The Maximum and the minimum deducing numerical value of the water level after bridge widening is 0.028m, and 0.018m respective. the seven sections water surface gradient becomes smaller until it becomes negative, the influence of bridge widening on the upstream is basically over, the range of influence is about 450m from the bridge to the upstream. reach

  11. Bellows flow-induced vibrations

    NASA Technical Reports Server (NTRS)

    Tygielski, P. J.; Smyly, H. M.; Gerlach, C. R.

    1983-01-01

    The bellows flow excitation mechanism and results of comprehensive test program are summarized. The analytical model for predicting bellows flow induced stress is refined. The model includes the effects of an upstream elbow, arbitrary geometry, and multiple piles. A refined computer code for predicting flow induced stress is described which allows life prediction if a material S-N diagram is available.

  12. Molecular evolution of multiple-level control of heme biosynthesis pathway in animal kingdom.

    PubMed

    Tzou, Wen-Shyong; Chu, Ying; Lin, Tzung-Yi; Hu, Chin-Hwa; Pai, Tun-Wen; Liu, Hsin-Fu; Lin, Han-Jia; Cases, Ildeofonso; Rojas, Ana; Sanchez, Mayka; You, Zong-Ye; Hsu, Ming-Wei

    2014-01-01

    Adaptation of enzymes in a metabolic pathway can occur not only through changes in amino acid sequences but also through variations in transcriptional activation, mRNA splicing and mRNA translation. The heme biosynthesis pathway, a linear pathway comprised of eight consecutive enzymes in animals, provides researchers with ample information for multiple types of evolutionary analyses performed with respect to the position of each enzyme in the pathway. Through bioinformatics analysis, we found that the protein-coding sequences of all enzymes in this pathway are under strong purifying selection, from cnidarians to mammals. However, loose evolutionary constraints are observed for enzymes in which self-catalysis occurs. Through comparative genomics, we found that in animals, the first intron of the enzyme-encoding genes has been co-opted for transcriptional activation of the genes in this pathway. Organisms sense the cellular content of iron, and through iron-responsive elements in the 5' untranslated regions of mRNAs and the intron-exon boundary regions of pathway genes, translational inhibition and exon choice in enzymes may be enabled, respectively. Pathway product (heme)-mediated negative feedback control can affect the transport of pathway enzymes into the mitochondria as well as the ubiquitin-mediated stability of enzymes. Remarkably, the positions of these controls on pathway activity are not ubiquitous but are biased towards the enzymes in the upstream portion of the pathway. We revealed that multiple-level controls on the activity of the heme biosynthesis pathway depend on the linear depth of the enzymes in the pathway, indicating a new strategy for discovering the molecular constraints that shape the evolution of a metabolic pathway.

  13. Heterogeneic dynamics of the structures of multiple gene clusters in two pathogenetically different lines originating from the same phytoplasma.

    PubMed

    Arashida, Ryo; Kakizawa, Shigeyuki; Hoshi, Ayaka; Ishii, Yoshiko; Jung, Hee-Young; Kagiwada, Satoshi; Yamaji, Yasuyuki; Oshima, Kenro; Namba, Shigetou

    2008-04-01

    Phytoplasmas are phloem-limited plant pathogens that are transmitted by insect vectors and are associated with diseases in hundreds of plant species. Despite their small sizes, phytoplasma genomes have repeat-rich sequences, which are due to several genes that are encoded as multiple copies. These multiple genes exist in a gene cluster, the potential mobile unit (PMU). PMUs are present at several distinct regions in the phytoplasma genome. The multicopy genes encoded by PMUs (herein named mobile unit genes [MUGs]) and similar genes elsewhere in the genome (herein named fundamental genes [FUGs]) are likely to have the same function based on their annotations. In this manuscript we show evidence that MUGs and FUGs do not cluster together within the same clade. Each MUG is in a cluster with a short branch length, suggesting that MUGs are recently diverged paralogs, whereas the origin of FUGs is different from that of MUGs. We also compared the genome structures around the lplA gene in two derivative lines of the 'Candidatus Phytoplasma asteris' OY strain, the severe-symptom line W (OY-W) and the mild-symptom line M (OY-M). The gene organizations of the nucleotide sequences upstream of the lplA genes of OY-W and OY-M were dramatically different. The tra5 insertion sequence, an element of PMUs, was found only in this region in OY-W. These results suggest that transposition of entire PMUs and PMU sections has occurred frequently in the OY phytoplasma genome. The difference in the pathogenicities of OY-W and OY-M might be caused by the duplication and transposition of PMUs, followed by genome rearrangement.

  14. Seismo-turbidite Sedimentology: Implications for Active Tectonic Margin Stratigraphy and Sediment Facies Patterns

    NASA Astrophysics Data System (ADS)

    Nelson, C. H.; Goldfinger, C.; Gutierrez Pastor, J.; Polonia, A.; Van Daele, M. E.

    2014-12-01

    Earthquakes generate mass transport deposits (MTDs); megaturbidites (MTD overlain by coeval turbidite); multi-pulsed, stacked, and mud homogenite seismo-turbidites; tsunamites; and seiche deposits. The strongest (Mw 9) earthquake shaking signatures appear to create multi-pulsed individual turbidites, where the number and character of multiple coarse-grained pulses for correlative turbidites generally remain constant both upstream and downstream in different channel systems. Multiple turbidite pulses, that correlate with multiple ruptures shown in seismograms of historic earthquakes (e.g. Chile 1960, Sumatra 2004 and Japan 2011), support this hypothesis. The weaker (Mw = or < 8) (e.g. northern California San Andreas) earthquakes generate dominantly upstream simple fining-up (uni-pulsed) turbidites in single tributary canyons and channels; however, downstream stacked turbidites result from synchronously triggered multiple turbidity currents that deposit in channels below confluences of the tributaries. Proven tsunamites, which result from tsunami waves sweeping onshore and shallow water debris into deeper water, are a fine-grained turbidite cap over other seismo-turbidites. In contrast, MTDs and seismo-turbidites result from slope failures. Multiple great earthquakes cause seismic strengthening of slope sediment, which results in minor MTDs in basin floor turbidite system deposits (e.g. maximum run-out distances of MTDs across basin floors along active margins are up to an order of magnitude less than on passive margins). In contrast, the MTDs and turbidites are equally intermixed in turbidite systems of passive margins (e.g. Gulf of Mexico). In confined basin settings, earthquake triggering results in a common facies pattern of coeval megaturbidites in proximal settings, thick stacked turbidites downstream, and ponded muddy homogenite turbidites in basin or sub-basin centers, sometimes with a cap of seiche deposits showing bi-directional flow patterns.

  15. Multiple mobile promoter regions for the rare carbapenem resistance gene of Bacteroides fragilis.

    PubMed

    Podglajen, I; Breuil, J; Rohaut, A; Monsempes, C; Collatz, E

    2001-06-01

    Two novel insertion sequences (IS), IS1187 and IS1188, are described upstream from the carbapenem resistance gene cfiA in strains of Bacteroides fragilis. Mapping, with the RACE procedure, of transcription start sites of cfiA in these and two other previously reported IS showed that transcription of this rarely encountered gene is initiated close to a variety of B. fragilis consensus promoter sequences, as recently defined (D. P. Bayley, E. R. Rocha, and C. J. Smith, FEMS Microbiol. Lett. 193:149-154, 2000). In the cases of IS1186 and IS1188, these sequences overlap with putative Esigma(70) promoter sequences, while in IS942 and IS1187 such sequences can be observed either upstream or downstream of the B. fragilis promoters.

  16. Achieving a golden mean: mechanisms by which coronaviruses ensure synthesis of the correct stoichiometric ratios of viral proteins.

    PubMed

    Plant, Ewan P; Rakauskaite, Rasa; Taylor, Deborah R; Dinman, Jonathan D

    2010-05-01

    In retroviruses and the double-stranded RNA totiviruses, the efficiency of programmed -1 ribosomal frameshifting is critical for ensuring the proper ratios of upstream-encoded capsid proteins to downstream-encoded replicase enzymes. The genomic organizations of many other frameshifting viruses, including the coronaviruses, are very different, in that their upstream open reading frames encode nonstructural proteins, the frameshift-dependent downstream open reading frames encode enzymes involved in transcription and replication, and their structural proteins are encoded by subgenomic mRNAs. The biological significance of frameshifting efficiency and how the relative ratios of proteins encoded by the upstream and downstream open reading frames affect virus propagation has not been explored before. Here, three different strategies were employed to test the hypothesis that the -1 PRF signals of coronaviruses have evolved to produce the correct ratios of upstream- to downstream-encoded proteins. Specifically, infectious clones of the severe acute respiratory syndrome (SARS)-associated coronavirus harboring mutations that lower frameshift efficiency decreased infectivity by >4 orders of magnitude. Second, a series of frameshift-promoting mRNA pseudoknot mutants was employed to demonstrate that the frameshift signals of the SARS-associated coronavirus and mouse hepatitis virus have evolved to promote optimal frameshift efficiencies. Finally, we show that a previously described frameshift attenuator element does not actually affect frameshifting per se but rather serves to limit the fraction of ribosomes available for frameshifting. The findings of these analyses all support a "golden mean" model in which viruses use both programmed ribosomal frameshifting and translational attenuation to control the relative ratios of their encoded proteins.

  17. XX males SRY negative: a confirmed cause of infertility.

    PubMed

    Vetro, Annalisa; Ciccone, Roberto; Giorda, Roberto; Patricelli, Maria Grazia; Della Mina, Erika; Forlino, Antonella; Zuffardi, Orsetta

    2011-10-01

    SOX9 is a widely expressed transcription factor playing several relevant functions during development and essential for testes differentiation. It is considered to be the direct target gene of the protein encoded by SRY and its overexpression in an XX murine gonad can lead to male development in the absence of Sry. Recently, a family was reported with a 178 kb duplication in the gene desert region ending about 500 kb upstream of SOX9 in which 46,XY duplicated persons were completely normal and fertile whereas the 46,XX ones were males who came to clinical attention because of infertility. We report a family with two azoospermic brothers, both 46,XX, SRY negative, having a 96 kb triplication 500 kb upstream of SOX9. Both subjects have been analyzed trough oligonucleotide array-CGH and the triplication was confirmed and characterised through qPCR, defining the minimal region of amplification upstream of SOX9 associated with 46,XX infertile males, SRY negative. Our results confirm that even in absence of SRY, complete male differentiation may occur, possibly driven by overexpression of SOX9 in the gonadal ridge, as a consequence of the amplification of a gene desert region. We hypothesize that this region contains gonadal specific long-range regulation elements whose alteration may impair the normal sex development. Our data show that normal XX males, with alteration in copy number or, possibly, in the critical sequence upstream to SOX9 are a new category of infertility inherited in a dominant way with expression limited to the XX background.

  18. Rearrangement of Upstream Sequences of the hTERT Gene During Cellular Immortalization

    PubMed Central

    Zhao, Yuanjun; Wang, Shuwen; Popova, Evgenya Y.; Grigoryev, Sergei A.; Zhu, Jiyue

    2010-01-01

    Telomerase expression, resulting from transcriptional activation of the hTERT gene, allows cells to acquire indefinite proliferative potential during cellular immortalization and tumorigenesis. However, mechanisms of hTERT gene activation in many immortal cell lines and cancer cells are poorly understood. Here, we report our studies on hTERT activation using genetically related pairs of telomerase-negative (Tel−) and -positive (Tel+) fibroblast lines. First, whereas transiently transfected plasmid reporters did not recapitulate the endogenous hTERT promoter, the promoter in chromosomally integrated bacterial artificial chromosome (BAC) reporters was activated in a subset of Tel+ cells, indicating that activation of the hTERT promoter required native chromatin context and/or distal regulatory elements. Second, the hTERT gene, located near the telomere of chromosome 5p, was translocated in all three Tel+ cell lines but not in their parental pre-crisis cells and Tel− immortal siblings. The breakage points were mapped to regions upstream of the hTERT promoter, indicating that the hTERT gene was the target of these chromosomal rearrangements. In two Tel+ cell lines, translocation of the endogenous hTERT gene appeared to be the major mechanism of its activation as the activity of hTERT promoter in many chromosomally integrated BAC reporters, with intact upstream and downstream neighboring loci, remained relatively low. Therefore, our results suggest that rearrangement of upstream sequences is an important new mechanism of hTERT promoter activation during cellular immortalization. The chromosomal rearrangements likely occurred during cellular crisis and facilitated by telomere dysfunction. Such translocations allowed the hTERT promoter to escape from the native condensed chromatin environment. PMID:19672873

  19. Mutations in Nonconserved Domains of Ty3 Integrase Affect Multiple Stages of the Ty3 Life Cycle

    PubMed Central

    Nymark-McMahon, M. Henrietta; Sandmeyer, Suzanne B.

    1999-01-01

    Ty3, a retroviruslike element of Saccharomyces cerevisiae, transposes into positions immediately upstream of RNA polymerase III-transcribed genes. The Ty3 integrase (IN) protein is required for integration of the replicated, extrachromosomal Ty3 DNA. In retroviral IN, a conserved core region is sufficient for strand transfer activity. In this study, charged-to-alanine scanning mutagenesis was used to investigate the roles of the nonconserved amino- and carboxyl-terminal regions of Ty3 IN. Each of the 20 IN mutants was defective for transposition, but no mutant was grossly defective for capsid maturation. All mutations affecting steady-state levels of mature IN protein resulted in reduced levels of replicated DNA, even when polymerase activity was not grossly defective as measured by exogenous reverse transcriptase activity assay. Thus, IN could contribute to nonpolymerase functions required for DNA production in vivo or to the stability of the DNA product. Several mutations in the carboxyl-terminal domain resulted in relatively low levels of processed 3′ ends of the replicated DNA, suggesting that this domain may be important for binding of IN to the long terminal repeat. Another class of mutants produced wild-type amounts of DNA with correctly processed 3′ ends. This class could include mutants affected in nuclear entry and target association. Collectively, these mutations demonstrate that in vivo, within the preintegration complex, IN performs a central role in coordinating multiple late stages of the retrotransposition life cycle. PMID:9847351

  20. The presence of p53 influences the expression of multiple human cytomegalovirus genes at early times postinfection.

    PubMed

    Hannemann, Holger; Rosenke, Kyle; O'Dowd, John M; Fortunato, Elizabeth A

    2009-05-01

    Human cytomegalovirus (HCMV) is a common cause of morbidity and mortality in immunocompromised and immunosuppressed individuals. During infection, HCMV is known to employ host transcription factors to facilitate viral gene expression. To further understand the previously observed delay in viral replication and protein expression in p53 knockout cells, we conducted microarray analyses of p53(+/+) and p53(-/-) immortalized fibroblast cell lines. At a multiplicity of infection (MOI) of 1 at 24 h postinfection (p.i.), the expression of 22 viral genes was affected by the absence of p53. Eleven of these 22 genes (group 1) were examined by real-time reverse transcriptase, or quantitative, PCR (q-PCR). Additionally, five genes previously determined to have p53 bound to their nearest p53-responsive elements (group 2) and three control genes without p53 binding sites in their upstream sequences (group 3) were also examined. At an MOI of 1, >3-fold regulation was found for five group 1 genes. The expression of group 2 and 3 genes was not changed. At an MOI of 5, all genes from group 1 and four of five genes from group 2 were found to be regulated. The expression of control genes from group 3 remained unchanged. A q-PCR time course of four genes revealed that p53 influences viral gene expression most at immediate-early and early times p.i., suggesting a mechanism for the reduced and delayed production of virions in p53(-/-) cells.

  1. Modeling the combined influence of host dispersal and waterborne fate and transport on pathogen spread in complex landscapes

    PubMed Central

    Lu, Ding; McDowell, Julia Z.; Davis, George M.; Spear, Robert C.; Remais, Justin V.

    2012-01-01

    Environmental models, often applied to questions on the fate and transport of chemical hazards, have recently become important in tracing certain environmental pathogens to their upstream sources of contamination. These tools, such as first order decay models applied to contaminants in surface waters, offer promise for quantifying the fate and transport of pathogens with multiple environmental stages and/or multiple hosts, in addition to those pathogens whose environmental stages are entirely waterborne. Here we consider the fate and transport capabilities of the human schistosome Schistosoma japonicum, which exhibits two waterborne stages and is carried by an amphibious intermediate snail host. We present experimentally-derived dispersal estimates for the intermediate snail host and fate and transport estimates for the passive downstream diffusion of cercariae, the waterborne, human-infective parasite stage. Using a one dimensional advective transport model exhibiting first-order decay, we simulate the added spatial reach and relative increase in cercarial concentrations that dispersing snail hosts contribute to downstream sites. Simulation results suggest that snail dispersal can substantially increase the concentrations of cercariae reaching downstream locations, relative to no snail dispersal, effectively putting otherwise isolated downstream sites at increased risk of exposure to cercariae from upstream sources. The models developed here can be applied to other infectious diseases with multiple life-stages and hosts, and have important implications for targeted ecological control of disease spread. PMID:23162675

  2. E2-mediated cathepsin D (CTSD) activation involves looping of distal enhancer elements.

    PubMed

    Bretschneider, Nancy; Kangaspeska, Sara; Seifert, Martin; Reid, George; Gannon, Frank; Denger, Stefanie

    2008-08-01

    Estrogen receptor alpha (ERalpha) is a ligand dependent transcription factor that regulates the expression of target genes through interacting with cis-acting estrogen response elements (EREs). However, only a minority of ERalpha binding sites are located within the proximal promoter regions of responsive genes. Here we report the characterization of an ERE located 9kbp upstream of the TSS of the cathepsin D gene (CTSD) that up-regulates CTSD expression upon estrogen stimulation in MCF-7 cells. Using ChIP, we show recruitment of ERalpha and phosphorylated PolII at the CTSD distal enhancer region. Moreover, we determine the kinetics of transient CpG methylation on the promoter region of CTSD and for the first time, at a distal enhancer element. We show that ERalpha is crucial for long-distance regulation of CTSD expression involving a looping mechanism.

  3. A Systematic Analysis of 2 Monoisocentric Techniques for the Treatment of Multiple Brain Metastases.

    PubMed

    Narayanasamy, Ganesh; Stathakis, Sotirios; Gutierrez, Alonso N; Pappas, Evangelos; Crownover, Richard; Floyd, John R; Papanikolaou, Niko

    2017-10-01

    In this treatment planning study, we compare the plan quality and delivery parameters for the treatment of multiple brain metastases using 2 monoisocentric techniques: the Multiple Metastases Element from Brainlab and the RapidArc volumetric-modulated arc therapy from Varian Medical Systems. Eight patients who were treated in our institution for multiple metastases (3-7 lesions) were replanned with Multiple Metastases Element using noncoplanar dynamic conformal arcs. The same patients were replanned with the RapidArc technique in Eclipse using 4 noncoplanar arcs. Both techniques were designed using a single isocenter. Plan quality metrics (conformity index, homogeneity index, gradient index, and R 50% ), monitor unit, and the planning time were recorded. Comparison of the Multiple Metastases Element and RapidArc plans was performed using Shapiro-Wilk test, paired Student t test, and Wilcoxon signed rank test. A paired Wilcoxon signed rank test between Multiple Metastases Element and RapidArc showed comparable plan quality metrics and dose to brain. Mean ± standard deviation values of conformity index were 1.8 ± 0.7 and 1.7 ± 0.6, homogeneity index were 1.3 ± 0.1 and 1.3 ± 0.1, gradient index were 5.0 ± 1.8 and 5.1 ± 1.9, and R 50% were 4.9 ± 1.8 and 5.0 ± 1.9 for Multiple Metastases Element and RapidArc plans, respectively. Mean brain dose was 2.3 and 2.7 Gy for Multiple Metastases Element and RapidArc plans, respectively. The mean value of monitor units in Multiple Metastases Element plan was 7286 ± 1065, which is significantly lower than the RapidArc monitor units of 9966 ± 1533 ( P < .05). For the planning of multiple brain lesions to be treated with stereotactic radiosurgery, Multiple Metastases Element planning software produced equivalent conformity, homogeneity, dose falloff, and brain V 12 Gy but required significantly lower monitor units, when compared to RapidArc plans.

  4. A Systematic Analysis of 2 Monoisocentric Techniques for the Treatment of Multiple Brain Metastases

    PubMed Central

    Stathakis, Sotirios; Gutierrez, Alonso N.; Pappas, Evangelos; Crownover, Richard; Floyd, John R.; Papanikolaou, Niko

    2016-01-01

    Background: In this treatment planning study, we compare the plan quality and delivery parameters for the treatment of multiple brain metastases using 2 monoisocentric techniques: the Multiple Metastases Element from Brainlab and the RapidArc volumetric-modulated arc therapy from Varian Medical Systems. Methods: Eight patients who were treated in our institution for multiple metastases (3-7 lesions) were replanned with Multiple Metastases Element using noncoplanar dynamic conformal arcs. The same patients were replanned with the RapidArc technique in Eclipse using 4 noncoplanar arcs. Both techniques were designed using a single isocenter. Plan quality metrics (conformity index, homogeneity index, gradient index, and R50%), monitor unit, and the planning time were recorded. Comparison of the Multiple Metastases Element and RapidArc plans was performed using Shapiro-Wilk test, paired Student t test, and Wilcoxon signed rank test. Results: A paired Wilcoxon signed rank test between Multiple Metastases Element and RapidArc showed comparable plan quality metrics and dose to brain. Mean ± standard deviation values of conformity index were 1.8 ± 0.7 and 1.7 ± 0.6, homogeneity index were 1.3 ± 0.1 and 1.3 ± 0.1, gradient index were 5.0 ± 1.8 and 5.1 ± 1.9, and R50% were 4.9 ± 1.8 and 5.0 ± 1.9 for Multiple Metastases Element and RapidArc plans, respectively. Mean brain dose was 2.3 and 2.7 Gy for Multiple Metastases Element and RapidArc plans, respectively. The mean value of monitor units in Multiple Metastases Element plan was 7286 ± 1065, which is significantly lower than the RapidArc monitor units of 9966 ± 1533 (P < .05). Conclusion: For the planning of multiple brain lesions to be treated with stereotactic radiosurgery, Multiple Metastases Element planning software produced equivalent conformity, homogeneity, dose falloff, and brain V12 Gy but required significantly lower monitor units, when compared to RapidArc plans. PMID:27612917

  5. Selection of Optimal Polypurine Tract Region Sequences during Moloney Murine Leukemia Virus Replication

    PubMed Central

    Robson, Nicole D.; Telesnitsky, Alice

    2000-01-01

    Retrovirus plus-strand synthesis is primed by a cleavage remnant of the polypurine tract (PPT) region of viral RNA. In this study, we tested replication properties for Moloney murine leukemia viruses with targeted mutations in the PPT and in conserved sequences upstream, as well as for pools of mutants with randomized sequences in these regions. The importance of maintaining some purine residues within the PPT was indicated both by examining the evolution of random PPT pools and from the replication properties of targeted mutants. Although many different PPT sequences could support efficient replication and one mutant that contained two differences in the core PPT was found to replicate as well as the wild type, some sequences in the core PPT clearly conferred advantages over others. Contributions of sequences upstream of the core PPT were examined with deletion mutants. A conserved T-stretch within the upstream sequence was examined in detail and found to be unimportant to helper functions. Evolution of virus pools containing randomized T-stretch sequences demonstrated marked preference for the wild-type sequence in six of its eight positions. These findings demonstrate that maintenance of the T-rich element is more important to viral replication than is maintenance of the core PPT. PMID:11044073

  6. Strategies for enhancing bioluminescent bacterial sensor performance by promoter region manipulation

    PubMed Central

    Bilic, Benny; Belkin, Shimshon

    2010-01-01

    Genetically engineered microbial reporter strains are based upon the fusion of an inducible sensing element upstream of a reporting element, so that the construct emits a dose-dependent signal when exposed to the inducing compound(s) or stress factor(s). In this communication1 we described several general approaches undertaken in order to enhance the sensing performance of such promoter::reporter fusions. Significant improvements in detection sensitivity, response kinetics and signal intensity were achieved by modi fication of the length of the promoter-containing DNA fragment, by random or site-directed mutagenesis and by promoter duplication. The general nature of these genetics manipulations makes them applicable to other types of promoter::reporter fusions. PMID:21326942

  7. Large-scale dynamics associated with clustering of extratropical cyclones affecting Western Europe

    NASA Astrophysics Data System (ADS)

    Pinto, Joaquim G.; Gómara, Iñigo; Masato, Giacomo; Dacre, Helen F.; Woollings, Tim; Caballero, Rodrigo

    2015-04-01

    Some recent winters in Western Europe have been characterized by the occurrence of multiple extratropical cyclones following a similar path. The occurrence of such cyclone clusters leads to large socio-economic impacts due to damaging winds, storm surges, and floods. Recent studies have statistically characterized the clustering of extratropical cyclones over the North Atlantic and Europe and hypothesized potential physical mechanisms responsible for their formation. Here we analyze 4 months characterized by multiple cyclones over Western Europe (February 1990, January 1993, December 1999, and January 2007). The evolution of the eddy driven jet stream, Rossby wave-breaking, and upstream/downstream cyclone development are investigated to infer the role of the large-scale flow and to determine if clustered cyclones are related to each other. Results suggest that optimal conditions for the occurrence of cyclone clusters are provided by a recurrent extension of an intensified eddy driven jet toward Western Europe lasting at least 1 week. Multiple Rossby wave-breaking occurrences on both the poleward and equatorward flanks of the jet contribute to the development of these anomalous large-scale conditions. The analysis of the daily weather charts reveals that upstream cyclone development (secondary cyclogenesis, where new cyclones are generated on the trailing fronts of mature cyclones) is strongly related to cyclone clustering, with multiple cyclones developing on a single jet streak. The present analysis permits a deeper understanding of the physical reasons leading to the occurrence of cyclone families over the North Atlantic, enabling a better estimation of the associated cumulative risk over Europe.

  8. SECIS elements in the coding regions of selenoprotein transcripts are functional in higher eukaryotes

    PubMed Central

    Mix, Heiko; Lobanov, Alexey V.; Gladyshev, Vadim N.

    2007-01-01

    Expression of selenocysteine (Sec)-containing proteins requires the presence of a cis-acting mRNA structure, called selenocysteine insertion sequence (SECIS) element. In bacteria, this structure is located in the coding region immediately downstream of the Sec-encoding UGA codon, whereas in eukaryotes a completely different SECIS element has evolved in the 3′-untranslated region. Here, we report that SECIS elements in the coding regions of selenoprotein mRNAs support Sec insertion in higher eukaryotes. Comprehensive computational analysis of all available viral genomes revealed a SECIS element within the ORF of a naturally occurring selenoprotein homolog of glutathione peroxidase 4 in fowlpox virus. The fowlpox SECIS element supported Sec insertion when expressed in mammalian cells as part of the coding region of viral or mammalian selenoproteins. In addition, readthrough at UGA was observed when the viral SECIS element was located upstream of the Sec codon. We also demonstrate successful de novo design of a functional SECIS element in the coding region of a mammalian selenoprotein. Our data provide evidence that the location of the SECIS element in the untranslated region is not a functional necessity but rather is an evolutionary adaptation to enable a more efficient synthesis of selenoproteins. PMID:17169995

  9. RNA Editing and Its Molecular Mechanism in Plant Organelles

    PubMed Central

    Ichinose, Mizuho; Sugita, Mamoru

    2016-01-01

    RNA editing by cytidine (C) to uridine (U) conversions is widespread in plant mitochondria and chloroplasts. In some plant taxa, “reverse” U-to-C editing also occurs. However, to date, no instance of RNA editing has yet been reported in green algae and the complex thalloid liverworts. RNA editing may have evolved in early land plants 450 million years ago. However, in some plant species, including the liverwort, Marchantia polymorpha, editing may have been lost during evolution. Most RNA editing events can restore the evolutionarily conserved amino acid residues in mRNAs or create translation start and stop codons. Therefore, RNA editing is an essential process to maintain genetic information at the RNA level. Individual RNA editing sites are recognized by plant-specific pentatricopeptide repeat (PPR) proteins that are encoded in the nuclear genome. These PPR proteins are characterized by repeat elements that bind specifically to RNA sequences upstream of target editing sites. In flowering plants, non-PPR proteins also participate in multiple RNA editing events as auxiliary factors. C-to-U editing can be explained by cytidine deamination. The proteins discovered to date are important factors for RNA editing but a bona fide RNA editing enzyme has yet to be identified. PMID:28025543

  10. Genome-wide analyses implicate 33 loci in heritable dog osteosarcoma, including regulatory variants near CDKN2A/B

    PubMed Central

    2013-01-01

    Background Canine osteosarcoma is clinically nearly identical to the human disease, but is common and highly heritable, making genetic dissection feasible. Results Through genome-wide association analyses in three breeds (greyhounds, Rottweilers, and Irish wolfhounds), we identify 33 inherited risk loci explaining 55% to 85% of phenotype variance in each breed. The greyhound locus exhibiting the strongest association, located 150 kilobases upstream of the genes CDKN2A/B, is also the most rearranged locus in canine osteosarcoma tumors. The top germline candidate variant is found at a >90% frequency in Rottweilers and Irish wolfhounds, and alters an evolutionarily constrained element that we show has strong enhancer activity in human osteosarcoma cells. In all three breeds, osteosarcoma-associated loci and regions of reduced heterozygosity are enriched for genes in pathways connected to bone differentiation and growth. Several pathways, including one of genes regulated by miR124, are also enriched for somatic copy-number changes in tumors. Conclusions Mapping a complex cancer in multiple dog breeds reveals a polygenic spectrum of germline risk factors pointing to specific pathways as drivers of disease. PMID:24330828

  11. Multiple origins of resistance-conferring mutations in Plasmodium vivax dihydrofolate reductase

    PubMed Central

    Hawkins, Vivian N; Auliff, Alyson; Prajapati, Surendra Kumar; Rungsihirunrat, Kanchana; Hapuarachchi, Hapuarachchige C; Maestre, Amanda; O'Neil, Michael T; Cheng, Qin; Joshi, Hema; Na-Bangchang, Kesara; Sibley, Carol Hopkins

    2008-01-01

    Background In order to maximize the useful therapeutic life of antimalarial drugs, it is crucial to understand the mechanisms by which parasites resistant to antimalarial drugs are selected and spread in natural populations. Recent work has demonstrated that pyrimethamine-resistance conferring mutations in Plasmodium falciparum dihydrofolate reductase (dhfr) have arisen rarely de novo, but spread widely in Asia and Africa. The origin and spread of mutations in Plasmodium vivax dhfr were assessed by constructing haplotypes based on sequencing dhfr and its flanking regions. Methods The P. vivax dhfr coding region, 792 bp upstream and 683 bp downstream were amplified and sequenced from 137 contemporary patient isolates from Colombia, India, Indonesia, Papua New Guinea, Sri Lanka, Thailand, and Vanuatu. A repeat motif located 2.6 kb upstream of dhfr was also sequenced from 75 of 137 patient isolates, and mutational relationships among the haplotypes were visualized using the programme Network. Results Synonymous and non-synonymous single nucleotide polymorphisms (SNPs) within the dhfr coding region were identified, as was the well-documented in-frame insertion/deletion (indel). SNPs were also identified upstream and downstream of dhfr, with an indel and a highly polymorphic repeat region identified upstream of dhfr. The regions flanking dhfr were highly variable. The double mutant (58R/117N) dhfr allele has evolved from several origins, because the 58R is encoded by at least 3 different codons. The triple (58R/61M/117T) and quadruple (57L/61M/117T/173F, 57I/58R/61M/117T and 57L/58R/61M/117T) mutant alleles had at least three independent origins in Thailand, Indonesia, and Papua New Guinea/Vanuatu. Conclusion It was found that the P. vivax dhfr coding region and its flanking intergenic regions are highly polymorphic and that mutations in P. vivax dhfr that confer antifolate resistance have arisen several times in the Asian region. This contrasts sharply with the selective sweep of rare antifolate resistant alleles observed in the P. falciparum populations in Asia and Africa. The finding of multiple origins of resistance-conferring mutations has important implications for drug policy. PMID:18442404

  12. Multiple origins of resistance-conferring mutations in Plasmodium vivax dihydrofolate reductase.

    PubMed

    Hawkins, Vivian N; Auliff, Alyson; Prajapati, Surendra Kumar; Rungsihirunrat, Kanchana; Hapuarachchi, Hapuarachchige C; Maestre, Amanda; O'Neil, Michael T; Cheng, Qin; Joshi, Hema; Na-Bangchang, Kesara; Sibley, Carol Hopkins

    2008-04-28

    In order to maximize the useful therapeutic life of antimalarial drugs, it is crucial to understand the mechanisms by which parasites resistant to antimalarial drugs are selected and spread in natural populations. Recent work has demonstrated that pyrimethamine-resistance conferring mutations in Plasmodium falciparum dihydrofolate reductase (dhfr) have arisen rarely de novo, but spread widely in Asia and Africa. The origin and spread of mutations in Plasmodium vivax dhfr were assessed by constructing haplotypes based on sequencing dhfr and its flanking regions. The P. vivax dhfr coding region, 792 bp upstream and 683 bp downstream were amplified and sequenced from 137 contemporary patient isolates from Colombia, India, Indonesia, Papua New Guinea, Sri Lanka, Thailand, and Vanuatu. A repeat motif located 2.6 kb upstream of dhfr was also sequenced from 75 of 137 patient isolates, and mutational relationships among the haplotypes were visualized using the programme Network. Synonymous and non-synonymous single nucleotide polymorphisms (SNPs) within the dhfr coding region were identified, as was the well-documented in-frame insertion/deletion (indel). SNPs were also identified upstream and downstream of dhfr, with an indel and a highly polymorphic repeat region identified upstream of dhfr. The regions flanking dhfr were highly variable. The double mutant (58R/117N) dhfr allele has evolved from several origins, because the 58R is encoded by at least 3 different codons. The triple (58R/61M/117T) and quadruple (57L/61M/117T/173F, 57I/58R/61M/117T and 57L/58R/61M/117T) mutant alleles had at least three independent origins in Thailand, Indonesia, and Papua New Guinea/Vanuatu. It was found that the P. vivax dhfr coding region and its flanking intergenic regions are highly polymorphic and that mutations in P. vivax dhfr that confer antifolate resistance have arisen several times in the Asian region. This contrasts sharply with the selective sweep of rare antifolate resistant alleles observed in the P. falciparum populations in Asia and Africa. The finding of multiple origins of resistance-conferring mutations has important implications for drug policy.

  13. Cryoablation of focal tachycardia originating from the right atrial free wall during upstream phrenic pacing to avoid phrenic nerve injury.

    PubMed

    Johnsrude, Christopher

    2015-01-01

    Recognition of the potential for phrenic nerve injury (PNI) often prompts less aggressive attempts at catheter ablation of multiple forms of tachycardia or abandoning ablation altogether. Some novel techniques to avoid PNI during catheter ablation have been described. Five patients (age: 13-57 years, three females) with ectopic atrial tachycardia originating from the right atrial free wall (RAFW) near the phrenic nerve underwent electrophysiology study with three-dimensional mapping and endocardial cryoablation. Upstream phrenic pacing was performed after cryoadherence was achieved, and cryoablation of ectopic foci was performed during close observation for occurrence of PNI and tachycardia elimination. Cryoablation acutely eliminated five of six atrial tachycardias originating close to the phrenic nerve. Transient PNI during cryothermy occurred in two patients, and resolved within 3 minutes. Patients were observed overnight on telemetry, with no early recurrences of targeted atrial tachycardias and no evidence of PNI. At last follow-up of 1-39 months, four patients were arrhythmia free on no medications. Catheter cryoablation during simultaneous upstream phrenic nerve pacing can lead to safe and effective elimination of focal atrial tachycardias originating from the RAFW close to the phrenic nerve. ©2014 Wiley Periodicals, Inc.

  14. Climate-induced trends in predator–prey synchrony differ across life-history stages of an anadromous salmonid

    USGS Publications Warehouse

    Bell, Donovan A.; Kovach, Ryan; Vulstek, Scott C.; Joyce, John E.; Tallmon, David A.

    2017-01-01

    Differential climate-induced shifts in phenology can create mismatches between predators and prey, but few studies have examined predator–prey mismatch across multiple life-history stages. We used long-term data from a warming stream with shifting salmonid migration timings to quantify intra-annual migration synchrony between predatory Dolly Varden (Salvelinus malma) and Pacific salmon prey and examined how predator–prey synchrony has been influenced by climate change. We demonstrate that Dolly Varden have become increasingly mismatched with spring downstream migrations of abundant pink salmon (Oncorhynchus gorbuscha) juveniles. However, Dolly Varden have remained matched with fall upstream migrations of spawning Pacific salmon, including coho (Oncorhynchus kisutch), sockeye (Oncorhynchus nerka), and pink salmon. Downstream predator–prey migration synchrony decreased over time and with higher temperatures, particularly with pink salmon. In contrast, upstream migration synchrony was temporally stable and increased with rising temperatures. Differing trends in Dolly Varden predator–prey synchrony may be explained by the direct use of salmon to cue upstream migration, but not downstream migration. Overall, we show that climate change can have differing impacts on predator–prey synchrony across life-history stages.

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dahabieh, Matthew S., E-mail: dahabieh@interchange.ubc.ca; Ooms, Marcel, E-mail: marcel.ooms@mssm.edu; Malcolm, Tom, E-mail: tmalc1@yahoo.com

    Transcription from the HIV-1 long terminal repeat (LTR) is mediated by numerous host transcription factors. In this study we characterized an E-box motif (RBE1) within the core promoter that was previously implicated in both transcriptional activation and repression. We show that RBE1 is a binding site for the RBF-2 transcription factor complex (USF1, USF2, and TFII-I), previously shown to bind an upstream viral element, RBE3. The RBE1 and RBE3 elements formed complexes of identical mobility and protein constituents in gel shift assays, both with Jurkat T-cell nuclear extracts and recombinant USF/TFII-I. Furthermore, both elements are regulators of HIV-1 expression; mutationsmore » in LTR-luciferase reporters and in HIV-1 molecular clones resulted in decreased transcription, virion production, and proviral expression in infected cells. Collectively, our data indicate that RBE1 is a bona fide RBF-2 binding site and that the RBE1 and RBE3 elements are necessary for mediating proper transcription from the HIV-1 LTR.« less

  16. Deletions involving long-range conserved nongenic sequences upstream and downstream of FOXL2 as a novel disease-causing mechanism in blepharophimosis syndrome.

    PubMed

    Beysen, D; Raes, J; Leroy, B P; Lucassen, A; Yates, J R W; Clayton-Smith, J; Ilyina, H; Brooks, S Sklower; Christin-Maitre, S; Fellous, M; Fryns, J P; Kim, J R; Lapunzina, P; Lemyre, E; Meire, F; Messiaen, L M; Oley, C; Splitt, M; Thomson, J; Van de Peer, Y; Veitia, R A; De Paepe, A; De Baere, E

    2005-08-01

    The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes.

  17. Deletions Involving Long-Range Conserved Nongenic Sequences Upstream and Downstream of FOXL2 as a Novel Disease-Causing Mechanism in Blepharophimosis Syndrome

    PubMed Central

    Beysen, D.; Raes, J.; Leroy, B. P.; Lucassen, A.; Yates, J. R. W.; Clayton-Smith, J.; Ilyina, H.; Brooks, S. Sklower; Christin-Maitre, S.; Fellous, M.; Fryns, J. P.; Kim, J. R.; Lapunzina, P.; Lemyre, E.; Meire, F.; Messiaen, L. M.; Oley, C.; Splitt, M.; Thomson, J.; Peer, Y. Van de; Veitia, R. A.; De Paepe, A.; De Baere, E.

    2005-01-01

    The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes. PMID:15962237

  18. The nuclear orphan receptors COUP-TF and ARP-1 positively regulate the trout estrogen receptor gene through enhancing autoregulation.

    PubMed Central

    Lazennec, G; Kern, L; Valotaire, Y; Salbert, G

    1997-01-01

    The rainbow trout estrogen receptor (rtER) is a positively autoregulated gene in liver cells. In a previous report, we showed that upregulation is mediated by an estrogen response element (ERE) located in the proximal promoter of the gene and that a half binding site for nuclear receptors (5'-TGACCT-3') located 15 bp upstream of the ERE is involved in the magnitude of the estrogen response. We now report that the human orphan receptor COUP-TF and a COUP-TF-like protein from trout liver are able to bind to the consensus half-site. When cotransfected with the rtER gene proximal promoter, COUP-TF had no regulatory functions on its own. Interestingly, COUP-TF enhanced rtER transactivation properties in the presence of estradiol in a dose-dependent manner when cotransfected with the rtER gene promoter. Unliganded retinoid receptor heterodimers had the same helper function as COUP-TF in the presence of estradiol but were switched to repressors when the ligand all-trans-retinoic acid was added. Mutation of the consensus half-site only slightly reduced COUP-TF helper function, suggesting that it actually results from a complex mechanism that probably involves both DNA binding of COUP-TF to the promoter and protein-protein interaction with another transcription factor bound to the promoter. Nevertheless, a DNA-binding-defective mutant of COUP-TF was also defective in ER helper function. Competition footprinting analysis suggested that COUP-TF actually establishes contacts with the consensus upstream half-site and the downstream ERE half-site that would form a DR-24-like response element. Interaction of COUP-TF with the DR-24 element was confirmed in footprinting assays by using nuclear extracts from Saccharomyces cerevisiae expressing COUP-TF. Finally, interaction of COUP-TF with mutants of the rtER gene promoter showed that COUP-TF recognizes the ERE when the upstream half-site is mutated. These data show that COUP-TF may activate transcription through interaction with other nuclear receptors. This cross-talk between liganded nuclear receptors and orphan receptors is likely to modulate the spectrum of action of a particular ligand-receptor complex and may participate in the cell-type specificity of the ligand effect. PMID:9271383

  19. Apparatus for measuring the decontamination factor of a multiple filter air-cleaning system

    DOEpatents

    Ortiz, John P.

    1986-01-01

    An apparatus for measuring the overall decontamination factor of first and second filters located in a plenum. The first filter separates the plenum's upstream and intermediate chambers. The second filter separates the plenum's intermediate and downstream chambers. The apparatus comprises an aerosol generator that generates a challenge aerosol. An upstream collector collects unfiltered aerosol which is piped to first and second dilution stages and then to a laser aerosol spectrometer. An intermediate collector collects challenge aerosol that penetrates the first filter. The filtered aerosol is piped to the first dilution stage, diluted, and then piped to the laser aerosol spectrometer which detects single particles. A downstream collector collects challenge aerosol that penetrates both filters. The twice-filtered aerosol is piped to the aerosol spectrometer. A pump and several valves control the movement of aerosol within the apparatus.

  20. Apparatus for measuring the decontamination factor of a multiple filter air-cleaning system

    DOEpatents

    Ortiz, J.P.

    1985-07-03

    An apparatus for measuring the overall decontamination factors of first and second filters located in a plenum. The first filter separates the plenum's upstream and intermediate chambers. The second filter separates the plenum's intermediate and downstream chambers. The apparatus comprises an aerosol generator that generates a challenge aerosol. An upstream collector collects unfiltered aerosol which is piped to first and second dilution stages and then to a laser aerosol spectrometer. An intermediate collector collects challenge aerosol that penetrates the first filter. The filtered aerosol is piped to the first dilution stage, diluted, and then piped to the laser aerosol spectrometer which detects single particles. A downstream collector collects challenge aerosol that penetrates both filters. The twice-filtered aerosol is piped to the aerosol spectrometer. A pump and several valves control the movement of aerosol within the apparatus.

  1. Effect of Dam operation on monthly and annual trends of flow discharge in the Qom Rood Watershed, Iran

    NASA Astrophysics Data System (ADS)

    Yaghmaei, Hiva; Sadeghi, Seyed Hamidreza; Moradi, Hamidreza; Gholamalifard, Mehdi

    2018-02-01

    Trends in flow discharge, temperature and rainfall from the Qom Rood Watershed, Iran, for a period of 1979-2016 were analyzed at monthly and annual time scales. Trend analyses were conducted using the Mann-Kendall test, the double-mass curve of mean annual discharge versus rainfall, and rainfall-runoff relationship before and after the 15 Khordad Dam operation. Multiple regression of flow discharge against rainfall and temperature was used to determine the residual trend at four meteorological and hydrological stations located upstream and downstream of the Qom Rood Watershed. Results showed that the temperature at the upstream and downstream stations did not have any significant trend, but a significant decreasing trend (P < .05) in rainfall was detected only in May (z = -1.66) at the downstream stations. There was a significant positive trend (P < .05) in rainfall in February (z = 2.22) and July (z = 2.15) at the upstream stations, and in October (z = 2.3) and November (z = 1.8) at the downstream stations. However, there was a noticeable decrease in monthly and annual flow discharge, and residual trend at 99% significance level at the downstream stations. At the upstream stations, the flow discharges had significant (P < .05) declining trend in all months, but annual flow discharge did not change significantly. Analysis of double mass curve between runoff and rainfall at the downstream stations showed an inconsistency in the line slope concordant with the time of 15 Khordad Dam operation. Annual mean discharge at the upstream stations did not show a significant change before and after 15 Khordad Dam operation. However, annual flow magnitude decreased significantly by 87.5 and 81.7% in Shad Abad and KoohSefid, respectively. These results confirmed that natural driving forces did not affect flow discharge changes and the observed decreasing tendency in flow discharge at the downstream stations was due to 15 Khordad Dam, and at the upstream stations due to diversion/storage dams. These findings highlighted the role of human interference in changing the hydrologic regime in the study area based on which appropriate adaptive decisions can be made.

  2. A 20 bp cis-acting element is both necessary and sufficient to mediate elicitor response of a maize PRms gene.

    PubMed

    Raventós, D; Jensen, A B; Rask, M B; Casacuberta, J M; Mundy, J; San Segundo, B

    1995-01-01

    Transient gene expression assays in barley aleurone protoplasts were used to identify a cis-regulatory element involved in the elicitor-responsive expression of the maize PRms gene. Analysis of transcriptional fusions between PRms 5' upstream sequences and a chloramphenicol acetyltransferase reporter gene, as well as chimeric promoters containing PRms promoter fragments or repeated oligonucleotides fused to a minimal promoter, delineated a 20 bp sequence which functioned as an elicitor-response element (ERE). This sequence contains a motif (-246 AATTGACC) similar to sequences found in promoters of other pathogen-responsive genes. The analysis also indicated that an enhancing sequence(s) between -397 and -296 is required for full PRms activation by elicitors. The protein kinase inhibitor staurosporine was found to completely block the transcriptional activation induced by elicitors. These data indicate that protein phosphorylation is involved in the signal transduction pathway leading to PRms expression.

  3. Delimiting regulatory sequences of the Drosophila melanogaster Ddc gene.

    PubMed Central

    Hirsh, J; Morgan, B A; Scholnick, S B

    1986-01-01

    We delimited sequences necessary for in vivo expression of the Drosophila melanogaster dopa decarboxylase gene Ddc. The expression of in vitro-altered genes was assayed following germ line integration via P-element vectors. Sequences between -209 and -24 were necessary for normally regulated expression, although genes lacking these sequences could be expressed at 10 to 50% of wild-type levels at specific developmental times. These genes showed components of normal developmental expression, which suggests that they retain some regulatory elements. All Ddc genes lacking the normal immediate 5'-flanking sequences were grossly deficient in larval central nervous system expression. Thus, this upstream region must contain at least one element necessary for this expression. A mutated Ddc gene without a normal TATA boxlike sequence used the normal RNA start points, indicating that this sequences is not required for start point specificity. Images PMID:3099170

  4. The human tartrate-resistant acid phosphatase (TRAP): involvement of the hemin responsive elements (HRE) in transcriptional regulation.

    PubMed

    Fleckenstein, E C; Dirks, W G; Drexler, H G

    2000-02-01

    The biochemical properties and protein structure of the tartrate-resistant acid phosphatase (TRAP), an iron-containing lysosomal glycoprotein in cells of the mononuclear phagocyte system, are well known. In contrast, little is known about the physiology and genic structure of this unique enzyme. In some diseases, like hairy cell leukemia, Gaucher's disease and osteoclastoma, cytochemically detected TRAP expression is used as a disease-associated marker. In order to begin to elucidate the regulation of this gene we generated different deletion constructs of the TRAP 5'-flanking region, placed them upstream of the luciferase reporter gene and assayed them for their ability to direct luciferase expression in human 293 cells. Treatment of these cells with the iron-modulating reagents transferrin and hemin causes opposite effects on the TRAP promoter activity. Two regulatory GAGGC tandem repeat sequences (the hemin responsive elements, HRE) within the 5'-flanking region of the human TRAP gene were identified. Studies with specific HRE-deletion constructs of the human TRAP 5'-flanking region upstream of the luciferase reporter gene document the functionality of these HRE-sequences which are apparently responsible for mediating transcriptional inhibition upon exposure to hemin. In addition to the previously published functional characterization of the murine TRAP HRE motifs, these results provide the first description of a new iron/hemin-responsive transcriptional regulation in the human TRAP gene.

  5. Destruction of a distal hypoxia response element abolishes trans-activation of the PAG1 gene mediated by HIF-independent chromatin looping

    PubMed Central

    Schörg, Alexandra; Santambrogio, Sara; Platt, James L.; Schödel, Johannes; Lindenmeyer, Maja T.; Cohen, Clemens D.; Schrödter, Katrin; Mole, David R.; Wenger, Roland H.; Hoogewijs, David

    2015-01-01

    A crucial step in the cellular adaptation to oxygen deficiency is the binding of hypoxia-inducible factors (HIFs) to hypoxia response elements (HREs) of oxygen-regulated genes. Genome-wide HIF-1α/2α/β DNA-binding studies revealed that the majority of HREs reside distant to the promoter regions, but the function of these distal HREs has only been marginally studied in the genomic context. We used chromatin immunoprecipitation (ChIP), gene editing (TALEN) and chromosome conformation capture (3C) to localize and functionally characterize a 82 kb upstream HRE that solely drives oxygen-regulated expression of the newly identified HIF target gene PAG1. PAG1, a transmembrane adaptor protein involved in Src signalling, was hypoxically induced in various cell lines and mouse tissues. ChIP and reporter gene assays demonstrated that the −82 kb HRE regulates PAG1, but not an equally distant gene further upstream, by direct interaction with HIF. Ablation of the consensus HRE motif abolished the hypoxic induction of PAG1 but not general oxygen signalling. 3C assays revealed that the −82 kb HRE physically associates with the PAG1 promoter region, independent of HIF-DNA interaction. These results demonstrate a constitutive interaction between the −82 kb HRE and the PAG1 promoter, suggesting a physiologically important rapid response to hypoxia. PMID:26007655

  6. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging themore » ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.« less

  7. In vitro transcription in the presence of DNA oligonucleotides can generate strong anomalous initiation sites.

    PubMed

    Chow, C W; Clark, M P; Rinaldo, J E; Chalkley, R

    1996-03-01

    In the present study, we have explored an unexpected observation in transcription initiation that is mediated by single-stranded oligonucleotides. Initially, our goal was to understand the function of different upstream regulatory elements/initiation sites in the rat xanthine dehydrogenase/oxidase (XDH/XO) promoter. We performed in vitro transcription with HeLa nuclear extracts in the presence of different double-stranded oligonucleotides against upstream elements as competitors. A new and unusual transcription initiation site was detected by primer extension. This new initiation site maps to the downstream region of the corresponding competitor. Subsequent analyses have indicated that the induction of a new transcription initiation site is anomalous which is due to the presence of a small amount of single-stranded oligonucleotide in the competitor. We found that this anomalous initiation site is insensitive to the orientation of the promoter and requires only a small amount of single-stranded oligonucleotide (< 2-fold molar excess relative to template). We surmise that a complementary interaction between the single-stranded oligonucleotide and transiently denatured promoter template may be responsible for this sequence-specific transcription initiation artifact. To study the regulation of transcription initiation by in vitro transcription approaches, we propose that one should probe the effect of removing transacting factors by adding an excess of a cognate oligonucleotide which does not bear exact sequence identity to the template.

  8. Molecular characterization of heat shock protein 70 (HSP 70) promoter in Japanese flounder (Paralichthys olivaceus), and the association of Pohsp70 SNPs with heat-resistant trait.

    PubMed

    Qi, Jie; Liu, Xudong; Liu, Jinxiang; Yu, Haiyang; Wang, Wenji; Wang, Zhigang; Zhang, Quanqi

    2014-08-01

    Ambient temperature is one of the major abiotic environmental factors determining the main parameters of fish vital activity. HSP70 plays an essential role in heat response. In this investigation, the promoter and structure of Paralichthys olivaceus hsp70 (Pohsp70) gene was cloned and predicted. 2558 bp upstream regulatory region of Pohsp70 was annotated with four potential promoter elements and four putative binding sites of transcription factors heat shock elements (HSE, nGAAn) in the upstream of the transcription start site. In addition, one intron with 454 bp in the 5'-noncoding region was found. Quantitative Real Time PCR analysis indicated that the transcript level of Pohsp70 was raised markedly after 1 h by heat shocked. Furthermore, 25 SNPs were identified in Pohsp70 by resequencing, seven of which was associated with heat resistance. In addition, two of the seven SNPs, namely SNP14 and SNP16, were observed in strong linkage disequilibrium. The haplotype with association analysis showed TAGGAG haplotype was more represented in heat susceptible group while (DEL/T) GAATA haplotype was more frequent in heat resistant group. The heat resistant SNPs and haplotype could be candidate markers potentially serving for selective breeding programs of Japanese flounder aimed at improving anti-stress and production. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. The Evolution of Riparian Landscape Elements Following Upstream Regulation and Depletion on the Rio Grande

    NASA Astrophysics Data System (ADS)

    Everitt, B. L.

    2006-12-01

    In 1915 closure of Elephant Butte Dam in central New Mexico profoundly altered the hydrologic regime of the Rio Grande for 560 km downstream, and set in motion a cascade of interwoven geomorphic, biological, and cultural responses. Geomorphic response included shrinking of the width and depth of the channel, and an increase in sinuosity. Cultural responses included artificial channel modification on 320 km of the river within the boundaries of the original irrigation project, beginning in 1933. The pre-dam river and its flood plain consisted of a mosaic of geomorphic elements that formed a functional riverine landscape, and founded a diverse habitat for the plants, animals, and people that lived there. A preliminary comparison of the modern river with pre-dam topographic mapping permits identification of individual landscape elements, including overflow land (flood plain) both cultivated and uncultivated, with oxbows and back-swamps. The pre-dam channel included a low water thread and un-vegetated flood bars. From pre-dam description and photographs we can assume the usual complement of pools and riffles, point bars and undercut banks. Until dredged in the 1970s, the unmodified reach retained the entire suite of landscape elements, although in somewhat different proportions from the pre-dam river, and remained a functional riparian system. Channel sinuosity increased from 1.45 in 1910 to 1.7 in 1970, thus riverbank habitat increased by 1.17%. In 1970 undercut banks still provided protection for fish, and point bars generated by lateral migration still provided seed beds for pioneer species. The smaller shallower channel raised groundwater beneath the flood plain and retarded flood waves, creating a generally more mesic environment, although the river occasionally dries up, as it did prior to 1915. In contrast, an impoverished suite of landscape elements characterizes the channelized reach. Lateral stability precludes point bars and undercut banks. Bounding levees separate the channel from its former flood plain. All areas are impacted by heavy machinery during periodic channel maintenance. I conclude that the environmental degradation caused by artificial channel modification has far outweighed any generated by upstream hydrologic control.

  10. Human hnRNP protein A1 gene expression. Structural and functional characterization of the promoter.

    PubMed

    Biamonti, G; Bassi, M T; Cartegni, L; Mechta, F; Buvoli, M; Cobianchi, F; Riva, S

    1993-03-05

    hnRNP protein A1 (34 kDa, pl 9.5) is a prominent member of the family of proteins (hnRNP proteins) that associate with the nascent transcripts of RNA polymerase II and that accompany the hnRNA through the maturation process and the export to the cytoplasm. New evidence suggests an active and specific role for some of these proteins, including protein A1, in splicing and transport. Contrary to the other hnRNP proteins, the intracellular level of protein A1 was reported to change as a function of proliferation state and cell type. In this work we analyse the A1 gene expression in different cells under different growth and differentiation conditions. Proliferation dependent expression was observed in lymphocytes and fibroblasts while purified neurons express high A1 mRNA levels both in the proliferative (before birth) and in the quiescent (after birth) state. Transformed cell lines exhibit very high (proliferation independent) A1 mRNA levels compared to differentiated tissues. A structural and functional characterization of the A1 gene promoter was carried out by means of DNase I footprinting and CAT assays. The observed promoter features can account for both elevated and regulated mRNA transcription. At least 12 control elements are contained in the 734 nucleotides upstream of the transcription start site. Assays with the deleted and/or mutated promoter indicate a co-operation of multiple transcriptional elements, distributed over the entire promoter, in determining the overall activity and the response to proliferative stimuli (serum).

  11. Xylem specific activation of 5' upstream regulatory region of two NAC transcription factors (MusaVND6 and MusaVND7) in banana is regulated by SNBE-like sites.

    PubMed

    Negi, Sanjana; Tak, Himanshu; Ganapathi, T R

    2018-01-01

    Deposition of secondary cell wall in the xylem elements is controlled by a subgroup of NAC (NAM, ATAF, CUC) family, known as vascular-related NAC transcription factors (VNDs). In the present study, we analyzed the 5' upstream regulatory region of two banana NAC transcription factors (MusaVND6 and MusaVND7) for tissue specific expression and presence of 19-bp secondary-wall NAC binding element (SNBE)-like motifs. Transgenic banana plants of Musa cultivar Rasthali harboring either PMusaVND7::GUS or PMusaVND6::GUS showed specific GUS (β-D-Glucuronidase) activity in cells of the xylem tissue. Approximately 1.2kb promoter region of either MusaVND6 or MusaVND7 showed presence of at least two SNBE-like motifs. This 1.2kb promoter region was retarded in a gel shift assay by three banana VND protein (VND1,VND2 and VND3). The banana VND1-VND3 could also retard the mobility of isolated SNBE-like motifs of MusaVND6 or MusaVND7 in a gel shift assay. Transcript levels of MusaVND6 and MusaVND7 were elevated in transgenic banana overexpressing either banana VND1, VND2 or VND3. Present study suggested a probable regulation of banana VND6 and VND7 expression through direct interaction of banana VND1- VND3 with SNBE-like motifs. Our study also indicated two promoter elements for possible utilization in cell wall modifications in plants especially banana, which is being recently considered as a potential biofuel crop.

  12. Xylem specific activation of 5’ upstream regulatory region of two NAC transcription factors (MusaVND6 and MusaVND7) in banana is regulated by SNBE-like sites

    PubMed Central

    2018-01-01

    Deposition of secondary cell wall in the xylem elements is controlled by a subgroup of NAC (NAM, ATAF, CUC) family, known as vascular-related NAC transcription factors (VNDs). In the present study, we analyzed the 5’ upstream regulatory region of two banana NAC transcription factors (MusaVND6 and MusaVND7) for tissue specific expression and presence of 19-bp secondary-wall NAC binding element (SNBE)-like motifs. Transgenic banana plants of Musa cultivar Rasthali harboring either PMusaVND7::GUS or PMusaVND6::GUS showed specific GUS (β-D-Glucuronidase) activity in cells of the xylem tissue. Approximately 1.2kb promoter region of either MusaVND6 or MusaVND7 showed presence of at least two SNBE-like motifs. This 1.2kb promoter region was retarded in a gel shift assay by three banana VND protein (VND1,VND2 and VND3). The banana VND1-VND3 could also retard the mobility of isolated SNBE-like motifs of MusaVND6 or MusaVND7 in a gel shift assay. Transcript levels of MusaVND6 and MusaVND7 were elevated in transgenic banana overexpressing either banana VND1, VND2 or VND3. Present study suggested a probable regulation of banana VND6 and VND7 expression through direct interaction of banana VND1- VND3 with SNBE-like motifs. Our study also indicated two promoter elements for possible utilization in cell wall modifications in plants especially banana, which is being recently considered as a potential biofuel crop. PMID:29438404

  13. Dissolved Strontium and Barium in Fresh and Saltwater: a 2-year Study in the Calcasieu River to the Gulf of Mexico

    NASA Astrophysics Data System (ADS)

    He, S.; Xu, Y. J.

    2016-02-01

    Strontium and barium to calcium ratios are often used as proxies for tracking animal movement across salinity gradients. As sea level rise continues, many estuarine rivers face saltwater intrusion, which may cause changes in mobility and distribution of these metals upstream. Despite intensive research on metal adsorption and desorption in marine systems, knowledge of the spatiotemporal distribution of these elements along estuarine rivers is still limited. In this study, we conducted an intensive monitoring of Sr and Ba dynamics along an 88-km long estuary, the Calcasieu River, which has been strongly affected by saltwater intrusion. Over the period from May 2013 to July 2015, we collected monthly water samples and performed in-situ water quality measurements at six sites from the upstream to the river mouth. Water samples were analyzed for dissolved Sr, Ba, and Ca concentrations. In-situ measurements of salinity, pH, water temperature, dissolved oxygen concentration, and specific conductance were taken. Our preliminary data showed that the Sr and Ca concentrations and the Sr/Ca ratio all increased significantly with decreasing distance to the Gulf of Mexico, while the Ba/Ca ratio decreased with decreasing distance to the Gulf. The spatial variation in Ba concentration was marginal. The Sr and Ca concentrations and ratios were positively related to salinity, while Ba/Ca was negatively related to salinity. All the elemental concentrations and ratios had considerable seasonal and interannual variations. There were significant differences among sampling months for all the elemental concentrations and ratios (p<0.05), and there were significant differences among sampling years for the Sr and Ca concentrations and the Ba/Ca ratio (p<0.05).

  14. Irrigation drainage studies of the Angostura Reclamation Unit and the Belle Fourche Reclamation Project, western South Dakota : results of 1994 sampling and comparisons with 1988 data

    USGS Publications Warehouse

    Sando, Steven K.; Williamson, Joyce E.; Dickerson, Kimberly K.; Wesolowski, Edwin A.

    2001-01-01

    The U.S. Department of the Interior started the National Irrigation Water Quality Program in 1985 to identify the nature and extent of irrigation-induced water-quality problems that might exist in the western U.S. The Angostura Reclamation Unit (ARU) and Belle Fourche Reclamation Project (BFRP) in western South Dakota were included as part of this program. The ARU and BFRP reconnaissance studies were initiated in 1988, during below-normal streamflow conditions in both study areas. Surface water, bottom sediment, and fish were resampled in 1994 at selected sites in both study areas during generally near-normal streamflow conditions to compare with 1988 study results. Concentrations of major ions in water for both the ARU and BFRP study areas are high relative to national baseline levels. Major-ion concentrations for both areas generally are lower for 1994 than for 1988, when low-flow conditions prevailed, but ionic proportions are similar between years. For ARU, dissolved-solids concentrations probably increase slightly downstream from Angostura Reservoir; however, the available data sets are insufficient to confidently discern effects of ARU operations on dissolved-solids loading. For BFRP, dissolved-solids concentrations are slightly higher at sites that are affected by irrigation drainage; again, however, the data are inconclusive to determine whether BFRP operations increase dissolved-solids loading. Most trace-element concentrations in water samples for both study areas are similar between 1988 and 1994, and do not show strong relations with discharge. ARU operations probably are not contributing discernible additional loads of trace elements to the Cheyenne River. For BFRP, concentrations of some trace elements are slightly higher at sites downstream from irrigation operations than at a site upstream from irrigation operations. BFRP operations might contribute to trace-element concentrations in the Belle Fourche River, but available data are insufficient to quantify increases. For both study areas, concentrations of several trace elements occasionally exceed National Irrigation Water Quality Program guidelines. Selenium routinely occurs in concentrations that could be problematic at sites upstream and downstream from both study areas. Elevated selenium concentrations at sites upstream from irrigation operations indicate that naturally occurring selenium concentrations are relatively high in and near the study areas. While ARU operations probably do not contribute discernible additional loads of selenium to the Cheyenne River, BFRP operations might contribute additional selenium loads to the Belle Fourche River. Concentrations of most trace elements in bottom sediment, except arsenic and selenium, are similar to typical concentrations for western U.S. soils for both study areas. Bottom-sediment arsenic and selenium (1988) concentrations in both study areas can reach levels that might be of concern; however, there is insufficient information to determine whether irrigation operations contribute to these elevated concentrations. Concentrations of most trace elements in fish in both study areas are less than values known to adversely affect fish or birds, although there are occasional exceedances of established criteria. However, selenium concentrations in fish samples routinely are within the National Irrigation Water Quality Program level of concern, and also commonly exceed the dietary guideline for avian consumers for both study areas. Selenium concentrations in fish samples generally are higher at sites downstream from irrigation operations. For BFRP, arsenic and mercury concentrations are elevated in fish samples from site B-18, which is influenced by mine tailings.

  15. Achieving a Golden Mean: Mechanisms by Which Coronaviruses Ensure Synthesis of the Correct Stoichiometric Ratios of Viral Proteins▿

    PubMed Central

    Plant, Ewan P.; Rakauskaitė, Rasa; Taylor, Deborah R.; Dinman, Jonathan D.

    2010-01-01

    In retroviruses and the double-stranded RNA totiviruses, the efficiency of programmed −1 ribosomal frameshifting is critical for ensuring the proper ratios of upstream-encoded capsid proteins to downstream-encoded replicase enzymes. The genomic organizations of many other frameshifting viruses, including the coronaviruses, are very different, in that their upstream open reading frames encode nonstructural proteins, the frameshift-dependent downstream open reading frames encode enzymes involved in transcription and replication, and their structural proteins are encoded by subgenomic mRNAs. The biological significance of frameshifting efficiency and how the relative ratios of proteins encoded by the upstream and downstream open reading frames affect virus propagation has not been explored before. Here, three different strategies were employed to test the hypothesis that the −1 PRF signals of coronaviruses have evolved to produce the correct ratios of upstream- to downstream-encoded proteins. Specifically, infectious clones of the severe acute respiratory syndrome (SARS)-associated coronavirus harboring mutations that lower frameshift efficiency decreased infectivity by >4 orders of magnitude. Second, a series of frameshift-promoting mRNA pseudoknot mutants was employed to demonstrate that the frameshift signals of the SARS-associated coronavirus and mouse hepatitis virus have evolved to promote optimal frameshift efficiencies. Finally, we show that a previously described frameshift attenuator element does not actually affect frameshifting per se but rather serves to limit the fraction of ribosomes available for frameshifting. The findings of these analyses all support a “golden mean” model in which viruses use both programmed ribosomal frameshifting and translational attenuation to control the relative ratios of their encoded proteins. PMID:20164235

  16. Geochemistry of the suspended sediment in the estuaries of the Mandovi and Zuari rivers, central west coast of India.

    PubMed

    Kessarkar, Pratima M; Shynu, R; Rao, V Purnachandra; Chong, Feng; Narvekar, Tanuja; Zhang, Jing

    2013-05-01

    The geochemistry of the suspended particulate matter (SPM) collected during the monsoon was determined to identify the sources of SPM and to understand the physicochemical processes in the Mandovi and Zuari river estuaries. The concentrations of SPM decrease seaward in both estuaries, but are relatively high at bay stations. Kaolinite is the most dominant clay mineral in the upstream of both rivers. Smectite increases seaward in both estuaries and is abundant in the bay. Upstream stations of Mandovi, where ore deposits are stored on the shore, exhibit high Fe, Mn, total rare earth elements (∑REE), and middle REE- and heavy REE-enriched patterns. Channel stations of both estuaries exhibit middle REE- and light REE-enriched patterns, which gradually changed seaward to middle REE- and heavy REE-enriched patterns. Canal stations exhibit the highest concentrations of major and trace metals. High metal/Al ratios occur at stations in the upstream of Zuari and at the confluence of canals in the Mandovi estuary. Enrichment factors of metals indicate that Mn is significantly polluted while other metals are moderately polluted. The δ(13)C and δ(15)N of organic matter indicate that the terrigenous organic matter at the upstream is diluted seaward by marine organic matter. Organic matter at bay stations is largely marine and altered-type. The compositions of SPM are controlled by the particulates from ore dust, the geology of the drainage basins, and the physicochemical processes in the estuaries. Particulates resuspended from the bay are dominated by ore dust, which are advected into the channels of both estuaries during the lull periods of the monsoon.

  17. Simian virus 40 major late promoter: an upstream DNA sequence required for efficient in vitro transcription.

    PubMed Central

    Brady, J; Radonovich, M; Thoren, M; Das, G; Salzman, N P

    1984-01-01

    We have previously identified an 11-base DNA sequence, 5'-G-G-T-A-C-C-T-A-A-C-C-3' (simian virus 40 [SV40] map position 294 to 304), which is important in the control of SV40 late RNA expression in vitro and in vivo (Brady et al., Cell 31:625-633, 1982). We report here the identification of another domain of the SV40 late promoter. A series of mutants with deletions extending from SV40 map position 0 to 300 was prepared by nuclease BAL 31 treatment. The cloned templates were then analyzed for efficiency and accuracy of late SV40 RNA expression in the Manley in vitro transcription system. Our studies showed that, in addition to the promoter domain near map position 300, there are essential DNA sequences between nucleotide positions 74 and 95 that are required for efficient expression of late SV40 RNA. Included in this SV40 DNA sequence were two of the six GGGCGG SV40 repeat sequences and an 11-nucleotide segment which showed strong homology with the upstream sequences required for the efficient in vitro and in vivo expression of the histone H2A gene. This upstream promoter sequence supported transcription with the same efficiency even when it was moved 72 nucleotides closer to the major late cap site. In vitro promoter competition analysis demonstrated that the upstream promoter sequence, independent of the 294 to 304 promoter element, is capable of binding polymerase-transcription factors required for SV40 late gene transcription. Finally, we show that DNA sequences which control the specificity of RNA initiation at nucleotide 325 lie downstream of map position 294. Images PMID:6321950

  18. Phase discriminating capacitive array sensor system

    NASA Technical Reports Server (NTRS)

    Vranish, John M. (Inventor); Rahim, Wadi (Inventor)

    1993-01-01

    A phase discriminating capacitive sensor array system which provides multiple sensor elements which are maintained at a phase and amplitude based on a frequency reference provided by a single frequency stabilized oscillator. Sensor signals provided by the multiple sensor elements are controlled by multiple phase control units, which correspond to the multiple sensor elements, to adjust the sensor signals from the multiple sensor elements based on the frequency reference. The adjustment made to the sensor signals is indicated by output signals which indicate the proximity of the object. The output signals may also indicate the closing speed of the object based on the rate of change of the adjustment made, and the edges of the object based on a sudden decrease in the adjustment made.

  19. Coordination of receptor signaling in multiple hematopoietic cell lineages by the adaptor protein SLP-76.

    PubMed

    Jordan, Martha S; Koretzky, Gary A

    2010-04-01

    The adaptor protein SLP-76 is expressed in multiple hematopoietic lineages including T cells, platelets, and neutrophils. SLP-76 mediated signaling is dependent on its multiple protein interaction domains, as it creates a scaffold on which key signaling complexes are built. SLP-76 is critical for supporting signaling downstream of both immunoreceptors and integrins. The signaling molecules used both upstream and downstream of SLP-76 are similar among these receptors and across cell types; however, important differences exist. Appreciating how SLP-76 coordinates signal transduction across different cell and receptor types provides insights into the complex interplay of pathways critical for activation of cells of the immune system that are essential for host defense.

  20. Differential Regulation of Native Estrogen Receptor-Regulatory Elements by Estradiol, Tamoxifen, and Raloxifene

    PubMed Central

    Levy, Nitzan; Tatomer, Dierdre; Herber, Candice B.; Zhao, Xiaoyue; Tang, Hui; Sargeant, Toby; Ball, Lonnele J.; Summers, Jonathan; Speed, Terence P.; Leitman, Dale C.

    2008-01-01

    Estrogen receptors (ERs) regulate gene transcription by interacting with regulatory elements. Most information regarding how ER activates genes has come from studies using a small set of target genes or simple consensus sequences such as estrogen response element, activator protein 1, and Sp1 elements. However, these elements cannot explain the differences in gene regulation patterns and clinical effects observed with estradiol (E2) and selective estrogen receptor modulators. To obtain a greater understanding of how E2 and selective estrogen receptor modulators differentially regulate genes, it is necessary to investigate their action on a more comprehensive set of native regulatory elements derived from ER target genes. Here we used chromatin immunoprecipitation-cloning and sequencing to isolate 173 regulatory elements associated with ERα. Most elements were found in the introns (38%) and regions greater than 10 kb upstream of the transcription initiation site (38%); 24% of the elements were found in the proximal promoter region (<10 kb). Only 11% of the elements contained a classical estrogen response element; 23% of the elements did not have any known response elements, including one derived from the naked cuticle homolog gene, which was associated with the recruitment of p160 coactivators. Transfection studies found that 80% of the 173 elements were regulated by E2, raloxifene, or tamoxifen with ERα or ERβ. Tamoxifen was more effective than raloxifene at activating the elements with ERα, whereas raloxifene was superior with ERβ. Our findings demonstrate that E2, tamoxifen, and raloxifene differentially regulate native ER-regulatory elements isolated by chromatin immunoprecipitation with ERα and ERβ. PMID:17962382

  1. Multiple intensity distributions from a single optical element

    NASA Astrophysics Data System (ADS)

    Berens, Michael; Bruneton, Adrien; Bäuerle, Axel; Traub, Martin; Wester, Rolf; Stollenwerk, Jochen; Loosen, Peter

    2013-09-01

    We report on an extension of the previously published two-step freeform optics tailoring algorithm using a Monge-Kantorovich mass transportation framework. The algorithm's ability to design multiple freeform surfaces allows for the inclusion of multiple distinct light paths and hence the implementation of multiple lighting functions in a single optical element. We demonstrate the procedure in the context of automotive lighting, in which a fog lamp and a daytime running lamp are integrated in a single optical element illuminated by two distinct groups of LEDs.

  2. Functional identification and regulatory analysis of Δ6-fatty acid desaturase from the oleaginous fungus Mucor sp. EIM-10.

    PubMed

    Jiang, Xianzhang; Liu, Hongjiao; Niu, Yongchao; Qi, Feng; Zhang, Mingliang; Huang, Jianzhong

    2017-03-01

    To enlarge the diversity of the desaturases associated with PUFA biosynthesis and to better understand the transcriptional regulation of desaturases, a Δ 6 -desaturase gene (Md6) from Mucor sp. and its 5'-upstream sequence was functionally identified in Saccharomyces cerevisiae. Expression of the Δ 6 -fatty acid desaturase (Md6) in S. cerevisiae showed that Md6 could convert linolenic acid to γ-linolenic acid. Computational analysis of the promoter of Md6 suggested it contains several eukaryotic fundamental transcription regulatory elements. In vivo functional analysis of the promoter showed the 5'-upstream sequence of Md6 could initiate expression of GFP and Md6 itself in S. cerevisiae. A series deletion analysis of the promoter suggested that sequence between -919 to -784 bp (relative to start site) named as eMd6 is the key factor for high activity of Δ 6 -desaturase. The activity of Δ 6 -desaturase was increased by 2.8-fold and 2.5-fold when the eMd6 sequence was placed upstream of -434 with forward or reverse orientations respectively. To our best knowledge, the native promoter of Md6 from Mucor is the strongest promoter for Δ 6 -desaturase reported so far and the sequence between -919 to -784 bp is an enhancer for Δ 6 -desaturase activity.

  3. Occurrence and concentrations of selected trace elements and halogenated organic compounds in stream sediments and potential sources of polychlorinated biphenyls, Leon Creek, San Antonio, Texas, 2012–14

    USGS Publications Warehouse

    Wilson, Jennifer T.

    2016-06-23

    Sediment samples collected from Leon Creek by the USGS during 2007–9 and 2012–14 at a total of eight sites following identical field and laboratory methods were evaluated to determine if potential PCB sources could be identified. Total PCB concentrations in the sediment samples collected upstream from the Joint Base site were low or nondetections; while concentrations in the samples collected on and downstream from the Joint Base site were greater. Congeners 180 and 138 constituted the greatest proportion of the PCB mixture in samples collected upstream from, on, and downstream from the Joint Base site. Upstream from the Joint Base site, congeners 180 and 138 constituted 50 percent and 35 percent respectively of the PCBs congeners found in the samples. On and downstream from the Joint Base site, congeners 180 and 138 constituted 80 percent and 13 percent respectively of the PCBs congeners found in the samples. Chi-square (C2) tests also indicate that samples collected from the Loop 410 site were statistically different from samples collected from the Joint Base site and sites downstream. The PCB congener pattern in the Leon Creek samples is most like the congener mixture in Aroclor 1260, which is chemically similar to the PCBs detected in the fish samples that resulted in the 2003 fish consumption advisory.

  4. Mutually Exclusive Splicing of the Insect Dscam Pre-mRNA Directed by Competing Intronic RNA Secondary Structures

    PubMed Central

    Graveley, Brenton R.

    2008-01-01

    Summary Drosophila Dscam encodes 38,016 distinct axon guidance receptors through the mutually exclusive alternative splicing of 95 variable exons. Importantly, known mechanisms that ensure the mutually exclusive splicing of pairs of exons cannot explain this phenomenon in Dscam. I have identified two classes of conserved elements in the Dscam exon 6 cluster, which contains 48 alternative exons—the docking site, located in the intron downstream of constitutive exon 5, and the selector sequences, which are located upstream of each exon 6 variant. Strikingly, each selector sequence is complementary to a portion of the docking site, and this pairing juxtaposes one, and only one, alternative exon to the upstream constitutive exon. The mutually exclusive nature of the docking site:selector sequence interactions suggests that the formation of these competing RNA structures is a central component of the mechanism guaranteeing that only one exon 6 variant is included in each Dscam mRNA. PMID:16213213

  5. Analysis of an existing experiment on the interaction of acoustic waves with a laminar boundary layer

    NASA Technical Reports Server (NTRS)

    Schopper, M. R.

    1982-01-01

    The hot-wire anemometer amplitude data contained in the 1977 report of P. J. Shapiro entitled, ""The Influence of Sound Upon Laminar Boundary'' were reevaluated. Because the low-Reynolds number boundary layer disturbance data were misinterpreted, an effort was made to improve the corresponding disturbance growth rate curves. The data are modeled as the sum of upstream and downstream propagating acoustic waves and a wave representing the Tollmien-Schlichting (TS) wave. The amplitude and phase velocity of the latter wave were then adjusted so that the total signal reasonably matched the amplitude and phase angle hot-wire data along the plate laminar boundary layer. The revised rates show growth occurring further upstream than Shapiro found. It appears that the premature growth is due to the adverse pressure gradient created by the shape of the plate. Basic elements of sound propagation in ducts and the experimental and theoretical acoustic-stability literature are reviewed.

  6. Flow Instabilities in Feather Seals due to Upstream Harmonic Pressure Fluctuations

    NASA Technical Reports Server (NTRS)

    Deng, D.; Braun, M. J.; Henricks, Robert C.

    2008-01-01

    Feather seals (also called slot seals) typically found in turbine stators limit leakage from the platform into the core cavities and from the shroud to the case. They are of various geometric shapes, yet all are contoured to fit the aerodynamic shape of the stator and placed as close as thermomechanically reasonable the powerstream flow passage. Oscillations engendered in the compressor or combustor alter the steady leakage characteristics of these sealing elements and in some instances generate flow instabilities downstream of the seal interface. In this study, a generic feather seal geometry was studied numerically by imposing an upstream harmonic pressure disturbance on the simulated stator-blade gap. The flow and thermal characteristics were determined; it was found that for high pressure drops, large fluctuations in flows in the downstream blade-stator gap can occur. These leakages and pulsations in themselves are not all that significant, yet if coupled with cavity parameters, they could set up resonance events. Computationally generated time-dependent flow fields are captured in sequence video streaming.

  7. The chloroplast tRNALys(UUU) gene from mustard (Sinapis alba) contains a class II intron potentially coding for a maturase-related polypeptide.

    PubMed

    Neuhaus, H; Link, G

    1987-01-01

    The trnK gene endocing the tRNALys(UUU) has been located on mustard (Sinapis alba) chloroplast DNA, 263 bp upstream of the psbA gene on the same strand. The nucleotide sequence of the trnK gene and its flanking regions as well as the putative transcription start and termination sites are shown. The 5' end of the transcript lies 121 bp upstream of the 5' tRNA coding region and is preceded by procaryotic-type "-10" and "-35" sequence elements, while the 3' end maps 2.77 kb downstream to a DNA region with possible stemloop secondary structure. The anticodon loop of the tRNALys is interrupted by a 2,574 bp intron containing a long open reading frame, which codes for 524 amino acids. Based on conserved stem and loop structures, this intron has characteristic features of a class II intron. A region near the carboxyl terminus of the derived polypeptide appears structurally related to maturases.

  8. Ongoing data reduction, theoretical studies and supporting research in magnetospheric physics

    NASA Technical Reports Server (NTRS)

    Scarf, F. L.; Greenstadt, E. W.

    1984-01-01

    Data from ISEE-3, Pioneer Venus Orbiter, and Voyager 1 and 2 were analyzed. The predictability of local shock macrostructure at ISEE-1, at the Earth's bow shock, from solar wind measurements made up-stream by ISEE-3, was conducted using computer graphic format. Morphology of quasi-parallel shock was reviewed. The review attempted to interrelate various measurements and computations involving the q-parallel structure and foreshock elements connected to it. A new classification for q-parallel morphology was suggested.

  9. Monolithically integrated fiber-to-the-home diplexers and triplexers using a bilevel etched 2 x 2 optical coupler.

    PubMed

    Zhang, Li; Wang, Lei; He, Jian-Jun

    2009-09-01

    A novel design of monolithically integrated diplexers and triplexers for fiber-to-the-home applications is presented. A bilevel etched asymmetrical 2 x 2 optical coupler is analyzed for efficient couplings of both upstream and downstream signals. The design of the diplexer is extended to a triplexer by adding an etched diffraction grating as an additional downstream demultiplexing element. The total size of the integrated diplexer and triplexer is smaller than 500 microm x 500 microm.

  10. Advantages and disadvantages in usage of bioinformatic programs in promoter region analysis

    NASA Astrophysics Data System (ADS)

    Pawełkowicz, Magdalena E.; Skarzyńska, Agnieszka; Posyniak, Kacper; ZiÄ bska, Karolina; PlÄ der, Wojciech; Przybecki, Zbigniew

    2015-09-01

    An important computational challenge is finding the regulatory elements across the promotor region. In this work we present the advantages and disadvantages from the application of different bioinformatics programs for localization of transcription factor binding sites in the upstream region of genes connected with sex determination in cucumber. We use PlantCARE, PlantPAN and SignalScan to find motifs in the promotor regions. The results have been compared and possible function of chosen motifs has been described.

  11. Experimental Study of Saddle Point of Attachment in Laminar Juncture Flow

    NASA Technical Reports Server (NTRS)

    Coon, Michael D.; Tobak, Murray

    1995-01-01

    An experimental study of laminar horseshoe vortex flows upstream of a cylinder/flat plate juncture has been conducted to verify the existence of saddle-point-of-attachment topologies. In the classical depiction of this flowfield, a saddle point of separation exists on the flat plate upstream of the cylinder, and the boundary layer separates from the surface. Recent computations have indicated that the topology may actually involve a saddle point of attachment on the surface and additional singular points in the flow. Laser light sheet flow visualizations have been performed on the symmetry plane and crossflow planes to identify the saddle-point-of-attachment flowfields. The visualizations reveal that saddle-point-of-attachment topologies occur over a range of Reynolds numbers in both single and multiple vortex regimes. An analysis of the flow topologies is presented that describes the existence and evolution of the singular points in the flowfield.

  12. Mapping the social impacts of small dams: The case of Thailand's Ing River basin.

    PubMed

    Fung, Zali; Pomun, Teerapong; Charles, Katrina J; Kirchherr, Julian

    2018-05-24

    The social impacts of large dams have been studied extensively. However, small dams' social impacts have been largely neglected by the academic community. Our paper addresses this gap. We examine the social impacts of multiple small dams in one upstream and one downstream village in Thailand's Ing River basin. Our research is based on semi-structured interviews with beneficiaries, government and NGOs. We argue that small dams' social impacts are multi-faceted and unequal. The dams were perceived to reduce fish abundance and provide flood mitigation benefits. Furthermore, the dams enabled increased access to irrigation water for upstream farmers, who re-appropriated water via the dams at the expense of those downstream. The small dams thus engendered water allocation conflicts. Many scholars, practitioners and environmentalists argue that small dams are a benign alternative to large dams. However, the results of our research mandate caution regarding this claim.

  13. Multi-stage fuel cell system method and apparatus

    DOEpatents

    George, Thomas J.; Smith, William C.

    2000-01-01

    A high efficiency, multi-stage fuel cell system method and apparatus is provided. The fuel cell system is comprised of multiple fuel cell stages, whereby the temperatures of the fuel and oxidant gas streams and the percentage of fuel consumed in each stage are controlled to optimize fuel cell system efficiency. The stages are connected in a serial, flow-through arrangement such that the oxidant gas and fuel gas flowing through an upstream stage is conducted directly into the next adjacent downstream stage. The fuel cell stages are further arranged such that unspent fuel and oxidant laden gases too hot to continue within an upstream stage because of material constraints are conducted into a subsequent downstream stage which comprises a similar cell configuration, however, which is constructed from materials having a higher heat tolerance and designed to meet higher thermal demands. In addition, fuel is underutilized in each stage, resulting in a higher overall fuel cell system efficiency.

  14. Design of the frame structure for a multiservice interactive system using ATM-PON

    NASA Astrophysics Data System (ADS)

    Nam, Jae-Hyun; Jang, Jongwook; Lee, Jung-Tae

    1998-10-01

    The MAC (Medium Access Control) protocol controls B-NT1s' (Optical Network Unit) access to the shared capacity on the PON, this protocol is very important if TDMA (Time Division Multiple Access) multiplexing is used on the upstream. To control the upstream traffic some kind of access protocol has to be implemented. There are roughly two different approaches to use request cells: in a collision free way or such that collisions in a request slot are allowed. It is the objective of this paper to describe a MAC-protocol structure that supports both approaches and hybrids of it. In our paper we grantee the QoS (Quality of Service) of each B-NT1 through LOC, LOV, LOA field that are the length field of the transmitted cell at each B-NT1. Each B-NT1 transmits its status of request on request cell.

  15. Atmospheric mercury footprints of nations.

    PubMed

    Liang, Sai; Wang, Yafei; Cinnirella, Sergio; Pirrone, Nicola

    2015-03-17

    The Minamata Convention was established to protect humans and the natural environment from the adverse effects of mercury emissions. A cogent assessment of mercury emissions is required to help implement the Minamata Convention. Here, we use an environmentally extended multi-regional input-output model to calculate atmospheric mercury footprints of nations based on upstream production (meaning direct emissions from the production activities of a nation), downstream production (meaning both direct and indirect emissions caused by the production activities of a nation), and consumption (meaning both direct and indirect emissions caused by final consumption of goods and services in a nation). Results show that nations function differently within global supply chains. Developed nations usually have larger consumption-based emissions than up- and downstream production-based emissions. India, South Korea, and Taiwan have larger downstream production-based emissions than their upstream production- and consumption-based emissions. Developed nations (e.g., United States, Japan, and Germany) are in part responsible for mercury emissions of developing nations (e.g., China, India, and Indonesia). Our findings indicate that global mercury abatement should focus on multiple stages of global supply chains. We propose three initiatives for global mercury abatement, comprising the establishment of mercury control technologies of upstream producers, productivity improvement of downstream producers, and behavior optimization of final consumers.

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nakanotani, Masaru; Matsukiyo, Shuichi; Hada, Tohru

    A shock–shock interaction is investigated by using a one-dimensional full particle-in-cell simulation. The simulation reproduces the collision of two symmetrical high Mach number quasi-perpendicular shocks. The basic structure of the shocks and ion dynamics is similar to that obtained by previous hybrid simulations. The new aspects obtained here are as follows. Electrons are already strongly accelerated before the two shocks collide through multiple reflection. The reflected electrons self-generate waves upstream between the two shocks before they collide. The waves far upstream are generated through the right-hand resonant instability with the anomalous Doppler effect. The waves generated near the shock aremore » due to firehose instability and have much larger amplitudes than those due to the resonant instability. The high-energy electrons are efficiently scattered by the waves so that some of them gain large pitch angles. Those electrons can be easily reflected at the shock of the other side. The accelerated electrons form a power-law energy spectrum. Due to the accelerated electrons, the pressure of upstream electrons increases with time. This appears to cause the deceleration of the approaching shock speed. The accelerated electrons having sufficiently large Larmor radii are further accelerated through the similar mechanism working for ions when the two shocks are colliding.« less

  17. Disposable world-to-chip interface for digital microfluidics

    DOEpatents

    Van Dam, R. Michael; Shah, Gaurav; Keng, Pei-Yuin

    2017-05-16

    The present disclosure sets forth incorporating microfluidic chips interfaces for use with digital microfluidic processes. Methods and devices according to the present disclosure utilize compact, integrated platforms that interface with a chip upstream and downstream of the reaction, as well as between intermediate reaction steps if needed. In some embodiments these interfaces are automated, including automation of a multiple reagent process. Various reagent delivery systems and methods are also disclosed.

  18. System and method for image registration of multiple video streams

    DOEpatents

    Dillavou, Marcus W.; Shum, Phillip Corey; Guthrie, Baron L.; Shenai, Mahesh B.; Deaton, Drew Steven; May, Matthew Benton

    2018-02-06

    Provided herein are methods and systems for image registration from multiple sources. A method for image registration includes rendering a common field of interest that reflects a presence of a plurality of elements, wherein at least one of the elements is a remote element located remotely from another of the elements and updating the common field of interest such that the presence of the at least one of the elements is registered relative to another of the elements.

  19. Transition Induced by a Streamwise Array of Roughness Elements on a Supersonic Flat Plate

    NASA Technical Reports Server (NTRS)

    Chou, Amanda; Kegerise, Michael A.

    2017-01-01

    Roughness is unavoidable on practical high-speed vehicles, so it is critical to determine its impact on boundary layer transition. The flow field downstream of a streamwise array of cylindrical roughness elements is probed with hot-wire anemometry in this experiment. Mean flow distortion is examined in several measurement planes in the wake of the cylindrical roughness using the streak strength profiles and contour plots of the mass flux and total temperature. The roughness element heights and spacings were varied and their instability modes were examined. Cylindrical roughness elements approximately 140 micron tall produce an odd instability mode that grows weakly with downstream distance in the measurement range of this experiment. Cylindrical roughness elements approximately 280 micron tall produce an even instability mode that grows, becomes nonlinear, and then breaks down. Transition onset remains constant relative to the most downstream roughness in the streamwise array when the 280 micron roughness elements are spaced 2 diameters apart. Transition onset occurs at an earlier upstream location relative to the most downstream roughness in the streamwise array when the roughness elements are spaced 4 diameters appear to recover before the next downstream roughness element, so the location of transition shifts with the location of the most downstream roughness element in the array. When the rough- apart. The wake behind roughness elements spaced 2 diameters apart do not ness elements are spaced 4 diameters apart, the flow behind the first roughness element has enough space to recover before feeding into the second roughness element, and thus, moves transition forward.

  20. Gene conversion as a secondary mechanism of short interspersed element (SINE) evolution

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kass, D.H.; Batzer, M.A.; Deininger, P.L.

    The Alu repetitive family of short interspersed elements (SINEs) in primates can be subdivided into distinct subfamilies by specific diagnostic nucleotide changes. The older subfamilies are generally very abundant, while the younger subfamilies have fewer copies. Some of the youngest Alu elements are absent in the orthologous loci of nonhuman primates, indicative of recent retroposition events, the primary mode of SINE evolutions. PCR analysis of one young Alu subfamily (Sb2) member found in the low-density lipoprotein receptor gene apparently revealed the presence of this element in the green monkey, orangutan, gorilla, and chimpanzee genomes, as well as the human genome.more » However, sequence analysis of these genomes revealed a highly mutated, older, primate-specific Alu element was present at this position in the nonhuman primates. Comparison of the flanking DNA sequences upstream of this Alu insertion corresponded to evolution expected for standard primate phylogeny, but comparison of the Alu repeat sequences revealed that the human element departed from this phylogeny. The change in the human sequence apparently occurred by a gene conversion event only within the Alu element itself, converting it from one of the oldest to one of the youngest Alu subfamilies. Although gene conversions of Alu elements are clearly very rare, this finding shows that such events can occur and contribute to specific cases of SINE subfamily evolution.« less

  1. Numerical Modeling of Sliding Stability of RCC dam

    NASA Astrophysics Data System (ADS)

    Mughieda, O.; Hazirbaba, K.; Bani-Hani, K.; Daoud, W.

    2017-06-01

    Stability and stress analyses are the most important elements that require rigorous consideration in design of a dam structure. Stability of dams against sliding is crucial due to the substantial horizontal load that requires sufficient and safe resistance to develop by mobilization of adequate shearing forces along the base of the dam foundation. In the current research, the static sliding stability of a roller-compacted-concrete (RCC) dam was modelled using finite element method to investigate the stability against sliding. A commercially available finite element software (SAP 2000) was used to analyze stresses in the body of the dam and foundation. A linear finite element static analysis was performed in which a linear plane strain isoperimetric four node elements was used for modelling the dam-foundation system. The analysis was carried out assuming that no slip will occur at the interface between the dam and the foundation. Usual static loading condition was applied for the static analysis. The greatest tension was found to develop in the rock adjacent to the toe of the upstream slope. The factor of safety against sliding along the entire base of the dam was found to be greater than 1 (FS>1), for static loading conditions.

  2. Detecting authorized and unauthorized genetically modified organisms containing vip3A by real-time PCR and next-generation sequencing.

    PubMed

    Liang, Chanjuan; van Dijk, Jeroen P; Scholtens, Ingrid M J; Staats, Martijn; Prins, Theo W; Voorhuijzen, Marleen M; da Silva, Andrea M; Arisi, Ana Carolina Maisonnave; den Dunnen, Johan T; Kok, Esther J

    2014-04-01

    The growing number of biotech crops with novel genetic elements increasingly complicates the detection of genetically modified organisms (GMOs) in food and feed samples using conventional screening methods. Unauthorized GMOs (UGMOs) in food and feed are currently identified through combining GMO element screening with sequencing the DNA flanking these elements. In this study, a specific and sensitive qPCR assay was developed for vip3A element detection based on the vip3Aa20 coding sequences of the recently marketed MIR162 maize and COT102 cotton. Furthermore, SiteFinding-PCR in combination with Sanger, Illumina or Pacific BioSciences (PacBio) sequencing was performed targeting the flanking DNA of the vip3Aa20 element in MIR162. De novo assembly and Basic Local Alignment Search Tool searches were used to mimic UGMO identification. PacBio data resulted in relatively long contigs in the upstream (1,326 nucleotides (nt); 95 % identity) and downstream (1,135 nt; 92 % identity) regions, whereas Illumina data resulted in two smaller contigs of 858 and 1,038 nt with higher sequence identity (>99 % identity). Both approaches outperformed Sanger sequencing, underlining the potential for next-generation sequencing in UGMO identification.

  3. Tunable optical frequency comb enabled scalable and cost-effective multiuser orthogonal frequency-division multiple access passive optical network with source-free optical network units.

    PubMed

    Chen, Chen; Zhang, Chongfu; Liu, Deming; Qiu, Kun; Liu, Shuang

    2012-10-01

    We propose and experimentally demonstrate a multiuser orthogonal frequency-division multiple access passive optical network (OFDMA-PON) with source-free optical network units (ONUs), enabled by tunable optical frequency comb generation technology. By cascading a phase modulator (PM) and an intensity modulator and dynamically controlling the peak-to-peak voltage of a PM driven signal, a tunable optical frequency comb source can be generated. It is utilized to assist the configuration of a multiple source-free ONUs enhanced OFDMA-PON where simultaneous and interference-free multiuser upstream transmission over a single wavelength can be efficiently supported. The proposed multiuser OFDMA-PON is scalable and cost effective, and its feasibility is successfully verified by experiment.

  4. Flow Structure Comparison for Two 7-Point LDI Configurations

    NASA Technical Reports Server (NTRS)

    Hicks, Yolanda R.; Tacina, Kathleen M.

    2017-01-01

    This paper presents a comparison primarily of the 2-D velocity profiles in the non-burning system; and for the luminescent flame structure for a 7-point Lean Direct Injector (LDI). This circular LDI array consists of a center element surrounded by six outer elements spaced 60 degrees apart; the spacing between all adjacent elements is the same. Each element consists of simplex atomizer that injects at the throat of a converging-diverging venturi, and an axial swirler upstream of the venturi throat to generate swirl. The two configurations were: 1) one which consists of all 60 co-swirling axial air swirlers, and; 2) one configuration which uses a 60 swirler in the center, surrounded by counter-swirling 45 swirlers. Testing was done at 5 atm and an inlet temperature of 800F. Two air reference velocities were considered in the cold flow measurements and one common air flow condition for the burning case.The 2D velocity profiles were determined using particle image velocimetry and the flame structure was determined using high speed photography.

  5. Water-quality investigation, Salinas River, California

    USGS Publications Warehouse

    Irwin, G.A.

    1976-01-01

    Concentrations of dissolved solids in the Salinas River, California, are variable and range from 164 to 494 milligrams per liter near Bradley and from 170 to 1,090 milligrams per liter near Spreckels. Higher concentrations near Spreckels are caused mainly by sewage inflow about 150 feet (50 meters) upstream. Concentrations of nitrogen, phosphorus, total organic carbon, selected trace elements, and pesticides also generally increase downstream from Pozo to Spreckels and are related to sewage effluent; however, high concentrations occur elsewhere in the river. Specific conductance and water discharge regression results indicate that relations were all significant at the 1-percent probability level at Paso Robles, Bradley, and Spreckels with the explained variance ranging from 66 to 74 percent. Concentations of nitrogen, phosphorus, total organic carbon, and trace elements are only infrequently related to water discharge. (Woodard-USGS)

  6. Using agent-based modeling to study multiple risk factors and multiple health outcomes at multiple levels.

    PubMed

    Yang, Yong

    2017-11-01

    Most health studies focus on one health outcome and examine the influence of one or multiple risk factors. However, in reality, various pathways, interactions, and associations exist not only between risk factors and health outcomes but also among the risk factors and among health outcomes. The advance of system science methods, Big Data, and accumulated knowledge allows us to examine how multiple risk factors influence multiple health outcomes at multiple levels (termed a 3M study). Using the study of neighborhood environment and health as an example, I elaborate on the significance of 3M studies. 3M studies may lead to a significantly deeper understanding of the dynamic interactions among risk factors and outcomes and could help us design better interventions that may be of particular relevance for upstream interventions. Agent-based modeling (ABM) is a promising method in the 3M study, although its potentials are far from being fully explored. Future challenges include the gap of epidemiologic knowledge and evidence, lack of empirical data sources, and the technical challenges of ABM. © 2017 New York Academy of Sciences.

  7. Use of the multipurpose transposon Tn KPK2 for the mutational analysis of chromosomal regions upstream and downstream of the sipF gene in Bradyrhizobium japonicum.

    PubMed

    Müller, P

    2004-04-01

    The DNA regions upstream and downstream of the Bradyrhizobium japonicum gene sipF were cloned by in vivo techniques and subsequently sequenced. In order to study the function of the predicted genes, a new transposon for in vitro mutagenesis, Tn KPK2, was constructed. This mutagenesis system has a number of advantages over other transposons. Tn KPK2 itself has no transposase gene, making transposition events stable. Extremely short inverted repeats minimize the length of the transposable element and facilitate the determination of the nucleotide sequence of the flanking regions. Since the transposable element carries a promoterless ' phoA reporter gene, the appearance of functional PhoA fusion proteins indicates that Tn KPK2 has inserted in a gene encoding a periplasmic or secreted protein. Although such events are extremely rare, because the transposon has to insert in-frame, in the correct orientation, and at an appropriate location in the target molecule, a direct screening procedure on agar indicator plates permits the identification of candidate clones from large numbers of colonies. In this study, Tn KPK2 was used for the construction of various symbiotic mutants of B. japonicum. One of the mutant strains, A2-10, which is defective in a gene encoding a protein that comigrates with bacterioferritin ( bcpB), was found to induce the formation of small and ineffective nodules.

  8. Destruction of a distal hypoxia response element abolishes trans-activation of the PAG1 gene mediated by HIF-independent chromatin looping.

    PubMed

    Schörg, Alexandra; Santambrogio, Sara; Platt, James L; Schödel, Johannes; Lindenmeyer, Maja T; Cohen, Clemens D; Schrödter, Katrin; Mole, David R; Wenger, Roland H; Hoogewijs, David

    2015-07-13

    A crucial step in the cellular adaptation to oxygen deficiency is the binding of hypoxia-inducible factors (HIFs) to hypoxia response elements (HREs) of oxygen-regulated genes. Genome-wide HIF-1α/2α/β DNA-binding studies revealed that the majority of HREs reside distant to the promoter regions, but the function of these distal HREs has only been marginally studied in the genomic context. We used chromatin immunoprecipitation (ChIP), gene editing (TALEN) and chromosome conformation capture (3C) to localize and functionally characterize a 82 kb upstream HRE that solely drives oxygen-regulated expression of the newly identified HIF target gene PAG1. PAG1, a transmembrane adaptor protein involved in Src signalling, was hypoxically induced in various cell lines and mouse tissues. ChIP and reporter gene assays demonstrated that the -82 kb HRE regulates PAG1, but not an equally distant gene further upstream, by direct interaction with HIF. Ablation of the consensus HRE motif abolished the hypoxic induction of PAG1 but not general oxygen signalling. 3C assays revealed that the -82 kb HRE physically associates with the PAG1 promoter region, independent of HIF-DNA interaction. These results demonstrate a constitutive interaction between the -82 kb HRE and the PAG1 promoter, suggesting a physiologically important rapid response to hypoxia. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Control of alternative splicing by forskolin through hnRNP K during neuronal differentiation.

    PubMed

    Cao, Wenguang; Razanau, Aleh; Feng, Dairong; Lobo, Vincent G; Xie, Jiuyong

    2012-09-01

    The molecular basis of cell signal-regulated alternative splicing at the 3' splice site remains largely unknown. We isolated a protein kinase A-responsive ribonucleic acid (RNA) element from a 3' splice site of the synaptosomal-associated protein 25 (Snap25) gene for forskolin-inhibited splicing during neuronal differentiation of rat pheochromocytoma PC12 cells. The element binds specifically to heterogeneous nuclear ribonucleo protein (hnRNP) K in a phosphatase-sensitive way, which directly competes with the U2 auxiliary factor U2AF65, an essential component of early spliceosomes. Transcripts with similarly localized hnRNP K target motifs upstream of alternative exons are enriched in genes often associated with neurological diseases. We show that such motifs upstream of the Runx1 exon 6 also bind hnRNP K, and importantly, hnRNP K is required for forskolin-induced repression of the exon. Interestingly, this exon encodes the peptide domain that determines the switch of the transcriptional repressor/activator activity of Runx1, a change known to be critical in specifying neuron lineages. Consistent with an important role of the target genes in neurons, knocking down hnRNP K severely disrupts forskolin-induced neurite growth. Thus, through hnRNP K, the neuronal differentiation stimulus forskolin targets a critical 3' splice site component of the splicing machinery to control alternative splicing of crucial genes. This also provides a regulated direct competitor of U2AF65 for cell signal control of 3' splice site usage.

  10. Upstream CREs participate in the basal activity of minute virus of mice promoter P4 and in its stimulation in ras-transformed cells.

    PubMed Central

    Perros, M; Deleu, L; Vanacker, J M; Kherrouche, Z; Spruyt, N; Faisst, S; Rommelaere, J

    1995-01-01

    The activity of the P4 promoter of the parvovirus minute virus of mice (prototype strain MVMp) is stimulated in ras-transformed FREJ4 cells compared with the parental FR3T3 line. This activation may participate in the oncolytic effect of parvoviruses, given that P4 drives a transcriptional unit encoding cytotoxic nonstructural proteins. Our results suggest that the higher transcriptional activity of promoter P4 in FREJ4 cells is mediated at least in part by upstream CRE elements. Accordingly, mutations in the CRE motifs impair P4 function more strongly in the FREJ4 derivative than in its FR3T3 parent. Further evidence that these elements contribute to hyperactivity of the P4 promoter in the ras transformant is the fact that they form distinct complexes with proteins from FREJ4 and FR3T3 cell extracts. This difference can be abolished by treating the FREJ4 cell extracts with cyclic AMP-dependent protein kinase (PKA) or treating original cultures with a PKA activator. These findings can be linked with two previously reported features of ras-transformed cells: the activation of a PKA-inhibited protein kinase cascade and the reduction of PKA-induced protein phosphorylation. In keeping with these facts, P4-directed gene expression can be up- or downmodulated in vivo by exposing cells to known inhibitors or activators of PKA, respectively. PMID:7636996

  11. Regulation of Bacteriocin Production in Streptococcus mutans by the Quorum-Sensing System Required for Development of Genetic Competence

    PubMed Central

    van der Ploeg, Jan R.

    2005-01-01

    In Streptococcus mutans, competence for genetic transformation and biofilm formation are dependent on the two-component signal transduction system ComDE together with the inducer peptide pheromone competence-stimulating peptide (CSP) (encoded by comC). Here, it is shown that the same system is also required for expression of the nlmAB genes, which encode a two-peptide nonlantibiotic bacteriocin. Expression from a transcriptional nlmAB′-lacZ fusion was highest at high cell density and was increased up to 60-fold following addition of CSP, but it was abolished when the comDE genes were interrupted. Two more genes, encoding another putative bacteriocin and a putative bacteriocin immunity protein, were also regulated by this system. The regions upstream of these genes and of two further putative bacteriocin-encoding genes and a gene encoding a putative bacteriocin immunity protein contained a conserved 9-bp repeat element just upstream of the transcription start, which suggests that expression of these genes is also dependent on the ComCDE regulatory system. Mutations in the repeat element of the nlmAB promoter region led to a decrease in CSP-dependent expression of nlmAB′-lacZ. In agreement with these results, a comDE mutant and mutants unable to synthesize or export CSP did not produce bacteriocins. It is speculated that, at high cell density, bacteriocin production is induced to liberate DNA from competing streptococci. PMID:15937160

  12. The chicken skeletal alpha-actin gene promoter region exhibits partial dyad symmetry and a capacity to drive bidirectional transcription.

    PubMed Central

    Grichnik, J M; French, B A; Schwartz, R J

    1988-01-01

    The chicken skeletal alpha-actin gene promoter region (-202 to -12) provides myogenic transcriptional specificity. This promoter contains partial dyad symmetry about an axis at nucleotide -108 and in transfection experiments is capable of directing transcription in a bidirectional manner. At least three different transcription initiation start sites, oriented toward upstream sequences, were mapped 25 to 30 base pairs from TATA-like regions. The opposing transcriptional activity was potentiated upon the deletion of sequences proximal to the alpha-actin transcription start site. Thus, sequences which serve to position RNA polymerase for alpha-actin transcription may allow, in their absence, the selection of alternative and reverse-oriented start sites. Nuclear runoff transcription assays of embryonic muscle indicated that divergent transcription may occur in vivo but with rapid turnover of nuclear transcripts. Divergent transcriptional activity enabled us to define the 3' regulatory boundary of the skeletal alpha-actin promoter which retains a high level of myogenic transcriptional activity. The 3' regulatory border was detected when serial 3' deletions bisected the element (-91 CCAAA TATGG -82) which reduced transcriptional activity by 80%. Previously we showed that disruption of its upstream counterpart (-127 CCAAAGAAGG -136) resulted in about a 90% decrease in activity. These element pairs, which we describe as CCAAT box-associated repeats, are conserved in all sequenced vertebrate sarcomeric actin genes and may act in a cooperative manner to facilitate transcription in myogenic cells. Images PMID:3211124

  13. ICAM-1-related long non-coding RNA: promoter analysis and expression in human retinal endothelial cells.

    PubMed

    Lumsden, Amanda L; Ma, Yuefang; Ashander, Liam M; Stempel, Andrew J; Keating, Damien J; Smith, Justine R; Appukuttan, Binoy

    2018-05-09

    Regulation of intercellular adhesion molecule (ICAM)-1 in retinal endothelial cells is a promising druggable target for retinal vascular diseases. The ICAM-1-related (ICR) long non-coding RNA stabilizes ICAM-1 transcript, increasing protein expression. However, studies of ICR involvement in disease have been limited as the promoter is uncharacterized. To address this issue, we undertook a comprehensive in silico analysis of the human ICR gene promoter region. We used genomic evolutionary rate profiling to identify a 115 base pair (bp) sequence within 500 bp upstream of the transcription start site of the annotated human ICR gene that was conserved across 25 eutherian genomes. A second constrained sequence upstream of the orthologous mouse gene (68 bp; conserved across 27 Eutherian genomes including human) was also discovered. Searching these elements identified 33 matrices predictive of binding sites for transcription factors known to be responsive to a broad range of pathological stimuli, including hypoxia, and metabolic and inflammatory proteins. Five phenotype-associated single nucleotide polymorphisms (SNPs) in the immediate vicinity of these elements included four SNPs (i.e. rs2569693, rs281439, rs281440 and rs11575074) predicted to impact binding motifs of transcription factors, and thus the expression of ICR and ICAM-1 genes, with potential to influence disease susceptibility. We verified that human retinal endothelial cells expressed ICR, and observed induction of expression by tumor necrosis factor-α.

  14. Overexpression of the CYP51A1 Gene and Repeated Elements are Associated with Differential Sensitivity to DMI Fungicides in Venturia inaequalis.

    PubMed

    Villani, Sara M; Hulvey, Jon; Hily, Jean-Michel; Cox, Kerik D

    2016-06-01

    The involvement of overexpression of the CYP51A1 gene in Venturia inaequalis was investigated for isolates exhibiting differential sensitivity to the triazole demethylation inhibitor (DMI) fungicides myclobutanil and difenoconazole. Relative expression (RE) of the CYP51A1 gene was significantly greater (P < 0.0001) for isolates with resistance to both fungicides (MRDR phenotype) or with resistance to difenoconazole only (MSDR phenotype) compared with isolates that were resistant only to myclobutanil (MRDS phenotype) or sensitive to both fungicides (MSDS phenotype). An average of 9- and 13-fold increases in CYP51A1 RE were observed in isolates resistant to difenoconazole compared with isolates with MRDS and MSDS phenotypes, respectively. Linear regression analysis between isolate relative growth on myclobutanil-amended medium and log10 RE revealed that little to no variability in sensitivity to myclobutanil could be explained by CYP51A1 overexpression (R(2) = 0.078). To investigate CYP51A1 upstream anomalies associated with CYP51A1 overexpression or resistance to difenoconazole, Illumina sequencing was conducted for three isolates with resistance to difenoconazole and one baseline isolate. A repeated element, "EL 3,1,2", with the properties of a transcriptional enhancer was identified two to four times upstream of CYP51A1 in difenoconazole-resistant isolates but was not found in isolates with the MRDS phenotype. These results suggest that different mechanisms may govern resistance to different DMI fungicides in the triazole group.

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ochiai, Yoshihiro

    Heat-conduction analysis under steady state without heat generation can easily be treated by the boundary element method. However, in the case with heat conduction with heat generation can approximately be solved without a domain integral by an improved multiple-reciprocity boundary element method. The convention multiple-reciprocity boundary element method is not suitable for complicated heat generation. In the improved multiple-reciprocity boundary element method, on the other hand, the domain integral in each step is divided into point, line, and area integrals. In order to solve the problem, the contour lines of heat generation, which approximate the actual heat generation, are used.

  16. CDDO and Its Role in Chronic Diseases.

    PubMed

    Mathis, Bryan J; Cui, Taixing

    2016-01-01

    There has been a continued interest in translational research focused on both natural products and manipulation of functional groups on these compounds to create novel derivatives with higher desired activities. Oleanolic acid, a component of traditional Chinese medicine used in hepatitis therapy, was modified by chemical processes to form 2-cyano-3,12-dioxoolean-1,9-dien-28-oic acid (CDDO). This modification increased anti-inflammatory activity significantly and additional functional groups on the CDDO backbone have shown promise in treating conditions ranging from kidney disease to obesity to diabetes. CDDO's therapeutic effect is due to its upregulation of the master antioxidant transcription factor Nuclear factor erythroid 2-related factor 2 (Nrf2) through conformational change of Nrf2-repressing, Kelch-like erythroid cell-derived protein with CNC homology-associated protein 1 (Keap1) and multiple animal and human studies have verified subsequent activation of Nrf2-controlled antioxidant genes via upstream Antioxidant Response Element (ARE) regions. At the present time, positive results have been obtained in the laboratory and clinical trials with CDDO derivatives treating conditions such as lung injury, inflammation and chronic kidney disease. However, clinical trials for cancer and cardiovascular disease have not shown equally positive results and further exploration of CDDO and its derivatives is needed to put these shortcomings into context for the purpose of future therapeutic modalities.

  17. Roles of calpain-calpastatin system (CCS) in human T cell activation.

    PubMed

    Mikosik, Anna; Jasiulewicz, Aleksandra; Daca, Agnieszka; Henc, Izabella; Frąckowiak, Joanna E; Ruckemann-Dziurdzińska, Katarzyna; Foerster, Jerzy; Le Page, Aurelie; Bryl, Ewa; Fulop, Tamas; Witkowski, Jacek M

    2016-11-22

    The immune response is determined by the speed of the T cell reaction to antigens assured by a state of readiness for proliferation and cytokine secretion. Proliferation, apoptosis and motion of many cell types are controlled by cytoplasmic proteases - µ- and m-calpain - and their inhibitor calpastatin, together forming the "calpain-calpastatin system" (CCS), assumed to modify their targets only upon activation-dependent cytoplasmic Ca2+ increase. Contrastingly to this notion, using quantitative real time PCR and semiquantitative flow cytometry respectively, we show here that the CCS genes are constitutively expressed, and that both calpains are constitutively active in resting, circulating human CD4+ and CD8+ lymphocytes. Furthermore, we demonstrate that calpain inhibition in the resting T cells prevents them from proliferation in vitro and greatly reduces secretion of multiple cytokines. The mechanistic reason for these effects of calpain inhibition on T cell functions might be the demonstrated significant reduction of the expression of active (phosphorylated) upstream signalling molecules, including the phospholipase C gamma, p56Lck and NFκB, in the inhibitor-treated cells. Thus, we propose that the constitutive, self-regulatory calpain-calpastatin system activity in resting human T cells is a necessary, controlling element of their readiness for complex and effective response to antigenic challenge.

  18. Multi-fidelity numerical simulations of shock/turbulent-boundary layer interaction with uncertainty quantification

    NASA Astrophysics Data System (ADS)

    Bermejo-Moreno, Ivan; Campo, Laura; Larsson, Johan; Emory, Mike; Bodart, Julien; Palacios, Francisco; Iaccarino, Gianluca; Eaton, John

    2013-11-01

    We study the interaction between an oblique shock wave and the turbulent boundary layers inside a nearly-square duct by combining wall-modeled LES, 2D and 3D RANS simulations, targeting the experiment of Campo, Helmer & Eaton, 2012 (nominal conditions: M = 2 . 05 , Reθ = 6 , 500). A primary objective is to quantify the effect of aleatory and epistemic uncertainties on the STBLI. Aleatory uncertainties considered include the inflow conditions (Mach number of the incoming air stream and thickness of the boundary layers) and perturbations of the duct geometry upstream of the interaction. The epistemic uncertainty under consideration focuses on the RANS turbulence model form by injecting perturbations in the Reynolds stress anisotropy in regions of the flow where the model assumptions (in particular, the Boussinesq eddy-viscosity hypothesis) may be invalid. These perturbations are then propagated through the flow solver into the solution. The uncertainty quantification (UQ) analysis is done through 2D and 3D RANS simulations, assessing the importance of the three-dimensional effects imposed by the nearly-square duct geometry. Wall-modeled LES are used to verify elements of the UQ methodology and to explore the flow features and physics of the STBLI for multiple shock strengths. Financial support from the United States Department of Energy under the PSAAP program is gratefully acknowledged.

  19. The fragmentation of 670A MeV neon-20 as a function of depth in water. I. Experiment

    NASA Technical Reports Server (NTRS)

    Schimmerling, W.; Miller, J.; Wong, M.; Rapkin, M.; Howard, J.; Spieler, H. G.; Jarret, B. V.

    1989-01-01

    We present the final analysis of an experiment to study the interaction of a beam of 670A MeV neon ions incident on a water column set to different thicknesses. The atomic number Z (and, in some cases, the isotopic mass A) of primary beam particles and of the products of nuclear interactions emerging from the water column close to the central axis of the beam was obtained for nuclei between Be (Z = 4) and Ne (Z = 10) using a time-of-flight telescope to measure the velocity and a set of silicon detectors to measure the energy loss of each particle. The fluence of particles of a given charge was obtained and normalized to the incident beam intensity. Corrections were made for accidental coincidences between multiple particles triggering the TOF telescope and for interactions in the detector. The background due to beam particles interacting in beam line elements upstream of the detector was calculated. Sources of experimental artifacts and background in particle identification experiments designed to characterize heavy ion beams for radiobiological research are summarized, and some of the difficulties inherent in this work are discussed. Complete tables of absolutely normalized fluence spectra as a function of LET are included for reference purposes.

  20. An Archaeal Immune System Can Detect Multiple Protospacer Adjacent Motifs (PAMs) to Target Invader DNA*

    PubMed Central

    Fischer, Susan; Maier, Lisa-Katharina; Stoll, Britta; Brendel, Jutta; Fischer, Eike; Pfeiffer, Friedhelm; Dyall-Smith, Mike; Marchfelder, Anita

    2012-01-01

    The clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated (Cas) system provides adaptive and heritable immunity against foreign genetic elements in most archaea and many bacteria. Although this system is widespread and diverse with many subtypes, only a few species have been investigated to elucidate the precise mechanisms for the defense of viruses or plasmids. Approximately 90% of all sequenced archaea encode CRISPR/Cas systems, but their molecular details have so far only been examined in three archaeal species: Sulfolobus solfataricus, Sulfolobus islandicus, and Pyrococcus furiosus. Here, we analyzed the CRISPR/Cas system of Haloferax volcanii using a plasmid-based invader assay. Haloferax encodes a type I-B CRISPR/Cas system with eight Cas proteins and three CRISPR loci for which the identity of protospacer adjacent motifs (PAMs) was unknown until now. We identified six different PAM sequences that are required upstream of the protospacer to permit target DNA recognition. This is only the second archaeon for which PAM sequences have been determined, and the first CRISPR group with such a high number of PAM sequences. Cells could survive the plasmid challenge if their CRISPR/Cas system was altered or defective, e.g. by deletion of the cas gene cassette. Experimental PAM data were supplemented with bioinformatics data on Haloferax and Haloquadratum. PMID:22767603

  1. An inversion involving the mouse Shh locus results in brachydactyly through dysregulation of Shh expression.

    PubMed

    Niedermaier, Michael; Schwabe, Georg C; Fees, Stephan; Helmrich, Anne; Brieske, Norbert; Seemann, Petra; Hecht, Jochen; Seitz, Volkhard; Stricker, Sigmar; Leschik, Gundula; Schrock, Evelin; Selby, Paul B; Mundlos, Stefan

    2005-04-01

    Short digits (Dsh) is a radiation-induced mouse mutant. Homozygous mice are characterized by multiple defects strongly resembling those resulting from Sonic hedgehog (Shh) inactivation. Heterozygous mice show a limb reduction phenotype with fusion and shortening of the proximal and middle phalanges in all digits, similar to human brachydactyly type A1, a condition caused by mutations in Indian hedgehog (IHH). We mapped Dsh to chromosome 5 in a region containing Shh and were able to demonstrate an inversion comprising 11.7 Mb. The distal breakpoint is 13.298 kb upstream of Shh, separating the coding sequence from several putative regulatory elements identified by interspecies comparison. The inversion results in almost complete downregulation of Shh expression during E9.5-E12.5, explaining the homozygous phenotype. At E13.5 and E14.5, however, Shh is upregulated in the phalangeal anlagen of Dsh/+ mice, at a time point and in a region where WT Shh is never expressed. The dysregulation of Shh expression causes the local upregulation of hedgehog target genes such as Gli1-3, patched, and Pthlh, as well as the downregulation of Ihh and Gdf5. This results in shortening of the digits through an arrest of chondrocyte differentiation and the disruption of joint development.

  2. An inversion involving the mouse Shh locus results in brachydactyly through dysregulation of Shh expression

    PubMed Central

    Niedermaier, Michael; Schwabe, Georg C.; Fees, Stephan; Helmrich, Anne; Brieske, Norbert; Seemann, Petra; Hecht, Jochen; Seitz, Volkhard; Stricker, Sigmar; Leschik, Gundula; Schrock, Evelin; Selby, Paul B.; Mundlos, Stefan

    2005-01-01

    Short digits (Dsh) is a radiation-induced mouse mutant. Homozygous mice are characterized by multiple defects strongly resembling those resulting from Sonic hedgehog (Shh) inactivation. Heterozygous mice show a limb reduction phenotype with fusion and shortening of the proximal and middle phalanges in all digits, similar to human brachydactyly type A1, a condition caused by mutations in Indian hedgehog (IHH). We mapped Dsh to chromosome 5 in a region containing Shh and were able to demonstrate an inversion comprising 11.7 Mb. The distal breakpoint is 13.298 kb upstream of Shh, separating the coding sequence from several putative regulatory elements identified by interspecies comparison. The inversion results in almost complete downregulation of Shh expression during E9.5–E12.5, explaining the homozygous phenotype. At E13.5 and E14.5, however, Shh is upregulated in the phalangeal anlagen of Dsh/+ mice, at a time point and in a region where WT Shh is never expressed. The dysregulation of Shh expression causes the local upregulation of hedgehog target genes such as Gli1-3, patched, and Pthlh, as well as the downregulation of Ihh and Gdf5. This results in shortening of the digits through an arrest of chondrocyte differentiation and the disruption of joint development. PMID:15841179

  3. Exposure of insects and insectivorous birds to metals and other elements from abandoned mine tailings in three Summit County drainages, Colorado

    USGS Publications Warehouse

    Custer, Christine M.; Yang, C.; Crock, J.G.; Shearn-Bochsler, V.; Smith, K.S.; Hageman, P.L.

    2009-01-01

    Concentrations of 31 metals, metalloids, and other elements were measured in insects and insectivorous bird tissues from three drainages with different geochemistry and mining histories in Summit Co., Colorado, in 2003, 2004, and 2005. In insect samples, all 25 elements that were analyzed in all years increased in both Snake and Deer Creeks in the mining impacted areas compared to areas above and below the mining impacted areas. This distribution of elements was predicted from known or expected sediment contamination resulting from abandoned mine tailings in those drainages. Element concentrations in avian liver tissues were in concordance with levels in insects, that is with concentrations higher in mid-drainage areas where mine tailings were present compared to both upstream and downstream locations; these differences were not always statistically different, however. The lack of statistically significant differences in liver tissues, except for a few elements, was due to relatively small sample sizes and because many of these elements are essential and therefore well regulated by the bird's homeostatic processes. Most elements were at background concentrations in avian liver tissue except for Pb which was elevated at mid-drainage sites to levels where ??-aminolevulinic acid dehydratase activity was inhibited at other mining sites in Colorado. Lead exposure, however, was not at toxic levels. Fecal samples were not a good indication of what elements birds ingested and were potentially exposed to. ?? Springer Science+Business Media B.V. 2008.

  4. Structure of the 5' region of the Hst70 gene transcription unit: presence of an intron and multiple transcription initiation sites.

    PubMed Central

    Scieglinska, D; Widłak, W; Konopka, W; Poutanen, M; Rahman, N; Huhtaniemi, I; Krawczyk, Z

    2001-01-01

    The rat Hst70 gene and its mouse counterpart Hsp70.2 belong to the family of Hsp70 heat shock genes and are specifically expressed in male germ cells. Previous studies regarding the structure of the 5' region of the transcription unit of these genes as well as localization of the 'cis' elements conferring their testis-specific expression gave contradictory results [Widlak, Markkula, Krawczyk, Kananen and Huhtaniemi (1995) Biochim. Biophys. Acta 1264, 191-200; Dix, Rosario-Herrle, Gotoh, Mori, Goulding, Barret and Eddy (1996) Dev. Biol. 174, 310-321]. In the present paper we solve these controversies and show that the 5' untranslated region (UTR) of the Hst70 gene contains an intron which is localized similar to that of the mouse Hsp70.2 gene. Reverse transcriptase-mediated PCR, Northern blotting and RNase protection analysis revealed that the transcription initiation of both genes starts at two main distant sites, and one of them is localized within the intron. As a result two populations of Hst70 gene transcripts with similar sizes but different 5' UTR structures can be detected in total testicular RNA. Functional analysis of the Hst70 gene promoter in transgenic mice and transient transfection assays proved that the DNA fragment of approx. 360 bp localized upstream of the ATG transcription start codon is the minimal promoter required for testis-specific expression of the HST70/chloramphenicol acetyltransferase transgene. These experiments also suggest that the expression of the gene may depend on 'cis' regulatory elements localized within exon 1 and the intron sequences. PMID:11563976

  5. Presenilins regulate neurotrypsin gene expression and neurotrypsin-dependent agrin cleavage via cyclic AMP response element-binding protein (CREB) modulation.

    PubMed

    Almenar-Queralt, Angels; Kim, Sonia N; Benner, Christopher; Herrera, Cheryl M; Kang, David E; Garcia-Bassets, Ivan; Goldstein, Lawrence S B

    2013-12-06

    Presenilins, the catalytic components of the γ-secretase complex, are upstream regulators of multiple cellular pathways via regulation of gene transcription. However, the underlying mechanisms and the genes regulated by these pathways are poorly characterized. In this study, we identify Tequila and its mammalian ortholog Prss12 as genes negatively regulated by presenilins in Drosophila larval brains and mouse embryonic fibroblasts, respectively. Prss12 encodes the serine protease neurotrypsin, which cleaves the heparan sulfate proteoglycan agrin. Altered neurotrypsin activity causes serious synaptic and cognitive defects; despite this, the molecular processes regulating neurotrypsin expression and activity are poorly understood. Using γ-secretase drug inhibitors and presenilin mutants in mouse embryonic fibroblasts, we found that a mature γ-secretase complex was required to repress neurotrypsin expression and agrin cleavage. We also determined that PSEN1 endoproteolysis or processing of well known γ-secretase substrates was not essential for this process. At the transcriptional level, PSEN1/2 removal induced cyclic AMP response element-binding protein (CREB)/CREB-binding protein binding, accumulation of activating histone marks at the neurotrypsin promoter, and neurotrypsin transcriptional and functional up-regulation that was dependent on GSK3 activity. Upon PSEN1/2 reintroduction, this active epigenetic state was replaced by a methyl CpG-binding protein 2 (MeCP2)-containing repressive state and reduced neurotrypsin expression. Genome-wide analysis revealed hundreds of other mouse promoters in which CREB binding is similarly modulated by the presence/absence of presenilins. Our study thus identifies Tequila and neurotrypsin as new genes repressed by presenilins and reveals a novel mechanism used by presenilins to modulate CREB signaling based on controlling CREB recruitment.

  6. Presenilins Regulate Neurotrypsin Gene Expression and Neurotrypsin-dependent Agrin Cleavage via Cyclic AMP Response Element-binding Protein (CREB) Modulation*

    PubMed Central

    Almenar-Queralt, Angels; Kim, Sonia N.; Benner, Christopher; Herrera, Cheryl M.; Kang, David E.; Garcia-Bassets, Ivan; Goldstein, Lawrence S. B.

    2013-01-01

    Presenilins, the catalytic components of the γ-secretase complex, are upstream regulators of multiple cellular pathways via regulation of gene transcription. However, the underlying mechanisms and the genes regulated by these pathways are poorly characterized. In this study, we identify Tequila and its mammalian ortholog Prss12 as genes negatively regulated by presenilins in Drosophila larval brains and mouse embryonic fibroblasts, respectively. Prss12 encodes the serine protease neurotrypsin, which cleaves the heparan sulfate proteoglycan agrin. Altered neurotrypsin activity causes serious synaptic and cognitive defects; despite this, the molecular processes regulating neurotrypsin expression and activity are poorly understood. Using γ-secretase drug inhibitors and presenilin mutants in mouse embryonic fibroblasts, we found that a mature γ-secretase complex was required to repress neurotrypsin expression and agrin cleavage. We also determined that PSEN1 endoproteolysis or processing of well known γ-secretase substrates was not essential for this process. At the transcriptional level, PSEN1/2 removal induced cyclic AMP response element-binding protein (CREB)/CREB-binding protein binding, accumulation of activating histone marks at the neurotrypsin promoter, and neurotrypsin transcriptional and functional up-regulation that was dependent on GSK3 activity. Upon PSEN1/2 reintroduction, this active epigenetic state was replaced by a methyl CpG-binding protein 2 (MeCP2)-containing repressive state and reduced neurotrypsin expression. Genome-wide analysis revealed hundreds of other mouse promoters in which CREB binding is similarly modulated by the presence/absence of presenilins. Our study thus identifies Tequila and neurotrypsin as new genes repressed by presenilins and reveals a novel mechanism used by presenilins to modulate CREB signaling based on controlling CREB recruitment. PMID:24145027

  7. LBH Gene Transcription Regulation by the Interplay of an Enhancer Risk Allele and DNA Methylation in Rheumatoid Arthritis.

    PubMed

    Hammaker, Deepa; Whitaker, John W; Maeshima, Keisuke; Boyle, David L; Ekwall, Anna-Karin H; Wang, Wei; Firestein, Gary S

    2016-11-01

    To identify nonobvious therapeutic targets for rheumatoid arthritis (RA), we performed an integrative analysis incorporating multiple "omics" data and the Encyclopedia of DNA Elements (ENCODE) database for potential regulatory regions. This analysis identified the limb bud and heart development (LBH) gene, which has risk alleles associated with RA/celiac disease and lupus, and can regulate cell proliferation in RA. We identified a novel LBH transcription enhancer with an RA risk allele (rs906868 G [Ref]/T) 6 kb upstream of the LBH gene with a differentially methylated locus. The confluence of 3 regulatory elements, rs906868, an RA differentially methylated locus, and a putative enhancer, led us to investigate their effects on LBH regulation in fibroblast-like synoviocytes (FLS). We cloned the 1.4-kb putative enhancer with either the rs906868 Ref allele or single-nucleotide polymorphism (SNP) variant into reporter constructs. The constructs were methylated in vitro and transfected into cultured FLS by nucleofection. We found that both variants increased transcription, thereby confirming the region's enhancer function. Unexpectedly, the transcriptional activity of the Ref risk allele was significantly lower than that of the SNP variant and is consistent with low LBH levels as a risk factor for aggressive FLS behavior. Using RA FLS lines with a homozygous Ref or SNP allele, we confirmed that homozygous Ref lines expressed lower LBH messenger RNA levels than did the SNP lines. Methylation significantly reduced enhancer activity for both alleles, indicating that enhancer function is dependent on its methylation status. This study shows how the interplay between genetics and epigenetics can affect expression of LBH in RA. © 2016, American College of Rheumatology.

  8. Mesoscale Surface Pressure and Temperature Features Associated with Bow Echoes

    DTIC Science & Technology

    2010-01-01

    contain several bowing segments. These multiple segments could occur at the same time and be located within the same bow, such as the serial derecho ...Examination of derecho environments using proximity soundings. Wea. Forecasting, 16, 329–342. Fovell, R. G., 2002: Upstream influence of numerically...Se- vere Local Storms, Hyannis, MA, Amer. Meteor. Soc., 4.6. Johns, R. H., and W. D. Hirt, 1987: Derechos : Widespread con- vectively induced

  9. Linear theory of boundary effects in open wind tunnels with finite jet lengths

    NASA Technical Reports Server (NTRS)

    Katzoff, S; Gardner, Clifford S; Diesendruck, Leo; Eisenstadt, Bertram J

    1950-01-01

    In the first part, the boundary conditions for an open wind tunnel (incompressible flow) are examined with special reference to the effects of the closed entrance and exit sections. Basic conditions are that the velocity must be continuous at the entrance lip and that the velocities in the upstream and downstream closed portions must be equal. In the second part, solutions are derived for four types of two-dimensional open tunnels, including one in which the pressures on the two free surfaces are not equal. Numerical results are given for every case. In general, if the lifting element is more than half the tunnel height from the inlet, the boundary effect at the lifting element is the same as for an infinitely long open tunnel. In the third part, a general method is given for calculating the boundary effect in an open circular wind tunnel of finite jet length. Numerical results are given for a lifting element concentrate at a point on the axis.

  10. Staphylococcal SCCmec elements encode an active MCM-like helicase and thus may be replicative

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mir-Sanchis, Ignacio; Roman, Christina A.; Misiura, Agnieszka

    2016-08-29

    Methicillin-resistant Staphylococcus aureus (MRSA) is a public-health threat worldwide. Although the mobile genomic island responsible for this phenotype, staphylococcal cassette chromosome (SCC), has been thought to be nonreplicative, we predicted DNA-replication-related functions for some of the conserved proteins encoded by SCC. We show that one of these, Cch, is homologous to the self-loading initiator helicases of an unrelated family of genomic islands, that it is an active 3'-to-5' helicase and that the adjacent ORF encodes a single-stranded DNA–binding protein. Our 2.9-Å crystal structure of intact Cch shows that it forms a hexameric ring. Cch, like the archaeal and eukaryotic MCM-familymore » replicative helicases, belongs to the pre–sensor II insert clade of AAA+ ATPases. Additionally, we found that SCC elements are part of a broader family of mobile elements, all of which encode a replication initiator upstream of their recombinases. Replication after excision would enhance the efficiency of horizontal gene transfer.« less

  11. Negative effect of the 5'-untranslated leader sequence on Ac transposon promoter expression.

    PubMed

    Scortecci, K C; Raina, R; Fedoroff, N V; Van Sluys, M A

    1999-08-01

    Transposable elements are used in heterologous plant hosts to clone genes by insertional mutagenesis. The Activator (Ac) transposable element has been cloned from maize, and introduced into a variety of plants. However, differences in regulation and transposition frequency have been observed between different host plants. The cause of this variability is still unknown. To better understand the activity of the Ac element, we analyzed the Ac promoter region and its 5'-untranslated leader sequence (5' UTL). Transient assays in tobacco NT1 suspension cells showed that the Ac promoter is a weak promoter and its activity was localized by deletion analyses. The data presented here indicate that the core of the Ac promoter is contained within 153 bp fragment upstream to transcription start sites. An important inhibitory effect (80%) due to the presence of the 5' UTL was found on the expression of LUC reporter gene. Here we demonstrate that the presence of the 5' UTL in the constructs reduces the expression driven by either strong or weak promoters.

  12. The Asian clam Corbicula fluminea as a biomonitor of trace element contamination: Accounting for different sources of variation using an hierarchical linear model

    USGS Publications Warehouse

    Shoults-Wilson, W. A.; Peterson, J.T.; Unrine, J.M.; Rickard, J.; Black, M.C.

    2009-01-01

    In the present study, specimens of the invasive clam, Corbicula fluminea, were collected above and below possible sources of potentially toxic trace elements (As, Cd, Cr, Cu, Hg, Pb, and Zn) in the Altamaha River system (Georgia, USA). Bioaccumulation of these elements was quantified, along with environmental (water and sediment) concentrations. Hierarchical linear models were used to account for variability in tissue concentrations related to environmental (site water chemistry and sediment characteristics) and individual (growth metrics) variables while identifying the strongest relations between these variables and trace element accumulation. The present study found significantly elevated concentrations of Cd, Cu, and Hg downstream of the outfall of kaolin-processing facilities, Zn downstream of a tire cording facility, and Cr downstream of both a nuclear power plant and a paper pulp mill. Models of the present study indicated that variation in trace element accumulation was linked to distance upstream from the estuary, dissolved oxygen, percentage of silt and clay in the sediment, elemental concentrations in sediment, shell length, and bivalve condition index. By explicitly modeling environmental variability, the Hierarchical linear modeling procedure allowed the identification of sites showing increased accumulation of trace elements that may have been caused by human activity. Hierarchical linear modeling is a useful tool for accounting for environmental and individual sources of variation in bioaccumulation studies. ?? 2009 SETAC.

  13. Development of a bioassay to screen for chemicals mimicking the anti-aging effects of calorie restriction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chiba, Takuya, E-mail: takuya@nagasaki-u.ac.jp; Tsuchiya, Tomoshi; Komatsu, Toshimitsu

    2010-10-15

    Research highlights: {yields} We identified four sequence motifs lying upstream of putative pro-longevity genes. {yields} One of these motifs binds to HNF-4{alpha}. {yields} HNF-4{alpha}/PGC-1{alpha} could up-regulate the transcription of a reporter gene linked to this motif. {yields} The reporter system described here could be used to screen candidate anti-aging molecules. -- Abstract: Suppression of the growth hormone/insulin-like growth factor-I pathway in Ames dwarf (DF) mice, and caloric restriction (CR) in normal mice extends lifespan and delays the onset of age-related disorders. In combination, these interventions have an additive effect on lifespan in Ames DF mice. Therefore, common signaling pathways regulatedmore » by DF and CR could have additive effects on longevity. In this study, we tried to identity the signaling mechanism and develop a system to assess pro-longevity status in cells and mice. We previously identified genes up-regulated in the liver of DF and CR mice by DNA microarray analysis. Motif analysis of the upstream sequences of those genes revealed four major consensus sequence motifs, which have been named dwarfism and calorie restriction-responsive elements (DFCR-REs). One of the synthesized sequences bound to hepatocyte nuclear factor-4{alpha} (HNF-4{alpha}), an important transcription factor involved in liver metabolism. Furthermore, using this sequence information, we developed a highly sensitive bioassay to identify chemicals mimicking the anti-aging effects of CR. When the reporter construct, containing an element upstream of a secreted alkaline phosphatase (SEAP) gene, was co-transfected with HNF-4{alpha} and its regulator peroxisome proliferator-activated receptor (PPAR) {gamma} coactivator-1{alpha} (PGC-1{alpha}), SEAP activity was increased compared with untransfected controls. Moreover, transient transgenic mice established using this construct showed increased SEAP activity in CR mice compared with ad libitum-fed mice. These data suggest that because of its rapidity, ease of use, and specificity, our bioassay will be more useful than the systems currently employed to screen for CR mimetics, which mimic the beneficial effects of CR. Our system will be particularly useful for high-throughput screening of natural and synthetic candidate molecules.« less

  14. Connections between meteorological and hydrological droughts in a semi-arid basin of the middle Yellow River

    NASA Astrophysics Data System (ADS)

    Li, Binquan; Zhu, Changchang; Liang, Zhongmin; Wang, Guoqing; Zhang, Yu

    2018-06-01

    Differences between meteorological and hydrological droughts could reflect the regional water consumption by both natural elements and human water-use. The connections between these two drought types were analyzed using the Standardized Precipitation Evapotranspiration Index (SPEI) and Standardized Streamflow Index (SSI), respectively. In a typical semi-arid basin of the middle Yellow River (Qingjianhe River basin), annual precipitation and air temperature showed significantly downward and upward trends, respectively, with the rates of -2.37 mm yr-1 and 0.03 °C yr-1 (1961-2007). Under their synthetic effects, water balance variable (represented by SPEI) showed obviously downward (drying) trend at both upstream and whole basin areas. For the spatial variability of precipitation, air temperature and the calculated SPEI, both upstream and downstream areas experienced very similar change characteristics. Results also suggested that the Qingjianhe River basin experienced near normal condition during the study period. As a whole, this semi-arid basin mainly had the meteorological drought episodes in the mid-1960s, late-1990s and the 2000s depicted by 12-month SPEI. The drying trend could also be depicted by the hydrological drought index (12-month SSI) at both upstream and downstream stations (Zichang and Yanchuan), but the decreasing trends were not significant. A correlation analysis showed that hydrological system responds rapidly to the change of meteorological conditions in this semi-arid region. This finding could be an useful implication to drought research for those semi-arid basins with intensive human activities.

  15. Splicing-factor alterations in cancers

    PubMed Central

    Anczuków, Olga; Krainer, Adrian R.

    2016-01-01

    Tumor-associated alterations in RNA splicing result either from mutations in splicing-regulatory elements or changes in components of the splicing machinery. This review summarizes our current understanding of the role of splicing-factor alterations in human cancers. We describe splicing-factor alterations detected in human tumors and the resulting changes in splicing, highlighting cell-type-specific similarities and differences. We review the mechanisms of splicing-factor regulation in normal and cancer cells. Finally, we summarize recent efforts to develop novel cancer therapies, based on targeting either the oncogenic splicing events or their upstream splicing regulators. PMID:27530828

  16. Distributing Characteristics of Heavy Metal Elements in A Tributary of Zhedong River in Laowangzhai Gold Deposit, Yunnan (China): An Implication to Environmentology from Sediments

    NASA Astrophysics Data System (ADS)

    Yang, Shuran; Danĕk, Tomáš; Yang, Xiaofeng; Cheng, Xianfeng

    2016-10-01

    Five heavy metal contents from five sediments and seven sediment profiles in an upstream reach of Zhedong river in Laowangzhai gold deposit were investigated in this research, along with analysis of the horizontal distribution, the surface distribution, the vertical distribution and the interlayer distribution of five heavy metal contents: arsenic (As), mercury (Hg), copper (Cu), lead (Pb) and zinc (Zn). The potential ecological risk of five heavy metals was evaluated to help understanding pollution control of Laowangzhai deposit.

  17. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, D.P.; Richardson, C.F.

    Three mercury measurement techniques were performed on synthesis gas streams before and after an amine-based sulfur removal system. The syngas was sampled using (1) gas impingers containing a nitric acid-hydrogen peroxide solution, (2) coconut-based charcoal sorbent, and (3) an on-line atomic absorption spectrophotometer equipped with a gold amalgamation trap and cold vapor cell. Various impinger solutions were applied upstream of the gold amalgamation trap to remove hydrogen sulfide and isolate oxidized and elemental species of mercury. The results from these three techniques are compared to provide an assessment of these measurement techniques in reducing gas atmospheres.

  18. A simple and inexpensive on-column frit fabrication method for fused-silica capillaries for increased capacity and versatility in LC-MS/MS applications.

    PubMed

    Wang, Ling-Chi; Okitsu, Cindy Yen; Kochounian, Harold; Rodriguez, Anthony; Hsieh, Chih-Lin; Zandi, Ebrahim

    2008-05-01

    A modified sol-gel method for a one-step on-column frit preparation for fused-silica capillaries and its utility for peptide separation in LC-MS/MS is described. This method is inexpensive, reproducible, and does not require specialized equipments. Because the frit fabrication process does not damage polyimide coating, the frit-fabricated column can be tightly connected on-line for high pressure LC. These columns can replace any capillary liquid transfer tubing without any specialized connections up-stream of a spray tip column. Therefore multiple columns with different phases can be connected in series for one- or multiple-dimensional chromatography.

  19. The Transposable Element Mariner Mediates Germline Transformation in Drosophila Melanogaster

    PubMed Central

    Lidholm, D. A.; Lohe, A. R.; Hartl, D. L.

    1993-01-01

    A vector for germline transformation in Drosophila melanogaster was constructed using the transposable element mariner. The vector, denoted pMlwB, contains a mariner element disrupted by an insertion containing the wild-type white gene from D. melanogaster, the β-galactosidase gene from Escherichia coli and sequences that enable plasmid replication and selection in E. coli. The white gene is controlled by the promoter of the D. melanogaster gene for heat-shock protein 70, and the β-galactosidase gene is flanked upstream by the promoter of the transposable element P as well as that of mariner. The MlwB element was introduced into the germline of D. melanogaster by co-injection into embryos with an active mariner element, Mos1, which codes for a functional transposase and serves as a helper. Two independent germline insertions were isolated and characterized. The results show that the MlwB element inserted into the genome in a mariner-dependent manner with the termini of the inverted repeats inserted at a TA dinucleotide. Both insertions exhibit an unexpected degree of germline and somatic stability, even in the presence of an active mariner element in the genetic background. These results demonstrate that the mariner transposable element, which is small (1286 bp) and relatively homogeneous in size among different copies, is nevertheless capable of promoting the insertion of the large (13.2 kb) MlwB element. Because of the widespread phylogenetic distribution of mariner among insects, these results suggest that mariner might provide a wide hostrange transformation vector for insects. PMID:8394264

  20. Transcription of the Streptococcus pyogenes Hyaluronic Acid Capsule Biosynthesis Operon Is Regulated by Previously Unknown Upstream Elements

    PubMed Central

    Falaleeva, Marina; Zurek, Oliwia W.; Watkins, Robert L.; Reed, Robert W.; Ali, Hadeel; Sumby, Paul; Voyich, Jovanka M.

    2014-01-01

    The important human pathogen Streptococcus pyogenes (group A Streptococcus [GAS]) produces a hyaluronic acid (HA) capsule that plays critical roles in immune evasion. Previous studies showed that the hasABC operon encoding the capsule biosynthesis enzymes is under the control of a single promoter, P1, which is negatively regulated by the two-component regulatory system CovR/S. In this work, we characterize the sequence upstream of P1 and identify a novel regulatory region controlling transcription of the capsule biosynthesis operon in the M1 serotype strain MGAS2221. This region consists of a promoter, P2, which initiates transcription of a novel small RNA, HasS, an intrinsic transcriptional terminator that inefficiently terminates HasS, permitting read-through transcription of hasABC, and a putative promoter which lies upstream of P2. Electrophoretic mobility shift assays, quantitative reverse transcription-PCR, and transcriptional reporter data identified CovR as a negative regulator of P2. We found that the P1 and P2 promoters are completely repressed by CovR, and capsule expression is regulated by the putative promoter upstream of P2. Deletion of hasS or of the terminator eliminates CovR-binding sequences, relieving repression and increasing read-through, hasA transcription, and capsule production. Sequence analysis of 44 GAS genomes revealed a high level of polymorphism in the HasS sequence region. Most of the HasS variations were located in the terminator sequences, suggesting that this region is under strong selective pressure. We discovered that the terminator deletion mutant is highly resistant to neutrophil-mediated killing and is significantly more virulent in a mouse model of GAS invasive disease than the wild-type strain. Together, these results are consistent with the naturally occurring mutations in this region modulating GAS virulence. PMID:25287924

  1. Temporary Restoration of Bull Trout Passage at Albeni Falls Dam, 2008 Progress Report.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bellgraph, Brian J.

    2009-03-31

    The goal of this project is to provide temporary upstream passage of bull trout around Albeni Falls Dam on the Pend Oreille River, Idaho. Our specific objectives are to capture fish downstream of Albeni Falls Dam, tag them with combination acoustic and radio transmitters, release them upstream of Albeni Falls Dam, and determine if genetic information on tagged fish can be used to accurately establish where fish are located during the spawning season. In 2007, radio receiving stations were installed at several locations throughout the Pend Oreille River watershed to detect movements of adult bull trout; however, no bull troutmore » were tagged during that year. In 2008, four bull trout were captured downstream of Albeni Falls Dam, implanted with transmitters, and released upstream of the dam at Priest River, Idaho. The most-likely natal tributaries of bull trout assigned using genetic analyses were Grouse Creek (N = 2); a tributary of the Pack River, Lightning Creek (N = 1); and Rattle Creek (N = 1), a tributary of Lightning Creek. All four bull trout migrated upstream from the release site in Priest River, Idaho, were detected at monitoring stations near Dover, Idaho, and were presumed to reside in Lake Pend Oreille from spring until fall 2008. The transmitter of one bull trout with a genetic assignment to Grouse Creek was found in Grouse Creek in October 2008; however, the fish was not found. The bull trout assigned to Rattle Creek was detected in the Clark Fork River downstream from Cabinet Gorge Dam (approximately 13 km from the mouth of Lightning Creek) in September but was not detected entering Lightning Creek. The remaining two bull trout were not detected in 2008 after detection at the Dover receiving stations. This report details the progress by work element in the 2008 statement of work, including data analyses of fish movements, and expands on the information reported in the quarterly Pisces status reports.« less

  2. Method and systems for collecting data from multiple fields of view

    NASA Technical Reports Server (NTRS)

    Schwemmer, Geary K. (Inventor)

    2002-01-01

    Systems and methods for processing light from multiple fields (48, 54, 55) of view without excessive machinery for scanning optical elements. In an exemplary embodiment of the invention, multiple holographic optical elements (41, 42, 43, 44, 45), integrated on a common film (4), diffract and project light from respective fields of view.

  3. Characterization of Stormflows and Wastewater Treatment-Plant Effluent Discharges on Water Quality, Suspended Sediment, and Stream Morphology for Fountain and Monument Creek Watersheds, Colorado, 1981-2006

    USGS Publications Warehouse

    Mau, David P.; Stogner, Sr., Robert W.; Edelmann, Patrick

    2007-01-01

    In 1998, the U.S. Geological Survey, in cooperation with Colorado Springs City Engineering, began a study of the Fountain and Monument Creek watersheds to characterize water quality and suspended-sediment conditions in the watershed for different flow regimes, with an emphasis on characterizing water quality during storm runoff. Water-quality and suspended-sediment samples were collected in the Fountain and Monument Creek watersheds from 1981 through 2006 to evaluate the effects of stormflows and wastewater-treatment effluent on Fountain and Monument Creeks in the Colorado Springs, Colorado, area. Water-quality data were collected at 11 sites between 1981 and 2001, and 14 tributary sites were added in 2003 to increase spatial coverage and characterize water quality throughout the watersheds. Suspended-sediment samples collected daily at 7 sites from 1998 through 2001, 6 sites daily from 2003 through 2006, and 13 tributary sites intermittently from 2003 through 2006 were used to evaluate the effects of stormflow on suspended-sediment concentrations, discharges, and yields. Data were separated into three flow regimes: base flow, normal flow, and stormflow. Stormflow concentrations from 1998 through 2006 were compared to Colorado acute instream standards and, with the exception of a few isolated cases, did not exceed water-quality standards for inorganic constituents that were analyzed. However, stormflow concentrations of both fecal coliform and Escherichia coli (E. coli) frequently exceeded water-quality standards during 1998 through 2006 on main-stem and tributary sites by more than an order of magnitude. There were two sites on Cottonwood Creek, a tributary to Monument Creek, with elevated concentrations of dissolved nitrite plus nitrate: site 07103985 (TbCr), a tributary to Cottonwood Creek and site 07103990 (lower_CoCr), downstream from site 07103985 (TbCr), and near the confluence with Monument Creek. During base-flow and normal-flow conditions, the median concentrations of dissolved nitrite plus nitrate ranged from 5.1 to 6.1 mg/L and were 4 to 7 times larger than concentrations at the nearest upstream site on Monument Creek, site 07103970 (MoCr_Woodmen). The source of these larger dissolved nitrite plus nitrate concentrations has not been identified, but the fact that all measurements had elevated dissolved nitrite plus nitrate concentrations indicates a relatively constant source. Most stormflow concentrations of dissolved trace elements were smaller than concentrations from base-flow or normal-flow samples. However, median concentrations of total arsenic, copper, lead, manganese, nickel, and zinc generally were much larger during periods of stormflow than during base flow or normal flow. Concentrations of dissolved and total copper, total manganese, total nickel, dissolved and total selenium, and dissolved and total zinc ranged from 3 to 27 times larger at site 07103707 (FoCr_8th) than site 07103700 (FoCr_Manitou) during base flow, indicating a large source of trace elements between these two sites. Both of these sites are located on Fountain Creek, upstream from the confluence with Monument Creek. The likely source area is Gold Hill Mesa, a former tailings pile for a gold refinery located just upstream from the confluence with Monument Creek, and upstream from site 07103707 (FoCr_8th). Farther downstream in Fountain Creek, stormflow samples for total copper, manganese, lead, nickel, and zinc were larger at the downstream site near the city of Security, site 07105800 (FoCr_Security), than at the upstream site near Janitell Road, site 07105530 (FoCr_Janitell), compared with other main-stem sites and indicated a relatively large source of these metals between the two sites. Nitrogen, phosphorus, and trace-element loads substantially increased during stormflow. Suspended-sediment concentrations, discharges, and yields associated with stormflow were significantly larger than those associated with normal flow. The Apr

  4. Tidal reversal and flow velocities using temperature and specific conductance in a small wetland creek

    NASA Astrophysics Data System (ADS)

    Eaton, Timothy T.

    2016-11-01

    Characterizing flow dynamics in very small tidal creeks is complicated and not well suited to methods developed for upland streams or coastal estuaries, due to low flows, bidirectionality and shallow waters. Simple instrumentation enables thermal and salinity signals to be used to observe flow directions and estimate velocities in these settings. Using multiple inexpensive sensors over 500 m along a tidally influenced wetland creek, I demonstrate how advection of temperature and specific conductance pulses reveal flood and ebb tides and the temporary reversal of flow by warmer, estuarine water from the receiving embayment. The sequential rise of temperature upstream was most evident under hot and dry conditions, after daily peak air temperatures of 25 °C or above, and was subdued or disrupted under cooler or rainy conditions in summertime. Changes in specific conductance at successive sites upstream were less susceptible to environmental influences and confirm tidal flood velocity of between 0.07 and 0.37 m/s. The tidally-induced flow reversal suggests that periodic high tide conditions can interfere with rapid dispersal of pollution discharges, such as from the combined sewer overflow (CSO) located upstream of the studied creek reach. This low-cost approach of temperature and specific conductance sensing in vegetated coastal wetlands where access, precise elevation control and creek discharge measurements are difficult, provides a simple way of tracking water masses when sufficient contrast exists between water sources.

  5. Multistress Regulation in Escherichia coli: Expression of osmB Involves Two Independent Promoters Responding either to σS or to the RcsCDB His-Asp Phosphorelay

    PubMed Central

    Boulanger, Alice; Francez-Charlot, Anne; Conter, Annie; Castanié-Cornet, Marie-Pierre; Cam, Kaymeuang; Gutierrez, Claude

    2005-01-01

    Transcription of the Escherichia coli osmB gene is induced by several stress conditions. osmB is expressed from two promoters, osmBp1 and osmBp2. The downstream promoter, osmBp2, is induced after osmotic shock or upon entry into stationary phase in a σS-dependent manner. The upstream promoter, osmBp1, is independent of σS and is activated by RcsB, the response regulator of the His-Asp phosphorelay signal transduction system RcsCDB. RcsB is responsible for the induction of osmBp1 following treatment with chlorpromazine. Activation of osmBp1 by RcsB requires a sequence upstream of its −35 element similar to the RcsB binding site consensus, suggesting a direct regulatory role. osmB appears as another example of a multistress-responsive gene whose transcription involves both a σS-dependent promoter and a second one independent of σS but controlled by stress-specific transcription factors. PMID:15838058

  6. Three-Dimensional, Laminar Flow Past a Short, Surface-Mounted Cylinder

    NASA Astrophysics Data System (ADS)

    Liakos, Anastasios; Malamataris, Nikolaos

    2016-11-01

    The topology and evolution of three-dimensional flow past a cylinder of slenderness ratio SR = 1 mounted in a wind tunnel is examined for 0 . 1 <= Re <= 325 (based on the diameter of the cylinder) where steady-state solutions have been obtained. Direct numerical simulations were computed using an in-house parallel finite element code. Results indicate that symmetry breaking occurs at Re = 1 , while the first prominent structure is a horseshoe vortex downstream from the cylinder. At Re = 150 , two foci are observed, indicating the formation of two tornadolike vortices downstream. Concurrently, another horseshoe vortex is formed upstream from the cylinder. For higher Reynolds numbers, the flow downstream is segmented to upper and lower parts, whereas the topology of the flow on the solid boundaries remains unaltered. Pressure distributions show that pressure, the key physical parameter in the flow, decreases everywhere except immediately upstream from the cylinder. In addition, creation of critical points from saddle-node-type bifurcations occur when the streamwise component of the pressure gradient changes sign. Finally, at Re = 325 , an additional horseshoe vorrtex is formed at the wake of the cylinder

  7. Discrete modelling of front propagation in backward piping erosion

    NASA Astrophysics Data System (ADS)

    Tran, Duc-Kien; Prime, Noémie; Froiio, Francesco; Callari, Carlo; Vincens, Eric

    2017-06-01

    A preliminary discrete numerical model of a REV at the front region of an erosion pipe in a cohesive granular soil is briefly presented. The results reported herein refer to a simulation carried out by coupling the Discrete Element Method (DEM) with the Lattice Boltzmann Method (LBM) for the representation of the granular and fluid phases, respectively. The numerical specimen, consisiting of bonded grains, is tested under fully-saturated conditions and increasing pressure difference between the inlet (confined) and the outlet (unconfined) flow regions. The key role of compression arches of force chains that transversely cross the sample and carry most part of the hydrodynamic actions is pointed out. These arches partition the REV into an upstream region that remains almost intact and a downstream region that gradually degrades and is subsequently eroded in the form of a cluster. Eventually, the collapse of the compression arches causes the upstream region to be also eroded, abruptly, as a whole. A complete presentation of the numerical model and of the results of the simulation can be found in [12].

  8. The control of lambda DNA terminase synthesis.

    PubMed Central

    Murialdo, H; Davidson, A; Chow, S; Gold, M

    1987-01-01

    Nu1 and A, the genes coding for bacteriophage lambda DNA terminase, rank among the most poorly translated genes expressed in E. coli. To understand the reason for this low level of translation the genes were cloned into plasmids and their expression measured. In addition, the wild type DNA sequences immediately preceding the genes were reduced and modified. It was found that the elements that control translation are contained in the 100 base pairs upstream from the initiation codon. Interchanging these upstream sequences with those of an efficiently translated gene dramatically increased the translation of terminase subunits. It seems unlikely that the rare codons present in the genes, and any feature of their mRNA secondary structure play a role in the control of their translation. The elimination of cos from plasmids containing Nu1 and A also resulted in an increase in terminase production. This result suggests a role for cos in the control of late gene expression. The terminase subunit overproducer strains are potentially very useful for the design of improved DNA packaging and cosmid mapping techniques. Images PMID:3029667

  9. Long-term memory deficits in Pavlovian fear conditioning in Ca2+/calmodulin kinase kinase alpha-deficient mice.

    PubMed

    Blaeser, Frank; Sanders, Matthew J; Truong, Nga; Ko, Shanelle; Wu, Long Jun; Wozniak, David F; Fanselow, Michael S; Zhuo, Min; Chatila, Talal A

    2006-12-01

    Signaling by the Ca(2+)/calmodulin kinase (CaMK) cascade has been implicated in neuronal gene transcription, synaptic plasticity, and long-term memory consolidation. The CaM kinase kinase alpha (CaMKKalpha) isoform is an upstream component of the CaMK cascade whose function in different behavioral and learning and memory paradigms was analyzed by targeted gene disruption in mice. CaMKKalpha mutants exhibited normal long-term spatial memory formation and cued fear conditioning but showed deficits in context fear during both conditioning and long-term follow-up testing. They also exhibited impaired activation of the downstream kinase CaMKIV/Gr and its substrate, the transcription factor cyclic AMP-responsive element binding protein (CREB) upon fear conditioning. Unlike CaMKIV/Gr-deficient mice, the CaMKKalpha mutants exhibited normal long-term potentiation and normal levels of anxiety-like behavior. These results demonstrate a selective role for CaMKKalpha in contextual fear memory and suggest that different combinations of upstream and downstream components of the CaMK cascade may serve distinct physiological functions.

  10. Eukaryotic Elongation Factor 1A Interacts with the Upstream Pseudoknot Domain in the 3′ Untranslated Region of Tobacco Mosaic Virus RNA

    PubMed Central

    Zeenko, Vladimir V.; Ryabova, Lyubov A.; Spirin, Alexander S.; Rothnie, Helen M.; Hess, Daniel; Browning, Karen S.; Hohn, Thomas

    2002-01-01

    The genomic RNA of tobacco mosaic virus (TMV), like that of other positive-strand RNA viruses, acts as a template for both translation and replication. The highly structured 3′ untranslated region (UTR) of TMV RNAs plays an important role in both processes; it is not polyadenylated but ends with a tRNA-like structure (TLS) preceded by a conserved upstream pseudoknot domain (UPD). The TLS of tobamoviral RNAs can be specifically aminoacylated and, in this state, can interact with eukaryotic elongation factor 1A (eEF1A)/GTP with high affinity. Using a UV cross-linking assay, we detected another specific binding site for eEF1A/GTP, within the UPDs of TMV and crucifer-infecting tobamovirus (crTMV), that does not require aminoacylation. A mutational analysis revealed that UPD pseudoknot conformation and some conserved primary sequence elements are required for this interaction. Its possible role in the regulation of tobamovirus gene expression and replication is discussed. PMID:11991996

  11. Conjoin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sjaardema, Gregory

    2010-08-06

    Conjoin is a code for joining sequentially in time multiple exodusII database files. It is used to create a single results or restart file from multiple results or restart files which typically arise as the result of multiple restarted analyses. The resulting output file will be the union of the input files with a status variable indicating the status of each element at the various time planes.Combining multiple exodusII files arising from a restarted analysis or combining multiple exodusII files arising from a finite element analysis with dynamic topology changes.

  12. Understanding multiple stressors in a Mediterranean basin: Combined effects of land use, water scarcity and nutrient enrichment.

    PubMed

    Segurado, Pedro; Almeida, Carina; Neves, Ramiro; Ferreira, Maria Teresa; Branco, Paulo

    2018-05-15

    River basins are extremely complex hierarchical and directional systems that are affected by a multitude of interacting stressors. This complexity hampers effective management and conservation planning to be effectively implemented, especially under climate change. The objective of this work is to provide a wide scale approach to basin management by interpreting the effect of isolated and interacting factors in several biotic elements (fish, macroinvertebrates, phytobenthos and macrophytes). For that, a case study in the Sorraia basin (Central Portugal), a Mediterranean system mainly facing water scarcity and diffuse pollution problems, was chosen. To develop the proposed framework, a combination of process-based modelling to simulate hydrological and nutrient enrichment stressors and empirical modelling to relate these stressors - along with land use and natural background - with biotic indicators, was applied. Biotic indicators based on ecological quality ratios from WFD biomonitoring data were used as response variables. Temperature, river slope, % of agriculture in the upstream catchment and total N were the variables more frequently ranked as the most relevant. Both the two significant interactions found between single hydrological and nutrient enrichment stressors indicated antagonistic effects. This study demonstrates the potentialities of coupling process-based modelling with empirical modelling within a single framework, allowing relationships among different ecosystem states to be hierarchized, interpreted and predicted at multiple spatial and temporal scales. It also demonstrates how isolated and interacting stressors can have a different impact on biotic quality. When performing conservation or management plans, the stressor hierarchy should be considered as a way of prioritizing actions in a cost-effective perspective. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Nitrogen budget in a lowland coastal area within the Po River basin (northern Italy): multiple evidences of equilibrium between sources and internal sinks.

    PubMed

    Castaldelli, Giuseppe; Soana, Elisa; Racchetti, Erica; Pierobon, Enrica; Mastrocicco, Micol; Tesini, Enrico; Fano, Elisa Anna; Bartoli, Marco

    2013-09-01

    Detailed studies on pollutants genesis, path and transformation are needed in agricultural catchments facing coastal areas. Here, loss of nutrients should be minimized in order to protect valuable aquatic ecosystems from eutrophication phenomena. A soil system N budget was calculated for a lowland coastal area, the Po di Volano basin (Po River Delta, Northern Italy), characterized by extremely flat topography and fine soil texture and bordering a network of lagoon ecosystems. Main features of this area are the scarce relevance of livestock farming, the intense agriculture, mainly sustained by chemical fertilizers, and the developed network of artificial canals with long water residence time. Average nitrogen input exceeds output terms by ~60 kg N ha(-1) year(-1), a relatively small amount if compared to sub-basins of the same hydrological system. Analysis of dissolved inorganic nitrogen in groundwater suggests limited vertical loss and no accumulation of this element, while a nitrogen mass balance in surface waters indicates a net and significant removal within the watershed. Our data provide multiple evidences of efficient control of the nitrogen excess in this geographical area and we speculate that denitrification in soil and in the secondary drainage system performs this ecosystemic function. Additionally, the significant difference between nitrogen input and nitrogen output loads associated to the irrigation system, which is fed by the N-rich Po River, suggests that this basin metabolizes part of the nitrogen excess produced upstream. The traditionally absent livestock farming practices and consequent low use of manure as fertilizer pose the risk of excess soil mineralization and progressive loss of denitrification capacity in this area.

  14. Plutella xylostella granulovirus late gene promoter activity in the context of the Autographa californica multiple nucleopolyhedrovirus genome.

    PubMed

    Ren, He-Lin; Hu, Yuan; Guo, Ya-Jun; Li, Lu-Lin

    2016-06-01

    Within Baculoviridae, little is known about the molecular mechanisms of replication in betabaculoviruses, despite extensive studies in alphabaculoviruses. In this study, the promoters of nine late genes of the betabaculovirus Plutella xylostella granulovirus (PlxyGV) were cloned into a transient expression vector and the alphabaculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV) genome, and compared with homologous late gene promoters of AcMNPV in Sf9 cells. In transient expression assays, all PlxyGV late promoters were activated in cells transfected with the individual reporter plasmids together with an AcMNPV bacmid. In infected cells, reporter gene expression levels with the promoters of PlxyGV e18 and AcMNPV vp39 and gp41 were significantly higher than those of the corresponding AcMNPV or PlxyGV promoters, which had fewer late promoter motifs. Observed expression levels were lower for the PlxyGV p6.9, pk1, gran, p10a, and p10b promoters than for the corresponding AcMNPV promoters, despite equal numbers of late promoter motifs, indicating that species-specific elements contained in some late promoters were favored by the native viral RNA polymerases for optimal transcription. The 8-nt sequence TAAATAAG encompassing the ATAAG motif was conserved in the AcMNPV polh, p10, and pk1 promoters. The 5-nt sequence CAATT located 4 or 5 nt upstream of the T/ATAAG motif was conserved in the promoters of PlxyGV gran, p10c, and pk1. The results of this study demonstrated that PlxyGV late gene promoters could be effectively activated by the RNA polymerase from AcMNPV, implying that late gene expression systems are regulated by similar mechanisms in alphabaculoviruses and betabaculoviruses.

  15. Ras1 interacts with multiple new signaling and cytoskeletal loci in Drosophila eggshell patterning and morphogenesis.

    PubMed Central

    Schnorr, J D; Holdcraft, R; Chevalier, B; Berg, C A

    2001-01-01

    Little is known about the genes that interact with Ras signaling pathways to regulate morphogenesis. The synthesis of dorsal eggshell structures in Drosophila melanogaster requires multiple rounds of Ras signaling followed by dramatic epithelial sheet movements. We took advantage of this process to identify genes that link patterning and morphogenesis; we screened lethal mutations on the second chromosome for those that could enhance a weak Ras1 eggshell phenotype. Of 1618 lethal P-element mutations tested, 13 showed significant enhancement, resulting in forked and fused dorsal appendages. Our genetic and molecular analyses together with information from the Berkeley Drosophila Genome Project reveal that 11 of these lines carry mutations in previously characterized genes. Three mutations disrupt the known Ras1 cell signaling components Star, Egfr, and Blistered, while one mutation disrupts Sec61beta, implicated in ligand secretion. Seven lines represent cell signaling and cytoskeletal components that are new to the Ras1 pathway; these are Chickadee (Profilin), Tec29, Dreadlocks, POSH, Peanut, Smt3, and MESK2, a suppressor of dominant-negative Ksr. A twelfth insertion disrupts two genes, Nrk, a "neurospecific" receptor tyrosine kinase, and Tpp, which encodes a neuropeptidase. These results suggest that Ras1 signaling during oogenesis involves novel components that may be intimately associated with additional signaling processes and with the reorganization of the cytoskeleton. To determine whether these Ras1 Enhancers function upstream or downstream of the Egf receptor, four mutations were tested for their ability to suppress an activated Egfr construct (lambdatop) expressed in oogenesis exclusively in the follicle cells. Mutations in Star and l(2)43Bb had no significant effect upon the lambdatop eggshell defect whereas smt3 and dock alleles significantly suppressed the lambdatop phenotype. PMID:11606538

  16. Ras1 interacts with multiple new signaling and cytoskeletal loci in Drosophila eggshell patterning and morphogenesis.

    PubMed

    Schnorr, J D; Holdcraft, R; Chevalier, B; Berg, C A

    2001-10-01

    Little is known about the genes that interact with Ras signaling pathways to regulate morphogenesis. The synthesis of dorsal eggshell structures in Drosophila melanogaster requires multiple rounds of Ras signaling followed by dramatic epithelial sheet movements. We took advantage of this process to identify genes that link patterning and morphogenesis; we screened lethal mutations on the second chromosome for those that could enhance a weak Ras1 eggshell phenotype. Of 1618 lethal P-element mutations tested, 13 showed significant enhancement, resulting in forked and fused dorsal appendages. Our genetic and molecular analyses together with information from the Berkeley Drosophila Genome Project reveal that 11 of these lines carry mutations in previously characterized genes. Three mutations disrupt the known Ras1 cell signaling components Star, Egfr, and Blistered, while one mutation disrupts Sec61beta, implicated in ligand secretion. Seven lines represent cell signaling and cytoskeletal components that are new to the Ras1 pathway; these are Chickadee (Profilin), Tec29, Dreadlocks, POSH, Peanut, Smt3, and MESK2, a suppressor of dominant-negative Ksr. A twelfth insertion disrupts two genes, Nrk, a "neurospecific" receptor tyrosine kinase, and Tpp, which encodes a neuropeptidase. These results suggest that Ras1 signaling during oogenesis involves novel components that may be intimately associated with additional signaling processes and with the reorganization of the cytoskeleton. To determine whether these Ras1 Enhancers function upstream or downstream of the Egf receptor, four mutations were tested for their ability to suppress an activated Egfr construct (lambdatop) expressed in oogenesis exclusively in the follicle cells. Mutations in Star and l(2)43Bb had no significant effect upon the lambdatop eggshell defect whereas smt3 and dock alleles significantly suppressed the lambdatop phenotype.

  17. Isolation and characterization of a novel pollen-specific promoter in maize (Zea mays L.).

    PubMed

    Wang, He; Fan, Mingxia; Wang, Guohong; Zhang, Chunyu; Shi, Lei; Wei, Zhengyi; Ma, Wenjuan; Chang, Jing; Huang, Senxin; Lin, Feng

    2017-06-01

    ZmSTK2_USP, located on the long arm of chromosome 4, belongs to the serine/threonine kinase gene in maize. The sequence analysis of 2100 bp upstream from the start codon ATG has shown that it contains cis-element motifs and two types of anther/pollen-specific promoter elements (GTGA and AGAAA), suggesting that it is the pollen-specific promoter. To investigate the function of ZmSTK2_USP promoter, the GUS gene fusion system was employed. In proZmSTK2_USP-GUS genetically modified plants, GUS activity was detected in mature pollen grains and pollen tubes but not found in other floral and vegetative tissues. These results show that proZmSTK2_USP is the pollen-specific promoter and drives pollen-specific activity during the middle stage of pollen development until pollen maturation.

  18. Identification and characterization of regulatory elements in the promoter of ACVR1, the gene mutated in Fibrodysplasia Ossificans Progressiva

    PubMed Central

    2013-01-01

    Background The ACVR1 gene encodes a type I receptor for bone morphogenetic proteins (BMPs). Mutations in the ACVR1 gene are associated with Fibrodysplasia Ossificans Progressiva (FOP), a rare and extremely disabling disorder characterized by congenital malformation of the great toes and progressive heterotopic endochondral ossification in muscles and other non-skeletal tissues. Several aspects of FOP pathophysiology are still poorly understood, including mechanisms regulating ACVR1 expression. This work aimed to identify regulatory elements that control ACVR1 gene transcription. Methods and results We first characterized the structure and composition of human ACVR1 gene transcripts by identifying the transcription start site, and then characterized a 2.9 kb upstream region. This region showed strong activating activity when tested by reporter gene assays in transfected cells. We identified specific elements within the 2.9 kb region that are important for transcription factor binding using deletion constructs, co-transfection experiments with plasmids expressing selected transcription factors, site-directed mutagenesis of consensus binding-site sequences, and by protein/DNA binding assays. We also characterized a GC-rich minimal promoter region containing binding sites for the Sp1 transcription factor. Conclusions Our results showed that several transcription factors such as Egr-1, Egr-2, ZBTB7A/LRF, and Hey1, regulate the ACVR1 promoter by binding to the -762/-308 region, which is essential to confer maximal transcriptional activity. The Sp1 transcription factor acts at the most proximal promoter segment upstream of the transcription start site. We observed significant differences in different cell types suggesting tissue specificity of transcriptional regulation. These findings provide novel insights into the molecular mechanisms that regulate expression of the ACVR1 gene and that could be targets of new strategies for future therapeutic treatments. PMID:24047559

  19. Characterization of New Otic Enhancers of the Pou3f4 Gene Reveal Distinct Signaling Pathway Regulation and Spatio-Temporal Patterns

    PubMed Central

    Robert-Moreno, Àlex; Naranjo, Silvia; de la Calle-Mustienes, Elisa; Gómez-Skarmeta, José Luis; Alsina, Berta

    2010-01-01

    POU3F4 is a member of the POU-homedomain transcription factor family with a prominent role in inner ear development. Mutations in the human POU3F4 coding unit leads to X-linked deafness type 3 (DFN3), characterized by conductive hearing loss and progressive sensorineural deafness. Microdeletions found 1 Mb 5′ upstream of the coding region also displayed the same phenotype, suggesting that cis-regulatory elements might be present in that region. Indeed, we and others have recently identified several enhancers at the 1 Mb 5′ upstream interval of the pou3f4 locus. Here we characterize the spatio-temporal patterns of these regulatory elements in zebrafish transgenic lines. We show that the most distal enhancer (HCNR 81675) is activated earlier and drives GFP reporter expression initially to a broad ear domain to progressively restrict to the sensory patches. The proximal enhancer (HCNR 82478) is switched later during development and promotes expression, among in other tissues, in sensory patches from its onset. The third enhancer (HCNR 81728) is also active at later stages in the otic mesenchyme and in the otic epithelium. We also characterize the signaling pathways regulating these enhancers. While HCNR 81675 is regulated by very early signals of retinoic acid, HCNR 82478 is regulated by Fgf activity at a later stage and the HCNR 81728 enhancer is under the control of Hh signaling. Finally, we show that Sox2 and Pax2 transcription factors are bound to HCNR 81675 genomic region during otic development and specific mutations to these transcription factor binding sites abrogates HCNR 81675 enhancer activity. Altogether, our results suggest that pou3f4 expression in inner ear might be under the control of distinct regulatory elements that fine-tune the spatio-temporal activity of this gene and provides novel data on the signaling mechanisms controlling pou3f4 function. PMID:21209840

  20. Synergism between a half-site and an imperfect estrogen-responsive element, and cooperation with COUP-TFI are required for estrogen receptor (ER) to achieve a maximal estrogen-stimulation of rainbow trout ER gene.

    PubMed

    Petit, F G; Métivier, R; Valotaire, Y; Pakdel, F

    1999-01-01

    In all oviparous, liver represents one of the main E2-target tissues where estrogen receptor (ER) constitutes the key mediator of estrogen action. The rainbow trout estrogen receptor (rtER) gene expression is markedly up-regulated by estrogens and the sequences responsible for this autoregulation have been located in a 0.2 kb upstream transcription start site within - 40/- 248 enhancer region. Absence of interference with steroid hormone receptors and tissue-specific factors and a conserved basal transcriptional machinery between yeast and higher eukaryotes, make yeast a simple assay system that will enable determination of important cis-acting regulatory sequences within rtER gene promoter and identification of transcription factors implicated in the regulation of this gene. Deletion analysis allowed to show a synergistic effect between an imperfect estrogen-responsive element (ERE) and a consensus half-ERE to achieve a high hormone-dependent transcriptional activation of the rtER gene promoter in the presence of stably expressed rtER. As in mammalian cells, here we observed a positive regulation of the rtER gene promoter by the chicken ovalbumin upstream promoter-transcription factor I (COUP-TFI) through enhancing autoregulation. Using a point mutation COUP-TFI mutant unable to bind DNA demonstrates that enhancement of rtER gene autoregulation requires the interaction of COUP-TFI to the DNA. Moreover, this enhancement of transcriptional activation by COUP-TFI requires specifically the AF-1 transactivation function of ER and can be observed in the presence of E2 or 4-hydroxytamoxifen but not ICI 164384. Thus, this paper describes the reconstitution of a hormone-responsive transcription unit in yeast in which the regulation of rtER gene promoter could be enhanced by the participation of cis-elements and/or trans-acting factors, such as ER itself or COUP-TF.

  1. The effects of land use on fluvial sediment chemistry for the conterminous U.S. - Results from the first cycle of the NAWQA Program: Trace and major elements, phosphorus, carbon, and sulfur

    USGS Publications Warehouse

    Horowitz, A.J.; Stephens, V.C.

    2008-01-01

    In 1991, the U.S. Geological Survey (USGS) began the first cycle of its National Water Quality Assessment (NAWQA) Program. The Program encompassed 51 river basins that collectively accounted for more than 70% of the total water use (excluding power generation), and 50% of the drinking water supply in the U.S. The basins represented a variety of hydrologic settings, rock types (geology), land-use categories, and population densities. One aspect of the first cycle included bed sediment sampling; sites were chosen to represent baseline and important land-use categories (e.g., agriculture, urban) in each basin. In total, over 1200 bed sediment samples were collected. All samples were size-limited (< 63????m) to facilitate spatial and/or temporal comparisons, and subsequently analyzed for a variety of chemical constituents including major (e.g., Fe, Al,) and trace elements (e.g., Cu, Zn, Cd), nutrients (e.g., P), and carbon. The analyses yielded total (??? 95% of the concentrations present), rather than total-recoverable chemical data. Land-use percentages, upstream underlying geology, and population density were determined for each site and evaluated to asses their relative influence on sediment chemistry. Baseline concentrations for the entire U.S. also were generated from a subset of all the samples, and are based on material collected from low population (??? 27??p km- 2) density, low percent urban (??? 5%), agricultural or undeveloped areas. The NAWQA baseline values are similar to those found in other national and global datasets. Further, it appears that upstream/underlying rock type has only a limited effect (mostly major elements) on sediment chemistry. The only land-use category that appears to substantially affect sediment chemistry is percent urban, and this result is mirrored by population density; in fact, the latter appears more consistent than the former.

  2. Ventromedial hypothalamic neurons control a defensive emotion state

    PubMed Central

    Kunwar, Prabhat S; Zelikowsky, Moriel; Remedios, Ryan; Cai, Haijiang; Yilmaz, Melis; Meister, Markus; Anderson, David J

    2015-01-01

    Defensive behaviors reflect underlying emotion states, such as fear. The hypothalamus plays a role in such behaviors, but prevailing textbook views depict it as an effector of upstream emotion centers, such as the amygdala, rather than as an emotion center itself. We used optogenetic manipulations to probe the function of a specific hypothalamic cell type that mediates innate defensive responses. These neurons are sufficient to drive multiple defensive actions, and required for defensive behaviors in diverse contexts. The behavioral consequences of activating these neurons, moreover, exhibit properties characteristic of emotion states in general, including scalability, (negative) valence, generalization and persistence. Importantly, these neurons can also condition learned defensive behavior, further refuting long-standing claims that the hypothalamus is unable to support emotional learning and therefore is not an emotion center. These data indicate that the hypothalamus plays an integral role to instantiate emotion states, and is not simply a passive effector of upstream emotion centers. DOI: http://dx.doi.org/10.7554/eLife.06633.001 PMID:25748136

  3. 26 CFR 1.72-5 - Expected return.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... the joint and survivor annuity element 110.40 Multiple from Table I (male, age 60) 18.2 Number of... anticipatable with respect to the joint and survivor annuity element 124.80 Multiple from Table V (age 60) 24.2... annuity payments to be received annually by the multiple shown in Table I or V (whichever is applicable...

  4. 26 CFR 1.72-5 - Expected return.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... the joint and survivor annuity element 110.40 Multiple from Table I (male, age 60) 18.2 Number of... anticipatable with respect to the joint and survivor annuity element 124.80 Multiple from Table V (age 60) 24.2... annuity payments to be received annually by the multiple shown in Table I or V (whichever is applicable...

  5. 26 CFR 1.72-5 - Expected return.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... the joint and survivor annuity element 110.40 Multiple from Table I (male, age 60) 18.2 Number of... anticipatable with respect to the joint and survivor annuity element 124.80 Multiple from Table V (age 60) 24.2... annuity payments to be received annually by the multiple shown in Table I or V (whichever is applicable...

  6. 26 CFR 1.72-5 - Expected return.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... the joint and survivor annuity element 110.40 Multiple from Table I (male, age 60) 18.2 Number of... anticipatable with respect to the joint and survivor annuity element 124.80 Multiple from Table V (age 60) 24.2... annuity payments to be received annually by the multiple shown in Table I or V (whichever is applicable...

  7. Gene-breaking: A new paradigm for human retrotransposon-mediated gene evolution

    PubMed Central

    Wheelan, Sarah J.; Aizawa, Yasunori; Han, Jeffrey S.; Boeke, Jef D.

    2005-01-01

    The L1 retrotransposon is the most highly successful autonomous retrotransposon in mammals. This prolific genome parasite may on occasion benefit its host through genome rearrangements or adjustments of host gene expression. In examining possible effects of L1 elements on host gene expression, we investigated whether a full-length L1 element inserted in the antisense orientation into an intron of a cellular gene may actually split the gene's transcript into two smaller transcripts: (1) a transcript containing the upstream exons and terminating in the major antisense polyadenylation site (MAPS) of the L1, and (2) a transcript derived from the L1 antisense promoter (ASP) that includes the downstream exons of the gene. Bioinformatic analysis and experimental follow-up provide evidence for this L1 “gene-breaking” hypothesis. We identified three human genes apparently “broken” by L1 elements, as well as 12 more candidate genes. Most of the inserted L1 elements in our 15 candidate genes predate the human/chimp divergence. If indeed split, the transcripts of these genes may in at least one case encode potentially interacting proteins, and in another case may encode novel proteins. Gene-breaking represents a new mechanism through which L1 elements remodel mammalian genomes. PMID:16024818

  8. Prediction of Geomagnetic Activity and Key Parameters in High-Latitude Ionosphere-Basic Elements

    NASA Technical Reports Server (NTRS)

    Lyatsky, W.; Khazanov, G. V.

    2007-01-01

    Prediction of geomagnetic activity and related events in the Earth's magnetosphere and ionosphere is an important task of the Space Weather program. Prediction reliability is dependent on the prediction method and elements included in the prediction scheme. Two main elements are a suitable geomagnetic activity index and coupling function -- the combination of solar wind parameters providing the best correlation between upstream solar wind data and geomagnetic activity. The appropriate choice of these two elements is imperative for any reliable prediction model. The purpose of this work was to elaborate on these two elements -- the appropriate geomagnetic activity index and the coupling function -- and investigate the opportunity to improve the reliability of the prediction of geomagnetic activity and other events in the Earth's magnetosphere. The new polar magnetic index of geomagnetic activity and the new version of the coupling function lead to a significant increase in the reliability of predicting the geomagnetic activity and some key parameters, such as cross-polar cap voltage and total Joule heating in high-latitude ionosphere, which play a very important role in the development of geomagnetic and other activity in the Earth s magnetosphere, and are widely used as key input parameters in modeling magnetospheric, ionospheric, and thermospheric processes.

  9. The genomic view of genes responsive to the antagonistic phytohormones, abscisic acid, and gibberellin.

    PubMed

    Yazaki, Junshi; Kikuchi, Shoshi

    2005-01-01

    We now have the various genomics tools for monocot (Oryza sativa) and a dicot (Arabidopsis thaliana) plant. Plant is not only a very important agricultural resource but also a model organism for biological research. It is important that the interaction between ABA and GA is investigated for controlling the transition from embryogenesis to germination in seeds using genomics tools. These studies have investigated the relationship between dormancy and germination using genomics tools. Genomics tools identified genes that had never before been annotated as ABA- or GA-responsive genes in plant, detected new interactions between genes responsive to the two hormones, comprehensively characterized cis-elements of hormone-responsive genes, and characterized cis-elements of rice and Arabidopsis. In these research, ABA- and GA-regulated genes have been classified as functional proteins (proteins that probably function in stress or PR tolerance) and regulatory proteins (protein factors involved in further regulation of signal transduction). Comparison between ABA and/or GA-responsive genes in rice and those in Arabidopsis has shown that the cis-element has specificity in each species. cis-Elements for the dehydration-stress response have been specified in Arabidopsis but not in rice. cis-Elements for protein storage are remarkably richer in the upstream regions of the rice gene than in those of Arabidopsis.

  10. Hydrochemical study of an arsenic-contaminated plain in Guandu, north Taiwan

    NASA Astrophysics Data System (ADS)

    Hsiao, Yu-Hsiang

    2015-04-01

    Arsenic pollution in Guandu Plain, north Taiwan is a critical issue due to highly developed anthropogenic activities. It was considered that arsenic was carried in by surface water system. Two major rivers, Huanggang Creek and South Huang Greek, flow through Guandu Plain. Both creeks originate from Tatung Volcano Group, which is extensively active in post-volcanic activities. In this study, the hydrochemistry along the two major rivers was studied for tracing the source of arsenic pollution in Guandu Plain. The pH values in the upstream water are in the range from 6 to 8 but dramatically decrease down to 2-4.5 in the downstream area. It can be concluded that the creeks are recharged with very low pH geothermal water. In addition, arsenic shows a different spatial distribution. In Huanggang Creek, arsenic concentration is much higher, about 200 ppb to 500 ppb, in the downstream than in the upstream while arsenic concentration is extremely low, below 1 ppb, in the downstream of South Huang Greek. The geochemical results show that rare earth elements (REEs) are depleted in the upstream both in Huanggang creek and South Huang creek, and the NASC-normalized ratios of heavy to light REE (Lu/La) in the upstream are very close to 1. This demonstrates that the upstream water is geochemically dominated by the interaction between water and sedimentary rock. In the downstream, the NASC-normalized REE pattern shows a quit different type which is depleted in light REEs (much higher Lu/La ratio). It is well known that igneous rock is depleted in light REEs; therefore, arsenic is possibly volcanic origin. In this study, PHREEQC, a thermodynamic modeling program, was also utilized to calculate the saturation index (SI) of hydrous ferric oxide (HFO), which can effectively scavenge arsenic in water. The results demonstrate that SI of HFO is mainly controlled by pH in this study. When pH is greater than 3.5, HFO start to precipitate and remove arsenic from water. Therefore, it is believed that the arsenic pollution in Guandu Plain could result from HFO co-precipitation due to the increase of pH when Huanggang creek and South Huang creek flow through the land.

  11. [Bacteriophage λ: electrostatic properties of the genome and its elements].

    PubMed

    Krutinina, G G; Krutinin, E A; Kamzolova, S G; Osypov, A A

    2015-01-01

    Bacteriophage λ is a classical model object in molecular biology, but little is still known on the physical properties of its DNA and regulatory elements. A study was made of the electrostatic properties of phage λ DNA and regulatory elements. A global electrostatic potential distribution along the phage genome was found to be nonuniform with main regulatory elements being located in a limited region with a high potential. The RNA polymerase binding frequency on the linearized phage chromosome directly correlates with its local potential. Strong promoters of the phage and its host Escherichia coli have distinct electrostatic upstream elements, which differ in nucleotide sequence. Attachment and recombination sites of phage λ and its host have a higher potential, which possibly facilitates their recognition by integrase. Phage λ and host Rho-independent terminators have a symmetrical M-shaped potential profile, which only slightly depends on the annotated terminator palindrome length, and occur in a region with a substantially higher potential, which may cause polymerase retention, facilitating the formation of a terminator hairpin in RNA. It was concluded that virtually all elements of phage λ genome have potential distribution specifics, which are related to their structural properties and may play a role in their biological function. The global potential distribution along the phage genome reflects the architecture of the regulation of its transcription and integration in the host genome.

  12. Two cis elements collaborate to spatially repress transcription from a sea urchin promoter

    NASA Technical Reports Server (NTRS)

    Frudakis, T. N.; Wilt, F.

    1995-01-01

    The expression pattern of many territory-specific genes in metazoan embryos is maintained by an active process of negative spatial regulation. However, the mechanism of this strategy of gene regulation is not well understood in any system. Here we show that reporter constructs containing regulatory sequence for the SM30-alpha gene of Stronglyocentrotus purpuratus are expressed in a pattern congruent with that of the endogenous SM30 gene(s), largely as a result of active transcriptional repression in cell lineages in which the gene is not normally expressed. Chloramphenicol acetyl transferase assays of deletion constructs from the 2600-bp upstream region showed that repressive elements were present in the region from -1628 to -300. In situ hybridization analysis showed that the spatial fidelity of expression was severely compromised when the region from -1628 to -300 was deleted. Two highly repetitive sequence motifs, (G/A/C)CCCCT and (T/C)(T/A/C)CTTTT(T/A/C), are present in the -1628 to -300 region. Representatives of these elements were analyzed by gel mobility shift experiments and were found to interact specifically with protein in crude nuclear extracts. When oligonucleotides containing either sequence element were co-injected with a correctly regulated reporter as potential competitors, the reporter was expressed in inappropriate cells. When composite oligonucleotides, containing both sequence elements, were fused to a misregulated reporter, the expression of the reporter in inappropriate cells was suppressed. Comparison of composite oligonucleotides with oligonucleotides containing single constituent elements show that both sequence elements are required for effective spatial regulation. Thus, both individual elements are required, but only a composite element containing both elements is sufficient to function as a tissue-specific repressive element.

  13. Promoter activity of polypyrimidine tract-binding protein genes of potato responds to environmental cues.

    PubMed

    Butler, Nathaniel M; Hannapel, David J

    2012-12-01

    Polypyrimidine tract-binding (PTB) proteins are RNA-binding proteins that target specific RNAs for post-transcriptional processing by binding cytosine/uracil motifs. PTBs have established functions in a range of RNA processes including splicing, translation, stability and long-distance transport. Six PTB-like genes identified in potato have been grouped into two clades based on homology to other known plant PTBs. StPTB1 and StPTB6 are closely related to a PTB protein discovered in pumpkin, designated CmRBP50, and contain four canonical RNA-recognition motifs. CmRBP50 is expressed in phloem tissues and functions as the core protein of a phloem-mobile RNA/protein complex. Sequence from the potato genome database was used to clone the upstream sequence of these two PTB genes and analyzed to identify conserved cis-elements. The promoter of StPTB6 was enriched for regulatory elements for light and sucrose induction and defense. Upstream sequence of both PTB genes was fused to β-glucuronidase and monitored in transgenic potato lines. In whole plants, the StPTB1 promoter was most active in leaf veins and petioles, whereas StPTB6 was most active in leaf mesophyll. Both genes are active in new tubers and tuber sprouts. StPTB6 expression was induced in stems and stolon sections in response to sucrose and in leaves or petioles in response to light, heat, drought and mechanical wounding. These results show that CmRBP50-like genes of potato exhibit distinct expression patterns and respond to both developmental and environmental cues.

  14. Control of alternative splicing by forskolin through hnRNP K during neuronal differentiation

    PubMed Central

    Cao, Wenguang; Razanau, Aleh; Feng, Dairong; Lobo, Vincent G.; Xie, Jiuyong

    2012-01-01

    The molecular basis of cell signal-regulated alternative splicing at the 3′ splice site remains largely unknown. We isolated a protein kinase A-responsive ribonucleic acid (RNA) element from a 3′ splice site of the synaptosomal-associated protein 25 (Snap25) gene for forskolin-inhibited splicing during neuronal differentiation of rat pheochromocytoma PC12 cells. The element binds specifically to heterogeneous nuclear ribonucleo protein (hnRNP) K in a phosphatase-sensitive way, which directly competes with the U2 auxiliary factor U2AF65, an essential component of early spliceosomes. Transcripts with similarly localized hnRNP K target motifs upstream of alternative exons are enriched in genes often associated with neurological diseases. We show that such motifs upstream of the Runx1 exon 6 also bind hnRNP K, and importantly, hnRNP K is required for forskolin-induced repression of the exon. Interestingly, this exon encodes the peptide domain that determines the switch of the transcriptional repressor/activator activity of Runx1, a change known to be critical in specifying neuron lineages. Consistent with an important role of the target genes in neurons, knocking down hnRNP K severely disrupts forskolin-induced neurite growth. Thus, through hnRNP K, the neuronal differentiation stimulus forskolin targets a critical 3′ splice site component of the splicing machinery to control alternative splicing of crucial genes. This also provides a regulated direct competitor of U2AF65 for cell signal control of 3′ splice site usage. PMID:22684629

  15. Bacillus subtilis δ Factor Functions as a Transcriptional Regulator by Facilitating the Open Complex Formation.

    PubMed

    Prajapati, Ranjit Kumar; Sengupta, Shreya; Rudra, Paulami; Mukhopadhyay, Jayanta

    2016-01-15

    Most bacterial RNA polymerases (RNAP) contain five conserved subunits, viz. 2α, β, β', and ω. However, in many Gram-positive bacteria, especially in fermicutes, RNAP is associated with an additional factor, called δ. For over three decades since its identification, it had been thought that δ functioned as a subunit of RNAP to enhance the level of transcripts by recycling RNAP. In support of the previous observations, we also find that δ is involved in recycling of RNAP by releasing the RNA from the ternary complex. We further show that δ binds to RNA and is able to recycle RNAP when the length of the nascent RNA reaches a critical length. However, in this work we decipher a new function of δ. Performing biochemical and mutational analysis, we show that Bacillus subtilis δ binds to DNA immediately upstream of the promoter element at A-rich sequences on the abrB and rrnB1 promoters and facilitates open complex formation. As a result, δ facilitates RNAP to initiate transcription in the second scale, compared with minute scale in the absence of δ. Using transcription assay, we show that δ-mediated recycling of RNAP cannot be the sole reason for the enhancement of transcript yield. Our observation that δ does not bind to RNAP holo enzyme but is required to bind to DNA upstream of the -35 promoter element for transcription activation suggests that δ functions as a transcriptional regulator. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Deciphering the Regulatory Logic of an Ancient, Ultraconserved Nuclear Receptor Enhancer Module

    PubMed Central

    Bagamasbad, Pia D.; Bonett, Ronald M.; Sachs, Laurent; Buisine, Nicolas; Raj, Samhitha; Knoedler, Joseph R.; Kyono, Yasuhiro; Ruan, Yijun; Ruan, Xiaoan

    2015-01-01

    Cooperative, synergistic gene regulation by nuclear hormone receptors can increase sensitivity and amplify cellular responses to hormones. We investigated thyroid hormone (TH) and glucocorticoid (GC) synergy on the Krüppel-like factor 9 (Klf9) gene, which codes for a zinc finger transcription factor involved in development and homeostasis of diverse tissues. We identified regions of the Xenopus and mouse Klf9 genes 5–6 kb upstream of the transcription start sites that supported synergistic transactivation by TH plus GC. Within these regions, we found an orthologous sequence of approximately 180 bp that is highly conserved among tetrapods, but absent in other chordates, and possesses chromatin marks characteristic of an enhancer element. The Xenopus and mouse approximately 180-bp DNA element conferred synergistic transactivation by hormones in transient transfection assays, so we designate this the Klf9 synergy module (KSM). We identified binding sites within the mouse KSM for TH receptor, GC receptor, and nuclear factor κB. TH strongly increased recruitment of liganded GC receptor and serine 5 phosphorylated (initiating) RNA polymerase II to chromatin at the KSM, suggesting a mechanism for transcriptional synergy. The KSM is transcribed to generate long noncoding RNAs, which are also synergistically induced by combined hormone treatment, and the KSM interacts with the Klf9 promoter and a far upstream region through chromosomal looping. Our findings support that the KSM plays a central role in hormone regulation of vertebrate Klf9 genes, it evolved in the tetrapod lineage, and has been maintained by strong stabilizing selection. PMID:25866873

  17. Murine homeobox-containing gene, Msx-1: analysis of genomic organization, promoter structure, and potential autoregulatory cis-acting elements.

    PubMed

    Kuzuoka, M; Takahashi, T; Guron, C; Raghow, R

    1994-05-01

    Detailed molecular organization of the coding and upstream regulatory regions of the murine homeodomain-containing gene, Msx-1, is reported. The protein-encoding portion of the gene is contained in two exons, 590 and 1214 bp in length, separated by a 2107-bp intron; the homeodomain is located in the second exon. The two-exon organization of the murine Msx-1 gene resembles a number of other homeodomain-containing genes. The 5'-(GTAAGT) and 3'-(CCCTAG) splicing junctions and the mRNA polyadenylation signal (UAUAA) of the murine Msx-1 gene are also characteristic of other vertebrate genes. By nuclease protection and primer extension assays, the start of transcription of the Msx-1 gene was located 256 bp upstream of the first AUG. Computer analysis of the promoter proximal 1280-bp sequence revealed a number of potentially important cis-regulatory sequences; these include the recognition elements for Ap-1, Ap-2, Ap-3, Sp-1, a possible binding site for RAR:RXR, and a number of TCF-1 consensus motifs. Importantly, a perfect reverse complement of (C/G)TTAATTG, which was recently shown to be an optimal binding sequence for the homeodomain of Msx-1 protein (K.M. Catron, N. Iler, and C. Abate (1993) Mol. Cell. Biol. 13:2354-2365), was also located in the murine Msx-1 promoter. Binding of bacterially expressed Msx-1 homeodomain polypeptide to Msx-1-specific oligonucleotide was experimentally demonstrated, raising a distinct possibility of autoregulation of this developmentally regulated gene.

  18. Application of direct-reading and elemental carbon analysis methods to measure mass-based penetration of carbon nanotubes through elastomeric half-face and filtering facepiece respirators.

    PubMed

    Vo, Evanly; Zhuang, Ziqing; Birch, Eileen; Birch, Quinn

    2016-01-01

    The aim of this study was to apply a direct-reading aerosol instrument method and an elemental carbon (EC) analysis method to measure the mass-based penetration of single-walled carbon nanotubes (SWCNTs) and multi-walled carbon nanotubes (MWCNTs) through elastomeric half-mask respirators (EHRs) and filtering facepiece respirators (FFRs). For the direct-reading aerosol instrument method, two scanning mobility particle sizer/aerodynamic particle sizer systems were used to simultaneously determine the upstream (outside respirator) and downstream (inside respirator) test aerosols. For the EC analysis method, upstream and downstream CNTs were collected on filter cassettes and then analyzed using a thermal-optical technique. CNT mass penetrations were found in both methods to be within the associated efficiency requirements for each type and class of the respirator models that were tested. Generally, the penetrations of SWCNTs and MWCNTs had a similar trend with penetration being the highest for the N95 EHRs, followed by N95 FFRs, P100 EHRs, and P100 FFRs. This trend held true for both methods; however, the CNT penetration determined by the direct-reading aerosol instrument method (0.009-1.09% for SWCNTs and 0.005-0.21% for MWCNTs) was greater relative to the penetration values found through EC analysis method (0.007-0.69% for SWCNTs and 0.004-0.13% for MWCNTs). The results of this study illustrate considerations for how the methods can be used to evaluate penetration of morphologically complex materials through FFRs and EHRs.

  19. Metabolic pathways as possible therapeutic targets for progressive multiple sclerosis.

    PubMed

    Heidker, Rebecca M; Emerson, Mitchell R; LeVine, Steven M

    2017-08-01

    Unlike relapsing remitting multiple sclerosis, there are very few therapeutic options for patients with progressive forms of multiple sclerosis. While immune mechanisms are key participants in the pathogenesis of relapsing remitting multiple sclerosis, the mechanisms underlying the development of progressive multiple sclerosis are less well understood. Putative mechanisms behind progressive multiple sclerosis have been put forth: insufficient energy production via mitochondrial dysfunction, activated microglia, iron accumulation, oxidative stress, activated astrocytes, Wallerian degeneration, apoptosis, etc . Furthermore, repair processes such as remyelination are incomplete. Experimental therapies that strive to improve metabolism within neurons and glia, e.g. , oligodendrocytes, could act to counter inadequate energy supplies and/or support remyelination. Most experimental approaches have been examined as standalone interventions; however, it is apparent that the biochemical steps being targeted are part of larger pathways, which are further intertwined with other metabolic pathways. Thus, the potential benefits of a tested intervention, or of an established therapy, e.g. , ocrelizumab, could be undermined by constraints on upstream and/or downstream steps. If correct, then this argues for a more comprehensive, multifaceted approach to therapy. Here we review experimental approaches to support neuronal and glial metabolism, and/or promote remyelination, which may have potential to lessen or delay progressive multiple sclerosis.

  20. Analyzing the Impacts of Dams on Riparian Ecosystems: A Review of Research Strategies and Their Relevance to the Snake River Through Hells Canyon

    PubMed Central

    Braatne, Jeffrey H.; Goater, Lori A.; Blair, Charles L.

    2007-01-01

    River damming provides a dominant human impact on river environments worldwide, and while local impacts of reservoir flooding are immediate, subsequent ecological impacts downstream can be extensive. In this article, we assess seven research strategies for analyzing the impacts of dams and river flow regulation on riparian ecosystems. These include spatial comparisons of (1) upstream versus downstream reaches, (2) progressive downstream patterns, or (3) the dammed river versus an adjacent free-flowing or differently regulated river(s). Temporal comparisons consider (4) pre- versus post-dam, or (5) sequential post-dam conditions. However, spatial comparisons are complicated by the fact that dams are not randomly located, and temporal comparisons are commonly limited by sparse historic information. As a result, comparative approaches are often correlative and vulnerable to confounding factors. To complement these analyses, (6) flow or sediment modifications can be implemented to test causal associations. Finally, (7) process-based modeling represents a predictive approach incorporating hydrogeomorphic processes and their biological consequences. In a case study of Hells Canyon, the upstream versus downstream comparison is confounded by a dramatic geomorphic transition. Comparison of the multiple reaches below the dams should be useful, and the comparison of Snake River with the adjacent free-flowing Salmon River may provide the strongest spatial comparison. A pre- versus post-dam comparison would provide the most direct study approach, but pre-dam information is limited to historic reports and archival photographs. We conclude that multiple study approaches are essential to provide confident interpretations of ecological impacts downstream from dams, and propose a comprehensive study for Hells Canyon that integrates multiple research strategies. PMID:18043964

  1. Negative and positive regulation by a short segment in the 5'-flanking region of the human cytomegalovirus major immediate-early gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nelson, J.A.; Reynolds-Kohler, C.; Smith, B.A.

    1987-11-01

    To analyze the significance of inducible DNase I-hypersensitive sites occurring in the 5'-flanking sequence of the major immediate-early gene of human cytomegalovirus (HCMV), various deleted portions of the HCMV immediate-early promoter regulatory region were attached to the chloramphenicol acetyltransferase (CAT) gene and assayed for activity in transiently transfected undifferentiated and differentiated human teratocarcinoma cells, Tera-2. Assays of progressive deletions in the promoter regulatory region indicated that removal of a 395-base-pair portion of this element (nucleotides -750 to -1145) containing two inducible DNase I sites which correlate with gene expression resulted in a 7.5-fold increase in CAT activity in undifferentiated cells.more » However, in permissive differentiated Tera-2, human foreskin fibroblast, and HeLa cells, removal of this regulatory region resulted in decreased activity. In addition, attachment of this HCMV upstream element to a homologous or heterologous promoter increased activity three-to fivefold in permissive cells. Therefore, a cis regulatory element exists 5' to the enhancer of the major immediate-early gene of HCMV. This element negatively modulates expression in nonpermissive cells but positively influences expression in permissive cells.« less

  2. Transcriptional activation of rat creatine kinase B by 17beta-estradiol in MCF-7 cells involves an estrogen responsive element and GC-rich sites.

    PubMed

    Wang, F; Samudio, I; Safe, S

    2001-01-01

    The rat creatine kinase B (CKB) gene is induced by estrogen in the uterus, and constructs containing rat CKB gene promoter inserts are highly estrogen-responsive in cell culture. Analysis of the upstream -568 to -523 region of the promoter in HeLa cells has identified an imperfect palindromic estrogen response element (ERE) that is required for hormone inducibility. Analysis of the CKB gene promoter in MCF-7 breast cancer cells confirmed that pCKB7 (containing the -568 to -523 promoter insert) was estrogen-responsive in transient transfection studies. However, mutation and deletion analysis of this region of the promoter showed that two GC-rich sites and the concensus ERE were functional cis-elements that bound estrogen receptor alpha (ERalpha)/Sp1 and ERalpha proteins, respectively. The role of these elements was confirmed in gel mobility shift and chromatin immunoprecipitation assays and transfection studies in MDA-MB-231 and Schneider Drosophila SL-2 cells. These results show that transcriptional activation of CKB by estrogen is dependent, in part, on ERalpha/Sp1 action which is cell context-dependent. Copyright 2001 Wiley-Liss, Inc.

  3. Prototyping phase of the high heat flux scraper element of Wendelstein 7-X

    DOE PAGES

    Boscary, Jean; Greuner, Henri; Ehrke, G.; ...

    2016-03-24

    The water-cooled high heat flux scraper element aims to reduce excessive heat loads on the target element ends of the actively cooled divertor of Wendelstein 7-X. Its purpose is to intercept some of the plasma fluxes both upstream and downstream before they reach the divertor surface. The scraper element has 24 identical plasma facing components (PFCs) divided into 6 modules. One module has 4 PFCs hydraulically connected in series by 2 water boxes. A PFC, 247 mm long and 28 mm wide, has 13 monoblocks made of CFC NB31 bonded by hot isostatic pressing onto a CuCrZr cooling tube equippedmore » with a copper twisted tape. 4 full-scale prototypes of PFCs have been successfully tested in the GLADIS facility up to 20 MW/m 2. The difference observed between measured and calculated surface temperatures is probably due to the inhomogeneity of CFC properties. The design of the water box prototypes has been detailed to allow the junction between the cooling pipe of the PFCs and the water boxes by internal orbital welding. In conclusion, the prototypes are presently under fabrication.« less

  4. Two ABREs, two redundant root-specific and one W-box cis-acting elements are functional in the sunflower HAHB4 promoter.

    PubMed

    Manavella, Pablo A; Dezar, Carlos A; Ariel, Federico D; Chan, Raquel L

    2008-10-01

    HAHB4 is a sunflower gene encoding a homeodomain-leucine zipper (HD-Zip) transcription factor. It was previously demonstrated that this gene is regulated at the transcriptional level by several abiotic factors and hormones. A previous analysis in the PLACE database revealed the presence of four putative ABREs. In this work these four elements and also one W-box and two root-specific expression elements were characterized as functional. Site-directed mutagenesis on the promoter, stable transformation of Arabidopis plants as well as transient transformation of sunflower leaves, were performed. The analysis of the transformants was carried out by histochemistry and real time RT-PCR. The results indicate that just one ABRE out of the four is responsible for ABA, NaCl and drought regulation. However, NaCl induction occurs also by an additional ABA-independent way involving another two overlapped ABREs. On the other hand, it was determined that the W-box located 5' upstream is responsive to ethylene and only two root-specific expression elements, among the several detected, are functional but redundant. Conservation of molecular mechanisms between sunflower and Arabidopsis is strongly supported by this experimental work.

  5. Hybrid wireless-over-fiber transmission system based on multiple injection-locked FP LDs.

    PubMed

    Li, Chung-Yi; Lu, Hai-Han; Chu, Chien-An; Ying, Cheng-Ling; Lu, Ting-Chien; Peng, Peng-Chun

    2015-07-27

    A hybrid wireless-over-fiber (WoF) transmission system based on multiple injection-locked Fabry-Perot laser diodes (FP LDs) is proposed and experimentally demonstrated. Unlike the traditional hybrid WoF transmission systems that require multiple distributed feedback (DFB) LDs to support different kinds of services, the proposed system employs multiple injection-locked FP LDs to provide different kinds of applications. Such a hybrid WoF transmission system delivers downstream intensity-modulated 20-GHz microwave (MW)/60-GHz millimeter-wave (MMW)/550-MHz cable television (CATV) signals and upstream phase-remodulated 20-GHz MW signal. Excellent bit error rate (BER), carrier-to-noise ratio (CNR), composite second-order (CSO), and composite triple-beat (CTB) are observed over a 40-km single-mode fiber (SMF) and a 4-m radio frequency (RF) wireless transport. Such a hybrid WoF transmission system has practical applications for fiber-wireless convergence to provide broadband integrated services, including telecommunication, data communication, and CATV services.

  6. The prostaglandin receptor EP2 activates multiple signaling pathways and β-arrestin1 complex formation during mouse skin papilloma development

    PubMed Central

    Chun, Kyung-Soo; Lao, Huei-Chen; Trempus, Carol S.; Okada, Manabu; Langenbach, Robert

    2009-01-01

    Prostaglandin E2 (PGE2) is elevated in many tumor types, but PGE2's contributions to tumor growth are largely unknown. To investigate PGE2's roles, the contributions of one of its receptors, EP2, were studied using the mouse skin initiation/promotion model. Initial studies indicated that protein kinase A (PKA), epidermal growth factor receptor (EGFR) and several effectors—cyclic adenosine 3′,5′-monophosphate response element-binding protein (CREB), H-Ras, Src, protein kinase B (AKT) and extracellular signal-regulated kinase (ERK)1/2—were activated in 12-O-tetradecanoylphorbol-13-acetate (TPA)-promoted papillomas and that PKA and EGFR inhibition (H89 and AG1478, respectively) decreased papilloma formation. EP2's contributions to the activation of these pathways and papilloma development were determined by inhibiting endogenous TPA-induced PGE2 production with indomethacin (Indo) and concomitantly treating with the EP2 agonist, CAY10399 (CAY). CAY treatment restored papilloma formation in TPA/Indo-treated mice and increased cyclic adenosine 3′,5′-monophosphate and PKA activation as measured by p-CREB formation. CAY treatment also increased EGFR and Src activation and their inhibition by AG1478 and PP2 indicated that Src was upstream of EGFR. CAY also increased H-Ras, ERK1/2 and AKT activation, and AG1478 decreased their activation indicating EGFR being upstream. Supporting EP2's contribution, EP2−/− mice exhibited 65% fewer papillomas and reduced Src, EGFR, H-Ras, AKT and ERK1/2 activation. G protein-coupled receptor (GPCR) activation of EGFR has been reported to involve Src's activation via a GPCR–β-arrestin–Src complex. Indeed, immunoprecipitation of β-arrestin1 or p-Src indicated the presence of an EP2–β-arrestin1–p-Src complex in papillomas. The data indicated that EP2 contributed to tumor formation via activation of PKA and EGFR and that EP2 formed a complex with β-arrestin1 and Src that contributed to signaling and/or EP2 desensitization. PMID:19587094

  7. The KRAS Promoter Responds to Myc-associated Zinc Finger and Poly(ADP-ribose) Polymerase 1 Proteins, Which Recognize a Critical Quadruplex-forming GA-element*

    PubMed Central

    Cogoi, Susanna; Paramasivam, Manikandan; Membrino, Alexandro; Yokoyama, Kazunari K.; Xodo, Luigi E.

    2010-01-01

    The murine KRAS promoter contains a G-rich nuclease hypersensitive element (GA-element) upstream of the transcription start site that is essential for transcription. Pulldown and chromatin immunoprecipitation assays demonstrate that this GA-element is bound by the Myc-associated zinc finger (MAZ) and poly(ADP-ribose) polymerase 1 (PARP-1) proteins. These proteins are crucial for transcription, because when they are knocked down by short hairpin RNA, transcription is down-regulated. This is also the case when the poly(ADP-ribosyl)ation activity of PARP-1 is inhibited by 3,4-dihydro-5-[4-(1-piperidinyl) butoxyl]-1(2H) isoquinolinone. We found that MAZ specifically binds to the duplex and quadruplex conformations of the GA-element, whereas PARP-1 shows specificity only for the G-quadruplex. On the basis of fluorescence resonance energy transfer melting and polymerase stop assays we saw that MAZ stabilizes the KRAS quadruplex. When the capacity of folding in the GA-element is abrogated by specific G → T or G → A point mutations, KRAS transcription is down-regulated. Conversely, guanidine-modified phthalocyanines, which specifically interact with and stabilize the KRAS G-quadruplex, push the promoter activity up to more than double. Collectively, our data support a transcription mechanism for murine KRAS that involves MAZ, PARP-1 and duplex-quadruplex conformational changes in the promoter GA-element. PMID:20457603

  8. Systematic review of dietary salt reduction policies: Evidence for an effectiveness hierarchy?

    PubMed

    Hyseni, Lirije; Elliot-Green, Alex; Lloyd-Williams, Ffion; Kypridemos, Chris; O'Flaherty, Martin; McGill, Rory; Orton, Lois; Bromley, Helen; Cappuccio, Francesco P; Capewell, Simon

    2017-01-01

    Non-communicable disease (NCD) prevention strategies now prioritise four major risk factors: food, tobacco, alcohol and physical activity. Dietary salt intake remains much higher than recommended, increasing blood pressure, cardiovascular disease and stomach cancer. Substantial reductions in salt intake are therefore urgently needed. However, the debate continues about the most effective approaches. To inform future prevention programmes, we systematically reviewed the evidence on the effectiveness of possible salt reduction interventions. We further compared "downstream, agentic" approaches targeting individuals with "upstream, structural" policy-based population strategies. We searched six electronic databases (CDSR, CRD, MEDLINE, SCI, SCOPUS and the Campbell Library) using a pre-piloted search strategy focussing on the effectiveness of population interventions to reduce salt intake. Retrieved papers were independently screened, appraised and graded for quality by two researchers. To facilitate comparisons between the interventions, the extracted data were categorised using nine stages along the agentic/structural continuum, from "downstream": dietary counselling (for individuals, worksites or communities), through media campaigns, nutrition labelling, voluntary and mandatory reformulation, to the most "upstream" regulatory and fiscal interventions, and comprehensive strategies involving multiple components. After screening 2,526 candidate papers, 70 were included in this systematic review (49 empirical studies and 21 modelling studies). Some papers described several interventions. Quality was variable. Multi-component strategies involving both upstream and downstream interventions, generally achieved the biggest reductions in salt consumption across an entire population, most notably 4g/day in Finland and Japan, 3g/day in Turkey and 1.3g/day recently in the UK. Mandatory reformulation alone could achieve a reduction of approximately 1.45g/day (three separate studies), followed by voluntary reformulation (-0.8g/day), school interventions (-0.7g/day), short term dietary advice (-0.6g/day) and nutrition labelling (-0.4g/day), but each with a wide range. Tax and community based counselling could, each typically reduce salt intake by 0.3g/day, whilst even smaller population benefits were derived from health education media campaigns (-0.1g/day). Worksite interventions achieved an increase in intake (+0.5g/day), however, with a very wide range. Long term dietary advice could achieve a -2g/day reduction under optimal research trial conditions; however, smaller reductions might be anticipated in unselected individuals. Comprehensive strategies involving multiple components (reformulation, food labelling and media campaigns) and "upstream" population-wide policies such as mandatory reformulation generally appear to achieve larger reductions in population-wide salt consumption than "downstream", individually focussed interventions. This 'effectiveness hierarchy' might deserve greater emphasis in future NCD prevention strategies.

  9. Sparse matrix multiplications for linear scaling electronic structure calculations in an atom-centered basis set using multiatom blocks.

    PubMed

    Saravanan, Chandra; Shao, Yihan; Baer, Roi; Ross, Philip N; Head-Gordon, Martin

    2003-04-15

    A sparse matrix multiplication scheme with multiatom blocks is reported, a tool that can be very useful for developing linear-scaling methods with atom-centered basis functions. Compared to conventional element-by-element sparse matrix multiplication schemes, efficiency is gained by the use of the highly optimized basic linear algebra subroutines (BLAS). However, some sparsity is lost in the multiatom blocking scheme because these matrix blocks will in general contain negligible elements. As a result, an optimal block size that minimizes the CPU time by balancing these two effects is recovered. In calculations on linear alkanes, polyglycines, estane polymers, and water clusters the optimal block size is found to be between 40 and 100 basis functions, where about 55-75% of the machine peak performance was achieved on an IBM RS6000 workstation. In these calculations, the blocked sparse matrix multiplications can be 10 times faster than a standard element-by-element sparse matrix package. Copyright 2003 Wiley Periodicals, Inc. J Comput Chem 24: 618-622, 2003

  10. Multiple methods integration for structural mechanics analysis and design

    NASA Technical Reports Server (NTRS)

    Housner, J. M.; Aminpour, M. A.

    1991-01-01

    A new research area of multiple methods integration is proposed for joining diverse methods of structural mechanics analysis which interact with one another. Three categories of multiple methods are defined: those in which a physical interface are well defined; those in which a physical interface is not well-defined, but selected; and those in which the interface is a mathematical transformation. Two fundamental integration procedures are presented that can be extended to integrate various methods (e.g., finite elements, Rayleigh Ritz, Galerkin, and integral methods) with one another. Since the finite element method will likely be the major method to be integrated, its enhanced robustness under element distortion is also examined and a new robust shell element is demonstrated.

  11. Intron Definition Is Required for Excision of the Minute Virus of Mice Small Intron and Definition of the Upstream Exon

    PubMed Central

    Haut, Donald D.; Pintel, D. J.

    1998-01-01

    Alternative splicing of pre-mRNAs plays a critical role in maximizing the coding capacity of the small parvovirus genome. The small-intron region of minute virus of mice (MVM) pre-mRNAs undergoes an unusual pattern of overlapping alternative splicing—using two donors (D1 and D2) and two acceptors (A1 and A2) within a region of 120 nucleotides—that determines the steady-state ratios of the various viral mRNAs. In this report, we show that the determinants that govern excision of the small intron are complex and are also required for efficient definition of the upstream exon. For the MVM small intron in its natural context, the two donors appear to compete for the splicing machinery: the position of D1 favors its usage, while the primary sequence of D2 must be more like the consensus sequence than is D1 to be used efficiently. We have genetically defined the branch points that are used for generation of the major and minor spliced forms and show that recognition of components of the small-intron acceptors is likely to be the dominant determinant in alternative small-intron excision. We have also identified a G-rich intronic enhancer sequence within the small intron that is essential for splicing of the minor form (D2 to A2) but not the major form (D1 to A1) of MVM mRNAs and is required for efficient definition of the upstream NS2-specific exon. In its natural context, the small intron appears to be excised by a mechanism consistent with intron definition. When the MVM small intron is expanded, various parameters of its excision are altered, indicating that critical cis-acting signals are context dependent. Relative use of the donors and acceptors is altered, and the upstream NS2-specific exon is no longer efficiently defined. The fact that definition of the upstream NS2-specific exon can be achieved by the MVM small intron in its natural context, but not when it is expanded, suggests that the multiple determinants that govern definition and excision of the small intron are required, in concert, for upstream exon definition. Our data are consistent with a model in which alternative splicing of the MVM P4-generated pre-mRNAs is governed by a hybrid of intron- and exon-defining mechanisms. PMID:9499034

  12. Component mode synthesis and large deflection vibration of complex structures. Volume 3: Multiple-mode nonlinear free and forced vibrations of beams using finite element method

    NASA Technical Reports Server (NTRS)

    Mei, Chuh; Shen, Mo-How

    1987-01-01

    Multiple-mode nonlinear forced vibration of a beam was analyzed by the finite element method. Inplane (longitudinal) displacement and inertia (IDI) are considered in the formulation. By combining the finite element method and nonlinear theory, more realistic models of structural response are obtained more easily and faster.

  13. Receptivity of Flat-Plate Boundary Layer in a Non-Uniform Free Stream (Vorticity Normal to the Plate)

    NASA Technical Reports Server (NTRS)

    Kogan, M. N.; Shumilkin, V. G.; Ustinov, M. V.; Zhigulev, S. V.

    1999-01-01

    Experimental and theoretical studies of low speed leading edge boundary layer receptivity to free-stream vorticity produced by upstream wires normal to the leading edge are discussed. Data include parametric variations in leading edge configuration and details of the incident disturbance field including single and multiple wakes. The induced disturbance amplitude increases with increases in the leading edge diameter and wake interactions. Measurements agree with the theory of M. E. Goldstein.

  14. Opposite consequences of two transcription pauses caused by an intrinsic terminator oligo(U): antitermination versus termination by bacteriophage T7 RNA polymerase.

    PubMed

    Lee, Sooncheol; Kang, Changwon

    2011-05-06

    The RNA oligo(U) sequence, along with an immediately preceding RNA hairpin structure, is an essential cis-acting element for bacterial class I intrinsic termination. This sequence not only causes a pause in transcription during the beginning of the termination process but also facilitates transcript release at the end of the process. In this study, the oligo(U) sequence of the bacteriophage T7 intrinsic terminator Tφ, rather than the hairpin structure, induced pauses of phage T7 RNA polymerase not only at the termination site, triggering a termination process, but also 3 bp upstream, exerting an antitermination effect. The upstream pause presumably allowed RNA to form a thermodynamically more stable secondary structure rather than a terminator hairpin and to persist because the 5'-half of the terminator hairpin-forming sequence could be sequestered by a farther upstream sequence via sequence-specific hybridization, prohibiting formation of the terminator hairpin and termination. The putative antiterminator RNA structure lacked several base pairs essential for termination when probed using RNases A, T1, and V1. When the antiterminator was destabilized by incorporation of IMP into nascent RNA at G residue positions, antitermination was abolished. Furthermore, antitermination strength increased with more stable antiterminator secondary structures and longer pauses. Thus, the oligo(U)-mediated pause prior to the termination site can exert a cis-acting antitermination activity on intrinsic terminator Tφ, and the termination efficiency depends primarily on the termination-interfering pause that precedes the termination-facilitating pause at the termination site.

  15. Control of asgE Expression during Growth and Development of Myxococcus xanthus

    PubMed Central

    Garza, Anthony G.; Harris, Baruch Z.; Greenberg, Brandon M.; Singer, Mitchell

    2000-01-01

    One of the earliest events in the Myxococcus xanthus developmental cycle is production of an extracellular cell density signal called A-signal (or A-factor). Previously, we showed that cells carrying an insertion in the asgE gene fail to produce normal levels of this cell-cell signal. In this study we found that expression of asgE is growth phase regulated and developmentally regulated. Several lines of evidence indicate that asgE is cotranscribed with an upstream gene during development. Using primer extension analyses, we identified two 5′ ends for this developmental transcript. The DNA sequence upstream of one 5′ end has similarity to the promoter regions of several genes that are A-signal dependent, whereas sequences located upstream of the second 5′ end show similarity to promoter elements identified for genes that are C-signal dependent. Consistent with this result is our finding that mutants failing to produce A-signal or C-signal are defective for developmental expression of asgE. In contrast to developing cells, the large majority of the asgE transcript found in vegetative cells appears to be monocistronic. This finding suggests that asgE uses different promoters for expression during vegetative growth and development. Growth phase regulation of asgE is abolished in a relA mutant, indicating that this vegetative promoter is induced by starvation. The data presented here, in combination with our previous results, indicate that the level of AsgE in vegetative cells is sufficient for this protein to carry out its function during development. PMID:11073904

  16. Infection of capilloviruses requires subgenomic RNAs whose transcription is controlled by promoter-like sequences conserved among flexiviruses.

    PubMed

    Komatsu, Ken; Hirata, Hisae; Fukagawa, Takako; Yamaji, Yasuyuki; Okano, Yukari; Ishikawa, Kazuya; Adachi, Tatsushi; Maejima, Kensaku; Hashimoto, Masayoshi; Namba, Shigetou

    2012-07-01

    The first open-reading frame (ORF) of apple stem grooving virus (ASGV), of the genus Capillovirus, encodes an apparently chimeric polyprotein containing conserved regions for replicase (Rep) and coat protein (CP). However, our previous study revealed that ASGV mutants with distinct and discontinuous Rep- and CP-coding regions successfully infect plants, indicating that CP expressed via a subgenomic RNA (sgRNA) is sufficient for viability of the virus. Here we identified a transcription start site of the CP sgRNA and revealed that CP translated from the sgRNA is essential for ASGV infection. We mapped the transcription start sites of both the CP and the movement protein (MP) sgRNAs of ASGV and found a hexanucleotide motif, UUAGGU, conserved upstream from both sgRNA transcription start sites. Mutational analysis of the putative CP initiation codon and of the UUAGGU sequence upstream from the transcription start site of CP sgRNA demonstrated their importance for ASGV accumulation. Our results also demonstrated that potato virus T (PVT), an unassigned species closely related to ASGV, produces two sgRNAs putatively deployed for the CP and MP expression and that the same hexanucleotide motif as found in ASGV is located upstream from the transcription start sites of both sgRNAs. This motif, which constituted putative core elements of the sgRNA promoter, is broadly conserved among viruses in the families Alphaflexiviridae and Betaflexiviridae, suggesting that the gene expression strategy of the viruses in both families has been conserved throughout evolution. Copyright © 2012 Elsevier B.V. All rights reserved.

  17. Lipid droplet-associated gene expression and chromatin remodelling in LIPASE 5'-upstream region from beginning- to mid-endodormant bud in 'Fuji' apple.

    PubMed

    Saito, Takanori; Wang, Shanshan; Ohkawa, Katsuya; Ohara, Hitoshi; Ikeura, Hiromi; Ogawa, Yukiharu; Kondo, Satoru

    2017-11-01

    We found that lipid accumulation in the meristem region and the expression of MdLIP2A, which appears to be regulated by chromatin remodeling, coincided with endodormancy induction in the 'Fuji' apple. In deciduous trees, including apples (Malus × domestica Borkh.), lipid accumulation in the meristem region towards endodormancy induction has been thought to be an important process for the acquisition of cold tolerance. In this study, we conducted histological staining of crude lipids in the meristem region of 'Fuji' apples and found that lipid accumulation coincided with endodormancy induction. Since a major component of lipid bodies (triacylglycerol) is esterified fatty acids, we analysed fatty acid-derived volatile compounds and genes encoding fatty acid-modifying enzymes (MdLOX1A and MdHPL2A); the reduction of lipid breakdown also coincided with endodormancy induction. We then characterised the expression patterns of lipid body-regulatory genes MdOLE1 and MdLIP2A during endodormancy induction and found that the expression of MdLIP2A correlated well with lipid accumulation towards endodormancy induction. Based on these results, we conducted chromatin remodelling studies and localized the cis-element in the 5'-upstream region of MdLIP2A to clarify its regulatory mechanism. Finally, we revealed that chromatin was concentrated - 764 to - 862 bp of the 5'-upstream region of MdLIP2A, which harbours the GARE [gibberellin responsive MYB transcription factor binding site] and CArG [MADS-box transcription factor binding site] motifs-meristem development-related protein-binding sites.

  18. SIMULATION OF DESCENDING MULTIPLE SUPRA-ARCADE RECONNECTION OUTFLOWS IN SOLAR FLARES

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cecere, M.; Schneiter, M.; Costa, A.

    After recent Atmospheric Imaging Assembly observations by Savage, McKenzie, and Reeves, we revisit the scenario proposed by us in previous papers. We have shown that sunward, generally dark plasma features that originated above posteruption flare arcades are consistent with a scenario where plasma voids (which we identify as supra-arcade reconnection outflows, SAROs) generate the bouncing and interfering of shocks and expansion waves upstream of an initial localized deposition of energy that is collimated in the magnetic field direction. In this paper, we analyze the multiple production and interaction of SAROs and their individual structures that make them relatively stable featuresmore » while moving. We compare our results with observations and with the scenarios proposed by other authors.« less

  19. Non-additive interactions involving two distinct elements mediate sloppy-paired regulation by pair-rule transcription factors

    PubMed Central

    Prazak, Lisa; Fujioka, Miki; Gergen, J. Peter

    2010-01-01

    The relatively simple combinatorial rules responsible for establishing the initial metameric expression of sloppy-paired-1 (slp1) in the Drosophila blastoderm embryo make this system an attractive model for investigating the mechanism of regulation by pair rule transcription factors. This investigation of slp1 cis-regulatory architecture identifies two distinct elements, a proximal early stripe element (PESE) and a distal early stripe element (DESE) located from −3.1 kb to −2.5 kb and from −8.1 kb to −7.1 kb upstream of the slp1 promoter, respectively, that mediate this early regulation. The proximal element expresses only even-numbered stripes and mediates repression by Even-skipped (Eve) as well as by the combination of Runt and Fushi-tarazu (Ftz). A 272 basepair sub-element of PESE retains Eve-dependent repression, but is expressed throughout the even-numbered parasegments due to the loss of repression by Runt and Ftz. In contrast, the distal element expresses both odd and even-numbered stripes and also drives inappropriate expression in the anterior half of the odd-numbered parasegments due to an inability to respond to repression by Eve. Importantly, a composite reporter gene containing both early stripe elements recapitulates pair-rule gene-dependent regulation in a manner beyond what is expected from combining their individual patterns. These results indicate interactions involving distinct cis-elements contribute to the proper integration of pair-rule regulatory information. A model fully accounting for these results proposes that metameric slp1 expression is achieved through the Runt-dependent regulation of interactions between these two pair-rule response elements and the slp1 promoter. PMID:20435028

  20. Informed decision-making in elective major vascular surgery: analysis of 145 surgeon-patient consultations.

    PubMed

    Etchells, Edward; Ferrari, Michel; Kiss, Alex; Martyn, Nikki; Zinman, Deborah; Levinson, Wendy

    2011-06-01

    Prior studies show significant gaps in the informed decision-making process, a central goal of surgical care. These studies have been limited by their focus on low-risk decisions, single visits rather than entire consultations, or both. Our objectives were, first, to rate informed decision-making for major elective vascular surgery based on audiotapes of actual physician-patient conversations and, second, to compare ratings of informed decision-making for first visits to ratings for multiple visits by the same patient over time. We prospectively enrolled patients for whom vascular surgical treatment was a potential option at a tertiary care outpatient vascular surgery clinic. We audio-taped all surgeon-patient conversations, including multiple visits when necessary, until a decision was made. Using an existing method, we evaluated the transcripts for elements of decision-making, including basic elements (e.g., an explanation of the clinical condition), intermediate elements (e.g., risks and benefits) and complex elements (e.g., uncertainty around the decision). We analyzed 145 surgeon-patient consultations. Overall, 45% of consultations contained complex elements, whereas 23% did not contain the basic elements of decision-making. For the 67 consultations that involved multiple visits, ratings were significantly higher when evaluating all visits (50% complex elements) compared with evaluating only the first visit (33% complex elements, p < 0.001.) We found that 45% of consultations contained complex elements, which is higher than prior studies with similar methods. Analyzing decision-making over multiple visits yielded different results than analyzing decision-making for single visits.

  1. Energetic-ion acceleration and transport in the upstream region of Jupiter: Voyager 1 and 2

    NASA Technical Reports Server (NTRS)

    Baker, D. N.; Zwickl, R. D.; Carbary, J. F.; Krimigis, S. M.; Lepping, R. P.

    1982-01-01

    Long-lived upstream energetic ion events at Jupiter appear to be very similar in nearly all respects to upstream ion events at Earth. A notable difference between the two planetary systems is the enhanced heavy ion compositional signature reported for the Jovian events. This compositional feature has suggested that ions escaping from the Jovian magnetosphere play an important role in forming upstream ion populations at Jupiter. In contrast, models of energetic upstream ions at Earth emphasize in situ acceleration of reflected solar wind ions within the upstream region itself. Using Voyager 1 and 2 energetic ( approximately 30 keV) ion measurements near the magnetopause, in the magnetosheath, and immediately upstream of the bow shock, the compositional patterns are examined together with typical energy spectra in each of these regions. A model involving upstream Fermi acceleration early in events and emphasizing energetic particle escape in the prenoon part of the Jovian magnetosphere late in events is presented to explain many of the features in the upstream region of Jupiter.

  2. Identification of upstream and intragenic regulatory elements that confer cell-type-restricted and differentiation-specific expression on the muscle creatine kinase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sternberg, E.A.; Spizz, G.; Perry, W.M.

    1988-07-01

    Terminal differentiation of skeletal myobalsts is accompanied by induction of a series of tissue-specific gene products, which includes the muscle isoenzymte of creatine kinase (MCK). To begin to define the sequences and signals involved in MCK regulation in developing muscle cells, the mouse MCK gene has been isolated. Sequence analysis of 4,147 bases of DNA surrounding the transcription initiation site revealed several interesting structural features, some of which are common to other muscle-specific genes and to cellular and viral enhancers.

  3. Design and performance of a 427-meter-per-second-tip-speed two-stage fan having a 2.40 pressure ratio

    NASA Technical Reports Server (NTRS)

    Cunnan, W. S.; Stevans, W.; Urasek, D. C.

    1978-01-01

    The aerodynamic design and the overall and blade-element performances are presented of a 427-meter-per-second-tip-speed two-stage fan designed with axially spaced blade rows to reduce noise transmitted upstream of the fan. At design speed the highest recorded adiabatic efficiency was 0.796 at a pressure of 2.30. Peak efficiency was not established at design speed because of a damper failure which terminated testing prematurely. The overall efficiencies, at 60 and 80 percent of design speed, peaked at approximately 0.83.

  4. Method and apparatus to selectively reduce NO.sub.x in an exhaust gas feedstream

    DOEpatents

    Schmieg, Steven J [Troy, MI; Blint, Richard J [Shelby Township, MI; Den, Ling [Sterling Heights, MI; Viola, Michael B [Macomb Township, MI; Lee, Jong-Hwan [Rochester Hills, MI

    2011-08-30

    A method and apparatus are described to selectively reduce NO.sub.x emissions of an internal combustion engine. An exhaust aftertreatment system includes an injection device operative to dispense a hydrocarbon reductant upstream of a silver-alumina catalytic reactor device. A control system determines a NO.sub.x concentration and hydrocarbon/NOx ratio based upon selected parameters of the exhaust gas feedstream and dispenses hydrocarbon reductant during lean engine operation. Included is a method to control elements of the feedstream during lean operation. The hydrocarbon reductant may include engine fuel.

  5. Using RSAT to scan genome sequences for transcription factor binding sites and cis-regulatory modules.

    PubMed

    Turatsinze, Jean-Valery; Thomas-Chollier, Morgane; Defrance, Matthieu; van Helden, Jacques

    2008-01-01

    This protocol shows how to detect putative cis-regulatory elements and regions enriched in such elements with the regulatory sequence analysis tools (RSAT) web server (http://rsat.ulb.ac.be/rsat/). The approach applies to known transcription factors, whose binding specificity is represented by position-specific scoring matrices, using the program matrix-scan. The detection of individual binding sites is known to return many false predictions. However, results can be strongly improved by estimating P value, and by searching for combinations of sites (homotypic and heterotypic models). We illustrate the detection of sites and enriched regions with a study case, the upstream sequence of the Drosophila melanogaster gene even-skipped. This protocol is also tested on random control sequences to evaluate the reliability of the predictions. Each task requires a few minutes of computation time on the server. The complete protocol can be executed in about one hour.

  6. Genome-wide DNA methylation map of human neutrophils reveals widespread inter-individual epigenetic variation

    PubMed Central

    Chatterjee, Aniruddha; Stockwell, Peter A.; Rodger, Euan J.; Duncan, Elizabeth J.; Parry, Matthew F.; Weeks, Robert J.; Morison, Ian M.

    2015-01-01

    The extent of variation in DNA methylation patterns in healthy individuals is not yet well documented. Identification of inter-individual epigenetic variation is important for understanding phenotypic variation and disease susceptibility. Using neutrophils from a cohort of healthy individuals, we generated base-resolution DNA methylation maps to document inter-individual epigenetic variation. We identified 12851 autosomal inter-individual variably methylated fragments (iVMFs). Gene promoters were the least variable, whereas gene body and upstream regions showed higher variation in DNA methylation. The iVMFs were relatively enriched in repetitive elements compared to non-iVMFs, and were associated with genome regulation and chromatin function elements. Further, variably methylated genes were disproportionately associated with regulation of transcription, responsive function and signal transduction pathways. Transcriptome analysis indicates that iVMF methylation at differentially expressed exons has a positive correlation and local effect on the inclusion of that exon in the mRNA transcript. PMID:26612583

  7. The human immunodeficiency virus type 1 long terminal repeat specifies two different transcription complexes, only one of which is regulated by Tat.

    PubMed Central

    Lu, X; Welsh, T M; Peterlin, B M

    1993-01-01

    The human immunodeficiency virus type 1 long terminal repeat sets up two different transcription complexes, which have been called processive and nonprocessive complexes. By mutating and substituting cis-acting sequences, we mapped elements of the human immunodeficiency virus long terminal repeat that are responsible for creating each transcription complex. Whereas processive complexes are efficiently assembled by upstream promoter elements in the absence of the TATA box, nonprocessive complexes absolutely require the TATA box. Moreover, the TATA box alone can set up these nonprocessive complexes, and nonprocessive but not processive complexes are trans activated by Tat. Finally, a strong DNA-binding site between the TATA box and trans-activation-responsive region interferes with either the assembly or movement of these nonprocessive complexes and diminishes the effects of Tat. Thus, Tat affects a critical step in the formation of elongation-competent transcription complexes. Images PMID:8445708

  8. AP-1 proteins in the adult brain: facts and fiction about effectors of neuroprotection and neurodegeneration.

    PubMed

    Herdegen, T; Waetzig, V

    2001-04-30

    Jun and Fos proteins are induced and activated following most physiological and pathophysiological stimuli in the brain. Only few data allow conclusions about distinct functions of AP-1 proteins in neurodegeneration and neuroregeneration, and these functions mainly refer to c-Jun and its activation by JNKs. Apoptotic functions of activated c-Jun affect hippocampal, nigral and primary cultured neurons following excitotoxic stimulation and destruction of the neuron-target-axis including withdrawal of trophic molecules. The inhibition of JNKs might exert neuroprotection by subsequent omission of c-Jun activation. Besides endogenous neuronal functions, the c-Jun/AP-1 proteins can damage the nervous system by upregulation of harmful programs in non-neuronal cells (e.g. microglia) with release of neurodegenerative molecules. In contrast, the differentiation with neurite extension and maturation of neural cells in vitro indicate physiological and potentially neuroprotective functions of c-Jun and JNKs including sensoring for alterations in the cytoskeleton. This review summarizes the multiple molecular interfunctions which are involved in the shift from the physiological role to degenerative effects of the Jun/JNK-axis such as cell type-specific expression and intracellular localization of scaffold proteins and upstream activators, antagonistic phosphatases, interaction with other kinase systems, or the activation of transcription factors competing for binding to JNK proteins and AP-1 DNA elements.

  9. Eccentric muscle challenge shows osteopontin polymorphism modulation of muscle damage.

    PubMed

    Barfield, Whitney L; Uaesoontrachoon, Kitipong; Wu, Chung-Sheih; Lin, Stephen; Chen, Yue; Wang, Paul C; Kanaan, Yasmine; Bond, Vernon; Hoffman, Eric P

    2014-08-01

    A promoter polymorphism of the osteopontin (OPN) gene (rs28357094) has been associated with multiple inflammatory states, severity of Duchenne muscular dystrophy (DMD) and muscle size in healthy young adults. We sought to define the mechanism of action of the polymorphism, using allele-specific in vitro reporter assays in muscle cells, and a genotype-stratified intervention in healthy controls. In vitro reporter constructs showed the G allele to respond to estrogen treatment, whereas the T allele showed no transcriptional response. Young adult volunteers (n = 187) were enrolled into a baseline study, and subjects with specific rs28357094 genotypes enrolled into an eccentric muscle challenge intervention [n = 3 TT; n = 3 GG/GT (dominant inheritance model)]. Female volunteers carrying the G allele showed significantly greater inflammation and increased muscle volume change as determined by magnetic resonance imaging T1- and T2-weighted images after eccentric challenge, as well as greater decrement in biceps muscle force. Our data suggest a model where the G allele enables enhanced activities of upstream enhancer elements due to loss of Sp1 binding at the polymorphic site. This results in significantly greater expression of the pro-inflammatory OPN cytokine during tissue remodeling in response to challenge in G allele carriers, promoting muscle hypertrophy in normal females, but increased damage in DMD patients. © The Author 2014. Published by Oxford University Press.

  10. Using Synthetic Biology to Distinguish and Overcome Regulatory and Functional Barriers Related to Nitrogen Fixation

    PubMed Central

    Wang, Xia; Yang, Jian-Guo; Chen, Li; Wang, Ji-Long; Cheng, Qi; Dixon, Ray; Wang, Yi-Ping

    2013-01-01

    Biological nitrogen fixation is a complex process requiring multiple genes working in concert. To date, the Klebsiella pneumoniae nif gene cluster, divided into seven operons, is one of the most studied systems. Its nitrogen fixation capacity is subject to complex cascade regulation and physiological limitations. In this report, the entire K. pneumoniae nif gene cluster was reassembled as operon-based BioBrick parts in Escherichia coli. It provided ∼100% activity of native K. pneumoniae system. Based on the expression levels of these BioBrick parts, a T7 RNA polymerase–LacI expression system was used to replace the σ54-dependent promoters located upstream of nif operons. Expression patterns of nif operons were critical for the maximum activity of the recombinant system. By mimicking these expression levels with variable-strength T7-dependent promoters, ∼42% of the nitrogenase activity of the σ54-dependent nif system was achieved in E. coli. When the newly constructed T7-dependent nif system was challenged with different genetic and physiological conditions, it bypassed the original complex regulatory circuits, with minor physiological limitations. Therefore, we have successfully replaced the nif regulatory elements with a simple expression system that may provide the first step for further research of introducing nif genes into eukaryotic organelles, which has considerable potentials in agro-biotechnology. PMID:23935879

  11. The SHOX region and its mutations.

    PubMed

    Capone, L; Iughetti, L; Sabatini, S; Bacciaglia, A; Forabosco, A

    2010-06-01

    The short stature homeobox-containing (SHOX) gene lies in the pseudoautosomal region 1 (PAR1) that comprises 2.6 Mb of the short-arm tips of both the X and Y chromosomes. It is known that its heterozygous mutations cause Leri-Weill dyschondrosteosis (LWD) (OMIM #127300), while its homozygous mutations cause a severe form of dwarfism known as Langer mesomelic dysplasia (LMD) (OMIM #249700). The analysis of 238 LWD patients between 1998 and 2007 by multiple authors shows a prevalence of deletions (46.4%) compared to point mutations (21.2%). On the whole, deletions and point mutations account for about 67% of LWD patients. SHOX is located within a 1000 kb desert region without genes. The comparative genomic analysis of this region between genomes of different vertebrates has led to the identification of evolutionarily conserved non-coding DNA elements (CNE). Further functional studies have shown that one of these CNE downstream of the SHOX gene is necessary for the expression of SHOX; this is considered to be typical "enhancer" activity. Including the enhancer, the overall mutation of the SHOX region in LWD patients does not hold in 100% of cases. Various authors have demonstrated the existence of other CNE both downstream and upstream of SHOX regions. The resulting conclusion is that it is necessary to reanalyze all LWD/LMD patients without SHOX mutations for the presence of mutations in the 5'- and 3'-flanking SHOX regions.

  12. Rho2 Palmitoylation Is Required for Plasma Membrane Localization and Proper Signaling to the Fission Yeast Cell Integrity Mitogen-Activated Protein Kinase Pathway

    PubMed Central

    Sánchez-Mir, Laura; Franco, Alejandro; Martín-García, Rebeca; Madrid, Marisa; Vicente-Soler, Jero; Soto, Teresa; Gacto, Mariano; Pérez, Pilar

    2014-01-01

    The fission yeast small GTPase Rho2 regulates morphogenesis and is an upstream activator of the cell integrity pathway, whose key element, mitogen-activated protein kinase (MAPK) Pmk1, becomes activated by multiple environmental stimuli and controls several cellular functions. Here we demonstrate that farnesylated Rho2 becomes palmitoylated in vivo at cysteine-196 within its carboxyl end and that this modification allows its specific targeting to the plasma membrane. Unlike that of other palmitoylated and prenylated GTPases, the Rho2 control of morphogenesis and Pmk1 activity is strictly dependent upon plasma membrane localization and is not found in other cellular membranes. Indeed, artificial plasma membrane targeting bypassed the Rho2 need for palmitoylation in order to signal. Detailed functional analysis of Rho2 chimeras fused to the carboxyl end from the essential GTPase Rho1 showed that GTPase palmitoylation is partially dependent on the prenylation context and confirmed that Rho2 signaling is independent of Rho GTP dissociation inhibitor (GDI) function. We further demonstrate that Rho2 is an in vivo substrate for DHHC family acyltransferase Erf2 palmitoyltransferase. Remarkably, Rho3, another Erf2 target, negatively regulates Pmk1 activity in a Rho2-independent fashion, thus revealing the existence of cross talk whereby both GTPases antagonistically modulate the activity of this MAPK cascade. PMID:24820419

  13. Thermionic nuclear reactor with internal heat distribution and multiple duct cooling

    DOEpatents

    Fisher, C.R.; Perry, L.W. Jr.

    1975-11-01

    A Thermionic Nuclear Reactor is described having multiple ribbon-like coolant ducts passing through the core, intertwined among the thermionic fuel elements to provide independent cooling paths. Heat pipes are disposed in the core between and adjacent to the thermionic fuel elements and the ribbon ducting, for the purpose of more uniformly distributing the heat of fission among the thermionic fuel elements and the ducts.

  14. Comprehensive Fuel Spray Modeling and Impacts on Chamber Acoustics in Combustion Dynamics Simulations

    DTIC Science & Technology

    2013-05-01

    multiple swirler configurations and fuel injector locations at atmospheric pressure con- ditions. Both single-element and multiple-element LDI...the swirl number, Reynolds’ number and injector location in the LDI element. Besides the multi-phase flow characteristics, several experimen- tal...region downstream of the fuel injector on account of a sta- ble and compact precessing vortex core. Recent ex- periments conducted by the Purdue group have

  15. Vaporization and Zonal Mixing in Performance Modeling of Advanced LOX-Methane Rockets

    NASA Technical Reports Server (NTRS)

    Williams, George J., Jr.; Stiegemeier, Benjamin R.

    2013-01-01

    Initial modeling of LOX-Methane reaction control (RCE) 100 lbf thrusters and larger, 5500 lbf thrusters with the TDK/VIPER code has shown good agreement with sea-level and altitude test data. However, the vaporization and zonal mixing upstream of the compressible flow stage of the models leveraged empirical trends to match the sea-level data. This was necessary in part because the codes are designed primarily to handle the compressible part of the flow (i.e. contraction through expansion) and in part because there was limited data on the thrusters themselves on which to base a rigorous model. A more rigorous model has been developed which includes detailed vaporization trends based on element type and geometry, radial variations in mixture ratio within each of the "zones" associated with elements and not just between zones of different element types, and, to the extent possible, updated kinetic rates. The Spray Combustion Analysis Program (SCAP) was leveraged to support assumptions in the vaporization trends. Data of both thrusters is revisited and the model maintains a good predictive capability while addressing some of the major limitations of the previous version.

  16. Structure and Expression of Hybrid Dysgenesis-Induced Alleles of the Ovarian Tumor (Otu) Gene in Drosophila Melanogaster

    PubMed Central

    Sass, G. L.; Mohler, J. D.; Walsh, R. C.; Kalfayan, L. J.; Searles, L. L.

    1993-01-01

    Mutations at the ovarian tumor (otu) gene of Drosophila melanogaster cause female sterility and generate a range of ovarian phenotypes. Quiescent (QUI) mutants exhibit reduced germ cell proliferation; in oncogenic (ONC) mutants germ cells undergo uncontrolled proliferation generating excessive numbers of undifferentiated cells; the egg chambers of differentiated (DIF) mutants differentiate to variable degrees but fail to complete oogenesis. We have examined mutations caused by insertion and deletion of P elements at the otu gene. The P element insertion sites are upstream of the major otu transcription start sites. In deletion derivatives, the P element, regulatory regions and/or protein coding sequences have been removed. In both insertion and deletion mutants, the level of otu expression correlates directly with the severity of the phenotype: the absence of otu function produces the most severe QUI phenotype while the ONC mutants express lower levels of otu than those which are DIF. The results of this study demonstrate that the diverse mutant phenotypes of otu are the consequence of different levels of otu function. PMID:8436274

  17. New insights into replication origin characteristics in metazoans

    PubMed Central

    Puy, Aurore; Rialle, Stéphanie; Kaplan, Noam; Segal, Eran

    2012-01-01

    We recently reported the identification and characterization of DNA replication origins (Oris) in metazoan cell lines. Here, we describe additional bioinformatic analyses showing that the previously identified GC-rich sequence elements form origin G-rich repeated elements (OGREs) that are present in 67% to 90% of the DNA replication origins from Drosophila to human cells, respectively. Our analyses also show that initiation of DNA synthesis takes place precisely at 160 bp (Drosophila) and 280 bp (mouse) from the OGRE. We also found that in most CpG islands, an OGRE is positioned in opposite orientation on each of the two DNA strands and detected two sites of initiation of DNA synthesis upstream or downstream of each OGRE. Conversely, Oris not associated with CpG islands have a single initiation site. OGRE density along chromosomes correlated with previously published replication timing data. Ori sequences centered on the OGRE are also predicted to have high intrinsic nucleosome occupancy. Finally, OGREs predict G-quadruplex structures at Oris that might be structural elements controlling the choice or activation of replication origins. PMID:22373526

  18. The 3’-Jα Region of the TCRα Locus Bears Gene Regulatory Activity in Thymic and Peripheral T Cells

    PubMed Central

    Kučerová-Levisohn, Martina; Knirr, Stefan; Mejia, Rosa I.; Ortiz, Benjamin D.

    2015-01-01

    Much progress has been made in understanding the important cis-mediated controls on mouse TCRα gene function, including identification of the Eα enhancer and TCRα locus control region (LCR). Nevertheless, previous data have suggested that other cis-regulatory elements may reside in the locus outside of the Eα/LCR. Based on prior findings, we hypothesized the existence of gene regulatory elements in a 3.9-kb region 5’ of the Cα exons. Using DNase hypersensitivity assays and TCRα BAC reporter transgenes in mice, we detected gene regulatory activity within this 3.9-kb region. This region is active in both thymic and peripheral T cells, and selectively affects upstream, but not downstream, gene expression. Together, these data indicate the existence of a novel cis-acting regulatory complex that contributes to TCRα transgene expression in vivo. The active chromatin sites we discovered within this region would remain in the locus after TCRα gene rearrangement, and thus may contribute to endogenous TCRα gene activity, particularly in peripheral T cells, where the Eα element has been found to be inactive. PMID:26177549

  19. Right-Brain/Left-Brain Integrated Associative Processor Employing Convertible Multiple-Instruction-Stream Multiple-Data-Stream Elements

    NASA Astrophysics Data System (ADS)

    Hayakawa, Hitoshi; Ogawa, Makoto; Shibata, Tadashi

    2005-04-01

    A very large scale integrated circuit (VLSI) architecture for a multiple-instruction-stream multiple-data-stream (MIMD) associative processor has been proposed. The processor employs an architecture that enables seamless switching from associative operations to arithmetic operations. The MIMD element is convertible to a regular central processing unit (CPU) while maintaining its high performance as an associative processor. Therefore, the MIMD associative processor can perform not only on-chip perception, i.e., searching for the vector most similar to an input vector throughout the on-chip cache memory, but also arithmetic and logic operations similar to those in ordinary CPUs, both simultaneously in parallel processing. Three key technologies have been developed to generate the MIMD element: associative-operation-and-arithmetic-operation switchable calculation units, a versatile register control scheme within the MIMD element for flexible operations, and a short instruction set for minimizing the memory size for program storage. Key circuit blocks were designed and fabricated using 0.18 μm complementary metal-oxide-semiconductor (CMOS) technology. As a result, the full-featured MIMD element is estimated to be 3 mm2, showing the feasibility of an 8-parallel-MIMD-element associative processor in a single chip of 5 mm× 5 mm.

  20. Heterogeneity of reward mechanisms.

    PubMed

    Lajtha, A; Sershen, H

    2010-06-01

    The finding that many drugs that have abuse potential and other natural stimuli such as food or sexual activity cause similar chemical changes in the brain, an increase in extracellular dopamine (DA) in the shell of the nucleus accumbens (NAccS), indicated some time ago that the reward mechanism is at least very similar for all stimuli and that the mechanism is relatively simple. The presently available information shows that the mechanisms involved are more complex and have multiple elements. Multiple brain regions, multiple receptors, multiple distinct neurons, multiple transmitters, multiple transporters, circuits, peptides, proteins, metabolism of transmitters, and phosphorylation, all participate in reward mechanisms. The system is variable, is changed during development, is sex-dependent, and is influenced by genetic differences. Not all of the elements participate in the reward of all stimuli. Different set of mechanisms are involved in the reward of different drugs of abuse, yet different mechanisms in the reward of natural stimuli such as food or sexual activity; thus there are different systems that distinguish different stimuli. Separate functions of the reward system such as anticipation, evaluation, consummation and identification; all contain function-specific elements. The level of the stimulus also influences the participation of the elements of the reward system, there are possible reactions to even below threshold stimuli, and excessive stimuli can change reward to aversion involving parts of the system. Learning and memory of past reward is an important integral element of reward and addictive behavior. Many of the reward elements are altered by repeated or chronic stimuli, and chronic exposure to one drug is likely to alter the response to another stimulus. To evaluate and identify the reward stimulus thus requires heterogeneity of the reward components in the brain.

  1. Pre-orthographic character string processing and parietal cortex: a role for visual attention in reading?

    PubMed

    Lobier, Muriel; Peyrin, Carole; Le Bas, Jean-François; Valdois, Sylviane

    2012-07-01

    The visual front-end of reading is most often associated with orthographic processing. The left ventral occipito-temporal cortex seems to be preferentially tuned for letter string and word processing. In contrast, little is known of the mechanisms responsible for pre-orthographic processing: the processing of character strings regardless of character type. While the superior parietal lobule has been shown to be involved in multiple letter processing, further data is necessary to extend these results to non-letter characters. The purpose of this study is to identify the neural correlates of pre-orthographic character string processing independently of character type. Fourteen skilled adult readers carried out multiple and single element visual categorization tasks with alphanumeric (AN) and non-alphanumeric (nAN) characters under fMRI. The role of parietal cortex in multiple element processing was further probed with a priori defined anatomical regions of interest (ROIs). Participants activated posterior parietal cortex more strongly for multiple than single element processing. ROI analyses showed that bilateral SPL/BA7 was more strongly activated for multiple than single element processing, regardless of character type. In contrast, no multiple element specific activity was found in inferior parietal lobules. These results suggests that parietal mechanisms are involved in pre-orthographic character string processing. We argue that in general, attentional mechanisms are involved in visual word recognition, as an early step of word visual analysis. Copyright © 2012 Elsevier Ltd. All rights reserved.

  2. In and out of the rRNA genes: characterization of Pokey elements in the sequenced Daphnia genome

    PubMed Central

    2013-01-01

    Background Only a few transposable elements are known to exhibit site-specific insertion patterns, including the well-studied R-element retrotransposons that insert into specific sites within the multigene rDNA. The only known rDNA-specific DNA transposon, Pokey (superfamily: piggyBac) is found in the freshwater microcrustacean, Daphnia pulex. Here, we present a genome-wide analysis of Pokey based on the recently completed whole genome sequencing project for D. pulex. Results Phylogenetic analysis of Pokey elements recovered from the genome sequence revealed the presence of four lineages corresponding to two divergent autonomous families and two related lineages of non-autonomous miniature inverted repeat transposable elements (MITEs). The MITEs are also found at the same 28S rRNA gene insertion site as the Pokey elements, and appear to have arisen as deletion derivatives of autonomous elements. Several copies of the full-length Pokey elements may be capable of producing an active transposase. Surprisingly, both families of Pokey possess a series of 200 bp repeats upstream of the transposase that is derived from the rDNA intergenic spacer (IGS). The IGS sequences within the Pokey elements appear to be evolving in concert with the rDNA units. Finally, analysis of the insertion sites of Pokey elements outside of rDNA showed a target preference for sites similar to the specific sequence that is targeted within rDNA. Conclusions Based on the target site preference of Pokey elements and the concerted evolution of a segment of the element with the rDNA unit, we propose an evolutionary path by which the ancestors of Pokey elements have invaded the rDNA niche. We discuss how specificity for the rDNA unit may have evolved and how this specificity has played a role in the long-term survival of these elements in the subgenus Daphnia. PMID:24059783

  3. Ursolic Acid Inhibits Adipogenesis in 3T3-L1 Adipocytes through LKB1/AMPK Pathway

    PubMed Central

    He, Yonghan; Li, Ying; Zhao, Tiantian; Wang, Yanwen; Sun, Changhao

    2013-01-01

    Background Ursolic acid (UA) is a triterpenoid compound with multiple biological functions. This compound has recently been reported to possess an anti-obesity effect; however, the mechanisms are less understood. Objective As adipogenesis plays a critical role in obesity, the present study was conducted to investigate the effect of UA on adipogenesis and mechanisms of action in 3T3-L1 preadipocytes. Methods and Results The 3T3-L1 preadipocytes were induced to differentiate in the presence or absence of UA for 6 days. The cells were determined for proliferation, differentiation, fat accumulation as well as the protein expressions of molecular targets that regulate or are involved in fatty acid synthesis and oxidation. The results demonstrated that ursolic acid at concentrations ranging from 2.5 µM to 10 µM dose-dependently attenuated adipogenesis, accompanied by reduced protein expression of CCAAT element binding protein β (C/EBPβ), peroxisome proliferator-activated receptor γ (PPARγ), CCAAT element binding protein α (C/EBPα) and sterol regulatory element binding protein 1c (SREBP-1c), respectively. Ursolic acid increased the phosphorylation of acetyl-CoA carboxylase (ACC) and protein expression of carnitine palmitoyltransferase 1 (CPT1), but decreased protein expression of fatty acid synthase (FAS) and fatty acid-binding protein 4 (FABP4). Ursolic acid increased the phosphorylation of AMP-activated protein kinase (AMPK) and protein expression of (silent mating type information regulation 2, homolog) 1 (Sirt1). Further studies demonstrated that the anti-adipogenic effect of UA was reversed by the AMPK siRNA, but not by the Sirt1 inhibitor nicotinamide. Liver kinase B1 (LKB1), the upstream kinase of AMPK, was upregulated by UA. When LKB1 was silenced with siRNA or the inhibitor radicicol, the effect of UA on AMPK activation was diminished. Conclusions Ursolic acid inhibited 3T3-L1 preadipocyte differentiation and adipogenesis through the LKB1/AMPK pathway. There is potential to develop UA into a therapeutic agent for the prevention or treatment of obesity. PMID:23922935

  4. Pooled genome wide association detects association upstream of FCRL3 with Graves' disease.

    PubMed

    Khong, Jwu Jin; Burdon, Kathryn P; Lu, Yi; Laurie, Kate; Leonardos, Lefta; Baird, Paul N; Sahebjada, Srujana; Walsh, John P; Gajdatsy, Adam; Ebeling, Peter R; Hamblin, Peter Shane; Wong, Rosemary; Forehan, Simon P; Fourlanos, Spiros; Roberts, Anthony P; Doogue, Matthew; Selva, Dinesh; Montgomery, Grant W; Macgregor, Stuart; Craig, Jamie E

    2016-11-18

    Graves' disease is an autoimmune thyroid disease of complex inheritance. Multiple genetic susceptibility loci are thought to be involved in Graves' disease and it is therefore likely that these can be identified by genome wide association studies. This study aimed to determine if a genome wide association study, using a pooling methodology, could detect genomic loci associated with Graves' disease. Nineteen of the top ranking single nucleotide polymorphisms including HLA-DQA1 and C6orf10, were clustered within the Major Histo-compatibility Complex region on chromosome 6p21, with rs1613056 reaching genome wide significance (p = 5 × 10 -8 ). Technical validation of top ranking non-Major Histo-compatablity complex single nucleotide polymorphisms with individual genotyping in the discovery cohort revealed four single nucleotide polymorphisms with p ≤ 10 -4 . Rs17676303 on chromosome 1q23.1, located upstream of FCRL3, showed evidence of association with Graves' disease across the discovery, replication and combined cohorts. A second single nucleotide polymorphism rs9644119 downstream of DPYSL2 showed some evidence of association supported by finding in the replication cohort that warrants further study. Pooled genome wide association study identified a genetic variant upstream of FCRL3 as a susceptibility locus for Graves' disease in addition to those identified in the Major Histo-compatibility Complex. A second locus downstream of DPYSL2 is potentially a novel genetic variant in Graves' disease that requires further confirmation.

  5. A Numerical Analysis on the Effects of Self-Excited Tip Flow Unsteadiness and Upstream Blade Row Interactions on the Performance Predictions of a Transonic Compressor

    NASA Astrophysics Data System (ADS)

    Heberling, Brian

    Computational fluid dynamics (CFD) simulations can offer a detailed view of the complex flow fields within an axial compressor and greatly aid the design process. However, the desire for quick turnaround times raises the question of how exact the model must be. At design conditions, steady CFD simulating an isolated blade row can accurately predict the performance of a rotor. However, as a compressor is throttled and mass flow rate decreased, axial flow becomes weaker making the capturing of unsteadiness, wakes, or other flow features more important. The unsteadiness of the tip clearance flow and upstream blade wake can have a significant impact on a rotor. At off-design conditions, time-accurate simulations or modeling multiple blade rows can become necessary in order to receive accurate performance predictions. Unsteady and multi- bladerow simulations are computationally expensive, especially when used in conjunction. It is important to understand which features are important to model in order to accurately capture a compressor's performance. CFD simulations of a transonic axial compressor throttling from the design point to stall are presented. The importance of capturing the unsteadiness of the rotor tip clearance flow versus capturing upstream blade-row interactions is examined through steady and unsteady, single- and multi-bladerow computations. It is shown that there are significant differences at near stall conditions between the different types of simulations.

  6. Common variants upstream of MLF1 at 3q25 and within CPZ at 4p16 associated with neuroblastoma.

    PubMed

    McDaniel, Lee D; Conkrite, Karina L; Chang, Xiao; Capasso, Mario; Vaksman, Zalman; Oldridge, Derek A; Zachariou, Anna; Horn, Millicent; Diamond, Maura; Hou, Cuiping; Iolascon, Achille; Hakonarson, Hakon; Rahman, Nazneen; Devoto, Marcella; Diskin, Sharon J

    2017-05-01

    Neuroblastoma is a cancer of the developing sympathetic nervous system that most commonly presents in young children and accounts for approximately 12% of pediatric oncology deaths. Here, we report on a genome-wide association study (GWAS) in a discovery cohort or 2,101 cases and 4,202 controls of European ancestry. We identify two new association signals at 3q25 and 4p16 that replicated robustly in multiple independent cohorts comprising 1,163 cases and 4,396 controls (3q25: rs6441201 combined P = 1.2x10-11, Odds Ratio 1.23, 95% CI:1.16-1.31; 4p16: rs3796727 combined P = 1.26x10-12, Odds Ratio 1.30, 95% CI: 1.21-1.40). The 4p16 signal maps within the carboxypeptidase Z (CPZ) gene. The 3q25 signal resides within the arginine/serine-rich coiled-coil 1 (RSRC1) gene and upstream of the myeloid leukemia factor 1 (MLF1) gene. Increased expression of MLF1 was observed in neuroblastoma cells homozygous for the rs6441201 risk allele (P = 0.02), and significant growth inhibition was observed upon depletion of MLF1 (P < 0.0001) in neuroblastoma cells. Taken together, we show that common DNA variants within CPZ at 4p16 and upstream of MLF1 at 3q25 influence neuroblastoma susceptibility and MLF1 likely plays an important role in neuroblastoma tumorigenesis.

  7. Common variants upstream of MLF1 at 3q25 and within CPZ at 4p16 associated with neuroblastoma

    PubMed Central

    Capasso, Mario; Vaksman, Zalman; Zachariou, Anna; Horn, Millicent; Diamond, Maura; Hou, Cuiping; Iolascon, Achille; Hakonarson, Hakon; Rahman, Nazneen

    2017-01-01

    Neuroblastoma is a cancer of the developing sympathetic nervous system that most commonly presents in young children and accounts for approximately 12% of pediatric oncology deaths. Here, we report on a genome-wide association study (GWAS) in a discovery cohort or 2,101 cases and 4,202 controls of European ancestry. We identify two new association signals at 3q25 and 4p16 that replicated robustly in multiple independent cohorts comprising 1,163 cases and 4,396 controls (3q25: rs6441201 combined P = 1.2x10-11, Odds Ratio 1.23, 95% CI:1.16–1.31; 4p16: rs3796727 combined P = 1.26x10-12, Odds Ratio 1.30, 95% CI: 1.21–1.40). The 4p16 signal maps within the carboxypeptidase Z (CPZ) gene. The 3q25 signal resides within the arginine/serine-rich coiled-coil 1 (RSRC1) gene and upstream of the myeloid leukemia factor 1 (MLF1) gene. Increased expression of MLF1 was observed in neuroblastoma cells homozygous for the rs6441201 risk allele (P = 0.02), and significant growth inhibition was observed upon depletion of MLF1 (P < 0.0001) in neuroblastoma cells. Taken together, we show that common DNA variants within CPZ at 4p16 and upstream of MLF1 at 3q25 influence neuroblastoma susceptibility and MLF1 likely plays an important role in neuroblastoma tumorigenesis. PMID:28545128

  8. Sequence and transcriptional analysis of the barley ctDNA region upstream of psbD-psbC encoding trnK(UUU), rps16, trnQ(UUG), psbK, psbI, and trnS(GCU).

    PubMed

    Berends Sexton, T; Jones, J T; Mullet, J E

    1990-05-01

    A 6.25 kbp barley plastid DNA region located between psbA and psbD-psbC were sequenced and RNAs produced from this DNA were analyzed. TrnK(UUU), rps16 and trnQ(UUG) were located upstream of psbA. These genes were transcribed from the same DNA strand as psbA and multiple RNAs hybridized to them. TrnK and rsp16 contained introns; a 504 amino acid open reading frame (ORF504) was located within the trnK intron. Between trnQ and psbD-psbC was a 2.24 kbp region encoding psbK, psbI and trnS(GCU). PsbK and psbI are encoded on the same DNA strand as psbD-psbC whereas trnS(GCU) is transcribed from the opposite strand. Two large RNAs accumulate in barley etioplasts which contain psbK, psbI, anti-sense trnS(GCU) and psbD-psbC sequences. Other RNAs encode psbK and psbI only, or psbK only. The divergent trnS(GCU) located upstream of psbD-psbC and a second divergent trnS(UGA) located downstream of psbD-psbC were both expressed. Furthermore, RNA complementary to psbK and psbI mRNA was detected, suggesting that transcription from divergent overlapping transcription units may modulate expression from this DNA region.

  9. Long river profiles, tectonism, and eustasy: A guide to interpreting fluvial terraces

    NASA Technical Reports Server (NTRS)

    Merritts, Dorothy J.; Vincent, Kirk R.; Wohl, Ellen E.

    1994-01-01

    Along three rivers at the Mendocino triple junction, northern California, strath, cut, and fill terraces have formed in response to tectonic and eustatic processes. Detailed surveying and radiometric dating at multiple sites indicate that lower reaches of the rivers are dominated by the effects of oscillating sea level, primarily aggradation and formation of fill terraces during sea level high stands, alternating with deep incision during low stands. A eustasy-driven depositional wedge extends tens of kilometers upstream on all rivers (tapering to zero thickness). This distance is greater than expected from studies of the effects of check dams on much smaller streams elsewhere, due in part to the large size of these rivers. However, the change in gradient is nearly identical to other base level rise studies: the depositional gradient is about half that of the original channel. Middle to upper reaches of each river are dominated by the effects of long-term uplift, primarily lateral and vertical erosion and formation of steep, unpaired strath terraces exposed only upstream of the depositional wedge. Vertical incision at a rate similar to that of uplift has occurred even during the present sea level high stand along rivers with highest uplift rates. Strath terraces have steeper gradients than the modern channel bed and do not merge with marine terraces at the river mouth; consequently, they cannot be used to determine altitudes of sea level high stands. Strath formation is a continuous process of response to long-term uplift, and its occurrence varies spatially along a river depending on stream power, and hence position, upstream. Strath terraces are found only along certain parts of a coastal stream: upstream of the aggradational effects of oscillating sea level, and far enough downstream that stream power is in excess of that needed to transport the prevailing sediment load. For a given size river, the greater the uplift rate, the greater the rate of vertical incision and, consequently, the less the likelihood of strath terrace formation and preservation.

  10. Assessment of sediments in the riverine impoundments of national wildlife refuges in the Souris River Basin, North Dakota

    USGS Publications Warehouse

    Tangen, Brian A.; Laubhan, Murray K.; Gleason, Robert A.

    2014-01-01

    Accelerated sedimentation of reservoirs and riverine impoundments is a major concern throughout the United States. Sediments not only fill impoundments and reduce their effective life span, but they can reduce water quality by increasing turbidity and introducing harmful chemical constituents such as heavy metals, toxic elements, and nutrients. U.S. Fish and Wildlife Service national wildlife refuges in the north-central part of the United States have documented high amounts of sediment accretion in some wetlands that could negatively affect important aquatic habitats for migratory birds and other wetland-dependent wildlife. Therefore, information pertaining to sediment accumulation in refuge impoundments potentially is important to guide conservation planning, including future management actions of individual impoundments. Lands comprising Des Lacs, Upper Souris, and J. Clark Salyer National Wildlife Refuges, collectively known as the Souris River Basin refuges, encompass reaches of the Des Lacs and Souris Rivers of northwestern North Dakota. The riverine impoundments of the Souris River Basin refuges are vulnerable to sedimentation because of the construction of in-stream dams that interrupt and slow river flows and because of post-European settlement land-use changes that have increased the potential for soil erosion and transport to rivers. Information regarding sediments does not exist for these refuges, and U.S. Fish and Wildlife Service personnel have expressed interest in assessing refuge impoundments to support refuge management decisions. Sediment cores and surface sediment samples were collected from impoundments within Des Lacs, Upper Souris, and J. Clark Salyer National Wildlife Refuges during 2004–05. Cores were used to estimate sediment accretion rates using radioisotope (cesium-137 [137Cs], lead-210 [210Pb]) dating techniques. Sediment cores and surface samples were analyzed for a suite of elements and agrichemicals, respectively. Examination of core characteristics along the depth profile suggests that there has been regular sediment mixing and removal, as well as non-uniform sediment deposition with time. Estimated mean accretion rates based on the three methods of determination (two time markers for 137Cs, 210Pb) ranged from 0.22–0.35 centimeters per year, and approximately 70 percent of cores had less 137Cs than expected. Concentrations of sediment-associated elements generally were within reported reference ranges, and all agrichemicals analyzed were below detection limits. Results suggest that there does not appear to be widespread sediment accumulation in impoundments of the Souris River Basin refuges. In addition, there were no identifiable patterns among sedimentation rates from the upstream (Des Lacs, Upper Souris) to the downstream (J. Clark Salyer) refuges. There were, however, apparent upstream to downstream patterns of increased concentrations of some elements (for example, aluminum, boron, and vanadium) that may warrant further exploration. Future related monitoring and research efforts should focus on areas with high potential for sediment accumulation, such as upstream areas adjacent to dams, to identify potential sediment problems before they become too severe. Further, assessments of suspended sediments transported in the Des Lacs and Souris Rivers would augment interpretation of sedimentation data by identifying potential sediment sources and areas with the greatest potential for accumulation.

  11. Triangular defects in the low-temperature halo-carbon homoepitaxial growth of 4H-SiC

    NASA Astrophysics Data System (ADS)

    Das, Hrishikesh; Melnychuk, Galyna; Koshka, Yaroslav

    2010-06-01

    Generation of triangular defects (TDs) is a significant obstacle in the way of increasing the growth rate of the low-temperature halo-carbon homoepitaxial growth of 4H-SiC conducted at 1300 °C. In this work, the structure of the TDs and the factors influencing TD generation were investigated. It has been found that TD concentration at 1300 °C is primarily influenced by the growth rate. Higher concentrations of the TDs were typically observed at the upstream regions of the sample. With the help of KOH defect delineation technique it was established that the locations of the TDs did not coincide with any of the substrate defects. Nucleation of small polycrystalline Si islands is the main origin for the TDs nucleation during the low-temperature growth, especially at moderate-to-low values of the C/Si ratio, which have been previously shown to be favorable for avoiding generation of 3C inclusions and morphology degradation. At typical low-temperature growth conditions, small polycrystalline Si islands can form on SiC surface (predominantly at the upstream portion of the growth zone). Those islands serve as nucleation centers for TDs and subsequently get evaporated. TDs are bound by two or often multiple partial dislocations, which results in one or multiple stacking faults, respectively. When arrays of partial dislocations were present at each edge of a TD, 3C polytype inclusions were often revealed by the oxidation technique and micro-Raman spectroscopy.

  12. Interpreting Beryllium-7 and Lead-210 fluxes and ratios for age dating fluvial sediments in Difficult Run Watershed, Virginia, USA

    NASA Astrophysics Data System (ADS)

    Karwan, D. L.; Pizzuto, J. E.; Skalak, K.; Benthem, A.

    2016-12-01

    The sources and transport of suspended sediments within watersheds of varying sizes remain an important area of study within the geosciences. Short term fallout radionuclides, such as Beryllium-7 (7Be) and Lead-210 (210Pb), and their ratios can be a valuable tool for gaining insight into suspended sediment transport dynamics. We use these techniques in combination with other sediment exchange and transport models to estimate residence and transport time of suspended sediment in nested reaches of the Difficult Run watershed (Virginia, USA) on timescales from storm events to centuries and longer. During several winter and spring 2015-2016 precipitation events, Beryllium-7 to excess Lead-210 ratios vary from 0.4 - 2.5 in direct channel precipitation and 0.2 - 1 on suspended sediment. Previously published age dating models would suggest that the suspended sediments were originally "tagged" by, or in contact with wet fallout of, by Beryllium7 fallout approximately 20-80 days before sampling. Sediments at the upstream reach (watershed size 14 km2) tend to be older ( 75 days), while sediments at the downstream reach (watershed size 117 km2) tend to be newer ( 20 days). We use multiple sediment transport models and hypothesize that fluvial sediments are tagged with direct channel precipitation between the upstream and downstream reach, explaining their apparently younger age. Our analysis includes error propagation as well as a comparison of radioisotope gamma analyses from different labs across multiple institutions.

  13. A randomized controlled trial of a community health worker intervention in a population of patients with multiple chronic diseases: Study design and protocol

    PubMed Central

    Kangovi, Shreya; Mitra, Nandita; Turr, Lindsey; Huo, Hairong; Grande, David; Long, Judith A.

    2017-01-01

    Upstream interventions – e.g. housing programs and community health worker interventions-address socioeconomic and behavioral factors that influence health outcomes across diseases. Studying these types of interventions in clinical trials raises a methodological challenge: how should researchers measure the effect of an upstream intervention in a sample of patients with different diseases? This paper addresses this question using an illustrative protocol of a randomized controlled trial of collaborative-goal setting versus goal-setting plus community health worker support among patients multiple chronic diseases: diabetes, obesity, hypertension and tobacco dependence. At study enrollment, patients met with their primary care providers to select one of their chronic diseases to focus on during the study, and to collaboratively set a goal for that disease. Patients randomly assigned to a community health worker also received six months of support to address socioeconomic and behavioral barriers to chronic disease control. The primary hypothesis was that there would be differences in patients’ selected chronic disease control as measured by HbA1c, body mass index, systolic blood pressure and cigarettes per day, between the goal-setting alone and community health worker support arms. To test this hypothesis, we will conduct a stratum specific multivariate analysis of variance which allows all patients (regardless of their selected chronic disease) to be included in a single model for the primary outcome. Population health researchers can use this approach to measure clinical outcomes across diseases. PMID:27965180

  14. Mrp--a new auxiliary gene essential for optimal expression of methicillin resistance in Staphylococcus aureus.

    PubMed

    Wu, S W; De Lencastre, H

    1999-01-01

    Screening of a library of Tn551 insertional mutants selected for reduction in the methicillin resistance level of the parental Staphylococcus aureus strain COL resulted in the isolation of mutant RUSA266 in which the minimal inhibitory concentration (MIC) of the parent was reduced from 1,600 to 1.5 micrograms/mL. Cloning and sequencing of the vicinity of the insertion site omega 726 identified an open reading frame (orf1365) encoding a very large polypeptide of more than 1,365 amino acids. A unique feature of the deduced amino acid sequence was the presence of multiple tandem repeats of 75 amino acids in the polypeptide, reminiscent of the structure of high-molecular-weight cell-surface proteins EF* and Emb identified in some streptococcal strains. Mutant RUSA266 with the inactivated gene, which we shall provisionally refer to as mrp (for multiple repeat polypeptide), produced a peptidoglycan with altered muropeptide composition, and both the reduced antibiotic resistance and the altered cell wall composition were co-transduced in back-crosses into the parental strain COL. Additional sequencing upstream of mrp has revealed that this gene was part of a five-gene cluster occupying a 9.2-kb region of the staphylococcal chromosome and was composed of glmM (directly upstream of mrp), two open reading frames orf310 and orf269 coding for two hypothetical proteins, and the gene encoding the staphylococcal arginase (arg). Transcriptional analysis demonstrated that the five genes in the cluster were transcribed together.

  15. Application of life cycle thinking in multidisciplinary multistakeholder contexts for cross-sectoral planning and implementation of sustainable development projects.

    PubMed

    Thabrew, Lanka; Ries, Robert

    2009-07-01

    Development planning and implementation is a multifaceted and multiscale task mainly because of the involvement of multiple stakeholders across sectors and disciplines. Even though top-down sectoral planning is commonly practiced, bottom-up cross-sectoral planning involving all relevant stakeholders in a transdisciplinary learning environment has been recognized as a better option, especially if the goal is to drive development projects toward sustainable implementation (Rowe and Fudge 2003; Müller et al. 2005; Global Development Research Center 2008). Even though many planning approaches have this goal, there are limited decision frameworks that are suitable for achieving consensus among stakeholders from multiple disciplines with sectoral objectives and priorities. In most instances, the upstream and downstream effects of development decisions are not thoroughly investigated or communicated with the relevant stakeholders, strongly affecting cross-sectoral integration in the real world (Wiek, Brundiers, et al. 2006). This article presents methodological aspects of developing a stakeholder based life cycle assessment framework (SBLCA) for upstream-downstream decision analysis in a multistakeholder development planning context. The applicability of the framework is demonstrated using simple examples extracted from a pilot case study conducted in Sri Lanka for sustainable posttsunami reconstruction at a village scale. The applicability of SBLCA in specific planning stages, how it promotes transdisciplinary learning and cross-sectoral stakeholder integration in phases of project cycles, and how local stakeholders can practice life cycle thinking in their village development planning and implementation are discussed.

  16. Analysis of a Near Field MIMO Wireless Channel Using 5.6 GHz Dipole Antennas

    NASA Astrophysics Data System (ADS)

    Maricar, Mohamed Ismaeel; Gradoni, Gabriele; Greedy, Steve; Ivrlac, Michel T.; Nossek, Josef A.; Phang, Sendy; Creagh, Stephen C.; Tanner, Gregor; Thomas, David W. P.

    2016-05-01

    Understanding the impact of interference upon the performance of a multiple input multiple output (MIMO) based device is of paramount importance in ensuring a design is both resilient and robust. In this work the effect of element-element interference in the creation of multiple channels of a wireless link approaching the near-field regime is studied. The elements of the 2-antenna transmit- and receive-arrays are chosen to be identical folded dipole antennas operating at 5.6 GHz. We find that two equally strong channels can be created even if the antennas interact at sub-wavelength distances, thus confirming previous theoretical predictions.

  17. Scanning sequences after Gibbs sampling to find multiple occurrences of functional elements

    PubMed Central

    Tharakaraman, Kannan; Mariño-Ramírez, Leonardo; Sheetlin, Sergey L; Landsman, David; Spouge, John L

    2006-01-01

    Background Many DNA regulatory elements occur as multiple instances within a target promoter. Gibbs sampling programs for finding DNA regulatory elements de novo can be prohibitively slow in locating all instances of such an element in a sequence set. Results We describe an improvement to the A-GLAM computer program, which predicts regulatory elements within DNA sequences with Gibbs sampling. The improvement adds an optional "scanning step" after Gibbs sampling. Gibbs sampling produces a position specific scoring matrix (PSSM). The new scanning step resembles an iterative PSI-BLAST search based on the PSSM. First, it assigns an "individual score" to each subsequence of appropriate length within the input sequences using the initial PSSM. Second, it computes an E-value from each individual score, to assess the agreement between the corresponding subsequence and the PSSM. Third, it permits subsequences with E-values falling below a threshold to contribute to the underlying PSSM, which is then updated using the Bayesian calculus. A-GLAM iterates its scanning step to convergence, at which point no new subsequences contribute to the PSSM. After convergence, A-GLAM reports predicted regulatory elements within each sequence in order of increasing E-values, so users have a statistical evaluation of the predicted elements in a convenient presentation. Thus, although the Gibbs sampling step in A-GLAM finds at most one regulatory element per input sequence, the scanning step can now rapidly locate further instances of the element in each sequence. Conclusion Datasets from experiments determining the binding sites of transcription factors were used to evaluate the improvement to A-GLAM. Typically, the datasets included several sequences containing multiple instances of a regulatory motif. The improvements to A-GLAM permitted it to predict the multiple instances. PMID:16961919

  18. A Partial Least Squares Based Procedure for Upstream Sequence Classification in Prokaryotes.

    PubMed

    Mehmood, Tahir; Bohlin, Jon; Snipen, Lars

    2015-01-01

    The upstream region of coding genes is important for several reasons, for instance locating transcription factor, binding sites, and start site initiation in genomic DNA. Motivated by a recently conducted study, where multivariate approach was successfully applied to coding sequence modeling, we have introduced a partial least squares (PLS) based procedure for the classification of true upstream prokaryotic sequence from background upstream sequence. The upstream sequences of conserved coding genes over genomes were considered in analysis, where conserved coding genes were found by using pan-genomics concept for each considered prokaryotic species. PLS uses position specific scoring matrix (PSSM) to study the characteristics of upstream region. Results obtained by PLS based method were compared with Gini importance of random forest (RF) and support vector machine (SVM), which is much used method for sequence classification. The upstream sequence classification performance was evaluated by using cross validation, and suggested approach identifies prokaryotic upstream region significantly better to RF (p-value < 0.01) and SVM (p-value < 0.01). Further, the proposed method also produced results that concurred with known biological characteristics of the upstream region.

  19. Long-term Records of Trace Metal Elements in Core Sediments: Anthropogenic Impacts in The Eure River Watershed

    NASA Astrophysics Data System (ADS)

    Gardes, T.; Debret, M.; Copard, Y.; Patault, E.; Deloffre, J.; Marcotte, S.; Develle, A. L.; Sabatier, P.; Chaumillon, E.; Coulombier, T.; Revillon, S.; Nizou, J.; Laberdesque, Y.; Koltalo, F.

    2017-12-01

    The Martot Dam is located in the Eure River Watershed (Normandy, France), few hundred meters upstream the Eure-Seine Rivers confluence. In the context of the European Water Framework Directive (2000/60/EC), the French Authorities planned to remove this dam in 2017. Nevertheless, impacts of the removal remain poorly studied. Classically, dam blocked sedimentary transfers downstream, but here, sediments are not blocked behind the dam but stored three hundred meters upstream in a hydraulic annex, called the Martot Pond. Furthermore, this pond is submitted to the tidal flow from the Seine Estuary despite the Martot Dam. The aim of the study is to evaluate the dam removal impacts on sedimentary transfers and re-suspension of contaminated sediments stored in the Martot Pond and the Eure River's channel. Concerning past transfers and sediments accumulation in the Eure River Watershed, sedimentary archives have been cored, before dam removal, at the Martot Pond and the Les Damps Pond (located 10km upstream the latter). Dating of sedimentary cores for both ponds indicates a sedimentation rate around 1 cm y-1. Trace metal elements quantification showed a wide metallic contamination with highest concentrations evidenced during the 1950-1960's (As: 13-22 mg kg-1; Cd: 40-55 mg kg-1; Cr: 170-210 mg kg-1; Cu: 400-490 mg kg-1; Hg: 2.3 mg kg-1; Mn: 1,280-2,200 mg kg-1; Ni: 64-75 mg kg-1; Zn: 905-990 mg kg-1) and the 1990-2000's (Cr: 95-215 mg kg-1; Ni: 100 mg kg-1; Pb: 670-855 mg kg-1). These variations of concentrations along cores can be associated with industrial past of the Eure River Watershed and sources of contamination can be identified. Thereby, Zn, Ni or Hg contamination could be associated with wastes of battery factory released in the Eure River during the economic recovery, while Pb contamination is linked to the activities of a cathode-ray tubes factory. Metals quantification in core materials highlighted anthropogenic impacts in the Eure River Watershed. These contaminated sediments could be re-suspended and transferred to the Seine River in case of remobilization in Martot Pond and the Eure River's channel after dam removal.

  20. Selfish DNA: a pharmaceutical perspective.

    PubMed

    Winckler, T

    2013-07-01

    Almost 25 years ago, Theo Dingermann published the discovery of a new mobile genetic element in the unicellular microbe Dictyostelium discoideum in the journal Science. An interesting property of this new molecular parasite, the Dictyostelium Repetitive Element (DRE), was that all integrations were found approximately 50 base pairs (bp) upstream of transfer RNA (tRNA) genes in the D. discoideum genome, thus implying an active targeting mechanism to avoid the disruption of host cell genes by the retrotransposition process. Since then, the facultative multicellular "social amoeba" D. discoideum has become a popular model for analyzing complex cellular functions such as cell movement, chemotaxis, phagocytosis, and cell differentiation, important areas of biomedical research that are often hard to investigate in cells from "higher organisms" including humans. Therefore, progress in the development of methods to study Dictyostelium biology has also provoked research on transposable elements in this organism. Early work on the DRE element suggested that studying its molecular mechanism of site-specific integration might promote human gene therapy technology through the design of integrating gene transfer vectors with low intrinsic genotoxic potential. In this review article, I will briefly review the original research performed on the DRE transposable element in the Dingermann lab and report on how the emergence of genomics technologies and the development of tools to analyze de novo retrotransposition events in D. discoideum cells will expand our knowledge of DRE biology in the future.

  1. Spatial characterization, risk assessment, and statistical source identification of the dissolved trace elements in the Ganjiang River-feeding tributary of the Poyang Lake, China.

    PubMed

    Zhang, Hua; Jiang, Yinghui; Wang, Min; Wang, Peng; Shi, Guangxun; Ding, Mingjun

    2017-01-01

    Surface water samples were collected from 20 sampling sites throughout the Ganjiang River during pre-monsoon, monsoon, and post-monsoon seasons, and the concentrations of dissolved trace elements were determined by inductively coupled plasma-mass spectrometry (ICP-MS) for the spatial and seasonal variations, risk assessment, source identification, and categorization for risk area. The result demonstrated that concentrations of the elements exhibited significant seasonality. The high total element concentrations were detected at sites close to the intensive mining and urban activities. The concentrations of the elements were under the permissible limits as prescribed by related standards with a few exceptions. The most of heavy metal pollution index (HPI) values were lower than the critical index limit, indicating the basically clean water used as habitat for aquatic life. As was identified as the priority pollutant of non-carcinogenic and carcinogenic concerns, and the inhabitants ingesting the surface water at particular site might be subjected to the integrated health risks for exposure to the mixed trace elements. Multivariate statistical analyses confirmed that Zn, As, Cd, and Tl were derived from mining and urban activities; V, Cd, and Pb exhibited mixed origin; and Co, Ni, and Cu mainly resulted from natural processes. Three categorized risk areas corresponded to high, moderate, and low risks, respectively. As a whole, the upstream of the Ganjiang River was identified as the high-risk area relatively.

  2. Form drag in rivers due to small-scale natural topographic features: 1. Regular sequences

    USGS Publications Warehouse

    Kean, J.W.; Smith, J.D.

    2006-01-01

    Small-scale topographic features are commonly found on the boundaries of natural rivers, streams, and floodplains. A simple method for determining the form drag on these features is presented, and the results of this model are compared to laboratory measurements. The roughness elements are modeled as Gaussian-shaped features defined in terms of three parameters: a protrusion height, H; a streamwise length scale, ??; and a spacing between crests, ??. This shape is shown to be a good approximation to a wide variety of natural topographic bank features. The form drag on an individual roughness element embedded in a series of identical elements is determined using the drag coefficient of the individual element and a reference velocity that includes the effects of roughness elements further upstream. In addition to calculating the drag on each element, the model determines the spatially averaged total stress, skin friction stress, and roughness height of the boundary. The effects of bank roughness on patterns of velocity and boundary shear stress are determined by combining the form drag model with a channel flow model. The combined model shows that drag on small-scale topographic features substantially alters the near-bank flow field. These methods can be used to improve predictions of flow resistance in rivers and to form the basis for fully predictive (no empirically adjusted parameters) channel flow models. They also provide a foundation for calculating the near-bank boundary shear stress fields necessary for determining rates of sediment transport and lateral erosion.

  3. Divergence in Morris Water Maze-Based Cognitive Performance under Chronic Stress Is Associated with the Hippocampal Whole Transcriptomic Modification in Mice

    PubMed Central

    Jung, Seung H.; Brownlow, Milene L.; Pellegrini, Matteo; Jankord, Ryan

    2017-01-01

    Individual susceptibility determines the magnitude of stress effects on cognitive function. The hippocampus, a brain region of memory consolidation, is vulnerable to stressful environments, and the impact of stress on hippocampus may determine individual variability in cognitive performance. Therefore, the purpose of this study was to define the relationship between the divergence in spatial memory performance under chronically unpredictable stress and an associated transcriptomic alternation in hippocampus, the brain region of spatial memory consolidation. Multiple strains of BXD (B6 × D2) recombinant inbred mice went through a 4-week chronic variable stress (CVS) paradigm, and the Morris water maze (MWM) test was conducted during the last week of CVS to assess hippocampal-dependent spatial memory performance and grouped animals into low and high performing groups based on the cognitive performance. Using hippocampal whole transcriptome RNA-sequencing data, differential expression, PANTHER analysis, WGCNA, Ingenuity's upstream regulator analysis in the Ingenuity Pathway Analysis® and phenotype association analysis were conducted. Our data identified multiple genes and pathways that were significantly associated with chronic stress-associated cognitive modification and the divergence in hippocampal dependent memory performance under chronic stress. Biological pathways associated with memory performance following chronic stress included metabolism, neurotransmitter and receptor regulation, immune response and cellular process. The Ingenuity's upstream regulator analysis identified 247 upstream transcriptional regulators from 16 different molecule types. Transcripts predictive of cognitive performance under high stress included genes that are associated with a high occurrence of Alzheimer's and cognitive impairments (e.g., Ncl, Eno1, Scn9a, Slc19a3, Ncstn, Fos, Eif4h, Copa, etc.). Our results show that the variable effects of chronic stress on the hippocampal transcriptome are related to the ability to complete the MWM task and that the modulations of specific pathways are indicative of hippocampal dependent memory performance. Thus, the divergence in spatial memory performance following chronic stress is related to the unique pattern of gene expression within the hippocampus. PMID:28912681

  4. Genomic structure, promoter identification, and chromosomal mapping of a mouse nuclear orphan receptor expressed in embryos and adult testes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, C.H.; Wei, Li-Na; Copeland, N.G.

    We have isolated and characterized overlapping genomic clones containing the complete transcribed region of a newly isolated mouse cDNA encoding an orphan receptor expressed specifically in midgestation embryos and adult testis. This gene spans a distance of more than 50 kb and is organized into 13 exons. The transcription initiation site is located at the 158th nucleotide upstream from the translation initiation codon. All the exon/intron junction sequences follow the GT/AG rule. Based upon Northern blot analysis and the size of the transcribed region of the gene, its transcript was determined to be approximately 2.5 kb. Within approximately 500 hpmore » upstream from the transcription initiation site, several immune response regulatory elements were identified but no TATA box was located. This gene was mapped to the distal region of mouse chromosome 10 and its locus has been designated Tr2-11. Immunohistochemical studies show that the Tr2-11 protein is present mainly in advanced germ cell populations of mature testes and that Tr2-11 gene expression is dramatically decreased in vitamin A-depleted animals. 23 refs., 7 figs.« less

  5. Influence of gene dosage and autoregulation of the regulatory genes INO2 and INO4 on inositol/choline-repressible gene transcription in the yeast Saccharomyces cerevisiae.

    PubMed

    Schwank, S; Hoffmann, B; Sch-uller, H J

    1997-06-01

    Expression of structural genes of phospholipid biosynthesis in yeast is mediated by the inositol/choline-responsive element (ICRE). ICRE-dependent gene activation, requiring the regulatory genes INO2 and INO4, is repressed in the presence of the phospholipid precursors inositol and choline. INO2 and, to a less extent, INO4 are positively autoregulated by functional ICRE sequences in the respective upstream regions. However, an INO2 allele devoid of its ICRE functionally complemented an ino2 mutation and completely restored inositol/choline regulation of Ino2p-dependent reporter genes. Low-level expression of INO2 and INO4 genes, each under control of the heterologous MET25 promoter, did not alter the regulatory pattern of target genes. Thus, upstream regions of INO2 and INO4 are not crucial for transcriptional control of ICRE-dependent genes by inositol and choline. Interestingly, over-expression of INO2, but not of INO4, counteracted repression by phospholipid precursors. Possibly, a functional antagonism between INO2 and a negative regulator is the key event responsible for repression or de-repression.

  6. Upstream oversight assessment for agrifood nanotechnology: a case studies approach.

    PubMed

    Kuzma, Jennifer; Romanchek, James; Kokotovich, Adam

    2008-08-01

    Although nanotechnology is broadly receiving attention in public and academic circles, oversight issues associated with applications for agriculture and food remain largely unexplored. Agrifood nanotechnology is at a critical stage in which informed analysis can help shape funding priorities, risk assessment, and oversight activities. This analysis is designed to help society and policymakers anticipate and prepare for challenges posed by complicated, convergent applications of agrifood nanotechnology. The goal is to identify data, risk assessment, regulatory policy, and engagement needs for overseeing these products so they can be addressed prior to market entry. Our approach, termed upstream oversight assessment (UOA), has potential as a key element of anticipatory governance. It relies on distinct case studies of proposed applications of agrifood nanotechnology to highlight areas that need study and attention. As a tool for preparation, UOA anticipates the types and features of emerging applications; their endpoints of use in society; the extent to which users, workers, ecosystems, or consumers will be exposed; the nature of the material and its safety; whether and where the technologies might fit into current regulatory system(s); the strengths and weaknesses of the system(s) in light of these novel applications; and the possible social concerns related to oversight for them.

  7. Transition Experiments on Large Bluntness Cones with Distributed Roughness in Hypersonic Flight

    NASA Technical Reports Server (NTRS)

    Reda, Daniel. C.; Wilder, Michael C.; Prabhu, Dinesh K.

    2012-01-01

    Large bluntness cones with smooth nosetips and roughened frusta were flown in the NASA Ames hypersonic ballistic range at a Mach number of 10 through quiescent air environments. Global surface intensity (temperature) distributions were optically measured and analyzed to determine transition onset and progression over the roughened surface. Real-gas Navier-Stokes calculations of model flowfields, including laminar boundary layer development in these flowfields, were conducted to predict values of key dimensionless parameters used to correlate transition on such configurations in hypersonic flow. For these large bluntness cases, predicted axial distributions of the roughness Reynolds number showed (for each specified freestream pressure) that this parameter was a maximum at the physical beginning of the roughened zone and decreased with increasing run length along the roughened surface. Roughness-induced transition occurred downstream of this maximum roughness Reynolds number location, and progressed upstream towards the beginning of the roughened zone as freestream pressure was systematically increased. Roughness elements encountered at the upstream edge of the roughened frusta thus acted like a finite-extent trip array, consistent with published results concerning the tripping effectiveness of roughness bands placed on otherwise smooth surfaces.

  8. Gene expression regulation by upstream open reading frames and human disease.

    PubMed

    Barbosa, Cristina; Peixeiro, Isabel; Romão, Luísa

    2013-01-01

    Upstream open reading frames (uORFs) are major gene expression regulatory elements. In many eukaryotic mRNAs, one or more uORFs precede the initiation codon of the main coding region. Indeed, several studies have revealed that almost half of human transcripts present uORFs. Very interesting examples have shown that these uORFs can impact gene expression of the downstream main ORF by triggering mRNA decay or by regulating translation. Also, evidence from recent genetic and bioinformatic studies implicates disturbed uORF-mediated translational control in the etiology of many human diseases, including malignancies, metabolic or neurologic disorders, and inherited syndromes. In this review, we will briefly present the mechanisms through which uORFs regulate gene expression and how they can impact on the organism's response to different cell stress conditions. Then, we will emphasize the importance of these structures by illustrating, with specific examples, how disturbed uORF-mediated translational control can be involved in the etiology of human diseases, giving special importance to genotype-phenotype correlations. Identifying and studying more cases of uORF-altering mutations will help us to understand and establish genotype-phenotype associations, leading to advancements in diagnosis, prognosis, and treatment of many human disorders.

  9. Gains and Losses of Transcription Factor Binding Sites in Saccharomyces cerevisiae and Saccharomyces paradoxus

    PubMed Central

    Schaefke, Bernhard; Wang, Tzi-Yuan; Wang, Chuen-Yi; Li, Wen-Hsiung

    2015-01-01

    Gene expression evolution occurs through changes in cis- or trans-regulatory elements or both. Interactions between transcription factors (TFs) and their binding sites (TFBSs) constitute one of the most important points where these two regulatory components intersect. In this study, we investigated the evolution of TFBSs in the promoter regions of different Saccharomyces strains and species. We divided the promoter of a gene into the proximal region and the distal region, which are defined, respectively, as the 200-bp region upstream of the transcription starting site and as the 200-bp region upstream of the proximal region. We found that the predicted TFBSs in the proximal promoter regions tend to be evolutionarily more conserved than those in the distal promoter regions. Additionally, Saccharomyces cerevisiae strains used in the fermentation of alcoholic drinks have experienced more TFBS losses than gains compared with strains from other environments (wild strains, laboratory strains, and clinical strains). We also showed that differences in TFBSs correlate with the cis component of gene expression evolution between species (comparing S. cerevisiae and its sister species Saccharomyces paradoxus) and within species (comparing two closely related S. cerevisiae strains). PMID:26220934

  10. Seasonal variability of the hydrogen exosphere of Mars

    NASA Astrophysics Data System (ADS)

    Halekas, J. S.

    2017-05-01

    The Mars Atmosphere and Volatile EvolutioN (MAVEN) mission measures both the upstream solar wind and collisional products from energetic neutral hydrogen atoms that precipitate into the upper atmosphere after their initial formation by charge exchange with exospheric hydrogen. By computing the ratio between the densities of these populations, we derive a robust measurement of the column density of exospheric hydrogen upstream of the Martian bow shock. By comparing with Chamberlain-type model exospheres, we place new constraints on the structure and escape rates of exospheric hydrogen, derived from observations sensitive to a different and potentially complementary column from most scattered sunlight observations. Our observations provide quantitative estimates of the hydrogen exosphere with nearly complete temporal coverage, revealing order of magnitude seasonal changes in column density and a peak slightly after perihelion, approximately at southern summer solstice. The timing of this peak suggests either a lag in the response of the Martian atmosphere to solar inputs or a seasonal effect driven by lower atmosphere dynamics. The high degree of seasonal variability implied by our observations suggests that the Martian atmosphere and the thermal escape of light elements depend sensitively on solar inputs.

  11. Geological nominations at UNESCO World Heritage, an upstream struggle

    NASA Astrophysics Data System (ADS)

    Olive-Garcia, Cécile; van Wyk de Vries, Benjamin

    2017-04-01

    Using my 10 years experience in setting up and defending a UNESCO world Heritage Geological nomination, this presentation aims to give a personal insight into this international process and the differential use of science, subjective perception (aesthetic and 'naturality'), and politics. At this point in the process, new protocols have been tested in order to improve the dialogue, accountability and transparency between the different stake-holders. These are, the State parties, the IUCN, the scientific community, and UNESCO itself. Our proposal is the Chaîne des Puys-Limagne fault ensemble, which combines tectonic, geomorphological evolution and volcanology. The project's essence is a conjunction of inseparable geological features and processes, set in the context of plate tectonics. This very unicit yof diverse forms and processes creates the value of the site. However, it is just this that has caused a problem, as the advisory body has a categorical approach of nominations that separates items to assess them in an unconnected manner.From the start we proposed a combined approach, where a property is seen in its entirety, and the constituent elements seen as interlinked elements reflecting the joint underlying phenomena. At this point, our project has received the first ever open review by an independent technical mission (jointly set up by IUCN, UNESCO and the State party). The subsequent report was broadly supportive of the project's approach and of the value of the ensemble of features. The UNESCO committee in 2016, re-referred the nomination, acknowledging the potential Outstanding Universal Value of the site and requesting the parties to continue the upstream process (e.g. collaborative work), notably on the recommendations and conclusions of the Independent Technical mission report. Meetings are continuing, and I shall provide you with the hot-off-the-press news as this ground breaking nomination progresses.

  12. Opposite Smad and chicken ovalbumin upstream promoter transcription factor inputs in the regulation of the collagen VII gene promoter by transforming growth factor-beta.

    PubMed

    Calonge, María Julia; Seoane, Joan; Massagué, Joan

    2004-05-28

    A critical component of the epidermal basement membrane, collagen type VII, is produced by keratinocytes and fibroblasts, and its production is stimulated by the cytokine transforming growth factor-beta (TGF-beta). The gene, COL7A1, is activated by TGF-beta via Smad transcription factors in cooperation with AP1. Here we report a previously unsuspected level of complexity in this regulatory process. We provide evidence that TGF-beta may activate the COL7A1 promoter by two distinct inputs operating through a common region of the promoter. One input is provided by TGF-beta-induced Smad complexes via two Smad binding elements that function redundantly depending on the cell type. The second input is provided by relieving the COL7A1 promoter from chicken ovalbumin upstream promoter transcription factor (COUP-TF)-mediated transcriptional repression. We identified COUP-TFI and -TFII as factors that bind to the TGF-beta-responsive region of the COL7A1 promoter in an expression library screening. COUP-TFs bind to a site between the two Smad binding elements independently of Smad or AP1 and repress the basal and TGF-beta-stimulated activities of this promoter. We provide evidence that endogenous COUP-TF activity represses the COL7A1 promoter. Furthermore, we show that TGF-beta addition causes a rapid and profound down-regulation of COUP-TF expression in keratinocytes and fibroblasts. The results suggest that TGF-beta signaling may exert tight control over COL7A1 by offsetting the balance between opposing Smad and COUP-TFs.

  13. Recurrent emergence of structural variants of LTR retrotransposon CsRn1 evolving novel expression strategy and their selective expansion in a carcinogenic liver fluke, Clonorchis sinensis.

    PubMed

    Kim, Seon-Hee; Kong, Yoon; Bae, Young-An

    2017-06-01

    Autonomous retrotransposons, in which replication and transcription are coupled, encode the essential gag and pol genes as a fusion or separate overlapping form(s) that are expressed in single transcripts regulated by a common upstream promoter. The element-specific expression strategies have driven development of relevant translational recoding mechanisms including ribosomal frameshifting to satisfy the protein stoichiometry critical for the assembly of infectious virus-like particles. Retrotransposons with different recoding strategies exhibit a mosaic distribution pattern across the diverse families of reverse transcribing elements, even though their respective distributions are substantially skewed towards certain family groups. However, only a few investigations to date have focused on the emergence of retrotransposons evolving novel expression strategy and causal genetic drivers of the structural variants. In this study, the bulk of genomic and transcribed sequences of a Ty3/gypsy-like CsRn1 retrotransposon in Clonorchis sinensis were analyzed for the comprehensive examination of its expression strategy. Our results demonstrated that structural variants with single open reading frame (ORF) have recurrently emerged from precedential CsRn1 copies encoding overlapping gag-pol ORFs by a single-nucleotide insertion in an upstream region of gag stop codon. In the parasite genome, some of the newly evolved variants appeared to undergo proliferative burst as active master lineages together with their ancestral copies. The genetic event was similarly observed in Opisthorchis viverrini, the closest neighbor of C. sinensis, whereas the resulting structural variants might have failed to overcome purifying selection and comprised minor remnant copies in the Opisthorchis genome. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Genome-wide analysis of salinity-stress induced DNA methylation alterations in cotton (Gossypium hirsutum L.) using the Me-DIP sequencing technology.

    PubMed

    Lu, X K; Shu, N; Wang, J J; Chen, X G; Wang, D L; Wang, S; Fan, W L; Guo, X N; Guo, L X; Ye, W W

    2017-06-29

    Cytosine DNA methylation is a significant form of DNA modification closely associated with gene expression in eukaryotes, fungi, animals, and plants. Although the reference genomes of cotton (Gossypium hirsutum L.) have been publically available, the salinity-stress-induced DNA methylome alterations in cotton are not well understood. Here, we constructed a map of genome-wide DNA methylation characteristics of cotton leaves under salt stress using the methylated DNA immunoprecipitation sequencing method. The results showed that the methylation reads on chromosome 9 were most comparable with those on the other chromosomes, but the greatest changes occurred on chromosome 8 under salt stress. The DNA methylation pattern analysis indicated that a relatively higher methylation density was found in the upstream2k and downstream2k elements of the CDS region and CG-islands. Almost 94% of the reads belonged to LTR-gspsy and LTR-copia, and the number of methylation reads in LTR-gypsy was four times greater than that in LTR-copia in both control and stressed samples. The analysis of differentially methylated regions (DMRs) showed that the gene elements upstream2k, intron, and downstream2k were hypomethylated, but the CDS regions were hypermethylated. The GO (Gene Ontology) analysis suggested that the methylated genes were most enriched in cellular processes, metabolic processes, cell parts and catalytic activities, which might be closely correlated with response to NaCl stress. In this study, we completed a genomic DNA methylation profile and conducted a DMR analysis under salt stress, which provided valuable information for the better understanding of epigenetics in response to salt stress in cotton.

  15. Concomitant expression of far upstream element (FUSE) binding protein (FBP) interacting repressor (FIR) and its splice variants induce migration and invasion of non-small cell lung cancer (NSCLC) cells.

    PubMed

    Müller, Benedikt; Bovet, Michael; Yin, Yi; Stichel, Damian; Malz, Mona; González-Vallinas, Margarita; Middleton, Alistair; Ehemann, Volker; Schmitt, Jennifer; Muley, Thomas; Meister, Michael; Herpel, Esther; Singer, Stephan; Warth, Arne; Schirmacher, Peter; Drasdo, Dirk; Matthäus, Franziska; Breuhahn, Kai

    2015-11-01

    Transcription factors integrate a variety of oncogenic input information, facilitate tumour growth and cell dissemination, and therefore represent promising therapeutic target structures. Because over-expression of DNA-interacting far upstream element binding protein (FBP) supports non-small cell lung cancer (NSCLC) migration, we asked whether its repressor, FBP-interacting repressor (FIR) is functionally inactivated and how FIR might affect NSCLC cell biology. Different FIR splice variants were highly expressed in the majority of NSCLCs, with the highest levels in tumours carrying genomic gains of chromosome 8q24.3, which contained the FIR gene locus. Nuclear FIR expression was significantly enriched at the invasion front of primary NSCLCs, but this did not correlate with tumour cell proliferation. FIR accumulation was associated with worse patient survival and tumour recurrence; in addition, FIR over-expression significantly correlated with lymph node metastasis in squamous cell carcinomas (SCCs). In vitro, we applied newly developed methods and modelling approaches for the quantitative and time-resolved description of the pro-migratory and pro-invasive capacities of SCC cells. siRNA-mediated silencing of all FIR variants significantly reduced the speed and directional movement of tumour cells in all phases of migration. Furthermore, sprouting efficiency and single cell invasiveness were diminished following FIR inhibition. Interestingly, the silencing of FIR isoforms lacking exon 2 (FIR(Δexon2)) alone was sufficient to reduce lateral migration and invasion. In summary, by using scale-spanning data derived from primary human tissues, quantitative cellular analyses and mathematical modelling, we have demonstrated that concomitant over-expression of FIR and its splice variants drives NSCLC migration and dissemination. Copyright © 2015 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  16. Efficient activation of transcription in yeast by the BPV1 E2 protein.

    PubMed Central

    Stanway, C A; Sowden, M P; Wilson, L E; Kingsman, A J; Kingsman, S M

    1989-01-01

    The full-length gene product encoded by the E2 open reading frame (ORF) of bovine papillomavirus type 1 (BPV1) is a transcriptional transactivator. It is believed to mediate its effect on the BPV1 long control region (LCR) by binding to motifs with the consensus sequence ACCN6GGT. The minimal functional cis active site, called the E2 response element (E2RE), in mammalian cells comprises two copies of this motif. Here we have shown that E2 can function in Saccharomyces cerevisiae by placing an E2RE upstream of a synthetic yeast assay promoter which consists of a TATA motif and an mRNA initiation site, spaced correctly. This E2RE-minimal promoter is only transcriptionally active in the presence of E2 protein and the resulting mRNA is initiated at the authentic start site. This is the first report of a mammalian viral transactivator functioning in yeast. The level of activation by E2 via the E2RE was the same as observed with the highly efficient authentic PGK promoter where the upstream activation sequence is composed of three distinct elements. Furthermore a single E2 motif which is insufficient in mammalian cells as an activation site was as efficiently utilized in yeast as the E2RE (2 motifs). Previous studies have shown that mammalian cellular activators can function in yeast and our data now extend this to viral-specific activators. Our data indicate however that while the mechanism of transactivation is broadly conserved there may be significant differences at the detailed level. Images PMID:2539584

  17. Differential Effects of Ethanol on c-Jun N-Terminal Kinase, 14-3-3 Proteins, and Bax in Postnatal Day 4 and Postnatal Day 7 Rat Cerebellum

    PubMed Central

    Heaton, Marieta Barrow; Paiva, Michael; Kubovic, Stacey; Kotler, Alexandra; Rogozinski, Jonathan; Swanson, Eric; Madorsky, Vladimir; Posados, Michelle

    2011-01-01

    These studies investigated ethanol effects on upstream cellular elements and interactions which contribute to Bax-related apoptosis in neonatal rat cerebellum at ages of peak ethanol sensitivity (postnatal day 4 [P4]), compared to later ages of relative resistance (P7). Analyses were made of basal levels of the pro-apoptotic c-jun N-termimal kinase (JNK), Bax, and the 14-3-3 anchoring proteins, as well as the responsiveness of these substances to ethanol at P4 versus P7. Dimerization of Bax with 14-3-3 was also investigated at the two ages following ethanol treatment, a process which sequesters Bax in the cytosol, thus inhibiting its mitochondrial translocation and disruption of the mitochondrial membrane potential. Cultured cerebellar granule cells were used to examine the protective potential of JNK inhibition on ethanol-mediated cell death. Basal levels of JNK were significantly higher at P4 than P7, but no differences in the other proteins were found. Activated JNK, and cytosolic and mitochondrially-translocated Bax were increased in P4 but not P7 animals following ethanol exposure, while protective 14-3-3 proteins were increased only at P7. Ethanol treatment resulted in decreases in Bax:14-3-3 heterodimers at P4, but not at P7. Inhibition of JNK activity in vitro provided partial protection against ethanol neurotoxicity. Thus, differential temporal vulnerability to ethanol in this CNS region correlates with differences in both levels of apoptosis-related substances (e.g., JNK), and differential cellular responsiveness, favoring apoptosis at the most sensitive age and survival at the resistant age. The upstream elements contributing to this vulnerability can be targets for future therapeutic strategies. PMID:22169498

  18. Open cycle ocean thermal energy conversion system

    DOEpatents

    Wittig, J. Michael

    1980-01-01

    An improved open cycle ocean thermal energy conversion system including a flash evaporator for vaporizing relatively warm ocean surface water and an axial flow, elastic fluid turbine having a vertical shaft and axis of rotation. The warm ocean water is transmitted to the evaporator through a first prestressed concrete skirt-conduit structure circumferentially situated about the axis of rotation. The unflashed warm ocean water exits the evaporator through a second prestressed concrete skirt-conduit structure located circumferentially about and radially within the first skirt-conduit structure. The radially inner surface of the second skirt conduit structure constitutes a cylinder which functions as the turbine's outer casing and obviates the need for a conventional outer housing. The turbine includes a radially enlarged disc element attached to the shaft for supporting at least one axial row of radially directed blades through which the steam is expanded. A prestressed concrete inner casing structure of the turbine has upstream and downstream portions respectively situated upstream and downstream from the disc element. The radially outer surfaces of the inner casing portions and radially outer periphery of the axially interposed disc cooperatively form a downwardly radially inwardly tapered surface. An annular steam flowpath of increasing flow area in the downward axial direction is radially bounded by the inner and outer prestressed concrete casing structures. The inner casing portions each include a transversely situated prestressed concrete circular wall for rotatably supporting the turbine shaft and associated structure. The turbine blades are substantially radially coextensive with the steam flowpath and receive steam from the evaporator through an annular array of prestressed concrete stationary vanes which extend between the inner and outer casings to provide structural support therefor and impart a desired flow direction to the steam.

  19. The SXT conjugative element and linear prophage N15 encode toxin-antitoxin-stabilizing systems homologous to the tad-ata module of the Paracoccus aminophilus plasmid pAMI2.

    PubMed

    Dziewit, Lukasz; Jazurek, Magdalena; Drewniak, Lukasz; Baj, Jadwiga; Bartosik, Dariusz

    2007-03-01

    A group of proteic toxin-antitoxin (TA) cassettes whose representatives are widely distributed among bacterial genomes has been identified. These cassettes occur in chromosomes, plasmids, bacteriophages, and noncomposite transposons, as well as in the SXT conjugative element of Vibrio cholerae. The following four homologous loci were subjected to detailed comparative studies: (i) tad-ata from plasmid pAMI2 of Paracoccus aminophilus (the prototype of this group), (ii) gp49-gp48 from the linear bacteriophage N15 of Escherichia coli, (iii) s045-s044 from SXT, and (iv) Z3230-Z3231 from the genomic island of enterohemorrhagic Escherichia coli O157:H7 strain EDL933. Functional analysis revealed that all but one of these loci (Z3230-Z3231) are able to stabilize heterologous replicons, although the host ranges varied. The TA cassettes analyzed have the following common features: (i) the toxins are encoded by the first gene of each operon; (ii) the antitoxins contain a predicted helix-turn-helix motif of the XRE family; and (iii) the cassettes have two promoters that are different strengths, one which is located upstream of the toxin gene and one which is located upstream of the antitoxin gene. All four toxins tested are functional in E. coli; overexpression of the toxins (in the absence of antitoxin) results in a bacteriostatic effect manifested by elongation of bacterial cells and growth arrest. The toxins have various effects on cell viability, which suggests that they may recognize different intracellular targets. Preliminary data suggest that different cellular proteases are involved in degradation of antitoxins encoded by the loci analyzed.

  20. Variation in local abundance and species richness of stream fishes in relation to dispersal barriers: Implications for management and conservation

    USGS Publications Warehouse

    Nislow, K.H.; Hudy, M.; Letcher, B.H.; Smith, E.P.

    2011-01-01

    1.Barriers to immigration, all else being equal, should in principle depress local abundance and reduce local species richness. These issues are particularly relevant to stream-dwelling species when improperly designed road crossings act as barriers to migration with potential impacts on the viability of upstream populations. However, because abundance and richness are highly spatially and temporally heterogeneous and the relative importance of immigration on demography is uncertain, population- and community-level effects can be difficult to detect. 2.In this study, we tested the effects of potential barriers to upstream movements on the local abundance and species richness of a diverse assemblage of resident stream fishes in the Monongahela National Forest, West Virginia, U.S.A. Fishes were sampled using simple standard techniques above- and below road crossings that were either likely or unlikely to be barriers to upstream fish movements (based on physical dimensions of the crossing). We predicted that abundance of resident fishes would be lower in the upstream sections of streams with predicted impassable barriers, that the strength of the effect would vary among species and that variable effects on abundance would translate into lower species richness. 3.Supporting these predictions, the statistical model that best accounted for variation in abundance and species richness included a significant interaction between location (upstream or downstream of crossing) and type (passable or impassable crossing). Stream sections located above predicated impassable culverts had fewer than half the number of species and less than half the total fish abundance, while stream sections above and below passable culverts had essentially equivalent richness and abundance. 4.Our results are consistent with the importance of immigration and population connectivity to local abundance and species richness of stream fishes. In turn, these results suggest that when measured at appropriate scales (multiple streams within catchments), with simple protocols amenable to use by management agencies, differences in local abundance and species richness may serve as indicators of the extent to which road crossings are barriers to fish movement and help determine whether road-crossing improvements have restored connectivity to stream fish populations and communities. Published 2011. This article is a US Government work and is in the public domain in the USA.

  1. Evolutionary divergence of vertebrate Hoxb2 expression patterns and transcriptional regulatory loci.

    PubMed

    Scemama, Jean-Luc; Hunter, Michael; McCallum, Jeff; Prince, Victoria; Stellwag, Edmund

    2002-10-15

    Hox gene expression is regulated by a complex array of cis-acting elements that control spatial and temporal gene expression in developing embryos. Here, we report the isolation of the striped bass Hoxb2a gene, comparison of its expression to the orthologous gene from zebrafish, and comparative genomic analysis of the upstream regulatory region to that of other vertebrates. Comparison of the Hoxb2a gene expression patterns from striped bass to zebrafish revealed similar expression patterns within rhombomeres 3, 4, and 5 of the hindbrain but a notable absence of expression in neural crest tissues of striped bass while neural crest expression is observed in zebrafish and common to other vertebrates. Comparative genomic analysis of the striped bass Hoxb2a-b3a intergenic region to those from zebrafish, pufferfish, human, and mouse demonstrated the presence of common Meis, Hox/Pbx, Krox-20, and Box 1 elements, which are necessary for rhombomere 3, 4, and 5 expression. Despite their common occurrence, the location and orientation of these transcription elements differed among the five species analyzed, such that Krox-20 and Box 1 elements are located 3' to the Meis, Hox/Pbx elements in striped bass, pufferfish, and human while they are located 5' of this r4 enhancer in zebrafish and mouse. Our results suggest that the plasticity exhibited in the organization of key regulatory elements responsible for rhombomere-specific Hoxb2a expression may reflect the effects of stabilizing selection in the evolution cis-acting elements. Copyright 2002 Wiley-Liss, Inc.

  2. Radiation detector having a multiplicity of individual detecting elements

    DOEpatents

    Whetten, Nathan R.; Kelley, John E.

    1985-01-01

    A radiation detector has a plurality of detector collection element arrays immersed in a radiation-to-electron conversion medium. Each array contains a multiplicity of coplanar detector elements radially disposed with respect to one of a plurality of positions which at least one radiation source can assume. Each detector collector array is utilized only when a source is operative at the associated source position, negating the necessity for a multi-element detector to be moved with respect to an object to be examined. A novel housing provides the required containment of a high-pressure gas conversion medium.

  3. MITRE sensor layer prototype

    NASA Astrophysics Data System (ADS)

    Duff, Francis; McGarry, Donald; Zasada, David; Foote, Scott

    2009-05-01

    The MITRE Sensor Layer Prototype is an initial design effort to enable every sensor to help create new capabilities through collaborative data sharing. By making both upstream (raw) and downstream (processed) sensor data visible, users can access the specific level, type, and quantities of data needed to create new data products that were never anticipated by the original designers of the individual sensors. The major characteristic that sets sensor data services apart from typical enterprise services is the volume (on the order of multiple terabytes) of raw data that can be generated by most sensors. Traditional tightly coupled processing approaches extract pre-determined information from the incoming raw sensor data, format it, and send it to predetermined users. The community is rapidly reaching the conclusion that tightly coupled sensor processing loses too much potentially critical information.1 Hence upstream (raw and partially processed) data must be extracted, rapidly archived, and advertised to the enterprise for unanticipated uses. The authors believe layered sensing net-centric integration can be achieved through a standardize-encapsulate-syndicateaggregate- manipulate-process paradigm. The Sensor Layer Prototype's technical approach focuses on implementing this proof of concept framework to make sensor data visible, accessible and useful to the enterprise. To achieve this, a "raw" data tap between physical transducers associated with sensor arrays and the embedded sensor signal processing hardware and software has been exploited. Second, we encapsulate and expose both raw and partially processed data to the enterprise within the context of a service-oriented architecture. Third, we advertise the presence of multiple types, and multiple layers of data through geographic-enabled Really Simple Syndication (GeoRSS) services. These GeoRSS feeds are aggregated, manipulated, and filtered by a feed aggregator. After filtering these feeds to bring just the type and location of data sought by multiple processes to the attention of each processing station, just that specifically sought data is downloaded to each process application. The Sensor Layer Prototype participated in a proof-of-concept demonstration in April 2008. This event allowed multiple MITRE innovation programs to interact among themselves to demonstrate the ability to couple value-adding but previously unanticipated users to the enterprise. For this event, the Sensor Layer Prototype was used to show data entering the environment in real time. Multiple data types were encapsulated and added to the database via the Sensor Layer Prototype, specifically National Imagery Transmission Format 2.1 (NITF), NATO Standardization Format 4607 (STANAG 4607), Cursor-on-Target (CoT), Joint Photographic Experts Group (JPEG), Hierarchical Data Format (HDF5) and several additional sensor file formats describing multiple sensors addressing a common scenario.

  4. Composite Spectrometer Prisms

    NASA Technical Reports Server (NTRS)

    Breckinridge, J. B.; Page, N. A.; Rodgers, J. M.

    1985-01-01

    Efficient linear dispersive element for spectrometer instruments achieved using several different glasses in multiple-element prism. Good results obtained in both two-and three-element prisms using variety of different glass materials.

  5. 75 FR 68714 - Final Flood Elevation Determinations

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-11-09

    ... mile +683 Village of Mayfield. upstream of Rogers Road. Chagrin River Approximately 40 feet +786 Village of Moreland upstream of Woodland Hills. Road. Approximately 1,200 feet +789 upstream of Woodland... Miles Road. Countrymans Creek Upstream of I-71......... +721 Village of Lindale. Downstream of Bellaire...

  6. Objective lens simultaneously optimized for pupil ghosting, wavefront delivery and pupil imaging

    NASA Technical Reports Server (NTRS)

    Olczak, Eugene G (Inventor)

    2011-01-01

    An objective lens includes multiple optical elements disposed between a first end and a second end, each optical element oriented along an optical axis. Each optical surface of the multiple optical elements provides an angle of incidence to a marginal ray that is above a minimum threshold angle. This threshold angle minimizes pupil ghosts that may enter an interferometer. The objective lens also optimizes wavefront delivery and pupil imaging onto an optical surface under test.

  7. The 'upstream wake' of swimming and flying animals and its correlation with propulsive efficiency.

    PubMed

    Peng, Jifeng; Dabiri, John O

    2008-08-01

    The interaction between swimming and flying animals and their fluid environments generates downstream wake structures such as vortices. In most studies, the upstream flow in front of the animal is neglected. In this study, we demonstrate the existence of upstream fluid structures even though the upstream flow is quiescent or possesses a uniform incoming velocity. Using a computational model, the flow generated by a swimmer (an oscillating flexible plate) is simulated and a new fluid mechanical analysis is applied to the flow to identify the upstream fluid structures. These upstream structures show the exact portion of fluid that is going to interact with the swimmer. A mass flow rate is then defined based on the upstream structures, and a metric for propulsive efficiency is established using the mass flow rate and the kinematics of the swimmer. We propose that the unsteady mass flow rate defined by the upstream fluid structures can be used as a metric to measure and objectively compare the efficiency of locomotion in water and air.

  8. NF-E2 and GATA binding motifs are required for the formation of DNase I hypersensitive site 4 of the human beta-globin locus control region.

    PubMed Central

    Stamatoyannopoulos, J A; Goodwin, A; Joyce, T; Lowrey, C H

    1995-01-01

    The beta-like globin genes require the upstream locus control region (LCR) for proper expression. The active elements of the LCR coincide with strong erythroid-specific DNase I-hypersensitive sites (HSs). We have used 5' HS4 as a model to study the formation of these HSs. Previously, we identified a 101 bp element that is required for the formation of this HS. This element binds six proteins in vitro. We now report a mutational analysis of the HS4 HS-forming element (HSFE). This analysis indicates that binding sites for the hematopoietic transcription factors NF-E2 and GATA-1 are required for the formation of the characteristic chromatin structure of the HS following stable transfection into murine erythroleukemia cells. Similarly arranged NF-E2 and GATA binding sites are present in the other HSs of the human LCR, as well as in the homologous mouse and goat sequences and the chicken beta-globin enhancer. A combination of DNase I and micrococcal nuclease sensitivity assays indicates that the characteristic erythroid-specific hypersensitivity of HS4 to DNase I is the result of tissue-specific alterations in both nucleosome positioning and tertiary DNA structure. Images PMID:7828582

  9. Human Fip1 is a subunit of CPSF that binds to U-rich RNA elements and stimulates poly(A) polymerase.

    PubMed

    Kaufmann, Isabelle; Martin, Georges; Friedlein, Arno; Langen, Hanno; Keller, Walter

    2004-02-11

    In mammals, polyadenylation of mRNA precursors (pre-mRNAs) by poly(A) polymerase (PAP) depends on cleavage and polyadenylation specificity factor (CPSF). CPSF is a multisubunit complex that binds to the canonical AAUAAA hexamer and to U-rich upstream sequence elements on the pre-mRNA, thereby stimulating the otherwise weakly active and nonspecific polymerase to elongate efficiently RNAs containing a poly(A) signal. Based on sequence similarity to the Saccharomyces cerevisiae polyadenylation factor Fip1p, we have identified human Fip1 (hFip1) and found that the protein is an integral subunit of CPSF. hFip1 interacts with PAP and has an arginine-rich RNA-binding motif that preferentially binds to U-rich sequence elements on the pre-mRNA. Recombinant hFip1 is sufficient to stimulate the in vitro polyadenylation activity of PAP in a U-rich element-dependent manner. hFip1, CPSF160 and PAP form a ternary complex in vitro, suggesting that hFip1 and CPSF160 act together in poly(A) site recognition and in cooperative recruitment of PAP to the RNA. These results show that hFip1 significantly contributes to CPSF-mediated stimulation of PAP activity.

  10. Human Fip1 is a subunit of CPSF that binds to U-rich RNA elements and stimulates poly(A) polymerase

    PubMed Central

    Kaufmann, Isabelle; Martin, Georges; Friedlein, Arno; Langen, Hanno; Keller, Walter

    2004-01-01

    In mammals, polyadenylation of mRNA precursors (pre-mRNAs) by poly(A) polymerase (PAP) depends on cleavage and polyadenylation specificity factor (CPSF). CPSF is a multisubunit complex that binds to the canonical AAUAAA hexamer and to U-rich upstream sequence elements on the pre-mRNA, thereby stimulating the otherwise weakly active and nonspecific polymerase to elongate efficiently RNAs containing a poly(A) signal. Based on sequence similarity to the Saccharomyces cerevisiae polyadenylation factor Fip1p, we have identified human Fip1 (hFip1) and found that the protein is an integral subunit of CPSF. hFip1 interacts with PAP and has an arginine-rich RNA-binding motif that preferentially binds to U-rich sequence elements on the pre-mRNA. Recombinant hFip1 is sufficient to stimulate the in vitro polyadenylation activity of PAP in a U-rich element-dependent manner. hFip1, CPSF160 and PAP form a ternary complex in vitro, suggesting that hFip1 and CPSF160 act together in poly(A) site recognition and in cooperative recruitment of PAP to the RNA. These results show that hFip1 significantly contributes to CPSF-mediated stimulation of PAP activity. PMID:14749727

  11. The legumin gene family: structure of a B type gene of Vicia faba and a possible legumin gene specific regulatory element.

    PubMed Central

    Bäumlein, H; Wobus, U; Pustell, J; Kafatos, F C

    1986-01-01

    The field bean, Vicia faba L. var. minor, possesses two sub-families of 11 S legumin genes named A and B. We isolated from a genomic library a B-type gene (LeB4) and determined its primary DNA sequence. Gene LeB4 codes for a 484 amino acid residue prepropolypeptide, encompassing a signal peptide of 22 amino acid residues, an acidic, very hydrophilic alpha-chain of 281 residues and a basic, somewhat hydrophobic beta-chain of 181 residues. The latter two coding regions are immediately contiguous, but each is interrupted by a short intron. Type A legumin genes from soybean and pea are known to have introns in the same two positions, in addition to an extra intron (within the alpha-coding sequence). Sequence comparisons of legumin genes from these three plants revealed a highly conserved sequence element of at least 28 bp, centered at approximately 100 bp upstream of each cap site. The element is absent from the equivalent position of all non-legumin and other plant and fungal genes examined. We tentatively name this element "legumin box" and suggest that it may have a function in the regulation of legumin gene expression. PMID:3960730

  12. Flow Structure Comparison for Two 7-Point LDI Configurations

    NASA Technical Reports Server (NTRS)

    Hicks, Yolanda R.; Tacina, Kathleen M.

    2017-01-01

    This paper presents a comparison primarily of the cold flow 2-D velocity profiles; and describes flame tube combusting flow operability for a 7-point Lean Direct Injector (LDI). This circular LDI array consists of a center element surrounded by six outer elements spaced 60 degrees apart; the spacing between all adjacent elements is the same. Each element consists of a simplex atomizer that injects at the throat of a converging-diverging venturi, and an axial swirler upstream of the venturi throat to generate swirl. The two configurations were: 1) one which consists of all 60 deg co-swirling axial air swirlers, and; 2) one configuration which uses a 60 deg swirler in the center, surrounded by counter-swirling 45 deg swirlers. Testing was done at 5- bar and at an inlet temperature of 700K. Two air reference velocities were considered in the cold flow measurements. The 2D velocity profiles were determined using particle image velocimetry. Results indicate the configuration using all 60 deg swirlers generates a field that moderates to a more uniform distribution at a shorter distance downstream and is more easily operable than the second configuration, which produces recirculation regions at the edges of the outer 45 deg swirlers, and results in a more stratified velocity field at any given axial location.

  13. A novel E2 box-GATA element modulates Cdc6 transcription during human cells polyploidization

    PubMed Central

    Vilaboa, Nuria; Bermejo, Rodrigo; Martinez, Pilar; Bornstein, Rafael; Calés, Carmela

    2004-01-01

    Cdc6 is a key regulator of the strict alternation of S and M phases during the mitotic cell cycle. In mammalian and plant cells that physiologically become polyploid, cdc6 is transcriptionally and post-translationally regulated. We have recently reported that Cdc6 levels are maintained in megakaryoblastic HEL cells, but severely downregulated by ectopic expression of transcriptional repressor Drosophila melanogaster escargot. Here, we show that cdc6 promoter activity is upregulated during megakaryocytic differentiation of HEL endoreplicating cells, and that Escargot interferes with such activation. Transactivation experiments showed that a 1.7 kb region located at 2800 upstream cdc6 transcription initiation site behaved as a potent enhancer in endoreplicating cells only. This activity was mainly dependent on a novel cis-regulatory element composed by an E2 box overlapping a GATA motif. Ectopic Escargot could bind this regulatory element in vitro and endogenous GATA-1 and E2A formed specific complexes in megakaryoblastic cells as well as in primary megakaryocytes. Chromatin Immunoprecipitation analysis revealed that both transcription factors were occupying the E2 box/GATA site in vivo. Altogether, these data suggest that cdc6 expression could be actively maintained during megakaryocytic differentiation through transcriptional mechanisms involving specific cis- and trans-regulatory elements. PMID:15590906

  14. Performance analysis of cross-seeding WDM-PON system using transfer matrix method

    NASA Astrophysics Data System (ADS)

    Simatupang, Joni Welman; Pukhrambam, Puspa Devi; Huang, Yen-Ru

    2016-12-01

    In this paper, a model based on the transfer matrix method is adopted to analyze the effects of Rayleigh backscattering and Fresnel multiple reflections on a cross-seeding WDM-PON system. As part of analytical approximation methods, this time-independent model is quite simple but very efficient when it is applied to various WDM-PON transmission systems, including the cross-seeding scheme. The cross seeding scheme is most beneficial for systems with low loop-back ONU gain or low reflection loss at the drop fiber for upstream data in bidirectional transmission. However for downstream data transmission, multiple reflections power could destroy the usefulness of the cross-seeding scheme when the reflectivity is high enough and the RN is positioned near OLT or close to ONU.

  15. Immediate changes in stream channel geomorphology, aquatic habitat, and fish assemblages following dam removal in a small upland catchment

    NASA Astrophysics Data System (ADS)

    Magilligan, F. J.; Nislow, K. H.; Kynard, B. E.; Hackman, A. M.

    2016-01-01

    Dam removal is becoming an increasingly important component of river restoration, with > 1100 dams having been removed nationwide over the past three decades. Despite this recent progression of removals, the lack of pre- to post-removal monitoring and assessment limits our understanding of the magnitude, rate, and sequence of geomorphic and/or ecological recovery to dam removal. Taking advantage of the November 2012 removal of an old ( 190 year-old) 6-m high, run-of-river industrial dam on Amethyst Brook (26 km2) in central Massachusetts, we identify the immediate eco-geomorphic responses to removal. To capture the geomorphic responses to dam removal, we collected baseline data at multiple scales, both upstream ( 300 m) and downstream (> 750 m) of the dam, including monumented cross sections, detailed channel-bed longitudinal profiles, embeddedness surveys, and channel-bed grain size measurements, which were repeated during the summer of 2013. These geomorphic assessments were combined with detailed quantitative electrofishing surveys of stream fish richness and abundance above and below the dam site and throughout the watershed and visual surveys of native anadromous sea lamprey (Petromyzon marinus) nest sites. Post-removal assessments were complicated by two events: (1) upstream knickpoint migration exhumed an older (ca. late eighteenth century) intact wooden crib dam 120 m upstream of the former stone dam, and (2) the occurrence of a 10-20 year RI flood 6 months after removal that caused further upstream incision and downstream aggradation. Now that the downstream reach has been reconnected to upstream sediment supply, the predominant geomorphic response was bed aggradation and associated fining (30-60% reduction). At dam proximal locations, aggradation ranged from 0.3 to > 1 m where a large woody debris jam enhanced aggradation. Although less pronounced, distal locations still showed aggradation with a mean depth of deposition of 0.20 m over the 750-m downstream reach. Post-removal, but pre-flood, bed surveys indicate 2 m of incision had migrated 25 m upstream of the former reservoir before encountering the exhumed dam, which now acts as the new grade control, limiting progressive headcutting. Approximately 1000 m3 of sediment was evacuated in the first year, with 67% of the volume occurring by pre-flood, process-driven (e.g., changes in base level) controls. The combination of changes in channel-bed sedimentology, the occurrence of a large magnitude flood, and the emergence of the new crib dam that is a likely barrier to fish movement was associated with major reductions in abundance and richness in sites downstream and immediately upstream adjacent to the former dam in post-removal sampling. At the same time, we documented the presence of four species of fish, including sea lamprey, which were not present above the dam prior to removal, indicating that upstream passage has been achieved; and we also documented lamprey spawning activity at sites immediately below the dam, which had previously been unsuitable owing to an excessively coarse and armored riverbed. Our results point to the importance of interactions between dam removal and flood disturbance effects, with important implications for short- and long-term monitoring and assessment of dam impacts to river systems.

  16. Dynamic interplay and function of multiple noncoding genes governing X chromosome inactivation

    PubMed Central

    Yue, Minghui; Richard, John Lalith Charles

    2015-01-01

    There is increasing evidence for the emergence of long noncoding RNAs (IncRNAs) as important components, especially in the regulation of gene expression. In the event of X chromosome inactivation, robust epigenetic marks are established in a long noncoding Xist RNA-dependent manner, giving rise to a distinct epigenetic landscape on the inactive X chromosome (Xi). The X inactivation center (Xic is essential for induction of X chromosome inactivation and harbors two topologically associated domains (TADs) to regulate monoallelic Xist expression: one at the noncoding Xist gene and its upstream region, and the other at the antisense Tsix and its upstream region. The monoallelic expression of Xist is tightly regulated by these two functionally distinct TADs as well as their constituting IncRNAs and proteins. In this review, we summarize recent updates in our knowledge of IncRNAs found at the Xic and discuss their overall mechanisms of action. We also discuss our current understanding of the molecular mechanism behind Xist RNA-mediated induction of the repressive epigenetic landscape at the Xi. PMID:26260844

  17. BORC Functions Upstream of Kinesins 1 and 3 to Coordinate Regional Movement of Lysosomes along Different Microtubule Tracks.

    PubMed

    Guardia, Carlos M; Farías, Ginny G; Jia, Rui; Pu, Jing; Bonifacino, Juan S

    2016-11-15

    The multiple functions of lysosomes are critically dependent on their ability to undergo bidirectional movement along microtubules between the center and the periphery of the cell. Centrifugal and centripetal movement of lysosomes is mediated by kinesin and dynein motors, respectively. We recently described a multi-subunit complex named BORC that recruits the small GTPase Arl8 to lysosomes to promote their kinesin-dependent movement toward the cell periphery. Here, we show that BORC and Arl8 function upstream of two structurally distinct kinesin types: kinesin-1 (KIF5B) and kinesin-3 (KIF1Bβ and KIF1A). Remarkably, KIF5B preferentially moves lysosomes on perinuclear tracks enriched in acetylated α-tubulin, whereas KIF1Bβ and KIF1A drive lysosome movement on more rectilinear, peripheral tracks enriched in tyrosinated α-tubulin. These findings establish BORC as a master regulator of lysosome positioning through coupling to different kinesins and microtubule tracks. Common regulation by BORC enables coordinate control of lysosome movement in different regions of the cell. Published by Elsevier Inc.

  18. BORC Functions Upstream of Kinesins 1 and 3 to Coordinate Regional Movement of Lysosomes Along Different Microtubule Tracks

    PubMed Central

    Guardia, Carlos M.; Farías, Ginny G.; Jia, Rui; Pu, Jing; Bonifacino, Juan S.

    2016-01-01

    Summary The multiple functions of lysosomes are critically dependent on their ability to undergo bidirectional movement along microtubules between the center and the periphery of the cell. Centrifugal and centripetal movement of lysosomes is mediated by kinesin and dynein motors, respectively. We recently described a multisubunit complex named BORC that recruits the small GTPase Arl8 to lysosomes to promote their kinesin-dependent movement toward the cell periphery. Here we show that BORC and Arl8 function upstream of two structurally distinct kinesin types: kinesin-1 (KIF5B) and kinesin-3 (KIF1Bβ and KIF1A). Remarkably, KIF5B preferentially moves lysosomes on perinuclear tracks enriched in acetylated α-tubulin, whereas KIF1Bβ and KIF1A drive lysosome movement on more rectilinear, peripheral tracks enriched in tyrosinated α-tubulin. These findings establish BORC as a master regulator of lysosome positioning through coupling to different kinesins and microtubule tracks. Common regulation by BORC enables coordinate control of lysosome movement in different regions of the cell. PMID:27851960

  19. A speed limit compliance model for dynamic speed display sign.

    PubMed

    Ardeshiri, Anam; Jeihani, Mansoureh

    2014-12-01

    Violating speed limits is a major cause of motor vehicle crashes. Various techniques have been adopted to ensure that posted speed limits are obeyed by drivers. This study investigates the effect of dynamic speed display signs (DSDSs) on drivers' compliance with posted speed limit. An extensive speed data collection upstream of, adjacent to, and downstream of DSDS locations on multiple road classes with different speed limits (25, 35, and 45 mph) was performed short-term and long-term after DSDS installation. Conventional statistical analysis, regression models, and a Bayesian network were developed to assess the DSDS's effectiveness. General compliance with speed limit (upstream of the DSDS location), time of day, day of week, duration of DSDS operation, and distance from the DSDS location were significantly correlated with speed limit compliance adjacent to the DSDS. While compliance with the speed limit due to the DSDS increased by 5%, speed reduction occurred in 40% of the cases. Since drivers were likely to increase their speed after passing the DSDS, it should be installed on critical points supplemented with enforcement. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. Association of ADRB2 polymorphism with triglyceride levels in Tongans.

    PubMed

    Naka, Izumi; Ohashi, Jun; Kimura, Ryosuke; Inaoka, Tsukasa; Matsumura, Yasuhiro

    2013-07-23

    Our previous study demonstrated that the A-allele of the single nucleotide polymorphism (SNP) rs34623097 located in the upstream region of the β2 adrenergic receptor gene (ADRB2) is significantly associated with risk for obesity in Oceanic populations. To investigate whether the ADRB2 polymorphisms explain part of the individual differences in lipid mobilization, energy expenditure and glycogen breakdown, the associations of 10 ADRB2 SNPs with total cholesterol, high-density lipoprotein cholesterol, low-density lipoprotein cholesterol and triglyceride levels were examined in 128 adults in Tonga. A multiple linear regression analysis adjusted for age, sex, and body mass index revealed that rs34623097 was significantly associated with triglyceride levels (P-value = 0.037). A copy of the rs34623097-A allele increased serum triglyceride levels by 70.1 mg/dL (0.791 mmol/L). None of the ADRB2 SNPs showed a significant association with total-cholesterol, high-density lipoprotein cholesterol, or low-density lipoprotein cholesterol. In a Tongan population, a SNP located in the upstream region of ADRB2 is associated with triglyceride levels independent of body mass index.

Top